id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,410 | https://bio-protocol.org/exchange/protocoldetail?id=1410&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Editing Detection by Direct Sequencing
Mehdi Jabnoune
DS David Secco
CL Cécile Lecampion
CR Christophe Robaglia
QS Qingyao Shu
YP Yves Poirier
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1410 Views: 8626
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
RNA editing is a widespread post-transcriptional phenomenon through which primary RNA sequences are altered by nucleotide insertion/deletion or base conversion. It occurs in a variety of organisms and cooperates with alternative splicing in increasing both proteomic and transcriptomic complexity. We describe here a method allowing RNA editing events detection by performing direct sequencing of both genomic DNA and cDNA from the same source.
Materials and Reagents
DNeasy Plant mini kit (QIAGEN, catalog number: 69104 )
RNeasy mini kit (QIAGEN, catalog number: 74104 )
pJET PCR cloning system (Thermo Fisher Scientific, Fermentas, catalog number: K1231 )
Recombinant DNase I (Life Technologies, Ambion®, catalog number: AM2235 )
M-MLV reverse transcriptase (Promega corporation, catalog number: 28025-013 )
Oligo(dT) 15 Primer (500 mg) (Promega corporation, catalog number: C1101 )
KOD high fidelity polymerase (TOYOBO, catalog number: KOD-201 200U )
Zymoclean Gel DNA Recovery Kit (ZYMO RESEARC, catalog number: D4001 )
Equipment
NanoDrop (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jabnoune, M., Secco, D., Lecampion, C., Robaglia, C., Shu, Q. and Poirier, Y. (2015). RNA Editing Detection by Direct Sequencing. Bio-protocol 5(5): e1410. DOI: 10.21769/BioProtoc.1410.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA sequencing
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,411 | https://bio-protocol.org/exchange/protocoldetail?id=1411&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Polysome-bound mRNA from Rice Solid Tissues Amenable for RT-PCR and Profiling Experiments
Mehdi Jabnoune
DS David Secco
CL Cécile Lecampion
CR Christophe Robaglia
QS Qingyao Shu
YP Yves Poirier
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1411 Views: 14483
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
Polysome profile analysis is a frequently performed task in translational control research that not only enables direct monitoring of the efficiency of translation but can easily be extended with a wide range of downstream applications such as Northern and western blotting, genome-wide microarray analysis or qRT-PCR. Here, we describe a method for the isolation and quantification of high-quality polysome-bound mRNA complexes from small quantities of liquid-nitrogen-frozen solid tissue samples of rice shoots/roots. The mRNA obtained can be further analyzed by methods that evaluate polysomal mRNA abundance at the individual transcript or global level.
Materials and Reagents
30-day-old rice roots or shoots
Liquid nitrogen
3 M sodium acetate (Thermo Fisher Scientific, catalog number: S209-500 )
Chloramphenicol (50 mg/ml) (Sigma-Aldrich, catalog number: C0378 )
Cycloheximide (50 mg/ml) (Sigma-Aldrich, catalog number: C7698 ) in MilliQ water
Note: Cycloheximide inhibits protein synthesis by blocking translation elongation. This molecule interferes with the translocation of tRNAs with the mRNA and the ribosome, resulting in fixed ribosomes on mRNAs.
8 M guanidine hydrochloride solution (Sigma-Aldrich, catalog number: G9284 )
Chloroform
Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
Isopropanol
KCl (Thermo Fisher Scientific, catalog number: BP-366-500 )
Linear acrylamide (5 mg/ml) (Life Technologies, InvitrogenTM, catalog number: AM9520 )
MgCl2 (Sigma-Aldrich, catalog number: M-2393 )
Nonidet P40 (Biocompare, catalog number: DG514 )
Phenol water saturated
Sucrose (Sigma-Aldrich, catalog number: S1888 )
Tris.HCl (pH 8.4) (Thermo Fisher Scientific, catalog number: BP152-1 )
Trizol reagent (Life Technologies, InvitrogenTM, catalog number: 15596-026 )
10x sucrose solution salts buffer (see Recipes)
2 M sucrose (see Recipes)
20-50 % sucrose solutions (see Recipes)
Polysome buffer (see Recipes)
Equipment
0.22 μm filter
Density gradient fractionation system composed by
Peristaltic pump (Gilson Minipuls 3 peristaltic pump)
Cary 60 UV-Vis Spectrophotometer (Agilent)
Flow cell quartz (1 mm 113 μl, 1/pk) (Agilent, catalog number: 6610019900 )
Fraction collector (Bio-Rad Laboratories, model: 2110 )
Beckman optima L-70 ultracentrifuge (Beckman Coulter)
Beckman tubes
Parafilm
Boekel scientific orbitron rotator I (115V) (Boekel Scientific)
Mini centrifuge (Eppendorf, model: 5415D)
NanoDrop (Thermo Fisher Scientific)
Software
The Agilent Cary WinUV software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,412 | https://bio-protocol.org/exchange/protocoldetail?id=1412&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Efficient Procedure for Protoplast Isolation from Mesophyll Cells and Nuclear Fractionation in Rice
Mehdi Jabnoune
DS David Secco
CL Cécile Lecampion
CR Christophe Robaglia
QS Qingyao Shu
YP Yves Poirier
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1412 Views: 23748
Edited by: Ru Zhang
Reviewed by: Marisa Rosa
Original Research Article:
The authors used this protocol in Aug 1993
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 1993
Abstract
Plant protoplasts, a proven physiological and versatile cell system, are widely used in high-throughput analysis and functional characterization of genes. Green protoplasts have been successfully used in investigations of plant signal transduction pathways related to hormones, metabolites and environmental challenges. This protocol, adapted from Zhang et al. (2011), describes a procedure for the isolation of rice protoplasts from green tissue and shows an efficient and rapid method for isolation of nuclei form these protoplasts which are commonly used in a variety of experimental procedures including the isolation of high-molecular-weight DNA (Watson and Thompson, 1986), in vitro DNA synthesis (Roman, 1980), isolation of labeled transcripts for differential screening of cDNA libraries (Somssich et al., 1989), preparation of nuclear extracts for in vitro transcription systems (Roberts and Okita, 1991), isolation of nuclear proteins (Harrison et al., 1992) and studies of protein targeting to the nucleus (Hicks and Raikhel, 1993).
Materials and Reagents
12-day-old plants with 1-2 cm leaves before flowering
Cellulase RS (Yakult Pharmaceutical)
Macerozyme R-10 (Yakult Pharmaceutical)
D-Mannitol (Sigma-aldrich, catalog number: M4125 )
KCl (Sigma-aldrich, catalog number: P9333 )
MES hydrate (Sigma-aldrich, catalog number: M8250 )
CaCl2 (Sigma-aldrich, catalog number: C1016 )
BSA Bovine serum albumin (Sigma-aldrich, catalog number: A2153 )
Spermidine (Sigma-aldrich, catalog number: S2626 )
EDTA (Sigma-aldrich, catalog number: EDS )
Sucrose (Sigma-aldrich, catalog number: 84097 )
Triton X-100 (Sigma-aldrich, catalog number: X100 )
DTT (Sigma-aldrich, catalog number: 43815 )
Enzyme solution (ES) (see Recipes)
Washing and incubation solution (WS1) (see Recipes)
Washing solution (WS2) (see Recipes)
MMG solution (see Recipes)
Nuclei isolation solution (NIB) (see Recipes)
Equipment
Razor blades (No18 sterile stainless steel scalpel balde) (Swann Morton, catalog number: 0323 )
Micro-dissecting forceps (Sigma-aldrich, catalog number: F3767 )
Nunc petri dishes (diam 90 mm × H 15 mm, surface area size 58 cm2, vented) (Sigma-aldrich, catalog number: Z717223 )
50 ml conical tubes (Bioland scientific, catalog number: A02-04 )
Orbitron Rotator I (115 V) (Boekel Scientific)
Nylon mesh CX-60 (120 µm) and CX-400 (38 µm) (Carolina Biological Supplies, catalog number: 65-2222N )
Glass funnel
Hemocytometer [Mfr Part Number: 3100; Cell depth: 0.100mm +/- 2% (1/10mm); Volume: 0.1 Microliter] (PGC Scientific, catalog number: 1907353 ).
Stereo Microscope (Olympus, catalog number: SZ51 )
25G5/8 gauge needle (Kendall, catalog number: KND8881511235 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell isolation
Plant Science > Plant cell biology > Organelle isolation
Cell Biology > Organelle isolation > Nuclei
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,413 | https://bio-protocol.org/exchange/protocoldetail?id=1413&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thirty-Second Net Stressor Task in Adult Zebrafish
Steven Tran
Robert Gerlai
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1413 Views: 8667
Edited by: Soyun Kim
Reviewed by: Antoine de Morree
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Zebrafish have become a popular animal model for behavioral neuroscience (Gerlai, 2014). Recent studies have demonstrated that brief experimental handling prior to euthanizing animals can subsequently alter biological measures quantified post-mortem (e.g. cortisol levels) (Ramsay et al., 2009; Tran et al., 2014). Here we provide a detailed protocol for a simple 30-sec net stressor task for adult zebrafish that increases whole-body cortisol levels without altering the levels of whole-brain dopamine, 3, 4-dihydroxyphenylacetic acid, serotonin, and 5-hydroxyindoleacetic acid (Tran et al., 2014).
Materials and Reagents
Adult zebrafish
System water: Reverse osmosis purified water supplemented with 60 mg/L instant ocean sea salt
2.8 L zebrafish housing tank and lid (Aquaneering, catalog number: ZT280 )
Equipment
Fish net (soft material)
Timer
Zebrafish housing (single sided, five shelf stand alone rack) (Aquaneering)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tran, S. and Gerlai, R. (2015). Thirty-Second Net Stressor Task in Adult Zebrafish. Bio-protocol 5(5): e1413. DOI: 10.21769/BioProtoc.1413.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,414 | https://bio-protocol.org/exchange/protocoldetail?id=1414&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Cellular Redox in Pollen with Redox-Sensitive GFP (roGFP) Using Live Cell Imaging
Wei-Jie Huang
Wei-Hua Tang
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1414 Views: 9951
Edited by: Ru Zhang
Reviewed by: Elias Bassil
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Redox homeostasis is a fundamental property of living cells and responds actively to both cellular metabolism and external stimulus. The development of redox-sensitive GFP (roGFP) enables dynamic monitoring of changes in cellular redox poise (Hanson et al., 2014). When excited alternatively at 405 nm and 488 nm, these probes exhibit significant opposing shifts at the emission spectra (505-530 nm), which enables ratiometric measurement of relative redox values. A more oxidized environment results in a higher 405/488 ratio. Previously, successful application of roGFPs in leaf epidermis or root cells has been reported. Here we provide a protocol describing the application of roGFP1 imaging in growing pollen tubes by confocal laser scanning microscopy.
Keywords: Pollen tube ROS Redox level Live cell imaging
Materials and Reagents
Transgenic tomato or tobacco pollen expressing roGFP1 under the control of the pollen-specific promoter LAT52
40% polyethylene glycol (molecular weight 4,000) (Sigma-Aldrich, catalog number: 81242 )
Pollen germination medium (see Recipes)
Equipment
Biovortexer (Bio Spec Products, catalog number: 1083 )
Orbital shaker (Kylin-Bell Lab Instruments, model: TS-2 )
6 or 24 well cell culture plate
Microscope slides and cover slips
Confocal microscope (OLYMPUS, model: FV1000) or other microscopes equipped with both 405 nm and 488 nm laser lines
Software
Olympus Fluoview version 3.0a
Note: ImageJ (version 1.49 g, Rasband, NIH, USA) can also be used to measure the intensities of confocal images.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, W. and Tang, W. (2015). Measurement of Cellular Redox in Pollen with Redox-Sensitive GFP (roGFP) Using Live Cell Imaging. Bio-protocol 5(5): e1414. DOI: 10.21769/BioProtoc.1414.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,415 | https://bio-protocol.org/exchange/protocoldetail?id=1415&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Splenic Dendritic Cells Using Fluorescence-activated Cell Sorting
ST Simon J Tavernier
FO Fabiola Osorio
SJ Sophie Janssens
Bart N Lambrecht
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1415 Views: 16755
Reviewed by: Kathrin SutterAndrea Introini
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
The spleen is a vastly vasculated organ and consists of a complex organized network of innate and adaptive immune cells. This permits the specialized functions of the spleen such as antibacterial and antifungal immunity and iron metabolism among others (Mebius and Kraal, 2005). Different dendritic cell (DC) subsets reside in the spleen and can be defined by the expression of unique surface markers. These DC subsets are recognized to perform non-redundant functions in the immune system (Merad et al., 2013). In our recent study, we found that Inositol Requiring Enzyme (IRE)-1 is specifically activated in splenic CD8a+ DCs. Furthermore, loss of X-box binding protein (XBP)-1 – the transcription factor regulated by IRE-1 – resulted in defective cross-presentation of dead cell associated antigens by splenic CD8a+ DCs (Osorio et al., 2014). This protocol allows the isolation of specific DC subsets for experimental use ex-vivo.
Materials and Reagents
Mice (Jackson Laboratories, C57Bl/6 )
2,2,2-tribromoethanol (Sigma-Aldrich, catalog number: T48402 )
2-methyl-2-butanol (Sigma-Aldrich, catalog number: 240486 )
PBS (Gibco, catalog number: 10010-015 )
0.5 M EDTA (Lonza, catalog number: 51234 )
2-mercaptoethanol (Sigma-Aldrich, catalog number M3148 )
BSA (Amresco, catalog number: 0332-500g )
HBSS (Life Technologies, catalog number: 24020-091 )
RPMI 1640 GlutaMax (Life Technologies, catalog number: 61870-010 )
Gentamycin (Gibco, catalog number: 15710-049 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F7524 )
Liberase TM (Roche Diagnostics, catalog number: 0 5401127001 ) (dilute 50 mg in 50 ml of RPMI, aliquot and stored at -20 °C)
DNase I (Roche, catalog number: 0 4536282001 ) (dilute content in 1 ml PBS, aliquot and stored at -20 °C)
FACS antibodies
CD3 - FITC (eBioscience, clone 145-2C11, dilution 1/300)
CD19 - FITC (eBioscience, clone 1D3, dilution 1/500)
CD11c - PE-eFluor610 (eBioscience, N418, dilution 1/300)
MHCII - APC-Cy7 (Biolegend, clone M5/114.15.2, dilution 1/1,000)
CD8a - PE-Cy5 (BD-Pharmingen, clone 53-6.7, dilution 1/600)
CD11b - PE-Cy7 (BD-Pharmingen, clone M1/70, dilution 1/800)
CD64 - AF647 (BD-Pharmingen, clone X54-5/7.1, dilution 1/100)
CD16/CD32 (Produced in-house, clone 2.4G2, dilution 1/200)
Note: The use of 2.4G2 minimizes background fluorescence by inhibiting non-specific binding of antibodies to FcG – receptors present on immune cells.
Fixable viability dye eFluor 506 (eBioscience, catalog number: 65-0866-18 )
Reconstitute vial with 400 μl PBS
Aliquot and store vials at -80 °C
Use at a dilution of 1/200
Anti-FITC microbeads (Miltenyi, catalog number 130-048-701 )
LD columns (Miltenyi, catalog number: 130-042-901 )
Ultra comp eBeads (eBioscience, catalog number: 01-2222-42 )
Trypan blue (Sigma-Aldrich, catalog number: T8154 )
Avertin (see Recipes)
2x digestion medium (see Recipes)
MACS buffer (see Recipes)
R10 medium (see Recipes)
Osmotic lysis buffer (see Recipes)
Equipment
100 μm Nylon cell strainer (Falcon, catalog number: 352360 )
15 ml tubes (Falcon, catalog number: 430791 )
35 mm Petri Dishes
5ml syringe (Norm-Ject, catalog number: 4020-000V0 )
25 Gauge needle (Terumo, catalog number: NN-2516R )
Pasteur pipette
Forceps
Surgical scissor/scalpel
37 °C warm water bath
Shaker
Centrifuge
Aspiration device
MACS MultiStand (Miltenyi, catalog number: 130-042-303 )
Midi MACS (Miltenyi, catalog number: 130-042-302 )
Polystyrene 5 ml tubes with 100 μm cell strainer cap (BD Falcon, catalog number: 352235 )
Polypropylene 5ml tubes (BD Falcon, catalog number: 352063 )
Microscope
Bürker-Türk counting plate
Multicolour FACS sorter (BD Aria II or equivalent cell sorter equipped with 405 nm, 488 nm and 633 nm lasers and appropriate filterset)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tavernier, S. J., Osorio, F., Janssens, S. and Lambrecht, B. N. (2015). Isolation of Splenic Dendritic Cells Using Fluorescence-activated Cell Sorting. Bio-protocol 5(5): e1415. DOI: 10.21769/BioProtoc.1415.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Antigen-presenting cell
Immunology > Immune cell staining > Flow cytometry
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,416 | https://bio-protocol.org/exchange/protocoldetail?id=1416&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Citrus Fruit Ascorbic Acid Extraction and Quantification by HPLC
Enriqueta Alós
Joanna Lado
María Jesús Rodrigo
Lorenzo Zacarías
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1416 Views: 18511
Edited by: Samik Bhattacharya
Reviewed by: Laia Armengot
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Citrus are among the most relevant sources of vitamin C (ascorbic acid + dehydroascorbic acid). Recent studies have revealed that it increases in the peel as fruit ripens and remains constant or even decreases in the pulp tissue. Moreover, important differences on ascorbic acid content exist among citrus varieties in both tissues. Here we describe a simple method for vitamin C analysis/quantification in the peel and pulp tissues of citrus fruit.
Keywords: Citrus Ascorbic acid Vitamin C HPLC Dehydroascorbic acid
Materials and Reagents
Citrus fruit tissue (ground frozen flavedo or pulp tissue)
Metaphosphoric acid (MPA) (65%) (Sigma-Adrich, catalog number: 79615 )
Orthophosphoric acid (Sigma-Adrich, catalog number: W290017 )
Tris base (Sigma-Adrich, catalog number: T1503 )
Methanol HPLC-grade (Sigma-Adrich, catalog number: 34860 )
Ascorbic acid (Sigma-Adrich, catalog number: A902902 )
C18 Sep Pak (Waters, catalog number: WAT091139 )
DTT (Sigma-Aldrich, catalog number: D0632 )
Sterile Mili-Q water
0.1% MPA (see Recipes)
2% MPA (see Recipes)
8.5% orthophosphoric acid (see Recipes)
400 mM Tris base (see Recipes)
200 mM DTT in 400 mM Tris base (see Recipes)
Methanol:Milli-Q water (15:85, v/v) (see Recipes)
Ascorbic acid stock solution I for standard curve (see Recipes)
Equipment
Disposable 15 ml plastic tubes
0.45 μm nylon filter (25 mm diameter) (Análisis Vínicos, catalog number: E0036 )
Refrigerated centrifuge (15 ml tubes)
Polytron (Kinematica AG, model: PT-1035 GT; http://www.kinematica.ch/en.html)
HPLC system with a photodiode array detector (PDA, Dionex)
Ultrabase C18 column (100 x 4.6 mm, 2.5 μm)
Software
Chromeleon version 6.80 (Dionex)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Alós, E., Lado, J., Rodrigo, M. J. and Zacarías, L. (2015). Citrus Fruit Ascorbic Acid Extraction and Quantification by HPLC . Bio-protocol 5(5): e1416. DOI: 10.21769/BioProtoc.1416.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Nutrition
Biochemistry > Other compound > Acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,417 | https://bio-protocol.org/exchange/protocoldetail?id=1417&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of Small RNA and qPCR Validation of miRNAs in Vigna mungo
Sujay Paul
Anirban Kundu
Amita Pal
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1417 Views: 10556
Edited by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Small RNAs like microRNAs (miRNAs), small interfering RNAs (siRNAs) and other noncoding RNAs including snRNA and snoRNA have tremendous impact on eukaryotic gene regulation. Extraction of high quality small RNAs is an important prerequisite for experimental analyses of miRNAs. This will prevent RNA degradation and remove associated contaminations including polyphenols, polysaccharides and other secondary metabolites. In this protocol we describe a simple way to isolate small RNAs from the leaf tissues of Vigna mungo combining the protocols of two commercially available kits with some modifications.
Keywords: MicroRNA MYMIV Next Gen Sequencing Vigna mungo
Materials and Reagents
Vigna mungo MYMIV-resistant recombinant inbred line, VMR84
mirPremier microRNA isolation kit (Sigma-Aldrich, catalog number: SNC10 )
Mir-X miRNA FirstStrand synthesis and SYBR qRT-PCR kit (Takara Bio Company, Clontech, catalog number: 638314 )
2-mercaptoethanol (Sisco Research Laboratories, catalog number: 1324196 )
Ethanol (Merck, catalog number: K41540783 )
Liquid nitrogen and dry ice
RNase free water (Bangalore Genei, catalog number: 612151181001730 )
Agarose (Sisco Research Laboratories, catalog number: 0140229 )
Ethidium bromide (Sisco Research Laboratories, catalog number: 054817 )
1x TAE buffer (see Recipes)
Ethidium bromide stock (see Recipes)
Equipment
Thermocycler (DNA Engine Cycler, model: PTC-200 )
Real-time qPCR (Biorad iQ5 Real-Time PCR Detection System)
Centrifuge (Thermo Fisher Scientific, model: MicroCL21 )
Electrophoresis apparatus (Bangalore Genei)
Heat block or water bath
Mortar and pestle
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Paul, S., Kundu, A. and Pal, A. (2015). Extraction of Small RNA and qPCR Validation of miRNAs in Vigna mungo. Bio-protocol 5(5): e1417. DOI: 10.21769/BioProtoc.1417.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,418 | https://bio-protocol.org/exchange/protocoldetail?id=1418&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Gas Chromatography-Mass Spectrometry-Based Two Stage Assay for Measurement of in vitro myo-Inositol 3-phosphate Synthase (INO1) Activity
JM James I. MacRae
Malcolm J. McConville
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1418 Views: 9266
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
This method describes an in vitro assay for measuring INO1 enzyme activity (the conversion of glucose 6-phosphate to myo-inositol 3-phosphate) in cell-free extracts. The method was first described for Plasmodium falciparum cells in MacRae et al. (2014) and consists of two parts: Part 1 describes the assay itself while part 2 describes analysis of the myo-inositol 3-phosphate product using gas chromatography-mass spectrometry (GC-MS).
Materials and Reagents
Cells to be assayed [in the development of this protocol, we used Plasmodium falciparum (3D7 strain) cell cultures and human red blood cells (kindly supplied by the Australian Red Cross)]
13C-U-glucose (Cambridge Isotope Laboratories, catalog number: CLM1396 )
Note: 13C-U-glucose refers to Universally-labelled glucose - i.e. where all six carbons are 13C-atoms.
Hexokinase (>130 Units/mg) (Sigma-Aldrich, catalog number: H4502 )
Adenosine triphosphate (ATP) (Sigma-Aldrich, catalog number: A6419 )
Magnesium chloride (MgCl2, AnalaR) (VWR International, catalog number: 25108.260 )
Tris-HCl (pH 7.5) (Sigma-Aldrich, catalog number: T5941 )
Ammonium chloride (NH4Cl) (Ajax, catalog number: 31-500G )
Nicotinamide adenine dinucleotide (NAD+) (Sigma-Aldrich, catalog number: N3014 )
NaHEPES (pH 7.4) (Sigma-Aldrich, catalog number: H3375 )
Ethylene glycol tetraacetic acid (Sigma-Aldrich, catalog number: E3889 )
Dithiothreitol (Sigma-Aldrich, catalog number: D0362 )
scyllo-Inositol (hereafter abbreviated to ‘sI’) (Sigma-Aldrich, catalog number: I8132 )
Glucose 6-phosphate (Sigma-Aldrich, catalog number: G7879 )
myo-Inositol 3-phosphate (Cayman Chemical Company, catalog number: CAY10007778 )
Chloroform (HPLC grade) (Thermo Fisher Scientific, catalog number: 10615492 )
Methanol (HPLC grade) (Thermo Fisher Scientific, catalog number: 10767665 )
Assay buffer (see Recipes)
Lysis buffer (see Recipes)
Additional materials required for GC-MS
Methoxyamine hydrochloride (Sigma-Aldrich, catalog number: 226904-25G )
Pyridine (Sigma-Aldrich, catalog number: 270970 )
BSTFA + 1% TMCS (Sigma-Aldrich, Supelco, catalog number: 33148 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Equipment
1.5 ml tubes (with safe-lock lids) (Eppendorf)
Bench-top centrifuge for 1.5 ml tubes
1 ml, 200 µl, and 20 µl pipettes and accompanying tips
37 °C water bath
Boiling water bath
Timer
Distilled (e.g. MilliQ) water supply
Light microscope, slides, and cover slips (for assessment of lysis)
Bench-top vortex or water bath sonicator (may be required for efficient lysis)
Additional equipment required for GC-MS
Gas Chromatography-Mass Spectrometer (e.g. Agilent 7890B-5977A)
DB-5MS + DG column, (30m x 0.25 mm, with 10 m inert gap) (Agilent, J&W)
Ultra high purity helium
1.5 ml tubes (Eppendorf)
2 ml glass vials for mass spectrometry (e.g. Agilent, part number: 5182-0715 )
9 mm caps with septa for glass vials (e.g. Agilent, part number: 5185-5820 )
250 µl vial inserts (glass) (Agilent, part number: 5183-2085 )
Rotary vacuum concentrator (e.g. Christ, model: RVC 2-33 CD Plus )
Microdispensers and accompanying glass capillaries (50 µl adjustable, 200 µl) (Drummond Scientific Company)
Software
ChemStation software (MSD ChemStation D.01.02.16) (Agilent)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Carbohydrate
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,419 | https://bio-protocol.org/exchange/protocoldetail?id=1419&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gram Stain for Intestinal Bacteria
LG Luise Goroncy
Robert Zeiser
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1419 Views: 11757
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
With this protocol you can perform a gram stain in paraffin embedded tissue sections.
Materials and Reagents
Tissue sections (paraffin embedded, gained from mice)
Paraffin (Engelbrecht, catalog number: 17932 )
Xylene (VWR International, catalog number: 28975 )
Ethanol (Sigma-Aldrich, catalog number: 32205 )
Iodine (Merck KGaA, catalog number: 109261 )
Safranin (Merck KGaA, catalog number: 109217 )
Crystal violet (Merck KGaA, catalog number: 109218 )
Decolorizing agent (Merck KGaA, catalog number: 110218 )
100% (v/v) ethanol (see Recipes)
96% (v/v) ethanol (see Recipes)
80% (v/v) ethanol (see Recipes)
Equipment
Slide
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial cell biology > Cell staining
Cell Biology > Cell staining > Cell wall
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
142 | https://bio-protocol.org/exchange/protocoldetail?id=142&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Culturing of C57BL/6 Mouse Embryonic Stem (ES) Cell Line
YP Yuqiong Pan
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.142 Views: 16947
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Using ATCC ES C57BL/6 as an example, it is shown here how to culture mouse embryonic stem (ES) cell line. The clonal embryonic stem cell line #693 ES C57BL/6 was derived from a strain C57BL/6J (B6) mouse blastocyst [PubMed: 11730008]. The ES cells were shown to populate the germ line of two host blastocyst donors, FVB/NJ (FVB) and the coisogenic strain C57BL/6-Tyrc-2J (c2J). Coat-color chimera production was high using c2J blastocysts while FVB blastocysts produced a low number of chimeras [PubMed: 11730008].
Materials and Reagents
Cells and cell line:
C57BL/6J (B6) mouse blastocyst (PubMed: 11730008 )
#693 C57BL/6 mouse ES cell line (ATCC, catalog number: SCRC-1002 ™)
CF1 mouse embryonic fibroblast (MEF) feeder cells (self-made from day 12.5 CF1 strain mouse embryos) or other mouse feeder cells such as DR4 (Applied StemCell, catalog number: 1013 )
Medium and growth factors:
DMEM (Life Technologies, Invitrogen™, catalog number: 11995-073 )
Fetal bovine serum (FBS), Qualified (US) (Life Technologies, Invitrogen™, catalog number: 26140-079 )
100x MEM non-essential amino acids (NEAA) (Life Technologies, Invitrogen™, catalog number: 11140-050 )
1,000x 2-Mercaptoethanol, liquid (Life Technologies, Invitrogen™, catalog number: 21985-023 )
100x L-Glutamine (20 mM), liquid (Life Technologies, Invitrogen™, catalog number: 25030-081 )
Penicillin/streptomycin (Pen/Strep), liquid (Life Technologies, Invitrogen™, catalog number: 15140-122 )
1,000 U/ml ESGRO® mouse leukemia inhibitory factor (LIF) (Merck KGaA, catalog number: ESG1107 )
TrypLE™ express stable trypsin-like enzyme with phenol red (Life Technologies, Invitrogen™, catalog number: 12605-028 )
Gelatin from porcine skin-BioReagent, Type A, powder (Sigma-Aldrich, catalog number: G1890-100G )
1x PBS (pH 7.4), liquid (Life Technologies, Invitrogen™, catalog number: 10010-049 )
Ethanol
0.25% gelatin (see Recipes)
Mouse ES cell medium (see Recipes)
Equipment
Incubator: 5% CO2 in humidified air, 37 °C (Thermo Fisher Scientific)
Centrifuges and rotor (Thermo IEC)
BD Primaria* Tissue Culture Dishes, 100 x 20 mm, 08-772-4F (Thermo Fisher Scientific, catalog number: 353803)
10 cm tissue culture dish
Water bath
0.22 µm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pan, Y. (2011). Culturing of C57BL/6 Mouse Embryonic Stem (ES) Cell Line. Bio-101: e142. DOI: 10.21769/BioProtoc.142.
Download Citation in RIS Format
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Developmental Biology > Cell growth and fate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,420 | https://bio-protocol.org/exchange/protocoldetail?id=1420&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neutrophil Isolation from the Intestines
LG Luise Goroncy
Robert Zeiser
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1420 Views: 10944
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
This protocol provides the possibility to isolate leukocytes including neutrophils out of intestinal tissues to use the received cells in further experiments of interest.
Materials and Reagents
HEPES (Serva, catalog number: 25245 )
EDTA (Merck KGaA, catalog number: 108418 )
Dispase in HBSS (BD Bioscience, catalog number: 354235 )
Collagenase D (Roche Diagnostics, catalog number: 11088866001 )
DNAse I (Sigma-Aldrich, catalog number: DN25 )
4% (v/v) FCS (PAN Biotech, catalog number: P30-3302 )
Ice-cold PBS (Gibco, catalog number: 14190-094 )
HBSS (Gibco, catalog number: 14175-053 )
Percoll (GE Healthcare, catalog number: 17-0891-01 )
10x PBS (Ambion, catalog number: AM9624 )
RPMI (Gibco, catalog number: 21875-034)
Cell-dissociation buffer (CD buffer) (see Recipes)
Digestion solution (see Recipes)
40% percoll (see Recipes)
80% percoll (see Recipes)
Equipment
Incubator (New Brunswick Scientific, incubator shaker G25)
15 ml tube (Greiner Bio-One, catalog number: 188161 )
Centrifuge (Thermo Scientific, model: Multifuge X1R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial cell biology > Cell staining
Cell Biology > Cell staining > Cell wall
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,421 | https://bio-protocol.org/exchange/protocoldetail?id=1421&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Phospho-KRAS by Electrophoretic Mobility Change in Human Cell Lines and in Tumor Samples from Nude Mice Grafts
CB Carles Barceló*
NP Noelia Paco*
DC Debora Cabot
EG Eduard Garrido
NA Neus Agell
MJ Montserrat Jaumot
*Contributed equally to this work
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1421 Views: 9368
Edited by: HongLok Lung
Reviewed by: Thomas J. BartoshShalini Low-Nam
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
KRAS is the oncogene most frequently mutated in human solid tumors especially in pancreas, colon, small intestine, biliary tract and lung. We have recently demonstrated that oncogenic KRAS needs S181 phosphorylation to fully display its oncogenic features suggesting its inhibition as a therapeutic treatment against KRAS-driven tumors. Due to the importance to detect KRAS phosphorylation in human tumors and the absence of specific antibodies against phosphorylated KRAS, we developed a new protocol based on the Phos-tag SDS methodology to detect this post-translational modification for KRAS. Phos-tag is a molecule that binds specifically to phosphorylated proteins, decreasing their migration speed in SDS-PAGE and allowing its separation from the non-phosphorylated forms.
Materials and Reagents
Human tumor cell lines
Human tumor samples grown in immunodeficient mice from living cells or tissue origins
Phos-tagTM acrylamide (Wako Chemicals GmbH, catalog number: 304-93521 , #AAL-107)
λ Protein phosphatase (≥400,000 units/ml) (Calbiochem, catalog number: 539514-20KV )
Anti- c- KRAS (clone Ab-1) mouse mAb (Calbiochem, catalog number: OP24 ) or any antibody against a putative tag-KRAS expressed (HA tag has been tested successfully)
Protease inhibitors final concentrations
Aprotinin: 150 nM (1 μg/ml) (Sigma-Aldrich, catalog number: A1153 ) (recommended stock solution 1 mg/ml)
Leupeptin: 20 μM (10 μg/ml) (Sigma-Aldrich, catalog number: L2884 ) (recommended stock solution 1 mg/ml)
Phenylmethanesulfonyl fluoride (PMSF): 1 mM (Sigma-Aldrich, catalog number: S6508 ) (recommended stock solution 100 mM)
Phosphatase inhibitors
Sodium orthovanadate: 0.2 mM (Sigma-Aldrich, catalog number: S6508) (recommended stock solution 200 mM)
Sodium fluoride: 5 mM (Sigma-Aldrich, catalog number: S7920 ) (recommended stock solution 1 M)
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896 )
Dynabeads Protein G for immunoprecipitation (Novex by Life Technologies, catalog number: 10003D )
Temed
13% ammonium persulfate (APS)
MnCl2 stock solutions 10 mM and 25 mM
λ phosphatase lysis buffer (see Recipes)
3x SDS sample buffer (see Recipes)
Electrophoresis running buffer (see Recipes)
Transfer buffer (see Recipes)
5 mM Phos-tag stock solution (see Recipes)
20x PBS (see Recipes)
Solution 1 for SDS-PAGE (see Recipes)
Solution 2 for SDS-PAGE (see Recipes)
Solution 3 for SDS-PAGE (see Recipes)
Resolving composition of a 12% SDS-PAGE mini gel (1.5 mm thickness) for Phos-tag (see Recipes)
Stacking composition of a 12% SDS-PAGE mini gel (1.5 mm thickness) (see Recipes)
Equipment
Tissue grinder (Dounce) (1 ml) (Wheaton, catalog number: 357538 )
Magnet DynaMagTM-2 (Life Technologies, catalog number: 12321D )
Tube Rotator (Bibby Scientific Ltd., Stuart SB2)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barceló, C., Paco, N., Cabot, D., Garrido, E., Agell, N. and Jaumot, M. (2015). Detection of Phospho-KRAS by Electrophoretic Mobility Change in Human Cell Lines and in Tumor Samples from Nude Mice Grafts. Bio-protocol 5(6): e1421. DOI: 10.21769/BioProtoc.1421.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Molecular Biology > Protein > Detection
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,422 | https://bio-protocol.org/exchange/protocoldetail?id=1422&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Chemiluminescence Based Receptor-ligand Binding Assay Using Peptide Ligands with an Acridinium Ester Label
MW Mari Wildhagen
MB Melinka A. Butenko
RA Reidunn B. Aalen
GF Georg Felix
MA Markus Albert
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1422 Views: 10698
Edited by: Tie Liu
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Studying the biochemical interaction of ligands with their corresponding receptors requires highly sensitive detection and monitoring of the bound ligand. Classically, radioactively labelled ligands have been widely used as highly sensitive tools for such binding measurements. Disadvantages of radiolabelling include instability of products, high costs and risks of working with radioactivity. Thus, assays using chemiluminescent probes offer convenient, highly sensitive alternatives. Here we suggest acridinium esters as suitable conjugates to label ligands of interest. Chemical oxidation of acridinium esters triggers chemiluminescence, allowing quantitation of this compound down to amol concentrations in standard luminometers. The first report about acridinium esters in immunoassays date back to 1983 (Weeks et al., 1983) and demonstrated the ability to conjugate acridinium to peptides, followed by using such peptides to measure receptor – peptide ligand interactions (Joss and Towbin, 1994).
Recently, this binding assay was adapted for studying derivatives of the plant peptide IDA (INFLORESCENCE DEFICIENT IN ABSCISSION) and their interaction with the corresponding receptor HSL2 (HAESA-LIKE 2) was reported (Butenko et al., 2014). Here we describe how this sensitive, nonradioactive binding approach can be used to reveal receptor-ligand binding in plant material.
Materials and Reagents
Plant material harboring the receptor of interest in an immobilized form
Suggested plant materials could be: Intact cells from suspension cultures, ground plant tissue or isolated receptors immobilized on immunoprecipitation beads.
Notes:
The receptor must be immobilized (on cells, cell debris, IP-beads) in order to allow efficient washing to remove unbound ligand without washing away the receptor molecules.
Levels of some receptors are exceedingly low. Therefore, overexpression, e.g. by transient expression in Nicotiana benthamiana (N. benthamiana) leaves (Li, 2011), may be required to obtain sufficient binding sites.
Use a negative control, same material lacking a functional receptor, whenever possible.
MES (2-ethanesulfonic acid)
NaCl
DTT
33 µl proteinase Inhibitor (Sigma-Aldrich, catalog number: P9599 )
5 mM citric acid
0.03 % H2O2 in 100 mM NaOH (prepare fresh from a 30% H2O2 stock)
Appropriate binding buffer (see Recipes)
Equipment
Mortar and pestle
Table top centrifuge
Luminometer (e.g. single tube machines like FB 12, Berthold technologies, that allows injection)
Acridinium-labeled peptide
Important: The modified peptide should be tested for biological activity in your usually used bio-assay of choice and should not deviate much from the activity of the unmodified peptide.
Unlabeled peptide (synthetic unlabeled peptides can be ordered by e.g. Biomatik)
Peptides and conjugation with acridinium
Note: Peptides can be ordered (on resin) from a company of choice or synthesized using solid-phase technology with Fmoc-protected amino acids. Acridinium esters can be conjugated to the N-terminal amino groups of the peptides on resin by coupling with N-hydroxysuccinimide activated acridinium esters (Cayman) before deprotection and purification of the peptides via HPLC.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wildhagen, M., Butenko, M. A., Aalen, R. B., Felix, G. and Albert, M. (2015). A Chemiluminescence Based Receptor-ligand Binding Assay Using Peptide Ligands with an Acridinium Ester Label. Bio-protocol 5(6): e1422. DOI: 10.21769/BioProtoc.1422.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant immunity > Perception and signaling
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,423 | https://bio-protocol.org/exchange/protocoldetail?id=1423&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chemiluminescence Detection of the Oxidative Burst in Plant Leaf Pieces
MA Markus Albert
MB Melinka A. Butenko
RA Reidunn B. Aalen
GF Georg Felix
MW Mari Wildhagen
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1423 Views: 17929
Edited by: Tie Liu
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The production of 'reactive oxygen species' (ROS), also termed oxidative burst, is a typical cellular response of animals and plants to diverse biotic and abiotic stresses. Here, we outline the detection of the ROS-burst in plant leaf pieces using a luminol-based bioassay which allows for the detection of chemiluminescence. The assay was originally described by Keppler et al. (1989) and subsequently adapted for other plant cells and tissues (Felix et al., 1999) and also used in recent publications (Albert et al., 2013; Albert et al., 2010; Butenko et al., 2014; Halter et al., 2014). In this protocol we outline a standardized version of this assay including remarks and recommendations for data evaluation and interpretation of results.
Materials and Reagents
Plant leaf pieces (any plant of interest, e.g. Arabidopsis or N. benthamiana transiently expressing a construct of interest)
Water
200 µM luminol L-012 (Wako Chemicals USA, catalog number: 075-05111 ; http://www.wako-chem.co.jp/english/labchem/journals/wpu_bio1/10.htm)
10 µg/ml peroxidase, horseradish peroxidase (AppliChem, catalog number: A3791 )
MAMPs or any elicitors of interest
Known MAMP as positive control (e.g. flg22, chitin-oligomers, etc.)
10x luminol master mix (see Recipes)
Equipment
Scissors
Petridishes
Small spatula
96 well plates, white, flat-bottomed (e.g., LIA-plate, whit, 96-well, flat-bottom, Greiner Bio-One GmbH) or suitable cuvettes for single cell instruments
Luminometer, either a 96 well plate reader (e.g., Centro LB 960, Microplate Luminometer, BERTHOLD TECHNOLOGIES) or a single cell instrument
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,424 | https://bio-protocol.org/exchange/protocoldetail?id=1424&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Scanner-based Time-lapse Root Phenotyping
Michael O. Adu
LW Lea Wiesel
MB Malcolm J. Bennett
MB Martin R. Broadley
Philip J. White
LD Lionel X. Dupuy
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1424 Views: 13013
Edited by: Samik Bhattacharya
Reviewed by: Arsalan DaudiRenate Weizbauer
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Non-destructive phenotyping of root system architecture can facilitate breeding for root traits that optimize resource acquisition. This protocol describes the construction of a low-cost, high-resolution root phenotyping platform, requiring no sophisticated equipment and adaptable to most laboratory and glasshouse environments. The phenotyping platform consists of germination paper abutting scanners and open-source image acquisition software which allows live imaging of root systems. The phenotyping platform is scalable, modular and inexpensive.
Keywords: Root system architecture Phenotyping Image analysis Brassica rapa Soil nutrient
Materials and Reagents
Seeds of the plants to be investigated
Note: We used seeds of Brassica rapa L.
Nutrient solution (see Recipes)
Note: Composition will depend on experimental requirements.
Equipment
Large (30 x 42 cm) and small (12 x 12 cm) steel blue Anchor seed germination paper (Anchor Paper Company, catalog number: SGB1924B) for phenotyping platform and seed germination, respectively
Duct tape (office DEPOT)
Ferrite magnetic strip with adhesive back (0.75 mm thick) (RS Components, catalog number: 297-9116)
Square bioassay or petri dishes (120 mm x 120 mm x 17 mm) (Sigma-Aldrich, catalog number: Z617679)
Note: This could be improvised with empty compact disc (CD) cases or any kind of transparent box that meets the specified dimensions.
Black Perspex plates (21.5 x 30.0 cm) custom-made from opaque cast acrylic boards (Perspex Cast 9T30 Black Sheet) (plastock)
Computer
Note: This should be Windows-based and should have a directory with sufficient space to save images. In our platform, a Canon flatbed scanner imaging a root system at 300 dpi produces a single image of 40.2 MB. With 24 scanners in operation and images taken every 12 h, a minimum free space of approximately 30.0 GB is required for an experiment lasting 14 days. We used a Dell computer Intel® CoreTM i3-4150 Processor- Dual Core, 4 GB 1,600 MHz Memory and 500 GB Hard Drive for our experiments but images were saved on 2 TB WD external hard drive.
Canon flatbed scanners (CanoScan, model: 5600F)
Note: Any scanner with a TWAIN driver can be used. A TWAIN driver is software that comes as part of the software package of digital imaging devices such as scanners and cameras. The TWAIN driver provides an interface for communication between the software and the hardware of digital imaging devices (http://www.twain.org/). In our platform, the TWAIN driver translated commands from our ArchiScan image acquisition software (http://www.archiroot.org.uk/) into instructions to control the hardware of the scanners.
Setting up scanners
Remove the cover of the scanner as shown in Figure 1.
Attach magnetic strips to the short-edges of the scanner window (Figure 1B).
Note: This is optional as duct tape could be used to hold plates to scanners.
Figure 1. A. Original flatbed scanner. B. Modified flatbed scanner with cover detached.
Support for germination paper
Glue to the edges of the Perspex plates strips of Perspex (0.3 x 0.3 x 30 cm and 0.3 x 0.3 x 21.5 cm for the long-edges and short-edges of the Perspex plate, respectively).
Note: This is to provide some separation between the plate and the scanners.
Allow two gaps in the Perspex strips, each approximately 3 cm wide, along the long edge of the Perspex plates to allow gas exchange with the surrounding atmosphere and unimpeded shoot growth (Figure 2).
Fix magnetic strips along the two short-edges of the Perspex plate to aid abutting of the Perspex plate to the scanner window (optional).
Figure 2. (A) Schematic representation of the Perspex plate used as a scanner cover and also to attach germination paper onto scanners. (B) Black Perspex plates used as scanner covers and also to hold germination paper vertically on scanner surfaces
Software
ImageJ (http://imagej.nih.gov/ij/)
ArchiScan and ImageJ custom macros for convex hull and particle analyses (Adu et al., 2014; http://www.archiroot.org.uk/ )
SmartRoot (Lobet et al., 2011; http://www.uclouvain.be/en-smartroot)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Adu, M. O., Wiesel, L., Bennett, M. J., Broadley, M. R., White, P. J. and Dupuy, L. X. (2015). Scanner-based Time-lapse Root Phenotyping. Bio-protocol 5(6): e1424. DOI: 10.21769/BioProtoc.1424.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant developmental biology > Morphogenesis
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,425 | https://bio-protocol.org/exchange/protocoldetail?id=1425&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rapid Preparation of Unsheathed Bacterial Flagella
Soazig Le Guyon
MR Mikael Rhen
Ute Römling
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1425 Views: 9997
Edited by: Fanglian He
Reviewed by: Amit DeyEsteban Paredes-Osses
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The flagellum is required for bacterial swimming and swarming motility. In the biphasic Salmonella enterica serovar Typhimurium (S. Typhimurium), the flagellar filament is build up by two distinct monomeric subunits, flagellin FliC and FljB. S. Typhimurium has the ability to switch between two flagellins, FliC and FljB, in a phase-variable manner. The switch to FliC is called phase H1 and considered important for bacterial growth and survival in the spleen in a murine infection model of typhoid fever. Flagellin is secreted as monomeric subunits, but the majority of flagellin is polymerized upon secretion as the flagellar filament. Salmonella flagellin has traditionally been isolated through a process involving multiple steps of centrifugation and acid treatment. Here, we delineate a simplified protocol for preparing Salmonella´s flagellin for analytical purpose to determine the amount of flagellin without the aid of antibodies. The growth conditions used were stationary phase, logarithmic phase and a low oxygen and high salt condition mimicking the gastrointestinal tract. Flagellin expression of other source organisms, such as other serovars of Salmonella enterica and Escherichia coli, including flagellar phase- or genetic variants can be analysed. Flagellin expression analysis complements flagella-associated phenotype analysis such as swimming and swarming behaviour.
Keywords: Bacteria Salmonella Flagellin Flagellar phase variation
Materials and Reagents
Bacterial strains (S. Typhimurium)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
100% trichloroacetic acid (Sigma-Aldrich, catalog number: T6399 )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Trizma® base (powder) (Sigma-Aldrich, catalog number: T1503 )
1 M HCl solution (Sigma-Aldrich, catalog number: H1758 )
Glycerol 1 L (Sigma-Aldrich, catalog number: 49781 )
Sodium dodecyl sulfate - 500 g (Sigma, catalog number: L4390 )
Tryptone (BD-catalog number: 211705 )
Yeast extract (BD, catalog number: 212750 )
Agar (BD, catalog number: 281230 )
Bromophenol blue (Shelton scientific, catalog number: IB74040 )
Glycerol stock for one vial (see Recipes)
LB medium (see Recipes)
1 M Tris (see Recipes)
2x SDS sample buffer (see Recipes)
Equipment
Falcon tubes (50 ml and 15 ml) (TPP, catalog numbers: 91050 and 91115 )
Filter Flasks (pore size 0.22 μm diameter) (TPP, catalog number: 99500 )
Eppendorf tubes (1.5 ml) (Sarstedt, catalog number: 72.690.001 )
Incubator (adjusted to 37 °C) (Memmert, model: ULE500 )
Rotary shaker (HTINFORS, model: Minitron )
Spectrophotometer (Hitachi, model: U1100 )
Thermoblock (PEQLAB, model: 1202 )
Vortex mixer (VWR International, model: 1719 )
Luer lock tips (BD PLASTIKPAK, catalog number: 302187 )
Needle (0.51 mm outer diameter) (BD Microlance sterile, model25 g x 5/8” x 100)
Sterile petri dishes (90 mm) (Sartorius, catalog number: 14-555-735 )
Centrifuge (HERAEUS, model: PICO17 )
Microcentrifuge (NeoLab, model: microcentrifuge II )
pH meter (Hanna instruments, model: pH211 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Guyon, S. L., Rhen, M. and Römling, U. (2015). Rapid Preparation of Unsheathed Bacterial Flagella . Bio-protocol 5(6): e1425. DOI: 10.21769/BioProtoc.1425.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Organelle isolation
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,426 | https://bio-protocol.org/exchange/protocoldetail?id=1426&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Substrate Specificity of Recombinant Ser/Thr Protein Kinase
AZ Anna A. Zorina
GN Galina V. Novikova
Dmitry A. Los
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1426 Views: 9288
Edited by: Maria Sinetova
Reviewed by: Yoko EguchiTatsuki Kunoh
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Protein kinases are enzymes that phosphorylate proteins in a cell. Determination of kinase activity in reactions of phosphorylation is a very convenient way for a biochemical characterization of this group of enzymes. Here we describe a method to determine the activity of a recombinant Ser/Thr protein kinase using as a possible substrate MBP, H1, and BSA.
Materials and Reagents
Escherichia coli (E.coli) strains - for cloning and for expression - DH5α, Rosetta (DE3 pLysS)
Specific synthetic oligonucleotides
PCR reagents (dNTP, MgCl2, PCR buffer, Taq-polymerase, DNA) (Thermo Fisher Scientific, catalog numbers: R0181 , EP0612 )
Plasmids for cloning and for expression [pTZ57R/T, pET41a(+)]
CaCl2 (Sigma-Aldrich, catalog number: C3306-250G ) (for transformation)
Antibiotics (Ampicillin, Kanamycine, Chloramphenicol) (AppliChem, catalog numbers: A-0839 , A-1493 , A-6435 )
Isopropyl thio-β-D-galactoside (IPTG) (Fermentas, catalog number: R0393 )
Tris-HCl (Sigma-Aldrich, catalog number: T6791 )
Ethylenediaminetetraacetic acid (EDTA) (AppliChem, catalog number: A-1104.0500 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815-5G )
Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889-10G )
Na3VO4 (Sigma-Aldrich, catalog number: S6508-10G )
NaF (Sigma-Aldrich, catalog number: S7920-100G )
β-glycerophosphate (Sigma-Aldrich, catalog number: G9422-50G )
Sucrose (AppliChem, catalog number: A-1125 )
Phenylmethylsulfonyl fluoride (PMSF) (AppliChem, catalog number: A-0999 )
Benzamidine hydrochloride (Sigma-Aldrich, catalog number: B6506 )
6-aminocaproic acid (Sigma-Aldrich, catalog number: A7824-25G )
2-(N-morpholino)ethanesulfonic acid (MES) (Amresco, catalog number: Am-E169-0.05 )
Myelin Basic Protein bovine (MBP) (Sigma-Aldrich, catalog number: M1891-5MG )
Histone from calf thymus (H1) (Sigma-Aldrich, catalog number: H5505-100MG )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: 05470-1G )
MgCl2 (AppliChem, catalog number: A-1447 )
Brilliant Blue R Concentrate (Sigma-Aldrich, catalog number: B8647 )
BCA Protein Assay Kit (Pierce Thermo Scientific, catalog number: 23227 )
Sodium dodecyl sulfate, SDS (Sigma-Aldrich, catalog number: L3771 )
TGX FastCast Acrylamide Starter Kit (12%) (Bio-Rad Laboratories, catalog number: 161-0175 )
N,N,N',N'-tetramethylethylenediamine (TEMED) (Bio-Rad Laboratories, catalog number: 161-0800 )
Ammonium Persulfate (APS) (Bio-Rad Laboratories, catalog number: 161-0700 )
Illustra NAP-5 Columns (GE Healthcare Life Sciences, catalog number: 17-0853-02 )
[γ-32P] ATP
Homogenization buffer (see Recipes)
Reaction mixture (see Recipes)
Equipment
Temperature controlled shaker (Heidolph, model: Unimax 1010 )
French Pressure Cell Press (Aminco) or glass beads (Sigma-Aldrich, catalog number: G4649 ) for cell disruption
Thermostat
Spectrophotometer
Gel electrophoresis equipment (Mini-PROTEAN Tetra Handcast Systems, Bio-Rad Laboratories, catalog number: 165-8000 )
Laminar flow box
Refrigerated microcentrifuge preset to 4 °C (Eppendorf, model: 5415 R )
Gel Dryer System (Bio-Rad Laboratories, catalog number: 165-1789 )
Exposure cassette/BioMax® intensifying screen set (Sigma-Aldrich, catalog numbers: C4979 and P8432 )
Carestream® Kodak® autoradiography GBX developer/replenisher (Sigma-Aldrich, catalog number: P7042 )
Carestream® Kodak® autoradiography GBX fixer/replenisher (Sigma-Aldrich, catalog number: P7167 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zorina, A. A., Novikova, G. V. and Los, D. A. (2015). Substrate Specificity of Recombinant Ser/Thr Protein Kinase. Bio-protocol 5(6): e1426. DOI: 10.21769/BioProtoc.1426.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Interaction
Cell Biology > Cell signaling > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,427 | https://bio-protocol.org/exchange/protocoldetail?id=1427&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Airbrush Infiltration Method for Pseudomonas syringae Infection Assays in Soybean
MB Shine
Da-Qi Fu
Aardra Kachroo
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1427 Views: 9648
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
We developed this protocol to assay the extent of proliferation of Pseudomonas syringae pv. glycinea in soybean leaves. This method specifically enables accurate pathogenesis assays of soybean plants at V2/V3 (2nd/3rd trifoliate) or higher stages of growth. The leaves of soybean plants at these growth stages are not amenable to bacterial infiltration using routine needleless syringe infiltration due to the high number of trichomes on these mature leaves. This method enables efficient infiltration of bacteria into the epidermal cells of mature leaves using a pressure pump.
Materials and Reagents
Plant material
Soybean (Glycine max Merr.) plants of V2 (2nd trifoliate), V3 (3rd trifoliate), or higher stages of growth were used. Plants at VC (two leaf stage)/V1 (1st trifoliate) stages can also be used. Cultivars for various R loci: Rpg1-b (Harosoy), Rpg2 (Merit, Norchief), Rpg3 (Flambeau), Rpg4 (Flambeau), rpg (Essex).
Bacterial strains
P. syringae pv. glycinea expressing avr gene of interest via the broad host range plasmids pDSK519 or pDSK600.
P. syringae pv. glycinea expressing empty pDSK519/600 plasmids as control.
Media and buffers
10 mM MgCl2 (sterile)
King’s B medium (plates and liquid media) (see Recipes)
Other reagents
Tryptone (Teknova, catalog number: T9012 )
K2HPO4 (Fisher BioReagents, catalog number: BP363 )
Glycerol (Affymetrix, catalog number: 16374 )
Agar (Affymetrix, catalog number: 10654 )
Silwet L-77 (Momentive, New Smyrna Beach)
Antibiotics (Gold Biotechnology)
Rifampicin (50 mg/ml) (R-120)
Kanamycin (50 mg/ml) (K-120)
Spectinomycin (100 mg/ml) (S-140)
Sreptomycin (300 mg/ml) (S150)
Equipment
High-speed floor centrifuge (Thermo Fisher Scientific, Sorvall RC 6 plus)
Spectrophotometer (Thermo Fisher Scientific, model: BioMate 5 )
Pressure pump (Gast Manufacturing, model: DOA-P704-AA )
Airbrush (Badger Air-brush, model: 250-2 )
Test tubes (Thermo Fisher Scientific)
Microcentrifuge tubes (Thermo Fisher Scientific)
Glass rods (Thermo Fisher Scientific)
Pellet pestles (Sigma-Aldrich)
Cork borer (1 cm diameter, Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,428 | https://bio-protocol.org/exchange/protocoldetail?id=1428&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Isolation from Synechocystis
Kirill S. Mironov
Dmitry A. Los
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1428 Views: 23144
Edited by: Maria Sinetova
Reviewed by: Claudia CatalanottiAksiniya Asenova
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
The protocol describes the procedure of total RNA isolation from cells of the cyanobacterium Synechocystis sp. PCC 6803. This protocol is also applicable to Synechococcus elongatus PCC 7942 and PCC 6301, Thermosynechococcus vulcanus, and other unicellular and filamentous species of cyanobacteria that do not have thick polysaccharide-containing outer layers. For the latter, Trizol-containing protocols should be adapted. The yield of RNA depends on optical density of cyanobacterial culture and may reach up to 10-20 µg of total RNA per 1 ml of cell culture. RNA isolated by this method can be used for Northern blot hybridization, RT-qPCR, microarrays and Next Generation Sequencing.
Keywords: Synechocystis Cyanobacteria RNA isolation RNA quality Hot phenol
Materials and Reagents
Cyanobacterial culture (50 ml) (OD750 ~ 2) grown in BG11 medium (Rippka, 1988)
95% ethanol for molecular biology (keep at -20 °C)
70% ethanol for molecular biology (30 ml of RNAse free water and 70 ml 95% ethanol, keep at -20 °C)
70% ethanol for sterilization
Phenol BioUltra (for molecular biology, TE-saturated, ~73%) (Sigma-Aldrich, catalog number: 77607 ) (keep at 4 °C)
1 M Tris-HCl (Life Technologies, catalog number: 15568-025 )
0.5 M EDTA-Na2 (pH 8.0) (Life Technologies, catalog number: AM9260G )
RNase-free autoclaved water
Chloroform (Sigma-Aldrich, catalog number: C2432 ) (keep at 4 °C)
10 M lithium chloride solution (Fluka, catalog number: 83268 ) (chill on ice before use)
RNAse-free DNAse
Agarose for molecular biology (Sigma-Aldrich, catalog number: A9539 )
TAE electrophoresis buffer (Sigma-Aldrich, catalog number: T9650 )
RNA ladder (Life Technologies, InvitrogenTM, catalog number 15620-016 )
TE buffer (see Recipes)
50/100 TE buffer (see Recipes)
10 M LiCl solution in water (see Recipes)
Cell fix solution (see Recipes)
Equipment
Saran wrap (any type)
Autoclave bag (Sigma-Aldrich, catalog number: Z692212 )
Safe-Lock tubes (2.0 ml) (Eppendorf, catalog number: 0030 120.094 )
50 ml plastic conical polypropylene tubes (sterile, nuclease-free, nonpyrogenic, autoclavable) (Life Technologies, catalog number: AM12501 or Corning, Falcon )
Autoclave
Refrigerated centrifuge with bucket rotor that fits 50 ml conical tubes (Eppendorf, model: 5804 R and Swing-bucket rotor A-4-44 with 50 ml Falcon adapters)
Refrigerated microcentrifuge preset to 4 °C (Eppendorf, model: 5415 R )
Water bath preset to 65 °C
Subzero refrigerators: -20 °C and -70 °C
Fume hood
Ice bath
Multi tube automated vortex (for example, Micro tube mixer MT-400, Tomy Digital Biology)
UV-spectrophotometer (preferably, Nanodrop)
Agarose gel electrophoresis equipment (VWR Mini Gel II Complete Horizontal Electrophoresis System, catalog number: 95043-650)
Note: Workplace, pipettes, gloves etc. should be cleaned with 70% ethanol before RNA isolation procedures. Conical tubes, Eppendorf tubes, pipette tips should be sterilized by autoclaving in autoclave bags before use.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mironov, K. S. and Los, D. A. (2015). RNA Isolation from Synechocystis. Bio-protocol 5(6): e1428. DOI: 10.21769/BioProtoc.1428.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,429 | https://bio-protocol.org/exchange/protocoldetail?id=1429&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Staining of Callose Depositions in Root and Leaf Tissues
SS Sebastian T. Schenk
Adam Schikora
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1429 Views: 26480
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
The plant cell wall is a physical barrier, which fulfills a plethora of functions, for example it can efficiently prevent pathogen’s entry into the cell. In addition, its changing composition contributes to plants inducible defense mechanisms. This layer of defense includes pathogen perception and is followed by the activation of defense responses resulting, among others, in a modification and remodeling of the cell wall. This relatively late defense response (hours or days after contact with pathogen) comprises the accumulation of polysaccharides, such as the 1,3-ß-glucan callose, phenolic compounds and reactive oxygen species. Callose depositions occur during normal plant growth (e.g. in the phloem), they can be also a response to different stress stimuli. During the response to pathogen attack, callose depositions are essential part of cell wall reinforcement and are important for successful plant defense. Here, we describe a method to stain callose apposition spots, which can be used to quantify this defense response.
Materials and Reagents
Plant material
Flg22 (a flagellin-derived, 22 amino acid-long peptide) (QRLSTGSRINSAKDDAAGLQIA)
100% ethanol
100% acetic acid (Carl Roth, catalog number: 3738.5 )
K2HPO4 (Carl Roth, catalog number: P749.2 )
Aniline blue or water blue (Fluka Chemika, catalog number: 95290)
Glycerol (Carl Roth, catalog number: 7530.4 )
Filter paper (Munktell, catalog number: 3.00343.080)
Destaining solution (see Recipes)
Wash solution (see Recipes)
Staining solution (see Recipes)
Equipment
Plastic equipment allowing to float plant material in staining solution (Grainer Falcon 50 ml tubes, catalog number: 227261 ; Grainer 6-well culture plates, catalog number: 657160 )
Vacuum pump (Savant Systems LLC, catalog number: SC110 : 25-30 Hg)
Microscope (Zeiss, model: Axioplan 2ie) with UV lamp (FluoArc/001.26B) and ‘DAPI’ filter (excitation filter 390 nm; dichroic mirror 420 nm; emission filter 460 nm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant cell biology > Cell staining
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
143 | https://bio-protocol.org/exchange/protocoldetail?id=143&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Inoue Method for Preparation and Transformation of Competent E. coli: "Ultra Competent" Cells
HI Hogune Im
Published: Oct 20, 2011
DOI: 10.21769/BioProtoc.143 Views: 47596
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol differs from other procedures in that the bacterial culture is grown at 18 °C rather than the conventional 37 °C. Otherwise, the protocol is unremarkable and follows a fairly standard course. Why growing the cells at low temperature should affect the efficiency of transformation is unknown. Perhaps the composition or the physical characteristics of bacterial membranes synthesized at 18 °C are more favorable for uptake of DNA, or perhaps the phases of the growth cycle that favor efficient transformation are extended. Incubating bacterial cultures at 18 °C is a challenge. Most laboratories do not have a shaking incubator that can accurately maintain a temperature of 18 °C summer and winter. One solution is to place an incubator in a 4 °C cold room and use the temperature control to heat the incubator to 18 °C. Alternatively, there is almost no loss of efficiency if the cultures are grown at 20-23 °C, which is the ambient temperature in many laboratories. Cultures incubated at these temperatures grow slowly with a doubling time of 2.5 to 4 h. To avoid reaching desired OD late at night, set up cultures in the evening and harvest the bacteria early the following morning. The procedure works well with many strains of E. coli in common use in molecular cloning, including XL1-Blue, DH1, JM103, JM108/9, DH5a, and HB101.
Materials and Reagents
Strains of E. coli: XL1-Blue, DH1, JM103, JM108/9, DH5a, and HB101.
DMSO: Oxidation products of DMSO, presumably dimethyl sulfone and dimethyl sulfide, are inhibitors of transformation (Hanahan, 1985). To avoid problems, purchase DMSO of the highest quality. (Merck KGaA/EMD Millipore, catalog number: ES-002-10F )
PIPES (Alfa Aesar, catalog number: 3p B21835-22 )
Deionized H2O
Yeast Extract
Tryptone
KCl
NaCl
NaOH
MgCl2
MgSO4
Antibiotic
MnCl2.4 H2O
CaCl2.2 H2O
Glucose
Liquid nitrogen
Ethanol
Sugar
Inoue transformation buffer (see Recipes)
SOB medium (see Recipes)
SOC medium (see Recipes)
Luria-Bertani (LB) medium (see Recipes)
0.5 M piperazine-1,2-bis(2-ethanesulfonic acid) (PIPES) (pH 6.7) (see Recipes)
Equipment
Centrifuges and Rotors (American Laboratory Trading)
Milli-Q filtration system (EMD Millipore)
Polypropylene 2059 tubes (17 x 100 mm) (BD Biosciences, Falcon®), chilled in ice
Shaking Incubator (18 °C)
Water bath (42 °C)
Nalgene filter
Disposable prerinsed Nalgene filter (0.45-mm pore size)
250-ml flask
Sorvall GSA rotor
Vacuum aspirator
Bent glass rod
Bunsen burner
0.22 μm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Im, H. (2011). The Inoue Method for Preparation and Transformation of Competent E. coli: "Ultra Competent" Cells. Bio-101: e143. DOI: 10.21769/BioProtoc.143.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,430 | https://bio-protocol.org/exchange/protocoldetail?id=1430&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lignin Extraction and Quantification, a Tool to Monitor Defense Reaction at the Plant Cell Wall Level
SS Sebastian T. Schenk
Adam Schikora
Published: Vol 5, Iss 6, Mar 20, 2015
DOI: 10.21769/BioProtoc.1430 Views: 15227
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Lignin is a complex polymer of phenolic compounds (monolignins), which contributes to the rigidity of the plant cell wall. Lignification is essential for plant development, however it is also one of the mechanisms of plant defense. Accumulation of lignin and the polymerization of monolignins at sides of pathogen attack protect the cell wall against cell wall-degrading enzymes and prevent therefore the pathogen’s penetration. In addition to cross-linkage of phenolic compounds, this resistance mechanism includes also callose and cellulose appositions on the cell wall. This results in structures called papillae, which provide the necessary resistance to the mechanical pressure exercised by fungal appressorium. Lignin accumulation in cell walls is therefore a part of plant defense responses. Here we describe a quantification method for lignin and cell wall phenolic compounds, which is based on an acid-catalyzed reaction resulting in a colored and soluble lignin-thioglycolate complex suitable for photometric measurements.
Keywords: Plant Defense Cell Wall Priming Lignin
Materials and Reagents
Plant material
Flg22 (a flagellin-derived, 22 amino acid-long peptide) (QRLSTGSRINSAKDDAAGLQIA)
80% aqueous methanol (Carl Roth, catalog number: 4627.6 )
Distilled water
Acetone (VWR International, catalog number: UN1090 )
NaOH (Carl Roth, catalog number: 6771.1 )
86% H3PO4 (J.T.Baker®, catalog number: 6024 )
Ethyl acetate (Carl Roth, catalog number: 6784.4 )
Thioglycolic acid (Sigma-Aldrich, catalog number: T3758 )
32% HCl (Carl Roth, catalog number: P074.3 )
Lignin (alkali) (Sigma-Aldrich, catalog number: 370959 )
1 M NaOH (see Recipes)
2 M HCl (see Recipes)
Equipment
Plastic equipment (Grainer Falcon 50 ml tubes, catalog number: 227261 ; Grainer 6-well culture plates, catalog number: 657160 )
Freeze drying machine
Tissue Lyser2 (manufactured by Retsch, provided by QIAGEN) and stainless steel beads (QIAGEN, catalog number: 69989 )
Shaker for tube rotation (with variable temperature)
Centrifuge (with variable temperature) (Eppendorf, centrifuge number: 5417R )
Vacuum pump (Savant Systems LLC, catalog number: SC110 : 25-30 Hg)
Rotary shaker for tube rotation
Photometer (Eppendorf, BioSpectrometer basic)
Note: The extraction procedure includes a separation of different fractions of phenolic compounds depending on their chemical properties. The soluble phenolic fraction is extracted with 80% methanol (Day 1). The cell wall-bound phenolic fraction is hydrolyzed (alkaline hydrolysis) and solved in ethyl acetate. The lignin fractions are extracted in the later steps of the procedure by binding the to the lingo-thioglycolic acid complex (Days 2 and 3). The soluble and cell wall-bound phenols fractions can be measured according the Folin-Ciocalteau method after Strack et al. (1988), or used for further HPLC analyses. The lignin complex can be measured directly after resolving in NaOH.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant cell biology > Cell staining
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,431 | https://bio-protocol.org/exchange/protocoldetail?id=1431&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lectin Binding Analysis of Streptococcus mutans Glycoproteins
Alejandro Avilés-Reyes
José A. Lemos
Jacqueline Abranches
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1431 Views: 8720
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Bacterial glycoproteins are of increasing interest due to their abundance in nature and importance in health and infectious diseases. However, only a very small fraction of bacterial glycoproteins have been characterized and its post-translational modification machinery identified. While analysis of glycoproteins can be achieved through various techniques, this is often limited by the specific characteristics of individual proteins such as type and level of glycosylation. Lectins are sugar-binding proteins that recognize specific glycoconjugates in a manner similar to antigen-antibody interactions. Here, we describe a simple method for the detection of glycoproteins using lectin-based Western blot analysis, which can be applied to different organisms and coupled with various other strategies for complementary analysis.
Materials and Reagents
Bacterial whole cell lysates
Brain heart infusion medium (BHI) (BD Biosciences, catalog number: 237500 )
Biotinylated lectin [Vector Laboratories, for Wheat Germ Agglutinin (WGA), catalog number: B-1025]
HRP-conjugated streptavidin (Cell Signaling Technology, catalog number: 3999 )
Tween 20 (Sigma-Aldrich, catalog number: P2287 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Enhanced chemiluminiscent detection kit (GE Healthcare, catalog number: RPN2108 )
Autoradiography films (Carestream Health, catalog number: 864-6770 )
NaCl (J.T.Baker®, catalog number: 3628-01 )
KCl (J.T.Baker®, catalog number: 3045-01 )
Na2HPO4 (J.T.Baker®, catalog number: 3827-01 )
KH2PO4 (J.T.Baker®, catalog number: 3246-01 )
Tris base (J.T.Baker®, catalog number: 4109-02 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Glycine (Thermo Fisher Scientific, catalog number: BP381-1 )
30% Acrylamide/Bis solution (Bio-Rad Laboratories, catalog number: 161-0158 )
Tetramethylethylenediamine (TEMED) (Life Technologies, catalog number: 15524-010 )
Ammonium persulfate (Bio-Rad Laboratories, catalog number: BP179-25 )
Glycerol (Alfa Aesar, catalog number: A16205 )
Methanol (BDH Chemicals, catalog number: BDH1135-4LP )
Bromophenol blue (Sigma-Aldrich, catalog number: B5525 )
1x phosphate buffer solution (PBS) (see Recipes)
Resolving gel (see Recipes)
Stacking gel (see Recipes)
2x sample buffer (see Recipes)
Running buffer (see Recipes)
Transfer buffer (see Recipes)
Blocking solution (see Recipes)
Primary solution (see Recipes)
Secondary solution (see Recipes)
Washing solution (see Recipes)
Equipment
0.1 mm glass beads (Research Products International)
Polyvinylidene fluoride (PVDF) membranes (EMD Millipore, catalog number: P2563-10EA )
3 mm Whatman paper (GE Healthcare)
CO2 Incubator
Sterile culture tubes (15 ml)
Screw cap tubes (1.7 ml)
Bead beater (BioSpec Products)
Protein electrophoresis running apparatus
Protein transfer apparatus
Power supply
Rocker
Film developer
pH meter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,432 | https://bio-protocol.org/exchange/protocoldetail?id=1432&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of 70S Ribosomes from Bacillus subtilis
SS Shota Suzuki
GA Genki Akanuma
FK Fujio Kawamura
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1432 Views: 11458
Reviewed by: Elizabeth LibbyManuela Roggiani
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
The eubacterial ribosome (70S) is a macromolecular complex that is composed of a small (30S) subunit and a large (50S) subunit. The small subunit comprises the 16S ribosomal RNA (rRNA) and more than 20 ribosomal proteins (r-proteins), whereas the large subunit comprises the 23S and 5S rRNAs and more than 30 r-proteins. Bacillus subtilis (B. subtilis) has 57 r-ribosomal protein genes and three rRNAs (16S, 23S and 5S rRNAs). Among them, we identified 21 r-proteins of the small subunit and 31 r-proteins of the large subunit in B. subtilis (Nanamiya et al., 2004). The functions and roles of individual components of the ribosome have not yet been completely clarified. Herein we describe in detail an ultracentrifugation-based protocol for the preparation of 70S ribosomes from exponentially growing cells of B. subtilis.
Keywords: Bacillus subtilis Ribosome 70S ribosomes
Materials and Reagents
Bacillus subtilis 168
NaCl
BD BactoTM tryptone (Difco, catalog number: 211705 )
BD BactoTM yeast extract (Difco, catalog number: 212750 )
Agar (Nissui, catalog number: 05835 )
Tris (Wako Pure Chemical Industries, catalog number: 512-97505 )
Magnesium acetate (Wako Pure Chemical Industries, catalog number: 139-15335 )
Ammonium acetate (Wako Pure Chemical Industries, catalog number: 019-02835 )
Dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 042-29222 )
Phenylmethylsulphonyl fluoride (PMSF)
Sucrose (Sigma-Aldrich, catalog number: S0389-55G )
Diethylpyrocarbonate (DEPC) treated water
Note: DEPC was added to distilled water at a final concentration of 1%, and then it stored at room temperature for over two hours. The DEPC-treated distilled water was autoclaved twice (121 °C, 20 min) and stored at room temperature.
LB medium (see Recipes)
Buffer I (see Recipes)
10-40% sucrose solutions (see Recipes)
Equipment
2 L flasks with cotton plugs
Innova 4080 bench top incubator shaker (New Brunswick scientific)
French pressure cell press [Aminco International (USA), model: FA-078 ]
Mini cell [Aminco International (USA), model: FA-003 ]
Gradient fractionator (BIOCOMP, catalog number: 152-001 )
Gradient master [Aminco International (USA), catalog number: 107-201M ]
Micro collector (ATTO Technology, catalog number: AC-5700P )
Nano drop 2000 (Thermo Fisher Scientific)
High-speed refrigerated centrifuge (e.g. Hitachi, model: himac CR22GII )
Angle rotor R10A3 (fixed angle, max: 10,000 rpm,18,800 x g, volume: 500 ml x 6) (Hitachi)
Centrifuge MX-300 (TOMY)
TMA-300 rotor (fixed angle, max: 15,000 rpm, 20,380 x g, volume: 2 ml x 24) (TOMY)
TMA-27 rotor (fixed angle, max: 15,000 rpm, 21,130 x g, volume: 15 ml x 4, 50 ml x 4) (TOMY)
Centrifuge tube (Nalgene, catalog number: 3148-0050 )
Ultra-centrifuge (e.g. Hitachi, model: CP-60E )
P55ST2 rotor (swinging bucket rotor, max: 55,000 rpm, 366,000 x g, volume: 5 ml x 6) (Hitachi)
P28S rotor (swinging bucket rotor, max: 28,000 rpm, 141,000 x g, volume: 40 ml x 6) (Hitachi)
P40ST rotor (swinging bucket rotor, max: 40,000 rpm, 284,000 x g, volume: 13 ml x 6) (Hitachi)
Open-top polyclear centrifuge tube for P40ST rotor (Seton Identification Products, part number: 7031 )
Open-top polyclear centrifuge tube for P28S rotor (Seton Identification Products, part number: 7052 )
Centrifuge ware for P55ST2 rotor (Hitachi, part number: 332245A )
Note: These rotors can substitute for other commercial rotors which can be used by the same centrifugal force as described in procedures.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Suzuki, S., Akanuma, G. and Kawamura, F. (2015). Purification of 70S Ribosomes from Bacillus subtilis. Bio-protocol 5(7): e1432. DOI: 10.21769/BioProtoc.1432.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > RNA
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,433 | https://bio-protocol.org/exchange/protocoldetail?id=1433&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nictation Assays for Caenorhabditis and Other Nematodes
DL Daehan Lee
Harksun Lee
MC Myung-kyu Choi
SP Sungsu Park
JL Junho Lee
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1433 Views: 9526
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Nov 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2011
Abstract
Nictation is a dauer-specific standing and waving behavior of the nematodes including Caenorhabditis species. Nictation enhances the capability of free-living nematodes to hitchhike to other animals as well as parasitic nematodes to infect their hosts. However, lack of an assay for this behavior has made it difficult to elucidate its underlying regulatory mechanisms and related genetic pathways. We have developed nictation assays that enable the quantification of the nictation behavior of individuals and groups of worms. Gauze assay is less quantitative but is an easier way to observe nictation behavior in plates with plenty of dauers. The micro-dirt chip made from PDMS mold is a more sophisticated method to quantify the nictation behavior. Nictation can be quantified on a micro-dirt chip either by measuring the average nictating time of individual dauers or by the fraction of nictating worms in a given dauer population.
Keywords: nictation c. elegans dauer micro-dirt chip gauze assay
Materials and Reagents
Dauer larva
SU-8 photoresist 2008 (MicroChem Corp)
Polydimethylsiolaxne (PDMS) (Sylgard® 184 Silicone Elastomer Kit, Dow-Corning)
Agar powder (OCI Company Ltd, catalog number: 9002-18-0 )
Cotton medical gauze
M9 solution (see Recipes)
Synthetic pheromone plates (see Recipes)
Equipment
Microwave oven or autoclave
Dissecting microscope (Leica Microsystems, model: S6E )
Mouth pipette with glass capillary (Chase)
60Φ Petri dish (SPL Life Sciences, model: 10060 )
Slide glass (Marienfeld)
Spatula
Glass flask
Incubator (Vision Scientific Co. Ltd., model: VS-8480S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lee, D., Lee, H., Choi, M., Park, S. and Lee, J. (2015). Nictation Assays for Caenorhabditis and Other Nematodes. Bio-protocol 5(7): e1433. DOI: 10.21769/BioProtoc.1433.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Nictation
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,434 | https://bio-protocol.org/exchange/protocoldetail?id=1434&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
TUNEL Assay in Kiwifruit Stigmatic Arms
Yolanda Ferradás
Marian López
Pilar Testillano
Manuel Rey
MG Ma Victoria González
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1434 Views: 10797
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) is a method for detecting DNA fragmentation by labelling the 3' terminal end of nucleic acids. This method can be used both in animal and plant tissues. In animal tissues, the use of Proteinase K is sufficient for permeabilizing the cells and to obtain optimal labelling, but in plant tissues, the presence of the cell wall, does not allow proper labelling. For this reason, we carried out several modifications to the original TUNEL protocol (ApoAlert® DNA Fragmentation Assay Kit, Clontech) to obtain an optimal labelling. These modifications were additional treatments with cellulase, Triton X-100 and Proteinase K. Also, we describe the optimization of the positive controls by adjusting the units of DNase used. The PI concentration for counterstaining has been also specifically adjusted to avoid excessive background noise and hence to correctly observe both labeled and unlabelled nuclei. This work also describes an additional protocol to collect, store and include samples (specifically stigmatic arms) in such a way that they do not interfere with the TUNEL labelling.
Keywords: Programmed Cell Death TUNEL assay DNA fragmentation assay Kiwifruit Plant reproductive biology
Materials and Reagents
Acetic acid (CH3COOH) (Panreac Applichem)
Acetone [(CH3)2CO] (Panreac Applichem)
ApoAlert® DNA Fragmentation Assay Kit (Clontech, catalog number: 630107 )
(3-Aminopropyl) triethoxy-silane (APTES) (C9H23NO3Si) (Sigma-Aldrich, catalog number: 440140 )
Cellulase Onozuka RS (Duchefa Biochemie, catalog number: C8003 )
Citifluor Solid Mountant kit (Agar Scientific, catalog number: AGR1326 )
Clear nail polish
Deionized H2O (Milli-Q H2O)
Distilled water
Disodium hydrogen phosphate (Na2HPO4) (Duchefa Biochemie)
Ethylenediaminetetraacetic acid (EDTA) (C10H16N2O8) (Duchefa Biochemie)
Ethanol (C2H5OH) (Panreac Applichem)
Formaldehyde (HCHO) (36.5-38%) (Panreac Applichem, catalog number: 48 131328 )
Monobasic potassium phosphate (KH2PO4) (Duchefa Biochemie)
Paraffin (Panreac Applichem, catalog number: 253211 )
Paraformaldehyde [(HCHO)n] (Panreac Applichem, catalog number: 141451 )
Potassium chloride (KCl) (Duchefa Biochemie)
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4864 )
Proteinase K (Sigma-Aldrich, catalog number: P4850 )
Recombinant DNase I (RNase-free) (TAKARA BIO, catalog number: 2270A )
Sodium chloride (NaCl) (Duchefa Biochemie)
Sodium hydroxide (NaOH) (Panreac Applichem)
Sulfuric acid (H2SO4) (Sigma-Aldrich)
Tertiary butyl alcohol/2-Methyl-2-Propanol (TBA) [(CH3)3COH] (Panreac Applichem, catalog number: 141903 )
Tris (hydroxymethyl) aminomethane hydrochloride (Tris-HCl) [NH2C(CH2OH)3·HCl] (Duchefa Biochemie)
Triton X-100 (Sigma-Aldrich)
Xylene [C6H4(CH3)2] (Panreac Applichem)
Fixing solution (see Recipes)
TBA solutions (see Recipes)
TBA:paraffin (see Recipes)
Formulated water (see Recipes)
APTES-coated slides (see Recipes)
1x PBS buffer (see Recipes)
4% formaldehyde in 1x PBS buffer (see Recipes)
2% Cellulase Onozuka in 1x PBS buffer (see Recipes)
0.5% Triton X-100 in 1x PBS buffer (see Recipes)
Tris-HCl (see Recipes)
EDTA (see Recipes)
100 mM Tris-HCl (see Recipes)
Proteinase K solution (see Recipes)
1x DNase I buffer (see Recipes)
1,500 U/ml DNase I (see Recipes)
PI solution (see Recipes)
Anti-Fade reagent (see Recipes)
Equipment
15 ml tubes
100 ml darkened bottles
100 ml darkened glass bottles
100 ml glass flasks
200 ml glass Coplin jars
250 ml glass jars
Autoclave
Filters sterile Filtropur S 0.2 (SARSTEDT AG)
Flat surface (wall tile)
Forceps
Fume hood
Glass coverslips
Glass-covered trays
Laboratory oven
Leica TCS-SP2 confocal microscope
Leuckart's bars for paraffin block preparation (ICT, SL., catalog number: 101 20996051645 )
Magnetic stirrer with heating plate
Microtome (Shibuya optical)
Microtome Blades Accu-Edge® low-profile (Sakura)
Paint brush
pH-meter
Scalpel with sterile blades
Slides
Software
LCS Software for Leica TCS-SP2 confocal microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ferradás, Y., López, M., Testillano, P., Rey, M. and González, M. V. (2015). TUNEL Assay in Kiwifruit Stigmatic Arms. Bio-protocol 5(7): e1434. DOI: 10.21769/BioProtoc.1434.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA labeling
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,435 | https://bio-protocol.org/exchange/protocoldetail?id=1435&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Membrane Flotation Assay
DV Dorothee A Vogt
MO Melanie Ott
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1435 Views: 13374
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Many postitive-stranded RNA viruses, such as Hepatitis C virus (HCV), highjack cellular membranes, including the Golgi, ER, mitchondria, lipid droplets, and utilize them for replication of their RNA genome or assembly of new virions. By investigating how viral proteins associate with cellular membranes we will better understand the roles of cellular membranes in the viral life cycle. Our lab has focused specifically on the role of lipid droplets and lipid-rich membranes in the life cycle of HCV. To analyze the role of lipid-rich membranes in HCV RNA replication, we utilized a membrane flotation assay based on an 10-20-30% iodixanol density gradient developed by Yeaman et al. (2001). This gradient results in a linear increase in density over almost the entire length of the gradient, and membrane particles are separated in the gradient based on their buoyant characteristics. To preserve membranes in the lysate, cells are broken mechanically in a buffer lacking detergent. The cell lysate is loaded on the bottom of the gradient, overlaid with the gradient, and membranes float up as the iodixanol gradient self-generates. The lipid content of membranes and the concentration of associated proteins will determine the separation of different membranes within the gradient. After centrifugation, fractions can be sampled from the top of the gradient and analyzed using standard SDS-PAGE and western blot analysis for proteins of interest.
Materials and Reagents
Huh7.5 cells
Huh7.5 cells containing replicating HCV Replicon RNA (= Replicon Cells) (Vogt et al., 2013)
Dulbecco’s Modified Eagle’s Medium (with 4.5 g/L glucose, L-glutamine & Sodium pyruvate) (DMEM) (Corning Cellgro, catalog number: 10-013-CV )
Fetal Bovine Serum (FBS) (Benchmark, catalog number: 100-106 )
Penicillin/Streptomicyn Solution 100x (Pen/Strep) (Corning Cellgro, catalog number: 30-002-Cl )
L-Glutamine (Corning Cellgro, catalog number: 25-005-CI )
G418 sulfate (Corning Cellgro, catalog number: 25-052-CI )
Dulbecco’s Phosphate Buffered Saline without Ca2+ and Mg2+ (PBS) (Corning Cellgro, catalog number: 21-031-CV )
Trypsin/EDTA (Corning Cellgro, catalog number: 25-052-CI)
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 ) (use as 1:100 dilution)
Trypan Blue Stain (Gibco, catalog number: 15250-061 )
BioRad Protein Assay (Bio-Rad Laboratories, catalog number: 500-0006 )
Brilliant Blue G-250 (Thermo Fisher Scientific, catalog number: 100-25 )
Iodixanol (60%) (Sigma-Aldrich, catalog number: D1566-250ML ) (kept at 4 °C for use in the experiment )
PBS/Sucrose (see Recipes)
20% iodixanol (see Recipes)
10% iodixanol (see Recipes)
2x Laemmli buffer (see Recipes)
Equipment
Ultra clear centrifuge tubes (Beckman Coulter, catalog number: 344059 )
37 °C 5% CO2 cell culture incubator
P1000 pipette
Microscope
Hematocytometer
Tight fitting dounce homogenizer (7 ml) (Wheaton, catalog number: 357542 )
Centrifuge (Beckman Coulter, model: Allegra 6R )
Spectrophotometer
Ultracentrifuge (Beckman Coulter, model: Optima L-80 XP with SW41T rotor)
Protein electrophoresis apparatus
Western blot apparatus
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vogt, D. A. and Ott, M. (2015). Membrane Flotation Assay. Bio-protocol 5(7): e1435. DOI: 10.21769/BioProtoc.1435.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Ex vivo model
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Fractionation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,436 | https://bio-protocol.org/exchange/protocoldetail?id=1436&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunoprecipitation of Proteins in Caenorhabditis elegans
KC Kevin K. Chan*
AS Ashwin Seetharaman*
GS Guillermo Selman*
PR Peter John Roy
*Contributed equally to this work
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1436 Views: 17481
Edited by: Peichuan Zhang
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Immunoprecipitation (IP) is a biochemical technique to precipitate a protein out of solution using an antigen that can specifically bind to that protein. IP can be performed to isolate and concentrate one particular protein from a sample of thousands of different proteins. IP is also readily performed to pull down interacting proteins of complexes out of solution. This protocol outlines the methods used to IP proteins in whole worm lysates and their preparation for detection on Western blots using denaturing conditions.
Materials and Reagents
Transgenic Caenohabditis elegans (C. elegans) strain with over-expressed protein of interest
Note: Depending on protein expression and specificity of antibody, this protocol can also be used to immunoprecipitate endogenous proteins.
OP50 Escherichia coli (E. coli) (C. elegans Genetic Center)
Trizma hydrochloride (Sigma-Aldrich, catalog number: T5941 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Tris base (BioShop, catalog number: TRS001 )
Bacto-tryptone (BD, catalog number: 211705 )
NaCl (BioShop, catalog number: SOD002 )
Cholesterol (95%) (Sigma-Aldrich, catalog number: C8503 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Na2HPO4 (Sigma-Aldrich, catalog number: S0876 )
KH2PO4 (Sigma-Aldrich, catalog number: P0662 )
MgSO4·7H2O (BioShop, catalog number: MAG521 )
EDTA (BioBasic, catalog number: EB0185 )
NP-40 (BioShop, catalog number: NON.505 )
PMSF (Roche, catalog number: 10837091001 )
Na3VO4 (Sigma-Aldrich, catalog number: S6508 )
Pepstatin-A (Sigma-Aldrich, catalog number: P4265 )
NaF (Sigma-Aldrich, catalog number: S7920 )
cOmplete protease inhibitor cocktail tablets (Roche, catalog number: 4693159001 )
SDS (Caledon, catalog number: 7771 )
Glycerol (BioShop, catalog number: GLY001 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M7154 )
Bromophenol blue (Sigma-Aldrich, catalog number: B5525 )
BCA protein assay kit (Thermo Fisher Scientific, catalog number: 23225 )
Siliconized low-binding tips 200-1,000 μl (Denville Scientific Inc., catalog number: P3193-S )
Siliconized low-binding tips 200 μl (Denville Scientific Inc., catalog number: P3010-S )
Protein A/G PLUS-Agarose non-conjugated beads (Santa Cruz Biotechnology, catalog number: SC-2003 )
EZview Red ANTI-FLAG M2 Affinity Gel conjugated beads (Sigma-Aldrich, catalog number: F2426 )
GFP polyclonal antibody, rabbit (Genscript, catalog number: A01388 )
GFP monoclonal antibody (B-2) (mouse) (Santa Cruz Biotechnology, catalog number: SC-9996 )
Donkey anti-rabbit IgG-HRP (Santa Cruz Biotechnology, catalog number: SC-2313 )
Goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, catalog number: SC-2005 )
MYOB dry mix (see Recipes)
MYOB plates (see Recipes)
M9 buffer (see Recipes)
Lysis buffer (see Recipes)
SDS-PAGE sample buffer (see Recipes)
Equipment
Refrigerated microcentrifuge (Eppendorf, model: 5417R )
Large centrifuge (Eppendorf, model: 5810R )
Rotisserie agitator (Barnstead Thermolyne LabQuake, model: C415110 )
Sonicator (Branson Sonifier, model: 450 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chan, K. K., Seetharaman, A., Selman, G. and Roy, P. J. (2015). Immunoprecipitation of Proteins in Caenorhabditis elegans. Bio-protocol 5(7): e1436. DOI: 10.21769/BioProtoc.1436.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,437 | https://bio-protocol.org/exchange/protocoldetail?id=1437&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microscopic Observation, Three-dimensional Reconstruction, and Volume Measurements of Sperm Nuclei
YO Yukinosuke Ohnishi
Takashi Okamoto
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1437 Views: 8299
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Karyogamy, a migration of the sperm nucleus toward the egg nucleus and their subsequent nuclear fusion, is an important biological event for initiating zygote formation toward early embryogenesis in angiosperms. However, how the male nucleus approaches and fuses with the female nucleus still remains unclear. Recently, time-lapse measurement of nuclear volume during karyogamic events revealed that the sperm nucleus enlarges during contact with the egg nucleus via possible one-directional migration of egg chromatin into sperm nucleus (Ohnishi et al., 2014). Here, we describe the protocol for microscopic observation, three-dimensional reconstruction, and volume measurements of sperm nuclei in rice zygotes/fused gametes, which are produced by an in vitro fertilization system (Uchiumi et al., 2006; Uchiumi et al., 2007). The present protocol will be applied for monitoring nuclear dynamics in cells during cell division, differentiation, de-differentiation and polarity formation as well as karyogamy progression.
Keywords: Egg cell Karyogamy Nuclear fusion Sperm cell Zygote
Materials and Reagents
Transgenic rice plants (Oryza sativa L. cv. Nipponbare) expressing SUN2-GFP or H2B-RFP fusion proteins that are targeted to nuclear membrane or nuclear chromatin, respectively (Ohnishi et al., 2014) (see Note 1)
Mannitol (Wako Chemicals USA, catalog number: 133-00845 )
370 mosmol/kg H2O (330 mM) mannitol solution (autoclaved)
450 mosmol/kg H2O (385 mM) mannitol solution (autoclaved)
Mineral oil (Sigma-Aldrich, catalog number: M8410-100ML )
Equipment
Inverted fluorescent microscope (OLYMPUS, model: BX-71 )
Confocal laser scanning (CLS) microscope (ZEISS, model: LMS 710 )
Non-treated plastic dishes with diameter of 3.5 cm (Iwaki, catalog number: 1000-035 )
Glass base dishes with diameter of 3.5 cm (Iwaki, catalog number: 3971-035 ) (see Note 2)
Coverslips (24 x 40 mm) (Thermo Fisher Scientific, catalog number: 125485J ) (siliconized at the edges with 5% dichloromethylsilane in 1,1,1-trichloroethane) (see Note 3)
Glass capillaries made from 50 μl aspirator tubes (Drummond Scientific Company, catalog number: 2-000-050 ) (Figure 1A-B) (see Note 4)
Manual handling injector (ST Science, type UJB)
Environmental chamber (Koito Industries Ltd., catalog number: K30-7248 )
Software
IMARIS software (Bitplane)
Note: A core scientific software module that delivers the necessary functionality for data management, visualization, analysis, segmentation and interpretation of 3D and 4D microscopy datasets.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,438 | https://bio-protocol.org/exchange/protocoldetail?id=1438&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Arabidopsis thaliana Root Hair Cell Cytoplasmic pH (pHc) Imaging
LB Ling Bai
YZ Yun Zhou
PW Pengtao Wang
CS Chun-Peng Song
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1438 Views: 8929
Edited by: Ru Zhang
Reviewed by: Fang Xu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
For monitoring the cellular pH in plants, engineered green fluorescent protein (GFP) has been used to indicate cellular pH. Pt-GFP is a pH-reporter protein which has been used ratiometrically in the double excitation mode, according to the fluorescence properties described for Pt-GFP (Schulte et al., 2006), and depending on our previous experiments, we present here a little and efficient protocol for monitoring the cytosolic pH value. In this protocol, root hair cellular pH was monitored in the PtGFP reporter lines. Cellular pH can be obtained according to the calibration curve which was performed in situ by using a series pH buffer.
Keywords: Cytoplasmic pH Root hair GFP
Materials and Reagents
Stable Pt-GFP transgenic WT line N9561 (background: Col-0) was obtained from the Nottingham Arabidopsis Stock Centre http://arabidopsis.info/StockInfo?NASC_id=9561).
Note: Pt-GFP T-DNA insertion mutant homozygous were obtained by crossing the T-DNA insertion mutant (what you interested, here meant the mutant with root hair growth problem) with the N9561. And we obtained the T-DNA insertion homozygous first by PCR (methods in http://signal.salk.edu/cgi-bin/tdnaexpress) in the F2 progeny, and we checked the fluorescence for Pt-GFP. Homozygous lines with fluorescence will be used for later analysis.
Digitonin (Sigma-Aldrich, catalog number: 11024-24-1 )
Note: Risk assessment: toxic. Digitonin is toxic by inhalation, contact with skin, wear protective gloves and clothing, wear respiratory protection, when handling this chemical.
2-(N-Morpholino) ethanesulfonic acid (MES) (Sigma-Aldrich, catalog number: 145224-94-8 )
N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: 7365-45-9 )
Murashige and Skoog (MS) medium (Phyto Tech, catalog number: M519 )
pH buffer solutions (see Recipes)
Equipment
Inverted Carl Zeiss LSM 710 confocal microscope
Plant growth chamber
2 ml tubes (Eppendorf tubes)
Forceps
Microscope slides
Microscope cover slips
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Ion analysis
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,439 | https://bio-protocol.org/exchange/protocoldetail?id=1439&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cyst Detection in Toxoplasma gondii Infected Mice and Rats Brain
Valeria Bellini
Corinne Loeuillet
Céline Massera
Marie-France Cesbron-Delauw
Pierre Cavaillès
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1439 Views: 9866
Edited by: Fanglian He
Reviewed by: Alexandros Alexandratos
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Toxoplasmosis caused by the intracellular parasite Toxoplasma gondii, is characterized by a life-long chronic infection. The parasite is an efficient neurotropic infectious agent that establishes its “safe” life by forming intracellular cysts in chronically infected animals and humans. This protocol describes the specific recipes and method to stain brain cysts from infected mice and rats for further quantification using epifluorescence microscopy. This method provides the possibility to scan the entire brain and thus to numerate all cysts.
Keywords: Toxoplasma gondii Cysts Epifluorescence microscopy Dolichos Quantification
Materials and Reagents
Human foreskin fibroblasts (HFFs) cells culture (ATTC, catalog number: SCRC-1042 )
Dulbecco's modified Eagle medium (DMEM) (Life Technologies, catalog number: 41966-029/052 )
Fetal bovine serum (FBS) (Eurobio®, catalog number: CVFSVF0001 )
Penicillin/streptomycin (PAN Biotech GmbH, catalog number: P0607-100 )
L-Glutamine (200 mM) (Life Technologies, catalog number: 25030-024 )
Dulbecco's phosphate-buffered saline (DPBS) (Life Technologies, catalog number: 14190-094/069 )
Proteinase K (molecular biology grade) (Bio-Rad Laboratories, catalog number: P8107S , Lot: 0051310)
TRIS (Euromedex, catalog number: 26-128-3094-B )
EDTA (Euromedex, catalog number: E013 )
SDS (Euromedex, catalog number: EU0660 )
NaCl (Euromedex, catalog number: 1112-A )
HCl (37% ACS reagent) (Sigma-Aldrich, catalog number: 258148-2.5ML )
Phenylmethylsulfonylfluoride (PMSF) (Euromedex, catalog number: 1111-C )
Hoescht 33258 (Life Technologies, Molecular Probes®, catalog number: H-3569 )
Formaldehyde methanol free (Polysciences, catalog number: 0 4018 )
Dolichos biflorus lectin coupled to fluorescein isothiocyanate (FITC) (Clinisciences, catalog number: FL-1031 )
Complete DMEM medium (see Recipes)
Phenylmethylsulfonylfluoride (PMSF) solution (see Recipes)
Lysis buffer (see Recipes)
Equipment
37 °C/5% CO2 cell culture incubator
6-well plates
Scissors and forceps
Glass homogenizers (Potter-Elvehjem PTFE, 15 ml) (Dutscher, catalog numbers: 057009 and 057021 )
15 ml polystyrene tubes
Epifluorescence microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bellini, V., Loeuillet, C., Massera, C., Cesbron-Delauw, M. and Cavaillès, P. (2015). Cyst Detection in Toxoplasma gondii Infected Mice and Rats Brain. Bio-protocol 5(7): e1439. DOI: 10.21769/BioProtoc.1439.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
144 | https://bio-protocol.org/exchange/protocoldetail?id=144&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Embryonic Stem Cell Differentiation to Hematopoietic Precursors
HI Hogune Im
Published: Vol 2, Iss 7, Apr 5, 2012
DOI: 10.21769/BioProtoc.144 Views: 15193
Original Research Article:
The authors used this protocol in May 2003
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2003
Abstract
Embryonic stem cells are derived from inner cell mass of an embryo that can differentiate into every cell type in the body. Clinically, cultured red blood cell supply is of great interest. However, some of the hurdles need to be overcome. This protocol describes a two step protocol to form embryoid body and differentiate them in to hematopoietic lineage cells, especially erythroid cells.
Materials and Reagents
Mouse embryonic stem cell (ES cells)
200 mM L-Glutamine (100 ml) (Life Technologies, Gibco®, catalog number: 320-5030AG )
Methylcellulose (STEMCELL Technologies, catalog number: 03134 )
Gelatin (STEMCELL Technologies, catalog number: 07903 )
Transferrin (Human) (Boehringer-Mannheim) (Roche Diagnostics, catalog number: 652202 )
MTG (Sigma-Aldrich, catalog number: M6145 )
Plasma derived serum (PDS) (Animal technologies) special order from company. Typically serum contains some PDGF, which inhibit differentiation (Must call company, animal technologies, Inc)
Epo (Amgen) (Thermo Fisher Scientific, catalog number: 50948385 )
Protein Free Hybridoma Media II (PFHM-II) (Life Technologies, Gibco®, catalog number: 12040-077 )
Ascorbic acid
Penicillin/Streptomycin (Pen/Strep) (Thermo Fisher Scientific, catalog number: SV30010 )
Fetal bovine serum (FBS)
Fetal calf serum (FCS)
Phosphate buffered saline (PBS)
Trypsin
EDTA
NaHCO3
Dulbecco's modified eagle medium (DMEM)
ES-IMDM (see Recipes)
Differentiation medium (see Recipes)
Secondary differentiation media (see Recipes)
Iscove’s modified dulbecco medium (IMDM) (Life Technologies, Gibco®, catalog number: 12200-036 , 1 L/pack) (see Recipes)
Cellulase (Sigma-Aldrich, catalog number: C-1794 ) (see Recipes)
Equipment
Standard table-top centrifuges
T25 flask
Snap cap tube
Incubator
Water bath
Gauge needle
50 ml Falcon tube
0.22 µm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Developmental Biology > Cell growth and fate
Stem Cell > Adult stem cell > Hematopoietic stem cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,440 | https://bio-protocol.org/exchange/protocoldetail?id=1440&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Leaf Disc Stress Tolerance Assay for Tobacco
Ajit Ghosh
Ashwani Pareek
Sneh L Singla-Pareek
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1440 Views: 14276
Edited by: Tie Liu
Reviewed by: Teresa Lenser
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Stress tolerance is a multigenic trait that depends on the coordinated action of several genes. Various physiological parameters, such as plant height and weight, total yield, chlorophyll content, photosynthesis rate, level of reactive oxygen species (ROS) and anti-oxidant activity could be correlated directly with the level of stress tolerance potential of any particular genotype. To evaluate the stress tolerance potential of a plant, leaf disc stress tolerance assay is a very rapid and widely acceptable experiment with minimum instrumentation facilities.
Keywords: Leaf disc Abiotic stress tolerance Plant Tobacco Rapid
Materials and Reagents
Young tobacco plants (to be tested)
Distilled water
Acetone (Sigma-Aldrich, catalog number: I10010 )
Stress reagents (such as NaCl, Sigma-Aldrich, catalog number: S7653 ; for salinity stress)
Liquid nitrogen
Extraction buffer (see Recipes)
Equipment
Leaf puncher/ cork borer (Sigma-Aldrich, catalog number: Z165220 )
Petri plates (60 x 15 mm)
Microcentrifuge tube
Tissue paper
Graduated cylinder
Mortar and pestle (Sigma-Aldrich, catalog number: Z112496 )
Glass cuvette (1 ml) (Sigma-Aldrich, catalog number: C8550-1EA )
Electronic balance
Spectrophotometer
Benchtop refrigerated centrifuge (Eppendorf, catalog number: 5427 R )
Vortexer (Sigma-Aldrich, catalog number: Z755613-1EA )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ghosh, A., Pareek, A. and Singla-Pareek, S. L. (2015). Leaf Disc Stress Tolerance Assay for Tobacco . Bio-protocol 5(7): e1440. DOI: 10.21769/BioProtoc.1440.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,441 | https://bio-protocol.org/exchange/protocoldetail?id=1441&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stress Tolerance Assay at the Seed Germination Stage for Tobacco
Ajit Ghosh
Ashwani Pareek
Sneh L Singla-Pareek
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1441 Views: 10599
Edited by: Tie Liu
Reviewed by: Teresa Lenser
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Stress tolerance of plants is a complex phenomenon that depends on the inter-related action of several morphological, physiological and biochemical parameters. Although stress affects normal physiological growth of a plant irrespective of its developmental stage, seed germination and seed setting are considered to be the most sensitive two. Therefore, to evaluate the stress tolerance potential of a particular plant species or variety, rate of seed germination in presence of stress is an important agronomic trait. This will provide a clear indication about the stress tolerance potential with minimum instrumentation facilities. The method is very simple, effective and highly reproducible that would provide quick and reliable results to the researchers.
Keywords: Seed germination Stress tolerance Tobacco Simple Plant
Materials and Reagents
Tobacco seeds (Nicotiana tabacum L. cv. Petit Havana, wild type and transgenic)
Sterile distilled H2O
Ethanol
Para film
Murashige and Skoog medium salt (Caisson Laboratories, catalog number: MSP09-1lt )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Agar (Plant tissue culture grade, Sigma-Aldrich, catalog number: A7921 )
Stress reagents (such as NaCl for salinity stress, and H2O2 for oxidative stress)
Germination media (see Recipes)
Equipment
Microcentrifuge tubes
Growth chamber
Laminar flow cabinet
Petri plates (100 x 20 mm)
Whatman filter paper
Autoclaved forceps
Electronic balance
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ghosh, A., Pareek, A. and Singla-Pareek, S. L. (2015). Stress Tolerance Assay at the Seed Germination Stage for Tobacco. Bio-protocol 5(7): e1441. DOI: 10.21769/BioProtoc.1441.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,442 | https://bio-protocol.org/exchange/protocoldetail?id=1442&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Cytokine Staining (ICS) on Human Lymphocytes or Peripheral Blood Mononuclear Cells (PBMCs)
SG Sheena Gupta
Holden Maecker
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1442 Views: 26357
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Production of cytokines plays an important role in the immune response. Cytokines are involved in many different pathways including the induction of many anti-viral proteins by IFN gamma, the induction of T cell proliferation by IL-2 and the inhibition of viral gene expression and replication by TNF alpha. Cytokines are not preformed factors but are rapidly produced and secreted in response to cellular activation. Intracellular cytokine detection by flow cytometry has emerged as the premier technique for studying cytokine production at the single-cell level. It detects the production and accumulation of cytokines within the endoplasmic reticulum after cell stimulation, allowing direct TH1 versus TH2 determination. It can also be used in combination with other flow cytometry protocols for immunophenotyping using cell surface markers or with MHC multimers to detect an antigen specific response, making it an extremely flexible and versatile method. This capability, combined with the high throughput nature of the instrumentation, gives intracellular cytokine staining an enormous advantage over existing single-cell techniques such as ELISPOT, limiting dilution, and T cell cloning. The principle steps of intracellular cytokine staining is as follows:
1. Cells are activated for a few hours using either a specific peptide or a non-specific activation cocktail;
2. An inhibitor of protein transport (e.g. Brefeldin A) is added to retain the cytokines within the cell;
3. Next, EDTA is added to remove adherent cells from the activation vessel;
4. After washing, antibodies to cell surface markers can be added to the cells;
5. The cells are then fixed in paraformaldehyde and permeabilized;
6. The anti-cytokine antibody is added and the cells can be analyzed by flow cytometer.
Materials and Reagents
PBMC (fresh or thawed frozen)
RPMI-1640 (Hyclone, catalog number: SH30027.01 )
FBS (Atlanta Biologicals, catalog number: S11150 )
100x Pen-strep-Glutamine (Hyclone, catalog number: SV30082.01 )
Benzonase (Sigma-Aldrich, catalog number: B7651 )
PBS (10x stock) (Rockland, catalog number: MB-008 )
Sodium azide (10% w/v solution) (Teknova, catalog number: S0209 )
PMA (Sigma-Aldrich, catalog number: P8139 )
Ionomycin (Calbiochem®, catalog number: 407952 )
Dynabeads Human T Activator CD3/CD28 (Life Technologies, InvitrogenTM, catalog number: 111.32D )
Brefeldin A (Sigma-Aldrich, catalog number: B7651)
1,000x monensin (BioLegend, catalog number: 420701 )
0.5 M EDTA (Sigma-Aldrich, catalog number: E-5134 )
LIVE/DEAD® fixable red dead cell stain (Life Technologies, InvitrogenTM, catalog number: L23102 )
10x FACS lysing solution (BD Biosciences, catalog number: 349202 )
10x FACS permeabilizing solution 2 (BD Biosciences, catalog number: 347692 )
Fluorochrome-linked surface markers [e.g. CD3-V500 (BD Biosciences, catalog number: 561416 ); CD8-V450 (BD Biosciences, catalog number: 560348 ); CD4-PerCP-Cy5.5 (BD Biosciences, catalog number: 341654 )]
Fluorochrome-linked cytokine antibodies [e.g. IFN gamma-FITC (BD Biosciences, catalog number: 340449 ); IL-17 PE (BD Biosciences, catalog number: 560438 ); IL-2 PE-Cy7 (BD Biosciences, catalog number: 560707 ); IL-22-APC (R&D systems, catalog number: IC7821A); TNF- Alexa fluor 700 (BD Biosciences, catalog number: 557996 )]
BD CompBeads [(anti-mouse Igκ, anti-rat Igκ, or anti-rat/hamster Igκ; BD Biosciences), for creating single-color compensation controls (BD Biosciences, catalog number: 560707)]
Immunoglobulin capture beads for single-color compensation (e.g., BD Biosciences, catalog number: 560497 )
Complete RPMI (see Recipes)
FACS buffer (see Recipes)
Equipment
96- deep well V-bottom plates (Corning, catalog number: 3960 ) (1 ml washes in a 2 ml well volume)
Falcon round-bottom FACS tubes
Magnet for Dynabead separation (BD Biosciences, IMag, catalog number: 552311 )
37 °C water bath
Biosafety cabinet
Centrifuge
CO2 incubator at 37 °C
Calibrated pipettes
ViCell (Beckman Coulter) or Hemocytometer cell counter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gupta, S. and Maecker, H. T. (2015). Intracellular Cytokine Staining (ICS) on Human Lymphocytes or Peripheral Blood Mononuclear Cells (PBMCs). Bio-protocol 5(7): e1442. DOI: 10.21769/BioProtoc.1442.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytokine
Immunology > Immune cell staining > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,443 | https://bio-protocol.org/exchange/protocoldetail?id=1443&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gravitropic Analysis of Tomato Seedlings using Time Lapse Video Imaging
Sulabha Sharma
Kamal Tyagi
Yellamaraju Sreelakshmi
Rameshwar Sharma
Published: Vol 5, Iss 7, Apr 5, 2015
DOI: 10.21769/BioProtoc.1443 Views: 8752
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Plants use gravity as a guide for growth and development. Gravitropism, a gravity-directed growth process, directs upward shoot movement for efficient photosynthesis and gaseous exchange. In addition, it also directs downward growth of roots in soil, for assimilation of water and nutrients required for growth and development. Using time lapse video imaging this process can be efficiently studied in a real time scale. The analysis of the response under different conditions can help to unravel the mechanisms regulating gravitropism.
Keywords: Tomato Auxin Gravitropism Timelapse photography Plant movement
Materials and Reagents
Tomato seeds (Cultivar Arka Vikas)
Sodium hypochlorite (Thermo Fisher Scientific, catalog number: 27096 )
Agar (HIMEDIA, catalog number: PCT0901 )
Distilled water
0.8% (w/v) agar (see Recipes)
Equipment
Blue light (An alternate light source can also be used) for gravitropic analysis was obtained from blue LEDs (Light Emitting diodes, λmax 470 nm, Kwality Photonics). Photon fluence of light was measured with a light meter fitted with a Quantum sensor (Skye Instruments, UK).
Spectrum of the blue light was measured using spectroradiometer purchased from International Light Technologies (model: RPS900W)
Quickcam Pro 3000 or 4000 (Logitech) or any other suitable webcam for recording the response
Germination paper (locally purchased) or blotting paper or Whatman paper
Square germination boxes (dimension 10 x10 x 6 cm, Laxbro) / or square petriplates
Square petriplate (dimension 12x12x2 cm, Genaxy, model: GEN-PTD-130SQ)
Forceps from Pro’Kit® 1PK-125T (dimension 12 x1 x 4 cm)
Software
SigmaPlot 10.0 (http://www.sigmaplot.com/products/sigmaplot/sigmaplot-details.php)
ImageJ (http://imagej.nih.gov/ij/)
Timelapse (http://tnlsoftsolutions.com/timelapsehome.php)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Sharma, S., Tyagi, K., Sreelakshmi, Y. and Sharma, R. (2015). Gravitropic Analysis of Tomato Seedlings using Time Lapse Video Imaging. Bio-protocol 5(7): e1443. DOI: 10.21769/BioProtoc.1443.
Whippo, C. W. and Hangarter, R. P. (2003). Second positive phototropism results from coordinated co-action of the phototropins and cryptochromes. Plant Physiol 132(3): 1499-1507.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant developmental biology > Gravitropism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,444 | https://bio-protocol.org/exchange/protocoldetail?id=1444&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In Gel Detection of Lipase Activity in Crude Plant Extracts (Olea europaea)
Agnieszka Zienkiewicz
Juan David Rejón
Krzysztof Zienkiewicz
Antonio Jesus Castro
Maria Isabel Rodríguez-García
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1444 Views: 7787
Edited by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Here, we provide a detailed protocol describing a SDS-PAGE based procedure to assay in gel neutral lipase activity. Total protein extracts are separated by SDS-PAGE and gels are treated with lipase substrate-α-naphthyl palmitate. This long-chain fatty acid ester is hydrolysed by lipases present in the gel. The product resulting from this reaction can be then visualized in the gel as yellow-brownish activity bands. This relatively simple and effective method of lipase assay detection can be used for crude protein extracts from different plant tissues.
Keywords: Lipase Olea europaea In gel
Materials and Reagents
Homogenized plant tissues
Liquid nitrogen
30% acrylamide stock (29: 1 acrylamide: bisacrylamide) (Bio-Rad Laboratories, catalog number: 161-0156 )
TEMED (Bio-Rad Laboratories, catalog number: 161-0801 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
2D Quant Kit (GE Healthcare, catalog number: 80-6483-56 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Bromphenol blue (Sigma-Aldrich, catalog number: B0126 )
Glycerol
Triton X-100 (Sigma-Aldrich, catalog number: T8532 )
Na2HPO4 (Sigma-Aldrich, catalog number: S3264 )
NaH2PO4 (Sigma-Aldrich, catalog number: 71505 )
N,N-Dimethylformamide (Fluka, catalog number: 72438 )
Fast blue B salt (Sigma-Aldrich, catalog number: D9805 )
α-naphthyl palmitate (Sigma-Aldrich, catalog number: N9875 )
Note: α-naphthyl palmitate catalog number: N9875 is no longer available in Sigma-Aldrich, but is available in Santa Cruz Biotechnology, catalog number: CAS 15806-43-6.
Extraction buffer (see Recipes)
12% separating gel (see Recipes)
4% stacking gel (see Recipes)
2 x SDS sample buffer (see Recipes)
1 M sodium phosphate buffer (see Recipes)
Developing solution (see Recipes)
Equipment
Mortar and pestle
Refrigerated centrifuge 5810R (Eppendorf, catalog number: 5810000.017 ) or similar, equipped with a rotor for 2 ml microcentrifuge tubes
Magnetic stirrer
2 ml microcentrifuge tube
Tubular glass vials
Mini-PROTEAN® Tetra Cell (Bio-Rad Laboratories, catalog number: 165-8000 )
Software
Quantity One software (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zienkiewicz, A., Rejón, J. D., Zienkiewicz, K., Castro, A. J. and Rodríguez-García, M. I. (2015). In Gel Detection of Lipase Activity in Crude Plant Extracts (Olea europaea). Bio-protocol 5(8): e1444. DOI: 10.21769/BioProtoc.1444.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Lipid-protein interaction
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,445 | https://bio-protocol.org/exchange/protocoldetail?id=1445&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring the Arsenic Content and Speciation in Different Rice Tissues
E. Marie Muehe
AK Andreas Kappler
CC Christina Chaban
BD Birgit Daus
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1445 Views: 9630
Edited by: Arsalan Daudi
Reviewed by: Mohan TCZhaohui Liu
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Arsenic (As) plays an important role in rice production as vast soils used for rice cultivation contain As. To understand how rice plants deal with inorganic As (III) and As (V) and organic As in their tissue, it is important to obtain specific information on how much and what species of As are present in which tissue of the rice plant. The protocol presented here allows to analyse the As contents and As speciation in roots, shoots, and husks of rice plants, and thus permits direct comparison of the As contents of these rice plant tissues.
Keywords: O. sativa Arsenate Arsenite
Materials and Reagents
Rice tissue (roots, shoots, husks) (Muehe et al., 2014)
Liquid nitrogen
65% HNO3 (Merck KGaA, catalog number: 100456 )
Double-distilled or MilliQ water
>30% H2O2 (Merck KGaA, catalog number: 107298 )
85% phosphoric acid (Merck KGaA, catalogue number: 100563 )
0.05 mol/L as stock solution as arsenite (Merck KGaA, catalog number: 106277 ), a 1,000 mg/L as stock solution as arsenate (Merck KGaA, catalog number: 119773 ) diluted to the appropriate concentrations
NH4NO3 (Merck KGaA, catalog number: 102596 )
Eluent A for LC-HPLC-ICP-MS (see Recipes)
Eluent B for LC-HPLC-ICP-MS (see Recipes)
Equipment
Mortar (diameter of at least 10 cm) and pestle (approximately 15 cm long)
Drying oven (adjustable to 60 °C)
WhatmanTM #1 filter papers (GE Healthcare, catalog number: 1440-125 )
Duran® test tubes, straight rim (13 x 100 mm) (Duran Group, catalog number: 26 131 12 )
Polyethylene flanged plug caps for tubes, natural (Globe Scientific, catalog number: 118240 )
Polytetrafluoroethylene (PTFE)-coated spatula (Fisher Scientific, catalog number: 10081074 ) to minimize metal contamination of the plant material from the spatula
Volumetric flask with glass stopper (10 ml)
Tube rack
Water bath
Glass funnel
Inductively coupled plasma atomic emission spectrometry ICP-AES (CIROS)
Inductively coupled plasma mass spectroscopy ICP-MS (Agilent Technologies, model: 7700 )
Autosampler vials (8 mm, brown glass, WICOM, vials are free of As) and screw caps with Teflon septum
Liquid chromatography (Agilent Technologies, model: 1200 ) equipped with a Shodex RSpak NN-614 column (150 mm x 6 mm; Shodex) coupled to inductively coupled plasma mass spectroscopy HPLC-ICP-MS (Agilent Technologies, model: 7700 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Muehe, E. M., Kappler, A., Chaban, C. and Daus, B. (2015). Measuring the Arsenic Content and Speciation in Different Rice Tissues. Bio-protocol 5(8): e1445. DOI: 10.21769/BioProtoc.1445.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant physiology > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,446 | https://bio-protocol.org/exchange/protocoldetail?id=1446&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Real-time Analysis of Lateral Root Organogenesis in Arabidopsis
Peter Marhavý
Eva Benková
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1446 Views: 9358
Edited by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Plants maintain capacity to form new organs such as leaves, flowers, lateral shoots and roots throughout their postembryonic lifetime. Lateral roots (LRs) originate from a few pericycle cells that acquire attributes of founder cells (FCs), undergo series of anticlinal divisions, and give rise to a few short initial cells. After initiation, coordinated cell division and differentiation occur, giving rise to lateral root primordia (LRP). Primordia continue to grow, emerge through the cortex and epidermal layers of the primary root, and finally a new apical meristem is established taking over the responsibility for growth of mature lateral roots [for detailed description of the individual stages of lateral root organogenesis see Malamy and Benfey (1997)]. To examine this highly dynamic developmental process and to investigate a role of various hormonal, genetic and environmental factors in the regulation of lateral root organogenesis, the real time imaging based analyses represent extremely powerful tools (Laskowski et al., 2008; De Smet et al., 2012; Marhavý et al., 2013; Marhavý et al., 2014). Herein, we describe a protocol for real time lateral root primordia (LRP) analysis, which enables the monitoring of an onset of the specific gene expression and subcellular protein localization during primordia organogenesis, as well as the evaluation of the impact of genetic and environmental perturbations on LRP organogenesis.
Materials and Reagents
Arabidopsis seedlings (5-6 days old) expressing Green Fluorescent Protein (GFP) or analogous reporters (YFP, RFP, CFP, mCherry and others) (Chalfie et al., 1994; Shaner et al., 2007)
MilliQ Water (H2O)
Sucrose (VWR International, catalog number: 27483.294 )
Murashige and Skoog basal salt mixture (MS salts) (Duchefa Biochemie, catalog number: M0221.0050 )
2- [N-morpholino] ethanesulfonic acid (MES) (Duchefa Biochemie, catalog number: M1503.0100 )
Potassium hydroxide (KOH) (Merck KGaA, catalog number: 1.05021.1000 )
Agar (LAB M, catalog number: MC029 )
Ethanol (EtOH) (Sigma-Aldrich, catalog number: 32221 -2.5L)
Seeds sterilization by ethanol (see Recipes)
½ MS media (see Recipes)
Growth conditions (see Recipes)
Equipment
Growth chamber to grow plant material
Square plates 120 x 120 x 17 mm (Greiner Bio-One GmbH, catalog number: 688102 )
Chambered cover glass (VWR, Kammerdeckgläser, Lab-TekTM, NuncTM - eine kammer, catalog number: 734-2056 )
Inverted confocal microscope (Zeiss, model: LSM 700 )
Note: Fully motorized X, Y, Z scanning stage is required to perform multi-position time-lapse experiment.
Objectives: 20x [suitable to monitor early phases of the lateral root primordia (LRP) initiation, Figure 2], 40x or 60x (suitable to monitor LRP from the stage I onwards, Figure 3)
Fluorescence signal detection system for GFP and other fluorescent reporters (Shaner et al., 2007)
Software
Software operating the confocal microscope
ImageJ (Abramoff et al., 2004)
CellseT (Pound et al., 2012)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Marhavý, P. and Benková, E. (2015). Real-time Analysis of Lateral Root Organogenesis in Arabidopsis. Bio-protocol 5(8): e1446. DOI: 10.21769/BioProtoc.1446.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell structure
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,447 | https://bio-protocol.org/exchange/protocoldetail?id=1447&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
13C Kinetic Labeling and Extraction of Metabolites from Adherent Mammalian Cells
PM Parul Mehrotra
NS Najmuddin Saquib
KR Kanury V. S. Rao
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1447 Views: 10049
Edited by: Fanglian He
Reviewed by: Valentine V TrotterKanika Gera
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Fluctuations in metabolite levels in mammalian cells are the most direct form of readout of the cellular metabolic state. The current protocol describes a method for pulse labeling and subsequent isolation of metabolites from adherent mammalian cells. The isolated metabolites can be identified and quantified by mass-spectrometry, allowing for estimation of the rates of synthesis and removal of metabolites from the system being analyzed.
Materials and Reagents
THP1 cells (from ATCC, catalog number: TIB 202 )
Methanol (LC-MS Ultra CHROMASOLV) (Sigma-Aldrich, catalog number: 14262 )
Water (LC-MS Ultra CHROMASOLV) (Sigma-Aldrich, catalog number: 14263 )
Acetonitrile (LC-MS Ultra CHROMASOLV) (Sigma-Aldrich, catalog number: 14261 )
Hexane (Sigma-Aldrich, catalog number: 296090 )
HCl (Sigma-Aldrich, catalog number: 258148 )
Trypan blue (Gibco, catalog number: 15250-061 )
Phorbol myristate acetate (PMA) (Sigma-Aldrich, catalog number: P8139 )
Pyridine (Sigma-Aldrich, catalog number: 270970 )
Sulfur trioxide pyridine (Sigma-Aldrich, catalog number: S7556 )
Barium acetate (Sigma-Aldrich, catalog number: 243671 )
D-Glucose (13C6 99%) (Euriso-Top, catalog number: CLM-481 )
RPMI culture media 1640 (Gibco, catalog number: 31800-014 )
Glucose free RPMI media-1640 (Sigma-Aldrich, catalog number: R1383 )
Dialyzed FBS (Hyclone, catalog number: SH30071.03 )
Cholate buffer (see Recipes)
Quenching mix (see Recipes)
Equipment
Bright-line hemacytometer (Sigma-Aldrich, catalog number: Z359629 )
Cell scraper
Culture dish
6 well plate (Nunc, catalog number: 140685 )
Flask (T-175, catalog number: 178983 )
Liquid nitrogen cylinder
Nitrogen gas cylinder
Water bath
Refrigerators (-20, -80, 4 °C)
Microcentrifuge (Eppendrof, model: 5418R )
Mono spin C18 plugs (GL Sciences, catalog number: 5010-21700 )
HPLC (Agilent, model: 1260 infinity ; Pump: Binary Pump VL, model: G1312C )
HPLC column
Amino column (Polaris 5 NH2 150 * 2.0 mm)
C18 column [ZORBAX Eclipse Plus C18 (Narrow Bore 2.1 * 150 mm 5 μ)]
Cyano column (Phenomenax Luna 150 * 2.0 mm 3 μ)
Mass spectrometer (ABSciex, hybrid 4000 QTrap)
Amber glass vials (Supelco, catalog number: 29117 )
Glass vials (Borosil, catalog number: 9910 )
Glass pasture pipette
Sonicator (Branson, model: 1210 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mehrotra, P., Saquib, N. and Rao, K. V. S. (2015). 13C Kinetic Labeling and Extraction of Metabolites from Adherent Mammalian Cells. Bio-protocol 5(8): e1447. DOI: 10.21769/BioProtoc.1447.
Mehrotra, P., Jamwal, S. V., Saquib, N., Sinha, N., Siddiqui, Z., Manivel, V., Chatterjee, S. and Rao, K. V. (2014). Pathogenicity of Mycobacterium tuberculosis is expressed by regulating metabolic thresholds of the host macrophage. PLoS Pathog 10(7): e1004265.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid isolation
Cell Biology > Cell metabolism > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,448 | https://bio-protocol.org/exchange/protocoldetail?id=1448&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Drug Susceptibility Assay for HBV Using Southern Blotting
SA Sung Hyun Ahn
YP Yong Kwang Park
Kyun-Hwan Kim
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1448 Views: 10432
Reviewed by: Yannick Debing
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Antiviral agents for the suppression of hepatitis B virus (HBV) have been used for treating chronic hepatitis B. However, the emergence of drug-resistant HBV is still a major problem for antiviral treatment. To identify and characterize the drug-resistant HBV, the construction of HBV replicon and in vitro drug susceptibility assay are essential. Here we describe the experimental methods to study drug-resistant HBV.
Keywords: Hepatitis B virus Antiviral agent Drug susceptibility Drug resistant mutation Southern blot
Materials and Reagents
Transfection HBV 1.2mer replicons
Huh7 cells (Liver Research Center, Rhode Island Hospital, Brown Medical School, Providence, USA)
Dulbecco modified Eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 11995 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 26140-079 )
Penicillin-streptomycin (Life Technologies, Gibco®, catalog number: 15140 )
Lipofectamine 2000 (Life Technologies, InvitrogenTM, catalog number: 11668-019 )
Opti-MEM® I Reduced Serum Medium (Opti-MEM) (Life Technologies, Gibco®, catalog number: 31985-088 )
HBV 1.2mer replicon [WT or Drug-resistant HBV, WT HBV1.2 replicon was kindly provided from Prof. W. S. Ryu (Yonsei University, Korea)]
Lamivudine (1~100 μM, provided by GlaxoSmithKline)
Adefovir (1~100 μM, provided by Gilead Sciences)
Clevudine (1~100 μM, provided by Bukwang Pharmaceutical Co.)
Entecavir (0.05~1 μM, Moravek)
Tenofovir (1~100 μM, provided by Gilead Sciences)
Extraction of viral DNA from HBV core particles
DNaseI (Takara Bio Company, catalog number: 2215B )
MungBean Nuclease (Takara Bio Company, catalog number: 2420B )
Proteinase K (Roche Diagnostics, catalog number: 03115801001 )
Phenol-chloroform-isoamyl alcohol 25:24:1 (Sigma-Aldrich, catalog number: 77617 )
Sodium acetate trihydrate (NaOAc) (Sigma-Aldrich, catalog number: 236500 )
HEPES lysis buffer (see Recipes)
Nuclease buffer (I) (see Recipes)
26% PEG solution (see Recipes)
Nuclease buffer (II) (see Recipes)
0.5% SDS solution (see Recipes)
Southern blot assay and the construction of the HBV probe
Certified Molecular Biology Agarose (Bio-Rad Laboratories, catalog number: 161-3102 )
Amersham Hybond-N+ membrane (GE Healthcare, catalog number: RPN203B )
SSC Buffer (Sigma-Aldrich, catalog number: 85639 )
Salmon sperm DNA (Life Technologies, InvitrogenTM, catalog number: AM9680 )
Poly ethylene glycol (PEG) (Sigma-Aldrich, catalog number: P5413 )
50x Denhardt’s solution (Sigma-Aldrich, catalog number: D2532 )
0.1 M sodium phosphate buffer (pH 7.0)
Formamide (Sigma-Aldrich, catalog number: F7503 )
HBV 1.2mer replicon
Klenow fragment and 10x Klenow buffer (Takara Bio Company, catalog number: 2140B )
dNTP (NEB, catalog number: N0446S )
[α-32P] dCTP (3,000 Ci/mmole, Perkin Elmer, catalog number: BLU513H500UC )
Quick Spin Columns for radiolabeled DNA purification (Sephadex G-50, Roche Diagnostics, catalog number: 11 273 973 001 )
Aat II (New England BioLabs, catalog number: R0117S )
Hind III (New England BioLabs, catalog number: R0104S )
Random primer (Bioneer, catalog number: N-7052 )
Na2HPO4 (Amresco, catalog number: 0404 )
NaH2PO4 (Amresco, catalog number: 0571 )
0.1 M sodium phosphate buffer (see Recipes)
Transfer solution (I) (see Recipes)
Transfer solution (II) (see Recipes)
Transfer solution (III) (see Recipes)
Hybridization solution (see Recipes)
Washing solution (I) (see Recipes)
Washing solution (II) (see Recipes)
Equipment
37 °C, 5% CO2 forced-air incubator (Thermo Fisher Scientific, Forma®, model: 3131 )
100 mm cell culture dish (Nunc®, catalog number: 172958 )
6 well plate (Nunc®, catalog number: 140675 )
Centrifuge (Eppendorf, catalog number: 5415R )
Pipet Aid XP (Drummond Scientific Company)
Electrophoresis system (Nihon Eido, catalog number: NB-1011 )
Dry oven
Hybridization bottle
Hybridization chamber
Heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Antiviral assay
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbe-host interactions > In vitro model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,449 | https://bio-protocol.org/exchange/protocoldetail?id=1449&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Introduction and Sequencing of Patient-isolated HBV RT Sequences into the HBV 1.2-mer Replicon
SA Sung Hyun Ahn
YP Yong Kwang Park
Kyun-Hwan Kim
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1449 Views: 8739
Reviewed by: Yannick Debing
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Antiviral agents for the suppression of hepatitis B virus (HBV) have been used for treating chronic hepatitis B. However, the emergence of drug-resistant HBV is still a major problem for antiviral treatment. To identify and characterize the drug-resistant HBV, the construction of HBV replicon and in vitro drug susceptibility assay are essential. Here we describe the experimental methods to study drug-resistant HBV.
Keywords: Hepatitis B virus Drug resistance Replication Reverse transcription
Materials and Reagents
Sera of patients with chronic hepatitis B (100~200 μl)
QIAamp MinElute virus spin kit (QIAGEN, catalog number: 57704 )
Ex taq polymerase (Takara Bio Company, catalog number: RR001A )
Forward primer (XhoI site is underlined): 5’-AAT CTT CTC GAG GAC TGG GGA CCC TGC ACC-3’
Reverse primer (NcoI site is underlined): 5’-GAG CAG CCA TGG GAA GGA GGT GTA TTT CCG-3’
Gel/PCR DNA Extraction kit (Real Biotech Corporation, catalog number: YDF100 )
pGEM-T Easy vector (Promega Corporation, catalog number: A1360 )
T4 ligase (Takara Bio Company, catalog number: 2011A )
LB broth high salt (Duchefa Biochemie, catalog number: L1704 )
MacConkey agar (BD, catalog number: 212123 )
LaboPass Plasmid Mini Purification Kit (COSMO Genetech, catalog number: CMP0111 )
HBV WT complete sequence (genotype C, GQ872210)
Xho I (New England BioLabs, catalog number: R0146S )
Nco I (New England BioLabs, catalog number: R0193S )
CutSmart™ buffer (New England BioLabs, catalog number: B7204S )
HBV 1.2 replicon (Figure 1)
TE buffer (see Recipes)
Figure 1. A plasmid map of the HBV 1.2-mer replicon with XhoI and NcoI sites highlighted
Equipment
Centrifuge (Eppendorf, catalog number: 5415R )
Pipet Aid XP (Drummond Scientific Company, catalog number: 4-000-202-E )
MJ Mini 48-Well Personal Thermal Cycler (Bio-Rad Laboratories, catalog number: PTC-1148 )
Nanodrop Spectrophotometer (Nanodrop, catalog number: ND-1000 )
Heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > DNA
Microbiology > Antimicrobial assay > Antiviral assay
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
145 | https://bio-protocol.org/exchange/protocoldetail?id=145&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Embryonic Stem Cell Maintenance for Differentiation
HI Hogune Im
Published: Oct 20, 2011
DOI: 10.21769/BioProtoc.145 Views: 16967
Download PDF
Ask a question
Favorite
Cited by
Abstract
Embryonic stem cells are derived from inner cell mass of an embryo that can differentiate into every cell type in the body. Clinically, cultured red blood cell supply is of great interest. However, some of the hurdles need to be overcome. This protocol describes a protocol to maintain mouse stem cells that will be used for hematopoietic lineage differentiation assay in the lab.
Materials and Reagents
Mouse embryonic stem cells (ES cells)
STO cells
Fetal calf serum (FCS) Gemini (pre-selected) (catalog number: 100-500 )
ATLAS biologicals, Summit (Summit Biotechnology, catalog number: FP-200-05 )
DMSO (Sigma-Aldrich)
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 14190-144 )
Gelatin (STEMCELL Technologies, catalog number: 0 7903 )
Monothiolglycerol (MTG): (Sigma-Aldrich, catalog number: M-1753 25 ml )
IMDM media (Life Technologies, Gibco®, catalog number: 12440-053 )
CCE cells (ATCC, catalog number: SCRC-1023 TM)
Mitomycine C (Sigma-Aldrich, catalog number: M0503 )
Penicillin/Streptomycin (Pen/Strep) (10,000 U) (Life Technologies, Gibco®, catalog number: 15140-122 )
NaHCO3 (Sigma-Aldrich, catalog number: S5761 )
Trypsin /EDTA (Lonza Group, catalog number: 17-161E )
HEPES buffer (Life Technologies, Gibco®)
MTG
BME
Eosin
Iscove’s modified dulbecco medium (IMDM) (10% FCS) media
β-Mercaptoethanol (BME) (see Recipes)
ES-DMEM media (see Recipes)
STO media (see Recipes)
ES freezing media (see Recipes)
Leukemia inhibitory factor (LIF) (screened) (see Recipes)
Dulbecco's modified eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 12100-046 , 1 L/pack) (Liquid, catalog number: 11965 ) (see Recipes)
Equipment
1 L with volumetric flask
0.45 micron filter
0.22 micron filter
T25 flask
T75 or T175 flask
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Developmental Biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,450 | https://bio-protocol.org/exchange/protocoldetail?id=1450&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Nucleotide Triphosphate Sugar Transferase Activity via Generation of Pyrophosphate
Kaisei Maeda
RN Rei Narikawa
MI Masahiko Ikeuchi
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1450 Views: 9536
Reviewed by: Claudia CatalanottiKanika Gera
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Nucleotide triphosphate (NTP) transferases (EC. 2. 7. 7. X) transfer a nucleoside monophosphate moiety from NTP to another substrate. NTP sugar transferases form a large member of the NTP transferase. There are many variations for the substrate combination of the NTP sugar transferases. It is important to measure the precise enzymatic activity of such NTP sugar transferases by a simple and efficient method. In our method, we measure pyrophosphate as a byproduct of nucleotide diphosphate (NDP)-sugar generation using the pyrophosphate assay kit. The kit reagents include two enzymes that convert pyrophosphate to phosphate, and then phosphorolyze chromogenic substrate to allow color development at 360 nm (see details below). Thus, the NDP-sugar formation can be simply traced as production of pyrophosphate, which is monitored by absorbance at 360 nm. This method is reliable and versatile for measurements of various pyrophosphate-producing enzymes that include NTP sugar transferases.
[Principle and overview] NTP transferases catalyze the reversible reaction as follows: NTP + sugar-1P <-> NDP-sugar + PPi
The enzyme reaction can be monitored as generation of inorganic pyrophosphate (PPi). The EnzChek Pyrophosphate Assay kit (Molecular Probes, Life Technologies, Carlsbad, CA) includes two enzymes and sufficient materials for color development to quantitate pyrophosphate. The inorganic pyrophosphatase (component E in the kit) degrades pyrophosphate into phosphate. Purine nucleoside phosphorylase (PNP, component B) utilizes phosphate to cleave the colorgenic substrate 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG, component A) into ribose-1-phosphate and 2-amino-6-mercapto-7-methylpurine. The product 2-amino-6-mercapto-7-methylpurine has the absorption maximum at 360 nm. The component C is the dilution solution that includes minimal MgCl2 sufficient for the inorganic pyrophosphatase. Thus, NTP transferase activity can be monitored at 360 nm as generation of a byproduct pyrophosphate.
Typically, the nucleotidyl sugar transferase reactions have been measured by High Performance Liquid Chromatography (HPLC) (Kawano et al., 2014). There are several advantages and disadvantages in HPLC method and our enzymatic method (O: advantage, X: disadvantage).
{HPLC method}
O) Can measure the reaction in both directions (NDP-sugar formation and degradation)
O) Can measure with a small amount of the sample protein
X) Can not follow the real-time reaction
X) The peaks of substrates and products must be separated in the chromatogram
{Pyrophosphate assay method}
O) Can observe the reaction in real-time
O) Easy to use many kinds of substrates because of the simple detection at 360 nm
O) Can be used in other pyrophosphate or phosphate generating reactions such as adenylate cyclase, diguanylate cyclase ( Enomoto et al., 2014), and DNA polymerase
X) Can not measure the pyrophosphate-consuming direction of the reversible reaction of NDP-sugar pyrophosphorylase. Km and kcat for NDP-sugar and pyrophosphate are not obtained by the pyrophosphate assay method but by HPLC method.
X) Need certain amount of the experimental protein. The maximum activity that the kit reagents allow corresponds theoretically to the rate of color development for the positive control is 2 x 10-2 U in our case. The instruction states the minimum detection of 5 x 10-5 U. Of course, the minimum activity we can measure may depend on the background activity due to contaminants in the substrates or in the sample preparation.
Figure 1. Chromogenic reactions in the assay kit
Materials and Reagents
EnzChek Pyrophosphate Assay kit (Molecular Probes, catalog number: E-6645 )
The contents of the components A~E are shown below.
2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG)
Purine nucleoside phosphorylase (PNP)
20x reaction buffer: 1.0 mM Tris-HCl, 20 mM MgCl2 (pH 7.5)
Pyrophosphate standard solution: 50 mM Na4P2O7
Inorganic pyrophosphatase
1 M MgCl2
100 mM substrates (our examples in Table 1)
Enzyme preparation (with or without imidazole, see note 5 below)
Equipment
Block incubator (ASTEC, model: BI-516S )
Spectrophotometer (Shimadzu, model: UV-2600 )
Electronic cooling and heating cuvette holder (Shimadzu, model: S-1700 )
Quarts cuvette with a lid
Table 1. An example of substrate reagents
Substrate
Company
Catalog number
Adenosine triphosphate (ATP)
Sigma-Aldrich
A-2383
Guanosine triphosphate (GTP)
Sigma-Aldrich
G-8877
Cytidine triphosphate (CTP)
Sigma-Aldrich
C-1506
Uridine triphosphate (UTP)
Sigma-Aldrich
U-6625
Deoxythymidine triphosphate (dTTP)
Sigma-Aldrich
T-0251
Glucose-1-phosphate (Glc-1P)
Sigma-Aldrich
G-9380
N-acetylglucosamine-1-phosphate (GlcNAc-1P)
Sigma-Aldrich
A-2142
Galactose-1-phosphate (Gal-1P)
Sigma-Aldrich
G-0380
Mannose-1-phosphate (Man-1P)
Santa Cruz
Biotechnology
SC-284868
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Maeda, K., Narikawa, R. and Ikeuchi, M. (2015). Measurement of Nucleotide Triphosphate Sugar Transferase Activity via Generation of Pyrophosphate. Bio-protocol 5(8): e1450. DOI: 10.21769/BioProtoc.1450.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,451 | https://bio-protocol.org/exchange/protocoldetail?id=1451&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Arabidopsis, Tomato and Barley Leaf Relative Water Content (RWC)
NS Nir Sade
EG Eyal Galkin
MM Menachem Moshelion
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1451 Views: 14071
Edited by: Tie Liu
Reviewed by: Xiao-qing Xu
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Measuring leaf relative water content (RWC) is a reliable and simple way to assess the water status of a leaf without any need for special equipment. Similar to leaf water potential, leaf RWC gives a strong indication of the plant’s response to different environmental conditions; yet RWC has been shown to be a more stable parameter than leaf water potential (Sade et al., 2009; Sade et al., 2012). Although measuring RWC is destructive to the leaf, with proper planning, it need not affect the plant’s behavior. This note will focus on three different model plants which are representative of plants with various leaf shapes (e.g., Arabidopsis, tomato and barley). The technique for measuring RWC is the same for all three of these species (as well as for plants with many other types of leaves).
Keywords: Relative water content Leaf water content Drought stress Salt stress
Materials and Reagents
4-week-old Arabidopsis plants grown under short-day conditions (8/16 L/D; 22/22 °C)
4-week-old tomato plants grown under moderate conditions (10/14 L/D; 25/20 °C)
4-week-old barley plants grown under short-day conditions (8/16 L/D; 16/10 °C)
Equipment
Zipper-locked plastic bag (8 x 12 cm) for each sample
Paper bag (8 x 12 cm) for each sample
Sharp scissors
Scalpel
Paper towels
Analytical balance with 0.1 mg readability
2-3 ml of 5 mM CaCl2 in DDW water for each sample
Marker pen
Plastic box that can be sealed tightly
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,452 | https://bio-protocol.org/exchange/protocoldetail?id=1452&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Random DNA Binding Selection Assay (RDSA)
YW Yafei Wang
ML Meizhong Luo
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1452 Views: 9259
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Protein-DNA interaction is a very important cellular process, by which regulation of DNA biological function, usually gene expression, is exerted. The method of random DNA binding selection assay (RDSA) can be used to identify DNA elements bound by proteins with DNA-binding activities. This method is based on the enrichment of the target DNA element by the immobilized recombinant protein on special beads and repeated PCR amplification.
Keywords: Protein-DNA interaction Transcription factor Cis-element Trans-element DNA-binding activities
Materials and Reagents
The prokaryotic expression vectors: pGEX-6P-1 (GE Healthcare) or pTXB3 (New England Biolabs)
The expression strain [Escherichia coli (E.coli) BL21 (DE3) or others]
T-Vector pGEMT-easy and T4-DNA ligase (Promega Corporation, catalog number: A1360 )
DNA polymerase (Takara Bio Company, catalog number: DR001 )
Sterile ddH2O (double distilled water)
Oligonucleotides (Pitzschke et al., 2009; Wang et al., 2014)
Chitin resin (New England Biolabs, catalog number: S6651S )
PBS buffer (see Recipes)
Column buffer (see Recipes)
RDSA buffer (Pitzschke et al., 2009) (see Recipes)
Table 1. Oligonucleotides for RDSA
Oligonucleotides for RDSA
RDSA_1
TAGTTGAGTCTCACAAACGAACAC(N20)CATTCCAAAATCCATGGCTGATA
RDSA_1 fo
TAGTTGAGTCTCACAAACGAACAC
RDSA_1 re
TATCAGCCATGGATTTTGGAATG
RDSA_2
AATGGATCCAAGCTTAAGC(N18)CGTTGAATTCCCATGGACA
RDSA_2 fo
AATGGATCCAAGCTTAAGC
RDSA_2 re
TGTCCATGGGAATTCAACG
Equipment
Glutathione sepharose beads (GE Healthcare)
The empty chromatography columns (Bio-Rad Laboratories)
4 °C refrigerator
Centrifuge
Whirling shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA-protein interaction
Molecular Biology > DNA > Gene expression
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,453 | https://bio-protocol.org/exchange/protocoldetail?id=1453&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Slot Blot Repair Assay
Jeong-Min Park
Tae-Hong Kang
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1453 Views: 20687
Edited by: HongLok Lung
Reviewed by: Pinchas Tsukerman
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Ultraviolet (UV) irradiation induces helix distorting photolesions such as cyclobutane pyrimidine dimers (CPD) and pyrimidine-pyrimidone (6-4) photoproducts (6-4PP) which threaten genomic integrity if unrepaired. In mammals, nucleotide excision repair (NER) is the only pathway that removes UV-induced DNA damages. Here we describe DNA slot blot repair assay for quantitative detection of NER activity using DNA damage specific antibodies such as anti-CPD and anti-6-4PP. Briefly, genomic DNA irradiated with UV was isolated from cells, and the genomic DNA was vacuum-transferred to a nitrocellulose membrane using a Bio-Dot SF microfiltration apparatus (Bio-Rad). A monoclonal antibody that recognizes CPD or 6-4PP was applied to detect the remaining amount of photolesions in the genomic DNA. For loading control of even loading, DNA onto the membrane can be further analyzed by SYBR-gold staining.
Keywords: DNA repair Nucleotide excision repair UV damage CPD 6-4PP
Materials and Reagents
QIAamp® DNA Mini Kit (QIAGEN, catalog number: 51306 )
Nitrocellulose membrane (GE Healthcare, catalog number: 10600003 )
Whatman filter paper 3 MM Chr (Whatman, catalog number: 3030-917 )
Mouse monoclonal antibody to CPD (Kamiya, catalog number: MC-062 )
Mouse monoclonal antibody to 6-4PPs (COSMO BIO, catalog number: NMDND002 )
Peroxidase affinipure goat anti-mouse IgG (H+L) (Jackson Laboratories, catalog number: 115-035-003 )
SYBR® Gold Nucleic Acid Gel Stain (Life Technologies, catalog number: S-11494 )
RNase A (100 mg/ml) (Bio Basic Canada Inc., catalog number: RB0473 )
Ethanol (Burdick & Jackson, catalog number: RP090-1 )
PBS (Bio Basic Canada Inc., catalog number: PD8117 )
Sodium azide (Junsei Chemical co., catalog number: 26628-22-8 )
NaOH (Bio Basic Canada Inc., catalog number: SB0617 )
EDTA (USB Corporation, catalog number: 6381-92-6 )
Ammonium acetate (NH4Ac) (Katayama Chemical, catalog number: 01-4400 )
Acetic acid (CH3COOH) (Merck Millipore, catalog number: 64-19-7 )
NaCl (Bio Basic Canada Inc., catalog number: DB0483 )
Sodium citrate (Bio Basic Canada Inc., catalog number: CB0035 )
HCl (Duksan PureChemicals, catalog number: 1129 )
Tris base (Bio Basic Canada Inc., catalog number: TB0196 )
Tween-20 (Bio Basic Canada Inc., catalog number: 9005-65-5 )
Non-fat dry milk (Sigma-Aldrich, catalog number: M7409-1BTL )
PierceTM ECL Plus Western Blotting Substrate (Life Technologies, catalog number: 32132 )
0.4 M NaOH + 10 mM EDTA buffer (see Recipes)
2 M ammonium acetate (see Recipes)
SSC (see Recipes)
TE buffer (see Recipes)
PBS-T (see Recipes)
Blocking buffer (see Recipes)
Buffer for primary antibody dilution (see Recipes)
Buffer for secondary antibody (see Recipes)
Equipment
Ultraviolet irradiator (UVP, catalog number: CL-1000 )
UV-C sensor (UVP, catalog number: 97-0016-01 )
Bio-Dot SF microfiltration apparatus (Bio-Rad Laboratories, catalog number: 170-6542 )
Vacuum pressure pump (Gardner Denver Welch Vacuum Technology Inc., catalog number: 2522C-10 )
Vacuum drier (JS Research Inc., catalog number: JSVO-30T )
Orbital shaker (Wisd Laboratory Instruments, catalog number: SHO-1D )
NanoDrop (Beckman Coulter, catalog number: DU-730 )
Heat block (Wealtec Corp., catalog number: HB-1 )
Gel doc (Bio-Rad Laboratories, catalog number: 75S/01085 )
Centrifuge (Hanil Science Industrial, catalog number: Smart R17 )
Microcentrifuge tube (SPL, catalog number: 60015 )
12-channel multi pipette (HTL LAB Solutions, catalog number: 5127 )
Paper forcep (USBECK, catalog number: 3110)
X-ray film 8 x 10 inch (Fujifilm Corporation, catalog number: HR-U30 )
X-ray Cassette-AFAB TYPE 8 x 10 inch (JPI, catalog number: AFAB8x10 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Park, J. and Kang, T. (2015). DNA Slot Blot Repair Assay. Bio-protocol 5(8): e1453. DOI: 10.21769/BioProtoc.1453.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA damage and repair
Molecular Biology > DNA > DNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,454 | https://bio-protocol.org/exchange/protocoldetail?id=1454&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Reconstitution Assay of miRNA Biogenesis by Arabidopsis DCL1
Tian Wang
Claudia Castillo-González
LY Lan You
RL Rui Li
LW Liwei Wen
Hongliang Zhu
Xiuren Zhang
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1454 Views: 9718
Edited by: Feng Li
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
microRNAs (miRNAs) are small non-coding RNAs, regulating most if not all, biological processes in eukaryotic organisms. miRNAs are initially processed from primary transcripts (pri-miRNAs) to produce miRNA precursors (pre-miRNAs), that are further processed into miRNA and its complementary strands (miRNA/*). In Arabidopsis, and possibly other plants, the processing from pri-miRNAs to pre-miRNAs and from pre-miRNAs to miRNA/* are both implemented through Dicer-like 1 (DCL1) complexes. Recently, we demonstrated isolation of DCL1 complexes of unprecedented quality from in planta. We further successfully reconstituted DCL1 cleavage assays in vitro that were able to fully recapitulate in vivo miRNA biogenesis. Here we provide a detailed protocol of DCL1 reconstitution assays. The protocol comprises three major parts (Figure 1): 1) Preparation of pri- and pre-miRNA transcripts (Procedures A-C); 2) Purification of the recombinant Arabidopsis DCL1 machinery from Nicotiana benthamiana (N. benthamiana) through immunoprecipitation (IP) (Procedures D and E); and 3) in vitro processing of radioisotope-labeled pri- or pre-miRNAs using the isolated DCL1 complexes (Procedure F). It is our desire that the protocol be a powerful tool for the RNAi community to study mechanistic issues or to develop RNA silencing technologies.
Keywords: Microprocessor Pri-miRNA MiRNA Dicer Arabidopsis
Materials and Reagents
Five to six-week old plants of N. benthamiana
Agrobacterium strain: ABI (Zhang et al., 2006)
Plasmid [pBA-2Flag-4Myc-DCL1, pBA-6Myc-HYL1, pBA-6Myc-SE. Detailed approach could refer to the Online Methods from Zhu et al. (2013). Negative control plasmid: pBA]
G-Tube® snap cap siliconized microcentrifuge tubes (VWR International, catalog number: 22179-004 )
Anti-FLAG® M2 magnetic beads (Sigma-Aldrich, catalog number: M8823 )
3x Flag peptide (NH2-MDYKDHDGDYKDHDIDYKDDDDK-COOH) (Sigma-Aldrich, catalog number: F4799 )
DNase (Promega Corporation, catalog number: M6101 )
3,000 Ci/mmol 10 mCi/ml [γ-32P]-ATP (PerkinElmer, catalog number: BLU502A100UC )
SuperaseIn RNase inhibitor (Ambion, catalog number: N8080119 )
T7 RNA polymerase (Ambion, catalog number: 18033019 )
Calf intestine alkaline phosphatase (NEB, catalog number: M0290S )
Phenol: chloroform: isoamyl alcohol (25:24:1) (Life Technologies, InvitrogenTM, catalog number: 15593049 )
NaAc (Sigma-Aldrich, catalog number: S7670 )
5 M ammonium acetate (Ambion, catalog: AM9071 )
GlycoBlue (Ambion, catalog number: AM9516 )
Decade marker (Ambion, catalog number: AM7778 )
Anti-c-Myc Agarose Affinity Gel (Sigma-Aldrich, catalog number: A7470 )
EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 05892953001 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Spermidine (Sigma-Aldrich, catalog number: S2626 )
DTT (DL-Dithiothreitol) (Sigma-Aldrich, catalog number: 43817 )
MgCl2 (Sigma-Aldrich, catalog number: M8266 )
NTP (Thermo scientific, catalog number: R0481 )
Deionized formamide (Ambion, catalog number: AM9342 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Xylene cyanol (Sigma-Aldrich, catalog number: X4126 )
EDTA (Sigma-Aldrich, catalog number: V900106 )
SDS (Sigma-Aldrich, catalog number: L3771 )
DEPC (Sigma-Aldrich, catalog number: V900882 )
KCl (Sigma-Aldrich, catalog number: V900068 )
Tris-HCl (Sigma-Aldrich, catalog number: V900312 )
Triton X-100 (Sigma-Aldrich, catalog number: V900502 )
PMSF (Sigma-Aldrich, catalog number: 78830 )
NaCl (Sigma-Aldrich, catalog number: V900058 )
ATP (Thermo scientific, catalog number: R1441 )
GTP (Thermo scientific, catalog number: R1461 )
Glycerol (Sigma-Aldrich, catalog number: V900122 )
0.1 M Glycine-HCl (Sigma-Aldrich, catalog number: 55097-5ML-F )
5x transcription buffer (see Recipes)
RNA loading buffer (see Recipes)
RNA elution buffer (see Recipes)
DEPC H2O (see Recipes)
RNA dissolve buffer (see Recipes)
Chloroform: isoamyl alcohol (24:1) (see Recipes)
IP buffer (see Recipes)
Protease inhibitor cocktail stock (see Recipes)
TBS buffer (see Recipes)
3x Flag elution buffer stock (4 mg/ml) (see Recipes)
Washing buffer (see Recipes)
Assay buffer (see Recipes)
Fixing buffer (see Recipes)
Equipment
Compact UV lamp (UVP, model: UVGL-25 )
Fluor-Coated TLC Plate (10 x 10 cm) (Ambion, catalog number: AM10110 )
Geiger counter (Medcom, model: CRM-100 )
Vertical electrophoresis system (Whatman, model: V15.17 )
Thermomixer C (Eppendorf, model: 5382000023 )
Gel dryer (Bio-Rad Laboratories, model: 583 )
Gel analyzer Quantity One (Bio-Rad Laboratories, version: 4.6.9 )
DynaMagTM-2 (Life technologies, model: 12321D )
Rugged Rotator (Glas-Col, model: 099A MR1512 )
PolyATtract® System 1000 Magnetic Separation Stand (Promega Corporation, model: Z541A )
Phospho imager (PharosFXTM plus system)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > RNA
Plant Science > Plant biochemistry > Protein
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,455 | https://bio-protocol.org/exchange/protocoldetail?id=1455&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biotinylation and Purification of Surface-exposed Helicobacter pylori Proteins
BV Bradley J. Voss
TC Timothy L. Cover
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1455 Views: 7719
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Interactions between pathogenic bacteria and host cells are often mediated by proteins found on the surfaces of the bacteria. The Gram-negative bacterium Helicobacter pylori is predicted to produce at least 50 surface-exposed outer membrane proteins, but there has been relatively little progress in experimentally analyzing the cell-surface proteome of this organism. Herein, we describe in detail a protocol that allows biotinylation and purification of surface-exposed H. pylori proteins. A comparative analysis of surface-exposed proteins identified by this biotinylation-based approach and by several other independent methods is described in a recent publication (Voss et al., 2014).
Keywords: Outer membrane proteins Autotransporter Type V secretion Adhesin Helicobacter pylori
Materials and Reagents
Tryptone (BD, catalog number: 211705 )
Proteose peptone #3 (BD, catalog number: 211693 )
Yeast Extract (BD, catalog number: 212720 )
NaCl (Acros Organics, catalog number: 207790250 )
Dextrose (Thermo Fisher Scientific, catalog number: D14-212 )
Fetal bovine serum (Atlanta Biologicals, catalog number: S11150 )
Tris Base (Thermo Fisher Scientific, catalog number: BP152 )
Na2HPO4 (Sigma-Aldrich, catalog number: S5136 )
KCl (Sigma-Aldrich, catalog number: P-9333 )
10x PBS (Corning, catalog number: 46-013-CM )
MgCl2.6H2O (Thermo Fisher Scientific, catalog number: M35 )
CaCl2 (Sigma-Aldrich, catalog number: C-4901 )
EDTA-Na2.2H2O (Sigma-Aldrich, catalog number: E4884 )
D-biotin (Sigma-Aldrich, catalog number: B4501 )
S-NHS-LC-Biotin (Thermo Fisher Scientific, catalog number: 21335 )
Zwittergent 3-14 (Fluka, catalog number: 40772 )
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 04693159001 )
Monomeric avidin magnetic beads, Blocking buffer, Regeneration buffer (Bioclone, catalog number: MMI-101 )
100% (w/v) TCA (Sigma-Aldrich, catalog number: T0699 )
Acetone (Thermo Fisher Scientific, catalog number: A16F )
Brucella broth (see Recipes)
Biotinylation buffer (see Recipes)
TNKCM (see Recipes)
Lysis buffer (see Recipes)
TKE (see Recipes)
TKEZ (see Recipes)
Sample dilution buffer (see Recipes)
Blocking buffer (see Recipes)
Regeneration buffer (see Recipes)
Wash buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
CO2 shaking incubator (ATR Biotech, model: AJ125B )
Bench top centrifuge (Thermo Fisher Scientific, catalog number: 75004381 )
Sonicator (Thermo Fisher Scientific, catalog number: FB505 )
Bench top centrifuge (Eppendorf, catalog number: 5424 )
Ultracentrifuge (Beckman Coulter, catalog number: A94469 )
Barnstead/Thermolyne Labquake Shaker Rotisserie (Labquake, catalog number: C400110 )
DynaMagTM- Spin Magnet (Life Technologies, catalog number: 12320D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,456 | https://bio-protocol.org/exchange/protocoldetail?id=1456&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Heterocysts from Anabaena sp. PCC 7120
ME Maria Ermakova
YA Yagut Allahverdiyeva
Published: Vol 5, Iss 8, Apr 20, 2015
DOI: 10.21769/BioProtoc.1456 Views: 14712
Edited by: Maria Sinetova
Reviewed by: Ron Saar-Dover
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
During combined nitrogen step-down, filaments of cyanobacterium Anabaena sp. PCC 7120 differentiate about 5-10% of vegetative photosynthetic cells into heterocysts, the specialized cells for N2 fixation (Walk, 1996). Heterocysts have a thick cell wall reducing permeation of O2 and consist of two additional layers composed of glycolipids and polysaccharides. The difference in structure and composition of the cell wall between heterocysts and vegetative cells allows separation and isolation of heterocyst. Heterocysts isolated by this protocol can be subjected to protein analysis and activity measurements, which do not require strict anaerobic conditions.
Keywords: Heterocyst Anabaena Cyanobacteria Nitrogenase Nitrogen fixation
Materials and Reagents
Anabaena sp. PCC 7120
BG110 growth medium-BG11 medium without addition of combined nitrogen (Rippka et al., 1979)
1 M 2-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid-KOH (TES) (pH 8.2)
1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid-NaOH (Hepes) (pH 7.2)
1 M NaCl
1 M Na-EDTA
Sucrose (Merck KGaA, catalog number: K45136551417 )
Lysozyme (N-acetylmuramide glycanhydrolase) (Roche Diagnostics, catalog number: 10837059001 )
Extraction buffer (see Recipes)
Equipment
50 ml Falcon tubes
500 ml centrifuge vials (optional)
Spectrophotometer (e.g. PerkinElmer, model: Lambda 25 )
Sorvall GS-3 rotor centrifuge for 500 ml vials (optional)
SL 16R centrifuge (6 x 50 ml) (e.g. Thermo Fisher Scientific)
Vortex
Sonicator (e.g. Labsonic U, B. Braun Melsungen AG)
Orbital shaker (e.g. Infors HT, Labotron)
Incubator (e.g. Certomat, B. Braun Melsungen AG)
Bright-field microscope (40x magnification)
Water bath or thermostat at 37 °C for Chlorophyll measurements
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ermakova, M. and Allahverdiyeva, Y. (2015). Isolation of Heterocysts from Anabaena sp. PCC 7120. Bio-protocol 5(8): e1456. DOI: 10.21769/BioProtoc.1456.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbial metabolism > Nitrogen fixation
Plant Science > Phycology > Blue-green algae
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,457 | https://bio-protocol.org/exchange/protocoldetail?id=1457&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glioma Associated Stem Cells (GASCs) Isolation and Culture
EB Evgenia Bourkoula
DM Damiano Mangoni
FC Federica Caponnetto
TI Tamara Ius
MS Miran Skrap
AB Antonio Paolo Beltrami
DC Daniela Cesselli
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1457 Views: 9257
Reviewed by: Hui ZhuSalma Hasan
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Glioma Associated Stem Cells (GASCs) represent a population of non-tumorigenic multipotent stem cells hosted in the microenvironment of human gliomas. In vitro, these cells are able, through the release of exosomes, to increase the biological aggressiveness of glioma-initiating cells. The clinical importance of this finding is supported by the strong prognostic value associated with the GASCs surface immunophenotype thus suggesting that this patient-based approach can provide a groundbreaking method to predict prognosis and to exploit novel strategies that target the tumor stroma (Bourkoula et al., 2014).
Keywords: Human glioma Stem cells Microenvironment Tumor-supporting function
Materials and Reagents
Hank’s balanced salt solution (HBSS) without calcium and magnesium (Sigma-Aldrich, catalog number: H2387 )
Collagenase type II (Sigma-Aldrich, catalog number: C6885-500MG )
Fetal bovine serum (FBS) (EuroClone, catalog number: ECS0180L )
Trypan blue (Sigma-Aldrich, catalog number T6146-5G )
Dulbecco’s phosphate buffered saline (D-PBS) (Life Technologies, catalog number: 14190-250 )
Fibronectin from human plasma 0.1% solution (cell culture tested) (Sigma-Aldrich, catalog number: F0895 )
Modified Eagle’s medium (MEM) Joklik without NaHCO3 (Sigma-Aldrich, catalog number: M0518 )
Hepes (powder) (Sigma-Aldrich, catalog number: H3375 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
Taurine (Sigma-Aldrich, catalog number: T0625 )
Penicillin-streptomycin (100x solution stabilized, sterile-filtered, suitable for cell culture) (Sigma-Aldrich, catalog number: P4333-100ML )
Insulin (Sigma-Aldrich, catalog number: I5523-50MG )
Dulbecco’s modified Eagle’s medium (DMEM) low glucose (Life Technologies, Gibco®, catalog number: 31600-091 )
MCDB-201 (Sigma-Aldrich, catalog number: M6770 )
Linoleic acid-bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: L9530 )
Dexamethasone (powder) (Sigma-Aldrich, catalog number: D2915 )
Ascorbic acid-2 phosphate (powder) (Sigma-Aldrich, catalog number: A8960 )
100x insulin-transferrin-selenium (ITS) (Life Technologies, Gibco®, catalog number: 41400-045 )
Stem cell tested fetal bovine serum (Stem Cells Technologies, catalog number: 10M37180 )
Human platelet derived growth factor-BB (hPDGF-BB) (Pepro Tech, catalog number: 100-14B )
Human epidermal growth factor (hEGF) (Pepro Tech, catalog number: AF-100-15 )
TrypLE-express dissociation reagent (Life Technologies, Gibco®, catalog number: 12605 )
Basic buffer (BB) (see Recipes)
Incubation buffer (IB) (see Recipes)
0.025% Collagenase type II (see Recipes)
0.4% Trypan blue solution (see Recipes)
Fibronectin-coated 100 mm petri dish (see Recipes)
Multipotent adult stem cell (MASC) medium (see Recipes)
Equipment
Sterile tissue culture dishes 100 x 20 mm style (BD Biosciences, Falcon®, catalog number: 353003 )
Scalpel blades (Sigma-Aldrich, catalog number 27046 )
Sterile serological transfer pipettes
Serological pipettes
Sterile Falcon tubes
Mesh filter (70 µm) (BD Biosciences, Falcon®, catalog number 352350 )
Biological hood (Faster, model: Safe FAST Elite )
Agitation rotor (Celbio, model: MINI OVEN )
Burker counting chamber (Sigma-Aldrich, catalog number: Z359629-1EA )
37 °C, 5% CO2, 5% O2 force air incubator (New Brunswick, model: Galaxy 170 R )
Centrifuge (Heraeus Instruments, model: Megafuge 1.0 R )
Light microscope (Leica Microsystems, model: DMIL )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bourkoula, E., Mangoni, D., Caponnetto, F., Ius, T., Skrap, M., Beltrami, A. P. and Cesselli, D. (2015). Glioma Associated Stem Cells (GASCs) Isolation and Culture. Bio-protocol 5(9): e1457. DOI: 10.21769/BioProtoc.1457.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Cancer stem cell
Cancer Biology > Cancer stem cell > Cell biology assays
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,458 | https://bio-protocol.org/exchange/protocoldetail?id=1458&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FLP/FRT Induction of Mitotic Recombination in Drosophila Germline
Pedro Prudêncio
Leonardo G. Guilgur
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1458 Views: 29566
Edited by: Arsalan Daudi
Reviewed by: Tzvetina Brumbarova
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The FLP/FRT system is a site-directed recombination technology based on the targeting of a recombination enzyme (flipase - FLP) to specific DNA regions designated as flipase recognition target (FRT) sites. Initially identified in Saccharomyces cerevisiae, the yeast FLP-enzyme and its FRT recombination targets were successfully transferred into each major chromosome arm in Drosophila (Golic and Lindquist, 1989). This offers the ability to mediate mitotic recombination in vivo during development in a controlled manner [revised in Theodosiou and Xu (1998)]. The controlled induction of the mitotic recombination events is usually performed by expressing the FLP under the control of the heat-shock (hs) promoter. This allows the expression of high FLP levels at specific developmental time windows. Strains carrying these genetically marked FLP/FRT chromosomes have greatly enhanced our ability to study gene function in both germline and somatic Drosophila tissues. Here we describe two different protocols: One to induce and identify homozygous mutant clones in ovaries and the other to generate female germline mutants for the analysis of maternal effects on embryogenesis.
Keywords: Drosophila FLP/FRT Mitotic Recombination Germline
Materials and Reagents
Fly stocks
w; FRT 42B, fand/CyO (Guilgur et al., 2014)
y w hs-FLP22/Y; FRT 42B nls-GFP/CyO hs-hid (Guilgur et al., 2014)
y w hs-FLP22; If/CyO hs hid (Guilgur et al., 2014)
FRT 42B ovoD/T(1;2)OR64/CyO (Guilgur et al., 2014; Bloomington Drosophila Stock Center, catalog number: 4434)
Molasses (Sipa Barley Malt48, Provida, catalog number: G109115B )
Bett syrup (Zuckerrubensirup, catalog number: 01939 )
Cornmeal (Provida)
Yeast granulated (LESAFFRE IBÉRICA)
Soy flour (Salutem, catalog number: 5601557003008 )
Agar ( Nzytech, catalog number: MB02904 )
Napagin (Dutscher, catalog number: 789063 )
Propionic acid (Acros Organics)
Fly food (see Recipes)
Equipment
Plastic bottles
Water bath at 37 °C
Stereoscope
Procedure
Generation and labeling of mutant clones using the FLP/FRT system
In this section we describe the generation of homozygous mutant clones for a recessive mutation fandango (fand) which has been characterized in Guilgur et al. (2014). In order to discriminate between fand homozygous mutant and wild-type clones, we combine the FLP/FRT system with a cell-autonomous marker as originally described in Xu and Rubin (1993). We use Green Fluorescent Protein tagged with a nuclear localization signal (nls-GFP) in order to easily identify clones based on the presence (wild type clones-nls-GFP plus) or absence (mutant clones-nls-GFP minus) of a nuclear GFP signal (Figure 1).
Flies were raised using standard techniques at 25 °C unless indicated. All crosses were set up in bottles and flipped to new food vials on a daily basis at least 4 times.
To generate homozygous mosaic clones of fandango allele we crossed virgins carrying the mutant allele (genotype: w; FRT 42B, fand/CyO) with males carrying the following markers: hs-flipase, the FRT 42B, the nls-GFP construct and a balancer CyO bearing the heat-shock-inducible pro-apoptotic transgene head involution defective (hid) (genotype: y w hs-FLP22/Y; FRT 42B nls-GFP/CyO hs-hid). The reverse cross could also be used (see Figure 2).
By the late second/third larval instar stages the F1 progeny was heat-shocked in a 37 °C water bath for 1 h, in order to induce mitotic recombination and the lethality of organisms carrying the balancer with hid transgene. An additional 1 h heat-shock in the following day could be done to increase the frequency of clones.
Note: The developmental stage selected to induce the mitotic recombination via heat shock can vary depending on the tissue to be analyzed. Doing two consecutive heat shock could increase the rate of recombination as a result of more flipase expression and therefore more clones will be generated. However, it is important be aware about the health of the original stocks used in the cross (sometimes mutant stocks are weak) and more than one heat shock could be harmful for the flies. In our case for the fand allele it was sufficient one heat shock. The number of flies used in the cross referred in section 1 are approximately 15 female virgins with 5 males.
Figure 1. Generating and labeling mutant clones using FLP/FRT system and a cell marker. In a heterozygous parental cell (A), FLP induces mitotic recombination between FRT sites (yellow arrow) on homologous 2R chromosome arms. Segregation of recombinant chromosomes at mitosis produces two daughter cells: A mutant cell bearing two copies of the mutant allele fand (D) and a wild-type cell containing only the wild-type form of the gene (C). The cell marker nls-GFP co-segregates with the wild-type gene (wild type twin-spot clones - nls-GFP plus) and the mutant clone cells are labeling by its absence (fand mutant clones - nls-GFP minus). The non-recombined cells are also identified by the lighter signal from only one copy of nls-GFP (B) (wild type one-spot clones - nls-GFP plus). Schematic representation of clone mosaics in Drosophila ovaries (E). FLP-recombinase target sequences (FRT) are depicted in cyan, fandango mutation in orange and the nls-GFP construct in ochre, heterozygous parental cell in light brown, one-spot cells in light green, twin-spot cells in green, fand mutant clone cells in pink.
Figure 2. Genetic crosses to recover FRT/FLP induced clones labeled by a cell marker
F1 adult females with normal wings (absence of curly wings indicates lack of the CyO balancer) were transferred to food vials supplemented with fresh baker’s yeast for 3 days prior to ovary dissection and processing (Figure 3A-B).
Figure 3. Fandango mutant clones in ovaries. Oogenesis is normal in fandango mutant ovary clones (A, B). Absence of endogenous nls-GFP (nls-GFP minus) indicated that the cells were homozygous for fand mutation. Contrary, presence of endogenous nls-GFP (nls-GFP plus) indicates wild type clones. Ovaries were stained for F-actin (red) and WGA (blue).
Generation of fandango maternal mutant embryos from germline mutant clones using the FLP/FRT OvoD system
In this section we describe the generation of female germline mutant clones to characterize the maternal effect of the recessive zygotic lethal mutation fandango (Guilgur et al., 2014). The genetic technique applied in this assay takes advantage of the properties of the yeast “FLP/FRT” site-specific recombination system in combination with the germline-dependent dominant female sterile OvoD mutation [originally described in Chou and Perrimon (1992)] (Figure 4).
Figure 4. Generating germline mutant clones using FLP/FRT and OvoD system. In a heterozygous parental cell (A), FLP induces mitotic recombination between FRT sites (yellow arrow) on homologous 2R chromosome arms. Segregation of recombinant chromosomes at mitosis produces two daughter cells: a mutant germ cell bearing two copies of the mutant allele fand (D) and a wild-type cell containing only the wild-type form of the gene (C). The presence of germ line-dependent dominant female sterile OvoD mutation blocks oogenesis generating atrophic ovaries (B, C). Therefore, all the developed ovaries are homozygous mutant for fand allele. Schematic representation of the generation of germline clone ovaries during Drosophila oogenesis (E). FLP-recombinase target sequences (FRT) are depicted in cyan, fandango mutation in orange, the OvoD dominant mutation in ochre, heterozygous parental cell in light brown, OvoD mutant cells in light grey, fand mutant clone cells in pink.
Flies were raised using standard techniques at 25 °C unless indicated. All crosses were set up in bottles and flipped to new food vials on a daily basis. The production of germline clones of the fandango allele was based on two crosses:
The objective of the first cross is to generate the so-called “OvoD males” carrying the hs-flipase, the FRT 42B, the dominant female sterile OvoD mutation and a balancer CyO bearing the heat-shock-inducible pro-apoptotic transgene head involution defective (hid) (OvoD males genotype: y w hs-FLP22/Y; FRT 42B OvoD/CyO hs-hid). These males are produced by crossing virgins of the genotype y w hs-FLP22; If/CyO hs hid, with males of the genotype FRT 42B OvoD/T(1;2)OR64/CyO (see Figure 5 cross b1).
Note: These males are easily recognized by the orange color of their eyes and by their curly wings (CyO).
Figure 5. Genetic crosses to recover FRT/FLP induced female flies carrying germline mutant clones
The objective of the second cross is to generate females carrying clonal germline mutants for the fandango allele.
For this, virgins carrying the fandango mutant allele (genotype: w; FRT 42B, fand/CyO) were crossed with previously produced “OvoD males”.
By the late second/third larval instar stages, the F1 progeny was heat-shocked in a 37 °C water bath for 1 h, in order to induce mitotic recombination and the lethality of organisms carrying the balancer (see Figure 5 cross b2).
Finally, F1 adult females with normal wings (lack of the CyO balancer) were transferred to food vials supplemented with fresh baker’s yeast for 3 days prior to egg collection. Since OvoD is a dominant mutation that critically disrupts oogenesis, heterozygous OvoD females develop atrophic ovaries incapable of producing eggs. Accordingly, only the germline stem cells in which FRT-mediated mitotic recombination was induced by the flipase (hs-FLP) will be capable of producing mature eggs. These eggs will necessarily be homozygous for the fandango mutation and can thus be collected, processed and analyzed in order to characterize the embryogenesis phenotypes of the mutation (Figure 6C-D). As controls, germline clones without any associated mutations were generated by crossing virgin flies carrying only the FRT42B recombination site (genotype: w; FRT 42B/CyO) with “OvoD males”, followed by the aforementioned heat shock procedure (Figure 6A-B).
Note: The number of flies used in the cross referred in section 5 are approximately 50 female virgins with 10 males.
Figure 6. Fandango maternal mutant embryos laid by females carrying germline clones originated by the FRT/FLP OvoD system. Panels show blastoderm cellularized control embryos (hs-FLP; FRT42B), and fand germline clone mutant embryos (hs-FLP; FRT42B fand, maternal mutant) (A-D). Control embryos showed normal epithelial architecture with elongated nuclei and columnar cell shape (A, B). fand germline clone mutant embryos showed abnormal epithelial architecture, the cortical nuclei failed to elongate and became mislocalized (C, D). (B-D) Magnification of C and D respectively. Embryos were stained for Slam (green), Neurotactin (red), and DNA (blue).
Recipes
Fly food (1 L)
Molasses (g): 80
Beet syrup (g): 22
Cornmeal (g): 80
Yeast granulated (g): 18
Soy flour (g): 10
Agar (g): 8
Boiling water (ml): 980
15% Niapagin (ml): 12
Propionic acid (ml): 8
Weigh all ingredients except Niapagin and Proprionic acid in a plastic beaker
Mix all ingredients in a beaker before adding to boiling water
Add boiling water gradually
Transfer the solution to a bottle
Autoclaved at 121 °C, 30 min
When the medium temperature reaches 45 °C-50 °C add Niapagin and Proprionic acid
Acknowledgments
We like to thank Paulo Navarro-Costa for critical reading of manuscript and Rui Martinho for his supervision. Funding: FCT-Fundacao para a Ciencia e Tecnologia (Portugal): Leonardo Gastón Guilgur, SFRH/BPD/47957/2008. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
References
Chou, T. B. and Perrimon, N. (1992). Use of a yeast site-specific recombinase to produce female germline chimeras in Drosophila. Genetics 131(3): 643-653.
Golic, K. G. and Lindquist, S. (1989). The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59(3): 499-509.
Guilgur, L. G., Prudencio, P., Sobral, D., Liszekova, D., Rosa, A. and Martinho, R. G. (2014). Requirement for highly efficient pre-mRNA splicing during Drosophila early embryonic development. Elife 3: e02181.
Theodosiou, N. A. and Xu, T. (1998). Use of FLP/FRT system to study Drosophila development. Methods 14(4): 355-365.
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117(4): 1223-1237.
Copyright: Prudêncio and Guilgur. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Molecular Biology > DNA > DNA recombination
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,459 | https://bio-protocol.org/exchange/protocoldetail?id=1459&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Extraction from Drosophila Embryos and Ovaries
Pedro Prudêncio
Leonardo G. Guilgur
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1459 Views: 19445
Edited by: Arsalan Daudi
Reviewed by: Tzvetina Brumbarova
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Here we provide the description of protocols to efficiently obtain protein extracts from embryos and ovaries of Drosophila melanogaster. These protocols are routinely applied in our laboratory and are based on two techniques: either embryos or ovaries are homogenized using a pestle and then the soluble proteins separated by centrifugation, or embryos are individually lysed by needle manipulation. The latter technique allows the use of small embryo numbers and the selection of specific developmental stages (Guilgur et al., 2014).
Keywords: Drosophila Protein extracts Embryos Ovaires
Materials and Reagents
Phosphate buffered saline tablets (Sigma-Aldrich, catalog number: P4417-100TAB )
Commercial bleach solution
Tween 20 (Sigma-Aldrich, catalog number: P5927 )
Tris-base (DBH Prolabo, catalog number: 33621.26 0)
NaCl (Panreac Applichem, catalog number: 121659.1211 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43819 )
NP-40 (IGEPAL CA-630) (Sigma-Aldrich, catalog number: I8896 )
Sodium fluoride (NaF) (Fluka, catalog number: 71519 )
NaOH (sodium hydroxide pellets) (Panreac, catalog number: 131687 )
Agar-agar (Nzytech, Agar-agar, catalog number: MB14801 )
Sugar (commercial)
Apple juice (commercial)
Niapagine (Dutscher, Niapagine, catalog number: 789063 )
Complete EDTA-free protease inhibitor tablets (Roche Diagnostics, catalog number: 04693159001 )
Sample buffer (2x Laemmli sample buffer) (Sigma-Aldrich, catalog number: S3401 )
Commercial fresh baker´s yeast paste
NB lysis buffer (see Recipes)
1 M Tris-HCl (see Recipes)
500 mM EDTA (see Recipes)
10% NP-40 (see Recipes)
0.5 M NaF (see Recipes)
1 M DTT (see Recipes)
Apple juice plates (see Recipes)
Equipment
Containers (dark tip boxes to increase the contrast with the white embryos)
Cell strainer (70 μm nylon cell strainer) (BD Biosciences, Falcon®, catalog number: 352350 )
1.5 ml tubes
1.5 μl pestles (Kimble Chase, catalog number: 749521-1590 )
Paint brush number 4
Needles (0.8 x 25 mm) (Terumo, catalog number: NN-2125R )
Tweezers (Fine Science Tools, Dumont #5 )
Refrigerated centrifuge (Eppendorf, model: 5424R )
Fly cages
Small Petri dishes (Sarstedt, catalog number: 83.1801.002 )
Filters (Acrodisc Syringe Filters 0.2 μm Supor Membrane) (Pall, catalog number: PN 4612 )
Procedure
For protein extraction from ovaries
Ovary dissection
Rear female flies alongside a small fraction (1:3) of males in food supplemented with fresh baker yeast paste for one to two days prior to dissection. This will stimulate oogenesis and lead to bigger ovaries (with increased numbers of late developmental stages).
Inactivate anaesthetized flies by decapitation.
Dissection technique (under stereoscope and using dissection plate and a pair of tweezers): For each fly, place the organism in a drop of 1x PBS and hold it in place by applying gentle pressure at the level of the upper thorax. Using the tweezers in the free hand tug gently at the lower part of the abdomen (ovipositor region) until the cuticle starts to detach from the fly, exposing the internal organs. Isolate ovaries from adjoining tissues and organs and transfer them to ice cold 1x PBS while dissecting the remaining flies (avoid keeping the ovaries in the 1x PBS solution for periods longer than 30 min) (see Video 1 for a visual description).
Video 1. Drosophila ovary dissection
Ovary protein extraction by sample homogenization
Transfer the isolated ovaries to a 1.5 ml tube containing 200 μl of ice-cold NB lysis buffer.
Manually homogenize samples using a pestle. Homogenization should ensure the complete breakdown of the tissue. If pestles are to be reused, wash them thoroughly with distilled water before processing other samples.
Centrifuge for 20 sec at ~10,000 rcf (4 °C) to settle down at the bottom of the tube the unprocessed tissue.
Repeat manual homogenization of the centrifuged material.
Centrifuge for 3 min at ~20,000 rcf (4 °C).
Transfer the supernatant to a new 1.5 ml tube, avoiding the upper lipid layer.
Repeat this centrifugation process (steps A2 e-f) two more times.
Quantify protein concentration and dilute to the final concentration (dependent on the requirements of downstream applications).
Dilute final concentration with an equal volume of 2x Laemmli sample buffer.
Heat samples for 5 min at 100 °C and immediately freeze them at -20 °C after a quick centrifuge spin-down. Extracts can be stored at -20 °C until necessary.
For protein extraction from embryos
Embryo collection and processing
For one to two days prior to embryo collection rear male and female flies on collection cages with standard apple juice agar plates supplemented with fresh baker yeast paste (Figure 1 A).
Start the collection by placing a clean apple juice agar plate on the cage. Let flies lay eggs for a given time interval.
While egg laying is taking place prepare the 5 individual containers for the subsequent processing of the embryos. Containers with the following solutions are required: 0.1% Tween 20 (in water), 50% commercial bleach (in water) and deionized water (3 containers). Place a collection basket (cell strainer) into the container with the 0.1% Tween 20 solution (starting point) (Figure 1A).
Collect embryos from the agar plate using a small paintbrush and place them in the partially immersed basket.
Gently stir the collection basket to wash the embryos. Dry the base of the collection basket in a paper tissue before transferring it to the subsequent container.
Transfer the embryos in the collection basket to the container with the 50% commercial bleach solution. Incubate for 5 min with gentle, periodic stirring. The purpose of this step (dechorionation) is to remove the chorionic membranes which constitute the eggshell covering the embryos. The dechorionated embryos will become hydrophobic and will float on the surface of the bleach solution (Figure 1B).
Transfer the embryos in the collection basket to a new container with deionized water. Wash for 2 min and repeat twice using each time new containers. Before starting the washes and also when transferring between the water containers dry the base of the collection basket in a paper tissue.
Note: Embryos can be stored at this step by transferring them to a 1.5 ml tube (remove excess water) that will be flash frozen in liquid nitrogen prior to storage at -80 °C.
Figure 1. Set up for embryonic protein extraction. Fly collection cages with standard apple juice agar plates and solution containers set up (A). Dechorionated embryos float on the surface of the bleach solution (B). Manually select embryos collected in a 0.5 ml tube lid (C1). Punctured embryo total extract (C2). Total extract collection by mixing with Laemmli sample buffer (C3). Embryo collection before pestle homogenization (Arrowhead 1, D1). Embryonic soluble protein extract after homogenization and centrifugation (Arrowhead 2, D2).
Embryo total protein extracts
Manual selection and needle homogenization protocol
After dechorionation, manually select embryos with sharp tweezers or a fine paintbrush and transfer them to a previously sectioned 0.5 ml tube lid (for a minimum of 10 embryos per lid) (Figure 1C1).
Dry as much as possible the embryos by absorbing the excess water with a dry paintbrush.
Individually puncture each embryo using a needle (Figure 1C2).
Gently mix the resulting lysate with 10 µl of 1x Laemmli sample buffer (Figure 1C3). Transfer the solution to a 1.5 ml collection tube.
Note: The volume of sample Laemmli buffer is according to the number of embryos used (1 µl per embryo).
Heat samples for 5 min at 100 °C and immediately freeze them at -20 °C after a quick centrifuge spin-down. Extracts can be stored at -20 °C until necessary.
Pestle homogenization protocol
After dechorionation, transfer embryos (20 μl volume) to a 1.5 ml tube containing 200 μl of ice-cold NB lysis buffer (Figure 1D1).
Note: This will correspond approximately to between 1 to 2 μg/μl of final protein concentration. Manually homogenize embryos using a pestle (~10 strokes). Homogenization should ensure the complete breakdown of the tissue. If pestles are to be reused, wash them thoroughly before processing other samples.
Centrifuge for 20 sec at ~10,000 rcf (4 °C) to settle down at the bottom of the tube the unprocessed tissue.
Repeat manual homogenization of the centrifuged material.
Centrifuge for 3 min at ~20,000 rcf (4 °C).
Transfer the supernatant to a new 1.5 ml tube, avoiding the upper lipid layer (Figure 1D2).
Repeat this centrifugation process (steps B2 i-j) two more times.
Quantify protein concentration and dilute to the final concentration (dependent on the requirements of downstream applications).
Dilute final concentration with an equal volume of 2x Laemmli sample buffer.
Heat samples for 5 min at 100 °C and immediately freeze them at -20 °C after a quick centrifuge spin-down. Extracts can be stored at -20 °C until necessary.
Recipes
NB buffer
Initial concentration
Volume
Final concentration
1 M NaCl
7.5 ml
150 mM NaCl
1 M Tris-HCl (pH 7.5)
2.5 ml
50 mM Tris-HCl (pH 7.5)
500 mM EDTA (pH 8.0)
200 µl
2 mM EDTA
10% NP-40
500 µl
0.1% NP-40
Add ddH2O to final volume of 50 ml
Sterilized by filtration (0.2 µm filter)
Make 10 ml Aliquots and store at -20 °C
Before use add to the 10 ml aliquot: 10 µl of 1 M DTT, 200 µl of 0.5 M NaF and dissolve one Complete EDTA-free tablet to the solution
1 M Tris-HCl (pH 7.5)
Dissolve 157.6 g of Tris-HCl to ~800 ml of ddH2O
Adjust pH to 7.5 with NaOH
Add ddH2O to final volume of 1,000 ml
Sterilized by filtration (0.2 µm filter)
Stored at RT
500 mM EDTA (pH 8.0)
Weigh 73.06 g of EDTA to ~400 ml of ddH2O
Adjust pH slowly to 8.0 with NaOH - EDTA dissolves when pH approaches 8
Add ddH2O to final volume of 500 ml
Sterilized by filtration (0.2 µm filter)
Stored at RT
10% NP-40
Dilute 10 ml of NP-40 to ddH2O in a final volume of 100 ml
Sterilized by filtration (0.2 µm filter)
Stored at RT
0.5 M NaF
Dissolve 2.0995 g of NaF to ddH2O in a final volume of 100 ml
Sterilized by Filtration (0.2 µm filter)
Aliquot and stored at -20 °C
1 M DTT
Dissolve 1.5425 g of DTT to ddH2O in a final volume of 10 ml in the fume hood
Sterilized by filtration (0.2 µm filter)
Aliquot and stored at -20 °C
Apple juice plates (1 L)
Weigh Agar-agar in a big plastic beaker 19.5 g
Add to the Agar-agar ddH2O 500 ml
Mix everything very well
Place the beaker in microwave until boiling
Wait for the medium to cool to 50 °C, stirring from time to time to avoid the formation of a film on the surface
Weigh sugar in an aluminum foil 20 g
Then add to the dissolve Agar-agar: The sugar, Apple juice 250 ml, Niapagin 10% 5 ml and ddH2O 250 ml
1 L of apple juice medium → 100 small plates
Store the plates at 4 °C no more than 30 days
Acknowledgments
We like to thank Paulo Navarro-Costa for critical reading of manuscript and Rui Martinho for his supervi-sion. Funding: FCT-Fundaçao para a Ciencia e Tecnologia (Portugal): Leonardo Gastón Guilgur, SFRH/BPD/47957/2008. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
References
Guilgur, L. G., Prudencio, P., Sobral, D., Liszekova, D., Rosa, A. and Martinho, R. G. (2014). Re-quirement for highly efficient pre-mRNA splicing during Drosophila early embryonic development. Elife 3: e02181.
Copyright: Prudêncio and Guilgur. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Prudêncio, P. and Guilgur, L. G. (2015). Protein Extraction from Drosophila Embryos and Ovaries. Bio-protocol 5(9): e1459. DOI: 10.21769/BioProtoc.1459.
Guilgur, L. G., Prudencio, P., Sobral, D., Liszekova, D., Rosa, A. and Martinho, R. G. (2014). Re-quirement for highly efficient pre-mRNA splicing during Drosophila early embryonic development. Elife 3: e02181.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
146 | https://bio-protocol.org/exchange/protocoldetail?id=146&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enrichment of Cells of Interest from Heterogeneous Murine Cells with BioMag Goat Anti-rat IgG
HW Hongcheng Wang
Published: Vol 2, Iss 7, Apr 5, 2012
DOI: 10.21769/BioProtoc.146 Views: 9009
Original Research Article:
The authors used this protocol in Sep 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2009
Abstract
BioMag Goat Anti-Rat IgG is a standard BioMag particle coated with polyclonal goat anti-rat IgG antibodies and is highly suited for use in cell sorting methods where a rat IgG antibody is used as a primary antibody. BioMag Goat Anti-Rat IgG can be used to separate the cells of interest from a heterogeneous cell population using negative selection. BioMag Goat Anti-Rat IgG can also be used as a secondary antibody in enzyme immunoassays and radioassays that utilize a rat IgG primary monoclonal antibody.
The efficiency of enrichment by negative selection depends on antigen availability and the total cell population. The author has intensive experience about enrichment of mouse CD4CD8 double negative (DN) thymocytes from total thymocytes which contains only about 2% DN population. Usually the DN population occupies more than 80% of total thymocyte after one round of enrichment. However the depletion efficiency is much lower for bone marrow cells.
Materials and Reagents
Mouse total thymocytes
BioMag goat anti-rat IgG (QIAGEN, 50 ml, catalog number: 310104 ) (QIAGEN, 500 ml catalog number: 310107 ) (1 mg/ml)
Rat anti-mouse CD4 antibody (BD Biosciences/BD Pharmingen™, catalog number: 553727 )
Rat anti-mouse CD8 antibody (BD Biosciences/BD Pharmingen™, catalog number: 553027 )
BioMag suspension
Thymocytes
Note: Whether add anti-CD4 antibody to do depletion or cell sorting is controversial because some researcher claimed that a minor subset of DN population, DN1, expresses low level of CD4.
Equipment
Imagnet magnetic separator (BD Biosciences/BD Pharmingen™, catalog number: 552311 , Batch, catalog number: 0000038241 )
Note: Qiagen also offers magnetic separator suitable for different containers such as single-tube (catalog number: 36910 ), 12-tube (catalog number: 36912 ), 15 ml/50 ml tube (catalog number: 36935 ), and flask (catalog number: 36937 ) as well.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, H. (2012). Enrichment of Cells of Interest from Heterogeneous Murine Cells with BioMag Goat Anti-rat IgG. Bio-protocol 2(7): e146. DOI: 10.21769/BioProtoc.146.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,460 | https://bio-protocol.org/exchange/protocoldetail?id=1460&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Assay to Test Manganese Tolerance in Arabidopsis
MM Magdalena Migocka
RB Robert Biskup
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1460 Views: 8222
Edited by: Arsalan Daudi
Reviewed by: Samik BhattacharyaRenate Weizbauer
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Manganese (Mn) is an essential nutrient required for the catalytic or regulatory function of several cellular enzymes. However, excessive Mn concentrations in plant tissues are toxic to plant cells as they negatively affect enzymatic activities, lead to oxidative stress and disturb the uptake and distribution of other essential mineral elements (Ca, P, Mg or Fe). Plants have developed multiple mechanisms to avoid heavy metals (including Mn) toxicity, including transport across the plasma membrane or tonoplast. The genes encoding transporters involved in Mn detoxification are now being identified in different plant species, and functional characterization of genes isolated from species can be easily carried out in Arabidopsis.
Here we provide a method to evaluate the tolerance to excess Mn of Arabidopsis lines transformed with empty vector pMDC43 or the same vector carrying cucumber gene CsMTP8 encoding putative manganese transporter localized in the vacuolar membrane. We analyzed the growth and developmental phenotypes of plants grown in controlled conditions (phytotrone) on sterile plates containing different concentrations of MnSO4 during a 16 days period. Mn accumulation was measured in the same plants grown in liquid medium supplemented or not (control) with toxic Mn concentration.
Keywords: Heavy metals Arabidopsis thaliana Manganese Atomic Absorption Spectrometry
Materials and Reagents
The seeds of Arabidopsis thaliana ecotype Columbia (Col-0) transformed with empty vector (pMDC43) or with vector pMDC43 carrying the coding sequence of CsMTP8 gene under 35S CaM promoter (35S::CsMTP8)
96% ethanol
5% sodium hypochlorite (NaClO) (commercial detergent ACE produced by Procter and Gamble)
Sterile water
1 M KOH (for pH establishment)
Murashige & Skoog Basal Medium (MS) (Sigma-Aldrich, catalog number: M5519 )
Phytagel (Sigma-Aldrich, catalog number: P8169 )
Salts for media preparation:
Ca(NO3)2 (POCH, catalog number: 874582797 )
MgSO4.7H2O (POCH, catalog number: 613780111 )
KH2PO4 (POCH, catalog number: 742020112 )
K2HPO4 (POCH, catalog number: 742100117 )
HNO3 (POCH, catalog number: 5296041 )
KNO3 (POCH, catalog number: 738910115 )
FeSO4.7H2O (POCH, catalog number: 902840115 )
MnSO4.H2O (POCH, Poland, catalog number: 616940119 )
H3BO3 (POCH, catalog number: 531360115 )
CuSO4.5H2O (POCH, catalog number: ACRS42361 )
ZnSO4.7H2O (POCH, catalog number: Ph. Eur. 6-265762730 )
(NH4)6Mo7O24.4H2O (POCH, catalog number: 139000115 )
Na2EDTA.2H2O (BioShop, catalog number: OM19432 )
Medium composition for growing plants on plates (see Recipes)
Medium composition for growing plants in liquid solution (see Recipes)
10 mM Na2EDTA (see Recipes)
65% HNO3 (see Recipes)
Equipment
Square (120 x 120 mm) petri dishes polystyrene sterile
Growth chamber or phytotrone (16/8 h photoperiod at 250 μmol·m−2·s−1 and 23 °C during the day and 22 °C during the night)
Fume hood
Laminar flow cabinet
Autoclave
Shaker
Forceps
Tubes 1.5 ml (Axygen)
Heating digester with closed vessels (mineralizator) (Kiejdal Digestion Unit DK-20, VELP Scientifica, catalog number: F30100350 )
Atomic absorption spectrophotometer (Perkin Elmer, model: AAS 3300 )
Image capturing device (regular digital SLR-single less reflex camera, e.g. Nikon D40 camera)
Precision balance (± 0.0001)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Migocka, M. and Biskup, R. (2015). An Assay to Test Manganese Tolerance in Arabidopsis. Bio-protocol 5(9): e1460. DOI: 10.21769/BioProtoc.1460.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,461 | https://bio-protocol.org/exchange/protocoldetail?id=1461&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Ralstonia solanacearum Colonization of Potato Germplasm Using Luminescence
Andrea Paola Zuluaga
Núria S. Coll
MV Marc Valls
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1461 Views: 10175
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
We have developed an unsophisticated, non-disruptive and accurate method for evaluation of pathogen colonization in planta. In this protocol we use a Ralstonia solanacearum (R. solanacearum) UY031 strain genetically modified to constitutively generate light from a synthetic luxCDABE operon stably inserted in its chromosome. This system allows bacterial quantification in a high-throughput manner, avoiding time-consuming and tedious bacterial dilution plating and colony counting. In addition, this system could be especially useful in plant breeding programs to detect bacterial latent growth in symptomless parental lines before their inclusion in long-term disease resistance breeding programs.
Materials and Reagents
Ralstonia solanacearum UY031 strain transformed with the reporter plasmid pRCG-Ppslux, which bears the chloroplast promoter PpsbA and the entire LuxCDABE operon (Figures 1 and 2)
Note: Plasmid and strain available under material transfer agreement (MTA) from Marc Valls’ laboratory.
Four-week-old Solanum tuberosum (S. tuberosum) and Solanum commersonii (S. commersonii) plants
Note: They were grown in a TREF universal potting soil mix, in a greenhouse, with 12 h light and temperatures maintained between 22 to 25 °C (50 to 60% relative humidity -RH) for three weeks and then transferred for an additional week into a growth chamber at 27 °C and 65% RH with a photoperiod of 12 h of light.
Gentamicin (75 µg/ml in solid and 5 µg/ml in liquid cultures) (Sigma-Aldrich, catalog number: G1264 )
Bacto-peptone (BactoTM, catalog number: 211677 )
Yeast extract (BactoTM, catalog number: 210929 )
Tryptone (BactoTM, catalog number: 211699 )
Casamino acids (BactoTM, catalog number: 223050 )
Dextrose Glucose (DifcoTM, catalog number: 215510 )
Bacto-agar (BactoTM, catalog number: 214030 )
Triphenyltetrazolium chloride (TTC) (DifcoTM, catalog number: 231121 )
Sodium phosphate dibasic heptahydrated (Na2HPO4.7H2O) (Sigma-Aldrich, catalog number: S9390 )
Potassium phosphate (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium chloride (NaCl) (VWR International, catalog number: 443824T )
Ammonium chloride (NH4Cl) (VWR International, catalog number: 0621 )
Magnesium sulfate (MgSO4) (VWR International, catalog number: 0338 )
Calcium chloride (CaCl2) (VWR International, catalog number: 1.02391.1000 )
L-glutamate (Sigma-Aldrich, catalog number: G1626-100G )
Rich B medium (see Recipes)
Boucher’s minimal medium (MM) (see Recipes)
Luria and Bertani broth (LB) (see Recipes)
1 M magnesium sulfate (MgSO4) (see Recipes)
20% glucose (see Recipes)
1 M calcium chloride (see Recipes)
20 mM L-glutamate (see Recipes)
To prepare 1 L of 1x MM (see Recipes)
Equipment
LAS4000 Chemiluminescence and Fluorescence Imaging System (Fujifilm Life Science)
Luminometer Berthold FB 12 (Titertek-Berthold, catalog number: 11010102 )
Spectrophotometer (Shimadzu Kyoto, model: UV-1603 visible spectrophotometer)
Incubator that can be set at 30 °C containing shaker for Erlenmeyer and tubes
Tabletop centrifuge (Eppendorf, model: 5418R )
Culture tubes (overflow volume 22 ml) (VWR International, catalog number: 47729-580 )
Sterile 150 ml flasks
2 ml Eppendorf tubes
Razor blade
Figure 1. Vector map of pRCG-Pps-lux, designed to generate the luminescent strain for detection of bacterial colonization and growth in planta
Figure 2. Visualization of Ralstonia solanacearum transformed with the pRCG-Pps-lux plasmid under white light A or chemiluminiscence B using the LAS4000 light imager
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,462 | https://bio-protocol.org/exchange/protocoldetail?id=1462&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Protocol to Measure the Cytoplasmic Calcium in Arabidopsis Guard Cells
LL Li Li
FL Feng Lin
YQ Yana Qu
Qun Zhang
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1462 Views: 10565
Edited by: Maria Sinetova
Reviewed by: Alexander Jones
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Cytoplasmic calcium ([Ca2+]cyt) acts as a stimulus-induced second messenger in multiple signal transduction cascades (Allen et al., 1999). In plant cells, a dramatic and readily assayed response to stimulus is the change of stomatal aperture. Changes in [Ca2+]cyt of stomatal guard cells were involved in stomatal movement in response to various stimuli and cellular processes. In general, there are two available ways to measure [Ca2+]cyt in guard cells, i.e., loading of calcium-sensitive fluorescence dyes such as fluo-3 AM and fura-2 or expressing genetically encoded calcium indicators such as yellow cameleon (Krebs et al., 2012). In this protocol, we aim at describing the experimental procedure to record [Ca2+]cyt fluctuation in guard cells with loading of fluo-3 AM upon ABA or PA treatment combining with fluorescence imaging performed with confocal laser scanning microscope.
Materials and Reagents
Plant materials: Arabidopsis thaliana ecotype Columbia-0 (wild type) was obtained from ABRC at Ohio State University (Columbus)
Glycine,N-[4-[6-[(acetyloxy)methoxy]-2,7-dichloro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxyethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxyethyl]-, (acetyloxy) methyl ester (Fluo-3, AM) (Life Technologies, InvitrogenTM, catalog number: F-14218 )
Potassium chloride (KCl) (Sangon Biotech, catalog number: PB0440 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sangon Biotech, catalog number: C0556 )
2-(N-morpholino) ethanesulfonic acid (MES) (free acid, monohydrate) (Sigma-Aldrich, catalog number: M3671 )
Potassium hydroxide (KOH) (Sangon Biotech, catalog number: PT1159 )
Egtazic acid, Glycol ether diamine tetraacetic acid (EGTA) (Sangon Biotech, catalog number: ED007 )
Chloroform (Sinopharm Chemical Reagent, catalog number: 10006818 )
Sodium hypochlorite solution (Sangon Biotech, catalog number: S1944 )
Agar (Sangon Biotech, catalog number: AJ637 )
Murashige & Skoog (MS) Basal Medium w/Vitamins (PhytoTechnology Laboratories®, catalog number: M519 )
Abscisic acid (ABA) (Sigma-Aldrich, catalog number: A1049 )
Phosphatidic acid (PA) (Avanti Polar Lipid, catalog number: 840858C )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
Ethanol anhydrous (Sangon Biotech, catalog number: ET0737 )
Tris (hydroxymethyl) aminomethane (Tris) (Sigma-Aldrich, catalog number: 252859 )
Epidermal buffer (see Recipes)
Fluo-3 AM stock solution (see Recipes)
Loading buffer (see Recipes)
ABA stock solution (see Recipes)
ABA working solution (see Recipes)
PA working solution (see Recipes)
Equipment
Graduated centrifuge tubes (1.5 ml)
Petri dish (6 cm diameter)
Cover glass (20 mm * 20 mm, 0.13-0.17 μm thickness)
Slides (76 mm * 26 mm, 1-2 mm thickness)
Forceps
Pipettor and matched tips
Growth chamber (Percival, model: I-41LL )
Zeiss LSM780 confocal laser scanning microscope
Microprocessor pH meter (HANNA® Instruments, model: HI-2211 )
Ultrasonic cell crusher (Scientz, model: JY92Ⅱ )
Software
Zeiss confocal software ZEN 2012 (blue edition)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, L., Lin, F., Qu, Y. and Zhang, Q. (2015). A Protocol to Measure the Cytoplasmic Calcium in Arabidopsis Guard Cells. Bio-protocol 5(9): e1462. DOI: 10.21769/BioProtoc.1462.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
What's the difference between loading buffer and FLuo-3 loading buffer?
0 Answer
6 Views
Apr 12, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,463 | https://bio-protocol.org/exchange/protocoldetail?id=1463&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Arabidopsis Metabolome Analysis Using Infusion ESI FT-ICR/MS
Reiko Motohashi
MS Masakazu Satou
Fumiyoshi Myouga
Akira Oikawa
DO Daisaku Ohta
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1463 Views: 8061
Edited by: Arsalan Daudi
Reviewed by: Sekhar Kambakam
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
We made the method for Arabidopsis metabolome analysis based on direct-infusion Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR/MS) (IonSpec). This method was sufficiently applied to metabolic phenotyping of Arabidopsis. This method is simple in that after homogenizing samples, powdered samples are dissolved in extraction solvents (acetone and methanol) to 20% fresh weight/volume. Extracted sample solutions are dried and dissolved in 50% (v/v) acetonitrile. Mass analysis using FT-ICR/MS (IonSpec) is performed in positive and negative ionization operation modes. Mass spectra are acquired over the 100-1,000 m/z range and accumulated to improve the S/N ratio.
Keywords: Metabolome Arabidopsis Albino ESI FT-ICR/MS
Materials and Reagents
3-week-old Arabidopsis plants
Liquid nitrogen
Acetone (HPLC grade) (Wako Chemicals USA, catalog number: 014-08681 )
Methanol (HPLC grade) (Wako Chemicals USA, catalog number: 134-14523 )
Nitrogen gas
EN1-16 (TAITEC, catalog number: 0076417-000 )
Formic acid (HPLC grade) (Wako Chemicals USA, catalog number: 063-04192 )
Lidocaine (anaesthetic) m/z 235.18104 (Wako Chemicals USA, catalog number: 120-02691 )
Prochloraz (agricultural chemical) m/z 376.03863 (Wako Chemicals USA, catalog number: 164-25131 )
Reserpine (alkaloid sedative drug) m/z 609.28121 (Wako Chemicals USA, catalog number: 184-00691 )
Bombesin (peptide) m/z 810.41479 (Wako Chemicals USA, catalog number: 339-40861 )
28~30% ammonia solution (Wako Chemicals USA, catalog number: 016-03146 )
Negative mode internal standards: 2.4-D (plant hormone) m/z 218.96157 (Wako Chemicals USA, catalog number: 040-18532 )
Ampicillin (antibiotic) m/z 348.10180 (Wako Chemicals USA, catalog number: 017-20531 , CHAPS 8 detergent) m/z 613.388865 (Wako Chemicals USA, catalog number: 341-04721 )
Tetra-N-acetylchitotetraose [(GluNAc)4] m/z 829.32023 (Tokyo Chemical Industry, catalog number: T2910 )
50% (v/v) acetonitrile (HPLC grade) (Wako Chemicals USA, catalog number: 018-19853 ) [use distilled water to dilute acetonitrile to 50%(v/v)]
Acetic acid (Wako Chemicals USA, catalog number: 014-20063 )
28~30% ammonia solution (Wako Chemicals USA, catalog number: 016-03146 )
Ultrapure water (recommended but not required)
Equipment
An IonSpec Explorer FT-ICR/MS equipped with a 7-tesla actively shielded superconducting magnet (Agilent, Ionspec)
Glass vial and teflon cap (GL Biochem, catalog number: 1030-46716 )
Glass pipette
0.45 µm filters (PTFE) (ADVANTEC®, catalog number: 13HP045AN )
Heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Motohashi, R., Satou, M., Myouga, F., Oikawa, A. and Ohta, D. (2015). Arabidopsis Metabolome Analysis Using Infusion ESI FT-ICR/MS. Bio-protocol 5(9): e1463. DOI: 10.21769/BioProtoc.1463.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant metabolism > Metabolite profiling
Systems Biology > Metabolomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,464 | https://bio-protocol.org/exchange/protocoldetail?id=1464&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chlorophyll Fluorescence Measurements in Arabidopsis Plants Using a Pulse-amplitude-modulated (PAM) Fluorometer
Reiko Motohashi
Fumiyoshi Myouga
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1464 Views: 18920
Edited by: Arsalan Daudi
Reviewed by: Sekhar Kambakam
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
In this protocol, to analyze PSII activity in photosynthesis, we measure the Fv/Fm (Fv=Fm ± Fo) value (Fo and Fm are the minimum and maximum values of chlorophyll fluorescence of dark-adapted leaves, respectively). Fv/Fm is a reliable marker of photo- inhibition (Krause et al., 1988). Chlorophyll fluorescence in leaves was measured at room temperature using a photosynthesis yield analyzer (MINI- PAM, Walz, Effeltrich, Germany) and a pulse-amplitude-modulated (PAM) fluorometer (TEACHING-PAM, Walz, Effeltrich, Germany).
Keywords: PAM Chlorophyll Fluorescence Arabidopsis
Materials and Reagents
Arabidopsis plants
Note: We plated Nossen ecotype seeds that had been surface-sterilized on germination medium (GM) agar plates (Motohashi et al., 2003) containing 1% sucrose, with the appropriate selection agent (antibiotic or herbicide) per specific genotype. Plants were kept at 4 °C for 3 days to improve germination rates and then grown in lighted growth chambers (CF-405, TOMY-Seiko, Tokyo, Japan) with approximately 75 μmol photon/m2/s at 22 °C under a 16 h-light /8-h dark cycle (long-day conditions) for 3 weeks.
Equipment
Photosynthesis yield analyzer (Walz, MINI- PAM) (the equipment used in this protocol) (Figure 1)
Compact design and easy operation are the most outstanding features of the MINI-PAM. This device is in particular well-suited for determination of quantum yield and photosynthetic electron transport rate (ETR). A flexible 5.5 mm glass fiberoptic was attached in the system and it can provide considerable high actinic intensities of white light. An optional 2 mm plastic fiberoptic (MINI-PAM/F1) is also used by excellent signal quality and can be attached to the cover of an optional gas-exchange system for measuring both CO2 and H2O exchange as well as fluorescence. For an exact measuring quantum flux density and temperature at precisely the fluorescence measuring spot, a useful leaf-clip holder is available as an accessory (Arabidopsis Leaf-Clip Holder, model: 2060-B). This leaf clip holder is especially developed for small leaves like an Arabidopsis leaf. With the help of the leaf clip holder, the photosynthetic active radiation (PAR) can be measured and an apparent electron transport rate (ETR) is calculated.
A simple explanation of the equipment used can be found at the following URL: http://www.walz.com/downloads/manuals/mini-pam-II/MINI-PAM-II_Broschure.pdf. It should be noted that the current equipment being sold is the MINI-PAM II.
Figure 1. Photosynthesis yield analyzer
Pulse-amplitude-modulated (PAM) fluorometer (TEACHING-PAM) (Walz) (alternative equipment which can be used to measure chlorophyll fluorescence)
Note: It is noted here that the MINI- PAM and TEACHING-PAM were developed for beginners; advanced researchers may utilize the larger PAM-2000 fluorometer (essentially the same instrument) to yield additional and more detailed results.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Motohashi, R. and Myouga, F. (2015). Chlorophyll Fluorescence Measurements in Arabidopsis Plants Using a Pulse-amplitude-modulated (PAM) Fluorometer. Bio-protocol 5(9): e1464. DOI: 10.21769/BioProtoc.1464.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Chlorophyll
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,465 | https://bio-protocol.org/exchange/protocoldetail?id=1465&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of HIV RNA and Human Herpesvirus DNA in Seminal Plasma
Milenka V. Vargas-Meneses
Marta Massanella
CI Caroline C. Ignacio
Sara Gianella
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1465 Views: 9626
Reviewed by: David PaulValeria Lulla
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Multiple viruses can co-infect the genital tract, modifying the immunologic and virologic milieu and possibly playing a role in viral transmission and pathogenesis. The aim of our studies has been to understand the complex relationships between HIV-1 RNA, and multiple human herpesviruses known to frequently replicate in the genital tract of HIV-infected men (i.e. cytomegalovirus [CMV], Epstein Bar virus [EBV], herpes simplex virus [HSV] types 1 and 2, and human herpesviruses [HHV] 6, 7 and 8) (Gianella et al., 2013a; Gianella et al., 2013b; Gianella et al., 2013c; Gianella et al., 2014). This protocol was designed to collect and process male genital secretion (GS), and to isolate and further quantify HIV RNA and DNA of seven HHV from seminal plasma using quantitative real time PCR technology.
Keywords: Seminal Plasma Taqman HIV HHV Cytomegalovirus
Materials and Reagents
For male genital secretion (GS) processing
Gibco® Hank’s balanced salt solution (HBSS) (no calcium, no magnesium, no phenol red) (Life Technologies, catalog number: 14175-095 )
Gibco® RPMI 1640 medium (Life Technologies, catalog number: 11875-093 )
GemCellTM U.S. origin fetal bovine serum (FBS) (Gemini-Bio Products, catalog number: 100-500 )
Gibco® penicillin-streptomycin (10,000 U/ml) (Life Technologies, catalog number: 15140-122 )
Gibco® L-Glutamine (200 mM) (Life Technologies, catalog number: 25030-024 )
Nystatin suspension (10,000 units/ml in DPBS) (Sigma-Aldrich, catalog number: N1638 )
Dimethyl sulfoxide (Hibri-MaxTM, sterile-filtered) (Sigma-Aldrich, catalog number: D2650 )
Waxie® bleach (Waxie Sanitary Supply, catalog number: 170016 )
Viral transport medium (VTM) (see Recipes)
20% GS complete RPMI medium (see Recipes)
20% GS freeze medium (see Recipes)
For RNA and DNA extraction and cDNA generation
QIAamp DNA mini kit (250 or 50 QIAamp mini spin columns) (QIAGEN, catalog numbers: 51306 or 51304 )
High pure viral RNA kit (Roche Diagnostics, catalog number: 11858882001 )
InvitrogenTM SuperScript® III first-strand synthesis system (Life Technologies, catalog number: 18080-051 )
Seal-Rite 1.5 ml microcentrifuge (flip-top) tube (natural) (USA Scientific, catalog number: 1615-5500 )
Note: These tubes are autoclaved before use.
Micro tubes 1.5 ml (type D, without skirted base and with assembled neutral screw cap) (SARSTEDT AG, catalog number: 72.692.005 )
Applied Biosystems® MicroAmp® reaction tube with cap (0.2 ml) (Life Technologies, catalog number: N8010540 )
1x Dulbecco’s phosphate buffered saline (DPBS) (Corning, CellgroTM, catalog number: 21-031-CV )
EDTA (0.5 M pH 8.0, molecular biology grade) (Promega Corporation, catalog number: V4231 )
Molecular biology grade sterile purified water (RNase, DNase, proteinase free) (Corning, CellgroTM, catalog number: 46-000-CM )
Tris hydrochloride (1 M solution pH 8.0, molecular biology grade) (Thermo Fisher Scientific, catalog number: BP1758-500 )
Note: 1 M Tris requires to be diluted to 10 mM with molecular grade water.
Ethyl alcohol pure (200 proof molecular biology grade) (Sigma-Aldrich, catalog number: E7023 )
MgCl2 (50 mM solution) (Bio-Rad Laboratories, catalog number: 170-8872 )
For quantitative Real Time PCR (RT-qPCR)
DNA plasmids or amplicons to be used as standards for RT-qPCR
Note: Quantification standards for the different herpes viruses were obtained using DNA plasmid preparations with known concentrations. We provided the nucleotide sequences for each standard amplicon (in a separate fasta file from 5’ to 3’) (please see Supplementary Material). Oligonucleotides can be custom synthetized (e.g. Ultramer® Oligonucleotides, Integrated DNA technologies [IDT]) and used directly as quantification standard, after measuring the amount of PCR-component template by spectrophotometry or droplet digital PCR.
If desired, amplicons can also be inserted into a plasmid using standard kits (e.g. Zero Blunt® TOPO® PCR Cloning Kit, catalog number: K2800J10) and stocks of construct can be generated with large batch cultures (using standard protocols). After purification, quantify plasmid concentration by spectrophotometry (or ddPCR) and extract clone vectors using standard procedures. Consider linearization to increase efficiency and avoid supercoil formation.
HIV RNA standard can be obtained from the DAIDS Virology Quality Assurance (VQA) Program (https://www.aidsreagent.org/, 150,000 copies HIV-1 RNA/ml spiked into negative plasma, catalog number: 3443 )
Molecular biology grade sterile purified water (Corning, CellgroTM, catalog number: 46-000-CM)
Primers and probes (Table 1)
Equipment
For male genital secretion (GS) processing
Fisherbrand™ polyethylene hinged-lid containers (Thermo Fisher Scientific, catalog number: 03-405-40 )
Curwood Parafilm MTM laboratory wrapping film (4-inch W X 125-ft L) (Thermo Fisher Scientific, catalog number: 13-374-10 )
Fisherbrand™ Infecon™ specimen transport bags (Thermo Fisher Scientific, catalog number: 19-287-215 )
Corning® 15 ml centrifuge tube (sterile) (Corning, catalog number: 430052 )
FisherbrandTM sterile polystyrene disposable serological pipets with magnifier stripe for 1 ml, 2 ml, 5 ml, 10 ml (Thermo Fisher Scientific, catalog numbers: 13-676-10G , 13-675-3C , 13-676-10H , 13-676-10J )
VWR® disposable aspirating pipets (polystyrene, sterile) (VWR International, catalog number: 414004-264 )
Micro tubes (2.0 ml, Type I, with skirted base and assembled neutral screw cap) (SARSTEDT AG, catalog number: 72.694.006 )
2.0 ml Ext FS CryoElite sterile cryogenic vials (yellow-cap) (Wheaton Science Products, catalog number: W985866 )
Nalgene® Mr. FrostyTM freezing container (Thermo Fisher Scientific, catalog number: 5100-0001 )
Allied® 1,500 ml disposable collection canisters (Allied Healthcare Products, catalog number: 20-08-0003 )
SorvallTM RC4 General Purpose Floor Model Centrifuge (Thermo Fisher Scientific, catalog number: 75004481 )
Original Pipetman Aid® Pipet Controller (Drummond Scientific Company, catalog number: 4-000-111-TC )
Stericup-HV, 0.45 µm, PVDF (500 ml) (EMDMILLIPORE, catalog number: SCHVU05RE )
Stericup-GV, 0.22 µm, PVDF (500 ml) (EMDMILLIPORE, catalog number: SCGVU05RE )
For RNA and DNA extraction and cDNA generation
Fisher® vortex genie 2, analog vortex mixer (Thermo Fisher Scientific, catalog number: 02-215-365 )
VWR® digital dry block heaters (or 2 heat blocks) (VWR Scientific Products, catalog number: 12621-088 )
Allegra® 64R high performance Benchtop centrifuge (Beckman Coulter, item number: 367585 )
Eppendorf® centrifuge (model: 5430 , 120 V, with Rotor, model: FA-45-30-11) (Eppendorf, 120V no longer available only 230V catalog number: 5427 000.216)
Applied Biosystems® GeneAmp® PCR system 9700 (96-well gold-plated) (Life Technologies, catalog number: 4314878 )
For quantitative Real Time PCR (RT-qPCR)
Applied Biosystems® MicroAmp® Optical 96-Well reaction plate (Life Technologies, catalog number: N8010560 )
Applied Biosystems® MicroAmp® optical adhesive film (Life Technologies, catalog number: 4311971 )
Applied Biosystems® MicroAmp® 96-Well Tray/Retainer Set (Life Technologies, catalog number: 403081 )
Corning® 50 ml centrifuge tube (sterile) (Corning, catalog number: 430290 )
Applied Biosystems® TaqMan® environmental master mix 2.0 (200 reactions) (Life Technologies, catalog number: 4396838 )
Applied Biosystems® 7900HT fast Real-Time PCR system with Fast 96-Well block module (Life Technologies, catalog number: 4351405 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > RNA
Microbiology > Microbial genetics > DNA
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,466 | https://bio-protocol.org/exchange/protocoldetail?id=1466&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MIFE Technique-based Screening for Mesophyll K+ Retention for Crop Breeding for Salinity Tolerance
Honghong Wu
LS Lana Shabala
MZ Meixue Zhou
Sergey Shabala
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1466 Views: 9449
Edited by: Tie Liu
Reviewed by: Rumen Ivanov
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Potassium is known as a rate-limiting factor for crop yield and plays an important role in plants response under abiotic stresses. Recently, cytosolic K+ retention ability in leaf mesophyll has emerged as an important component of plant salt tolerance mechanism (Wu et al., 2013; Wu et al., 2014; Wu et al., 2015). In this protocol, the procedure for screening leaf mesophyll for K+ retention by the MIFE (microelectrode ion flux estimation) technique is described in detail using wheat as an example. By measuring NaCl-induced K+ efflux in leaf mesophyll, a large number of plant accessions can be screened and categorised according to their salinity stress tolerance. The method provides a rapid and reliable tool that targets the activity of specific membrane transporters directly contributing to salinity tolerance trait and, because of this, has a competitive advantage over traditional whole-plant phenotyping. While the focus of this protocol is on wheat, the suggested method may be adopted for screening K+ retention in leaf mesophyll in any other crop species.
Keywords: K+ retention Ion flux Salinity stress Mesophyll cells Breeding
Materials and Reagents
Two to three week old wheat seedlings
NaCl (Sigma-Aldrich, catalog number: 746398 )
KCl (Sigma-Aldrich, catalog number: 746436 )
CaCl2 (Sigma-Aldrich, catalog number: C5670 )
K+ LIX (liquid ion exchanger) (Sigma-Aldrich, catalog number: 60031 )
Tributylchlorosilane (Sigma-Aldrich, catalog number: 282707 )
ddH2O
95% ethanol (VWR International, catalog number CHESEA042-20L-P )
Commercial bleach (contains 42 g/L NaClO)
Agar (Oxoid, catalog number: LP0011 )
Parafilm
Basic salt medium (BSM) solution (mM) (see Recipes)
Backfilling solution for K+ ion selective microelectrode (see Recipes)
Filling solution for a reference electrode (see Recipes)
K+ calibration solutions (μM) (see Recipes)
Potting mix (see Recipes)
Equipment
The MIFE (microelectrode ion flux estimation) system (designed, manufactured and distributed by the University of Tasmania)
(http://www.phys.utas.edu.au/physics/biophys/mifecom/MIFEHome/Home.html)
Glasshouse
Vertical electrode puller (Narishige, model: PP-830 )
Electrode filling station (contains a three-dimensional micromanipulator and a microscope)
Laboratory fume cupboard (model: 1800)
Inverted tissue culture microscope (Radical Instruments, model: RTC-6 )
Microscope (Nikon, model: 100100 ) used in the electrode filling station
Micromanipulator (Narishige, model: MMT-5 ) used in the electrode filling station
Oven (Euromiad compact cooker, model: MC 110 T )
Distiller (Labglass, model: 03DD )
pH meter (Thermo Fisher Scientific, model: Orion 420 A +)
Burner
Magnetic stirrer (ISG® Hotplate and Magnetic stirrer, model: 153-005 ) and stirring bars
Borosilicate glass capillaries (GC 150-10) (1.5 O.D. x 0.86 I.D. x 100 L mm) (Harvard Apparatus, catalog number: 30-0053 )
Borosilicate glass capillaries (GC 100-10) (1.0 O.D. x 0.56 I.D. x 100 L mm) (Harvard Apparatus, catalog number: 30-0016 )
Petri dishes (85 mm and 35 mm diameters)
Perspex holder for immobilization of the leaf samples
Metal electrode rack for electrode silanization
Plastic electrode holder for storing silanized electrode blanks
Standard surgical blades (Kiato stainless steel, model: BS 2982:1992, ISO 7740 )
Syringe (Terumo, catalog number: SS-10L )
Plastic needle (20 μl) (Eppendorf, catalog number: 5424 956.003 )
Plastic-coated weights
Silver wire (A-M Systems, catalog number: 787000 )
4.5 L PVC (polyvinyl chloride) pots
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wu, H., Shabala, L., Zhou, M. and Shabala, S. (2015). MIFE Technique-based Screening for Mesophyll K+ Retention for Crop Breeding for Salinity Tolerance. Bio-protocol 5(9): e1466. DOI: 10.21769/BioProtoc.1466.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,467 | https://bio-protocol.org/exchange/protocoldetail?id=1467&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Chlorophyll a and Carotenoids Concentration in Cyanobacteria
Tomáš Zavřel
Maria A. Sinetova
Jan Červený
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1467 Views: 34596
Edited by: Fanglian He
Reviewed by: Seda Ekici
Original Research Article:
The authors used this protocol in Nov 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2012
Abstract
This is a protocol for precise measurement of chlorophyll a and total carotenoid concentrations in cyanobacteria cells. Cellular chlorophyll concentration is one of the central physiological parameters, routinely followed in many research areas ranging from stress physiology to biotechnology. Carotenoids concentration is often related to cellular stress level; combined pigments assessment provides useful insight into cellular physiological state. The current protocol was established to minimize time and equipment requirements for the routine pigments analysis. It is important to note that this protocol is suitable only for cyanobacteria containing chlorophyll a, and is not designed for species containing other chlorophyll molecules.
Keywords: Pigments Photosynthesis Methanol extraction Spectrophotometry
Materials and Reagents
Cyanobacteria culture (Note 1)
Methanol ≥99.9% (GC) (Sigma-Aldrich)
Equipment
Eppendorf safe-lock tubes (1.5 ml)
Centrifuge with relative centrifugal force (RCF) of 15,000 x g and cooling option to +4 °C (Sigma-Aldrich, model: 1-16 K )
Pipette 100 µl -1,000 µl + pipette tips (RAININ, Mettler-Toledo)
Fridge (+4 °C)
Spectrophotometer with slit width 1 nm (Shimadzu, model: UV-2600 )
Spectrophotometric plastic or glass VIS/UV-VIS semi-micro 0.75-1.5 ml cuvettes
Mixing device (Silamat S6, Ivoclar Vivadent) or vortex (IKA MS3 digital, IKA®)
Aluminum foil
Holder for Eppendorf tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zavřel, T., Sinetova, M. A. and Červený, J. (2015). Measurement of Chlorophyll a and Carotenoids Concentration in Cyanobacteria. Bio-protocol 5(9): e1467. DOI: 10.21769/BioProtoc.1467.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Chlorophyll
Biochemistry > Other compound > Carotenoid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
After step 7 and before step 9, do I need to re-homogenize the sample and mix the pellet before observing in the spectrophotometer?
1 Answer
16 Views
May 18, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,468 | https://bio-protocol.org/exchange/protocoldetail?id=1468&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity
DC Daniel F. Caddell
TW Tong Wei
CP Chang-Jin Park
PR Pamela C. Ronald
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1468 Views: 12598
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Feb 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2012
Abstract
Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research.
Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.
Keywords: Dexamethasone Xa21-mediated immunity Xanthomonas oryzae pv. oryzae Glucocorticoid receptor
Materials and Reagents
Wild-type rice seeds (Oryza sativa ssp. japonica cv. Kitaake)
Transgenic rice seeds containing pTA7002::Myc::Xa21 (Park et al., 2012)
Transgenic rice seeds containing Ubi::Myc::Xa21 (Park et al., 2010)
Xanthomonas oryzae pv. oryzae (Xoo; Philippines race 6, strain PXO99Az)
Dexamethasone (Sigma-Aldrich, catalog number: D1756 )
Dimethyl sulfoxide (DMSO) (Thermo Fisher Scientific, catalog number: D128-1 )
Tween-20 (Bio-Rad Laboratories, catalog number: 170-6531 )
Sterile H2O (Milli-Q)
TRIzol (Life Technologies, InvitrogenTM, catalog number: 15596-026 )
M-MLV reverse transcriptase (Life Technologies, InvitrogenTM, catalog number: 28025-013 )
SsoFastEvaGreenSupermix (Bio-Rad Laboratories, catalog number: 172-5203 )
Peptone sucrose agar (PSA) solid media containing 20 µg/ml cephalexin (MP Biomedicals, catalog number: 02150585 ) (see Recipes)
Dexamethasone (see Recipes)
Greenhouse rice growing conditions (see Recipes)
Walk-in growth chamber rice growing conditions (see Recipes)
Equipment
Spray bottle (550 ml) (any supplier) for dexamethasone foliar spray
1.5 ml Eppendorf tube (any supplier)
Surgical scissors (sharp/sharp, straight, 5 ½ inch or similar) for Xoo clipping inoculation
5 ½ inch square disposable pots
Supertub (24 inch x 36 inch x 8 inch) (Mac Court Products, model: ST3608 or similar)
Scale suitable for measurements down to 0.0001 g (any manufacturer)
Spectrophotometer suitable for taking optical density measurements at 600 nm (any manufacturer)
Growth chamber (14 h light and 10 h dark photoperiod with 28 °C temperature) (any manufacturer) for rice seed germination
Incubation chamber (28 °C) (any manufacturer) for Xoo preparation
Greenhouse capable of temperature and humidity control for growing rice plants
Walk-in growth chamber (conviron or equivalent) for Xoo inoculation and dexamethasone treatment
qPCR machine (Bio-Rad Laboratories, model: CFX96 Real-Time PCR )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Caddell, D. F., Wei, T., Park, C. and Ronald, P. C. (2015). The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity. Bio-protocol 5(9): e1468. DOI: 10.21769/BioProtoc.1468.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,469 | https://bio-protocol.org/exchange/protocoldetail?id=1469&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ELISA Detection of Endogenous Serum Albumin in the Mouse Brain: A Measure of Extravasation Following Brain Injury
Shotaro Michinaga
Yutaka Koyama
Published: Vol 5, Iss 9, May 5, 2015
DOI: 10.21769/BioProtoc.1469 Views: 10354
Reviewed by: Kae-Jiun Chang
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
After stroke and brain contusion, serum proteins extravasate into nerve tissue through disrupted blood-brain barrier (BBB). Because extravasations of serum proteins result in vasogenic brain edema, serum albumin level in the brain is an indicator of BBB disruption and brain edema after brain insults. In this protocol, extravasation of endogenous albumin is measured in the damaged mouse brain, which would be valuable in the evaluation of vasogenic brain edema formation (Michinaga et al., 2014).
Keywords: Blood-brain barrier Brain edema Endothelial permeability Brain microvessel
Materials and Reagents
Mouse Albumin ELISA Quantitation Set (Bethyl Laboratories, catalog number: E90-134 )
Note: This set includes an anti-mouse albumin goat antibody for plate coating, a mouse reference serum and a HRP-conjugated anti-mouse albumin goat antibody.
Mouse serum albumin (Sigma-Aldrich, catalog number: A3139 )
SureBlueTM TMB microwell peroxidase substrate (Kirkegaard & Perry Laboratories, catalog number: 52-00-01 )
450 nm BioFX® liquid Nova-Stop solution for TMB microwell substrates (SurModics, catalog number: LSTP-0100-01 )
BCA protein assay reagent A (Thermo Fisher Scientific, catalog number: 23221 )
BCA protein assay reagent B (Thermo Fisher Scientific, catalog number: 23224 )
Bovine serum albumin (BSA) set (Thermo Fisher Scientific, catalog number: 23208)
Pentobarbital sodium salt (Nacalai Tesque, catalog number: 26427-14 )
PBS (Santa Cruz Biotechnology, catalog number: sc-24946 )
Triton X-100 (Nacalai Tesque, catalog number: 35501-15 )
Tris (hydroxymethyl) aminomethane (Nacalai Tesque, catalog number: 35409-45 )
HCl (Nacalai Tesque, catalog number: 18321-05 )
NaCl (Nacalai Tesque, catalog number: 31320-05 )
NP-40 (Nacalai Tesque, catalog number: 23640-94 )
Deoxycholic acid (Wako Chemicals USA, catalog number: 044-18812 )
SDS (Nacalai Tesque, catalog number: 31607-65 )
EDTA (Nacalai Tesque, catalog number: 15114-15 )
Phenylmethylsulfonyl fluoride (Enzo Life Science, catalog number: ALX-270-184-G025 )
Aprotinin (Sigma-Aldrich, catalog number: A6103 )
PBS (see Recipes)
PBST (see Recipes)
Lysis buffer (see Recipes)
Equipment
Scissors (Fine Science Tools, catalog number: 14002-14 )
Forceps (Fine Science Tools, catalog number: 11271-30 )
Hemostats (Fine Science Tools, catalog number: 13002-10 )
Winged needle (Terumo, catalog number: SV-27DL )
Syringe (Terumo, catalog number: SS-30ESZ )
Razor (FEATHER Safety Razor, catalog number: FH-10 )
Acrylic brain slicer (Muromachi Kikai, catalog number: MK-MC-01 )
1.5 ml sampling tubes (Bio-Bik, catalog number: RC-0170 )
15 ml conical tube (BD Biosciences, Falcon®, catalog number: REF 352196 )
96-well plate (Thermo Fisher Scientific, catalog number: 167008 )
Pipette tips (2 to 200 µl) (Eppendorf, catalog number: 0030 073. 800 )
Stereotactic device (Narishige, model: SR-6N )
ELISA plate set (Sumitomo Bakelite, catalog number: BS-X7310 )
Note: This set includes ELISA plates, plate seals, an antibody-immobilizing solution and a soaking solution.
Micropipettes (2 to 20 µl and 20 to 200 µl, Eppendorf)
Microplate reader (Bio-Rad Laboratories, model: 680 )
Digital Sonifier® (Branson, model: 250D )
Centrifuge (Hitachi, model: CF15RXII )
Microplate mixer (AS ONE Corporation, model: NS-4P )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Michinaga, S. and Koyama, Y. (2015). ELISA Detection of Endogenous Serum Albumin in the Mouse Brain: A Measure of Extravasation Following Brain Injury. Bio-protocol 5(9): e1469. DOI: 10.21769/BioProtoc.1469.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Blood brain barrier
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
147 | https://bio-protocol.org/exchange/protocoldetail?id=147&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Restriction Enzyme Accessibility Protocol in Mammalian Cells
HI Hogune Im
Published: Oct 20, 2011
DOI: 10.21769/BioProtoc.147 Views: 11920
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes a method to indirectly assess chromatin structure by using restriction enzyme in mammalian cells, modified from Current Protocols.
Materials and Reagents
Tris
NaCl
MgCl2
DTT
EDTA
SDS
Chloroform
PBS
NP-40
70% EtOH
NaAc
Phenol/chloroform
Digest buffer (NEB)
Restriction enzyme (NEB)
TE (Tris 10 mM, EDTA 1 mM) buffer
Proteinase K (Promega corporation, catalog number: V3021 )
NP-40 (United States biological corporation, catalog number: N3500 )
Lysis buffer (see Recipes)
Wash buffer (see Recipes)
Stop solution (see Recipes)
Equipment
Type B dounce homogenizer
Centrifugation
Falcon 2059 tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA-protein interaction
Cell Biology > Cell structure > Chromosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,470 | https://bio-protocol.org/exchange/protocoldetail?id=1470&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Histochemical Detection of Zn in Plant Tissues
Ilya Seregin*
Anna Kozhevnikova*
Henk Schat
*Contributed equally to this work
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1470 Views: 10272
Edited by: Maria Sinetova
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Accumulation of metals in plant tissues, and occasionally, different cells of the same tissue, may be highly non-uniform (Seregin and Kozhevnikova, 2008). Easy-to-use histochemical methods may greatly help to investigate the distribution and accumulation of metals within and among plant tissues, and also provide information on their subcellular localization (Seregin and Kozhevnikova, 2011). The histochemical techniques of zinc (Zn) visualization are based on the formation of the blue-colored complex of Zn with the metallochrome indicator Zincon (C20H15N4NaO6S), or the green-fluorescent complex with Zinpyr-1 (C46H36Cl2N6O5) (Seregin et al., 2011; Seregin and Kozhevnikova, 2011). A method for histochemical Zn detection in plant tissues using Zinpyr-1 was first proposed by Sinclair et al. (2007), and later modified by Seregin et al. (2011), and Seregin and Kozhevnikova (2011). Histochemical data supplement the results of quantitative analysis, thus allowing a detailed study of the distribution, accumulation, and translocation pathways of Zn within the plant, which are important topics in modern plant physiology. These histochemical techniques have been successfully applied in different plant species, for example Zea mays (Seregin et al., 2011), Noccaea caerulescens and Thlaspi arvense (Kozhevnikova et al., 2014a), Capsella bursa-pastoris and Lepidium ruderale (Kozhevnikova et al., 2014b), in which Zn was detected in different root and shoot tissues. Here, we present the full staining protocols for these methods, developed or modified in our lab (Seregin and Kozhevnikova, 2011; Kozhevnikova et al., 2014a; Kozhevnikova et al., 2014b).
Keywords: Zinc localization Zincon Zinpyr-1 Histochemical techniques Plant tissues
Materials and Reagents
Staining with Zinpyr-1 (see Recipes)
Zinpyr-1 or 4′, 5′-Bis[bis(2-pyridylmethyl)aminomethyl]-2′,7′-dichlorofluorescein (C46H36Cl2N6O5, Mr= 823.72) (Sigma-Aldrich, catalog number: 40667 or Millitech, catalog number: ZP1 )
Dimethyl sulfoxide or DMSO (C2H6OS)
Ethylenediaminetetraacetic acid (disodium salt) (Na2EDTA, C10H14O8N2Na2⋅2H2O, Mr = 372.24)
Super demineralized water
Staining with Zincon (see Recipes)
Zincon sodium salt (C20H15N4NaO6S, Mr = 462.4) (Sigma-Aldrich, catalog number: 201332 )
Borax (Na2B4O7⋅10 H2O)
Sodium hydroxide (NaOH)
Ethylenediaminetetraacetic acid, disodium salt (Na2EDTA, C10H14O8N2Na2⋅2H2O, Mr = 372.24)
Super demineralized water
Equipment
Light microscope with a color digital camera attachment (staining with Zincon); confocal microscope or fluorescence microscope with appropriate filters and digital camera attachment (staining with Zinpyr-1; see below for spectral characteristics of the dye)
Micro pipettes (100-1,000 µl) and pipette tips
Vortex
Precision balances
Razor blades
50 ml, 100 ml and 1 L flasks
2 ml microtubes
5 ml or 15 ml centrifuge tubes
Heat-resistant 20 ml flask
Microscope slides and cover glasses
Tweezers
Dissecting needles
Magnetic stirrer with heating
Axio Imager Z2 microscope (ZEISS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Seregin, I., Kozhevnikova, A. and Schat, H. (2015). Histochemical Detection of Zn in Plant Tissues. Bio-protocol 5(10): e1470. DOI: 10.21769/BioProtoc.1470.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Ion analysis
Cell Biology > Cell staining > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,471 | https://bio-protocol.org/exchange/protocoldetail?id=1471&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine Liver Myeloid Cell Isolation Protocol
Benoit Stijlemans
AS Amanda Sparkes
CA Chloé Abels
JK Jiri Keirsse
LB Lea Brys
YE Yvon Elkrim
PB Patrick De Baetselier
AB Alain Beschin*
JG Jo A Van Ginderachter*
*Contributed equally to this work
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1471 Views: 31227
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
In homeostasis, the liver is critical for the metabolism of nutrients including sugars, lipids, proteins and iron, for the clearance of toxins, and to induce immune tolerance to gut-derived antigens. These functions predispose the liver to infection by blood-borne pathogens, and to a variety of diseases ranging from toxin and medication-induced disorders (CCl4, acetaminophen) to metabolic disorders (steatohepatitis, alcoholic liver disease, biliary obstruction, cholestasis) or autoimmunity. Chronic liver injury often progresses to life threatening fibrosis and can end in liver cirrhosis and hepatocellular carcinoma (Pellicoro et al., 2014).
The liver contains parenchymal cells or hepatocytes that make up the majority of hepatic cells. It also contains non-parenchymal structural cells such as sinusoidal endothelial cells and a large number of non-parenchymal innate immune cells, mainly monocytes, neutrophils, macrophages, DCs, NK and NKT cells that can trigger an adaptive immune response in the case of infections or other pathogenic insults (Jenne and Kubes, 2013). How this immune response is regulated determines the extent of acute and chronic liver injury (Stijlemans et al., 2014). In this context, liver macrophages have been demonstrated to play central but divergent (from initiating to resolving) functions in liver injury (Sica et al., 2014). It has become clear in the last years that hepatic macrophages consist of two classes, tissue-resident macrophages, the Kupffer cells (KCs) originating from yolk sac/fetal liver progenitors and tissue-infiltrating macrophages originating from bone marrow-derived Ly6CHi monocytes (Jinhoux and Jung, 2014; Tacke and Zimmerman, 2014). Distinguishing the activities of KCs from those of monocyte-derived macrophages during liver injury or repair is currently a frontline research topic in the macrophage field. Indeed, considering that clinical management of liver failure remains problematic, a better understanding of the immune mechanisms regulating liver injury is expected to allow the development of new therapeutic modalities. Here, we describe an isolation technique for liver non-parenchymal polymorphonuclear (PMN) and mononuclear myeloid cells permitting their molecular and functional characterization.
Keywords: Myeloid Cell Kupffer Cell (KC) Monocyte-derived macrophages Polymorphonuclear (PMN) myeloid cell Liver injury
Materials and Reagents
7-8 weeks old female C57Black/6 mice (Janvier Labs)
RPMI-1640 medium (RPMI) (Life Technologies, catalog number: 52400-041 )
Collagenase Type III (Worthington Biochemical, catalog number: LS004180 )
DNase I (Roche Diagnostics, catalog number: 04536282001 )
Heparin (sodium salt from porcine intestinal mucosa) (Sigma-Aldrich, catalog number H3393-1MU )
Hank’s buffered salt solution (HBSS) without calcium or magnesium or phenol red (Life Technologies, Gibco®, catalog number: 14175-053 )
NH4Cl (Merck KGaA, catalog number: 01145.0500 )
KHCO3 (Merck KGaA, catalog number: 04854.0500 )
EDTA (Duchefa Biochemie, catalog number: E0511.1000 )
HCl (37% stock solution) (Merck KGaA, catalog number: 1.00317.1000 )
Fetal bovine serum (FBS) (BiowhittakerTM/Lonza, catalog number: DE14-801F )
LymphoprepTM (Axis-shield, catalog number: 1114547 )
PercollTM (GE Healthcare, catalog number: 17-0891-01 )
Purified CD16/CD32 (Fc-Block) (clone 2.4G2) (BD Biosciences, catalog number: 553142 )
PE-Cy7-conjugated anti-CD11b antibody (clone M1/70) (BD Biosciences, catalog number: 552850 )
AF647-conjugated anti-Ly6C antibody (clone ER-MP20) (Serotec, catalog number: MCA2389A647 )
PerCP-Cy5.5-conjugated anti-I-A/I-E (MHC-II) antibody (clone M5/114.15.2) (Biolegend, catalog number: 107626 )
FITC-conjugated anti-Ly6G antibody (clone 1A8) (BD Biosciences, catalog number: 551460 )
APC-Cy7-conjugated CD45 antibody (clone 30-F11) (BD Biosciences, catalog number: 103116 )
PE-conjugated F4/80 antibody (clone CI: A3-1) (AbD Serotec, catalog number: MCA497PET )
Trypan blue (BDH Chemicals, catalog number: 34078 )
NaCl (Thermo Fisher Scientific, catalog number: 10428420 )
KH2PO4 (Merck KGaA, catalog number: 1.04873.1000 )
Na2HPO4.2H2O (Merck KGaA, catalog number: 1.06580.1000 )
L-glutamine (Sigma-Aldrich, catalog number: G8540-100G )
Penicillin (Life Technologies, Gibco®, catalog number: 15140-122 )
Streptomycin (Life Technologies, Gibco®, catalog number: 15140-122)
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360-039 )
Non-essential amino acids (Life Technologies, Gibco®, catalog number: 11140-035 )
Liver digestion medium (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
33% Percoll working solution (see Recipes)
Erythrocyte lysis buffer (see Recipes)
MACS buffer (see Recipes)
Cell suspension medium (see Recipes)
Blocking medium (see Recipes)
Complete medium (see Recipes)
Trypan blue working solution (see Recipes)
Equipment
Polyester filters cut in 10 x 10 cm squares, thread diameter 70 μm (Spectrumlabs, catalog number: 146490 )
10 ml syringes (Omnifix, catalog number: 473203 )
BD Falcon 50 ml polypropylene tubes (BD Biosciences, catalog number: 2070 )
BD Falcon 15 ml polypropylene tubes (BD Biosciences, catalog number: 2096 )
BD Falcon 5 ml polypropylene round-bottom tube (BD Biosciences, catalog number: 352063 )
Needles (Microlance 22G1 ½, 0.7 * 40 mm) (BD Biosciences, ref: 301000 )
Sterile culture hood
Surgical scissors and forceps
37°C, 5% CO2 cell culture incubator (Forma Scientific)
Pipettes
Centrifuges (Eppendorf, models: 5810R and 5417C )
Orbital shaker (Belgolabo, model: Julabo type SW-20C ) used at 200 rpm
Light microscope (Olympus, model: CK2 )
Multicolor flow cytometer (BD Biosciences, FACSCantoTM )
GentleMACSTM Dissociator (Miltenyi Biotec, catalog number: 130-093-235 )
GentleMACSTM C-tubes (Miltenyi Biotec, catalog number: 130-093-237 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stijlemans, B., Sparkes, A., Abels, C., Keirsse, J., Brys, L., Elkrim, Y., Baetselier, P. D., Beschin, A. and Ginderachter, J. A. V. (2015). Murine Liver Myeloid Cell Isolation Protocol . Bio-protocol 5(10): e1471. DOI: 10.21769/BioProtoc.1471.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Myeloid cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,472 | https://bio-protocol.org/exchange/protocoldetail?id=1472&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence-based CAPS Multiplex Genotyping on Capillary Electrophoresis Systems
Jelena Perovic*
Cristina Silvar*
Dragan Perovic
NS Nils Stein
Frank Ordon
*Contributed equally to this work
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1472 Views: 9185
Edited by: Fanglian He
Reviewed by: Kabin XieKanika Gera
Original Research Article:
The authors used this protocol in Jun 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2011
Abstract
Recent advances in next-generation sequencing techniques allow the detection of a large number of SNPs and their use in a high throughput manner. However, Cleaved Amplified Polymorphic Sequences (CAPSs) still play a significant role as complement to other high throughput methods for SNP genotyping. Therefore, new methods focusing on the acceleration of this type of markers are highly desirable. The combination of the classical CAPS technique and a M13-tailed primer multiplexing assay was used to develop an agarose gel free protocol for the analysis of SNPs via restriction enzyme digestion. PCR products were fluorescence labeled with a universal M13 primer and subsequently digested with the appropriate restriction endonuclease. After mixing differently labeled products, they were detected on a capillary electrophoresis system. This method allows the cost-effective genotyping of several SNPs in a multiplexed manner at an overall low cost in a short period of time. Additionally, this method could be efficiently combined with the simultaneous detection of SSRs at the same electrophoresis run resulting in a procedure well suited for marker-based selection procedures, genotyping of mapping populations and the assay of genetic diversity.
Keywords: CAPS SNP Fluorescence-based multiplexing M13 tail Marker-assisted selection
Materials and Reagents
DNA (25 ng/µl) (e.g. from two-weeks old barley seedlings; or according to PCR practice of each particular organism)
PCR reagents
0.5 U of Taq FIREPol® DNA polymerase (Solis Biodyne FIREPol®, catalog number: 01-01-01000 ; any other suppliers should be also satisfactory) with the corresponding 10x PCR buffer (supplied with FIREPol® DNA polymerase)
25 mM MgCl2 (supplied with FIREPol® DNA polymerase)
dNTPs (10 µM each) (Thermo Fisher Scientific, catalog number: R0182 )
Forward specific primer tailed at the 5´end with a universal M13 tail (1µM) (5´- CACGACGTTGTAAAACGAC-3´) (desalted) (Microsynth)
Reverse specific primer (10 µM) (desalted) (Microsynth)
Fluorescence (6-FAM, HEX, NED or Cy5, D2, D3) labeled primer with a complementary sequence to the M13 tail (10 µM) (Metabion, Planegg/Steinkirchen)
Restriction analysis
Restriction endonucleases (New England Biolabs or Fermentas)
1x Buffer restriction endonucleases (New England Biolabs or Fermentas)
1.5% agarose (Sigma-Aldrich, catalog number: A9539 )
Ethidium bromide (Roche Diagnostics, catalog number: HP46.2 )
DNA loading buffer 3x [6x; 30% (v/v) glycerol, 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol FF]
Analysis on ABI PRISM 3100 Genetic Analyzer Separation Gel (Applied Biosystems, catalog number: 4363929 )
ROTISOLV® HPLC gradient grade water (Roche Diagnostics, catalog number: A511.3 )
HiDiTMFormamide as Sample Loading Buffer (Applied Biosystems, catalog number: 4311320 )
GeneScanTMROX size standard (Applied Biosystems, catalog number: 401734 )
96 well half skirted PCR plates (Kisker, catalog number: G060/H/1E/OA-SS )
Analysis on Beckman Coulter CEQTM 8000 Genetic Analysis System
GenomeLabTM Separation Gel LPA I (Beckman Coulter, catalog number: 608010 )
96 well half skirted, segmented PCR plates (Kisker, catalog number: G060/H/1E-SG )
Separation Buffer plates, non-sterile (Beckman Coulter, catalog number: 609844 )
GenomeLabTM DNA Size Standard 600 (Beckman Coulter, catalog number: 608095 )
GenomeLabTM Separation Buffer (Beckman Coulter, catalog number: 608012 )
Formamide as Sample Loading Buffer (Sigma-Aldrich, catalog number: F9037 ) or original Sample Loading Buffer (SLS) (Beckman Coulter, catalog number: 608082)
Gel running buffer (see Recipes)
Equipment
Thermal Cycler (Applied Biosystems)
Horizontal Electrophoresis system (Bio-Rad Laboratories, Sub-Cell® Model 96 Cell)
ABI PRISM 3100 Genetic Analyzer or Beckman Coulter CEQTM 8000 Genetic Analysis System
Heating block, bath or oven for restriction analysis
PCR 96-well plate or tubes
Software
GeneMapper® 4.0 Software (Applied Biosystems) or GenomeLabTM GeXP Software (Beckman Coulter)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Perovic, J., Silvar, C., Perovic, D., Stein, N. and Ordon, F. (2015). Fluorescence-based CAPS Multiplex Genotyping on Capillary Electrophoresis Systems. Bio-protocol 5(10): e1472. DOI: 10.21769/BioProtoc.1472.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,473 | https://bio-protocol.org/exchange/protocoldetail?id=1473&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pyrosequencing Approach for SNP Genotyping in Plants Using a M13 Biotinylated Primer
Cristina Silvar
Dragan Perovic
AC Anna M Casas
EI Ernesto Igartua
Frank Ordon
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1473 Views: 9714
Edited by: Fanglian He
Reviewed by: Kabin XieKanika Gera
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
Single Nucleotide Polymorphisms (SNPs), which constitute single base-pair variations in the DNA sequence, are the most abundant molecular markers in plant and animal genomes. They are becoming the markers of choice for genotyping in all fields of molecular biology, as they are easily prone to automation and high throughput, for example through pyrosequencing. This technology is accurate, flexible and can be easily automated. However, the need for primers labelled with biotin, promptly rise the cost of any methodology employing a pyrosequencing approach. In this protocol we described an improved, efficient, reliable and cost-effective pyrosequencing protocol, based on a universal M13 biotinylated primer, for SNP genotyping in plants.
Keywords: SNP Pyrosequencing M13 tail Marker-assisted selection Cost-effective
Materials and Reagents
DNA (25 ng/µl) e.g. from two-weeks old barley seedlings; or according to PCR practice of each particular organism
PCR reagents
0.5 U Taq DNA polymerase (Solis Biodyne FIREPol®, catalog number: 01-01-01000 ) or HotStart Taq polymerase (Solis Biodyne HOT FIREPol®, catalog number: 01-02-01000 ; any other suppliers should be also satisfactory) with the corresponding 10x PCR buffer (supplied with Taq DNA polymerase)
25 mM MgCl2 (supplied with Taq DNA polymerase)
dNTPs (10 µM each) (Thermo Fisher Scientific, catalog number: R0182 )
Forward specific primer tailed at the 5´end with a universal M13 tail (5´- CACGACGTTGTAAAACGAC-3´) (desalted) (1 µM)
Reverse specific primer (desalted) (10 µM)
Biotinylated universal primer with a complementary sequence to the M13 tail (10 µM) (Metabion, Planegg/Steinkirchen)
Agarose (Sigma-Aldrich, catalog number: A9539 )
Ethidium bromide (Roche Diagnostics, catalog number: HP46.2 )
Pyrosequencing reagents
Sequencing primer (desalted) (10 µM)
Streptavidin Sepharose HP (GE Healthcare, catalog number: 17-5113-01 )
Annealing buffer (QIAGEN, catalog number: 979009 ) (see Recipes)
Binding buffer (QIAGEN, catalog number: 979006 ) (see Recipes)
Denaturation solution (QIAGEN, catalog number: 979007 ) (see Recipes)
Washing buffer (QIAGEN, catalog number: 979008 ) (see Recipes)
High-purity water (Milli-Q)
70% ethanol
PyroMark Gold Q96 Reagents (enzyme mixture, substrate mixture and nucleotides) (QIAGEN, catalog number: 972807 )
Gel running buffer (see Recipes)
6x DNA loading buffer (see Recipes)
Equipment
Thermal Cycler (Applied Biosystems)
Horizontal Electrophoresis system (Bio-Rad Laboratories)
PyroMark Q96 instrument (QIAGEN, catalog number: 9001525 )
PyroMark Q96 plate (QIAGEN, catalog number: 979002 )
PyroMark Q96 Vacuum Workstation (220 V) (QIAGEN, catalog number: 9001529 )
Vacuum pump (KNF Lab, Typ N816.1.2 KN.18)
Orbital shaker for microtiter plates
Heating block (80 °C)
PyroMark Q96 Cartridge (QIAGEN, catalog number: 979004 )
PCR 96-well plate (Greiner Bio-One, catalog number: 652250 )
Software
PyroMark Assay Design Software V.1.0.6. (QIAGEN)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,474 | https://bio-protocol.org/exchange/protocoldetail?id=1474&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genome-Wide siRNA Screen for Anti-Cancer Drug Resistance in Adherent Cell Lines
EB Elza C. de Bruin
MJ Ming Jiang
MH Michael Howell
JD Julian Downward
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1474 Views: 12344
Edited by: HongLok Lung
Reviewed by: Michael EnosAgnieszka Pastula
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The expression of genes is frequently manipulated in cell lines to study their cellular functions. The use of exogenous small Interfering RNAs (siRNAs) is a very efficient technique to temporarily downregulate the expression of genes of interest [reviewed by Hannon and Rossi (2004)]. A genome-wide siRNA library allows the user to study both the effect of each individual gene on a particular cell phenotype in a high throughput manner and also assess its phenotypic effect relative to all other genes targeted. Several factors that potentially influence the outcome of a screen need to be considered when performing a large siRNA screen (Jiang et al., 2011). Here we present a detailed protocol for a genome-wide screen to identify genes involved in anti-cancer drug resistance using the human siGENOME library from Dharmacon. In this protocol, we focus on resistance to treatment with the Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitor (EGFR-TKI) erlotinib in the lung cancer cell line PC9, which is exquisitely sensitive to EGFR-TKIs (de Bruin et al., 2014). This protocol can be used for other cell lines and other drug treatments, as we expand in the Notes below.
Materials and Reagents
Human lung adenocarcinoma cell line PC9 (RIKEN BioResource Center, catalog number: RCB4455 )
RPMI 1640 Medium containing L-Glutamine (Life Technologies, Gibco®, catalog number: A10491-01 )
Note: For cell culture, the medium is supplemented with 10% FBS and 1% Penicillin Streptomycin (see details FBS and Pen/Strep below).
Penicillin streptomycin (Life Technologies, Gibco®, catalog number: 15070-063 )
Fetal bovine serum (FBS) (PAA Laboratories GmbH, catalog number: A15-101 )
Opti-MEM® I Reduced Serum Medium (Life Technologies, Gibco®, catalog number: 31985-047 )
384-well tissue culture plates, black with clear F-bottom (4titude, Anachem, catalog number: 4TI-0201 were used for our screen; currently plates from Greiner bio-one (catalog number: 781091 ) are used
Adhesive foil plate seal (Brandle Plate Sealer, Alpha Biotech)
5x siRNA buffer (GE Healthcare, catalog number: B-002000-UB-100 )
Human siGENOME SMARTpool siRNA library (GE Healthcare, catalog number: G-005005 )
Note: We used an older version (from 2005) for our study (de Bruin et al., 2014) that is no longer available. Updated versions will contain other siRNA sequences as well as annotations, which will impact results. We therefore strongly recommend validating identified genes using other approaches.
siRNA controls (see Note 1)
Negative controls:Human siGENOME non-targeting siRNA 2 (GE Healthcare, catalog number: D-001210-02 ), RISC-Free control siRNA (catalog number: D-001220-01 ), ON-Targetplus non-targeting (catalog number: D-001810-10 )
Positive controls: Human siGENOME SMARTpool UBB (GE Healthcare, catalog number: M-013382-01 ) and PLK1 (Dharmacon, catalog number: M-003290-01 )
DharmaFECT 2 siRNA transfection reagent (GE Healthcare, catalog number: T-2002-01 ) (see Note 2)
DAPI (Roche Diagnostics, catalog number: 10236276001 )
siGENOME LaminA/C control siRNA (GE Healthcare, catalog number: D-001050-01-05 ) (see Note 3)
Human LaminA/C antibody (catalog number: SC-7292 ) (see Note 3)
Phosphate buffered saline (PBS) (pH 7.0, made in-house)
Erlotinib (Enzo Life Sciences, catalog number: BML-DL279 )
Equipment
Acumen (TTP LABTECH, mode: eX3 )
ArrayscanVTi HCS microscope (Cellomics)
Biomek FX Liquid handling platform (Beckman Coulter)
Countess Cell counter (Life Technologies)
Liquid dispensor8-channel [for our screen the WellMate (Matrix) was used, currently the FluidX (Xrd-384) is used]
Cytomat 24 °C CO2 incubator 37 °C and 5% CO2
Note: The Cytomat is a cell culture incubator that has racks built in holding ~500 plates, and the racks rotate to minimize plate edge effects.
Plate washer (BioTek Instruments, model: ELx405 Select CW , Figure 1)
Plate sealer (Brandel Plate Sealer, Alpha Biotech)
Figure 1. Picture of plate washer
Important considerations
Before performing a large-scale siRNA screen, there are a few crucial points to consider and to optimize in order to obtain the best results (Jiang et al., 2011). These include:
Optimization of the siRNA transfection: Reagent, cell number, siRNA concentration.
Optimization of the drug dose, treatment time length in combination with the siRNA transfection for drug resistant/sensitizing screens.
Details of these optimization steps are provided in the Notes section at the end of this protocol. We recommend performing, if possible, a pilot screen with a range of random siRNAs and selected control RNAs to determine the feasibility and screen read-out prior to the genome-wide screen.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > General technique > Cancer therapy
Molecular Biology > RNA > RNA interference
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,475 | https://bio-protocol.org/exchange/protocoldetail?id=1475&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determining the Relative Fitness Score of Mutant Viruses in a Population Using Illumina Paired-end Sequencing and Regression Analysis
HQ Hangfei Qi
CO C. Anders Olson
NW Nicholas C. Wu
YD Yushen Du
RS Ren Sun
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1475 Views: 8438
Edited by: Arsalan Daudi
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Recent advances in DNA sequencing capacity to accurately quantify the copy number of individual variants in a large and diverse population allows in parallel determination of the phenotypic effects caused by each genetic modification. This systematic profiling approach is a combination of forward and reverse genetics, which we refer to as quantitative high-resolution genetics (qHRG). This protocol describes how to determine the relative fitness score of each variant compared to wild type (WT) virus based on its frequency determined by Illumina sequencing. Random mutagenesis techniques will be used to introduce randomization at each codon position of the targeted region, thereby generating a comprehensive input mutant library with substitutions at each position of interest (Qi et al., 2014; Wu et al., 2014a; Wu et al., 2014b). After selection, each selected library will be sequenced by Illumina paired-end sequencing and the frequency of each mutation will be determined. Based on the change in frequency, the relative fitness score of each mutant can be calculated with regression analysis.
Materials and Reagents
The Huh-7.5.1 cell line (kindly provided by Dr. Francis Chisari from the Scripps Research Institute, USA)
Dulbecco's modified Eagle medium (DMEM) (Corning, Cellgro®, catalog number: 10-017-CV )
Fetal bovine serum (FBS) (Omega Scientific, catalog number: FB-11 )
100x non-essential amino acids solution (Life Technologies, catalog number: 11140050 )
1 M HEPES (Life Technologies, catalog number: 15630080 )
100x Penicillin-Streptomycin-Glutamine (Life Technologies, catalog number: 10378016 )
10x trypsin supplemented with EDTA (Life Technologies, Gibco®, catalog number: 15400054 )
Plasmid that carries the HCV viral genome (pFNX-HCV) was synthesized based on the chimeric sequence of J6/JFH1 virus
Note: In this protocol, we are taking the HCV NS5A mutant library as an example to describe the procedures to relative fitness determination (Qi et al., 2014). A mutant virus library where each codon of interest was individually substituted with ‘NNK’, where N represents random incorporation of A/T/G/C; K represents random incorporation of T/G. The randomized codons therefore include 32 nucleotide combinations, which cover all possible amino acid.
100% ethanol (Decon Labs, catalog number: 2701 )
QIAamp Viral RNA Mini Kit for viral RNA purification (QIAGEN, catalog number: 52906 )
Sterile, RNase-free pipet tips (with aerosol barriers for preventing cross-contamination) (OLYMPUS, catalog numbers: 24-401 , 24-404 , 24-412 , 24-430 )
SuperScriptTM III Reverse Transcriptase Kit (Life Technologies, InvitrogenTM, catalog number: 18080-044 )
RNaseOUT Recombinant Ribonuclease Inhibitor (Life Technologies, InvitrogenTM, catalog number: 10777-019 )
KOD Hot Start DNA Polymerase Kit (Novagen®, catalog number: 71086-4 )
PureLink® Quick PCR Purification Kit (Life Technologies, InvitrogenTM, catalog number: K3100-02 )
T4 Polynucleotide Kinase (PNK) (New England Biolabs, catalog number: M0201S )
NEB buffer 2 (New England Biolabs, catalog number: B7002S )
dATP (100 mM) (Life Technologies, InvitrogenTM, catalog number: 10216-018 )
Klenow Fragment (3’ to 5’ exo-) enzyme (New England Biolabs, catalog number: M0212S )
T4 DNA Ligase Kit (Life Technologies, InvitrogenTM, catalog number: 15224-017 )
Equipment
15 cm cell culture dishes (Genesee Scientific, catalog number: 25-203 )
T-150 cell culture flasks (Genesee Scientific, catalog number: 25-211 )
37 °C, 5% CO2 cell culture incubator
1.7 ml Microtubes (1.5 ml) (Genesee Scientific, catalog number: 22-282 )
Falcon 50 ml tubes (Corning, catalog number: 14-432-22 )
Falcon 15 ml tubes (Corning, catalog number: 05-527-90)
Microcentrifuge (with rotor for 1.5 ml and 2 ml tubes) (Eppendorf, model: 5424 )
Centrifuge (with rotor for 15 ml and 50 ml Falcon tubes) (Thermo Fisher Scientific, Legend RT)
NanoDrop ND-1000 UV Spectrophotometer (Thermo Fisher Scientific)
Thermal cycler (Eppendorf, catalog number: 950030050 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Qi, H., Olson, C. A., Wu, N. C., Du, Y. and Sun, R. (2015). Determining the Relative Fitness Score of Mutant Viruses in a Population Using Illumina Paired-end Sequencing and Regression Analysis . Bio-protocol 5(10): e1475. DOI: 10.21769/BioProtoc.1475.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Systems Biology > Genomics > Sequencing
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,476 | https://bio-protocol.org/exchange/protocoldetail?id=1476&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transient Transformation of Artemisia annua
Dongming Ma
Hong Wang
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1476 Views: 8088
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Transient transformation of Artemisia annua does not depend on chromosomal integration of heterologous DNA, and recombinant DNA can be introduced into plant cells via Agrobacterium aided by vacuum. The leaves of 7th and 8th internode from 4-week-old seedlings were chosen as explants, a vacuum system was applied to facilitate agrobacteria into plant cells, the co-cultivation was in the dark at 25 °C for 36-72 h, then GUS or GFP maker genes were used for testing the efficiency of the transformation. The method is used for quick transferring of genes into Artemisia annua (A. annua) by transient transformation.
Keywords: Artemisia annua Agrobacterium tumefaciens Transient transformation
Materials and Reagents
Artemisia annua leaves from 4-week-old aseptic seedlings
Agrobacterium tumefaciens (A. tumefaciens) strain EHA105 (or LBA4404)
Lysogeny broth (LB) medium (pH 7.0, containing 50 mg/L rifampicin and 50 mg/L kanamycin)
Murashige and Skoog medium (MS) liquid medium (Sigma-Aldrich, catalog number: M5524 )
100 μM acetosyringone (Sigma-Aldrich, catalog number: D134406 )
10 mM MgCl2
0.005% Silwet L-77 (Agri-Turf Supplies, catalog number: VIS-01 )
Glycerol
Filter paper (Lab Depot, catalog number: TLDCFP1-032 )
Yeast extract broth (YEB) medium (see Recipes)
Equipment
Vacuum pump (Barnant, model: 400-1903 )
Desiccator (Ted Pella, catalog number: 2246 )
Erlenmeyer flasks (VWR International, catalog number: 89095-266 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ma, D. and Wang, H. (2015). Transient Transformation of Artemisia annua. Bio-protocol 5(10): e1476. DOI: 10.21769/BioProtoc.1476.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,477 | https://bio-protocol.org/exchange/protocoldetail?id=1477&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Human, Bacterial and Fungal Amplicon Collection and Processing for Sequencing
JO Julia Oh
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1477 Views: 12292
Reviewed by: Aksiniya AsenovaEmily Cope
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Sequencing taxonomic marker genes is a powerful tool to interrogate the composition of microbial communities. For example, bacterial and fungal community composition can be evaluated in parallel using the 16S ribosomal RNA gene for bacteria or the internal transcribed spacer region in fungi. These are conserved regions that are universal to a taxonomic clade, yet have undergone some degree of evolution such that different lineages can be differentiated. Conserved regions are used for design of universal priming sites that allow amplification of the marker gene out of a mixed microbial community. Here, we describe our standard operating procedure to collect and sequence 16S rRNA and ITS1 amplicons from human skin. We use the 16S rRNA V1-V3 region for skin samples, as it has greater power for classifying common staphylococci in the skin. This protocol is adapted for 454 pyrosequencing of amplicons.
Keywords: Microbiome 16S rRNA ITS Skin microbiome extraction
Materials and Reagents
Sample collection and DNA extraction
Catch-All sample collection swabs (Epicentre, catalog number: QEC89100 )
MasterPure yeast DNA purification kit (Epicentre, catalog number: MPY80200 )
Yeast cell lysis buffer (Epicentre, catalog number: MPY80200)
ReadyLyse (Epicentre, catalog number: R1810M )
Promega DNA IQ Spin baskets (Promega Corporation, catalog number: U1221 )
Stainless steel beads, 5mm (QIAGEN, catalog number: 69989 )
MoBio PCR water (MoBio, catalog number: 17000-10 )
100% (200 proof) ethanol (Warner-Graham Company, catalog number: 64-17-5 )
70% ethanol made from 350 ml of 100% ethyl alcohol and 150 ml of MoBio water
PureLink Genomic DNA Mini Kit (Life Technologies, InvitrogenTM, catalog number: K182002 )
PCR amplification
Accuprime Taq polymerase HiFi (Life Technologies, InvitrogenTM, catalog number: 12346-086 )
Forward and reverse primers with designated barcodes (IDT custom order)
MinElute PCR purification kit (QIAGEN, catalog number: 28006 )
QuantIT ds DNA assay, high sensitivity (Life Technologies, InvitrogenTM, catalog number: P7589 )
Ampure (SPRI) beads, 60 ml kit (Agencourt, catalog number: A63881 )
TE (pH 8.0) (Life Technologies, catalog number: AM9849 )
Equipment
2.0 ml Safe-Lock Biopur individually sealed tubes (Eppendorf, catalog number: 0030 121.597 )
Sterile scissors (VWR, catalog number: 82027-594 )
Sterile tweezers (VWR, catalog number: 231-SA-SE )
Safe-Lock PCR Biopur tube (Eppendorf, catalog number: 0030 123.344 )
15 and 50 ml conical tubes (Falcon, catalog numbers: 14-959-49D and 14-432-22 )
96-well thermocycler plates (USA Scientific, catalog number: 1402-9596 )
Clear adhesive plate seals (USA Scientific, catalog number: 2978-2100 )
Foil plate seals (USA Scientific, catalog number: 2923-0110 )
Reagent reservoirs (USA Scientific, catalog number: 2320-2620 )
Heated shaking block that holds Eppendorf tubes (Eppendorf Thermomixer C)
Bead beater (Qiagen TissueLyser II, catalog number: 85300 )
Bead beater adapters (Qiagen TissueLyser Adapter Sets, catalog number: 69982 )
UV crosslinker (UVP, catalog number: CL-1000 )
Microcentrifuge (Eppendorf, Centrifuge 5415D )
Thermocycler (Applied Biosystems Veriti)
Plate centrifuge (Beckman Coulter, Allegra 6KR)
Fluorometer plate reader (Thermo Scientific, catalog number: 5210450 )
Multi-channel pipettes (pre- and post-PCR designated)
96- well microplates for fluorescence-based assays (Life Technologies, catalog number: M33089 )
Qubit 2.0 Fluorometer (Life Technologies, InvitrogenTM, catalog number: Q32866 )
Qubit 2.0 Quantitation Starter Kit (Life Technologies, InvitrogenTM, catalog number: Q32871 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > DNA
Microbiology > Microbe-host interactions > In vivo model
Systems Biology > Genomics > Sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,478 | https://bio-protocol.org/exchange/protocoldetail?id=1478&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plant Materials and Growth Conditions of Japanese Morning Glory (Ipomoea nil cv. Violet)
KS Kenichi Shibuya
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1478 Views: 10322
Edited by: Tie Liu
Reviewed by: Yuko Kurita
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Japanese morning glory (Ipomoea nil) is a summer annual vine that typically produces ephemeral flowers. This plant has been used extensively to investigate flowers, including studies on flowering, flower color, and petal senescence. Here we describe the materials and optimal growth conditions used to grow the Japanese morning glory cultivar, “Violet”, in a growth chamber. Violet plants are transformable with Agrobacterium (Rhizobium), and we have used this cultivar to examine petal senescence (Shibuya et al., 2009; Shibuya et al., 2014).
Keywords: Morning glory Ipomoea Flower Plant
Materials and Reagents
Japanese morning glory cultivar, “Violet” (Ipomoea nil cv. Violet) seeds
Note: Seeds of the Japanese morning glory cultivar, “Violet” (Ipomoea nil cv. Violet), as well as other cultivars can be obtained through the National BioResource Project, Japan (http://www.shigen.nig.ac.jp/asagao/).
Horticultural soil (Nippi Horticulture soil No. 1; Nihon Hiryo)
Fertilizer (Hyponex, catalog number: 15-30-15 )
Equipment
Growth chamber
12 cm-diameter pots
Metal wire (1 m)
Utility knife
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shibuya, K. (2015). Plant Materials and Growth Conditions of Japanese Morning Glory (Ipomoea nil cv. Violet). Bio-protocol 5(10): e1478. DOI: 10.21769/BioProtoc.1478.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,479 | https://bio-protocol.org/exchange/protocoldetail?id=1479&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Proximity Ligation Assay (PLA) to Detect Protein-protein Interactions in Breast Cancer Cells
Mike Z Lin
JM Janet L Martin
RB Robert C Baxter
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1479 Views: 32247
Edited by: HongLok Lung
Reviewed by: Shannon Ruppert
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Protein-protein interaction networks provide a global picture of cellular function and biological processes, and the dysfunction of some interactions causes many diseases, including cancer. The in situ proximity ligation assay (PLA) is a powerful technology capable of detecting the interactions among proteins in fixed tissue and cell samples. The interaction between two proteins is detected using the corresponding two primary antibodies raised in different species. Species-specific secondary antibodies (PLA probes), each with a unique short DNA strand attached to it, bind to the primary antibodies. When the PLA probes are in close proximity (<40 nm), the DNA strands can interact through a subsequent addition of two other circle-forming DNA oligonucleotides. Several-hundredfold replication of the DNA circle can occur after the amplification reaction, and a fluorescent signal is generated by labelled complementary oligonucleotide probes. Therefore, each detected signal is visualized as an individual fluorescent dot, which can be quantified and assigned to a specific subcellular location based on microscopy images. This revolutionary technique enables us to study the protein complex formation with high specificity and sensitivity compared to the other traditional methods, such as co-immunoprecipitation (Co-IP).
Materials and Reagents
Antibody pair for detecting protein-protein interaction (two primary antibodies must have been raised in different species, e.g. rabbit-anti-EGFR from Cell Signaling Technology, catalog number: 2232 ; mouse-anti-DNA-PK from BD Pharmingen, catalog number: 556456 )
DuolinkTM in situ reagents
DuolinkTM in situ PLA reagents
Duolink in situ complementary oligonucleotide probe MINUS and PLUS [5x, secondary antibody conjugated with a PLA oligonucleotide, the choice of PLA probes depends on the species of your primary antibodies: e.g. anti-rabbit PLUS (Sigma-Aldrich, catalog number: DUO82029 ); anti-mouse MINUS (Sigma-Aldrich, catalog number: DUO 92004)].
Blocking solution (Sigma-Aldrich, catalog number: DUO82014 ): For blocking of the sample if you have not already optimized your primary antibody with another blocking solution, e.g. 2% BSA in PBS.
Antibody diluent (Sigma-Aldrich, catalog number: DUO82015 ): For dilution of PLA probes and the primary antibodies, alternatively PBS solution with 1% BSA works as well.
Duolink detection reagents
Ligation reagents (5x, contains oligonucleotides that hybridize to the PLA probes and all components needed for ligation except the Ligase) (Sigma-Aldrich, catalog number: DUO82016 )
Ligase (1 unit/μl) (Sigma-Aldrich, catalog number: DUO82029)
Amplification reagents (5x, contains all components needed for Rolling Circle Amplification except the Polymerase. Included are also oligonucleotide probes labelled with a fluorophore that hybridize to the RCA product): Containing far red fluorescently labelled oligonucleotides (Sigma-Aldrich, catalog number: DUO82019 )
Polymerase (10 unit/μl): (Sigma-Aldrich, catalog number: DUO82030 )
The Duolink detection reagents are available to purchase as a kit from Sigma-Aldrich (e.g. catalog number for Duolink in situ Detection Reagents Far Red DUO92013 ).
Duolink washing buffer A and B (see recipes)
ProLong Gold antifade reagent with DAPI (Life Technologies, catalog number: P-36931), alternatively regular immunofluorescence mounting media and DAPI can be used separately.
Reagents required for fixation and permeabilization of the sample (e.g. 3.7% fresh-made formaldehyde and 0.1% Triton X-100 diluted in PBS)
Equipment
Fluorescence microscope equipped as follows (e.g. Leica TCS SP5 Microsystems)
Excitation/emission filters compatible with fluorophore (ranging from 488-633 nm) and nuclear stain (ultraviolet) excitation/emission
Camera and software for image acquisition
Shaker
Humidity chamber (moist chamber) (Figure 1)
Freeze block for enzymes
37 °C incubator
Pipettes (covering the range from 1 μl to 1,000 μl)
Glass cover slips compatible with fluorescence microscopy (12 mm diameter and 0.13 to 0.16 mm thickness) (Optics, catalog number: 01 115 20 )
MilliQ® or other equivalently high purity water
Software
Duolink ImageTool software is highly recommended (Demo version for free-download: http://www.olink.com/products/duolink/downloads/duolink-image-tool). Alternatively, ImageJ or LAS AF Lite software from Leica Microsystems can be used for analysis.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, M. Z., Martin, J. L. and Baxter, R. C. (2015). Proximity Ligation Assay (PLA) to Detect Protein-protein Interactions in Breast Cancer Cells . Bio-protocol 5(10): e1479. DOI: 10.21769/BioProtoc.1479.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Molecular Biology > Protein > Protein-protein interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
148 | https://bio-protocol.org/exchange/protocoldetail?id=148&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Midbrain Neuron-glia Mixed Cultures
HG Huiming Gao
Published: Vol 2, Iss 7, Apr 5, 2012
DOI: 10.21769/BioProtoc.148 Views: 13024
Original Research Article:
The authors used this protocol in Feb 2002
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2002
Abstract
Mixed neuron-glia cultures provide a unique tool to study cellular contribution and molecular pathways in various neurological disorders. They are also invaluable for exploring neuron-glia interaction under physiological and pathological conditions. The relatively long-lasting midbrain neuron-glia mixed cultures generated following this protocol have been widely used to study the pathogenesis of Parkinson’s disease, the most common neurodegenerative movement disorder.
Materials and Reagents
Poly-D-lysine (Sigma-Aldrich, catalog number: P7280 )
MEM (Life Technologies, Gibco®, catalog number: 11090-08 )
D-Glucose
Sterile water
Sterile PBS
Trypan blue dye
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
Heat-inactivated horse serum (HS) (Life Technologies, Gibco®, catalog number: 26050-088 )
None essential nonessential amino acids (Life Technologies, Gibco®, catalog number: 11140-050 ) (100 ml)
Sodium pyruvate (Sigma-Aldrich, catalog number: S8636 ) (100 ml)
200 mM L-glutamine (Life Technologies, Gibco®, catalog number: 25030-081 ) (100 ml)
Penicillin/streptomycin (Sigma-Aldrich, catalog number: P0781 ) (100 ml)
Poly-D-lysine stock solution (see Recipes)
Maintenance culture medium (see Recipes)
Treatment medium (see Recipes)
Equipment
Cell culture incubator
Standard benchtop centrifuges
Hemocytometer
Dissection microscope
Scissors and forceps
Sterile filter (0.2 µm)
Foil
24-well plates
Laminar hood
50-ml tube
10-ml pipet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,480 | https://bio-protocol.org/exchange/protocoldetail?id=1480&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Particles of Recombinant ASC and NLRP3
FM Fátima Martín-Sánchez
AG Ana I. Gómez
PP Pablo Pelegrín
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1480 Views: 11954
Reviewed by: Jia Li
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
NLRP3 inflammasome is a multiprotein complex responsible for the activation of inflammatory caspase-1, resulting in processing and release of pro-inflammatory cytoquines IL-1β and IL-18 (Schroder and Tschopp, 2010). This inflammasome is composed of the sensor protein NLRP3 connected to caspase-1 through the adaptor protein ASC (apoptosis-associated speck-like protein with a caspase-recruitment domain) (Schroder and Tschopp, 2010). We and others have reported that upon inflammasome activation functional oligomeric inflammasome particles of NLRP3 and ASC were released from cells, acting as danger signals to amplify inflammation by promoting the activation of caspase-1 extracellularly (Baroja-Mazo et al., 2014; Franklin et al., 2014).
Studying the extracellular function of oligomeric ASC and NLRP3 inflammasome particles was possible by purification of recombinant particles of ASC or the constitutively activated NLRP3 mutant associated with cryopyrin-associated periodic syndromes (CAPS, mutation p.D303N), both tagged with the yellow fluorescent protein (YFP) and expressed in HEK293 cells. The purification process was facilitated by the fact that expression of recombinant ASC or mutant NLRP3 in HEK293 cells resulted in their spontaneous aggregation into specks (Baroja-Mazo et al., 2014) and the protocol was originally adapted from Fernandes-Alnemri and Alnemri (2008).
Materials and Reagents
HEK293T cell line (ATCC® number: CRL-11268 )
Dulbecco´s Modified Eagle´s medium F12 (DMEM-F12) (Biowest, catalog number: L0090 )
10% (v/v) Fetal Bovine Serum (Lonza, catalog number: DE14-801F )
200 mM L-Glutamine (Lonza, catalog number: 17-605E )
Penicillin and streptomycin (Lonza, catalog number: 17-603E )
Liquid nitrogen
1x DPBS (Life Technologies, Gibco®, catalog number: 14190-094 )
1x Percoll (see Recipes)
Buffer A (see Recipes)
2x CHAPS (see Recipes)
1x CHAPS (see Recipes)
Equipment
Tissue culture flasks with quick-release screw cap 75 ventilation (SARSTEDT AG, catalog number: 83.1813.002 )
Tissue culture plate with lid, hydrophobic, sterile (SARSTEDT AG, catalog number: 83.1839 )
37 °C, 5% CO2 cell culture incubator
Table top cooling centrifuge with rotor for 15 ml Falcon tubes (Sigma-Aldrich, catalog number: 3K30 )
Table top cooling microcentrifuge with rotor for 2 ml tubes (HERMLE, catalog number: Z216MK )
Water bath at 37 °C
Syringe (1 ml) (Nipro Syringe, catalog number: SY31SCTU EC )
20 G and 25 G needles (Becton, Dickinson and Company, catalog number: 300600 )
Tissue culture class II laminar flow hood (Telstar Bio II)
Inverted microscope with epifluorescence (Nikon Eclipse Ti)
Bürker counting chamber
Ultrafree-CL low-binding Durapore PVDF membrane (5 µm) (EMD Millipore, catalog number: UFC40S25 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Host defense > General
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,481 | https://bio-protocol.org/exchange/protocoldetail?id=1481&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA-binding Protein Immunoprecipitation (RIP) to Examine AUF1 Binding to Senescence-Associated Secretory Phenotype (SASP) Factor mRNA
EA Elise Alspach
SS Sheila A. Stewart
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1481 Views: 14148
Edited by: HongLok Lung
Reviewed by: Jyotiska Chaudhuri
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Immunoprecipitation and subsequent isolation of nucleic acids allows for the investigation of protein:nucleic acid interactions. RNA-binding protein immunoprecipitation (RIP) is used for the analysis of protein interactions with mRNA. Combining RIP with quantitative real-time PCR (qRT-PCR) further enhances the RIP technique by allowing for the quantitative assessment of RNA-binding protein interactions with their target mRNAs, and how these interactions change in different cellular settings. Here, we describe the immunoprecipitation of the RNA-binding protein AUF1 with several different factors associated with the senescence-associated secretory phenotype (SASP) (Alspach and Stewart, 2013), specifically IL6 and IL8. This protocol was originally published in Alspach et al. (2014).
Materials and Reagents
Tissue culture
DMEM (Sigma-Aldrich, catalog number: D6429 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F2442 )
Medium M199 (Sigma-Aldrich, catalog number: M7528 )
Penicillin/streptomycin (Sigma-Aldrich, catalog number: P4333 )
BJ human foreskin fibroblasts
Bleomycin sulfate (Sigma-Aldrich, catalog number: B8416 )
BJ culture media (see Recipes)
General materials
Bradford Protein Assay reagent (Bio-Rad Laboratories, catalog number: 500-0006 )
Polyclonal anti-AUF1 antibody (EMD Millipore, catalog number: 07260MI )
Normal Rabbit IgG antibody (Cell Signaling Technology, catalog number: 2729 )
Protein A Dynabeads (Life Technologies, catalog number: 10002D )
MCLB (mammalian cell lysis buffer) (see Recipes)
NT2 buffer (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Immunoprecipitation reagents
Tris
EDTA
NP40
NaCl
Phosphate-buffered saline (PBS)
SDS
Deoxycholate
MgCl2
NaH2PO4
RNAse OUT (Life Technologies, catalog number: 10777-019 )
Proteinase K (Sigma-Aldrich, catalog number: P6556 )
RiboPure RNA isolation kit (Life Technologies, catalog number: AM1924 )
qRT-PCR reagents
dNTPs
Hexanucleotide mix (Roche Diagnostics, catalog number: 11277081001 )
SuperScript II Reverse Transcriptase (Life Technologies, catalog number: 18064-014 )
Power SYBR GREEN PCR master mix (Life Technologies, catalog number: 4367659 )
Primers
IL6 forward: 5′-ACA TCCTCGACGGCA TCTCA-3′
IL6 reverse: 5′-TCACCAGGCAAGTCTCCTCA-3′
IL8 forward: 5′-GCTCTGTGTGAAGGTGCAGT-3′
IL8 reverse: 5′-TGCACCCAGTTTTCCTTGGG-3′
Equipment
Tissue Culture
37 °C forced-air incubator maintained at 5% CO2 and 5% O2 (Thermo Fisher Scientific, Forma Series II water jacketed CO2 incubator)
Laminar-flow biosafety cabinet (Labconco Purifier Class II Biosafety Cabinet)
Immunoprecipitation
Spectrophotometer capable of reading at 450 and 595 nm
Dyna-mag magnetic bead separator (Life Technologies, catalog number: 12321D )
Micro centrifuge
End-over-end tube rotator (Thermo Fisher Scientific, catalog number: 400110Q )
qRT-PCR
PCR machine (Bio-Rad Laboratories, model: C1000 thermo cycler )
Real-time PCR detection system (Bio-Rad Laboratories, model: CFX96 Real Time System )
General equipment
Tissue culture cell scrapers
Refrigerated micro centrifuge
Heat block capable of reaching 70 °C
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Alspach, E. and Stewart, S. A. (2015). RNA-binding Protein Immunoprecipitation (RIP) to Examine AUF1 Binding to Senescence-Associated Secretory Phenotype (SASP) Factor mRNA. Bio-protocol 5(10): e1481. DOI: 10.21769/BioProtoc.1481.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA-protein interaction
Molecular Biology > RNA > qRT-PCR
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,482 | https://bio-protocol.org/exchange/protocoldetail?id=1482&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Establishment of a Symbiotic in vitro System between a Green Meadow Orchid and a Rhizoctonia-like Fungus
EE Enrico Ercole
MR Michele Rodda
MG Mariangela Girlanda
SP Silvia Perotto
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1482 Views: 11250
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Symbiotic orchid seed germination in an in vitro system allows the growth of mycorrhizal protocorms and plantlets for scientific purposes. Orchids in nature need to establish a mycorrhizal symbiosis with fungal partners to germinate and develop into adult plants. Here we present a protocol for symbiotic germination of the terrestrial Mediterranean green meadow orchid Serapias vomeracea. The fungal symbiont Tulasnella calospora (T. calospora) (Basidiomycetes, Cantharellales) was chosen because of its common occurrence (Girlanda et al., 2011), its ability to grow in culture and compatibility in germination assays. T. calospora is one of the most common rhizoctonia-like fungi associated with terrestrial as well as epiphytic orchids.
Materials and Reagents
Serapias vomeracea seeds (collected in the field, in the north-west Mediterranean meadows of Italy; seeds from this orchid species could be retrieved through “index seminum” of international botanic gardens or germplasm banks)
Tulasnella calospora inoculum (strain MUT 4182) (previously grown in sterile culture on MEA medium)
Sterile double deionized water (neutral pH)
Tween-20 (Sigma-Aldrich, catalog number: P2287 )
Milled oats (retrieved from organic shops)
Malt Extract (Sigma-Aldrich, Fluka, catalog number: 70167 )
Ethanol (Sigma-Aldrich, Fluka, catalog number: 0 2860 )
5% sodium hypochlorite (commercial bleach)
Agar (Sigma-Aldrich, catalog number: A1296 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Peptone (Sigma-Aldrich, Fluka, catalog number: P5905 )
Sterilizing solution (see Recipes)
Solid oat medium (see Recipes)
MEA medium (see Recipes)
Equipment
Balance
Small spatula
Small metal forceps
Sterile 10 x 10 mm Whatman No.1 filter paper
Lancets
2.0 ml centrifuge tubes
Micropipette
Filter tips
Centrifuge
Vortex
Timer
Laminar flow hood
Petri dishes (9 cm diameter)
Parafilm (Sigma-Aldrich, catalog number: P7793 )
Bunsen burner
Climatic chamber (Binder GmbH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Endosymbiosis
Plant Science > Plant physiology > Plant growth
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,483 | https://bio-protocol.org/exchange/protocoldetail?id=1483&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Mitochondrial Respiration Rate in Maize (Zea mays) Leaves
Xiao-Min Wang
NC Ning Chang
YB Yu-Rong Bi
Bao-Cai Tan
Published: Vol 5, Iss 10, May 20, 2015
DOI: 10.21769/BioProtoc.1483 Views: 8144
Edited by: Tie Liu
Reviewed by: Fernanda SalvatoFang Xu
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Mitochondria play essential roles in plant growth and development as they host the oxidative phosphorylation pathways, tricarboxylic acid cycle and other important metabolisms. Disruption of mitochondrial functions frequently leads to embryo lethality. Moreover, mitochondria play roles in programmed cell death, pathogen and stress responses in plants. In contrast to animal mitochondria, plant mitochondria possess an additional electron transport pathway, the cyanide-resistant alternative pathway catalyzed by a single alternative oxidase (AOX). Unlike cytochrome pathway that is coupled to oxidative phosphorylation via proton translocation, electron transport from ubiquinol to AOX is non-phosphorylating. It releases the energy as heat. Chlorolab II liquid-phase oxygen electrode (Hansatech) is a high-precise Clark type oxygen electrode, which is equipped with the powerful WINDOWS software and could record the oxygen changes in real time. Its electrode disc comprises a central platinum cathode and a concentric silver anode. The electrode disc is connected to an electrode control unit which applies a small polarising voltage between the platinum and silver electrodes. In the presence of oxygen, a small current is generated proportional to oxygen content in the sample. It could respond sensitively and rapidly to small changes of oxygen content in the sample. This protocol describes how to measure the mitochondrial total respiration rate, cytochrome pathway capacity as well as alternative pathway capacity in maize leaves with chlorolab II oxygen electrode.
Keywords: Mitochondrial total respiration rate Cytochrome pathway capacity Alternative pathway capacity Chlorolab II liquid-phase oxygen electrode
Materials and Reagents
Leaves of maize seedlings
Potassium cyanide (KCN) (Sigma-Aldrich, catalog number: 207810 )
Salicylhydroxamic acid (SHAM) (Sigma-Aldrich, catalog number: S607 )
Sodium dithionite (Sigma-Aldrich, catalog number: 71699 )
Reaction medium buffer (see Recipes)
0.2 M KCN (see Recipes)
0.2 M SHAM (see Recipes)
Equipment
Chlorolab II liquid-phase oxygen electrode (Hansatech)
Thermostatic water bath
Circulating water pump
Microsyringe (50 μl)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X., Chang, N., Bi, Y. and Tan, B. (2015). Measurement of Mitochondrial Respiration Rate in Maize (Zea mays) Leaves. Bio-protocol 5(10): e1483. DOI: 10.21769/BioProtoc.1483.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Respiration
Plant Science > Plant cell biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,484 | https://bio-protocol.org/exchange/protocoldetail?id=1484&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the Developmental Origin of Seeds Containing Endosperm Using Flow Cytometric Analysis
Christian Sailer
AS Anja Schmidt
Ueli Grossniklaus
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1484 Views: 9597
Edited by: Tie Liu
Reviewed by: Kaisa Kajala
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Seeds derived from a diploid, sexual plant typically contain a 2n embryo (n+n) and 3n endosperm, a ratio characteristic for most flowering plants. However, this ratio is altered in apomictic species, which reproduce asexually through seeds (Koltunow and Grossniklaus, 2003). Apomixis is usually a facultative trait and encompasses several developmental steps: (1) apomeiosis (avoidance of meiosis), (2) parthenogenesis (embryo development without fertilization), and (3) functional endosperm formation (autonomous without fertilization or pseudogamous requiring fertilization). If all three steps occur, this process results in maternal offspring (2n+0), which is genetically identical to the mother plant (clonal). Moreover, sexual and apomictic pathways can occur in the same plant and sometimes they cross over, producing polyhaploid offspring (n+0; resulting from meiosis and parthenogenesis) or BIII hybrids (2n+n; resulting from apomeiosis and fertilization) (Rutishauser, 1947). The different types of offspring can be determined in a flow cytometric seed screen (FCSS), in which the relative chromatin content of stained nuclei is determined by measuring their fluorescence intensity. This allows a comparison of the ploidy of the endosperm to the ploidy of the embryo and, thus, an inference of the pathway by which a seed was formed (Matzk et al., 2000). This method is particularly useful to characterize the developmental origin of seeds in apomictic plants or reproductive mutants of sexual species.
Here, we present the protocol for an FCSS in Brassicaceae that has specifically been adapted to plants of the genus Boechera. However, in principle this protocol can be applied to any species producing seeds that contain endosperm.
Keywords: Flow cytometry Seed development Endosperm Flow cytometric seed screen Apomixis
Materials and Reagents
Citric acid monohydrate (Sigma-Aldrich, catalog number: 33114 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Na2HPO4.2H2O (Merck KGaA, catalog number: 1.06580.1000 )
4’,6-Diamidin-2-phenylindol (DAPI) (Life Technologies, InvitrogenTM, catalog number: D1306 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Sheath fluid; Iso-Diluent (Beckman Coulter, catalog number: NPE 629967 )
Cleaning solution (Beckman Coulter, catalog number: 629969 )
Shutdown solution (Beckman Coulter, catalog number: 629968 )
Stock solutions (see Recipes)
Otto 1 solution 0.01% (see Recipes)
Otto 1 solution 1% (see Recipes)
Otto 1 solution 0.5% (see Recipes)
Otto 2 solution (see Recipes)
Equipment
1.2 ml Cluster tube and rack (sterile) (Thermo Fischer Scientific, catalog number: 07-200-320 )
Storage plate cap strips (Thermo Fisher Scientific, catalog number: AB-0981 )
3 mm stainless steel beads (Schieritz & Hauenstein, catalog number: 22.455.0011 )
Nunc Fritted deep well plates (Thermo Fisher Scientific, catalog number: 278011 )
96-well V-bottom plates (SARSTEDT AG, catalog number: 82.1583.001 )
200 μl tips (SARSTEDT AG, catalog number: 70.760.002 )
1 ml tips (Rainin/Mettler Toledo, catalog number: RC-1000/10 )
Single channel pipettes (Gilson, catalog number: P10 , P1000 )
Multichannel pipette 10-100 µl (Thermo Fisher Scientific, catalog number 4661130 )
Multichannel pipette 30-300 µl (Thermo Fisher Scientific, catalog number 4661140 )
Mixer mill (Retsch, model: MM300 )
Centrifuge (Eppendorf, model: 5810R )
UV lamp (part of 13. flow cytometer)
Flow cytometer (Beckman Coulter, Cell Lab Quanta SC, serial number: AN020010 )
Flow cytometer robotics (Beckman Coulter, MPL, Cell Lab Quanta SC, serial number: AN90022 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sailer, C., Schmidt, A. and Grossniklaus, U. (2015). Determination of the Developmental Origin of Seeds Containing Endosperm Using Flow Cytometric Analysis. Bio-protocol 5(11): e1484. DOI: 10.21769/BioProtoc.1484.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,485 | https://bio-protocol.org/exchange/protocoldetail?id=1485&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dictyostelium Cultivation, Transfection, Microscopy and Fractionation
Jennifer Hirst
Robert R Kay
David Traynor
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1485 Views: 13264
Edited by: Arsalan Daudi
Reviewed by: Alexandros Alexandratos
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The real time visualisation of fluorescently tagged proteins in live cells using ever more sophisticated microscopes has greatly increased our understanding of the dynamics of key proteins during fundamental physiological processes such as cell locomotion, chemotaxis, cell division and membrane trafficking. In addition the fractionation of cells and isolation of organelles or known compartments can often verify any subcellular localisation and the use of tagged proteins as bait for the immunoprecipitation of material from cell fractions can identify specific binding partners and multiprotein complexes thereby helping assign a function to the tagged protein. We have successfully applied these techniques to the Dictyostelium discoideum protein TSPOON that is part of an ancient heterohexamer membrane trafficking complex (Hirst et al., 2013). TSPOON is the product of the tstD gene in Dictyostelium and is not required for growth or the developmental cycle in this organism. Dictyostelium amoebae will exist in a vegetative phase where growth is sustained by the phagocytosis of bacteria. When this food source is spent they enter a developmental phase where the amoebae aggregate, via chemotaxis to extracellular waves of cAMP, into multicellular structures that subsequently form a fruiting body containing viable spores (Muller-Taubenberger et al., 2013). In the laboratory this cycle takes less than 24 h to complete and as a further aid to manipulation the requirement for a bacterial food source has been circumvented by the derivatisation of the wild type and isolation of axenic strains that can also grow in a nutrient rich broth. Axenic strains like Ax2 are the mainstay of laboratory research using Dictyostelium (Muller-Taubenberger et al., 2013). A description of Dictyostelium cell cultivation, the generation of cell lines that overexpress TSPOON-GFP and TSPOON null cells, and subsequent analysis (Muller-Taubenberger and Ishikawa-Ankerhold, 2013) is detailed below.
Keywords: Dictyostelium Cultivation Transfection Microscopy Immunoprecipitation
Materials and Reagents
Dictyostelium Ax2 cells can be obtained from the Dictyostelium stock centre (http://dictybase.org/StockCenter/StockCenter.html)
Note: Ax2 strain DBS0235521 is recommended due to the relatively few duplications within its genome (Bloomfield et al., 2008).
HL5 with glucose (Formediun, catalog number: HLG0102 )
LOFLO (Formediun, catalog number: LF1001 )
Ultra-pure dH2O (e.g. Milli-Q system, EMD Millipore)
KH2PO4 (Thermo Fisher Scientific, catalog number: P/4800/53 )
K2HPO4 (anhydrous) (Sigma-Aldrich, catalog number: 60353 )
MgSO4.7H2O (VWR International, catalog number: 25165.260 )
CaCl2.2H2O (VWR International, catalog number: 22317.260 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
KCl (Thermo Fisher Scientific, catalog number: P/4280/53 )
NaCl (VWR International, catalog number: 27810.295 )
NaHCO3 (VWR International, catalog number: 27778.236 )
NaH2PO4.2dH2O (Thermo Fisher Scientific, catalog number: 10723621 )
Na2HPO4 (anhydrous) (Thermo Fisher Scientific, catalog number: S4520/53 )
KOH (VWR International, catalog number: 26668.263 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
EDTA disodium salt dihydrate (VWR International, catalog number: 20302.260 )
HCl (Thermo Fisher Scientific, catalog number: H/1200/PB08 )
Klebsiella aerogenes (available from http://dictybase.org/StockCenter/StockCenter.html)
50 mM L-ascorbic acid (Sigma-Aldrich, catalog number: A5960 )
Ethanol (Sigma-Aldrich, catalog number: 3112 )
Chloroform (VWR International, catalog number: 22711.290 )
Plasmids pDT51, pDT61, pDT70 and pJH101 together with gene knockout vectors for iplA, mscS, mclN, phdA and dagA can be obtained from David Traynor
Note: Plasmid pLPBLP can be ordered through dictyBase (http://www.dictybase.org/db/cgi-bin/dictyBase/SC/plasmid_details.pl?id=9).
HiSpeed® Plasmid Midi Kit (QIAGEN, catalog number: 12643 )
Hygromycin 100 mg/ml sterile solution (Invivogen HygroGold, catalog number: ant-hg-5 )
Blasticidin S 100 mg/ml sterile solution (Invivogen, catalog number: ant-bl-1 )
G418 (20 mg/ml solution) (Life Technologies Geneticin®, catalog number: 11811-031 )
Quick-gDNA MiniPrep kit (Zymo Reasearch, catalog number: D3025 )
Expand 20 kbPLUS PCR system (dNTPack) (F. Hoffmann-La Roche, catalog number: 04743814001 )
Oligonucleotide primers (custom synthesised by Sigma-Aldrich)
Freezing medium [sterilised horse serum containing 7.5% (v/v) DMSO]
Horse serum (Sigma-Aldrich, catalog number: H1270 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
Master stock of 200 mM cAMP
4x NuPAGE® LDS sample buffer (Life Technologies, Novex, catalog number: NP0008 )
Protein A (PA) sepharose CL-4B beads (GE Healthcare, catalog number: 17-0780-01 )
Acetone (Thermo Fisher Scientific, catalog number: A/0560/17 )
Protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 11873580001 )
Precast NuPAGE 4-12% Bis-Tris gels (Life Technologies, Novex)
Coomassie G-250 SimplyBlue safe stain (Life Technologies, InvitrogenTM, catalog number: LC6060 )
PierceTM BCA protein assay (Thermo Fisher Scientific, catalog number: 23225 )
Phenol solution (Equilibrated with 10 mM Tris HCl, pH 8.0, 1 mM EDTA) (Sigma-Aldrich, catalog number: P4557 )
Adenosine 3′, 5′-cyclic monophosphate (cAMP) (free acid) (Sigma-Aldrich, catalog number: A9501 )
TritonTM X-100 solution (~10% in H2O) (Sigma-Aldrich, catalog number: 93443 )
Sodium dodecyl sulphate (SDS) solution (10% in H2O SDS) (Sigma-Aldrich, catalog number: 71736 )
SM agar (Formediun, catalog number: SMA0120 )
SM broth (Formediun, catalog number: SMB0102 )
Trichloroacetic acid (VWR International, catalog number: 102863H )
Q5 (NEB, catalog number: M0491 )
Pwo (Roche Diagnostics, catalog number: 11644947001 )
KOD polymerases (Merk Millipore, catalog number: 71086 )
Antifade mounting medium Fluoromount-G® (Cambridge Bioscience, catalog number: 0100-01 ) 71086 or Prolong® (Life Technologies, catalog number: P10144 )
Axenic medium (see Recipes)
LOFLO medium (see Recipes)
SM agar (see Recipes)
SM broth (see Recipes)
Trichloroacetic acid (see Recipes)
KK2 buffer (see Recipes)
KK2C buffer (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
Electroporation buffer E50 (see Recipes)
Dense suspension of Klebsiella aerogenes (see Recipes)
Tris-HCl buffer (see Recipes)
TE buffer (see Recipes)
20 mg/ml G418 (see Recipes)
Freezing medium (see Recipes)
50 mM L-Ascorbic (see Recipes)
Master stock of cAMP (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
PBS-T (see Recipes)
Elution buffer (see Recipes)
Equipment
Sterile tissue culture dishes [(100 x 20 mm style, Corning, catalog number: 353003 or Nunc, catalog number: 172958 ) (35 x 10 mm style, Corning, catalog number: 353001 )]
Sterile 96 flat bottomed well tissue culture dishes (Corning Costar, catalog number: 3799 )
Sterile 50 ml plastic tubes (SARSTEDT AG, catalog number: 62.547.004 or Corning, catalog number: 352070 )
1.8 ml CryoTube vials (Thermo Fisher Scientific, catalog number: 377267 )
Pipetting reservoir (120 ml capacity) (Thermo Fisher Scientific, catalog number: 10717964 )
Steribag pouches (140 mm x 50 mm x 330 mm) (Thermo Fisher Scientific, catalog number: 12728995 )
Microfuge tubes (Sarstedt Micro tube 1.5 ml) (SARSTEDT AG, catalog number: 72.690 )
Lab-Tek chambered coverglass with cover (Thermo Fisher Scientific, catalog number: 155411 and 155380 )
Glass bottom microwell 35 mm petri dishes with 20 mm microwell (MatTek, catalog number: P35G-1.5-20-C )
Disposable cell spreaders (Biologix, catalog number: 65-100 )
Cryo preservation module (Agilent StratCooler Lite Preservation module, catalog number: 400006 )
21G (0.8 mm x 40 mm) needles (Becton Dickinson, catalog number: 304432 )
Spatula (150 x 4 mm) (Thermo Fisher Scientific, catalog number: 11503482 )
Platinum wire inoculating loop and insulated holder (Thermo Fisher Scientific, catalog number: 10669652 and 12882775 )
Nunc sterile plastic needles and loops (Thermo Fisher Scientific, catalog number: 254399 and 254410 )
Syringe filters (0.22 µm) for sterilisation of small volumes (Elkay, catalog number: E25-PS22-50S )
Sterile disposable syringes for sterilisation of small volumes (Becton Dickinson, Plastipak 50 ml, catalog number: 30086 ; 20 ml, catalog number: 300613 ; 10 ml, catalog number: 302188 )
Swin-LokTM plastic filter holder 25 mm (GE Healthcare, catalog number: 420200 )
Prefilters. 25 mm cellulose absorbent pads (Merck Millipore, catalog number: AP1002500 )
Nucleopore Track-Etch polycarbonate membrane 3.0 µm (GE Healthcare, catalog number: 110612 )
Micro bio-spin chromatography column (Bio-Rad Laboratories, catalog number: 732-6204 )
Duran bottles (or equivalent autoclavable media bottles) 1,000 ml, 500 ml and 150 ml (Thermo Fisher Scientific, catalog numbers: FB-800-1000 , FB-800-500 and 11699888 )
Foam stoppers (50 mm x 50 mm and 50 mm x 38 mm) (Thermo Fisher Scientific, catalog number: 11522563 and 11512563 )
Aluminium foil (300 mm x 75 mm x 0.02 mm) (Prowrap, catalog number: JR307518U )
Disposable plastic filter bottle units (150 ml) (Millipore Stericup, SCGPU01RE ) or 500 ml (Millipore Stericup, catalog number: SCGPU05RE )
Steritop bottle top filter unit (1,000 ml) (EMD Millipore, SCGPT10RE )
Corning Filter System (1,000 ml) (Corning, catalog number: 430186 )
Universal bottle (Thermo Fisher Scientific, catalog number: BTS-402-050M )
Temperature controlled shaking incubator (e.g. Infors Multitron standard or Innova 4330)
Temperature controlled incubator (e.g. Panasonic, model: MIR-254 PE or MIR-154 PE )
Tissue culture hood (e.g. Scanlaf Mars Safety 2)
Ultrapure water supply (e.g. Milli-Q® Advantage A10 Ultrapure Water Purification System)
Autoclave
Water bath (e.g. Grant SUB Aqua 12 Plus)\
pH meter and calibration buffers (e.g. Hanna Instruments Edge Hybrid pH, catalog number: HI-2020-02 )
Cell counter (e.g. Beckman Coulter Z1) or haemocytometer (Weber Scientific)
Bench top centrifuge (e.g. Thermo Fisher Scientific, model: IEC CL30 or Eppendorf, model: 5702R )
Bench top microfuge (e.g. Eppendorf, model: 5424 or 5424R )
Thermocycler (96 x 0.2 ml tube block) (e.g. Biometra TGradeint or Applied Biosystems Veriti)
Programmable peristaltic pump (e.g. Watson Marlow, model: 505Di )
8 channel electronic pipette (e.g. eLine 50-1,200 µl) (Sartorius, catalog number: 730391 ) and 50-1,200 µl tips (SafetySpaceTM filter tips) (Sartorius, catalog number: 79121F )
Confocal microscope (e.g. ZEISS, model: LSM710 or LSM780 )
TIRF microscope (e.g. Nikon Corporation)
Note: Both the Zeiss confocal and Nikon TIRF microscopes are supplied with the manufacturers image analysis software (Zen and NIS-Elements respectively) but due to the limited time users have on this equipment image analysis is usually performed on a dedicated computer work station running these software packages that are an additional purchase from the manufacturers. Free to use image analysis software (open source) packages are also routinely used. ImageJ and Fiji can be used for the confocal and TIRF images. ImageJ can be downloaded from http://imagej.nih.gov/ij and Fiji from http://fiji.sc/Fiji.
Electroporator (e.g. BIO-RAD Xcell) and 1 mm gap width cuvettes (Cell Projects, catalog number: EP-201 )
Potter-Elvehjem homogensier (Wheaton, catalog number: 358049 )
Ultracentrifuge (Beckman Coulter, model: Optima MAX-XP )
Orbitrap Mass Spectrometer (Thermo Fisher Scientific)
0.2 ml PCR strip tube with 12 wells and separate cap (VWR International, catalog number: 53509-306 )
TLA-110 rotor (Beckman Coulter)
XCell SureLock® Mini-Cell and XCell II™ blot module (Life Technologies, Novex, catalog number: EI0002 ) and power supply (Bio-Rad Laboratories, PowerPacTMHC High-Current Power Supply, catalog number: 164-5052 )
Procedure
Growing Dictyostelium cells
If possible all work with live Dictyostelium discoideum cells should be done in a 22 °C temperature controlled room. The initiation and passaging of cultures either in shaken suspension or in dishes should be done under sterile conditions in a tissue culture hood. It is very important to renew stocks every month from spores or frozen stocks stored at -80 °C or in liquid nitrogen.
Ax2 or the TSPOON null cells (HM1725 and HM1727) cells are grown in shaken suspension (22 °C, 180 rpm) in axenic medium in 250 ml or 500 ml conical flasks (seed at 0.5-2 x 105 cells/ml) and harvested in mid log phase (2-5 x 106 cells/ml). Doubling time in these conditions is normally 8-11 h.
Alternatively, cells can be grown on tissue culture plates and harvested when confluent (each plate should yield 1-2 x 107 cells) (Figure 1). This is useful when relatively few are required for confocal or TIRF microscopy.
Figure 1. A phase contrast light photomicrograph of a near confluent lawn of Dictyostelium amoebae. The cells were grown and photographed in a 10 cm tissue culture dish containing 12 ml of axenic medium. Note that there are few gaps between individual cells. The scale is shown in the bottom right.
Electroporation of Dictyostelium cells (based on Pang et al., 1999)
Harvest mid log phase cells into 50 ml sterile plastic tubes and centrifuge at 300 x g for 2-3 min to pellet the cells. Aspirate supernatant and add 50 ml of ice cold E50 buffer and resuspend the cell pellet by gently tapping and shaking the tube.
Determine the number of cells/ml using an automated cell counter or a haemocytometer.
Centrifuge at 300 x g for 2-3 min to pellet the cells and then resuspend at 4 x 107/ml in ice cold E50 buffer. Place the cell suspension on ice and incubate for 5 min (if the cells start to settle then gently mix by agitation).
For overexpression plasmids such as pJH101 (TSPOON-GFP fusion driven by the constitutively active actin15 promoter) or pDT58 and pDT61 (both contain the TSPOON-GFP fusion driven by the TSPOON promoter), transfer 0.1 ml of the cell suspension to a pre-chilled sterile electroporation cuvette (1 mm gap width) and add 10-30 µg of supercoiled plasmid DNA (preferably in ≤15 µl of Tris-HCl or TE buffer and prepared according to the manufacturer’s instructions using the HiSpeed® Plasmid Midi Kit) then mix by gently pipetting up and down avoiding introducing air bubbles to the cell suspension. Return the cuvette to ice (Figure 2).
The most common and reliable gene disruption in Dictyostelium is achieved with blasticidin S as the selective agent using a plasmid containing the resistance cassette (such as pLPBLP) flanked on either side with DNA homologous to the targeted gene (Faix et al., 2004; Faix and Kimmel, 2006). This targeting/disruption cassette should be freed from the remainder of the construct by complete digestion with restriction enzymes. To knockout TSPOON, plasmid pDT70 (based on pLPBLP) was cut with ApaI and SacII (these enzymes generate 3’ overhangs in the cut DNA but enzymes that leave 5’ overahangs e.g. BamHI or blunt cutters like PvuII can be used in any combination to liberate the disruption cassette). The enzymes where removed by a single phenol extraction followed by three extractions with chloroform and the cut DNA precipitated with ethanol (Sambrook and Russel, 2001). Resuspend the cut DNA at 2-3 mg/ml in Tris-HCl or TE buffer. Add 15-20 µg of the disruption cassette DNA to each 0.1 ml of cell suspension, again in a chilled sterile electroporation cuvette (1 mm gap width) and mix as in step B4a.
Figure 2. A photograph of the electroporation apparatus described in this protocol. In the background the BioRad Xcell is shown with the pod open and loaded with an electroporation cuvette (1cm gap width). In the ice bucket is two more cuvettes awaiting electroporation. In the foreground a tube (15 ml) containing the axenic medium that will be added (0.5 ml) after each cuvette is pulsed twice to electroporate the cell suspension within. A tissue culture dish with 6 wells each of which contains 3 ml of axenic medium is also shown and after recovery on ice for 5 min, 100 µls of the electroporated cell suspension will be added to each well of this dish.
The cell/DNA suspension should be electroporated quickly to minimise cell sedimentation in the cuvette.
Remove the cuvette from the ice and dry off any excess moisture on the electrodes with a tissue before placing in the electroporation pod.
The parameters should be set at 0.75-0.85 kV, 25 µF capacitance with resistance set at infinity (∞) for the Bio-Rad Xcell. The same parameters are used on the Bio-Rad GenePulser and GenePulserII however they may need to be optimised with electroporation devices from other manufacturers.
Deliver two pulses 5 sec apart to each cuvette and then quickly add 0.5 ml of sterile room temperature axenic medium, mix by gentle pipetting up and down and then return the cuvette to ice for 5 min.
For the selection process and screening of transformants see Faix et al. (2004); Kimmel and Faix (2006); Muller-Taubeberger et al. (2006).
Isolation of overexpression and knockout cell lines
For each cuvette prepare a 6 well tissue culture plate with 3 ml of axenic medium in each well.
Remove a cuvette from ice and resuspend the cells by gentle pipetting before adding 0.1 ml to each well of the tissue culture dish.
Incubate at 22 °C overnight (normally 16-24 h) before adding, in duplicate wells, 10 µg/ml, 20 µg/ml and 40 µg/ml G418 (for plasmids pJH101 and pDT61).
For selection with hygromycin, add 30 µg/ml, 60 µg/ml and 90 µg/ml (for pDT58).
Change the selection medium by aspiration to remove dead cells every 2-3 days and the wells should be confluent after 9-14 days. (Hygromycin appears to be less efficient at killing Dictyostelium amoebae than G418 and it is therefore important to replace the medium every 2-3 days as directed to ensure the removal of dead and dying cells that will become detached from the tissue culture plate).
The wells are screened for optimum expression by dislodging the cells by pipetting up and down and removing 0.3 ml into a single well of a chambered coverslip (8 well).
The cells are allowed to settle and attach for 20-30 min before the medium in each well is aspirated and replaced by 0.3 ml of LOFLO medium or KK2C.
The cells are then examined by confocal or TIRF microscopy for the presence and distribution of the GFP fusion protein (Figures 3 and 4).
Figure 3. Overexpression of TSPOON-GFP. The top panel are cells transfected with pDT61 (TSPOON-GFP fusion protein driven by the Tspoon promoter) and selected for 14 days in axenic medium containing 10µg/ml G418. Most cells express the fusion protein but at varying levels. The bottom panel is mock transfected cells. The cells in both panels where transferred to LoFlo medium for 30 minutes before being imaged by confocal microscopy using exactly the same image collection parameters. Note the faint autofluorescence in the mock transfected cells visible as puncta. The scale is indicated in the bottom right of the figure.
Figure 4. A TIRF image of TSPOON-GFP. The amoebae were transfected and selected as in Figure 3. Cells were transferred into KK2C (plus 50 µg/ml L-ascorbic acid) 3 h prior to image collection. The scale is indicated.
To make a permanent stock, the well(s) with the optimum expression are harvested by pipetting the axenic medium up and down to dislodge the cells which are then used to initiate a larger culture (grown with the appropriate levels of G418 or hygromycin) either in shaken suspension or several 10 cm tissue culture dishes each with 12 ml of axenic medium.
A minimum of 8 x 107 cells should be harvested and pelleted by centrifugation (300 x g for 2 min) then resuspended in 1.6 ml of freezing medium and processed as in step C23.
To isolate knockout mutants the cell suspension should be diluted to appropriate densities to ensure clonality over a range of cell survival. This is particularly important when the targeted gene affects growth because wild type non-homologous recombinants are likely then to outgrow such a knockout, making the screen and its isolation more difficult.
To ensure clonality, the cell suspension from a single cuvette is first added to a total of 15 ml of axenic medium in 50 ml plastic tube so that the cells are approximately 2.67 x 105/ml.
This cell suspension is further diluted 10 (2.67 x 104/ml), 50 (5.33 x 103/ml), 100 (2.67 x 103/ml), 200 (1.33 x 103/ml) and 400 fold (0.67 x 103/ml). Each dilution is made into a total of 15 ml of axenic medium and 100 µl/well is dispensed into a separate 96 well tissue culture plate for each dilution.
Normally 4 x 96 well plates are prepared for the 100, 200 and 400 fold dilutions so 50 ml of diluted cells should be prepared for each of these dilutions.
Incubate the plates in a moist atmosphere (such as in a large plastic cake storage box lined with wet tissues) at 22 °C overnight (normally 16-24 h) before adding 100 µl of axenic medium containing 20 µg/ml blasticidin S to each well (10 µg/ml final).
Change the selection medium to remove dead cells every 2-3 days by forcefully ‘throwing’ the medium into a large tissue lined (stops splash back into wells) container. Add 200 µl of fresh axenic medium containing 10 µg/ml of blasticidin S to each well.
Note: Plating out the cells into the 96 well plates and replenishing the medium is best achieved with a 8 channel electronic pipette fitted with tips each with a capacity of 1,200 µl. The cell suspension or fresh media is dispensed from a sterile plastic reservoir. These reservoirs can be reused after autoclaving in a steribag pouch.
The 96 well plate containing the least diluted cells should have confluent wells after 9 days whereas the plates containing the 100, 200 and 400 fold dilutions may take up to 21 days (times are average based on the use of many different knockout vectors but deletion of a gene that impairs growth in axenic medium is likely to increase these times). Dilutions are usually screened from plates where <30 wells/plate are occupied, as these are likely to be clonal.
The cells from each confluent well are harvested by pipetting up and down, then transferred to 1.5 ml microcentrifuge tube containing 0.75 ml of sterile KK2 (this is to dilute residual axenic medium after the cells are pelleted).
Refill the well with 200 µl of fresh axenic medium containing 10 µg/ml of blasticidin S. The cells are pelleted in a benchtop microfuge at full speed for 20 sec and the supernatant removed by aspiration.
Genomic DNA from the cell pellet can then be isolated using a variety of commercial kits but we prefer the Quick-gDNA MiniPrep kit from Zymo Reasearch as it is quick, has few steps and reproducibly yields good quality genomic DNA for screening by PCR using a variety of polymerases [Expand 20 kb plus polymerase (Roche) was found to be optimal for the TSPOON screen but we have also used Q5, Pwo and KOD polymerases].
In the case of the TSPOON knockout, isolation and screening took 17 days from the start of selection until confluent wells where observed in the plates containing the 200 and 400 fold dilutions.
The PCR screen used TSPOON specific primer (TCP) oligonucleotides TCP15: (5’-GATGAAATTTATCAGATATTGATTTCATGAATGTTTCACC-3’) and TCP16 (5’-CTGCTGATGTTGGTTTATAGGTGGCAAACCACCATC-3’) both of which bind outside the disruption cassette to minimise false positives generated by single crossover recombination events. The gene encoding TSPOON (tstD, DDB_G0350235) is located on chromosome 1 and is flanked by genes DDB_G0271002 and DDB_G026990. The exact genomic location of TCP15 is 1:3986383..3986422 and TCP16 is 1:3982321..3982356. All the oligonucleotide primers used in this protocol are located within these coordinates.
The PCR reactions (in 0.2 ml tubes) consisted of a total of 25 µl containing 1x Expand 20kbPLUS buffer, 0.4 nM of each primer, 5 µl of the Quick-gDNA miniprep, 500 µM dNTPs and 0.25 µl (5 units) of Expand 20kbPLUS polymerase.
The cycling parameters were step (1) 92 °C for 1 min 15 sec; (2) 92 °C for 30 sec; (3) 52 °C for 45 sec; (4) 62 °C for 7 min; (5) 62 °C for 5 min. Steps 2 to 4 were repeated a further 36 times before the reactions were held at 4 °C until analysed by gel electrophoresis (Sambrook and Russel, 2001).
The PCR product from wild-type clones is ~4.1 kb and TSPOON knockout clones ~4.7 kb.
The insertion of blasticidin resistance cassette and flanking DNA introduces restriction sites into the knockout PCR product that are absent in the wild type. This is a useful further proof of correct targeting as digestion of these products with a restriction enzyme such as SmaI for TSPOON, leaves the wild type product intact but cuts the knockout product into 3 fragments.
A total of 46 wells where screened by this method, 37 were TSPOON knockouts, 6 were wild type and 3 were not clonal as they contained both PCR products. Therefore, the targeting frequency for this the tstD gene was 80% and though high was in keeping with other genes targeted by this procedure in our laboratory such as 76% for iplA, 67% mscS, 57% mclN, 50% phdA and 12% dagA.
Four TSPOON knockouts, isolated from different 96 well plates, were processed further (2 for study and 2 as backup).
The wells containing these cells were harvested as before, the cells diluted in KK2 to 0.6-1.2 cells/µl (a confluent well contains ~105 cells).
SM agar plates were prepared each with a 0.4 ml drop of a dense suspension of Klebsiella aerogenes bacteria (Figure 5).
Figure 5. A SM agar plate covered in a lawn of Klebsiella aerogenes with Dictyostelium colonies visible. The translucent periphery of a colony consists of vegetative amoebae while at the centre fruiting bodies and other multicellular structures have formed. Colonies suitable for harvesting and freezing should be ~1 to 1.5 cm in diameter and clearly separated from neighbours. Suitable colonies in this example are indicated by the black arrowheads. Approximately 6 amoebae in 10 µl of KK2 were directly added a 400 µl drop of a dense suspension of Klebsiella aerogenes already on the plate and then evenly spread. Colonies were visible 4 days after plating and this photograph was taken after 6 days. The scale is shown in the bottom right.
Add 10 µl of the diluted cell suspension to this drop and spread evenly over the plate with a sterile plastic spreader.
Discrete colonies appear within 4-5 days and one per knockout was harvested when they had reached ~1.5 cm in diameter.
The flat end of a sterilised small metal spatula was used to transfer the entire colony directly into 1.6 ml of freezing medium within a CryoTube on ice. The CryoTubes were intermittently vortexed to ensure an even suspension and then transferred to cryo preservation module chilled to 4 °C.
The module is then transferred to a -80 °C freezer overnight and then the tubes can remain at -80 °C (cells remain viable for >2 years) or be transferred to a liquid nitrogen storage tank (indefinite viability).
Microscopy
Fixed and live cells were analysed my microscopy at the vegetative or the aggregation competent stage of development.
For live vegetative cells
Simply harvest growing cells from axenic culture and transfer an appropriate number of cells so that final density is 0.5-1.5 x 105/cm2 into a glass bottom dish or chambered coverslip containing LOFLO medium (this has been formulated to minimise background and cellular autofluorescence compared to standard axenic medium and it will keep the cells vegetative for a while) or KK2C (they will start to develop in this buffer but autofluorescence and photosensitivity will be minimised).
Incubate at 22 °C for 10 min to allow the cells to attach then aspirate the medium (do not allow the cells to dry) and replace with fresh LOFLO or KK2C. They can then be used for live cell imaging or fixed.
For developed cells
Transfer 0.5-1.5 x 105/cm2 into KK2C and replace the KK2C once the cells have attached.
Incubate at 22 °C for 8-10 h to allow the cells to become aggregation competent.
Alternatively transfer 1 x 106 cells into a 35 mm tissue culture dish containing 2 ml of KK2C, allow the cells to attach and then replace the KK2C and incubate at 22 °C for 1 h.
Transfer the dish to 15 °C overnight (15-17 h) and then return the dish to 22 °C for 1 h before transfer (at 0.5-1.5 x 105/cm2) to a glass bottom dish (the cells should aggregate within 2-3 h at 22 °C).
If larger quantities of developed cells are needed then resuspend vegetative cells at 2 x 107/ml in KK2C and transfer them into a conical flask with a volume of at least 5 times that of the cell suspension to ensure optimum aeration. The cells are shaken at 180 rpm at 22 °C for 1 h then a 100 µl droplet of KK2C, containing enough cAMP (diluted from a master stock) so that the final concentration of the entire suspension is 100 nM, is dispensed into the suspension every six minutes for 3.5-5.0 h via a programmable peristaltic pump. This procedure mimics the pulsatile waves of cAMP that are emitted through a developing population of amoebae and is useful for mutant strains defective in early development and cAMP signalling.
Harvest the cells and pellet by centrifugation 300 x g for 2 min, aspirate off the supernatant and resuspend the cells at 1 x 107/ml in KK2C and plate as before at 0.5-1.5 x 105/cm2.
There are numerous ways to fix Dictyostelium amoebae for immunocytochemistry (ICC) and they can be found elsewhere (DictyBase1 and 2, Jungbluth et al., 1994; Hagedorn et al., 2006).
Confocal laser scanning microscopy.
Live cell imaging is normally a balance between detecting the tagged fusion protein (signal to noise ratio) and damaging the cells with the laser due to free radicals produced by the illumination interacting with cellular constituents or the fluorophore tag. With a 10x or 20x lens this is never normally a problem but at these magnifications there is little or no spatial resolution within a cell to be gained given that Dictyostelium cells are ~10-15 µm in diameter.
Normally a 63x or 100x lens is needed to resolve the subcellular localisation of a tagged protein within a Dictyostelium amoeba.
Vegetative amoebae are particularly sensitive to damage especially from shorter wavelengths such as the 405 nm laser. An Argon laser (25-35 mW) is fitted to most confocal miscroscopes for imaging YFP, GFP and CFP fusion proteins and excessive power will result in phototoxicity and photobleaching so the laser strength should be kept to a minimum (normally 2-10% for the 488 nm laser line).
Longer wavelength laser lines such as 561 mn used for RFP tagged proteins present less of a problem and can be used at higher power (>15%) signal can be increased by opening the pinhole.
Avoid line averaging, slow scans and real time deconvolution.
Developed cells are usually less sensitive to laser damage but it can be fusion protein dependent. For instance a GFP tagged protein that resides in the plasma membrane may render the cells more sensitive (due to lipid oxidation in the membrane) than a cytoplasmic protein. L-Ascorbic acid (50-100 µm final) to scavenge free radicals can be added to minimise this problem and the vitamin E analogue Trolox C has also been used to this end (add 1 mM to the growth medium and incubate overnight before imaging).
If phototoxicity cannot be overcome then consider switching to a spinning disc confocal microscope (SDCM) where illumination is restricted to thousands of small confocal volumes during image acquisition rather than through the whole sample thus reducing photobleaching and phototoxicity.
To follow the movement of vegetative cells frames should be captured every 2-30 sec and for developed cells every 1-20 sec. The fastest realistic frame rate is 1/sec. It may be necessary to reduce the area scanned from the default 512 pixels x 512 pixels to 512 x 300 as this allows slower scans (better images) and maximises the frame rate (Frigault et al., 2009; Muller-Taubenberger and Ishikawa-Ankerhold, 2011).
For cells expressing the promoter_TSPOON-GFP construct typical settings used had the 488 nm laser power set at 5% and the pinhole opened up to 2.5 Airy units with a 512 pixels x 300 pixels frame collected every second. For faster temporal resolution switch to a SDCM.
With fixed cells and ICC photobleaching can be a problem but the use of an antifade mounting medium (typically Fluoromount-G®) can minimise this and allows slower scan speeds and averaging to give better images.
TIRF microscopy.
The problem of phototoxicity is usually more acute with vegetative Dictyostelium cells, in part because although the evanescent field is limited to the initial ~100 nm of the sample from the coverslip, the plasma membrane is strongly illuminated.
Image cells that have been in LOFLO or KK2C for at least one hour. The inclusion of L-Ascorbic acid may be necessary.
Keep the laser power and the illumination time to a minimum.
Since there is no scanning the frame rate is higher. A 100x lens (high NA) should be used with an additional 1.5x zoom lens if present as this allows ameobae to be imaged in great detail.
Filter all buffers (0.22 µm) to remove particulates.
Typical settings for cells expressing promoter_TSPOON-GFP construct had the 488 nm laser power set at 7% with an exposure time of 0.08 sec collecting 512 x 512 frames at up to 12 per sec.
Cell Fractionation
Cells expressing A15_GFP (control) or promoter_TSPOON-GFP were grown until they reached a density of 2-4 x 106/ml in selective media, and by microscopy >50% of cells were expressing GFP.
Starting with a maximum of 8 x 108 cells, the cells were washed in KK2 buffer and then pelleted at 300 x g for 3 min. All subsequent steps were performed at 4 °C.
The cells were resuspended in PBS with a protease inhibitor cocktail, lysed by 8 strokes of a motorized Potter–Elvehjem homogenizer (grinding chamber clearance 0.1-0.15 mm) followed by 5 strokes through a 21-g needle to ensure full lysis.
Alternatively, the cells can be resuspended at 1-5 x 108/ml and placed in a syringe fitted with a 25 mm filter holder containing a prefilter and a Nucleopore filter (3.0 µm). The cell suspension is then passed through this filter assembly twice.
The lysate was then centrifuged at 4,100 x g for 32 min to pellet nuclei and unbroken cells, and the postnuclear supernatant further centrifuged at 50,000 rpm (135,700 x g RCFmax) for 30 min in a TLA-110 rotor to recover the membrane pellet and cytosolic supernatant.
A standard protein assay was used to assess protein recovery in the 2 fractions, and volumes adjusted for equal protein.
Alternatively, to equalise volumes, the cytosolic supernatant was concentrated by precipitation with 10% tricholoroacetic acid at 4 °C for 30 min and recovered by centrifugation 14,000 x g for 10 min. Samples precipitated with trichloroacetic acid were washed with ice cold acetone (-20 °C), air dried for 2 min and then resuspended in the same volume as the pellet fractions.
Protein pulldowns
Immunoprecipitations were performed using amoebae stably expressing TSPOON-GFP under a constitutive (A15_ TSPOON-GFP) and its own promoter (prom_TSPOON-GFP), and non-transformed cells were used as a control. The amounts given here are recommended for a large scale immunoprecipitation sufficient for proteomic identification of interacting proteins under native conditions. The size of the starting culture, and all subsequent volumes can be reduced accordingly for smaller scale immunoprecipitations, for instance where the identification of proteins are made by Western blotting. The protocol can also be amended for denatured (by heat and/or the presence of SDS but are not detailed here) immunoprecipitations.
Cells were grown until they reached a density of 2-4 x 106/ml in selective media, and by microscopy >50% of cells were expressing GFP.
Up to 8 x 108 cells were pelleted by centrifugation at 300 x g for 2 min, washed twice in 50 ml of KK2 buffer before being resuspended at 2 x 107 cells/ml in KK2 buffer and starved for 4-6 h at 22 °C whilst shaking at 180 rpm.
The cells were then pelleted at 300 x g for 3 min, lysed in 4 ml PBS-T plus protease inhibitor cocktail tablet, extracted for 20 min with rotation at 8 rpm in a 15 ml tube at 4 °C, and then spun 20,000 x g for 15 min to remove debris and insoluble material.
By BCA protein assay the resulting lysate contained 10-15 mg total protein.
The lysates were precleared by adding 100 µl of PA sepharose bead slurry (50% v/v in PBS) and incubated for 30 min with rotation at 8 rpm, followed by centrifugation at 2,200 x g for 3 min to pellet beads.
The supernatant was transferred (~ 5 ml) to a fresh tube, and this is the starting material for the immunoprecipitation (protein concentration should be 2-4 mg/ml).
For maximum recovery the lysates were immunoprecipitated using an in-house antibody against GFP overnight with rotation at 4 °C, though it may be sufficient to incubate for as little as 90 min.
The appropriate antibody concentration requires individual optimization, though the recommended starting point is generally 2 to 5-fold higher than used for Western blotting.
Following incubation with anti-GFP, 50 µl PA sepharose bead slurry (50% v/v in PBS) was added for 90 min at 4 °C with rotation at 8 rpm.
An alternative would be to use a commercial source of polyclonal anti-GFP, or an anti-GFP that is already coupled to sepharose, for example GFP-TRAP that has the benefit of the antibody remaining coupled to the PA sepharose when immunoprecipitated proteins are eluted from the beads. In this case the addition of PA sepharose at this step is omitted.
The antibody complexes recovered by centrifugation 2,200 x g for 3 min, and then washed twice with 10 ml PBS-T, resuspended in 1 ml of PBS, and transferred into a 1.5 ml microfuge tube.
The antibody complexes were washed a further two times with PBS, pelleting the beads at 8,000 x g for 20 sec, and then eluted from the beads with 200 µl elution buffer warmed to 60 °C for 10 min.
The beads are then pelleted at 8,000 x g for 20 sec, and the supernatant carefully removed; this can be facilitated by using a fine gel loading tip to remove the last 50 µl as the beads do not enter the tip, or by the use a micro bio-spin chromatography column.
Eluted proteins were then precipitated with 1.2 ml acetone overnight (3-20 h) at -20 °C and centrifuged at 10,000 x g for 5 min, 4 °C. An overnight precipitation increases the yield particularly for low protein concentrations but extending it beyond this results in a lower recovery.
The supernatant is removed and the pellet air dried for 2 min and resuspended in a buffer of choice (e.g. 1x LDS sample buffer for SDS-PAGE).
For Western blotting of samples SDS-PAGE gels were run and transferred according to a standard protocol (Sambrook and Russel, 2001).
For proteomics, the samples were run on pre-cast NuPAGE 4-12% Bis-Tris gels, stained with Coomassie G-250 SimplyBlue SafeStain and then cut into 8 gel slices. Each gel slice was processed by filter-aided sample preparation solution digest, and the sample was analyzed by liquid chromatography–tandem mass spectrometry in an Orbitrap mass spectrometer.
Proteins that came down in the non-transformed control were eliminated, as were any proteins with less than 5 identified peptides, proteins that did not consistently coimmunoprecipitate in three independent experiments, or proteins of very low abundance compared with the bait (i.e., molar ratios of <0.002). The remaining proteins were considered to be specifically immunoprecipitated.
Recipes
Axenic medium
35.5 g HL5 with glucose
200 mg dihydrostreptomycin
Note: Do not use streptomycin as it is inactivated during autoclaving.
Add ultrapure dH2O to 1,000 ml
Dispense into conical flasks
75 ml/250 ml flask stoppered with 50 mm x 38 mm foam bung
150 ml/500 ml flask stoppered with 50 mm x 38 mm foam bung
750 ml/ 2,000 ml flask stoppered with 50 mm x 50 mm foam bung
The top of each flask should be covered over with a small piece (12 cm x 12 cm) of aluminium foil to prevent the top of the stopper being contaminated by dust during storage
Autoclave to sterilise
Note: 121 °C for no longer than 15 min and remove from the autoclave as soon as possible to avoid caramelisation i.e. the media turning dark brown in colour. With larger more sophisticated autoclaves with extra safety features that extend the cycle time then this may have to be reduced to as low as 7 min.
Alternatively filter sterilise (Steritop 1,000 ml unit, 0.22 µm) into sterile 1,000 ml Duran bottles or use a 1,000 ml Corning filter unit (0.22 µm)
Stored in the dark at 22 °C
LOFLO medium
8.4 g LOFLO medium
100 mg dihydrostreptomycin
Add ultrapure dH2O to 500 ml
Filter sterilise (0.22 µm) using a 500 ml Stericup filter unit
Store in the dark at 22 °C (short term) or 4 °C (long term)
SM agar
41.7 g SM agar
Add ultrapure dH2O to 1,000 ml
Autoclave to sterilise
Note: 121 °C for no longer than 15 min and remove from the autoclave as soon as possible to avoid caramelisation. With larger more sophisticated autoclaves with extra safety features that extend the cycle time then this may have to be reduced to as low as 7 minutes.
Cool to 60 °C in a heated water bath prior to pouring 25-30 ml per 10 cm diameter plastic petridish
Once the agar has set and cooled place the dishes in an airtight box or seal up in batches (15-20 plates) in plastic bags (use the bags the dishes were packed in) to minimise desiccation
Stored in the dark at 22 °C (short term <1 week) or 4 °C (long term)
SM broth
24.7 g SM broth
Add ultrapure dH2O to 1,000 ml
Dispense 10 ml into each 20 ml Universal bottle
Autoclave to sterilise
Note: 121 °C for no longer than 15 min and remove from the autoclave as soon as possible to avoid caramelisation. With larger more sophisticated autoclaves with extra safety features that extend the cycle time then this may have to be reduced to as low as 7 min.
Stored in the dark at 22 °C
KK2 buffer
2.24 g KH2PO4
0.52 g K2HPO4, anhydrous
Add ultrapure dH2O to 1,000 ml
Autoclave to sterilise in 1,000 ml Duran bottles (121 °C for 15 min)
pH after autoclaving should be ~6.1
Add 2 ml of sterile 1 M MgSO4
Stored at 22 °C
KK2C buffer
1,000 ml of sterile KK2
0.1 ml of sterile 1 M CaCl2
Stored at 22 °C
1 M MgSO4
246.48 g MgSO4
Add ultrapure dH2O to 1,000 ml
Autoclave to sterilise in 150 ml Duran bottles (121 °C for 15 min)
Stored at 22 °C
1 M CaCl2
147.02 g CaCl2
Add ultrapure dH2O to 1,000 ml
Autoclave to sterilise in 150 ml Duran bottles (121 °C for 15 min)
Stored at 22 °C
Dense suspension of Klebsiella aerogenes
Prepare a SM agar plate with Klebsiella streaked out on it so that there are individual colonies (stored at 8 °C and renew every 2 months from frozen stocks)
Pick a colony with a flame sterilised platinum loop (or a disposable sterile plastic needle or plastic loop) and use this to seed a universal bottle containing SM broth
Incubate the bottle for 48 h at 22 °C and vortex before using
Stored in the dark at 8 °C
Renew every month
Electroporation buffer E50
2.38 g HEPES
1.86 g KCl
0.29 g NaCl
0.5 ml of 1 M MgSO4
0.21 g NaHCO3
0.08 g NaH2PO4.2dH2O
Add ultrapure dH2O to 500 ml
Adjust to pH 7.0 with KOH
Filter sterilise (0.22 µm) using a 500 ml Stericup filter unit and stored at 4 °C
Tris-HCl buffer
0.12 g Trizma® base
Add ultrapure dH2O to 100 ml
Adjust to pH 8.0 with HCl
Autoclave to sterilise in a 150 ml Duran bottle
Stored at 22 °C
TE buffer
0.12 g Trizma® base
0.04 g EDTA
Add ultrapure dH2O to 100 ml
Adjust to pH 8.0 with HCl
Autoclave to sterilise in a 150 ml Duran bottle
Stored at 22 °C
20 mg/ml G418
552 mg Geneticin® G418 sulphate adjusted for a potency of 724 µg/mg
Note: Potency varies from batch to batch.
Add ultrapure dH2O to 20 ml
Filter sterilise with 20 ml syringe fitted with a 0.22 µm syringe filter
Stored at -20 °C in 1 ml aliquots in sterile 1.5 ml microfuge tubes the G418 solution retains its potency for >2 years. Working stocks should be stored at 4oC and used within 6 months
Freezing medium
150 ml horse serum
11.25 ml [7.5% (v/v)] DMSO
Filter sterilise (0.22 µm) using a 150 ml Stericup filter unit
Aliquot into sterile 50 ml tubes and stored at -20 °C and should be used within 1 year
50 mM L-Ascorbic
0.22 g L-Ascorbic
Add ultrapure dH2O to 25 ml
Filter with 50 ml syringe fitted with a 0.22 µm syringe filter to remove particulates
Stored in 0.5 ml aliquots at -20 °C
Master stock of cAMP
6.6 g cAMP
Add ultrapure dH2O to 95 ml
Adjust to pH 7.0 very carefully with KOH (Note: All the cAMP will not dissolve until the pH <5)
Add ultrapure dH2O to final volume of 100 ml
Filter sterilise (0.22 µm) using a 150 ml Stericup filter unit and stored in 20 ml aliquots at -20 °C
PBS
8.01 g NaCl
0.20 g KCl
1.42 g Na2HPO4, anhydrous
0.24 g KH2PO4
Add ultrapure dH2O to 1,000 ml
Autoclave in 500 ml Duran bottles to sterilise (121 °C for 15 min)
Stored at 22 °C
PBS-T
PBS adjusted to 1% Triton X-100, using a 10% Triton stock solution
Filter sterilise for long term storage (0.22 µm)
Stored at 22 °C or 4 °C (long term storage)
Trichloroacetic acid
100 g trichloroacetic acid
Dissolve in 35 ml ultrapure dH2O
Then make up to 100ml with ultrapure dH2O
Stored at 22 °C
Elution buffer
1.21 g Trizma® base
Add ultrapure dH2O to 75 ml
20 ml SDS 2% (w/v) from 10% solution
Adjust to pH 8.0 with HCl
Add ultrapure dH2O to a final volume of 100 ml
Filter sterilise (0.22 µm) using a 150 ml Stericup filter unit and stored in 1 ml aliquots at
-20 °C
Acknowledgments
This study was supported by the Medical Research Council [(MC_U105115237), DT and RRK] and the The Wellcome Trust (JH) .The electroporation of Dictyostelium amoebae is based on the method of Pang, Lynes and Knecht (Pang et al., 1999).
References
Bloomfield, G., Tanaka, Y., Skelton, J., Ivens, A. and Kay, R. R. (2008). Widespread duplications in the genomes of laboratory stocks of Dictyostelium discoideum. Genome Biol 9(4): R75.
DictyBase 1 http://www.dictybase.org/techniques/geneex/indirect_immunofluo.html.
DictyBase 2 http://www.dictybase.org/techniques/microscopy/fixation_rgomer.html.
Faix, J., Kreppel, L., Shaulsky, G., Schleicher, M. and Kimmel, A. R. (2004). A rapid and efficient method to generate multiple gene disruptions in Dictyostelium discoideum using a single selectable marker and the Cre-loxP system. Nucleic Acids Res 32(19): e143.
Hagedorn, M., Neuhaus, E. M. and Soldati, T. (2006). Optimized fixation and immunofluorescence staining methods for Dictyostelium cells. Methods Mol Biol 346: 327-338.
Hirst, J., Schlacht, A., Norcott, J. P., Traynor, D., Bloomfield, G., Antrobus, R., Kay, R. R., Dacks, J. B. and Robinson, M. S. (2014). Characterization of TSET, an ancient and widespread membrane trafficking complex. Elife 3: e02866.
Jungbluth, A., von Arnim, V., Biegelmann, E., Humbel, B., Schweiger, A. and Gerisch, G. (1994). Strong increase in the tyrosine phosphorylation of actin upon inhibition of oxidative phosphorylation: correlation with reversible rearrangements in the actin skeleton of Dictyostelium cells. J Cell Sci 107 ( Pt 1): 117-125.
Kimmel, A. R. and Faix, J. (2006). Generation of multiple knockout mutants using the Cre-loxP system. Methods Mol Biol 346: 187-199.
Muller-Taubenberger, A. (2006). Application of fluorescent protein tags as reporters in live-cell imaging studies. Methods Mol Biol 346: 229-246.
Muller-Taubenberger, A. and Ishikawa-Ankerhold, H. C. (2013). Fluorescent reporters and methods to analyze fluorescent signals. Methods Mol Biol 983: 93-112.
Muller-Taubenberger, A., Kortholt, A. and Eichinger, L. (2013). Simple system--substantial share: the use of Dictyostelium in cell biology and molecular medicine. Eur J Cell Biol 92(2): 45-53.
Pang, K. M., Lynes, M. A. and Knecht, D. A. (1999). Variables controlling the expression level of exogenous genes in Dictyostelium. Plasmid 41(3): 187-197.
Sambrook, J. and Russel, D. W. (2001). Molecular cloning: A laboratory manual. Third edition. Cold Spring Harbor.
Copyright: Hirst et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Hirst, J., Kay, R. R. and Traynor, D. (2015). Dictyostelium Cultivation, Transfection, Microscopy and Fractionation. Bio-protocol 5(11): e1485. DOI: 10.21769/BioProtoc.1485.
Hirst, J., Schlacht, A., Norcott, J. P., Traynor, D., Bloomfield, G., Antrobus, R., Kay, R. R., Dacks, J. B. and Robinson, M. S. (2014). Characterization of TSET, an ancient and widespread membrane trafficking complex. Elife 3: e02866.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fixed-cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,486 | https://bio-protocol.org/exchange/protocoldetail?id=1486&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Magnaporthe oryzae Inoculation of Rice Seedlings by Spraying with a Spore Suspension
Aya Akagi
CJ Chang-Jie Jiang
Hiroshi Takatsuji
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1486 Views: 14725
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Fungal blast caused by Magnaporthe oryzae (M. oryzae) leads to a serious yield loss of rice. Appropriate assessment of disease occurrence is necessary to investigate the nature of the disease and plant strategies to resist the disease. We describe our assay method of disease severity of M. oryzae on intact rice leaves grown on soil.
Keywords: Rice Magnaporthe oryzae Inoculation
Materials and Reagents
Fungal blast (Magnaporthe oryzae) stocks (NIAS Genbank, http://www.gene.affrc.go.jp/index_en.php)
Oat meal agar plates (9 cm diameter) (Difco oatmeal agar; Difco)
Rice (Oryza sativa subsp. japonica) seeds
Soil (Bonsol No.2; Sumitomo Chemical Co., Ltd. http://www.sumitomo-chem.co.jp/)
Sterilized water
Equipment
Bacteria spreader
Conical plastic tubes (50 ml) (Greiner)
Eppendorf tubes (1.5 ml) (Eppendorf)
Filter paper (Advantec)
Fungal growth cabinet with black fluorescent lights (Toshiba, model: FL15BLB )
Glass funnel
Hemocytometer (Fuchs-Rosenthal, Hirschmann EM Techcolor)
KimWipe (Nippon Paper Crecia Co., Ltd., model: Wiper S-200 )
Microscope (Leica Microsystems)
Petri dishes (9 cm diameter)
Sprayer (Figure 1C; Tokyo Koyama Plastic, Co., Ltd., model: K380 )
Sterilized painting brush (Figure 1B)
Dew chamber (Ozawa corporation, model: 513A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Akagi, A., Jiang, C. and Takatsuji, H. (2015). Magnaporthe oryzae Inoculation of Rice Seedlings by Spraying with a Spore Suspension. Bio-protocol 5(11): e1486. DOI: 10.21769/BioProtoc.1486.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,487 | https://bio-protocol.org/exchange/protocoldetail?id=1487&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Damage Sensitivity Assays in Caenorhabditis elegans
Hyun-Min Kim
MC Monica P. Colaiácovo
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1487 Views: 11951
Edited by: Peichuan Zhang
Reviewed by: Michael EnosMohlopheni Marakalala
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
C. elegans has served as a genetically tractable multicellular model system to examine DNA damage-induced genotoxic stress which threatens genome integrity. Importantly, the high degree of conservation shared between worms and humans offers the advantage that findings about DNA damage-induced cell cycle arrest/checkpoint response and DNA double-strand break repair in worms are applicable to human studies. Here, we describe simple DNA damage sensitivity assays to quantify the response of C. elegans to diverse types of DNA damaging agents. These assays have provided important insights into the mechanisms of function for factors such as ZTF-8 that are involved in DNA damage repair and response in the C. elegans germline. These DNA damage sensitivity assays rely on the straightforward readouts of either egg or larval lethality and involve the use of various DNA damaging agents. We use γ-irradiation (γ-IR), which produces DNA double-strand breaks (DSBs), camptothecin (CPT), which induces single-strand breaks, nitrogen mustard (HN2), which produces interstrand crosslinks (ICLs), hydroxyurea (HU), which results in replication fork arrest thus preventing DNA synthesis, and UV-C, which causes photoproducts (pyrimidine dimers). See Table 1. Comparisons between the relative sensitivity/resistance observed in, for example, mutants compared to wild type, for various DNA damaging agents allows for inferences regarding potential repair pathways being affected.
Keywords: DNA damage C. elegans DNA repair Genotoxin Germline
Materials and Reagents
E.coli OP50 (Carolina, catalog number 155073 )
M9 (He, 2011)
NGM agar media (He, 2011)
M9 500 ml + Triton X-100 50 μl
Mechlorethamine hydrochloride (Sigma-Aldrich, catalog number 122564 )
Camptothecin (Sigma-Aldrich, catalog number C9911 )
Hydroxyurea (Sigma-Aldrich, catalog number H8627 )
Triton X-100 (Sigma-Aldrich, catalog number T8787 )
20% Alkaline Hypochlorite Solution (see Recipes)
Equipment
24-well plates (OLYMPUS, catalog number 25-102 )
Short tip disposable glass Pasteur pipets (VWR International, catalog number 14673-010 )
Petri dishes (60 x 15 mm) (VWR International, catalog number 25384-092 )
Sealing film (Parafilm M, catalog number: PM996 )
Nutator mixer (Clay Adams, model: 1105 Mixer )
20 °C incubator (Thermo Fisher Scientific, Precision 815)
37 °C shaking incubator (New Brunswick, Innova 4330 )
37 °C incubator ((VWR Internationa, 1510E)
Benchtop centrifuge for spinning 15 ml tubes (Lanmet, Hermle Z, model: 400K )
Stereo microscope (Leica Microsystems, model: MZ75 )
UV crosslinker (Stratagene, model: 2400 Stratalinker) with 254 nm UV bulbs
γ-IR irradiator (Shepherd & Associates, Mark 1 Cs137 irradiator)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,488 | https://bio-protocol.org/exchange/protocoldetail?id=1488&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Simple Digital Photography for Assessing Biomass and Leaf Area Index in Cereals
Jaume Casadesús
Dolors Villegas
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1488 Views: 11446
Edited by: Samik Bhattacharya
Reviewed by: Maria SinetovaJoern Klinkenberg
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
These instructions refer to obtaining fast and low-labour estimates of ground cover, leaf area index and green biomass for a large number of plots, as those encountered in cereal breeding programs. The procedure includes obtaining the pictures in the field and processing them once downloaded to a computer.
Keywords: Image processing Biomass assessment Non-destructive methods Leaf Area Index
Materials and Reagents
Crop
Note: The crop must be free of green weeds. The presence of spikes, flowers, etc. on the external part of the canopy may require using a specific calibration curve for that development stage.
Equipment
Conventional digital camera.
Note: This is the only equipment required once the method has been calibrated for a range of crops similar to those where it has to be applied. Any commercial camera, compact or reflex, is suitable.
A digital area meter is required for calibrating leaf area index (LAI, e.g. DIAS II, Delta-T Devices)
A drying oven is required for calibrating biomass (e.g. Memmert, model: 800 , minimum precision required: 2 °C)
A precision balance is required for calibrating biomass (e.g. Mettler Toledo, model: PB3002-L , minimum precision required: 0.1 g)
Software
Image processing software that allows quantifying the average colour of the whole picture
Note: The program BreedPix 2.0 described in Casadesús and Villegas (2014) is a suitable tool for processing a large number of pictures with the minimal required steps by the user. It can be obtained for free from the authors. General-purpose free software for quantitative image analysis (such as ImageJ or Fiji) can also be used but in this case a macro should be written specifically for this protocol.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Casadesús, J. and Villegas, D. (2015). Simple Digital Photography for Assessing Biomass and Leaf Area Index in Cereals. Bio-protocol 5(11): e1488. DOI: 10.21769/BioProtoc.1488.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Phenotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,489 | https://bio-protocol.org/exchange/protocoldetail?id=1489&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FRAP Analysis of LET-23::GFP in the Vulval Epithelial Cells of Living Caenorhabditis elegans Larvae
MW Michael Walser
AH Alex Hajnal
JE Juan M. Escobar-Restrepo
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1489 Views: 8431
Edited by: Peichuan Zhang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The Caenorhabditis elegans (C. elegans) vulva is a well-established system to study organ development as the molecular mechanisms that govern its formation are conserved in animals. Of special interest is the EGFR/RAS/MAPK signaling pathway that is required for fate acquisition and morphogenesis of the vulva. let-23 encodes the sole homologue of the epidermal growth factor receptor (EGFR), is expressed at the plasma membrane of the vulval precursor cells (VPCs) and is activated by LIN-3 EGF at the end of the L3 larval stage to initiate vulva development. LET-23 activity can be modulated through altering its subcellular and plasma membrane localization. To study the trafficking of EGF receptor in a living organism, we created a functional LET-23::GFP translational reporter worm line (Haag et al., 2014) and quantified the mobile fraction of LET-23::GFP at the basolateral membrane of the VPCs by fluorescence recovery after photobleaching (FRAP). Here we describe the protocol for LET-23::GFP FRAP at the basolateral membrane of the VPCs and the data analysis using FIJI (ImageJ).
Materials and Reagents
C. elegans strain zhIs038 [let-23::gfp; unc-119(+)] (Haag et al., 2014)
Note: For information on maintenance of C. elegans: http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html.
4% agarose pads (for an example see http://www.wormatlas.org/agarpad.html by Monica Driscoll)
M9 solution with 20 mM tetramisole hydrochloride (anesthetic)
M9 buffer for C. elegans (see Recipes)
Equipment
Standard microscopy slides and 18 x 18 cover slips
Zeiss LSM710 confocal microscope equipped with 458/488/514 nm argon laser
Computer with FIJI (ImageJ. National Institutes of Health) and appropriate Plugins for FRAP analysis (see below)
Software
LSM710 ZEN software (ZEISS)
FIJI (Image J) (National Institutes of Health)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Walser, M., Hajnal, A. and Escobar-Restrepo, J. M. (2015). FRAP Analysis of LET-23::GFP in the Vulval Epithelial Cells of Living Caenorhabditis elegans Larvae. Bio-protocol 5(11): e1489. DOI: 10.21769/BioProtoc.1489.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
149 | https://bio-protocol.org/exchange/protocoldetail?id=149&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Microglia Cultures and Mixed Glial Culture
HG Huiming Gao
Published: Nov 5, 2011
DOI: 10.21769/BioProtoc.149 Views: 19356
Download PDF
Ask a question
Favorite
Cited by
Abstract
Primary rodent microglia-enriched cultures are the most popular model to study microglial biology in vitro and to explore immune signaling pathways. Mixed glial cultures that contain microglia and astroglia are very useful for investigating the precise mechanisms of microglia-astroglia interaction during immune reaction. This protocol has been developed and improved over the years by various researchers in Dr. Hong’s lab, especially Dr. Bin Liu.
Materials and Reagents
Poly-D-lysine (Sigma-Aldrich, catalog number: P7280 )
DMEM/F12 (Life Technologies, InvitrogenTM, catalog number: 11330-032 )
D-Glucose
Sterile water
Sterile PBS
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
Non-essential amino acids (100 ml) (Life Technologies, Gibco®, catalog number: 11140-050 )
Sodium pyruvate (100 ml) (Sigma-Aldrich, catalog number: S8636 )
200 mM L-glutamine (100 ml) (Life Technologies, Gibco®, catalog number: 25030-081 )
Penicillin/streptomycin (100 ml) (Sigma-Aldrich, catalog number: P0781 )
DMEM/F12-based culture medium (see Recipes)
Poly-D-lysine stock solution (see Recipes)
Treatment medium (see Recipes)
Equipment
Cell culture incubator
Centrifuges
Dissection microscope
Scissors and forceps
T175 flasks
70 µm nylon filter (sterile)
50 ml tube
Sterile filter (0.2 µm)
Foil
Laminar hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,490 | https://bio-protocol.org/exchange/protocoldetail?id=1490&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Net High-affinity Urea Uptake in Maize Plants
Laura Zanin
NT Nicola Tomasi
RP Roberto Pinton
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1490 Views: 8503
Edited by: Samik Bhattacharya
Reviewed by: Sriema L. Walawage
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Despite its extensive use as a nitrogen fertilizer, the role of urea as a directly accessible nitrogen source for crop plants is still poorly understood. So far, the physiological and molecular aspects of urea acquisition have been investigated only in a few plant species highlighting the importance of a urea transporter in roots, DUR3 (Kojima et al., 2007; Wang et al., 2012; Zanin et al., 2014a). Regarding maize plants, a crop that needs a large amount of urea fertilizer, the capability to take up urea via an inducible and high-affinity transport system has been recently characterized (Zanin et al., 2014a; Zanin et al., 2014b). Here, we described a small-scale protocol suitable for the measurement of urea net high-affinity uptake in roots of intact maize plants.
Keywords: Transport Nitrogen Root Corn Method
Materials and Reagents
Maize seeds (Zea mays L., cv. PR33T56, Pioneer Hi-bred Italia S.p.A., Parma, Italy)
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 60370 )
Calcium sulphate (CaSO4) (Sigma-Aldrich, catalog number: 12090 )
Urea [CO(NH2)2] (Sigma-Aldrich, catalog number: 15604 )
Diacetylmonoxime [CH3C(=NOH)COCH3] (Sigma-Aldrich, catalog number: 31550 )
Thiosemicarbazide (NH2CSNHNH2) (Sigma-Aldrich, catalog number: 89050 )
Sulphuric acid (H2SO4) (Sigma-Aldrich, catalog number: 320501 )
Ortho-phosphoric acid (H3PO4) (Sigma-Aldrich, catalog number: W290017 )
Ferric chloride hexahydrate (FeCl3) (Sigma-Aldrich, catalog number: 12319 )
Sterile deionized water
KCl (Sigma-Aldrich, catalog number: P9541 )
CaSO4 (Sigma-Aldrich, catalog number: 12090 )
MgSO4 (Sigma-Aldrich, catalog number: 746452 )
KH2PO4 (Sigma-Aldrich, catalog number: P9791 )
NaFe-EDTA (Sigma-Aldrich, catalog number: 03650 )
H3BO3 (Sigma-Aldrich, catalog number: B7901 )
MnSO4 (Sigma-Aldrich, catalog number: 221287 )
ZnSO4 (Sigma-Aldrich, catalog number: Z1001 )
CuSO4 (Sigma-Aldrich, catalog number: C3036 )
Na2MoO4 (Sigma-Aldrich, catalog number: M1651 )
Nutrient solution (see Recipes)
Urea solution stock (see Recipes)
Mixed colour reagent (see Recipes)
Mixed acid reagent (see Recipes)
Colour development reagent (see Recipes)
Equipment
Growth chamber and hydroponic growing system (including plastic net, plastic pots)
pH meter (Jenway, model: 3510 )
Plastic box (15 x 10 cm; H 4 cm; Figure 1A, alternatively you can use the bottom of the pipette tips, Sigma-Aldrich, catalog number: P5161 )
0.2 ml 96-well plate (AB ANALITICA Advanced Biomedicine, catalog number: B50601 ; Figure 1B)
Clear 96-well microplate with flat bottoms (STARLAB, catalog number: S1837-9600 ; Figure 1C)
Sealing tapes, optically clear (SARSTEDT AG, catalog number: 95.1994 )
Thermocycler (Eppendorf, model: Mastercycler® personal )
Orbital shaker (Janke & Kunkel IKA-Labortechnik, model: KS 501D )
Spectrophotometric multiwell plate reader (TECAN, model: GENios Microplate Reader )
Timer
Pipettes (Eppendorf, model: 0.5-10 μl, 20-200 μl, 100-1,000 μl, Eppendorf Reference® 2 ) and tips
1.5 ml plastic tubes (Eppendorf, catalog number: 0030 125.150 )
Absorbent paper (Sigma-Aldrich, catalog number: Z270849 )
Figure 1. Plastic equipment. A. plastic box; B. 0.2 ml 96-well plate; C. Clear 96-well microplate.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zanin, L., Tomasi, N. and Pinton, R. (2015). Measurement of Net High-affinity Urea Uptake in Maize Plants. Bio-protocol 5(11): e1490. DOI: 10.21769/BioProtoc.1490.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Plant Science > Plant metabolism > Nitrogen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,491 | https://bio-protocol.org/exchange/protocoldetail?id=1491&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Identification of T Cell Stimulatory Self-lipid Antigens
ML Marco Lepore
SS Sebastiano Sansano
CL Claudia de Lalla
PD Paolo Dellabona
GC Giulia Casorati
GL Gennaro De Libero
LM Lucia Mori
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1491 Views: 9385
Reviewed by: Savita NairRamalingam Bethunaickan
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Autoreactive T cells restricted to CD1 molecules and specific for endogenous lipids are abundant in human blood (de Jong et al., 2010; de Lalla et al., 2011). A few self-lipid molecules recognized by diverse individual T cell clones and accumulated within APCs following stress signals or cell transformation have been identified so far (de Jong et al., 2010; Chang et al., 2008; Lepore et al., 2014). These findings suggested that auto-reactive CD1-restricted T cells display broad lipid specificities and may play critical roles in different types of immune responses including cancer immune surveillance, autoimmunity and antimicrobial immunity. Therefore, the identification of the repertoire of self-lipid molecules recognized by T cells is important to study the physiologic functions of this T cell population and to assess their therapeutic potential (Lepore et al., 2014). Here we describe the protocol we established to isolate and identify endogenous lipids derived from leukemia cells, which stimulate specific autoreactive CD1c-restricted T lymphocytes (Lepore et al., 2014). This protocol can be applied to isolate lipid antigens from any type of target cells and to investigate the self-lipid antigen specificity of autoreactive T cells restricted to all CD1 isoforms (Facciotti et al., 2012).
Keywords: Self-lipid antigens CD1 Autoreactive T cells
Materials and Reagents
Autoreactive CD1-restricted T cell clones (generated as described in de Lalla et al. 2011)
THP-1 cells (ATCC TIB-202TM, or other target cells able to stimulate the T cell clones in a CD1-dependent manner and in the absence of exogenously provided antigens)
Antigen presenting cells (APCs) expressing relevant CD1 isoforms and per se poorly stimulating autoreactive T cell
RPMI 1640 (Amimed, catalog number: 1-41F01-I )
Stable glutamine (Amimed, catalog number: 5-10K50-H )
Sodium pyruvate (Amimed, catalog number: 5-60F00-H )
Non essential amino acids (Amimed, catalog number: 5-13K00-H )
Kanamycin (Amimed, catalog number: 4-08F00-H )
Fetal bovine serum (Lonza, catalog number: DE14-802F )
PBS without Ca2+ and Mg2+ (Amimed, catalog number: 3-05F29-I )
ELISA
MAb pairs: Purified anti-human GM-CSF (BioLegend, catalog number: 502202 ), biotin-conjugated anti-human GM-CSF (BioLegend, catalog number: 502304 ); purified anti-human IFN-γ (BioLegend, catalog number: 50750 ), biotin-conjugated anti-IFN-γ (BioLegend, catalog number: 502504 )
HRP-streptavidin (BioLegend, catalog number: 405210 )
OPD SIGMAFAST (Sigma-Aldrich, catalog number: P9187-50SET )
Cytokine standards: Recombinant human GM-CSF (BioLegend, catalog number: 572409 ), recombinant human IFN-γ (BioLegend, catalog number: 570209 )
Anti-CD1 blocking antibodies (anti-CD1c mAb) (Abcam, catalog number: ab18216-100 )
Anti-human CD19 mAbs (Miltenyi Biotec, catalog number: 130-097-055 )
Methanol (Applichem, catalog number: A0688, 2500PE )
Chloroform (Applichem, catalog number: A1585, 1000 )
Ethyl acetate (Merck KGaA, catalog number: 1.00868.1000 )
1-Butanol (Sigma-Aldrich, catalog number: 34867 )
Diisopropyl ether (Sigma-Aldrich, catalog number: 3827-IL-F )
Isopropanol (Applichem, catalog number: A1592.2500 )
Acetic acid (Applichem, catalog number: A2354.0500 )
Acetone (Applichem, catalog number: A1567.2500 )
Acetonitrile (Riedel-De Haen, catalog number: 34967 )
Hexane (Sigma-Aldrich, catalog number: 34994 )
HCl 37% fuming (Merck KGaA, catalog number: 317.1000 )
Formic acid (Merck KGaA, catalog number: 1.11670.1000 )
Ammonium acetate (Sigma-Aldrich, catalog number: A1542 )
H2O (Sigma-Aldrich, catalog number: 95304 )
Water-saturated butanol (see Recipes)
Elution solutions for lipid fractionation on amino-cartridge (see Recipes)
Complete medium (see Recipes)
Equipment
Aminopropyl cartridges (SEP-PAK Vac 6 cc, 500 mg NH2 cartridges) (Waters Corporation, catalog number: WAT200606)
HPLC system (Jasco)
Nucleodur C18 Pyramid end-capped column (3-μm particle size, 3-mm ID, 125-mm length) (Macherey-Nagel, catalog number: N9040986 )
Automated fraction collector (Gilson, catalog number: FC203B )
Glass conical tubes (30 ml and 1 ml volumes, Glass Keller)
Glass pipettes (Pirex)
96 wells flat bottom culture plates (BD Biosciences, Falcon®, catalog number: 353075 )
96 wells ELISA immune-plates (Maxisorp, Nunc, catalog number: 439454 )
Humidified CO2 cell culture incubator (Heraeus, Hera cell 150)
Spectrophotometer/ELISA Reader (Synergy H1 Hybrid Reader, BioTek Instruments)
Sonicator (Sonics, Vibra Cell)
Rotating wheel (Labinco BV, catalog number: 76000 )
Manometer-regulated N2 gas tank (Carba gas)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lepore, M., Sansano, S., Lalla, C. D., Dellabona, P., Casorati, G., Libero, G. D. and Mori, L. (2015). Extraction and Identification of T Cell Stimulatory Self-lipid Antigens. Bio-protocol 5(11): e1491. DOI: 10.21769/BioProtoc.1491.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,492 | https://bio-protocol.org/exchange/protocoldetail?id=1492&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Total and 2-LTR (Long terminal repeat) HIV DNA, HIV RNA and Herpesvirus DNA in PBMCs
Marta Massanella
Sara Gianella
SL Steven M. Lada
DR Douglas D. Richman
MS Matthew C. Strain
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1492 Views: 13126
Reviewed by: Vaibhav B ShahVamseedhar Rayaprolu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Almost all individuals infected with human immunodeficiency virus (HIV) are also infected with cytomegalovirus (CMV) and Epstein Barr virus (EBV). The aims of our studies have included characterizing and measuring the latent HIV reservoir and understanding the association between asymptomatic replication of CMV (and other herpesvirus, including EBV) and this HIV reservoir (Gianella et al., 2014). This protocol was designed to simultaneously co-extract DNA and RNA from the same peripheral blood mononuclear cell (PBMC) aliquot and quantify HIV, CMV and EBV DNA, as well as HIV RNA using droplet digital PCR (ddPCR).
For collection and processing of male genital secretions and quantification of HIV RNA and DNA from seven human herpesviruses from seminal plasma, refer to protocol “Quantification of HIV RNA and Human Herpesvirus DNA in Seminal Plasma” (Vargas-Meneses et al., 2015).
Keywords: HIV reservoir Droplet Digital PCR (ddPCR) CMV EBV
Materials and Reagents
Cell processing and flow cytometry
1x Dulbecco’s phosphate buffered saline (DPBS) (Corning, catalog number: 21-031-CV )
RPMI 1640 medium (Life Technologies, Gibco®, catalog number: 11875-093 )
GemCell U.S. origin fetal bovine serum (FBS) (Gemini Bio Products, catalog number: 100-500 )
37% formaldehyde solution (Sigma-Aldrich, catalog number: F8775-500ML )
Sodium azide Reagents Plus (NaN3) (Sigma-Aldrich, catalog number: S2002-25G )
Antibodies
CD3-APC (BD, catalog number: 340440 )
CD4-FITC (BD, catalog number: 347413 )
CD45-PerCP-Cy5.5 (BD, catalog number: 340953 )
AllPrep DNA/RNA Mini Kit (QIAGEN, catalog number: 80204 )
Staining flow cytometry buffer (staining buffer) (see Recipes)
1% formaldehyde (1% FA) buffer (see Recipes)
RLT plus buffer + β-ME (see Recipes) (included in the AllPrep DNA/RNA Mini Kit)
70% ethanol buffer (see Recipes)
10 mM Tris elution buffer (see Recipes)
DNA/RNA co-extraction and DNA precipitation
RNase-free DNase set (QIAGEN, catalog number: 79254 )
AllPrep DNA/RNA Mini Kit (QIAGEN, catalog number: 80204)
Molecular biology grade sterile purified water (RNase, DNase, proteinase free)
Ethyl alcohol pure (200 Proof molecular biology grade) (Sigma-Aldrich, catalog number: E7023 )
3 M NaOAc (sodium acetate) (Affymetrix, catalog number: 75897 )
UltraPure glycogen (Life Technologies, catalog number: 10814010 ) (concentration: 20 µg/µl)
2-Mercaptoethanol (β-ME) (Life Technologies, Gibco®, catalog number: 21985-023 )
Tris hydrochloride (1 M solution pH 8.0 molecular biology grade) (Thermo Fisher Scientific, catalog number: BP1758-500 )
RNase-free DNase set (see Recipes)
ddPCR
Ban-II restriction enzyme (New England Biolabs, catalog number: R0119L )
Primers and probes (Table 1, IDT.) (Final PCR concentration: 900 nM primer, 250 nM probe)
iScript advanced cDNA synthesis kit (Bio-Rad Laboratories, catalog number: 172-5038 )
ddPCR supermix for probes (no dUTP) (Bio-Rad Laboratories, catalog number: 1863024 )
Droplet generator cartridges and gaskets (Bio-Rad Laboratories, catalog number: 1864007 )
Droplet generator oil (Bio-Rad Laboratories, catalog number: 1863005 )
Droplet reader oil (Bio-Rad Laboratories, catalog number: 1863004 )
2x buffer control (Bio-Rad Laboratories, catalog number: 1863052 )
Pierceable foil heat seal (Bio-Rad Laboratories, catalog number: 1814040 )
Multichannel reagent trough
Molecular biology grade sterile purified water (RNase, DNase, proteinase free)
Equipment
Cell processing and flow cytometry
96-well plate V-bottom (VWR International, catalog number: 12-565-460 )
Water bath at 37 °C
BD Accuri (with plate loader) (BD, catalog number: 653118 ) or equivalent flow cytometer
SorvallTM RC4 general purpose floor model centrifuge (Thermo Fisher Scientific, catalog number: 75004481 ) or equivalent
DNA/RNA co-extraction and DNA precipitation
Collection tubes (2 ml) (QIAGEN, catalog number: 19201 )
BD 3 ml Leur-LokTM Syringe with detachable BD 23G 1½ PrecisionGlideTM needle (BD, catalog number: 309589 )
BD 20G 1½ PrecisionGlideTM needle (BD, catalog number: 305176 )
Sterile 1.5 ml microcentrifuge Eppendorf tubes
Sterile 1.5 ml Micro tubes with screw cap
Pasteur pipette (transfer pipette)
Vortex
Heating block
Table centrifuge
NanoDrop 2000 Spectrophotometer
ddPCR
96-Well PCR clean plate
Strip caps
Plate sealing adhesive film
96-Well semi-skirted PCR plate (Eppendorf, catalog number: 951020362 )
Low retention pipette tips (200 µl and 20 µl)
1.5 ml screw-top tubes
Biorad droplet generator and reader, QX200 droplet digital PCR system (Bio-Rad Laboratories, catalog number: 186-4001 )
PX1 PCR plate sealer (Bio-Rad Laboratories, catalog number: 181-4000 )
Thermocycler
Special multichannel pipette for ddPCR droplet transfer (P-50) (e.g. Rainin, catalog number: L8-50XLS+ )
Centrifuge to spin plates
Spectrophotometry (Nanodrop)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Massanella, M., Gianella, S., Lada, S. M., Richman, D. D. and Strain, M. C. (2015). Quantification of Total and 2-LTR (Long terminal repeat) HIV DNA, HIV RNA and Herpesvirus DNA in PBMCs. Bio-protocol 5(11): e1492. DOI: 10.21769/BioProtoc.1492.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Microbiology > Microbial genetics > DNA
Microbiology > Microbial genetics > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,493 | https://bio-protocol.org/exchange/protocoldetail?id=1493&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enzymatic Activity Assays for Base Excision Repair Enzymes in Cell Extracts from Vertebrate Cells
Melike Çağlayan
JH Julie K. Horton
SW Samuel H. Wilson
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1493 Views: 7906
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
We previously reported enzymatic activity assays for the base excision repair (BER) enzymes DNA polymerase β (pol β), aprataxin (APTX), and flap endonuclease 1 (FEN1) in cell extracts from Saccharomyces cerevisiae (Çağlayan and Wilson, 2014). Here, we describe a method to prepare cell extracts from vertebrate cells to investigate these enzymatic activities for the processing of the 5´-adenylated-sugar phosphate-containing BER intermediate. This new protocol complements our previous publication. The cell lines used are wild-type and APTX-deficient human lymphoblast cells from an Ataxia with Oculomotor Apraxia Type 1 (AOA1) disease patient, wild-type and APTX-null DT40 chicken B cells, and mouse embryonic fibroblast (MEF) cells. This protocol is a quick and efficient way to make vertebrate cell extracts without using commercial kits.
Materials and Reagents
Cell lines used in this study
The human cell lines used are the wild-type C2ABR and AOA1 L938 (Harris et al., 2009). The AOA1 cell line was derived from the peripheral blood of a Japanese AOA1 patient and has a point mutation within the HIT domain of APTX involving substitution of proline for leucine at position 206.
The DT40 cell lines are the wild-type and APTX null. The APTX null cell line has the aptx gene deletion from valine 78 onwards that inactivates APTX (Ahel et al., 2006).
The mouse embryonic fibroblast cell lines are pol β-/- and pol β+/+ MEFs previously developed in our laboratory (Sobol et al., 1996).
RPMI 1640 medium with glutamine (Gibco, catalog number: 11875-093 )
DMEM high-glucose medium (HyClone, catalog number: SH30081 )
Chicken serum (Life Technologies, catalog number 16110-082 )
Glutamax-1 (Gibco, catalog number: 35050-061 )
Fetal bovine serum-FBS (HyClone, catalog number: SH30910 ).
EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, catalog number: 11836170001 )
Bio-Rad Protein Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
EDTA (Sigma-Aldrich, catalog number: 93283 )
Potassium chloride-KCl (Sigma-Aldrich, catalog number: P9333 )
Sodium chloride-NaCl (Sigma-Aldrich, catalog number: S7653 )
Glycerol (Sigma-Aldrich, catalog number: G9012 )
Tissue-culture grade 2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Nonidet P 40-NP40 (Sigma-Aldrich, catalog number: 74385 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Magnesium chloride-MgCl2 (Sigma-Aldrich, catalog number: M8266 )
Formamide (Sigma-Aldrich, catalog number: F9037 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Xylene cyanol (Sigma-Aldrich, catalog number: X4126 )
Dithiothreitol-DTT (Sigma-Aldrich, catalog number: D0632 )
Sodium borohydride-NaBH4 (Sigma-Aldrich, catalog number: 247677 )
Urea (National Diagnostic, catalog number: EC-605 )
Trizma-base (Sigma-Aldrich, catalog number: T4661 )
Boric Acid (Promega Corporation, catalog number: H5003 )
AccuGel (40%) 19:1 Acrylamide to Bisacrylamide Stabilized Solution (National Diagnostic, catalog number: EC-850 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678-25G )
Tetramethylethylenediamine (Sigma-Aldrich, catalog number: T9281-25ML )
Sterile water
Purified enzymes: Recombinant human DNA polymerase β [purified as described Çağlayan et al. (2014)], recombinant human APTX (Fitzgerald catalog number: 80R-1256 ), and recombinant human FEN1 [purified as described Çağlayan et al. (2014)].
DNA substrate: The gapped DNA substrate with a uracil base at position 17 at the 5'-end of the 3'-end FAM-labeled oligonucleotides. The sequence information for the upstream, downstream and template oligonucleotides were previously published Çağlayan et al. (2015).
Lysis buffer (see Recipes)
10x reaction buffer (see Recipes)
Gel-loading buffer (see Recipes)
10x TBE solution and 1x TBE solution as PAGE running buffer (see Recipes)
15% Denaturing Polyacrlamide Gel or PAGE solution (see Recipes)
Equipment
Eppendorf tubes
Screw cap conical tube (15 ml)
Refrigerated table-top centrifuge
Refrigerated Eppendorf centrifuge
Table-top heat block
Tissue culture CO2 incubators set at 34, 37, and 39.5 °C
Cell scraper
Polyacrylamide gel electrophoresis (PAGE) apparatus
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Çağlayan, M., Horton, J. K. and Wilson, S. H. (2015). Enzymatic Activity Assays for Base Excision Repair Enzymes in Cell Extracts from Vertebrate Cells. Bio-protocol 5(11): e1493. DOI: 10.21769/BioProtoc.1493.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA damage and repair
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,494 | https://bio-protocol.org/exchange/protocoldetail?id=1494&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Wall Biomass Preparation and Fourier Transform Mid-infrared (FTIR) Spectroscopy to Study Cell Wall Composition
Ricardo M. F. da Costa
GA Gordon G. Allison
Maurice Bosch
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1494 Views: 9390
Edited by: Samik Bhattacharya
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Plant cell wall biomass is an abundant and renewable organic resource. Of the polymers it encloses, cellulose and hemicellulose are regarded as a raw material for the production of fuels and other products (Klemm et al., 2005; Slavov et al., 2013). Nonetheless, current usage of lignocellulosic biomass is still below its full potential due to a series of limiting factors mainly related to the cell wall recalcitrance to saccharification, a severe constraint to maximum biomass usability in downstream processing (Pauly and Keegstra, 2008).
As a strategy to optimise bio-energy and bio-refining applications, an increasing amount of effort is being put into the advancement of our knowledge concerning the cell wall compositional roots of recalcitrance. Fourier transform mid-infrared spectroscopy (FTIR) represents a very useful tool on this enterprise, as it allows for a high-throughput, non-destructive and low unit cost procedure for the examination of cell wall biomass (Allison et al., 2009; Carpita and McCann, 2015). Furthermore, the use of Attenuated Total Reflection (ATR) in conjunction with infrared spectroscopy (IR) enables cell wall biomass samples to be examined in solid state without extensive preparation. Nonetheless, the analysis of purified cell wall preparations instead of the intact plant biomass is highly recommended, as it minimises or even eradicates interference from biomass components which are not part of the cell wall. Further information regarding the fundamentals of FTIR may be found elsewhere (Smith, 2011).
Datasets generated from FTIR spectroscopy can be extensive and complex. In these situations, data-driven modelling techniques are often used as exploratory approaches to identify the most distinctive features of the collected spectra. Here we suggest the use of Principal Component Analysis (PCA), a frequently employed method to transform a large set of variables into a smaller set of new variables (principal components), effectively reducing dataset dimensionality.
When the aim is a complete and detailed biomass characterisation, the FTIR-PCA method here described does not exclude the need for parallel wet gravimetric and analytical procedures. However, it does lead to a rapid identification of the major compositional shifts across large sets of samples; thus contributing to steer research pathways, minimise time-draining analytical procedures and reduce overall research costs.
Keywords: FTIR Cell wall Lignocellulose Biomass Biofuel
Materials and Reagents
Lignocellulosic biomass
Note: Depending on the aims of the researcher, lignocellulosic biomass from different species, organs or tissues may be used, providing it is conveniently prepared as indicated in the Procedure section below. For an example of the application of this protocol, please refer to da Costa et al. (2014).
Deionised H2O
70% (v/v) aqueous ethanol (molecular biology grade)
Chloroform/methanol (1:1 v/v) (molecular biology grade)
100% acetone (molecular biology grade)
Type-I porcine α-amylase (Sigma-Aldrich, catalog number: A6255 ) (saline suspension; 29 mg protein/ml; 1714 units/mg protein)
0.1 M sodium acetate buffer (see Recipes)
0.1 M ammonium formate buffer (see Recipes)
0.001 M sodium azide (see Recipes)
Equipment
Laboratory safety equipment (gloves, eye protection and safety mask are recommended particularly during sodium azide handling)
Freezer
pH meter
Freeze dryer (Edwards Pirani 501 Super Modulyo, Edwards Ltd.)
Analytical mill (Ika, A11 basic)
Sieves (pore sizes: 0.18 and 0.85 mm)
Plastic centrifuge tubes (50 ml, with screw cap) (Greiner Bio-One GmbH)
Vortex mixer
Shaking incubator
Centrifuge
Fume hood
Block heater
FTIR spectrometer (Equinox 55, Bruker Optik) equipped with a Golden Gate ATR accessory (Specac)
Software
Bruker OPUS IR spectroscopy software (version 5.0; Bruker Optik)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：da Costa, R. M. F., Allison, G. G. and Bosch, M. (2015). Cell Wall Biomass Preparation and Fourier Transform Mid-infrared (FTIR) Spectroscopy to Study Cell Wall Composition. Bio-protocol 5(11): e1494. DOI: 10.21769/BioProtoc.1494.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,495 | https://bio-protocol.org/exchange/protocoldetail?id=1495&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cytokine-Stimulated Phosphoflow of Whole Blood Using CyTOF Mass Cytometry
RF Rosemary Fernandez
Holden Maecker
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1495 Views: 14563
Reviewed by: Yang Fu
Original Research Article:
The authors used this protocol in 0 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
0 2014
Abstract
The ability to assess the function of a range of cytokine, antigen receptor, and Toll-like receptor (TLR) signaling pathways in a range of immune cells could provide a kind of fingerprint of the state of the human immune system. The mass cytometry or CyTOF, platform allows for the parallel application of about 40 labeled antibodies to a single sample, creating the possibility to read out many cell types and signaling pathways in a single small blood sample. We developed such a mass cytometry panel, consisting of 22 antibodies to cell surface lineage markers and 8 antibodies to phospho-specific epitopes of signaling proteins. These antibodies were chosen to discriminate all major white blood cell lineages, to a level of detail that includes subsets such as naïve, central memory, effector memory, and late effector CD4+ and CD8+T cells, naïve, transitional, and switched memory B cells, plasmablasts, myeloid and plasmacytoid dendritic cells, CD16+ and CD16+CD56+ NK cells, CD16+ and classical monocytes etc. 32 such cell subsets are defined in our standard gating scheme. The eight phospho-specific antibodies were chosen to represent major signaling nodes responsive to cytokine, TLR, and antigen receptor signaling. This antibody panel is used with 8 standard stimulation conditions (unstimulated, IFNa, IL-6, IL-7, IL-10, IL-21, LPS, PMA+ ionomycin), although other stimuli can be added. Comparison of healthy controls to subjects with immune deficiencies of unknown etiology may help elucidate the mechanisms of such deficiencies.
Phosphorylation of tyrosine, serine, and threonine residues is critical for the control of protein activity involved in various cellular events. An assortment of kinases and phosphatases regulate intracellular protein phosphorylation in many different cell signaling pathways, such as T and B cell signaling, those regulating apoptosis, growth and cell cycle control, plus those involved with cytokine, chemokine, and stress responses. Phosphoflow assays combine phospho-specific antibodies with the power of flow cytometry to enhance phospho protein study. In our assay, peripheral blood mononuclear cells are stimulated by cytokines, fixed, surface-stained with a cocktail of antibodies labeled with MAXPAR (Brand Name) metal-chelating polymers and permeabilized with methanol. They are then stained with intracellular phospho-specific antibodies.
We use a CyTOFTM mass cytometer to acquire the ICP-MS data. The current mass window selected is approximately AW 103-203, which includes the lanthanides used for most antibody labeling, as well as iridium and rhodium for DNA intercalators. Subsequent analysis of the dual count signal data using FlowJo software allows for cell types to be analyzed based on the dual count signal in each mass channel. The percentage of each cell type is determined and reported as a percent of the parent cell type. Median values are reported to quantitate the level of phosphorylation of each protein in response to stimulation. Comparing the level of phosphorylation between samples can offer insight to the status of the immune system. Whole blood stimulation is the closest to the in vivo condition and it allows for assessment of granulocyte population as well as lymphocytes and monocytes.
Materials and Reagents
Whole blood from patient or donor
Cytokine aliquots (IFNα, IL-6, IL-7, IL-10, IL-21, LPS, PMA/Ionomycin etc.)
IFNa (PBL Interferon source, catalog number: 11105-1 )
IFNg2 (BD Biosciences, catalog number: 554617 )
IL6 (BD Biosciences, catalog number: 550071 )
IL7 (BD Biosciences, catalog number: 554608 )
IL10 (BD Biosciences, catalog number: 554611 )
IL21 (Life Technologies, Gibco®, catalog number: PHC0214 )
IL2 (BD Biosciences, catalog number: 554603 )
CD3 (BD Biosciences, catalog number: 555329 )
CD28 (BD Biosciences, catalog number: 555725 )
LPS (Sigma-Aldrich, catalog number: L7770 )
IL5 (Pepro Tech, catalog number: 200-05 )
IL17A (Pepro Tech, catalog number: 200-17 )
IL17E (Pepro Tech, catalog number: 200-24 )
Methanol (Thermo Fisher Scientific, catalog number: A452SK-1 )
Dulbecco’s Phosphate-buffered saline (Ca2+, Mg2+)
Phenotyping and phosphoprotein antibodies filtered with 0.1 um spin filters to get even staining of markers
Ir-intercalator stock solution from Fluidigm Sciences (Rh103-intercalator can be used)
10x phosphate-buffered saline (Rockland, catalog number: MB-008 )
Smart tube 1x thaw-lyse buffer (Smart Tube Inc.)
Complete RPMI (see Recipes)
CyFACS buffer (see Recipes)
Equipment
Nunc Coded Cryobank Vials (Cluster tubes, catalog number: 374078 )
37 °C water bath
Biosafety cabinet
Centrifuge
CO2 incubator at 37 °C
Calibrated pipettes
8 or 12 pin aspirator (V&P Scientific, model: Inc VP187A )
Smart tube proteomic stabilizer (Smart Tube Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernandez, R. and Maecker, H. T. (2015). Cytokine-Stimulated Phosphoflow of Whole Blood Using CyTOF Mass Cytometry. Bio-protocol 5(11): e1495. DOI: 10.21769/BioProtoc.1495.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,496 | https://bio-protocol.org/exchange/protocoldetail?id=1496&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cytokine-stimulated Phosphoflow of PBMC Using CyTOF Mass Cytometry
RF Rosemary Fernandez
Holden Maecker
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1496 Views: 17905
Reviewed by: Ivan Zanoni
Download PDF
Ask a question
Favorite
Cited by
Abstract
Phosphorylation of tyrosine, serine, and threonine residues is critical for the control of protein activity involved in various cellular events. An assortment of kinases and phosphatases regulate intracellular protein phosphorylation in many different cell signaling pathways. These pathways include T and B cell signaling, regulating growth and cell cycle control, plus cytokine, chemokine, and stress responses. Phosphoflow assays combine phosphoprotein-specific antibodies with the power of flow cytometry to enhance phosphoprotein study. In our assay, peripheral blood mononuclear cells are stimulated by cytokines, fixed, surface-stained with a cocktail of antibodies labeled with MAXPAR (brand name) metal-chelating polymers and permeabilized with methanol. They are then stained with intracellular phospho-specific antibodies.
We use a CyTOFTM mass cytometer to acquire the ICP-MS (inductively coupled plasma mass spectrometry) data. The current mass window selected is approximately AW 103-203, which includes the lanthanides used for most antibody labeling, as well as iridium and rhodium for DNA intercalators. Subsequent analysis of the dual count signal data using FlowJo software allows for cell types to be analyzed based on the dual count signal in each mass channel. The percentage of each cell type is determined and reported as a percent of the parent cell type. Median values are reported to quantitate the level of phosphorylation of each protein in response to stimulation. Comparing the level of phosphorylation between samples can offer insight to the status of the immune system.
Materials and Reagents
PBMC (fresh or thawed frozen)
Benzonase (Pierce Antibodies, catalog number: 88701 )
Cytokine aliquots (IFNα, IFNγ, IL-6, IL-7, IL-10, IL-21, IL-2 etc.)
IFNa (PBL Interferon source, catalog number: 11105-1 )
IFNg2 (BD Biosciences, catalog number: 554617 )
IL6 (BD Biosciences, catalog number: 550071 )
IL7 (BD Biosciences, catalog number: 554608 )
IL10 (BD Biosciences, catalog number: 554611 )
IL21 (Life Technologies, Gibco®, catalog number: PHC0214 )
IL2 (BD Biosciences, catalog number: 554603 )
CD3 (BD Biosciences, catalog number: 555329 )
CD28 (BD Biosciences, catalog number: 555725 )
LPS (Sigma-Aldrich, catalog number: L7770 )
IL5 (Pepro Tech, catalog number: 200-05 )
IL17A (Pepro Tech, catalog number: 200-17 )
16% PFA (Alfa Aesar, catalog number: 4368 )
Methanol (Thermo Fisher Scientific, catalog number: A452SK-1 )
Deep Well plate (Costar, catalog number: 3960 )
Phenotyping and phosphoprotein antibodies filtered with 0.1 um spin filters (EMD Millipore, model: UFC30VV00 )
Ir-intercalator stock solution from DVS (Rh103-intercalator can be used) (catalog number: 201192 B )
1x CyPBS PBS (Rockland, catalog number: MB-008 )
Complete RPMI (see Recipes)
CyFACS buffer (see Recipes)
Equipment
37 °C water bath
Biosafety cabinet
Centrifuge
CO2 incubator at 37 °C
Calibrated pipettes
8 or 12 pin aspirator (V&P Scientific, model: VP187A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell staining > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,497 | https://bio-protocol.org/exchange/protocoldetail?id=1497&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Image Analysis of Membrane Microdomains Labelled by Fluorescently Tagged Proteins in Arabidopsis thaliana and Nicotiana benthamiana
Iris K. Jarsch
Thomas Ott
Published: Vol 5, Iss 11, Jun 5, 2015
DOI: 10.21769/BioProtoc.1497 Views: 9209
Edited by: Arsalan Daudi
Reviewed by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
We have recently characterized co-existing membrane microdomains that are labeled by different proteins in living plant cells (Jarsch et al., 2014). For this approach we first created a digital fingerprint for each of the twenty marker proteins using quantitative image analysis. Here we recorded parameters such as domain size, density and shape based on image segmentation. We found highly reproducible patterns of any of the proteins over a large number of biological replicates. Furthermore we exclusively acquired images from lowly expressing cells and chose our imaging conditions in a way that resulted in images where no pixel was saturated.
This protocol describes in detail the methods that have been used to analyze quantitative differences in localization of members of the remorin protein family in membrane microdomains of Arabidopsis thaliana and Nicotiana benthamiana (Jarsch et al., 2014). The proteins were either individually or pairwise expressed as fluorophore fusions in the respective plant. Image acquisition was performed using standard Confocal Laser Scanning Microscopy (CLSM) and image analysis was performed using ImageJ.
[Introduction] Since confocal laser-scanning or other state-of-the-art fluorescence microscopes are nowadays often regarded as standard equipment a modern research institution should have, the amount of published cell biological data has massively increased over the last years. This certainly also correlates with the availability of an increasing number of fluorophores and corresponding expression vectors that have made it comparably easy to generate large numbers of tagged proteins. One main concern about showing microscopy images in publications is the subjectivity they have been selected with. In addition, and certainly very unfortunate in several cases, the scientific community as well as reviewers of manuscripts have requested ‘no background-high fluorescence’ images from the authors. As a consequence researchers often started selecting the images based on aesthetic aspects rather than showing the most representative ones. Furthermore the majority of images are based on strong over-expression of proteins. Therefore quantitative image analysis has become an absolute requirement in order to make robust statements on cell biological observations and the frequency with which they have been observed. However, this does not only require gaining novel skills but also high numbers of biological repetitions in a standardized way. Furthermore, it should be the ultimate goal to work under conditions where the protein of interest is expressed at native levels. While this may have to be overcome for lowly abundant proteins, researchers should nevertheless aim for similar levels and may thus accept more background noise in the images.
It should be noted that all parameters and protocol specifications provided within this protocol have been optimized for the expression we used in a current study (Jarsch et al., 2014). Most likely they have to be adapted for any analyses in different laboratories.
Keywords: Cell biology Quantitative image analysis Microdomain Arabidopsis
Materials and Reagents
4-5 weeks old Nicotiana benthamiana (N. benthamiana) plants (soil grown)
4-5 weeks individually potted stable transgenic Arabidopsis thaliana (A. thaliana) lines expressing AvrPto under control of a dexamethasone (DEX)-inducible promoter as described previously (Hauck et al., 2003; Tsuda et al., 2012) (lines available upon request from the authors of the original publication) (soil grown)
Agrobacterium strains
GV3101 C58 mp90RK for constructs in pAM-PAT:35S and pH7YGW2
Agl1 for constructs in pUbi and pGWB1-based vectors
MgCl2 (Carl Roth, catalog number: 2189 )
MES KOH (pH 5.6) (Carl Roth, catalog number: 4256.2 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
EtOH
Silwett L-77 (Leu+Gygax AG, catalog number: CH-SL7-033-01 )
Infiltration solution for Agrobacterium tumefaciens-mediated transient transformation of N. benthamiana or A. thaliana (see Recipes)
DEX-solution for pre-treatment of AvrPto-DEX inducible A. thaliana (see Recipes)
Equipment
Table-top centrifuge for 2 ml tubes (Eppendorf, model: 5424 )
Spectrometer (Pharmacia Biotech (now: GE Healthcare, Ultrospec 3000 pro)
1 ml syringes (Braun catalog number: 9161406V )
2 ml reaction tubes for centrifugation (SARSTEDT AG, catalog number: 72.695.500 )
50 ml spray flask (Carl Roth, Karlsruhe, catalog number: EP66 )
4 mm biopsy punch or similar tool (cork borer) to excise leaf discs (recommended: Produkte für Medizintechnik (pfm), 4 mm, catalog number: 49401 )
Microscope cover glasses (Carl Roth, 24 x 60 mm, #1,5 (170 micron), catalog number: H878 )
Microscope slides (Langenbrick, 76 x 26 x 1 mm, catalog number: 03-0010/90 )
Confocal microscope (Leica Microsystems, model: SP5 )
Leica DFC350FX digital camera
Objectives used for this experiment: HC PL APO 20x/0.70 ImmCorr CS and HCX PL APO 63x/1.20 W CORR CS)
Excitation using an argon laser (100 mW, Lasos LGK 7872 ML05 SP5) [for YFP: 514 nm (excitation), 525-600 nm (emission); for CFP: 456 nm (excitation); 475-620 nm (emission)]
Software
ImageJ (Plug-in supplemented version: Fiji)
Intensity Correlation Analysis Bundle from the Wright Cell Imaging Facility (WCIF Image) (Li et al., 2004)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jarsch, I. K. and Ott, T. (2015). Quantitative Image Analysis of Membrane Microdomains Labelled by Fluorescently Tagged Proteins in Arabidopsis thaliana and Nicotiana benthamiana. Bio-protocol 5(11): e1497. DOI: 10.21769/BioProtoc.1497.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Biochemistry > Protein > Fluorescence
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,498 | https://bio-protocol.org/exchange/protocoldetail?id=1498&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electroporation of Embryonic Chick Eyes
Agustín Luz-Madrigal
Erika Grajales-Esquivel
Katia Del Rio-Tsonis
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1498 Views: 12835
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The chick embryo has prevailed as one of the major models to study developmental biology, cell biology and regeneration. From all the anatomical features of the chick embryo, the eye is one of the most studied. In the chick embryo, the eye develops between 26 and 33 h after incubation (Stages 8-9, Hamburger and Hamilton, 1951). It originates from the posterior region of the forebrain, called the diencephalon. However, the vertebrate eye includes tissues from different origins including surface ectoderm (lens and cornea), anterior neural plate (retina, iris, ciliary body and retinal pigmented epithelium) and neural crest/head mesoderm (stroma of the iris and of the ciliary body as well as choroid, sclera and part of the cornea). After gastrulation, a single eye field originates from the anterior neural plate and is characterized by the expression of eye field transcriptional factors (EFTFs) that orchestrate the program for eye development. Later in development, the eye field separates in two and the optic vesicles form. After several inductive interactions with the lens placode, the optic cup forms. At Stages 14-15, the outer layer of the optic cup becomes the retinal pigmented epithelium (RPE) while the inner layer forms the neuroepithelium that eventually differentiates into the retina. One main advantage of the chick embryo, is the possibility to perform experiments to over-express or to down-regulate gene expression in a place and time specific manner to explore gene function and regulation. The aim of this protocol is to describe the electroporation techniques at Stages 8-12 (anterior neural fold and optic vesicle stages) and Stages 19-26 (eye cup, RPE and neuroepithelium). We provide a full description of the equipment, materials and electrode set up as well as a detailed description of the highly reproducible protocol including some representative results. This protocol has been adapted from our previous publications Luz-Madrigal et al. (2014) and Zhu et al. (2014).
Keywords: Electroporation Chick Eyes Stages 19-26 (eye cup stages) Stages 8-12 (anterior neural fold and optic vesicle stages)
Materials and Reagents
Fertilized specific pathogen free (SPF) (Charles River Laboratories) or white Leghorn chicken eggs (Note 1)
10x Hank's balanced salt solution (HBSS) (Thermo Fisher Scientific, catalog number: 14185-052 )
Fast green FCF (Sigma-Aldrich, catalog number: F7258 )
Indian Ink Type A (Pelikan)
Tris (hydroxymethyl) aminomethane (suitable for cell culture) (Sigma-Aldrich, catalog number: 252859 )
EDTA (Ethylenediaminetetraacetic acid), suitable for cell culture (Sigma-Aldrich, catalog number: E6758 )
pCAG- GFP (Addgene plasmid, catalog number: 11150 ) or pEGFP-N1 (Takara Bio Company, Clontech)
Plasmid and RCAS-DNA [the name RCAS stands for Replication-Competent ASLV long terminal repeat (LTR) with a Splice acceptor] (Note 6)
Morpholinos (Note 7)
NaCl (Fisher Scientific, catalog number: BP358-1 ) (MW 58.44 g/mol)
CaCl2 anhydrous (Acros Organics, catalog number: AC34961-5000 ) (MW 110.98 g/mol)
KCl (Fisher Scientific, catalog number: P217-500 ) (MW 74.55 g/mol)
Na2HPO4 Dibasic anhydrous (Fisher Scientific, catalog number: S374-500 ) (MW 141.96 g/mol)
KH2PO4 Dibasic Anhydrous (Fisher Scientific, catalog number: P290-500 ) (MW 174.18 g/mol)
Ringer’s solution (see Recipes)
10x Hank's balanced salt solution (HBSS) (see Recipes)
Fast green FCF (see Recipes)
1 M Tris (see Recipes)
0.5 M EDTA (see Recipes)
TE buffer for plasmid solutions (see Recipes)
Equipment
Beveled-edge watch glass (to hold the egg during the electroporation) (Thermo Fisher Scientific, catalog number: 15-355 )
200 μl tips sterile (Corning Incorporated)
Capillary tubing borosilicate for microinjection (1.0 mm OD, 0.5 mm ID/fiber) [Frederick Haer & Co (FHC), catalog number: 30-30-1 ]
1 ml syringe (Thermo Fisher Scientific)
Pre-pulled beveled glass needles 50 mm long, 20 µm tip diameter and sharpened 10 to 12° (these glass needles are made following the instructions of the Micropipette Puller and Micropipette Beveler- Figure 1d-e)
35 mm plastic tissue culture plates (Corning Incorporated)
3/4 inch wide clear tape (Scotch, 3 M)
Micro dissecting tweezers #55 and #5 (Roboz, catalog numbers: RS-4984 and RS-4978 )
ECM 830 High Throughput Electroporation System (Figure 1a), a Square Wave Pulse generator for in vitro and in vivo electroporation with remote operation Footswitch (BTX, Harvard Apparatus, SKU: ECM_830 _for_In_Vivo_Applications)
Microinjector (Figure 1b), MicroJect 1000A (BTX, Harvard Apparatus, SKU: 45- 0750 ) with foot Switches to inject and fill and a stainless steel pipette holder (Figure 1c)
Micropipette beveler (Sutter Instrument Company, model: BV-10 ) (Figure 1d)
Vertical micropipette puller (Sutter Instrument Company, model: P-30 ) (Figure 1e)
Nitrogen tank Compressed 2.2 UN1066 NI NI230PP 230CF PP (CAGA580) (Weiler Welding)
Stereo zoom microscope (Motic, model: SMZ-168 , catalog number: 1100200500322) or equivalent
Tungsten halogen light source (series equipped with Fiber Optic, model: 8375 ) (Fostec ACE)
Rotating incubator (45 of angle rotation every hour) calibrated at 37-39 °C (99 to 103 °F) and relative humidity of 50-55% (83-87 °F or 28-31 °C, on wet bulb thermometer) (e.g. Breeding Technology, 1202E Classic Sportsman, https://www.gqfmfg.com/store/front.asp)
Incubator Thermal Air Hova-Bator (https://www.gqfmfg.com/store/front.asp)
200 μl micropipette
Blue-light filter (12.5 mm diameter, ~100% transmittance up to 500 nm) (Edmond Optics, catalog number: 52-530 )
Electrodes (Note 8)
Stage-8-12 electrodes (for set up see Figure 2)
Platinum/Iridium (Pt/Ir) Microelectrodes unit of 3 (Frederick Haer&Co, catalog number: UEPMEEVENNND ), use the following Metal Microelectrode Spec Sheet (http://www.fh-co.com/uploads/files/ue-spec-2013.pdf) for ordering
Extreme-Temperature Polyimide Tubing (0.007" ID, 1/16", OD, 0.08" Wall, 1'L,Clear Amber, McMasterCarr, catalog number: 5707K12 )
Plastic holder (made utilizing a 20 µl pipet tip) with ~2 mm diameter and ~3 mm length (see Figure 2 c1-2)
Bend-and-Stay 302/304 Stainless Steel Wire (0.032" diameter, 1' Long, McMASTER- CARR, catalog number: 6517K66 )
Precision Miniature Stainless Steel Tubing, 304 Stainless Steel, 15 Gauge, 0.072" OD, 0.05" ID, .011" Wall (McMASTER-CARR, catalog number: 8988K31 )
White Delrin® Acetal Resin Rod, 3/8" Diameter (McMASTER-CARR, catalog number: 8572K53 ). This Resin Rod is modified with a press fit to incorporate internally the Stainless Steel Tubing (material #v) and to fit in the polycarbonate tube that functions as a hand holder (material #vii) (Figure 1d).
Impact-Resistant Polycarbonate Round Tube (McMASTER-CARR, catalog number: 8585K11 )
1 m of 26 gauge (stranded, aluminum wire)
Connector; BNC; Nickel Plated Brass; 20; Gold Plated Beryllium Copper; PVC (Pomona, catalog number: 4969 )
Flow Mix 60 sec (Epoxy, 1250 psi Strength, part number: 21445 ) (Devcon)
ectrodes (for set up see Figure 3)
One genetrode kit (5 mm, Gold plated thick electrode - L-shaped, in ovo gene) (Harvard Apparatus, model: 512, catalog number: 45-0115 )
One platinum/iridium microelectrode unit of 3 (Frederick Haer & Co, catalog number: UEPMEEVENNND), see part “i” from Stage-8-12 electrodes for ordering instructions.
Tygon® microbore tubing ( 0.010" ID x 0.030"OD, 100 ft/roll) (Cole-Parmer, catalog number: EW-06419-00 ) (Characteristics: Extremely flexible, non-toxic; nonpyrogenic; biocompatible) (Formulation Tygon, catalog number: ND-100-80 )
Extreme-Temperature Polyimide Tubing .0089" ID, .0104", OD, .0008" Wall (1 L, Clear Amber) (McMaster-Carr, catalog number: 51085K42 )
One Capillary tubing borosilicate for Microinjection, 1.0 mm OD, 0.5 mm ID/fiber (Frederick Haer&Co, catalog number: 30-30-1)
One 1 ml pipet tip (Corning Incorporated)
50 cm aluminum wire (stranded), 26 gauge
Connector; BNC; Nickel Plated Brass; 20; Gold Plated Beryllium Copper; PVC (Pomona, catalog number: 4969)
Flow mix 60 sec (Epoxy, 1250 psi Strength, part number: 21445) (Devcon)
Figure 1. Electroporation equipment. The electroporation equipment consist of the ECM 830 electroporator (a), Microinjector MicroJect 1000A and stainless steel pipette holder (b, c), Micropipette Beveler and Puller necessary to make glass needles (d, e).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Luz-Madrigal, A., Grajales-Esquivel, E. and Del Rio-Tsonis, K. (2015). Electroporation of Embryonic Chick Eyes. Bio-protocol 5(12): e1498. DOI: 10.21769/BioProtoc.1498.
Download Citation in RIS Format
Category
Neuroscience > Development > Morphogenesis
Developmental Biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,499 | https://bio-protocol.org/exchange/protocoldetail?id=1499&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gentiobiose Feeding in Gentian in vitro Overwintering Buds or Plantlets
HT Hideyuki Takahashi
MN Masahiro Nishihara
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1499 Views: 7401
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
To study the functions of sugars in plants, feeding experiment is one of the most common and easy methods. However, the traditional method, e.g., a floating of leaf discs on sugar-containing solution seems to have an insufficient efficiency of sugar uptake, despite of high osmotic and injury effects. This is a protocol to feed oligosaccharide gentiobiose into in vitro cultured tissues of gentian. This protocol enables to incorporate gentiobiose into intact tissues without exposure to osmotic stress and may be useful to other plant species that are able to propagate by shoot tip culture.
Keywords: Gentian Gentiobiose Overwintering bud Plantlet Budbreak
Materials and Reagents
Gentian (Gentiana triflora) tissue culture plantlets
Sucrose
Gentiobiose (Sigma-Aldrich, catalog number: G3000-5G )
Gellan gum (Wako USA, catalog number: 075-03075 )
Liquid nitrogen
Milli Q grade water
MS vitamins (see Recipes)
Propagation medium (see Recipes)
IOWB induction medium (see Recipes)
Gentiobiose medium (see Recipes)
Equipment
Sterile magenta boxes (sterilized by autoclaving)
Surgical tape (3M, catalog number: 1530-0 )
Glass culture tubes (sterilized by autoclaving)
Silicon plugs (sterilized by autoclaving)
Sterile 15 ml plastic tubes (such as Greiner Bio-One GmbH, catalog number: 188271 )
Sterile syringe filter (Millipore, catalog number: SLGP033RS )
Sterile petri dishes (IWAKI PUMPS, catalog number: SH90-20 )
Cutoff filter (Millipore, catalog number: UFC5003BK )
Growth chambers
Clean bench
Scalpel
Forceps
Ball miller
Centrifuge
Freeze dryer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Takahashi, H. and Nishihara, M. (2015). Gentiobiose Feeding in Gentian in vitro Overwintering Buds or Plantlets. Bio-protocol 5(12): e1499. DOI: 10.21769/BioProtoc.1499.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Nutrition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
15 | https://bio-protocol.org/exchange/protocoldetail?id=15&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Small Scale Native Affinity Purifications of Solubilized Membrane Proteins from Yeast
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.15 Views: 16811
Download PDF
Ask a question
Favorite
Cited by
Abstract
In this protocol, we show how to purify membrane proteins from yeast using affinity purification under native conditions at a small scale.
Materials and Reagents
PBS
HEPES
KOAc*
Mg(OAc)2
CaCl2
Sorbitol
Wash buffer
EDTA free protease inhibitors (Roche Diagnostics)
Digitonin (EMD Chemicals)
Protease Inhibitors (DMSO, leupeptin, pepstatin) (Sigma-Aldrich)
ANTI-Flag M2 affinity gel (Sigma-Aldrich)
3x FLAG peptide (Sigma-Aldrich)
NaF# (Ser/Thr phosphatase inhibitor)
Na3VO4 (Tyr phosphatase inhibitor)
Lysis buffer (see Recipes)
Immunoprecipitation buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
BECKMAN centrifuge and TLA-55 rotor
Acid washed 425-600 glass beads (Sigma-Aldrich)
Beckman centrifuge tubes (Beckman Coulter)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
150 | https://bio-protocol.org/exchange/protocoldetail?id=150&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Neuron-enriched Cultures (Method 2)
HG Huiming Gao
Published: Nov 5, 2011
DOI: 10.21769/BioProtoc.150 Views: 12819
Download PDF
Ask a question
Favorite
Cited by
Abstract
Neuron-enriched cultures are a useful tool to study neuronal development and the molecular pathways that come in to play during neuronal death in various neurological disorders. This protocol is for generating midbrain neuronal cultures from late embryo rodent brain. This method uses Neurobasal medium and B27 serum-free supplement. The long-lasting (> 4 weeks) midbrain neuron-enriched cultures generated following this protocol have been wildly used to study the pathogenesis of Parkinson’s disease, the most common neurodegenerative movement disorder. The neuron-enriched cultures prepared following this protocol will contain < 10% astroglia. The usage of B27 serum-free supplement will definitively increase the cost. This protocol has been developed and improved over the years by various researchers in Dr. Hong’s lab, especially Dr. Bin Liu.
Materials and Reagents
Poly-D-lysine (Sigma-Aldrich, catalog number: P7280 )
DMEM/F12 (Life Technologies, Gibco®, catalog number: 11330-032 )
D-Glucose (please add catalog number)
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
200 mM L-glutamine (Life Technologies, Gibco®, catalog number: 25030-081 ) (100 ml)
Penicillin/streptomycin (Sigma-Aldrich, catalog number: P0781 ) (100 ml)
Neurobasal medium (Life Technologies, InvitrogenTM, catalog number: 12348-017 )
50x B27 serum-free supplement (Life Technologies InvitrogenTM/Gibco®, catalog number: 21103-049 ) (10 ml)
Sterile PBS
MEM
Trypan blue dye
Poly-D-lysine solution (see Recipes)
Serum-containing culture medium (see Recipes)
Equipment
Cell culture incubator
Centrifuge
Dissection microscope
Scissors and forceps
24-well plates
Sterile filter (0.2 µm)
Foil
Laminar hood
50-ml tube
10-ml pipet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits