text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
globally , cardiovascular disease ( cvd ) is the leading cause of death with up to 80% occurring in low and middle income countries ( lmics ) . premature death due to cvd is rapidly growing in sub - saharan africa ( ssa ) . hypertension and dyslipidemia are thought to be the major risk factors for cvd . a systematic review on hypertension in ssa yielded 17 studies conducted between 1998 and 2008 in 11 countries and found an overall prevalence of 16.2% , with small variation between urban and rural communities . in uganda , the prevalence of hypertension ranges from 14.6% in the rural areas to 27.2% in the periurban area . in western populations , the prevalence of dyslipidemia coexisting with hypertension has been estimated at 1524% [ 3 , 7 ] . over 40% of all newly diagnosed hypertensive patients there is dearth of data on the burden of dyslipidemia among patients with hypertension in ssa . hypertension and dyslipidemia are both independent modifiable risk factors for cvd . however , some studies suggest that dyslipidemia may play a role in the development of hypertension via endothelial damage . the risk for cvd is higher in the presence of both hypertension and dyslipidemia than by the individual disease entities . in high income countries , strategies targeting the reduction of serum cholesterol levels provide the single most important benefit against cvd resulting from coronary heart disease ( chd ) when evaluated in a cohort setting . a review on a number of cohort studies and randomised clinical trials found that a 10% decrease in cholesterol reduced the risk of chd by 50% at the age of 40 and this benefit reduces to 20% by the age of 70 . in contrast , blood pressure control provides only a 20% risk reduction of mortality due to chd in high income settings . current medical practice encourages risk stratification for all persons at risk of chd including those with hypertension . cardiovascular risk assessment based solely on serum low density lipoprotein cholesterol ( ldl - c ) has been found to be inadequate [ 13 , 14 ] and even in persons on statin therapy with normal or near normal ldl - c serum levels , there remains risk for future cardiovascular events . hypertriglyceridemia has been identified as an independent cardiovascular risk factor [ 15 , 16 ] . hypertriglyceridemia is a proxy for atherogenic dyslipidemia ( elevated tg ( triglyceride ) and low high density lipoprotein cholesterol ) [ 16 , 17 ] , a component of the metabolic syndrome and a known risk factor for chd . despite interaction with other lipids that might increase atherogenic risk and in - subject variation , elevated tg has been shown to be a good predictor of chd in consideration of the high density lipoprotein cholesterol ( hdl - c ) levels and is used in clinical practice to predict atherosclerosis [ 17 , 18 ] . the lipid ratio log [ tg / hdl - c ] ( atherogenic index ) provides an alternative simple option for risk stratification . the use of this ratio is to reflect the balance between risk and protective lipoprotein forces as well as acting as a correlate with ldl - c particle size , ldl - phenotype b , and small hdl - c particles . this ratio has also been evaluated as a prognostic tool in predicting chd and its predictive value far outweighs that of absolute lipid parameters [ 20 , 21 ] as well as the tc ( total cholesterol)/hdl ratio given its strong correlation with lipoprotein particle size . uganda bears a significant burden of hypertension and like other ssa countries is not presently equipped with the necessary resources , expertise , and technology to manage the cvd sequelae . a recent study done within a rural population reflected the dominant dyslipidemic pattern to be that of low serum hdl - c levels and a good proportion with hypertriglyceridemia . whereas there are well - recognised recommendations on the use of serum ldl - c and tc for cardiovascular risk assessment , there is limited progress in addressing concerns with low serum hdl - c which may lead to underestimation of chd risk . the atherogenic index provides a simple and reliable method for point of care risk assessment that can be done by nonspecialists even within hard - to - reach areas . the aim of this study was to assess the atherogenic risk profile using the atherogenic index among people living in rural uganda . a population based survey was conducted in 2011 among 7507 individuals aged 13 years and above living in an established rural cohort in southwestern uganda , the general population cohort ( gpc ) consisting of 25 villages . this cohort has been in existence for the last 25 years and was initially established for the purpose of investigating hiv trends in rural uganda . research activities have since been broadened to include noncommunicable diseases , assessing burden and risk factors . this information included age , sex , and occupation , level of education , marital status , smoking history , and use of alcohol . blood pressure measurement , height , weight , and hip and waist circumferences were measured as described by riha et al . participants found to have systolic blood pressure 140 mmhg and/or diastolic pressure 90 mmhg were referred to as having hypertension . participant categorisation using body mass index ( bmi ) was as follows : bmi 18.5 , bmi 2529.9 , overweight , and bmi 30 , obese . categorisation by waist - hip ratio ( whr ) was as follows : abnormal in male if > 0.95 and abnormal in females if > 0.8 . participants underwent phlebotomy for purposes of a nonfasting lipid profile ( tc , tg , hdl - c , and low density lipoprotein cholesterol ( ldl - c ) ) , hiv serology , and glycated haemoglobin ( hba1c ) . all blood samples were transported on the same day to a central laboratory for sample processing and testing . lipid profile analysis was done using the enzymatic colorimetric assay by the cobas integra 400 plus . cut - off values for the different lipid parameters representative of dyslipidemia were as follows : tc > 5.2 mmol / l , tg > 2.3 mmol / l , ldl - c > 3.4 mmol / l , and hdl - c < 1.04 mmol / l , male , and < 1.3 mmol / l , female . participants with hba1c 6.5% were termed as diabetic , hba1c 66.49% were termed as high risk for diabetes , and hba1c < 6% were termed as low risk for diabetes . hiv testing was done in accordance with the ministry of health guidelines . to assess the atherogenic risk we used the atherogenic index defined as log(triglycerides / hdl - c ) . the risk was categorised into low ( < 0.1 ) , intermediate ( 0.10.24 ) , and high ( > 0.24 ) . age and systolic and diastolic blood pressure were summarized with means and corresponding standard deviations ( sd ) . atherogenic risk was determined using proportions in each category and the chi - squared test was used to compare proportions . we used the ordered logistic regression model to evaluate the effect of demographic characteristics , blood pressure , lipid profiles , and hiv status on atherogenic risk and the results were presented by sex . to avoid residual confounding and loss of power the continuous variables were included into the model as centered and assessed for nonlinearity by fitting a first - order fractional polynomial to the data . analysis was done using stata 13 ( stata corp , college station , tx ) . the study was conducted in accordance with the principles of the declaration of helsinki and was approved by the uganda virus research institute research ethics committee ( uvri rec ) in entebbe , uganda , and by the uganda national council of science and technology ( unsct ) . written informed consent was obtained from all study participants . for participants below the age of 18 years , parental consent and formal assent to participate in the study were obtained as per the ugandan national guidelines for research involving humans as research participants . participants with hypertension and raised serum lipids were referred to a care clinic for further management and received standard of care ( health education on risk factor prevention and/or control and drug therapy with statins ) . the study enrolled 7507 participants , the majority were females ( 55% ) , and the mean age was 49.9 years ( sd 20.2 ) . there were equal distributions of participants across the different levels of urbanicity , most of the participants were under the age of 30 , and the use of alcohol and tobacco was more common among the male participants ( table 1 ) . from the physical and laboratory measurements we found more female participants to be overweight and obese and have an abnormal whr . approximately 18% of participants were identified as having hypertension and only 2% had controlled hypertension on treatment . the most common form of dyslipidemia was low serum hdl - c levels ( table 1 ) . the proportion of participants with intermediate and high atherogenic risk was 17% and 25% , respectively , with the greater proportion at high risk being male participants ( figure 1 ) . participants with hypertension ( particularly those with suboptimal control on treatment ) , residents from less urbanised villages , hiv - infected participants not on antiretroviral therapy ( art ) , overweight and obese participants , and participants with abnormal hba1c had significantly higher odds of having high atherogenic risk ( table 2 ) . being female , 30 years of age and above , having attained higher level of education , current consumption of alcohol , and being on art were significantly associated with lower odds of having high atherogenic risk . abnormal total cholesterol serum levels and history of smoking had no association with atherogenic risk . urbanisation influences environmental and individual factors that may have impact on cardiovascular risk . in this study we assessed the risk for atherosclerosis using the atherogenic index in a rural ugandan cohort . the atherogenic index in comparison to absolute lipid parameters and to tc / hdl - c ratio provides more accurate estimates of cardiovascular risk and is more likely to be a better screening tool . our study is one of the few studies in the region that provides insight into the use of the atherogenic index and having a cohort already in establishment provides the unique opportunity to conduct pilot studies that generate hypotheses to guide future research in this field . this study also assesses the use of the atherogenic index in a widely distributed rural population and is not only restricted to most at - risk populations . the atherogenic index requires minimal expertise and can be widely implemented as a screen method for cardiovascular disease even within remote locations . a population based survey done in iran and using the atherogenic index found a similar high estimate of atherogenic risk . the interheart study , an observational study involving 52 countries spread across all continents , found that persons with history of myocardial infarction had three times the odds of having a raised apob / apoa1 ratio ( surrogate for atherogenic dyslipidemia ) compared to persons without history of myocardial infarction . an observational study done in brazil found that persons with coronary disease had two times the odds of having an abnormal tg / hdl - c ratio . in our study participants with hypertension had higher odds of risk for atherosclerosis . we found that 27% of participants with hypertension had a high atherogenic risk , a higher estimate compared to a nigerian study that found a lower proportion of patients with hypertension at risk for chd using ldl - c / hdl - c ratios for risk stratification . we attributed this difference in proportions to the atherogenic index being a correlate to lipoprotein size which may predict risk better . participants on treatment , but with uncontrolled hypertension , were more likely to be at risk of atherosclerosis compared to those not on treatment and those with controlled hypertension . literature shows that blood pressure control gives minimal reduction of cardiovascular risk especially among those older than 40 years and in our study we found the mean age to be 49 years . this could explain why even among participants on treatment and controlled hypertension atherogenic risk was still high . participants that were hiv infected and art naive were more likely to have a high atherogenic risk , a finding similar to other studies done , possibly owing to their high inflammatory state . the use of art was found to be protective as art is thought to reduce inflammatory markers and provide cardioprotection . however , other studies have found the use of protease inhibitors ( pi ) to increase the serum levels of atherogenic lipoproteins . in this population first - line therapy we also observed that a high atherogenic index was less prevalent in participants aged 60 years and above and yet it is more likely that individuals in this age category are more at risk of cardiovascular events . the hiv prevalence in this cohort is higher in the younger age group and we thought this may be the main driver for the increased risk in this age group . abnormal hba1c as a screen for diabetes was also found to be associated with high atherogenic risk . diabetes affects the integrity of the vasculature and is also associated with other conditions that predispose to chd , such as hypertension and dyslipidemia that may explain the increased risk . previous epidemiological studies have shown cholesterol to predict risk of chd and ldl - c to be associated with future risk ; however , we did not find any association between high serum cholesterol levels and atherogenic risk in this rural population . similar to the framingham study and the interheart study we demonstrated that obesity and abdominal obesity were associated with increased risk of chd in this study population . our study showed that participants from less urbanised villages were more likely to be at high risk for chd . however previous studies done within this same population showed that persons in less urbanised villages were more likely to indulge in physical activity and eat fruits and vegetables , factors thought to reduce risk for chd . it may be possible that a different set of risk factors , yet to be explored , is responsible for the risk of chd in this population . our study was limited in that we did not derive lipid parameters from fasted samples which may impact on risk estimation if there should be any variation with parameters derived after fasting . we also did not ascertain differences among the subcategories of participants with hypertension that may have accounted for differences in risk profile . however this study provides insight into estimated cardiovascular risk in a widely distributed rural population taking into account environmental , infectious , and noninfectious risk factors and provides a platform for further research into possible causes of high atherogenic risk whose findings may give information on preventive strategies . a significant proportion of persons in this rural ugandan population are at risk of atherosclerosis . persons with hypertension , untreated hiv infection , abnormal glycaemia , and obesity appear to be more at risk and may be considered as target groups for intervention programs . follow - up studies are needed to further assess other risk factors including the role of genetics in cardiovascular risk in this population . | background . hypertension and dyslipidemia are independent risk factors for coronary heart disease and commonly coexist .
cardiovascular risk can be reliably predicted using lipid ratios such as the atherogenic index , a useful prognostic parameter for guiding timely interventions .
objective .
we assessed the cardiovascular risk profile based on the atherogenic index of residents within a rural ugandan cohort .
methods . in 2011 , a population based survey was conducted among 7507 participants .
sociodemographic characteristics , physical measurements ( blood pressure , weight , height , and waist and hip circumference ) , and blood sampling for nonfasting lipid profile were collected for each participant .
atherogenic risk profile , defined as logarithm base ten of ( triglyceride divided by high density lipoprotein cholesterol ) , was categorised as low risk ( < 0.1 ) , intermediate risk ( 0.10.24 ) , and high risk ( > 0.24 ) .
results .
fifty - five percent of participants were female and the mean age was 49.9 years ( sd 20.2 ) .
forty - two percent of participants had high and intermediate atherogenic risk .
persons with hypertension , untreated hiv infection , abnormal glycaemia , and obesity and living in less urbanised villages were more at risk .
conclusion .
a significant proportion of persons in this rural population are at risk of atherosclerosis .
key identified populations at risk should be considered for future intervention against cardiovascular related morbidity and mortality .
the study however used parameters from unfasted samples that may have a bearing on observed results . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we hereby report a case of severe bullous emphysema resulting in pneumothorax in a patient with a few years of marijuana abuse . we hereby report a case of a 25-year - old african american male who presented to the emergency room with sudden onset of shortness of breath and right - sided chest pain . his social history is significant for smoking two to four cigarettes and two to three joints of marijuana / day for the last 8 years . there is no history of significant occupational or animal exposure , intravenous drug use , or use of any medications . his past medical history is significant for sarcoidosis diagnosed 10 years back by bronchoscopy and biopsy . he was started on steroids for sarcoidosis , but was noncompliant to treatment . on physical examination , the chest exam revealed decreased breath sounds as well as hyper - resonance on percussion over the right lung field . a chest radiograph was performed , which showed a right - sided pneumothorax with no mediastinal lymphadenopathy [ figure 1 ] . subsequently , a chest computerized tomography ( ct ) was performed , which showed severe emphysematous bulla in the bilateral lungs with upper lobe predominance [ figure 2 ] . chest radiograph showing right - sided pneumothorax on presentation computerized tomographic scan showing severe bilateral upper lobe bullous lung disease the full - blood examination was normal , with no eosinophilia . an angiotensin - converting enzyme level was performed , which was normal ( 44 ; reference range : 1268 ) . alpha-1-antitrypsin was also within the normal range ( 151 ; reference range : 90200 ) . sputum microscopy and culture for bacteria , acid - fast bacilli , and fungi were negative . pulmonary function testing revealed a severe obstructive ventilatory defect , with a possible associated restrictive ventilator defect , and no response to the bronchodilator . gas transfer was significantly reduced . after excluding all the potential causes of cystic lung disease [ table 1 ] and taking into consideration his new - onset marijuana smoking in the last 8 years the patient was treated with a chest tube and subsequently discharged with advice to quit marijuana smoking and further referral to general surgery for bullous resection . main differential diagnoses of bullous lung disease in adults and features , from the current case , against these diagnoses the harmful effects of tobacco smoking , especially over a period of several years , leading to large emphysematous lung bulla have been well documented . however , the chronic pulmonary effects of marijuana smoking are less well described and there are very few reports demonstrating the association of marijuana smoking with large lung bulla . in 1972 , miller et al . reported a case of pneumomediastinum resulting from performing high - pressure valsalva maneuvers during marijuana smoking . in 2000 , johnson et al . described four cases of large lung bulla in young men with significant exposure to marijuana but low exposure to tobacco . according to the more recent data in 2008 , hii et al . conducted a prospective case series consisting of 10 patients who regularly used marijuana and who developed new respiratory symptoms . similarly , in 2008 , beshay et al . conducted a retrospective case series in which , among the 102 patients who presented with spontaneous pneumothorax at the emergency unit within a 2.5-year period , 17 patients who had relevant pulmonary emphysema and history of marijuana abuse were retrospectively evaluated systematically . the study concluded marijuana abuse as one of the important differentials in case of emphysema in young individuals . marijuana smoking frequently , known as pot , is of significant concern because of its frequent use among young adults . it may be a combination of direct pulmonary toxicity from components in marijuana in susceptible smokers and airway barotrauma related to the high inspiratory pressure and prolonged breath - hold generated during marijuana smoking . studies have shown that marijuana smoking involves a two - thirds larger puff volume , a one - third greater depth of inhalation , and four - times longer breath - holding time than tobacco smoking . this inhalation pattern can result in an increased risk of spontaneous pneumothorax , as seen in marijuana smokers . besides spontaneous pneumothorax , regular marijuana users also experience more cough , sputum , and wheezes than nonsmokers . three to four joints of marijuana per day have been reported to give as many symptoms as an average of 24 cigarettes . we affirm that in all cases of bullous emphysema in young individuals , marijuana abuse should be included in the differential diagnosis . the period of marijuana smoking plays an important role in the development of lung emphysema . video - assisted thoracoscopic surgery ( vats ) should be considered as one of the options for resection of bulla and prevention of recurrent pneumothoraces . | marijuana abuse has been on an increasing trend worldwide in the last decade .
we hereby report a case of severe bullous emphysema resulting in pneumothorax in a patient with few years of marijuana abuse .
we also review the major conditions in the differential diagnosis of bullous emphysema in adults . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
approximately 5%10% of chronic hepatitis b ( chb ) patients worldwide are co - infected with hepatitis d virus ( hdv ) . hdv requires the hepatitis b surface antigen ( hbsag ) for a complete replication cycle ; therefore , infection is only possible in individuals with chb , known as superinfection , or in the context of co - infection with hepatitis b virus ( hbv ) and hdv together . the incidence of hbv / hdv co - infection and hdv superinfection is unknown in most countries , including canada . although co - infection with hbv and hdv is often self - limiting in adults , over 70% of chb patients with hdv superinfection develop chronic hbv / hdv infection and are at higher risk of cirrhosis and hepatocellular carcinoma compared to hbv mono - infection . hdv superinfection also is associated with fulminant hepatitis and is a significant concern in hbv / hdv endemic regions and immigrant populations from such regions . this study is the first detailed longitudinal clinical and virological characterization of hdv superinfection in canada , with the surprising finding of transmission occurring between spouses despite almost a decade of marriage , with 2 children that had been successfully immunized against hbv . a 38-year old genotype d chb male presented to the hospital in july 2015 with a 1-week history of jaundice , fever , epigastric pain , and rash . the patient was not cirrhotic and had been treated for approximately 2 years with tenofovir dixoproxil fumurate ( tdf ) , with a quantitative hbv dna measurement of 2.12 log10 iu / ml . due to progressive liver dysfunction the patient was urgently transferred to the regional liver transplantation unit . testing was done to determine the etiology of fulminant liver failure , including acetaminophen levels , septicemia , and abdominal ultrasound with doppler ultrasonography of the hepatic vessels , all of which were unremarkable or normal . possible infectious disease causes , including herpes simplex virus , epstein barr virus , cytomegalovirus , and other hepatitis viruses were all found to be negative , with the exception of positive antibody and rna results for hepatitis d virus . it was noted that he had tested negative for hdv at 6 months and 2 years prior ( table 1 ) . he subsequently stabilized and after 3 months he had improved liver function and by 16 months follow - up he remained clinically stable with child - pugh class a cirrhosis , normal liver function , and undetectable hbv dna , although his quantitative hbsag ( qhbsag ) and hdv rna continued to be detectable.table 1longitudinal serological and molecular markers of hbv and hdv infection in the wife and husband over time.table 1date ( month - yy)wifehusbandhbv dnaa ( log10 iu / ml)hbsagb ( log10 iu / ml)hdv abchdv rnadhdv rnae ( log10 copies / ml)hbv dnaa ( log10 iu / ml)hbsagb(log10 iu / ml)hdv abchdv rnadhdv rnae ( log10 copies / ml)mar-116.53may-112.03pos6.55dec-116.26aug-112.11mar-125.85nov-122.20jun-131.783.30negnov-131.082.08posjan-141.97pos5.93sep-14<1jan-15<14.59pospos6.02negjul-15<11.97pos6.392.121.10pospos4.39oct-15<13.16negjan-16<14.52<1pos3.11apr-16tndfjul-16<11.97pospos4.29tndpostndoct-16tnd2.80pos3.65jan-17posnegahbv dna measured by the cobas ampliprep / cobas taqman v.2 assay ( roche diagnostics , laval , qc ) from 2011 to 12 and by the realtime hbv assay ( abbott laboratories , mississauga , on ) 2013 and beyond.bquantitative hbsag was measured by the abbott architect hbsag assay ( limit of detection 0.05 iu / ml).chdv antibodies were measured by the wantai hdv - igg elisa assay ( beijing wantai biological pharmacy enterprise co. , beijing , china).dhdv rna detection was performed by nested pcr .equantitative hdv rna was measured by an in - house real - time rt - pcr method having a linear range of 3.11 log10 to 10.44 log10 copies / ml and a limit of detection of 3.11 log10 copies / ml , based on previously described methods , .ftnd , target not detected . longitudinal serological and molecular markers of hbv and hdv infection in the wife and husband over time . hbv dna measured by the cobas ampliprep / cobas taqman v.2 assay ( roche diagnostics , laval , qc ) from 2011 to 12 and by the realtime hbv assay ( abbott laboratories , mississauga , on ) 2013 and beyond . quantitative hbsag was measured by the abbott architect hbsag assay ( limit of detection 0.05 iu / ml ) . hdv antibodies were measured by the wantai hdv - igg elisa assay ( beijing wantai biological pharmacy enterprise co. , beijing , china ) . quantitative hdv rna was measured by an in - house real - time rt - pcr method having a linear range of 3.11 log10 to 10.44 log10 copies / ml and a limit of detection of 3.11 log10 copies / ml , based on previously described methods , . the patient s primary risk factor for hdv transmission was exposure to his wife , who had known hbeag negative , anti - hbe positive , genotype a chb ( diagnosed during routine prenatal screen ) . at presentation ( 5 years prior ) , she had low - level hbv dna ( 2.11 log10 iu / ml ) and normal liver stiffness measurement ( lsm ; 4.4 kpa ) . approximately 30 months after initial assessment , she was diagnosed with chronic hdv infection , with high levels of hdv rna ( 6 log10 copies / ml ) , which was also found following retrospective testing of an archived sample previously only tested for hbv markers . over 5 years of follow - up , she continued to have low - level hbv dna ( table 1 ) , but significant qhbsag levels ( 4.5 log10 iu / ml ) and fluctuating lsm values ( 4.4 9.3 kpa ) . she was treated with 48 weeks of pegylated ifn / tdf therapy , ( initiated 6 months after her husband developed acute liver failure ) . the wife had peg - ifn - related side effects but liver function remained normal . following completion of ifn treatment , hbv dna and hdv rna were not detected and she remains on tdf for chb . the couple had emigrated independently from mongolia and met in canada approximately 10 years previously . the couple has 2 canadian - born children who received hbv immunization and have hbv immunity . both subjects provided written informed consent to participate and for testing of archived and prospectively collected blood samples for research ( university of calgary conjoint ethics research board , i d 16636 ) . to investigate possible interspousal transmission , hdv was extracted from serum obtained from both the patient and his wife and the full hdv genome was pcr - amplified . the complete genomes were approximately 1670 bp in length ( genbank accession numbers ky379246 and ky379247 ) and differed by < 1% nucleotide distance ( 0.51% 0.17% ; mega7 ) . phylogenetic analysis of longitudinal hdv delta antigen ( dag ) coding sequence ( 357 bp , genbank accession numbers ky379238 to ky379245 , ky458181 , ky458182 ; fig . 1b ) from the couple demonstrate hdv evolution following transmission , with 2 nucleotide substitutions apparent in the husband s dag sequence ( at nt 1000 and nt 1246 ) differing from the dag sequence of the wife close to the 6-month time of suspected transmission ( fig . the husband s dag sequence remained nearly identical throughout the 16-month follow - up ( over 357 bp ; fig . 2 ) , while the wife s dag sequence displayed increased heterogeneity , particularly following initiation of treatment ( 16 - 07 - 06 sequence ; figs . 1(a ) phylogenetic analysis of full genome hdv sequence of husband ( ) and wife ( ) with genbank reference sequences for all hdv genotypes . ( b ) phylogenetic analysis of the delta antigen coding region ( 357 bp , approximately nt 9061262 based on the numbering of genbank accession no . m58629 ) from longitudinal specimens of husband ( ) and wife ( ) . the date of specimen collection is provided beside each sequence ( y / m / d ) . sequenced diagnostic reference samples unrelated to the couple , but residing in the same canadian location are shown ( ) . maximum likelihood phylogenetic analysis was performed using mega7 with 500 bootstrap replicates and the tamura-3-parameter + gamma substitution model as the most appropriate model for the alignment data . the ruler shows the branch length for a pairwise distance equal to ( a ) 0.1 or ( b ) 0.05 . the genbank accession numbers for the sequences reported are ky379238 to ky379247 , ky458181 , ky458182.fig . 2longitudinal hdv delta antigen region sequence ( 357 bp ) from spousal couple specimens , by date ( y - m - d ) . the major nucleotide substitutions observed between husband and wife or among longitudinal samples are denoted by the boxes . 2 ( a ) phylogenetic analysis of full genome hdv sequence of husband ( ) and wife ( ) with genbank reference sequences for all hdv genotypes . ( b ) phylogenetic analysis of the delta antigen coding region ( 357 bp , approximately nt 9061262 based on the numbering of genbank accession no . m58629 ) from longitudinal specimens of husband ( ) and wife ( ) . the date of specimen collection is provided beside each sequence ( y / m / d ) . sequenced diagnostic reference samples unrelated to the couple , but residing in the same canadian location are shown ( ) . maximum likelihood phylogenetic analysis was performed using mega7 with 500 bootstrap replicates and the tamura-3-parameter + gamma substitution model as the most appropriate model for the alignment data . the ruler shows the branch length for a pairwise distance equal to ( a ) 0.1 or ( b ) 0.05 . the genbank accession numbers for the sequences reported are ky379238 to ky379247 , ky458181 , ky458182 . longitudinal hdv delta antigen region sequence ( 357 bp ) from spousal couple specimens , by date ( y - m - d ) . the major nucleotide substitutions observed between husband and wife or among longitudinal samples are denoted by the boxes . m58629 ( 357 bp region is found at nt 906 to nt 1262 ) . this is the first reported case in canada , confirmed by hdv complete genome phylogenetic analysis , of spousal transmission after nearly 10 years of marriage and ongoing transmission risk factors ( co - habitation and sexual contact ) , , . the couple s country of origin , mongolia , is highly endemic for hdv , thus it is assumed that the wife has been hbv / hdv co - infected since childhood or as a young adult . prior to hdv transmission to her spouse , the wife experienced high hdv rna ( 6 log10 copies / ml ) , which likely contributed to liver fibrosis progression and increased infectious risk . despite the high genomic variability within hdv genotype 1 ( up to 12% nucleotide distance ) , there was near - complete sequence identity ( 99.5% ) , with nucleotide shifts or substitutions observed within the dag coding region with increasing time from transmission . hdv superinfection of the husband appears to have subsequently led to chronic hdv infection , with suppressed hbv dna a few months following hdv superinfection . although hbv suppression in hdv chronic co - infection is common , several longitudinal studies have shown dynamic fluctuations between hbv dna and hdv rna over time , possibly due to immune or environmental factors or changes in hbsag , suggesting ongoing risk of hbv dna flares . hdv is dependent on hbsag for viral packaging and release from infected cells and on pres1 protein expression for receptor binding . thus , the detection of qhbsag in the husband over the clinical follow - up period portends a higher likelihood of ongoing hdv replication . this study illustrates the continuing risk of hdv transmission in long - term hbv - infected co - habitants / spouses . hdv superinfection is associated with a high risk of severe disease , including fulminant hepatitis as was observed in our patient . although , co - habitants / spouses may consider preventative measures to reduce the risk of transmission , it is interesting that the couple had both a long - term relationship and 2 children without hdv superinfection . thus , this study raises several clinical questions ; namely , ( i ) should couples use barrier protection and conception with assisted reproduction methods , similar to recommendations for hiv prior to the advent of highly suppressive antiviral therapy ? ; ( ii ) is therapy a consideration even in inactive chb mono - infected carriers , if they have a close hbv / hdv co - infected contact , in order to potentially lower qhbsag levels and the risk of hdv transmission ? ; ( iii ) should peg - ifn and/or suppressive nucleos(t)ide antiviral therapy be considered with the hbv / hdv co - infected partner , even though lowering hbv dna could lead to an increase in hdv viremia and transmission risk , due to the complex viral interactions that occur during co - infection ? this study illustrates the clinical challenge regarding optimal management of hdv and hbv co - infection , and the need for detailed long - term epidemiological and virological studies . this research did not receive any specific grant from funding agencies in the public , commercial , or not - for - profit sectors . study subjects provided written informed consent to participate and for testing of archived and prospectively collected blood samples for research ( university of calgary conjoint ethics research board , i d 16636 ) . | in chronic hepatitis b ( chb ) , hepatitis d virus ( hdv ) superinfection can lead to acute liver failure .
the incidence of hdv superinfection is unknown , but is often detected in immigrants from hdv endemic countries . in this report , we characterize long - term clinical and virological outcomes in a hepatitis b virus ( hbv ) infected carrier before and after hdv superinfection , acquired from their spouse having hbv / hdv co - infection . a 38 year - old mongolian male with chb on anti - hbv therapy developed acute liver failure following hdv superinfection .
although he recovered , avoiding the need for liver transplant , hdv serological and molecular markers of infection persisted for the subsequent 16-month follow - up period , suggesting the development of chb / hdv co - infection .
the source of his hdv was from his wife of 10 years , a 34-year old mongolian female known to have inactive chb / hdv co - infection but who was not on anti - hbv therapy .
phylogenetic analysis of the complete hdv genome from the couple showed > 99% similarity , with post - transmission longitudinal sequence revealing specific nucleotide substitutions between both spouse s hdv genome sequences .
this study highlights the ongoing risk of hdv superinfection due to long - term co - habitation or sexual transmission in chb patients .
the fact that transmission occurred after almost a decade of marriage may be due to host immune or environmental factors that created a more favorable condition for transmission . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
recently they are receiving a great attention among pet owners ( 1 , 2 ) . these animals have become increasingly popular as an exotic household pet due to being unique , cute , low and easy maintenance pets . it is estimated that there are more than 40,000 in houses of people in the united states ( 3 , 4 ) . though hedgehogs traditionally categorized in the now abandoned order of insectivora , these animals not exclusively insectivores but are nearly considered omnivorous . hedgehogs feed on insects , snails , frogs , snakes , carrion and mushroom grass roots ( 5 ) . this animal can interfere in some zoonotic pathogens such as , capillaria aerophila , salmonella spp . and this rodent can be considered as an appropriate host for a wide variety of parasites , bacteria , viruses and fungi both in medical and veterinary fields ( 6 , 7 ) . biogeographically e. concolor is considered temperate eurasian species that is the hedgehog of the well - watered forest , agricultural areas and shrub - land of northwestern and northern iran through to the alborz region ( 8) . to the best of our knowledge , there is no published work on helminthic infection of hedgehogs in iran though hedgehogs have a cosmopolitan distribution in our country particularly in north of iran . thus , the primary objective of the current investigation was to prepare a list of parasitic helminthes of hedge - hogs in north of iran . an investigation was performed on ten ( four males and six females ) dead hedgehogs due to road casualties that were hit by cars from april to january 2011 in rural areas of babol city ( 3632 39 all of bodies were transferred to parasitology laboratory of islamic azad university of babol for precise examination and identification . firstly , individual data of dead hedgehog including site of death , date of collection and gender were recorded precisely . secondly , at the necropsy process of hedgehog corpses , the abdominal and thoracic cavities were incised and the viscera were removed . the following internal organs were dissected and washed carefully : the lungs , trachea , heart and liver were dissected and rinsed after macroscopic examination for the presence of helminth . afterwards , the digestive tract ( stomach , small intestine and large intestine ) were separated and opened up along its entire and frequently rinsed in order to gather the whole contents . the contents of each organ separately were screened by aid of mesh 70 and in the next step the remnants was sieved and transferred to petri dishes for more investigation . for the purpose of collecting tiny helminthes which probably are attaching to mucosal layer of the stomach and intestinal tract a stereomicroscope all of the isolated specimens from each part of the body were counted , removed , fixed and preserved in 70% ethanol . in the next stage , they were cleared in lacto phenol and studied in temporary mou - nts by means of light microscope . the parasites identifications were performed according to available systematic keys including ( 10 - 12 ) an investigation was performed on ten ( four males and six females ) dead hedgehogs due to road casualties that were hit by cars from april to january 2011 in rural areas of babol city ( 3632 39 all of bodies were transferred to parasitology laboratory of islamic azad university of babol for precise examination and identification . firstly , individual data of dead hedgehog including site of death , date of collection and gender were recorded precisely . secondly , at the necropsy process of hedgehog corpses , the abdominal and thoracic cavities were incised and the viscera were removed . the following internal organs were dissected and washed carefully : the lungs , trachea , heart and liver were dissected and rinsed after macroscopic examination for the presence of helminth . afterwards , the digestive tract ( stomach , small intestine and large intestine ) were separated and opened up along its entire and frequently rinsed in order to gather the whole contents . the contents of each organ separately were screened by aid of mesh 70 and in the next step the remnants was sieved and transferred to petri dishes for more investigation . for the purpose of collecting tiny helminthes which probably are attaching to mucosal layer of the stomach and intestinal tract a stereomicroscope all of the isolated specimens from each part of the body were counted , removed , fixed and preserved in 70% ethanol . in the next stage , they were cleared in lacto phenol and studied in temporary mou - nts by means of light microscope . the parasites identifications were performed according to available systematic keys including ( 10 - 12 ) were obtained : two nematodes , one cestode and one acanthocephalan including crenosoma striatum ( crenosomatidae ,
fig . 3 ) ( 11 ) and nephridiacanthus major ( oligacanthorhynchidae ) ( 12 ) , respectively . from ten hedgehogs , two ( 20% ) of them were infected with c. striatum , four hedgehogs ( 40% ) harbored physaloptera clausa , one ( 10% ) had hymenolepis erinacei and three ( 30% ) of them were infected with nephridiacanthus major . the localization , prevalence , intensity , abundance , range and median of helminth species in hedgehogs were analyzed and presented in table 1 . in the current survey the following helminthes were collected : c. striatum from lung , p. clausa in stomach and n. major and h. erinacei from small intestine . the general prevalence of present study noticeably was high ( 100% ) which corresponds to other investigations results ( 13 , 14 ) . however , there are two separate studies on two of hedgehogs helminthes in iran before this study , brief report of c. striatum in urmia ( north eastern iran ) , although the prevalence ( in 10 checked hedgehogs ) and the genus and species of hedgehogs are not mentioned ( 15 ) . and in the second study , nephridiacanthus major was found in one ( of two checked , intensity 2 ) erinaceus concolor from mazandaran province and one hemiechinus auritus from golestan province ( intensity 35 ) , acanthocephalan samples were studied morphologically with light microscope and scanning electron microscope ( for the first time ) , also histopathology study was done that showed extensive damage of this acanthocephalan to the infected hosts ( 16 ) . this is worthwhile to clarify that some surveys have proven the major role of hedgehogs as a reservoir and carrier host in urban , peri - urban and rural environments ( 17 ) . in addition classical ruminant helminthes were reported also from atelerix albiventris ( west african hedgehog ) ( 18 , 19 ) . cirak studied on 18 e. concolor ( 10 females , 8 males ) and introduced the following helminth and parasitic burden : p. clausa ( 72.2% ) , c. striatum ( 55.5% ) , a. erinacei ( 55.5% ) , h. erinacei ( 55.5% ) , n. major ( 50% ) and e. aerophilus ( 22.2% ) ( 9 ) . based on gaglio investigation on european hedgehogs ( e. europaeus ) by dissection , 91% of studied animals had parasitic helminth infection . besides , six helminth species were collected including five nematodes ( c. striatum , e. aerophilus , capillaria erinacei , c. ovoreticulata and capillaria spp . ) , one trematode ( brachylaemus erinacei ) and merely one acanthocephalan ( oliganthorhynchus erinacei ) ( 13 ) . in an elaborate survey on two hedgehogs comprising atelerix algirus and paraechinus aethiopicus in algeria these helminth species were recognized : one cestodes , mathevotaenia erinacei , eight species of nematodes : aonchotheca erinacei in the lumen , spirurids in the intestine , c. striatum in the lungs , gongylonema mucronatum ( in oesophagus , p. clausa in the stomach , physaloptera sp . larvae in the mesentery , pterygodermatites plagiostoma in the stomach , spirura rytipleurites seurati in the intestine ; and one acanthocephalan , moniliformis moniliformis in the lumen . the most prevalent species both in a. algirus and p. aethiopicus was p. clausa 64.0% and 64.7% , respectively ( 14 ) . however , they have a flexible diet , feed on a variety of vertebrate , invertebrate animals as well as carrion and plant matter when accessible . therefore , they have an immense potential ability about transferring causative agents of diseases owing to having a wide variety of food choices . nowadays they are considered as an important companion in many households , contributing in activities such as physical , emotional and social development of children and the well - being of their owners , particularly in the elderly individuals . despite of this fact that pets offer noticeable benefits , nonetheless , neither pet owners nor veterinary healthcare providers are enough knowledgeable concerning the potential of many of these animals to transfer zoonotic diseases ( 20 ) . the following zoonotic helminth parasites were recorded from hedgehog : capillaria hepatica from switzerland ( 21 ) , moniliformis moniliformis and mathevotaenia from algeria ( 22 ) . considering aforementioned facts , it is crystal clear that two major groups including pet owners and veterinary surgeons are more at the risk of zoonose diseases owing to close contact with exotic animals . control and prevention of zoonotic diseases is associated with breaking the cycle of transmission , and there is no shadow of doubt that education is the major key to control ( 20 ) . thus , further precise helminthological investigations are required due to noticeable unexplored area of our country in order to ascend our knowledge concerning helminthic parasites of hedgehogs and probable zoonoses and veterinary diseases . | backgroundrecently there is a high tendency among exotic pet owners for keeping hedgehogs .
this mammal can transfer some significant zoonotic pathogens to human .
hence , the present study was conducted for the first time to prepare a list of helminth parasites of hedgehogs ( erinaceus concolor ) in north of iran.methodsten ( four males and six females ) road killed hedgehogs were collected during april to january 2011 in rural areas of babol city , mazandaran province , iran .
all of internal organs were scrutinized for helminth burden .
the extracted specimens were fixed and preserved in 70% ethanol and then cleared in lacto - phenol solution .
helminth identification was carried out according to available systematic keys.resultsall the examined hedgehogs ( 100% ) were infected with parasitic helminth as following : two hedgehogs ( 20% ) were infected with crenosoma striatum , four hedgehogs ( 40% ) harbored physaloptera clausa , one ( 10% ) host had hymenolepis erinacei and three ( 30% ) of them were infected with nephridiacanthus major.conclusionthis is noteworthy that the current survey is the first report of helminth parasites fauna of eastern european hedgehog in iran . since
, this is the first such investigation in our country , more researches are required to perform on unexplored areas of iran in order to increase our knowledge regarding hedgehog parasitic diseases |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ichthyosis prematurity syndrome ( ips ; omim608649 ) is a rare autosomal recessive disorder of cornification caused by mutations in fatty acid transport protein four gene ( fatp4 ) 1 , 2 . key features of ips are premature delivery , thick caseous desquamating epidermis and respiratory symptoms at the time of birth , which recover into a lifelong ichthyosis with severe itching 3 . ips is mainly described in the scandinavian population ; however a few reports in entirely distinct populations have been published 4 , 5 . here , we describe a first indian ips patient with a novel homozygous missense mutation c.530t > c(p.leu177pro ) in the fatp4 gene . the patient , a male , was born at 31 weeks of gestation by cesarean section with a birth weight of 1815 g. the pregnancy was complicated by polyhydramnios , chorioamnionitis and premature rupture of fetal membranes . the parents were consanguineous and a sibling born 18 months earlier was a preterm female who reportedly died of respiratory distress in the early neonatal period . the patient had respiratory depression requiring resuscitation , and subsequently ventilator support and supplemental oxygen . the skin was erythrodermic with thick vernix caseosalike scales accentuated over the scalp , back , arms , gluteal region , and thighs ( fig . , the scales subsided and were replaced by a generalized mild ichthyosis with pruritus ( fig . benign progression of skin phenotype in ips patient . at 48 h after birth caseosa like scales were widely present across the body including scalp ( a ) , arm ( b ) and changes in color of occluded ( whitish ) and nonoccluded ( brownish ) areas on thigh ( c ) . skin conditions rapidly improved with reduction in scales on the scalp at 2 months of age ( d ) mild ichthyosis on the arm at 2 months of age ( e ) . peripheral eosinophilia with 15% eosinophils was detected at birth in our patient with white blood cell count over 20,000 cells / mm ( normal 400012,000 cells / mm ) . at 5 months of age , the wbc count was 31,500 cells / mm with 45% eosinophils and total serum ige was 1951.6 iu / ml ( normal 129.0 ) . ultrastructural studies of the skin biopsy showed pathognomonic aggregations of curved membranous structures in the cytosol of granular and cornified cells ( fig . the sequencing analysis of fatp4 gene in our patient reveal novel , previously undescribed homozygous missense mutation c.530t > c that is predicted to lead to a p.leu177 prosubstitution in the atp / ampbinding domain of fatp4 ( fig . the p.leu177is conserved among species and was not found in 100 normal populationmatched indian alleles . ( a , b ) ultrastructurally the ips skin showed aggregations of curved membranous structures in the cytosol of granular and cornified cells ( black arrowheads ) with lipid droplets ( white arrowheads ) interspersed with curved and linear arrays of lamellar material within corneocytes . ( c ) sanger sequencing reveal novel fatp4 mutation c.530t > c ( p.leu177pro ) in the proband and parents . the clinical features and course of our patient was similar to previously described characteristics of ips 1 , 2 , 3 , 4 . all previously reported ips patients from scandinavia are either homozygotes or compound heterozygotes for the nonsense mutation c.504c > a(p.cys168x ) in atp / ampbinding domain 2 , while our patient is the first one reported to be homozygous for missense mutation in this domain . apparently , both nonsense and missense mutations in the atp / amp motif affect fatty acid activation and transport , leading to abnormalities in lipid metabolism and ips pathology . providing sufficient knowledge of the disorder to obstetricians and neonatologists worldwide may improve awareness about ips features and reduce significant obstetric and neonatal morbidity due to preterm delivery and associated severe life threatening neonatal asphyxia . | key clinical messageichthyosis prematurity syndrome ( ips ) is reported mainly from scandinavia where most of the cases are homozygous or compound heterozygous for the nonsense mutation c.504c > a ( p.cys168 * ) in exon3 indicating a common ancestor for this mutation .
the occurrence of ips in an indian patient suggests that it is more widespread than previously reported . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the treatment of mediastinitis and sternal osteomyelitis , a change of treatment is emerging from open as well as vacuum and irrigation procedures toward combined procedures . the current gold standard is early and radical surgical debridement , followed by vacuum therapy and plastic surgery reconstruction . sternal infections and mediastinitis can result from infections , tumors , injuries or as a consequence of radiotherapy . despite the undisputed advantages of this route of access , severe complications may occur , which lead to further interventions with an extended hospital stay and increased costs for the health system . complications are principally divided into infection - induced vs. non - infection - induced and stable vs. instable conditions . the most severe complication for the patient is mediastinitis with concomitant instability of the sternum . incidence and risk factors with an incidence of 1 - 4% , postoperative mediastinitis and sternal osteomyelitis is rare [ 3 , 5 , 6 ] . however , the complications arising as a result of perioperative infections show a significant mortality rate up to 50% [ 3 , 6 ] , on average 10 - 25% . considered as risk factors for this postoperative complication are insulin - dependent diabetes mellitus , obesity , immunosuppression , chronic obstructive pulmonary disease ( copd ) , sternal osteoporosis , irradiation of the operated area , use of bilateral internal thoracic arteries as bypass grafts , decreased or increased body mass , renal failure and inadequate surgical techniques thoracic wall tumors may also lead to infections with subsequent mediastinitis [ 4 , 6 , 8,9,10,11,12 ] . the diagnosis of postoperative mediastinitis or sternal osteomyelitis usually occurs in a clinical setting based on the typical signs of a local wound infection . the majority of patients show wound secretion accompanied by leukocytosis , an elevated c - reactive protein ( crp ) value as well as elevated body temperature . half of the patients have sternal instability in addition . on the basis of clinical study some patients , however , also arrive for admission with an open wound and in some cases with torn out and exposed sternal wires . in uncertain cases , a computed tomography ( ct ) or magnetic resonance tomography ( mrt ) may help in the decision - making process . classification of mediastinitis mediastinitis ( figure 1 ) is defined in accordance with the guideline of the us centers for disease control and prevention ( cdc ) as an a3 infection . this means that the infection appears within 30 days or within one year in the case of implants and fulfills at least one of the following criteria : purulent secretion from the drainage tube connected to the organ or body cavity;spontaneous opening of the wound , reopening at temperatures over 38 or pain as well as isolation of pathogens from a culture taken under sterile conditions from the organ or body cavity;abscess or other sign of infection during the course of reoperation , clinical examination , histopathological examination or imaging procedures;diagnosis of the attending surgeon / physician . purulent secretion from the drainage tube connected to the organ or body cavity ; spontaneous opening of the wound , reopening at temperatures over 38 or pain as well as isolation of pathogens from a culture taken under sterile conditions from the organ or body cavity ; abscess or other sign of infection during the course of reoperation , clinical examination , histopathological examination or imaging procedures ; diagnosis of the attending surgeon / physician . the goal is to control the infection and to achieve prompt sternal stability with adequate soft tissue coverage [ 3 , 11 ] . wound healing strategies comprise open wound treatment , vacuum and irrigation drainage , vacuum - assisted closure therapy ( vac ) and reconstruction using flap plasties . this includes reopening the sternum , surgical debridement , changing dressings with moist compresses up to spontaneous wound closure by granulation and epithelialization . because of their high failure rate and a mortality rate of over 50% due to sepsis , tissue erosion or direct injuries of the right ventricle caused by the sternum or sharp - edged fragments , these methods were dropped [ 4 , 14 ] . this also included reopening the sternum , surgical debridement of the entire area as well as removal of osteosynthetic material . this is followed by extensive irrigation of the wound and the insertion of a vacuum - irrigation system retrosternally . the sternum is then closed in the conventional manner , the soft tissues closing in layers [ 4 , 5 ] . this is followed by continuous or intermittent irrigation , until three pathogen - free effluates are obtained from the irrigation fluid . if this does not succeed , the vacuum - irrigation therapy should be terminated after four weeks at the latest . disadvantages of the method are the creation of possible dead spaces ( irrigation channels ) , the risk of catheter erosion of vital organs and the danger of systemic absorption of the vacuum - irrigation fluid or a tamponade . and there is little influence of infected soft tissue . due to its high morbidity and mortality rate of up to 36% , this method should now only be applied in exceptional cases . use of vacuum assisted closure therapy a promising approach in the treatment of mediastinitis following heart surgery is the vac -therapy , a secondary healing system . this was introduced by argenta and morykwas in 1997 [ 15 , 16 ] and is based on the application of a uniform local vacuum of up to 120 mmhg in the wound area . chronic and partly also acute and sub - acute wounds are characterized by peripheral edema , which impedes microcirculation and lymph drainage . the uniform vacuum acting on the wound causes removal of fluid and a reduction of pressure in the local tissue . this leads to a dilatation of the capillaries and improves the flow properties of the blood , arterial blood flow , proliferation of granulation tissue and angiogenesis . recent publications show promising results , although the number of cases observed is limited and the underlying healing mechanisms are relatively unknown . vac should be performed for a short a time as possible and serves as an interim measure until final soft tissue reconstruction . . there are only a few contraindications described in the literature for the application of vac . thus , some patients report on pain if the system was installed near their chest wound . in others , excessive growth of granulation tissue into the sponge occurred , above all when sponges were not changed in a timely fashion . both disadvantages can be readily brought under control , however , if the pressure is applied slowly and does not drop below 120 mmhg and the sponge is changed regularly [ 15 , 16 , 20 , 21 ] . the reconstruction of the anterior chest wall may be achieved by local pedicled or free flaps ( figure 2 ) . musculus pectoralis major ; transposition of the greater omentum ; musculus latissimus dorsi ; musculus rectus abdominis . these autologous tissues are ideally suited for covering surfaces with well - vascularized tissue , filling possible dead spaces as well as ensuring coverage of exposed parts of the sternum [ 4 , 9 , 22,23,24 ] . in principle , surgical reconstruction can be achieved by using autologous tissue or synthetic material . most chest wall defects can be treated with local , musculocutaneous tissue , in infection - induced defects following sternotomy in particular using the pectoralis major . having excellent rotational capability , the pectoralis major offers the possibility of covering at least the upper two thirds of the sternum . it is preferably dissected off the sternal origin , mobilized up to the humeral insertion and , if deemed necessary , detached there [ 4 , 11 , 14 , 22 , 25 ] . additional length is given by dissection of the flap from the costal origins and the clavicular part . but one has to keep in mind , that the pars clavicularis of the muscle stays untouched . acting this way the pedicle can be completely isolated on the thoraco - acrominal trunk . with an intact ipsilateral internal thoracic artery , it can also be detached from the humeral insertion to perform a turn over flap . the dissection starts performing the tendon desinseration at the humerus , followed by the costal parts , the blood supply of the thoraco - acrominal trunk and is completed by raising the muscle from the clavicular part . the blood supply is guaranteed by the secondarily determined perforators of the internal thoracic artery . optically , it is not possible to avoid the formation of a protrusion , which some patients find disturbing [ 4 , 11 ] . in the presence of an advanced infection , parasternal vascularization is unreliable or destroyed . for extensive defects , especially on the lower third of the sternum , pectoralis major flaps can also be dissected with the rectus muscle in continuity and be implemented as a so - called bridging flap . when doing this , if possible , the ipsilateral internal thoracic artery should be intact [ 11 , 24 ] ( figure 3 ) . therapeutic options to reconstruct defects with the pectoralis major . the distal section of the wound is at particular risk , as here the greatest force of gravity and most movement acts on the ribcage and the pectoralis muscles are by their nature least developed . the greater omentum ( figure 4 ) is perfused with blood by the gastro - epiploic vessels along the greater curvature of the stomach . it contains many immunologically active cells and shows anti - infective activity [ 4 , 11 , 26 , 27 ] . the greater omentum has a wide range ; the mediastinum can be filled in satisfactorily . the flap can be pedicled via the right as well as via the left gastro - epiploic artery . many surgeons prefer transpositioning of the greater omentum , above all , if foreign material lies exposed and irrigation channels have to be filled . together with adequate surgical debridement , resolute intensive care as well as antibiotic monitoring , the method markedly improved the clinical results and concomitantly reduced the length of time in the prone position for the patient . it is , however , a two - cavity intervention with all the complication possibilities associated with this and a mortality rate of 12 - 36% ( figures 5 and 6 ) . further problems , influencing the local zone of defect coverage , are the protracted secretion and possibly necessary skin transplants . latissimus dorsi muscle this muscle receives its blood supply via the thoracodorsal artery and intercostal and lumbar perforators . the latissimus dorsi flap can be implemented as a pedicled , single or double flap as well as a free flap plasty [ 11 , 14 , 28 ] . the skin islets can measure a good 10 cm and can be oriented horizontally , vertically and obliquely . whilst preparing the flap , the patient must be positioned onto his side so that repositioning may be necessary during the operation . however , the effect on respiratory capacity is greater after using the rectus abdominis muscle as a reconstruction measure . the donor side morbidity following latissimus dorsi plasty is a little higher , and there is the disadvantage of changing position during operation . rectus abdominis muscle some authors favor the sole use of the rectus abdominis muscle . for sternal reconstruction , they are suitable as cranially pedicled flaps . along with the increased logistic investment , the following disadvantages of the muscle flap plasties also have to be considered : hematomas and seromas with subsequent revision;necrosis and wound healing disturbances;dysaesthesias in the operation area for a considerable time after the intervention;abnormal sternal mobility under stress such as cough or lateral position as a consequence of an unhealed sternotomy;tension and excessive distension in the distal scar area in female patients with mammary hyperplasia . hematomas and seromas with subsequent revision ; necrosis and wound healing disturbances ; dysaesthesias in the operation area for a considerable time after the intervention ; abnormal sternal mobility under stress such as cough or lateral position as a consequence of an unhealed sternotomy ; tension and excessive distension in the distal scar area in female patients with mammary hyperplasia . concerns regarding restricted pulmonary function following reconstruction by means of muscle flaps could be dispelled [ 11 , 14 , 22 , 24 , 25 ] . common to all procedures , taking the central criteria ( table 1 ) into consideration , is the goal of bringing about healing of the sternal infection . central treatment criteria . to achieve this ( table 2 ) with the simplest measure and then step - by - step escalate the therapy . in our patient collective , we use multistep therapy with phase - specific procedures and the following algorithm : complete removal of the infected and necrotic tissue and all foreign material , bacterial monitoring and antibiotic therapy;restabilization of the sternum depending on the findings and the time interval from the first operation;application of vac;plastic surgery coverage after abatement of the infection parameters with pectoralis muscle plasty . complete removal of the infected and necrotic tissue and all foreign material , bacterial monitoring and antibiotic therapy ; restabilization of the sternum depending on the findings and the time interval from the first operation ; plastic surgery coverage after abatement of the infection parameters with pectoralis muscle plasty . radical , extensive debridement encompassing all infected structures is indispensable , also meaning that all osteosynthetic material has to be removed . a continuing infection can otherwise maintain progressive necrosis and in this way destroy tissue that is necessary for myoplastic coverage . the same applies for infected or necrotic bony parts of the sternum or the rib insertions . non - infected , vital sternum parts should be preserved to improve thoracic stability and to avoid postoperative respiratory insufficiency . subsequently , the entire wound must be extensively mechanically cleaned and irrigated . at each debridement swabs are taken and therapy is completed by administration of an antibiotic according to an antibiogram . with suitable wound conditions direct wound closure may be carried out . otherwise vac is recommended . the sponge selected for this should be as small as possible to avoid the soft tissues from shrinking , thereby facilitating later myoplastic reconstruction considerably . a small bacterial load can , in individual cases , be accepted . in isolated cases , ruptures of the right ventricle may occur during these interventions . as long as no connective tissue plate has formed retrosternally , which as a general rule occurs after 6 - 8 weeks , fixation of the sternum or residual part of the sternum must be carried out . according to our experience , restabilization of the sternum is therefore absolutely necessary , dependent on when the heart operation is performed , to prevent mechanical traumatization of the mediastinal structures , in particular of the right ventricle . this may happen due to : continuos spreading infection;sharp ends of the sternum;increased or decreased intrathoracic pressure;adhesions between the sternum and the heart . continuos spreading infection ; sharp ends of the sternum ; increased or decreased intrathoracic pressure ; adhesions between the sternum and the heart . complete rewiring need not be carried out , about 3 - 4 cerclages or cords being sufficient to prevent injury to the heart or vessels [ 4 , 22 , 27 , 30 , 31 ] . therefore , in the vac phase for every revision restabilization must be carried out once again . if as a result of severe osseous destruction secure refixation is not possible , further stabilization during vac is achieved by means of a vacuum . as a result of selective refixation only an accidental loss of vacuum as a result of detachment of the foil , disconnection of the vac system or excessive mobilization can be corrected unproblematically without exposing the patient to the danger of a ruptured ventricle . we dispense with covering the medial structures with compresses or membranes soaked in paraffin without refixation of the sternum . if the interval from the heart operation to treatment of the mediastinitis is longer than 6 - 8 weeks and if there is an adequate retrosternal connective tissue layer , refixation of the sternum becomes unnecessary . in these cases , in consultation with the patient , stabilization of the sternum can be achieved by means of pseudarthrosis . as a result of the myocutaneous plastic coverage , good additional stability is achieved by the muscle portions growing into the bony residual cavities [ 9 , 11 ] . in our own patient collective , all patients showed a deep infection with the involvement of the sternum and/or the mediastinum . after an average of three debridements of the soft tissues and the sternum with the removal of the avital areas by means of sequesterectomy and partial resections the sternum lay relatively denuded . from our point of view it is of immense importance to cover the remaining osseous sternum with well - perfused tissue and not adding protracted , secondary wound healing with the resulting presternal dysfunctional scar tissue . furthermore , further stabilization is achieved as a result of myoplastic coverage . the therapeutic algorithm , radical surgical debridement , vac therapy serving as a conditioning and bridging treatment with additional myoplastic reconstruction , proved to be a save and reliable technique for treating deep sternal infections with good results , no recurrent infections and a justifiable risk . | with an incidence rate of 1 - 4% , mediastinitis following cardiac surgery is a rarely occurring complication , but may show a mortality rate of up to 50% .
risk factors for sternal instability are insulin - dependent diabetes mellitus , obesity , immunosuppressed state , chronic obstructive pulmonary disease , osteoporosis , history of radiation , renal failure , body height , smoking and nutritional state .
the aim of this paper is to show an overview of this clinical picture , present the risk factors and elucidate the therapy options chronologically . as a result of interdisciplinary cooperation ,
a therapy concept has developed which is adapted to the patient individually .
therapy begins with the simplest measures and , if deemed necessary , this is then escalated step by step .
the aim of the treatment is to bring the infection under control , which requires radical surgical debridement , removal of infected and necrotic tissue , removal of all foreign bodies ( including wires and osteosynthesis material ) and the removal of all infected , necrotic osseous material if necessary followed by vacuum - assisted closure therapy .
the reconstruction of defects of the anterior chest wall is achievable using different muscle flaps .
mostly the muscle pectoralis major is used unilaterally or bilaterally with or without disinsertion of the tendon .
other options are the omental flap , the muscle latissimus dorsi flap or the muscle rectus abdominis flap . a combined approach comprising surgical debridement ,
short - term vacuum therapy and subsequent myoplastic coverage has proved successful and can be carried out with a high standard of safety . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
balance is the process in which the human body constantly works to maintain its center of
gravity1 . balance is achieved through
the integration of afferent information from the visual system , the vestibular system , and
the somatosensory system by the central nervous system4 . out of this afferent information , the cutaneous sensation from the
soles of the feet is known to play a very important role in controlling balance2 . people with sensory impairment of the sole
show large postural sway and have difficulties maintaining their balance3 . when the sensation of the sole has been
degraded by ice or anesthesia , even healthy persons have poorer postural control abilities
than those with normal sensation4 , 5 . many therapeutic approaches for improving balance control have been studied6,7,8 . among the approaches , stimulating the sole
using an insole for instance , according to qiu f et al.6 and hatto et al.9 , the texture and intervals of the stimulation of the insoles
affects static postural control . while many studies have shown that stimulation of the sole
affects balance control , additional inserts for the insoles can not be easily added to
treatment , because doing so can contribute to instability?9 many studies that have examined orthotic insoles have compared prefabricated insoles with
customized insoles . the largest difference between these two types of insoles is in the
degree to which they accurately fit the wearer s feet . most studies indicate that the
difference in the degree between prefabricated insoles and customized insoles is not
large10 , 11 . however , customized insoles can enhance the tactile information of
the sole more than prefabricated insoles12 . that is , customized insoles are thought to increase the degree of
contact between the soles and the insoles so that richer tactile information can be
obtained . the present study examined the effect that the degree of the contact between insoles and
soles has on static balance . toward this end based on the results of previous studies , the hypothesis of
this study was that higher degrees of contact between insoles and soles would enhance static
balance ability . the study was conducted with 13 adult males and females who had no orthopedic or
neurosurgical pathological condition in the feet and no past history of surgery on the feet
or the ankle joint . the mean age of the study subjects was 23.22.39 years , their mean
height was 170.48.10 cm , and their mean weight was 62.3314.47 kg . all of the subjects were
provided with sufficient explanation about the experiment , and each voluntarily agreed to
participate in this study . the present study was approved by the research ethics committee
of the catholic university of daegu . the following three types of insoles were used in the experiment : 1 ) a flat insole not
thermally formed ( no orthotic insole condition , nc ) , 2 ) a customized orthotic insole with
the area of contact removed by about half ( partial condition , pc ) , and 3 ) a customized
orthotic insole with whole contact with the sole ( full condition , fc ) ( fig 1fig . 1.three orthotic insole contact conditions were used : ( a ) no orthotic insole ( nc ) , ( b )
orthotic insole removed by about half ( pc ) , and ( c ) complete orthotic insole ( fc ) ) . three orthotic insole contact conditions were used : ( a ) no orthotic insole ( nc ) , ( b )
orthotic insole removed by about half ( pc ) , and ( c ) complete orthotic insole ( fc ) the contact area under soles was the greatest in fc , and the least in nc . individual
insoles were made through a thermal forming machine and the surfaces were removed , except
for the heel cup since it might have affected the alignment of the skeleton . the nc insole was made from eva ( ethylene - vinyl acetate
copolymer ) with the contact surface raised by 20 mm . the pc and fc insoles are made from eva
with the contact surface raised by 20 mm ( fig 1 ) . all of the subjects wore each of the three different types of insoles for this
experiment . after wearing the insoles , the subjects were
instructed to place both feet parallel to each other , position their arms comfortably , and
look straight ahead . measurements of
each insole condition were repeated three times , and a 5-minute rest was provided between
the tasks . order effects were prevented by applying counterbalancing to the insole
conditions for the subjects . postural sway data generated during quiet standing were collected using the
accugait force plate ( amti , newton , ma , usa ) . force sensors under the force
plate convert the physical force exerted by an individual into ground reaction forces and
moments in the x ( mediolateral ) , y ( anteroposterior ) , and z ( vertical ) axes . the signals
from the force plate were recorded by a computer with sampling frequency of 200 hz , and
prepared for offline analysis using matlab ( mathworks , ma , usa ) . the raw data of
the signals consisted of the ground reaction forces and moments in each axis
( fx , fy ,
fz , mx ,
my , and mz ) . the raw data were
filtered using a low - pass butterworth filter with a cut - off frequency of 15 hz , and then
used to calculate time - varying center of pressure ( cop ) in the anteroposterior ( ap ) and
mediolateral ( ml ) displacements . cop displacements represent postural sway and were derived
using the following equations :
where dz is the distance from the surface to the plate . the cop displacements were used to calculate the postural sway parameters : cop displacement
range , total distance of cop displacement , and mean cop velocity . all parameters were
calculated separately in the anteroposterior ( ap ) and mediolateral ( ml ) directions . range = |max(cop )
max(cop)|where n is the total
number of data points ( 60,000 ) and t is the total duration ( 30 s ) . range
represents the linear distance between the most positive and negative cop trajectory positions
and indicates the extent of postural sway . total distance of cop displacement represents the
length traveled by the cop in 30 seconds and indicates the total amount of postural sway . mean
velocity refers to postural sway length per unit time ( 1 s ) . a larger value in this variable
indicates a corresponding longer postural sway length per unit time . dependent variables in the current study were the cop parameters : cop displacement range ,
total distance of cop displacement , and mean cop velocity . one - way repeated anovas were used to examine the
significance of differences among the conditions ( nc , pc , fc ) . according to the statistical results , the effects of the insole conditions were
statistically significant for all cop parameters except for the cop ap velocity ( p>0.05 ) . post - hoc analyses showed that the fc condition was the most stable condition for ml cop ,
total ap distance , and ml velocity . in post - hoc tests , the cop ap range and total ml
distance , balance was most unstable under the nc condition . these results indicate that
higher degrees of contact between insoles and soles reduce postural sway and further
stabilize posture ( table 1table 1.comparison of cop variations based on the contact ratiocop parametersrange ( cm)total distance ( cm)velocity ( cm / s)directionapmlapmlapmlflat ( a)mn ( stdev)2.04 ( 0.56)0.93 ( 0.42)21.22 ( 5.49)13.40 ( 4.43)0.71 ( 0.18)0.45 ( 0.15)range ( min - max)1.403.220.482.0214.1835.868.0022.900.471.200.270.7650% ( b)mn ( stdev)1.80 ( 0.32)0.85 ( 0.29)21.31 ( 5.38)12.23 ( 3.90)0.71 ( 0.18)0.41 ( 0.13)range ( min- max)0.992.290.482.0213.9132.727.7423.300.461.090.260.78100% ( c)mn ( stdev)1.70 ( 0.45)0.82 ( 0.33)20.43 ( 3.59)12.20 ( 3.74)0.68 ( 0.12)0.41 ( 0.13)range ( min- max)0.842.640.411.3713.3426.067.1321.880.440.870.270.73p - value0.0050.0230.0370.0410.1210.024levela>(b = c)(a = b)>c(a = b)>ca>(b = c)a = b = ca>(b = c)*p<0.05 ; ap : anteroposterior ; ml : mediolateral ) . * p<0.05 ; ap : anteroposterior ; ml : mediolateral the present study examined changes in balance control ability based on the degree of
contact between the soles and the insoles . the results showed that the ap range , and total
ml distance and velocity decreased when pc and fc insoles were used in comparison to when
the nc insole was used . also , the ml range and total distance in the fc condition than in
the nc and pc conditions . these results indicate that static balance improved as the degree
of contact between the soles and insoles increased . first , these findings are attributable to the fact
that the degree of contact between the soles and the insoles were associated with
facilitation of an ankle neutral position . that is , correction of the ankle position by the
functional insoles is thought to have balanced the muscles and the structures around the
ankle facilitating more effective postural responses13 . previous studies have revealed that changes in the coronal and
sagittal planes of the feet affect the surrounding structures causing abnormal motion of the
feet13 , 14 . in addition , balancing of surrounding structures is an important
element in total ankle15 . second , enhancement of somatic sense by increased sole contact area is considered to have
contributed to improved postural control . according to the results of previous studies , although balance control ability decreases when sole sensation is inhibited by applying ice
to the sole , it improves when stimulation to the sole is increased by the use of textured
insoles4 , 16,17,18 . these results indicate that somatic sense is enhanced by tacile
stimulation of the sole , resulting in an improvement in postural control6 , 9 , 10 , 19 . the results of the present study provide several suggestions for the use of functional
insoles in clinics . first , using insoles with high sole contact for persons with greatly
impaired balance ability ( e.g. , elderly persons ) is recommended , since the insoles would
improve their static balance ability . second , using prefabricated insoles that can support
the sole to some extent would also be capable of improving balance ability . in the present
study , no significant differences were found in the cop parameters between the pc and fc
conditions , and this may indicate that prefabricated insoles can sufficiently improve
balance stability as well as customized insoles . it included only a small number of subjects and
the subjects were adults in their 20s . the degree of contact with the insoles might change with the shape of a
subject s sole ( e.g. , flat feet , pes cavus ) . in future studies , more accurate examinations
will be necessary in order to sufficiently consider the feet characteristics of the subjects
and the time it takes the subjects to adapt to wearing of insoles . | [ purpose ] this study examined the effect of the degree of the contact area between the
insoles and soles on static balance . [ subjects and methods ] thirteen healthy male and
female adults voluntarily participated .
all of the subjects wore three different types of
insoles ( no orthotic insole , partial contact , full contact ) in the present experiment .
the
subjects were instructed to place both feet parallel to each other and maintain static
balance for 30 seconds .
center of pressure parameters ( range , total distance , and mean
velocity ) were analyzed .
[ results ] the results show that the anteroposterior range and
mediolateral ( ml ) total distance and velocity decreased when orthotic insoles with partial
contact or full contact were used in comparison to when a flat insole ( no orthotic insole )
was used . also , the ml range and total distance were lower with full contact than in the
other two conditions .
these results indicate that static balance improves as the degree of
contact between the soles and insoles increases .
[ conclusion ] the results of this study
suggests that using insoles with increased sole contact area would improve static balance
ability . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the mechanism of action of local anaesthetics on neuromuscular transmission and their effects on synaptic and electrophysiologic components of the nerve cell are still under investigation . however , clinical and experimental evidences suggest that these drugs may interfere with the neuromuscular transmission and potentiate the effects of neuromuscular blocking drugs . it is highly important to understand that neuromuscular blockers may interact with other drugs used simultaneously during anaesthesia . these drugs can alter the margin of safety of neuromuscular transmission and modify the effects of neuromuscular blocking drugs . this interaction may contribute to a higher incidence of the residual blockade and postoperative complications . using genuinely brazilian technology , enantiomeric manipulation of racemic bupivacaine components resulted in a new formulation containing 25% of the r - isomer ( + ) and 75% of the s - isomer ( ) of bupivacaine . although anaesthesia produced by the new formulation is comparable to that obtained with the racemic formulation , the presence of only 25% of the r ( + ) -isomer of bupivacaine conferred a lower risk of cardiotoxicity and neurotoxicity to anaesthetic activity . the aim of this study was to evaluate the effect of a 50% enantiomeric excess bupivacaine mixture ( s75-r25 ) on neuromuscular transmission , and its influence on neuromuscular block produced by pancuronium , using an experimental model . exsanguination was performed by sectioning of the neck vessels , to facilitate identification and removal of the left hemidiaphragm and a portion of the corresponding phrenic nerve . to evaluate the effect of a 50% enantiomeric excess bupivacaine mixture on neuromuscular transmission and its influence on neuromuscular block produced by pancuronium , a technique described by bulbring was used . preparations were fixed in a vat containing 40 ml of tyrode nutrient solution , constantly aerated with carbogen ( 95% o2 + 5% co2 ) and maintained at 37c . the diaphragm was maintained under constant tension ( 5.0 g ) by its tendinous portion through a wire connected to a load cell bg50 gms isometric transducer . indirect stimulation was applied at a frequency of 0.1 hz and duration of 0.2 ms . study drugs were administered to the tyrode solution containing the preparation , with a graduated pipette . to evaluate the effect of drugs on neuromuscular transmission , either used alone or combined , three groups were formed ( n = 5 ) : group i - r25-s75% ( 5 g / ml ) ; group ii - pancuronium ( 2 g / ml ) ; group iii - pancuronium ( 2 g / ml ) in a preparation previously exposed to r25-s75% ( 5 g / ml ) . in group iii ( r25-s75% - pancuronium ) , pancuronium was added to the preparation 30 min after the addition of r25-s75% . muscle response to indirect stimulation was recorded during 60 min after addition of the drugs . in the rat diaphragm , the effects of r25-s75% on miniature endplate potentials ( mepps ) and membrane potentials ( mps ) were also studied . the following parameters were evaluated : ( 1 ) the amplitude of diaphragmatic response to indirect stimulation , before and 60 min after adding of r25-s75% ; ( 2 ) the amplitude of diaphragmatic response to indirect stimulation , before and 60 min after the sole addition of pancuronium alone and in a preparation previously exposed to r25-s75% ; ( 3 ) mps and mepps ( pptm ) . the wilcoxon test was used for analysis of muscle fibre mps . to evaluate the reduction in amplitude of muscle response , a student 's t - test ( normal distribution ) was used . in the concentration studied , r25-s75% did not cause any reduction in the amplitude of muscle response to indirect stimulation , in a rat phrenic nerve - diaphragm preparation when used as the sole drug . blockade produced by pancuronium alone was ( 54.9 14.1% ) . in preparations previously exposed to r25-s75% , pancuronium produced a 100% block , with a significant difference ( p = 0.015 ) compared to the block produced by pancuronium alone [ figure 1 ] . the effects on mepps ( pptm ) were characterised by a decrease in the frequency and amplitude until complete block [ figure 3 ] . degree of blockade with r25-s75 and pancuronium alone and in preparation previously exposed to r25-s75 r25-s75 effect on membrane potential in the rat diaphragm preparation r25-s75 effect on miniature endplate potential in the rat diaphragm preparation in clinical practice , it is quite common for the practitioner to combine regional anaesthesia with general anaesthesia . in addition , other anaesthetic techniques are commonly performed with the use of local anaesthetics . peak blood levels of local anaesthetics may be achieved , and neuromuscular transmission may be affected . therefore , it is imperative to conduct studies into the probable mechanism of interaction and response , to explain the influence of local anaesthetics on neuromuscular blockers . the effects of neuromuscular blocking agents should be closely observed and monitored , in particular when they are simultaneously used with other drugs or in situations where the safety margin of the neuromuscular junction is compromised . synergism between local anaesthetics and neuromuscular blocking agents may produce residual curarization and prolonged neuromuscular block . residual paralysis is common at the time of tracheal extubation and arrival at the post - anaesthetic care unit , despite qualitative neuromuscular monitoring and use of neostigmine . some authors have described that local anaesthetics may interfere with neuromuscular transmission , due to nerve conduction blockade . however , low concentrations of these drugs may reduce the amplitude , without altering the frequency of mepps . the influence of local anaesthetics on these parameters may indicate a presynaptic action , consequently decreasing acetylcholine release or reducing the sensitivity of the postjunctional membrane to acetylcholine . in our study , impaired neurotransmitter release was observed . this event was demonstrated by a progressive decrease in the frequency and amplitude of mepps . in addition to preventing the generation and propagation of action potential , local anaesthetics may selectively depress motor fibre conduction . through postsynaptic action , binding to different specific acetylcholine sites may block acetylcholine - induced contractile response , temporarily occluding nicotinic receptor channels . racemic bupivacaine , enantiomeric bupivacaine mixture , ropivacaine , levobupivacaine and mepivacaine , all have in common a piperidine ring containing a chiral centre that provides optical isomers with s ( ) and r ( + ) configurations . along with receptor affinity , , we observed that a 50% enantiomeric excess bupivacaine mixture in the concentration used and administered alone in a rat phrenic nerve - diaphragm preparation , failed to affect neuromuscular transmission . nevertheless , it significantly potentiated the block produced by pancuronium previously added to the preparation . these results are in agreement with other experimental and clinical studies showing that local anaesthetic alone does not affect neuromuscular transmission . however , local anaesthetics may potentiate neuromuscular block produced by different neuromuscular blocking drugs . similarly to other studies , we observed that a 50% enantiomeric excess bupivacaine mixture in the concentration used did not alter mps of muscle fibres . , it may be inferred that this drug does not exert a depolarising action on muscle fibres . the mechanism of action of these drugs on the neuromuscular junction is not related to stabilising the activity of the muscle membrane . however , the drug prevents the conduction of propagated action potentials , without affecting mp . the structure and physicochemical characteristics of local anaesthetics may be determining factors for different effects . interpretation of their mechanism of action should not be restricted to the importance of interaction between these drugs and lipids or directly with sodium channel proteins . a broader interpretation should exist , providing a more global view of their action on cell membranes . the results showed that r25-s75% in the concentration used , potentiated neuromuscular block produced by pancuronium . the lack of effect on mp demonstrates that it has no depolarising action on muscle fibre . the interaction between blockade potentiation and increased risk of residual curarization suggests that neuromuscular block monitoring is necessary whenever these drugs are used simultaneously in clinical practice . | background and aims : local anaesthetics are drugs that are widely used in clinical practice
. however , the effects of these drugs on the neuromuscular junction and their influence on the blockade produced by non - depolarising neuromuscular blocking drugs are still under investigation .
the aim of this study was to evaluate , in vitro , the influence of a 50% enantiomeric excess bupivacaine mixture on neuromuscular transmission and neuromuscular block produced by pancuronium.methods:rats were distributed into three groups ( n = 5 ) according to the drug studied namely , 50% enantiomeric excess bupivacaine mixture ( 5 g / ml ) ; pancuronium ( 2 g / ml ) ; 50% enantiomeric excess bupivacaine mixture + pancuronium .
the following parameters were evaluated : ( 1 ) effects of a 50% enantiomeric excess bupivacaine mixture on membrane potential ( mp ) and miniature endplate potentials ( mepps ) ; ( 2 ) amplitude of diaphragmatic response before and 60 min after the addition of a 50% enantiomeric excess bupivacaine mixture ; the degree of neuromuscular block with pancuronium and pancuronium combined with a 50% enantiomeric excess bupivacaine mixture.results:a 50% enantiomeric excess bupivacaine mixture did not alter the amplitude of muscle response ( mp ) but decreased the frequency and amplitude of mepp .
the block produced by pancuronium was potentiated by a 50% enantiomeric excess bupivacaine mixture.conclusion:a 50% enantiomeric excess bupivacaine mixture used alone did not affect neuromuscular transmission , but potentiated the neuromuscular block produced by pancuronium .
no action was shown on the muscle fibre , and alterations on mepps demonstrated a presynaptic action . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 79-year - old male patient visited our hospital due to right hip pain and motion disturbance after a fall . according to the radiographic images , he had an intertrochanteric fracture without comminuted fracture fragments . the patient 's medical history showed that he had been previously diagnosed with a right brain infarction and vascular dementia . however , he did not show noticeable neurological symptoms and was not taking any antithrombotic agents . the patient had also received a femoral nailing procedure due to a left intertrochanteric fracture three years ago . four days after the injury , the patient underwent a closed reduction on a fracture table under c - arm image intensifier control before the operational management . for the closed reduction , we pulled the injured right limb as internally rotating 15. after confirming proper fracture reduction , we further adducted the limb 20 for insertion of a femoral nail . after the closed reduction first , a transverse skin incision was made from the greater trochanter tip proximally for 5 cm and the fascia of the gluteus maximus and the abductor muscle was subsequently split in line with its fibers . after insertion of a guide pin into the tip of the greater trochanter , a proximal femoral nail ( zimmer natural nail system - cephalomedullary femoral nail - asia short ; zimmer , warsaw , in , usa ) , with a neck shaft angle of 130 was implanted over the guide pin . we used a lag screw ( 10.5 mm diameter and 90.0 mm length ) and a distal interlocking screw ( 5.0 mm diameter and 27.5 mm length ) . during the surgery , satisfactory reduction and fixation the drainage tube was not applied because there was no sign of bleeding from the operation site . one day after the surgery , the patient complained of pain and swelling on the injured thigh . on the second day , hemoglobin levels ( hb ) dropped from 9.6 to 7.7 g / dl without any noticeable signs of bleeding . we transfused packed red blood cell ( 2 packs ) to the patient . on the third day after the surgery , the patient experienced a temporary drop in blood pressure followed by rapid recovery . however , the pain and diffuse swelling on the middle thigh were not alleviated and the hb level dropped to 8.3 g / dl on the 7th day following surgery . the patient was subjected to computed tomography ( ct ) angiography of the lower limb . using the ct , we identified a pseudoaneurysm adjacent to the perforating artery branch at the level of the distal interlocking screw , potentially due to blood vessel damage and intramuscular hematoma of anterior thigh muscle ( fig . , a radiologist performed an angiogram and observed that the psedoaneurysm originated from the perforating branch of the deep femoral artery . he applied coil embolization with four micro coils to the damaged vessel under fluoroscopic angiogram control . after the coil embolization , radiographs confirmed the absence of an aneurysmal sac and further blood leakage ( fig . following the embolization , the patient 's thigh swelling remained and he was subjected to another ct angiography . the pseudoaneurysm was not visible , but a large hematoma in the rectus femoris was observed ( fig . the patient started training with a walker and discharged 4 weeks after the initial operation . it has been known that arterial damage occurring during the treatment of intertrochanteric femoral fractures is very rare ; a review of the literature supports this . in 1964 , dameron1 ) reported a case with a deep femoral artery psudoaneurysm following the treatment of an intertrochanteric fracture2 ) ; after , additional cases were continuously reported . major reasons for these arterial damages include 1 ) direct injuries due to fracture fragments3 ) , 2 ) damages due to over - penetration of a drill bit , 3 ) prolonged irritation on a blood vessel wall owing to the protruding screws , and 4 ) injuries caused by improperly positioned retractors24 ) . in addition , these types of injuries could occur throughout the various stages of the fracture episode including 1 ) direct damage by less trochanter fracture fragment when the injury is given3 ) , 2 ) the surgical reduction process , 3 ) screw insertion , and 4 ) longstanding irritation of the inserted screw in the months and years following surgery5 ) . it has been frequently reported that diagnoses of the psudoaneurysms may be delayed from several hours to several months after the surgery6 ) . according to previous case reports , psudoaneurysms of the deep femoral artery recently , however , femoral arterial damages were reported throughout the literature related to surgeries using proximal femoral nailing for the treatment of the intertrochanteric fracture . yang et al.8 ) and grimaldi et al.9 ) reported superficial femoral arterial ruptures following the insertion of distal interlocking screws with asian - pacific type gamma nail and gamma 3 nail respectively . to our knowledge , however , there has been no case report to address the formation of a psudoaneurysm caused by the rupture of the deep femoral artery when proximal femoral nailing was used . these findings imply that the formation of a psudoaneurysm can occur both in superficial and deep femoral artery regardless of the fixation devices used . when the proximal femoral nailing procedure is used , the possibility of an injury to the blood vessel could increase because it is usually performed following adduction and internal rotation of the injured limb to make the insertion of nails easier . furthermore in the process of reduction , a perineal post is used to draw the lower limb in . this could lead to the displacement of medial soft tissues towards the lateral side , place blood vessels closer to the femur and elevate the likelihood of arterial damages . yang et al.10 ) conducted a study to observe changes in the superficial femoral artery with the color - flow duplex scanning . they found that the distance between the femur and the superficial femoral artery is significantly reduced when the patient 's femur was in adduction and adduction - internal rotation positions compared to the neutral position . they also found that in 60% of cases , the distance was less than 10 mm when the lower limb was in the adduction - internal rotation position . in 8% of cases , given the results of this study , the authors recommend that interlocking screws should be inserted when a patient 's femur is located in the neutral position . han et al.11 ) investigated the relationship between the insertion sites of interlocking screws and femoral arteries with ct angiography . through their study , the authors addressed that 1 ) superficial femoral arteries are located anterior while deep femoral arteries are posterior and 2 ) average distances to the femur are 9.24 - 9.87 mm and 27.27 - 27.81 mm for deep femoral and superficial femoral arteries , respectively . this result implies that deep femoral arteries are more likely to be damaged during surgical procedures . the lag screw of a proximal femoral nail , used in the current case , has 15 anteversion to the main body . , we confirmed the diagnosis 7 days after the surgery , mainly due to the lack of recognition regarding this complication . chong et al.12 ) suggested that there is a triad of symptoms for psudoaneurysm resulting from deep femoral arterial damages : 1 ) thigh swelling , 2 ) continuous bleeding of the fasciotomy wound , and 3 ) anemia with falling hb levels . in our case , we did not notice bleeding on the surgical sites or subcutaneous hemorrhage . rather , the patient experienced middle thigh swelling with pain , unexplained anemia and an episode of drop in blood pressure . therefore , it is recommended that careful examinations should be performed when considering the possibility of blood vessel damage as suggested above . in order to make an accurate diagnosis , non - invasive ct angiography could be a more appropriate choice rather than the ultrasonic doppler . ultrasonic doppler may be limited in providing clear images of deep femoral arterial damages due to the location of the arteries . if the psudoaneurysm is confirmed by ct angiography , coil embolization would be the best alternative for treatment as demonstrated in the current case46 ) . it is also possible to consider insertion of a stent - graft38 ) depending upon conditions of adjacent blood vessels . recently , injection of thrombin has been used for treatment13 ) . in some cases , surgical procedures would be options , including ligation of the psudoaneurysm through the surgical exploration to confirm arterial damages or direct removal of damaged blood vessels . previous studies57 ) , however , have addressed complications of these surgical methods , including postoperative infections and vast blood loss during surgery . therefore , surgical treatment should be minimized . to prevent the formation of a psudoaneurysm , it is advisable to release the traction and place the patient in the neutral position when inserting distal interlocking screws . appropriate drill guides might be needed to avoid over - penetration of the femur . in order to diagnose this type of vascular complication early , it is important to be aware and monitor signs and symptoms related to the possibility of postoperative blood vessel damage throughout intertrochanteric fracture surgical procedures . specifically , it is highly recommended to consider the possibility of a psudoaneurysm when a patient presents with diffuse swelling and pain on the thigh in which surgery has been done , and unexplained anemia following the surgery . we recommend a diagnosis via ct angiography and coil embolization with angiography as the best option for the treatment of a psudoaneurysm after surgery for femur fracture fixation . | recently , we experienced a case where the diagnosis and management of a deep femoral artery rupture was delayed .
this vascular complication occurred during the insertion of a distal interlocking screw of a proximal femoral nail for the fixation of an intertrochanteric femur fracture .
a 79-year - old male patient was diagnosed with a right intertrochanteric fracture after a fall .
we fixed the fracture with a proximal femoral nail ( zimmer natural nail system ) .
one day after the procedure , the patient complained of pain and swelling on the anteromedial side of his middle thigh followed by hypotension , anemia and prolonged thigh swelling .
computed tomography angiography was performed 7 days after the procedure .
we found a pseudoaneurysm of the perforating artery caused by injury to the deep femoral artery and an intramuscular hematoma in the anterior thigh muscle .
we successfully treated the pseudoaneurysm using coil embolization . throughout the management of intertrochanteric femoral fractures , it is important to be aware and monitor signs and symptoms related to the possibility of blood vessel damage .
when a patient presents with swelling and pain on the middle thigh and/or unexplained anemia postoperatively , the possibility that these symptoms are caused by an injury to the femoral artery must be considered . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the main orthodontic malocclusions that require maximum anchorage for premolar extraction are severe crowding and protrusion . extraction of permanent teeth to set the occlusion to class i is a routine approach in orthodontic treatment . achieving maximum or absolute anchorage is the most important strategy among the systems minimizing the anchorage loss during space closure . recently , temporary anchorage devices ( tads ) such as miniscrews , mini - implants , and miniplates have been introduced in orthodontic practice as absolute anchorage mechanics . studies showed that bone anchorage treatments showed less anchorage loss than tooth anchorage mechanics . over the past 60 years , skeletal anchorage systems showed a variety of design , material , and placement locations . miniscrews are applied for many treatment modalities such as the corrections in the anteroposterior dimension such as retraction , protraction , distalization , and in the vertical dimension such as openbites , vertical control in high - angle patients , intrusion and extrusion of the teeth , deepbite , and canted occlusal planes . the purpose of the study is to determine the anchorage potential of tads for canine retraction during space closure and compare and evaluate the amount of anchorage loss and the movement of molars during canine retraction in class i dentoalveolar protrusion . this retrospective study was designed to evaluate the effects of tads as an absolute anchorage compared to conventional molar - anchored canine retraction . a total of fifty patients were selected having a class i malocclusion with a treatment indication of bilateral maxillary first premolar extraction ; and they were divided into two groups . the first group consisted of 25 patients with a mean age of 18.7 years ( ranged 1422 years ; 16 girls and 9 boys ) to whom tads were applied as an anchorage mechanic between the attached gingiva of the upper second premolar and first molar teeth . the second group consisted of 25 patients with a mean age of 19.4 years ( ranged 1323 years ; 14 girls and 11 boys ) , in whom conventional molar anchorage was reinforced with a transpalatal arch ( tpa ) . the first molar bands were soldered to a transpalatal bar constructed on the plaster models , and the tpa is applied to the upper first molar teeth . all the patients were treated by the same orthodontist with 0.022 roth - prescribed brackets . among the patients who have completed their fixed orthodontic treatment , the inclusion criteria were as follows : ( 1 ) patients without any craniofacial deformity and systemic diseases , ( 2 ) having a malocclusion requiring first premolar extraction , ( 3 ) maximum anchorage need for space closure , ( 4 ) angle class i malocclusion with anterior protrusion with an anb angle of maximum 4 and minimum of 1. the treatment schedules of all the selected patients were inspected , and the patients who received the standardized treatment protocol were chosen for this study . according to the treatment protocol , tads had been placed between the upper second premolar and first molar teeth on the attached gingiva following leveling and aligning of the dental arch . ti coil springs had been applied between the upper canine bracket and tad on the 0.019 0.025 stainless steel arch to provide a continuous force of 150 g on a bracket slot of 0.022 with roth 's prescription . tpas had been constructed on the plaster models and applied after the initial leveling and aligning of the upper arch . the landmarks and the cephalometric points , planes , and measurements are shown and described in figure 1 . lateral cephalometric analysis : ( 1 ) the distance between the upper molar and pterygoid vertical plane ( u6 pterygoid vertical plane distance ) ; ( 2 ) the distance between the upper canine and pterygoid vertical plane ( u3 pterygoid vertical plane distance ) ; ( 3 ) upper molar inclination ( u6 - frankfort horizontal angle ) ; ( 4 ) upper molar inclination ( u6 - pp angle ) ; ( 5 ) upper canine inclination ( u3 - frankfort horizontal angle ) ; ( 6 ) upper canine inclination ( u3 - pp angle ) ; ( 7 ) upper molar extrusion ( u6 - frankfort horizontal distance ) ; ( 8) upper molar extrusion ( u6 to pp distance ) ; ( 9 ) upper canine extrusion ( u3 - frankfort horizontal distance ) ; ( 10 ) upper canine extrusion ( u3 - pp distance ) ; ( 11 ) ans - xi - pm ; ( 12 ) , go - gn - sn ; ( 13 ) fma pre- and post - treatment measurements were performed twice 2 weeks apart by the same examiner via the same digitizing software . paired sample t - test was applied to measure the difference between the two measurements of the randomly selected twenty cephalograms , no significant difference was found ( p > 0.05 ) , and the values ranged between 0.86 and 0.94 in the accepted limits . the normality of data was checked in two groups and the data were nonsignificant , thus a parametric statistical analysis was performed . the pre- and post - treatment comparisons within the same group were performed via paired sample t - test . the comparisons of tad and tpa groups were analyzed via independent sample t - test via statistical package for social sciences ( spss ) version 22.0 ( ibm corp , ny , usa ) . the landmarks and the cephalometric points , planes , and measurements are shown and described in figure 1 . lateral cephalometric analysis : ( 1 ) the distance between the upper molar and pterygoid vertical plane ( u6 pterygoid vertical plane distance ) ; ( 2 ) the distance between the upper canine and pterygoid vertical plane ( u3 pterygoid vertical plane distance ) ; ( 3 ) upper molar inclination ( u6 - frankfort horizontal angle ) ; ( 4 ) upper molar inclination ( u6 - pp angle ) ; ( 5 ) upper canine inclination ( u3 - frankfort horizontal angle ) ; ( 6 ) upper canine inclination ( u3 - pp angle ) ; ( 7 ) upper molar extrusion ( u6 - frankfort horizontal distance ) ; ( 8) upper molar extrusion ( u6 to pp distance ) ; ( 9 ) upper canine extrusion ( u3 - frankfort horizontal distance ) ; ( 10 ) upper canine extrusion ( u3 - pp distance ) ; ( 11 ) ans - xi - pm ; ( 12 ) , go - gn - sn ; ( 13 ) fma pre- and post - treatment measurements were performed twice 2 weeks apart by the same examiner via the same digitizing software . paired sample t - test was applied to measure the difference between the two measurements of the randomly selected twenty cephalograms , no significant difference was found ( p > 0.05 ) , and the values ranged between 0.86 and 0.94 in the accepted limits . the normality of data was checked in two groups and the data were nonsignificant , thus a parametric statistical analysis was performed . the pre- and post - treatment comparisons within the same group were performed via paired sample t - test . the comparisons of tad and tpa groups were analyzed via independent sample t - test via statistical package for social sciences ( spss ) version 22.0 ( ibm corp , ny , usa ) . the pretreatment statistics of differences among the groups concerning the lateral cephalometric measurements is shown in table 1 . after treatment , the difference between the values was 2.4 mm , indicating a significant difference ( p < 0.01 ) . similarly , the upper molar angle relative to the frankfort horizontal ( fh ) plane ( p < 0.05 ) and palatal plane ( p < 0.01 ) showed a significant difference after treatment when two groups were compared . the canine distalization showed a similar range of movement between the two groups concerning the inclination relative to fh and palatal plane that shows an insignificant difference ( p > 0.05 ) . the net difference for vertical movement of the maxillary first molar in relation to fh plane was 0.9 mm , and 1.2 mm relative to the palatal plane , however the differences were not significant ( p > 0.05 ) . the extrusion of the canine following distalization had similar values relative to fh and palatal plane when comparing the two groups , indicating an insignificant difference ( p > 0.05 ) . the vertical facial measurements ( lower facial height , go - gn - sn , and mandibular plane angle ) showed no significant differences after treatment among the groups . comparison of temporary anchorage device and transpalatal arch groups at t0 comparison of treatment changes between t0 and t1 the main objective of this study was to evaluate the dental and skeletal effects and the efficiencies of tads and tpas for canine retraction movement . the mean measurements at the beginning of the treatment for both groups are given in table 1 . the measurements of the two groups showed similar values indicating that the groups are harmonious . analysis of the differences between the two groups showed the differences between absolute anchorage of tads and reinforced anchorage mechanics ( tpa ) . the results of this study agree with the results of the studies suggesting the placement of tads for absolute anchorage . thiruvenkatachari et al . and herman et al . compared the amount of anchorage loss observed in the first molars reinforced with and without tads during canine retraction and stated that no anchorage was lost on the side where tad was placed . similarly , in our study , no anchorage loss was seen in the tad group , but a mean 2.4 mm of mesial movement was observed in the tpa group . garfinkle et al . evaluated the effectiveness of tads in a controlled clinical trial to provide anchorage for the closure of canine spaces in premolar extraction cases and reported that no anchorage was lost with the system ; in addition , the stability of the miniscrews was constant up to 250 g force applied , showing a similarity with these results . several studies have investigated the relationship between optimum force magnitude and rate of canine retraction . storey and smith have reported an optimum force of 150200 g for retraction , iwasaki et al . suggested that an 18 g force could be an effective force for tooth movement ; likewise , ricketts advocated a 75 g force and lee recommended a 150200 g as the optimum force for canine retraction . since in general , light forces are thought to be more biologic and less painful , in our study , 150 g force was applied to be effective for canine retraction . benson et al . have compared two groups with midpalatal implants and reinforced anchorage with headgear , revealing that the skeletal and dental points moved mesially with an average of 0.5 mm in headgear group and no movement in midpalatal implant group . the findings of the anchorage loss in the study of sharma et al . showed an anchor loss of 4 mm in tpa anchorage systems . they have evaluated the maxillary molar distance as the indicator of anchorage loss , whereas in this study , the amount of molar mesialization , tipping , and extrusion was also inspected in the tpa group . storey and smith showed that with conventional orthodontic mechanics , 550% of the total extraction space can be taken up by an anchor unit made up of the first molar and second premolar for canine retraction , showing a similarity to our results . tpa is not a convenient maximum anchorage device and does not provide a significant protection on the anteroposterior position , inclination , and extrusion of the maxillary first molars for canine retraction following extraction . these results showed that the mean anchorage loss was 2.4 mm ; therefore , tpa did not adequately reinforce the posterior anchorage in maximum anchorage conditions . it would be beneficial to evaluate the effectiveness of different approaches of achieving orthodontic space closure using tad - supported anchorage . although the treatment duration can not be reduced by tads , the better posterior anchorage and greater retraction of the upper anterior teeth are achieved compared to the conventional anchorage systems . the conventional anchorage systems caused the molars to extrude , leading the vertical facial height to increase . | objective : the purpose of this study was to compare the dental and skeletal effects of canine retraction using conventional anchorage reinforcement systems and comparing them with the usage of tads.materials and methods : the sample consisted of 50 patients having class i malocclusions with bimaxillary protrusion indicated for first premolar extraction , and allocated into two groups .
the first group consisted of 25 patients with a mean age of 18,7 years ( min:14 , max:22 years , 16 girls and 9 boys ) that tads were applied as an anchorage mechanic between attached gingiva of upper second premolar and first molar teeth .
the second group consisted of 25 patients with a mean age of 19,4 years ( min:15 , max:23 years , 14 girls and 11 boys ) that conventional molar anchorage with transpalatal arch ( tpa ) was applied for the anchorage mechanics against canine retraction.results:the results showed that mean mesial movement and the tipping of the first molars in tad group between t0 - t1 were insignificant ( p > 0,05 ) , however in the tpa group were significant ( p<0,01 ) .
vertical movement of the molars were not significant when two groups were compared ( p>0,05).conclusion : although tpa is a useful appliance , it does n't provide an effective anchorage control on anteroposterior movement maxillary first molar teeth concerning first premolar extraction treatment .
tads are more convenient to provide absolute anchorage during maxillary canine retraction in contrast to transpalatal arch . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
afflictions of shoulder by tuberculosis is rare and when it occurs its more commonly a dry lesion ( caries sicca ) . wet lesions in shoulder are rare and we report this case for the rarity of its occurrence . a 55yrs old female patient presented with a painful swelling with restriction of movements of the right shoulder since six months . patient had taken various treatments without any relief ; there was no history of trauma , weight loss , recent infection in the past or any history of tuberculosis in family or contact with tubercular patient . antero - posterior and axial x - rays of the right shoulder showed no bony involvement however , ultrasonography showed lipoma . serological investigations showed a markedly raised erythrocyte sedimentation rate ( 73 mm / hr ) and a positive c - reactive protein . dna pcr was positive for tuberculosis and patient was started on anti - tubercular treatment(category i ) for six months . any patient coming with the complaints of long standing painful restriction of the movements of the shoulder associated with or without complaints swelling , shall be evaluated to rule out skeletal tuberculosis along with other differential diagnosis of periarthritis of shoulder and adhesive capsulitis . most of the patients with skeletal tuberculosis may not necessarily present with the constitutional symptoms of fever , weight loss , etc and also because of the widespread prevalence of the organism in india . out of all the skeletal tuberculosis , 50% accounts for the spinal tuberculosis and rest 50% accounts for the tuberculosis of the joints ( sacroiliac joint , hip joint , knee joint , shoulder joint , elbow joint , wrist joint ) tuberculosis of the small bones(metatarsus , metacarpus and the phalanges ) , tuberculosis of the tendon sheaths and bursae and the tuberculous osteomyelitis . it varies from an incidence rate of 0.9 to 1.7% . out of the total extra pulmonary tuberculosis . the variants of extra pulmonary or skeletal tuberculosis are the classical dry type / atrophic type ( caries sicca ) 2 or the fulminating or caseating type of shoulder tuberculosis associated with cold abscesses or sinus formation . the atrophic type is further observed into 4 various types depending on the affections , i.e. type i , the caries sicca the atrophic form , type ii the caries exudate with swelling and cold abscess formation and type iii the caries mobile with good range of passive movements . a 55yrs old female patient who presented with a painful swelling with restriction of movements of the right shoulder since six months . patient had taken various treatments without any relief ; there was no history of trauma , weight loss , recent infection in the past or any history of tuberculosis in family or contact with tubercular patient . right shoulder revealed restricted movements ; no local rise in temperature , tenderness was present over anterior and posterior aspect of the right shoulder diffusely . external rotation and abduction movements antero - posterior and axial x - rays of the right shoulder showed no bony involvement however , ultrasonography showed lipoma . serological investigations showed a markedly raised erythrocyte sedimentation rate ( 73 mm of fall in 1 hr ) and a positive c - reactive protein . after pre - anaesthetic evaluation the patient was posted for excision of the mass for which supine position was given with the bolster under the right shoulder [ fig.1 ] , deltopectoral approach was taken[fig . the fluid released along with the rice bodies was also collected and were sent for histopathological examination which showed bursitis with loose boodies and dna pcr ( positive ) testing respectively , following which the patient was given a shoulder immobilizer and was started empirically on anti - tubercular treatment(category i ) for six months . patient in supine position with bolster und er the right shoulder joint deltopectoral approach taken with the internervous plain between the deltoid and pectoralis major soft tissue dissection with capsular release of the swelling rice bodies seen on further dissection of the swelling mycobacterium tuberculosis is responsible for almost all the cases of osteo - articular tuberculosis in india . atypical mycobacteria , other than m. tuberculosis fiumanis or bovis have also been reported in bony lesions . certain precipating factors responsible for transmission of atypical mycobacteria are trauma , local steroidal injection , iatrogenic , diabetes mellitus , poor nutrition , poor hygienic conditions , use of immuno- suppressive drugs , acquired immuno - deficiency syndrome . the gold standards for the diagnosis of osseous tuberculosis are culture of mycobacterium tuberculosis from bone tissue , positive ziehl - neelsen staining and positive dna pcr ( as in this case ) . treatment includes standard antituberculosis drugs for six months or category - i under revised national tuberculosis control programme as per as world health organisation guideline for management of tuberculosis . though swelling associated with restriction of range of movements and pain is a rare clinical presentation of form of tuberculosis of the shoulder but can not be ruled out completely without proper further evaluation of the condition with the help of serological as well as radiological means available . a clear knowledge of the mechanism of injury coupled with a thorough clinical examination can help us in the diagnosis of such rare injuries at the earliest . | introduction : afflictions of shoulder by tuberculosis is rare and when it occurs its more commonly a dry lesion ( caries sicca ) .
wet lesions in shoulder are rare and we report this case for the rarity of its occurrence.case report : a 55yrs old female patient presented with a painful swelling with restriction of movements of the right shoulder since six months .
patient had taken various treatments without any relief ; there was no history of trauma , weight loss , recent infection in the past or any history of tuberculosis in family or contact with tubercular patient .
right shoulder revealed restricted movements with no local rise in temperature .
tenderness was present over anterior and posterior aspect of the right shoulder diffusely .
external rotation and abduction movements were restricted while adduction and flexion were not restricted .
power of the muscles was unaffected with no neurological deficit .
antero - posterior and axial x - rays of the right shoulder showed no bony involvement however , ultrasonography showed lipoma .
serological investigations showed a markedly raised erythrocyte sedimentation rate ( 73 mm / hr ) and a positive c - reactive protein .
surgical excision of the mass revealed rice bodies .
dna pcr was positive for tuberculosis and patient was started on anti - tubercular treatment(category i ) for six months.conclusion:any patient coming with the complaints of long standing painful restriction of the movements of the shoulder associated with or without complaints swelling , shall be evaluated to rule out skeletal tuberculosis along with other differential diagnosis of periarthritis of shoulder and adhesive capsulitis .
most of the patients with skeletal tuberculosis may not necessarily present with the constitutional symptoms of fever , weight loss , etc and also because of the widespread prevalence of the organism in india . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
debonding is a common occurrence in orthodontic treatment . despite the improvements in the quality of adhesive materials , the prevalence of bracket detachment is still more than 57% and rebonding of the detached brackets is preferred by a large number of orthodontists . therefore , obtaining a reliable adhesive bond between tooth enamel and orthodontic bracket is essential . economical issues are also important ; the cost factor is reduced if the debonded bracket can be used again . regarding the shear bond strength of rebonded brackets , literature reports inconsistent findings . some studies report lower bond strength , while others report comparable or higher bond strength values [ 711 ] . various adhesive clean - up methods have been reported in the literature , among them sandblasting and er : yag laser irradiation have been shown to provide rebond strength comparable to that of new brackets . using new brackets for rebonding has shown reduction of 20 to 40% in bond strength in different studies , based on the methods of bonding . microleakage allows for the passage of oral fluids and bacteria and thus white spot lesions may form under the bracket surface area [ 1416 ] . in addition , when rebonding brackets , the bracket bases are often not intact , and the degree up to which we could clean the base from residual adhesives affects the microleakage . this may be attributed to the fact that when the bracket base is altered by the method of adhesive cleaning following debonding , the composite adaptation to the base would be different compared to what we have in new bracket bases . in the process of adhesive clean up , methods used can alter the bracket base properties such as its mesh form , which has been documented in previous researches by scanning electron microscope examination . therefore we hypothesized that different methods of adhesive removal may result in different microlaekage values . since higher microleakage score can gradually lead to white spot formation and subsequent esthetic problems , we believed that the comparison of microleakage between these two methods of adhesive removal and a control group was worth studying . james et al . reported that microleakage around orthodontic brackets increased the risk of demineralization . found that microleakage at the adhesive - bracket interface with metal brackets was more than with ceramic brackets , which may result in lower shear bond strength and formation of white spot lesions . assessed the microleakage beneath brackets with different light curing units and bracket types and concluded that ceramic brackets cured with diode units had the lowest microleakage scores . so far , to our knowledge , some studies have assessed bond strength of rebonded brackets but the literature is scarce on the microleakage of rebonded brackets . considering the results of previous studies in support of er : yag laser irradiation and sandblasting as clinically acceptable methods of adhesive removal for bracket rebonding [ 1921 ] , the aim of this study was to compare the in vitro microleakage of metal brackets rebonded using er : yag laser and sandblasting . the teeth were free of caries , cracks or gross irregularities of the enamel structure . the teeth were stored in distilled water at room temperature until the experiment . before bonding , the teeth were polished with fluoride - free pumice powder . the teeth were randomly divided into three groups of 20 namely the control group ( c ) , laser group ( l ) , and sandblast group ( s ) . etching was done with 37% phosphoric acid gel ( ormco , italy ) applied to the buccal surface of teeth for 30 seconds . the teeth were then sprayed with water for 20 seconds and dried with oil - free air spray for 20 seconds until the buccal surfaces of the teeth appeared frosty.a thin coat of light cure primer ( ormco , italy ) was applied to the etched surfaces and the base of brackets using a microbrush . the light cure adhesive ( greenglue , italy ) was applied to each bracket base . the brackets were placed with tweezers with optimum pressure and then cured with quartz tungsten halogen light curing unit ( faraz dentin , iran ) for 40 seconds ( 10 seconds for each bracket side ) . debonding was done with a bracket removing plier ( dentaurum , germany ) in l group and s group with caution not to distort the brackets . after removal of brackets , the remnant adhesive on enamel surfaces was removed with tungsten carbide bur until no composite was detectable by the naked eye under unit lamp . adhesive removal procedure :
group l : adhesive on the back of the brackets was removed with er : yag laser device ( fontana , 1210 ljubljana , slovenia ) at a wavelength of 2,940 nm , spot size of 0.9 mm and ro2-c headpiece . the laser operated in pulse mode ( medium short pulse ) at a distance of 5 mm perpendicular to the bracket bases . the mean power output was 5.5 w and the laser was used at 225 mj and 15 hz for 10 seconds with air and water coolant .group s : sandblasting was done using aluminumoxide abrasion unit model ii ( danville engineering co , usa ) using 50m aluminum oxide abrasive powder at a distance of 3 mm from bracket base for 5 seconds , with the nozzle tip sweeping in a mesiodistal direction and the base of each debonded bracket was etched under 50 psi pressure . micro etching was stopped when the metal base appeared roughened and no resin remnants were detectable on visual inspection . group l : adhesive on the back of the brackets was removed with er : yag laser device ( fontana , 1210 ljubljana , slovenia ) at a wavelength of 2,940 nm , spot size of 0.9 mm and ro2-c headpiece . the laser operated in pulse mode ( medium short pulse ) at a distance of 5 mm perpendicular to the bracket bases . the mean power output was 5.5 w and the laser was used at 225 mj and 15 hz for 10 seconds with air and water coolant . group s : sandblasting was done using aluminumoxide abrasion unit model ii ( danville engineering co , usa ) using 50m aluminum oxide abrasive powder at a distance of 3 mm from bracket base for 5 seconds , with the nozzle tip sweeping in a mesiodistal direction and the base of each debonded bracket was etched under 50 psi pressure . micro etching was stopped when the metal base appeared roughened and no resin remnants were detectable on visual inspection . teeth conditioning with 37% phosphoric acid was done as mentioned earlier , except no rubber cup prophylaxis of the enamel surfaces was performed prior to the etching process . rebonding of the recycled brackets was done as initial bonding in groups l and s. before dye penetration , the apex of each sample was sealed with sticky wax , then nail varnish was applied to the entire surfaces of the teeth except for 1 millimeter around the brackets . after that , the teeth were immersed in 2% methylene blue solution for 24 hours at room temperature . after being removed from the solution , samples were rinsed under tap water and brushed to remove the superficial dye ; then teeth were mounted vertically in acrylic blocks . two parallel longitudinal sections were made with a diamond disk in a sectioning machine ( safaei , iran ) in buccolingual direction . evaluation of dye penetration was done under a stereomicroscope ( 20 magnification ) ( sz 40 , olympus , tokyo , japan ) . dye penetration at both gingival and occlusal margins of the brackets at the enamel - adhesive and the adhesive - bracket interfaces in each section was measured using an electronic digital gauge ( shoka golf , japan ) and the data were recorded to the nearest 0.05 mm value . both the adhesive bracket and the enamel adhesive interfaces were evaluated at the gingival and occlusal margins in the three groups . since the kolmogorov- smirnoff test showed that the data distribution was not normal , a non- parametric test ( kruskal- wallis ) was used . etching was done with 37% phosphoric acid gel ( ormco , italy ) applied to the buccal surface of teeth for 30 seconds . the teeth were then sprayed with water for 20 seconds and dried with oil - free air spray for 20 seconds until the buccal surfaces of the teeth appeared frosty.a thin coat of light cure primer ( ormco , italy ) was applied to the etched surfaces and the base of brackets using a microbrush . the light cure adhesive ( greenglue , italy ) was applied to each bracket base . the brackets were placed with tweezers with optimum pressure and then cured with quartz tungsten halogen light curing unit ( faraz dentin , iran ) for 40 seconds ( 10 seconds for each bracket side ) . debonding was done with a bracket removing plier ( dentaurum , germany ) in l group and s group with caution not to distort the brackets . after removal of brackets , the remnant adhesive on enamel surfaces was removed with tungsten carbide bur until no composite was detectable by the naked eye under unit lamp . adhesive removal procedure :
group l : adhesive on the back of the brackets was removed with er : yag laser device ( fontana , 1210 ljubljana , slovenia ) at a wavelength of 2,940 nm , spot size of 0.9 mm and ro2-c headpiece . the laser operated in pulse mode ( medium short pulse ) at a distance of 5 mm perpendicular to the bracket bases . the mean power output was 5.5 w and the laser was used at 225 mj and 15 hz for 10 seconds with air and water coolant .group s : sandblasting was done using aluminumoxide abrasion unit model ii ( danville engineering co , usa ) using 50m aluminum oxide abrasive powder at a distance of 3 mm from bracket base for 5 seconds , with the nozzle tip sweeping in a mesiodistal direction and the base of each debonded bracket was etched under 50 psi pressure . micro etching was stopped when the metal base appeared roughened and no resin remnants were detectable on visual inspection . group l : adhesive on the back of the brackets was removed with er : yag laser device ( fontana , 1210 ljubljana , slovenia ) at a wavelength of 2,940 nm , spot size of 0.9 mm and ro2-c headpiece . the laser operated in pulse mode ( medium short pulse ) at a distance of 5 mm perpendicular to the bracket bases . the mean power output was 5.5 w and the laser was used at 225 mj and 15 hz for 10 seconds with air and water coolant . group s : sandblasting was done using aluminumoxide abrasion unit model ii ( danville engineering co , usa ) using 50m aluminum oxide abrasive powder at a distance of 3 mm from bracket base for 5 seconds , with the nozzle tip sweeping in a mesiodistal direction and the base of each debonded bracket was etched under 50 psi pressure . micro etching was stopped when the metal base appeared roughened and no resin remnants were detectable on visual inspection . teeth conditioning with 37% phosphoric acid was done as mentioned earlier , except no rubber cup prophylaxis of the enamel surfaces was performed prior to the etching process . before dye penetration , the apex of each sample was sealed with sticky wax , then nail varnish was applied to the entire surfaces of the teeth except for 1 millimeter around the brackets . after that , the teeth were immersed in 2% methylene blue solution for 24 hours at room temperature . after being removed from the solution , samples were rinsed under tap water and brushed to remove the superficial dye ; then teeth were mounted vertically in acrylic blocks . two parallel longitudinal sections were made with a diamond disk in a sectioning machine ( safaei , iran ) in buccolingual direction . evaluation of dye penetration was done under a stereomicroscope ( 20 magnification ) ( sz 40 , olympus , tokyo , japan ) . dye penetration at both gingival and occlusal margins of the brackets at the enamel - adhesive and the adhesive - bracket interfaces in each section was measured using an electronic digital gauge ( shoka golf , japan ) and the data were recorded to the nearest 0.05 mm value . both the adhesive bracket and the enamel adhesive interfaces were evaluated at the gingival and occlusal margins in the three groups . since the kolmogorov- smirnoff test showed that the data distribution was not normal , a non- parametric test ( kruskal- wallis ) was used . the results of kruskal- wallis test revealed no significant differences in microleakage scores among the groups ( p=0.157 ) . thus , no more tests were done for multiple comparisons . comparison of the microleakage scores between the occlusal and gingival margins at the enamel adhesive and adhesive bracket interfaces is shown in table 1 . comparison of the microleakage scores between the occlusal and gingival margins at the enamel - adhesive and adhesive - bracket interfaces . n indicates sample size , sd : standard deviation , ns : not significant ( p < 0.05 was significant ) in all groups , the gingival margin of enamel adhesive interfaces showed higher microleakage while at the adhesive - bracket interfaces , the occlusal margin exhibited higher microleakage ; however , the differences were not statistically significant . comparisons among the three groups at the occlusal margin , gingival margin and both showed no statistically significant difference . the mean microleakage scores in the c group , s group and l group were 0.343 , 0.502 and 0.496 , respectively ( table 2 ) . comparison of total microleakage scores sd = standard deviation , ns : not significant ( p < 0.05 was significant ) thus , the mean microleakage score was the highest in s group and the lowest in c group ; however the differences were not statistically significant . today , a large number of orthodontists prefer to rebond the debonded brackets . according to the results of the current study , sandblasting and er - yag laser for adhesive removal from the back of debonded brackets can affect the microleakage scores at the occlusal and gingival margins of enamel - adhesive and adhesive - bracket interfaces ; although the difference was not statistically significant . the overall microleakage score was the highest in s group followed by l group and c group , respectively.in the bracket adhesive interfaces , the microleakage scores were greater in the occlusal margin , while the gingival margin at the enamel - adhesiveinterface had higher microleakage scores . since we used dual contour brackets , it can be claimed that adhesive thickness was uniformly even at the occlusal and gingival levels . yassaei et al . investigated the shear bond strength of brackets recycled with different methods of resin removal ( including sandblast and er : yag laser ) and concluded that sandblasting and er : yag laser were efficient in - office methods of reconditioning debonded brackets , with minimal damage to the bracket base . ishida et al . conducted a study on shear bond strength of rebonded brackets in which adhesive remnants of the debonded brackets were removed with different methods such as sandblast and er , cr : ysgg laser , and they found that using sandblast and er , cr : ysgg laser for adhesive removal can certainly enhance the use of recycled orthodontic brackets .according to previous studies , sandblast and er laser are suitable methods of resin removal for rebonding brackets [ 19 , 20 , 21 ] . with respect to the critical role of microleakage in white spot formation and reducing the shear bond strength , and the importance of rebonding in clinical orthodontics , we decided to conduct the present study to compare the microleakage beneath the base of brackets rebonded after sandblasting and er : yag laser irradiation.yagci et al . found that when direct and indirect bonding methods were used at the enamel adhesive and adhesive bracket interfaces , microleakage scores at the gingival margins were greater than at the occlusal margins .arhun et al . observed that microleakage scores at the incisal and gingival margins of brackets showed significant differences , implying increased microleakage at the gingival margin . they attributed these differences to the curvature of the tooth morphology , which can result in thicker composite at the gingival margin . they observed that lower or no microleakage scores at the occlusal compared to the gingival margin can be related to the curing method ; because of lighting from the occlusal direction . investigated the microleakage under orthodontic brackets using high intensity curing lights and concluded that gingival margins in all groups had higher microleakage scores compared to occlusal margins at both adhesive interfaces . uysal et al . observed the microleakage under metallic and ceramic brackets bonded with orthodontic self - etching primer systems and found that gingival margins in all groups had higher microleakage scores in comparison with occlusal margins for both adhesive interfaces ; and enamel - adhesive interfaces exhibited more microleakage than did the adhesive - bracket interfaces .literature reports contradictory results regarding the bond strength of rebonded brackets ; some researchers concluded that reusing the brackets did not affect the bond strength significantly , while others concluded that rebonding led to lower bond strength . to our knowledge , some studies have assessed bond strength of rebonded brackets but no literature has reported the effect of rebonding on microleakage . comparison of the microleakage scores among the three groups showed that they had no statistically significant difference ( p > 0.05 ) , although the mean microleakage scores were the highest in the sandblast group and the lowest in the control group . er - yag laser irradiation and sandblasting for removing the adhesive from the back of the debonded brackets prior to rebonding had no significant effect on microleakage scores ; therefor the microleakage scores were clinically acceptable using these methods prior to rebonding the brackets.microleakage score was higher in bracket adhesive interfaces in all groups except for the sandblast group . microleakage score was higher in gingival margin at the enamel - adhesive interfaces and in occlusal margin at the adhesive bracket interfaces . | objectives : debonding is a common occurrence in orthodontic treatment and a considerable number of orthodontists prefer to rebond the detached brackets because of economic issues . the aim of this study was to compare the microleakage beneath rebonded stainless steel brackets using two methods of adhesive removal namely sandblast and laser.materials and methods : sixty human premolar teeth were randomly divided into three groups . following bonding the brackets , group 1 served as the control group .
brackets in groups 2 and 3 were debonded , and adhesive removal from the bracket bases was done by means of sandblasting and er - yag laser , respectively .
after rebonding , teeth in each group were stained with 2% methylene blue for 24 hours , sectioned and examined under a stereomicroscope .
marginal microleakage at the adhesive - enamel and bracket - adhesive interfaces in the occlusal and gingival margins was determined .
statistical analysis was done using the kruskal - wallis test.results:comparison of the microleakage scores among the three groups revealed no statistically significant difference ( p > 0.05 ) . at the enamel - adhesive interface
, the gingival margins in all groups showed higher microleakage while in the adhesive - bracket interface , the occlusal margin exhibited greater microleakage.conclusion:er-yag laser irradiation and sandblasting for adhesive removal from the debonded brackets yielded clinically acceptable microleakage scores . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an acute mi occurs when myocardial ischemia exceeds a critical threshold , usually due to an acute plaque rupture in the coronary arteries , and the cellular cascade of events overwhelms myocardial cellular repair mechanisms leading to myocardial cell damage.1 myocardial ischemia occurs as a result of plaque buildup in the coronary arteries , a disease formally known as atherosclerosis or coronary artery disease ( cad ) . rupturing of vulnerable atherosclerotic plaque follows a period of continual plaque destabilization and/or plaque growth due to various pathobiological processes.2 plaque contents are enclosed within a stabilizing fibrous cap that prevents exposure of the thrombogenic core to the bloodstream , and weakening of this cap can therefore lead to plaque rupture and mi.3 there is substantial evidence illustrating a positive relationship between low - density lipoprotein cholesterol ( ldl - c ) and elevated triglyceride ( tg ) to cad progression . oxidized ldl particles damage endothelium and promote plaque rupture . although ldl - c is well studied , there is also a significant inverse relationship between high - density lipoprotein cholesterol ( hdl - c ) , the good cholesterol , and cad progression . studies show that the strongest independent risk factor for cad is a low serum concentration of hdl , resulting in an increased risk of mi and stroke , although many patients with mi have normal hdl - c levels.4 in this review , we discuss the potential role of low hdl in accelerated cad and examine the need for patients in this subset to be treated with appropriate medication to help prevent mi . numerous factors influence the reduction of hdl - c levels , including smoking and elevated nonfasting tg levels . in a study by xenophontos et al analyzing the relationship between low hdl - c levels ( < 40 mg / dl ) , smoking , and polymorphism and mi in greek cypriot males , it was shown that smoking reduces hdl - c and apolipoprotein concentrations and increases ldl - c , plasma tgs , and very - low - density lipoprotein tgs , which all contribute to an increased risk of mi.5 when tg levels are elevated , tgs saturate hdl particles , leading to an increased exchange of cholesterol esters by cholesteryl esterase transfer protein.6 furthermore , a study by virmani et al showed that thin - cap fibroatheromas , a type of vulnerable plaque and the major precursor lesion associated with plaque rupture , are the most common in patients with low hdl - c levels and a high total cholesterol / hdl ratio.7,8 numerous factors influence the reduction of hdl - c levels , including smoking and elevated nonfasting tg levels . in a study by xenophontos et al analyzing the relationship between low hdl - c levels ( < 40 mg / dl ) , smoking , and polymorphism and mi in greek cypriot males , it was shown that smoking reduces hdl - c and apolipoprotein concentrations and increases ldl - c , plasma tgs , and very - low - density lipoprotein tgs , which all contribute to an increased risk of mi.5 when tg levels are elevated , tgs saturate hdl particles , leading to an increased exchange of cholesterol esters by cholesteryl esterase transfer protein.6 furthermore , a study by virmani et al showed that thin - cap fibroatheromas , a type of vulnerable plaque and the major precursor lesion associated with plaque rupture , are the most common in patients with low hdl - c levels and a high total cholesterol / hdl ratio.7,8 hdls in the blood serum represent heterogeneous lipoproteins with a density > 1.063 g / ml and a small size between 5 and 12 nm.9 hdl - c is composed of proteins apolipoprotein a - i ( apoa - i ) and apolipoprotein a - ii ( apoa - ii ) and other molecules , including phospholipids , cholesterol esters , unesterified cholesterol , and tgs . recent studies have examined numerous hdl subclasses that differ in the quality and quantity of lipids and apolipoproteins and can be distinguished by shape , charge , density , and size through various methods.10 the varying methods used to determine hdl subclasses are inconsistent in their findings , each method obtaining various sets of subclasses in comparison to another . in a recent review of the hdl subfractions , rizzo et al discussed a unified and integrated hdl nomenclature that defined five hdl subclasses for simplicity : very large , large , medium , small , and very small hdl particles . however , the two major subclasses discussed in literature are the hdl2 and hdl3 , which are large and small , dense hdl particles , respectively . hdl particle structures consist of an outer layer composed of free cholesterol , phospholipids , and varied apolipoptroteins and a hydrophobic center composed of tgs and the esters of cholesterol.10,11 hdls can contribute to the maintenance of endothelial cell homeostasis and have potent antioxidant properties via the following enzymes : paraoxonase-1 ( pon1 ) , platelet - activating factor acetylhydrolase ( paf - ah ) , glutathione selenoperoxidase , lecithin - cholesterol acyltransferase ( lcat ) , and phospholipid transfer protein.10 hdl particles also display antithrombotic and antiaggregating properties via the protection of the endothelium through different mechanisms : by stimulating endothelial cell nitric oxide and prostacyclin production , hdl particles are able to promote better regulation of vascular structure and tone.10,12,13 the capacity of hdl to inhibit endothelial cell apoptosis has , therefore , been suggested as an important potential antiatherogenic property , and interruptions to this function can be deleterious . another important function of hdl particles is the protection of ldl particles from oxidation through the activity of associative enzymes such as paf - ah and pon.10 perhaps the most relevant atheroprotective function of hdl is to promote the removal of intracellular cholesterol by a process called reverse cholesterol transport ( rct ) . as defined by vergeer et al.14 , rct is the uptake of cholesterol from peripheral cells by lipid - poor apoa - i and hdl that is mediated by lipid transporter molecules such as atp - binding cassette transporter a1 and g1 and scavenger receptor b - i , and the subsequent delivery to the liver for ultimate excretion into the feces as neutral sterols or bile acids . the whole rct process is physiologically important as it allows removal of excess cholesterol from the artery wall and from atherosclerotic plaques , thereby reducing plaque buildup in the arteries that can lead to an mi.15 in the troms study , a 7-year , prospective , population - based observational study of carotid plaque progression was measured using ultrasound in 1,952 subjects with evidence of carotid atherosclerosis at baseline ; it was shown that more dense , echogenic atherosclerotic plaques were associated with higher levels of hdl - c . the stability and density of these plaques can be attributed to the removal of the lipid within the plaque via rct.16,17
figure 1 illustrates the various roles of hdl.18 the major subclasses of hdl , hdl2 , and hdl3 vary in their composition and activities of lipids and apolipoproteins.19 in hdl3 populations , for example , increased activities of antioxidative enzymes such as pon1 , paf - ah , and lcat , as well as a composition dominated by apoj , apol-1 , and apof proteins have been noted . in hdl2 populations , different proteins such as apoe , apoc-1 , apoc-11 , and apoc-111 have been seen to dominate in these larger , less dense particles.10 the importance of the differing compositions and functionalities remains ambiguous . numerous studies on hdl functionality propose the value of obtaining more information on hdl subfractions such as lipids and apolipoproteins as a means of better understanding the relationship between hdl - c and cardiovascular diseases . moreover , there are equivocal data in studies analyzing these two subclasses and a direct relationship with cad and mi remains unclear . as discussed by rizzo et al , the two major subclasses , hdl2 and hdl3 , possess different functionalities , yet most studies support the view that larger hdl2 particles are more atheroprotective.10 however , stampfer et al analyzed the cholesterol and apolipoprotein contents of 246 male patients with and without mis and found that although hdl2 was indeed associated with lower mi risk , it is hdl3 that had the strongest correlation with mi and was therefore the strongest mi predictor . meanwhile , salonen et al.20 studied 1,799 randomly selected male subjects who were 43 , 48 , 54 , or 60 years old and found that a total serum hdl - c level of < 1.09 mmol / l was associated with a 3.3-fold risk of acute mi , serum hdl2 cholesterol of < 0.65 mmol / l was associated with a 4.0-fold risk of acute mi , and serum hdl3 cholesterol of < 0.4 mm / l was associated with a 2.0-fold risk of acute mi . the authors concluded that both total hdl and hdl2 levels were inversely related to mi risk , possibly conferring atheroprotection against ischemic heart disease , while the role of hdl3 remains ambiguous . contrastingly , martin et al.21 investigated the two major hdl subclasses , hdl2 and hdl3 , in secondary prevention and found that increased risk for long - term hard clinical events is associated with low hdl3 , but not hdl2 or total hdl . evidence from analysis of the triumph study of 2,465 acute mi patients , and the ihcs study of 2,414 patients who underwent coronary angiography , determined that hdl3 was independently associated with a 50% greater risk for mi in each study . thus , the individual atheroprotective roles of hdl2 and hdl3 remain controversial . as with the vast majority of biological molecules , infection / inflammation and oxidative stresses have been shown to be causative factors in the alteration of lipoprotein particles.22 the duration of infection / inflammation induces numerous changes in the apolipoproteins , enzymes , and transfer proteins associated with hdl - c , as well as a reduction in hdl - c levels.23 hypothetically , the alterations of associative molecules inexorably result in functional changes of the hdl - c particles themselves . the known molecules affected are lecithin ( lcat ) , cholesteryl esterase transfer protein , hepatic lipase , and phospholipid transfer protein , which play important roles in hdl metabolism and rct.2427 a study in 1995 comparing hdl before and during an acute phase response ( apr ) systemic reaction to infectious and noninfectious tissue destructive processes in both human beings and rabbit model produced the following results : in rabbits , from the onset of apr the protective effect of hdl progressively decreased and was completely lost by day three . as serum amyloid a ( saa ) levels in acute phase hdl ( ap - hdl ) increased , apo a - i levels decreased 73% . concurrently , pon and paf - ah levels in hdl declined 71 and 90% , respectively , from days one to three . after day three , there was some recovery of the protective effect of hdl . these results indicate that during bodily responses to infection and inflammation , changes to hdl and its associative proteins disarm its ability to protect ldl from oxidation in the aortic cell wall a key function of hdl in the prevention of cad and can become pro - inflammatory agents.2428 riwanto et al compared the effects of hdl particles in mouse cohorts with cad ( hdl - cad ) vs hdl particles in healthy subjects ( hdl - healthy ) for the activation of endothelial anti- and proapoptotic signaling pathways to determine which changes to the lipoprotein were relevant , thereby illustrating how structural changes to hdl proteomics may be harmful.29 according to this study , hdl - healthy reduced endothelial apoptosis in the aorta , whereas hdl - cad did not reduce endothelial apoptosis . proteomic analysis identified significantly reduced clusterin levels and an increase in the apoc - iii content in hdl - cad relative to hdl - healthy , which contribute to this discrepancy in function . clusterin is a protein that , when bound to hdl , increases its endothelial antiapoptotic effects . conversely , apoc - iii has been found to diminish the capacity of hdl to lessen endothelial apoptosis and has been shown to transfer between lipoproteins.29,30 this study also shows that the apoc - iii content was not only increased in the hdl fraction , but also in the serum and the ldl / very - low - density lipoprotein fraction of patients with cad , suggesting an increased synthesis or a reduced clearance of apoc - iii in patients with cad . moreover , elevated apoc - iii levels have been linked to other factors associated with atherosclerotic plaque vulnerability and progression such as hypertriglyceridemia , metabolic syndrome , and diabetes mellitus.3133 apoc - iii also inhibits the clearance of tg - rich lipoproteins , a key process in the prevention of cad , and when bound to ldl is independently associated with an increased risk of cad.34 taken together , these adverse effects of dysfunctional hdl may offer an explanation for how low serum levels of hdl - c contribute to the destabilization and increased vulnerability of atherosclerotic plaque , potential rupture , and mi . the major subclasses of hdl , hdl2 , and hdl3 vary in their composition and activities of lipids and apolipoproteins.19 in hdl3 populations , for example , increased activities of antioxidative enzymes such as pon1 , paf - ah , and lcat , as well as a composition dominated by apoj , apol-1 , and apof proteins have been noted . in hdl2 populations , different proteins such as apoe , apoc-1 , apoc-11 , and apoc-111 have been seen to dominate in these larger , less dense particles.10 the importance of the differing compositions and functionalities remains ambiguous . numerous studies on hdl functionality propose the value of obtaining more information on hdl subfractions such as lipids and apolipoproteins as a means of better understanding the relationship between hdl - c and cardiovascular diseases . moreover , there are equivocal data in studies analyzing these two subclasses and a direct relationship with cad and mi remains unclear . as discussed by rizzo et al , the two major subclasses , hdl2 and hdl3 , possess different functionalities , yet most studies support the view that larger hdl2 particles are more atheroprotective.10 however , stampfer et al analyzed the cholesterol and apolipoprotein contents of 246 male patients with and without mis and found that although hdl2 was indeed associated with lower mi risk , it is hdl3 that had the strongest correlation with mi and was therefore the strongest mi predictor . meanwhile , salonen et al.20 studied 1,799 randomly selected male subjects who were 43 , 48 , 54 , or 60 years old and found that a total serum hdl - c level of < 1.09 mmol / l was associated with a 3.3-fold risk of acute mi , serum hdl2 cholesterol of < 0.65 mmol / l was associated with a 4.0-fold risk of acute mi , and serum hdl3 cholesterol of < 0.4 mm / l was associated with a 2.0-fold risk of acute mi . the authors concluded that both total hdl and hdl2 levels were inversely related to mi risk , possibly conferring atheroprotection against ischemic heart disease , while the role of hdl3 remains ambiguous . contrastingly , martin et al.21 investigated the two major hdl subclasses , hdl2 and hdl3 , in secondary prevention and found that increased risk for long - term hard clinical events is associated with low hdl3 , but not hdl2 or total hdl . evidence from analysis of the triumph study of 2,465 acute mi patients , and the ihcs study of 2,414 patients who underwent coronary angiography , determined that hdl3 was independently associated with a 50% greater risk for mi in each study . as with the vast majority of biological molecules , the function of hdl - c particles is dependent on their structure . infection / inflammation and oxidative stresses have been shown to be causative factors in the alteration of lipoprotein particles.22 the duration of infection / inflammation induces numerous changes in the apolipoproteins , enzymes , and transfer proteins associated with hdl - c , as well as a reduction in hdl - c levels.23 hypothetically , the alterations of associative molecules inexorably result in functional changes of the hdl - c particles themselves . the known molecules affected are lecithin ( lcat ) , cholesteryl esterase transfer protein , hepatic lipase , and phospholipid transfer protein , which play important roles in hdl metabolism and rct.2427 a study in 1995 comparing hdl before and during an acute phase response ( apr ) systemic reaction to infectious and noninfectious tissue destructive processes in both human beings and rabbit model produced the following results : in rabbits , from the onset of apr the protective effect of hdl progressively decreased and was completely lost by day three . as serum amyloid a ( saa ) levels in acute phase hdl ( ap - hdl ) increased , apo a - i levels decreased 73% . concurrently , pon and paf - ah levels in hdl declined 71 and 90% , respectively , from days one to three . after day three , there was some recovery of the protective effect of hdl . these results indicate that during bodily responses to infection and inflammation , changes to hdl and its associative proteins disarm its ability to protect ldl from oxidation in the aortic cell wall a key function of hdl in the prevention of cad and can become pro - inflammatory agents.2428 riwanto et al compared the effects of hdl particles in mouse cohorts with cad ( hdl - cad ) vs hdl particles in healthy subjects ( hdl - healthy ) for the activation of endothelial anti- and proapoptotic signaling pathways to determine which changes to the lipoprotein were relevant , thereby illustrating how structural changes to hdl proteomics may be harmful.29 according to this study , hdl - healthy reduced endothelial apoptosis in the aorta , whereas hdl - cad did not reduce endothelial apoptosis . proteomic analysis identified significantly reduced clusterin levels and an increase in the apoc - iii content in hdl - cad relative to hdl - healthy , which contribute to this discrepancy in function . clusterin is a protein that , when bound to hdl , increases its endothelial antiapoptotic effects . conversely , apoc - iii has been found to diminish the capacity of hdl to lessen endothelial apoptosis and has been shown to transfer between lipoproteins.29,30 this study also shows that the apoc - iii content was not only increased in the hdl fraction , but also in the serum and the ldl / very - low - density lipoprotein fraction of patients with cad , suggesting an increased synthesis or a reduced clearance of apoc - iii in patients with cad . moreover , elevated apoc - iii levels have been linked to other factors associated with atherosclerotic plaque vulnerability and progression such as hypertriglyceridemia , metabolic syndrome , and diabetes mellitus.3133 apoc - iii also inhibits the clearance of tg - rich lipoproteins , a key process in the prevention of cad , and when bound to ldl is independently associated with an increased risk of cad.34 taken together , these adverse effects of dysfunctional hdl may offer an explanation for how low serum levels of hdl - c contribute to the destabilization and increased vulnerability of atherosclerotic plaque , potential rupture , and mi . the well - known hdl hypothesis suggests that therapies aimed at raising hdl - c concentrations will lower the risk of cad and mi . in a widely cited meta - analysis of four large studies ( total number of individuals studied : 15,252 ) , a 1 mg / dl increase of hdl - c levels was reported to be associated with a 2%3% decreased cvd risk.14,35 niacin , presently prescribed with a statin , is one of the most commonly used pharmacological therapy aimed at raising hdl - c concentrations in patients with such risks . at a pharmacological dose of ~1.52 g per day , niacin is one of the most potent agents available for this purpose . niacin also reduces all proatherogenic lipids and lipoproteins , including total cholesterol , tgs , very - low - density lipoprotein , ldl , and lipoprotein(a).15 despite its popularity , the efficacy of niacin has come into question in recent studies.36 two distinct studies , atherosclerosis intervention in metabolic syndrome with low hdl / high triglycerides and impact on global health outcomes ( aim - high ) and heart protection study 2 treatment of high - density lipoprotein to reduce the incidence of vascular events ( hps2-thrive ) were aimed at evaluating whether adding the modern , extended - release niacin formulations to statin therapy provides incremental benefit over statin therapy alone in terms of cardiovascular primary events in patients with established cad.15 these clinical trials studied specific populations of stable ischemic heart disease patients , excluding patients with mi or those with significant residual mixed dyslipidemia not treated with optimal doses of intensive statin therapy.37 both the aim - high and hps2-thrive clinical trials were stopped prematurely due to a lack of beneficial effects and an inability to meet primary endpoints of reduced cardiovascular disease and mi risk.38 a genetic study conducted by voight et al failed to show a causal association between hdl - c elevation and reduced risk of mi . using two mendelian randomization analyses , they tested the hypothesis of this causal association . voight et al identified the endothelial lipase gene ( lipg ) variant that has a serine substituted for asparagine at amino acid 396 ( lipg 396ser ) that only affects hdl - c without changing other lipid / nonlipid mi risk factors . carriers of lipg 396ser display significant increases in hdl - c as compared to noncarriers . to determine whether the carriers of this lipg 396ser are protected from mi , voight et al studied the association of lipg asn396ser a single - nucleotide polymorphism in the lipg with incident mi in 50,763 participants from six prospective cohort studies . they found that this lipg variant did not protect against mi , challenging the idea that higher levels of hdl - c confer protection.39 data from this study show no direct correlation between hdl - c levels and risk of mi from a genetic standpoint , suggesting that increasing hdl - c medically is not sufficient to prevent mi . however , one caveat to the above study , rizzo et al suggest that total hdl - c may not accurately reflect the true atheroprotective properties in particular patients . there have been a number of recent studies on the novel monoclonal antibody drugs , evolocumab ( amgen ) and alirocumab ( sanofi aventis / regeneron ) . these drugs comprise a monoclonal antibody targeting a liver protein : proprotein convertase subtilisin / kexin type 9 ( pcsk9 ) that inactivates it [ reviewed in ref . 40 ] . these studies , odyssey41 and osler,42 suggest pcsk inhibitors may be highly effective ldl - c lowering drugs for patients who are statin intolerant , and therefore potentially lower the risk for cad , mi , and stroke . although there is sufficient data supporting its effect on ldl , more data are warranted to discuss its effects on hdl and patients with dyslipidemia . in this review , we have established that hdl is decreased in many patients with acute mi . brief analysis of its subparticles show that increasing total concentration may not be sufficient to protect mi . however , blood levels of hdl < 40 mg / dl may be an effective warning sign for atherosclerotic development . therefore , in these patients , statin treatment should be used to prevent accelerated cad and mi . in the future , more data from the new pcsk9 inhibitors will help ascertain their role in this process . | low hdl is an independent risk factor for myocardial infarction .
this paper reviews our current understanding of hdl , hdl structure and function , hdl subclasses , the relationship of low hdl with myocardial infarction , hdl targeted therapy , and clinical trials and studies .
furthermore potential new agents , such as alirocumab ( praluent ) and evolocumab ( repatha ) are discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
many people who stutter report that their stuttering goes away completely in certain situations , such as when they speak to their children or to a pet , sing , talk in chorus with others , or even adopt a novel manner of speaking ( for example , speaking with an accent or speaking as an actor onstage ) . speaking under delayed auditory feedback , which delivers an echo of one s voice while speaking ( one hears back one s voice with a split - second delay ) , or frequency - altered feedback , which delivers feedback of one s voice with a pitch shift ( one hears one s voice altered to be either higher or lower in pitch ) , can also induce fluency in many people who stutter . the fact that people who stutter often show a dramatic decrease in stuttering during an altered - feedback condition one that usually disrupts speech in fluent speakers suggests that the auditory and motor centers of the brain interact differently in this group relative to fluent speakers . in addition , many of the fluency - inducing conditions promote slowed rates of speech and provide externally delivered timing cues for speech movement . these conditions may compensate for a speech system that is less able to sequence speech movements rapidly and perhaps unable to rely on internal timing of speech movements . data from recent neuroimaging studies on stuttering give us insights into the possible bases of these fluency - inducing conditions in stuttering speakers . the main brain regions that work together to make fluent speech production possible include areas in the frontal cortex of the brain , which controls movement planning and execution , and auditory sensory regions located farther back , in the temporoparietal cortex . regions deeper within the brain , including the basal ganglia , thalamus , and cerebellum , also support speech movements by providing internal timing and sequencing cues . it is in these brain regions and their connections that researchers have found brain function and anatomy differences between stuttering speakers and fluent speakers . fluid , effortless speech production is possible because of well - established connections among brain regions that support auditory processing , motor planning , and motor execution . these connections become established when a child learns to speak by matching the sounds that he has heard in a model s , such as a mother s , speech with sounds generated by his own speech movements . with practice , the child s speech sounds begin to match the targeted speech sounds . according to one speech model , the auditory cortex , which houses the auditory representation of speech sounds , is connected with speech planning and execution areas.1 this connection is achieved through a dorsal stream that researchers posit to be much more highly developed in the left hemisphere . researchers claim that the dorsal stream anatomically corresponds to the superior longitudinal fasciculus , a major white - matter pathway that connects the brain structures located in the anterior ( motor ) and posterior ( sensory ) parts of the brain.2 the white - matter tracts act like electric cables , transmitting nerve impulses from one part of the brain to another . if the integrity of these white - matter tracts is compromised , the rapid information exchange that needs to occur among the major areas that support speech may also be compromised . some neuroimaging data support the idea that people who stutter may have aberrant connections relative to fluent speakers , primarily in the left hemisphere that involves a major white - matter tract ( figure 1 ) . in this white - matter pathway , the superior longitudinal fasciculus connects the brain regions involved in speech planning in the inferior frontal region with the auditory regions involved in the sensory feedback of speech sounds , via the motor cortex , which is responsible for speech - motor execution ( figure 2 ) . studies have reported subtle decreases in white - matter integrity in the left superior longitudinal fasciculus in both children and adults who stutter.36 according to some studies , stuttering speakers have greater volume and activity in the right side of the brain compared to the left side , perhaps as a reaction to the left - sided connectivity deficits . nonstuttering adults , in contrast , have greater left- than right - side auditory cortex volume . moreover , stuttering adults with the greatest rightward asymmetry ( right greater than left ) brain volume in an auditory association region exhibited more severe stuttering and experienced the greatest benefit from delayed auditory feedback during speech production.7 researchers who examined brain - activity patterns in adults who stutter during various speech - production tasks found underactivity in the auditory cortex and overactivity in the motor regions . relative to the nonstuttering control group , stuttering speakers exhibited heightened activity in the right hemisphere in motor regions810 as well as in the cerebellum11 and lowered activity in the auditory areas . in conjunction with abnormal anatomy in these regions , and particularly in the left hemisphere , this right - sided overactivity might be explained as a compensatory reaction to the left - sided deficit in the auditory areas . the neural correlates of stuttering are difficult to establish when examining only adults , since people who stutter for decades may develop compensatory mechanisms that have become hardwired in the brain . these compensatory effects which are much less likely in the brains of children may confound the core deficit associated with stuttering . as it turns out , all studies discussed above involved adult participants , mostly due to the practical challenges of conducting neuroimaging research on young children . researchers have conducted large - scale studies examining typical brain development in children , however . these studies show that brain structures supporting speech and language development have a protracted growth pattern relative to other areas of the brain ( such as vision).1214 researchers found that the superior longitudinal fasciculus continues to develop even up to adolescence.15,16 thus , during the course of speech acquisition , it is possible that structures supporting speech production may develop differently in children who stutter compared to children who speak fluently . in addition , the development of these structures and the connectivity among them may differ in children who recover from stuttering compared to those who continue to stutter into adulthood . given that in typical brain development , these structures particularly maintain plasticity into later childhood and adolescence , the discovery of differences may also have significant implications for therapy that results in lasting recovery from stuttering . in the only published study to date on the neuroanatomical bases of childhood stuttering , we compared children with persistent stuttering , children who recovered naturally from stuttering , and age - matched fluent controls on several different brain structure measures . all 21 children who participated were 8- to 12-year - old , right - handed boys.3 we examined both differences in the integrity of white matter ( the tracts that connect different areas in the brain ) and differences in the volume of gray matter ( composed of nerve - cell bodies and dendrites , where information processing takes place ) among the groups . we found evidence of decreased white - matter integrity in the superior longitudinal fasciculus underlying the sensorimotor cortex in stuttering children relative to age - matched controls . a decrease in white - matter integrity in this area may mean that signals among the movement planning , execution , and sensory brain areas may not be transmitted in a sufficiently rapid manner to allow for fluent speech production . this decrease was common for both those who were persistent stutterers and those who had recovered from stuttering . interestingly , the recovered group showed an intermediate level of white - matter integrity , between that of the persistent stuttering and control groups . additionally , the recovered children showed trends of increased white - matter integrity in the right - hemisphere homologue region , the equivalent region in the right hemisphere that mirrored the left hemisphere region found to have less integrity in stuttering children . these findings warrant confirmation with larger groups to determine whether brain areas showing distinct growth in recovered children ( as found in this study ) underlie natural recovery . that study found that left - sided white - matter integrity decreases in the sensorimotor cortex region in adults who stutter compared to controls.4 the left - sided decrease in white - matter integrity found in adults and now in children clearly suggests that this may be one of the important structural bases for stuttering . although the school - age children who had persistent stuttering had been stuttering since two to four years of age and were likely to have adopted some compensatory behaviors similar to those of adults , this can not be said about the age - matched group of children who had recovered from stuttering and who had not been stuttering for at least two years prior to their study participation . the fact that both groups exhibited the same white - matter differences compared to the control children suggests that this structural difference may be associated with the risk of developing stuttering , regardless of outcome . in addition , our study reported significant differences in white - matter integrity between children with a stuttering history ( both persistent and recovered ) versus fluent children in an area that contains thalamocortical and corticonuclear tracts . these tracts connect cortical brain regions with subcortical areas and cranial nerves , respectively , that can directly control speech musculature . if these connections are affected , coordination of speech musculature allowing adequate timing , amplitude , and sequence manipulation that is typical of fluent speech could be affected as well . right - hemisphere brain volume increases previously reported in adults who stutter17,18 were not found when examining gray - matter volume in children who stutter.3 children who stutter exhibited the typical leftward asymmetry in gray - matter volume , particularly in the posterior temporal cortices ( auditory association areas ) . perhaps the auditory cortex increases found in children with persistent stuttering are the result of continuing to stutter for six to nine years after onset.3 in summary , children who stutter , regardless of whether they continue to stutter or recover from stuttering , appeared to have brain connectivity differences when compared to their nonstuttering peers . the differences suggested that dynamic and timely interactions among the left motor cortical and sensory regions may be affected in children who stutter , thus resulting in nonfluent speech . all children , including both of the stuttering groups , exhibited the normal left - greater - than - right asymmetry pattern . this suggests that the increased right - sided volume found in adults who stutter could be the result of compensation for aberrant left - hemisphere connectivity . because this study was based on relatively small numbers of children and the persistent children were more than two years past the onset of stuttering symptoms , it is important to replicate these findings in larger groups and in younger children closer to stuttering onset . in addition , this study examined only boys who stutter ; considering the skewed sex ratio in stuttering ( for every girl who stutters , there are five to seven boys who stutter ) and the fact that most girls who stutter recover from it , it would be important to examine both gender groups in future studies . the anomalous anatomical growth reported in children who stutter may impact how brain regions interact when producing speech . in turn , sustained anomalous function could lead to further structural changes in the brain . to date , researchers have conducted only a few studies examining differences in brain function in young children who stutter . any study that uses magnetic resonance imaging ( mri ) or functional magnetic resonance imaging ( fmri ) , for example , requires restriction of head movement ; children must stay immobilized in a small space under loud noise during scanning . other techniques , such as positron - emission tomography ( pet ) , involve injecting radioactive substances , which are inappropriate to use in children without a clinical justification . perhaps reflecting these practical challenges , studies measuring brain function in stuttering children have so far been limited to using event - related potentials , or erps . these studies involve measuring stereotypical electrophysiological responses to a given stimulus ( such as auditory presentation of a tone or a vowel ) via an electroencephalogram ( eeg ) or magnetoencephalogram ( meg ) . using electrodes or very sensitive coils along the scalp , eeg and meg can pick up electrical and magnetic field potentials , respectively , which are associated with neural activity . both methods can capture the brain responses of interest almost as soon as they occur . however , the spatial resolution , which relates to localizing the brain activity to a certain region of the brain , is much less reliable than other neuroimaging methods such as fmri . an erp study conducted with school - age children who stutter reported that stuttering children were significantly less accurate than controls when making rhyming judgments that required phonological rehearsal . the authors noted that the brain s evoked responses related to the cognitive processes preceding this task were altered in children who stutter , and that the responses peaked earlier in the right hemisphere than in the left , while the brain responses peaked earlier in the left than the right in the controls.19 the same research group conducted another erp study on preschool - age children who stutter and found that children who stutter lacked a characteristic waveform that is typically elicited in normal children in response to deviant auditory stimuli . this indicated aberrant cognitive mechanisms involved in processing auditory stimuli , even in the youngest stuttering children.20 another study examining school - age children who stutter used meg to examine a well - known phenomenon that illustrates the interaction between speech motor and auditory areas : vocalization - induced suppression.21 the auditory cortex is normally inhibited during vocalization , unlike when we listen to a recording of the same vocalization . according to scientists , this phenomenon underscores the tight collaboration between the auditory and motor regions of the brain to enable normal speech production . the researchers measured the brain s evoked responses to listening to a tone , listening to a vowel , and producing a vowel in school - age children who stutter . the children did not differ from age - matched controls in their evoked response to simply listening to the tone , but they did differ in their response to vowel perception and production . the amplitude of the evoked responses did not differ , but the latency of response was delayed in both hemispheres of children who stutter . in the most recently published study , the extent of laterality ( left versus right cerebral dominance ) in brain function for phonological and prosodic contrast tasks was reported in adults , school - age children , and preschool - age children who stutter.22 the phonological task involved perceiving differences in distinct units of speech sounds , while prosody contrasts involved perceiving differences in intonation . the authors expected that speech sounds , compared to intonation changes , would be perceived better in the left hemisphere compared to the right , as the former involves linguistic processing , which lateralizes to the left hemisphere in the vast majority of individuals . using near infrared spectroscopy , a method that allows noninvasive examination of brain function similar to fmri and pet , but is less restrictive for young participants , the researchers found that age - matched nonstuttering speakers consistently exhibited greater left than right laterality of brain response when listening to auditory stimuli differing in phoneme versus prosody . in contrast , not even one subject among the stuttering group exhibited leftward laterality for the phoneme versus prosodic contrasts . this was true for all age groups , including the youngest preschool - age children . the researchers speculated that due to left - sided anatomical deficiencies , both linguistic and prosodic functions may lateralize to the right hemisphere in stuttering children , and as this pattern is maintained , children may display right - sided structural increases , as have been reported in anatomical studies of adults who stutter.7,17,23 current data point to differences in brain function and anatomy , involving both auditory and motor areas of the brain , even in the earliest stages of stuttering . the functional brain differences in stuttering children , when sustained , could result in structural brain changes , in turn resulting in abnormal laterality of auditory - motor interaction for speech processing which is reported in stuttering adults . future studies that track both functional and structural brain growth as stuttering children develop are likely to give us more definitive answers on a number of still - unanswered issues , such as why some children naturally recover from stuttering and why many more girls grow out of stuttering than boys . currently there is no cure that works for all people who stutter . at present , behavioral therapy by a skilled speech - language pathologist ( ideally someone who specializes in fluency ) is the most viable option for treating stuttering . although much more data is needed before direct clinical applications can be made , there is support for early intervention for children who stutter . if parents are concerned about their child s stuttering , and the child has been stuttering for more than six months , therapeutic intervention should be considered . the brain regions found to be different in stuttering children are primarily those that undergo active growth and are plastic during childhood , and are thus more likely to respond to treatment that stimulates brain development toward more normal growth patterns . it is probable that there is greater chance of lasting recovery if therapy is delivered during early childhood rather than after adolescence . in the latter case , the stuttering speaker may still benefit ( as king george vi did ) , but he may need effortful monitoring of his speech to achieve fluency , and there is possibility of relapse . experienced clinicians claim that successful treatment of children often takes less time than is necessary for adults , and normal fluency is the goal for most children . for these children , recovery may occur either because they adopt a compensatory neural growth pattern that successfully makes up for the deficient brain regions , or because they are able to adopt a pattern of development that resembles normally fluent children ( we do not at present have any evidence to substantiate either of these claims ) . if a child continues to stutter into adolescence and beyond , the window of dynamic growth in the speech regions supporting fluent speech may close ; an adult is likely to be much more resistant to change . reflecting these ideas , the goal for most adult therapeutic interventions is not normal fluency , but rather a state in which stuttering occurs with less tension ( stuttering modification ) or a speech pattern that is volitional and consciously controlled due to relearning the components of fluent speech , including respiration , phonation , and articulation ( fluency shaping ) . these modified speech patterns are different from the effortless and automatic speech production that is typical of normally fluent speakers . treatment in adults must also address psychosocial issues , which are less commonly seen in early childhood stuttering . adults who stutter are likely to have developed an emotional reaction to their stuttering , and many exhibit avoidance behavior associated with speech situations , which can exacerbate and perpetuate stuttering . several groups have studied brain changes associated with stuttering treatment ( primarily fluency shaping ) during adulthood.11,2426 some of the major findings indicate that therapy leads to attenuation of right - hemisphere overactivity seen before therapy , as well as a shift toward more activity in the left hemisphere regions supporting planning , execution , and auditory feedback of speech . abnormal basal ganglia activity also decreased following therapy.27 these brain changes are still very different from brain activity we see during speech of fluent individuals , however an indication that at least at the neural level , there are limits to what adults who stutter can achieve through therapy . these findings all the more support the idea that early intervention may be important , as therapy during early childhood provides an opportunity to alter or normalize brain function before stuttering - induced changes become hardwired and perhaps less responsive to therapy . in the future , researchers should examine therapy s effects on children and determine whether therapy - induced recovery during early childhood leads to similar brain function and structure as found in children who have recovered or children who have never stuttered . if the therapy - induced brain changes do not lead to brain structure and function that resemble normal brain growth in children who never stuttered , yet the children who once stuttered achieve full recovery without relapse , this may indicate a successful compensatory growth that may be a goal of future behavioral treatment for both children and adults . advances in genetics research may lead to better understanding of the molecular basis and biological pathways associated with stuttering2830 and , eventually , to better diagnostic and treatment approaches including pharmacological treatment * and gene therapy . stuttering shows a strong familial aggregation,3335 and twin studies have shown that there is greater concordance for identical twins than for fraternal twin pairs.3638 while it is certain that there is a strong genetic contribution to stuttering , the mode of inheritance is still unclear . several genome - wide linkage studies3943 have indicated only moderate evidence of linkage to any one region , and replication of results across the different labs has been sparse . the recent discovery of mutations of specific genes associated with lysosomal dysfunction ( dysfunction of the cell organelles that break down cellular waste matter and debris ) in stuttering families44 has been suggested as a possible neurochemical basis for the white - matter deficits,45 but the results await replication by independent groups . more research must confirm the relationship between the genetic mutations and brain development patterns relevant to stuttering . we are still at an early stage of understanding the basis for this enigmatic speech condition . with more advances in the study of the neural bases and genetics of stuttering , scientists may find an objective biological marker for persistent stuttering , as well as brain changes that lead to successful recovery from stuttering . these future developments will lead to better clinical assessment and bring us closer to finding treatment targets . as we near the discovery of the etiology of stuttering | editor s note : after many decades of attributing stuttering to causes ranging from childhood trauma to overly anxious personalities , scientists have used neuroimaging techniques to uncover measurable differences in the brain activity of people who stutter versus fluent speakers .
but while researchers have made great strides in understanding stuttering in adults , the neural basis of stuttering in children largely remains a mystery .
we do not yet know why up to 80 percent of children who stutter recover without intervention , nor do we know how to distinguish those who will recover without intervention from those who will not .
however , recent findings support the idea that early intervention can alter or normalize brain function before stuttering - induced changes become hardwired . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
careful monitoring of anchorage is one of the most important factors in successful orthodontic treatment . to obtain stable anchorage , osseointegrated implants have been used to obtain absolute anchorage without the need for patient cooperation . however , osseointegrated implants require a precise 2-stage protocol and considerable time for osseointegration . in addition , these implants are expensive and there is a limited area for their insertion due to their size . kanomi first introduced miniscrew implants ( msis ) , which can be placed almost anywhere , in either the maxilla or the mandible , with a simple procedure . over time , the ease of placement and removal , effectiveness in anchorage without patient cooperation and benefit of their low cost has increased the popularity of these devices . many studies and successful clinical cases have been published describing the use of msis for orthodontic anchorage . however , msis can untimely be lost due to their mobility during the orthodontic treatment . therefore , the stability of msis must be further improved to prevent these failure rates . with msis , the reason for this stability is believed to be a result of mechanical interlocking . because msis are not osseointegrated , their anchorage potential is most likely influenced by the quantity of bone into which they are placed . in addition to bone quality and quantity , surgical technique and screw geometry are factors that affect primary stability . because clinicians have little control over the bone quantity available for screw placement , due to the presence of roots and anatomic landmarks , screw geometry and surgical technique remain the parameters to be improved for the success of the procedure . several in vitro studies have been conducted to enhance the bone - screw contact area and increase the force resistance and stability ( anchorage ) of miniscrews by changing the length and width of the screws . for the purpose of increasing the contact area at the bone - screw interface and obtaining maximum support from the cortical plate , instead of using wider screws or bicortical screws , we designed a new apparatus , a mini implant ring ( mir ) , placed at the neck of the screw . the purpose of this in vitro study was to evaluate the effects of this mir on the anchorage force resistance ( afr ) and the stability of orthodontic msis . what is the effect of the mir apparatus on the afr and stability relative to cortical bone thicknesses ( cbt ) ? forty - eight self - drilling , titanium ( ti-6al-4v ) grade 5 cylindrical msis ( tm , trimed , ankara , turkiye ) , 1.6 mm in diameter and 9 mm in length , were used for the study [ figure 1 ] . the 24 mirs used in the study group had outer diameters of 5 mm and inner diameters of 2 mm [ figure 2a c ] . they had four spines on the side , which were in contact with the cortical bone surface . the spines were 0.75 mm of length and made of titanium ( ti-6al-4v ) grade 5 . a hole in the mir was designed to fit to the neck of the msi . a schematic and a clinical application of the mir the miniscrew implants used in the study ( a , b ) lateral and top views of the mini implant ring ( mir ) . ( c ) dimensions of the mir diagram showing the application of the mini implant ring miniscrew , applied with the mini implant ring that was used in a case for en masse retraction bovine ilium was used as the bone model . the cortical thickness of the bone segments ranged from approximately 0.5 mm to 2.5 mm from the iliosacral joint toward the hip joint . these values are similar to the mean values of the cortical thicknesses of the human maxilla and mandible . the bone segments were sliced and eight bone slices , which had a minimum width of 5 mm , were obtained . care was taken to place the adjacent miniscrews , one from the control group and another from the study group , to ensure even distribution of the cortical thicknesses of the bone segments in both groups [ figure 5 ] . miniscrew implants on bone slices and adjacent msis inserted , one from the control group and the other one from the test group the msis were inserted with the use of a handled screwdriver ( trimed , ankara , turkiye ) until the distance from the bone to the screw collar was 2 mm . in the mir group , the mir was placed with the help of a hand instrument , called an mir pusher ( trimed , ankara , turkiye ) , for the spines to penetrate the cortical bone . in both groups , after insertion of the msis , final screwing , to 1 mm from final insertion depth , was performed using a torque screwdriver ( n2 dpsk , nakamura , mfg co. ltd . ) and the maximum insertion torque ( mit ) values were measured for each msi . the remaining 1 mm distance left after final insertion was the space left for the clinical soft - tissue . in the mir group , after insertion of all of the msis , the bone slices were sectioned into small blocks , which had a minimum of 4 mm of bone tissue around each screw [ figure 6 ] . embedding the bone - screw block using a custom - made positioning device a device was designed for positioning the bone - screw block during the embedding in acrylic resin so that the msis were aligned perpendicular to the axis of mechanical testing . the msis were subjected to a tangential force load perpendicular to the screw using an instron test machine adjusted to a crosshead speed of 0.05 mm / s . during the loading , the displacement of the screws was measured up to a distance of 0.6 mm , which represented the adequate displacement without slippage that would result in clinical screw mobility and potential failure . after the torque measurement upon removal , the samples were sectioned through the center of the miniscrew hole to examine the cbt . the mean cortical thicknesses of the bone samples for the mir and control groups were 1.22 0.49 mm and 1.23 0.49 mm , respectively . each group was divided into two subgroups and these subgroups were designated as thick or thin according to whether their cbt was greater or less than 1.15 mm [ table 1 ] . intergroup comparison of the cbt statistical tests were performed with the statistical package for the social sciences ( spss ) software , ( spss inc . , chicago , il , usa ) version 15.0 . a power analysis ( g*power version 3.1.0 , universitt kiel , germany ) revealed that a sample size of 24 for each group would provide 95% power to detect significant differences at a significance level of p = 0.5 . group differences for afr , removal torque and cbt were assessed by the independent samples t - test and mit was studied with the mann - whitney u - test . the chi - square test was performed to determine the differences in mobility . when p < 0.05 , the results were considered to be significant . the mean cortical thicknesses of the bone samples for the mir and control groups were 1.22 0.49 mm and 1.23 0.49 mm , respectively . each group was divided into two subgroups and these subgroups were designated as thick or thin . the mean cbt for the thick subgroups was significantly greater than that for the thin subgroups ( p < 0.001 ) . the mean cbt for the thin subgroups ( mir and control ) and thick subgroups ( mir and control ) were similar when compared [ table 1 ] . msis inserted with mirs showed significantly greater anchorage force values , compared with msis inserted without mirs ( p < 0.001 ) . in the subgroups with thin cortical bone , the afr of the msis inserted with mirs was significantly greater than the afr of msis inserted without mirs ( p < 0.001 ) . in addition , in the subgroups with thick cortical bone , the anchorage values of msis inserted with mirs were significantly greater than those inserted without mirs ( p < 0.05 ) . cbt had an effect on the afr of the msis in the control group [ table 2 ] , whereas the anchorage resistance did not differ significantly with regard to cbt if the miniscrews were applied with mirs ( p > 0.05 ) . intergroup comparison of the afr msis inserted with mirs showed significantly greater insertion torque values when compared with msis inserted without mirs ( p < 0.01 ) . the insertion torque values of msis inserted with mirs in the thin cortical bone group were significantly greater than those of the msis of the control group inserted to thin cortical bone ( p < 0.05 ) . in addition , the insertion torque into the thick cortical bone of the mir group was significantly greater than that in the control group ( p < 0.05 ) . the mit for both mir and control groups was significantly greater than that of the subgroups presenting with thin cortical bone ( p < 0.01 ) . intergroup comparison of the mit the data analysis showed that the mirs did not have a significant effect on the removal torque values either when evaluated overall or when the subgroups were evaluated separately ( p > 0.05 ) . bone specimens with thick cortical bone had significantly greater removal torque values than specimens from the thin subgroups ( p < 0.01 ) . intergroup comparison of the mrt there were more mobile screws in the control group than in the mir group , but the difference was not statistically significant ( p > 0.05 ) . cbt had an effect on the mobility of the miniscrews in the control group ( p < 0.05 ) . however , the mobility of miniscrews inserted with mirs was not significantly affected in terms of cbt ( p > 0.05 ) . the mean cortical thicknesses of the bone samples for the mir and control groups were 1.22 0.49 mm and 1.23 0.49 mm , respectively . each group was divided into two subgroups and these subgroups were designated as thick or thin . the mean cbt for the thick subgroups was significantly greater than that for the thin subgroups ( p < 0.001 ) . the mean cbt for the thin subgroups ( mir and control ) and thick subgroups ( mir and control ) were similar when compared [ table 1 ] . msis inserted with mirs showed significantly greater anchorage force values , compared with msis inserted without mirs ( p < 0.001 ) . in the subgroups with thin cortical bone , the afr of the msis inserted with mirs was significantly greater than the afr of msis inserted without mirs ( p < 0.001 ) . in addition , in the subgroups with thick cortical bone , the anchorage values of msis inserted with mirs were significantly greater than those inserted without mirs ( p < 0.05 ) . cbt had an effect on the afr of the msis in the control group [ table 2 ] , whereas the anchorage resistance did not differ significantly with regard to cbt if the miniscrews were applied with mirs ( p > 0.05 ) . msis inserted with mirs showed significantly greater insertion torque values when compared with msis inserted without mirs ( p < 0.01 ) . the insertion torque values of msis inserted with mirs in the thin cortical bone group were significantly greater than those of the msis of the control group inserted to thin cortical bone ( p < 0.05 ) . in addition , the insertion torque into the thick cortical bone of the mir group was significantly greater than that in the control group ( p < 0.05 ) . the mit for both mir and control groups was significantly greater than that of the subgroups presenting with thin cortical bone ( p < 0.01 ) . the data analysis showed that the mirs did not have a significant effect on the removal torque values either when evaluated overall or when the subgroups were evaluated separately ( p > 0.05 ) . bone specimens with thick cortical bone had significantly greater removal torque values than specimens from the thin subgroups ( p < 0.01 ) . there were more mobile screws in the control group than in the mir group , but the difference was not statistically significant ( p > 0.05 ) . cbt had an effect on the mobility of the miniscrews in the control group ( p < 0.05 ) . however , the mobility of miniscrews inserted with mirs was not significantly affected in terms of cbt ( p > 0.05 ) . the stability of these small - sized appliances depends on parameters such as the properties of the hard and soft - tissues , screw design , insertion procedure and the amount of force applied . however , the key determinant for stationary anchorage is the quality and quantity of the bone into which the msis are placed . evaluated the effect of cbt on the success of msis and concluded that the insertion site should have a cbt of at least 1 mm . stated that when using msis in patients with a high mandibular plane angle , special care should be taken in the presence of thin cortical bone to avoid failures . it has been observed that the more screw - cortical bone contact there is , the greater stability and resistance to failure there will be . therefore , an appliance , the mir , was designed , which increased the cortical bone surface area in contact with the anchorage unit . in this study , the mir is a ring designed to increase the surface contact area of msis with cortical bone . nalbantgil et al . , using finite element analysis , concluded that the spines on the miniplates were highly efficient in reducing the stress on the fixation screws . in general , with conventional screw implants , the load concentration has a tendency to occur on the first threads , leading to increased stress on the surrounding cortical bone and possibly resulting in resorption . if the load can be delivered to a larger bone surface , then the damage , which is relative to stress over an area , might be reduced . as this study confirms , the greater area of distributed load is , the greater the msi 's stability and resistance to loading will be . msis with larger diameters provide greater surface area , which increases torque and afr as a result of increased friction and greater support at the bone - to - screw interface . however , the insertion of an msi with a diameter greater than 1.6 mm needs careful consideration for placement and inserting these msis safely is generally very difficult because of anatomic limitations . these authors mentioned that if the range of cbt between groups is not too small , the effect of cbt on stability can be demonstrated . in our study , there was a significant difference in the thickness of the cortical bone between the groups . in addition , the anchorage potentials of the control group displayed significant differences between the subgroups with thin and thick cortical bones . however , the anchorage potentials of the subgroups with thin and thick cortical bones did not show any significant difference in the mir group . for the mir group , our hypothesis is that the mirs were so effective that the thickness of the cortical bone did not vary sufficiently to demonstrate an effect . as expected , a significant difference in insertion torque was found between the control and the mir group . an increase in the insertion torque was expected due to the penetration of the spines into the cortical bone . to prevent an undesirable increase in insertion torque , a hand instrument , which we called the mir pusher , was designed and used to push the mirs into cortical bone . the mean insertion torque for the mir group was 15.30 n / cm . this force was within the limits recommended by previous studies concerning success rates and was less than the limit necessary to avoid complications , such as the breakage of the msi . the main purpose of this study was to determine how much the mir would increase the force anchorage values of msis . we also wanted to determine the effects of mir appliances on mit and mrt because each of these measurements is a determinant of primary stability . insertion torque analysis was used to measure the mechanical retention achieved by screwing and removal torque analysis is a method used to assess the stability and the osseointegration capacity of msis . we did not want to experience any unwanted increases or decreases in terms of mit , mrt or mobility . we found a significant ( p < 0.01 ) difference in terms of mit between the control and mir groups ( this difference was within the desired limits ) and we observed an improvement in terms of mrt and mobility , but the difference was not statistically significant . within the limits of this in vitro study , these findings suggest that the mir appliance increased the force anchorage resistance of msis without causing any biomechanical side - effects . in this in vitro study , however , in vivo reactions to immediate loading of msis can be replicated with in vitro studies because msi stability is believed to result from mechanical interlocking and it does not require a period for osseointegration . the bone samples used in this study , which were obtained from the ilium of bovines , enabled us to standardize the testing conditions . in the clinic further studies are needed to evaluate the biologic responses of soft- and hard - tissues as well as the success rate of screw anchorage , when mirs is used . within the limits of this in vitro study , the results of this investigation demonstrated that the newly designed appliance ( mir ) increased anchorage resistance and insertion torque , thereby increasing the primary stability and anchorage resistance of msis . the mir might have a favorable effect on msi stability in patients presenting with thin cortical bone . | objective : an appliance was designed to increase the cortical bone surface contact area of miniscrew implants ( msis ) . the purpose of this in vitro study was to evaluate the effects of this appliance on the anchorage force resistance and the stability of orthodontic msis.materials and methods : a total of 48 msis were placed into bone specimens prepared from the ilium of bovines .
half were placed with the newly designed apparatus and half were placed conventionally .
all the specimens were subjected to tangential force loading perpendicular to the msi with lateral displacement of 0.6 mm , using an instron universal testing machine .
the maximum removal torque of each tested specimen was also recorded .
both study and control groups were divided into two subgroups based on whether they had thin and thick cortical bone.results:the test group had statistically higher force anchorage resistance and maximum insertion torque values than the control group ( p < 0.001 ) .
the results were found to be more significant in cases in which the cortical bone was thin ( p < 0.001).conclusions : within the limits of this in vitro study , the present findings suggest that the newly designed apparatus might have a favorable effect on msi stability in patients presenting with thin cortical bone .
clinical studies are necessary to confirm the results that were observed in vitro . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
patients experiencing acute respiratory distress may require either non - invasive ventilation ( niv ) or full mechanical ventilation via endotracheal intubation . although the majority of patients with acute respiratory distress have traditionally been treated with invasive ventilation , select patients are good candidates for niv . appropriate indications for niv in hemodynamically stable patients are hypercapnic respiratory failure due to chronic obstructive pulmonary disease ( copd ) exacerbation , congestive heart failure ( chf ) , obstructive sleep apnea , and pneumonia . compliance with niv is often challenging , due to agitation and anxiety associated with the illness as well as the ventilation facemask ; such a scenario does not allow the patient to be comfortably and adequately ventilated . patients must not only be sufficiently sedated to avoid agitation but also alert and cooperative to initiate respiration and protect their airway . however , many doctors report infrequent use of sedation therapy with non - invasive ventilation , as oversedation is associated with respiratory depression and lack of airway protection , leading to invasive mechanical ventilation . an extensive literature search revealed one case series of 10 patients showing that dexmedetomidine is able to provide an appropriate amount of sedation with minimal respiratory depression . a 91-year - old female was admitted to the hospital after a syncopal episode . the patient had a past medical history of copd , chf , hypertension , depression , atrial fibrillation , fourth thoracic spine compression fracture , and pneumonia . furosemide was given once per day at home and in the intensive care unit to treat congestive heart failure , and the patient was given nebulizer treatments of albuterol , ipratropium , levalbuterol , and budesonide throughout her stay in the hospital to treat her copd . the patient 's admission glasgow coma scale was 13 and her baseline vital signs were heart rate of 101 beats per minute , tachypnea with a respiratory rate of 32 breaths per minute , a blood pressure of 156/65 mm hg , and an oxygen saturation by pulse oximetry ( spo2 ) of 91% . admission blood chemistry showed mild hyponatremia , and an elevated brain natriuretic peptide of 199 ng / l ( normal < 99 ng / l ) . admission chest radiography taken before bilevel positive airway pressure ( bipap ) showed focal pneumonia in the right lower lung , a widened mediastinum , and enlargement of the cardiac silhouette . due to respiratory distress , the patient was transitioned from a 50% facemask to bipap ( settings : fio2= 50% , 8/4 cm h2o , 14 bpm ) and became agitated shortly after . to mitigate her agitation , she was administered dexmedetomidine , without a bolus , at a starting dose of 0.2 g / kg / hr , and continued on doses ranging from 0.2 to 0.5 g / kg / hr titrated to a sedation scale . the patient received dexmedetomidine for a total of 40 h. after 1 h the dexmedetomidine was given , the patient was no longer agitated , with a ramsey score of three . her vital signs showed no significant hemodynamic changes 2 h post - dexmedetomidine initiation , while her respiratory rate returned to normal ( 19 breaths per minute ) and spo2 increased to 97% . the patient did not experience bradycardia or hypotension , which are possible side effects of dexmedetomidine . the echocardiogram while on dexmedetomidine and bipap showed an ejection fraction of 60 - 65% , trace mitral and tricuspid regurgitation , and moderate to severe aortic stenosis . after discontinuation of the dexmedetomidine infusion , and given the previous agitation , haloperidol 1 mg every 6 h intravenously was given for an additional 2 days to maintain the non - agitated state . the total length of non - invasive ventilation was 3 days and 14 h. the patient was neither intubated nor received invasive mechanical ventilation , and was discharged from the hospital and icu without other respiratory complications . our recent experience with this patient demonstrates the use of dexmedetomidine to achieve a level of comfort necessary for bipap compliance . the use of a sedative , such as a continuously infused benzodiazepine during niv is contraindicated due to concerns of airway protection and respiratory depression . dexmedetomidine , however , is a unique sedative that possesses anxiolytic , analgesic , and sympatholytic properties that provide comfort with minimal respiratory depression . although propofol has been used successfully in conjunction with niv , its range of effective concentrations is narrower than that of dexmedetomidine , and propofol 's concentrations must be tightly monitored by computer - assisted intravenous administration . in comparison to propofol , dexmedetomidine is both easier and safer to use with respect to its range of effective concentrations . our case study showed that dexmedetomidine aided in achieving a balance between patient sedation and alertness . attaining this level of consciousness in a patient can allow airway protection , which can reduce morbidity and mortality by avoiding full mechanical ventilation . with a desirable level of comfort maintained , bipap was able to continuously improve the patient 's respiratory distress , eventually permitting the patient to be weaned off of bipap . this allowed the patient to better protect her airway , resulting in a reduced risk of ventilator - associated pneumonia . furthermore , patients with underlying copd who receive non - invasive ventilation to treat pneumonia have a lower risk of future intubation , shorter icu stay , and reduced 2 month mortality . in summation , dexmedetomidine with niv optimized the efficacy of bipap , which reduced the risk of respiratory complications in our patient . the use of continuously infused dexmedetomidine , with its unique sedative properties , makes it ideal in the setting of niv , and we encourage more widespread use for this indication . | patients with chronic obstructive pulmonary disease and congestive heart failure exacerbations , as well as pneumonia benefit from the use of non - invasive ventilation ( niv ) , due to increased patient comfort and a reduced incidence of ventilator - associated pneumonia .
however , some patients do not tolerate niv due to anxiety or agitation , and traditionally physicians have withheld sedation from these patients due to concerns of loss of airway protection and respiratory depression .
we report our recent experience with a 91-year - old female who received niv for acute respiratory distress secondary to pneumonia .
the duration of niv was a total time period of 86 h , using the bilevel positive airway pressure mode via a full face mask .
the patient was initially agitated with the niv , but with the addition of the dexmedetomidine , she tolerated it well .
the dexmedetomidine was administered without a loading dose , as a continuous infusion ranging from 0.2 to 0.5 mcg / kg / hr , titrated to a ramsey score of three .
this case illustrates the safe use of dexmedetomidine to facilitate niv , and improve compliance , which may reduce icu length of stay . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
sometimes a few minutes delay in treatment may have serious consequence for patient , thus to save the lives of patients immediate and urgent measures will be required ( 1 ) . acute pesticide poisoning is an important cause of morbidity and mortality in iran and worldwide ( 2 ) . the general patterns of poisoning show a lot of variations among the developing countries ( 3 , 4 ) . the complex multifactorial etiology of suicide suggests the need to consider gender differences when developing effective strategies for suicide prevention ( 5 ) . in asia , there were 46% male and 54% female to attempt suicide with the age range 24.97 years , and the largest occupational groups were self - employed then house - keeping and low socio economic status . the most common drug groups were benzodiazepines and then antidepressant and antiepileptic medications ( 1 ) . of 26078 emergency patients , 11465 were admitted for acute poisoning . among them , 45 patients who came to the emergency room were died . the death was happened in 1% cases that the most common causes were opioids , medicines and pesticide poisoning . the most common age group that has been reported was 15 - 24 and then 25 - 45 years old . seventy eight percent ( 78.3% ) attempted suicide and the most common complications were respiratory and heart problems ( 6 ) . a review of u.s . poison center data for 2004 showed over 12,000 exposures to tricyclic antidepressants ( tcas ) ( 7 ) , and over 40,000 exposures to salicylate - containing products ( 8) . ( 9 ) in psychiatric center of la courna university in spain was performed in 2011 and described the effective factors on recurrent attempted suicide during 10 years on 5424 patients . of 5424 patients , 4509 cases had attempted suicide again , and the results showed that a previous suicide is the main risk factor for repeating suicide , also other risk factors include : age , gender , low living status , job , and the previous psychiatric diagnosis . of psychiatric problems affective disorders followed by personality disorder and schizophrenia the comparative study of suicide in people with or without mental disorder was conducted on 392 patients that had suicide attempt from october 2005 until june 2008 . the findings show a significant difference in selection of the suicide method in patients with mental disorders compared to those without mental disorders ( 9 ) . the experience of previous studies in recent decades emphasize on the important role of psychiatric problems in suicide attempts including self - induced poisoning . in our country , the exact statistics of the toxicity and its complications are not available . the aim of this study was to survey the prevalence of psychiatric disorders in patients with drug poisoning . this study was conducted on patients with poisoning admitted to the emergency section of ali - ebn - abitaleb hospital in rafsanjan city , iran . exclusion criteria included 1 ) people who have suffered a loss of consciousness and have been admitted to the intensive care unit ( icu ) , 2 ) people who have overdosed medications for any reasons , for example , a person with dementia who had consumed too much medicine . a sample size of 116 patients was randomly selected and studied for drug poisoning . all patients who were referred due to poisoning were studied by filling out the questionnaires and entering into an interview by a psychiatrist . they filled out a demographic questionnaire which was a researcher - made questionnaire to assess demographic characteristics . past history of depression and obsessive compulsive disorder ( ocd ) was also evaluated through face - to - face interview of a psychiatrist with patients based on the diagnostic and statistical manual of mental disorders , fifth edition(dsm-5 ) criteria . also , patients data for anxiety were collected through state trait anxiety inventory ( stai ) ( spielberger , 1983 ) . the stai is a widely used 40-item measure of enduring ( trait ) and transient ( state ) anxiety symptoms , with well - supported reliability and validity . the state anxiety score was used in the analyses and focuses on how you are feeling in this moment . reported scores ranged from 0 to 86 ( 10 ) . ( 11 ) have tested the validity of this questionnaire using the factor analysis method . factor analysis showed that this test consists of three main structures as state anxiety , lack of anxiety and trait anxiety , which is a good indicator of reliability . test - retest reliability showed coefficients between 0.73 - 0.86 . also , it had good correlation ( r = 0.75 - 0.85 ) with other anxiety scales such as the taylor anxiety scale , which indicates a good criterion validity of the instrument . zamani et al . showed that cronbach 's alpha coefficient for trait anxiety in male subjects was 0.79 and in females was 0.84 and for state anxiety cronbach 's alpha coefficient was 0.85 in males and 0.89 in females ( 11 ) . data obtained from interviews and questionnaires were collected and then analyzed using ssps version 17 software ( spss inc . chicago , usa ) . the chi- square test was used to analyze the data , and information was provided by frequency , mean and standard deviation . this study was conducted on patients with poisoning admitted to the emergency section of ali - ebn - abitaleb hospital in rafsanjan city , iran . exclusion criteria included 1 ) people who have suffered a loss of consciousness and have been admitted to the intensive care unit ( icu ) , 2 ) people who have overdosed medications for any reasons , for example , a person with dementia who had consumed too much medicine . all patients who were referred due to poisoning were studied by filling out the questionnaires and entering into an interview by a psychiatrist . they filled out a demographic questionnaire which was a researcher - made questionnaire to assess demographic characteristics . past history of depression and obsessive compulsive disorder ( ocd ) was also evaluated through face - to - face interview of a psychiatrist with patients based on the diagnostic and statistical manual of mental disorders , fifth edition(dsm-5 ) criteria . also , patients data for anxiety were collected through state trait anxiety inventory ( stai ) ( spielberger , 1983 ) . the stai is a widely used 40-item measure of enduring ( trait ) and transient ( state ) anxiety symptoms , with well - supported reliability and validity . the state anxiety score was used in the analyses and focuses on how you are feeling in this moment . reported scores ranged from 0 to 86 ( 10 ) . ( 11 ) have tested the validity of this questionnaire using the factor analysis method . factor analysis showed that this test consists of three main structures as state anxiety , lack of anxiety and trait anxiety , which is a good indicator of reliability . also , it had good correlation ( r = 0.75 - 0.85 ) with other anxiety scales such as the taylor anxiety scale , which indicates a good criterion validity of the instrument . zamani et al . showed that cronbach 's alpha coefficient for trait anxiety in male subjects was 0.79 and in females was 0.84 and for state anxiety cronbach 's alpha coefficient was 0.85 in males and 0.89 in females ( 11 ) . data obtained from interviews and questionnaires were collected and then analyzed using ssps version 17 software ( spss inc . released 2008 . chicago , usa ) . the chi- square test was used to analyze the data , and information was provided by frequency , mean and standard deviation . this study included 116 poisoned patients referred to ali - ebn - abitaleb emergency section in rafsanjan city , with mean age of 24.6 7 years and the range was 14 - 49 years . the cases of the study included 71 male ( 61% ) and 45 females ( 39% ) . participants were divided into two age groups : 14 - 24 years ( 65 patients ; 56% ) and 25 - 49 years ( 51 patients ; 44% ) . of all participants , 78 cases ( 67.5% ) were single , and 34 ( 29.5% ) were married , and 4 ( 3% ) were widowed or divorced . of these cases 79 patients ( 68% ) were living in urban and 37 ( 32% ) were living in rural areas . in terms of the education level , 34 patients ( 29.3% ) had college education , 34 ( 29.3% ) had high school education , 32 ( 27.5% ) had guidance school education and 16 ( 13% ) had primary school education . in regard to the occupation of patients , 36 cases ( 31% ) were employed , 35 ( 30% ) were student and collegian , 24 ( 20% ) were housekeeper , 12 ( 10% ) were unemployed , and 9 cases ( 7% ) were worker . among medications and poisons , 19.8% of poisoned patients consumed analgesics , 19% consumed benzodiazepine , 15.5% opium , 14.7% organophosphorous , 9.5% tca , 9.5% alcohol , 3.4 rat poison , 5.6% pesticide , 0.9% tacked barbiturates , 0.9% amphetamines , and 1.7% consumed detergent . in terms of relative frequency of anxiety , 88 cases ( 75.9% ) were moderate , 14 ( 12.1% ) were mild and 14 ( 12.1% ) were affected with severe type . table 1 shows the frequency of different levels of anxiety in subjects according to gender . a mild anxiety score was 32 - 42 , the moderate 43 - 53 and the severe was 54 or above . according to the above results moderate anxiety in males has the highest value ( 80.3% ) , but severe anxiety in them is the lowest level ( 7% ) . the relationship between gender and anxiety was tested using the chi - square test after classification and disapproved with non - significant p value ( p = 0.113 ) . table 2 shows frequency of patients with different levels of anxiety after classification for age . according to the results shown in table 2 , in the age group of 14 - 24 years , moderate type of anxiety ( 80% ) has the highest rate and mild anxiety ( 9.2% ) was the lowest level . there was no significant relationship between anxiety and age groups ( p = 0.466 ) . table 3 shows frequency of patients with different levels of anxiety after classification for marital status . according to table 3 , moderate type of anxiety ( 78.2% ) was the highest level in single persons and mild anxiety ( 0.0% ) was the lowest level in widowed or divorced . results of the chi - square test showed no significant relationship between anxiety and marital status after classification among the participants ( p = 0.600 ) . table 4 shows the frequency of patients with different levels of anxiety after classification for type of poisoning . results of this study showed that the severe anxiety type ( 75% ) had the highest rate in cases of intentional poisoning , and mild anxiety ( 9.7% ) had the lowest rate of intentional poisoning . the results of the chi - square test showed no significant relationship between anxiety and type of poisoning in the participants ( p = 0.498 ) . table 5 shows the frequency of patients with different levels of anxiety after classification for history of mental disorders . according to the table results , moderate type of anxiety ( 76.7% ) , had the highest rate in individuals with a history of mental disorders and severe anxiety ( 10% ) had the lowest rate in individuals with a history of mental disorders . these relationships were tested by the chi- square test and were not significant ( p = 0.905 ) . there was no significant relationship between anxiety and a history of suicide attempt among the participants ( p value = 0.120 ) . also , the severity of obsession in individuals with or without history of suicide was similar . severity of obsession was significantly correlated with the level of education ( p = 0.001 ) . as with increasing age , severity of disorders is more severe ( p = 0.023 ) . there was no significant association between the severity of obsession and sex , occupation , type of poisoning , residence , history of past suicide attempts and type of drug . the relative frequency of occurrence of ocd : the type of medium was max ( 38.8% ) and the lowest to severe ocd ( 31.9% ) and mild was 29.3% . the relationship between depression and history of mental disorders in the past ( p = 0.001 ) , level of education ( p = 0.045 ) and the history of suicide attempts ( p = 0.001 ) was significant . there was no significant relationship between the severity of depression and age , sex , occupation , type of poisoning , residence , and the type of suicide . sixty - one percent of the participants were males and 39% were females , which indicate the relative frequency of intoxication among men . a study by ashkani et al . on 100 patients with poisoning included 46% male and 54% female at the shiraz university of medical sciences in 2002 ( 1 ) . internationally , women are more likely than men to attempt suicide by deliberate self - poisoning , which may be due to increased vulnerability and susceptibility of women ( 12 ) . however , the results of the present study showed that male participants with poisoning were more than females . this may have happened by chance and/or as a result of a limited sample size . the mean age in our study was 24.6 7 years . in studies that were performed by kalkan et al . at turkey ( mean age of 34.7 1.3 yaers ) ( 13 ) , and by rafighdoost at birjand university of medical sciences ( an age range = 15 to 24 ) ( 6 ) , age group of youth had the most common prevalence of poisoning that has the same result with our studies . according to the results of carlsten et al . ( 12 ) the prevalence of poisoning in single people is significantly more than married ones . one reason for this report may be that those people who lived alone and those who have failed in love , are at higher risk ( 12 ) . based on studies conducted in india and england , the poisoning in single individuals is more than married , of course , it was greater in men ( 14 ) . marital problems , family conflict and less social support systems on the rights of women against men in family life may be the causes of higher toxicity in married women than men in external review ( 1 ) . in our study , in ashkani study on 100 poisoned patients at the shiraz university of medical sciences in 2002 , similarly poisoning in education levels of high school and middle school were the most common ( 1 ) . our study and above analysis showed that increasing education level to high school rises the risk of suicide poisoning , which can be alarming for us . a study conducted by ashkani et al . at shiraz university of medical sciences in 2002 showed that the most common occupation group which was susceptible was those with self - employment ( 1 ) . can be said poisoning in the self - employment group can be triggered by status of the job and also access to toxic substances and among the educated class due to emotional problems , schools , family and social problems . in a study by rafighdoost that was performed on organophosphate poisoning on 50 patients in 2007 in birjand city , iran , 78.3% of cases have been intentional poisoning ( 6 ) . based on our results and previous reports , the high rate of intentional poisoning in society can be alarming merely requiring investigation . in our study , in ashkani study , the most common drug group was benzodiazepines and then antidepressants ( 1 ) . from view of socioeconomic status : 39% with high social class , 35.5% with low social class and 29% were moderate . in a study by eizadi et al . in isfahan university in 2012 , which was performed on 384 patients , most patients were in the high socioeconomic ( 15 ) . in a study by jesus alberdi et al . in the psychiatric center of lacoruna university in 2011 that was performed on 5824 patients , history of previous mental disorders , low social and economic status , and age are reported among the risk factors for deliberate poisoning ( 9 ) . in ashkani study , also one of the effective risk factors for deliberate poisoning was low socioeconomic status ( 1 ) . among the mentioned studies , only the former was in accordance with our statistical work and 2 others were opposed . the low socioeconomic status can be considered as one of the causes of voluntary poisoning , this is because of poverty and lack of essential facilities to have a good life . nowadays , because of industrial life particularly in high social class and being away from each other , the deliberate poisoning rate in high socioeconomic status is growing up . in our study , history of previous mental disorders the results of a study by the eizadi et al . in isfahan on 385 patients showed that about 82.5% had a history of mental problems ( 15 ) . a study conducted at the university of pennsylvania in 2007 on 275 poisoning cases showed that the most causes of repeated suicide attempts were the prior psychiatric disorders . jesus alberdi showed that the effective risk factors on suicide attempt are prior psychiatric disorders . all of the above were opposed to our results and some reasons for this were : 1 ) patients did not accept their mental disorders , 2 ) they did not trust to their therapists ( 9 ) . in our study , past history of suicide attempt in 81% of the participants was not reported . also , according to the text book of psychiatry , the most common cause of suicide was a previous suicide attempt . all of the above were opposed to our findings and the reasons of this are : 1 ) poisoned patients who had a history of suicide in several times were referred to the psychiatric center , however , they refused to go to the psychiatric center because they are not honest about their suicide , 2 ) due to the small city and the fear of stigma for future career , education and marriage , they try to hide it . since an unsuccessful suicide attempt may be followed by a successful suicide and eventually may lead to death , these people will have to pay more attention ( 14 ) . findings of the first study in regards with history of suicide attempts were similar to ours and the last two were not consistent with them . this could be the reason for need to studies with larger sample sizes and the study of other mental disorders that we have not dealt with . in our study one of the leading causes of deliberate self - poisoning so , in those who had a history of psychiatric disorders in the past , severity of depression was higher . causes of it can be the acceptance of patients from their self - psychological problems , being unable to perform their usual tasks and the rejection from their family . also , the severity of depression in high school students is higher than other age groups because of their emotional and education problems ( especially unsuccessful university entrance exam , push to go to military service etc . ) . there was no significant relationship between the severity of anxiety and age , sex , socio - economic situation , occupation , type of poisoning , residence , history of suicide in the past and the type of suicide . the results of the above - mentioned studies were in consistent with the findings of our study . there was a significant relationship between the severity of depression and past history of mental disorders ( p = 0.045 ) . however , a subgroup of male attempters reporting interpersonal conflicts is characterized by a lower level of depression ( 16 ) . there was no significant association between the severity of obsession and sex , occupation , type of poisoning , residence , history of past suicide attempts and type of drug . if illness , particularly depression and drug abuse be accompanied by obsession , action of poisoning or suicide attempt happens more . prevalence of anxiety in poisoning caused by a variety of toxins and medications are common in the general population ; so , this justifies the need for counseling and treatment of these disorders before the event . | background : expansion of technology and progression of sciences have led to wider access to agricultural and industrial drugs and chemicals , which has resulted in many problems . both in wanted and unwanted ways people may take these toxic agents , which perhaps may be along with many unpredictable , life - threatening and mortal outcomes .
based on many studies , most of intentional poisonings arise from an origin of patients psychological backgrounds , which confirms necessity and importance of the recent study.objectives:this study aimed to study the prevalence of psychiatric disorders in patients with drug poisoning.patients and methods : in this descriptive cross - sectional study , 116 cases of poisoning referred to emergency room of ali - ebn - abitaleb hospital in rafsanjan city , iran , were randomly selected .
frequency of anxiety among participants was evaluated through the spielberger questionnaire .
a past history of depression and obsession was also evaluated through interview by a psychiatrist based on diagnostic and statistical manual of mental disorders ( dsm-5 ) criteria .
all data were then collected and analyzed using spss version 17.results:anxiety , as the second most common reason of psychiatric disorders in cases of poisoning , with a prevalence of 12.1% in form of mild , 75.9% moderate and 12.1% severe , was confirmed among the participants of this study.conclusions:the prevalence of anxiety among cases of poisoning with both drugs and chemicals are noticeably higher than general population .
this fact strongly suggests the necessity of in - advance consultation and treatment of any underlying psychiatric disorders of patients to prevent prospective complications . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
renal artery dissection occurs mainly after direct vessel injury ( such as trauma or endovascular intervention ) or in hypertensive patients with underlying arterial diseases ( such as fibromuscular dysplasia or atherosclerosis ) . the clinical presentation with acute low back or flank pain and haematuria is readily misleading and suggests renal colic . conventional imaging , including ultrasound and doppler explorations , is not sensitive enough to detect the dissection nor the renal infarction and patients are usually treated for urolithiasis unless a computed tomography scan ( cts ) is performed . since the first report in 1944 , almost 200 cases of srads have been published , of which 25% were diagnosed at necropsy . the availability of non - invasive and more sensitive - contrasted imaging techniques should facilitate recognition of such cases while reducing the delay in diagnosing srad and allowing earlier treatment . in this study , we report six patients who were referred to our nephrology department between 1997 and 2010 and presented with srad . all were men between 33 and 55 years of age . they had no cardiovascular risk factors , except one patient who had a past history of smoking . all patients presented acute unilateral flank pain with inguinal irradiation and sometimes haematuria on urinary dipstick testing and were most commonly diagnosed with renal colic , delaying the diagnosis of renal infarction by several days ( table 1 ) . proteinuria was significant in two cases . among the most frequent biochemical abnormalities , we noted elevated lactate dehydrogenase concentrations and inflammatory markers including increased white blood cells , c - reactive protein and fibrinogen levels ( table 2 ) . haemostasis was within the normal range , but the research for circulating anticoagulant was positive in two patients ( data not shown ) . renal ultrasound was performed in all cases at admission but failed to detect renal infarction . we performed contrast - enhanced abdominal cts to diagnose the renal infarction ( figure 1 ) and estimate the area of extension ( between 15 and 50% of the kidney surface ) . renal infarction affected mainly the left side ( 4/6 ) but was bilateral in one patient . we then performed angiotomodensitometry ( a - cts ) in some cases and magnetic resonance imaging angiography ( a - mri ) in others , completed by percutaneous selective renal arteriography ( figure 2 ) to identify vascular lesions and the vessels ' anatomy . three patients had multiple renal arteries and the dissection usually affected segmental branches but concerned also the main renal artery in two cases . only one of them was treated by angioplasty with stent implantation ( two stents ) , whilst conservative management was elected for all other patients for various reasons including the presence of a circulating false lumen , overpassed renal infarction or dissection of small branches of arteries , precluding revascularization possibilities . all patients were treated by oral anticoagulation ( anti - vitamin k ) or anti - platelets . two patients were lost to follow - up ; the others were followed up for a period of between 4 months and 13 years . they had normal blood pressure ( one without any treatment and three with anti - hypertensive drug therapy ) and their renal function remained stable . demographic and baseline clinical and disease characteristics ( n = 6 ) biochemical parameters at diagnosisa
crp , c - reactive protein ; na , not available ; wbc , white blood cells ; alat , alanin aminotransferase ; asat , aspartate aminotransferase ; pt , prothrombin time ; aptt , activated partial thromboplastin time . enhanced abominal cts showing median infarction of the left kidney ( patient number six ) . renal selective angiography ; ( a ) patient number six ; ( b ) patient number five . as illustrated by our clinical report , detection of srad is often delayed or missed because the condition is rare and its clinical presentation is non - specific . indeed , patients with acute renal infarction commonly have abdominal , flank or low back pain as in renal colic . the clinical presentation in our series is mainly consistent with previous reports but also illustrates new findings . first of all , there is a male predominance with a classic male to female ratio of 4:1 . this predominance could be even stronger with a ratio of 10:1 as described by edwards et al . in the most important series to date reporting on 35 patients . srad occurs predominantly in the fourth decade ( mean age of our series is 39 years ) of patients without known cardiovascular risk factors except tobacco use . another finding that our series showed was that the left renal artery was clearly more frequently involved . some authors suggest that anatomical characteristics predispose the left renal artery to dissection in the case of traumatic injury or acceleration / deceleration [ 58 ] . bilateral disease is encountered in 1015% of srad cases [ 911 ] usually because of underlying arterial disease . we identified fibromuscular dysplasia in half of our cases , confirming the high prevalence reported by lacombe et al . in their series of 22 patients treated by surgery . the third finding that we want to underline is the fact that spontaneous dissection can occur in normal vessels under normal blood pressure , but subjected to extreme exertion , as was the case with patients five and six , who practised body building . some authors suggest that vigourous exercise may subject the renal artery to such an unusual degree of stretching that it causes intimal tear and subsequent arterial dissection [ 1215 ] . more discordant is the fact that our patients were not all hypertensive at diagnosis . in rats , kidney infarction induces acute hypertension associated with a transient renin elevation . in humans , several authors have described the occurrence of malignant hypertension in the aftermath of a renal infarction [ 13 , 1719 ] whereas other case reports suggested that hypertension is not consistently associated , some patients remaining normotensive [ 12 , 2023 ] . it is important to note that in most of the series , patients are referred for endovascular or surgical [ 9 , 10 , 2426 ] revascularization , whose indication relies on the presence of uncontrolled hypertension and/or kidney failure , which easily explains the nearly 100% rate of hypertension . moreover , there was a large proportion of fibrodysplasia ( up to 90% ) [ 4 , 26 ] and/or atheroma [ 25 , 27 ] identified in the surgical series. the high prevalence of arterial pathology underlying the dissection may also help to explain the high frequency of hypertension in these series . in cases of srad with renal infarction , the diagnosis must be made as early as possible to increase the chances of renal revascularization and recovery . our experience confirms that doppler and/or ultrasound have poor diagnostic sensitivity since the dissection may affect intra - renal arterial branches and polar arteries whilst cts , on the other hand , never failed to identify the area of renal infarction . the performance of invasive exploration by angiography is recommended at an early stage to identify the vascular lesion and propose endovascular treatment . the precise mechanism by which srad occurs still remains poorly understood . one hypothesis raised by two small series suggests that physical exertion could be the trigger for dissection by stretching the arterial wall [ 12 , 13 ] . the right renal artery is less often affected than the left because its greater length allows a better distribution of shear stress . another hypothesis , as believed by some authors , suggests that srad is a clinical variant of fibromuscular dysplasia or atherosclerosis . in our series , however , the demographic characteristics of our patients are not those commonly observed in arterial dysplasia or atherosclerosis as these were men without any identified cardiovascular risk factors . additionally , in contrast to atherosclerotic lesions , the dissection occurred in the distal part of renal artery rather than the aortic ostium . finally , in half of our cases , the dissecting process also affected intra - renal arterial branches and sometimes the polar arteries . once diagnosed , there are several options for the treatment of srad ranging from conservative treatment to endovascular and surgical intervention , depending on the stage at which the diagnosis is made and the severity of the renal lesion . there is no therapeutic consensus and revascularization is usually proposed as a second option , for patients with medically uncontrolled hypertension or progressive renal dysfunction [ 3 , 4 , 9 , 24 , 25 ] . anti - hypertensive treatment combined with anti - aggregate platelet therapy appears to be safe and effective in most patients , with a mean follow - up reaching almost 10 years [ 12 , 2931 ] . although the natural history of renal artery dissection has not been well documented , it seems that remodelling of the dissected artery with re - entry points may restore a nearly normal renal flow , as it occurred with patient number six and as suggested by cases of spontaneous resolution [ 4 , 11 ] . studied the anatomical evolution of dissections by ct angiography with three - dimensional reconstruction and found that arterial remodelling occurs in most of the dissected branches without occlusive or aneurismal evolution . the poor outcome of surgical arterial reconstruction with a high rate of nephrectomy ( 40% ) is attributed in part to the frequent involvement of renal artery branches . percutaneous endovascular treatment with renal artery stenting is quite appealing and appears more likely to supplant surgical intervention since it is a less invasive and a safer treatment [ 2 , 15 , 28 , 32 , 33 ] . nevertheless , endovascular approaches are indicated depending on how early the diagnosis is made and how quickly the revascularization occurs , which is crucial to reducing the area of infarction and preserve renal function . due to this short time frame for intervention , we consider that direct non - invasive imaging by angio - cts or angio - mri is required if srad is suspected . the clinical presentation of srad is misleading and the diagnosis should be advocated when renal crisis is not associated with urolithiasis or alternatively when hypertension is present . such imaging techniques are invaluable for assessing renal artery morphology and area of renal infarction [ 17 , 18 ] . the six cases reported here highlight the difficulties in establishing the diagnosis of srad and emphasize the importance of performing appropriate renal imaging , as soon as the diagnosis is considered . | spontaneous renal artery dissection ( srad ) is a rare entity , which often presents diagnostic difficulties because of its non - specific clinical presentation .
we report six cases complicated with renal infarction , occurring in middle - aged male patients without risk factors , illustrating the difficulty and delay for diagnosing srad .
ultrasound and doppler imaging were not sensitive enough to confirm the diagnosis , and contrast - enhanced abdominal computed tomography was used to correct the diagnosis and allow the clinicians to propose appropriate treatment .
we conclude that considering the urgency in diagnosing and treating srad , contrast enhanced abdominal tomography and/or abdominal magnetic resonance imaging should be proposed as soon as a suspicion of srad is evoked by the clinical presentation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the rise of european science during the renaissance is greatly indebted to the flourishing of the sciences during the islamic golden age [ 13 ] . in the eastern caliphate of baghdad , thereafter , thanks to their own perceptive observations , trials , and skills , renowned scholars such as muhammad ibn zakariya al - razi or rhazes ( 865925 ) , ali ibn al - abbas al - majusi or haly abbas ( 930994 ) , and abu - ali al - husain ibn abdollah ibn sina or avicenna ( 9811037 ) remarkably contributed to the scientific treasure of this era . meanwhile , in the western caliphate of crdoba , muslim physicians and philosophers almost as brilliant as those of the east strongly promoted this scientific movement . studied and practiced medicine at seville and crdoba , al - zahrawi or albucasis ( 9361013 ) , ibn zuhr or avenzoar ( 10921162 ) , and ibn rushd or averros ( 11261198 ) were the most influential physicians of the western lands . nonetheless , some believe that medieval islamic physicians had been merely a medium for greco - roman ideas . on the other hand , abbasids ' attempts to resurrect the conviction that the greek medicine is in essence derived from persian have persuaded some medical historians to repudiate the former idea . the idea of muslim physicians being solely interpreters of the science rather than compilers is mostly attributed to the medieval islamic surgeons [ 9 , 10 ] . in particular , where the islamic surgeon neglected to indicate an example of a procedure 's usage , or to modify the procedure or instrumentation in any way from that handed down from his predecessors , such an interpretation of a literary tradition unrelated to the actual practice of surgery is encouraged . in contrast , in some medieval islamic medical books , the surgical instructions represent a change in the usual techniques or are accompanied by a case history , implying that the procedure was actually undertaken . a proof of the latter is the surgical instruments first depicted in details by al - zahrawi in his book of al - tasrif . herein , we review the description of the surgical management of gynecomastia by al - zahrawi and compare it with that of the ancient greek , medieval , and modern medicine . abul qasim khalaf ibn al - abbas al - zahrawi , known as abulcasis or albucasis in the west ( figure 1 ) , was born in al - zahra ( near crdoba , spain ) in 936 ad [ 12 , 13 ] . he sprang from the ansar tribe of medina , saudi arabia , who had settled earlier in spain . he lived most of his life in crdoba where he studied , taught , and practiced medicine and surgery [ 12 , 15 ] . al - zahrawi became one of the most famous surgeons of the muslim era and was physician to abd al - rahman iii ( 912961 ) and his son al - hakam ii ( 915976 ) of spain , the umayyad caliphs of crdoba . unlike his well - known published work , a few details remain about al - zahrawi 's life . al - zahrawi was first mentioned by the andalusian scholar , abu muhammad ibn hazm ( 9931064 ) , as one of the great physician surgeons of the moorish spain [ 12 , 13 ] . the first known biography of al - zahrawi was illustrated in al - humaydi 's jadhwat al - muqtabis fi dhikri volat al - andalus ( on andalusian savants ) compiled six decades after al - zahrawi 's death [ 12 , 13 ] . after nearly five decades of medical career full with great original contributions particularly in the court of caliph , al - zahrawi died in 1013 ad [ 17 , 18 ] . al - zahrawi 's thirty - book medical treatise , kitab al - tasrif leman ajiz an al - taalif ( the arrangement of medical knowledge for one who is not able to compile a book for himself ) , completed in 1000 ad , covers a broad range of medical topics [ 15 , 19 ] . al - tasrif , an illustrated encyclopedia of medicine and surgery , greatly influenced the progress of medicine and surgery in europe since it was translated into latin by gerard of cremonia ( 11141187 ) , an italian translator of arabic scientific works . thanks to translations into different european languages including french and english , al - tasrif displaced avicenna 's the canon of medicine as the textbook for medical education in many of the european universities between 12th17th centuries ad [ 15 , 19 ] . the most important part of al - tasrif comprises three books on surgery : on cauterization , on incision , perforation , venesection , and wounds , and on bone - setting . these books contain various aspects of surgical treatment in details based on al - zahrawi 's personal experiences of the surgical operations ( figure 2 ) . al - zahrawi based his published work , in particular the surgical books , upon greek authorities , of whom the most impressing was paulus of aegina ( ca . nonetheless , al - zahrawi added his several personal experiences along with almost 200 illustrations of instruments ' designs . the latter , many of which al - zahrawi devised himself , is deemed as an important innovation in the history of surgical literature . in later centuries , almost all european surgeons referred to al - zahrawi 's masterpiece of surgery . interestingly , erafeddin sabuncuolu ( 13851468 ) , a medieval ottoman surgeon and physician , compiled a translation of al - zahrawi 's al - tasrif in his book of cerrahiye - tu l - hanniyye ( imperial surgery ) accompanied with his own experiences and illustrations of surgical procedures . the second surgical book of al - tasrif includes a chapter on surgical treatment of gynecomastia , on the treatment of male breast when it resembles the female . what follows is a translation of the chapter related to the gynecomastia and the related surgical treatment . the breast of some males may swell on the attaining puberty so as to resemble the female breast , and they remain permanently swollen and ugly . if this is abhorrent , a semicircular incision should be made on the breast like the figure from b to g ( figure 3 ) , then dissect away all the fatty tissue and pack the wound with a cicatrizing compound and sew the lips together and dress until healed . but if the breast is pendulous and flabby on account of its size , as happens in women , you should make two semicircular incisions on the upper side the ends joining one another , in such wise that the longer incision encircles the other like this ( figure 4 ) , from b to g. then dissect away the skin between the two incisions and remove the fat and sew up as we have described , and apply styptic powder and the necessary dressings until healed . but if you can not make incision as full and perfect as it ought to have been , because the patient is restless , or because hemorrhage arises , you should pack the wound with cotton wool soaked in corrosive ointment and leave it till it eats away the reminder of the fat , then dress until healed . although the concept of breast enlargement in males was first implied by aristotle ( 384322 bc ) , the well - known roman physician claudius galenus ( 129200 ad ) coined the term gynecomastia in the second century ad . thereafter , gynecomastia has been applied to an atypical enlargement of male 's breast . there is no historical evidence of any surgical treatment for gynecomastia in pre - galenic , galenic , and post - galenic era until paulus of aegina , a seventh century byzantine greek physician , first indicated the surgical treatment of gynecomastia in his epitome of medicine ( seven books ) . later in the islamic golden age , haly abbas described surgical management of gynecomastia in his kitab al - maliki ( the royal book ) mostly based on that of paulus of aegina . another muslim physician attempted to provide the physicians and surgeons with surgical treatment of gynecomastia was al - zahrawi or albucasis , a well - known andalusian surgeon . although some believe that al - zahrawi merely replicated the writings on gynecomastia from paulus of aegina 's epitome , al - zahrawi 's modification of the procedure and administered medications ( see below ) might be indicative of his own practice of the procedure . almost four centuries later , erefeddin sabuncuolu illustrated the surgical techniques for the management of gynecomastia quite based on the related descriptions by paulus of aegina and al - zahrawi . the surgical techniques used to treat the gynecomastia throughout the medieval era were roughly the same . the first technique included making a lunate incision above the breast , removal of the subcutaneous fat , and application of a cicatrizing compound . in contrast to the site of incision ( below the breast ) indicated by paulus of aegina , al - zahrawi recommended making the incision above the breast . al - zahrawi 's different techniques might provide further breast uplift . on the other hand , unlike his greco - roman predecessors , al - zahrawi suggested usage of the flesh - growing substance at the end of the surgical procedure for the management of gynecomastia . as later stated by ibn sina or avicenna ( 9801037 ad ) in the canon of medicine , dragon 's blood ( calamus draco ) is an example of the cicatrizing or flesh - growing substance . interestingly , wound healing and antimicrobial effects of this medicinal herb have been recently proved by the modern medicine . this might imply that al - zahrawi was not only knowledgeable about the surgical techniques but also familiar with pharmacology . the second surgical technique described by al - zahrawi for the treatment of gynecomastia involved making two lunate incisions along the upper part of the breast to allow the removal of subcutaneous fat and redundant skin as well as application of styptic powder . although the former was a verbatim description of paulus of aegina 's surgical technique for the management of severe gynecomastia , al - zahrawi first recommended application of the styptic powder following the severe gynecomastia surgical procedure . according to the traditional islamic medicine , sprinkling powder over the surgical wound accelerates the wound healing and consists of aloe ( aloe vera ) , dragon 's blood ( calamus draco ) , gum arabic tree ( acacia arabica ) , sarcocolla ( astrargalus fasciculifolius bioss ) , and myrrh ( commiphora molmol ) . the efficacy of the natural substances prescribed by al - zahrawi for the gynecomastia surgical wound healing has been confirmed in the modern medicine ( table 1 ) . it is now believed that hematoma is the most common complication of surgery for the relief of gynecomastia . it is noteworthy that al - zahrawi lucidly indicated hemorrhage as the complication of the surgical management of gynecomastia and , therefore , he recommended compression cotton dressing . this important detail of the surgery for the treatment of gynecomastia had not been previously reported by the ancient greek , roman , and even other medieval islamic physicians and surgeons . in addition , al - zahrawi recommended application of corrosive ointment to erode the reminder of the fat . according to the traditional islamic medicine resources , zanjar ( verdigris or copper acetate ) was a well - known corrosive agent [ 35 , 39 ] . verdigris and other copper - containing compounds were administered for the treatment of inflammatory diseases in the ancient egyptian and roman medicine . in the history of gynecomastia , al - zahrawi was the first physician and surgeon who employed the verdigris in the treatment of some cases of gynecomastia . the efficacy of this substance might be attributed to its anti - inflammatory activity . in modern practice , surgical management of gynecomastia is recommended after any underlying causes have been treated or following the failure of pharmacologic treatment . in contrast , the medieval clinicians including paulus of aegina and al - zahrawi neglected the probable etiologies of the condition in their writings , albeit they were pioneers in clinical endocrinology . this might give rise to the most of the medieval islamic physicians ' failure to indicate the gynecomastia in their medical books . in modern medicine , all related surgical procedures are designed to completely remove the excess breast tissue while minimizing scarring on the chest . as a result , semicircular intraareolar incision together with liposuction constitutes the treatment of mild to moderate gynecomastia , while more severe cases require periareolar incision and subsequent skin resection and nipple transposition . in comparison with the modern aesthetic criteria , the aesthetic outcome of al - zahrawi 's surgical techniques for the treatment of gynecomastia , in particular with respect to the shape and site of the surgical incision and excess skin resection , might be considered as satisfactory but not excellent , at least for the time being . the breast reduction for men with gynecomastia later , although al - zahrawi seemed to base his descriptions of surgery for gynecomastia upon those of paulus of aegina , his modification of the procedure and application of the medicinal substances might be indicative of al - zahrawi 's own practice of the procedure . al - zahrawi 's surgical procedures remained unchanged for many centuries thenceforward until the technological evolution in the recent centuries . | the rise of european science during the renaissance is greatly indebted to the flourishing of the sciences during the islamic golden age .
however , some believe that medieval islamic physicians and in particular surgeons had been merely a medium for greco - roman ideas .
contrarily , in some medieval islamic medical books , such as al - tasrif of al - zahrawi ( 9361013 ) , the surgical instructions represent a change in the usual techniques or are accompanied by a case history , implying that the procedure was actually undertaken . along with the hundreds of chapters on different diseases and related medical and surgical treatments , al - tasrif includes a chapter on surgical techniques for gynecomastia .
the present paper is a review of the description of the surgical management of gynecomastia by al - zahrawi as well as that of the ancient greek , medieval , and modern medicine .
although al - zahrawi seemed to base his descriptions of surgery for gynecomastia upon those of paulus of aegina , his modification of the procedure and application of the medicinal substances might be indicative of al - zahrawi 's own practice of the procedure .
al - zahrawi 's surgical procedures remained unchanged for many centuries thenceforward until the technological evolution in the recent centuries . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
thyroid hormones affect bone remodeling in patients with thyroid disease by acting directly or indirectly on bone cells.[14 ] tsh may also affect bone health by interacting with tsh receptors expressed on osteoblasts and osteoclast precursors.[57 ] the relative contribution of thyroid hormone excess and tsh deficiency in causation of bone loss remains unresolved . in experimental animals , studies in subjects with exogenous subclinical hyperthyroidism did not reveal any effect on bone mineral density ( bmd ) in men and premenopausal women , whereas the effect in postmenopausal women is equivocal . the association of subclinical hypothyroidism and bmd are varied.[811 ] many authors have studied relation of thyroid functions with bmd in euthyroid postmenopausal women,[1215 ] but there is limited information on correlation of thyroid function with bmd in euthyroid premenopausal women and males below 50 years of age . hence , we undertook this cross sectional study to evaluate the correlation of thyroid function with bmd in subjects aged less than 50 years with normal thyroid function and subclinical hypothyroidism . this study was carried out as part of general health examination of all members of resident welfare associations of 4 residential colonies of delhi , one each from north , south , east , and west for a general health checkup on voluntary basis . men > 50 years of age , women who were either post - menopausal or > 50 years of age , and subjects with diabetes , hepatic disease , renal disease , alcoholism , family history of fracture , overt hypo - or hyper - thyroidism , or receiving any medication likely to influence bone mineral status were excluded from the study . body mass index ( bmi ) was calculated by weight in kilogram divided by square of height in meters . fasting blood samples were drawn for the estimation of serum 25(oh)d , intact parathyroid hormone , total and ionized calcium , inorganic phosphorus , and alkaline phosphatase ( alp ) . the study was approved by the ethics committee of the institute of nuclear medicine and allied sciences and all subjects gave written informed consent . thyroid function tests ( tft ) were performed by electrochemiluminiscence assay with the following normal range ft3 ( 2.8 - 7.1 pmol / l ) , ft4 ( 12.0 - 22.0 anti - tpo antibody was measured by using electrochemiluminiscence kits from roche ( germany ) with normal range from 0.0 - 34.0 subjects > 102.0 iu / l i.e. 3 times the upper limit of normal were considered to have significant anti - tpo antibody positivity . biochemical estimations were carried out using automated analyzer ( hitachi 902 fully automated biochemistry analyzer ; roche , manheim , germany ) and commercial kits ( roche , manheim , germany ) . the normal range for different biochemical parameters are as follows : serum total calcium ( 2.2 - 2.55 mmol / l ) , ionized calcium ( 1.12 - 1.32 mmol / l ) , and alkaline phosphatase were ( females : < 240 u / l ; males : < 270 u / l ) . the serum concentrations of 25(oh)d ( reference range : 22.5 - 94 nmol / l ) and pth ( reference range : 10 - 65 ng / l ) were measured by ria ( diasorin , stillwater , mn ) and electrochemiluminiscence assay ( roche diagnostics , gmdh - manheim , germany ) respectively . bone mineral density ( bmd ) at anteroposterior ( ap ) lumbar spine ( l1-l4 ) , femur ( total hip , femoral neck ) and forearm ( total , ultra distal and 33% radius ) was measured using the prodigy oracle ( ge lunar corp . , madison , instrument variation was determined regularly using a phantom supplied by the manufacturer and mean coefficient of variation was < 0.5% . for in vivo measurements , mean coefficients of variation for all sites were < 1% . subjects ( 1290 ) were divided in two groups : group1 ( 1115 subjects , 86.8% ) with normal thyroid function and group 2 ( 175 subjects , 13.2% ) with subclinical hypothyroidism defined as normal ft4 and tsh > 4.2 miu / l . statistical analysis was carried out using epi info 3.5.3 ( cdc , atlanta , ga , usa ) . if barlett 's chi - square test for equality of population variances was < 0.05 then kruskal - wallis test was applied . multiple regression analysis was done to ascertain association between thyroid functions and bmd at various sites . pearson 's correlation coefficient was calculated to assess the strength of relationship between thyroid function test and bmd at various sites . a p value of < 0.05 was considered statistically significant . bmd at all sites ( radius , femur and spine ) were comparable in both groups [ table 2 ] . when both groups were divided according to tsh levels ( 0.3 - 1.6 , > 1.6 - 2.9 , > 2.9 - 4.2 and > 4.2 - 6.2,>6.2 - 8.2 , > 8.2 ) there were no statistically significant differences in bmd at all sites between groups in either of sexes analysed separately ( data not shown ) . basic characteristics of study population bone mineral density ( gm / cm ) in subjects with normal thyroid function tests and subclinical hypothyroidism among euthyroid subjects , ft4 were positively associated with bmd at 33% radius after adjustment for age , sex , bmi , 25(oh)d and pth levels in multiple regression analysis the association between ft4 bmd at femoral neck did not achieve statistical significance [ table 3 ] . among subjects with sch , ft4 was negatively associated with bmd at lumbar spine in univariate ( r = 0.02 , p=0.07 ) and multivariate analysis ( r = 0.07 , p= 0.041 ) [ table 4 ] . in correlation analysis , ft4 was positively correlated with bmd at radius and femoral neck among all subjects [ table 5 ] . multiple regression analysis of tft and bmd in euthyroid subjects ( after adjustment for age , sex , bmi , pth and 25(oh)d levels ) multiple regression analysis of tft and bmd in sch subjects ( after adjustment for age , sex , bmi , pth and 25(oh)d levels ) correlation of thyroid function tests and bone mineral density among all subjects among euthyroid subjects , ft3 was negatively associated with bmd at femoral neck after adjustment for age , sex , bmi , 25(oh)d and pth levels in multiple regression analysis [ table 3 ] . among subjects with sch , ft3 was negatively associated with bmd at 33% radius ( r = 0.14 , p=0.01 ) in multivariate analysis [ table 4 ] . in correlation analysis , ft3 showed no correlation with bmd at any site among all subjects [ table 5 ] . tsh was positively associated with bmd at 33% radius among euthyroid subjects in multiple regression analysis after adjustment of various factors mentioned above . tsh showed no association with bmd at any site in univariate or multiple regression analysis in subjects with sch [ table 4 ] . tsh showed no correlation with bmd at any site among all subjects [ table 5 ] . in the present study , ft3 was noted to be negatively associated with bmd at femoral neck whereas ft4 was positively associated and correlated with bmd at radius and femoral neck ; and tsh was neither associated nor correlated with bmd at any site in euthyroid subjects below 50 years of age . griemnes et al , in a large cross sectional troms study among men and postmenopausal women , found no association between tsh and bmd with serum tsh being in the normal range after adjustment for age , weight , height , smoking habits , physical activity and use of hormone replacement therapy in women . in contrast , baqi et al , reported significant positive influence of tsh on bmd in postmenopausal women at lumbar spine and femoral neck independent of age , and bmi in multiple regression analysis . a negative correlation of tsh with bone mineral content has also been reported in healthy euthyroid subjects in a small study . we divided the study subjects from both groups in tsh tertiles and found no difference in bmd among tertiles in either group . similar observation has been made in a large population based study by svare et al . however , a hospital - based study from south korea found an increasing hip and lumbar bmd with increasing tsh from low normal to high normal tsh level . morris et al , also studied the association between tsh ( within normal range ) and hip bmd in postmenopausal women . they reported that women with tsh values in the lower normal range ( 0.39 - 1.79 miu / l ) had higher risk for osteopenia and osteoporosis than those with tsh values in the higher normal range ( 1.8 - 4.6 miu / l ) . the positive association and correlation of ft4 with bmd at radius in euthyroid subjects observed in present study was in contrast to a large population based cohort study involving healthy euthyroid postmenopausal women where ft4 was negatively correlated with bmd at hip . similarly , a negative correlation of ft4 with bone mineral content has also been reported in healthy euthyroid subjects . baqi et al , however , reported no correlation between ft4 and bmd in post menopausal women . negative association of ft3 with bmd at femoral neck in euthyroid subjects in the present study was also observed by murphy et al , in healthy postmenopausal euthyroid women . however , there are studies which did not reveal any correlation between thyroid hormones and bmd in premenopausal women and cured cases of differentiated thyroid carcinoma with subnormal tsh levels on thyroxin replacement . since there was no effect of thyroid hormones noted on bmd at lumbar spine in euthyroid subjects in present study , it suggests that thyroid hormones have more pronounced effect on cortical than trabecular bone . there was no difference in bmd at any site between euthyroid subjects and subjects with subclinical hypothyroidism . one small study , in contrast , did report decrease in bmd at femoral neck but found no difference in bmd at lumbar spine in postmenopausal women with subclinical hypothyroidism compared to euthyroid controls . however , another study reported significantly higher bmd in premenopausal women with post surgical subclinical hypothyroidism . lack of association between tsh and bmd at any site observed in subjects with sch in the present study , was consistent with the findings of a small study in postmenopausal women at lumbar spine and total hip . bertoli et al , who measured bmd and bone mineral contents at different regional sites in 32 postmenopausal women , reported direct relationship between leg bmd and tsh . in a population based study , svare et al , demonstrated that bmd at radius was lower in subjects with tsh < 0.1 we therefore hypothesize that tsh values above 0.1 miu / l probably plays a permissive role in maintaining bmd which would also explain the lack of association of tsh with bmd in both euthyroid and sch subjects as seen in the present study . in contrast , patients with thyrotoxicosis have a low bone mass partly because their tsh is below the required threshold for maintaining bmd . low concentration of tsh may be necessary for local expression of type-2 deiodinase in osteoblasts which via generation of t3 locally may have a positive effect on osteoblast . this is further supported by a genetic study where tshr knockout and haploinsufficient mice with normal thyroid hormone levels have decreased bone mass . similarly , the exogenous administration of low doses of tsh in animal experiments have positively influenced bone remodeling by inhibiting osteoclast differentiation and activating osteoblast differentiation , thus eliciting both antiresorptive and anabolic bone effects . the main strength of study was large sample size and population based study and limitation was being a cross sectional study , changes in bmd could not be assessed in relation to thyroid function tests over a period of time . thyroid hormones appear to have more pronounced positive effect on cortical bone than trabecular bone in euthyroid subjects . | background : thyroid hormones affect bone remodeling in patients with thyroid disease by acting directly or indirectly on bone cells . in view of limited information on correlation of thyroid function with bone mineral density ( bmd ) in euthyroid subjects , we undertook this study to evaluate the correlation between thyroid function with bmd in subjects with normal thyroid function and subclinical hypothyroidism.material and methods : a total of 1290 subjects included in this cross sectional study , were divided in group-1 with normal thyroid function and group-2 with subclinical hypothyroidism . fasting blood samples
were drawn for the estimation of serum 25(oh)d , intact parathyroid hormone , total and ionized calcium , inorganic phosphorus , and alkaline phosphatase .
bmd at lumbar spine , femur , and forearm was measured.results:bmd at all sites ( radius , femur , and spine ) were comparable in both groups .
there was no difference in bmd when subjects were divided in tertiles of tsh in either group . in group-1 ,
ft4 and tsh were positively associated with bmd at 33% radius whereas ft3 was negatively associated with bmd at femoral neck in multiple regression analysis after adjustment for age , sex , bmi , 25(oh)d and pth levels . in group-2
, there was no association observed between tsh and bmd at any site . amongst
all study subjects ft4 and ft3 were positively correlated with bmd at lumbar spine and radius respectively among all subjects.conclusion:tsh does not affect bmd in euthyroid subjects and subjects with subclinical hypothyroidism .
thyroid hormones appear to have more pronounced positive effect on cortical than trabecular bone in euthyroid subjects . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the purpose of all sports training is the maximization of the physical and mental elements
required to perform exercises or play games . therefore , the application of specialized and
specific training suitable for sports is important . in particular , the acquisition of
maximum muscle strength and power is an essential element of all sports . plyometric training
is widely used as a method of developing explosive power capacity in those sports that
require jumping ability such as athletics , basketball , and volleyball1 . most sports require various kinds of fast and slow muscle strength and speed2 . although typical training methods for
increasing the muscle strength of athletes include weight training , such as resistance
exercises and plyometric training3 , the
power necessary for explosive jumping refers to the power exhibited in dynamic states4 . plyometric training is a type of muscle strength exercise that can improve basic physical
strength and it has been extensively studied for the improvement of exercise performance
ability . it is an explosive and repetitive rebounding load type exercise that uses the
muscles stretch reflexes and stretch - shortening cycles to develop lower extremity
muscles5 , 6 . stretch reflexes are used to promote motor unit mobilization in
order to reduce differences between speeds and muscle strength7 . in athletics , diverse efforts have been made to try and enhance records through active
studies and the development of training methods . with increasing interest in athletics , the
importance of athletics scientification has been recognized . desired records in athletics
can not be achieved only with natural movements and efforts , but also require more reasonable
and scientific training content and methods8 . the physical strength elements required for athletic throwing
events include muscle strength , swiftness , agility , speed , flexibility , and physical
balance . although plyometric training and weight training are implemented as representative
training methods for improving swiftness and agility , most studies of it have been conducted
with players of other sports . therefore , the purpose of the present study was to identify the effects of lower extremity
plyometric training for 12 weeks , performed by high school throwing event athletes , on
isokinetic lower extremity muscle strength and lumbar muscle strength in order to develop
more efficient training methods . the study subjects were 10 throwing event athletes attending k physical education high
school . the subjects were randomly assigned to a control group of five subjects and an
experimental group of five subjects . the experimental group performed 12 weeks of lower
extremity plyometric training in addition to general physical strength training programs
implemented during school hours . the control group ( n=5 ) was 17.600.54 years old in age ,
1.74.584.60 cm in height , and 73.229.90 kg in weight , and had 14.525.67% body fat , and kg
lean body mass 32.924.81 . the plyometric training group was 17.600.89 years old in age ,
173.587.78 cm in height , and 77.2211.66 kg in weight , and had 15.346.30% body fat , and
35.1626.85 81 kg lbm . to analyze the body composition , an inbody 3.0 instrument ( biospace , korea ) was used as
experimental equipment to measure the subjects heights , weight , body fat percentages , and
muscle masses and a biodex system 4.0 ( biodex , usa ) was used to measure isokinetic
muscle - joint and lumbar muscle strengths . the plyometric training consisted of 15 techniques out of the training methods introduced
in the power up plyometric training9 . lateral jump with one foot10315315511 . jump and dead run10315315512 . running up the stairs with one foot10315315513 . running up the stairs with both feet10315315514 . running up the stairs aside10315315515 . running fast and light103153155 . the plyometric program was implemented without any training load three times
per week during daybreak exercises performed by the experimental group . the number of times
and the number of sets were changed over time as follows : three sets of 10 times in the
1st4th weeks , three sets of 15 times in the 5th8th weeks , and five sets of 15 times in the
9th12th weeks . to measure kinetic lumbar muscle strength , a biodex system 4.0 was used to measure average
power . when stabilized after warm - up exercises , the subject s body regions other than the
lumbar region were fixed using adjustable pads so that they would not be subject to external
force during extension and flexion movements . the lower extremities and the chest were fixed
using straps to restrict the actions of the other muscles . the rotation axis of the joint
being tested was aligned with the rotation axis of the dynamometer , and the subjects were
encouraged to exert maximum efforts . the average power of flexion and extension was
calculated from the values of 4 repeated measurements of lumbar extension and flexion at
60/sec . the data obtained were processed using the sas ver 9.12 statistics program . the means and
standard deviations of the two groups were calculated . to examine differences between the
groups and between measurement time points , the results of the prior test were set as
covariates and analyses of covariance ( ancova ) were conducted . post hoc tests of differences
between the groups were conducted using the least squares mean ( lsm ) method only when the
assumption that the gradients of regression lines were statistically the same within the
groups was established , and improvement rate independent t - tests were conducted to examine
differences in records between athletes of different items . all the subjects understood the purpose of this study and provided their written informed
consent prior to their participation in the study in accordance with the ethical standards
of the declaration of helsinki . according to the ancova results of lumbar extensor muscle strength at 60/sec , the overall
reliability of the model was significant ( f=27.28 p<0.001 ) . in the results of the prior
test , the common gradient of regression straight lines of lumbar extensor muscle strength at
60/sec was significant within each treatment , indicating that the initial value of the
ancova did not significantly affect actions after the treatment ( f=26.19 p<0.001 ) . the
main effect , i.e. , the differences between the groups resulting from the experimental
treatment , was significant ( f=22.15 , p<0.002 ) . in the lumbar extensor muscle strength at 60/sec , the standard deviation of the control
group decreased from 327.2258.41 nm in the prior test to 274.6249.95 nm in the
post - treatment test , and the standard deviation of the experimental group improved from
341.8481.96 nm in the prior test to 382.5877.65 nm in the post - treatment test ( table 2table 2 . least mean square ( lsm ) of lumbar extensor muscle strength at 60/sec and
comparison of differences between the groups ( nm)grouppre_msdpost_msdmeansdcontrol group327.2258.41274.6249.95280.5714.38*experimental group341.8481.96382.5877.65376.6214.38*p<0.01 ) . the lsms of both groups were compared and the results shown in ( table 2 ) indicated that there were differences when seen based on
two - tailed tests ( p<0.002 ) . however , one - tailed tests were appropriate in the present
study , and the significance level was eventually shown to be 0.001 ( 0.0021/2 ) , indicating
that the lumbar extensor muscle strength at 60/sec was significantly different between the
two groups . according to the ancova results of lumbar flexor muscle strength at 60/sec , the overall
reliability of the model was significant ( f=6.21 p<0.02 ) . the common gradient of linear
regression of lumbar flexor muscle strength at 60/sec was significant within each
treatment , indicating that the initial value of the ancova did not significantly affect
post - treatment actions ( f=6.58 p<0.003 ) . the main effect , i.e. , the differences between
the groups made by the experimental treatment , was significant ( f=6.26 , p<0.004 ) . in the lumbar flexor muscle strength at 60/sec , the standard deviation of the control
group decreased from 170.1244.75 nm in the pre - test to 153.9420.24 nm in the post - test and
the standard deviation of the experimental group improved from 167.4445.25 nm in the
pre - test to 185.6832.45 nm in the post - test ( table
3table 3 . least mean square ( lsm ) of lumbar flexor muscle strength at 60/sec and
comparison of differences between the groups ( nm)grouppre_msdpost_msdmeansdcontrol group170.1244.75153.9420.24153.379.28*experimental group167.4445.25185.6832.45186.249.28*p<0.01 ) . the lsms of both groups were compared and the results indicate that there were differences based on two - tailed tests
( p<0.004 ) . however , one - tailed tests were appropriate for the present study , and the
significance level was eventually shown to be 0.002 ( 0.0041/2 ) , indicating that the lumbar
flexor muscle strength at 60/sec was significantly different between the two groups . since measurement of peak torque is very accurate and is highly reproducible , all
isokinetic contractile force values can be standardized and utilized as reference data . lumbar flexor / extensor muscle strength at 60/sec in two - tailed tests
showed significant differences between the two groups ( p<0.01 ) . this result is consistent
with those of youm and colleagues10 , who
reported that after implementing abs and back training , the expression ratio of abdominal
and lumbar muscle strengths significantly increased ( 14.53% ) , and also with those of
brittenham11 , who reported that
abdominal / lumbar training evenly developed abdominal , spinal , and gluteal muscles conferring
positive effects on power expression . the differences in isokinetic muscle strength centered
on the waist between sports activities are similar to as the results of a previous study
which indicated that the major reason is the development of the muscles around the
waist12 . although plyometric training mainly jumping consist of exercises , appropriate levels of
stimulation are required for back muscle strength to increase lower extremity muscle
strength . ju13 reported that plyometric
training was correlated with the improvement of lumbar joint flexor / extensor muscle
strength . standaert and colleagues14 reported that
when posture swayed due to lumbar stabilization exercises , the transversus abdominis muscle
( tra ) was activated and that muscle activity was reduced when lumbar stability was deficient
or there was a problem in motor control . gresswell and colleagues15 reported that functional activities caused changes in
intra - abdominal pressure and that the tra was activated before the erector spinae muscle was
activated when loads were imposed on the spine . maffiuletti et al.16 reported that four
weeks of plyometric training performed by 10 female volleyball players improved lower
extremity muscle strength by 20% . although most studies of plyometric training examined the
degree of improvement of lower extremity muscle strength , the present study revealed good
results from an examination of lumbar flexor / extensor muscle strength . we consider that the
increase in core muscle strength improved the athletes motor abilities . plyometric training positively affected the performance of high school throwing event
athletes . to summarize the study findings , the application of plyometric training with high
intensity and loads improved the performance of athletes who perform highly intensive
exercises at normal times . | [ purpose ] the physical strength elements required for athletic throwing events include
muscle strength , swiftness , agility , speed , flexibility , and physical balance .
although
plyometric training and weight training are implemented as representative training methods
for improving swiftness and agility , most studies of it have been conducted with players
of other sports .
[ subjects ] the study subjects were 10 throwing event athletes attending k
physical education high school .
the subjects were randomly assigned to a control group of
five subjects and an experimental group of five subjects . to analyze the body composition ,
an inbody 3.0 instrument ( biospace , korea ) was used as experimental equipment to measure
heights , weight , body fat percentages , and muscle masses and a biodex system 4.0 ( biodex ,
usa ) was used to measure isokinetic muscle - joint and lumbar muscle strengths . the
plyometric training consisted of 15 techniques out of the training methods introduced in
the power up plyometric training. the plyometric program
was implemented without any
training load three times per week during daybreak exercises for the experimental group .
the number of times and the number of sets were changed over time as follows : three sets
of 10 times in the 1st 4th weeks , three sets of 15 times in the 5th8th weeks , and five
sets of 15 times in the 9th12th weeks .
[ results ] according to the ancova results of
lumbar extensor muscle strength at 60/sec , the overall reliability of the model was
significant . according to the ancova results of lumbar flexor muscle strength at 60/sec ,
the overall reliability of the model was significant .
[ conclusion ] plyometric training
positively affected high school throwing event athletes . to summarize the study findings
,
the application of plyometric training with high intensity and loads improved the results
of athletes who perform highly intensive exercises at normal times . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the financial management of health care in france is undertaken mainly by the statutory health insurance system as a branch of the wider social security system . the health insurance system s current structure is based on its founding text , the ordinance of 4 october 1945 and subsequent legislative measures . this system has covered the entire population of france since 1 january 2000 when the couverture maladie universelle ( cmu , universal health coverage act ) extended basic health insurance cover to all legal residents of france . the french statutory health insurance system is a compulsory scheme and covers all households regardless of health status , income , number of persons , etc . it provides a somewhat uniform field of reimbursement , with the basket of goods and services covered by the insurance funds being identical for all the statutory schemes with the reimbursement rate being the same for the three main insurance schemes since 2000 . the exceptions are the alsace - moselle region s local scheme and certain public sector schemes . membership in one of the health insurance funds of the statutory health insurance depends on the profession of each person . in the context of the cmu , however , participation depends on legal residence in france and on the level of income . any dependants of the insured person are also covered by his / her health insurance . the three main health insurance schemes are as follows : ( a ) the general scheme ( rgime gnral ) covers employees in commerce and industry and their families ( about 84% of the population ) as well as persons receiving cmu , estimated in late 2003 at about 1,500,000 person ( 2.4% of the population ) . ( b ) the agricultural scheme ( mutualit sociale agricole ) covers farmers and agricultural employees and their families ( about 7.2% of the population ) . ( c ) the scheme for the non - agricultural self - employed ( canam ) covers craftsmen and self - employed persons , including self - employed professionals such as lawyers ( about 5% of the population ) . statutory health insurance funds three - quarters of the health expenditure and therefore leaves considerable scope for complementary sources of funding . taking into account recipients of couverture maladie universelle complmentaire ( complementary universal health coverage 6% of the population ) , about 91% of the french population are covered by the complementary health insurance scheme , which covers the same health basket as the statutory schemes and not other goods and services . the most important benefit catalogues for france and their underlying criteria are displayed in tables 1 and 2 while the following sections are confined to curative health care services.table 1 catalogues and implicit regulationgbrccamngaplsac atumed . all other outpatient curative care ( paramedical)+ 3.5 . services of curative home care++hc.2 services of rehabilitative care 1 . other medical nondurables++ 3 . therapeutic devices and other medical durables++hc.6 prevention and public health services+gbr general benefit regulation , ccam list of physicians and dentists technical procedures , ngap list of physicians consultations and other health professionals activity , lsac atu positive lists of drugs , med . dev . positive lists of medical devices , nabm positive lists nabm biology procedure , sp . reg . specific regulationtable 2 benefit - defining laws / decrees , catalogues and implicit regulationgbrccam , ngaplsac atumed . reg.legal status : law , decreelawuncam decisionministerial orderministerial orderuncam decisionadministrative documentdecision makerparliament uncam , on the advice of has and unocministers of health and social security , on the advice of the transparency commissionministers of health and social security on the advice of the ad hoc commissionuncam , on the advice of has and unocoriginal purpose : entitlements , reimbursement , target settingreimbursementpositive listpositive listpositive listpositive listpositive listtariffsfee scheduleprices or reference pricesreference pricesfee schedulepositive - negative definition of benefitspositivepositivepositivepositivepositivepositivedegree of explicitness3 ( except inpatient care : 1)33332 or 3if itemized : goods / procedures only ; linked to indicationsmainly goods and procedures ; linked to indicationsprocedures , sometimes linked to indicationspharmaceutical products , linked to indicationsgoods linked to indicationsprocedures linked to indicationsmainly indicationsupdating regularlyregularlyregularlyregularly gbr general benefit regulation , ccam list of physicians and dentists technical procedures , ngap list of physicians consultations and other health professionals activity , lsac atu positive lists of drugs , med . positive lists of medical devices , nabm positive lists nabm biology procedure , sp . reg . specific regulation1 , all necessary ; 2 , areas of care ; 3 items catalogues and implicit regulation gbr general benefit regulation , ccam list of physicians and dentists technical procedures , ngap list of physicians consultations and other health professionals activity , lsac atu positive lists of drugs , med . positive lists of medical devices , nabm positive lists nabm biology procedure , sp . reg . specific regulation benefit - defining laws / decrees , catalogues and implicit regulation gbr general benefit regulation , ccam list of physicians and dentists technical procedures , ngap list of physicians consultations and other health professionals activity , lsac atu positive lists of drugs , med . dev . positive lists of medical devices , nabm positive lists nabm biology procedure , sp . reg . specific regulation 1 , all necessary ; 2 , areas of care ; 3 items health benefit catalogues are drawn up at national level with the whole range of goods and services reimbursed by the statutory scheme being specified in article l.321 - 1 of the social security code ( ssc ) . the reimbursement of goods and services depends on their inclusion in positive lists , according to articles l.162 - 1 - 7 , l.162 - 17 , and l. 165 - 1 of the ssc . until 2004 positive lists were officially enforced by ministerial orders detailing the inclusion of new goods and services . ministers made their decisions upon the advice of ad hoc scientific commissions and agencies , for example , the national agency for accreditation and evaluation in health care ( anaes ) . the inclusion of all the listed procedures depends on anaes advice which considers the effectiveness and/or safety of these procedures and the conditions under which they need to be performed . reimbursement is legal only when goods or services are provided in an appropriate medical context . reimbursement for all goods and all paramedical procedures depends on the provision of a prescription , which serves as confirmation of the necessity of such goods and services . for some types of treatment , such as physiotherapy and spa treatment , the prescription from a physician coverage by statutory health insurance is subject to the prior authorization ( entente pralable ) of the physicians advising the health insurance funds , after examination of the patient s case history and a possible interviewing of the patient . according to article l.322 - 2 of the ssc , the insured person s copayment is fixed by a decision of union nationale des caisses dassurance maladie ( uncam , national union of health insurance funds ) within rate limits defined by a council of state decree . the patient s contribution to the total cost of treatment varies according to the type of treatment , being higher for outpatient care and drugs compared to hospital treatment . the copayment must be paid by the insured person or , where applicable , by their complementary health insurance fund . council of state decrees also define copayment exemption conditions ( article l.322 - 3 of the ssc ) . the most important exemptions are linked to the health status , especially in the case of one person suffering from one of 30 specified long - term illnesses , for example , diabetes , aids , cancer , and psychiatric illness , and if the patient is suffering from one or several incapacitating diseases . other health status - based exemptions concern , for example , disabled persons under the age of 20 years and pregnant women during the final 4 months of pregnancy . the health benefit basket is explicitly defined by positive lists of goods for both the public and the private sectors . positive lists only apply to services delivered by private sector professionals in their own practices or in private for - profit hospitals . conversely , services dispensed in public hospitals or private not - for - profit hospitals were mainly the subject of implicit definition since they were paid for by a global budget , which means in practice that basically every dispensed service was reimbursed . services qualifying for reimbursement by the health insurance system include : ( a ) inpatient care and treatment in public or private healthcare institutions ; ( b ) outpatient care provided by general practitioners , specialists , dentists , and midwives ; and ( c ) diagnostic services and care prescribed by physicians and performed by laboratories and paramedical professionals , such as nurses , physiotherapists and speech therapists . in july 2005 , two health benefit catalogues for curative services exist : ( a ) the classification commune des actes mdicaux ( ccam ) , which revises the previous medical services catalogue , has been adopted in 2005 with its application still only partial . ( b ) the general fee schedule ( nomenclature gnrale des actes professionnels , ngap ) , which is the medical procedures positive list for health professionals in private practice , in their own surgeries and consulting rooms and in private - for - profit hospitals , remains in force until the ccam is fully implemented . the social security act of 18 december 2003 ( loi de financement de la scurit sociale , lfss ) changed the inpatient acute care funding rules , but implementation is still in progress . the situation will continue to change during the next few years for at least two reasons . firstly , the positive list for physicians procedures , the ccam , applies to both private and public hospitals ( article 162 - 1 - 7 of the ssc ) , which had not been the case before . secondly , the implementation of the per - case payment reform that will lead to the result of both sectors being brought into line . these situations before and after the reforms of 2004 - 2005 are shown in table 3.table 3 definition of benefit catalogues for inpatient care before 20042005after 20042005funding rules depend upon hospital status : ph and pnfph , vs. pfphnew funding rules making the basket more explicitrange of reimbursed medical procedures defined at least for pfph but not for other services , e.g. , nursing caresame list of medical procedures for both private and public hospitals ( article 162 - 1 - 7 of the ssc),no positive list for ph , an implicit coverage for all services in ph and pnfph mainly financed by the global budgetsame prospective per - case payment system for ph and pfph for all medical , surgery and obstetrics services , based on drg - type classification of ghs , but tariffs still differ from ph to pfph.basket of reimbursable drugs defined for ph and pfphbasket of reimbursable drugs defined for ph and pfphph public hospital ,
pnfph private non - for - profit hospital , pfph private - for - profit hospital , drg diagnosis - related group , ghs homogeneous stay group definition of benefit catalogues for inpatient care ph public hospital ,
pnfph private non - for - profit hospital , pfph private - for - profit hospital , drg diagnosis - related group , ghs homogeneous stay group as seen in table 3 , there has been no positive list to define reimbursable services in public and in private not - for - profit hospitals , in which inpatient services were regulated by implicit coverage . however , the implementation of the per - case payment system will simplify the situation as all medical , surgery and obstetrics services in all hospitals will be included in it . the reform will also change the remuneration schemes of inpatient and outpatient care . services provided in inpatient or outpatient acute care will be financed through a payment - per - case system . this is based on a diagnosis - related group type of classification of 700 groupes homognes de malades ( ghm ) , considering comorbidities . a nationally fixed tariff ( groupe homogne de sjours , ghs , homogeneous group of stays ) outpatient procedures will be paid on a fee - for - service basis , and organ retrieval and emergency services by annual lump sum payments . this payment system also includes earmarked funding ( missions dintrt gnral et aide la contractualisation , migac ) to finance other activities , such as research and education , but also certain healthcare activities promoted by contracts between hospitals and regional health agencies . the new ghs payment system has been in operation since 1 march 2005 for private - for - profit hospitals . procedures carried out by physicians are always paid separately and directly to the physicians concerned on a fee - for - service basis , while in public hospitals , tariffs include specialists salaries . since july 2005 , the ccam is used as the general fee schedule and can be considered as the positive list for private for hospitals . health insurance funds will not finance any stay if one of these procedures does not apply . ccam is currently available only for technical procedures such as surgery , medical imaging , and radiotherapy performed by physicians . paramedical services , including , physiotherapy , which are linked to inpatient medical procedures , are reimbursed only if they are an essential part of the medical treatment . regarding the definition of the health basket , the rules for day - case patient care are the same as those applicable to inpatient care . patients who need health care have until now been free to choose which physician to consult and have also been allowed to refer themselves to specialists . only few general practitioners have begun playing the role of gatekeepers , although a few of them have been making some attempts in this regard since 1996 . all those benefiting from health insurance coverage in france are obliged to choose their main physician ( mdecin traitant ) . as a result there will be higher user charges if a person chooses to consult a specialist directly without being referred by her / his gate - keeping the basket of reimbursable outpatient curative services is defined by a positive list which is also used as a fee - schedule for health professionals in private practice . until march 2005 this will be replaced by the new ccam classification . in a rather lengthy process ccam specifies only technical procedures such as diagnosis , surgery , and radiology performed by specialists and dentists . ccam is also being used in public hospitals to charge for outpatient care and to specify the reimbursement rate . this classification is not yet used for specialist consultations or procedures carried out by other healthcare professionals who are still in use of the ngap . the ccam is fully comprehensive in content as it contains details of all medical procedures , even those that are not reimbursable . each procedure corresponds to only one label and one code , eliminating any ambiguity and making it easy to use . there are 17 chapters which are based on the organ system to which the procedures refer . the ccam is based on the rule of procedural totality , meaning that each label implicitly contains all the operations necessary for the performance of the medical procedure . it was drawn up as a resource - based relative value scale ( rbrvs ) by the main health insurance fund ( cnamts ) with the collaboration of health professionals , and the anaes being involved in the selection of effective procedures . since the reform of 13 august 2004 the uncam , which includes representatives of the three main sickness funds , is in charge of preparing and updating the positive lists . uncam will be assisted in its decision making by the advice of the two newly created bodies , the high health authority ( haute autorit de sant ) , which replaced the anaes and the national union of complementary health insurance organizations ( union nationale des organismes dassurance maladie complmentaire , unoc ) . the same criteria used for the ngap will be used for the taxonomy of medical procedures leaving room for improvements in medical services and achieving cost - containment at the same time . nevertheless , the ministries of health and social security retain the right to reject uncam s decisions and to include or exclude goods and services in or from the list , especially if public health issues are concerned . a commission comprising healthcare professionals unions and representatives of uncam has been created to determine the general rules for drawing up the rbrvs and then for validating the scale proposed by the health insurance fund services . in addition , uncam is responsible for negotiating the tariffs of medical procedures with healthcare professionals unions and for determining the levels of copayment and coinsurance . other outpatient services such as auxiliary services provided by nurses , physiotherapists , orthoptists , speech therapists and chiropodists must be provided on medical prescription in order to be reimbursed . in the area of complementary and alternative medicine ( cam ) special recognition these two therapies are thus recognized and may be legally practiced , but only by physicians or licensed physiotherapists on medical prescriptions for acupuncture . a few osteopathy and chiropractic procedures have recently been included in the ccam in addition to certain vertebral manipulations which were already listed in the ngap . the range of services covered by statutory health insurance does not include cosmetic surgery and some other treatments and services of uncertain effectiveness such as spa treatments . the issue of the allocation of scarce resources means that choices must be made which may result in the nonreimbursement of certain procedures , for example , bone density measurement when performed in the private sector as a preventive measure , and the imposition of limits on the frequency for which they can be reimbursed , such as mammography for cancer screening purposes . the entitlements laid down in the ssc include services provided by independent physicians ( home visits ) and by other health professionals such as nurses and hospital - at - home services . regarding palliative care at home , according to article r 162 - 1 - 10 of the ssc , a multidisciplinary team of health professionals can be organized at the special request of a person whose state of health demands it , to provide palliative home care . the remuneration can be paid on a fee - for - service basis or as a lump sum . this study faces a number of limitations which may affect the analysis of the french health benefit basket . firstly , the study was carried out in a period of changes related to the redefinition of the medical procedures for both inpatient and outpatient care . furthermore , the introduction of the new ccam catalogue has been postponed several times due to conflicts of interest between health professionals , especially those between the physicians unions and the health insurance funds . the catalogue deals with the two issues of the remuneration of healthcare professionals and the state regulation . secondly , the recent health insurance reform ( health insurance act , 13 august 2004 ) affects all actors involved in the definition of the benefit catalogue and thus the decision criteria . the high health authority , for instance , is expected to have considerable powers . at the same time , uncam is also playing an important role in the drawing up of the positive lists of procedures . however , the ministers of health and social security still retain their right to reject the uncam s decisions . it could be asked whether the change regarding the delegation of the task of drawing up benefit catalogues to a so - called self - governing body is fully effective , as this is the case in germany . it is too early to assess the consequences that these new regulations will bring about , but it can be anticipated that it might well be a case of plus a change , plus cest la mme chose , as both the french government and the physicians have always played a major role in the healthcare decision - making process . thirdly , the french system offers a mix of explicit regulation for ambulatory care , pharmaceuticals and medical devices , dental care , etc . , with benefit catalogues and positive lists and of implicit regulation for a large part of inpatient care . altogether the package of health care services covered is comprehensive and wide - ranging although that the additional billing is rather high for certain types of goods and services . as a consequence of the implicitness of the coverage with particular respect to inpatient care , we have noted some differences between principles and practice , indicating that not all services are actually covered to the same extent . finally , the drawing - up of the positive lists still remains hotly contested among those at the health and social security ministries who were interviewed for this study . current french health policy combines the harmonization of regulation with the reduction in health inequalities on the basis of improved knowledge of public health needs . however , this policy is being implemented in a context of increasing health expenditure and especially of increasing user charges . it is a contradictory situation in which things that have been received by the one hand have again been taken away by the other one . | the french health benefit basket is defined principally by positive lists of reimbursed goods and services ; however , global budget - financed hospital - delivered services are more implicitly defined .
the range of reimbursable curative care services is defined by two coexisting positive lists / fee schedules : the classification commune des actes mdicaux ( ccam ) and the nomenclature gnrale des actes professionnels ( ngap ) .
the national union of health insurance funds has been updating these positive lists since august 2004 , with the main criterion for inclusion being the proposed procedure s effectiveness .
this is assessed by the newly created high health authority ( replacing the former anaes ) .
in addition , complementary health insurers are consulted in the inclusion process due to their important role in french healthcare financing . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
buerger 's disease is characterized by peripheral ischemia of an inflammatory nature with a self - limiting course . shionoya 's criteria for the diagnosis of buerger 's disease are ( 1 ) smoking history ; ( 2 ) onset before age 50 ; ( 3 ) infrapopliteal arterial occlusion ; ( 4 ) either upper limb involvement or phlebitis migrans ; ( 5 ) absence of atherosclerotic risk factors other than smoking . confident clinical diagnosis of buerger 's disease may be made only when all 5 requirements have been met . buerger 's disease is the most common cause of peripheral vascular disease ( pvd ) in india . contrary to that in western countries where it accounts for 0.5% to 12% of all peripheral vascular diseases , it constitutes 45% to 63% in india . the majority of patients present with an advanced stage of ischemia ; hence , most of them require surgical intervention in the form of either lumbar sympathectomy , omentopexy , or major or minor amputations . recent times have seen rapid development in laparoscopic procedures , so much so , that almost all intraperitoneal procedures are being done by minimally invasive techniques . however , the development of retroperitoneoscopy has been slow compared with that of transperitoneal laparoscopy . this is because of the inability to produce pneumoretroperitoneum with direct introduction of a veress needle in the retroperitoneum . introduction of balloon dissection techniques of the retroperitoneum by gaur has opened up new horizons in the field of retroperitoneoscopy . the improvement in optics and availability of better instruments now provides a bright , high - resolution magnified image so that the anatomy is more visible than in open surgery . a medline search yielded very few articles related to retroperitoneoscopic lumbar sympathectomy , and therefore the procedure is neither standardized nor widely practiced , which could partly be because of the relative rarity of buerger 's disease in the western hemisphere . because of sufficient experience gained by us in retroperitoneoscopic surgery pertaining to the kidney , ureter , and adrenal gland , our surgical team became quite familiar with anatomic dissection of the retroperitoneum ; hence , it was considered appropriate to perform and standardize the procedure of retroperitoneoscopic lumbar sympathectomy . between june 2001 and february 2002 , 8 patients presenting with symptoms and signs of advanced ischemia of the lower limb were included in the study . all patients were smokers and presented with progressive disease despite being managed conservatively . clinical profile of cases included in the study * all patients were male . all patients were male with age ranging from 27 to 42 years , with a mean age of 35.5 years . history of smoking ranged from 8 to 30 years ( mean , 16 years ) . all patients were treated previously with conservative management , but most of them did not quit smoking or stopped temporarily . clinical examination showed involvement of the distal arteries of the lower limb , with palpable femoral and popliteal arteries on both sides . a duplex doppler scan revealed normal vasculature up to the popliteal artery with complete block distally . keeping in mind the prolonged history of smoking , the typical clinical presentation , and the findings of the doppler scan , these patients were labeled as having buerger 's disease of the lower limb and angiography was not considered necessary . the patients had hemoglobin in the range of 9 g / dl to 12 g / dl . total serum proteins were in the normal range , while serum albumin was in a lower normal range . all the procedures were performed with the patient under general anesthesia with muscle relaxation and assisted ventilation . the patient was placed in a lateral position with a 15 to 20 inclination from the vertical axis towards the back ( supine position ) , and the patient was supported with sandbags and strapped across the pelvis ( figure 1 ) . the kidney bridge was elevated , and the table was separated by 20 to increase the space available between the last rib and the iliac crest . the lower leg was flexed , and the upper leg was kept extended to flatten the psoas muscle . a 15-mm incision was made just below the tip of 12th rib ( figure 2 ) . illumination of the surgical field was enhanced with the fiber - optic light cord of the laparoscope . blunt finger dissection was carried out between the posterior surface of gerota 's fascia and the psoas muscle , enough to accommodate a large balloon dissector . patient in lateral position with a 15 to 20 inclination from the vertical axis towards the back . a ready - made , kidney - shaped , trocar - mounted , silicon balloon dissector was introduced into the space created earlier . the balloon was inflated with air to the equivalent of 750 ml to 1000 ml of saline , and distention could be monitored via a laparoscope introduced through the trocar into the transparent balloon which was kept inflated for 3 to 5 minutes to achieve good hemostasis . the deflated balloon was withdrawn and peritoneum was further stripped from the transversalis fascia using a 0 laparoscope with counterpressure from the left hand . the first port was used for the laparoscope after tightening the incision around the 10-mm port by taking 2 sutures through the muscles and reinforcement with purse - string sutures through the skin to prevent gas leakage . the second 10-mm port was placed just above the iliac crest in line with the first port . the third and fourth 5-mm ports were placed anterior to the first 2 ports in such a manner that the 4 ports formed a rectangle ( figure 2 ) . the 3 secondary ports were placed with finger guidance in which the trocar was introduced over the tip of the index finger to avoid injury to any vital tissue . blunt dissection was carried out from the superior attachment of the psoas muscle to the common iliac vessels inferiorly with mixter forceps and a suction cannula to define the medial border of the psoas muscle . the lumbar sympathetic chain on the left side lies just medial to the medial border of the psoas . the chain was hooked near the l3 ganglion with a 5-mm endo - babcock ; rami were divided with cautery and a hook dissector , which released the chain ( figure 3 ) . then dissection was carried out inferiorly , the l4 ganglion lying behind the common iliac vessels was identified , and the chain was divided distal to it . the divided chain was retracted anterosuperiorly , and cephalad dissection was carried out after retracting the kidney anteriorly . although ganglia can be identified easily in laparoscopic surgery , superiorly glistening fibers of the crus of the diaphragm running obliquely act as a landmark for the l1 ganglion . the chain was divided superior to the l1 ganglion , and the l1 to l4 ganglions along with the intervening chain were removed for unilateral sympathectomy . photograph ( a ) and schematic representation ( b ) of sympathetic chain held with endo - babcock forceps . on the right side , lumbar veins were ligated with 3 - 0 vicryl on the vena caval side and clipped on the lateral side . the vena cava was exposed on the lateral side only and kept attached to the peritoneum on the anterior and medial side . peritoneum was retracted medially along with the vena cava , and the lumbar chain was exposed . the study included 8 male patients , aged 27 to 42 years , with a mean age of 35.5 years . two patients had right - sided disease , and 6 patients had left - sided disease . the indications for lumbar sympathectomy were resting pain in 4 patients , nonhealing ulcer in 2 patients , and digital gangrene in 2 patients . the operating time for the first case was 72 minutes and steadily decreased with mean time for all the cases being 38 minutes . the postoperative stay ranged from 1 to 3 days with an average in - hospital stay of 1.5 days . all patients were satisfied with the small incisions , minimal postoperative pain , and fast recovery . no significant complications were seen in any patients . though the wound was closed in all patients without a drain , no hematoma or seroma was encountered postoperatively . all patients made a fast recovery and returned to work between 1 to 2 weeks after surgery . postoperatively , immediate improvement occurred in skin warmth on palpation in all the patients , though no objective assessment of skin temperature was made . the 4 patients with resting pain reported marked improvement in pain with a complete disappearance of pain at the end of 1 week . the nonhealing ulcers of the other 2 patients healed spontaneously in the next 3 weeks . two patients , who presented with digital gangrene , had amputation of the toes at the metatarso - phalangeal joints . one of them had amputation of the big toe , whereas the other had amputation of the first 2 toes . the amputated stumps healed uneventfully . follow - up of all the 8 patients has ranged from 12 to 19 months . no recurrence of disease in any patient has been noted ; and so far , none has required a major amputation . though laparoscopy is a familiar procedure , it makes sense that a retroperitoneal organ should be approached by the retroperitoneal route only . however , a few basic problems to be dealt with while performing retroperitoneoscopic surgery are the limited working space , the absence of landmarks , and prevention of peritoneal penetration . placement of a large balloon after making a space over the psoas muscle with the finger and inflating it with 750 ml to 1000 ml of medium provided adequate working space . the balloon can be inflated either with air or saline . relative advantages and disadvantages of either medium have not been proven so far ; hence , it is a matter of personal choice . however , overdistension of the balloon should be avoided because it may have a potential adverse hemodynamic effect and may tear the peritoneum . some authors prefer retroperitoneal dissection without a balloon using only the index finger , which provides adequate space and decreases operating time by 10 to 15 minutes required for balloon dissection . leakage of gas into the parities leading to subcutaneous emphysema could be a cumbersome problem , which can be avoided by tightening the muscles around the port , which is subsequently reinforced by applying a purse - string suture in the skin . cincinnati , oh ) particularly useful for retroperitoneal procedures , which have a conical sleeve with a flange around the port , which snugly fits into the incision thereby preventing separation of muscles and consequent leakage of gas into the parities . to ensure safe placement of secondary ports under endoscopic guidance , it is essential that the entry of the port be monitored under direct vision with a laparo - scope . this is not easy in a constrained retroperitoneal space , which requires placement of ports closer to each other and also because of the fact that the adjacent undersurface of the flank abdominal wall can not be adequately visualized endoscopically despite placing considerable torque on the laparoscope . to overcome this problem , we prefer to place the secondary ports with finger guidance , with a trocar in 1 hand and the index finger of the opposite hand placed in the retroperitoneum acting as a guard . all 3 secondary ports were placed under finger guidance before creating pneumoretroperitoneum . in our study , this could be because after balloon dissection , peritoneum was further stripped off the parities by using blunt dissection with a 0 telescope and counterpressure with the opposite hand . due to the absence of landmarks , orientation is also a major problem in retroperitoneoscopy , which can be improved if the camera assistant stands on the same side as the surgeon . , one should clearly define the medial border of the psoas muscle and follow it up superiorly up to the crus of the diaphragm and inferiorly up to the iliac vessels . the ureter is invariably swept forward with peritoneum , but if visible also acts as a landmark . in left - sided lumbar sympathectomy , the aorta can be a major landmark ; however , we feel exposure of the aorta should be avoided , as it necessitates exposure of paraaortic lymph nodes , which often have vascular adhesions around them due to recurrent foot infections , and these adhesions often lead to cumbersome ooze . for right - sided lumbar sympathectomy , the inferior vena cava is meticulously dissected , and only its lateral side is exposed . anterior and medial sides of inferior vena cava are kept attached to the peritoneum , so that after creation of pneumoretroperitoneum and retraction of peritoneum , the inferior vena cava is easily retracted to the desired position . we prefer to start dissection of the lumbar chain at the level of the l3 ganglion as it lies in line with the dissecting port . subsequently , the chain is dissected downwards to the l4 ganglion , and retraction of the divided chain antero - superiorly helps in further dissection of the rest of the ganglia and chain . although the magnified view provided by the laparoscope gives an excellent display of ganglia and rami , iliac vessels inferiorly and oblique running shiny glistening fibers of crus of the diaphragm act as important landmarks for l4 and l1 ganglia , respectively . because the patients in our study belonged to the low socioeconomic strata , they had practically no fat in the retroperitoneum , making stripping of peritoneum a bit difficult in a few cases . also , because of walking barefoot and recurrent foot and lower limb infections , they occasionally had fibrous adhesions , which had to be sharply divided while stripping the peritoneum . for the same reasons , the lymph node chain was also enlarged , but it never posed a technical difficulty during dissection of the chain . because the lumbar sympathetic chain lies lateral to the para - aortic and para - caval lymph node chain , the dissection should not be carried over the lymph nodes ; otherwise , cumbersome ooze is likely to ensue . the ureter never needed to be stripped separately because it was retracted while stripping the peritoneum . though we operated on a small series of 8 cases only , experience gained by us in other retroperitoneoscopic procedures was very valuable . the mean operating time in our study was significantly less than that of other studies with an average operating time of 38 minutes . despite limited experience , postoperative pain at the operation site was negligible and so was the need for analgesia . the patients were discharged within 1 to 2 days and returned to work after 1 week . our patients were from a low socioeconomic strata ; therefore , the quick return to work was a clear advantage over the longer recuperation time required after open surgery . follow - up of the patients ranging from 12 to 19 months has not revealed recurrence of the disease , which proves the efficacy of retroperitoneoscopy as an alternative to conventional procedures . despite limited experience with this procedure , retroperitoneoscopic lumbar sympathectomy is a safe and effective procedure for patients with advanced buerger 's disease requiring lumbar sympathectomy . | background : the conventional lumbar sympathectomy procedure through the extraperitoneal route requires a muscle cutting - splitting incision , which leads to significant postoperative pain and prolonged convalescence . with increasing experience in retroperitoneoscopic procedures , we did a pilot study to explore the role of retroperitoneoscopy in lumbar sympathectomy .
we describe herein our technique used for the surgery.methods:the patient was placed in a lateral position .
a 15-mm incision was made just below the 12th rib , and retroperitoneal space was created using blunt finger dissection . a custom - made
, large balloon was inserted and inflated with the equivalent of 750 ml to 1000 ml of saline .
the second 10-mm port was placed in line with the first port above the iliac crest .
the third and fourth 5-mm ports were placed anterior to the first 2 ports .
peritoneum was retracted anteriorly .
the medial border of the psoas muscle was used as a landmark and a chain identified immediately medial to it .
lumbar vessels were ligated on the right side .
the first to fourth lumbar sympathetic ganglia were removed with the intervening chain .
the port sites were closed without a drain.results:we attempted and successfully completed this procedure in 8 patients ; 6 on the left side and 2 on the right side .
the average operating time was 38 minutes .
the mean hospital stay was 1.5 days .
all patients had symptomatic pain relief and clinical improvement.conclusions:retroperitoneoscopic lumbar sympathectomy is a safe and effective procedure .
it has a short convalescent time and minimal morbidity ; hence , it is a viable alternative for the open procedure . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mountain ginseng pharmacopuncture ( mgp ) is the first intravenous injection pharmacopuncture using an extract distilled from mountain cultivated ginseng or mountain wild ginseng in korean traditional medicine . mountain wild ginseng refers to ginseng ( panax ginseng c. a. meyer ) of the araliaceae family that is naturally grown in the mountain . based on the growth environment and the cultivation , commercial ginseng can be classified into three grades ; cultivated ginseng , mountain cultivated wild ginseng and mountain wild ginseng . cultivated ginseng is grown artificially on farms and account for the major quantity of ginseng in the current market . mountain wild ginseng is slower in growth and more sensitive to environmental changes than cultivated ginseng , showing a preference for are - as with fluctuating daily temperatures and less exposure to direct sunlight . these differences may result in a variation of the active compounds between cultivated ginseng and mountain wild ginseng . mountain cultivated wild ginseng can be considered as mimicry mountain wild ginseng ; it is seeded and grown in forests and mountains . it is widely accepted in both korea and china that mountain wild ginseng produces more potent medicinal activity than mountain cultivated wild ginseng or cultivated ginseng . however , only a few studies have been conducted to compare the food components and the pharmacological activities between mountain wild ginseng and both cultivated and mountain cultivated ginseng [ 3 , 4 ] . because authenticity tests of mountain wild ginseng are very difficult and confusing , scientific criteria of authenticity are needed . thus , an objective diagnostic method that used gene analysis to identify mountain ginseng ( mg ) was developed . comparing gene activation between numerous mg samples and regular ginseng , genes only existing in mg , such as p - nrt2 , p - rpoc1 , p - psbb , and p - gapdh , were found [ 3 - 6 ] . because of the high - cost and authenticity issues associated with mountain wild ginseng , mountain cultivated ginseng which is similar to mountain wild ginseng according to the gene analysis , is used for pharmacopuncture . although continuous clinical studies have been performed to obtain more objective data on the efficacies of mgp , safety tests are still necessary . the aims of this study were to evaluate the safety of mgp , and to conduct single- dose toxicity tests of mgp . 18 sprague - dawley ( sd ) rats of each gender were obtained from a specific pathogen - free facility ( biotoxtech , oh chang , korea ) at 5 weeks of age and were used after a week of quarantine and acclimatization . the animals were housed in a room maintained at 19.0 23.2 under a relative humidity of 33.0% 59.5% . the room was illuminated with artificial lighting for 07:00 to 19:00 hours and had 10 15 air changes per hour . three animals were housed in suspended stainless - steel wire - mesh cages and were allowed sterilized tap water and commercial rodent chow ( teklad certified irradiated global 18% protein rodent diet 2918c , harlan laboratories , inc . this study protocol was approved by the institutional animal care of biotoxtech co. ( oh chang , korea ) . the process for the manufacturing mgp was performed in a pathogen - free facility ( korean pharmacopuncture institute , seoul , korea ) , as described previously . mg of over 10 years which was cultivated from the seeds of mountain wild ginseng , was selected for the mgp . first , we washed mg with running water and dried it in the air - conditioned room . second , dried mg was powdered in to fine particles ( size are below 10 ) and decocted for 2 hours in distilled water . remnants were then removed , and the decoction was distilled before yielding the desired herbal acupuncture . then the pharmacopuncture was filtered using 0.1 filter paper and was then kept in the container . finally , the pharmacopuncture was sterilized before being used . healthy male and female rats , 5 of each sex were selected and assigned to 1 of 3 groups : control group ( normal saline ) , low - dose group ( 10 mg / kg ) , and high - dose group ( 20 mg / kg ) . all animals were observed for clinical signs at 30 minutes , 1 hour and 2 hours after the first injection and at 30 minutes , 1 hour , 2 hours , 4 hours and 6 hours after the second injection . clinical signs were observed daily from the injection day to 14 day after the first injection . the body weight of each rat was measured at the initiation of treatment , and at 3 days , 7 days and 14 days after the injection . the scheduled day of study termination , all surviving animals were anesthetized by co2 inhalation . tissues were obtained from the following organs of all surviving animals and fixed with 10% neutral buffered formalin solution : brain , heart , liver , spleen , kidney , lung , spinal nerves . data on body weights were tested by using sas ( version 9.2 , sas institute inc , usa ) . if the variance was homogeneous , the data were subjected to one - way analysis of variance ( anova ) . if significant changes were observed on the one - way anova , the data were analyzed by using the multiple comparison procedure of dunnett s test ( p < 0.05 , p < 0.01 ) . no treatment - related mortalities occurred in sd rats treated with any dose of the mgp . also , no clinical signs were observed in the male and the female sd rats of the experimental groups during the observation period . hematuria was observed in 1 of the rats of control groups , but it was not caused by mpg . no significant changes in weight were observed in the experimental groups compared to the control group ( fig 1 , 2 ) . no abnormal macroscopic appearances were observed on necropsy in either the control or the experimental groups . all experimental groups showed no abnormal signs caused by intravenous injection of mgp . in the control and the high - dosage groups , some changes were observed in the kidney , lung , liver and spleen , but those changes seemed to have occurred naturally or accidentally ( fig 3 - 6 ) . mgp is administered intravenously , and intravenous injection is enlisted as a legal manipulation in korean classification procedures in medicine and resource . for this reason , intravenous injection of mgp has been studied . in a randomized controlled trial of mgp , no significant changes in blood pressure , hematology , biochemistry and urine analysis were reported . however , immune protein , which acts against microbes and pathogenic organisms , vitamin d binding protein , which protects the lung at the time of inflammatory response , ras - related protein ral - a , which controls phospholipid metabolism , cytoskeletal formation , and membrane traffic , and transferrin which balances the iron level in the body were reported to be increased significantly , after the administration of mgp , but antitrypsin , which is secreted with inflammatory responses in the lungs , were reduced [ 13 , 14 ] . also no effects on heart rate variability and pulse - wave factors were revealed in middle - aged women . there are many types of flavonoid compounds , such as quercetin , hesperidin and anthocyacanidins in mgp , and these constituents were reported to have actions that improved liver functions [ 17 , 18 ] , and that produced anti - oxidant [ 19 - 23 ] , anti - cancer [ 7 , 24 - 30 ] , anti - hypertensive , anti - diabetic , anti - obesity and anti - depressant effects . thus , mgp has been used to treat progressive disorders such as cancer [ 35 - 40 ] and amyotropic lateral sclerosis . the present study was conducted to evaluate the safety of mgp , and the results of this study showed no mortalities and no significant changes in sd rats caused by intravenous injection of mgp . these results correspond with those of an earlier study which reported that mgp caused negligible toxicity . although the safety of mgp has been demonstrated through a single - dose toxicity test , still further study , like a 4-week repeated toxicity test , is needed . based on the results of this study , we can conclude with certainly that the lethal dose of mgp is higher than 20 ml / kg in sd rats and that intravenous injection of mgp in sd rats is a safe treatment considering that the usual clinical dose of mgp is about 0.3 ml / kg . the field of traditional korean medicine ( tkm ) has a long waited technology that uses the vessel as a treatment medium , as the vessel provides the quickest path of drug ab - sorption . a limitation on treating patients is the difficulty of oral administration of medicines , but pharmacopuncture , especially mgp has opened the door for immediate treatment benefits . as the result of this study , we can conclude with certainly that intravenous injection of mgp is safe . | objectives : mountain ginseng pharmacopuncture ( mgp ) is an extract distilled from either mountain cultivated ginseng or mountain wild ginseng .
this is the first intravenous injection of pharmacopuncture in korea .
the word intravenous does not discriminate between arteries , veins , and capillaries in oriental medicine , but only the vein is used for mgp .
the aim of this study is to evaluate the intravenous injection toxicity of mgp through a single - dose test in sprague - dawley ( sd ) rats.methods:male and female 6-week - old sd rats were injected intravenously with mgp ( high dosage of 20 ml / kg or low dosage of 10 ml / kg ) .
normal saline was injected into the rats in the control group by using the same method .
after the rats has treated , we conducted clinical observations , body - weight measurements and histological observations.results:in this study , no mortalities were observed in any of the experimental groups . also , no significant changes by the intravenous injection of mgp were observed in the body weights , or the histological observations in any of the experimental groups compared to the control group .
the lethal dose for intravenous injection of mgp was found to be over 20 ml / kg in sd rats.conclusion:considering that the dosage of mgp generally used each time in clinical practice is about 0.3 ml / kg , we concluded with confidence that mgp is safe pharmacopuncture . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in real world tasks decision - making and working memory often occur in the context of other complex behaviors , including spatial navigation . for example , when driving through a city towards a destination , sensory information defining context and place engages memory and decision circuits to plan turns at upcoming intersections . the posterior parietal cortex ( ppc ) is a prime candidate for the neuronal circuitry combining the cognitive processing elements necessary for such tasks . in primates the ppc is important for perceptual decision - making and categorization , movement planning , and spatial attention . studies in rats suggest that the ppc is also important for encoding route progression during navigation . using a virtual reality system for mice and cellular resolution optical imaging methods , we developed a t - maze - based navigation paradigm combining all these cognitive elements and characterized the neuronal circuit dynamics in the ppc , which have not been studied in this combined behavioral context . neuronal activity patterns in the ppc have been studied using microelectrode recordings during spatial attention , working memory , and perceptual decision tasks . these studies have commonly found cells with sustained firing rate changes spanning entire task periods ( cue , delay , response periods ) . for example , cells with persistent activity throughout the delay period of memory - guided saccade / reach tasks have frequently been recorded . also , studies have identified neurons with ramps of increasing firing rate spanning the accumulation of evidence period in a motion perception task . neurons with sustained activity during the same task period often have similar activity time courses , suggesting the presence of classes of cells ( e.g. delay cells ) and implying that the task - dependent neuronal dynamics are low - dimensional . the low - dimensional dynamics can be reproduced in recurrent attractor network models , in which each cell s activity is typically an amplitude - scaled version of a prototypical time series . in contrast , recent analysis of prefrontal cortex activity has identified heterogeneous neuronal activity time courses , in which a neuron s activity can be thought of as the sum of a few activity modes . in addition , there is growing evidence for sequences of neuronal activation within local circuits , in which each neuron is active for only a fraction of a task period , including during working memory tasks in the prefrontal cortex and the hippocampus and during an object construction task in the ppc . sequences suggest dynamics that are high - dimensional , without the presence of classes of cells with relatively homogeneous activity time courses . we explored whether ppc dynamics are best described in terms of cell classes or high - dimensional dynamics . during a navigation - based decision task the dynamics were high - dimensional : neurons were active in choice - specific sequences in which information moves from one neuronal population to another across time in the task ; although the neuronal activity patterns could be divided into cue , delay , and response groups , sequences were present within each group . furthermore , exploiting the ability of cellular resolution optical measurements to provide the relative anatomical location of the recorded cells , we found that neurons active during behaviorally - distinct task periods and on trials with different behavioral choices were spatially intermixed over microcircuit length scales . using a virtual reality system , we trained mice to navigate through a virtual t - maze in a task that incorporated both visual discrimination and a memory - guided response ( methods ; fig . visual cues present in the initial section of the maze indicated which direction to turn at the t - intersection to receive a water reward ( one set of cues to indicate a right turn and a second set for a left turn ; supplementary fig . 1c ) . between the cue section and the t - intersection , mice ran through a delay maze section that was identical on left and right turn trials ; visual information about the reward location was thus present only in the cue section . the task resembled traditional delay tasks in its cue - delay - response structure but differed in that ongoing sensorimotor activity was present throughout the task , including the delay period . mice performed the task with high levels of accuracy ( 83 9% correct , p < 0.0001 vs. 50% , t - test ; fig . 1b ) . within and across trials , individual mice ran at highly consistent speeds ( supplementary fig . 2 ) ; however , running speeds varied between mice and the maze position at which mice began rotating the spherical treadmill to make a right or left turn differed across trials ( turn onset ; fig . 1c , 3 ; methods ) . to compare behaviorally similar epochs of the task across trials , individual trials were aligned to the time points when the cue was no longer visible ( cue offset ) , the turn onset , and the end of the trial ; these alignment points formed the boundaries of cue ( trial start to cue offset : 5.1 2.6 s ) , delay ( cue offset to turn onset : 4.2 1.2 s ) , and turn task periods ( turn onset to trial end : 3.0 1.8 s ) . because the location of the mouse ppc has not been characterized , we first performed retrograde and anterograde labeling experiments to locate it anatomically ( methods , supplementary fig . we identified a region consistent with the rat and primate ppc based on the set of areas from where it received axonal projections , the areas to which it sent projections , and its location relative to other cortical regions ( anterior to visual cortex and posterior to somatosensory cortex ) . we therefore considered this area to be the mouse ppc . to test if the ppc was required for the behavioral task , we inactivated it using bilateral injections of the gabaa receptor agonist muscimol . muscimol reversibly decreased behavioral performance from high levels of accuracy in control sessions to near chance levels , but did not affect the rate of trials performed ( fraction correct : no injections 87 7% , saline 85 5% , muscimol 54 5% p < 0.0001 vs. no injections , t - test ; trials per minute : no injections 3.2 0.5 , muscimol 3.1 0.3 , p > 0.8 , t - test ; fig . in contrast , ppc inactivation did not significantly affect performance on a visually - guided task in which a visual cue was present at the reward site and visible throughout the trial , indicating that the decrease in performance on the memory - guided task was unlikely due to a major visual or motor deficit ( no injections : 90 5% , muscimol : 87 5% , p > 0.2 , t - test ; fig . 1e , supplementary fig . we used two - photon microscopy to image layer 2/3 ppc neurons expressing the genetically - encoded calcium indicator gcamp3 , which increases in fluorescence intensity in response to action potential firing ( methods ) . on average , we imaged ~65 cells simultaneously within a ~300 m by ~150 m area ( range : 3794 cells ) . nearly all imaged cells showed statistically significant ca transients during the behavioral session ( 96% of cells had > 0.2 transients per minute ; methods ) . of the cells with high levels of activity ( > 2 ca transients per minute on average ; supplementary fig . 5 ) , ~73% had significant increases in their mean fluorescence intensity traces ( f / f , averaged across trials ) during a specific time in the trial or inter - trial interval ( task - modulated cells ; fig . these task - modulated cells had ca transients for only short time intervals on individual trials ( 11 8% of time points in trials with a transient ) such that only a small fraction of neurons was active simultaneously ( fig . 2b e , supplementary figs . 8 , 9a ) ; cells with prolonged activity patterns covering a large fraction of the trial were not observed . the majority ( ~71% ) of task - modulated cells had significantly different levels of activity on correct right and left choice trials ( choice - specific cells ) . similar choice - specific , task - modulated activity patterns were observed in extracellular electrophysiological recordings ( supplementary figs . cells were also active on error trials , such that neurons active during the cue period tended to be correlated with the cue identity , and neurons active during the turn period in general were correlated with the behavioral response ( supplementary fig . only a small fraction of cells had obvious reward - related signals ( ~2% of active cells with p < 0.01 , t - test , comparing f / f values within ~0.6 s after the reward was given on correct trials or missed on error trials ) . when the activity patterns of all the choice - specific , task - modulated cells were ordered according to the time profile of their ca transients , the active periods across cells were staggered relative to one another in time forming a sequence of neuronal activation covering the entire trial length ( fig . 2c d , supplementary fig . different sequences of neurons were activated on left and right trials ( fig . 2c d and absence of activity in fig . although these plots of sequences combined cells from different experiments and averaged across trials , similar properties were observed when considering only the cells imaged in a single mouse and on individual trials ( fig . sequences were also apparent in the ~29% of task - modulated cells that did not have choice - specific activity ; these cells participated in the sequences for both right and left choice trials ( supplementary fig . sequences similar to those during the task were not observed in shuffled versions of the dataset , demonstrating that the sequences were not an artifact created by ordering the data ( supplementary fig . 14a because previous studies of the ppc have categorized cells into classes with cue , delay , or response period activity , we examined if neurons in the sequence were grouped based on behavioral periods . the distribution of activity times of all cells in the population ( calculated for each cell as the center - of - mass ( com ) in time of the mean f / f during the trial , tcom ) had three peaks corresponding to the cue , delay , and turn periods , suggesting a possible grouping by behavioral period ( fig . consistently , principal component analysis ( pca ) on the mean f / f traces for all cells revealed three intermixed groups , with each group mostly containing cells preferring the same behavioral period ( fig . although the population of neurons could be divided into groups , the temporal activity patterns within each individual period were heterogeneous and formed sequences ( fig . cells within their preferred period were active for only a fraction of the period ( 35 16% of time points in preferred periods with a ca transient ) with different cells active at different times . although cells with activity covering a large fraction of the period were occasionally observed ( e.g. fig . 2c top panel ) , these cells were rare ( 4% of cells with activity lasting for > 60% of the period ; supplementary fig . 9b ) ; the distribution of epoch coverage by an individual neuron s activity was similar during the delay and cue or turn periods ( p > 0.1 , ks test ) . furthermore , pearson s correlations between the non - averaged f / f traces for cell pairs with the same trial - type and behavioral period preferences varied widely , with a large fraction of pairs having low correlation coefficients ( supplementary fig . the low correlation coefficients could be due to activity at different times in the period , as expected for sequences , or activity at the same time in the trial except on different trials . however , the probability that both cells in these pairs had ca transients or both cells did not have transients on the same trial during their preferred epoch was generally high ( supplementary fig . 16b ) , suggesting that the diversity primarily resulted from differences in the activity times of cells within trials . together these data indicate that classes of cells with homogeneous activity patterns were not present . rather , choice - specific sequences of neurons were activated in all behavioral periods , with a lower density of cells in the sequence at the borders between periods . to further examine the sequential neuronal activation on individual trials , we calculated correlations between the activity patterns of cells using the non - averaged f / f time series . cells that were active at similar time points in the trial on average ( measured as the difference in tcom values on correct trials , tcom ) had , on correct trials and in their preferred behavioral periods , highly correlated f / f traces and peaks in their cross correlation at a lag approximately equal to tcom ( supplementary fig . h ) ; these relationships in the non - averaged f / f time series provide further evidence for sequential activity on individual trials . cells that were active at similar times on correct trials were also highly correlated on error trials and in non - preferred periods ( supplementary fig . 16c f ) . additionally , cells that were sequentially activated during their preferred behavioral period on correct trials were sequentially active with similar lags during error trials and other time points in the task ( supplementary fig . the choice - specific activity could result if mice experienced different visual stimuli and running patterns on right and left trials and if ppc activity was modulated by those differences . to examine this , we first performed a multiple regression analysis to determine the potential effects of the parameters defining the mouse s running trajectory on the fluorescence changes during the delay period ( supplementary table 1 ) . these parameters could not explain the choice - specific activity patterns , suggesting that any differences in running trajectories between right and left trials did not trigger the activity we observed . in addition , we performed two sets of experiments to further examine whether the maze visual stimuli alone or the mouse s running patterns triggered ppc activity . in the first experiments , movies of simulated left and right turn runs through the t - maze , which closely approximated real runs , were played to mice that passively viewed the visual scenes ( open - loop experiments ; supplementary fig . 17a mice were trained on a virtual linear track to perform a simple running back and forth task ( run to one end for a reward , turn around , run to the other end for the next reward ) . the linear track had several visual patterns on the walls , all of which were the same as patterns in portions of the t - maze ( supplementary fig . the task required similar running and turning behaviors to the t - maze , except that turns were not memory - guided based on visual cues and a delay period and there was not a two - alternative forced - choice structure . the overall levels of activity during the simulated t - maze runs or during the linear track task were much lower than when mice actively performed the t - maze task ( supplementary figs . 17c d , 18c d ) . also , only a small fraction of neurons had significant increases in activity at specific locations in the maze , either during the simulated t - maze runs or in the linear track , suggesting that cells were not activated robustly by location - specific visual scenes or running patterns ( simulated runs : 1.3% , linear track : 5.8% , t - maze : 32.3% ; supplementary figs . these results suggest that ppc neurons in the t - maze were not activated only by the visual information or by the running patterns of the mouse . the heterogeneous and sequential neuronal activity patterns during the t - maze task indicated that we should consider the dynamics of the population rather than classes of cells . we therefore analyzed the dynamics as a trajectory through a state space of neuronal population activity ( neuronal circuit trajectory ) . at each time point , the activity state of the circuit containing n simultaneously imaged neurons was defined as a point in an n - dimensional space , with each dimension representing the activity ( f / f values ) of a single neuron . different trajectories ( visualized using factor analysis for dimensionality reduction ) were traversed for trials with different behavioral choices ( fig . the trajectories for correct right and left choice trials began the trial at similar positions , gradually diverged to reach a peak separation near the time of the behavioral choice , and converged to the starting point in the inter - trial interval ( fig . , we used a classifier based on the distance from an individual trial trajectory to the mean right and left choice trajectories at single time points . it was possible , from the activity of a small population of neurons located in close anatomical proximity ( ~65 neurons separated by < 250 m ) , to predict the mouse s choice on single correct trials at better than chance levels during the cue , delay , and turn periods ( methods ; fig . 4e , supplementary fig . the activity in the ppc can therefore be considered as divergent , choice - specific trajectories through a state space of neuronal population activity . some trajectories began close to the correct choice trajectory during the cue period and transitioned toward the error choice trajectory later in the trial ; such transitions occurred at a wide range of points in the trial ( gray traces in fig . 4f , supplementary fig . the error trial trajectories were more similar to the correct choice trajectory during the cue period and closer to the error choice trajectory during the turn period ( cue offset : trajectory selectivity index = 0.13 0.22 , p < 0.001 vs. 0 , t - test ; trial end : trajectory selectivity index = 0.18 0.15 , p < 0.001 vs. 0 ; fig . therefore , individual trajectories transitioned between the mean correct right and left choice trajectories at many time points during trials , but most frequently switched during the delay period . to determine how the cells implementing the activity dynamics were anatomically organized , we first examined if cells with different response preferences , such as activity peaks at different times in the trial or different preferences for right and left choice trials , were present in the same regions of the ppc or separated into different areas . each ~250 m by ~125 m area ( i.e. field - of - view with simultaneously imaged cells ) contained both right and left choice - preferring cells of approximately equal numbers and cells with activity peaks at a wide range of times in the trial ( fig . next , within each imaged area we compared the activities of pairs of neurons as a function of the distance between the neurons cell bodies . the difference in the trial - type selectivity for cells in a pair did not depend significantly on the distance between cells , indicating that left and right choice - preferring cells were intermixed ( = 0.04 , spearman s correlation , p > 0.05 ; fig . tcom for a cell pair did not differ with the distance between the cells , indicating that cells active during different periods of the task were intermingled ( = 0.01 , p > 0.6 ; fig . however , cells that were separated by less anatomical distance had f / f traces that were significantly more correlated than cell pairs further apart , but the relationship between the correlation coefficient and distance was weak ( all pairs of active cells : = 0.16 , p < 0.001 ; pairs with the same trial - type and behavioral period preference : = 0.22 , p < 0.001 fig . this weak relationship could be due to overlapping fluorescence changes , such as from dendritic signals , or could reflect an actual , weak spatial organization . regardless , cells with highly different activity patterns were intermixed over short length scales , and an anatomical separation of the response properties we measured was not present . the choice - specific sequences of ppc neuronal activation we report here add to the growing list of studies that have identified cortical sequences of activity states during working memory tasks . furthermore , because we demonstrated that ppc activity was necessary only for the memory - guided task , the sequences of activation were likely important at least for the memory aspect of the task . sequence - based dynamics may therefore be a common framework for circuit function during memory and decision tasks , including during navigation behaviors . such dynamics could potentially be implemented using feedforward architectures or liquid state machines related to those that have been proposed for working memory . our results also offer a way to unite previous work on neural coding in the ppc . navigation , memory , and choice information may be combined in the sequences such that the identity of the active sequence reflects choice - related information for working memory and movement planning and the currently active cell within the sequence reflects spatial or temporal progression through the task , which were highly correlated in our task ( supplementary fig . it seems unlikely that ppc neurons only provided location information in a context - dependent manner , like hippocampal place cells , because unlike place cells ppc neurons did not encode spatial location during a linear track task ( supplementary fig . a possible explanation for heterogeneity and sequences in our experiments versus stereotypy and low - dimensional dynamics , which have been emphasized in previous recordings and models of ppc activity , is that the ppc adopts different dynamics depending on the demands of the behavioral task . because traditional delayed saccade tasks , for example , have one spatiotemporal component during the delay period ( fixation before making a response ) , the ppc may adopt sustained activity patterns . in contrast , during tasks that involve many spatial and temporal components , as are common in natural behaviors and during navigation , the ppc may utilize sequences of activation . alternatively , sequences of activity may be present in the primate ppc during traditional tasks but have yet to be identified , consistent with emerging evidence for heterogeneous temporal response properties . in addition , different regions or layers of the ppc may have differing activity dynamics , or the dynamics of rodent and primate ppc circuits may differ . because cells that were active at distinct time points in the task and that participated in different choice - specific sequences were spatially intermingled , this extends previous work in sensory cortex , motor cortex , and the hippocampus showing spatial intermixing of heterogeneous response properties in cells encoding qualitatively similar types of information ( e.g. orientation selectivity in visual cortex ) or cells with activity during similar task epochs . these findings differ from the predictions of models that have emphasized the spatial clustering of similar response patterns , as in functional columns , and that propose connectivity defined by axonal - dendritic overlap without fine - scale specificity . rather , our results support a model in which microcircuits are formed by highly specific synaptic connectivity and are comprised of neuronal motifs , such as those identified in brain slice recordings in sensory cortices and amongst visual cortical neurons with the same orientation selectivity . our results showing that cell pairs that were sequentially active during their preferred periods on correct trials had similar activity relationships even during error trials and the inter - trial interval suggest the presence of such motifs ( supplementary fig . we note however that activity trajectories occasionally switched during a trial between the prototypical correct left and right choice trajectories , including frequently on error trials , suggesting that the mouse s decision was not necessarily irreversibly reached immediately after a trial s start ( trajectory selectivity switch during the delay period or last 1 s of the cue period : 63% of error trials , 20% of correct trials ; fig . sequences may therefore play a role in some aspect of decision - related processes , but further experiments will be necessary to assess this possibility . our results motivate consideration of a conceptual framework for decision - making and working memory in which sensory information used for the decision activates a neuronal sequence of activity . the sequence begins in a choice - independent state , which could be mediated by neurons that are not choice - specific ( supplementary fig . 7b ) , and then moves toward a choice - specific trajectory and away from other trajectories in a manner dependent on the incoming information . a decision is proposed to be reached when the sequence of activity intersects a choice - specific trajectory ; different decisions involve intersections with different trajectories . upon reaching a decision , changing decisions would occur through transitions between trajectories , but as time progresses in the task , the state space distance between trajectories increases , in effect creating a larger barrier to change . in this view , decision - making and working memory utilize an ordered progression through a sequence in which information moves from one population of neurons to another over time . the framework we propose is an extension of a point - of - view first considered in describing the dynamics underlying behavioral choices in the leech nervous system . it has both some similarities and differences from drift / diffusion - to - bound , race , and recurrent network models of decision - making implemented as neuronal integrator winner - take - all circuits . these models are similar to the trajectory - based view in that different decisions correspond to a divergence in state space surrounding a separatrix . however , these models differ from the sequence framework in that decisions are reached when the activity approaches a choice - specific fixed point with working memory maintained as stable activity at that point . thus , although these circuits can demonstrate divergent trajectories to reach the fixed points associated with different choices , the trajectories are defined by relatively homogeneous changes in the activity of the population , and the same set of neurons participate in all stages of the decision - making and working memory process . a complete description of the experimental methods and data analysis is available in the supplementary information . | the posterior parietal cortex ( ppc ) plays an important role in many cognitive behaviors ; however , the neural circuit dynamics underlying ppc function are not well understood .
here we optically imaged the spatial and temporal activity patterns of neuronal populations in mice performing a ppc - dependent task that combined a perceptual decision and memory - guided navigation in a virtual environment .
individual neurons had transient activation staggered relative to one another in time , forming a sequence of neuronal activation spanning the entire length of a task trial .
distinct sequences of neurons were triggered on trials with opposite behavioral choices and defined divergent , choice - specific trajectories through a state space of neuronal population activity .
cells participating in the different sequences and at distinct time points in the task were anatomically intermixed over microcircuit length scales ( < 100 micrometers ) . during working memory decision tasks
the ppc may therefore perform computations through sequence - based circuit dynamics , rather than long - lived stable states , implemented using anatomically intermingled microcircuits . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
when molecules bind in solution via noncovalent
forces or proteins
shift between conformational states , the associated changes in entropy
can be substantial and are typically commensurate with the corresponding
changes in enthalpy and free energy . as a consequence , the changes
in entropy are important determinants of the equilibrium constants
for such changes in state . the change in overall entropy can itself
be expressed as the sum of two parts : the change
in the solvation entropy , averaged over the conformational distribution
of the solute(s ) , and the change in the configurational entropy , which
is associated with the conformational fluctuations of the solute(s ) . the configurational entropy depends on the overall shape and width
of the joint probability density function ( pdf ) over the solute s
internal coordinates . prior studies indicate that changes in not only
the solvent entropy but also the configurational entropy can be substantial . for example , both nmr and computational studies point to large changes
in configurational entropy when proteins bind other molecules . the configurational entropy depends on the pdf of individual
conformational
variables , such as bond torsions , that is , on their first - order marginal
pdfs ; but it also depends on the correlations among these variables .
in particular , one may write the full entropy as the sum of the first - order
entropy and an additional term due to correlation : sfull = s1 + sfullcorr . intuitively ,
greater correlation implies lower entropy because correlation implies
less freedom to explore configurational space for a given set of marginal
distributions . however , it is not yet clear whether there are any
physical patterns or rules as to what types of molecular processes
lead to net increases versus decreases in correlation entropy or how
large the contributions from correlation are likely to be . correlation
entropy is of particular interest in relation to changes in nmr order
parameters , such as when proteins change conformations or bind other
molecules . these changes are often interpreted , at least semiquantitatively ,
in terms of changes in configurational entropy . however , such nmr data are not directly informative about changes
in correlation . as a consequence , it is of interest to consider the
nature of correlation contributions to the entropy changes of interest . the identification and characterization of correlated motion is also
of broader interest , as correlations may be indicative of mechanistic
couplings important in phenomena such as binding and allostery , and knowledge of the nature and range of correlations in proteins
would contribute insight into the basic mechanisms of protein motions
and function . the role of correlations as determinants of changes
in configurational
entropy has been the topic of a number of insightful contributions . it has been proposed , based on empirical relationships among measured
nmr order parameters and binding entropies , that changes in correlation
entropy on binding vary linearly with changes in measures of the entropy
that neglect correlation . encouraging results have been obtained for relative binding entropies ,
s , among variants ( e.g. , mutants ) of
a given protein protein system , and it will be interesting
to learn how well such approaches work for the absolute another notable contribution provides evidence , based on extensive
molecular dynamics ( md ) simulations , that inter - residue side - chain
correlations lower the absolute configurational entropy by about 1020% of the first - order rotameric entropy . however ,
it is still of interest to probe the potential contributions from
correlations involving main - chain torsions , and , again , to examine
large - scale changes like binding and conformational shifts . another
contribution has argued , based on molecular simulation data , that
changes in correlations do not contribute significantly to the entropy
changes associated with biomolecular functions and thus proposed that entropic interpretations of nmr
order parameters may safely neglect any contributions from changes
in correlation ; and a prior study of calmodulin , using quasi - harmonic analysis , reached a similar conclusion . the role of torsional correlations as determinants of binding entropy
has also been addressed through application of the mutual information
expansion ( mie ) to multiple long md simulations
of a protein peptide system . interestingly ,
this analysis reported large entropic contributions from changes in
pairwise torsion torsion correlations , including correlations
involving main - chain torsions and the six degrees of freedom ( dof )
specifying the location of the peptide relative to the protein . these
results would suggest that changes in torsional correlations , including
those of the main chain , can not be safely neglected . however , although
this study provided a reasonably clear accounting of the strongest
pairwise correlations in a large protein system , there were numerical
problems for the many weak pairwise correlations . in addition , the
simulations lacked the power to estimate third - order and higher correlation
terms , which are also of interest . in summary , despite significant
prior work , there are still important , unanswered questions regarding
the role of torsional correlations as determinants of changes in configurational
entropy . today , increasingly powerful techniques for both simulation
and
entropy analysis allow comparatively rigorous in silico studies of
the configurational entropy changes associated with binding and conformational
changes . the present study takes advantage of such techniques to revisit
the important topic of correlation entropy for two molecular cases . the first is the experimentally studied association , in chloroform ,
of ethyleneurea with a designed host molecule ( figure 1 ) , whose small size allows correlation
terms of order greater than two to be converged ; the second is the
58-residue protein bpti , where an available millisecond - duration this simulation of bpti has
been extensively studied in a variety of post - analysis works that
include investigation of allostery , isomerization
rates of disulfide bonds , nmr order parameters , and entropy enthalpy transduction . the results presented here bear on the sign ,
magnitude , and determinants of correlation contributions to entropy
changes and hence on the entropic interpretation of nmr order parameter
data . host bold red bonds indicate the host torsion
angles for which the entropy was computed . thin green lines define
one distance variable ( dashed green , h to o ) , two angle variables
( n h o , h o c ) , and three torsional variables
( central bonds n h , h o , o c ) , which together
define the relative position and orientation of the two molecules
in their bound state . we studied the role of correlations
as determinants of entropy
changes on binding and conformational change through analysis of md
simulations . the contributions of pairwise and higher - order correlations
to the entropy were estimated by applying the mie and maximum information
spanning tree ( mist ) methods to the simulation trajectories . these approaches are suitable for the present purpose because they
express the total entropy as a sum of terms accounting for successively
higher - order correlations among the conformational variables . the
following subsections detail the configurational
entropy s of a molecule or supramolecular complex
of na atoms , at standard concentration ,
is given by1here kb is boltzmann s
constant , (x ) is the pdf of the cartesian
coordinates x = ( x1, ... ,x3na ) of the system , c is a standard concentration
( usually taken as 1 mol / l = 6.022 10 molecules / ) , (q ) = [x(q)]j(q ) is the pdf of internal coordinates q = ( q1, ... ,q3na6 ) , j(q ) is the jacobian of the transformation xq , and the first term in the second
line of eq 1 arises from the overall translation
and rotation of the system . the change , s , of the standard configurational entropy on the binding of host
a and guest b to form the complex ab is then2where sx , the internal entropy
of molecule x = a , b , ab , is defined
by3which is the entropy of the pdf x(q ) of the internal coordinates of
system x plus the term that arises from the jacobian jx(q ) of the transformation x rotational
terms kb ln(8/c ) associated with systems a , b , and ab , only one survives in the change given in eq 2 . note that an isothermal change in the configurational entropy s of a system , defined as in eq 1 ,
equals the change in the full ( i.e. , spatial plus momentum ) thermodynamic
entropy of the system . ( the present notation
differs from that of ref ( 33 ) , where a tilde is used to indicate the internal - coordinate
entropy alone . ) the first term on the right - hand side of eq 3 may be estimated by the mie or mist approaches
based on the boltzmann sample of internal coordinates , qi , i = 1, ... ,ns afforded by a molecular simulation . the second
term in eq 3 is estimated by a simple arithmetic
mean , 4 where the sum runs
over the points qi , i = 1, ... ,ns of the
same sample . stiff dof do not contribute much to entropy
changes , as their pdfs
change little on binding . therefore , the present entropy analysis
focused on the soft variables ; that is , the eight soft torsions of
the host and , for the bound complex , six additional dof specifying
the relative position and orientation of the two molecules that form
the complex ( figure 1 ) . participant
in the binding process so that , to a good approximation , the change
in internal entropy is given by5here sab is the
entropy , eq 3 , of the complex computed based
on only the soft torsions of the bound host and the relative position / orientation
variables . sa is the entropy ,
eq 3 , of the unbound host computed using soft
torsions only . thus , the configurational entropy of a total of 14
internal coordinates had to be estimated from the simulation of the
bound complex and compared with the corresponding estimate of the
configurational entropies of eight internal coordinates from the simulation
of the unbound host . we used the generalized amber force field ( gaff ) and am1-bcc charges to
parametrize our systems . the software package amber 12 with pmemd gpu support was used to run the md simulations at constant temperature and pressure
( npt ) . production simulations ran for a duration of 5 s for
both the unbound host and the bound complex , immersed in the solvent
chloroform , which was treated explicitly . the temperature was maintained at 300 k by the langevin thermostat
with the collision frequency scaling set to 1.0 ps , and the pressure was set to 1 bar using the berendsen barostat
with a relaxation time set to 2 ps . snapshots were saved every 1 ps ,
resulting in five million sample points per simulation . the time series
of torsion angles of interest were computed from the simulation data
with the program cpptraj . first , we applied the mie , where instead of computing the required
marginal entropies by the histogram method , we instead used the more powerful kth nearest neighbor
( nn ) estimation of entropy ; this combined approach is termed
the mie - nn method . we also directly applied
the nn method to estimate the entropies of the full 8- and 14-dimensional
pdfs of the host and complex , respectively , using extrapolations in
time for multiple values of k. the extrapolation
for each value of k used the phenomenological function
form tst tst + ak / t , where ak is
fitted separately for each value of k but all values
of k shared the exponent p and asymptote
tst. note , however , that different values of p and
tst were fitted for the free host and bound complex . we use the difference
of both fit curves to estimate tst. finally ,
we also applied the mist approximation in combination
with the nn method . like mie , mist is a systematic , dimension - reduction
approximation based on an information - theoretic expansion of entropy .
unlike mie , however , mist approximations of increasing order are guaranteed
to furnish decreasing upper bounds of the exact entropy . for the protein
analysis , we limit attention to the contributions
of pairwise correlations , due to the computational expense of converging
higher - order correlation terms . even the pairwise contribution can
be challenging to compute for a large system , because the second - order
mutual information contributions , which appear in both the mie and
mist , are greater than or equal to zero . thus , even if two torsions
are entirely uncorrelated , their mutual information will approach
zero asymptotically from above with increased sampling . for a protein ,
the sum of many spurious positive correlation contributions from the
many torsion torsion pairs can yield a misleadingly large estimate
of the overall pairwise contribution to the entropy . here first , to maximize
convergence , we study a single , 1 ms trajectory of bpti in explicit
solvent , which was generated on the anton
supercomputer . this is much longer than
the prior study of torsion torsion correlations in protein peptide
binding , which processed 2 s of
simulation trajectories generated by 200 independent 10 ns runs starting
from the same conformation . the bpti simulation , which provided over
four million snapshots at 250 ps intervals , used the tip4p - ew water
model , and , for the protein , the amber
ff99sb force field with additional corrections
to side - chain torsions of isoleucines was used . the original study
of this simulation decomposed the trajectory into conformational clusters ,
or states , based on a kinetic clustering approach . subsequent thermodynamic analysis indicated that clusters 1 and 2 have free energies that are equal
to within 0.5 kcal / mol , but their total entropies , including
both the protein and the solvent molecules , differ by 3.2
kcal / mol . their configurational entropies were estimated to differ
by over 18 kcal / mol based on mist analysis . this very large difference in configurational entropy is accompanied
by visibly larger conformational fluctuations for cluster 2 versus
cluster 1 . here we expand on the prior thermodynamic analysis by examining the role of torsional correlations
as determinants of the large difference in configurational entropy
between clusters 1 and 2 . in addition to using a much longer
simulation , we employ mist instead
of mie , as the former requires postprocessing many fewer torsion this not only saves computer time but also , relative to the
mie , reduces the error from summing many small , potentially spurious
pairwise contributions from large numbers of torsion torsion
pairs , as previously discussed . we also address the problem of residual
pairwise contributions by repeating the calculations with a cyclic
permutation technique that removes spurious entropic contributions
due to inadequate sampling , as previously detailed . although the nn method allows well - converged entropy estimates
to be obtained with less simulation data , we used the histogram method
for this study because it allows the nearly 400 000 mutual
information pairs to be processed considerably more quickly . the subtraction
of spurious correlation from each mist pair removes numeric bias of the entropy estimate from the histogram method
for a given cluster . because the spurious correlation estimates are
computed using the same number of frames as the original mutual information
estimate for a given pair , any sample bias for a given cluster is
removed before computing the difference in entropies between clusters
that have different frame counts . the full bond - angle - torsion
coordinate system of bpti comprises
889 torsion angles . treating each of these torsions separately can
lead to trivial high - order correlations ; we eliminated these by redefining the torsion angles ( j ) of all of the torsions that share the same
rotatable bond as phase angles ( j ) of a single , representative torsion angle ( i):6for
bpti , 500 of the torsion angles are treated
as phase angles in this manner . it should be noted that in our prior
analysis of this simulation we accounted
only for those phase angles that had three of the four torsion atoms
in common with a master torsion angle . we now also include any torsion
that shares the two atoms that form the central rotable bond . we also
found very rare rotations of the nh2 moieties within the
guanidinium group of the arginine residues . these procedural changes
caused the mist-889c entropy estimate to slightly change from ts = 18.9 to 18.1
kcal / mol ( table 2 ) . we also determined
whether restricting the set of torsions included
in the entropy calculations to only those most perturbed by the conformational
change affects the entropy results . we quantified the degree to which
a torsion angle s pdf changes between clusters 1 and 2 by computing
the jensen if p is the pdf of a torsion
for cluster 1 and q is its pdf for cluster 2 , the
jsd metric is given by7where s ( ) is the shannon
entropy of the pdf in the argument . the jsdm is zero when the two
pdfs are identical and attains a maximum value of 0.83 when the two
pdfs are completely nonoverlapping ; we considered a torsional pdf
to be significantly perturbed if its jsdm between clusters 1 and 2
was greater than 0.083 . leibler
divergence , the jsdm has the merit of
being unaffected by the ordering of the two pdfs . computing the jsdm
between two pdfs of the same torsion angle involves only 1-d pdfs ,
so we obtained it from a straightforward histogram method . when the host and guest are both free in solution , they both rotate
freely relative to each other , and , for a standard concentration of
1 m , each effectively occupies its own volume of 1660 . after they
have bound to form a noncovalent complex , their relative rotation
and translation is markedly constrained , and this reduction in rotational
and translational freedom in itself contributes a loss in configurational
entropy . whether the net change in configurational entropy is unfavorable then depends on how the rest of the system responds to the binding
event . for this small host guest system , the overall change
in configurational entropy is found to remain unfavorable , as tsfull = 8.43 kcal / mol
( table 1 ) . ( note that this entropy change ,
as well as the others in this section , includes the kb ln(8/c ) term in eq 2 . ) most of this overall
entropy change is manifested in the first - order entropy contribution ,
ts1 =
6.03 kcal / mol , which by definition neglects all correlation contributions .
however , increased correlation clearly plays a role , given the 2.4
kcal / mol difference between the full entropy , which accounts for correlations ,
and the first - order entropy , which does not . thus , we find that binding
induces increased correlations , which further oppose binding . this
pattern is opposite to a prior computational result , indicating that
proteins with lower first - order side - chain entropies tend to have
partly balancing decreases in side - chain correlations . much of the change in entropy can be attributed
to changes in the relative rotational and translational dof of the
host and guest : application of the mie - nn method to these six key
variables in the bound state yields estimates for tsrt of 5.0 , 5.9 , and
6.1 kcal / mol , relative to the unbound state , at the first , second
and third orders of the mie , respectively . it should be noted , however ,
that alternative systems of internal coordinates could give different
results for these quantities . the
roles of pairwise and third - order correlations may be examined
within both the mie and mist expansions ( table 1 ) . interestingly , the mie at both second and third order agrees well
with the estimate of the full - order entropy , indicating that , for
this method , the pairwise correlations account for the bulk of the
total correlations . however , it should be noted that there is no guarantee
that higher order terms , if computable , would continue smoothly toward
the full - order result . the mist approach proceeds more gradually toward
the full - order estimate and , at third order , already captures most
of the correlation present in the full - order estimate . correlation contributions at
each reported order are also reported : tsmcorr = tsm + ts1 , and tsfullcorr = tsfull + ts1 . the correlation contribution identified here is considerably larger
than that previously reported for thermal perturbations of a series
of dipeptides ( < 0.1 kcal / mol ) and the much larger villin headpiece
protein ( < 0.4 kcal / mol ) . the present
result corresponds to 0.17 kcal / mol change in correlation entropy
per soft dof of the complex ( 14 variables ) or 0.30 kcal / mol per soft
dihedral angle ( 8 dihedrals ) . these values may be compared with prior
results for the binding of a 9-residue peptide to the 145-residue
protein tsg101 , where changes in second - order
correlation on binding led to an entropy penalty of 0.3 kcal / mol
per residue of the protein peptide system . assuming an average
of four soft dihedrals per residue , the correlation entropic penalty
is 0.075 kcal / mol per soft dihedral , which is less than the
present host this smaller value probably reflects ,
at least in part , the fact that the protein has many dof that are
not closely coupled with the binding site . thus , the mie results for
orders one , two , and three remained constant to within 0.1 kcal / mol
over the simulation time interval 4 to 5 s , and the mist results
at the third order were numerically even more stable than the corresponding
third - order mie results . it is worth noting that we also attempted
to compute tsm at orders m 4 ,
but convergence was not favorable , and extrapolation was not attempted ,
as the estimates obtained at different values of k differed from each other to a much greater extent than those in
the full - dimensional k - nn estimates . it appears that
these numerical problems stem in part from the much greater number
of mathematical clusters of variables that must be analyzed for larger
values of the order m ( m > 3 ) . a prior 1 ms simulation of the 58-residue protein bpti , using explicit
water , yielded several different conformational clusters . subsequent thermodynamic analysis of the simulation
results indicated that the total entropy of the protein water
system changes by about ts = 3.0 kcal / mol on transitioning from the more crystal - structure
like cluster 1 to the more flexible cluster 2 . interestingly , the change in configurational entropy for
this conformational shift is much larger : the second - order mist estimates
range from 15.1 to 18.1 kcal / mol ( table 2 ) , depending on methodological
details discussed later . because the total entropy can be expressed
as the configurational entropy plus an appropriately defined solvation
entropy , one may conclude that the strongly
favorable increase in configurational entropy on going from cluster
1 to cluster 2 is largely canceled by an opposing decrease in solvent
entropy . the estimated change in configurational entropy on going
from cluster 1 to cluster 2 greatly exceeds that computed for the
host guest system ( previously described ) . this is perhaps not
surprising given the much larger size of the protein system ; on the
other hand , a change in conformational state might be expected to
produce a smaller entropy change than a binding event . the first set of results is computed
by applying the mist approach to all 889 protein torsions , without
( mist-889 ) and with ( mist-889c ) a correction for possible incomplete
sampling , based on cyclic permutations of the trajectory . the second
set results from applying mist to only the 157 torsions whose pdfs
change most between the two clusters , based on their jsdm values . again , results are presented without ( mist-157 ) and with ( mist-157c )
the permutation correction . it is
of interest to break down the estimated change in configurational
entropy between clusters 1 and 2 into its first order and pairwise
correlation contributions . at first order , the increase in torsional
entropy on going from cluster 1 to cluster 2 is found to be about
21.1 kcal / mol ( table 2 ) , while , as
previously noted , accounting for pairwise correlations reduces this
change to 15.1 to 18.1 kcal / mol . thus , although the
first - order entropy becomes much more favorable , a concurrent increase
in pairwise torsional correlations effectively cancels out 36
kcal / mol of the first - order entropy difference . this cancelation of
1530% of the first - order entropy by changes in correlation
is in striking agreement with a prior simulation study of protein
side - chain entropy , previously mentioned . however , it is opposite in sense to what we observe for the host guest
system , above : there , changes in correlation reinforce , rather than
balance , the first - order change in configurational entropy of binding . we tested the robustness of the present entropy estimates by two
substantial variations in the method results . first , we corrected
the estimate of each pairwise mutual information used in the mist
calculations for possible spurious correlation due to inadequate sampling
by subtracting out pairwise entropies computed with a permuted , and
hence entirely decorrelated , trajectory . as shown in table 2 , results with ( mist-889 )
and without ( mist-889c ) this correction for possible spurious correlations
due to inadequate convergence differ by only a few kilocalories per
mole we also recalculated both the first- and second - order entropies
using only the 157 torsions with greatest jsdms between clusters 1
and 2 . as shown in figure 3 , the torsions with the largest jsdm values , that is , the ones whose
pdfs differ most between clusters 1 and 2 , reside in the two loops
toward the top of the protein in this representation . this is not
surprising because increased motion of these loops is a hallmark of
cluster 2 , as illustrated in figure 1 of a
prior study of this simulation . the use
of only 157 torsions dramatically reduces the total number of mutual
information pairs ( 12 246 versus 394 716 ) that need
to be calculated prior to computing the mist estimate of the configurational
entropy . even with such a large reduction in the total number of torsions ,
the results are all within 2 kcal / mol of those based on all 889 torsions ,
for both the uncorrected ( mist-157 ) and permutation - corrected ( mist-157c )
estimates . guest
binding , estimated by the k nearest - neighbor method ,
as a function of simulation time t. each data point
is the delta entropy estimate between the host and complex for a given
value of t and k , and each line
is the difference in the host and complex phenomenological fit functions
for a given value of k , where the fits for the host
and were allowed to approach their own asymptotic values as t . the fitted values of the exponent p are 0.365 and 0.221 , for the host and complex , respectively . the gray horizontal dashed line at tsfull = 8.43 kcal / mol indicates delta in asymptotic
values for the host and complex . dark blue represents the minimum possible divergence of 0.00 ,
and red represents the maximum observed value of 0.75 . it is also of interest to determine which parts
of the protein
contribute most to the mist entropy estimates . as a first level of
analysis , we decomposed the change in first - order configurational
entropy into main - chain and side - chain contributions and the change
in correlation entropy into main - chain / main - chain , main - chain / side - chain ,
and side - chain / side - chain contributions . as shown in table 3 , the main - chain contribution to the first - order
change is twice the side - chain contribution , and main - chain / main - chain
torsion pairs similarly provide the largest contribution to the change
in correlation entropy , especially after the permutation corrections
are applied . these results suggest that changes in main - chain torsions
play a predominant role in determining changes in configurational
entropy , at least in the present system , so that a focus on side - chain
contributions may be unduly limiting . the middle panel ,
which displays the changes in pairwise mutual information for all
torsional pairs , shows clear diagonal patterning , which indicates
correlation contributions from torsions that are near each other in
protein sequence and hence in space . it also shows large patches corresponding
to the two loops highlighted in the left - hand panel . as shown in the
graph along the top of the heat map , these loops are also subject
to large changes in first - order entropy . the strong off - diagonal patches
associated with loop loop correlations mean that correlation
contributions are strong for torsions that are near each other in
space yet not in sequence . torsion 154 is 1 of tyr10
and has an intense stripe in the side - chain and side - chain / main - chain
sections of the heat map , indicating strong correlations with many
other torsions . torsions 170 and 264 , which are 2 and 3 of the disulfide bridge between the two
loops ( cys14-cys38 ) , also have particularly intense stripes in the
heat map . the right - hand panel of figure 4 is
the same as the middle one , except that it only marks those torsion
pairs included in the mist estimate of the pairwise entropy . thus ,
mist selects only highly correlated pairs within each conformational
cluster , and it is interesting to see that this procedure focuses
attention even more on the diagonals . thus , torsions that are near
neighbors in sequence contribute the most to the computed entropy
difference . structural analysis of the changes in pairwise correlation between
clusters 1 and 2 for torsions throughout bpti . left : cartoon representation
of bpti with structural features having large correlation annotated
by the torsion number ( superscripted ) and residue number ( bold ) . loop
1 ( purple ) and loop 2 ( orange ) are connected by the central disulfide
bridge ( cys14-cys38 ) and show strong intra- and interloop correlation . center : mutual information heat map for all torsion pairs pertaining
to the 332 nonphase side - chain and main - chain / torsions . the first 116 torsions correspond to main - chain torsions starting
at residue 1 , and the following 216 are side - chain torsions , again
starting at residue 1 . main - chain torsions of loop 1 start at torsion
16 ( residue 8) and end at torsion 34 ( residue 17 ) . main - chain torsions
of loop 2 start at torsion 69 , residue 34 and end at torsion 86 , residue
43 . the disulfide bridges are side - chain torsions 264 , 313 , and 330 . the mutual information and entropy values represent cluster 2 minus
cluster 1 deltas and are reported in units of s / kb . furthermore , each delta in pairwise mutual information
had the average delta in pairwise spurious mutual information ( 0.0057 ) ,
as determined by the previous permutation analysis subtracted from
its value to minimize numerical bias . the estimated change in pairwise correlation entropy of about
36
kcal / mol corresponds to about 0.05 to 0.10 kcal / mol / residue for this
protein of 58 residues . this may be compared with the value of 0.3
kcal / mol / residue computed for the tsg101-peptide binding system ( above ) . it seems reasonable that the binding reaction
of the tsg101 system might lead to a larger perturbation per residue
than the conformational change studied here . inadequate sampling can
cause the correlation entropy to be overestimated , and the net simulation
time of 2 s for tsg101 is much less than the 1 ms of time available
for bpti , so convergence could also play a role in the observed difference . finally , it is worth noting that bpti s three disulfide bridges
may dampen its total configurational flexibility relative to tsg-101 ,
which lacks such structural constraints . the
results presented here bear on several aspects of the contributions
of torsional correlations to changes in configurational entropy . a
central result is that well - converged simulations clearly show nontrivial
contributions to configurational entropy changes from changes in correlations ,
for both binding and conformational change events . for the host guest
system , the correlation contributions amount to about 40% of the first - order
entropy , and they act in the same sense as the first - order contribution ;
that is , they further reduce the configurational entropy of binding .
for the conformational change of bpti , the correlation contribution
of 36 kcal / mol represents 1530% of the first - order
entropy but now acting in the opposite sense ; that is , correlation
acts opposite to the first - order term . the conclusion that correlation
contributes significantly to configurational
entropy differences is consistent with a prior quasiharmonic study
using cartesian coordinates and with mie studies using bond - angle - torsion coordinates . it is also consistent
with a recent study that applied mist to side - chain rotameric states
across a series of different proteins . however , it appears less consistent with a prior simulation study
of peptides and a small protein , which indicated relatively small
contributions from changes in correlation . we conjecture that the apparent inconsistency stems largely from
the different nature of the cases studied . in the prior study , changes
in configurational entropy were computed for five dipeptides in solution ,
when t was changed from 270 to 380 k , but perhaps
these small molecules were largely unstructured and uncorrelated at
both temperatures . for villin headpiece , the prior study considered
only a 20 k temperature change , which may have been too small to produce
much change in overall motion . moreover , the villin headpiece simulations
at 300 k were terminated at 70 ns because the protein structure was
beginning to change significantly after 75 ns in two of the runs .
perhaps continuing the run , so as to include the impending conformational
change , would have altered the findings . finally , for the villin study ,
the small magnitude of the correlation contributions observed may
result in part from the study s neglect of inter - residue correlations . interestingly , another prior study , of calmodulin , which also suggested that changes in correlation
entropy are small , likewise studied a temperature change ( 295 to 346
k ) , rather than focusing explicitly on a conformational change or
binding event . in summary , the current body of evidence seems consistent
with a view that clear - cut conformational changes and binding events
tend to be associated with quantitatively important entropic contributions
from changes in correlation . this conclusion suggests that one can not
confidently overlook the potential importance of correlation in the
entropic interpretation of nmr order parameter studies , at least for
proteins undergoing well - defined binding events or conformational
changes . recently , however , it has been suggested , based on
empirical and
simulation data , that the entropy contribution of correlation is roughly
proportional to the first - order entropy , sfullcorr
0.17s1 , so that a total
entropy change may be estimated as sfull 0.83s1 . such a regularity would clearly be useful , given that computing
or measuring correlations is difficult . it also can make intuitive
sense , as the entropy of a set of correlated dof may require a larger
correlation correction if they become more flexible , at least up to
a point , and , indeed , the present results for bpti fit the pattern
rather well . however , the host guest binding results do not
fit the pattern . here the change in correlation entropy has the same
sign as the change in the first - order entropy , such that sfullcorr 1.4s1 . in respect
of the sign of the relationship , this result agrees with a prior simulation
study of peptide binding by the protein tsg101 . it is perhaps worth noting that although greater correlation
necessarily decreases entropy , relative to the first - order entropy ,
the change in correlation in the course of some process
may work in either direction . one may speculate , based on the available
data , that binding , in particular , tends to generate decreases in
both first - order and correlation entropy , but only further study could
establish this point . what one may conclude at this point is that
the change in correlation entropy can , in general , either reinforce
or compensate the change in first - order entropy . as a consequence ,
entropy changes derived from changes in nmr order parameters can not
be reliably assumed to represent either upper or lower limits of the
total entropy change . the present methodology also affords a
detailed look at the specific
torsions and torsional correlations that determine the computed entropy
changes in bpti . we find that the estimated entropy difference between
clusters 1 and 2 of bpti is associated largely , though not exclusively ,
with changes in the conformational distributions of main - chain torsions . this holds not only at first but also at second order , where changes
in pairwise torsional correlations contribute . thus , entropy estimates
that neglect main - chain contributions , including main - chain correlations ,
risk incurring substantial errors . it is also of interest that the
most significant pairwise correlations involve torsions that are close
to each other in space , either because they are sequence neighbors
or because they are brought together by the 3-d fold of the protein .
it will be interesting to learn whether longer - ranged correlations
are important for more complex and flexible proteins than bpti , which
is small and is cross - linked by three disulfide bridges . an
innovative methodological aspect of this study is that it has
presented the first application of the mie - nn and mist - nn methods
to a binding problem , albeit a simple one , and the first md - based
estimation of the change in configurational entropy on binding at
full dimensionality . such methods can have broader applicability to
larger systems as well , especially when coupled to the use of information
theoretic methods , like the jensen shannon divergence approach
used here , to select the most relevant dof and subsequently drastically
reduce the combinatorics associated with mie and mist calculations . given advancing computer power , exemplified by the millisecond protein
simulation of bpti , quantitative investigation of correlations at
higher than second order in a system as large as bpti may soon become
computationally feasible . | for
biomolecules in solution , changes in configurational entropy
are thought to contribute substantially to the free energies of processes
like binding and conformational change . in principle
, the configurational
entropy can be strongly affected by pairwise and higher - order correlations
among conformational degrees of freedom .
however , the literature offers
mixed perspectives regarding the contributions that changes in correlations
make to changes in configurational entropy for such processes . here
we take advantage of powerful techniques for simulation and entropy
analysis to carry out rigorous in silico studies of correlation in
binding and conformational changes . in particular , we apply information - theoretic
expansions of the configurational entropy to well - sampled molecular
dynamics simulations of a model host guest system and the protein
bovine pancreatic trypsin inhibitor .
the results bear on the interpretation
of nmr data , as they indicate that changes in correlation are important
determinants of entropy changes for biologically relevant processes
and that changes in correlation may either balance or reinforce changes
in first - order entropy .
the results also highlight the importance
of main - chain torsions as contributors to changes in protein configurational
entropy . as simulation techniques grow in power , the mathematical
techniques used here will offer new opportunities to answer challenging
questions about complex molecular systems . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
with the development of bladder outlet obstruction ( boo ) , the bladder undergoes not only morphologic and physiologic changes , but also functional and symptomatic changes . despite the high prevalence of boo among older men , the underlying mechanisms that are responsible for the bladder dysfunction induced by boo remain poorly understood . the urothelium was previously considered to be a simple passive barrier between the urinary tract and urine . recently the urothelium and suburothelial space have received renewed interest because of their possible roles in the pathophysiology of bladder dysfunction . the urothelium is now understood to be an active organ that plays an important role in regulating bladder disorders . it has been shown in some animal models that water transfer can occur across the urothelium from the bladder to the systemic circulation [ 2 - 4 ] . those studies suggested that the urothelium can mediate water and solute transport under certain circumstances [ 5 - 9 ] . several studies have shown that rabbit and guinea pig urinary bladder epithelium contains an aldosterone - stimulated sodium transporter . this transporter has been identified as an epithelial sodium channel ( enac ) that is known to be responsible for salt and fluid transport across the epithelia of many tissues . recently reported on the localization of aqp1 , 2 , and 3 in rat urothelium . they reported the presence and regulation of aqps in the urothelium of rats after the rats underwent 24 hours of dehydration and then a water loading test . they suggested that the aqps in the urothelium may play a role in epithelial cell volume and in controlling osmolarity , and they strongly suggested the possibility of bulk water movement across the urothelium . rubenwolf et al demonstrated that aqps are expressed in cultured urothelium and they suggested a potential role for aqps in transurothelial water and solute transport in humans . however , there are currently no studies that have investigated the expression of aqp in the urothelium of rats after boo or the functional activity of these proteins in response to boo . primarily , aqp1 functions as a passive water pore that increases water transport across cell membranes in response to an osmotic driving force . furthermore , some evidence suggests that aqp1 has an ion channel function that has potential significance to basic and clinical research involving the regulated control of water and ion fluxes across membranes . on the basis of these data , we hypothesized that aqp1 channels may be further impacted by boo , which may cause bladder dysfunction , at least in part , by an increase in the urothelial permeability of ion and water . the purpose of this study was to investigate the impact of boo on aqp1 expression in the rat urinary bladder . twenty female sprague - dawley rats ( 230 - 240 g each ) were divided into 2 groups : the control ( con ) group ( n=10 ) and the boo group ( n=10 ) . the animals were premedicated with xylazine ( 2.2 mg / kg , i m ) and anesthetized with a zolazepam / tiletamine cocktail ( 4.4 mg / kg , i m ) . a midline abdominal incision was made and the bladder and proximal urethra were dissected free of the surrounding tissue . to create an intravesical obstruction , a pe-90 ( polyethylene catheter-90 ) catheter was placed beside the proximal urethra and a 3-zero silk ligature was tied around the urethra and catheter . all the rats were in an overnight fasting state before the experiments were performed ; they were given a standard diet before that time . the protocol for the animal surgery was approved by the ethics committee of the chonnam national university medical school . the tissue homogenates ( 30 g of protein ) were separated by 12% sds - polyacrylamide gel electrophoresis and the proteins were then transferred to a pvdf membrane ( amersham pharmacia biotech , little chalfont , united kingdom ) . the blots were then washed with tris - buffered saline tween-20 ( 10 mm tris - hcl , ph 7.6 , 150 mm nacl , 0.05% tween-20 ) . the membrane was blocked with 5% skimmed milk for 1 hour and was then incubated with the appropriate primary antibody . monoclonal rabbit antibodies for aqp1 ( chemicon , temecula , ca , usa ) and monoclonal rabbit antibodies for glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) ( sigma , st . the membrane was then washed and the antibody reactions were detected by using goat anti - rabbit - igg conjugated to horseradish peroxidase . densitometry analysis was performed with a studio star scanner and by using the nih image v1 - 57 software . the tissue was placed in 4% paraformaldehyde fixative for 16 hours and the tissue was then processed for washing and dehydration . immunohistochemistry was performed by using an immunoperoxidase procedure ( vector abc kit ; vector laboratories , burlingame , ca , usa ) . the tissue sections were deparaffinized in xylene , dehydrated in a graded series of ethanol solutions , rinsed twice in phosphate - buffered saline ( pbs ) , and then treated with 3% h2o2 in 60% methanol for 30 minutes to quench the endogenous peroxidase activity . after washing twice ( 5 minutes each time ) in pbs , the sections were next incubated for 12 to 14 hours with purified rabbit antibodies for aqp1 ( chemicon ) in pbs with 0.3% bovine serum albumin . for the negative control , the sections were incubated in pbs containing only 5% normal goat serum . the tissue sections were deparaffinized in xylene , dehydrated in a graded series of ethanol solutions , rinsed in pbs , and then treated with normal goat serum for 30 minutes to block any nonspecific binding . after washing in pbs , the sections were incubated with antibodies for aqp1 ( chemicon ) in pbs with 0.3% bovine serum albumin for 12 to 14 hours at 4. for a negative control , the sections were incubated in pbs containing only 5% normal goat serum . the sections were then rinsed in pbs and incubated for 30 minutes with the antirabbit igg conjugated to fluorescein ( vector laboratories ) . finally , the tissue sections were examined and photographed under a fluorescence microscope . the sections were then rinsed 3 times in pbs and incubated sequentially with the biotinylated secondary antibody and the abc reagent , and each incubation was done for 30 minutes . the sections were then incubated for 5 minutes with the peroxidase substrate solution contained in the kit . at last , twenty female sprague - dawley rats ( 230 - 240 g each ) were divided into 2 groups : the control ( con ) group ( n=10 ) and the boo group ( n=10 ) . the animals were premedicated with xylazine ( 2.2 mg / kg , i m ) and anesthetized with a zolazepam / tiletamine cocktail ( 4.4 mg / kg , i m ) . a midline abdominal incision was made and the bladder and proximal urethra were dissected free of the surrounding tissue . to create an intravesical obstruction , a pe-90 ( polyethylene catheter-90 ) catheter was placed beside the proximal urethra and a 3-zero silk ligature was tied around the urethra and catheter . all the rats were in an overnight fasting state before the experiments were performed ; they were given a standard diet before that time . the protocol for the animal surgery was approved by the ethics committee of the chonnam national university medical school . the tissue homogenates ( 30 g of protein ) were separated by 12% sds - polyacrylamide gel electrophoresis and the proteins were then transferred to a pvdf membrane ( amersham pharmacia biotech , little chalfont , united kingdom ) . the blots were then washed with tris - buffered saline tween-20 ( 10 mm tris - hcl , ph 7.6 , 150 mm nacl , 0.05% tween-20 ) . the membrane was blocked with 5% skimmed milk for 1 hour and was then incubated with the appropriate primary antibody . monoclonal rabbit antibodies for aqp1 ( chemicon , temecula , ca , usa ) and monoclonal rabbit antibodies for glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) ( sigma , st . the membrane was then washed and the antibody reactions were detected by using goat anti - rabbit - igg conjugated to horseradish peroxidase . densitometry analysis was performed with a studio star scanner and by using the nih image v1 - 57 software . the tissue was placed in 4% paraformaldehyde fixative for 16 hours and the tissue was then processed for washing and dehydration . immunohistochemistry was performed by using an immunoperoxidase procedure ( vector abc kit ; vector laboratories , burlingame , ca , usa ) . the tissue sections were deparaffinized in xylene , dehydrated in a graded series of ethanol solutions , rinsed twice in phosphate - buffered saline ( pbs ) , and then treated with 3% h2o2 in 60% methanol for 30 minutes to quench the endogenous peroxidase activity . after washing twice ( 5 minutes each time ) in pbs , the sections were next incubated for 12 to 14 hours with purified rabbit antibodies for aqp1 ( chemicon ) in pbs with 0.3% bovine serum albumin . for the negative control , the tissue sections were deparaffinized in xylene , dehydrated in a graded series of ethanol solutions , rinsed in pbs , and then treated with normal goat serum for 30 minutes to block any nonspecific binding . after washing in pbs , the sections were incubated with antibodies for aqp1 ( chemicon ) in pbs with 0.3% bovine serum albumin for 12 to 14 hours at 4. for a negative control , the sections were incubated in pbs containing only 5% normal goat serum . the sections were then rinsed in pbs and incubated for 30 minutes with the antirabbit igg conjugated to fluorescein ( vector laboratories ) . finally , the tissue sections were examined and photographed under a fluorescence microscope . the sections were then rinsed 3 times in pbs and incubated sequentially with the biotinylated secondary antibody and the abc reagent , and each incubation was done for 30 minutes . the sections were then incubated for 5 minutes with the peroxidase substrate solution contained in the kit . at all the animals survived for three weeks after the creation of a partial boo . there was no significant difference in body weight between the 2 groups . the weights ( mg ) of the bladders were significantly greater in the boo group ( 64015.3 ) than in the control group ( 125.317.6 ) , and this finding supported the proper creation of boo ( p<0.05 ) . in the control rats , the urothelium consisted of 3 - 4 layers of transitional cells and lamina propria . the bladder wall of the boo animals was thicker than that of the normal controls . in the boo group , the histology of the bladder tissue showed relative epithelial thinning and distortion of the mucosa compared with that of the control . the proportion of bladder smooth muscle was also markedly higher in the boo group than in the control group ( fig . aqp1 was mainly expressed in the subepithelial capillaries and venules of the lamina propria , including the suburothelial tiny arterioles located just beneath the urothelium . the immunohistochemistry revealed that in terms of the cellular patterns of labeling , the expression of aqp1 in the control group was similar to that in the boo group . 3 ) showed a marked increase in the expression of aqp1 in the boo group . aqp1 protein was recognized in all groups , but there was a significant increase in aqp1 protein in the boo group compared with the control group ( p<0.05 ) ( fig . in the control rats , the urothelium consisted of 3 - 4 layers of transitional cells and lamina propria . the bladder wall of the boo animals was thicker than that of the normal controls . in the boo group , the histology of the bladder tissue showed relative epithelial thinning and distortion of the mucosa compared with that of the control . the proportion of bladder smooth muscle was also markedly higher in the boo group than in the control group ( fig . aqp1 was mainly expressed in the subepithelial capillaries and venules of the lamina propria , including the suburothelial tiny arterioles located just beneath the urothelium . the immunohistochemistry revealed that in terms of the cellular patterns of labeling , the expression of aqp1 in the control group was similar to that in the boo group . 3 ) showed a marked increase in the expression of aqp1 in the boo group . aqp1 protein was recognized in all groups , but there was a significant increase in aqp1 protein in the boo group compared with the control group ( p<0.05 ) ( fig . these results suggest that aqps may play a role in the bladder dysfunction induced by boo . this study sheds light on the possible occurrence of water and solute movement via aqps in the rat urinary bladder and the related changes after boo . the incidence of overactive bladder symptoms such as frequency , urgency , and urge incontinence in men older than 40 years is estimated to be 16.6% . symptoms of an overactive bladder can be the result of detrusor overactivity or detrusor instability that is induced by a variety of causes . detrusor overactivity is thought to be caused by increased afferent nerve activity , but little is known about the underlying mechanisms by which boo increases the afferent nerve activity . the urothelium is known to have very low permeability to several urinary solutes and substrates . it has been found that the composition of the urine changes during its transport through the urine passages from the renal pelvis to the urinary bladder , and this finding has been ascribed to a modifying function of the urothelium . hibernating bears that can reabsorb their entire daily urine production during the months of winter are a dramatic example of net urothelial water and solute transport . araki et al . investigated the role of enac in the bladder dysfunction of male patients who were clinically diagnosed with boo . they reported that in patients with boo , the enac expressed in the human urinary bladder epithelium and the expressed levels of enac were significantly higher than in patients who did not have boo . the authors suggested that the enac expression in the bladder epithelium might be implicated in the mechanosensory transduction that occurs in the bladder afferent pathways , and this induces detrusor instability by boo . aqps are expressed in many fluid - containing tissues and they are involved in many physiological mechanisms , including the transportation of transepithelial fluid , the concentration of urine , and the secretion of gland fluid . aqp1 was the first identified member of the family , and it is expressed at a high rate in water - transporting cells , such as those in the proximal tubule and the thin descending limb in the kidney , and in red blood cells . however , aqp1 is also expressed in vascular smooth muscle cells and vascular endothelial cells where net water movement does not appear to be important . to support the hypothesis of water movement in the bladder from the subepithelial capillaries to the lumen , this study investigated the expression of aqps with focus on the aqp1 expression in the urinary bladder . in the current study , aqp1 was mainly expressed in the capillaries , arterioles , and venules of the urinary bladder . our findings agree with the results of a previous study by spector et al , who showed that aqps in the genitourinary tract urothelium likely play a role in regulating urothelial cell volume and osmolality . they revealed that dehydrated rats had a significant upregulation of aqp expression , and this finding provides presumptive evidence that aqps are involved in water and solute transport across the urothelium . rubenwolf et al demonstrated the expression of aqps in cultured human urothelial cells , and they suggested that aqps play a potential role in transurothelial water and solute transport in the human bladder . it has been reported that aqp1 is abundant in a variety of tissues , and the tissues that express aqp1 exhibit high water permeability and a high osmotic urine concentration , gall secretion , formation of cerebrospinal fluid , and spermatozoa concentration . lu et al recently reported that aqp1 is expressed in male reproductive organs such as the rete testis , vas deference , prostate , and seminal vesicle , and this finding provides valuable information on the role of aqp1 in water transport to regulate water homeostasis in male reproductive physiology . the rete testis is the initial segment of the male reproductive tract and has a large vascular surface area . the rete testis alters the nature of the fluid produced by the seminiferous tubule for making more homogeneous sperm . aqp1 has been observed in the rete testis and a significant change in water content was found in aqp1 knockout mice , which indicates that this water channel does indeed play an exclusive role in water transport for forming the rete testis fluid and sperm transit . no studies to date have investigated the expression of the aqp family members in the urinary bladder of the boo rat model or the changes in the functional activity of these proteins in response to boo . in the present study , the expression of aqp1 these findings suggest that aqps are influenced by the bladder dysfunction induced by anatomical changes such as boo . one of the possible reasons behind this influence on the expression of aqp is believed to be due to the significance of the location of the aqp expression at the suburothelial space immediately below the basal lamina of the epithelium , which is well supplied by microvasculature ( aqp1 ) . our results may suggest that boo leads to a significant up - regulation of aqp1 expression , which provides presumptive evidence that aqps are involved in the bladder dysfunction induced by boo . the limitation of this study is that we did not fully unveil the precise functional activity of aqp1 , although we did show the changes in the expression of aqp1 in the boo rat urinary bladder . further studies are needed to investigate the expression and localization of all the aqp family members in the urinary bladder and their functional role in the underlying mechanisms of bladder pathophysiology . boo causes a significantly increased expression of aqp1 in the rat urinary bladder . this may imply that aqps have a functional role in the bladder dysfunction that occurs in association with boo . further study is needed to clarify the exact functional role of the different aqps in the urinary bladder . | purposeaquaporins ( aqps ) are membrane proteins that facilitate water movement across biological membranes .
aqps are also called water channels , and they have recently been reported to be expressed in rat and human urothelium .
the purposes of this study were to investigate the effect of bladder outlet obstruction ( boo ) on the rat urothelium and aqp1 expression in rat urothelium.materials and methodsfemale sprague - dawley rats ( 230 - 240 g each , n=20 ) were divided into 2 groups : the sham group ( the con group , n=10 ) and the partial boo group ( the boo group , n=10 ) .
the boo group underwent a partial boo . the expression and cellular localization of aqp1
were determined by performing western blotting and immunohistochemistry on the rat urinary bladder.resultsaqp1 immunoreactivity in both the control and the boo groups was localized in the capillaries , arterioles , and venules of the lamina propria of the urinary bladder .
the protein expression of aqp1 was significantly increased in the boo group.conclusionsthis study showed that boo causes a significant increase in the expression of aqp1 .
this may imply that aqp1 has a functional role in the detrusor instability that occurs in association with boo . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the clinical features of this complication including severe throbbing pain , oral malodor and unpleasant taste . onset of symptoms is 42 - 72 h after tooth extraction and there is no any redness or purulent discharge of the affected sites . the main complaint of affected patient is severe pain that causes impairment in daily activities . this pain can be referred to forehead , ears and neck and is resistant to pain relief drugs . the pathogenesis of this pain after extraction is not completely known , but several factors have been suggested as predisposing factors including trauma to the alveolar socket , infection at the site of tooth extraction , presence of vasoconstrictor in local anesthesia , smoking , intake of oral contraceptive pill ( ocp ) , menstruation , residual foreign bodies , root segments in alveolar bone , extra irrigation or severe curettage , ejection of saliva after extraction . treatment of this condition needs correct diagnosis that can be facilitated by its clinical symptoms including unusual severe pain , lack of a blood clot in the socket , presence of necrotic material and oral malodor . because of its unknown etiology , the treatment is only palliative intervention with prescribing anti - inflammatory drugs . for prevention of dry socket some drugs have been suggested like anti - fibrinolytic , irrigation , disinfectants and topical antibiotics . this cross - sectional prospective study consisted of patients referred to yazd dental clinics for tooth extraction from may 2010 to jun 2010 . four thousand seven hundred and seventy nine patients were selected and included in our study . a questionnaire with relevant information including age , gender , site of tooth extraction , history of systemic disease , drug sensitivity , smoking , intake of ocp , women menstrual status , level of oral hygiene , tooth extraction with damage , curettage and extra irrigation , previous dental infections and used methods to relief pain , was filled for all samples . among them , just 28 patients returned with dry socket phenomena . all collected data was analyzed by spss software using descriptive analysis and fisher exact test . during 2-months of our study , only 28 people were diagnosed with dry socket . in our study , the average age of people with dry socket was 36.6113.59 years and without dry socket 42.8615.49 years [ table 1 ] . mean age in the group with and without dry socket the results presented higher prevalence in female than male ( 0.08% versus 0.04 ) [ table 2 ] and lower jaw was more involved than upper jaw ( 2.5 times ) [ table 3 ] . the incidence of dry socket in teeth extractions without injury had been reported 0.04% while in damage cases were 1% [ table 4 ] . dry socket distribution based on gender dry socket distribution based on extraction sit dry socket distribution based on tooth injury dry socket distribution based on tooth infection also some factors such as smoking , taking ocp and menstruation increased the chance of dry socket development , but these relations did not show any significant statistical difference ( p=0.911 , 0.584 and 0.302 respectively ) [ tables 68 ] . dry socket distribution based on smoking dry socket distribution based on oral contraceptive pill intake dry socket distribution based on menstruation status the more affected teeth in this study were third molar , first molar , second molar , premolars , canine and incisors , respectively . dry socket distribution based on kind of tooth the incidence of dry socket differed significantly with the level of oral hygiene and patients systemic disease . dry socket distribution based on oral health level dry socket distribution based on systemic disease totally , some factors showed significant correlation with dry socket occurrence including age , tooth infection , level of hygiene and systemic disease while other did not show any significant difference . a distinct etiology is not determined , but generally increase of fibrinolytic activities is considered as main etiologic factor that can dissolve the blood clot . when some anti - fibrinolytic agents were placed at the site of tooth extraction , incidence of dry socket was reduced . surgical damage leading to release of different tissue agents and inoculation of bacterial agents are two main factors for beginning of local fibrinolytic activities . the prevalence of dry socket in the present study was 0.6% that approximately was lower than previous studies , that it may be related to racial and geographical factors . amaratunga ( 3.5% ) , wagaiya ( 3.3% ) , ogini ( 4.1% ) , larsen ( 4.8% ) , ognnlewe ( 5.6% ) , singh ( 2% ) , bortoluzi ( 0.6% ) , khorasani ( 0.85% ) and kadkhodaei ( 2.9% ) have reported these prevalence . these wide ranges of prevalence are probably related to the differences between diagnostic criteria of this condition . in our study , the average age of people with dry socket was 36.6113.59 years and without dry socket 42.8615.49 years similar to the ogunlewe and khorasani study . it can be attributed to more acute periodontal infection and pericoronitis in this age range . generally , this complication can be seen more during third molar surgery and in fourth decade of life . the prevalence of dry socket incidence in our study in female was more than male ( 0/8% versus 0/4% ) but the difference was not statistically significant . amaratunga , ognnlewe , wagaiya , ogini and khorasani reported same results with predisposing factors such as malnutrition , iron and vitamin deficiencies , usage of oral contraceptive and menstruation in women . although , the incidence of dry socket in females are more than males , but did not show any statistical significant differences ( p=0.117 ) . in this study , the incidence of dry socket in mandible was more than maxilla ( 0.07 versus 0.05 ) but it was not statistically significant ( p=0.393 ) . study , incidence of mandible was 2/5 times , while in ogini was 3 times more than maxilla . some researchers believe that the etiology of more incidence of dry socket in lower jaw is related to more bone density , lower blood supply and reduced capacity of granulation tissue production.[58 ] the more affected teeth in this study were third molar , first molar , second molar , premolars , canine and incisors , respectively . approximately same as khorasani , wagaiyu and upadhyaya studies . the more involvement of third molar can be attributed to more bone thickness in this area , wideness of roots , lack of easy access for cleansing surgical site by the patients , and in addition , the amounts of the mandibular third molar surgery in respect to other teeth extraction . the incidence of dry socket in teeth extractions without injury had been reported 0.4% while in damage cases were 1% comparable to previous studies . also , the incidence of dry socket in cases with history of tooth infection was 0.09% and in cases without infection was 0.04% that was statistically significant . relative distribution of dry socket in addicted and non addicted individuals was not statistically significant ( p=0.911 ) while fazakerley , bortoluzzig and khorasani reported different findings . also the incidence of dry socket differed significantly with the level of hygiene and/or their systemic disease ( 0.015 and 0.004 respectively ) . the results of our study suggested that trauma during surgery or extraction and poor hygiene are important factors that increase the incidence of dry socket , these factors should be considered before and after tooth extractions . | background : dry socket is one of the most prevalent complications occurring after tooth extraction . the prevalence of such condition has been reported to be highly different , ranging from 0.5 to 68.4% . the etiology and pathogenesis of this entity are not clearly known and many related predisposing factors have been discussed .
the goal of this study was to evaluate the relative prevalence of this entity after tooth extraction and determine the contributing factors in patient referring to yazd dental clinics.materials and methods : this cross - sectional prospective study was carried out at yazd dental clinics ( from may 2010 to jun 2010 ) .
four thousand seven hundred and seventy nine patients were selected and included in our study .
characteristics such as : age , gender , site of extraction , number of extracted tooth , trauma during extraction , oral hygiene , smoking , systemic disease , menstrual cycle , history of dental infection and oral contraceptive pill intake were determined and data was analyzed using descriptive statistical analysis and fisher 's exact test .
p value 0.05 was considered significant.results:over the two - month period of the study , among of 4,779 patients , 28 patients returned with dry socket phenomena .
our results showed that the incidence of dry socket was 0.6% and females were more common involved than males ( 0.08% versus 0.04% ) .
the ratio of mandible to maxilla was 2.5 to1 and mandibular third molars were more often involved than other teeth .
trauma , poor oral hygiene and smoking had increased the incidence of dry socket.conclusion:the results of our study suggested that trauma during surgery or extraction and poor oral hygiene are important factors that increase the incidence of dry socket , these factors should be considered before and after tooth extractions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during the last decades food allergies ( fa ) and food intolerances ( fi ) have increased ( nwaru et al . , 2014 ) especially in children ( vargas et al . , 2011 ) , even if estimates of their actual incidence and prevalence are uncertain . the gold standard of diagnosis the double - blind placebo - controlled food challenge ( dbpcfc ) has been utilised only in a few epidemiological studies to define fa and fi ( soares - weiser et al . , most estimates are based on self - diagnosis or specific immunoglobulin e ( ige ) or skin - prick test sensitisation to common food allergens , tests that are both known to overestimate the actual frequency of fa and fi ( nwaru et al . , 2014 ) . people with fa and fi suffer symptoms that affect both their health and lifestyle ( cummings et al . , 2010 ) . hence , there is considerable interest in reducing the exposure risk and informing consumers on the first signs of an allergic reaction ( de silva et al . , 2014 ) so that they can treat themselves or seek qualified medical attention . symptoms may be mild and limited to the oral cavity but also generalised and severe allergic reactions may occur , sometimes involving multiple organs and systems such as the skin and mucosal tissues and the gastrointestinal , respiratory and cardiovascular tracts ( versluis et al . , 2015 ) . regulatory authorities generally require measures to control fa and fi such as proper store and management of some foods and ingredients , control programmes and good manufacturing practices to minimise the chance of cross - contamination in the processing facilities . some manufacturers have always used a precautionary labelling on a voluntary basis to alert consumers that some products might be subject to accidental contaminations . appropriate labelling of foods containing substances or products causing allergies and intolerances is indeed essential to help people to prevent and manage food adverse reactions . in the european union ( eu ) labelling of all foods and ingredients causing allergies and intolerances is established by regulation ( eu ) no 1169/2011 ( european commission , 2011 ) . annex ii of this regulation contains a list of ingredients or other substances or products ( such as processing aids ) with a scientifically proven allergenic or intolerance effect , that must be indicated on the labels , when used in the production of foods and still present therein , to enable consumers , particularly those suffering from a food allergy or intolerance , to make informed choices which are safe for them . symptoms may include hives , itching , swelling , eczema , vomiting , diarrhea and nausea but also , in some cases , anaphylaxis , which is potentially life - threatening either by breathing difficulties and/or a sudden drop in blood pressure ( sicherer et al . , 2000 ) . . symptoms of intolerance are sometimes vague and may include a combination of gastrointestinal problems , such as bloating and wind , diarrhea , nausea and indigestion , aggravation of eczema or asthma ( casellas et al . 1169/2011 as follows : soybeans and products thereof [ ( except : fully refined soybean oil and fat ; natural mixed tocopherols ( e306 ) , natural d - alpha tocopherol , natural d - alpha tocopherol acetate , and natural d - alpha tocopherol succinate from soybean sources ; vegetable oils derived phytosterols and phytosterol esters from soybean sources ; plant stanol ester produced from vegetable oil sterols from soybean sources ) ] ; milk and products thereof ( including lactose ) ( except : whey used for making alcoholic distillates including ethyl alcohol of agricultural origin ; lactitol ) . aim of this work was to search for soybean and lactose in pre - packed meat products and meat preparations and to evaluate the compliance of the food labels with the legislation in force . soybean protein was searched in n. 58 samples of meat products ( n. 6 wrstel pork , n. 2 wrstel pork / beef , n. 5 wrstel chicken / turkey , n. 2 wrstel chicken / cheese , n. 1 wrstel chicken , n. 7 mortadella , n. 3 salami hungarian type , n. 4 salami milano , n. 2 salami napoli , n. 3 cooked ham , n. 4 cooked shoulder ham , n. 1 smoked bacon , n. 1 bacon non smoked , n. 1 smoked bacon slice , n. 1 diced bacon non smoked , n. 1 diced smoked bacon , n. 1 stewed bacon , n. 3 lyoner with peppers , n. 1 lyoner classical , n. 1 cotechino , n. 2 hamburger cooked ham , n. 1 cooked meat in jelly , n. 1 meat pate , n. 1 luncheon meat , n. 1 cooked turkey breast , n. 1 roasted turkey , n. 1 cooked chicken breast , n. 1 cooked chicken in jelly ) produced in or distributed by 19 establishments ( a , b , c , d , e , f , g , h , i , j , k , l , m , n , o , p , q , r , s ) . fifty - five samples of meat products and n. 8 of meat preparations ( table 1 ) produced in 21 plants ( a , b , c , t , u , v , w , x , y , z , aa , ab , ab , ac , ad , ae , af , ag , ah , ai , aj , ak ) were tested for lactose . sampling for lactose was repeated 4 months later for products still present on the market . all samples were collected at retail in some provinces of campania region ( southern italy ) and selected on the basis of the absence of any information on the labels about the presence of the two searched allergens , with the exception of n. 5 samples tested for lactose , as reported in table 1 . the analyses were performed in the laboratory of the food hygiene unit of the department of veterinary medicine and animal production , university of naples using the elisa kit ridascreen fast soybean ( r - biopharm , darmstadt , germany ) , a sandwich enzyme immunoassay for the quantitative analysis of native and processed soy proteins in food . the limit of quantification is 2.5 mg kg soy protein . according to the producer s indications there is a weak cross - reactivity of 0.0017% to legumes of the tribe phaseoleae ( various species of beans ) and to legumes of the genus vicia ( 0.0003% ) . there is no cross - reactivity to other legumes like peanut , lentil , pea , lupine as well as milk ( casein , ( -lac - toglobulin ) or egg proteins . a spectrophotometer sirio s reader ( seac radim company , calenzano , italy ) was used . allergen concentration was calculated by use of a cubic spline function with the aid of the specific program ridawin software . the uv - method kit lactose / d - galactose used for lactose is an enzymatic method ( boehringer mannheim / r - biopharm , darmstadt , germany ) . lactose is hydrolysed to d - glucose and d - galactose at ph 6.6 in the presence of the enzyme -galactosidase and water . d - galactose is oxidised at ph 8.6 by nicotinamide - adenine dinucleotide ( nad ) to dgalactonic acid in the presence of the enzyme -galactose dehydrogenase . the amount of reduced nad formed in reaction is stoichiometric to the amount of lactose , and d - galactose . the detection limit is 7 mg l. lactose was determined according to the manufacturer s instructions ( www.r-bio-pharm.com ) using a spectrophotometer uv / vis jasco model v-530 ( jasco , oklahoma city , ok , usa ) . levels above the detection limit of 0.31 mg kg were found only in two samples , one wrstel from chicken and turkey ( 0.41 mg kg ) and one cooked turkey breast ( 0.93 mg kg ) , produced in two different establishments . lactose levels ranged from 0.11 up to 2.95 g/100 g. the concentrations were lower than 1 g/100 g in n. 57 samples ( 90.47% ) and lower than 2 g/100 g in n. 4 food items ( 6.35% ) . in the remaining two samples , one mortadella and one burger from cooked ham , levels of 2.95 and 2.90 , respectively , were observed ( table 1 , figure 1 ) . on the whole , following the described screening method , most examined samples were suspected positive to the searched allergens . soybean traces were found in 50 out of 58 examined samples but no indication for soy was present in the labels of these products even if indications on the presence / absence of many other allergens , mainly gluten , milk and products thereof , mustard , celery , pistachio , were reported . renov and tremlov ( 2009 ) , using an indirect competitive elisa method , searched soy proteins in 131 heat - processed meat product samples randomly purchased in the market chain of the czech republic and detected the allergen in 84% of the samples . ( 2015 ) , using commercial elisa kits , detected the presence of soybean in 29 out of 100 samples of different meat products ( boiled sausages with different composition , fermented sausages , meat tins ) taken from retail shops . no declaration concerning the allergen was reported in the labels of the samples examined in both researches . lactose levels above the detection limit were found in all the 63 samples tested for this substance even if indications concerning its presence were given only in the following five products ( using different wordings ) : wrstel from pork b60 and salami a72 reported lactose free ; mortadella ah68 reported produced in a plant where milk is used ; diced cooked ham of high quality aa74 reported it may contain milk and products thereof , and fresh sausage from turkey and chicken z89 reported it may contain milk . lactose was found in the four above mentioned meat products also at the second sampling and even at higher levels . this observation applies , however , to nearly all samples examined at the second control since higher ( sometimes double ) concentrations than those found at the first sampling were detected in 18 out of the 21 examined samples . the different wordings used to indicate the presence of traces protect food business operators from disputes following the consumption of their products but rely on the choice of the allergic consumer , who becomes the only responsible for the assumption of the food . in this regard it is interesting the outcome of the efsa scientific opinion on lactose thresholds in lactose intolerance and galactosaemia ( efsa , 2010 ) . ( 2010 ) , most individuals diagnosed with lactose intolerance or lactose maldigestion can tolerate 12 g of lactose as a single dose , particularly if taken with food , with no or minor symptoms . there is some evidence that many lactose maldigesters tolerate daily doses of 20 to 24 g of lactose if distributed throughout the day and consumed together with other nutrients . this notwithstanding , the panel on dietetic products , nutrition and allergies concludes that a single threshold of lactose for all lactose intolerant subjects can not be determined owing to the great variation in individual tolerances since symptoms of lactose intolerance have been described after intake of < 6 g of lactose in some subjects . some eu member states have set at national level lactose thresholds for foodstuffs other than those intended for infants . denmark , estonia , finland , norway , sweden , germany , slovenia , hungary set levels ranging from 10 to 100 mg/100 g final product for the use of the term lactose - free , while levels of 1 g/100 g final product were established in denmark , estonia , finland , norway , sweden , ireland for the term low lactose ( efsa , 2010 ) . according to these values most examined samples might be marked as low lactose , whereas for none of them the wording lactose - free might be used . the presence of allergens in traces is not a rare result and might be due to different reasons , including contaminated raw materials , accidental cross - contamination , manufacturing facilities that , despite a routine cleaning , still contain traces of allergens from a previous processing cycle , use of processing aids , means of transport and promiscuous installations . in many cases it is possible , even if it is not always easy , to control cross - contamination . however , it must also be recognised that it is difficult to separate the production lines that involve the use of allergens from those ones that should be free . the ideal solution would require separated lines but this is not always possible , especially in small or medium food plants . the possibility that , due to cross - contamination , small amounts of allergenic substances may be transferred to foods that should be allergenic - free is cause of concern not only for consumers but also for food business operators . when a minimum tolerable value of a specific allergen is not specified , even if measures are in place to control contamination , it is difficult for a manufacturer to decide whether to declare the presence of traces . the request of fixing minimum tolerance thresholds is therefore strongly supported by the producers . still , the solution of the problem is complex because it involves different skills and two conflicting requirements need to be solved : the request of the producers , especially those who can not ensure zero contamination mainly for structural reasons , and the opinion of the scientific community , which supports that , having allergic consumers a different sensitivity to the allergens , it is not possible to define a minimum level below which the food can be considered as safe . the problem of the cross - contamination is complicated by the risk of cross - reactivity with different allergens . in peanut - allergic patients a clinically relevant sensitisation to other legumes such as soybean , lupine , lentil , or pea occurs . in a group of 39 peanut - sensitised patients , 82,55 , and 87% of patients were also sensitised to lupine , pea , and soybean , respectively , whereas , based on dbpcfc , 29 - 35% had symptoms to these beans ( barre et al . , 2008 ) . ( 2013 ) showed that 60% of soy - allergic patients had a concomitant peanut allergy . the peanut allergic group often showed specific ige to soy extract , soy 2s and gly m 8 albumins and soy gly m 5 and gly m 6 cupins . barre et al . ( 2007 ) built models of vicilin - like allergens from peanut ( ara h 1 ) , walnut ( jug r 2 ) , hazelnut ( cor a 11 ) , and cashew nut ( ana o 1 ) using the x - ray coordinates of soybean gly m 5 to illustrate the structural similarity of these allergens . in addition , their study included one experiment with a pool of a number of sera from peanut - allergic patients , which indicated ige reactivity to the three allergens jug r 2 , cor a 11 and ana o 1 , as well as to the soybean allergen gly m 5 . for this reason , currently the only solution for food business operators is a careful application of self - monitoring plans to verify if they can guarantee the absence of traces . in conclusion , the results of the present research underline the need for careful controls and planning by operators as part of the self - control plans . it also highlights the need of attention on the part of the competent authorities , considering not only the consumers health but also the great attention the media pay to the topic . in fact , in order to make easier and safer food choices for people suffering from food allergies and intolerances it is mandatory to indicate the presence of products or substances causing allergy and intolerance not only on the label of prepackaged products , as previously required , but also for non - pre - packaged foods sold at retail or administered at any level , including all forms of public distribution and restoration , such as catering , restaurants and canteens , to reduce the risk for allergic people whenever having a meal outside their home . | food allergies and intolerances have increased during the last decades and regulatory authorities have taken different measures to prevent and manage consumers adverse reactions , including correct labelling of foods .
aim of this work was to search for soybean and lactose in meat products and meat preparations taken from retail in some provinces of campania region ( southern italy ) and to evaluate the food labels compliance with regulation ( eu ) n.1169/2011 .
soybean and lactose were searched using commercial kits in n. 58 samples of meat products produced in or distributed by 19 establishments , and in n. 55 samples of meat products and n. 8 of meat preparations produced in 21 plants .
all samples were selected on the basis of the absence of any information on the labels about the presence of the two searched allergens , with the exception of n. 5 samples tested for lactose .
traces of soybean were detected in 50 out of the 58 examined samples , at concentrations up to 0.93 mg kg1 . only two samples contained levels above the detection limit of 0.31 mg kg1 .
lactose levels ranging from 0.11 to 2.95 g/100 g , i.e. above the detection limit , were found in all the tested samples ( n. 63 ) .
the results of the present research underline the need for careful controls and planning by operators as part of the self - control plans , and deserve attention from the competent authorities considering not only the consumers health but also the great attention media pay to regulations providing consumers with information on food . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a significant challenge in science education is how to move students from thinking about science as a collection of facts to be memorized toward a deeper understanding of concepts and scientific ways of thinking . within undergraduate science , technology , engineering , and mathematics ( stem ) education , one approach that has garnered considerable attention is learning - to - write strategies designed to improve student scientific writing ( moskovitz and kellogg , 2011 ) . in contrast , there has been a relative neglect of writing - to - learn ( wtl)using writing to improve student understanding of content , concepts , and the scientific method . despite substantial evidence that writing can be an effective tool in student learning and engagement ( e.g. , poirrier , 1997 ; bangert - drowns et al . , 2004 ; brewster and klump , 2004 ; thaiss and zawacki , 2006 ; carter et al . , 2007 ; graham and perin , 2007 ; national survey of student engagement , 2008 ) and that wtl strategies can enhance knowledge acquisition and cognitive skill development in science disciplines ( rivard , 1994 ) , wtl practices are still not widely implemented . rivard 's insightful review of wtl in science disciplines identified several key issues that impede widespread acceptance and application of research findings . since different types of writing tasks result in different kinds of learning , we need to determine the links between writing and both critical thinking and conceptual change . furthermore , writing practices need to be studied in context , rather than in isolation , and research designs need to examine the interactions among specific learning objectives , personal characteristics ( e.g. , prior knowledge ) , models of instruction ( coverage vs. conceptual understanding ) , and specific writing tasks . the underlying metacognitive processes necessary for learning specific types of knowledge ( declarative , procedural , and conditional ) also must be identified and targeted by corresponding wtl strategies . since higher - order thinking involves restructuring knowledge , we need to determine what types of writing activities evoke this process of knowledge transformation . moreover , systematic , action - oriented research involving both qualitative and quantitative studies is needed to bridge the gap between researchers and practitioners . all these issues are still relevant today . given the promise of wtl and the specificity of rivard 's recommendations for further research , what accounts for the lack of progress in the intervening 18 yr , and what new approaches will be needed going forward ? we argue that two of the major deterrents to progress are the lack of a community of science faculty committed to undertaking and applying the necessary research , and the absence of a conceptual framework to systematically guide study designs and integrate findings . a third deterrent is the continuing disconnect between research and practice , which prevents instructors from identifying and incorporating appropriate wtl interventions . in an effort to address these issues , we undertook an initiative , supported by the national science foundation ( nsf ) and sponsored by the reinvention center ( a consortium of 65 u.s . research universities dedicated to the improvement of undergraduate education at research universities ) , to build a community of wtl / stem educators who would undertake a heuristic review of the literature and formulate a conceptual framework to guide collaborative studies and educational practices . although we acknowledge that some writing pedagogies can be resource - intensive to implement , there are ample sources highlighting more efficient and equally effective strategies for responding to student writing ( e.g. , spear , 1987 ; thaiss , 1998 ; elbow and belanoff , 1999 ; ferris , 2003 ; russell , 2005 ; volz and saterbak , 2009 ; bean and weimer , 2011 ) . therefore , we began with the premise that stem faculty reluctance to incorporate writing in their courses derives largely from a lack of awareness of the research on the effectiveness of wtl , since most published findings are in journals not regularly read by stem faculty and the majority of studies use methods unfamiliar to most scientists . rather than simply reviewing the literature yet again and delivering take - home messages to stem faculty ( a traditional approach ) , we hypothesized that a more effective approach would be to engage stem faculty directly in identifying promising wtl practices that improve undergraduate learning in stem education ( a community - based approach ) . our first step in building community was to form a wtl working group made up of 12 well - known experts in stem research and education ( table 1 ) . its members formulated the intellectual framework for the project and conducted a heuristic review of the literature that had four specific objectives : 1 ) create a searchable database of wtl resources for both educators and researchers ; 2 ) identify empirically validated and promising wtl practices ; 3 ) determine critical gaps in current knowledge ; and 4 ) lay the foundation for multi - university empirical studies of the effectiveness of wtl practices in improving student learning in stem disciplines . wtl working group members the second step was to engage the stem community in discussion of the most promising findings of the heuristic review and the implications for educational practice and research . our method was to offer a workshop on wtl in stem at the reinvention center 2010 conference . the workshop was attended by 80 stem faculty ( the majority of whom were nominated by their universities ' vice provosts ) who collectively considered how effective and promising wtl approaches could be applied in courses they teach , and who developed recommendations for the next steps in the research process to advance understanding of effective uses of wtl practices in stem education . the postworkshop evaluation survey responses ( n = 30 ) indicated that 76% of participants believe wtl will be an effective new tool in strengthening their students ' engagement ; 90% expressed openness to experimenting with wtl practices and encouraging their colleagues to do so also ; 79% expressed readiness to play a leadership role in the development of wtl at their institutions . these findings attest to the value of the community - based approach . more specifically , by engaging the stem community in both formulating the conceptual framework for the review of the literature and also in processing the findings with regard to the implications for both practice and subsequent research , we brought to bear a more diverse and inclusive perspective and yielded a set of recommendations more ready for implementation than the traditional approach of a single reviewer providing take - home messages . furthermore , the community - building process resulted in faculty not only expressing their readiness to participate in the development and implementation of wtl practices on their campuses but also undertaking planning of multi - university collaborative initiatives . several key findings identified in the seminal national research council report how people learn : brain , mind , experience , and school ( national research council , 2000 ) have implications for educational practices : learning changes the physical structure and functional organization of the brain and people construct new knowledge and understanding based on what they already know and believe . a related finding is that neurocognitive development continues through adolescence into adulthood , as the brain , particularly the prefrontal cortex , goes through a remodeling process ; these changes in the brain are paralleled by changes in the cognitive abilities supported by these regions , particularly the development of cognitive skills involved in executive functions , social cognition , and self - regulation ( blakemore and chowdhury , 2006 ) . this ongoing remodeling of the brain is the dynamic context in which undergraduate educational experiences are both impacted by and contribute to the development of higher - order cognitive processes and evaluative thinking . recent theory directs attention beyond the first - order cognitive processes that enable us to know about the world to the second - order metacognitiveknowing about knowingprocesses that enable us to regulate cognitive , emotional , and motivational processes during learning ( kuhn , 1999 ) . we now understand that successful learners are self - regulated , in that they employ a number of metacognitive processes while making meaning of information and their experiences . they elaborate on their existing knowledge , formulate relationships and make connections among items , develop self - explanations , and monitor their own understanding and comprehension . there has been a corresponding paradigm shift in education from a focus on the curriculum and the acquisition of content knowledge to developing the learners ' metacognitive skills and learning strategies ( mayer , 1992 ) by incorporating modeling to make thinking visible and disciplinary practices overt , providing graduated supported practice ( scaffolding ) , and encouraging reflection . writing affords one of the most effective means for making thinking visible , and wtl practices can foster learning of both content and modes of thinking characteristic of disciplinary experts . these advances in understanding about how people learn provide the salient conceptual framework for a common and compelling research agenda that we propose take the following general form : what is the role of [ specific wtl practice ] in improving [ disciplinary - specific learning objective ] through impacting [ specific cognitive , metacognitive , motivational , and/or emotional process ] , as a function of [ context variables , such as course level and class size ; discipline ; level , background , and goals of students ; and subdiscipline , local , and institutional factors ] ? having a common conceptual framework for research enables stem educators to undertake studies appropriate to their interests and particular context , while simultaneously participating in collaborative studies within and across universities , such that their findings contribute to the broader delineation and mapping of effective wtl practices . building on rivard 's review , we focused our review on empirical studies published after 1994 in which writing strategies were designed to improve undergraduates ' learning in stem disciplines . we examined 324 journal articles , books , book sections , conference proceedings , and reports that were identified through searches in the web of science and eric databases or suggested by the working group . of these sources , 203 specifically focused on wtl pedagogies within stem disciplines at the college level . we filtered studies through the lens of learning theory and used our conceptual framework to organize and categorize findings by level of course , discipline , and learning objectives . representative studies reporting empirically validated practices , as well as descriptive studies that are promising and warrant further trials , were identified for each cell of the resulting matrix ( table 2 ) . in addition , all studies were characterized by a number of additional key words to facilitate database searches ( table 3 ) . key citations from the wtl in stem bibliographic database , organized by learning outcomes , discipline , and course level , that represent exemplary descriptive studies , empirically validated studies , and promising practices gaps in the table do not necessarily indicate an absence of studies , but rather indicate that we did not identify illustrative studies in those areas . the database of 324 journal articles , books , book sections , conference proceedings , and reports ( located at http://bit.ly/fjudgo ) can be searched by key words ( table 3 ) . to search for multiple key words simultaneously , use the advanced search feature of the database and specify search fields as anywhere . our heuristic review found mostly descriptive case studies reporting on the effectiveness of particular wtl practices in improving students ' learning . building upon emerging efforts supported by the literature to move the research toward the analytical and experimental levels , we offer the following recommendations . acquisition of knowledge , but as the construction of understanding and meaning as a result of social interaction . it is already well recognized that improving learning is no longer just a matter of strengthening associations and habits , but involves a change in understanding ( schoenfeld , 1999 ; kuhn , 2005 ) . the implications of writing assignments in stem disciplines , therefore , should be reconceptualized to foster within students a shift from second , to establish the links between writing and both conceptual change and critical thinking within specific disciplines , learning objectives need to be operationally defined in terms of the disciplinary content , conceptual knowledge , or the ways of thinking that characterize experts in the field and must include the underlying processes proposed to mediate and moderate the effect of particular wtl practices on student learning ( table 2 ) . although there has been an enduring focus in higher education on developing critical thinking and reasoning as general skills across academic disciplines , research is increasingly providing support for the view that reasoning is situation or domain specific ( beyer et al . , 2007 ) third , studies must specifically seek to delineate the mechanisms of effect that is , the way in which a particular wtl practice brings about an improvement in student learning . how does writing cause learning to occur ? is it simply a matter of increasing time on task , or do students learn by applying cognitive and metacognitive strategies while writing ? in addressing these questions , four interrelated systems have been demonstrated to affect learning and therefore serve as potential intervention targets for wtl practices . cognition involves the skills to encode and recall information : rehearsal , elaboration , organization , and comprehension - monitoring learning strategies ( weinstein and mayer , 1985 ) ; and the processes of problem solving and critical thinking ( schraw et al . , 2006 ) . motivation involves those prior beliefs and attitudes that affect engagement with the task and the development and use of cognitive and metacognitive processes ( schraw et al . , 2006 ) . emotion involves anxiety associated with performance , for example test anxiety or stereotype threat , and the notion of troublesome knowledge , that is , when learning involves transformations in beliefs , commitments , and matters of identity ( meyer and land , 2005 ) . although several studies have looked at the impact of metacognition in writing to promote learning gains ( thompson et al . , 2005 , hanson and williams , 2008 ) , mechanisms of effect are rarely considered in wtl research in stem ( although shah et al . , 2009 , is a notable example of how mechanisms could be studied ) . fourth , the extant evidence supports the effectiveness of two types of wtl assignments in particular for improving learning in stem disciplines : 1 ) assignments that focus critical reflection on one 's epistemic beliefs regarding knowledge and understanding , problem solving , and application of knowledge ( e.g. , bangert - drowns et al . , 2004 , lerch et al . , 2006 ) ; and 2 ) assignments that engage the student in formulating a reasoned argument ( e.g. , kelly et al . , 2000 ; bradley , 2001 ; kelly and takao , 2002 ; lerner , 2007 ; armstrong et al . , 2008 ) . fifth , we urge the adoption of a hybrid research paradigm that builds on the insights , methods and rubrics , and interpretative frameworks that characterize wtl scholarship in the humanities and social sciences , while promoting the hypothesis testing , controls , and experimental paradigm typical of the cognitive and natural sciences ( van maanen , 1988 ; lave and wenger , 1991 ; kirsch and sullivan , 1992 ; handelsman et al . , 2004 ; schell and rawson , 2010 ) . such a hybrid paradigm would encourage multifactorial analytical and experimental - level studies that investigate and compare the impact of wtl practices on disciplinary - specific learning outcomes , using qualitative as well as quantitative assessment methods , as a function of hypothesized mediating and moderating variables , including emotional and motivational factors and learning context . finally , to address the gap between research and practice , we recommend that , in reporting on their work , researchers give attention to the kind of classroom situations and goals for which a specific wtl strategy is intended . such information is necessary if practitioners are going to be confident in their choice and implementation of an intervention . rivard 's conviction that the area of writing to learn in science is ideal for developing collaborative projects in classroom inquiry ( p. 976 ) remains as true today as it was 18 yr ago . what is different is that the combination of the emerging community of wtl/ stem educators , a learning - based conceptual framework , the database resulting from our heuristic review , and the adoption of the hybrid paradigm enables and empowers collaborative multi - university initiatives involving multidisciplinary teams of investigators to formulate and implement common protocols across multiple settings . | despite substantial evidence that writing can be an effective tool to promote student learning and engagement , writing - to - learn ( wtl ) practices are still not widely implemented in science , technology , engineering , and mathematics ( stem ) disciplines , particularly at research universities . two major deterrents to progress
are the lack of a community of science faculty committed to undertaking and applying the necessary pedagogical research , and the absence of a conceptual framework to systematically guide study designs and integrate findings . to address these issues , we undertook an initiative , supported by the national science foundation and sponsored by the reinvention center , to build a community of wtl / stem educators who would undertake a heuristic review of the literature and formulate a conceptual framework .
in addition to generating a searchable database of empirically validated and promising wtl practices , our work lays the foundation for multi - university empirical studies of the effectiveness of wtl practices in advancing student learning and engagement . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
physical activity , or rather the lack of it , has become a significant risk factor for chronic diseases in modern society . the consequences of hypokinesis are widespread across highly developed ( 1 3 ) and developing countries ( those with average and low income ) ( 4 , 5 ) . while confronting this phenomenon , public health campaigns around the globe put forward the increase of physical activity among inactive people as their primary goal ( 6 ) ( inactive meaning those who do not undertake vigorous or moderate physical activity , also known as sedentary society ) ( 7 ) . however , the sedentary lifestyle is not the exact opposite ofthe physically active lifestyle ( 2 , 8 , 9 ) . although both the lack of physical activity and prolonged sitting are serious risk factors for chronic diseases , their consequences are not dependent on each other ( 3 , 1012 ) . scientists have proven that the physiological effects of sedentary behaviours are often more harmful ( 13 ) than insufficient amounts of physical activity itself ( 14 , 15 ) . it appears that activities requiring low energy expenditure such as sitting down , watching tv , reading , working in front of a computer , computer games , lying down or napping , or driving a car ( 1.01.5 met ) ( 16 , 17 ) may have a stronger relationship with the risk of metabolic syndrome than the lack of any physical activity at all ( 14 , 18 , 19 ) . watching tv , in particular , is linked with obesity ( 20 , 21 ) , cardiovascular disease ( 22 , 23 ) or type ii diabetes ( 20 ) . on the other hand , the sedentary lifestyle is not necessarily asynonym for lack of physical acti - vity ( 24 ) , as shown by individuals who meet or exceed the recommended amount of physical activity , even though they spend a long time on sitting ( 16 ) . in this case , the consequences of a prolonged sitting might be independent of the protective effects of regular physical activity . there are individuals who do not meet the who recommendations , even though they do not spend a long time sitting . instead regardless of the relationships described above , prolonged sitting is akey problem facing public health ( 13 ) . it appears that adults employed on a full - time basis spend the majority of their working hours sitting ( 25 ) . the rapid increase in the use of a car as the main means of transport leads to congestion on the roads and , in consequence , extends travel time ( especially during the peak hours ) ( 26 ) . spending leisure time on watching first , it requires lower energy expenditure than any other sedentary behaviour ( for example , driving a car , writing or reading ) ( 28 , 29 ) . scientists report that in a typical american household , the tv is switched on for longer than 8hrs per day ( 27 ) , with the average above 2hrs per day ( 25 ) . the sitting / lying down time median in other investigated countries is 5h per day ( from 3h per day in portugal , brazil and columbia , up to 6h per day in taiwan , norway , hong kong and saudi arabia ) ( 4 ) . the above data indicate that attention should be turned towards understanding the mechanisms underpinning sedentary behaviours . further exploration of these behaviours should change the direction of health research ( 7 , 30 ) . qualitative and quantitative data collection is extremely important in this particular case , as it would contribute to our understanding of this constantly growing problem . the aim of the current investigation was to evaluate the sedentary behaviours among the polish population , with a particular focus on the relationship between these behaviours and the possibility of compensating their effects with various forms of leisure - time physical activities . the relationships between sitting time and individual factors of polish citizens ( age , gender , level of education ) and environmental factors ( the accessibility of the sports classes and venues , the ratings of these classes and the ratings of the local authorities work in the realm of sport and recreation ) are analysed in the current work . the survey was conducted between 10 october 2012 and 14 november 2012via computer - assisted telephone interviews ( cati ) . the interviews were administered by qualified and supervised surveyors who delivered the questions in a way that was equally easy to comprehend for all respondents . the research tools in the current investigation were the polish long version of international physical activity questionnaire ( ipaq ) and the bespoke survey on the determinants of sport activity among the polish population . the survey included questions about the frequency , duration , place and the type of sport for all activities . additionally , the participants were asked to rate the attractiveness of these classes and to provide ratings of the work done by local authorities within sport and recreation . the ipaq provided the information on physical activity in specific domains ( such as occupational , commuting , domestic chores , sports and leisure ) as well as the duration of sitting time during the weekdays and weekends ( 31 ) . the respondents were asked about the duration of sitting at work , at home , while studying and in their leisure time in the last 7 days prior to the survey . this included the time they spent sitting by the desk , sitting when visiting friends , while reading , watching tv or lying down ( sleep was not included ) . the time of sitting in / on the vehicles ( i.e. , in a car , on a bus or on a motorcycle ) was also specified in minutes per day . the total and average sitting times ( during the weekdays and weekends ) were calculated according to the formulae below . total sitting time min / week = sitting time in minutes during weekdays x 5 days + sitting time in minutes during weekend x 2 days average sitting time min / day= sitting time in minutes during weekdays x 5 days + sitting time in minutes during weekend x 2 days / 7 the total weekly duration of sitting was obtained by adding the time spent on commuting / transportation per week . for the purpose of the current study , only information on physical activity undertaken in leisure time ( in the last week prior to the start of the survey ) was used . after performing a standardised calculation of the durations and the frequencies of declared physical activities ( vigorous , moderate activities and walking ) ( 31 ) , and with the who recommendations on the amount of physical activity needed to maintain a good health taken into account , the respondents were divided into two groups : those who follow the recommendations ( n=874 ) and those who do not ( n=630 ) . furthermore , those who declared undertaking 150minutes of moderate physical activity or 75 minutes of vigorous physical activity per week ( or the equivalent combination of moderate and vigorous physical activity ) were classified as physically active . the investigated sample consisted of 1,505 polish citizens ( age range 1864 years old ) . they were selected through the stratified - quota sampling method , with the demographic variables such as age , gender , education and the place of residence as strata . the quotas were established proportionally , based on the data that were made accessible to the researchers by the central statistical office . furthermore , in order to increase the representativeness of the sample , a data - weighting procedure was usedfor the variables listed above . the quotas were proportionally assessed based on the data provided by the central statistical office ( data sources : national census of population and local data bank ) . the characteristics of the polish population statistical analysis was run on ibmspss statistics version 21 . the descriptive statistical analysis provided detailed characteristics of the dependent variables by using the mean ( x ) , median ( me ) and standard deviation ( sd ) . the kolmogorov - smirnov test was used for assessing whether the data are distributed normally ( the sitting time during the weekdays and weekends , the sitting time in the vehicles and the total sitting time were taken into account ) . given that the assumption of normality in the collected data was violated ( p<0.05 ) , further statistical analyses required use of chi and non - parametric tests such as u mann - whitney , kruskall wallis and wil - coxon . the significant differences between dependent and independent variables ( individual : age , gender , education , participation in sport for all ; environmental : the number of and the state of free and paid sports facilities , the costs and attractiveness of the classes offered by paid public sports and leisure centres , local authorities input in promoting physical activity ) were examined ( p<0.05 ) . the relationships between the time spent on sitting and the individual and environmental factors among polish citizens were investigated through log - linear analysis . the respondents were divided into two groups : those who spent more than 2545min per day on sitting and those who spent less than 2545min per day on sitting ( the median of the duration of sitting was the cutoff point ) . there were two analyses run separately : one taking into consideration the individual factors and one for the environmental factors . the strength of the relationship between these variables and the time polish citizens spend on sitting was expressed through the odds ratios ( or ) ( with 95% confidence intervals ) . the descriptive statistical analysis provided detailed characteristics of the dependent variables by using the mean ( x ) , median ( me ) and standard deviation ( sd ) . the kolmogorov - smirnov test was used for assessing whether the data are distributed normally ( the sitting time during the weekdays and weekends , the sitting time in the vehicles and the total sitting time were taken into account ) . given that the assumption of normality in the collected data was violated ( p<0.05 ) , further statistical analyses required use of chi and non - parametric tests such as u mann - whitney , kruskall wallis and wil - coxon . the significant differences between dependent and independent variables ( individual : age , gender , education , participation in sport for all ; environmental : the number of and the state of free and paid sports facilities , the costs and attractiveness of the classes offered by paid public sports and leisure centres , local authorities input in promoting physical activity ) were examined ( p<0.05 ) . the relationships between the time spent on sitting and the individual and environmental factors among polish citizens were investigated through log - linear analysis . the respondents were divided into two groups : those who spent more than 2545min per day on sitting and those who spent less than 2545min per day on sitting ( the median of the duration of sitting was the cutoff point ) . there were two analyses run separately : one taking into consideration the individual factors and one for the environmental factors . the strength of the relationship between these variables and the time polish citizens spend on sitting was expressed through the odds ratios ( or ) ( with 95% confidence intervals ) . the total sitting time of polish citizens ( during the weekdays , weekends and when commuting ) averages 9.45.1h / day ( 46.926.5h / week ) . it appears that there is no difference in the average sitting time during weekdays and weekends ( 4.02.8h / day ; 242.9169.1h / weekend 4.02.7h / day ; 240.8162.9h / week , respectively ) . the average time spent sitting in a vehicle was 78.4111.0min / day ( table 2 ) . the significant relationships were not found when the socio - demographic factors were taken into account , with one exception : gender . the results showed that men ( 251.1170 min / week ) spend significantly more time on sitting during weekends ( chi=45.0 ; p=0.04 ) than women ( 230.9155 min / week ) . average ( sd ) sitting time ( in min / day ) and the total sitting time ( in min / week ) of the polish population during weekdays , weekends , spent in mechanical vehicles ( when commuting ) depending on the socio - demographic factors engaging in any type of physical activity of a continued duration of 10 minutes in leisure time was declared by 67.8% of the polish population ( table 3 ) . it appears that participation in sport for all depends on gender ( chi=11.7 ; p<0.001 ) , age ( ch=58.7 ; p<0.001 ) and education ( ch=28.7 ; p<0.001 ) . men ( 48.0% ) , young adults ( aged 1824 : 61.1% ; aged 2529 : 52.5% ) and those educated to a degree level ( 56.7% ) participated in sport for all more often than the remaining groups of respondents . women ( 60.8% ) , those in the 5059 and 6064 age groups ( 34.5% and 31.5% , respectively ) and respondents with primary education ( 64.1% ) more often declared lack of engagement in physical activities . the most popular sports are cycling ( 21.2% ) , swimming ( 13.4% ) and running ( 12.2% ) . cycling as a main type of physical activity is declared mostly by the respondents who are in the age range of 5059 ( 44.7% ) and over 60 years old ( 42.6% ) . younger adults ( 1824 years old ) , on the other hand , choose swimming and running more of ten ( 26.9% and 35.2% , respectively ) . overall , both men and women tend to choose cycling as their favourite type of sport ( 31.1% and 42.9% , respectively ) . the frequency and duration time of sport activities in which polish citizens ( n=1,505 ) participated in their leisure time despite a relatively high proportion of respondents declaring participation in sport for all , only 9.6% of polish citizens exercise on a daily basis ( table 3 ) . as many as 13.9% of the respondents engage in a physical activity 34 times per week and 24.3% exercise sporadically ( a few times per month or year ) . the results show that more men than women exercised 12 times ( chi=7.3 ; p<0.05 ) and 3itimes ( chi=11.0 ; p<0.05 ) per week . the proportion of men who did sports 1 2 times per week was 22.8% , whereas this proportion for women was 17.3% . the same pattern was shown for the group of people declaring engaging in a physical activity 34 times per week ( 16.9% of men and 11.0% of women ) . interestingly , women declared lack of any physical activity more often than men did ( 35.2% vs. 29.2% ; chi=6.2 ; p<0.05 ) . furthermore , women who were physically active reported shorter durations of their exercises than men : they worked out for less than 30min / day more often than mendid ( 35.3% and 18.9% , respectively ; chi=69.1 ; p<0.05 ) . however , when the durations of more than 60min / day were considered , polish womenstrainings were less frequent than those of men ( 26.8% and 45.2% , respectively ; chi=42.4 ; p<0.05 ) . it appears that women participated in organised classes more often than men did ( 34.3% , 16.2% , respectively ; chi=42.8 ; p<0.05 ) , whereas men reported using public sports facilities , free ( 19.5% and 19.8% ; chi=8.7 ; p<0.05 ) and paid ( chi=43.1 ; p<0.05 ) , more than women ( 12.5% and 6.1% ) . the proportion of people who met who health recommendations , based on the type of activity ( vigorous , moderate and walking ) undertaken in leisure time , was 58.1% ( in which the proportion of men was 57.7% and of women despite the lack of significant differences when age , gender and education were taken into account , there was a relatively high proportion of physically active people in the 4049 age group ( 62.7% ) . on the other hand , the analysis of individual and environmental factors showed that the only factor that determines the duration of sitting of more than 2545 min / week is participation in sport for all ( see table 4 ) , where the value of 2545min / week is a median of the total sitting time declared by the respondents . according to the results , the odds ratios of sitting above the median is higher ( or=1.33 [ 1.031.72 ] ) among those who do not engage in any form of physical activity in their leisure time ( 54.5%vs . individual factors determining the sitting time , odds ratios ( or ) and the 95% confidence intervals of those sitting below and above 2545min / week the remaining factors , such as the accessibility of sports facilities , the attractiveness of the classes and facilities and the activities of the local authorities within the area of sport and recreation , do not play an important role in the longer durations of sitting ( see table 5 . ) . it appears that the sitting time of the polish population is not dependent on the who health recommendations being met ( 58.1% ) or not ( 41.9% ) . environmental factors determining the sitting time , odds ratios ( or ) and the 95% confidence intervals of those sitting below and above 2545min / week the current investigation conducted on a representative sample of the polish population shows that the duration of sitting ( regardless of participation in any kind of physical activity ) is a very important risk factor for chronic diseases . it appears that the time spent sitting has increased in comparison with the data from 2009 ( from 343min / day to 401.8min / day ) ( 32 ) . at the moment , polish citizens spend 2812.4159 - 3.9min / week sitting , which is very close to the numbers reported in the developed countries . for instance , british citizens sit 53.823.0h / week ( roughly 3228min / week ) , the dutch 60.021.0h-/week ( roughly 3602min / week ) and the americans from 53.019.8 to 56.023.5h / week , depending on the data sources ( roughly 3361 3860 min / week ) ( 33 ) . the polish population s results are higher than those of countries such as czech republic ( 2295.5 min / week ) ( 34 ) , portugal ( 23071107 min / week ) ( 35 ) and belgium ( 21911057 min / week ) ( 35 ) . the median sitting time of polish citizens is 2545 min / week , which is higher than in norway , where , depending on the level of education , men are more likely to spend their time sitting than women ( 3544h / week and 3240h / week , respectively ; these values in minutes per week would be 21002640 for men and the spanish also spend less time sitting than polish people : 373.1184.6min / day ( roughly 2612min / week ) ( 37 ) . however , it should be pointed out that the cited data were compared with the total time the polish population devoted to sitting ( during weekdays and weekends ) , including the time spent in vehicles when commuting ( the total without commuting time is 2418.81430.3 min / week ) , whereas the investigations conducted in the czech republic considered only the weekdays and the spanish research excluded the time spent sitting in mechanical vehicles ( when commuting ) . furthermore , some of the authors ( 35 , 36 ) did not specify what was included in the sitting time . additionally , it needs to be noted that in the research to date , there is a lack of sufficient evidence that the questions in the surveys were used appropriately ( the met thresholds have not been established ) . this , in turn , suggests that the sitting - time indicator relies solely on the respondents declarations , which creates problems when comparing the data across different populations and does not seem to be a reliable measure of the total sitting time of any investigated population . regardless of the methodological differences , it is clear that the duration of sitting among the polish population has increased and their physical activity level is insufficient ( only 9.6% of respondents exercise every day and 13.9% exercise 34 times per week ) . thesenumbers are alarming and concerning , given that , according to some researchers , prolonged sitting significantly decreases the time people spend on exercising ( 39 ) . furthermore , as mentioned in the introduction , spending leisure time on sitting might decrease the possibility of meeting the who health recommendations ( 2 ) . additionally , it may correlate with metabolic diseases ( 4043 ) , obesity ( 40 ) and high blood pressure ( 39 ) among those who are not physically active . the current findings suggest that polish citizens who are not physically active are 1.33[1.031.72 ] times more exposed to sitting durations longer than 2545min / week ( > 6h ) . it is worrying that within the investigated sample , the authors did not find a relationship between the sitting durations and their healthy behaviours ( implementation of the recommended amount of physical activity ) . this suggests that polish citizens do not link the need to spend their leisure time actively with preventing asedentary lifestyle . interestingly , they declare participation in sport for all ( 70% ) , but they do not see the need to exercise on a regular basis . this may be a result of old habits or a lack of awareness of healthy lifestyle behaviours . meanwhile , chu and moy ( 39 ) argue that even those who meet these recommendations but sit more than 9.3h per day are in the 3.82 times greater risk of developing metabolic syndrome . it is therefore expected that this problem may also appear among the most active polish citizens ( those in the 4049 age group ) in the future . at the moment , the majority of the respondents in this particular age group ( 62.7% ) meet who recommendations , but their sitting time is longer than for those in other age groups ( 252.4173.5min / day ) . despite the fact that sedentary behaviours form an independent risk factor for modern diseases , it seems appropriate to ask whether the duration of sitting among the polish population is linked with the opportunities ( or the lack of thereof ) of undertaking leisure physical activity in their place of residence . unfortunately , the database in the explored topic is rather limited and provides mostly information promoting healthy lifestyle choices ( 44 , 45 ) . the majority of research focuses on the relationship between the undertaken physical activity and urbanisation ( 46 , 47 ) or pollution ( 48 ) ( particularly in the context of the means of transportation choice ) ( 49 ) . the research to date also provides analysis of the relationship between environmental factors ( i.e. , access to the sports facilities ) and leisure physical activity ( 50 , 51 ) . however , the data provided mainly concern the citizens of wealthy countries ( 5254 ) . in general , the health behaviours among people are the results of their individual characteristics ( such as income , age or education ) and the environmental factors ( such as the local authorities activities , sport and recreation infrastructure , physical activity initiatives , or the use of land ) ( 5557 ) . the results of the current study confirm that men ( 48.0% ) , young adults ( aged 1824 : 61.1%;aged 2529 : 52.5% ) and those educatedto a degree level ( 56.7% ) participate in the sport for all initiative more often than the remaining subjects . these variables appear to be significant factors supporting the healthy behaviours of the respondents ( 58 , 59 ) . however , many reports indicate that people are more likely to undertake a physical activity if they have the support of their social groups ( 60 ) and the governmental plans ( 61 ) . the marketing strategies ( 62 ) , access to equipment ( 58 , 63 ) , financing public sport facilities ( 45 ) , promoting active ways of spending leisure time ( 64 ) , safety , andsupport of decision - makers on development and implementation of sport initiatives ( 65 ) strongly influence the development of attitudes and behaviours of those who live in environments that do not actively promote physical activity and present many barriers in accessing sport facilities . this seems to be an issue for the people living in poor areas : they have to overcome more obstacles when making healthy choices ( 63 , 6668 ) . this suggests that anincrease in accessibility of free sports facilities and better focus on the safety of public places may encourage those of poorer backgrounds to increase their physical activity ( 69 ) . it appears that people are more active when they have access to sport facilities , both free and paid ( 70 ) . in rural missouri , for instance , making the hiking trails more accessible created an opportunity to promote physical activity among the groups of people who were at greatest risk of becoming physically inactive , especially among women and those with a lower socio - economic status ( 60 ) . the closeness of golf courses has increased physical activity among older people ( 71 ) . however , providing free facilities does not itself lead to anincrease in physical activity , as shown in the current study ( 72 ) . despite the fact that 8.4% of the polish population take advantage of free sports facilities , there is no relationship between these activities and the time of sitting . this yields the effective initiatives that would raise the awareness of the problem and the consequences of the sedentary lifestyle . the plan for educating people about the ways to fight the sedentary behaviours is also needed . unfortunately , the results of the current work suggest that a more intense campaign promoting a healthy lifestyle is needed in poland . as revealed by the analysis , the environmental factors ( with the exclusion of one case of participation in the sport for all initiative ) did not correlate with the sitting time among the polish population . the results showed that there was no relationship between the duration of sitting longer than 6hrs per day and the recommended by who amount of physical activity , the number and state of free and paid sports facilities , the cost and attractiveness of classes , and the engagement of local authorities in the area of sport and recreation . this may indicate that local interventions are not effective , polish citizens prefer passive recreation and a lack of awareness in this matter . it should be underlined that there is a link between lack of physical activity and the risk of prolonged sitting ( or=1.33[1.031.72 ] ) . moreover , the recent natpol reports reveal that the level of physical activity among the polish population is ( at best ) moderate ( 73 ) . additionally , the upcoming changes in the age structure within the population and a desperately low fitness level of polish youth may increase the proportion of inactive people . with all the above in mind , the authors present the following conclusions :
the immediate cooperation with the ministry of health concerning the increase of polish citizens awareness of the risks brought by sedentary lifestyle is necessary.it is necessary to intensify the consistent efforts aiming at the development of the environments promoting anactive lifestyle among the polish population at their place of residence . the focus of these efforts is also directed towards prevention of the sedentary lifestyle ; these efforts should include planning more effective strategies aiming to engage more local communities in active recreation , partnerships development and the exchange of experiences and information about the obstacles people have overcome.the suggestion that future recommendations forthe amount of physical activity include guidelines intervening in the time people spend on sitting seems well justified.further investigation of the environmental factors with the widest scope possible is advised . the immediate cooperation with the ministry of health concerning the increase of polish citizens awareness of the risks brought by sedentary lifestyle is necessary . it is necessary to intensify the consistent efforts aiming at the development of the environments promoting anactive lifestyle among the polish population at their place of residence . the focus of these efforts is also directed towards prevention of the sedentary lifestyle ; these efforts should include planning more effective strategies aiming to engage more local communities in active recreation , partnerships development and the exchange of experiences and information about the obstacles people have overcome . the suggestion that future recommendations forthe amount of physical activity include guidelines intervening in the time people spend on sitting seems well justified . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | abstractbackgroundthe aim of the current investigation was to evaluate the sedentary lifestyle of the polish population and its link with prolonged sitting in light of individual and environmental factors.methodsthe sample consisted of 1505 polish people between 18 and 64 years old .
the computer - assisted telephone interview ( cati ) survey was conducted with the polish version of international physical activity questionnaire ( ipaq - lf ) and the survey of the determinants of a sport activity among the polish population .
the relationships between the time spent sitting and the individual and environmental factors among polish citizens were investigated through log - linear analysis.resultsthe total time polish people spent sitting was 2812.41593.9 min / week . during the weekend , men ( chi2=45.0 ; p=0.04 ) spent significantly more time sitting than women ( 251.1170.1min / week , 230.9155.0 min / week , respectively ) . despite the relatively high proportion of people declaring participation in the sport for all initiative ( 67.8% ) ,
only 9.6% of polish people undertake a physical activity on a daily basis .
the odds ratios above the median ( > 2545 min / week ) are higher ( or=1.33 ; 95% ci=1.031.72 ) for those who are not physically active ( 54.5% vs. 45.5% ) .
there was no relationship between prolonged sitting time and the environmental factors.conclusionit is necessary to increase consistent efforts to create an environment that would successfully promote anactive lifestyle among polish citizens in their place of residence and prevent sedentary behaviours within this population .
the recommendations for physical activity should include the guidelines intervening in the time people spend sitting . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
at present , hepatitis b virus ( hbv ) infection remains one of the major global public health problems . over one - third of the world s population ( about 2 billion people ) has been infected with hbv at some time in their life , and about 350 million of those remain infected . the distribution of hbv throughout the world shows that , unfortunately , china is an area where hbv infection is highly prevalent . according to a 2008 nationwide survey of china by the ministry of health ( moh ) , there were approximately 93 million chronic hbv carriers . to reduce morbidity and mortality from chronic hbv infection , current antiviral agents for the treatment of chb include interferon ( ifn ) and nucleoside analogues . as a kind of immunomodulator , ifn has been used since the early 1980s in attempts to suppress hbv replication . although treatment with ifn may lead to a durable response , its unpleasant adverse effects ( flu - like symptoms , fatigue , leucopoenia , hair loss , anorexia , etc . ) , and high cost limited its use . nucleoside analogues such as lamivudine ( lmv ) , adefovir , entecavir and telbivudine then became the most common drugs used for antiviral therapy . these chemically synthesized drugs can imitate natural nucleosides , and are integrated into newly synthesized hbv dna , causing chain termination or competitively inhibiting the reverse transcriptase ( rt ) activity of the viral polymerase to restraint viral replication . lmv is the first safe oral nucleoside analogue approved for the treatment of hbv by the fda ( december 1998 ) , and it has become the clinical drug of first choice because it is effective and well - tolerated , although it requires long - term therapy . however , long - term treatment may induce mutations . through the sequencing analysis of the hbv gene , a series of mutations associated with lmv at diverse positions in the rt domain have been identified , located in codon positions 180 , 204 , 173 [ 1315 ] , 213 and 207 , and others . the existence of those mutations may not only cause distinct virological responses in patients , but also cause drug resistance and eventually lead to treatment failure . the development of different drug resistance mutations was influenced by the characteristics of patients and the hbv itself . however , there have been few investigations on whether different hbv genotypes may affect the incidence of lmv resistance mutations . the aim of the present study was to investigate chb patients in southern china to determine the prevalence characteristics of hbv genotypes and lmv resistance mutations , the association of hbv genotypes / lmv resistance mutations with the age / sex characteristics of those patients , as well as the relationship between hbv genotypes and lmv resistance mutations . this study was approved by the ethics committee of west china hospital , sichuan university , and written informed consent was obtained from all participants . between august 2009 and july 2010 , 185 consecutive patients with chb were recruited from the hepatitis clinic of west china hospital of sichuan university . the patients were positive for hepatitis b surface antigen ( hbs ag ) , had hbv viral loads 3 log copies / ml , and did not have other infectious diseases such as human immunodeficiency virus , hepatitis c or hepatitis d. blood samples ( 510 ml ) were collected from all patients , using disposable syringes under aseptic conditions . sera were separated and stored in a freezer at 20c until the time of use . hbv dna was extracted from 200 l of serum using chelex 100 ( ke hua bio - engineering co. ltd . , hbsag was detected by enzyme - linked immunosorbent assay . to measure the quantity of hbv dna , the light cycler 480 system for real - time pcr ( roche diagnostics , shanghai , china ) the amplification conditions of pcr consisted of 42c for 5 min and 94c for 5 min , 40 cycles of 94c for 7 sec , and 60c for 50 sec , followed by a final primer extension at 72c for 5 min . sequencing was performed using an abi 3130 genetic analyzer ( applied biosystems , foster city , ca , usa ) . mutations were detected by using the hepatitis b virus drug resistance mutations and genotypes detection kit ( yuan qi bio - medicine co. ltd . , the hbv genotypes were determined by using a web - based genotyping tool for viral sequences from the national center for biotechnology information ( ncbi ) . the nucleotide sequences were compared with those of the hbv genotypes at ncbi ( nucleotide locus af286594 ) . data were analyzed using tests for categorical variables and t tests for continuous variables when appropriate . values were expressed as mean sd for normally distributed variables , and median for non - normally distributed variables . the effects of age , sex and hbv genotypes on lmv mutations were estimated as odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) using binary logistic regression . all statistical analysis was performed using the statistical package for the social sciences ( spss 17.0 for windows ; spss inc , chicago , il , usa ) . this study was approved by the ethics committee of west china hospital , sichuan university , and written informed consent was obtained from all participants . between august 2009 and july 2010 , 185 consecutive patients with chb were recruited from the hepatitis clinic of west china hospital of sichuan university . the patients were positive for hepatitis b surface antigen ( hbs ag ) , had hbv viral loads 3 log copies / ml , and did not have other infectious diseases such as human immunodeficiency virus , hepatitis c or hepatitis d. blood samples ( 510 ml ) were collected from all patients , using disposable syringes under aseptic conditions . sera were separated and stored in a freezer at 20c until the time of use . hbv dna was extracted from 200 l of serum using chelex 100 ( ke hua bio - engineering co. ltd . , hbsag was detected by enzyme - linked immunosorbent assay . to measure the quantity of hbv dna , the light cycler 480 system for real - time pcr ( roche diagnostics , shanghai , china ) the amplification conditions of pcr consisted of 42c for 5 min and 94c for 5 min , 40 cycles of 94c for 7 sec , and 60c for 50 sec , followed by a final primer extension at 72c for 5 min . sequencing was performed using an abi 3130 genetic analyzer ( applied biosystems , foster city , ca , usa ) . mutations were detected by using the hepatitis b virus drug resistance mutations and genotypes detection kit ( yuan qi bio - medicine co. ltd . , the hbv genotypes were determined by using a web - based genotyping tool for viral sequences from the national center for biotechnology information ( ncbi ) . the nucleotide sequences were compared with those of the hbv genotypes at ncbi ( nucleotide locus af286594 ) . data were analyzed using tests for categorical variables and t tests for continuous variables when appropriate . values were expressed as mean sd for normally distributed variables , and median for non - normally distributed variables . the effects of age , sex and hbv genotypes on lmv mutations were estimated as odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) using binary logistic regression . all statistical analysis was performed using the statistical package for the social sciences ( spss 17.0 for windows ; spss inc , chicago , il , usa ) . a p value of less than 0.05 was considered statistically significant . all 185 samples were successfully sequenced . in total , 91 ( 49.19% ) of these lmv resistance substitutions ( lmv resistance mutations group ) , 88 ( 47.57% ) were had no drug resistance mutations ( without mutations group ) , the remaining 6 ( 3.24% ) patients mutations were irrelevant to lmv . six lmv - related mutation sites were detected : rt204 , rt180 , rt207 , rt173 , rt213 , and rt181 . the vast majority of patients ( 78/91 , 85.71% ) had the mutations at site rt204 , and a compensatory mutation at position rt180 was detected in 35 ( 35/78 , 44.87% ) of these patients . rt180 mutation always existed along with abnormal rt204 ( 35/36 , 97.22% ) , and only 1 was accompanied with rt181 . it is obvious that the pattern of rtm204i alone was dominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) , while other mutation patterns were rare . age and sex characteristics between lmv - resistant patients and patients without any mutations are shown in table 2 . no significant difference was observed between the 2 groups ( age : t=0.434 , p>0.05 ; sex : =3.07 , p>0.05 ) . figure 1 shows the distribution and frequency of age between the 2 groups . there was no significant difference between 2 groups with various age ranges in both females and males . for the 91 lmv - resistant individuals , the isolates of genotypes b and c were 57 ( 62.64% ) and 34 ( 37.36% ) , respectively . table 2 shows the incidence rates of lmv resistance were not significantly different between hbv genotypes b and c ( =0.02 , p>0.05 ) . regression analysis showed that patient age , sex and hbv genotypes did not have significant effects on lmv mutation ( or : 1.01 , 95% ci : 0.981.04 , p=0.64 ; or : 0.51 , 95% ci : 0.241.08 , p=0.08 ; or : 0.91 , 95% ci : 0.491.68 , p=0.76 ) . the age and sex distribution of the 115 patients with genotype b hbv were 35.4610.73 years and the males / females ratio was 89/26 , similar to those of the 70 patients with genotype c , which were ( 34.949.48 ) years and a male / female ratio of 58/12 ( comparing mean age : t=0.332 , p>0.05 ; sex : =0.80 , p>0.05 ) . in the 91 patients with lmv resistance mutations , the mean age and sex ratio of patients infected with hbv genotype b were similar to those of patients infected with hbv genotype c. ( mean age : t=0.317 , p>0.05 ; sex : =1.67 , p>0.05 ) ( table 3 ) . the genotype distributions and frequencies of patients with various mutation patterns were counted , calculated and summarized in table 4 . rtm204i mutation in genotype b ( 45.61% ) was more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) ; however , the incidence rates of other mutation patterns were not significantly different between genotypes b and c. all 185 samples were successfully sequenced . in total , 91 ( 49.19% ) of these lmv resistance substitutions ( lmv resistance mutations group ) , 88 ( 47.57% ) were had no drug resistance mutations ( without mutations group ) , the remaining 6 ( 3.24% ) patients mutations were irrelevant to lmv . six lmv - related mutation sites were detected : rt204 , rt180 , rt207 , rt173 , rt213 , and rt181 . the vast majority of patients ( 78/91 , 85.71% ) had the mutations at site rt204 , and a compensatory mutation at position rt180 was detected in 35 ( 35/78 , 44.87% ) of these patients . rt180 mutation always existed along with abnormal rt204 ( 35/36 , 97.22% ) , and only 1 was accompanied with rt181 . it is obvious that the pattern of rtm204i alone was dominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) , while other mutation patterns were rare . age and sex characteristics between lmv - resistant patients and patients without any mutations are shown in table 2 . no significant difference was observed between the 2 groups ( age : t=0.434 , p>0.05 ; sex : =3.07 , p>0.05 ) . there was no significant difference between 2 groups with various age ranges in both females and males . only 2 genotypes were identified in 185 patients b ( 115 , 62.16% ) and c ( 70 , 37.84% ) . for the 91 lmv - resistant individuals , the isolates of genotypes b and c were 57 ( 62.64% ) and 34 ( 37.36% ) , respectively . table 2 shows the incidence rates of lmv resistance were not significantly different between hbv genotypes b and c ( =0.02 , p>0.05 ) . regression analysis showed that patient age , sex and hbv genotypes did not have significant effects on lmv mutation ( or : 1.01 , 95% ci : 0.981.04 , p=0.64 ; or : 0.51 , 95% ci : 0.241.08 , p=0.08 ; or : 0.91 , 95% ci : 0.491.68 , p=0.76 ) . the age and sex distribution of the 115 patients with genotype b hbv were 35.4610.73 years and the males / females ratio was 89/26 , similar to those of the 70 patients with genotype c , which were ( 34.949.48 ) years and a male / female ratio of 58/12 ( comparing mean age : t=0.332 , p>0.05 ; sex : =0.80 , p>0.05 ) . in the 91 patients with lmv resistance mutations , the mean age and sex ratio of patients infected with hbv genotype b were similar to those of patients infected with hbv genotype c. ( mean age : t=0.317 , p>0.05 ; sex : =1.67 , p>0.05 ) ( table 3 ) . the genotype distributions and frequencies of patients with various mutation patterns were counted , calculated and summarized in table 4 . rtm204i mutation in genotype b ( 45.61% ) was more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) ; however , the incidence rates of other mutation patterns were not significantly different between genotypes b and c. lmv , the major oral nucleoside analogue , was approved for the treatment of chronic hepatitis b in china in 1999 . however , it has the highest resistance rate in patients receiving long - term therapy . about 20% of patients taking lmv for 1 year develop resistance , and the resistance rate is 70% for patients who take lmv for 5 years . this study showed that the incidence rate of lmv resistance in southern china reached 49.19% , which was much higher than that of other nucleoside analogues ( 3.24% ) . to date , 8 genotypes ( a to h ) of hbv have been identified world - wide . it was previously reported that genotype c is predominant in the regions north of the yangtze river , while genotype b is more frequent in southern china , and genotypes e , f , g and h were not found in any of the patients studied . in this study we found genotypes b ( 62.16% ) and c ( 37.84% ) in 185 chb patients from sichuan province , which is considered to be part of southern china . studies have reported that in lmv treatment of chb , resistance primarily took place in hbv with genotypes b and c , whereas no difference in rates of resistance has been observed between the 2 genotypes . our results are consistent with these studies , indicating that there is nt a significant difference in the incidence of lmv resistance between genotypes b and genotype c. it was reported that in china chb patients with genotype b were younger in age and more likely to be males , compared to those of genotype c ( 31.412.3 vs. 33.312.2 , p=0.01 ; 16.9% vs. 22.4% , p=0.03 , for genotypes b and c , respectively ) . the mean age of lmv - resistant patients infected with hbv of genotype c ( 39.111.4 years old ) were significantly older than that of genotype b ( 33.79.7 years old ) ( t=6.55 , p<0.01 ) . however , in our study the mean ages of lmv - resistant patients were not significantly different between genotypes b and c. this discrepancy may be caused by the different sampling in our study , as we chose mainly southern chinese and the sample size of our study is relatively small . thus , further investigation is needed to shed light on the age and sex tendency in genotypes b and genotype c. as the reverse transcriptase lacks a proofreading function , hbv has a high mutation rate . our results show that lmv resistance may be highly related to mutations at site rt204 of the ymdd motif . and another mutation position , rt180 , which is also located in the ymdd motif and next to rt204 , always compensates for the mutation at rt204 . these findings agree with the hypothesis that the most frequent mutations are rtl180 m and rtm204i / v [ 2326 ] . otherwise , amino acid change at position rt181 in the rt domain could induce cross - resistance to lamivudine and adefovir , and rt173 , rt207 and rt213 sites were known as the common compensatory mutations to confer reduction in susceptibility to lamivudine . according to a previous study , about one - third of chb patients had rt204 mutation . the frequency of rt204 mutation in our study was 42.16% ( 78/185 ) ; 96.30% of the patients with rtm204v also had rtl180 m , while 93.48% of the patients with rtm204i did not . this verifies that the rtm204v mutations are always accompanied by rtl180 m , while rtm204i mutations are not . the pattern of rtm204i alone was predominantly observed ( 36.26% ) , followed by rtm204v + rtl180 m ( 23.08% ) . the rtm204i alone mutation in genotype b ( 45.61% ) was significantly more frequent than that in genotype c ( 20.59% ) ( =5.77 , p<0.05 ) . xu lj et al . reported the incidence rate of rta181v / t mutation in genotype c was significantly higher than that in genotype b. we also identified this mutation ; however , the frequencies are basically the same as in genotypes b and c. the clinical significance of this mutation requires further investigation . other mutations and mixed combinations were also observed ( rtm204i+rtv207m / l , rtm204i+rtv173l , rtm204i+rts213 t , rtm204v+rtl180m+rtv173l / m , rtm204v+rtl180m+rtv207 m , rtm204i / v+rtl180m+rts213 t ) , but with the relatively small sample size in this study , it would be inappropriate to draw strong conclusions on the distributions of those genotypes in southern china . we intend to expand the sample size to improve this part of the data in future research . our study concludes that lmv has very high resistance incidence , and hbv with genotypes b and c are the main prevalent strains among chb patients in southern china . there was no significant difference between genotype b and genotype c in the incidence of lmv resistance . the rtm204i pattern in lmv - resistant patients infected with genotype b hbv is much more common than that in patients infected with genotype c hbv . considering the general prevalence of lmv resistance in southern china , testing before treatment is a rational practice for optimal therapeutic decision - making . | summarybackgroundlamivudine ( lmv ) , as the preferred oral drug for use in treatment of hbv , always results in development of resistance mutations after long - term treatment . in this study we investigated chronic hepatitis b ( chb ) patients in southern china to determine whether different hbv genotypes affect the incidence of lmv resistance mutations.material/methodsthe study recruited 185 chb patients living in southern china .
enzyme - linked immunosorbent assay was used to test for hbv serological markers , and hbv dna was quantified by real - time pcr .
sequencing was performed to detect hbv genotypes and mutations.resultsthere were 49.19% ( 91/185 ) chb patients with hbv resistant to lmv .
only 2 genotypes were found : b and c ; 62.16% ( 115/185 ) of patients were infected with genotype b hbv and 37.84% ( 70/185 ) of patients were infected with genotype c hbv .
the incidence rate of lmv resistance was not significantly different between genotype b and c ( 49.57% vs. 48.57% , p>0.05 ) .
for the mean age and sex ratio , no significant difference was found .
the pattern of rtm204i alone was predominantly observed ( 36.26% , 33/91 ) , followed by rtm204v+rtl180 m ( 23.08% , 21/91 ) .
the overall incidence rate of rtm204i mutation in genotype b ( 45.61% , 26/57 ) was more frequent than that in genotype c ( 20.59% , 7/34 ) ( 45.61% vs. 20.59% , p<0.05 ) , but the incidence rate of other mutation patterns was not significantly different between genotypes b and c.conclusionsour results emphasize that a lmv resistance test before treatment is of great importance in rational and optimal chb therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
nonalcoholic fatty liver disease ( nafld ) refers to the accumulation of hepatic steatosis not due to excess alcohol consumption . it is estimated that approximately 20%40% of the people in various countries have excess fat accumulation in the liver . nafld encompasses a spectrum of disorders ranging from hepatic steatosis to nonalcoholic steatohepatitis ( nash ) , cirrhosis , or hepatocellular carcinoma . despite its severity and high prevalence many factors including lipid metabolic disturbance , insulin resistance ( ir ) , oxidative stress , and mitochondrial dysfunction are known to cause the occurrence and aggregation of nafld . according to the prevailing theory of nafld pathogenesis , ir and lipid dysregulation are the first hit toward nafld , which may trigger following hits spontaneously such as oxidative stress , inflammation , necrosis , apoptosis , and fibrosis . therefore , targeting steatosis and ir in the early stage of nafld is extremely important for the retardation of nafld in both basic research and clinical trials . although the initial accumulation of fat in the liver can occur through several mechanisms , most previously done research implicates ir as the key mechanism in primary nafld , leading to hepatic steatosis . ir is associated with an increase in peripheral lipolysis , uptake of fatty acids by the liver , and synthesis of triglycerides , which promote the accumulation of hepatic fat . nowadays , the methods for treating nafld involve rational diet , exercise , and medicines including metformin , statins , and fibrates . however , these drugs have some adverse effects or contraindications , and no consensus exists on the most effective drug therapies . recently , emerging evidence suggests the possible use of herbal derivatives in treating nafld , such as green tea , garlic , resveratrol , and coffee in both preclinical studies and clinical trials . the therapeutic hepatoprotective activity of ethanolic extracts of edible lotus leaves was studied , indicating that the hepatoprotective activity of lotus leaf extract was comparable with that of a standard treatment comprising silymarin , a known hepatoprotective drug . np is the germ of the lotus seeds , which tastes bitter and generally can be removed . a previous research demonstrated the protective effect of total alkaloid and alkaloid compounds including liensinine , isoliensinine , or neferine from np against oxidative stress induced by tertiary - butyl hydroperoxide , suggesting their involvement in the cytoprotective effect on oxidative stress in liver . furthermore , total alkaloid and alkaloid compounds from np displayed a significant cytoprotective effect against hepatic steatosis ( data not reported ) . therefore , the aim of the present study was to investigate the effects of npa on ameliorating ir in high - fat diet- ( hfd- ) induced nonalcoholic fatty liver disease in mice . and the possible mechanisms were also studied . hfd , composed of 5% lactalbumin , 10% cholesterol , 20% lard oil , and 1% yolk powder , was obtained from research diets , inc . serum blood glucose , free fatty acid , alanine amino transferase ( alt ) and aspartate aminotransferase ( ast ) detection kits , and bicinchoninic acid protein assay kit were obtained from nanjing jiancheng institute of biotechnology ( nanjing , china ) . phosphorylated insulin receptor substrate 1 ( irs-1 ) and c - jun n - terminal kinase ( jnk ) antibody were purchased from sigma chemicals co. the insulin enzyme immunoassay kit was purchased from puer biotechnology co. , ltd . enzyme - linked immunosorbent assay ( elisa ) kits for tumor necrosis factor alpha ( tnf- ) and interleukin-6 ( il-6 ) were supplied by glory science co. ltd . then , the extraction was centrifuged at 1500 g for 15 min , and the supernatant was collected . next , 5% hcl solution was used to immerse the extract , followed by the addition of naoh to regulate ph to 9 - 10 . the crude sample was then extracted with chloroform using liquid - liquid separation . the collected soluble fraction from chloroform the alkaloid composition of npa was also reported in previous studies [ 13 , 14 ] , which indicated that 3 alkaloid components of liensinine , isoliensinine , and neferine make up the majority in npa . male wistar rats ( 180200 g ) were provided by the experimental animal center of fujian university of traditional chinese medicine ( fuzhou , china ) . the animals were housed in a room with a controlled temperature ( 21 3c ) , relative humidity ( 65%70% ) , and 12 h light / dark cycles . after adaptation for 1 week , the rats were used for the experiment approved by the ethical committee and the laboratory animal center of fujian university of traditional chinese medicine . group i ( normal control ) was given distilled water ( 10 ml / kg body weight ) and normal feeding . groups ii vi were administered with hfd feeding for 8 weeks to induce nafld in the animal . among them , group ii was designed as the model control group . groups iii v were administered with npa ( 200 , 400 , and 600 mg / kg , resp . at the end of the experiment , blood samples of all rats were obtained via the abdominal vein under anesthesia after an overnight fasting . liver sample from each rat was collected for molecular measurement and stored at 80c for the assays . serum was obtained from blood after centrifugation ( 2500 g , 10 min ) . the serum blood glucose , free fatty acid , alt , and ast levels of rats were detected using corresponding detection kits according to the manufacturer 's protocols . fasting serum insulin was determined using elisa kit for insulin following the manufacturer 's protocol . using an elisa reader , the homeostasis model assessment of ir ( homa - ir ) was calculated as [ fasting blood glucose ( mmol / l ) fasting serum insulin ( mu / l)/22.5 ] . an elisa kit for tnf- or interleukin-6 ( il-6 ) was employed for estimating the serum levels of these parameters . western blotting assay for detecting phosphorylation of jnk or irs-1 in liver tissue was determined according to the method described by li et al . with some modification . then , it was denatured , resolved with sodium sulfate poly acrylamide gel electrophoresis , and transferred onto a polyvinylidene difluoride membrane ( pvdf ) . after blocking , the membranes were individually incubated overnight with mouse anti - jnk ( 1 : 700 dilution ) , mouse anti - p - jnk ( 1 : 700 dilution ) , mouse anti - irs-1 ( 1 : 700 dilution ) , or mouse anti - p - irs-1 ( 1 : 700 dilution ) , respectively , followed by washing and incubation with secondary antibodies to show the resulting bands . the data were analyzed using one - way analysis of variance coupled with duncan post hoc multiple range test at 95% confidence level using spss ( version 16.0 , chicago , usa ) . before the start of the experiment , the average body weight of each group was similar . as showed in table 1 , after feeding with hfd for 8 weeks , the body weights of rats in the nafld group significantly increased compared with the control group , indicating that hfd had a significant influence on body weight . however , after oral administration of npa ( 400 and 600 mg / kg ) for 4 weeks , the body weight of rats significantly reduced compared with the nafld group . therefore , the consumption of npa could significantly reduce the body weight of nafld rats . to correlate hepatic injury with nafld , serum alt and ast measurements were conducted in each group of rats . as shown in figure 1 , the progression of nafld significantly induced the higher levels of both serum alt and ast compared with the control rats . however , the levels of alt and ast significantly decreased in a dose - dependent manner after npa treatment , and the hepatoprotective effects produced by npa at the dose of 600 mg / kg reach the highest as well as the positive control group . therefore , npa treatment potently alleviated hepatic injury by reducing the levels of aminotransferases . as noted , ir and glucose metabolism dysfunction are typical clinical symptoms of nafld and metabolic syndrome . eight weeks of daily ingestion of hcd contributed to the insulin resistance of the model group , which exhibited a significant increase in fasting blood glucose ( fbg ) compared with the control group . however , after npa exposure , the concentrations of fbg in blood significantly decreased in a dose - dependent manner compared with the model group . the fasting serum insulin level increased significantly in association with the elevated fbg in the model group ; however , npa intake at higher dose significantly decreased the fasting insulin level in groups iv - v compared with the nafld group . a high - fat , cholesterol - rich diet induced a significant increase of ir in the nafld model group animals compared with the control group , as indicated by the high homa - ir . npa administration in groups iv - v could decrease their homa - ir level compared with the model group , reaching the control range ( table 2 ) . our results showed that the nafld model rats could exhibit a much higher level of free fatty acid ( fft ) compared with the control group ( figure 2 ) . however , treating the nafld model with npa at a concentration of 400 or 600 mg / kg could significantly inhibit the fft level in serum , suggesting its significant effect on alleviating steatosis in rats . rats fed with hfd for 8 weeks showed a significant increase in serum tnf- and il-6 levels compared with the rats in the control group . treatment with npa ( 400 or 600 mg / kg ) significantly decreased these high levels compared with the control group . notably , npa at a higher dose could decrease the serum il-6 level to a much greater extent , which was comparable with the positive control group ( figures 3(a ) and 3(b ) ) . the results showed that jnk phosphorylation significantly increased in the nafld rats compared with the normal group . thus , increased jnk phosphorylation might explain the increased ir ( figure 4(a ) ) . it is well established that the insulin signaling pathway is impaired in obese objects as a result of decreased irs phosphorylation . in the present nafld model , western blot results showed that hepatic tissue levels of phosphorylated irs-1 were inhibited by the induction of nafld . however , cotreatment with npa completely restored the levels of these proteins ( figure 4(c ) ) , indicating the basis of improving ir in nafld . the aim of the present study was to evaluate the hepatoprotective effect of npa by ameliorating ir in a model of hfd - induced nafld . hfd is well known to increase body weight and induce ir , in addition to an inflammatory and oxidative burden in rodent models . in the present study , high - fat , the aforementioned findings confirmed that 8 weeks of hfd feeding in rats resulted in increments in body weight , adiposity index , systemic ir , and inflammatory markers . hfd feeding could also increase serum ffa , causing the overloads of ffa in hepatocytes and promoting lipogenesis . nafld is defined histologically as the presence of lipid droplets in more than 5% of hepatocytes , not caused by excessive alcohol consumption , drugs , or viruses . ir represents the main link among obesity , metabolic syndrome , and liver disease with fat accumulation , that is , nafld . the present research investigated the effect of npa on the metabolic alterations in the glucose level and ir in hfd - induced nafld . feeding the rats with hfd resulted in dramatic increases in the fbg , ffa , and ir . it is well known that infusions of triglyceride emulsions to rapidly increase ffa levels would cause a decrease in insulin sensitivity . therefore , controlling ir , as well as associated glucose metabolism and lipid accumulation , is the first but most important step toward the therapy of nafld . the adipocytes are no longer considered passive cells that store excessive triglycerides but are instead considered active cells that regulate the energy balance and secrete the proinflammatory cytokines il-6 and tnf- . tnf- is an important mediator of ir due to its ability to influence the tyrosine kinase activity of the insulin receptor . in the present study , this suggested that multiple immunomodulatory factors could contribute to the chronic inflammatory condition and hepatocytes injury observed in nafld . it is assumed that inflammatory factors may be mediators of ir because the plasma levels of both markers are correlated negatively with insulin sensitivity . excessive fat accumulation in hepatocytes , regardless of its cause , tends to induce the activation of nuclear factor-b , which is the key regulator of inflammation . subsequently , the expression of inflammatory cytokines tnf- and il-6 may lead to infiltration of neutrophils and inflammation in liver injury . impaired irs-1 phosphorylation is responsible for reduced insulin signaling and impaired downstream pi3k / akt signal transduction . it is well established that the insulin signaling pathway is impaired in obese patients as a result of decreased irs phosphorylation . some authors suggest that lipolysis induced by tnf- and il-6 , resulting in the inhibition of irs , may represent a major mechanism . thus , it could be considered that the restoration of irs-1 might be beneficial for the amelioration of nafld . the present results showed that insulin hypersecretion was prevalent in the group of nafld model rats , which significantly decreased on administering npa . considering the survival - promoting role of irs-1 in several hepatic diseases , particularly nafld , the restoration of this pathway would definitely contribute to the improvement in ir . lipid peroxidation products can activate transcription factor nf - kb in patients with nafld , a key transcription factor that regulates the expression of several proinflammatory cytokines and hepatic inflammation . in fact , it is now generally established that jnk1 is central to obesity - induced ir , although jnk2 might also play a contributing role . the present results suggested that jnk phosphorylation might be responsible for aggravating ir , as nafld group advanced to more severe form . hence , inhibition of jnk phosphorylation by npa adds to its modulation effect on ir during napld progression . in conclusion , the present results supported the view that the pathogenesis of nafld was complex with inducing inflammation and ir , as well as increasing serum glucose and free fatty acid level . moreover , cotreatment with npa could regulate ir through restoring phosphorylation of irs-1 and alleviating phosphorylation of jnk in liver tissue , suggesting its involvement in modulating ir by protein phosphorylation during nafld progression . further investigations are needed to ensure the safety , benefits , and utility of npa in patients with nafld . | this study aimed to investigate the effects of total alkaloids from nelumbinis plumula ( npa ) on insulin resistance ( ir ) of high - fat diet- ( hfd- ) induced nonalcoholic fatty liver disease ( nafld ) .
rats were fed with hfd for 8 weeks to induce nafld .
then , the effect of npa on ameliorating ir in hfd - induced nafld was evaluated .
fasting serum insulin was determined using an enzyme - linked immunosorbent assay ( elisa ) kit for insulin following the manufacturer 's protocol .
some inflammatory cytokines such as tumor necrosis factor alpha ( tnf- ) and interleukin-6 ( il-6 ) were determined using elisa kits to assess the inflammatory burden in rats .
the results showed that hfd could induce a significant increase in blood glucose and ir in rats .
however , rats treated with npa ( 400 or 600 mg / kg ) showed improved ir and reduction in serum inflammatory cytokines tnf- and il-6 .
further investigation indicated that npa could inhibit ir by restoring the insulin receptor substrate-1 ( irs-1 ) and suppressing the expression of c - jun n - terminal kinase ( jnk ) phosphorylation .
the present results supported the view that the pathogenesis of nafld was complex with inflammation , together with increasing serum glucose and ir . also , jnk and irs phosphorylation were suggested for their involvement in the modulating of ir during nafld progression .
therefore , npa may serve as a potential natural remedy against ir in nafld . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
kuala lumpur , which is the federal capital and the largest city in malaysia , is also suffering from air pollution problem . the last decade has seen its phenomenal growth as a centre of commerce in the region , and this trend is still continuing . with the increase in energy consumption and urbanization in kuala lumpur , the increase in ambient air pollution seems inevitable . air pollutants , which exist in the form of solid , semisolid , liquid , and gas , are emitted directly or indirectly from their sources . some heavy metals such as lead and cadmium are common environmental pollutants in industrialised and developing countries . lead is a very toxic , nondegradable heavy metal that exists naturally in earth 's crust [ 4 , 5 ] . lead in the atmosphere arises from two major ways , which are primary sources including lead from mining activities and secondary sources such as industrial emission , battery manufacturing , and additives in motor vehicles gasoline . in any population , children are more vulnerable to lead exposure than adults because children have higher hand - to - mouth activities and higher rate of gastrointestinal absorption , and their developing brains are more sensitive to insults from lead exposure . ionic species either anions or cations can significantly be found in the form of particulate in the air especially during air pollution . generally , anions such as sulphate ( so4 ) and nitrate ( no3 ) are secondary particulates and usually dominate air pollution . calcium ( ca ) that arises from soils and magnesium ( mg ) and chloride ( cl ) that comes from marine sources are some examples of cations . this paper reports the concentration of lead , cations , and anions in air at the primary schools in kuala lumpur . then , the concentrations of the parameters between indoor and outdoor air in every sampling station are compared . this study was conducted in kuala lumpur , which is a city characterised with highly congested traffic city . six sampling points were chosen by using stratified random sampling , and size for known population was calculated . suspended particulate for indoor and outdoor air was sampled using low volume sampler ( minivol pm10 ) for 24 h with fibre glass filter papers pore size 0.45 m and diameter 47 mm . the first half was used for analysis of anions and cations , whilst the second half was used for analysis of lead . for lead concentration determination , a part of the filter paper was added with nitric acid and perchloric acid in the ratio of 16 : 4 . then , the mixture was filtered using vacuum pump with cellulose acetate filter papers ( pore size 0.2 m ) , and 50 ml of deionised water was added . lead concentration in the samples was determined using inductively coupled plasma mass spectrophotometry ( icp - ms ) . for anions and cations analysis , the second part of the filter paper was added with 40 ml of deionised water into centrifuge tube . then , the mixture was filtered using vacuum pump and 100 ml of deionised water was added . the concentration of cations ( mg , ca , and k ) was analysed using atomic absorption spectroscopy , while the concentration of anions ( no3 and so4 ) was determined using hach dr 2800 spectrophotometer . the data were then analysed using statistical package for the social sciences ( spss ) software version 16 . overall , this study indicated that lead concentration was higher for indoor air than outdoor air . for indoor air , the lead concentrations were in the range of 5.18 1.08 g / g7.01 0.08 g / g . for outdoor air , the lead concentrations were in the range of 3.25 0.35 g / g4.09 0.71 g / g ( see table 2 ) . based on one - way anova test , there was a significant difference ( p < 0.05 ) for the lead concentrations in indoor air . station f showed the highest lead concentration for indoor air as the classroom was near the main road , which was highly congested during peak hours . state that stationeries , desk paint , and coloured book wrappers contribute to lead in indoor air . the concentration of mg in indoor air was in the range of 1.833.87 mg / g , while the concentration of mg in outdoor air was 2.634.41 mg / g ( see table 3 ) . mg is one of the components with high concentration in sea spray aerosol , which was far from sampling points . next , for ca , the range of concentration was quite high , 30.30 2.09 mg / g48.33 1.97 mg / g in indoor air , while the range of concentration for outdoor air was 39.51 5.01 mg / g65.13 9.42 mg / g ( see table 3 ) . this finding could be because the cation exists naturally in soils and earth 's crust ; thus it has higher concentration in indoor air than outdoor air . there was a significant difference in ca concentrations for both indoor and outdoor air based on the statistical results . the concentration of k for indoor air was in the range of 38.07 1.0360.56 3.71 mg / g , while the concentration of k for outdoor air was in the range of 37.64 5.33 mg / g66.33 7.54 mg / g ( see table 3 ) . statistical results showed that the significant difference in the concentration of k was only in outdoor air . the concentration of so4 in indoor air at every sampling point was in the range of 21.76 1.13 g / g23.42 0.91 g / g , while the concentration of so4 in outdoor air was in the range of 22.89 2.04 g / g23.95 0.92 g / g ( see table 4 ) . the concentration of ion so4 was high in outdoor air due to the emission from motor vehicles in the heavy traffic nearby the schools . emission of anthropogenic pollutants such as sulphur dioxide , vehicles exhaust , and natural emission from decaying plants and animals may increase the concentration of so4 in the air . the concentration of no3 in indoor air was in the range of 21.34 0.97 g / g24.80 0.58 g / g , while the concentration of no3 in outdoor air was in the range of 29.72 0.31 g / g32.00 0.75 g / g ( see table 4 ) . overall , the concentration of no3 was found higher in outdoor air than in indoor air . fuels and exhaust emission from motor vehicles were the main sources for the anions in the air . concentration of lead for both indoor and outdoor air at the sampling stations did not exceed the 1.5 g / m standard given by the department of environment . but the level of the contaminants must be monitored from time to time because exposure to the high concentration of lead can cause chronic health effects . all the sampling stations showed concentration of cations and anions higher in outdoor air than indoor air . this finding could be because the outdoor environment was exposed to higher sources of these cations and anions . relative concentration for cations in this study was ca > k > mg , while for anions it was no3 > so4 . | this study was carried out to determine the concentration of lead ( pb ) , anions , and cations at six primary schools located around kuala lumpur . low volume sampler ( minivol pm10 ) was used to collect the suspended particulates in indoor and outdoor air .
results showed that the concentration of pb in indoor air was in the range of 5.18 1.08 g / g7.01 0.08 g / g .
all the concentrations of pb in indoor air were higher than in outdoor air at all sampling stations .
the concentrations of cations and anions were higher in outdoor air than in indoor air .
the concentration of ca2 + ( 39.51 5.01 mg / g65.13 9.42
mg / g ) was the highest because the cation existed naturally in soil dusts , while the concentrations of no3 and so42 were higher in outdoor air because there were more sources of exposure for anions in outdoor air , such as highly congested traffic and motor vehicles emissions . in comparison , the concentration of no3 ( 29.72 0.31 g / g32.00
0.75 g / g ) was slightly higher than so42. the concentrations of most of the parameters in this study , such as mg2 + , ca2 + , no3 , so42 , and pb2 + , were higher in outdoor air than in indoor air at all sampling stations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
preeclampsia is a condition , within the spectrum of hypertensive disorders of pregnancy , characterized by elevated blood pressure and proteinuria , which can progress to involve multiple organ systems . the royal college of obstetricians and gynecologists clinically defines preeclampsia as the presence of pregnancy - induced hypertension ( blood pressure 140/90 mmhg after 19 weeks of gestation ) and significant proteinuria ( > 03 g/24 h ) . preeclampsia can be further categorized as mild or severe , depending upon the classification system that is used . severe preeclampsia includes severe hypertension ( 170/110 mmhg ) and heavy proteinuria , and may also include other maternal signs of end - organ dysfunction . across the globe , approximately 800 women die due to preventable causes of pregnancy and childbirth ; 99% of these deaths occur in low and middle - income countries ( lmics ) . in the early years of the 21 century , the millennium development goals explicitly placed maternal health at the core of the struggle against poverty and inequality . hypertensive disorders of pregnancy are an important cause of severe morbidity and mortality among mothers and infants ; and 10% of all women experience it during pregnancy . globally , preeclampsia is the second - leading cause of maternal mortality , resulting in an estimated 76,000 maternal deaths annually . in addition , 500,000 fetal and newborn lives are lost annually due to the perinatal consequences of preeclampsia . moreover , preeclampsia complicates 28% of all pregnancies , and 1015% of direct maternal deaths are associated with preeclampsia and eclampsia . the syndrome of hemolysis , elevated liver enzymes and low platelets is a severe manifestation of preeclampsia and complicates approximately 0.50.9% of all pregnancies and 1020% of cases with severe preeclampsia . a 20-fold increase in maternal mortality is associated with preeclampsia arising at < 32 weeks compared with that at 37 weeks . according to a systematic review and meta - analysis published in 2007 , preeclampsia is associated with increased risk of having hypertension , ischemic heart disease and stroke in later life . overall mortality among women several years later was also greater in those who had preeclampsia . hypertension and/or proteinuria during pregnancy have also been associated with stillbirth while preeclampsia is strongly associated with fetal growth restriction , low birth weight , preterm delivery , respiratory distress syndrome , and admission to neonatal intensive care . it is hypothesized that inadequate trophoblast invasion in early pregnancy results in impaired placental perfusion , leading to an increase in oxidative stress . according to one of the hypotheses , impaired remodeling of the spiral artery is the basis for this stage of the disease . the later stage of the disease is the development of systemic endothelial dysfunction , which is responsible for the characteristic clinical manifestations of preeclampsia . underlying metabolic and cardiovascular conditions carry risks for endothelial dysfunction themselves , which is why they are postulated to play an important role in the pathogenesis of late - onset preeclampsia . it has been proposed that reduced placental perfection due to oxidative stress causes endothelial dysfunction , hence linking the two stages of the syndrome . there is also a genetic association with a multifactorial polygenic inheritance , suggested to play a role in the development of this disease . most of the maternal deaths in lmics occur at the community - level where the majority of women do not have access to the health care facility . failure to identify preeclampsia along with a delay in responding to the clinical signs and symptoms is responsible for nearly half of maternal deaths and more than half of fetal deaths . in community setups , determining the cause of death is difficult , and often reliance is placed on the relatives or caretakers recall of the symptoms experienced by the women prior to death . hence , there is a need for laying the extensive groundwork in development and implementation of guidelines and protocols at the community - level especially in lmics . screening and early detection of preeclampsia in the community could lead to a decrease in the preventable mortality of mother and the fetus . guidelines could be also useful for establishing thresholds for referral to specialist care , and assessment procedures for suspected preeclampsia cases . prompt diagnosis of preeclampsia in community settings is necessary to ensure maternal and fetal well - being . unlike women with severe preeclampsia , therefore , delays in diagnosis , adequate primary care , and referral to a specialist are likely to be important contributors of adverse maternal and fetal outcomes . while there are numerous clinical guidelines for diagnosis and management of preeclampsia in specialist or tertiary care centers , preeclampsia community guidelines ( precog ) were published in 2005 , after having been formulated following the national institute for clinical excellence 's ( nice ) recommendations for the development of guidelines . this guideline makes provisions for assessing risk based on evidence , and gives clear criteria for referral to specialist centers , and also establishes a schedule for monitoring women in the community after 20 weeks gestation . however , it is important to note that these guidelines work best only in health systems of developed nations , and there is a need to contextualize it as per those of lmics . perhaps the most important initial step toward a diagnosis of preeclampsia in community settings is the assessment of risk . a meta - analysis by duckitt and harrington showed that the risk of preeclampsia is increased in women with a previous history of preeclampsia ( relative risk 7.19 ) and in those with anti - phospholipids antibodies ( relative risk 9.72 ) and preexisting diabetes ( relative risk 3.56 ) . patients with multiple pregnancy , nulliparity , family history , raised body mass index before pregnancy and maternal age > 40 for multiparous women were shown to have increased the risk for preeclampsia as well . a population - based retrospective study from canada also concluded an approximately seven - fold higher risk of recurrent severe preeclampsia among women who has severe preeclampsia in previous pregnancy ( 6.8% ; 95% confidence interval 5.77.9% ) . moreover , a history of early - onset preeclampsia is associated with increased odds of adverse pregnancy outcomes despite a normotensive second pregnancy . according to the precog assessment of risk should be performed before 20 weeks of gestation and women should be referred for expert evaluation by specialist if they have either had a previous preeclampsia , a multiple pregnancy , preexisting underlying medical conditions like renal disease or chronic hypertension or any two other risk factors from a list . complete absence of antenatal care is known to be strongly associated with fetal death . however , there is no evidence to recommend special antenatal care in addition to routine , to women who might be at risk for preeclampsia but otherwise do not qualify for specialist referral according to precog criteria . it is possible for women with no risk factors for preeclampsia to develop the condition . nice recommends assessment for preeclampsia at weeks 16 , 28 , 34 , 36 , 38 , 40 , and 41 for healthy parous women with a single fetus . however , such rigorous schedule of hospital visits might not be implementable in a lmic nation where health systems are overburdened at one end and patients themselves find it difficult to visit healthcare facilities due to cost and distance considerations . there is an immense role that community healthcare workers can play in this arena and future research should be directed to this issue . assessments done after 20 weeks gestation , by identifying possible onset of preeclampsia from signs and symptoms including new hypertension , new proteinuria , symptoms of headache , visual disturbance , epigastric pain , vomiting , reduced fetal movements , and an infant that is small for gestational age can help identifying high - risk cases for referral to specialist care . in the community , fetal compromise is usually assessed by asking women about reduced fetal movements or by assessment for small for gestational age fetus . the world health organization ( who ) antepartum care model calls for a blood pressure check in the second antenatal visit in addition to testing for proteinuria in nulliparous women or in women with previous preeclampsia . the method of measuring blood pressure is critical : errors have been implicated in maternal deaths . regular maintenance and calibration checks are vital in ensuring that blood pressure is measured as accurately as possible . low - cost self - measurement oscillometric devices , with features suitable for use in an adult population in a low - resource setting in the lmics , have shown to be acceptable . while both inflationary and deflationary oscillometry devices are acceptable for measuring blood pressure , it is possible that inflationary oscillometry is more accurate for screening for hypertension in pregnant women with preeclampsia . in conclusion , measuring blood pressure and proteinuria is challenging in low - resource settings due to the financial cost and lack of training . significant training is needed to measure blood pressure accurately , along with the availability of well - maintained equipment , both of which pose a challenge to the early identification of preeclampsia in community settings . numerous clinical , biophysical , and biochemical screening tests have been proposed for the early detection of preeclampsia over the past decades . no single screening test used for preeclampsia prediction has gained widespread acceptance into clinical practice . it is important to identify at - risk women in the community and building the capacity of the caregivers in community and staff at the primary health centers to manage women with preeclampsia and eclampsia at the primary care level itself . only those that develop complications should be referred to prevent overburdening of tertiary care facilities . the causes of preeclampsia are still largely debatable and mostly unknown . hence , it is difficult to formulate strategies for effective primary prevention at this stage . research in the past decade has identified some major risk factors for preeclampsia , and identification and modification of these factors might result in a decrease in its frequency . advanced maternal age , obesity , and no utilization of prenatal care are the risk factors identified for preeclampsia . overweight and obese women have an increased risk for preeclampsia , while underweight women have an increased risk for preterm delivery . there is some evidence that secondary prevention with calcium supplementation and aspirin administration during pregnancy are beneficial in women with low calcium intake , and at a very high risk of developing severe early onset disease , respectively . anti - platelet agents , especially low - dose aspirin , have small - moderate benefits when used for prevention of preeclampsia . when anti - platelet agents were compared to placebo or no agent , there was a 17% reduction in the risk of preeclampsia associated with the use of anti - platelet agents . there was a small ( 8% ) reduction in the risk of delivery before 37 completed weeks . overall there was a 14% reduction in baby deaths in the anti - platelet group . there was a 10% reduction in risk of small - for - gestational age babies . there is a need for further research to assess women , which are likely to benefit most from such interventions and to identify best time of starting treatment , as well as optimal dosing . a meta - analysis that assessed the influence of starting aspirin before 16 weeks of gestation found a 52% reduction in the risk of preeclampsia compared with the control group , however no difference was observed when started after 16 weeks . calcium supplementation during pregnancy , when compared with placebo , appears to approximately halve the risk of preeclampsia . it also reduces the risk of preterm birth and occurrence of death or serious morbidity . however , it is of note that existing evidence shows that only women with a low dietary calcium intake are likely to benefit from calcium supplementation . since most pregnant women in lmics are deficient in calcium , calcium supplementation is an intervention of interest for lmics . other dietary nutritional measures , including administration of vitamin c and other anti - oxidants , or drugs have not shown clear , irrefutable benefit , and there is insufficient evidence to recommend clinical use . the goal of managing preeclampsia is to keep blood pressure of woman in the normal range with anti - hypertensives and prevent the development of complications like eclampsia . delivery of the fetus and placenta is the only definitive treatment for preeclampsia but the option , is sadly not available for most patients who are diagnosed before the baby is full - term . once blood pressure increases above a certain level , it may lead to direct vascular damage , which in turn leads to life - threatening complications such as renal failure , stroke , and fetal distress . thus for women with severe preeclampsia , before 34 weeks of gestation , expectant management is recommended , such that maternal hypertension is under control , and maternal organ dysfunction or fetal distress is absent and can be monitored . however , the evidence - based behind expectant management for decreasing neonatal morbidity is small and based on data from only limited number of trials . in contrast to nonsevere hypertension , severe hypertension ( defined as systolic blood pressure 160 and/or diastolic blood pressure 110 ) must be treated . the confidential inquiry into maternal and child health highlighted the importance of treating severe hypertension and demonstrated that the failure of anti - hypertensive therapy was the most common source of sub - standard care even in high resource settings . the choice of anti - hypertensive however is largely guided by the clinicians experience and familiarity with a particular drug and on what is known about adverse effects and teratogenic potential due to lack of good quality evidence from trials . the full intravenous or intramuscular regimen of magnesium sulfate is the drug of choice for both prevention of eclampsia in severe preeclampsia cases as well as treatment of eclampsia . in the united kingdom , widespread uptake of magnesium sulfate is thought to account for the decline in the incidence of eclampsia . in lmics healthcare access is poor and routine antenatal coverage is not universal or of poor quality resulting in most patients visiting a clinician at the stage of severe preeclampsia or eclampsia . such cases are an obstetric emergency considering the impending danger to the mother and the baby . magnesium sulfate has been found to be beneficial to use in terms of significantly decreased the risk of eclampsia ( about half ) and risk of placental abruption ( more than half ) when compared with placebo or no anti - convulsant . use of magnesium sulfate in the community is however limited because of apprehension among healthcare workers about its safety . this , despite its clear effectiveness , low - cost , and being on the essential medicines for most countries , if not all . toxicity can be monitored clinically by respiratory rate , urine output and deep tendon reflexes . limited provider knowledge and training , and lack of national guidelines and protocols and sociocultural factors and various other factors for underutilization of magnesium sulfate has already been identified . for primary care facilities where full schedule of magnesium sulfate can not be given or when development of further complications is anticipated , who recommends giving the loading dose of magnesium followed by referral to a higher level health - care facility . health care worker training and confidence building measures are hence an important part of the strategy for controlling the problem of preeclampsia . trials comparing alternative regimens of magnesium sulfate for preeclampsia are of poor quality - too small and unreliable for making any conclusions and hence its clinical use not recommended . evidence exists that a series of strategies including standardized assessment and surveillance , adequate management of severe hypertension , and prevention of eclampsia have the potential for reducing risks of adverse maternal outcomes in women with preeclampsia . however , this involves a full detailed work - up in addition to the routine clinical tests done and hence might be not feasible in terms of costs as well as implementation in lmics . furthermore , intervention delivery and targeting the ones at high risk are a major issue in many lmics . despite the existing proven interventions to prevent and manage preeclampsia and eclampsia , effective delivery strategies still remain unexplored . access to health care , distance , and cost are major obstacles for women in lmics to seek care for preeclampsia . antenatal care utilization is around 68% in lmics compared with 98% in high resource settings . the region of the world with the lowest levels of use is south asia , where only 54% of pregnant women have at least one antenatal care visit . though the principles of care for women with preeclampsia remain the same globally , there is a need to adapt guidelines in the context of these and other problems unique to lmics . delays in identification , transport , and initiation of treatment because of number of factors lead to additional health system issues and this need to be accounted when contextualizing evidence regarding preeclampsia in lmics . one of the ways forward , especially for the lmics , could be scaling up of existing community - based delivery platforms for screening and delivering intervention strategies . many lmics have an existing cadre of community health workers ( chws ) for example shasthyo sebikas ( bangladesh ) , village health worker ( bhutan ) , village health guide ( india ) , female community health volunteer ( nepal ) , and lady health visitor ( pakistan ) . these existing cadres could be utilized for screening and early referrals to prevent delays in identification and treatment . evidence from bangladesh , a typical lmic , clearly indicates that outcomes were better for community - based maternal care programs implemented by posting trained midwives posted in villages at primary health care system . there are successful examples from pakistan where chws workers and midwives have been trained to administer misoprostol in women with postpartum hemorrhage . this is supportive to of the recommendation that with proper training , it is feasible to incorporate even emergency medication administration in community settings where accessibility and availability are an issue . such an approach is also reasonable as chws are already functioning within the communities to deliver health promotion , preventive care and essential curative maternal , newborn child health services . however , there is a need to train these chws on the concepts related to the prevention and management of preeclampsia and eclampsia specifically . there is also a need for focused primary care funding to evaluate success of such programs before large - scale implementation can be done especially with regard to conditions like preeclampsia and eclampsia , which turn to emergencies within a very short span of time . such efforts thus need to be supplemented by the development of rapid and effective emergency care facilities and capacity building of health facilities where women are being referred to . it is important to note that there is a need to shift from the current approach of either vertical programs ( which only aim at reducing disease - specific targets ) or horizontal programs ( which only aim at solving health system issues and consequently more time consuming and difficult to implement ) . for better maternal and child care it is important to take a diagonal approach as of now and also aim at focused research at primary care level to improve the evidence base for it . | hypertensive disorders of pregnancy contribute significantly to maternal mortality and morbidity .
preeclampsia belongs to the spectrum of hypertensive disorders of pregnancy and if undiagnosed and/or untreated leads to fatal consequences for both the mother and the baby .
early detection and prevention of preeclampsia is limited by uncertainty in the knowledge about its etiopathogenesis . while much work has been done in establishing clinical guidelines for management of preeclampsia in the hospital or tertiary care settings ,
there is considerable lack of work in the domain of evidence - based guidelines for screening , identification and management of preeclampsia at the community - level .
the article reviews these issues with special considerations and to challenges faced in low and middle - income countries .
there is a need to focus on low - cost screening and interventions in the community to achieve a significant impact on preventable maternal and fetal mortality in order to control the burden of preeclampsia significantly as well as investing on more research at primary care level to improve the evidence base for community - level interventions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
noninvasive pressure support ventilation ( psv ) , delivered via a nose- or a face - mask , is widely used because it reduces patient work of breathing ( wob ) [ 13 ] . this is critical for patients with impaired lung mechanics resulting from lung diseases such as copd or ards . the effectiveness of psv depends on the ability of the ventilator to adjust breath - by - breath inspiratory flow to match the patient s inspiratory demand . juban et al . reported that some copd patients recruit their expiratory muscles to terminate inspiration when the ventilator was still inflating the lungs . however , chiumello et al . observed that the breathing rate and tidal volume could be modified by regulating the flow - cycling criteria in patients recovering from acute lung injury ( ali ) . breathing rate , tidal volume , and inspiratory time depend on the level of pressure support ( ps ) and the individual patient s lung mechanical properties ( impedance and muscle effort ) . each psv breath is flow - cycled and termination criteria can be either a fixed flow value ( e.g. , 5 l / min ) , or a percentage of the peak inspiratory flow ( e.g. , 25% ) , referred to as conventional cycling . the ability to adjust flow - cycling criteria to use either conventional or automated regulation software algorithms is now available in many devices . patient - ventilator asynchrony , a misalignment between the timing of the ventilator cycle and the patient s respiratory cycle , is very common during assisted ventilation . high levels of asynchrony may prolong the time required for ventilator support and subsequently result in further complications and prolonged weaning from mechanical ventilation [ 1012 ] . approaches to auto - adjust triggering and cycling have been developed to minimize these problems . the aim of this bench study was to evaluate and compare the effects on breathing pattern and patient - ventilator cycling synchronization between automated cycling and conventional flow - cycling protocols during psv . the stimulator settings used in this study are consistent with the protocol published by ferreira et al . the series 1101 lung simulator ( hans rudolph inc . , shawnee , ks , usa ) is a computerized lung simulator that consists of a piston that moves inside a cylinder . compliance , resistance , and inspiratory muscle pressure profile ( negative pressure created by the respiratory muscles ) may be set by the user . the simulator was adjusted to simulate a patient or a healthy adult placed in a semi - reclined position ( incline 45 ) . three combinations of inspiratory resistance ( rins ) , expiratory resistance ( rexp ) , respiratory compliance ( crs ) , and breathing rate ( br ) were set to simulate lung mechanics in a patient with copd ( rins=20 cmh2o / ls , rexp=20 cmh2o / ls , crs=50 ml / cmh2o , br=15 bpm ) , a patient with ards ( rins=5 cmh2o / ls , rexp=5 cmh2o / ls , crs=25 ml / cmh2o , br=30 bpm ) , and normal adult lungs ( rins=5 cmh2o / ls , rexp=5 cmh2o / ls , crs=100 ml / cmh2o , br=15 bpm ) [ 1618 ] . the inspiratory times of the 3 types of respiratory mechanics ( 1.0 s for copd , 0.8 s for ards , and 1.5 s for normal adult ) were chosen to assess the effect of inspiratory time on triggering and cycling synchronization . patient inspiratory effort was set at 5 cmh2o in the 3 patterns of respiratory mechanics , and pressure reduction generated 300 ms after the onset of an occluded inspiratory effort was 3.6 cmh2o . the simulator incorporates user - controlled leaks by a plateau exhalation valve ( pev ) . for this experiment , the leak flow was maintained at 2528 l / min during a peak airway pressure of 20 cmh2o . an endotracheal tubes ( i d , 22 mm ) inserted through the mouth was used to direct gas coming from the facemask to the simulator . a medium - sized oronasal facemask without an exhalation port ( bestfit ; curative medical inc . , santa clara , ca , usa ) was affixed tightly to the head of the mannequin with standard straps . a leak of < 12 l / min was measured at 20 cmh2o of positive pressure when the pev was removed . two bilevel ventilators were compared using the lung simulator with a system leak : v60 ( respironics ; murrysville , pa , usa ) and flexo st 30 ( curative medical inc . , santa clara , ca , usa ) . each ventilator was connected to the lung simulator by a standard disposable corrugated circuit ( length , 2.0 m ) . humidifiers and heat and moisture exchangers were removed . both of the ventilators were set in psv mode , as follows : positive end - expiratory pressure ( peep ) , 5 cm h2o ; pressure support ( ps ) level , 5 cmh2o ( normal adult ) and 15 cmh2o ( copd and ards ) ; back - up respiratory rate , 10 breaths / min ; maximal duration of the inspiratory phase , 4.0 s. the trigger sensitivity was set to be as sensitive as possible while avoiding auto - triggering . the inspiratory rise time was set to 100 ms . once the baseline pressure had stabilized , at least 5 min was allowed for the ventilator to synchronize with the simulator . if synchronization did not occur , changes in sensitivity , inspiratory effort , or both were made and recorded . if synchronization was not finally achieved , the ventilator was considered to be unable to provide assisted ventilation at the level of the leak . in all cases , failure to synchronize resulted in rapid auto - triggering or an inability to trigger . after stabilization , 10 representative breaths were collected with a sampling interval of 1 min . inspiratory triggering synchronization was assessed using the triggering delay ( td ) , the triggering pressure - time product ( ptpt ) . inspiratory time included ventilator insufflation time ( ti vent ) , the time between the beginning of the simulated inspiratory effort and the end of the ventilator s insufflation , and ti simu , the simulated active inspiration time . cycling delay time ( cdelay ) was measured as the time from the end of the inspiratory effort of the simulator to the moment when the ventilator cycled from inspiration to expiration . a negative value reflects premature interruption of pressurization ( premature cycling ) , and a positive value reflects a pressurization time that exceeds the patient s inspiratory effort ( delayed cycling ) . the peak inspiratory flow ( pif ) , the peak expiratory flow ( pef ) , and the inspiratory tidal volume ( vt insp ) were monitored by the simulator . the expiratory tidal volume was measured by the ventilator ( vt exp ) , and the leak volume ( vt leak ) was calculated from the difference of vt insp and vt exp . statistical analyses were carried out using the statistical software package , spss version 11.0 ( spss ; chicago , il , usa ) . comparisons of variables at different cycling sensitivity settings were made using the t test . the stimulator settings used in this study are consistent with the protocol published by ferreira et al . the series 1101 lung simulator ( hans rudolph inc . , shawnee , ks , usa ) is a computerized lung simulator that consists of a piston that moves inside a cylinder . compliance , resistance , and inspiratory muscle pressure profile ( negative pressure created by the respiratory muscles ) may be set by the user . the simulator was adjusted to simulate a patient or a healthy adult placed in a semi - reclined position ( incline 45 ) . three combinations of inspiratory resistance ( rins ) , expiratory resistance ( rexp ) , respiratory compliance ( crs ) , and breathing rate ( br ) were set to simulate lung mechanics in a patient with copd ( rins=20 cmh2o / ls , rexp=20 cmh2o / ls , crs=50 ml / cmh2o , br=15 bpm ) , a patient with ards ( rins=5 cmh2o / ls , rexp=5 cmh2o / ls , crs=25 ml / cmh2o , br=30 bpm ) , and normal adult lungs ( rins=5 cmh2o / ls , rexp=5 cmh2o / ls , crs=100 ml / cmh2o , br=15 bpm ) [ 1618 ] . the inspiratory times of the 3 types of respiratory mechanics ( 1.0 s for copd , 0.8 s for ards , and 1.5 s for normal adult ) were chosen to assess the effect of inspiratory time on triggering and cycling synchronization . patient inspiratory effort was set at 5 cmh2o in the 3 patterns of respiratory mechanics , and pressure reduction generated 300 ms after the onset of an occluded inspiratory effort was 3.6 cmh2o . the simulator incorporates user - controlled leaks by a plateau exhalation valve ( pev ) . for this experiment , the leak flow was maintained at 2528 l / min during a peak airway pressure of 20 cmh2o . an endotracheal tubes ( i d , 22 mm ) inserted through the mouth was used to direct gas coming from the facemask to the simulator . a medium - sized oronasal facemask without an exhalation port ( bestfit ; curative medical inc . , santa clara , ca , usa ) was affixed tightly to the head of the mannequin with standard straps . a leak of < 12 l / min was measured at 20 cmh2o of positive pressure when the pev was removed . two bilevel ventilators were compared using the lung simulator with a system leak : v60 ( respironics ; murrysville , pa , usa ) and flexo st 30 ( curative medical inc . , each ventilator was connected to the lung simulator by a standard disposable corrugated circuit ( length , 2.0 m ) . humidifiers and heat and moisture exchangers were removed . both of the ventilators were set in psv mode , as follows : positive end - expiratory pressure ( peep ) , 5 cm h2o ; pressure support ( ps ) level , 5 cmh2o ( normal adult ) and 15 cmh2o ( copd and ards ) ; back - up respiratory rate , 10 breaths / min ; maximal duration of the inspiratory phase , 4.0 s. the trigger sensitivity was set to be as sensitive as possible while avoiding auto - triggering . the inspiratory rise time was set to 100 ms once the baseline pressure had stabilized , at least 5 min was allowed for the ventilator to synchronize with the simulator . if synchronization did not occur , changes in sensitivity , inspiratory effort , or both were made and recorded . if synchronization was not finally achieved , the ventilator was considered to be unable to provide assisted ventilation at the level of the leak . in all cases , after stabilization , 10 representative breaths were collected with a sampling interval of 1 min . inspiratory triggering synchronization was assessed using the triggering delay ( td ) , the triggering pressure - time product ( ptpt ) . inspiratory time included ventilator insufflation time ( ti vent ) , the time between the beginning of the simulated inspiratory effort and the end of the ventilator s insufflation , and ti simu , the simulated active inspiration time . cycling delay time ( cdelay ) was measured as the time from the end of the inspiratory effort of the simulator to the moment when the ventilator cycled from inspiration to expiration . a negative value reflects premature interruption of pressurization ( premature cycling ) , and a positive value reflects a pressurization time that exceeds the patient s inspiratory effort ( delayed cycling ) . the peak inspiratory flow ( pif ) , the peak expiratory flow ( pef ) , and the inspiratory tidal volume ( vt insp ) were monitored by the simulator . the expiratory tidal volume was measured by the ventilator ( vt exp ) , and the leak volume ( vt leak ) was calculated from the difference of vt insp and vt exp . statistical analyses were carried out using the statistical software package , spss version 11.0 ( spss ; chicago , il , usa ) . comparisons of variables at different cycling sensitivity settings were made using the t test . the respironics v60 and curative flexo st 30 ventilators were able to adapt to the system leak ( 2528 l / min ) without requiring adjustment of the triggering settings . representative breathing cycles with auto - track setting in the 3 models are shown in figure 1 . as shown in table 1 , the vt leak differed under the cycling criteria in the copd model ( p<0.001 ) , which was the highest with the auto - trak cycling criteria ( 212.229.06 ml ) and decreased with sensitivity level using conventional triggering ( high : 106.427.35 , moderate : 63.417.48 , low : 25.2 v 7.16 ) . the td was < 100 ms for the 2 ventilators in all respiratory mechanics models . for an inspiratory effort of 5 cmh2o , the ptpt was similar despite the modification of cycling criteria . higher values for pif were found during the auto - trak protocol than for conventional cycling criteria in copd and ards models ( p<0.05 tables 1 , 2 ) . at 5 and 15 cmh2o of pressure support , the vt increased at lower cycling criteria sensitivity levels with conventional psv settings in all conditions . in the copd model , tinsp , pef and cdelay were also increased as a result of reducing the sensitivity level of the conventional cycling criteria ( table 1 ) . in the ards model , premature cycling was found during conventional protocols when cycling criteria was preset at the high and moderate levels . cycling delays only occurred at the lowest sensitivity level of the conventional cycling criteria ( 15.00.10 ms ) and during auto - trak protocol ( 15.20.42 ms ) . in the normal adult model ( table 3 ) , tinsp was raised from 878.4019.02 ms to 1455.8020.95 ms after the cycling criteria was set at the lowest sensitivity level ( p<0.05 ) . premature cycling was also eliminated and a small delay in cycling ( 105.115.82 ) was found . premature cycling occurred during psv with the auto - trak system . according to the 3 respiratory mechanics models , the value of the inspiratory flow at the end of inspiration with the high , moderate , and low sensitivity levels for the cycling criteria during conventional protocols were approximately 35% pif , 15% pif , and 5% pif ( figure 2 ) . the td was < 100 ms for the 2 ventilators in all respiratory mechanics models . for an inspiratory effort of 5 cmh2o , the ptpt was similar despite the modification of cycling criteria . higher values for pif were found during the auto - trak protocol than for conventional cycling criteria in copd and ards models ( p<0.05 tables 1 , 2 ) . at 5 and 15 cmh2o of pressure support , the vt increased at lower cycling criteria sensitivity levels with conventional psv settings in all conditions . in the copd model , tinsp , pef and cdelay were also increased as a result of reducing the sensitivity level of the conventional cycling criteria ( table 1 ) . in the ards model , similar outcomes premature cycling was found during conventional protocols when cycling criteria was preset at the high and moderate levels . cycling delays only occurred at the lowest sensitivity level of the conventional cycling criteria ( 15.00.10 ms ) and during auto - trak protocol ( 15.20.42 ms ) . in the normal adult model ( table 3 ) , tinsp was raised from 878.4019.02 ms to 1455.8020.95 ms after the cycling criteria was set at the lowest sensitivity level ( p<0.05 ) . premature cycling was also eliminated and a small delay in cycling ( 105.115.82 ) was found . according to the 3 respiratory mechanics models , the value of the inspiratory flow at the end of inspiration with the high , moderate , and low sensitivity levels for the cycling criteria during conventional protocols were approximately 35% pif , 15% pif , and 5% pif ( figure 2 ) . during noninvasive positive pressure ventilation , air leak around the mask is unavoidable , and this can interfere with patient - ventilator synchrony and aggravate intolerance . asynchronous events include ineffective triggering , double - triggering , auto - triggering , premature cycling , and delay cycling . observed patient - ventilator asynchrony incidents in 60 patients with acute hypercapnic or non - hypercapnic respiratory failure during noninvasive psv . evaluated the effects on patient - ventilator synchrony with 2 different expiratory cycling mechanisms ( flow - cycling and time - cycling ) in the recovery of patients with acute lung injury . in the presence of air leak , the time - cycling mechanism provided a better patient - machine interaction than the flow - cycling mechanism ( 25% of pif ) nevertheless , tikioka et al . found that in ards or ali patients the patient - ventilator interaction could be adjusted by modifying the conventional flow - cycling criteria . premature cycling with double - triggering appeared when the flow - cycling criteria sensitivity was set at a high level ( 35% of pif ) . delayed cycling was often observed with the lowest sensitivity flow - cycling level ( 1% ) . in the present study of simulated obstructive , restrictive , and normal respiratory mechanics , automated triggering and conventional cycling at different flow sensitivities independent of the cycling criteria , delayed cycling was always observed in the copd model . improved cycling synchrony was found with high - level cycling criteria , in which the cut - off point for inspiratory flow was about 35% of pif . however , the selection of high - level cycling criteria could result in severe premature cycling in restrictive and normal lung conditions . these data suggest that modification of cycling criteria may be able to improve patient - ventilator synchrony . optimal patient - ventilator synchrony , especially during non - invasive ventilation ( niv ) , can be very difficult to achieve due to the presence of air leaks . although several intensive care units ( icu ) and transport ventilators are now designed specifically to provide niv , algorithms , inherent in the design of a mechanical ventilator , the absence or deficiency of leak compensation can increase the risk of asynchrony and lead to an increase in wob and patient discomfort . . found that different niv algorithms provided by icu ventilators could result in various cycling patterns . a recent study compared the performance and patient - ventilator synchrony between different kinds of ventilators during niv . by using a lung model that simulated obstructive disease with spontaneous breathing effort , the authors observed that auto - triggering and delayed cycling occurred with icu and transport ventilators . dedicated niv devices that use an niv algorithm demonstrated better performance and fewer asynchrony events . some dedicated niv machines , such as the respironics bipap vision , required no adjustment of triggering and cycling sensitivity because it can adapt to air leaks ranging from 0 to 37 l / min . poor performance was observed at the preset ps and peep levels in the respironics bipap vision and drager carina bi - level ventilators when the leakage was increased to 52 l / min . this is a pattern of the actual airflow of the patient , offset by 15 l / min and delayed by 300 ms . when the inspiratory flow of the patient crosses the shape signal , the ventilator terminates inspiration and cycles to exhalation . the auto - trak system improves patient - ventilator synchrony by adjusting to changing breathing patterns and dynamic leaks . the auto - adaptive triggering , cycling , and leak adjustments may help reduce the time that clinicians spend adjusting thresholds and re - fitting masks . previous studies have shown that a triggering delay times between 100 and 120 ms do not generate adverse clinical effects . vasconcelos et al . compared the auto - trak software algorithm with conventional settings in terms of patient - ventilator synchrony and discomfort in 12 healthy volunteers who underwent psv via an endotracheal tube ( 6 mm ) positioned with a mouthpiece . the asynchrony index ( ai ) and discomfort scores were not significantly different between the 2 protocols . however , in the present study , the use of the auto - trak system was associated with a greater triggering delay ( 169 ms ) in the copd model and premature cycling in the ards model . study are that the tests were performed by an icu ventilator with conventional settings and the performance of the auto - trak system was evaluated with a 6-mm endotracheal tube , not a mask . in the present bench model study , the use of automatic triggering and cycling systems with a facemask demonstrated different inspiratory termination characteristics than the conventional flow - cycling setting used for psv . the benefit of an automatic cycling setting is better patient - machine cycling synchronization in patients with respiratory failure , simplified ventilator management , and fewer errors caused by individual manipulations . in conclusion , the use of automatic triggering during psv has a better effect on patient - ventilator cycling synchrony , as evident by shorter triggering time delays and lower ptpt , than conventional flow - cycling settings in respiratory failure patients . the advantage of conventional flow - cycling criteria settings was found to be the avoidance of serious asynchronous events when respiratory mechanics are extremely unstable . | backgroundpressure support ventilation ( psv ) is a standard method for non - invasive home ventilation .
a bench study was designed to compare the effectiveness of patient - ventilator inspiratory termination synchronization with automated and conventional triggering in various respiratory mechanics models.material/methodstwo ventilators , the respironics v60 and curative flexo st 30 , connected to a hans rudolph series 1101 lung simulator , were evaluated using settings that simulate lung mechanics in patients with chronic obstructive pulmonary disease ( copd ) , acute respiratory distress syndrome ( ards ) , or normal lungs .
ventilators were operated with automated ( auto - trak ) or conventional high- , moderate- , and low - sensitivity flow - cycling software algorithms , 5 cmh2o or 15 cmh2o pressure support , 5 cmh2o positive end - expiratory pressure ( peep ) , and an air leak of 2528 l / min.resultsboth ventilators adapted to the system leak without requiring adjustment of triggering settings . in all simulated lung conditions ,
automated cycling resulted in shorter triggering delay times ( < 100 ms ) and lower triggering pressure - time product ( ptpt ) values .
tidal volumes ( vt ) increased with lower conventional cycling sensitivity level . in the copd model ,
automated cycling had higher leak volumes and shorter cycling delay times than in conventional cycling .
asynchronous events were rare .
inspiratory time ( tinsp ) , peak expiratory flow ( pef ) , and cycling off delay time ( cdelay ) increased as a result of reduction in conventional cycling sensitivity level . in the ards and normal adult lung models ,
premature cycling was frequent at the high - sensitive cycling level.conclusionsoverall , the auto - trak protocol showed better patient - machine cycling synchronization than conventional triggering .
this was evident by shorter triggering time delays and lower ptpt . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there are approximately 610,000 acute stroke patients in brazil per year , accounting for up
to 10% of hospital admissions , which makes acute stroke not only the principle cause of
chronic incapacity in adults but also the cause of high morbidity and mortality indices and
a significant impact on the health system1,2,3,4 . with the advent of treatment units organized around and specialized in stroke , there was a significant diminution in the
mortality and dependence of affected individuals after hospital discharge5 , 6 . stroke is the principle cause of mortality and incapacity in brazil , and there remains a
scarcity of stroke units and rehabilitation services . a stroke unit ( stroke - u ) is defined as an organized service and space with a focus on care
of patients with stroke during hospitalization by a multidisciplinary team specialized in
stroke management5 . in brazil , the report
of implementation of a stroke - u was in 2003 in the city of joinville , and it described an
observable effect in absolute numbers on lethality and the survival curve in the first 30
days after stroke7 . stroke patients commence the rehabilitation process in the hospitalization phase , and the
time at which patients initiate rehabilitation after discharge has become important in
recent years due to high rates of patients presenting with incapacity after stroke8 . diverse studies affirm that a delay in
initiation of the rehabilitation process is associated with a worse functional outcome9 , 10 ,
principally as a result of a reduction in exposure of the patient to therapeutic
interventions during the period of greatest cerebral plasticity11,12,13 . implementation of a stroke - u currently produces shorter hospitalization periods , reduces
morbidity and mortality , and facilitates of patient access to rehabilitation centers after
hospital discharge14 , 15 . the present study aimed to characterize patients attended in a
rehabilitation service before and after stroke - u implementation in a brazilian population in
relation to hospitalization time and permanence in the hospital ( los ) , time between
discharge and rehabilitation initiation ( dr ) , and functional incapacity . the hypothesis of
the study was that implementation of a stroke - u would result in a shorter los for patients
in addition to a shorter dr and increased functional capacity . this was a cohort study with retrospective analysis the medical records of 170 patients
with a clinical diagnosis of ischemic stroke supported by imaging studies who were being
treated in an integrated rehabilitation service in the clinical hospital at university
estadual paulista ( hc - unesp ) . the exclusion criteria were hemorrhagic stroke , thrombolysis
in acute phase ( first 4.5 hours ) , previous modified rankin scale ( mrs ) 1 , prior stroke ,
structural bone deformities , associated neurological disease , or prior cognitive
deficit . hc - unesp attends to a population of 275 thousand inhabitants and diagnoses an average of
352 patients with stroke per year . in 2010 , an acute stroke - u with 5 beds and a
multidisciplinary team ( neurologist , speech language pathologist , physiotherapist , and
nurses ) was implemented in the hospital s emergency department , serving as a direct
reference for 13 cities . after analysis of the medical records , the patients were distributed into two groups : a
pre - stroke - u group comprised of patients admitted to the rehabilitation service between
january 2002 and december 2009 and a post - stroke - u group comprised of patients admitted to
the rehabilitation service between january 2010 and december 2012 . all the patients admitted
to the rehabilitation service participated in an integrated regime of physiotherapy and
occupational therapy ; each session lasted 45 minutes , and sessions were performed 3 times
per week for 90 days . the procedures during the rehabilitation regime were the same before
and after implantation of the stroke - u . the data obtained were age ; gender ; etiology , that is , large vessels , cardioembolic , small
vessels , other causes and indeterminate causes , according to the toast classification16 ; bamford classification17 , that is , lacunar infarct ( lacs ) , partial
anterior circulation stroke ( pacs ) , total anterior circulation stroke ( tacs ) , and posterior
circulation stroke ( pocs ) ; length of stay ( los ) ; delay until rehabilitation ( dr ) and
functional outcome ( mrs ) . the variables utilized as potential confounding factors for
functional outcome were age , gender , toast classification , bamford classification , and type
of treatment received . the outcomes observed were los ( in days ) , dr ( months ) , and functional
incapacity 90 days after ictus measured by mrs as prioritized in the principle clinical
trials that utilized this scale18 , 19 . all the variables were obtained from the
botucatu stroke databank and recorded in accordance with our research protocol , which was
approved by the research ethics committee of the botucatu school of medicine . the subjects
analyzed composed an intentional - type , non probabilistic sample from a target population of
patients with a stroke diagnosis from the region attended by hc - unesp between 2002 and 2012 . the effect of stroke - u implementation on the outcomes was estimated by comparing patients
who underwent rehabilitation after 2010 ( year of stroke - u implementation ) with those who
underwent rehabilitation prior to 2010 . comparison of the patients attended before and after stroke - u implementation was performed
by mann - whitney test , test , and fisher s exact test , and multinomial
regression model adjusted to explain current incapacity as a function of time between
discharge and rehabilitation initiation by period . in the period from january 2002 to december 2012 , the medical records of 300 patients
referred to the rehabilitation service with a stroke diagnosis were analyzed . of these
individuals , 130 were excluded ( base on the exclusion criteria ) , thereby leaving 170 medical
records to be analyzed for the study . of these 170 individuals , 51.2% were male , and the
average age was 63 years ( 1090 ) . regarding the etiologies , 20% presented stroke originating
in large vessels , 17.6% presented stroke resulting from cardioembolism , 22.4% presented
stroke originating in small vessels , 32.4% presented stroke resulting from indeterminate
causes , and 7.6% presented stroke resulting from others causes . the strokes were classified
as lacs , pacs , tacs and pocs in 39.4% , 35.9% , 12.9% and 11.8% , respectively ( table 1table 1.comparison of patients attended before and after stroke - u implementationvariabletotal sample20022009(n = 84)20102012(n = 86)page on admission ( y)63 ( 1090)57 ( 1090)65 ( 3290)0.002gender ( male)51.2%49.4%53.2%0.634los ( days)8.6 ( 060)10.5 ( 060)7 ( 060)0.036dr ( months)1.1 ( 099)1.3 ( 099)1.0 ( 012)0.04toast classificationlarge vessels34 ( 20%)16 ( 19%)18 ( 20.9%)cardioembolic30 ( 17.6%)14 ( 16.7%)16 ( 18.6%)0.920small vessels38 ( 22.4%)18 ( 21.4%)20 ( 23.3%)indeterminate55 ( 32.4%)30 ( 35.7%)25 ( 29.1%)others13 ( 7.6%)6 ( 7.1%)7 ( 8.1%)bamford classificationlacs67 ( 39.4%)32 ( 38.1%)35 ( 40.7%)pacs61 ( 35.9%)31 ( 36.9%)30 ( 34.9%)0.947tacs22 ( 12.9%)10 ( 11.9%)12 ( 13.9%)pocs20 ( 11.8%)11 ( 13.1%)9 ( 10.5%)mrs0260.6%48.1%72.2%325.9%36.7%15.2%0.004 411.8%13.9%10.1%51.7%1.3%2.5%los : length of stay ; dr : delay until rehabilitation ; mrs : modified rankin scale ;
mann - whitney test , test ,
fisher s exact test ) . los : length of stay ; dr : delay until rehabilitation ; mrs : modified rankin scale ;
mann - whitney test , test ,
fisher s exact test in the period of 2010 to 2012 , the patients were significantly older , whereas the los and
dr were significantly shorter ; furthermore , the distribution of individuals in the mrs range
of 0 to 2 was greater , augmenting the percentage of patients classified as having mild
incapacity when compared with the period prior to stroke unit implementation . there was no
difference between etiology ( toast classification ) and localization ( bamford classification )
in the two periods ( table 1 ) . the relationship between period in which rehabilitation was initiated and the resultant
functional incapacity is shown in table
2table 2.multinomial regression model adjusted to explain current incapacity as a function
of time between discharge and rehabilitation initiationperiodmrsorci ( or ; 95%)p200220090 to 2 ( n=41)3 ( n = 31)1.0(0.91.0)0.0734 ( n = 11)1.0(1.01.0)0.0395 ( n = 1)1.0(0.91.0)0.082201020120 to 2 ( n=62)3 ( n = 13)1.0(1.01.0)0.0264 ( n = 9)1.0(1.01.0)0.0015 ( n = 2)1.0(0.91.0)0.399general ( 20022012)0 to 2 ( n=103)3 ( n = 44)1.0(1.01.0)0.0134 ( n = 20)1.0(1.01.0)0.0085 ( n = 3)1.0(1.01.0)0.046mrs : modified rankin scale ; or : odds ratio ; ci : confidence interval . according to the adjust regression model , each day of additional delay in the
period of 2002 to 2009 resulted in an estimated risk of a patient presenting an mrs of 4
( moderately severe incapacity ) of 0.13% ( or = 1.0013 ; p=0.039 ) relative to an mrs 0 to 2
( mild incapacity ) , while in 2010 to 2012 , the risk increased to 2.48% ( or = 1.0248 ;
p=0.001 ) . considering the last 10 years , the relative risk of the patient being classified
as having an mrs of 4 increased by 0.21% ( or = 1.0021 ) for each day of delay in commencing
rehabilitation after hospital discharge . our study demonstrated that after the implementation of the stroke - u , shorter
hospitalization and rehabilitation delay times , as well as better functional outcomes , were
observed . a diverse variety of benefits were observed in the individuals that underwent
rehabilitation organized by means of a multidisciplinary team , such as reduction of
mortality , recuperation of functional independence , and faster return to domicile , in
comparison with those that did not undergo the same rehabilitation5 . it is
important to emphasize that this may have been due to a longer life expectancy of the
population and increased prevalence of non - transmissible chronic diseases in this age
group20 , in addition to an etiological
investigation more accurate for detecting lacunar and small - vessel strokes , common in this
age range after stroke - u installation21 , 22 . in relation to hospitalization time , we can affirm that the integrated regime of
rehabilitation organized by means of a multidisciplinary team shortened the stay5 by reducing diverse complications related to
immobility and prolonged hospitalization23,24,25 .
with the diminution of diverse complications related to prolonged hospitalization time , we
may infer that patients after stroke - u implementation would have fewer complications and
greater recovery of independence in daily activities . the medical literature has discussed the ideal time for initiating the process of
rehabilitation after stroke . the principle guidelines indicate that rehabilitation must be
started as soon as possible or in an early manner and that the ability to rise from bed is a
predictor of functional independence , and they also indicate that the shorter the time to
initiate the rehabilitation process , the higher the level of functional independence and
discharge to domicile26,27,28,29 . in a study by murie - fernndez and colleagues , the authors
observed that for each day of delay in commencing rehabilitation , the functional
independence measure score decreased by 0.3 points9 . in our study , the time until arrival at the rehabilitation service
was shorter after stroke - u implementation because of the team structure and therapeutic
planning by means of protocols integrated between the hospital and rehabilitation
center . there was improvement in the level of functional independence after 90 days of monitoring
at the rehabilitation service among patients hospitalized in the stroke - u , highlighting that
for this outcome there was no impact of risk factors or etiologies associated with stroke . individuals who commence the rehabilitation process without delays are associated with a
lower index of complications and higher scores for functional independence30 . the decrease in mrs in our study probably
originated from the decrease in delay of rehabilitation and to the integral assistance
provides to patients through organized protocols during the hospital period , in addition to
the shorter hospitalization time and frequent visits with the patients made by the
multidisciplinary team until hospital discharge . the present study is limited in that it is a retrospective review of data from medical
records of the patients . the effects of acute medical complications were not included in our
analyses due to a lack of sufficient data on these variables . furthermore , the time of
inclusion in the group of patients after implementation of the stroke - u was lower , although
the numbers of patients were similar in both groups ; this was due to the increase in
admissions to hc - unesp for stroke after the implementation of the stroke - u . another factor
to consider is that the mrs was the only variable used to measure the functional outcome . although , other scales could supply a detailed picture of the functional state of a patient ,
the mrs was reported to be an efficacious instrument for examination of functional
incapacity in the principle randomized clinical studies on the subject31,32,33 . the results of the present study showed that after implementation of stroke - u , the patients
attended by the rehabilitation service presented shorter hospitalization times and
rehabilitation delays as well as lower functional incapacity . | [ purpose ] the study aimed to characterize patients treated by rehabilitation section
after establishment of an acute stroke unit .
[ subjects and methods ] medical consultation
records of individuals with ischemic stroke were studied retrospectively , excluding
individuals with hemorrhagic stroke , thrombolysis , previous modified rankin scale 1 ,
prior stroke , structural bone deformities , associated neurological disease , and prior
cognitive deficit .
the data evaluated were age , gender , etiology , localization , treatment
received , ictus onset , hospitalization time , discharge date , and date of first evaluation
at the rehabilitation center .
the modified rankin scale in 90 days after ictus was
utilized to measure functional incapacity with the individuals divided into two groups ,
before and after acute stroke unit implementation ( 2010 ) .
functional incapacity was
compared between before and after acute stroke unit implementation by the mann - whitney
test , 2 test and fisher s exact test .
[ results ] the medical records of 170
patients were evaluated . in the group evaluated after 2010 ,
the patients were
significantly older and presented a shorter time between hospitalization and discharge ,
shorter time until the first evaluation in rehabilitation , and increased percentage of
mild incapacity ( modified rankin scale = 0 to 2 ) .
[ conclusion ] after acute stroke unit
implementation , the patients treated in the rehabilitation section presented a shorter
hospitalization time and rehabilitation delay and less functional incapacity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dizziness in the elderly is a serious health concern due to the increased morbidity caused by falling . the most common cause of dizziness in the elderly , benign paroxysmal positional vertigo ( bppv ) , is frequently undiagnosed , and bedside treatment of these patients can be difficult due to neck and back stiffness , which makes repeated and accurate repositioning maneuvers difficult . after a fall , a 96-year - old woman was referred by a resident neurologist for intractable bppv . the patient was placed on a motorized turntable and repositioned to remove the calcite particles from the affected posterior semicircular canal . video monitoring of the eyes allowed confirmation of the diagnosis , as well as an immediate evaluation of the effectiveness of the maneuver . every patient with dizziness or imbalance , even in the absence of typical complaints of bppv , should be tested with provocation maneuvers , because the clinical picture of bppv is not always typical . even if elderly patients with dizziness are very frail , the completion of provocation maneuvers is imperative , since the therapeutic maneuvers are extremely effective . benign paroxysmal positional vertigo ( bppv ) causes dizziness , imbalance , and nausea , and is fairly common , especially in the elderly , reaching a cumulative incidence of almost 10% at the age of 80.1 moreover , unrecognized bppv is strikingly frequent , with a prevalence of up to 9% in geriatric outpatient clinics.2 imbalance due to bppv is a serious health concern , since falling leads , directly or indirectly , to 12% of all deaths in elderly populations.3 bppv occurs when calcite particles detach from the utricle and enter a semicircular canal of the inner ear.4 the canals are fluid - filled rotational sensors that transduce head rotational acceleration into a neural signal roughly proportional to head velocity . due to the inertia of the endolymph fluid , head rotation causes a relative fluid flow , which bends the cupula membrane and deflects hair cells.5 when calcite particles enter the canal , the gravitational movement of the particles due to head tilt creates endolymphatic currents that cause cupular displacement , resulting in vertigo attacks accompanied by nystagmus . head trauma can sometimes precipitate bppv,6 though age - related degeneration of the otoconia probably contributes to the prevalence of bppv in the elderly.7 fortunately , repositioning maneuvers to move the particles out of the canals are highly efficient,8 and can lead to a significant reduction in the number of falls in the elderly.9 the effectiveness of these maneuvers in the elderly is controversial , with some studies suggesting they are less effective10 and others finding no age - related difference in outcome.11 bedside treatment of the elderly can be difficult due to neck and back stiffness , which makes accurate and repeated maneuvers difficult . this issue can be overcome by treating frail elderly patients on a motorized turntable that safely moves them to displace the particles from the affected canal.8 a 96-year - old patient was hospitalized after experiencing a fall that resulted in a broken pubic bone . the patient complained of short - lasting dizziness when stooping , and the resident neurologist diagnosed bppv of the right posterior canal . due to the age and frailty of the patient after the fall , manual repositioning treatments were not attempted , and the patient was referred to our dizziness clinic . we performed an epley repositioning maneuver12 with the patient firmly and safely seated in a motorized turntable ( see figure 1 and supplementary video ) . video monitoring of the eyes allowed us to confirm the diagnosis of the affected canal by the presence and direction of typical vertical - torsional nystagmus , and to immediately evaluate the effectiveness of the liberation maneuver . the patient was first slowly rotated backwards by 120 in the plane of the right posterior canal ( dix hallpike maneuver),13 eliciting up - beating nystagmus induced by particle movement . there was also a small torsional component that beat counterclockwise ( toward the affected right ear ) , however , this is difficult to appreciate in the video . an epley repositioning maneuver was then performed , rotating the patient about the body yaw axis until the patient looked downward , 45 from horizontal . due to the age of the patient , we returned her upright immediately to minimize discomfort . no nystagmus was observed during the epley maneuver , perhaps because the stimulation was lower due to particle displacement as a result of the previous dix hallpike maneuver tested the effectiveness of the repositioning , as we occasionally find that residual symptoms persist after a single treatment . no nystagmus was observed after the second backward movement , showing that the single repositioning had successfully displaced the calcite particles from the posterior canal , curing the patient . follow - up of the patient several months later confirmed that she no longer experienced positional vertigo . treating patients with bppv on a motorized turntable offers several advantages over bedside treatment,8 including increased precision and the repeatability of maneuvers for both diagnosing the affect canal(s ) and treatment . the elderly deserve special consideration because accurate manual repositioning can be difficult due to neck and back stiffness , compounded by hesitancy of the treating physician to move a frail patient . while some patients express reservation upon seeing the turntable , our experience is that the elderly are quite receptive and tolerate the treatments well . in the past year , we have treated over 90 patients on the turntable without adverse consequences , and similar devices have been described and used in even greater numbers of patients,8 demonstrating the safety of using motorized turntables in treating bppv . turntable repositioning is suitable for most patients but may not be possible in the presence of claustrophobia , morbid obesity , cervical fractures , or severe respiratory or cardiac insufficiency . | backgrounddizziness in the elderly is a serious health concern due to the increased morbidity caused by falling
. the most common cause of dizziness in the elderly , benign paroxysmal positional vertigo ( bppv ) , is frequently undiagnosed , and bedside treatment of these patients can be difficult due to neck and back stiffness , which makes repeated and accurate repositioning maneuvers difficult.case presentationafter a fall , a 96-year - old woman was referred by a resident neurologist for intractable bppv .
the patient was placed on a motorized turntable and repositioned to remove the calcite particles from the affected posterior semicircular canal .
video monitoring of the eyes allowed confirmation of the diagnosis , as well as an immediate evaluation of the effectiveness of the maneuver.conclusionevery patient with dizziness or imbalance , even in the absence of typical complaints of bppv , should be tested with provocation maneuvers , because the clinical picture of bppv is not always typical .
even if elderly patients with dizziness are very frail , the completion of provocation maneuvers is imperative , since the therapeutic maneuvers are extremely effective .
a motorized turntable is very helpful to perform the repositioning accurately and safely . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the nhanes , conducted annually since 1999 by the centers for disease control and prevention , is an ongoing survey designed to measure the health and nutritional status of the civilian noninstitutionalized u.s . the surveys include household interviews , standardized physical examinations , and collection of medical histories and biologic specimens . some of these specimens were used to assess exposure to environmental chemicals ( 10 ) . among 9,643 participants in the nhanes 20032004 , pbdes and pbbs were measured in serum from a random one - third subsample of subjects aged 12 years . the nhanes standardized home interview was followed by a detailed physical examination in a mobile evaluation clinic or the participant 's home . waist circumference was measured at the high point of the iliac crest to the nearest 0.1 cm at the end of normal expiration . serum triglyceride concentration was measured enzymatically , and hdl cholesterol concentration was analyzed using the direct hdl cholesterol immunoassay method . up to four blood pressure measurements were obtained from each participant . to establish high blood pressure status , we used the average of the last two measurements of blood pressure for participants who had three or four measurements , the last measurement for participants with only two measurements , and the only measurement for participants who had one measurement . bfrs were measured by high - resolution gas chromatography / high - resolution mass spectrometry using isotope dilution for quantification . the bfrs were reported on a lipid - adjusted basis using concentrations of serum total cholesterol and triglycerides . among 11 bfrs measured in the nhanes , we selected five pbdes ( pbde-28 , pbde-47 , pbde-99 , pbde-100 , and pbde-153 ) and one polybrominated biphenyl ( pbb ; pbb-153 selected ) for which at least 60% of study subjects had concentrations more than the limit of detection . a total of 1,367 study participants aged 20 years with information on serum concentrations of six bfrs and fasting or random plasma glucose were included for analysis . participants were considered to have diabetes if 1 ) their fasting plasma glucose was 126 mg / dl , 2 ) their nonfasting plasma glucose was 200 mg / dl , or 3 ) they were taking insulin or an oral agent . we defined the metabolic syndrome among fasting participants using the national cholesterol education program definition . this definition required that the participant satisfied three or more of the following five criteria : 1 ) waist circumference 102 cm in men and 88 cm in women , 2 ) fasting triglycerides 150 mg / dl , 3 ) hdl cholesterol < 40 mg / dl in men and < 50 mg / dl in women , 4 ) blood pressure 130/85 mmhg or on antihypertensive medication , and 5 ) fasting glucose 100 mg / dl or on antidiabetes medication . among 1,367 study subjects , 655 participants had information on fasting morning samples suitable for measurement of triglycerides and glucose . after excluding 18 subjects with missing data on waist circumference , the final sample size was 637 . for each bfr , participants with serum concentrations under levels of limit of detection were regarded as the reference group and those with detectable values categorized by cut points at the 25th , 50th , and 75th percentiles . variables considered to be confounders in the multivariable analysis were age , sex , race / ethnicity , poverty income ratio ( the ratio of income to the family 's poverty threshold ; higher poverty income ratio means wealthier ) , and bmi . in the case of metabolic syndrome , we further considered cigarette smoking ( never , former , or current ) , cotinine concentrations ( ng / ml ) , alcohol consumption ( g / day ) , and leisure - time physical activity ( vigorous , moderate , or none ) as possible confounders . in 149 participants , we substituted median values of the remaining participants for missing poverty income ratio , bmi , cotinine concentrations , or alcohol consumption . estimates of main results were calculated accounting for stratification and clustering , adjusting for age , race and ethnicity , and poverty income ratio instead of using sample weights . this adjustment has been regarded as a good compromise between efficiency and bias ( 12 ) . as results were very similar with sas 9.1 and sudaan 9.0 , we present the results based on sas 9.1 . sd for age and bmi were 49.7 19.3 years and 28.3 5.9 kg / m , respectively . in general , pbb-153 showed different patterns of association with demographic factors from pbdes , except pbde-153 ( table 1 ) . among six bfrs , only pbb-153 was positively associated with age , while pbdes showed no or inverse associations with age . in addition , participants with high pbb-153 tended to be white men and to have high socioeconomic status . however , most pbdes were not associated with sex , tended to be higher among nonwhites , and tended to be found in participants with low socioeconomic status . both pbb-153 and pbde-153 were inversely associated with bmi , while other pbdes were not associated with bmi . serum concentrations of pbb-153 were not associated with those of pbdes , except for a weak correlation with pbde-153 . all five pbdes were strongly and positively associated among each other . there were 156 diabetic case subjects among 1,367 participants ( prevalence 11.4% ) . the associations with diabetes depended on bfr ( table 2 ) . after adjusting for age , sex , race , poverty income ratio , and bmi , there was a significant positive association across five categories of pbb-153 with diabetes prevalence , with adjusted odds ratios of 1.0 , 0.7 , 1.4 , 1.6 , and 1.9 ( p for trend < 0.01 ) . among five pbdes , there was a nonlinear association with diabetes across five categories of serum concentrations of pbde-153 , with adjusted odds ratios of 1.0 , 1.6 , 2.6 , 2.7 , and 1.8 ( p for quadratic term < 0.01 ) . although both pbde-99 and pbde-100 tended to show inverted u - shaped associations similar with pbde-153 , they failed to reach statistical significance . further adjustment for waist circumference did not change these results ( data not shown ) . there was a positive association with the prevalence of metabolic syndrome across five categories of serum pbb-153 concentration , with adjusted odds ratios of 1.0 , 1.5 , 3.1 , 3.1 , and 3.1 ( p for trend < 0.01 ) ( table 3 ) . similar to the association with diabetes , pbde-153 showed an inverted u - shaped association with metabolic syndrome , with adjusted odds ratios of 1.0 , 2.1 , 2.5 , 2.4 , and 1.7 ( p for quadratic term = 0.02 ) . when we separately studied the five components of metabolic syndrome , pbb-153 was nonlinearly associated with waist circumference , high triglycerides , and low hdl cholesterol ( p for quadratic terms = 0.09 , < 0.01 , and 0.07 , respectively ) . pbb-153 tended to be positively associated with high fasting glucose but did not reach statistical significance . however , pbb-153 was significantly associated with glycemia , defined using the higher cutoff point for fasting glucose of 110 mg / dl instead of 100 mg / dl ( data not shown ) . pbde-153 also showed an inverted u - shaped association with high triglycerides ( p for quadratic term < 0.01 ) . waist circumference or fasting glucose also showed some nonlinear trends , but none were significant . in this article , we continued our examination of the relationships of pops with diabetes and metabolic syndrome by studying bfrs . among six bfrs , pbb-153 and pbde-153 were significantly associated with both diabetes and metabolic syndrome , although dose - response relationships did not appear to be the same between these two chemicals . thus , these data provide limited support for the proposition that besides chlorinated pops , other chemicals with properties of persistence in adipose tissue and endocrine disruptors may also disturb glucose and lipid metabolism . however , evidence in favor of this conclusion is much stronger for chlorinated pops ( 13 ) than for the brominated pops , which were the focus of this article . in our previous studies on chlorinated pops ( 13 ) , most chemicals belonging to the pcb and organochlorine pesticide classes showed strong associations with diabetes and metabolic syndrome . despite the chemical and physical similarities among pcbs , pbbs , or pbdes , most chemicals belonging to pbdes , except pbde-153 , were not clearly associated with diabetes and metabolic syndrome . in fact , there is an important difference in exposure route of pbdes from chlorinated pops or pbbs . at first , like chlorinated pops , diet was regarded as a major pathway of exposure to pbdes because they also bioaccumulate in food chains ( 13 ) . however , recent studies discovered that the main exposure route of pbdes in the general population is house dust , not diet , because it is used as an additive to retard fire and flames in a variety of commercial and household products ( 14 ) . humans are exposed to pbdes in house dust in direct inhalation , ingestion , and dermal exposure ( 5 ) . unlike pbdes , pbbs were prohibited in the u.s . in the 1970s after an accidental human exposure in michigan ( 15 ) . thus , their main exposure route would be diet , which is similar to that for chlorinated pops ( 15 ) . serum concentrations of five chemicals belonging to pbdes showed very strong mutual correlations , consistent with common exposure sources . however , a serum pbb-153 concentration showed , at most , weakly positive associations in comparison with associations with pbdes . as pbdes were measured among the nhanes participants in whom pcbs were not measured , we could not examine the correlation between pcbs and pbdes . however , other studies with simultaneous measurement reported no association between these two chemicals ( 16 ) . therefore , serum concentrations of chlorinated pops or pbbs , with exposure primarily through food , may reflect a cumulative lifetime dose of exposure . however , serum concentrations of pbdes may be a mixture of more recent exposure to indoor pollution and cumulative low exposure to diet . pbbs and chlorinated pops ( 13 ) were strongly associated with age , while most pbdes were not , or even inversely , associated with age . unlike traditional toxicological effects due to acute high - dose exposure , disturbance of glucose and lipid metabolism due to pops in adipose tissue as endocrine disruptors may require long - term exposure . thus , we think that serum concentrations of pbdes may not reflect a biologically important long - term dose . furthermore , toxicological studies have shown that different exposure routes led to different pharmacokinetics in terms of uptake , distribution , and elimination ( 17 ) . however , pbde-153 tended to stand out from other pbdes in several ways . even though pbde-153 showed an inverse association with age , opposite to that of pbb-153 , serum concentrations of pbde-153 , compared with other pbdes , were more positively correlated with those of pbb-153 . in addition , both the higher concentrations in men and the inverse association with bmi were similar to those of pbb-153 but different from other pbdes . the significant associations of pbb-153 and pbde-153 need further discussion in relation to their differing dose - response curves . interestingly , in our previous studies ( 13 ) , we also found nonlinear dose - response relations of pcbs with various outcomes , including plateaus or inverted u - shaped associations . among various subclasses of pops , pcbs are the subclass that has most similar structures to bfrs ( 5 ) . thus , a similar dose - response curve between pcbs and bfrs may be biologically plausible . in fact , in addition to pcbs , most chlorinated pops showed an association that was much steeper across lower background concentrations than across higher background concentrations . although a linear dose - response relation is generally regarded by epidemiologists as a criterion for causality , the possibility of inverted u - shaped associations with endocrine disruptors has been suggested by some experimental studies ( a strong effect across low doses but a weakened or no effect at high doses ) ( 18 ) . although researchers cautioned that low - dose effects can not be extrapolated from animal studies to humans ( 19 ) , our findings on pcbs , pbbs , or pbdes suggest that this concept might also apply in the human body . this nonlinear dose - response curve may explain previous epidemiological findings in the michigan cohort with accidental high exposure to pbbs ( 20 ) . in fact , this prospective cohort study did not show any association between pbb concentrations and incident diabetes . however , serum concentrations of the reference group in the michigan cohort were already much higher than those of current participants . no association in subjects with high exposure to pops but strong associations in subjects with background exposure to pops were similarly observed with chlorinated pops ( 21 ) . even though it is still unclear what biological mechanism is involved in the association of pops with diabetes and metabolic syndrome , the potential of xenobiotics to disrupt glucose and lipid metabolism in mammals is a well - developed theory in toxicology ( 8) . indeed , many of the early toxicity responses in animal studies with a range of pollutants note glucosuria , dyslipidemia , increased gluconeogenesis , and fatty liver ( 8) . furthermore , dioxin - like compounds exert their effects through binding to the aryl - hydrocarbon receptor , which is thought to antagonize peroxisome proliferator activated receptors ( 9 ) . in fact , both of these pops showed positive associations with waist circumference after adjusting for bmi . in our previous studies ( 13 ) , pcbs were also inversely associated with bmi but positively associated with waist circumference , while other chlorinated pops were weakly and positively associated with both bmi and waist circumference . the exposure to pops may affect visceral adipose tissue differently than subcutaneous adipose tissue , and these effects may depend on pop subclass . furthermore , even though pops are generally observed to be positively associated with obesity , associations between pops and obesity would not be simple . for example , a high intake of fatty food is related to both a high pop exposure and obesity . on the contrary , furthermore , some experimental studies have reported that the exposure to endocrine disruptors itself can induce obesity ( 22 ) . as these mechanisms do not all act in the same direction , the associations between pops and obesity may be diverse . first , the current findings should be interpreted with caution due to the cross - sectional nature of this study . even though our results are biologically plausible because some pbdes are reported to cause the disturbance of glucose and lipid metabolism in adipose tissue ( 7 ) , we could not exclude the possibility that changes in metabolic state due to disease could have created the associations we observed . second , bfrs were not measured in the same population as chlorinated pops in the nhanes , so we could not simultaneously consider the effect of chlorinated pops . there may be a possibility of synergistic effects that multiple pops reinforce each other 's toxicity in the general population , as we discussed previously ( 21 ) . third , inference should be made cautiously in light of the multiple comparisons intrinsic in this investigation . along with our previous findings on chlorinated pops , our current study suggests that the background exposure to some brominated pops may be closely related to disturbance of glucose and lipid metabolism in the general population . prospective studies of the relation of pops with diabetes and metabolic syndrome are needed because both the exposure and the disease have substantial prevalence and the public health significance of such a relation could be marked . | objective chlorinated persistent organic pollutants ( pops ) , endocrine disruptors accumulated in adipose tissue , were associated with diabetes and metabolic syndrome .
brominated flame retardants ( bfrs ) , such as polybrominated diphenyl ethers ( pbdes ) or polybrominated biphenyls ( pbbs ) , are another class of pops for which body burden is increasing .
cross - sectional associations of serum concentrations of bfrs with diabetes and metabolic syndrome were studied.research design and methods in the national health and nutrition examination survey 20032004 , 1,367 adults were examined with respect to diabetes status .
five pbdes and one pbb were selected , detectable in 60% of participants . for the outcome metabolic syndrome , we restricted the analysis to 637 participants with a morning fasting sample.resultscompared with subjects with serum concentrations below the limit of detection , prevalent diabetes had differing dose - response associations with serum concentrations of pbb-153 and pbde-153 .
adjusted odds ratios across quartiles of serum concentrations for pbb-153 or pbde-153 were 1.0 , 0.7 , 1.4 , 1.6 , and 1.9 ( p for trend < 0.01 ) and 1.0 , 1.6 , 2.6 , 2.7 , and 1.8 ( p for quadratic term < 0.01 ) , respectively .
pbb-153 was also positively associated with the prevalence of metabolic syndrome with adjusted odds ratios of 1.0 , 1.5 , 3.1 , 3.1 , and 3.1 ( p for trend<0.01 ) . as in its association with diabetes
, pbde-153 showed an inverted u - shaped association with metabolic syndrome.conclusionspending confirmation in prospective studies , lipophilic xenobiotics , including brominated pops stored in adipose tissue , may be involved in the pathogenesis of diabetes and metabolic syndrome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
significant improvement of kidney transplantation results in the early postoperative period during recent decades is accompanied by the expansion of the pool of patients with long periods of observation . the most difficult problem of the late postoperative period is chronic nephropathy of the transplant [ 16 ] . late dysfunction of kidney transplant is polygenic and multistep process that leads to returning to dialysis or patient 's death [ 2 , 7 , 8 ] . the steadily increasing number of kidney transplants in the future is one of the significant sources of expanding of the pool of dialysis patients due to a new and rather specific form of chronic renal failure , a chronic allograft nephropathy . effective treatment must not only predict the rate of growth of transplanted kidney dysfunction but also have guidelines for immunosuppression and determine the optimum timing of the transfer of transplant recipients on dialysis treatment program [ 921 ] . the objective of this study is to increase the efficiency of the treatment of recipients in the late period after kidney transplantation by estimating the probability of loss of function of kidney transplant in the long - term period after transplantation . 330 patients who had been receiving renal replacement therapy since 1987 till 2012 and living longer than one year with a functioning kidney transplant were selected in the study group . there were 61.2% males and 38.8% females . most of them were on hemodialysis ( 96% ) ; 13 patients received preemptive transplant . immunosuppression ( at the initial stage of our work ) consisted of cyclosporine , azathioprine , and steroids . later ( since the year 2000 ) in all cases of induction anti - cd-25 monoclonal or other depleting antibodies were used . immunosuppression maintenance spectrum was added by tacrolimus , prolonged - release tacrolimus , mycophenolate mofetil , mycophenolate sodium , or everolimus . clinical and laboratory monitoring of the patient and kidney transplant were usually carried out on outpatient basis . surveys were carried out depending on the period after kidney transplantation with a frequency of once a month up to 24 times per year . particular attention was paid to the level of blood pressure , hemoglobin in the full blood count , creatinine concentration in blood plasma , and daily protein excretion . if necessary , sonography of transplant was performed . we considered as appropriate the immunosuppression in which concentration of immunosuppressants in the blood was within the therapeutic range and the number of leukocytes in full blood analysis corresponded to normal . the diagnosis of anemia was made at hemoglobin concentration of less than 130 g / l for men and less than 120 g / l for women . the blood pressure less than 140/90 mm hg was considered as normal , blood pressure more than 140159/9099 mm hg was considered as moderately elevated , and the blood pressure more than 160/100 mm hg was considered as high . the degree of proteinuria was assessed by daily urinary protein excretion : minimum : loss of protein < 0.5 g / day , moderate : 0.51 g / day , and severe : more than 1.0 g / day . in order to standardize the results , as a starting point of late dysfunction we conventionally adopted the increase of creatinine level to 0.3 mmol / l in plasma for the first time detected after kidney transplantation . we used sf-36 scale to assess patients ' quality of life . in order to identify the features that can be used to assess the degree of risk of death with a functioning transplant or return to the program hemodialysis the method of constructing of mathematical predicting models has been used . to predict the subsequent duration of the well - functioning of allotransplant the prognostic significance of 15 baseline clinical and sociodemographic characteristics on the results of the survey one year after transplantation was investigated . we studied age of the recipient at the time of renal transplantation , primary diagnosis , which led to the development of end - stage renal failure , type of donation ( cadaveric or living ) , duration of hemodialysis treatment before kidney transplantation ( in years ) , the presence of an induction immunosuppressive therapy with antibodies , the presence of hepatitis b or c infection at time of transplantation , education ( primary school , general secondary education , or university ) , type of residence ( urban , rural ) , number of previous transplantations ( 0 , 1 , 2 , or 3 ) , the concentration of creatinine in the blood one year after transplantation ( mmol / l ) , blood pressure one year after transplantation ( mm hg ) , the concentration of hemoglobin in the blood one year after transplantation ( g / l ) , proteinuria one year after transplantation ( none , minimal : < 0.5 g / l , moderate : 0.51 g / l ) , and the duration of satisfactory function of renal transplant ( in years ) to death with a functioning graft or to return to the program hemodialysis . the choice of factors taken as a basis was determined , first of all , by their accessibility to the wide range of physicians having the recipients in the late postoperative period under supervision . that is why we studied the possibility to use the most informative ones to predict the loss of kidney transplant function . to assess the data obtained we used methods of parametric statistics including definition of their accuracy according to student 's criterion . to reveal the most informative signs at assessing the degree of death risk with the functioning transplant or returning to programmed hemodialysis , for the purpose of possible correction of emergent threat , cox multiple - factor regression model with the calculation of correlation coefficients was used . in this model the influence of each factor under study is characterized by an assessed coefficient which reflects the specific weight of the factor itself in the complex of assumed influence . the connection between studied separate risk factors of kidney transplant function loss was analyzed with the use of conjugation tables and by means of calculating the correlation coefficients . in constructing of regression model of prognostication the result was considered positive if the recipient lived for more than 3 years from the time of transplantation . analysis of -coefficients of the generalized regression model for the forecast was performed . on a dedicated set of features predictive model standardization of all stages of pre- , intra- , and postoperative period facilitated an increase in one - year survival rate of kidney transplants especially in separate years of the last decade till 100% . in the late period in a year or later after the kidney transplant recipient 's quality of life was close to the quality of life of healthy people and is significantly higher than the patients who continued dialysis ( table 1 ) . so the quality of life after transplantation was largely determined by the presence or absence of renal transplant dysfunction which dominated in the structure of adverse outcomes in transplant transplantations in late postoperative period . this is the reason why all the necessary measures should be carried out including prognostication and influence upon the modifying factors to ensure the stable kidney transplant function . development of renal allograft dysfunction usually associated with anemia , hypertension , proteinuria , infections , and other adverse events . in the analysis of the anemia prevalence in the late period after kidney transplantation and its correlation with survival of patients and transplants it is revealed that before kidney transplantation 98.7% of patients had signs of anemia . one year after kidney transplantation 20% of patients had anemia signs , three years after 28% , in 5 years 37% , in 10 years 45% , and in 15 years 46% . functional survival of patient 's transplants with normal levels of hemoglobin in the blood after 15 years of the operation was three times higher than that in the group of patients with anemia ( figure 1 ) . before kidney transplantation 1.8% of patients had normal blood pressure ( bp ) , one year after kidney transplantation normal blood pressure occurred in 27% of patients , after 3 years , in 31% of patients , after 5 years , in 37% of patients , after 10 years , in 45% of patients , and after 15 years , in 54% of patients . functional survival in patient 's transplants with normal blood pressure after 15 years was 2.8 times higher than that in the group of patients with hypertension , and patients survival rate was almost 5 times higher ( figure 2 ) . our data also confirm the close connection between the severity of proteinuria , the presence of symptoms of chronic nephropathy of transplant , and the rate of its progression . the average duration of transplant functioning from the moment of the detection of minimal proteinuria was 4.3 2.5 years , with moderate proteinuria it was 2.7 2.2 years , and in severe proteinuria it was 0.8 0.3 years . we found out that the rate of chronic nephropathy development in renal transplant depended on the duration of satisfactory function of renal transplant . patients who had signs of late dysfunction one year after transplantation returned to hemodialysis in 19.4 2.6 months after the first recorded increase of the plasma creatinine up to 0.3 patients who had symptoms of late dysfunction 2 - 3 years after transplantation returned to hemodialysis in 40.0 0.6 months after the first recorded increase of the plasma creatinine up to 0.3 patients who had symptoms of late dysfunction 5 years after transplantation returned to hemodialysis in 44.5 0.9 months after the first recorded increase of the plasma creatinine up to 0.3 mmol / l . in order to predict the duration of satisfactory function of the transplanted kidney we investigated the predictive value of 15 basic clinical laboratory and sociodemographic variables of the survey one year after transplantation ( table 2 ) . 233 ( 70.6% ) analysis of -coefficients of the generalized regression model showed that three characteristics can be deemed the most significant ( p < 0.001 ) for the forecast : blood creatinine and hemoglobin level and degree of proteinuria . it was found that three signs can be the most significant ( p < 0.001 ) : creatinine concentration in the blood ( x1 ) , hemoglobin concentration in the blood ( x2 ) , and severity of proteinuria ( x3 ) . the resulting predictive model using these factors was described by the equation : y = 0.967 x1 + 0.00955 x2 0.143 x3 0.068 , where x1 is creatinine ( mmol / l ) , x2 is hemoglobin ( g / l ) , and x3 is proteinuria in a year after transplantation ( g / l ) . if as a result of calculation within the created model y value is less than ycrit , a negative result is predicted ( a loss of transplant function in three years from the time of transplantation ) and otherwise a positive ( favorable ) result is predicted . determination of creatinine and hemoglobin level in the blood as well as the concentration of protein in the urine in one year after kidney transplantation with the calculation of prognostic criterion predicts the loss of renal allotransplant function in 3 years after surgery . the advantages of the method are the possibility of quantitative forecasting of renal allotransplant losses which is based not only on its excretory function assessment , but also on an assessment of other characteristics that may have important prognostic value and does not always directly correlate with changes in its excretory function . in order to assess the risk of death with a transplant functioning or return to the program hemodialysis the predictive model calculation and prognosis will be automatically done in the electronic table ( figure 3 ) . the calculator designed by us has been patented ( http://uapatents.com/4-68339-sposib-prognozuvannya-vtrati-funkci-nirkovogo-transplantata.html ) and is available on the internet ( https://yadi.sk/i/w9dat4yrsfrnz ) . the accuracy of prediction of renal transplant function loss three years after transplantation was 92% . progression of chronic renal dysfunction of the transplant is accompanied by the simultaneous loss of the benefits of a successful transplantation and the growth of problems due to immunosuppression . based on a retrospective analysis of results of treatment of kidney transplant of the recipients with blood creatinine higher than 0.3 mmol / l , we adhere to the following principles in the correction of immunosuppression which allow decreasing the rate of chronic dysfunction of the transplant development or decreasing the risk of complications in case of loss of its function.do not prescribe high doses of steroids and do not have the steroid pulse therapy.do not increase the dose of received cyclosporine or tacrolimus and stop medication if there is an increase in nephropathy.continue immunosuppression with medicines of mycophenolic acid which are not nephrotoxic.enhance monitoring of immunosuppression and prevention of infectious complications.cancel immunosuppression at returning to hemodialysis treatment . cancellation of steroids should be done gradually , sometimes for several months . when the discomfort is associated with transplant ( temperature , pain in the projection of the transplanted kidney , and hematuria ) short courses of low doses of steroids administered orally or intravenously do not prescribe high doses of steroids and do not have the steroid pulse therapy . do not increase the dose of received cyclosporine or tacrolimus and stop medication if there is an increase in nephropathy . cancellation of steroids should be done gradually , sometimes for several months . when the discomfort is associated with transplant ( temperature , pain in the projection of the transplanted kidney , and hematuria ) short courses of low doses of steroids administered orally or intravenously mmol / l , and in the third group concentration in blood plasma was more than 1.0 dates of the return of transplant recipients with delayed renal transplant dysfunction are largely dependent on the psychological state of the patient , severity of depression , the desire to ensure the irreversibility of the transplanted kidney dysfunction , and fear that the dialysis will contribute to the deterioration of renal transplant function . the survival rate of patients of the first group after return to hemodialysis was 7.4 + 2.8 years , and in the second and third groups it was , respectively , 5.3 3.2 and 2.8 + 2.6 years . in general , the noninvasive prediction of loss of renal transplant function based on quantitative criteria which diversely characterized the state of renal transplant enabled timely influence on modifiable risk factors for dysfunction of the transplanted kidney , correct immunosuppression , or return kidney transplant recipients to dialysis treatment . our experience of renal transplantation confirms the principle possibility to achieve a guaranteed high level of patient 's rehabilitation . the quality of medical and social rehabilitation after kidney transplantation is comparable with healthy individuals and is much better than the patients being treated with hemodialysis.the results of kidney transplantation are largely determined by the presence of renal allotransplant dysfunction which dominated in the structure of the causes of an unfavorable outcome of kidney transplantation in the late postoperative period . more later development of the kidney transplant dysfunction correlated with the greater duration of the period prior to the loss of its function.the absence of anemia and proteinuria after kidney transplantation allows counting on a significant improvement in survival of renal allotransplant and a recipient . correction of blood pressure also allows counting on a significant improvement in the results of renal transplantation in the late postoperative period.determination of creatinine and the hemoglobin concentration in blood and the protein concentration in urine one year after transplantation with the calculation of prognostic index allows predicting the loss of renal allotransplant function in 3 years after transplantation with accuracy up to 92% . the constructed mathematical model for predicting the loss of renal allotransplant function can be realized in the tabular processor excel and thus be used in medical practice.for patients with delayed renal allotransplant dysfunction it is reasonable to restart the hemodialysis program at achieving plasma concentrations of creatinine of 0.50.7 mmol / l . our experience of renal transplantation confirms the principle possibility to achieve a guaranteed high level of patient 's rehabilitation . the quality of medical and social rehabilitation after kidney transplantation is comparable with healthy individuals and is much better than the patients being treated with hemodialysis . the results of kidney transplantation are largely determined by the presence of renal allotransplant dysfunction which dominated in the structure of the causes of an unfavorable outcome of kidney transplantation in the late postoperative period . more later development of the kidney transplant dysfunction correlated with the greater duration of the period prior to the loss of its function . the absence of anemia and proteinuria after kidney transplantation allows counting on a significant improvement in survival of renal allotransplant and a recipient . correction of blood pressure also allows counting on a significant improvement in the results of renal transplantation in the late postoperative period . determination of creatinine and the hemoglobin concentration in blood and the protein concentration in urine one year after transplantation with the calculation of prognostic index allows predicting the loss of renal allotransplant function in 3 years after transplantation with accuracy up to 92% . the constructed mathematical model for predicting the loss of renal allotransplant function can be realized in the tabular processor excel and thus be used in medical practice . for patients with delayed renal allotransplant dysfunction it is reasonable to restart the hemodialysis program at achieving plasma concentrations of creatinine of 0.50.7 mmol / l . at the same time hemodialysis immunosuppressive therapy must be canceled . | background . this study is provided to increase the efficiency of the treatment of kidney transplant recipients by predicting the development of the late allotransplant dysfunction . methods .
330 patients who have lived for more than one year with functioning kidney allograft were evaluated .
to predict the subsequent duration of the well - functioning of allotransplant the prognostic significance of 15 baseline clinical and sociodemographic characteristics on the results of the survey one year after transplantation was investigated .
the result was considered to be positive in constructing the regression prognostication model if recipient lived more than 3 years from the time of transplantation . results .
it was established that more late start of renal allograft dysfunction after transplantation correlates with the more time it takes till complete loss of allograft function .
creatinine and hemoglobin blood concentration and the level of proteinuria one year after transplantation within created mathematical model allow predicting the loss of kidney transplant function three years after the transplantation .
patients with kidney transplant dysfunction are advised to renew the program hemodialysis upon reaching plasma creatinine concentration 0.50.7 mmol / l .
conclusion .
values of creatinine , hemoglobin , and proteinuria one year after transplantation can be used for subsequent prognostication of kidney transplant function . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a patient with this condition is prone to develop infections due to poor t - cell formation and function . this rare syndrome results in hypocalcemia arising from parathyroid hypoplasia , thymic hypoplasia , and outflow tract defects of the heart . , we discuss the radiological features , laboratory findings , and the cytogenetic results that aided in the diagnosis of this rare syndrome . a 4-month - old infant presented with complaints of cough , cold , and breathlessness that had persisted for 2 days . initial clinical examination revealed bilateral wheeze on auscultation and subtle dysmorphic facial appearance which included small chin , small mouth , and coarse facial features . the mother also gave history of abortion of her previous pregnancy during the 2 trimester because of cardiac anomaly identified on fetal ultrasound ( usg ) scan . in view of its difficulty in breathing , the baby was admitted to the intensive care unit ( icu ) and was started on oxygen and nebulization . the baby was intubated and started on synchronized intermittent mandatory ventilation ( simv ) mode . chest radiograph frontal projection showed bilateral air space opacities with right upper lobe consolidation suggestive of pneumonia [ figure 1 ] . the baby was started on antibiotics and oral ribavirin . during the next day in icu , the child had seizures . biochemistry analysis showed reduced calcium level of 5.7 mg / dl ( normal value : 8.510.1 mg / dl ) . 25-hydroxy - vitamin d level was low and measured 13.4 ng / ml ( normal value : < 20 ng / ml ) . the parathyroid hormone ( pth ) level was normal in spite of the low calcium . blood investigations showed low hemoglobin measuring 7.5 g / dl ( normal value : 1114 g / dl ) and a total wbc count of 10,700 cells / ml . polymerase chain reaction ( pcr ) blood analysis showed positivity for cytomegalovirus ( cmv ) . flow cytometery of lymphocytes showed combined t - cell and b - cell immunodeficiency . in spite of good antibiotic cover and physiotherapy , intravenous immunoglobulin and steroids were started to treat persistent infection , following the hematologist 's advice . computed tomography ( ct ) of the chest with intravenous contrast showed hypoplastic thymus [ figure 2a ] and right upper lobe consolidation [ figure 2b ] . ct chest with maximum intensity projection ( mip ) and volume - rendered ( vr ) images showed aberrant right subclavian artery [ figure 3a and b ] . in view of dysmorphic facial features , chest infection , hypoplastic thymus , immunodeficiency , hypocalcemia , and decreased vitamin d , with a previous history of abortion of the fetus because of cardiac anomaly , a strong possibility of dgs was suspected . fluorescent in situ hybridization ( fish ) study was done to look for chromosomal defects . the results showed deletion of chromosome 22q11.2 [ figure 4 ] , which confirmed the diagnosis of this rare entity . the baby 's respiratory distress gradually settled and the infant was discharged on the parent 's request . ( a ) contrast - enhanced axial image of ct chest in mediastinal window shows absent thymus ( asterisk ) . ( b ) non - contrast axial image of ct chest in lung window shows consolidation involving the right upper lobe ( right arrow ) . ( a ) ct scan - coronal maximum intensity projection ( mip ) in arterial phase of chest shows aberrant right subclavian artery ( asterisk ) . ( b ) ct scan volume - rendered image shows aberrant right subclavian artery ( asterisk ) . fluorescent in situ hybridization ( fish ) study shows deletion of chromosome 22q11.2 ( arrow ) dgs is a primary immunodeficiency disease caused by deletion of genetic material from chromosome 22q11.2 . as part of this genetic defect , the thymus gland may be affected and this impairs the production of t - lymphocytes , which causes recurrent infections . the incidence of this rare syndrome was around 1 in 5000 births in the general population in the uk , according to the report of alison et al . more than 180 anomalies have been reported , so far ; the expression of dgs varies from person to person and a single affected individual will not have all the anomalies . the pathogenesis behind this rare entity is deletion of chromosome 22q11.2 , which causes third and fourth branchial pouch defects and may lead to hypoplasia or absence of thymus and/or parathyroid gland . dgs , in most instances , occurs sporadically and around 10% of the cases are inherited from one of the family members . the defective gene is autosomal dominant and there is 50% risk of transmitting the deletion to the child . the clinical features requiring the clinician to perform 22q11.2 deletion studies may vary from person to person depending on the age of the patient . the common classic findings include conotruncal cardiac anomalies ( i.e. , ventricular septal defect , tetralogy of fallot , vascular rings , and interrupted aortic arch ) , palatal abnormalities ( cleft palate and cleft lip ) , nasal regurgitation and/or hyper nasal speech , behavioral problems , psychiatric illness ( bipolar disorder or schizophrenia ) , immunodeficiency ( reduced t lymphocytes leading to recurrent infections ) , hypocalcemia , and characteristic facial features . radiological evaluation of a patient with suspected dgs includes evaluation of central nervous system , craniofacial abnormalities , musculoskeletal system , and cardiothoracic contents . a detailed evaluation of craniofacial system has to be done to check for external auditory canal ( eac ) stenosis , prominent nose , thin upper lip , and asymmetric face . ct with contrast of the head and neck is required to identify the presence of aberrant course of internal carotid arteries , hypoplastic adenoids , and middle ear anomalies . contrast - enhanced ct ( cect ) of the chest should be done to check for ventricular septal defect , tetralogy of fallot , aortic arch anomalies , vascular ring , absent thymus , and to identify lung infections . it is estimated that approximately 90% of patients with the clinical diagnosis of dgs have a deletion of a specific portion of chromosome number 22 at position 22q11.2 , called a microdeletion . approximately 90% of 22q11.2 deletions occur spontaneously and have not been passed on from the mother or father of the child . but once the diagnosis has been made , genetic counseling is critical and testing should be offered to parents and other family members . managing dgs needs a multidisciplinary approach and the cause for each symptom should be identified and treated accordingly . in our case , there was thymic hypoplasia ( as evident in ct imaging ) with decreased t lymphocyte production which , in turn , caused the b lymphocytes to produce insufficient antibodies ; hence , immunoglobulin therapy and antibiotics were administered . blood investigations revealed low calcium and vitamin d levels ; appropriate calcium and vitamin d supplements were administered . digeorge syndrome ( dgs ) is a rare genetic disorder which can cause a wide array of symptoms . the diagnosis is often missed or delayed because pregnant women are not routinely screened for this rare entity . hence , in any neonate with congenital hypocalcemia , recurrent infection , and seizure with absent parathyroid and thymus gland evident on imaging , a suspicion of dgs should arise and a detailed radiological , clinical , and cytogenetic examination should be carried out to avoid unnecessary complications . | digeorge syndrome is a congenital genetic disorder that affects the endocrine system , mainly the thymus and parathyroid glands .
the syndrome produces different symptoms , which vary in severity and character between patients .
it manifests with craniofacial dysmorphism and defects in the heart , parathyroid , and thymus .
patients can present with a palatal deformity and nasal speech .
this rare entity is caused mainly due to deletion of chromosome 22q11.2 .
radiographic evaluation of digeorge syndrome is necessary to define aberrant anatomy , evaluate central nervous system , craniofacial abnormalities , musculoskeletal system , and cardiothoracic contents .
it also helps in planning surgical procedures and surgical reconstructions .
we report a case of digeorge syndrome in a 4-month - old neonate and discuss the clinical , imaging , and cytogenetic findings that helped in the diagnosis of this rare entity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in 2013 , specimens were collected from a shiitake cultivation farm , located beside high mountains in geochang - gun , gyeongnam province , korea . slime mold fruiting bodies developed on the top and side surfaces of the oak logs , a year after being cut . the bark of infected oak logs came off easily , exposing the sapwood beneath ( fig . 1a , 1b , and 1c ) . fruiting bodies formed close , profuse , large colonies and mature sporangia appeared brown , cylindrical , 10 to 15 mm tall with dark reddish - brown spore - masses ( fig . 1d ) . after removing the spores , the sporangium appeared bright brown ( fig . the sporophore morphology , surface structures of sporangia , columella , capillitium , peridium , spores , stalk , and hypothallus of the slime mold samples were assessed through stereomicroscopy and light microscopy . the stalk appeared black , shiny , and slender , measuring 1.0~4.0 0.1 mm to 0.2 mm . primary branches extended from junctions within the net and at distant intervals from the columella , simple at first , then suddenly branching vigorously to form a smooth surface net with rounded or angular mesh forms measuring 20~70 m in width ( fig . the columella was black , reaching almost to the top of the sporotheca , tapered , rigid , and flexuous towards the tip ( fig . 2c ) . spores were lilac - brown , 7~9 m in diameter , almost smooth with fine , pale warts ( fig . for in vitro culture , moist chambers consisting of a sealed sterilized plastic box with three sheets of kim 's towel at the bottom . spore masses and fruiting bodies were transferred to the plastic box and incubated at room temperature ( 25~28 ) . 3b ) . based on morphological characteristics , the pathogenic slime mold causing decay of the oak bark was identified as stemonitis splendens rostaf , as reported by nieves - rivera and stephenson . | severe bark decay disease was observed on oak logs at a shiitake cultivation farm in geochang - gun , gyeongnam province .
the symptoms observed were fruiting bodies that had developed on the top and side surface of oak logs . as a result ,
the bark came off easily exposing the sapwood .
slime mold specimens collected from oak logs showed developing fruiting bodies comprising of stalks , hypothallus , capillitium , and columella , and the causal agent of bark decay disease was identified as stemonitis splendens on the basis of morphological characteristics . to our knowledge , this is the first report of stemonitis splendens causing bark decay of oak logs used for shiitake mushroom cultivation in korea . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
male sprague - dawley rats ( 8 weeks old , 200250 g ) and c57/b6 mice ( 8 weeks old ) were housed in air - conditioned rooms ( 2224c ) under a 12/12-h light / dark cycle and fed standard chow . p53-null ( 810 weeks old , mixed background c57bl/6j and 129/sv ) mice were described previously ( 19 ) . homozygous wild - type ( wt ) and knockout ( ko ) mice were originated from heterozygous mating , so only littermate wt and ko animals were compared in each experiment . animals were treated and killed when they were 12 to 14 weeks of age before any sign of morbidity resulting from tumor development occurred . animals were killed by decapitation between 1000 and 1200 h. animal experiments were conducted in accordance with the standards approved by the faculty animal committee at the university of santiago de compostela , and the experiments were performed in agreement with the rules of laboratory animal care and international law on animal experimentation . rats ( n = 8/group ) , were assigned to one of the following groups : fed ad libitum , deprived of food for 48 h , and fasted during 48 h and refed during 24 h. all animals had free access to tap water . rats were anesthetized by an intraperitoneal injection of ketamine ( 100 mg / kg body wt)/xylazine ( 15 mg / kg body wt ) . mice were anesthetized by an intraperitoneal injection of tribromoethanol ( 480 mg / kg ; sigma - aldrich , st louis , mo ) . intracerebroventricular cannulae were implanted stereotaxically in rats ( 20 ) or mice ( 21 ) , as described previously . rats received an intracerebroventricular administration of 5 l of vehicle or ghrelin ( 5 g ; bachem , bubendorf , switzerland ) . for the inhibition of sirt1 , we used two potent specific inhibitors of sirt1 : ex527 ( 1 to 5 - 10 g in a total volume of 5 l ; tocris bioscience , st . louis , mo ) ( 22 ) and sirtinol ( 1 to 5 - 10 g in a total volume of 5 l ; tocris bioscience ) ( 23 ) before ghrelin administration . for the experiments involving only two groups ( vehicle versus ghrelin ) , the vehicle was saline . for the experiments involving sirt1 inhibitors , the vehicle was dmso , because ex527 and sirtinol were both diluted in dmso . mice received an intracerebroventricular administration of vehicle , ghrelin ( 5 g ) , or aicar ( 3 g ; sigma - aldrich a9978 ) in a total volume of 2 l . for the experiments involving vehicle versus ghrelin and vehicle versus aicar , the vehicle was saline . we used the same dose of ghrelin for both rats and mice because this dose has been demonstrated to be effective in both species ( 2 ) . we used eight rats per group , and the experiments were repeated at least twice . hypothalami were homogenized in ice - cold lysis buffer containing 50 mmol / l tris - hcl ( ph 7.5 ) , 1 mmol / l egta , 1 mmol / l edta , 1% triton x-100 , 1 mmol / l sodium orthovanadate , 50 mmol / l sodium fluoride , 5 mmol / l sodium pyrophosphate , 0.27 mol / l sucrose , 0.1% 2-mercaptoethanol , and complete protease inhibitor cocktail ( 1 tablet/50 ml ; roche diagnostics , mannheim , germany ) . homogenates were centrifuged at 13,000 g for 10 min at 4c , supernatants were removed , and aliquots were snap - frozen in liquid nitrogen . hypothalamus lysate ( 40 g ) was subjected to sds - page on 6% polyacrylamide gels and electrotransferred on a polyvinylidene fluoride membrane . membranes were blocked for 1 h in tbs - tween 20 ( tbst : 50 mmol / l tris - hcl [ ph 7.5 ] , 0.15 mol / l nacl , and 0.1% tween 20 ) containing 5% skimmed milk or 3% bsa ( for pampk thr and pacc ser ) and probed for 16 h at 4c in tbst , 5% skimmed milk , or 3% bsa ( for pampk thr , pacc ser , sirt1 , and acetyl - p53-lys ) with the appropriate dilution of the indicated antibodies ( acetyl - coa carboxylase [ acc ] : 1:1500 ; pacc : 1:2000 ; ampk1 : 1:1000 ; ampk2 : 1:1000 ; pampk : 1:2000 ; -actin ( loading control ) : 1:2000 ) . acc was detected using horseradish peroxidase ( hrp)-conjugated coupled streptavidin ( amersham biosciences , little chalfont , u.k . ) . detection of proteins was performed using hrp - conjugated secondary antibodies and an enhanced chemiluminescence reagent ( amersham biosciences ) . acc , pacc-ser , ampk1 , and ampk2 were obtained from upstate biotechnology ( temecula , ca ) ; pampk-thr from cell signaling ; fatty acid synthase ( fas ) , pcreb , and foxo1 from santa cruz biotechnology ( santa cruz , ca ) ; and -actin from abcam ( cambridge , u.k . ) , as described previously ( 6 ) . for the blotting assays , the experiments constituted by two groups : sprague - dawley rats and mice ( wt and p53 ko ) treated with ghrelin or aicar and analyzed using a nonparametric mann constituted by four groups ( sprague - dawley rats treated with vehicle , ghrelin , ex527 , and ex527 + ghrelin , or with vehicle , ghrelin , sirtinol , and sirtinol + ghrelin ) , the data were analyzed by two - way anova , followed by a post hoc multiple comparison test ( tukey s test ) . coronal hypothalamic sections ( 16 m ) were cut on a cryostat and immediately stored at 80c until hybridization . for agrp , npy , and bsx mrna detection these probes were 3-end labeled with [ s]deoxy - atp using terminal deoxynucleotidyl transferase . the specificity of the probes was confirmed by incubating the sections with an excess of the unlabeled probes , as reported previously ( 24,25 ) . in situ hybridizations antisense oligonucleotides for in situ hybridization analysis the frozen sections were fixed with 4% paraformaldehyde in phosphate buffer ( 0.1 mol / l , ph 7.4 ) at room temperature for 30 min . they were dehydrated using 70% , 80% , 90% , 95% , and 100% ethanol for 5 min each . the hybridization solution contained 5 10 ( agrp and bsx ) or 1 10 cpm ( npy ) per slide of the labeled probe , 4 standard saline citrate ( ssc ) , 50% deionized formamide , 1 denhardt s solution , 10% dextran sulfate , and 10 g / ml sheared , single - stranded salmon sperm dna . afterward , the hybridization sections were sequentially washed in 1 ssc at room temperature , four times in 1 ssc at 42c ( 30 min / wash ) , and once in 1 ssc at room temperature ( 1 h ) and then rinsed in water and ethanol . finally , the sections were air - dried and exposed to hyperfilm -max ( amersham biosciences ) at room temperature for 4 to 6 days for agrp and npy and for 21 days for bsx . the slides were developed in kodak d-19 developer ( eastman kodak co. , rochester , ny ) , fixed ( kodak fixer ) , and counterstained with methylene blue . to compare anatomically similar regions , the slides from control and treated animals at each treatment time were always exposed to the same autoradiographic film . all sections were scanned , and the specific hybridization signal was quantified by densitometry using the molecular analyst digital imaging system ( bio - rad laboratories inc . , richmond , ca ) . the optical density of the hybridization signal was determined and subsequently corrected by the optical density of its adjacent background value . for this reason , a rectangle with the same dimensions in each case was drawn enclosing the hybridization signal over each nucleus and over adjacent brain areas of each section ( background ) . we used 16 to 20 sections for each animal ( 45 slides , 4 sections / slide ) . the mean of these 16 to 20 values was used as the densitometry value for each animal . chronic intracerebroventricular and intracardiac cannulae were implanted under ketamine / xylazine anesthesia , as described above . after surgery , the animals were placed directly in isolation test chambers for 5 days and were given free access to regular rat chow and tap water . on the day of the experiment , blood samples ( 0.3 ml ) were withdrawn at the appropriate times . the animals ( n = 79 rats / group ) received vehicle , ghrelin ( 12 nmol / kg i.v . ) , ex527 ( 1 g i.c.v . ) , or ex527 + ghrelin . plasma growth hormone ( gh ) concentrations were determined by double - antibody radioimmunoassay using materials supplied by the national hormone pituitary program , as described previously ( 27 ) . values are expressed in terms of the gh reference preparation ( gh - rp-2 ) . the experiments constituted by two groups : sprague - dawley rats and mice ( wt and p53 ko ) treated with ghrelin or aicar and analyzed using a nonparametric mann whitney test . in the experiments constituted by four groups ( sprague - dawley rats treated with vehicle , ghrelin , ex527 , and ex527 + ghrelin , and vehicle , ghrelin , sirtinol , and sirtinol + ghrelin ) , the data were analyzed by two - way anova , followed by a post hoc multiple comparison test ( tukey s test ) . data are expressed as mean sem and analyzed using pasw statistics 18.0 software ( spss inc . , chicago , il ) . a value of p < 0.05 was considered as being significant . male sprague - dawley rats ( 8 weeks old , 200250 g ) and c57/b6 mice ( 8 weeks old ) were housed in air - conditioned rooms ( 2224c ) under a 12/12-h light / dark cycle and fed standard chow . p53-null ( 810 weeks old , mixed background c57bl/6j and 129/sv ) mice were described previously ( 19 ) . homozygous wild - type ( wt ) and knockout ( ko ) mice were originated from heterozygous mating , so only littermate wt and ko animals were compared in each experiment . animals were treated and killed when they were 12 to 14 weeks of age before any sign of morbidity resulting from tumor development occurred . animals were killed by decapitation between 1000 and 1200 h. animal experiments were conducted in accordance with the standards approved by the faculty animal committee at the university of santiago de compostela , and the experiments were performed in agreement with the rules of laboratory animal care and international law on animal experimentation . rats ( n = 8/group ) , were assigned to one of the following groups : fed ad libitum , deprived of food for 48 h , and fasted during 48 h and refed during 24 h. all animals had free access to tap water . rats were anesthetized by an intraperitoneal injection of ketamine ( 100 mg / kg body wt)/xylazine ( 15 mg / kg body wt ) . mice were anesthetized by an intraperitoneal injection of tribromoethanol ( 480 mg / kg ; sigma - aldrich , st louis , mo ) . intracerebroventricular cannulae were implanted stereotaxically in rats ( 20 ) or mice ( 21 ) , as described previously . rats received an intracerebroventricular administration of 5 l of vehicle or ghrelin ( 5 g ; bachem , bubendorf , switzerland ) . for the inhibition of sirt1 , we used two potent specific inhibitors of sirt1 : ex527 ( 1 to 5 - 10 g in a total volume of 5 l ; tocris bioscience , st . louis , mo ) ( 22 ) and sirtinol ( 1 to 5 - 10 g in a total volume of 5 l ; tocris bioscience ) ( 23 ) before ghrelin administration . for the experiments involving only two groups ( vehicle versus ghrelin ) , for the experiments involving sirt1 inhibitors , the vehicle was dmso , because ex527 and sirtinol were both diluted in dmso . mice received an intracerebroventricular administration of vehicle , ghrelin ( 5 g ) , or aicar ( 3 g ; sigma - aldrich a9978 ) in a total volume of 2 l . for the experiments involving vehicle versus ghrelin and vehicle versus aicar , the vehicle was saline . we used the same dose of ghrelin for both rats and mice because this dose has been demonstrated to be effective in both species ( 2 ) . we used eight rats per group , and the experiments were repeated at least twice . hypothalami were homogenized in ice - cold lysis buffer containing 50 mmol / l tris - hcl ( ph 7.5 ) , 1 mmol / l egta , 1 mmol / l edta , 1% triton x-100 , 1 mmol / l sodium orthovanadate , 50 mmol / l sodium fluoride , 5 mmol / l sodium pyrophosphate , 0.27 mol / l sucrose , 0.1% 2-mercaptoethanol , and complete protease inhibitor cocktail ( 1 tablet/50 ml ; roche diagnostics , mannheim , germany ) . homogenates were centrifuged at 13,000 g for 10 min at 4c , supernatants were removed , and aliquots were snap - frozen in liquid nitrogen . hypothalamus lysate ( 40 g ) was subjected to sds - page on 6% polyacrylamide gels and electrotransferred on a polyvinylidene fluoride membrane . membranes were blocked for 1 h in tbs - tween 20 ( tbst : 50 mmol / l tris - hcl [ ph 7.5 ] , 0.15 mol / l nacl , and 0.1% tween 20 ) containing 5% skimmed milk or 3% bsa ( for pampk thr and pacc ser ) and probed for 16 h at 4c in tbst , 5% skimmed milk , or 3% bsa ( for pampk thr , pacc ser , sirt1 , and acetyl - p53-lys ) with the appropriate dilution of the indicated antibodies ( acetyl - coa carboxylase [ acc ] : 1:1500 ; pacc : 1:2000 ; ampk1 : 1:1000 ; ampk2 : 1:1000 ; pampk : 1:2000 ; -actin ( loading control ) : 1:2000 ) . acc was detected using horseradish peroxidase ( hrp)-conjugated coupled streptavidin ( amersham biosciences , little chalfont , u.k . ) . detection of proteins was performed using hrp - conjugated secondary antibodies and an enhanced chemiluminescence reagent ( amersham biosciences ) . acc , pacc-ser , ampk1 , and ampk2 were obtained from upstate biotechnology ( temecula , ca ) ; pampk-thr from cell signaling ; fatty acid synthase ( fas ) , pcreb , and foxo1 from santa cruz biotechnology ( santa cruz , ca ) ; and -actin from abcam ( cambridge , u.k . ) , as described previously ( 6 ) . for the blotting assays , the experiments constituted by two groups : sprague - dawley rats and mice ( wt and p53 ko ) treated with ghrelin or aicar and analyzed using a nonparametric mann whitney test . in the experiments constituted by four groups ( sprague - dawley rats treated with vehicle , ghrelin , ex527 , and ex527 + ghrelin , or with vehicle , ghrelin , sirtinol , and sirtinol + ghrelin ) , the data were analyzed by two - way anova , followed by a post hoc multiple comparison test ( tukey s test ) . coronal hypothalamic sections ( 16 m ) were cut on a cryostat and immediately stored at 80c until hybridization . for agrp , npy , and bsx mrna detection these probes were 3-end labeled with [ s]deoxy - atp using terminal deoxynucleotidyl transferase . the specificity of the probes was confirmed by incubating the sections with an excess of the unlabeled probes , as reported previously ( 24,25 ) . in situ hybridizations antisense oligonucleotides for in situ hybridization analysis the frozen sections were fixed with 4% paraformaldehyde in phosphate buffer ( 0.1 mol / l , ph 7.4 ) at room temperature for 30 min . they were dehydrated using 70% , 80% , 90% , 95% , and 100% ethanol for 5 min each . the hybridization solution contained 5 10 ( agrp and bsx ) or 1 10 cpm ( npy ) per slide of the labeled probe , 4 standard saline citrate ( ssc ) , 50% deionized formamide , 1 denhardt s solution , 10% dextran sulfate , and 10 g / ml sheared , single - stranded salmon sperm dna . afterward , the hybridization sections were sequentially washed in 1 ssc at room temperature , four times in 1 ssc at 42c ( 30 min / wash ) , and once in 1 ssc at room temperature ( 1 h ) and then rinsed in water and ethanol . finally , the sections were air - dried and exposed to hyperfilm -max ( amersham biosciences ) at room temperature for 4 to 6 days for agrp and npy and for 21 days for bsx . the slides were developed in kodak d-19 developer ( eastman kodak co. , rochester , ny ) , fixed ( kodak fixer ) , and counterstained with methylene blue . to compare anatomically similar regions , the slides from control and treated animals at each treatment time were always exposed to the same autoradiographic film . all sections were scanned , and the specific hybridization signal was quantified by densitometry using the molecular analyst digital imaging system ( bio - rad laboratories inc . , richmond , ca ) . the optical density of the hybridization signal was determined and subsequently corrected by the optical density of its adjacent background value . for this reason , a rectangle with the same dimensions in each case was drawn enclosing the hybridization signal over each nucleus and over adjacent brain areas of each section ( background ) . we used 16 to 20 sections for each animal ( 45 slides , 4 sections / slide ) . the mean of these 16 to 20 values was used as the densitometry value for each animal . chronic intracerebroventricular and intracardiac cannulae were implanted under ketamine / xylazine anesthesia , as described above . after surgery , the animals were placed directly in isolation test chambers for 5 days and were given free access to regular rat chow and tap water . on the day of the experiment , blood samples ( 0.3 ml ) were withdrawn at the appropriate times . the animals ( n = 79 rats / group ) received vehicle , ghrelin ( 12 nmol / kg i.v . ) , ex527 ( 1 g i.c.v . ) , or ex527 + ghrelin . plasma growth hormone ( gh ) concentrations were determined by double - antibody radioimmunoassay using materials supplied by the national hormone pituitary program , as described previously ( 27 ) . values are expressed in terms of the gh reference preparation ( gh - rp-2 ) . the experiments constituted by two groups : sprague - dawley rats and mice ( wt and p53 ko ) treated with ghrelin or aicar and analyzed using a nonparametric mann whitney test . in the experiments constituted by four groups ( sprague - dawley rats treated with vehicle , ghrelin , ex527 , and ex527 + ghrelin , and vehicle , ghrelin , sirtinol , and sirtinol + ghrelin ) , the data were analyzed by two - way anova , followed by a post hoc multiple comparison test ( tukey s test ) . data are expressed as mean sem and analyzed using pasw statistics 18.0 software ( spss inc . , chicago , il ) . a value of p < 0.05 was considered as being significant . rats fasted during 48 h exhibited a loss of body weight , whereas the refeeding during 24 h partially led to a substantial recovery ( fig . acetyl - p53 levels , a marker of sirt1 activity in vivo ( 28 ) , were decreased in the hypothalamus of fasted rats ( f2,18 = 3.651 , p < 0.05 ) , whereas those levels were similar to baseline in rats after refeeding ( fig . because ghrelin is a key player for increasing feeding behavior , we tested the hypothesis that central ghrelin administration might stimulate hypothalamic sirt1 activity . as previously reported , ghrelin increased food intake after 2 h ( f1,13 = 24.161 , p < 0.001 ; fig . 1c ) and 6 h ( f1,13 = 36.14 , p < 0.001 ; fig . 1e ) ( 29 ) and decreased hypothalamic acetyl - p53 levels after 2 h ( f1,13 = 7.915 , p < 0.01 ; fig . 1d ) and 6 h ( f1,13 = 7.645 , p < 0.05 ; fig . a : fasting for 48 h caused a significant ( p < 0.001 ) decrease in body weight , whereas refeeding during 24 h partially recovered the weight loss . b : hypothalamic acetylated p53 levels decreased in fasted rats and recovered in refed rats . effects of intracerebroventricular ghrelin injection ( 5 g / rat ) after 2 h on food intake ( c ) , and hypothalamic acetylated p53 levels ( d ) . effects of intracerebroventricular ghrelin injection ( 5 g / rat ) after 6 h on food intake ( e ) , and hypothalamic acetylated p53 levels ( f ) . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . values are the mean sem . * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . we next studied the functional relevance of these findings by assessing whether the pharmacologic blockade of sirt1 activity might regulate the orexigenic action of ghrelin . first , we observed that the central injection of ex527 , a potent inhibitor of sirt1 activity , increased hypothalamic acetyl - p53 levels at different doses ( 1 , 5 , and 10 g ; supplementary fig . we then centrally administered ghrelin , ex527 , and ex527 + ghrelin to the rats . we found that ghrelin increased food intake at 2 h ( data not shown ) and 6 h ( f3,27 = 12.282 , p < 0.001 ; fig . 2a ) , but when the sirt1 inhibitor was administered 20 min before ghrelin , the orexigenic action of ghrelin was markedly blunted after 6 h ( fig . 2a ) . because ghrelin increases food intake through its effects on hypothalamic fatty acid metabolism ( 5,6 ) , we next assessed the levels of several key enzymes for the synthesis of lipids . we found that 6 h after an intracerebroventricular ghrelin injection , pampk levels were increased ( f3,28 = 2.455 , p < 0.05 ) , but acc levels were decreased ( f3,27 = 6.045 , p < 0.01 ) . . a : effects of intracerebroventricular ghrelin injection ( 5 g / rat ) , ex527 ( 1 g / rat ) , and ghrelin + ex527 on food intake after 6 h. hypothalamic protein levels of pampk , ampk1 , ampk2 , pacc , acc , fas ( b and c ) , pcreb , foxo1 ( d ) , and bsx , npy , and agrp ( e and f ) after 6 h of ghrelin and ex527 injection . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . values are the mean sem . * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . it is important to note that even though pampk levels were increased , pacc did not reach statistical significance , probably because of the different kinetics of phosphorylation of both enzymes ( 6 ) . furthermore , the higher expression of the transcription factors foxo1 ( f3,27 = 2.509 , p < 0.05 ) , pcreb ( f3,26 = 3.668 , p < 0.05 ; fig . 2d ) , and bsx ( f3,26 = 3.526 , p < 0.05 ; fig . 2e and f ) and the neuropeptides npy ( f(3,26 ) = 4.362 , p < 0.05 ) and agrp ( f3,26 = 3.33 , p < 0.05 ; fig . 2e and f ) in the hypothalamic arcuate nucleus induced by ghrelin was also abolished when the sirt1 inhibitor was coadministered . when we used sirtinol , another inhibitor of sirt1 activity , results were similar to those obtained with ex527 ( supplementary fig . 1 ) . tumor suppressor protein p53 is a substrate of sirt1 , and it is found hyperacetylated in sirt1 ko mice ( 30 ) . because a recent report showed that p53 is involved in energy metabolism and homeostasis ( 31 ) , for this purpose , we treated wt and p53 ko mice with intracerebroventricular ghrelin , following the same protocol as that described above . the p53 ko mice did not show alterations in body weight , food intake , fat mass , or nonfat mass compared with wt littermates ( supplementary fig . d ) . as expected , central ghrelin administration increased food intake in wt animals , whereas identical intracerebroventricular ghrelin treatment in p53 ko animals had no effect on food intake after 2 ( fig . effects of intracerebroventricular ghrelin injection ( 5 g / mouse ) on food intake after 2 h ( a ) and 6 h ( b ) in wt and p53 ko mice . hypothalamic protein levels of pampk , ampk1 , ampk2 , pacc , acc , and fas after 6 h of ghrelin injection ( c and d ) . values were normalized with to those of the internal control -actin , and the results are expressed as arbitrary units . values are the mean sem . * p < 0.05 , * * p < 0.01 . no principal differences were found between wt and p53 ko mice regarding the expression of ampk1 , ampk2 , or fas ( fig . it is noteworthy that we found that 6 h after its central injection , ghrelin increased pampk levels in wt mice ( f1,12 = 4.466 , p < 0.05 ) but failed to do so in p53 ko mice ( fig . 3c and d ) , suggesting that p53 is an essential mediator of ghrelin actions on ampk . the levels of pampk and pacc are correlated in normal conditions ; however , we found that the hypothalamic levels of pacc are downregulated in p53 ko mice ( f1,12 = 8.576 , p < 0.01 ) but not in wt mice ( fig . although we do not have a clear explanation for these results , it seems that ghrelin is able to activate acc when p53 is not present , suggesting that p53 might also regulate the actions of ghrelin on different key enzymes modulating fatty acid metabolism . further studies analyzing not only protein levels but also enzymatic activity and lipolysis / lipogenesis will be necessary to address this issue . furthermore , we detected that central ghrelin injection decreased acc levels in both wt ( f1,12 = 2.844 , p < 0.05 ) and p53 ko mice ( f1,12 = 6.699 , p < 0.01 ; fig . 3c and d ) , indicating that p53 is not essential for ghrelin - mediated acc regulation . central injection of aicar , a potent activator of ampk activity , stimulates food intake in rodents ( 32 ) . to determine whether p53 is a crucial player for the orexigenic action of aicar , we centrally treated p53 ko mice with aicar ( 3 g ) and found a stimulation in food intake after 6 h ( f1,12 = 3.542 , p < 0.05 ; fig . hypothalamic pampk levels were also increased in p53 ko mice treated with aicar ( f1,12 = 4.479 ; fig . therefore , our data indicate that p53 is not required for the orexigenic action of direct ampk activators . a : effects of intracerebroventricular aicar injection ( 3 g / mouse ) on food intake after 6 h in p53 ko mice . b and c : hypothalamic protein levels of pampk , pacc , ampk1 , ampk2 , acc , and fas after 6 h of aicar injection . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . finally , we assessed whether the sirt1 pathway is mediating other neuroendocrine actions of ghrelin , namely gh secretion . administration of ghrelin ( 27 ) led to the expected increase in plasma gh levels at 5 , 10 , and 15 min ( fig . 5a ) , whereas the central blockade of sirt1 did not alter that response ( fig . ghrelin exhibited a similar stimulatory effect in both area under the curve and mean peak gh levels ( fig . a : effects of intravenous ghrelin injection ( 12 nmol / kg ) , intracerebroventricular ex527 ( 1 g / rat ) , and ghrelin + ex527 on plasma gh levels in adult male freely moving rats . area under the curve ( auc ) ( b ) and mean peak gh ( c ) levels . rats fasted during 48 h exhibited a loss of body weight , whereas the refeeding during 24 h partially led to a substantial recovery ( fig . acetyl - p53 levels , a marker of sirt1 activity in vivo ( 28 ) , were decreased in the hypothalamus of fasted rats ( f2,18 = 3.651 , p < 0.05 ) , whereas those levels were similar to baseline in rats after refeeding ( fig . because ghrelin is a key player for increasing feeding behavior , we tested the hypothesis that central ghrelin administration might stimulate hypothalamic sirt1 activity . as previously reported , ghrelin increased food intake after 2 h ( f1,13 = 24.161 , p < 0.001 ; fig . 1c ) and 6 h ( f1,13 = 36.14 , p < 0.001 ; fig . 1e ) ( 29 ) and decreased hypothalamic acetyl - p53 levels after 2 h ( f1,13 = 7.915 , p < 0.01 ; fig . 1d ) and 6 h ( f1,13 = 7.645 , p < 0.05 ; fig . a : fasting for 48 h caused a significant ( p < 0.001 ) decrease in body weight , whereas refeeding during 24 h partially recovered the weight loss . b : hypothalamic acetylated p53 levels decreased in fasted rats and recovered in refed rats . effects of intracerebroventricular ghrelin injection ( 5 g / rat ) after 2 h on food intake ( c ) , and hypothalamic acetylated p53 levels ( d ) . effects of intracerebroventricular ghrelin injection ( 5 g / rat ) after 6 h on food intake ( e ) , and hypothalamic acetylated p53 levels ( f ) . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . we next studied the functional relevance of these findings by assessing whether the pharmacologic blockade of sirt1 activity might regulate the orexigenic action of ghrelin . first , we observed that the central injection of ex527 , a potent inhibitor of sirt1 activity , increased hypothalamic acetyl - p53 levels at different doses ( 1 , 5 , and 10 g ; supplementary fig . we then centrally administered ghrelin , ex527 , and ex527 + ghrelin to the rats . we found that ghrelin increased food intake at 2 h ( data not shown ) and 6 h ( f3,27 = 12.282 , p < 0.001 ; fig . 2a ) , but when the sirt1 inhibitor was administered 20 min before ghrelin , the orexigenic action of ghrelin was markedly blunted after 6 h ( fig . because ghrelin increases food intake through its effects on hypothalamic fatty acid metabolism ( 5,6 ) , we next assessed the levels of several key enzymes for the synthesis of lipids . we found that 6 h after an intracerebroventricular ghrelin injection , pampk levels were increased ( f3,28 = 2.455 , p < 0.05 ) , but acc levels were decreased ( f3,27 = 6.045 , p < 0.01 ) . a : effects of intracerebroventricular ghrelin injection ( 5 g / rat ) , ex527 ( 1 g / rat ) , and ghrelin + ex527 on food intake after 6 h. hypothalamic protein levels of pampk , ampk1 , ampk2 , pacc , acc , fas ( b and c ) , pcreb , foxo1 ( d ) , and bsx , npy , and agrp ( e and f ) after 6 h of ghrelin and ex527 injection . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . * p < 0.05 , * * p < 0.01 , * * * p < 0.001 . it is important to note that even though pampk levels were increased , pacc did not reach statistical significance , probably because of the different kinetics of phosphorylation of both enzymes ( 6 ) . furthermore , the higher expression of the transcription factors foxo1 ( f3,27 = 2.509 , p < 0.05 ) , pcreb ( f3,26 = 3.668 , p < 0.05 ; fig . 2d ) , and bsx ( f3,26 = 3.526 , p < 0.05 ; fig . 2e and f ) and the neuropeptides npy ( f(3,26 ) = 4.362 , p < 0.05 ) and agrp ( f3,26 = 3.33 , p < 0.05 ; fig . 2e and f ) in the hypothalamic arcuate nucleus induced by ghrelin was also abolished when the sirt1 inhibitor was coadministered . when we used sirtinol , another inhibitor of sirt1 activity , results were similar to those obtained with ex527 ( supplementary fig . tumor suppressor protein p53 is a substrate of sirt1 , and it is found hyperacetylated in sirt1 ko mice ( 30 ) . because a recent report showed that p53 is involved in energy metabolism and homeostasis ( 31 ) , for this purpose , we treated wt and p53 ko mice with intracerebroventricular ghrelin , following the same protocol as that described above . the p53 ko mice did not show alterations in body weight , food intake , fat mass , or nonfat mass compared with wt littermates ( supplementary fig . d ) . as expected , central ghrelin administration increased food intake in wt animals , whereas identical intracerebroventricular ghrelin treatment in p53 ko animals had no effect on food intake after 2 ( fig . effects of intracerebroventricular ghrelin injection ( 5 g / mouse ) on food intake after 2 h ( a ) and 6 h ( b ) in wt and p53 ko mice . hypothalamic protein levels of pampk , ampk1 , ampk2 , pacc , acc , and fas after 6 h of ghrelin injection ( c and d ) . values were normalized with to those of the internal control -actin , and the results are expressed as arbitrary units . values are the mean sem . * p < 0.05 , * * p < 0.01 . no principal differences were found between wt and p53 ko mice regarding the expression of ampk1 , ampk2 , or fas ( fig . it is noteworthy that we found that 6 h after its central injection , ghrelin increased pampk levels in wt mice ( f1,12 = 4.466 , p < 0.05 ) but failed to do so in p53 ko mice ( fig . 3c and d ) , suggesting that p53 is an essential mediator of ghrelin actions on ampk . the levels of pampk and pacc are correlated in normal conditions ; however , we found that the hypothalamic levels of pacc are downregulated in p53 ko mice ( f1,12 = 8.576 , p < 0.01 ) but not in wt mice ( fig . although we do not have a clear explanation for these results , it seems that ghrelin is able to activate acc when p53 is not present , suggesting that p53 might also regulate the actions of ghrelin on different key enzymes modulating fatty acid metabolism . further studies analyzing not only protein levels but also enzymatic activity and lipolysis / lipogenesis will be necessary to address this issue . furthermore , we detected that central ghrelin injection decreased acc levels in both wt ( f1,12 = 2.844 , p < 0.05 ) and p53 ko mice ( f1,12 = 6.699 , p < 0.01 ; fig . 3c and d ) , indicating that p53 is not essential for ghrelin - mediated acc regulation . central injection of aicar , a potent activator of ampk activity , stimulates food intake in rodents ( 32 ) . to determine whether p53 is a crucial player for the orexigenic action of aicar , we centrally treated p53 ko mice with aicar ( 3 g ) and found a stimulation in food intake after 6 h ( f1,12 = 3.542 , p < 0.05 ; fig . hypothalamic pampk levels were also increased in p53 ko mice treated with aicar ( f1,12 = 4.479 ; fig . therefore , our data indicate that p53 is not required for the orexigenic action of direct ampk activators a : effects of intracerebroventricular aicar injection ( 3 g / mouse ) on food intake after 6 h in p53 ko mice . b and c : hypothalamic protein levels of pampk , pacc , ampk1 , ampk2 , acc , and fas after 6 h of aicar injection . values were normalized to those of the internal control -actin , and the results are expressed as arbitrary units . finally , we assessed whether the sirt1 pathway is mediating other neuroendocrine actions of ghrelin , namely gh secretion . administration of ghrelin ( 27 ) led to the expected increase in plasma gh levels at 5 , 10 , and 15 min ( fig . 5a ) , whereas the central blockade of sirt1 did not alter that response ( fig . 5a ) . ghrelin exhibited a similar stimulatory effect in both area under the curve and mean peak gh levels ( fig . a : effects of intravenous ghrelin injection ( 12 nmol / kg ) , intracerebroventricular ex527 ( 1 g / rat ) , and ghrelin + ex527 on plasma gh levels in adult male freely moving rats . area under the curve ( auc ) ( b ) and mean peak gh ( c ) levels . our current data demonstrate that the hypothalamic sirt1/p53 pathway is crucial for the orexigenic effect of ghrelin . pharmacologic inhibition of sirt1 or genetic depletion of p53 abolish the effects of ghrelin on ampk and thereby blunt ghrelin - induced effects on transcription factors , including pcreb , foxo1 , and bsx , and neuropeptides , such as npy and agrp , leading to a suppression of ghrelin - induced food intake . it has been reported recently that sirt1 mrna is located in metabolically relevant areas of the mouse neuroaxis , such as pro - opiomelanocortin neurons , which are critical for energy and glucose homeostasis ( 11 ) . it seems that sirt1 regulates the central melanocortin system ( 13 ) and that the specific lack of sirt1 in the brain abolishes the higher physical activity induced by calorie restriction ( 12 ) . more specifically , the lack of sirt1 in pro - opiomelanocortin neurons causes hypersensitivity to diet - induced obesity because of reduced energy expenditure ( 17 ) . concurring with those data , we observed that acetylation of p53 in the hypothalamus is decreased after food deprivation , indicating that sirt1 as a deacetylase increased its hypothalamic activity during starvation . therefore , the regulation of hypothalamic sirt1 activity by nutritional status is similar to its regulation in several peripheral tissues ( 33 ) . ghrelin is a stomach - derived hormone that rapidly increases food intake and body weight ( 1,29 ) . its regulation by nutritional status was controversial because the assays detected both acyl - ghrelin and des - acyl ghrelin and thus were not specific . studies using new technologies for separately detecting both isoforms indicate that circulating des - acyl ghrelin increases significantly with fasting , whereas blood acyl - ghrelin levels are not changed over the course of fasting ( 34,35 ) . most of the effects of ghrelin are exerted through the gh secretagogue receptor 1a ( ghs - r1a ) ( 36 ) , which is expressed in agrp / npy neurons in the hypothalamic arcuate nucleus ( 37 ) . the orexigenic effect of ghrelin is mediated by ampk , a key upstream master regulator of lipid metabolism ( 5,6 ) . however , the molecular events regulating ampk phosphorylation after the activation of the ghs - r1a are unknown . in the present work , we demonstrate that central ghrelin administration increases hypothalamic sirt1 activity , stimulating the deacetylation of p53 . more interestingly and consistent with previous findings ( 14 ) , the blockade of central sirt1 activity abolished the potent orexigenic effect of ghrelin . at molecular level , the ghrelin - induced activation of ampk is prevented when sirt1 activity is blocked . the interaction between sirt1 and ampk has been previously shown in vitro , indicating that resveratrol activates ampk in neurons ( 38 ) . although pharmacologic experiments based on the administration of sirt1 inhibitors to animal models are providing important insight into principal effects , targets , and mechanisms of the sirt1 system , understanding the function of its endogenous role requires more sophisticated approaches , such as genetic disruption of sirt1 or its substrates . we focused on p53 because this tumor - suppressor protein is a well - known target of sirt1 action , and there is growing evidence of its role on metabolism and energy balance in peripheral tissues ( 31 ) . our results indicate that p53 is required for the ghrelin - induced food intake , because ghrelin failed to increase food intake in p53 ko mice . in accordance with pharmacologic findings , ghrelin stimulated hypothalamic pampk levels in wt mice but failed to do so in p53 ko mice . on the other hand , it has been shown that sirt1 is a target gene of p53 in some but not all of the tissues ( 31,39 ) , so it might be possible that p53 mediates the changes in sirt1 upon ghrelin treatment or calorie restriction . however , the observed correlation between acetylated p53 and sirt1 activity in the hypothalamus on different experimental conditions indicate that p53 is an essential mediator of sirt1-dependent effects of ghrelin on ampk . mice lacking p53 in specific hypothalamic areas will be essential to demonstrating which particular neuronal circuits are responsible for those actions . however , the central sirt1/p53 pathway is not required by direct ampk activators , because aicar stimulated food intake in p53-deficient mice . therefore , these findings corroborate that the central sirt1/p53 pathway is not associated with aicar - induced activation of ampk . finally , our results indicate that ghrelin stimulated gh release as expected , but the blockade of central sirt1 did not modify gh levels . therefore , it seems that the central sirt1/p53 pathway is specifically mediating the ghrelin orexigenic action and suggests that different neuronal pathways modulate ghrelin - induced food intake and gh secretion . in summary , we provide a combination of pharmacologic and genetic evidence to demonstrate that the central nervous system sirt1/p53 pathway is essential for the orexigenic response to ghrelin ( fig . 6 ) . the molecular pathway mediating those effects involves alterations in ampk activation , which leads to changes in hypothalamic fatty acid metabolism , and finally , modifies feeding behavior . schematic overview summarizing our proposed model for the molecular mechanisms initiated by the activation of the ghrelin receptor leading to ampk activation and finally to an increased feeding behavior . ros , reactive oxygen species ; cpt , carnitine palmitoyltransferase ; ucp , uncoupling protein . ( a high - quality color representation of this figure is available in the online issue . ) | objectiveghrelin is a stomach - derived peptide that increases food intake through the activation of hypothalamic amp - activated protein kinase ( ampk ) .
however , the molecular mechanisms initiated by the activation of the ghrelin receptor , which in turn lead to ampk activation , remain unclear .
sirtuin 1 ( sirt1 ) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53 .
we tested the hypothesis that the central sirt1/p53 pathway might be mediating the orexigenic action of ghrelin.research design and methodssirt1 inhibitors , such as ex527 and sirtinol , and ampk activators , such as aicar , were administered alongside ghrelin in the brain of rats and mice ( wild - type versus p53 knockout [ ko ] ) .
their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by western blot and in situ hybridization.resultsthe central pretreatment with ex527 , a potent sirt1 inhibitor , blunted the ghrelin - induced food intake in rats .
mice lacking p53 , a target of sirt1 action , failed to respond to ghrelin in feeding behavior .
ghrelin failed to phosphorylate hypothalamic ampk when rats were pretreated with ex527 , as it did in p53 ko mice .
it is noteworthy that the hypothalamic sirt1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin , because central administration of aicar , a potent ampk activator , increased food intake in p53 ko mice .
finally , blockade of the central sirt1 pathway did not modify ghrelin - induced growth hormone secretion.conclusionsghrelin specifically triggers a central sirt1/p53 pathway that is essential for its orexigenic action , but not for the release of growth hormone . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 26-year - old male presented to our hospital complaining of cough and hemoptysis for 7 days . a resident of columbia , mo , he had recently flown back home from vacation in california . there was no significant past medical history , and the patient was not on any medications . he smoked 1 - 2 cigarettes per day , but denied alcohol intake or drug abuse . family history was significant for hypertension in both parents . on arrival to the hospital , the patient 's pulse was 112/min and regular , and bp was 220/128 mm hg , respiratory rate 38/min . laboratory data showed anemia , thrombocytopenia , and renal failure ( table 1 ) . presuming the diagnosis of a pulmonary renal syndrome , the patient was treated with 1-gram methylprednisolone and plasmapheresis pending results of serological investigations . changes secondary to malignant hypertension , ( figures 1(a ) and 1(b ) ) and superimposed changes secondary to chronic hypertension ( figures 2(a ) and 2(b ) ) were noted . immunofluorescence showed peripheral c3 trapping and weak ( 1 + ) linear staining of glomerular basement membrane by igg . after renal biopsy , patient had an episode of bleeding for which he underwent left renal arteriolar embolization . a diagnosis of malignant hypertension ( mht ) presenting with lh , with acute anuric renal failure from thrombotic microangiopathy and with underlying chronic kidney disease secondary to primary hypertension was made . only few cases of malignant hypertension presenting as pulmonary renal syndrome have been reported [ 13 ] . patient 's strong family history , negative past medical history , and relatively small kidneys with increased echogenicity on ultrasound suggest that our patient most likely had underlying ckd secondary to uncontrolled severe primary hypertension . the selective angiogram performed for postbiopsy complication did not reveal renal artery stenosis of the left ( smaller ) kidney . a hypothesis that extreme bp elevation leads to vascular endothelial damage or hormonal changes ( namely renin - angiotensin - aldosterone system activation ) may explain why some people progress to mht phase . in mht , narrowed arteriolar lumen ( due to myointimal hyperplasia and fibrinoid necrosis ) and endothelial damage leading to thrombotic lesions in the arterioles result in shear stress on passing blood stream . clinical differentiation between ttp and malignant hypertension can be difficult , but normal mental status and normal adamts-13 helped rule out ttp in our case . smoking , platelet dysfunction due to underlying uremia , and thrombocytopenia due to maha may have predisposed our patient to pulmonary hemorrhage . pulmonary hemorrhage during air travel has been reported , but those patients had underlying chronic lung conditions , which were not found in our patient . in absence of serum antibodies to the gbm , we interpreted the low - intensity linear igg staining of the gbm as false positive . biopsies from patients with diabetic glomerulosclerosis , hypertensive vascular disease , renal transplant , myeloma , sle , deceased donor kidneys after perfusion , and normal autopsy kidneys may have less intense linear igg deposits . our patient remains dialysis dependant and is currently on the transplant list . serum creatinine at presentation remains a significant prognostic factor for renal recovery in patients with malignant hypertension . the authors mentioned in the paper confirm that all the authors have contributed towards the preparation of the paper . they also confirm that they had no conflict of interests during the preparation of this paper and they have no disclosures to make . | pulmonary - renal syndrome is a medical emergency ; etiology of which has broad differential diagnosis .
delay in both diagnosis and initiation of management may result in end - organ damage .
management decisions may have to be empiric till a rapid , definitive tissue diagnosis is established .
we present such a case where prompt recognition and immediate treatment was initiated , although the patient sustained irreversible end - organ damage .
the case also highlights the need to interpret the kidney biopsy data ( namely , immunofluroscence findings ) in the context of clinical presentation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the development of neuroscience in the last century and in recent years has been very influential in many fields of knowledge such as economics , politics , law , philosophy , public relations , art , etc . reciprocally , different disciplines of knowledge have also influenced the development of neuroscience and science as a whole , pointing out the important keystones of the neuroscientific agendas and also influencing scientific research from different sociocultural perspectives . this interwoven mix of different areas of knowledge has been essential to the rise of a neuroculture ( frazzetto and anker , 2009 ) that is influencing our life under the prism of the latest neuroscientific discoveries . furthermore , this neuroculture can have a significant impact on neuroscientists in their daily practice creating new ways of thinking that will influence their research . many artists have used discoveries , data , illustrations , paradigms or scientific methodologies guided by different goals , motifs , global and personal narratives , and mediums . through their holistic artworks , they not only echo the latest scientific discoveries , but many times their works go beyond the nature and meaning of these discoveries , enriching them with their personal narratives , ambiguity or critical opinions of some aspects of neuroscientific research and opening a neurocultural dialog to a wider audience . besides adding complexity , these artworks also add plasticity , subjectivity and intra - individual differences to the neuroscientific models . the personal experiences are many times hidden by the normative scientific method , and other times highlighted by the subjectivity of artists , are essential to add reality , complexity , and plasticity to the neuroscientific models . that is why i would like to explain my position as an artist at the junction between neuroscience and art . i completed my phd in conjunction with the museum cajal , working with the original slides and scientific drawings of santiago ramon y cajal ( 18521934 ) . besides being completely astonished by the historical and current neuroscientific concepts , and esthetics of his histological slides , drawings , ( garcia - lopez et al . , 2010 ) , articles , and books , i was impressed by the great abundance of metaphors that he employed in his scientific writings . possibly , even more impressive concerning cajal 's metaphors are their naturalistic and organic essence . many of these metaphors could be considered rhetorical ornaments , although they also function as explanatory and even as heuristic tools for proposing his models and theories about brain functioning . as lakoff and johnson pointed out in their seminal book metaphors we live by ( lakoff and johnson , 1980 ) , metaphors are not just rhetorical figures of speech , but ways of thinking . describing cajal 's approach to the brain , sherrington wrote :
a trait very noticeable in him was that in describing what the microscope showed he spoke habitually as though it were a living scene the intense anthropomorphism of his descriptions of what the preparations showed was at first startling to accept . he treated the microscopic scene as though it were alive and were inhabited by beings which felt and did and hoped and tried even as we do . it was personification of natural forces as unlimited as that of goethe 's faust , part 2 . a nerve - cell by its emergent fiber groped to find another we must , if we would enter adequately into cajal 's thought in this field , suppose his entrance , through his microscope , into a world populated by tiny beings actuated by motives and strivings and satisfactions not very remotely different from our own . he would envisage the sperm - cells as activated by a sort of passionate urge in their rivalry for penetration into the ovum - cell . listening to him i asked myself how far this capacity for anthropomorphizing might not contribute to his success as an investigator.(canon , 1949 ; freire and garca - lpez , 2008 ) a trait very noticeable in him was that in describing what the microscope showed he spoke habitually as though it were a living scene the intense anthropomorphism of his descriptions of what the preparations showed was at first startling to accept . he treated the microscopic scene as though it were alive and were inhabited by beings which felt and did and hoped and tried even as we do . it was personification of natural forces as unlimited as that of goethe 's faust , part 2 . a nerve - cell by its emergent fiber groped to find another we must , if we would enter adequately into cajal 's thought in this field , suppose his entrance , through his microscope , into a world populated by tiny beings actuated by motives and strivings and satisfactions not very remotely different from our own . he would envisage the sperm - cells as activated by a sort of passionate urge in their rivalry for penetration into the ovum - cell . listening to him i asked myself how far this capacity for anthropomorphizing might not contribute to his success as an investigator . the use of metaphors by scientists has been studied by many scholars to see the cultural and personal influences that model the scientific practice ( hyman , 1962 ; young , 1985 ; sontag , 1990 ; todes , 1997 , 2009 ; otis , 2002 ) . they are useful as heuristic tools , but they can also become dangerous traps and obstacles , which can lead to initial progress but later stagnation in science ( kuhn , 1962 ) . for cajal , ( cajal , 1901 ) , in his personal interpretation of the psyche 's myth . he often named different morphological structures using naturalistic terms : star - cells of the cerebellum , claw endings of the granule cells , etc . , and named different cells and cellular endings with plant names such as mossy fibers , climbing fibers , rosacea endings , and nest endings ( cajal , 18991904 ) . he also related the development of neurons to plants when he successfully applied the ontogenic method to study the nervous system :
since the full grown forest turns out to be impenetrable and indefinable why not revert to the study of the young wood , in the nursery stage.(cajal , 1901 ) since the full grown forest turns out to be impenetrable and indefinable why not revert to the study of the young wood , in the nursery stage . cajal related plants to neurons not only by their morphology and development , but also because of their physiology , advancing his theories about the plasticity of the nervous system :
as opposed to the reticular theory , the theory of the free arborization of the cellular processes that are capable of developing seems not only the most likely , but also the most encouraging . a continuous pre - established net like a lattice of telegraphic wires in which no new stations or new lines can be created somehow rigid , immutable , incapable of being modified , goes against the concept that all we hold of the organ of thought that within certain limits , is malleable and capable of being perfected by means of well - directed mental gymnastics , above all during its period of development . if we did not fear making excessive comparisons , we would defend our idea by saying that the cerebral cortex is similar to a garden filled with innumerable trees , the pyramidal cells , which can multiply their branches thanks to intelligent cultivation , sending their roots deeper and producing more exquisite flowers and fruits every day.(cajal , 1894 ; see also defelipe , 2006 ) as opposed to the reticular theory , the theory of the free arborization of the cellular processes that are capable of developing seems not only the most likely , but also the most encouraging . a continuous pre - established net like a lattice of telegraphic wires in which no new stations or new lines can be created somehow rigid , immutable , incapable of being modified , goes against the concept that all we hold of the organ of thought that within certain limits , is malleable and capable of being perfected by means of well - directed mental gymnastics , above all during its period of development . if we did not fear making excessive comparisons , we would defend our idea by saying that the cerebral cortex is similar to a garden filled with innumerable trees , the pyramidal cells , which can multiply their branches thanks to intelligent cultivation , sending their roots deeper and producing more exquisite flowers and fruits every day . being born in a village ( petilla de aragon , navarra in spain ) , being a naturalist and being an artist were part of adolescent experiences that would latter emerge on his science life inside the lab . they reflect cultural , social , and personal narratives of the age they were created . nowadays , these organic metaphors could be old - fashioned or even dead neuroscientific metaphors , if we compare them to many of the current mechanistic terms employed by neuroscientists to refer to the brain ( computational analogies , circuits , wires , cables , switching , firing , etc . ) der mensch als industriepalast ( man as industrial palace ) ( 1926 ) . from fritz i do not want to transmit the perception that organic metaphors are more truthful , useful , or beautiful than the mechanistic ones . mechanistic metaphors seem more objective than organic ones , but i believe comparing the brain to a computer has the same heuristic value as comparing the brain to a cauliflower . depending on where you put the focus of your analysis , both systems of metaphors give us opposite , but complementary intellectual models , and both have their own esthetic beauty . for instance , it is interesting to note that the telegraph - nervous system model rejected by cajal to explain the plasticity of the cerebral cortex was useful for hodgkin and huxley ( 1952 ) in their nobel prize - winning studies of nerve action potential generation and propagation . they used the differential equation that describes coaxial cable transmission ( the spatiotemporal telegrapher 's equation , which had been developed to model signal propagation for the design of the transatlantic undersea cable ) ( daugman , 2001 ) . reciprocally , the use of brain 's computer analogies has been very useful for the development of new technologies and important scientific fields like cybernetics and artificial intelligence ( ai ) research . although from a pragmatic point of view , the mechanistic metaphors can be more useful for scientists to continue their research about the brain , i find them negative as neurocultural products because they help to create a mechanical , deterministic , and reductionist vision of the human being . they hide some essential characteristics about the brain ( natural origin , plasticity , self - organization , self - consciousness , emotional behavior , etc . ) . the vision of the nervous system that neuroculture creates is essential to envisioning ourselves and developing our life projects . from an educational perspective , i found more value to turn to another famous art - related metaphor of cajal ( 1901 ) that envisions us as self - builders of our projects :
every man if he so desires becomes sculptor of his own brain . every man if he so desires becomes sculptor of his own brain . interestingly , in a sort of unconscious echo of this metaphor , the conceptual artist jonathan keats put his brain , as well as it 's original thoughts up for sale . he registered a copyright of his brain as a sculpture created by him through the act of thinking . according to an interview with the bbc , he wanted to attain temporary immortality , on the grounds that the copyright act would give him intellectual rights on his mind for a period of 70 years after his death . he reasoned that , if he licensed out those rights , he would fulfill the cogito ergo sum ( i think , therefore i am ) , paradoxically surviving himself by seven decades . he then facilitated the sale by producing an exhibition and catalog at the san francisco modernism gallery . the artwork consists of mri images of his brain activity as he thought about art , beauty , love , and death ( see also frazzetto and anker , 2009 ) . using mechanistic models is not a new procedure , and it is inscribed in a long philosophical and scientific tradition ( descartes , 1664 ; la mettrie , 1748 ) that has usually equated the brain - mind - nervous system to the latest technological innovation in every generation ; the catapult by the greeks ( searle , 1984 ) , the telegraph ( du bois - reymond 's idea released in a public lecture held in 1851 , review in otis , 2001 ) , the jacquard loom ( sherrington , 1942 ) , the telephone switchboard , the computer ( von neumann , 1958 ) . lan vital of vitalist philosophy . once eliminated the vital sparks , energies , and spirits , mechanistic science became the new religion with their objective metaphors . some disciplines such as cybernetics , ai research , and radical behaviorism have especially enhanced the mechanistic terms during the last century . it is still impressive how skinner ( 1971 ) on the first chapter , a technology of behavior , of his book entitled beyond freedom and dignity , tries to escape from the anthropomorphic metaphors of psychoanalysis to start using his battery of mechanistic metaphors . in an era of mechanical objectivity , radical behaviorists found the best place to eliminate any kind of subjectivity of the human mind . it was not until the visualization of the brain in action with new imaging techniques and the parallel development of cognitive neuroscience that the inside cognitive process of the mind / brain became again objective . the behaviorist approaches were easily accepted and permeated many levels of society and educational systems . they were so resonant with human culture because we had already been transformed into machines before . the technology of behavior has been already in use in every society since ancient times : from the classical system of punishment and reward of education , religion , etc . it facilitated the phenomenon of socialization and education despite being also at the ground of many anti - humanistic positions that enhanced the use of man as a medium or machine . during the process of socialization the great achievement of radical behaviorists , mechanistic biologists , and some cybernetic approaches were to make us believe that even our nature was only mechanical . through the abuse of mechanistic terms and analogies to refer to our body , brain , and physiological processes , we were transformed into cultural cyborgs . besides this conceptual and partial transformation of man to machine , we also assisted to deeper changes in the scientific practice , from cajal 's laboratory where he worked usually alone , to laboratories that are were envisioned as authentic factories . nowadays , science is one of the main important economic activities . because of it 's economic importance , the great competition , the race for arriving first to the new discovery , and many other reasons , many labs have become fabrics of science production . depending on many aspects such as : the educational system , the country , the team principal investigator , among other factors , these factory lab models reject more or less the development of science creativity and originality to form robotic scientists with a high degree of specialization to produce very ambitious science projects that require a lot of mechanical daily hard work , but with very few creative reward , especially for young scientists . but of course , the transformations of society and culture of the last centuries did not only take place in the science education systems and scientific labs . many machines and technologies became more used by artists , though art has always been linked to technology . some art studios were transformed into art factories as soon as this notion of art became such an important socioeconomic industry . during last century , the number of assistants in art studios has increased , whereby transforming many studios into companies . i was surprised of how some artists refer to themselves as object makers in order to highlight their craftsmanship activity . of course , a painting or a sculpture is an object , but is it only that ? naming them only as objects removes any kind of spiritual value of the work ; it only focused on the objective properties of the object . but what about the other characteristics of the artwork , such as the effort of the artist , the intention , the narrative , it 's symbolic meaning , etc . ? i am also a mechanical product of this mechanistic culture and society . a mechanical product enhanced by science . i had this intuition that i had transformed myself into a machine while i was completing my bachelor in molecular biology . before finishing , i realized i did not want to become a scientist . through the excessive theoretical approach , dogmatism , memorization of data , and lack of experimentation inside the lab , i did not develop my scientific creativity and originality . i have always considered myself a very creative person and furthermore , a person that needs to be creative to be happy . although i did not develop my creativity as a scientist , as compensation to this excessive mechanization , my artistic creativity was enhanced . i had always made art at home , but it was not until this progressive mechanization that i started to feel the imperious necessity of creating art . this creativity and altered sensibility was also pointing to the necessity to express myself . only very creative scientists can express themselves through their science as we have seen in the case of cajal . it was during a visit to the venice biennale ( 2003 ) , during the last year of my bachelor , when i realized i wanted to mix science and art . there was an installation by the israeli artist , michal rovner entitled , against order ? against disorder? at the israel pavilion that was synthesizing the main ideas of molecular and evolutionary genetics , and social engineering in a very pleasant and instantaneous way . all the chromosomes , molecular cascades , cellular cultures , population genetics , eugenics , etc . the main ideas i arrived through memorizing a great quantity of biochemical cascades , signaling pathways , etc . , were already synthesized in a single image through a superposition of different visual metaphors . furthermore , these ideas were amplified in very different and ambiguous ways that multiply the number of meanings and interpretations . for working in the interface between science and art , i wanted to learn more about science to have a better approach to the science and art interaction . i was lucky i could find the museum cajal , and besides obtaining my phd , i obtained the perfect link between my personal narrative and my global one . because of my cajalian influence , i have been working with organic or naturalistic metaphors with a special goal in mind : i would like to enhance the public vision of the brain as a natural organ rather than as a mechanical and cybernetic one . it is a romantic yet lost battle to renaturalize the public perception of the brain through my artwork , but it is still worthy . as an artist , i started to work with some of the cajalian metaphors such as the neurons as butterflies of the soul ( figure 2 ) , or the cortical garden ( see section 2.1 ) ( figure 3 ) . that is also one of the reasons i usually work with silk ( the product of the cocoons neurons - butterflies ) ( figure 4 ) , a very fragile / resistant and plastic material related to the butterfly 's metamorphosis or neuronal plasticity . interestingly , silk has been recently used as a scaffold for neuronal grafts , regeneration , and remielinzation in the peripherical nervous system ( allmeling et al . , 2008 ; photo video installation : digital print on velvet paper and video ( dimension variable ) . silk explosion or how to destroy 10 cocoons that will never become butterflies ( 2011 ) . silk , mdf , electrical conduit , cfl ligthbulbs , plexiglass , shrink fast plastic . 6 6 3 m. middendorf gallery ( baltimore ) . these naturalistic metaphors are the starting point of my artwork . it is through the use of these concepts , intuitions , personal experiences , materials , mediums , and different methods ( very much influenced by scientific experimentation ) that i try to make my artwork . in the case of the sculpture silk explosion or how to destroy 10 cocoons that will never become butterflies , ( figure 4 ) , besides using silk , i also used a technical approach reminiscent of my microscopic observations . in this sculpture , the light plays an essential role catching the attention of the audience . the light is filtered through the shrinkfast transparent plastic scaffold and silk obtaining textures similar to the histological stainings like the golgi method ( figure 5 ) . details of the silk explosion or how to destroy 10 cocoons that will never become butterflies ( 2011 ) . silk , mdf , electrical conduit , cfl ligthbulbs , plexiglass , shrink fast plastic . 6 6 3 m. middendorf gallery ( baltimore ) . the global naturalistic narrative i explained overlaps with my personal narrative , which is to become the oil or petrol of my artistic machinery . of course , art is a process of research and experimentation when many times i become detached from my initial narrative only to arrive to a new place that becomes the real artwork . this is not only important for my art practice but also for my life philosophy . when the perception you have from yourself does not fit with who you really are , and you develop a mechanical behavior , is the moment to look for a new experience to alter your state . step by step , i have abandoned this first - theoretical and metaphorical approach for a more experimental one . at the present time , i do not think too much in logical linear terms while i am working . i try to be free of prejudices and theoretical premises , and follow my intuition guided by the experimentation in the studio . at the end of the day , i have an empiric personality , as beautifully sung by battiato , and life is an experiment . my practice of sculpture is not only an exterior project , but an inherent work in progress . as cajal once said and jonathan keats updated , i am shaping and reshaping another important sculpture that i hope will never cease . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . i completed my phd in conjunction with the museum cajal , working with the original slides and scientific drawings of santiago ramon y cajal ( 18521934 ) . besides being completely astonished by the historical and current neuroscientific concepts , and esthetics of his histological slides , drawings , ( garcia - lopez et al . , 2010 ) , articles , and books , i was impressed by the great abundance of metaphors that he employed in his scientific writings . possibly , even more impressive concerning cajal 's metaphors are their naturalistic and organic essence . many of these metaphors could be considered rhetorical ornaments , although they also function as explanatory and even as heuristic tools for proposing his models and theories about brain functioning . as lakoff and johnson pointed out in their seminal book metaphors we live by ( lakoff and johnson , 1980 ) , metaphors are not just rhetorical figures of speech , but ways of thinking . describing cajal 's approach to the brain , sherrington wrote :
a trait very noticeable in him was that in describing what the microscope showed he spoke habitually as though it were a living scene the intense anthropomorphism of his descriptions of what the preparations showed was at first startling to accept . he treated the microscopic scene as though it were alive and were inhabited by beings which felt and did and hoped and tried even as we do . it was personification of natural forces as unlimited as that of goethe 's faust , part 2 . a nerve - cell by its emergent fiber groped to find another we must , if we would enter adequately into cajal 's thought in this field , suppose his entrance , through his microscope , into a world populated by tiny beings actuated by motives and strivings and satisfactions not very remotely different from our own . he would envisage the sperm - cells as activated by a sort of passionate urge in their rivalry for penetration into the ovum - cell . listening to him i asked myself how far this capacity for anthropomorphizing might not contribute to his success as an investigator.(canon , 1949 ; freire and garca - lpez , 2008 ) a trait very noticeable in him was that in describing what the microscope showed he spoke habitually as though it were a living scene the intense anthropomorphism of his descriptions of what the preparations showed was at first startling to accept . he treated the microscopic scene as though it were alive and were inhabited by beings which felt and did and hoped and tried even as we do . it was personification of natural forces as unlimited as that of goethe 's faust , part 2 . a nerve - cell by its emergent fiber groped to find another we must , if we would enter adequately into cajal 's thought in this field , suppose his entrance , through his microscope , into a world populated by tiny beings actuated by motives and strivings and satisfactions not very remotely different from our own . he would envisage the sperm - cells as activated by a sort of passionate urge in their rivalry for penetration into the ovum - cell . listening to him i asked myself how far this capacity for anthropomorphizing might not contribute to his success as an investigator . the use of metaphors by scientists has been studied by many scholars to see the cultural and personal influences that model the scientific practice ( hyman , 1962 ; young , 1985 ; sontag , 1990 ; todes , 1997 , 2009 ; otis , 2002 ) . they are useful as heuristic tools , but they can also become dangerous traps and obstacles , which can lead to initial progress but later stagnation in science ( kuhn , 1962 ) . for cajal , ( cajal , 1901 ) , in his personal interpretation of the psyche 's myth . he often named different morphological structures using naturalistic terms : star - cells of the cerebellum , claw endings of the granule cells , etc . , and named different cells and cellular endings with plant names such as mossy fibers , climbing fibers , rosacea endings , and nest endings ( cajal , 18991904 ) . he also related the development of neurons to plants when he successfully applied the ontogenic method to study the nervous system :
since the full grown forest turns out to be impenetrable and indefinable why not revert to the study of the young wood , in the nursery stage.(cajal , 1901 ) since the full grown forest turns out to be impenetrable and indefinable why not revert to the study of the young wood , in the nursery stage . cajal related plants to neurons not only by their morphology and development , but also because of their physiology , advancing his theories about the plasticity of the nervous system :
as opposed to the reticular theory , the theory of the free arborization of the cellular processes that are capable of developing seems not only the most likely , but also the most encouraging . a continuous pre - established net like a lattice of telegraphic wires in which no new stations or new lines can be created somehow rigid , immutable , incapable of being modified , goes against the concept that all we hold of the organ of thought that within certain limits , is malleable and capable of being perfected by means of well - directed mental gymnastics , above all during its period of development . if we did not fear making excessive comparisons , we would defend our idea by saying that the cerebral cortex is similar to a garden filled with innumerable trees , the pyramidal cells , which can multiply their branches thanks to intelligent cultivation , sending their roots deeper and producing more exquisite flowers and fruits every day.(cajal , 1894 ; see also defelipe , 2006 ) as opposed to the reticular theory , the theory of the free arborization of the cellular processes that are capable of developing seems not only the most likely , but also the most encouraging . a continuous pre - established net like a lattice of telegraphic wires in which no new stations or new lines can be created somehow rigid , immutable , incapable of being modified , goes against the concept that all we hold of the organ of thought that within certain limits , is malleable and capable of being perfected by means of well - directed mental gymnastics , above all during its period of development . if we did not fear making excessive comparisons , we would defend our idea by saying that the cerebral cortex is similar to a garden filled with innumerable trees , the pyramidal cells , which can multiply their branches thanks to intelligent cultivation , sending their roots deeper and producing more exquisite flowers and fruits every day . being born in a village ( petilla de aragon , navarra in spain ) , being a naturalist and being an artist were part of adolescent experiences that would latter emerge on his science life inside the lab . they reflect cultural , social , and personal narratives of the age they were created . nowadays , these organic metaphors could be old - fashioned or even dead neuroscientific metaphors , if we compare them to many of the current mechanistic terms employed by neuroscientists to refer to the brain ( computational analogies , circuits , wires , cables , switching , firing , etc . ) der mensch als industriepalast ( man as industrial palace ) ( 1926 ) . from fritz i do not want to transmit the perception that organic metaphors are more truthful , useful , or beautiful than the mechanistic ones . mechanistic metaphors seem more objective than organic ones , but i believe comparing the brain to a computer has the same heuristic value as comparing the brain to a cauliflower . depending on where you put the focus of your analysis , you will highlight or hide some important characteristics about the brain . both systems of metaphors give us opposite , but complementary intellectual models , and both have their own esthetic beauty . for instance , it is interesting to note that the telegraph - nervous system model rejected by cajal to explain the plasticity of the cerebral cortex was useful for hodgkin and huxley ( 1952 ) in their nobel prize - winning studies of nerve action potential generation and propagation . they used the differential equation that describes coaxial cable transmission ( the spatiotemporal telegrapher 's equation , which had been developed to model signal propagation for the design of the transatlantic undersea cable ) ( daugman , 2001 ) . reciprocally , the use of brain 's computer analogies has been very useful for the development of new technologies and important scientific fields like cybernetics and artificial intelligence ( ai ) research . although from a pragmatic point of view , the mechanistic metaphors can be more useful for scientists to continue their research about the brain , i find them negative as neurocultural products because they help to create a mechanical , deterministic , and reductionist vision of the human being . they hide some essential characteristics about the brain ( natural origin , plasticity , self - organization , self - consciousness , emotional behavior , etc . ) . the vision of the nervous system that neuroculture creates is essential to envisioning ourselves and developing our life projects . from an educational perspective , i found more value to turn to another famous art - related metaphor of cajal ( 1901 ) that envisions us as self - builders of our projects :
every man if he so desires becomes sculptor of his own brain . every man if he so desires becomes sculptor of his own brain . interestingly , in a sort of unconscious echo of this metaphor , the conceptual artist jonathan keats put his brain , as well as it 's original thoughts up for sale . he registered a copyright of his brain as a sculpture created by him through the act of thinking . according to an interview with the bbc , he wanted to attain temporary immortality , on the grounds that the copyright act would give him intellectual rights on his mind for a period of 70 years after his death . he reasoned that , if he licensed out those rights , he would fulfill the cogito ergo sum ( i think , therefore i am ) , paradoxically surviving himself by seven decades . he then facilitated the sale by producing an exhibition and catalog at the san francisco modernism gallery . the artwork consists of mri images of his brain activity as he thought about art , beauty , love , and death ( see also frazzetto and anker , 2009 ) . using mechanistic models is not a new procedure , and it is inscribed in a long philosophical and scientific tradition ( descartes , 1664 ; la mettrie , 1748 ) that has usually equated the brain - mind - nervous system to the latest technological innovation in every generation ; the catapult by the greeks ( searle , 1984 ) , the telegraph ( du bois - reymond 's idea released in a public lecture held in 1851 , review in otis , 2001 ) , the jacquard loom ( sherrington , 1942 ) , the telephone switchboard , the computer ( von neumann , 1958 ) . philosophical mechanism has been essential to reject the lan vital of vitalist philosophy . once eliminated the vital sparks , energies , and spirits , mechanistic science became the new religion with their objective metaphors . some disciplines such as cybernetics , ai research , and radical behaviorism have especially enhanced the mechanistic terms during the last century . it is still impressive how skinner ( 1971 ) on the first chapter , a technology of behavior , of his book entitled beyond freedom and dignity , tries to escape from the anthropomorphic metaphors of psychoanalysis to start using his battery of mechanistic metaphors . in an era of mechanical objectivity , radical behaviorists found the best place to eliminate any kind of subjectivity of the human mind . it was not until the visualization of the brain in action with new imaging techniques and the parallel development of cognitive neuroscience that the inside cognitive process of the mind / brain became again objective . the behaviorist approaches were easily accepted and permeated many levels of society and educational systems . they were so resonant with human culture because we had already been transformed into machines before . the technology of behavior has been already in use in every society since ancient times : from the classical system of punishment and reward of education , religion , etc . it facilitated the phenomenon of socialization and education despite being also at the ground of many anti - humanistic positions that enhanced the use of man as a medium or machine . during the process of socialization the great achievement of radical behaviorists , mechanistic biologists , and some cybernetic approaches were to make us believe that even our nature was only mechanical . through the abuse of mechanistic terms and analogies to refer to our body , brain , and physiological processes , we were transformed into cultural cyborgs . besides this conceptual and partial transformation of man to machine , we also assisted to deeper changes in the scientific practice , from cajal 's laboratory where he worked usually alone , to laboratories that are were envisioned as authentic factories . nowadays , science is one of the main important economic activities . because of it 's economic importance , the great competition , the race for arriving first to the new discovery , and many other reasons , many labs have become fabrics of science production . depending on many aspects such as : the educational system , the country , the team principal investigator , among other factors , these factory lab models reject more or less the development of science creativity and originality to form robotic scientists with a high degree of specialization to produce very ambitious science projects that require a lot of mechanical daily hard work , but with very few creative reward , especially for young scientists . but of course , the transformations of society and culture of the last centuries did not only take place in the science education systems and scientific labs . many machines and technologies became more used by artists , though art has always been linked to technology . some art studios were transformed into art factories as soon as this notion of art became such an important socioeconomic industry . during last century , the number of assistants in art studios has increased , whereby transforming many studios into companies . i was surprised of how some artists refer to themselves as object makers in order to highlight their craftsmanship activity . of course , a painting or a sculpture is an object , but is it only that ? naming them only as objects removes any kind of spiritual value of the work ; it only focused on the objective properties of the object . but what about the other characteristics of the artwork , such as the effort of the artist , the intention , the narrative , it 's symbolic meaning , etc . ? i am also a mechanical product of this mechanistic culture and society . a mechanical product enhanced by science . i had this intuition that i had transformed myself into a machine while i was completing my bachelor in molecular biology . before finishing , i realized i did not want to become a scientist . through the excessive theoretical approach , dogmatism , memorization of data , and lack of experimentation inside the lab , i did not develop my scientific creativity and originality . i have always considered myself a very creative person and furthermore , a person that needs to be creative to be happy . although i did not develop my creativity as a scientist , as compensation to this excessive mechanization , my artistic creativity was enhanced . i had always made art at home , but it was not until this progressive mechanization that i started to feel the imperious necessity of creating art . this creativity and altered sensibility was also pointing to the necessity to express myself . only very creative scientists can express themselves through their science as we have seen in the case of cajal . it was during a visit to the venice biennale ( 2003 ) , during the last year of my bachelor , when i realized i wanted to mix science and art . there was an installation by the israeli artist , michal rovner entitled , against order ? against disorder? at the israel pavilion that was synthesizing the main ideas of molecular and evolutionary genetics , and social engineering in a very pleasant and instantaneous way . all the chromosomes , molecular cascades , cellular cultures , population genetics , eugenics , etc . the main ideas i arrived through memorizing a great quantity of biochemical cascades , signaling pathways , etc . , were already synthesized in a single image through a superposition of different visual metaphors . furthermore , these ideas were amplified in very different and ambiguous ways that multiply the number of meanings and interpretations . for working in the interface between science and art , i wanted to learn more about science to have a better approach to the science and art interaction . i was lucky i could find the museum cajal , and besides obtaining my phd , i obtained the perfect link between my personal narrative and my global one . because of my cajalian influence , i have been working with organic or naturalistic metaphors with a special goal in mind : i would like to enhance the public vision of the brain as a natural organ rather than as a mechanical and cybernetic one . it is a romantic yet lost battle to renaturalize the public perception of the brain through my artwork , but it is still worthy . as an artist , i started to work with some of the cajalian metaphors such as the neurons as butterflies of the soul ( figure 2 ) , or the cortical garden ( see section 2.1 ) ( figure 3 ) . that is also one of the reasons i usually work with silk ( the product of the cocoons neurons - butterflies ) ( figure 4 ) , a very fragile / resistant and plastic material related to the butterfly 's metamorphosis or neuronal plasticity . interestingly , silk has been recently used as a scaffold for neuronal grafts , regeneration , and remielinzation in the peripherical nervous system ( allmeling et al . , 2008 ; photo video installation : digital print on velvet paper and video ( dimension variable ) . silk explosion or how to destroy 10 cocoons that will never become butterflies ( 2011 ) . silk , mdf , electrical conduit , cfl ligthbulbs , plexiglass , shrink fast plastic . it is through the use of these concepts , intuitions , personal experiences , materials , mediums , and different methods ( very much influenced by scientific experimentation ) that i try to make my artwork . in the case of the sculpture silk explosion or how to destroy 10 cocoons that will never become butterflies , ( figure 4 ) , besides using silk , i also used a technical approach reminiscent of my microscopic observations . in this sculpture , the light plays an essential role catching the attention of the audience . the light is filtered through the shrinkfast transparent plastic scaffold and silk obtaining textures similar to the histological stainings like the golgi method ( figure 5 ) . details of the silk explosion or how to destroy 10 cocoons that will never become butterflies ( 2011 ) . silk , mdf , electrical conduit , cfl ligthbulbs , plexiglass , shrink fast plastic . 6 6 3 m. middendorf gallery ( baltimore ) . the global naturalistic narrative i explained overlaps with my personal narrative , which is to become the oil or petrol of my artistic machinery . of course , art is a process of research and experimentation when many times i become detached from my initial narrative only to arrive to a new place that becomes the real artwork . this is not only important for my art practice but also for my life philosophy . when the perception you have from yourself does not fit with who you really are , and you develop a mechanical behavior , is the moment to look for a new experience to alter your state . step by step , i have abandoned this first - theoretical and metaphorical approach for a more experimental one . at the present time , i do not think too much in logical linear terms while i am working . i try to be free of prejudices and theoretical premises , and follow my intuition guided by the experimentation in the studio . at the end of the day , i have an empiric personality , as beautifully sung by battiato , and life is an experiment . my practice of sculpture is not only an exterior project , but an inherent work in progress . as cajal once said and jonathan keats updated , i am shaping and reshaping another important sculpture that i hope will never cease . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | neuroculture , conceived as the reciprocal interaction between neuroscience and different areas of human knowledge is influencing our lives under the prism of the latest neuroscientific discoveries . simultaneously
, neuroculture can create new models of thinking that can significantly impact neuroscientists ' daily practice .
especially interesting is the interaction that takes place between neuroscience and the arts .
this interaction takes place at different , infinite levels and contexts .
i contextualize my work inside this neurocultural framework . through my artwork ,
i try to give a more natural vision of the human brain , which could help to develop a more humanistic culture . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
newly developed miniaturized vision tests have allowed , in a clinically relevant way , to evaluate the influence of magnification and age on the near visual acuity of dentists . the use of optical aids to improve manual precision has long been a tradition in many medical professions . dentistry seems to be an ideal environment for the use of loupes and microscopes , because operative treatments are performed in a small and narrow environment . however , the idea that magnification devices should be used as standard devices in dentistry is relatively new [ 24 ] . the body of evidence supporting the general assumption that optical magnification improves the quality of caries detection and filigree therapy is weak . most publications about visual acuity and the influence of magnification [ 69 ] , or concerning microscopes and endodontics [ 2 , 1012 ] , are based on expert opinions and case reports . an obvious gap between anecdotal conjecture and solid evidence - based decision making exists with respect to the use of optical aids in dentistry . in a previous study with the help of miniaturized visual tests and a light box , the present authors found a large variability in the near visual acuity of dentists and a significant correlation with the dentists age . yet , the tests were not incorporated in an oral cavity , and thus , the clinical relevance of these miniaturized visual tests was limited . therefore , the aims of the present study were : to test near visual acuity and the influence of magnification and age in a simulated clinical situationto compare the results to the previous study , where the same group of dentists was tested under standardized conditions ex ore with a light box to test near visual acuity and the influence of magnification and age in a simulated clinical situation to compare the results to the previous study , where the same group of dentists was tested under standardized conditions ex ore with a light box the near visual acuity of 40 dentists from the dental school of the university of bern was evaluated using miniaturized visual tests fixed in a dental phantom head unit . the distribution of the dentists in the different age groups was as follows : 2530 years , n = 16 ; 3135 years , n = 9 ; 3640 years , n = 2 ; 4145 years , n = 5 ; 4650 years , n = 1 ; 5155 years , n = 3 ; 5660 years , n = 3 ; 6165 years , n = 1 . visual tests with e - optotypes , ranging from 0.05 to 0.5 mm , allowed for the quantification of visual acuity at a typical dental working distance , as described in a previous study . the tests were mounted in cavities in maxillary second premolars and first molars of a dental phantom unit ( kavo , biberach , germany ) ( fig . 1).fig.1the fixation of the visual tests in distal box cavities of phantom teeth allows the testing of visual acuity under simulated clinical conditions the fixation of the visual tests in distal box cavities of phantom teeth allows the testing of visual acuity under simulated clinical conditions the head was positioned on a dental chair . 4 , hahnenkratt gmbh , knigsbach , germany ) were used , and the operating lamp ( delight , planmeca oy , helsinki , finland ) for conditions 1 through 4 was individually arranged by the test persons . visual performance was tested under the following conditions : natural visual acuity ( nv ) : no magnification devices , distance of 300 mm ( typical working distance ) , operating lampfree natural visual acuity ( nvf ) : no magnification devices and free choice of the distance ( typical controlling distance ) , operating lampgalilean loupe system ( g ) ( evc250n , surgitel , ann arbor , mi , usa ) : magnification of 2.5 ; distance of 380 mm ; operating lampkeplerian loupe system ( k ) ( eyemag pro s , zeiss , oberkochen , germany ) : magnification of 4.3 ; distance of 400 mm ; operating lampoperating microscope ( m4 ) ( leica m300 , leica microsystems , heerbrugg , switzerland ) : magnification of 4 ; distance of 250 mm ; integrated lightoperating microscope ( m6.4 ) : same as condition 5 , but with magnification of 6.4 . natural visual acuity ( nv ) : no magnification devices , distance of 300 mm ( typical working distance ) , operating lamp free natural visual acuity ( nvf ) : no magnification devices and free choice of the distance ( typical controlling distance ) , operating lamp galilean loupe system ( g ) ( evc250n , surgitel , ann arbor , mi , usa ) : magnification of 2.5 ; distance of 380 mm ; operating lamp keplerian loupe system ( k ) ( eyemag pro s , zeiss , oberkochen , germany ) : magnification of 4.3 ; distance of 400 mm ; operating lamp operating microscope ( m4 ) ( leica m300 , leica microsystems , heerbrugg , switzerland ) : magnification of 4 ; distance of 250 mm ; integrated light operating microscope ( m6.4 ) : same as condition 5 , but with magnification of 6.4 . the loupes were fixed on a headband , which allowed the dentists to wear their respective prescription eyeglasses ( when necessary ) in all groups . during the visual tests , the position of the loupes , the eye object distance , and the reading of the e - optotypes were all controlled by the same expert . the smallest line of the visual test that could be read without mistakes was registered . the distance between the three bars of the letter e ( = 1/5 the size of e ) corresponds to the smallest detectable structure and allows to calculate the visual acuity . the metric dimension of the bar spacing in the registered line ( e.g. , 0.03 mm ) was converted into the reciprocal value ( e.g. , 33.3/mm ) . this allowed to achieve a positive correlation between the metric value and the quality of the visual performance . the influence of the different magnification systems ( conditions 16 ) was tested for all dentists . to investigate the influence of the dentists age , the present authors calculated the correlation between age and visual acuity for the different optical conditions and compared the results of the two subgroups a < 40 years ( n = 27 ) and b 40 years ( n = 13 ) . finally , the results of the present study were compared with the results of the previous study , where the visual performance of the same dentists was tested on the light box and not in a setup simulating the clinical situation . for statistical analysis , descriptive statistical analysis was carried out to determine the means and medians as well as the nonparametric 95 % confidence intervals ( ci ) for all dentists . the influence of the respective groups of dentists and different loupe systems on the visual acuity was analyzed by using rank tests for linear models based on wilcoxon scores , followed by wilcoxon signed rank tests with bonferroni spearman s rank correlation coefficient was used to detect monotone relationships between age and visual acuity . for the third part , spearman s rank correlation coefficient and pearson s correlation coefficient were used to detect monotone and linear relationships between the results of the previous study and those of the present one concerning nv , g , and k. the relative improvement of visual performance with magnification ranged from 250 % ( galilean loupe ) to 961 % ( operating microscope , 6.4 ) , compared to natural visual acuity . statistical analysis revealed significant differences between all tested conditions ( p < 0.01 ) ( table 1).table 1visual performance ( mean , median , nonparametric 95 % confidence intervals ) and the relative improvement of all tested dentists under all test conditionsconditionmeanmedian95 % ciimprovement of visual performance ( nv = 100 % ) nv*8.4311.5211.5213.98100 % nvf*15.2018.0416.7921.01180 % g*21.0721.0119.5222.90250 % k*31.9434.3429.7634.34379 % m4*57.2753.4853.4858.19679 % m6.4*81.0181.5975.1387.41961 % note the difference between nv and nvf due to the natural magnification by moving closer to the object*p < 0.01 , significant differences within the columns visual performance ( mean , median , nonparametric 95 % confidence intervals ) and the relative improvement of all tested dentists under all test conditions note the difference between nv and nvf due to the natural magnification by moving closer to the object * p < 0.01 , significant differences within the columns the correlation between age and visual performance under the different conditions is presented in table 2 . the exceptions were nvf with a strong correlation and m6.4 with a weak correlation.table 2the correlation between age and visual performance was medium for all optical conditions except nvf ( strong correlation ) and m6.4 ( weak correlation)conditionspearman s rank correlationnv0.543nvf0.747g0.686k0.563m40.485m6.40.286 the correlation between age and visual performance was medium for all optical conditions except nvf ( strong correlation ) and m6.4 ( weak correlation ) the mean visual performance , medians , and 95 % cis for groups a ( < 40 years ) and b ( 40 years ) are presented in table 3 . for all tested conditions , significant differences between the two groups were detected ( p < 0.001 or p < 0.05 ) . both groups benefitted from the magnification of the galilean and keplerian loupes and even more from the sophisticated optics of the operating microscope . the visual acuity of group a in natural vision at a closer distance ( nvf ) was better than the acuity of group b with galilean loupes ( g ) . the difference between conditions nvf and g was not as pronounced for group a as for group b.table 3visual performance ( mean , median , nonparametric 95 % confidence intervals ) for the two groups < 40 and 40 years under all test conditionsconditionage < 40 years ( n = 27 ) ( 1/mm)age 40 years ( n = 13 ) ( 1/mm)meanmedian95 % cimeanmedian95 % cinv*11.1611.5211.5214.633.350n.a.nvf*20.2921.0118.2721.015.750n.a.g*23.3821.0121.0125.3816.7818.0414.7818.04k*34.3834.3432.0537.0127.3927.2824.8029.76m4**60.0758.1955.4964.6152.0648.0848.0855.49m6.4**85.1587.4182.5994.2173.3175.7662.8481.59note the differences from nvf to g between the two groupsn.a . not available : due to the skewed distribution , a calculation of the 95 % confidence interval was not possible ( in the older group when visual performance with the naked eye was tested*p < 0.001 ; * * p < 0.05 , significant differences within the columns visual performance ( mean , median , nonparametric 95 % confidence intervals ) for the two groups < 40 and 40 years under all test conditions note the differences from nvf to g between the two groups n.a . not available : due to the skewed distribution , a calculation of the 95 % confidence interval was not possible ( in the older group when visual performance with the naked eye was tested * p < 0.001 ; * * p < 0.05 , significant differences within the columns the comparison of the present study with the previous study on a light box revealed a strong correlation between the two setups when no magnification device was used ( nv ; spearman s correlation coefficient , 0.698 ) and when the galilean system was used ( g ; pearson s correlation coefficient , 0.725 ) . the correlation was medium for the keplerian system ( k ; spearman s correlation coefficient , 0.622 ) . a large variability in natural visual acuity was found ( 018.04 , 1/mm bar spacing ) , which corroborated the results of a previous study under optimal conditions ex ore . some of the tested dentists had better visual acuity without optical aids than others with galilean loupes . the visual acuity can , as expected , be significantly improved by the use of magnification devices ( 250961 % , table 1 ) , independent of age and natural visual acuity . when using keplerian loupes , all dentists achieved a significantly higher visual acuity than with galilean loupes . the different magnification factors of the two systems have a clinical rationale : galilean loupes are small and ergonomic but have a magnification limit of 2.5 ( 3.2 with optical constraints ) , while the magnification of keplerian loupes is not constrained . the large difference between the microscope and the head - mounted loupe systems , even with comparable magnification factors , was unexpected . the highly superior performance of the operating microscope could be due to the different optical construction of the microscope with a greater angle between the two optical beams . a further , possibly even more important reason could be the static position of the microscope , which offsets any disturbances caused by head movements . this effect is only detectable in a simulated clinical setting as used in this study . presbyopia ( loss of accommodation ) starts around the age of 40 years and is combined with other changes in the eye , such as decreasing sensitivity to contrast , increasing sensitivity to glare , and lower visual performance [ 15 , 16 ] . the influence of presbyopia on the visual performance was analyzed in two different mathematical approaches . the strong correlation between age and natural visual acuity in a free , i.e. , closer , distance ( nvf ) could be expected due to the loss of accommodation . however , the only marginal correlation between age and acuity using the microscope ( m6.4 ) was unexpected . an explanation could be the fact that the microscope allows a parallel view without any accommodation and is therefore less able to account for presbyopic deficiencies . the division into two groups ( < 40 and 40 years old ) allowed the quantification of the age - related deficiencies in a second , more comprehensible approach . 40 years old , the condition nvf exhibited a 72 % lower visual performance . this condition has an evident clinical importance : by reducing the working distance , the dentist profits from a natural magnification which is quantified in the difference between the conditions nv and nvf in the younger group a ( < 40 years old ) ( table 3 ) . this natural magnification is widely used in diagnostic situations and mostly compromised with increasing age . the comparison of the extraoral visual test under optimum visual conditions ( direct view , light box , supported head ) with the intraoral visual test in a phantom head showed a strong correlation for unaided natural vision and galilean loupes . the correlation for keplerian loupes was less pronounced . this could indicate that head - mounted higher magnifications are more sensitive to tremors arising from the head and dental mirrors in a clinical situation . however , an extraoral near vision test seems to be a valid surrogate to judge the performance that would be achieved in the clinical situation . common near vision tests , such as those used by opticians , are physically too large to assess visual acuity at the scale on which dentists work . this is , with one exception , also true for the few research studies identified in the literature [ 15 , 18 , 19 ] . the e - optotypes used in the present study ranged from 0.05 to 0.5 mm and were proven to have adequate discriminatory properties . the placement of the tests in artificial teeth provided a realistic simulation of the dental setting , including variables such as the illumination source and the reduced contrast in a cavity , which may influence the visual performance during dental work . however , not all parameters for an objective optical value can be standardized in a simulated clinical setting . the pragmatic question of whether a small structure can be recognized or not seems to be more adequate for a clinical approach . therefore , the visual acuity angle was substituted for the metric dimension of the smallest recognized bar spacing under the given conditions . the reciprocal calculation of bar spacing allowed for a positive correlation between metric values and visual performance . the results of this study suggest the importance of reliable near vision tests for dental personnel . dental students as well as dental personnel with increasing age should be aware of their natural near vision in order to choose adequate optical aids . whether or not an adjusted visual acuity has an impact on the precision of diagnostic and operative procedures remains the subject of further studies . the near visual acuity under simulated clinical conditions varies highly between individuals and decreases over one s lifetime . there is a need for a free accessible visual test at a dental working distance to objectively measure the visual performance of dental students and dental personnel in order to provide personalized recommendations for the use of magnification devices . individuals with poor natural visual acuity or an age 40 years can reliably compensate their visual deficiencies by using optical aids . | objectivesthis study examined the near visual acuity of dentists in relation to age and magnification under simulated clinical conditions.materials and methodsminiaturized visual tests were performed in posterior teeth of a dental phantom head in a simulated clinical setting ( dental chair , operating lamp , dental mirror ) .
the visual acuity of 40 dentists was measured under the following conditions : ( 1 ) natural visual acuity , distance of 300 mm ; ( 2 ) natural visual acuity , free choice of distance ; ( 3 ) galilean loupes , magnification of 2.5 ; ( 4 ) keplerian loupes , 4.3 ; ( 5 ) operating microscope , 4 , integrated light ; ( 6 ) operating microscope , 6.4 , integrated light.resultsthe visual acuity varied widely between individuals and was significantly lower in the group 40 years of age ( p < 0.001 ) .
significant differences were found between all tested conditions ( p < 0.01 ) .
furthermore , a correlation between visual acuity and age was found for all conditions .
the performance with the microscope was better than with loupes even with comparable magnification factors .
some dentists had a better visual acuity without optical aids than others with galilean loupes.conclusionsnear visual acuity under simulated clinical conditions varies widely between individuals and decreases throughout life .
visual deficiencies can be compensated for with optical aids.clinical relevancenewly developed miniaturized vision tests have allowed , in a clinically relevant way , to evaluate the influence of magnification and age on the near visual acuity of dentists . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
behcet 's disease ( bd ) is often complicated by vascular complications with a clear preponderance for venous involvement1 ) . arterial and cardiac complications including aneurysms , arteritis , and thrombosis are rare but life threatening complications2 , 3 ) . we report an unusual case of successive vascular complications including extensive venous thrombosis , huge right ventricular ( rv ) thrombus , multiple pulmonary thromboembolisms , and a pulmonary artery aneurysm ( paa ) rupture in a patient with an established diagnosis of bd . in march , 2003 , a 54-year - old man presented with cough , dyspnea and intermittent fever that began two months earlier . two years previously , he was diagnosed with bd based on the clinical manifestations of recurrent oral and genital ulcers , skin manifestations including erythema nodosum and papulopustular lesions , and a positive pathology test . he had a previous history of recurrent venous occlusions at multiple sites , including the common femoral vein , great saphenous vein and inferior vena cava . he had been on maintenance coumadin therapy until eight months earlier when he stopped treatment and was lost to follow up . on examination , his body temperature , heart rate and blood pressure were 38.1 , 110/min and 120/80 mmhg , respectively . multiple discrete round ulcers were observed on his lower lip mucosa , tongue and scrotum . the initial complete blood count revealed a hemoglobin count of 12.6 g / dl , a platelet count of 36810/l , and a white cell count of 10.610/l . the esr was elevated to 73 mm / hr and the c - reactive protein was positive at 4.7 mg / dl . the anticardiolipin antibodies were negative but the lupus anticoagulant was positive ( 92.7 sec ) . the chest x - ray revealed haziness in the right middle and left upper lobes . transthoracic echocardiography showed a mobile ill - defined 2.01.3 cm sized mass that was attached to the tip of the papillary muscle of rv but valvular vegetation was not observed ( figure 1a ) . the lung scan revealed multiple perfusion defects on the right upper , right lower , and left lower lung fields ( figure 1b ) . coumadin and methylprednisolone 24 mg / d were started under a diagnosis of bd complicated by intracardiac thrombosis and multiple pulmonary thromboembolisms , . after the coumadin treatment for one year , the right ventricular thrombus was completely resolved . in october 2004 , he suddenly developed a hemoptysis of 700 ml associated with chest pain and dyspnea . the body temperature , heart rate , respiratory rate and blood pressure were 38 , 140/min , 44/min and 110/70 mmhg , respectively . the complete blood count showed a hemoglobin level , a white blood cell count and a platelet count of 11.0 g / dl , 16.410/l and 40510/l , respectively . the coagulation profile , esr , crp , and blood chemistry were within the normal limits . the chest ct scan and pulmonary angiography revealed a pulmonary hemorrhage from a rupture of the right pulmonary artery and a thrombus within the aneurysm ( figure 2 ) . the patient was diagnosed with a rupture of paa and was started on high dose glucocorticoid and cyclophosphamide pulse therapy . after the completion of 6 cycles of cyclophosphamide therapy , he was maintained on azathioprine 100 mg / d and methylprednisolone 8 mg / d . his progress was uneventful for 10 months , and the paa decreased in size . in august 2005 , he developed recurrent hemoptysis , which resolved with high dose glucocorticoid therapy . however , he died during a third episode of massive hemoptysis in october 2005 , twelve months after the initial presentation . since the main pathological feature of bd is vasculitis , the condition is often complicated by vascular complications with an incidence of vascular involvement ranging from 7 to 29%2 ) . the venous lesions are mainly venous occlusions , while arterial lesions are either arterial aneurysms or arterial occlusions . arterial complications , particularly when multiple vessels are involved , have grave consequences often leading to mortality . endothelial cell injury by the deposition of immune complexes has been implicated as an important cause of hypercoagulability and thrombosis . vascular inflammation can lead to the enhancement of platelet aggregation and an impairment of fibrinolysis resulting in a thrombosis4 , 5 ) . recently , the von willebrand factor antigen6 ) , hyperhomocysteinemia , and antiphospholipid antibodies were reported to play a role in thrombus formation in bd7 , 8) . however , thrombosis within the cardiac chamber is extremely rare9 ) and can only occur in settings where the immune system is extensively activated . this is because the endocardium is less prone to damage from circulating immune complexes and various inflammatory mediators due to high velocity dynamic blood flow within the cardiac chambers . in our patient , the increased lupus anticoagulant and plasma homocysteine concentration was documented during the severe disease flare up resulting in a thrombosis of the pulmonary artery and rv . our case demonstrates that multiple thrombophilic factors act cumulatively to trigger a fulminant thrombotic phenomenon . the consequent neovascularization and degeneration of arterial wall result in the formation of an aneurysm12 ) . hemoptysis is the main presenting symptom but thrombi within paa can cause secondary ischemia in the lung parenchyma . medical treatment with immunosuppressive agents is preferred over surgery because a recurrent aneurysm or fistula at the anastomotic site is a common complication after a surgical resection13 ) . there are reports of the regression of paa associated with bd after a treatment with high dose glucocorticoid and cyclophosphamide combination14 , 15 ) . however , the successful control of the symptoms with these therapeutic regimens is not always enough to prevent a recurrence or rupture . when a bd patient with thrombophilic tendency experiences a major flare in the disease activity , a search for other vascular complications is recommended because multiple catastrophic vascular events can be triggered by the inflammation . | arterial and cardiac involvement of behcet 's disease is a rare but life threatening complication .
the rupture of an arterial aneurysm might result in sudden death .
we report a 54-year - old man with an established diagnosis of behcet 's disease who presented with multiple cardiovascular complications that eventually lead to his death .
he presented with extensive venous occlusions , and sequentially developed right ventricular thrombosis with multiple pulmonary thromboembolisms , and a pulmonary artery aneurysm .
we report this unusual sequence of cardiovascular complications in a patient with behcet 's disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a systematic approach when further investigating such patients is important to ensure that primary liver disease is excluded , rarer causes are not overlooked , and unnecessary invasive investigations are avoided . this case illustrates that elevated serum aminotransferases may be derived from tissues other than hepatocytes , such as skeletal muscle cells by using the example of a rare muscle disorder , rippling muscle disease . a 43-year - old male fitness trainer presented to the hepatology clinic after being referred by his general practitioner with elevated serum aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) levels ( 23 times the upper limit of normal ) over a period of 7 months . bilirubin , gamma - glutamyl transpeptidase ( ggt ) and alkaline phosphatase ( alp ) were within normal range . on further questioning , the patient gave a history of rippling muscle disease diagnosed when he was 9 years old . specifically he had no history of alcohol abuse or dependency , no history of illicit drug use , no known history of hepatitis and he was not on any regular medications . a detailed family history and research into previous investigations performed on the patient and his family revealed that his father and elder brother had been found to have elevated serum creatine kinase ( ck ) concentrations . genetic linkage analysis had pointed to caveolin-3 mutations in all of them . on physical examination , there were no stigmata of chronic liver disease , and gastrointestinal , cardiovascular and respiratory examinations were unremarkable . positive neuromuscular findings consistent with rippling muscle disease included a long - standing history of activity - related fatigue of upper and lower limb muscle groups . characteristic muscle rippling was demonstrated after minimal activity of proximal muscles in the upper limbs and lower limbs bilaterally ( online suppl . video clips 1 and 2 ; for all online suppl . material , see www.karger.com/doi/10.1159/000351824 ) . full liver screen including a liver ultrasound , viral hepatitis , cytomegalovirus screen and autoimmune screen were also normal . there was no evidence of haemochromatosis or wilson 's disease with normal iron studies , serum copper and caeruloplasmin . a fibroscan of the liver demonstrated median stiffness of 5.9 kpa consistent with minimal or absent fibrosis . previous diagnostic studies including a gastrocnemius muscle biopsy when the patient was 9 years of age showed predominance of type 1 fibres , with isolated fibres exhibiting atrophy . alt and ast catalyse the transfer of the alpha - amino groups of alanine and aspartate , respectively , to the alpha - keto group of ketoglutarate . various studies have analysed the clinical significance of asymptomatic deranged serum aminotransferases [ 2 , 3 ] . in a british study of patients where the diagnosis was not evident with history , physical examination and non - invasive tests including ultrasound scans , the most common diagnoses were found to be non - alcoholic fatty liver disease and alcoholic liver disease . in another prospective study where patients went on to have a liver biopsy , steatosis and steatohepatitis were the most common diagnoses . results have tended to vary depending on the prevalence of liver disease in the population groups studied and the extent to which an underlying cause for these abnormalities was explored . for example , in a study of american blood donors , a diagnosis could not be established in the majority of patients with incidental elevated alt . this was partly attributed to the limited investigations and diagnostic algorithm used in the study . in the setting of elevated serum aminotransferases ( less than five times the normal range ) , the following investigative steps can be derived from the american gastroenterological association recommendations [ 5 , 6 ] : ( 1 ) thorough history and physical examination . assess for alcohol use , viral hepatitis b and c , haemochromatosis and fatty liver disease . ( 3 ) identify non - hepatic causes ( primary muscle disease , hypo- and hyperthyroidism , coeliac disease , adrenal insufficiency and anorexia nervosa ) . ( 4 ) identify rarer liver conditions such as autoimmune hepatitis , wilson 's disease , alpha-1-antitrypsin deficiency and adult bile ductopenia . ( 5 ) proceed to a liver biopsy ( patients with greater than two - fold elevation in aminotransferases ) or observe over a period of time ( patients with less than two - fold elevation in aminotransferases ) before liver biopsy . however , the decision to pursue specific investigations should be based on the pattern of abnormality of liver tests , and be directed by features obtained from history , physical examination and pre - test probability . in this case , elevated serum aminotransferases with a normal serum ggt and alp indicated a hepatocellular pattern of injury as opposed to cholestasis . non - invasive investigations performed on the patient did not reveal a hepatic cause , but a detailed history raised the distinct possibility of a non - hepatic cause . the patient gave a history of long - standing muscle fatigue since childhood and consistently exhibited typical signs of rippling muscle disease , such as the rippling phenomenon . serum aminotransferases were elevated in conjunction with serum ck , which is a known marker of muscle injury . serum aminotransferase levels reflect the rate at which they enter and are cleared from the circulation . they are catabolised by proteolysis in the reticulo - endothelial system and are not excreted in significant amounts in urine and bile . hence , derangement is usually related to damage to tissues rich in the aminotransferases , or to changes in cell membrane permeability that permit leakage into the circulation . although hepatocytes contain the highest concentration of alt and ast , it is well established that they are also present in other tissues such as cardiac and skeletal muscle . because their isoenzymes are not tissue - specific , isoenzyme measurements of alt and ast do not aid in identifying the tissue of origin accurately . in this clinical setting , chronic degeneration and regeneration of muscle fibres that were demonstrated in the patient 's muscle biopsy causing leakage of these enzymes into the circulation explain the chronic low - grade elevation of aminotransferases . a 43-year - old male fitness trainer presented to the hepatology clinic after being referred by his general practitioner with elevated serum aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) levels ( 23 times the upper limit of normal ) over a period of 7 months . bilirubin , gamma - glutamyl transpeptidase ( ggt ) and alkaline phosphatase ( alp ) were within normal range . on further questioning , the patient gave a history of rippling muscle disease diagnosed when he was 9 years old . specifically he had no history of alcohol abuse or dependency , no history of illicit drug use , no known history of hepatitis and he was not on any regular medications . a detailed family history and research into previous investigations performed on the patient and his family revealed that his father and elder brother had been found to have elevated serum creatine kinase ( ck ) concentrations . genetic linkage analysis had pointed to caveolin-3 mutations in all of them . on physical examination , there were no stigmata of chronic liver disease , and gastrointestinal , cardiovascular and respiratory examinations were unremarkable . positive neuromuscular findings consistent with rippling muscle disease included a long - standing history of activity - related fatigue of upper and lower limb muscle groups . characteristic muscle rippling was demonstrated after minimal activity of proximal muscles in the upper limbs and lower limbs bilaterally ( online suppl . video clips 1 and 2 ; for all online suppl . material , see www.karger.com/doi/10.1159/000351824 ) . full blood count examination and serum urea and electrolytes examination were normal . full liver screen including a liver ultrasound , viral hepatitis , cytomegalovirus screen and autoimmune screen were also normal . there was no evidence of haemochromatosis or wilson 's disease with normal iron studies , serum copper and caeruloplasmin . a fibroscan of the liver demonstrated median stiffness of 5.9 kpa consistent with minimal or absent fibrosis . previous diagnostic studies including a gastrocnemius muscle biopsy when the patient was 9 years of age showed predominance of type 1 fibres , with isolated fibres exhibiting atrophy . alt and ast catalyse the transfer of the alpha - amino groups of alanine and aspartate , respectively , to the alpha - keto group of ketoglutarate . various studies have analysed the clinical significance of asymptomatic deranged serum aminotransferases [ 2 , 3 ] . in a british study of patients where the diagnosis was not evident with history , physical examination and non - invasive tests including ultrasound scans , the most common diagnoses were found to be non - alcoholic fatty liver disease and alcoholic liver disease . in another prospective study where patients went on to have a liver biopsy , steatosis and steatohepatitis were the most common diagnoses . results have tended to vary depending on the prevalence of liver disease in the population groups studied and the extent to which an underlying cause for these abnormalities was explored . for example , in a study of american blood donors , a diagnosis could not be established in the majority of patients with incidental elevated alt . this was partly attributed to the limited investigations and diagnostic algorithm used in the study . in the setting of elevated serum aminotransferases ( less than five times the normal range ) , the following investigative steps can be derived from the american gastroenterological association recommendations [ 5 , 6 ] : ( 1 ) thorough history and physical examination . assess for alcohol use , viral hepatitis b and c , haemochromatosis and fatty liver disease . ( 3 ) identify non - hepatic causes ( primary muscle disease , hypo- and hyperthyroidism , coeliac disease , adrenal insufficiency and anorexia nervosa ) . ( 4 ) identify rarer liver conditions such as autoimmune hepatitis , wilson 's disease , alpha-1-antitrypsin deficiency and adult bile ductopenia . ( 5 ) proceed to a liver biopsy ( patients with greater than two - fold elevation in aminotransferases ) or observe over a period of time ( patients with less than two - fold elevation in aminotransferases ) before liver biopsy . however , the decision to pursue specific investigations should be based on the pattern of abnormality of liver tests , and be directed by features obtained from history , physical examination and pre - test probability . in this case , elevated serum aminotransferases with a normal serum ggt and alp indicated a hepatocellular pattern of injury as opposed to cholestasis . non - invasive investigations performed on the patient did not reveal a hepatic cause , but a detailed history raised the distinct possibility of a non - hepatic cause . the patient gave a history of long - standing muscle fatigue since childhood and consistently exhibited typical signs of rippling muscle disease , such as the rippling phenomenon . serum aminotransferases were elevated in conjunction with serum ck , which is a known marker of muscle injury . serum aminotransferase levels reflect the rate at which they enter and are cleared from the circulation . they are catabolised by proteolysis in the reticulo - endothelial system and are not excreted in significant amounts in urine and bile . hence , derangement is usually related to damage to tissues rich in the aminotransferases , or to changes in cell membrane permeability that permit leakage into the circulation . although hepatocytes contain the highest concentration of alt and ast , it is well established that they are also present in other tissues such as cardiac and skeletal muscle . because their isoenzymes are not tissue - specific , isoenzyme measurements of alt and ast do not aid in identifying the tissue of origin accurately . in this clinical setting , chronic degeneration and regeneration of muscle fibres that were demonstrated in the patient 's muscle biopsy causing leakage of these enzymes into the circulation explain the chronic low - grade elevation of aminotransferases . caveolin-3 is a protein that forms flask - shaped invaginations called caveolae on the cytoplasmic surface of the sarcolemma . it is composed of 151 amino acids and is synthesised in the endoplasmic reticulum of muscle cells . mutations in this gene result in underexpression of the caveolin-3 protein [ 8 , 9 ] . four known skeletal muscle phenotypes have been attributed to the various caveolin-3 mutations identified to date . they are : ( 1 ) limb - girdle muscular dystrophy type 1c characterised by weakness and wasting restricted to the proximal limb - girdle musculature . ( 2 ) isolated hyperckaemia no clinical manifestations . ( 3 ) rippling muscle disease characterised by signs such as percussion - induced rapid contractions and stretch - induced muscle mounding or rippling . other clinical features may include muscle fatigue , muscle stiffness , tip - toe walking and myalgia . muscle biopsies may show characteristic features such as muscle fibre degeneration and regeneration , a predominance of type 1 fibres and fibre size variability . patients may exhibit significant overlap between these phenotypes , and some suggest that they be seen as a clinical continuum [ 8 , 11 ] . in our patient , the characteristic rippling phenomenon demonstrated clinically , genetic linkage analyses and suggestive findings in the muscle biopsy pointed to the diagnosis of rippling muscle disease . immunohistochemistry was not performed as he had been lost to follow - up in later years . however , it was noted that the patient 's father and brother had elevated ck levels , but were relatively asymptomatic . this illustrates the phenotypic variability amongst individuals with the same mutation , suggesting incomplete penetrance . to date , there are no case reports on deranged liver tests as a result of caveolin-3 deficiency - related muscle disease , though there are reports of elevated aminotransferases in other more common muscle diseases . , in a case series analysis study done in singapore , showed that aminotransferases were elevated in all patients in their cohort with biopsy - proven duchenne or becker 's muscular dystrophy and that their levels were inversely proportional to their extent of mobility and age . this case adds to the existing medical literature in highlighting a different muscle pathophysiology driving similar laboratory results . along with muscle degeneration , changes in the sarcolemmal architecture secondary to caveolin-3 underexpression could also contribute to the chronic leakage of aminotransferases into the circulation . caveolin-3 deficiency has been implicated in one case series of familial hypertrophic cardiomyopathy and some instances of arrhythmogenic long qt syndrome . the current consensus on caveolin-3-deficient muscle diseases is that patients need symptomatic care with the aim to preserve muscle function . regular monitoring of respiratory and cardiac function is also recommended on a case by case basis . it was explained to the patient that the cause of his deranged liver tests was in fact chronic muscle disease . given that it seemed to demonstrate an autosomal dominant pattern of inheritance , he was referred to a clinical genetics specialist for genetic counselling and it was suggested that his offspring be tested for caveolin-3 deficiency . the outcome of the consultation and our recommendations were communicated to the patient 's general practitioner . | a 43-year - old man was referred by his general practitioner to the hepatology clinic with deranged serum aminotransferases , discovered as part of routine blood tests .
the objective was to identify the cause of elevated serum aminotransferases in this patient in a systematic manner .
thorough history and physical examination revealed a background history of rippling muscle disease secondary to caveolin-3 protein deficiency , with typical clinical signs .
there was a positive family history of musculoskeletal disease in the patient 's father and brother .
previous diagnostic tests performed to investigate the patient 's musculoskeletal symptoms , including muscle biopsies , were revisited .
subsequent systematic investigations such as blood tests , liver ultrasound scan and fibroscan were performed to exclude potential causes of the deranged serum aminotransferases .
liver biopsy was not performed . a consistent pattern of chronic low - grade elevations of serum aminotransferases , less than three times the upper limit of the normal range ,
was found .
this was associated with a consistently elevated serum creatine kinase and normal renal function tests .
previous muscle biopsies had revealed chronic degenerative and regenerative changes suggestive of a focal necrotizing myopathy .
liver ultrasound scan and fibroscan were normal . with exclusion of other liver diseases and identification of profoundly elevated serum creatine kinase concentration ,
the deranged aminotransferases were attributed to rippling muscle disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
structural
modifications of biomolecules and polymers , as well
as derivatization of particles and surfaces , are commonly achieved
using click chemistry. this term describes a set of bimolecular reactions that permits
the efficient formation of a covalent link between two substrates
( a.k.a . the majority of click strategies are based on 1,3-dipolar
or diels alder cycloadditions , imine formation , and addition
to carbon carbon multiple bonds . since azide and alkyne moieties are very uncommon in natural products , i.e. , bioorthogonal ,
the copper - catalyzed ( cuaac ) or strain - promoted azide alkyne
cycloadditions ( spaac ) have found many applications in labeling biomolecules , protein modification , synthesis of bioconjugates , and developing
biotech tools . chemoselective sequential click ligation brings
the ability to
introduce multiple functionalities to biological molecules , drug delivery vehicles , polymer , or surfaces . cross - linking of biological molecules using sequential
click chemistry allows for the preparation of complex macromolecules . one method relies on two ( or more ) mutually
orthogonal click reactions , e.g. , cuaac and diels alder , spaac and spanc , spaac and hetero - diels alder , as well as other combinations . these strategies
provide excellent selectivity but require derivatization of substrates
with different functionalities . to avoid this complication , sequential
click ligation may employ reactions of the same type , most commonly
azide alkyne cycloaddition . this approach relies on the differences
in the reactivity of alkyne moieties or on the deprotection
of terminal acetylenes . the use of cytotoxic copper(i ) catalyst and/or deprotecting reagents ,
however , somewhat reduces the utility of this method . in addition ,
terminal acetylene were found to inhibit cysteine proteases by forming
thioether with the catalytically active thiol . here , we report the development of the spaac - based
selective sequential
click strategy , which permits cross - linking of two different azide - tagged
substrates without the use of catalysts or activating reagents ( scheme 1 ) . dibenzocyclooctynes are apparently too large
to fit into the active site cavity of a protease . selection of the
reactive moieties for the construction of the sequential spaac cross - linking
agent was based on the orthogonality requirement . the first click
reaction should occur only at one end of the linker , while the second
ligation should not degrade connection to the first substrate . we
have chosen azadibenzocyclooctyne ( adibo , scheme 1 ) as the first spaac moiety ,
as this cyclooctyne combines high reactivity toward azides with excellent
aqueous stability and long shelf life . photodibo ( scheme 1 ) , on the other hand ,
does not react with azides in the dark and possesses excellent thermal
stability . exposure of photodibo moiety
to a low intensity 350 nm light results in the efficient decarbonylation
and the formation of azide - reactive dibenzocyclooctyne ( dibo ) . adibo , dibo , and corresponding triazole adducts have virtually no
absorbance at 350 nm , and , therefore , are stable under photodecarbonylation
conditions . ( a ) r , r = n - bu ; ( b ) r , r = bn ; ( c )
r = bsa , r = fluorescein ; ( d ) r = sio2-beads , r = bsa . the heterobifunctional adibo - photodibo cross - linker
( 1 ) was prepared by the dcc / dmap - assisted coupling of
adibo - acid ( 5 ) with of pehtamethylenehydroxy - derivatized
photodibo ( 6 , scheme 2 ) . the efficiency and selectivity
of cross - linker 1 were
evaluated using its reaction with benzyl azide . the accurate rate
measurements of the first and second click reaction were conducted
by uv spectroscopy at 25 0.1 c in methanol under pseudo - first - order
conditions . the uv spectrum of adibo - photodibo ( 1 ) contains
characteristic features of both adibo ( a band at 292 nm ) and photodibo
( intense bands at 331 and 347 nm ) chromophores ( figure 1a , black trace ) . all stages of the conversion of 1 can be , therefore , conveniently monitored by uv spectroscopy . the
addition of the excess of benzyl azide ( 0.120 mm ) to the methanol
solution of 1 leads to the rapid disappearance of the
band at 292 nm , while photodibo bands remain unchanged ( figure 1a , red trace ) . the decay adibo band followed the
single exponential equation well ( figure 1b ) .
the dependence of the observed pseudo - first - order rate constants on
azide concentration was linear and produced second - order rate constant k= 0.406 0.001 m s. this value is consistent with literature data for adibo . after the completion of the first click reaction , the cyclopropenone
protection of the triple bond in 2 was removed by 2 min
irradiation of the reaction mixture with 350 nm fluorescent lamps
( scheme 1 ) . the conversion of photo - dibo was
followed by the disappearance of the characteristic cyclopropenone
bands at 331 and 347 nm and the formation of the dibo band at 319
nm ( figure 1a ) . the disappearance of the latter
band due to the addition of the second molecule of benzyl azide to 3 also showed clean first - order kinetics ( figure 1b ) . the second - order rate of this reaction ( k = 0.072 0.004 m s ) is similar to the values reported for dibo . ( a )
uv spectra of 50 m methanol solutions of adibo - photodibo
( 1 , black line ) ; product of the first click reaction 2b ( red line ) ; product of photoactivation 3b ( blue
line ) ; product of the second click reaction 4b ( purple
line ) . ( b ) kinetics traces of the first ( black circles ) and the second
( blue hexagons ) click reactions in the presence of 10 mm of benzyl
azide . photoactivation
second click sequence indicates clean and
quantitative conversion at every step ( figure 2 ) . thus , 50 m methanol solution of 1 ( figure 2a ) was treated with an equimolar amount of butyl
acid and incubated for 48 h under ambient conditions to ensure complete
conversion . the hplc trace ( figure 2b ) and
esi - hrms of the resulting product ( mh , calc . for c50h54n5o7 836.4018 , found
836.4016 ) confirmed the quantitative formation of 2a
( note : apparently , head - to - tail and head - to - head isomers have very
similar retention times on c-18 column ) . found 808.4067 )
with no detectable amounts of side products ( figure 2c ) . the addition of the second equivalent of butyl azide cleanly
gives the final adduct 4a after 48 h incubation ( figure 2d ; mh , calc . for c53h63n8o6 907.4865 , found 907.4867 ) . hplc traces of the sequential click ligation
( scheme 1 ) : ( a ) starting linker 1 ; ( b ) reaction mixture
after the reaction of 1 with equimolar amount of butyl
azide ; ( c ) product of photodecarbonylation step ( 3a ) ;
( d ) product ( 4a ) of the second click reaction with equimolar
amount of azide . as an illustrative example ,
we have employed adibo - photodibo cross - linker
( 1 ) for the selective conjugation of azido - derivatized
bsa ( 7 ) with ( 3-azidopropylcarbamoyl)fluorescein ( azido - fl ,
8 , mixture of 5- and 6-isomers , scheme 3 ) .
after each click reaction the functionalized protein was isolated
and characterized by maldi . the azido - derivatized bsa ( 7 ) was prepared by treating the native bsa with 1-azido-3-iodopropane . protein 7 was incubated with an excess of the cross - linker 1 in aqueous solution overnight and resulting bsa derivative 2c ( scheme 3 ) was isolated by gel filtration . an aqueous solution of 2c was irradiated for 2 min using
350 nm fluorescent lamps and treated with 50-fold excess of azidofl 8 overnight and purified by gel filtration ( scheme 3 ) . the resulting fluorescein - derivatized bsa ( 4c ) clearly shows characteristic absorbance and emission of
the fluorescein chromophore ( figure 3 ) . the protein content of the
solution of 4c was determined
using coomassie brilliant blue dye assay , while the emission intensity
of 4c and the absorbance in the fluorescein region were
compared to the fluorescence and absorbance of an aqueous solution
of an authentic fluorescein sample of the same concentration ( figure 3 ) . these experiments confirm high cross - linking
efficiency ( 8492% ) of the adibo - photodibo ( 1 ) . the high yield of azido - bsa ( 7 ) labeling was somewhat
surprising result since it is commonly accepted that commercial bsa
samples contain 0.60.8 equiv of free thiols . the rest of cys34
moieties are believed to form a disulfide with cysteine or glutathione . we believe
that free thiol content of the bsa is actually higher than reported
previously , since ellman s test , which uniformly used in these
measurements , often underestimates sh contents in proteins , especially in proteins containing acidic cys
residues . absorption ( dash dotted line ) and emission
spectra ( solid
line ) of 11 m pbs solution of bsa fluorescein conjugate
( 10 ) and emission spectrum of a 11 m pbs solution
of fluorescein ( dotted line ) . to test the suitability of adibo - photodibo ( 1 ) for
protein immobilization , we have employed this cross - linking agent
for the attachment of azido - bsa ( 7 ) to azide - functionalized
silica microbeads . first , a photo - diels alder click reaction between 8-(2-(2-(2-aminoethoxy)ethoxy)ethoxy)-3-(hydroxymethyl)naphthalen-2-ol
( 9 , nh2-teg - nqmp ) and ( 2-(2-azidoethoxy)ethoxy)ethylene produced heterobifunctional
linker 10 ( scheme 4 ) . it is important
to note that 2-alkoxybenzochroman 10 is stable under
neutral conditions , but becomes hydrolytically labile at ph < 3 . linker 10 was then edc - coupled
to commercial carboxylate - functionalized silica microbeads to yield
target azide - derivatized microbeads bearing acid - labile linker ( 11 , scheme 4 ) . silica beads bearing
azido functionality ( 11 ) were
first derivatized with linker 1 ( click 1 ) by overnight
incubation with adibo - photodibo ( 1 ) in dmf ( scheme 5 ) . the resulting microbeads were added to 10 m
pbs solution of azido - bsa ( 7 ) and irradiated with 350
nm light for 2 min ( scheme 5 ) . the reaction
mixture was incubated under ambient conditions for 16 h and the beads
were separated and washed . the bradford assay of the combined supernatants
from the reaction mixture after click reaction 2 showed
that there was virtually no protein present in the solution . this
observation illustrates the high efficiency of azido - bsa ( 7 ) immobilization using linker 1 . as bsa was immobilized to silica beads via an
acid - sensitive 2-alkoxybenzochroman
fragment , the protein can be cleaved
from the solid support at low ph ( scheme 6 ) .
to validate the release of the protein , silica microbeads bearing
immobilized bsa were incubated in 0.1 m perchloric acid overnight . the protein released from the beads was isolated from the supernatant
via spin filtration and reconstituted to the original volume in pbs . total protein concentration in the resulting solution was determined
to be 9.12 m by bradford assay , which corresponds to the ca . the bsa protein is stable in an aqueous 0.1 m perchloric
acid solution , at least for the time frame ( 16 h ) used for the release
of protein from silica microbeads . the
heterobifunctional adibo - photodibo linker ( 1 )
allows for the efficient ligation of azide - tagged substrates , or for
the immobilization of azide - functionalized molecules on an azide - coated
surfaces . since the covalent conjugation is achieved via strained - promoted
azide alkyne cycloaddition ( spaac ) and photochemical activation ,
this method does not require any catalysts or other reagents . this
sequential click strategy is applicable to both homogeneous and heterogeneous
cross - linking . the use of phototrigger in the sequential click system
enables the spatiotemporal control to the cross - linking chemistry . additionally , the incorporation of a hydrolytically labile fragment
in protein surface linker , allows for the release of a protein
under the action of dilute acid . | heterobifunctional
linker allows for selective catalyst - free ligation
of two different azide - tagged substrates via strained - promoted azide alkyne
cycloaddition ( spaac ) .
the linker contains an azadibenzocyclooctyne
( adibo ) moiety on one end and a cyclopropenone - masked dibenzocyclooctyne
( photo - dibo ) group on the other .
the first azide - derivatized substrate
reacts only at the adibo end of the linker as the photo - dibo moiety
is azide - inert . after the completion of the first spaac step , photo - dibo
is activated by brief exposure to 350 nm light from a fluorescent
uv lamp .
the unmasked dibo group then reacts with the second azide - tagged
substrate .
both click reactions are fast ( k = 0.4
and 0.07 m1 s1 , respectively )
and produce quantitative yield of ligation in organic solvents or
aqueous solutions .
the utility of the new cross - linker has been demonstrated
by conjugation of azide functionalized bovine serum albumin ( azido - bsa )
with azido - fluorescein and by the immobilization of the latter protein
on azide - derivatized silica beads .
the bsa
bead linker was
designed to incorporate hydrolytically labile fragment , which permits
release of protein under the action of dilute acid .
uv activation
of the second click reaction permits spatiotemporal control of the
ligation process . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
when the objective of the study is investigation of count data using some variables , statistical modeling is used . in statistics , poisson distribution is used for investigating the count data if the mean and variance of the distribution are the same . if these two measures are not the same ( variance is larger than the mean = over dispersion ) , then negative binomial distribution is preferred . statistical modeling is from suitable methods to investigate the relationship between various phenomena , especially in medicine and health . poisson regression is of the models which is used in count variables such as the number of blood donations , the number of stopping addiction , the number of failed courses or semester etc . and the poisson regression is a subset of a large set of statistical modeling which is called generalized linear model ( glm ) . sometimes the count variables which are used to build a statistical modeling , have an inflation in zero which are divided into poisson zero inflated or negative binomial zero inflated distributions according to the nature of the variables .
there are various researches that used statistical modeling on count data which applied negative binomial or poisson regressions ; zero inflated poisson or negative binomial regressions . rafiee ( 1 ) used negative binomial distribution for modeling of the period of hospitalization of mothers after child birth as the best model . wong and lam ( 2 ) applied poisson regression with zero inflated for modeling of dmf for the students health situation . barondess et al ( 3 ) used poisson regression with zero inflated to model the estimated number of cigarettes which is used by new smokers of different races in the usa in 2010 . mohammadfam et al ( 4 ) applied a model for the number of work accidents in 2009 and showed the best model is a poisson regression with zero inflation . one of the applications of this method is in the modeling of educational count data such as the number of failed courses or the number of failed semesters in university students . this application which is considered as a part of the students academic performance has a great efficient . the academic performance has relationship with some educational and demographic factors of the students as well . mlambo ( 5 ) showed that gender , age and entry qualifications have a relationship with the academic performance . foster ( 6 ) proved that gender , age , motivation , prior academic performance are variables which have relationship with the academic performance . kooi ( 7 ) showed that age and academic background have strong relationship with the academic performance . garkaz et al ( 8) showed that the type of diploma , students interest , employment status and gender are factors which have relationship with the academic performance . trockel et al ( 9 ) showed that exercise , eating and sleep habit , time management , religious habit , period of work in a week , gender and age are from the variables which affect the academic performance of the students . since there are many demographic , educational , andeconomicalfactors which affect the academic performance of the students , in each research only some of them are presented . also , in most recent research , descriptive statistics or ordinary or logistic regressions are used to analyze or model the educational data and there is very few work on academic performance of the university students using poisson of negative binomial regression with zero inflation . unfortunately , there is nothing in the literature about the application of zero inflated poisson or negative binomial for modeling of the failed courses and semesters in university students . this studyintend to apply statistical modeling , especially poisson and negative binomial regressions with zero inflated to model the number of failed courses and semesters in the students of iran university of medical sciences . in these models some educational and demographic factors which affect the academic performance of the students were used as the predictor variables . this cross - sectional study was performed in 2009 and 2010 in iran university of medical sciences . the target population was all current students of the university in 2009 which were almost 6000 in different educational levels . the sample of 670 students was selected using stratified random sampling . to choose the sample from the target population , simple random sampling in each stratum the demographic and educational data was collected from the university education file and the information regarding to attendance of the student in university accommodation was collected from the deputy head of the university in students affairs . the data consist of the first and surnames of the students , the student i d , discipline , faculty ( one for each faculty and zero for others ) , the educational level ( one for each level and zero for others ) , gender ( one for males and zero for females ) , the year of entrance , marital status according to year of entrance ( single=1 and married=0 ) , using university accommodation , being native , quota system ( no quota=1 , others=0 ) , university average , the number of failed courses and semesters . the students score are from zero to 20 in all iranian university systems and if a student receives a score of less than 10 in undergraduate or less than 14 in postgraduate courses , he fails the course . also , the mean of less than 12 in undergraduate and less than 14 in postgraduate semesters are considered as the failed semester . the students can not pursue their study if they have more than four failed semesters . the students demographic and educational data were combined to the file of the number of failed courses and semesters to produce the final data set .
for data analysis and modeling , the descriptive statistics and zero inflated poisson regression and zero inflated negative binomial regression were used to analyze the final data set . the number of students with no failed courses were 478 ( 71.3% ) and 192 ( 28.7% ) students had one or more failed courses . the students with one , two , three , four or more failed courses were 92 ( 13.7% ) , 37 ( 5.5% ) , 22 ( 3.3% ) and 41 ( 6.2% ) , respectively . the number of students with one or more failed semester were 24 ( 3.6% ) and 31 ( 4.6% ) , respectively . the results of zero inflated ( zi ) poisson regression fit are shown in table 1 .
in poisson regression for the number of failed courses ( table 1 ) , one unit increase in total university average resulted in 0.64 decreases in logarithm of the number of failed courses . also , one unit increase in the number of failed semesters caused 2.73 decreases in the logarithm of the odd of inflated zero . furthermore , the change of educational level from other levels to bachelor or master levels resulted in 0.27 and 0.96 decrease of the expected logarithm of the numbers of failed courses . finally , the change of gender from male to female caused 0.24 decrease of expected logarithm of the numbers of failed courses , and the change of marital status from married to single increased 0.05 of the expected logarithm of the numbers of failed courses .
in the regression of failed semesters , the university average had negative relationship with the numbers of failed semesters and a unit increase in university average resulted in 0.24 decrease in expected logarithm of the numbers of failed semesters . also , with the change of quota system from other quota system to free quota system , the expected logarithm of the numbers of failed semester decreased by 0.47 . furthermore , a unit increase in the number of failed courses caused the logarithm odd of inflated zero to decrease by 1.56 . * - using robust method
as one can see , in regression of the number of failed courses , a unit increase in university average resulted in 0.83 decreases in logarithm of the number of failed courses . also , with a unit increase in the number of failed semesters , the logarithm of odd of the zero inflated decreased by 35.88 . the change of faculties from other to faculty of management and rehabilitation caused 1.24 and 1.07 increase in expected logarithm of the number of failed courses , respectively . the change of educational level from other levels to bachelor , certificate and master levels , the expected logarithm of the number of failed courses decreased by 0.81 , 0.8847 and1.45 , respectively .
in regression of failed semesters , the university average has negative relationship with the number of failed semesters and with a unit increase in university average , the expected logarithm of the number of failed semesters decreased by 0.42 . also , with the change of quota system from other system to free quota system , the expected logarithm of the numbers of failed semesters decreased by 0.47 . furthermore , with a unit increase of the numbers of failed courses , the logarithm odd of inflated zero decreased by 1.56 . all of these results are the same as table 1 on the regression with the response variables of the number of failed semesters . the research results showed that in poisson and negative binomial regressions with zero inflated using the number of failed semesters as the response variable , the variables of the university average and quota system have inverse relationship with the response variable , so the increase of the university average and the change from other quota system to free quota system caused a decrease in failed semesters . in a research ( 10 ) it was shown that in the students with free quota system , the number of failed semesters is less than other students which is the same as this study . also , we have to consider the fact that failing is less in clever students and in these students the failure is a rare outcome . furthermore , the students with free system are almost clever and have very less failure . therefore , quota system is from the factors which decrease the failed semesters . on the other hand , a unit increase in the number of failed courses in both models , decrease the logarithm odd of inflated zero . thus , the increase in the number of failed courses resulted in the number of failed semesters . this is in the same direction due to the high correlations ( 0.81 ) of the failed courses and semesters . therefore , with increase of the number of failed courses , the chance of having failed semesters increase . in both regression models with the response variable of the number of failed courses , the university average and the bachelor and master educational levels have negative relationship . in both models , the increase of university average resulteda decrease of the number of failed courses , and the decrease in negative binomial regression is more than poisson regression . in a research it was shown that there is a negative relationship between the university average and the number of failed courses which is the same as this research ( 10 ) . also , the change from other educational levels to bachelor and master levels caused a decrease of the number of failed courses in these levels . the decrease in the number of failed courses in bachelor and master levels is logical due to the little failure courses in these levels .
in poisson regression with the failed courses as the response variable , the variables of genderandmarital status have inverse and positive relationship to the number of failed courses , respectively , and the failed courses are more in males than females and in singles than married . in different research ( 5,6,8,10,11 ) , it was shown that gender and marital status have effect to the failed courses or semesters . research it is shown that the singles are more successful in their educations than married and have less failed courses which is opposite of this study ( 12 ) .
in the negative binomial regression , with the number of failed courses , the variables of bachelor level and the faculties of management and rehabilitation caused the increase in the number of failed courses . since the number of failed courses in bachelor level is more than master level , so the result makes sense . also , rehabilitation faculty has the most failure in the university which is the same as the model result . finally , in seems that the entrance of the management faculty to the model , with many failures , is for adjustment of the effects of other variables in the model . on the other hand , a unit increase in the failed semester , in both models , increases the logarithm odd of inflated zero and this reduction in negative binomial model is 13 times of the poisson model , and this result was expected due to the high correlation between the failed courses and semesters . it is concluded from all results that in the failed courses regression model , the university average and quota system have the most roles and the increase in university average resulted in the reduction of failed semesters . also , the change from other quota system to free quota system resulted in the decrease of failed semesters . furthermore , in these models , the increase in the number of failed courses cause a decrease in the logarithm odd of zero inflated . therefore , with the increase of the university average and choosing free quota system it is possible to reduce the failed semesters .
in the regressions of the number of failed courses , the university average has an important role and its increase causes the decrease of the number of failed courses . other affected variables to the number of failed courses are different in both models . on the other hand , the increases in the number of failed semesters , decrease the logarithm of zero inflated in both models and the amounts of these changes are different . therefore , the increase in university average and choosing more bachelor and master students can reduce the failed courses . this work was supported by iran university of medical sciences under the grant number of 370 . | background : the number of failed courses and semesters in students are indicators of their performance .
these amounts have zero inflated ( zi ) distributions . using zi poisson and negative binomial
distributions we can model these count data to find the associated factors and estimate the parameters .
this study aims at to investigate the important factors related to the educational performance
of students .
methods : this cross - sectional study performed in 2008 - 2009 at iran university of medical sciences
( iums ) with a population of almost 6000 students , 670 students selected using stratified random
sampling .
the educational and demographical data were collected using the university records .
the
study design was approved at iums and the students data kept confidential .
the descriptive statistics
and zi poisson and negative binomial regressions were used to analyze the data .
the data were
analyzed using stata .
results : in the number of failed semesters , poisson and negative binomial distributions with zi ,
students total average and quota system had the most roles . for the number of failed courses , total
average , and being in undergraduate or master levels had the most effect in both models .
conclusion : in all models the total average have the most effect on the number of failed courses or
semesters .
the next important factor is quota system in failed semester and undergraduate and master
levels in failed courses .
therefore , average has an important inverse effect on the numbers of
failed courses and semester . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
vulvovaginal candidiasis is defined as vulvovaginitis associated with vaginal carriage of candida spp . and is a common problem with a high rate of morbidity . this infection is characterized by vulvar pruritus and increased vaginal discharge . at present , clinical treatment for vulvovaginal candidiasis vaginal infection in pregnant women increases the incidence of fungal dermatitis and thrush in newborns , following vaginal delivery . some fungal pathogens can move up the reproductive tract and penetrate the fetal membrane , leading to infection , which can result in abortion and/or premature delivery . the diagnosis and treatment of vulvovaginal candidiasis are subject to certain restrictions owing to the long period of time required for fungal culture and identification . in recent years , as a result of increasing sexual activity , the wide use of broad - spectrum antibiotics , anticancer drugs , immunosuppressants , corticosteroids , and oral contraceptives and an increase in the diabetes rate , the incidence of vaginitis associated with candida spp . has increased significantly . an increase in the antifungal drug resistance in candida spp . has also been observed , making treatment of this infection more difficult ( 2 , 3 ) . some studies have identified alternative antifungal drugs that have been reported to be effective in the treatment of candida infections . for example , sadeghi nejad et al . ( 4 ) showed that the extracts from fruits of heracleum persicum had potential anti - candida activity . the emergence of antifungal resistance has resulted in an urgent need for laboratory support in the treatment of fungal infections , which includes the rapid identification of fungal pathogens and selection of appropriate methods for the in vitro susceptibility testing of clinical isolates . infections in the genital tracts of female patients in chongqing and to evaluate the resistance to commonly used antifungals by retrospectively analyzing the composition and drug susceptibility of candida spp . isolated from the vaginal and cervical secretion specimens in both gynecological outpatients and inpatients between january 2010 and december 2011 . from the outpatients and inpatients at the second affiliate hospital , chongqing university of medical sciences , 2,129 women who presented with increased vaginal discharge or pus , vulvar itching , abdominal pain , and other symptoms of infection of the reproductive tract were selected . patients from the chongqing region were selected over a 2-year period from january 2010 to december 2011 . ethical approval was obtained from the second affiliate hospital of the chongqing university of medical sciences . the subjects were between 18 and 79 years of age ( average age , 35.8 years ) , and of these subjects , 116 were < 20 years old , 1,815 were between 20 and 49 years old , and 198 were 50 years old . patients who had undergone a general physical or gynecological examination for any reason and had used medication within 1 week before specimen collection were excluded from the study . all specimens were collected by qualified gynecologists who obtained vaginal swabs from the dome and sidewalls of the vagina . vaginal secretions were collected in sterile test tubes containing l ml of 0.9% saline for the culture of fungi . vaginal secretions were cultured on sabouraud dextrose agar ( oxoid , uk ) at both 25c and 37c for 2 or 3 days , respectively . putative positive colonies were white or cream in color with glossy and smooth surfaces . if no colonies were evident within 2 weeks , the sample was considered negative . yeast - like colonies were gram - stained to exclude any bacterial colonies that had been mistakenly identified as yeast . colonies were then inoculated on chromagar medium ( france ) at 35c for 24 - 48 hours . green or emerald green colonies were identified as c. albicans , blue - gray colonies were identified as c. tropicalis , and purple - embossed colonies with smooth and glossy surfaces were identified as c. glabrata . pink - to - purple large flat colonies with rough edges were identified as c. krusei , while colonies of the other phenotypes were identified as other candida spp . these atypical isolates were further identified using the vitek 2 compact automatic microbial identification system ( biomerieux , france ) . drug susceptibility testing was performed using the atb fungus drug susceptibility testing system ( biomerieux company , france ) . the following drugs and concentrations were tested : 5-flucytosine ( 0.125 - 64 g / ml ) ; amphotericin b , voriconazole , itraconazole ( each between 0.03 and 16 g / ml ) ; and fluconazole ( 0.125 - 64 g / ml ) . the minimum inhibitory concentrations of all drugs were obtained according to the clsi m27-a3 guidelines ( 6 , 7 ) . in each test , the reference strain c. albicans atcc 14053 was used for quality control . according to the manufacturer instructions , a suspension of c. albicans with a turbidity of 2 mcfarland was prepared , and 20 l of this suspension was transferred to an ampule of atb fungus 3 medium . then after incubation at 35c for 24 hours , the strips were read using the atb expression bacteriology analyzer automatic system ( biomerieux , france ) . statistical analyses were performed using the spss software , version 17.0 ( spss ; chicago , il , usa ) . from the outpatients and inpatients at the second affiliate hospital , chongqing university of medical sciences , 2,129 women who presented with increased vaginal discharge or pus , vulvar itching , abdominal pain , and other symptoms of infection of the reproductive tract were selected . patients from the chongqing region were selected over a 2-year period from january 2010 to december 2011 . ethical approval was obtained from the second affiliate hospital of the chongqing university of medical sciences . the subjects were between 18 and 79 years of age ( average age , 35.8 years ) , and of these subjects , 116 were < 20 years old , 1,815 were between 20 and 49 years old , and 198 were 50 years old . patients who had undergone a general physical or gynecological examination for any reason and had used medication within 1 week before specimen collection were excluded from the study . all specimens were collected by qualified gynecologists who obtained vaginal swabs from the dome and sidewalls of the vagina . vaginal secretions were collected in sterile test tubes containing l ml of 0.9% saline for the culture of fungi . vaginal secretions were cultured on sabouraud dextrose agar ( oxoid , uk ) at both 25c and 37c for 2 or 3 days , respectively . putative positive colonies were white or cream in color with glossy and smooth surfaces . if no colonies were evident within 2 weeks , the sample was considered negative . yeast - like colonies were gram - stained to exclude any bacterial colonies that had been mistakenly identified as yeast . colonies were then inoculated on chromagar medium ( france ) at 35c for 24 - 48 hours . green or emerald green colonies were identified as c. albicans , blue - gray colonies were identified as c. tropicalis , and purple - embossed colonies with smooth and glossy surfaces were identified as c. glabrata . pink - to - purple large flat colonies with rough edges were identified as c. krusei , while colonies of the other phenotypes were identified as other candida spp . these atypical isolates were further identified using the vitek 2 compact automatic microbial identification system ( biomerieux , france ) . drug susceptibility testing was performed using the atb fungus drug susceptibility testing system ( biomerieux company , france ) . the following drugs and concentrations were tested : 5-flucytosine ( 0.125 - 64 g / ml ) ; amphotericin b , voriconazole , itraconazole ( each between 0.03 and 16 g / ml ) ; and fluconazole ( 0.125 - 64 g / ml ) . the minimum inhibitory concentrations of all drugs were obtained according to the clsi m27-a3 guidelines ( 6 , 7 ) . in each test , the reference strain c. albicans atcc 14053 was used for quality control . according to the manufacturer instructions , a suspension of c. albicans with a turbidity of 2 mcfarland was prepared , and 20 l of this suspension was transferred to an ampule of atb fungus 3 medium . after incubation at 35c for 24 hours , the strips were read using the atb expression bacteriology analyzer automatic system ( biomerieux , france ) . statistical analyses were performed using the spss software , version 17.0 ( spss ; chicago , il , usa ) . from 2,129 samples of female genital tract secretions collected over a 2-year period , 478 isolates ( positivity rate of 22.45% ) representing 8 candida spp . were detected . of the isolates , 82.64% were c. albicans , 8.16% were c. tropicalis , 4.39% were c. glabrata , 1.88% were c. parapsilosis , 1.26% were c. krusei , 1.05% were c. guilliermondii , 0.42% were c. lusitaniae , and 0.21% were c. dubliniensis ( table 1 ) . standards and the age demographics in china , patients were divided into three groups : ( 1 ) subjects < 20 years of age , ( 2 ) subjects between 20 and 49 years of age , and ( 3 ) subjects > 50 of age . the results showed that the detection rates of candida - related vaginal disease in age groups 1 and 2 were significantly higher than those in age group 3 ( p < 0.05 ) . differences between age groups 1 and 2 were not statistically significant ( p > 0.05 ) , as shown in table 2 . resistance of the 3 most commonly isolated candida spp . to the 5 antifungals tested was low ( table 3 ) . the resistance rate to amphotericin b was the lowest ( 0 - 0.5% ) with sensitivity rates between 97.4% and 100% . the resistance rates to voriconazole were between 0% and 5.2% and the sensitivity rates were between 89.7% and 100% , while the resistance rates to itraconazole were between 0% and 7.7% and the sensitivity rates were between 82.1% and 90.4% . from 2,129 samples of female genital tract secretions collected over a 2-year period , 478 isolates ( positivity rate of 22.45% ) representing 8 candida spp . were detected . of the isolates , 82.64% were c. albicans , 8.16% were c. tropicalis , 4.39% were c. glabrata , 1.88% were c. parapsilosis , 1.26% were c. krusei , 1.05% were c. guilliermondii , 0.42% were c. lusitaniae , and 0.21% were c. dubliniensis ( table 1 ) . according to the world health organization ( who ) standards and the age demographics in china , patients were divided into three groups : ( 1 ) subjects < 20 years of age , ( 2 ) subjects between 20 and 49 years of age , and ( 3 ) subjects > 50 of age . the results showed that the detection rates of candida - related vaginal disease in age groups 1 and 2 were significantly higher than those in age group 3 ( p < 0.05 ) . differences between age groups 1 and 2 were not statistically significant ( p > 0.05 ) , as shown in table 2 . resistance of the 3 most commonly isolated candida spp . to the 5 antifungals tested was low ( table 3 ) . the resistance rate to amphotericin b was the lowest ( 0 - 0.5% ) with sensitivity rates between 97.4% and 100% . the resistance rates to voriconazole were between 0% and 5.2% and the sensitivity rates were between 89.7% and 100% , while the resistance rates to itraconazole were between 0% and 7.7% and the sensitivity rates were between 82.1% and 90.4% . vulvovaginal candidiasis frequently colonizes the female reproductive tract with typical symptoms of vaginal itching , redness , and tofu - like vaginal discharge ( 8) . owing to the inappropriate use of antifungal drugs ( i.e. , repeated administration or long - term use ) , the appearance of drug - resistant strains has been increasing in china , making antifungal treatment increasingly difficult ( 9 ) . in this study , 2.129 vaginal secretions from patients with reproductive tract infections in the chongqing region were analyzed for fungal infection . the results showed that 478 subjects were infected with 8 candida spp . , of which c. albicans accounted for 395 cases , c. glabrata accounted for 39 cases , c. tropicalis accounted for 21 cases , and other candida accounted for 23 cases . this indicates that candida infection is high in patients with gynecological reproductive tract infections in the chongqing region . is affected by the immune status of the host , lower body resistance , ph changes in the vagina , lifestyle , abuse of antibiotics and pregnancy ( 10 , 11 ) . in our study , the overall positivity rate of candida infection was 22.45% , of which c. albicans was the main species identified . this is consistent with the results of the other studies ( 12 - 16 ) . this observation differs somewhat from the other studies , where c. krusei was more commonly isolated than c. tropicalis , but these variations may be owing to differences in the populations and geographical locations of the studies . recent reports indicate that the association of c. glabrata with vaginal candidiasis has been gradually increasing ( 15 ) , and this may be related to the wide use of clinical azole drugs or nonstandardized treatments . even if there is no direct evidence that vulvovaginal candidiasis is sexually transmitted , the incidence of vulvovaginal candidiasis is known to increase upon initiation of sexual activity ( 17 ) . indeed , sexual transmission between partners may be a factor in the increasing incidence of candidiasis . studies have shown that the infection rates of spouses of candida spp .- positive male partners were 4 times higher than those of male partners without candida infection . infections were detected in the penis of 15% of the partners of female patients with candidiasis ( 18 , 19 ) . our study has shown that the detection rates of candida spp . in the under 20 and 20 - 49 years this indicates that vaginal candidiasis occurs more often in women of reproductive age in chongqing . we believe that the increase in vaginal infections in this population may be related to their more active sexual behavior . in recent years , drug resistance in candida spp . to common antifungal drugs has been increasing ( 20 , 21 ) . in our study , drug susceptibility tests were performed on 478 strains of candida . our results showed that 3 main species , including c. albicans , had low resistance to the 5 antifungal drugs . in particular , resistance rates to amphotericin b were the lowest , ranging from 0% to 0.5% , with sensitivity rates ranging from 97.4% to 100% ; resistance rates to voriconazole ranged from 0% to 5.2% and sensitivity rates ranged from 89.7% to 100% . however , owing to the side effects of amphotericin b and voriconazole , their use in candidiasis treatment is limited . the sensitivity rates of c. glabrata to fluconazole and itraconazole were 84.6% and 82.1% , respectively , which were lower than those of c. tropicalis and c. albicans . buitron garcia - figueroa et al . ( 22 ) reported that in vaginal candidiasis , the infection rates of c. glabrata is rising commensurate with the drug resistance rates to fluconazole ( 68.2% ) . ( 23 ) also showed that the overall susceptibility rates for itraconazole and fluconazole were 77.6% and 91.9% , respectively . resistance rates were only observed in c. glabrata for itraconazole ( 24.1% ) and posaconazole ( 14.5% ) , and in c. krusei for itraconazole ( 81.5% ) . ( 24 ) reported that the resistance rates of c. albicans to fluconazole and itraconazole were 0.7% and 2.7% , respectively . the different resistance rates observed in these studies may be owing to the differences in the study populations and geographical locations or differences in antifungal use , which is not regulated in china . on the basis of our results , we suggest that the identification of yeast infections by smear microscopy alone is not sufficient and that clinicians should attempt to cultivate causative candida spp . from vaginal secretions and design antifungal treatments based on drug susceptibility testing ( 25 ) . this approach should help to reduce the recurrence of candida infections and to mitigate against increasing antifungal resistance . | backgroundvulvovaginal candidiasis is defined as vulvovaginitis associated with vaginal carriage of candida spp . and is a common problem with a high rate of morbidity.objectivesto investigate the distribution of candida spp . and evaluate the corresponding antifungal susceptibility in women with genital tract infection in chongqing , southwestern china.patients and methodssamples ( n = 2.129 ) were obtained from female patients with symptoms of genital tract infection .
candida spp .
were isolated from the specimens and were identified using a coloration medium and the vitek 2 compact automatic microbial identification system .
antifungal susceptibility testing was performed using the atb fungus drug susceptibility testing system.resultsfrom 2,129 samples , 478 ( 22.45% ) isolates of candida were isolated , of which 395 ( 82.64% ) were candida albicans , 39 ( 8.16% ) were c. glabrata , 21 ( 4.39% ) were c. tropicalis , 9 ( 1.88% ) were c. parapsilosis , and 14 ( 2.93% ) were other candida spp .
the resistance of c. albicans , c. glabrata , and c. tropicalis to 5 antifungal drugs ( amphotericin b , voriconazole , fluconazole , 5-fluorocytosine , and itraconazole ) ranged from 0.5% to 6.4% , 0% to 7.7% , and 0% to 9.6% , respectively.conclusionscandida albicans was the major pathogen associated with candidiasis of the female genital tract in patients in chongqing .
the results of the antifungal sensitivity of the isolates suggest that it is important for clinicians to administer appropriate antifungals for the treatment of candida spp
. infections . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
people of south asian origin in the uk ( people with ancestral origins from pakistan , india , bangladesh , and sri lanka ) manifest obesity - related diseases more frequently and earlier than other groups , [ 1 , 2 ] at lower levels of body mass index to european populations . genetic factors are important , however the increased incidence of these diseases is strongly associated with rising obesity in this group where lifestyle changes can reduce risk factors such as a sedentary lifestyle , diet , smoking , stress , and depression . in the uk , south asians are the largest ethnic minority who now comprise the majority ethnic group in several urban locations from the latest uk consensus . they are also at considerably higher risk of diabetes than the general uk population and have a mortality rate from coronary heart disease at approximately 40% greater than the general population . despite this , there remains little evidence of successful interventions among south asian groups and theories of health behaviour only specify a limited subset of cognitive determinants that are assumed to be most proximal to the general population 's behaviour . health research has focused on the differential occurrence rate of specific diseases in ethnic minority groups in relation to indigenous uk populations . ethnicity is not just a question of language and research exploring cultural differences , including how experiences and health beliefs reflect health behaviors ( an action taken by a person to maintain , attain , or regain good health to prevent illness ) , is still limited among people of south asian descent . given the elevated risk of lifestyle - related disease in south asian communities , there is a need to identify beliefs that may contribute to health risks and current health behaviours exploring psychosocial risk factors for ill - health ( e.g. , socioeconomic status , diet , family conflict , attitudes / beliefs , health - related behaviours , and work patterns ) . nice guidelines ( national institute for health and clinical excellence ) recommend advice on lifestyle change is tailored for different groups particularly minority groups as their uptake of health information is lower than other groups and underresearched . there is some consensus that addressing deep - rooted influences on health behaviours in at - risk groups , including cultural influences , is important [ 79 ] . culture is a complex interaction of a multitude of factors that give people an ethnic belonging and also impacts on their lifestyle and predisposition to chronic disease . for any intervention to be successful on meeting the needs of the target community , providers need to be informed by an understanding of a group 's lifestyles , attitudes , and beliefs . a more complete explanation of particular health behaviours is necessary by extending theories to include other relevant determinants . investigation of these variables by qualitative research provides insight into factors that may be mediators of motivation to change behaviour such as cultural and social norms . qualitative research can be used to inform strategy for the promotion of healthy lifestyles and recognised as increasingly important in developing the evidence base for public health . these methodologies are especially appropriate for understanding individuals ' and groups ' subjective experience whilst , being sensitive to the contextual , social , economic , and cultural factors which influence health beliefs and behaviours . these are difficult to access using quantitative approaches as such methods do not give us an adequate understanding of the factors involved . the inductive nature of qualitative research allows for theory to emerge from the lived experiences of research participants rather than the predetermined hypotheses testing of quantitative approaches . a review of uk literature was carried out to identify available evidence on the perceptions around lifestyle disease and health behaviours among uk south asian populations . investigating what is known about awareness , knowledge , perceptions , and misconceptions about living a healthy lifestyle for uk south asians enhancing our understanding of social and cultural constructs among this group . further , to identify key themes emerging from research , helping guide intervention programmes and future research . articles for inclusion ( see table 2 ) were scientific articles written in english and studies exploring health behaviours among uk south asians aiming to capture the nature of their behaviours and lifestyle choices . three electronic strategies were used ( using thesaurus terms , free - text terms , and broad - based terms ) for searching across bibliographic databases ( see figure 1 ) . a wide range of databases ( i.e. , medline , web of knowledge , cochrane library , psyinfo , and embase ) and public health websites ( i.e. , who , dh , and hpa ) including government websites ; nhs scotland library , health technology assessments ( hta ) , and national institute of health and clinical excellence ( nice ) were searched . to ensure inclusion of papers which may not be submitted to peer review additional websites searched include diabetes uk ; nhs evidence specialist collection for diabetes ; relevant references from published literature were followed up and all potentially relevant articles and titles and abstracts of articles were screened and full - text copies of potentially relevant articles were reviewed . as the terms south asian , health beliefs and health behaviour have many synonyms , these terms were not always present in the research objective / s . , based on common elements from existing criteria for qualitative study quality assessment [ 1216 ] and has been used to guide the review and evaluation of the elements of each particular study , given its context and purpose . articles were examined for methodological quality and all clearly defined their purpose giving adequate descriptions of sampling and justification for data collection . however , details for sample validation and assessment of generalisability were less clear with limited evidence of triangulation . various qualitative methodologies were used with few justifying their reasoning for the chosen method and detail of analysis . all studies clearly identified experiences inherent among this group , with interpretations that could serve to further the understanding of the participant 's experience and in view of these criteria all ten studies were included due to evidence of good rigour . the findings , context , and analysis of the ten included studies were used as data in the present study . a metaethnographic approach described by noblit and hare the steps of which are ( outlined in figure 2 ) taken to synthesise themes and patterns identified by reading and rereading the included studies . this systematic approach translates ideas , concepts , and metaphors across different studies and is increasingly seen as a favourable approach to synthesising qualitative health research . once themes were identified an attempt was then made to translate these into each other . in this process , primary themes or first - order constructs are understood as reflecting participants ' understandings , as reported in the included studies ( usually found in the results section of an article ) . secondary themes or second - order constructs are understood as interpretations of participants ' understandings made by authors of these studies ( and usually found in the discussion and conclusion section of an article ) . translation involves the comparison of themes across papers and an attempt to match themes from one paper with themes from another , ensuring that a key theme captures similar themes from different papers from the reciprocal translation a table was constructed showing each theme . when synthesising translations to develop an overarching framework ( or third - order interpretation ) , translated themes are used to develop hypotheses into a line - of argument synthesis . line - of - argument syntheses create new models , theories , or understanding rather than a description of the synthesised papers . included articles had to present an acceptable and justified qualitative research method ( based on the criteria in table 3 ) but few provided enough detail to judge this accurately and a variety of methods and paradigms were presented . however , it was accepted that the main interest of the studies was of the experience that was being explicated . this paper incorporates the concepts identified in the primary studies into a more subsuming theoretical structure . this structure may include concepts which were not found in the original studies but which help to characterise the data as a whole and take into account different settings and subgroups . although the foci of the studies were not all directly comparable , a number of recurring first- and second - order constructs were identified . although inclusion of evidence was not restricted by study type other than use of qualitative methods , there was a focus on study designs that elicited views around health behaviour rather than views on treatment programmes and health services . the studies employed methodologies that range from case studies to semistructured interviews , and in - depth interviews to focus group discussions . taping with transcription of data was the most common method used to demonstrate credibility . ethnically matched interviewers , peer debriefing , and multiple researchers were also common . all the studies explored in some manner health beliefs and perceptions associated with lifestyle . of these ( see table 4 ) , three were based on thematic analysis , one used framework analysis , a form of critical theory of phenomenological and sociological approaches , and four stated that they used grounded theory . qualitative data analysis software packages were used by four studies but only one used this as their sole method of analysis . the studies were all conducted in england and the combined sample of participants across studies included 377 ( 153 males , 224 females ) south asian adult participants with a wide age bracket for all studies with participants aged from 2182 years of age . the populations investigated were either south asian in general or specified group of indian , pakistani , or bangladeshi groups . three studies had small control / comparative groups of european , white british , or afro - caribbean . seven studies looked at those with either type i or type ii diabetes or chd and three looked at healthy the studies investigated a variety of research questions exploring elements of health beliefs and behaviours specific to this group . the studies ' research questions can be separated into the following groups.knowledge , understanding , and beliefs of lifestyle related disease ( type ii diabetes or chd ) ( 6).dietary intake and physical activity related to diabetes care ( 2).health perceptions and the role of diet ( 1).barriers and attitudes to physical activity ( 1 ) . knowledge , understanding , and beliefs of lifestyle related disease ( type ii diabetes or chd ) ( 6 ) . dietary intake and physical activity related to diabetes care ( 2 ) . different studies used methodological and epistemological approaches to analyse data however a number of consistent findings emerged and a broad range of contributors were identified regarding the uptake of healthy behaviours from a south asian perspective . this paper looks at the evidence , focusing on the identified main themes in table 5 . the results have been grouped under two categories to be discussed further within this paper . difficulty identifying aspects of lifestyle that contribute to the development of lifestyle - related disease [ 19 , 21 ] with diabetes suggested as causing obesity . the majority of studies found that south asian participants lacked understanding of the relationship between lifestyle and disease . those diagnosed with a lifestyle - related condition were often unconvinced of the impact their lifestyle choices had on health . personal disease risk and cause were often instead attributed to a range of external influences commonly stress , heredity , pollution , and too much sugar or fried food in their diet as influential factors on health . a shared assertion by those with diabetes or chd was not being sure or understanding the root cause of their disease [ 18 , 21 , 25 ] . indeed , very few related their own lifestyle choices and behaviours in any direct and obvious way . lawton et al . reported that first generation participants regarded the development of diabetes almost universally to factors outside their control suggesting it was the will of allah / god , genetics , or a change in climate and environment brought about by their migration to the uk . the mention of an imbalance of bodily fluids ( based on humoral medicine ) and imbalances of sugar in their blood were reasons given for their condition . many were able to recall and quote lifestyle advice from health professionals but the relative importance of these risk factors did not appear to influence beliefs or translate to behaviour change . for example , males understood smoking to be linked with disease but few were convinced this would impact on their health . increased risk of disease was often not linked with likely risk factors , that is , being overweight . whilst , stress was more commonly cited as cause of disease development [ 23 , 25 ] . where weight loss had been advised , this advice was confounded by beliefs that carrying extra weight was not an indication of being unhealthy or a health problem but quite the opposite indicating good health , weight , or status and reduced incentive to engage in weight loss behaviour [ 23 , 25 ] . similarly , physical activity was not readily identified as a risk factor although low impact activity such as walking was related to general well being . physical activity was considered as negatively impacting health or exacerbating illness by increasing physical weakness [ 19 , 26 , 28 ] . uncertainty over the type of exercise needed and duration for impact appeared a common barrier to forming intentions and across studies more clarity on the risk factors and preventive actions were desired . personal and familial risks of diabetes and chd were observed without concern and few linked such diseases specifically with risks related to their ethnicity . one study did however find knowledge of risk factors for developing type ii diabetes high ( bangladeshi sample ) and this awareness was primarily described due to experiences of diabetes by relatives or friends . when discussing prevention of diabetes participants believed fear of the devastating impact of diabetes would motivate preventive action across the bangladeshi community . others , felt diabetes was so widespread in their community and ( implicitly ) something not to be too concerned about . often , it was not until diagnosis of chd or diabetes that signalled the need to adopt a healthier lifestyle [ 21 , 22 ] . some described how their own experience of developing disease complications , that of similarly affected relatives and friends , or fear of needing extensive treatment ( such as insulin injections ) had encouraged them to engage in exercise . however , these perceptions also acted as a demotivational effect as far as the uptake or maintenance of physical activity once diagnosed with diabetes . lifestyle changes were often focused on diet rather than physical activity , which researchers suggested was due to their focus of diabetes and chd on imbalances , sugar or fat intake all related to diet rather than physical activity . physical degeneration and weakness were viewed as virtually synonymous and an inevitable consequence of ageing with the belief that little , if anything , can be done to reverse or delay this process [ 23 , 28 ] . for some the perception of ill health being due to age was borne out of their exposure to the high number of family and fellow community members suffering from numerous health problems . a belief in control over individual health status was contradictory as accounts of understanding that food and activity choices influence health . however , many reasoned an individual 's role in their health was externally influenced if not controlled inducing a more passive approach to health . we have much fear of this disease , once this disease is developed , there will be no way to save yourself . we have much fear of this disease , once this disease is developed , there will be no way to save yourself . grace et al . compared south asians with white populations and found south asians more likely to externalise responsibility of diabetes , reporting general life circumstances as central to cause in comparison with internalised responsibility by white groups . however , both groups cited beliefs that they had been fated to suffer chd or diabetes [ 19 , 21 ] . this demonstrates beliefs around disease occurrence may be common to people with these conditions however , fatalism did appear stimulated by south asian religious beliefs . fatalistic views have often been associated with south asian cultural and religious beliefs , and many of these studies found evident expressions that ill health was fate . religious fatalism was often suggested as just among older relatives rather than the participants themselves and attributing illness to events or agents outside of the body rather than to primary failure of an organ within it was evident among older generations . however , even those with family history of diabetes and those with understanding of their role in health status often mentioned the idea of god , and not the individual , as being ultimately responsible for health [ 19 , 23 ] . fatalistic views were reinforced by beliefs that health , illness , and death are preordained by allah / god but family experience of disease and experiences by relatives were also significant . reported health conditions were often viewed as the will of god but the individual still had a responsibility to look after their health . illness could be described as an indication from god that they had not looked after their health and a sign that changes needed to be made to their lifestyle . ludwig et al . found female participants expressed a strong sense of fatalism with regard to personal health risks and weight gain related to the ageing process described as normal and inevitable . causal attributions were influenced by fatalist approaches to health and the uptake of health behaviours but not always defined by cultural or religious beliefs and those with a strong family history of diabetes tended to view their diagnosis as inevitable and accepted it with resignation feeling like there was nothing that they could have done to avoid the onset of their condition . individuals with diabetes and chd expressed great anxiety about their health and some experienced depression related to their lack of understanding over why they were afflicted . a lack of individual control over health was highly related to feelings of anxiety and hopelessness regarding their condition [ 21 , 27 ] . a view prevalent among the older generations was that management of health should be left to qualified health professionals . specific barriers such as language difficulties and multiple health problems were described as reasons for their lack of ability / interest in understanding their own condition . a number of participants felt it impertinent to ask questions of their healthcare professional and to do doctors were viewed as busy , authoritative , and knowledgeable , rarely making mistakes and with full understanding of the individual 's condition . the use of a family member as translator was necessary for some and they asked fewer questions so as not to appear difficult . instead , reference to family networks and history of diabetes among family or friends created the main informational sources , which reduced their need to seek additional support . younger participants expressed a high value on education and learning with interest in increasing their control over their health . however , this was not necessarily matched by action as few attended organised educational initiatives or support groups citing excuses relating to lack of time . health information and advice was gathered for the most part from health professionals , peers , and elders , and information was viewed as accessible and helpful . word of mouth was the primary source for delivery and receipt of information [ 18 , 26 ] playing an important role in defining the information received . health professionals were reported to be sources of advice and motivation to make lifestyle changes however difficulties arose when attempting to use advice . . found south asian woman were strongly , though passively , influenced by their doctor 's recommendations . it is well documented that knowledge alone does not always translate to behaviour change and more so for the women influenced by strong family networks prioritising adherence to cultural and social norms . an ability to recall guidance received from doctors was apparent [ 18 , 23 ] but cultural norms acted as a barrier when attempts were made to change behaviour . information from peers / elders was viewed with high regard and for those who had a family history of dealing with diabetes ; family was described as a major source of information . this information was more relevant to their cultural norms increasing likelihood of individuals internalising the information . uncertainty about information from health professionals particularly when alternate advice was received from peers / elders . alternate advice included understanding the main cause of diabetes as being high dietary sugar intake and beliefs that kerala and other bitter foods prevent and help manage diabetes instead of considering the larger modifications to their lifestyle suggested by health professionals [ 18 , 23 ] . one study of south asian women found in contrast to receiving considerable nutritional advice from dieticians , they typically received cursory and general exhortations , to just do more exercise as part of other health consultations in primary and secondary care . he ( health professional ) just says just do more exercise that 's it the doctors and the health advisors they do not give you the proper information . they do not push you it would help if ( we ) had people telling ( us ) how to do the exercise . he ( health professional ) just says just do more exercise that 's it the doctors and the health advisors they do not give you the proper information . they do not push you it would help if ( we ) had people telling ( us ) how to do the exercise . the need to prioritise engagement in health behaviours such as physical activity or dietary modification was clearly reduced by beliefs common among this group . advice and support from health professionals did not appear to have the same impact as peers / elders on their enduring health beliefs and behaviours . even though many expressed the need for lifestyle changes to benefit their health , intentions were frequently not made clear and transforms into behaviour change . similar barriers to behaviour change arose across studies and a disproportionate amount of barriers to leading a healthier lifestyle were described . the idea of preventing disease by a healthy lifestyle was not a goal strived for , highly regarded , or prioritised . many participants exhibited low perceived behavioural control in regard to their dietary choices and physical activity behaviour . perceived behavioural control is an individual 's perceived ease or difficulty of performing a particular behaviour . there was no concept or goal of being physically fit or gaining enjoyment from exercise and this relates to distinct beliefs and behaviours among this group . basic awareness of physical activity being important for health but a clear lack of putting this into practice . walking was the most common form of physical activity with few attending any organised forms of activity . cultural and social expectations , time constraints , and health problems appeared to reduce the likelihood of physical activity . there was an absence of exercise culture within this group together with a distinctive dislike for most forms of exercise offered locally such as gyms [ 26 , 28 ] . what was accepted as being healthy ( being physically active ) was seen as less important than social norms like group socialising , the religious requirement for modesty , and the cultural rejection of sporting identity or dress and therefore motivation to be active through specific exercise was near nonexistent . the role of cultural beliefs and traditions were displayed as important in leisure time choices , influencing motivation to engage in activities such as joining a sports team or using local leisure facilities as traditionally sports and games are not pursued by adults . environmental barriers may also have influence on participation in physical activity as participants often lived in urban city environments . lawton et al . found dislike of outdoor activities , bad weather , and a high usage of cars even for short journeys to the shops meant that indoor activities were the most appealing . however , two studies found cultural factors and a lack of awareness of the benefits of physical activity the biggest impact on behaviour [ 26 , 28 ] . the notion of exercise for oneself beyond daily work was perceived by some as a selfish activity , or given little priority as expectations by family and community were more important especially by women [ 25 , 26 ] who prioritised family expectations and needs . the notion of family first was a key influencer on time - restricting opportunities for individual interests and activities . for women , it remained a function relegated to normal daily duties rather than any enjoyment or added provision of time to focus on being physically active . many made reference to activity needing to be socially rewarding with the appeal being of group rather than individual activity . exercise demanded justification or sanction to occupy one 's time and resources in this way . the emphasis was on the cultural importance of being active day to day , rather than the physical activity appeared culturally irrelevant in the case of bangladeshi groups the word physical activity or exercise was noted as not featuring within their native dialect giving us understanding of why it is viewed as an informal activity predominantly involving walking only . some reflected on their religious beliefs as encouraging and instructing them to look after their health by keeping physically fit . less formal and less obvious forms of exercise were mentioned such as walking and carrying out prayers ( namaz ) as worthy and health giving forms of exercise [ 22 , 23 ] . as a consequence of leading very busy lives men and women pointed out this was evidence for them being physically active already as part of their daily duties . lack of time was a key barrier to physical activity , yet being active daily was viewed as a strong cultural obligation . for men the culture of a strong work ethic meant they felt obligated to dedicate their time to providing for their family working very long or antisocial hours often in shops or restaurants . women felt they were by definition , engaging appropriately in physical activity from care - giving , house - keeping , and work day activities so extra time for specific exercise ( i.e. , aerobics class ) was not acceptable as family duties were their priority . family concern was described as a motivator to be physically active and as weight gain may compromise the woman 's role as family carer or the man 's role of the wage earner reference to this rather than individual health gains . women expressed that breathlessness , increased heart rate , and sweating ( normal by products of physical exertion ) as something they wished to avoid [ 25 , 26 ] . women described principal motivations to walking were relaxation and refreshment from getting out of doors , a change of scenery , and in particular as a form of socialising with other women . a couple of studies with women only samples delved deeper women cited a variety of externally imposed barriers of which they had little or no control over like adhering to cultural expectations that women should walk slowly in public not being seen to hurry . restrictions on women leaving the home ( especially to enter mixed - sex settings ) and to remain within the home was a traditional social norm , this norm conflicted with efforts at lifestyle change . a few pointed to once a woman is married , she is expected to stay indoors , attending to domestic chores and responsibilities,women can not go out you have to cook and provide meals at the right time , so because of that there is a restriction . he ( husband ) goes out when he feels like it , but it is different for women . women can not go out you have to cook and provide meals at the right time , so because of that there is a restriction . he ( husband ) goes out when he feels like it , but it is different for women . further barriers for women included language , racial harassment , dress codes , modesty , and inappropriate facilities [ 22 , 28 ] . gender separated sessions were described as preferable , however many had never attempted to attend these sessions even though they had been recommended to them [ 25 , 26 ] . suggestions to increase physical activity included activities organised by members of their own community as this would ensure a culturally appropriate environment with men and women exercising separately , with separate changing areas and they would that said , attending fixed time sessions was deemed difficult as previously described there are many competing demands on their time often with higher priority . accounts of food and eating practices were at least partly informed by concepts and experiences common to this respondent group . family expectations impacted on dietary choices , food preparation , and consumption . in relation to food practices the importance attached to group norms and social values was a theme common across studies . these norms often acted as barriers to encouraging lifestyle change as lack of knowledge was not the main barrier but a complex value hierarchy . a traditional south asian diet presented particular problems for their health ; amount of oil used in cooking , fried foods , and the high sugar content and popularity of asian sweets . south asian foods were viewed as risky by many and this caused difficulties when adapting their diet . grace et al . found this belief influenced by health professionals and south asian patients misinterpret or misunderstood health professional 's advice regarding diet and dieting . few mentioned cutting out these foodstuffs instead accounts of restraint of risky asian foodstuffs was common and contrasted with white europeans who were more likely to remove risky items completely from their diet . health was a consideration with food practices but was interwoven with other issues and concerns . insight came from those participants with diabetes or chd who felt changes to their traditional recipes could not be made without having to choose less appealing , bland and unpalatable western food that lacked acceptability . some of the authors felt that positive aspects of traditional food practices should be reinforced , including cooking from scratch using a variety of fresh and healthy ingredients , offering fresh fruit and nuts rather than sweets with the idea that traditional asian foods can be made non- risky without compromising taste . food and health practices in particular were seen to be influenced by peers or elders due to the social and cultural norms that they recognised [ 23 , 25 ] . the influence the social environment and , in particular , the views of peers and significant others a theme as engagement in behaviour which is practiced by and valued by their peers . consumption of foodstuffs plays an important role in social networks with the of offering and receipt of food , the creation of social networks by gift - giving ' in the form of luxurious or traditional food , and the social significance of cooking for guests and of celebratory meals . this strong hospitality culture was pivotal and the role of consuming south asian food viewed obligatory otherwise risk offence or alienation from the community . social expectations were evidently highly valued and therefore certain standards and food preparation were expected to please guests . what is accepted to be healthy ( small portion size , limited rich , and fatty food ) was seen as less important than the social norms of hospitality . lawton et al . found most participants continued to consume south asian foods despite concerns that they may be detrimental to their glycaemic control . restraint was the central method used to allow a balance between the risks associated with eating traditional food against alienating themselves from their culture , families , and communities . for those diagnosed with diabetes few suggested ways that they had changed or adapted their diet since being diagnosed other than when cooking use of ghee for special occasions only . males , reportedly , had little or no input into food preparation so were reliant on female household members to cook food appropriate for them . grace et al . found some felt control of their diet should be imposed and policed by family members so through external influences . responsibility to maintain traditional practices was felt by most women and younger women described receiving advice ( whether it was asked for or not ) from their elders to achieve the correct practice . women also expressed a moral conflict between individualist goals and collectivist goals ( e.g. , the individual goal of healthy eating compared with the shame to the family of not providing guests with generous special menu food ) . however , grace et al . found that although older women felt strong pressure to conform to traditional norms and expectations ; younger and second - generation women felt able to resist pressure to conform . many experienced considerable difficulties in trying to lose weight and this may be related to the individual nature of weight loss . as noted with both physical activity and dietary modification doing things for oneself is not highly regarded in this group . the idea of work as a unit makes weight loss difficult , as changes can not be made without inclusion of all household members and having the families support . some with diabetes described having to have meals separate from their family who continued with their usual diet status . body image was recognised by many authors as a potential barrier to healthy lifestyle behaviours . positive personal appearance being related to a larger size is a cultural barrier that outweighed personal motivation for weight loss , and for older people weight loss was seen as potentially weakening . this may in part be due to the culturally acceptable nature of being of a larger size , weight is not always perceived as unhealthy and may be viewed as indicating good health , weight , or status . the extent to which importance was attached to an ideal body size differed by gender , age and it was not always women that were keen on managing weight . for women , dieting was not common , only if the issue was raised by a health professional had they considered dieting for weight loss . this study also found perception of own weight was often not correct with most perceiving themselves not overweight when body mass index calculations showed they were . weight perception may also be affected by modesty traditions as some pointed out that a woman dressed in traditional clothing was not always aware of her shape . women viewed weight gain as an inevitable path in a woman 's life after - children and due to age linked with underlying beliefs of fate and destiny , which impacted motivation to make changes . although , where there had been positive experiences of weight loss seen in a peer or elder this acted as motivation to diet . these ten studies provide insight into possible reasons why south asian perceptions may be at odds with individualistic motivations in commercialised healthy living ( e.g. , gym membership ) and with current models of behaviour change . concepts such as self - efficacy or empowerment where emphasis is placed on individuals and their self - efficacy ( e.g. , health belief model ) may not be readily applicable to south asians along with the current focus on self - management of disease . this requires considerable motivation and prioritisation of health by the individual but when the benefits of engaging in health - related behaviours are not readily identified and long - term health not a prioritised goal . high importance is attached to group norms and social values , so supporting initiatives , which receive community endorsement , may help to alleviate people 's anxieties taking time out from their obligations to perform exercise . delivering education , advice , and support to the whole family given the broader role that the shared consumption of south asian food plays in community life is important and may help reduce concerns about not participating in cultural acts . there is also need to consider the nature of social support networks , essential for promoting health behaviour change , that is , extended families living within households as social support from family members will encourage healthy diet and physical activity adherence . lifestyle advice given by health professionals needed to be culturally appropriate to enable individuals to put the information into practice . health professionals need to be aware their advice can lack acceptability and therefore unlikely to be followed . health professionals need to be aware advice lacking in acceptability may reduce adherence and so highlights the need for sensitivity to patient motivations and cultural commonality by health professionals . more specifically a need for strategies focusing on healthy cooking practices through the promotion of lower fat authentic versions of traditional recipes and understanding different ideas on body image in relation to health risks will likely assist behaviour change . consideration of the term physical activity and activities associated , the amount of exercise , physical limits were often unknown and questioned . physical activity was not identified as a main factor in the aetiology of obesity and poor physical health ; this lack of association should cause concern for health providers . lack of knowledge and perceived lack of control over health , means behaviour modification is likely to be harder among this group . walking stood as women 's most popular activity for keeping active as this was easily controlled and incorporated into daily routines , accompanied by the benefits of meeting other people . this should be sensitive to south asian concerns and motivations , such as those identified here and use of community peer education may be an effective way to assist levels of self - efficacy . for now health promoters may need to consider working with , rather than against , cultural norms , values , and individual perceptions . for instance , rather than appealing to the promotion of individual health and personal gain , they might consider emphasising the benefits of physical activity and dietary change in terms of helping people to maintain their roles within their families and to fulfill their obligations to others . strong family networks and frequent history of diabetes appears to create strong emotional support among south asians seeking advice from each other and therefore also means that they are unlikely to seek additional support . emphasis on support from family to make changes and high regard from informal sources of information ( peers , elders , etc . ) reinforces that family - based educational interventions are useful in these communities to build on beliefs , attitudes , and behaviours already existing . it may be prudent to invest energy and resources in raising general awareness through group and community - based initiatives spread in particular through word of mouth as a useful approach for promotion . contemporary health promotion is built on assumptions of individualism and self - investment and may need to be rethought for south asian groups . typical health promotion is based on education and awareness therefore unlikely that large - scale campaigns are reaching south asian groups who look to their peers as role models and advisors . clearly , a number of factors give south asians their unique sense of identity and belonging and cultural preferences influence engagement with different recreational activities and food choices . in common with other areas of interest relating to people of south asian origin , it is important to bear in mind the heterogeneity of this broad ethnic group and to be aware that the attitudes and health beliefs of specific subgroups may not be common to all migrant south asians converting awareness into action . however , considering their health risks , understanding disease risks , and importance of engaging in preventive behaviours are imperative for this group . interventions have previously been based on western behaviour models and no information regarding the cultural - appropriateness of these exists . the term culturally sensitive has been widely employed to describe initiatives , which have been tailored to increase their appropriateness for minority ethnic communities . however , understanding of the factors to be considered in developing adapted interventions is still developing , within a wider context of competing theory - based strategies . these studies help us to understand the cultural factors responsible for poor adherence to lifestyle advice but more studies are needed on the cultural acceptability of different types of exercise and dietary regimens in south asians . the development of a framework to better understand the factors underlying south asian health behaviours and how this relates to the initiation and maintenance of a healthier lifestyle would be of use to health professionals and service providers in addressing health inequalities among this group . qualitative research is helping to reveal how social and cultural forces shape health behaviours and can work to explain why information and programmes alone are often not enough to change it . | objective . to review available qualitative evidence in the literature for health beliefs and perceptions specific to uk south asian adults . exploring available insight into the social and cultural constructs underlying perceptions related to health behaviours and lifestyle - related disease
. methods .
a search of central databases and ethnic minority research groups was augmented by hand - searching of reference lists . for included studies ,
quality was assessed using a predetermined checklist followed by metaethnography to synthesise the findings , using both reciprocal translation and line - of - argument synthesis to look at factors impacting uptake of health behaviours .
results .
a total of 10 papers varying in design and of good quality were included in the review .
cultural and social norms strongly influenced physical activity incidence and motivation as well as the ability to engage in healthy eating practices .
conclusions .
these qualitative studies provide insight into approaches to health among uk south asians in view of their social and cultural norms .
acknowledgement of their approach to lifestyle behaviours may assist acceptability of interventions and delivery of lifestyle advice by health professionals . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the strain was derived from a mixture of
immature mosquitoes collected in five municipalities of havana , cuba . the adults were
reared in 18 x 18 x 18 inch collapsible cages ( bioquip , usa ) maintained at 26c 0.5c
in 80 - 85% relative humidity ( rh ) with a photoperiod of 12:12 h ( light / dark ) . a
continuous supply of sucrose solution was provided . female mosquitoes were given access
to an anesthetised mouse and allowed to blood feed for 30 min weekly . sex separation was based on pupal size ; ae . aegypti female pupae are
visibly larger than male pupae and hatch later ( forattini 2002 ) . pupae were individually removed from the rearing tray using
a disposable pipette . in all cases , the mosquitoes were sexed prior to transferring them
to the large cages . sterilisation - a 0.6% solution of thiotepa ( sigma , belgium ) was
prepared in distilled water buffered to ph 8.6 . young male pupae ( 1 - 4 h old ) were
immersed in this solution for 6 h , rinsed twice in dechlorinated water and transferred
to a mosquito breeder ( bioquip ) for emergence . because both fertile and sterile males
were needed for each release in the suppression phase , a fraction of the male pupae
was treated with thiotepa . large cages - three identical indoor screened cages ( 1.46 m in width ,
1.85 m in length and 2.02 m in height ) were used for the suppression trial . the exterior
walls , floor and ceiling were made of concrete and room dividers between cages were a
fine metallic mesh in appropriate aluminium frames ( fig .
1 ) . resting and hiding sites were provided in the form of the following
household objects : cotton curtains , a chair , a table , a vase with artificial flowers and
a shelf . a constant environment of 26c 2c , 80 - 85% rh and a 12:12 h light : dark
photoperiod was maintained . fig . 1 : sketch of large laboratory cages . three identical screened cages just
over 5 m3 were used . cages were randomly assigned as follows : cage a contained
fertile females and fertile males in a 1:1 ratio ( control ) , cage b fertile
females , fertile males and sterilised males in a 1:1:5 ratio and cage c fertile
females , fertile males and sterilised males in a 1:1:2 ratio . a table was located inside the cages
to place animals for mosquito blood - feeding , oviposition containers , recipients
with pupae to release and sugar source . cdc light traps were hung inside the
cage and again accessed through sleeves .
two treatment cages and one control cage were established as follows : cage a contained
fertile females and fertile males at a 1:1 ratio ( control ) ; cage b contained fertile
females , fertile males and sterilised males at a 1:1:5 ratio and cage c contained
fertile females , fertile males and sterilised males at a 1:1:2 ratio . access to each cage was obtained through a sleeve opening through which a table could be
reached where the oviposition containers , animals for blood - feeding and a constant sugar
source were placed . battery - operated cdc light traps were hung inside the cage and
accessed through sleeves . cages were randomly assigned to each treatment once a stable
population had been established in all cages ( the end of the pre - treatment phase ) . target populations ( pre - treatment phase ) - stable mosquito colonies
were established in each of the three cages during a 20 week pre - treatment phase . seventy pupae of each sex were added for an initial population of 140 individuals per
cage and 50 individuals of each sex per cage were added weekly . the required number of each sex were added to a mosquito breeder ( bioquip ) placed on the
tables inside the cages and the devices were uncovered once daily to allow the emerged
adult mosquitoes to escape . four restrained guinea pigs were placed on the table of each cage around sunrise for 30
min on alternate days as a blood - feeding source and mating stimulus . continuous access
was allowed to a sucrose source by placing sugar - water - soaked cotton pads in the
cages . three oviposition containers consisting of glass trays ( 18 cm in diameter , 5 cm in
height ) lined with filter paper and filled with 900 ml of tap water were added to each
cage . water and filter papers were replaced to
collect eggs three times per week ( monday , wednesday and friday ) to prevent the eggs
from hatching inside the cages . the eggs were counted once a week to determine the total
egg lay per week . the eggs were counted under a dissecting microscope and the total
oviposition was recorded by week . the eggs were allowed to mature on the moist paper
strips for seven days and were then immersed in tap water at 36c . the filter papers with eggs were recovered from the hatching trays and
were examined under a stereoscope . the hatch rate was assessed by the following formula : ( number of hatched
eggs / total number of eggs ) x 100 . the adult populations were monitored weekly from week 2 using cdc light traps turned on
at 08:00 am every monday ; at this time , the rooms were kept in the dark for 10 min . thereafter , the room light was turned on and the traps were quickly removed from the
cages , while being kept operational to prevent mosquitoes escaping . the collected
mosquitoes were gently removed by a manual aspirator , counted by sex and returned to
their respective cages . the end of the pre - treatment phase was determined by the observation of a stable
baseline population for three consecutive weeks in all cages . suppression phase - throughout the suppression phase , pupae were added
to each cage each week to maintain the population in addition to the sterile males that
were added to the treatment cages to simulate releases in an sit programme . each week ,
50 male and 50 female pupae were added to the control cage . the number of pupae added to
each treatment cage during the suppression phase was adjusted to reflect the impact of
the thiotepa - treated males on the egg quantity and fertility . the percentage of female
pupae added back to the control cage was calculated from the number of fertile eggs laid
( total number of eggs laid multiplied by hatch rate ) . for example , 6,254 eggs were laid
in the control cage ( a ) in week 25 , of which 64.3% hatched , yielding 3,939 fertile eggs
laid in total ; thus , the 50 female pupae represented 1.26% of the total fertile eggs
laid . therefore , 1.26% of the fertile eggs collected from each of the treatment cages
were added back that week in the form of female pupae and the same number of fertile
male pupae , rounded down , were also added . then , a sufficient number of sterile
( thiotepa - treated ) male pupae was added back to achieve a 5:1 and 2:1 ratio ( sterile
male : fertile male ) in treatment cages b and c , respectively . for example , on week 25 , 20
female pupae were added to cage b ( 1.26% of the 1,633 fertile eggs collected from the
cage that week ) and therefore , 100 sterile males and 20 fertile males were also added . ( sterile males released : existing male population ) in the
treatment cages remained constant throughout the suppression phase and the relative
population sizes were maintained by the addition of female and fertile male pupae as a
proportion of the number of fertile eggs collected . ethics - this study was carried out according to the principles
expressed in the declaration of helsinki . the protocols were approved by the
institutional research ethical committee at the institute of tropical medicine pedro
kour ( certificate # 54966 ) . the permission for the use of guinea pigs was obtained from
the institutional ethical committee after demonstrating that all measures were taken to
avoid unnecessary suffering and severe damage to the animals . this study aimed to determine the efficacy of thiotepa - treated males to eradicate stable
cage populations of ae . aegypti when introduced into these populations
at the pupal stage at 5:1 and 2:1 ratios relative to the fertile male populations . target populations were established in three identical laboratory cages just over 5
m in volume by adding 50 male and 50 female pupae weekly to an initial
population of 140 individuals . after an initial drop in the hatch rate between weeks 4
( the 1st week of oviposition ) and 7 , the hatch rate stabilised at approximately 65 - 70%
and remained stable with only minor fluctuations until the suppression phase was
initiated at week 20 ( fig . the weekly adult
catch rate ( number of adult females caught in a 10 min trapping session ) rose rapidly
from approximately five per cage in week 2 to approximately 20 per cage by week 8 , after
which time it stabilised in all cages ( fig . the total egg production and eggs laid per female per week followed the same pattern as
the egg hatch rate ( data not shown ) . one of these stable populations was randomly
assigned as a control cage and the others were used as treatment cages with two or five
sterile male pupae added weekly for each fertile male pupa .
fig . stable hatch rate was achieved in each of the three cages during a
pre - treatment phase . vertical arrow represents the start of the release of
thiotepa - treated mosquitoes into the cages b and c.
fig . number of adult females caught weekly in a 10 min
trapping session with cdc light traps . stable mosquito colonies were
established in each of the three cages during a pre - treatment phase . vertical
arrow represents the start of the release of thiotepa - treated mosquitoes into
the cages b and c.
in the control cage , the weekly introductions of 50 males and 50 females continued
throughout the experiment and the reproductive parameters remained stable throughout the
experiment . in the cage in which two sterile male pupae were introduced for every
fertile male pupae reintroduced into the cage , which were set at a proportion equal to
the proportion of fertile eggs added to the control cage each week , the hatch rate
declined gradually for the first 10 weeks after the start of the suppression phase
( fig . 2 ) . after this time , the hatch rate
stabilised at approximately 45% , compared to a rate of approximately 65% in the control
cage . the adult catch rate did not respond to the releases until approximately five
weeks into the suppression phase , after which time there was a small reduction in the
adult catches in the 2:1 release cage , which stabilised at approximately 15 adults
caught per trapping session compared to approximately 20 in the control cage ( fig . when five sterile males were added for each fertile male , however , the effect of sterile
releases on the cage population was more marked . after only two weeks of suppression ,
the hatch rate had already begun to fall noticeably and by the fifth week of release ,
the egg hatch rate was reduced by a third ( fig .
2 ) . this rapid decline continued until 15 weeks after the first release when no
eggs collected from this cage hatched ; three consecutive weeks of a 0% hatch rate were
recorded before the experiment was stopped as elimination was deemed to have been
achieved . the effect on the adult catch rate again took longer , but by 15 weeks into the
suppression phase , the adult catch had fallen to only one adult per trapping session in
the 5:1 release cage ( fig . the eggs laid per female per week remained fairly stable at 15 - 20 throughout the
suppression phase . some fluctuation in the 5:1 release cage ( data not shown ) , likely
caused by the very low number of eggs collected towards the end of the experiment . total
egg production followed a similar pattern as hatch rate and adult catch rate in the
treatment cages , though never reached zero ( data not shown ) . population eradication was
thus achieved with a 5:1 , but not a 2:1 release of thiotepa - treated males . the weekly release of thiotepa - sterilised males at a 5:1 ratio with the fertile males
was shown to be sufficient to eradicate a large cage population of ae . aegypti in 15 weeks , whereas eradication was not achieved with a 2:1 release
ratio . the introduction of thiotepa - treated males continued until the 5:1 release ratio
treatment cage had produced no fertile eggs for three weeks , at which time the
experiment was ended . when the experiment was terminated , the hatch rate in the cage
where sterile males were released at a 2:1 ratio exceeded 40% and the egg hatch and
adult population ( measured by adult catch during weekly trapping sessions ) appeared to
have stabilised by 10 weeks after the start of the suppression phase . in applying the sit to a target area , efficiency could be maximised by following the
procedure described in this experiment and monitoring the hatch rate of eggs collected
in the target area while releasing sterile males in a constant ratio to the wild male
population . in this way , fewer males would need to be reared and released over time as
the wild population is reduced . this might be desirable because the rearing capacity
could then be used to target a second site for population suppression . alternatively ,
the programme could release a constant number of sterile males so that as the programme
progressed and the wild male population fell , the release ratio and thus the
effectiveness of the releases would increase . this approach might be particularly
suitable in an area where the immigration of mosquitoes from outside the target area is
expected to be a problem , although the costs would be greater . we have shown that the sterilisation of males with thiotepa and the release of these
sterile pupae is an effective strategy for suppressing ae . aegypti
populations and can cause elimination of a target population in 15 weeks at a
release ratio of 5:1 ; this length of time and scale of release is feasible in the
setting of an sit programme . although further replicates would be desirable , this was
not possible due to practical limitations and the results of this experiment are
sufficiently reassuring regarding the performance of thiotepa - treated males to warrant
moving directly to larger , more naturalistic suppression trials . there are , however ,
some limitations in laboratory experiments of this kind , even in large cages that have
been modified to be similar to conditions found within a human dwelling where
ae . aegypti might be found resting given their propensity for using
breeding sites close to human habitation in cuba ( diguez
et al . the immigration of fertile insects and the emergence of fertile
adults from breeding sites within the target area would make elimination more
challenging ; the immigration of fertilised females from outside the target site has been
implicated in the failure of culex quinquefasciatus and ae . aegypti elimination using chemosterilised males in new delhi in 1971 ( dame et al . 2009 ) . the effect of adult immigration
could be minimised by releasing sterile males into a buffer zone around the target
suppression site or by successively controlling the mosquito population in zones in a
sweeping pattern of releases ( dame et al . the effect of adults emerging from existing eggs laid in the trial site , a particular
problem in aedes spp whose eggs are resistant to desiccation , could be
minimised by breeding site reduction prior to release . there is the possibility that the competitiveness of the sterilised males could be
impaired relative to that measured in laboratory trials by the less controlled and most
likely harsher conditions found in the open field . in one recent example of such an
effect , a transgenic line of ae . aegypti was shown to be able to
suppress stable laboratory populations through weekly releases of effectively sterile
males within 10 - 20 weeks ( de valdez et al . 2011 ) ,
but this same strain failed to achieve elimination in large outdoor field cages in
southern mexico with 17 weeks of releases ( facchinelli
et al . 2013 ) . finally , the density of adult mosquitoes in the cages at the end of the trial was
unrealistically high compared to the population densities that are likely to be found in
nature . for example , a study in guasave sinaloa , mexico , measured an adult density index
of approximately three ae . aegypti adults per premises ( garca et al . 2011 ) and work in a vietnamese village
found a female adult abundance of between one-43 individuals per house ( jeffery et al . however , it is not practicable
to maintain a stable population at these low densities in artificial conditions and a
larger cage population allows for a more effective demonstration of the effectiveness of
sterile releases . however , these results are valuable because they show that sit using thiotepa
sterilisation is a promising technique and that further exploration of the technique and
testing on a larger and more natural scale would be worthwhile . any gross reduction in
the performance of sterilised males would likely have become apparent during the course
of this trial , making elimination at a 5:1 ratio impossible . a five - to - one release ratio
is relatively low , which is a promising sign for the success of an sit programme using
thiotepa sterilisation . the sterile males seem to have successfully competed for mates
with the untreated males , as evidenced by the increased number of sterile eggs laid in
the treatment cages relative to the control over time . any impact on male performance
caused by the mutagenic action of thiotepa is expected to be fairly minimal and if a
modest reduction in competitiveness becomes apparent in more stringent testing , this
could be overcome with an increased release ratio . the present study is a significant step in addressing the gaps in the knowledge related
to the inclusion of sit as a practical part of integrated vector management for dengue
control . field trials to assess the effectiveness of the technology for application in
cuba will require the establishment of public confidence and the gathering of extensive
resources and labour . however , although additional studies are required to guarantee the
safety and efficacy of thiotepa as a sterilising method for mosquito releases , the
success of the sterile mosquitoes in suppressing target cage populations in this study
is likely to help gain acceptance for this method and other technologies based on
sit . | the sterile insect technique ( sit ) is a promising pest control method in terms of
efficacy and environmental compatibility . in this study
, we determined the efficacy
of thiotepa - sterilised males in reducing the target aedes aegypti
populations .
treated male pupae were released weekly into large laboratory
cages at a constant ratio of either 5:1 or 2:1 sterile - to - fertile males .
a two - to - one
release ratio reduced the hatch rate of eggs laid in the cage by approximately a
third and reduced the adult catch rate by approximately a quarter , but a 5:1 release
drove the population to elimination after 15 weeks of release .
these results indicate
that thiotepa exposure is an effective means of sterilising ae .
aegypti
and males thus treated are able to reduce the reproductive capacity of a
stable population under laboratory conditions .
further testing of the method in
semi - field enclosures is required to evaluate the mating competitiveness of sterile
males when exposed to natural environmental conditions .
if proven effective , sit
using thiotepa - sterilised males may be incorporated into an integrated programme of
vector control to combat dengue in cuba . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the 1950s , pulse - chase experiments using radioactive precursors showed that ~95% of the rna made in mammalian nuclei is degraded within minutes . at the time , no credible reason could be proposed for this astonishing turnover , and only later did we discover it results from the destruction of non - coding rnas and intronic regions within coding transcripts . while such synthesis and destruction appears utterly wasteful , it is nevertheless an integral part of metabolism . at the molecular level for example , for every 100 transcripts initiated by a bacterial polymerase in vitro and in vivo , ~99 abort within ~10 nucleotides . these aborting transcripts are not contained in current catalogs of transcripts made using rna - seq , as they are too short to be mapped . eukaryotic polymerases then undergo a structural transition on escape from the promoter , but many stall and/or abort prematurely after 20500 nucleotides to give the promoter - proximal peak seen by rna - seq . consequently , the production of each full - length sense transcript is accompanied by the synthesis of > 100 shorter products . in a human cell , the associated energy costs must be marginal , as typically nine - tenths of a message will now be spliced out and degraded . unfortunately , there is little data on the half - lives of prematurely - terminated products , but it is likely they will be less than those of an intron ( typically ~5 min ) simply because they are so much shorter . note that even the machines that we expect to perform precisely also initiate inefficiently ; most unique sequences in dividing human cells are present in equimolar amounts , but ~200-bp segments from origins of replication are in excess and are presumably generated as dna polymerases abort . ( a ) strings of red spheres depict nucleotides ( nts ) incorporated into ~300 transcripts being copied from sense / anti - sense strands of a 15-kbp gene in a cell population . most polymerases abort prematurely to yield short unstable transcripts of 210 nucleotides from both strands , a few pause / abort after generating unstable transcripts of 20500 nucleotides , and only one generates a stable full - length transcript . the numbers of transcripts in each class are not known , and are included for illustrative purposes only ; however , there are probably so many short aborting ones of 210 nucleotides that the same general conclusion can be drawn irrespective of precise numbers . ( b ) after 20 ms ( when an elongating polymerase incorporates ~1 labeled nucleotide ; yellow ) , most incorporated label is in short transcripts that soon abort and are quickly degraded ; the long transcript contains one label , which goes undetected using most current methods . ( c ) after 5 min ( when a polymerase incorporates ~15 000 nucleotides ) , the one stable transcript is completely filled with label ; however , label incorporated early during the pulse into the many short aborting transcripts has turned over ( and so goes undetected ) . imagine that we could see every nucleotide in every transcript copied from a typical human gene as it is incorporated during a 20-ms pulse ( when a polymerase adds ~1 nucleotide ) , and know what its fate might be ( fig . as the process is so inefficient , most labels at the end of the pulse will be in the many short transcripts that soon abort ( and are degraded rapidly , probably within seconds ) . only a tiny fraction will be in molecules that contribute to the stable transcriptome . now imagine we repeat the experiment using a 5 min pulse ( long enough for a polymerase to transcribe the gene ; fig . all transcripts labeled early on will have been degraded , and the few contributing to the stable transcriptome will contain a much higher fraction of label ( because they are both stable and longer ) . as traditional methods usually require pulses of > 5 min to allow detection of the full - length rna ( usually the one of interest ) , they completely miss the rapidly turning - over fraction . in contrast to transcription , current reviews see a ribosome initiating efficiently , and then most being able to translate all the way to a termination codon without mishap although some will stall to be rescued by pathways like those involved in non - stop and no - go decay . most products made by ribosomes are also seen as stable , with the half - life of a typical human protein being ~20 h ( this average covers a wide range varying from minutes to tens of hours ) . if production is efficient , and most products are stable , then the efficiency of translation must be very different from that of transcription ! genome sequences are annotated using complex assumptions , and it remains difficult to predict which segments encode open - reading frames ( orfs ) that are translated into protein , especially when those segments are short . for example , it was initially assumed that orfs should be longer than 300 nucleotides , but ~10% of mouse orfs are shorter than this , and both ribosome profiling ( a method for monitoring ribosome binding along a message ) and proteomics show that many such short orfs ( sorfs ) are translated , whether they lie in genic or non - coding rnas . about 50% of human mrnas also encode upstream open - reading frames ( uorfs ) of 9 nucleotides ( median length 48 nucleotides ) ; many of these uorfs are as evolutionarily conserved as orfs , and are translated into products that are present in 102,000 copies in the cell . for example , translation of uorfs reduces expression of associated orfs , and mutations introducing a uorf into the 5 leader of the mrna encoding cdkn2a predisposes individuals to melanoma , in ldlr to familial hypercholesterolemia , and in cftr to cystic fibrosis . some products of sorfs are also medically important , like gnrh1 in hormonal signaling , ccl / cxcl members in innate immunity , and defensins in pathogen protection . only now are the dedicated pipelines needed for their detection being developed , with 74 new human peptides at the tip of the iceberg being found in a recent survey . experiments using short pulses have uncovered an incredibly - high turnover of newly - made peptides . these short pulses were being used in an attempt to solve an old chestnut whether or not translation occurs in nuclei and we now digress to discuss this . studies in the 1950s showed that isolated nuclei could incorporate radiolabeled amino acids into acid - insoluble protease - sensitive material , and this provoked a debate about whether this ( apparently nuclear ) synthesis was due to contamination by cytoplasmic ribosomes . subsequently , it was shown that protein synthesis in bacteria is often spatially coupled to transcription , and it was expected it would be the same in eukaryotes . but the discovery of introns seemed to provide a good reason why such coupling should not occur : if nuclear ribosomes translated introns which possess many termination codons too many truncated peptides would be produced , and some would surely be toxic . clearly , restricting intron - containing rna to nuclei , and translation of intron - free mrna to the cytoplasm , this killed the idea that any translation might occur in nuclei . from time to time , the debate concerning nuclear translation has been re - opened . for example , translation is involved in proofreading mrna during nonsense - mediated decay ( nmd ) . nmd involves the detection of inappropriately - placed termination codons in transcripts and degradation of the faulty rna . as some nmd may occur in human nuclei , and as a translating ribosome is the only known mechanism able to detect stop codons , this points to some nuclear ribosomal activity . ( however , contrary findings indicate that nmd is predominantly cytoplasmic in yeast and mammals . ) thus , when hela cells are permeabilized and allowed to extend nascent peptides by ~15 residues in the presence of a translational precursor like biotin - lys - trna ( and triphosphates required for transcription ) , ~10% of the label in newly - made protein is nuclear ; this signal is reduced by incubation with transcriptional inhibitors , which suggests that some translation is biochemically coupled to transcription . more recently , cells were pulsed for 5 min with puromycin ( a structural mimic of aminoacyl - trna ) , permeabilized , and fixed ; puromycin is incorporated by ribosomes into c - termini of nascent peptides , and it was then immuno - localized using an anti - puromycin antibody . however , in both cases cells were permeabilized , and so critics can say cytoplasmic ribosomes were now able to enter nuclei to give rise to artifactual signals . and although initiation factors , ribosomal proteins , and 80s ribosomes are all found in the nucleoplasm close to transcription sites , this might be expected : ribosomes are made in nucleoli and have to be exported through the nucleoplasm to get to the cytoplasm . we can then summarize this digression as follows : since introns were discovered , the overwhelming consensus has been that all translation occurs in the cytoplasm . baboo et al . revisited the question whether there was any nuclear translation using intact cells , and pulses too short to allow peptides made by cytoplasmic ribosomes to enter nuclei during the pulse . azido - homoalanine ( aha ) is a met analog that possesses a reactive azide group , and aha - containing peptides can be localized after clicking hela cells ( or primary diploid human cells ) were fed aha for periods as short as 5 s ( during which a ribosome in a living cell polymerizes ~25 residues , or ~one - sixteenth the length of a typical protein ) . results obtained using a 2 min aha pulse are illustrated in figure 2 , and they are astonishing in two respects . first , there is clear nuclear signal which appears brighter than the cytoplasmic one , although integration over the larger cytoplasmic area shows nuclei contain slightly less than half of all signals . signals are reduced by pretreatment with translational inhibitors ( so ribosomes are involved ) , and increased by pretreatment with a proteasomal inhibitor ( so label is in protein ) . second , signals in both compartments disappear during chases with half - lives of less than a minute , so that almost none remains after 5 min . figure 2 . hela cells were starved of met for 15 min to deplete pools , pulsed for 2 min 2 mm aha , and chased ( 05 min ; 0.2 mm met without aha ) . after fixation and clicking on alexa 555 , dna was counterstained with dapi , images collected using a wide - field microscope , and fluorescence intensities of alexa 555 ( sd ) seen during the chase in the cytoplasm and nucleus normalized relative to values at 0 min . ( b ) after a 2 min aha pulse , nuclei appear the brightest ; however , integration over the larger area of the cytoplasm indicates that this compartment contains slightly more signal . ( c ) if the 2 min pulse is followed by a 5 min chase , essentially no signal is seen . ( d ) alexa 555 fluorescence in both nucleus and cytoplasm declines rapidly during a chase . from baboo et al . essentially similar results are obtained using two structurally - unrelated precursors puromycin ( immunolocalized as above ) and heavy amino acids . in the latter case , amino acids were tagged with n ( or c ) , and distributions of incorporated n ( or c ) were mapped using a mass spectrometer attached to a microscope an approach called nanosims ( high - resolution secondary - ion mass spectrometry ) . in a variant experiment , hela cells were incubated for 2 min in both [ c]amino acids and [ n]amino acids ; then , ( cn ) ions derived from both nucleus and cytoplasm could be detected . signals were again sensitive to ribosomal inhibitors , and decayed with half - lives of < 1 min . this is consistent with the coupling by a ribosome of two different amino acids into one peptide bond , followed by the rapid destruction of that bond . the answer is simple : we should only expect to detect it using a pulse that is roughly the length of the half - life , and such short pulses have not been used previously . how can these results be reconciled with the known ~20 h half - life of the mature proteome ? once we remember that this half - life was measured using pulses lasting days , the answer is again simple . just as only a tiny fraction of label incorporated during a short pulse is found in the one stable transcript in figure 1 , a 5 s or 2 min pulse should not be expected to label much of the mature proteome if a substantial amount of abortive translation and rapid turnover occurs . but we should expect more labels to be incorporated into that mature proteome using longer pulses , and it is . thus , if the experiment in figure 2c is repeated using 10 min and 1 h pulses , progressively more signals survive the 5 min chase . finally , making a peptide is energetically costly , so how can the system support such waste ? again the answer is simple : the cost must be marginal , as it is for transcription . the extraordinary turnover is simply explained if the efficiency of translation is like that of transcription . just as the polymerization of one full - length transcript is associated with an unproductive turnover of many shorter ones ( fig . 1 ) , we suggest that the polymerization of each full - length peptide is regulated by the synthesis of many shorter peptides that are rapidly degraded . we envisage the scale of the peptide abortion has been underestimated , with perhaps only one in 20 initiated ribosomes translating all the way to a termination codon to generate a product that will contribute to the mature proteome . we speculate that most recently - initiated ribosomes abort close to the beginning of uorfs , sorfs , and orfs because they fail to escape ( like an rna polymerase ) into a structure that allows stable elongation ( fig . 3 ) ; then , the resulting short peptides ( combined with those made by translating to ends of many uorfs and sorfs ) are degraded rapidly . figure 3 . a model illustrating how dark - matter peptides ( green lines i - iii ) and the mature proteome ( iv ) might arise . most initiated ribosomes terminate prematurely ( giving i and iii ) , and some translate to the end of the uorf ( giving ii ) ; the resulting peptides are rapidly degraded ( half - life < 1 min ) , to give rise to the astonishing turnover seen using short pulses . a minority of ribosomes translates the whole orf ( giving iv ) ; such peptides are the ones detected conventionally using long pulses ( they are generally stable and contribute to the mature proteome ) . from baboo this dark - matter world of aborting peptides has been hidden from our view for reasons much like those that had obscured dark - matter rna . ( 1 ) as illustrated in figure 1 , such a fraction can only be detected using a pulse time roughly the order of the half - life , and then so little label is incorporated that biochemical detection is challenging . ( 2 ) translation was traditionally monitored by incubation in radioactive amino acids , followed by protein precipitation with trichloroacetic acid and scintillation counting ; however di- and/or tri - peptides ( and probably longer ones too ) are not precipitated and so were missed using this traditional approach . short peptides are retained during the fixation used for microscopy , compared with the traditional acid extraction . ) ( 3 ) short peptides are also missed during gel electrophoresis ; those with < 100 residues run together in most gels at the front , and those with < 10 remain unresolved even in dedicated gels . in both cases , they are difficult to detect because they bind proportionally less of any stain , and/or pass through membranes without binding during blotting . ( 4 ) if shorter than ~12 residues , they become indistinguishable from the background produced by proteasomes . ( 5 ) by analogy with a polymerase , a recently - initiated ribosome may bind less tightly to its mrna than one that has translated further and so might be more likely to detach . this could explain why ribosome profiling uncovers only a small peak of bound ribosomes near initiation codons ( as unstable ones detach ) , and why translation inhibitors increase the area of this peak by freezing unstable ones on the message . ( 6 ) most peptides with < 6 peptides can not be mapped uniquely within the human proteome by mass spectrometry , and so are missed using current approaches . the abortive synthesis and turnover probably play additional important roles including : ( 1 ) a nuclear ribosome might proofread a pre - mrna as it is being made to see if it has been spliced appropriately ( and so does not contain premature termination codons ) . then , the faulty rna and truncated peptide produced as a by - product would be degraded ( it was stated earlier that the discovery of introns killed the idea that translation might occur in nuclei because ribosomes must be prevented from translating intron - containing transcripts ; however , a nuclear ribosome would not see a termination codon in an intron if that ribosome was so placed it could only act on the transcript once splicing had occurred . ) ( 2 ) if such nuclear proofreading of mrnas is error - prone , perhaps the system has a second go with a cytoplasmic ribosome at detecting a mis - spliced transcript once that transcript reaches the cytoplasm ( with consequential degradation of truncated peptides produced as by - products ) . ( 3 ) some mechanism must also exist to weed out the many non - coding transcripts like the anti - sense promoter transcripts ( which are immediately degraded ) from the few sense ones that go on to contribute to the stable transcriptome . again , ribosomes acting co - transcriptionally as part of the nmd machinery could sense the difference between the two ( as non - coding transcripts probably contain many stop codons ) . ( 4 ) many more proteins than hitherto expected may misfold during synthesis , to be degraded immediately . ( 5 ) in the special case of antigen - presenting cells , some newly - made peptides may be processed rapidly , and the resulting fragments used in the defense against infection . in all these cases whether it be nuclear ribosomes that specialize in proofreading newly - made transcripts , or cytoplasmic ones dedicated to mass - production the result is the same : inefficient translation , abortive production , and rapid degradation of resulting peptides . the discovery of any new world always raises many questions . for example , how many different fractions of short peptides are there in a cell , how quickly does each one turn over , and what are the associated energy costs ? critically , we also need to establish what roles the peptides in each fraction might play , and what additional effects the turnover might have . thus , fluorescent tagging of proteins and super - resolution microscopy allow us to monitor interactions in living cells in ever - sharper detail . moreover , we can use new bioinformatic pipelines to identify sorfs , ribosome profiling to see if they are translated , and however , we have seen that many challenges remain , especially in detecting and mapping short peptides . and like their counterparts in the rna world | astrophysicists use the term dark matter to describe the majority of the matter and/or energy in the universe that is hidden from view , and biologists now apply it to the new families of rna they are uncovering . we review evidence for an analogous hidden world containing peptides .
the critical experiments involved pulse - labeling human cells with tagged amino acids for periods as short as five seconds .
results are extraordinary in two respects : both nucleus and cytoplasm become labeled , and most signals disappear with a half - life of less than one minute . just as the synthesis of each mature mrna
is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded , it seems that the synthesis of each full - length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides .
some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly - made rna for inappropriately - placed termination codons ( a process that triggers nonsense - mediated decay ) . we speculate that some dark - matter peptides will play other important roles in the cell . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the structure and function of endocrine glands ( i.e. , well - developed peripheral blood vessels and hormone secretion ) make them particularly susceptible to autoimmune disease . autoimmune thyroid disease ( aitd ) may occur when genetically susceptible individuals are exposed to environmental modulating triggers such as infection , iodine , or stress . the effects of antibodies and effector t cells specific for thyroid antigens lead to the progressive destruction of normal thyroid tissue . the autoimmune response in graves ' disease ( gd ) is biased towards a cd4 th2 response and is focused on antibody production . the production of anti - tsh - receptor antibodies promotes chronic overproduction of thyroid hormone . the fact that gd and hd are commonly observed in the same family tree reflects a similar genetic basis for the 2 diseases [ 4 , 5 ] . the major histocompatibility complex ( mhc ) class i chain - related gene a ( mica ) is located within the human mhc locus , centromeric to hla - b and telomeric to hla - drb1 . in response to stress ( e.g. , viral infection , dna damage , or malignant transformation ) , mica proteins are expressed on the surface of freshly isolated gastric epithelial and endothelial cells and fibroblasts , where they engage the activating receptor nkg2d , which is expressed by nk , nkt , cd8 + t , and t cells , and activated macrophages . although the relationships between nkg2d and mica polymorphisms associated with autoimmune and neoplastic diseases , including ankylosing spondylitis , behet 's disease , psoriasis vulgaris , and kawasaki 's disease , have been defined , this is not the case for the association of mica alleles with aitd . in the present study , we aimed to assess the association between mica polymorphisms , as classified by the world health organization ( who ) , with korean children with aitd . we also evaluated the frequencies of the mica allele according to age , sex , and thyroid - associated ophthalmopathy ( tao ) in patients with aitd . the present study included 81 patients diagnosed with aitd ( 36 hd ; 45 gd ) who were treated in the pediatric endocrine clinic of seoul st . seventy - three patients were also included in previously by us . for comparison , 70 genetically unrelated healthy korean adults without a history of aitd were studied as a control group . the control subjects consisted mainly of staff and students from the medical college of the catholic university of korea . hd was diagnosed when at least 3 of the following fisher 's criteria were met : ( 1 ) goiter , ( 2 ) diffuse goiter and decreased radionuclide uptake during thyroid scan , ( 3 ) presence of either circulating thyroglobulin or microsomal autoantibodies or both , and ( 4 ) hormonal evidence of hypothyroidism . the diagnosis of gd was based on the confirmation of clinical symptoms and the biochemical confirmation of hyperthyroidism , including the diagnosis of goiter , the elevated i uptake by the thyroid gland , the presence of antibodies reactive against the tsh receptor , and the elevated thyroid hormone levels . patients with other forms of autoimmune diseases , hematologic diseases or endocrine diseases , or both were excluded . genomic dna was extracted from 4 ml of peripheral blood mixed with ethylenediaminetetraacetic acid ( edta ) using the accuprep dna extraction kit ( bioneer , daejeon , republic of korea ) and stored at 20c . pcr amplifications were performed in 10 l reaction mixtures in 96-well thin - walled trays ( nippon genetics , tokyo , japan ) . the reaction mixtures consisted of 1.52.0 m sequence - specific primers , 0.1 g genomic dna , 20 mm ( nh4)2so4 ( sigma , dorset , uk ) , 75 mm tris - hcl ( ph 8.8 ) ( sigma , dorset , uk ) , 200 m of each dntp ( roche , mannheim , germany ) , 1.75 mm mgcl2 ( sigma , dorset , uk ) , 0.22 units of taq polymerase ( intron biotechnology , seongnam , republic of korea ) , and 0.15 m internal control primers that amplify an 834 bp portion of the human growth hormone gene ( 5 primer , gccttcccaaccattccctta ; 3 primer , gagaaaggcctggaggattc ) . a mycycler thermalcycler ( bio - rad inc . , hercules , ca , usa ) was used to perform pcr as follows : initial denaturation at 95c for 90 s ; 10 cycles of denaturation at 95c for 30 s , annealing at 64.5c for 50 s , and elongation at 72c for 20 s ; 10 cycles of denaturation at 95c for 30 s , annealing at 61.5c for 50 s , and elongation at 72c for 30 s ; 10 cycles of denaturation at 95c for 30 s , annealing at 60c for 50 s , and elongation at 72c for 40 s , followed by cooling to 20c . ten microliters of each reaction was electrophoresed through 1.5% agarose gels containing 2.5 g / ml ethidium bromide ( sigma aldrich , mo , usa ) for 22 min at 250 mv in 1 tbe buffer . we evaluated the mica allele frequencies according to age , sex , and thyroid - associated ophthalmopathy ( tao ) in aitd . the diagnosis of tao was based on the presence of typical clinical features and was classified according to the criteria of the american thyroid association [ 14 , 15 ] . patients with no symptoms or with only the lid lag sign were considered to have non - tao , whereas those with soft tissue changes , proptosis or extraocular muscle dysfunction , or both were considered to have a disease of the eye . the statistical package for social sciences 12.0 for windows ( spss , chicago , il , usa ) was used for statistical calculations . the significance of the difference in the distribution of mica alleles was assessed using the chi - square and fisher 's exact tests . multiplication of the p value by the number of comparisons for calculating corrected p value ( pc ) was done , and pc below 0.05 is considered significant . the relative risk was calculated using the woolf formula and handan 's modification for cases in which the variables included zero . the frequencies of hla - a , b , c , drb1 , and mica were calculated by direct counting , and the patterns of two locus haplotypes and hardy - weinberg equilibrium for mica were estimated using the maximum - likelihood method with the expectation - maximization ( em ) algorithm using pypop [ 17 , 18 ] . in the analyses of the association of aitd , mica010 , and hla alleles , the basic data are tabulated in a 2 4 table . the data were analyzed using test numbers ( 1)(8 ) ( table 4 ) , including stratification of each of the associated factors against each other and are presented in a series of 2 2 tables . a stronger association of 1 allele is established when it is significantly associated with the condition of individuals positive or negative for the other associated allele . the subject group consisted of 81 patients ( 65 girls and 16 boys ) with aitd . aitd was categorized as hd ( n = 36 ) and gd ( n = 45 ) . twenty - three patients were diagnosed with tao , 21 with gd ( 21/45 , 46.6% ) , and 2 with hd ( 2/36 , 5.5% ) . for patients with aitd , the allele frequencies of mica*010 ( or = 2.21 ; 95% ci , 1.303.76 , p < 0.003 , pc < 0.042 ) were higher than the control group ( table 1 ) . significant differences were not detected in mica allele frequencies according to sex and age in patients with aitd ( data not presented ) . among patients with gd , those without tao ( n = 24 ) exhibited higher frequencies of mica*010 ( or = 2.99 ; 95% ci , 1.476.08 , p < 0.003 , pc < 0.042 ) and lower frequencies of mica*008 ( or = 0.08 ; 95% ci , 0.010.62 , p < 0.001 , pc < 0.014 ) than did the normal control group . there were no significant differences in the frequencies of mica allele frequencies between the non - tao and tao groups ( table 2 ) among patients with gd . for patients with aitd , two - locus haplotypes with frequencies higher than 3% were as follows : mica*010-hla - a*02 ( 26.6% ) , mica*010-hla - b*46 ( 22.5% ) , mica*010-b*62 ( 8.0% ) , mica*010-hla - c*01 ( 22.9% ) , mica*010-hla - c*04 ( 4.2% ) , mica*010-hla - c*09 ( 3.5% ) , mica*010-hla - dr*08 ( 16.0% ) , and mica*010-hla - dr*09 ( 4.9% ) . all of these two - locus haplotypes showed high linkage disequilibrium ( table 3 ) , and the strongest linkage disequilibrium was observed between mica*010 and hla - b*46 . in control subjects , the two - locus haplotypes with frequencies higher than 3% were as follows : mica*010-hla - a*02 ( 8.5% ) , mica*010-hla - b*46 ( 6.6% ) , mica*010-b*62 ( 9.56% ) , mica*010-hla - c*01 ( 8.8% ) , mica*010-hla - c*09 ( 3.0% ) , and mica*010-hla - dr*08 ( 5.9% ) ( data not presented ) . we investigated the relative strength of the associations of mica*010 and hla - b*46 with aitd . test numbers ( 1 ) and ( 2 ) showed that both were associated with aitd . hla - b*46 showed an association in mica*010-negative ones ( test numbers ( 6 ) ) . according to test number ( 8) various hypotheses have been proposed to explain the role of mica in autoimmune diseases . with respect to tissue subjected to stress , the recognition of mica by cells expressing nkg2d might participate in the induction of autoimmune diseases . autoreactive immune cells expressing mica are also recognized and killed by nkg2d - activated nk cells . if the autoreactive immune cells escape from the attack of the nkg2d - bearing cells , they have the potential to proliferate and induce pathological autoimmunity . in our present study , the frequency of the mica*010 allele in patients with aitd was higher than that in the control group . those of mica*004 ( or = 0.16 ; 95% ci , 0.040.76 , p < 0.015 , pc < 0.21 ) and mica*008 ( or = 0.42 ; 95% ci , 0.220.81 , p < 0.010 , pc < 0.14 ) in patients with aitd were lower than in the control group but not significant ( table 1 ) . in a recent study , the frequencies of the mica a5 and a5.1 alleles were higher and lower , respectively , for chinese children with gd compared with the control groups . according to the nomenclature recommended by the who ( http://www.anthonynolan.org.uk/hig/ , in july 2012 ) , mica*010 is included with mica a5 , and mica*008 is included with mica a5.1 . therefore , the results of our study are similar to those of the study conducted in china , although there are no reports on the association between mica and aitd in other populations . more than 50 human mica alleles have been recognized , and the frequencies of each allele are different in different populations . mica*008 is the most common allele in caucasians with an allele frequency of 46% , but it is very rare in koreans with an allele frequency of 10% . in koreans , mica*010 is the most common allele . the mica gene comprises 6 exons , which encode a leader peptide , 3 distinct extracellular domains ( 1 , 2 , 3 ) , a transmembrane domain , and a cytoplasmic tail , respectively . single amino acid substitutions occur frequently within exons 24 , which encode the 3 extracellular domains . in mica*010 , a proline residue is substituted for an arginine residue at position 6 in the first strand of the 1 domain . the single proline substitution disrupts the secondary structure of the sheet , interfering with the folding of the protein , and abolishes its expression by inhibiting its ability to translocate to the cell surface . therefore , nk cell may be more downregulated in mica*010-positive patients with aitd than in the control groups . mica*008 is expressed as a soluble molecule , because it is encoded by a sequence that contains a single - nucleotide insertion , which results in the synthesis of a protein truncated within the transmembrane region . this particular form of mica*008 , which is distinct from products of other alleles of mica , is generated by a different mechanism of release from the cell surface involving enclosure in exosomes [ 26 , 27 ] . elevated levels of soluble mica have been detected in the sera of patients with various types of cancer , and the levels of soluble mica can be used as a diagnostic marker for cancer progression . the release of soluble mica from tumor cells reduces the cell surface density of mica , leading to reduced susceptibility to nkg2d - mediated cytotoxicity and systemic downregulation of the cell surface expression of nkg2d on effector cells . in our study , the frequencies of mica*008 in patients with aitd tend to be lower than the control group . these results may suggest that nkg2d - bearing cell activation is more upregulated in patients with aitd than the control groups . in patients with rheumatoid arthritis , large amounts of soluble mica , presumably derived from synoviocytes , were detected in serum , and they might be stimulating autoreactive t cells . these data suggest a potential role for mica gene polymorphisms in the susceptibility to autoimmune disease [ 28 , 29 ] . along with ethnic diversity of the distribution of mica alleles , the allelic frequencies of mica*019 , the other soluble form of mica , are very low in the korean population . therefore , no significant difference was observed in the allele frequencies of mica*019 between the aitd and the control groups . tao is a common inflammatory autoimmune disease of the orbit , which is very closely associated with gd and is considered an autoimmune response against one or several ophthalmological autoantigens shared with the thyroid . nearly 80% of gd patients exhibit symptoms involving the eyes , and half of these patients exhibit clinically significant tao . in our present study , 23 of 81 patients were diagnosed with tao and included 21/45 ( 46.6% ) patients with gd and 2 ( 2/36 , 5.5% ) patients with hd . although the precise pathophysiology of tao remains unclear , it is likely to reflect an autoimmune reaction involving sensitized t lymphocytes and autoantibodies directed against specific orbital or thyroid - and - orbital shared antigens . several studies have reported associations between tao and mhc class i , ii , and ctla4 ; however , association of mica alleles with tao have not been reported . we observed an increased frequency of the mica*010 allele and a decreased allele frequency of mica*008 in the non - tao gd group compared with controls . therefore , we suggest that mica*010 and mica*008 may be protective and deleterious alleles , respectively , in patients with tao . mica might be in linkage disequilibrium with hla because of its proximity to those of hla - b and hla - c loci . therefore , we investigated the two - locus haplotype frequencies between mica*010 and hla in the aitd group . the data indicate that the two - locus haplotype frequencies identified in order of highest to lowest were as follows : mica*010-a*02 , mica*010-c*01 , mica*010-b*46 , and mica*010-dr*08 in patients with aitd . all of these two - locus haplotypes exhibited significant linkage disequilibrium , with the strongest observed between mica*010 and hla - b*46 . the frequency of the mica*010-hla - b46 two - locus haplotype was estimated as 5.8% and that of mica*010-hla - dr*08 was estimated as 5% in the korean population . analysis of the disease associations of mica*010 and hla - b*46 with aitd revealed the associations of mica*010 and hla - b*46 with aitd . although the mica*010 association was weaker than that of hla - b*46 , these results may suggest an association of the mica allele with aitd . in this study , we observed increased frequency of the mica*010 in korean pediatric patients with aitd compared with the controls . non - tao gd patients exhibited higher frequencies of mica*010 and lower frequencies of mica*008 compared with the controls . however , this information may provide basic data on the association of mica polymorphism with pathogenesis of aitd . a larger and statistically more powerful molecular study | background .
major histocompatibility complex class i chain - related gene a ( mica ) is a ligand for the activating nkg2d receptor expressed on natural killer ( nk ) cells .
we aimed to assess the association of mica polymorphism with autoimmune thyroid disease ( aitd ) in korean children . methods .
eighty - one patients with aitd were recruited .
we analyzed mica polymorphisms by pcr - ssp and compared the results with those of 70 healthy controls .
results . in aitd ,
the allele frequencies of mica010 ( or = 2.21 ; 95% ci , 1.303.76 , p < 0.003 , pc < 0.042 ) were higher than those of controls .
patients who did not have thyroid - associated ophthalmopathy showed higher frequencies of mica010 ( or = 2.99 ; 95% ci , 1.476.08 , p < 0.003 , pc < 0.042 ) and lower frequencies of mica008 ( or = 0.08 ; 95% ci , 0.010.62 , p < 0.001 , pc < 0.014 ) compared to those of controls .
hla - b46 , which shows the strongest association with aitd compared with other hla alleles , showed the strongest linkage disequilibrium with mica010 .
analyses of the associations between mica010 and hla - b46 with aitd suggest an association of the mica allele with aitd . conclusions .
our results suggest that innate immunity might contribute to the pathogenesis of aitd . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
three hundred ninety - three patients had cerebral decta in our department from february 2014 to july 2013 . a total of 35 consecutive patients presented with massive spontaneous sah suspected for intracranial aneurysms were retrospectively evaluated . three patients with intracranial metal artifacts and 2 patients with inadequate data sets were excluded . the group of patients was consisted of 12 men and 18 women , with a mean age of 61.73 years ranging from 28 to 80 years . all of the patients were scanned on a second - generation dual - source ct system ( definition flash ; siemens ag , forchheim , germany ) . all cerebral cta were performed using dual - source , dual - energy mode , with the tube voltage and current 80 kvp / sn140 kvp and 177 ma/89 ma , respectively . the other parameters used included the following : 2 128 0.6 mm acquisition collimation by using flying focus spot ; gantry rotation time , 0.28 second ; pitch , 0.7 ; 0.75-mm slice thickness ; and 0.5-mm slice distance with 250-mm scan field of view and a medium soft convolution kernel of d10f . the caudal - cranial direction was used for all imaging . the contrast agent ( 350 mg iodine / ml , iohexol ; beilu pharma , beijing , china ) was intravenously injected through antecubital vein via 20-gauge needle by a power injector ( sct-210 ; medrad inc , indianola , pa ) . a total amount of 40 ml contrast agent , followed by 40 ml saline solution at flow rates of 4 ml / s , was used for all patients . the scan delay was individually determined by a bolus - tracking technique with trigger threshold set at 100 hounsfield unit ( hu ) on the ascending aorta . all images were transferred to a workstation ( mmwp ; siemens ag , forchheim , germany ) for image evaluation . after decta acquisition , the linear mixing image sets were reconstructed automatically using a ratio of 0.6 ( 0.6 80 kvp + 0.4 140 kvp ) . the optimized images using nonlinear image blending method were reconstructed based on a modified sigmoid function ( fig . 1 ) , which was referred to as optimum contrast in the commercial software supplied within the workstation . the blending center and blending width were set around 100 to 150 hu and 20 to 30 hounsfield unit ( hu ) , respectively , in the nonlinear image blending process . illustration of the linear ( a ) and nonlinear ( b ) image blending technique in decta . in linear blending method , the 2 energy data sets were blended with a fixed ratio ( 0.6 ) for each pixel independent of the voxel ct value . in nonlinear blending method ( a modified sigmoid function referred to as moidal blending function ) , however , the mixing ratio of each pixel was calculated according to its attenuation value and adjusted by the 2 parameters bc and bw . pixels with ct values less than bc - bw/2 in the linearly blended reference images were shifted toward a blending ratio of 0.3 for a minimized noise ; pixels with ct value greater than the bc + bw/2 were shifted toward a 100% weight of low kv data sets for a maximized contrast ; pixels with ct value within the range of bw were blended with a variable ratio increased linearly as demonstrated by the oblique line . the ct volume dose index and the dose - length product were automatically determined and recorded from the ct scanner at the end of each examination . the mean ct volume dose index and dose - length product for the decta were 6.53 0.23 mgy and 120 11.67 mgy cm , respectively . the quantitative image quality was evaluated by cerebral artery enhancement , attenuation of sah , image noise , and the following calculated signal - to - noise ratio ( snr ) and contrast - to - noise ratio ( cnr ) . for each patient , the attenuation values of the proximal segment ( m1 ) of middle cerebral arteries ( mcas ) ( which was defined as the cerebral artery enhancement ) and the surrounding sah were measured at the same slice and same location of the 2 image sequences . the regions of interest ( roi ) was maintained as large as possible with vessel wall and calcifications and/or soft plaques avoided . the image noise was defined as the standard deviation of the attenuation value measured in vitreous with roi as larger as possible ( fig . signal - to - noise ratio was calculated as the attenuation values of m1 divided by image noise , and cnr was the contrast divided by image noise . the roi was placed at the m1 segment of mca ( a ) and the surrounding sah ( b ) . the image noise was defined as the standard deviation of the attenuation value measured in vitreous with roi as larger as possible ( c ) . all of the images were evaluated independently by 2 neuroradiologists who were blinded to patient history and the blending methods . the maximum intensity projection images were used for evaluation on a commercial workstation ( mmwp ) . when there was a discrepancy between 2 readers , cerebral arteries were rated per segment on a 5-point scale : 5 , excellent , no obvious image noise and artifacts , sharp vessel structures , and satisfactory details ; 4 , good , mild image noise and artifacts , less clear vessel structures and details ; 3 , fair , moderate image noise and artifacts , optimal enhancement but insufficient for diagnosis ; 2 , poor , severe image noise and artifacts , suboptimal vessel , inadequate for diagnosis ; 1 , undiagnosable , severe image noise and artifacts , blurry vessel structures , no diagnosis possible . the segments surrounding the circle of willis , including bilateral middle cerebral artery ( m1 , m2 ) , anterior cerebral artery ( a1 , a2 ) , posterior cerebral artery ( p1 , p2 ) , anterior communicating artery , and posterior communicating artery , were evaluated , respectively . the statistical analysis was performed using spss ( spss version 15 ; spss inc , chicago , ill ) . the paired student t test was used to compare the ct values of the intracranial artery and the background sah , image noise , snr , and cnr between the linear and nonlinear blending images . the wilcoxon mann - whitney tests were used to estimate the segmental scorings of the 2 image sequences . the interobserver and intraobserver agreement was calculated by test ( < 0.2 , slight or poor agreement ; 0.20.4 , fair agreement ; 0.40.6 , moderate agreement ; 0.60.8 , substantial agreement ; > 0.8 , excellent agreement ) . three hundred ninety - three patients had cerebral decta in our department from february 2014 to july 2013 . a total of 35 consecutive patients presented with massive spontaneous sah suspected for intracranial aneurysms were retrospectively evaluated . three patients with intracranial metal artifacts and 2 patients with inadequate data sets were excluded . the group of patients was consisted of 12 men and 18 women , with a mean age of 61.73 years ranging from 28 to 80 years . all of the patients were scanned on a second - generation dual - source ct system ( definition flash ; siemens ag , forchheim , germany ) . all cerebral cta were performed using dual - source , dual - energy mode , with the tube voltage and current 80 kvp / sn140 kvp and 177 ma/89 ma , respectively . the other parameters used included the following : 2 128 0.6 mm acquisition collimation by using flying focus spot ; gantry rotation time , 0.28 second ; pitch , 0.7 ; 0.75-mm slice thickness ; and 0.5-mm slice distance with 250-mm scan field of view and a medium soft convolution kernel of d10f . the caudal - cranial direction was used for all imaging . the contrast agent ( 350 mg iodine / ml , iohexol ; beilu pharma , beijing , china ) was intravenously injected through antecubital vein via 20-gauge needle by a power injector ( sct-210 ; medrad inc , indianola , pa ) . a total amount of 40 ml contrast agent , followed by 40 ml saline solution at flow rates of 4 ml / s , was used for all patients . the scan delay was individually determined by a bolus - tracking technique with trigger threshold set at 100 hounsfield unit ( hu ) on the ascending aorta . all images were transferred to a workstation ( mmwp ; siemens ag , forchheim , germany ) for image evaluation . after decta acquisition , the linear mixing image sets were reconstructed automatically using a ratio of 0.6 ( 0.6 80 kvp + 0.4 140 kvp ) . the optimized images using nonlinear image blending method 1 ) , which was referred to as optimum contrast in the commercial software supplied within the workstation . the blending center and blending width were set around 100 to 150 hu and 20 to 30 hounsfield unit ( hu ) , respectively , in the nonlinear image blending process . illustration of the linear ( a ) and nonlinear ( b ) image blending technique in decta . in linear blending method , the 2 energy data sets were blended with a fixed ratio ( 0.6 ) for each pixel independent of the voxel ct value . in nonlinear blending method ( a modified sigmoid function referred to as moidal blending function ) , however , the mixing ratio of each pixel was calculated according to its attenuation value and adjusted by the 2 parameters bc and bw . pixels with ct values less than bc - bw/2 in the linearly blended reference images were shifted toward a blending ratio of 0.3 for a minimized noise ; pixels with ct value greater than the bc + bw/2 were shifted toward a 100% weight of low kv data sets for a maximized contrast ; pixels with ct value within the range of bw were blended with a variable ratio increased linearly as demonstrated by the oblique line . the ct volume dose index and the dose - length product were automatically determined and recorded from the ct scanner at the end of each examination . the mean ct volume dose index and dose - length product for the decta were 6.53 0.23 mgy and 120 11.67 mgy cm , respectively . the quantitative image quality was evaluated by cerebral artery enhancement , attenuation of sah , image noise , and the following calculated signal - to - noise ratio ( snr ) and contrast - to - noise ratio ( cnr ) . for each patient , the attenuation values of the proximal segment ( m1 ) of middle cerebral arteries ( mcas ) ( which was defined as the cerebral artery enhancement ) and the surrounding sah were measured at the same slice and same location of the 2 image sequences . the regions of interest ( roi ) was maintained as large as possible with vessel wall and calcifications and/or soft plaques avoided . the image noise was defined as the standard deviation of the attenuation value measured in vitreous with roi as larger as possible ( fig . signal - to - noise ratio was calculated as the attenuation values of m1 divided by image noise , and cnr was the contrast divided by image noise . the roi was placed at the m1 segment of mca ( a ) and the surrounding sah ( b ) . the image noise was defined as the standard deviation of the attenuation value measured in vitreous with roi as larger as possible ( c ) . all of the images were evaluated independently by 2 neuroradiologists who were blinded to patient history and the blending methods . the maximum intensity projection images were used for evaluation on a commercial workstation ( mmwp ) . when there was a discrepancy between 2 readers , a joint - reading session was used to reach consensus . cerebral arteries were rated per segment on a 5-point scale : 5 , excellent , no obvious image noise and artifacts , sharp vessel structures , and satisfactory details ; 4 , good , mild image noise and artifacts , less clear vessel structures and details ; 3 , fair , moderate image noise and artifacts , optimal enhancement but insufficient for diagnosis ; 2 , poor , severe image noise and artifacts , suboptimal vessel , inadequate for diagnosis ; 1 , undiagnosable , severe image noise and artifacts , blurry vessel structures , no diagnosis possible . the segments surrounding the circle of willis , including bilateral middle cerebral artery ( m1 , m2 ) , anterior cerebral artery ( a1 , a2 ) , posterior cerebral artery ( p1 , p2 ) , anterior communicating artery , and posterior communicating artery , the statistical analysis was performed using spss ( spss version 15 ; spss inc , chicago , ill ) . the paired student t test was used to compare the ct values of the intracranial artery and the background sah , image noise , snr , and cnr between the linear and nonlinear blending images . the wilcoxon mann - whitney tests were used to estimate the segmental scorings of the 2 image sequences . the interobserver and intraobserver agreement was calculated by test ( < 0.2 , slight or poor agreement ; 0.20.4 , fair agreement ; 0.40.6 , moderate agreement ; 0.60.8 , substantial agreement ; > 0.8 , excellent agreement ) . the mean attenuation measured in m1 segment was significantly higher in the nonlinearly blended images than the linearly blended images , with a dramatic increase of 72 hu ( p < 0.01 ) . however , the mean ct value of background sah and the image noise were significantly lower in the nonlinearly blended images compared with those of linearly blended images , although the differences were slight ( both p < 0.01 ) . because of the increased cerebral artery enhancement and the decreased attenuation of sah and image noise , the calculated snr and cnr of the nonlinearly blended images were also significantly superior compared with those of linearly blended images , with an improvement of 15.06 and 13.97 , respectively ( both p < 0.01 ) . quantitative measurement of image quality table 2 displayed the results of qualitative evaluation of image quality for each group on a per - segment based analysis . the segmental scorings of the nonlinear blending image ( 31.6% segments with a score of 5 , 57.4% segments with a score of 4 , 11% segments with a score of 3 ) ranged significantly higher than those of linear blending images ( 11.5% segments with a score of 5 , 77.5% segments with a score of 4 , 11% segments with a score of 3 ) ( p < 0.01 ) ( fig . intraobserver agreement between the first and second evaluation of image quality for both observers reached excellent agreement with statistics of 0.844 and 0.858 , respectively . qualitative evaluation of image quality example images from a 50-year - old male patient with sudden headache who received cerebral decta after massive sah was found in the basal cistern . axial images of the 2 blending method was presented with the same window width ( 286 hu ) and window level ( 100 hu ) , showing the difference of cnr between them . ct values of the m1 , sah , and image noise were 188.3 hu , 75.1 hu , and 7.1 hu for linear blending image ( a ) , and 243.4 hu , 70.1 hu , and 5 hu for nonlinear blending image ( b ) , respectively . two maximum intensity projection images were also presented with the same window width ( 461 hu ) and window level ( 208 hu ) , the nonlinear blending image ( d ) showed obviously brighter intracranial arteries with more clear margin and lower background attenuation and image noise , as compared with the linear blending image ( c ) . the mean attenuation measured in m1 segment was significantly higher in the nonlinearly blended images than the linearly blended images , with a dramatic increase of 72 hu ( p < 0.01 ) . however , the mean ct value of background sah and the image noise were significantly lower in the nonlinearly blended images compared with those of linearly blended images , although the differences were slight ( both p < 0.01 ) . because of the increased cerebral artery enhancement and the decreased attenuation of sah and image noise , the calculated snr and cnr of the nonlinearly blended images were also significantly superior compared with those of linearly blended images , with an improvement of 15.06 and 13.97 , respectively ( both p < 0.01 ) . table 2 displayed the results of qualitative evaluation of image quality for each group on a per - segment based analysis . the segmental scorings of the nonlinear blending image ( 31.6% segments with a score of 5 , 57.4% segments with a score of 4 , 11% segments with a score of 3 ) ranged significantly higher than those of linear blending images ( 11.5% segments with a score of 5 , 77.5% segments with a score of 4 , 11% segments with a score of 3 ) ( p < 0.01 ) ( fig . intraobserver agreement between the first and second evaluation of image quality for both observers reached excellent agreement with statistics of 0.844 and 0.858 , respectively . qualitative evaluation of image quality example images from a 50-year - old male patient with sudden headache who received cerebral decta after massive sah was found in the basal cistern . axial images of the 2 blending method was presented with the same window width ( 286 hu ) and window level ( 100 hu ) , showing the difference of cnr between them . ct values of the m1 , sah , and image noise were 188.3 hu , 75.1 hu , and 7.1 hu for linear blending image ( a ) , and 243.4 hu , 70.1 hu , and 5 hu for nonlinear blending image ( b ) , respectively . two maximum intensity projection images were also presented with the same window width ( 461 hu ) and window level ( 208 hu ) , the nonlinear blending image ( d ) showed obviously brighter intracranial arteries with more clear margin and lower background attenuation and image noise , as compared with the linear blending image ( c ) . inadequate intracranial artery contrast might be primarily responsible for the unsatisfactory image quality of cerebral cta in patients with massive spontaneous sah . generally , multiple strategies can be applied for the purpose of increasing vascular opacification during the examination of cta , such as elevating the amount , concentration or injection flow rate of contrast media , or lowing the tube voltage in single energy scan . in decta , with both low - energy and high - energy data sets available , vessel visualization can be improved in another way by using blended images . theoretically , low - kilovolt scan provides images with better iodine contrast at the price of higher noise , whereas the high - kilovolt images are lower in contrast but less noisy . the standard linear blending technique , which is default set in the second generation of dual - source dual - energy ct system , mixes the 2 energy ( 80 kv and sn140 kv ) data sets with a fixed ratio for each pixel independent of the voxel ct value . this method allows to produce images to be more than 80 kv or 140 kv like by adjusting the weighting factors but still suboptimal in terms of contrast because the advantages of each data set ( contrast or sharpness ) are partially offset by its drawbacks ( blurring or noise ) due to the linear nature of the technique . by contrast , the nonlinear blending method based on the moidal blending function is designed to shift the high - density pixel toward a higher weight of 80 kv for maximized iodine contrast and the low - density pixel toward a higher weight of 140 kv for lower background attenuation and noise characteristic ( fig . 1 ) . taking variable mixing ratio calculated pixel by pixel according to its attenuation value would balance the advantages and disadvantages of both scan mode , thus acquiring optimized image cnr . the present study evaluated the outcome of linear and nonlinear blending in image quality of cerebral decta in spontaneous sah patients . it depicted a prominent improvement ( 13.97 and 15.06 , respectively ) of cnr and snr in nonlinear blending images due to the dramatic increase ( approximately 72 hu ) in intracranial arterial enhancement in addition to a slight decrease in the image noise and attenuation of background sah compared with that of linear blending images . subjectively , more ( additional 20% ) cerebral arterial segments got a scoring of excellent in nonlinear blending images . our study definitely confirmed the advantage of nonlinear blending technique in improving vessel visualization by optimizing image contrast resolution . without altering the routine scan protocol , early in 2008 , initial studies by eusemann et al and holmes et al first demonstrated that nonlinear blending of dual - energy data outperformed the linear blending data with improved cnr and visual preference for a variety of different organs and pathologies of interest . after that , decta using nonlinear blending function has been experimented for many clinical applications , such as improving the detection of hypervascular liver hepatocellular carcinoma during the arterial phase scan and providing images with better tumor conspicuity in the evaluation of renal masses during the nephrographic phase of enhancement . in a study in pigs by kartje et al , the delayed myocardial enhancement in acute myocardial infarction ( mi ) was revealed with enhanced visualization due to the nonlinear image blending in the late - phase decta imaging of mi . similarly , better image quality with optimal contrast and improved vascular visualization in decta for portal venography and abdominal angiography has also been presented in 2 recent studies . our study investigated its application in cerebral cta in sah patients and achieved quite satisfactory results with improved vascular visualization . our results offered a preferred method to analyze image data of cerebral decta and encouraged broad postprocessing implementation not only for the goal of easier and faster bone removal but also for the purpose of increasing contrast and better vascular visualization . a practical problem during the postprocessing of optimum contrast was how to choose the bc and bw values because different combinations of the 2 defining parameters could generate a large number of images with different features . although optimized setting of bc and bw was deemed to be organ , pathologies of interest , and patient dependent , there were still some basic principles and guidance that could be followed according to experiences gained from previous studies . for bc , a value taking the average ( or at least between the ) ct value of the high - contrast region and the results of our study were consistent with this suggestion , where the settings were close to the mean difference between the ct values of mca and the surrounding sah measured from the linearly blended images . the adjustment of bw was used to provide a sharper or smoother transition between the 2 data sets . a narrow value setting could lead to images with high contrast but might appear artificial sometimes due to abrupt transition between the 2 data sets , while too wide a setting of bw would reduce the degree of contrast . in regard to cta , a relatively narrow width might be recommended for the purpose of increasing contrast . in the present study , we chose 20 to 30 hu as the bw and achieved an increase in ct values of mca from 235 hu to 307 hu . although parameters selected in our study were not necessarily the best optimal value , our study had shown that nonlinear blending images with properly selected parameters indeed provided significant improvement in cnr over images with linear blending method . first , the study did not comprise a large number of patients but were sufficient to show the advantage of nonlinear blending technique . second , not all segments of the intracranial arteries were evaluated , for the reason that majority of the intracranial aneurysms were located adjacent to the circle of willis . third , diagnostic performance of each blending method was not assessed for detection and evaluation of aneurysms . this was intended to be a preliminary study to evaluate the feasibility of using nonlinear blending technique for assessing intracranial vessels . a large scale prospective study to assess this technique for the evaluation of intracranial aneurysms our study indicated the nonlinear image blending technique was superior to the linear blending technique in vascular visualization for cerebral decta by optimizing contrast enhancement in spontaneous sah patients . this optimum contrast function of decta can be pursued with a broader range of clinical applications in the future . | objectivethe aim of this study was to investigate the image quality of cerebral dual - energy computed tomography ( ct ) angiography using a nonlinear image blending technique as compared with the conventional linear blending method in patients with spontaneous subarachnoid hemorrhage ( sah).methodsa retrospective review of 30 consecutive spontaneous sah patients who underwent a dual - source , dual - energy ( 80 kv and sn140 kv mode ) cerebral ct angiography was performed with permission from hospital ethical committee .
optimized images using nonlinear blending method were generated and compared with the 0.6 linear blending images by evaluating cerebral artery enhancement , attenuation of sah , image noise , signal - to - noise ratio ( snr ) , and contrast - to - noise ratio ( cnr ) , respectively .
two neuroradiologists independently assessed subjective vessel visualization per segment using a 5-point scale.resultsthe nonlinear blending images showed higher cerebral artery enhancement ( 307.24 58.04 hounsfield unit [ hu ] ) , lower attenuation of sah ( 67.07 6.79 hu ) , and image noise ( 7.18 1.20 hu ) , thus achieving better snr ( 43.92 11.14 ) and cnr ( 34.34 10.25 ) , compared with those of linear blending images ( 235.47 46.45 hu for cerebral artery enhancement , 70.00 6.41 hu for attenuation of sah , 8.39 1.25 hu for image noise , 28.86 8.43 for snr , and 20.37 7.74 for cnr ) ( all p < 0.01 ) . the segmental scorings of the nonlinear blending image ( 31.6% segments with a score of 5 , 57.4% segments with a score of 4 , 11% segments with a score of 3 ) ranged significantly higher than those of linear blending images ( 11.5% segments with a score of 5 , 77.5% segments with a score of 4 , 11% segments with a score of 3 ) ( p < 0.01 ) .
the interobserver agreement was good ( = 0.762 ) , and intraobserver agreement was excellent for both observers ( = 0.844 and 0.858 , respectively).conclusionsthe nonlinear image blending technique improved vessel visualization of cerebral dual - energy ct angiography by optimizing contrast enhancement in spontaneous sah patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the inflammatory and immune reactions induced by the bacterial plaque represent the main characteristics of periodontitis , and this disease represents a particularly cogent example of
problem arising from the phenomenon . studies have demonstrated that periodontal disease affects between 10% and 15% of the
world 's population , representing the greatest cause of tooth loss
. there is strong evidence that this disease affects a specific , predisposed group of the
population that presents an exacerbated inflammatory / immune response to the
periodontopathogenic bacteria that accumulate on the teeth and around the
gingival tissue , which in turn may lead to tissue damage [ 1 , 3 ] . the exact mechanism of periodontitis development , including the prior agents or
mediators involved , is not clear . periodontitis manifests itself as a
multifactor phenomenon , including the generation of reactive oxygen species
( ros ) . the strong evidence linking ros to the pathological destruction of the
connective tissue during periodontal disease rests on the presence of
neutrophils infiltration as the main event in the host 's response to bacterial
invasion [ 1 , 5 ,
6 ] . furthermore , hydroxyl radical
( oh ) is
most active in damaging important molecules such as dna proteins and lipids ,
while hydrogen peroxide ( h2o2 ) , even not being considered a potent ros , is capable of crossing the nuclear membrane and also damaging the
dna . quantitatively , the main source of superoxide anion
( o2 ) and other ros responsible for initiation reactions is the respiratory chain . however , its presence in the periodontal tissue results first and foremost from
the activation of phagocytes ( neutrophils and macrophages ) , such as
antibacterial agents [ 1 , 5 , 8 ] . it has been suggested that superoxide anion is
involved in bone reabsorption which has been corroborated by studies that have
demonstrated the presence of this anion in reabsorption zones adjacent to the osteoclasts
. the hydroxyl radical is able to initiate a classical chain reaction
known as lipid peroxidation leading to the vasodilation production and rat bone
reabsorption . an example of the damage caused by hydrogen peroxide is that it can stimulate the phosphorylation of the nf - kb - ikb
complex activating the nk - kb and facilitating nuclear
translocation and downstream of proinflammatory cytokines , including
interleukin-2 ( il-2 ) , interleukin-6 ( il-6 ) , interleukin-8 ( il-8 ) ,
-interferon ,
and tumor necrosis factor- ( tnf- ) that are
very important in the pathogenesis of periodontal disease [ 1012 ] . ros production is inevitable in all aerobic organisms including humans , who necessarily posses a complex system of antioxidant defense [ 8 , 13 ] . if the homeostasis is interrupted in favor of ros , an oxidative stress situation is
created . the aim of this study was to evaluate the involvement of proinflammatory and oxidative stress markers in individuals with chronic periodontal disease . september , 2003 in a single centre ( peridontologic centre , florianopolis , santa catarina , brazil ) . eighteen subjects were divided into 2
groups : experimental group ( e ) , comprising individuals with chronic periodontitis , age 52.95.0
( 4 men and 5 women ) , with the following inclusion criteria :
presence of chronic inflammation ( pain , redness , heat , swelling ) , diagnosed
according to bleeding on probing , at least 5 or 6 sites with probing depth
5 mm , attachment loss 3 mm , and extensive radiographic bone loss
. control group ( c ) , was composed of healthy individuals , age 51.19.6 ( 4 men and 5 women ) with no prior history of periodontal disease . for both groups , the following items were considered as exclusion
criteria : infection , cardiovascular and/or neurological illness , renal
insufficiency and/or diabetes ; pregnancy ; smoking ; use of antibiotics and/or
hormonal or nonhormonal anti - inflammatory drugs 6 months prior to tissue
collection . in the day of the surgical procedures , this study was in agreement with the ethical principles of the world
medical association declaration of helsinki ( 1964 ) . permission for this study
was obtained from the ethical committee for human research of the federal
university of santa catarina ( project no . 210/2002 ) and the study included
only individuals that agreed to participate after reading and signing a free
and informed consent form , except those with difficulty in understanding and
communicating , with physical handicap , or both , which could have compromised
the sample collection . all of the surgical procedures were assessed and performed by a periodontist ,
according to the necessity for each treatment . the patients with chronic
periodontitis ( experimental group ) were submitted a pocket depth reduction technique
from palatal / lingual , buccal , and interproximal sites . the biopsies were
obtained from inflammatory granulation tissues , connective and epithelium
tissues . the samples collected from the control group were obtained from quarantined
mucosa during the surgical procedures of impacted third molars removed
following orthodontic recommendation or after the reopening of dental implants . all samples from the experimental and control groups were removed
during the surgical and were immediately frozen in liquid nitrogen ( 170c ) subsequently latter laboratory analysis . on the day of
the experiments , the samples were deathward at room temperature to determine
the different parameters : cat , gpx , gst , gr , mpo activities , and the contents
of tg , gsh , gssg , and tbars . the method described by aebi was employed to measure the
catalase activity ( cat ) by measuring the decay of a freshly prepared 10 mm
hydrogen peroxide solution at 240 nm . glutathione peroxidase ( gpx ) was measured at 340 nm through the
glutathione / nadph / glutathione reductase system by the dismutation of tert - butyl
hydroperoxide . glutathione s - transferase ( gst ) activity was determined at 340 nm using cdnb ( 1-chloro-2 , 4-dinitrobenzene ) as substrate and a 0.15 m gsh concentration . finally , glutathione reductase ( gr ) activity was assayed at 340 nm by measuring the
rate of nadph oxidation . results were expressed as mmolg(cat ) and mol ming ( gpx , gst , and gr ) . nonprotein thiols , mostly present as the reduced form of glutathione ( gsh ) , were measured at 412 nm according to beutler using elmann 's reagent ( dtnb : 2-dithionitrobenzoic acid ) .
immediately after thawing , acid extracts were obtained by adding tissue
portions to 12% trichloroacetic acid ( 1 : 4 w / v ) , which were then centrifuged at
15 000 g for 5 minutes at 5c . supernatants from the acid extracts were added to a buffer
containing 0.25 mm dtnb in 0.1 m na2po4 , ph 8.0 , and the
formation of the thiolate anion was immediately determined . total glutathione
( tg ) was also measured at 412 nm in acid extracts according to the enzymatic
method of tietze . oxidized
glutathione ( gssg ) was also determined by calculating the difference ( in
equivalents of gsh ) between total glutathione and reduced glutathione contents . results were expressed as mol g. myeloperoxidase activity was measured
according to the method developed by rao et al . , and was estimated by
colorimetric measurement at 450 nm on an elisa plate reader
. thiobarbituric acid - reactive substance ( tbars ) contents were determined to assess endogenous
lipid oxidation in gingival tissue according to ohkawa et al . and bird and draper . after thawing ,
gingival portions were immediately added to 12% trichloroacetic acid ( 1 : 4 v / v )
and were then centrifuged at 15 000 g for 5 minutes at 5c . supernatants were added to 50 mm tris - hcl ph 7.0 , vortexed for 20 seconds , added to 0.67% ( w / v ) 2-thiobarbituric
acid , maintained in boiling water for 60 minutes , cooled at 5c for 30 minutes , and then analyzed
spectrophotometrically at 535 nm . concentrations were expressed as nmol tbars / g
wet tissue using 535=153 mmcm . all the biochemical parameters described
above were measured in duplicate , except for the tbars determinations , which
were measured in triplicate . the results were expressed as mean sem . statistical differences
between groups were determined by independent student t test
analysis . for all analyses , p<.05 was used to assess overall differences . these results show that there were no significant differences in
catalase activity in the experimental group ( e ) compared to the control group ( p=.523 ) . however , a significant increase in gpx activities in the experimental
group when compare to the control group ( p=.006 ) was detected ( see table 1 ) . furthermore , in the experimental group , a significant increase of
glutathione s - transferase ( gst ) values compared to the control group ( p=.001 ) was also observed ( see table 1 ) . the analysis of glutathione reductase
( gr ) revealed no differences between the studied groups ( p=.481 ) ( see table 1 ) . the myeloperoxidase activity
revealed a significant increase of this inflammatory biomarker in the
experimental group ( p=.003 ) ( see table 1 ) . in relation to the total
glutathione ( tg ) and the reduced glutathione ( gsh ) contents , no differences in the
values of the experimental group compared to the control group were found ( p>.05 ) ( table 1 ) . however , the values obtained for oxidized glutathione
( gssg ) showed a significant increase in the experimental group when compared to
the control group ( p=.019 ) ( see table 1 ) . lipoperoxidation was
measured through tbars contents , which were significantly a higher increase in
the experimental group ( p=.015 ) ( see table 1 ) . few studies have considered
the effect of the imbalance between oxidants and antioxidants in patients with
periodontitis , which in turn predisposes such individuals to the damaging
effects of ros in the periodontium . ellis and collaborators analyzed gingival tissues from patients with
severe periodontal disease and showed that the activity of catalase was
decreased . in the present study , the activity of catalase was
not different when the experimental and control groups were compared . one
possible explanation for these different responses is that the patients with
periodontal disease were in distinct stages of the disease . in this regard , it
is well known that the antioxidant responses found in different pathologies
depend on the severity or extension suffered by the patients , and long - term
chronic conditions may have jeopardized the antioxidant defenses . the analysis of the enzyme glutathione peroxidase
revealed a significant increase in the experimental group . a gpx increase in
gingival samples from dogs and humans with periodontal disease the gpx increase may represent possible
antioxidant compensation in detoxification reactions of organic peroxides
produced during oxidative stress in gingival tissue . furthermore , glutathione s - transferase ( gst ) also
revealed a significant increase in its activities in the experimental group . since gst has a direct role in the neutralization of hydroperoxides derived
from the lipoperoxidation processes , increases in gst activities are probably
related to the oxidative stress caused by the periodontal inflammatory process
[ 8 , 29 ] . gst comprises a group of enzymes that are also able to detoxify a
variety of compounds including xenobiotics derived from pathogenic
microorganisms , catalyzing their conjugation with gsh . hence , increases in gst activities are excellent indicators of endogenous detoxification from
exogenous sources . the enzyme
glutathione reductase ( gr ) has an important accessory antioxidant function
related to glutathione peroxidase and glutathione s - transferase . gr
intervention continuously regenerates gsh from gssg in the presence of nadph ,
therefore preventing cellular loss of gsh . however , in the current study ,
no differences in gr activities were detected in gingival tissue between the
two groups . the ubiquitous tripeptide glutathione ( gsh ) acts
directly as a generic ros scavenger or as a cofactor of gpx and gst , either by
catalyzing the reduction of hydrogen peroxide and lipid hydroperoxides or by
the conjugation / excretion processes of the so - called phase ii reactions . total and reduced glutathione revealed a tendency to increase , but the values
were not significantly different in patients with periodontitis compared to the
controls . despite gsh , these results suggest a de novo synthesis of glutathione , which is
extremely necessary for the homeostasis of cells . some periodontopathogenic
bacteria deplete gsh , and this may explain the amount of this antioxidant was
not elevated in the gingival tissue of patients with periodontitis combined with an increase of the gpx activity in the affected tissue [ 33 , 34 ] . a similar result was obtained in gingival
tissue and blood , but lower levels of gsh were detected in the crevicular
gingival fluid of patients with chronic periodontitis , when compared to normal
subjects [ 27 , 35 ] . on the other hand , a significant increase in gssg
concentrations was detected in the experimental group , which is a clear
biomarker of oxidative stress detected in inflammatory processes linked to
periodontitis . 2002 ) found less gssg in gingival
cervical fluid of patients with chronic periodontitis . consistent with the
results for gssg , tissue lipoperoxidation , measured as tbars contents in the
gingival tissue , also displayed a significant increase ( p=.015 ) in
individuals affected by periodontitis , and oxidative stress , in the gingival
tissue associated with periodontal disease . the systemic depletion of antioxidants clearly
indicates that in chronic periodontitis the antioxidant system is affected by a
relatively strong oxidation insult , which can also deplete nutritional
antioxidants such as vitamin e and c in plasma and also vitamin e in red cell
membrane . moreover , myeloperoxidase activity in
gingival tissue showed a significant increase in patients with periodontal
disease when compared to the control group , an indicative of a chronic
inflammatory process also reflected at a systemic level . these results were
similar to the measurements obtained from the analysis of crevicular gingival
fluid in humans with periodontal disease . oxidative stress processes and alterations in the
immune system are closely related and have been described in different
diseases , thus both the aspects also seem to be linked to the
pathogenesis of periodontal disease , and can also be detected in the
plasma of patients with periodontitis [ 8 , 27 ,
35 ] . however , the extent to which
ros overgeneration influences the initiation and progression of periodontal
diseases is still unknown . in conclusion , in spite of the
limited number of samples examined in the present study , the
results indicate a relationship between proinflammatory and oxidative stress
biomarkers and periodontal disease . | objective . to evaluate the involvement of proinflammatory and oxidative stress markers in gingival tissue in individuals with chronic periodontitis .
subject and methods .
eighteen subjects were divided in two groups : experimental ( age 52.95.0 ) and control ( age 51.19.6 ) .
the activities of enzymatic antioxidants such as catalase , glutathione peroxidase ( gpx ) , glutathione s - transferase ( gst ) , glutathione reductase , nonenzymatic antioxidants : total glutathione and reduced glutathione , oxidized glutathione ( gssg ) , thiobarbituric acid reactive substances ( tbars ) , and myeloperoxidase activity ( mpo ) were evaluated in gingival tissues from interproximal sites .
statistical differences between groups were determined by independent student t test and p<.05 .
results .
individuals with periodontal disease exhibited a significant increase in the activities of mpo , gpx , gst , and also in tbars and gssg levels in gingival tissue compared to the control group ( p<.05 ) .
conclusion .
the results of the present work showed an important correlation between oxidative stress biomarkers and periodontal disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 40-year - old caucasian gentleman visited our hospital with complaints of sudden onset of diplopia of two weeks duration . the night before the onset he was at a dance party where he consumed alcohol and cocaine . he visited the eye casualty the next day and was advised a magnetic resonance imaging ( mri ) scan . there was no associated history of decreased vision , eye pain , headache , flashes , floaters , headache , nausea and signs and symptoms of raised intracranial pressure . his personal history included consumption of a bottle of wine daily since 20 years and occasional cocaine use since three to four years . examination revealed visual acuity of 20/20 in each eye with normal anterior segment and fundus in both eyes . neuro - ophthalmic and orthoptic assessment confirmed pupil - sparing iiird and ivth nerve paresis of the left eye [ fig . 1 ] and urgent mri reported an area of increased signal intensity in the brainstem mainly in the left side with mass effect [ fig . 4 ] . magnetic resonance angiography revealed an area of high signal intensity in the vicinity of the posterior communicating region on the left side [ fig . 5 ] . this represented a vascular event probably due to a small bleed arising from the vertebral basilar region . his symptoms and general health had deteriorated in the first week in the interim when we first saw him till he was seen in peripheral hospital . his ocular symptoms started to improve four weeks from then significantly , that there was no diplopia in primary gaze . he was followed in the ophthalmology department in a tertiary hospital eight weeks later and then at six months and was subsequently discharged with complete recovery of eye movements . subsequently , he was doing well and was discharged and is being currently followed by an oncologist / radiotherapist . this patient presented with intracerebral hemorrhage in a distribution commonly seen with hypertensive vasculopathy.1,2 astrocytoma is the most common glial tumor but is more commonly located in the cerebrum , leptomeninges , spinal cord and usually present with other associated focal neurological signs and symptoms . this case represents a rare manifestation of the tumor with only fascicular iii and iv nerve paresis . an important cause of spontaneous ( non - traumatic ) intracranial hemorrhage not due to cerebral aneurysm , vascular malformation or hypertensive cerebrovascular disease is brain tumor which has been reported to represent 0.9 to 11% of spontaneous intracranial hemorrhage according to various studies.3 hemorrhage due to tumor is significantly more common in younger patients with the exception of pituitary adenoma . wakai et al . in their study reported that 42.2% patients showed no evidence of clinical symptoms related to bleeding , 33.3% had preceding history related to brain tumors and in 24.4% the apoplectic syndrome was the initial presentation and out of them only four were astrocytoma.4 kothbauer in their autopsy series of 430 spontaneous cerebral hematomas found that 21 out of 44 tumor - associated hematomas were anaplastic gliomas , 17 associated with metastatic tumors , two with oligodendrogliomas , two malignant lymphomas and one meningioma.5 in another series of 235 surgically verified brain tumors by bromowicz , eight had hemorrhage into the tumor and out of them three had anaplastic astrocytoma.6 the anatomical elucidation of this infrequent palsy is difficult but the possible mechanism here is astrocytoma and associated hemorrhage which was located in the oculomotor nerve fascicle , where the pupillary efferent fibers are anatomically separate from the fibers to the extraocular muscle and also the trochlear nerve fascicle as they transverse the brainstem . therefore , screening for mass lesions using neuro - imaging , preferably mri , is indicated in patients with the presentation of pupil - sparing third and other nerve paresis where diagnosis of hypertensive or ischemic vasculopathy is often made , as timely intervention may carry a favorable prognosis . | a case of spontaneous , painless partial iii ( pupil - sparing ) and iv fascicular nerve paresis as the first presentation of anaplastic astrocytoma is reported .
the other ocular , neurological and systemic examination was within normal limits .
the literature and possible anatomical location of this atypical presentation is reviewed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
upper tract urinary diversion is a well - known practice in adults for pelvic malignancy whether it is temporary or permanent . in children , indications are becoming limited nowadays , because definitive primary surgical correction is the preferred treatment option for refluxive or obstructive uropathy . there are , however , certain situations where definitive surgeries may need to be delayed , e.g. , if there is uncontrolled urinary infection , sepsis , deteriorating renal function and presence of hugely dilated ureter . in these conditions , there are several ways of creating cutaneous ureterostomy ; however , laparoscopic technique is gaining popularity for temporary loop ureterostomy . in some cases undiversion is done when clinical condition improves and in others ureteric reimplantation is planned for a later date . when ureteric reimplantation is the plan by open technique , ureterostomy can be done by minimal invasive technique and placed at the end(s ) of the suprapubic creaseline ( pfannentiel incision site ) . we describe here our experience of this novel technique in a small group of children . from 1 , january 2009 to 31 , july 2012 , 7 children were treated with laparoscopy - assisted cutaneous ureterostomy ( lacu ) followed by ureteric reimplantation . indications for ureterostomy was primary obstructive megaureter in three cases , hugely dilated ureters with grade v refluxes in three cases and posterior urethral valve ( puv ) with bilateral grade v refluxes and deteriorating renal function in one case . three trocars were used in unilateral lesions : supraumbilical port for camera , right or left flank port for ureter mobilisation and 3 port at either right or left end of suprapubic creaseline for stoma [ figure 1 ] . for bilateral cases 5 trocars were used : supraumbilical port for camera , one port in each flank for ureteral mobilisation and one port at each end of suprapubic creaseline for stomas [ figure 2 ] . legs of the patient were suspended down to make room for the monitor at the foot end of operating table with the surgeon on the opposite side of lesion / procedure and assistant on the affected side . the most distal manoeuverable part of tortuous ureter was mobilised after making a hole in the overlying parietal peritoneum using hook cautery and maryland forceps . then the ureter was grasped with a babcock forceps and pulled to the surface at either end of suprapubic creaseline for creation of stoma through 5-mm or 10-mm trocar depending on the size of ureter [ figures 3a , b and 4 ] . during this pulling of ureter insufflations gas ureteric reimplantation was planned later on when physically and biochemically patients become fit . during reimplantation , then minor adhesions were released and trans - trigonal reimplantation performed bringing the stoma site inside urinary bladder and discarding the distal portion obviating the need for repair of ureter and leaving no extra scar on skin . ports placement for unilateral stoma ports placement for bilateral stoma ( a ) grasping the ureter ( b ) exteriorisation of loop of ureter bilateral stoma at each end of suprapubic crease the ethical review committee for thesis and research of chattagram maa - o - shishu hospital medical college gave permission to conduct this retrospective study . the age , sex , operative techniques , operating time , complications and outcome were evaluated . ages ranged from 6 months to 9 years ( mean 4.6 2.8 ) with six males and one female . mean operating time was 39.8 12.5 minutes ( range 25 - 65 minutes ) per stoma . there was no major intraoperative complication . except for peri - stomal excoriations no major complication occurred postoperatively . ureteric reimplantations were successfully done in all the seven cases 6 - 12 months after ureterostomy needing tapering in one case . mean follow - up was 1.7 8 years ( range , 6 months to 2.5 years ) . renal functions were improved in six cases in terms of serum creatinine and isotope renogram studies and one patient deteriorated after reimplantation [ table 1 ] . laparoscopy , these days is a well - accepted modality in the treatment of a wide range of surgical problems in children . the truth is , diagnostic laparoscopy for impalpable testes was the fore - runner of paediatric laparoscopy and now laparoscopy is also widely practiced in other fields of paediatric urology . laparoscopic cutaneous ureterostomy can be done either by retroperitoneoscopy or by transperitoneal route and retroperitoneoscopy has the advantage of avoiding possible intra - abdominal adhesions while transperitoneal approach facilitates bilateral procedures . cutaneous ureterostomy has its own complications including failure , ureteral hernia , retraction and stenosis , acute pyelonephritis and deterioration in renal function . laparoscopy reduces the risk of hernia , retraction and stenosis by its minimal damage to the abdominal wall layers during procedure . we did not find any of these complications in our series except persistence of urinary infection in two cases for more than 1 month . however , peri - stomal excoriation developed in all cases which persisted until reimplantation in two cases . we have managed this excoriation applying zinc oxide paste and a pad of soft clothe was applied over that to absorb the urine which was changed frequently . all of our patients were improved clinically and with normal creatinine level ( < 1.0 mg / dl ) after cutaneous ureterostomy [ table 1 ] . ureters in those occasions were brought out through flank ports which produced more than one scars during subsequent definitive procedure . in our technique we have anticipated future necessity for reimplantation and planned to bring out the ureters in a way so that a need of further scar creation is obviated . the extra length and tortuosity of megaureters allowed us to remove the post - stoma portion of ureter and reimplant the stoma site within the urinary bladder . urinary diversion is very infrequently practiced nowadays except in certain situations mentioned earlier . before starting this practice of cutaneous ureterostomy we used to perform cutaneous vesicostomy in this selected group of patients . so in this study we have got a limitation of not being able to compare open ureterostomy with laparoscopic procedure . our technique has the advantages over other laparoscopic techniques in that it avoids extra scar in ureter as well as on the skin . laparoscopy also has got its obvious advantages over open technique including avoiding a big scar . however , we have avoided laparoscopy in two cases during study period considering the very critical condition with renal impairment , electrolyte and acid - base imbalance and opted for cutaneous vesicostomy under local anaesthesia . laparoscopy - assisted cutaneous ureterostomy can be fashioned at suprapubic creaseline to facilitate future reimplantation without much jeopardy and extra scar . | background : cutaneous ureterostomy is still practiced despite a trend towards primary surgical correction for obstructive or refluxive uropathy . for future open reimplantation
, ureterostomy can be created by minimal invasive technique at the end(s ) of the suprapubic creaseline.materials and methods : from 1 january 2009 to 31 july 2012 , seven children were treated with laparoscopy - assisted cutaneous ureterostomy followed by ureteric reimplantation .
indications were primary obstructive megaureter 3 , hugely dilated ureters with reflux 3 and posterior urethral valve with poor general health 1 .
the distal manoeuverable part of tortuous ureter was pulled to the surface at either end of suprapubic creaseline to create the stoma . during reimplantation
, this stoma was dismembered and brought inside urinary bladder obviating the need for stoma - site repair.results:mean age was 4.6 2.8 years with six males .
there were three bilateral cases with total 10 lesions .
mean operating time was 39.8 12.5 minutes .
mean follow - up was 1.7 0.8 years and except for peri - stomal excoriations no major complication occurred .
all these were reimplanted 6 - 12 months after ureterostomy and faring well except in one case.conclusions:laparoscopy-assisted cutaneous ureterostomy can be fashioned at suprapubic creaseline to facilitate future reimplantation without much jeopardy and extra scar . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
phlebosclerotic colitis ( pc ) is a rare disease ; chronic mesenteric ischemia that is characterized by calcification of the mesenteric vein and thickening of the colonic wall , which result in ischemic colitis.1 ischemic colitis is primarily caused by arterial obstruction secondary to arteriosclerosis , thrombosis , or embolism in the left - sided colon . however , pc is affected by fibrosis and sclerosis of the mesenteric vein that cause colonic congestion.12 the underlying pathophysiology is unclear , but a few studies have suggested that it might be related to toxins , calcinosis , raynaud phenomenon , esophageal dysmotility , sclerodactyly , and telangiectasia ( crest ) syndrome , churg - strauss syndrome , lymphocytic phlebitis , portal hypertension , cardiac disease , diabetes mellitus , dyslipidemia , or hemodialysis.34 pc usually involves the proximal colon and has no obvious cause , but certain toxins absorbed from the right - sided colon have been implicated in causing chronic venous damage.2 we report a case of pc with a transverse colonic stricture in a patient with chronic kidney disease , who had been taking multiple kinds of herbal medications for over 6 months . a 57-year - old man visited inje university ilsan paik hospital after experiencing abdominal pain , nausea , and vomiting for 3 weeks . he had visited our emergency room for the same symptoms 2 weeks prior , where he was suspected of having paralytic ileus . however , he was discharged against our medical advice , insisting that his symptoms were not severe . the herbal medication included more than 10 herbal ingredients such as sansisi ( gardenia jasminoides ) , hua shi ( magnesium silicate ) , long gu ( mastodi ossis fossilia or talc ) , and mu li ( ostrea gigas ) . the patient looked acutely ill ; his blood pressure was 132/71 mmhg , pulse rate 97/min , respiratory rate 20/min , and body temperature 36.2. the patient 's abdomen was distended and tympanic , and showed tenderness without rebound tenderness . laboratory tests were as follows : white blood cell 6,970/mm , hemoglobin 8.1 g / dl , platelet count 372,000/mm , bun 43 mg / dl , creatinine 4.52 mg / dl , and crp 0.3 mg / dl . a plain radiograph showed diffuse small bowel distension and colon wall calcification along the colonic area ( fig . because of his reduced renal function , a non - contrast - enhanced ct scan was taken , which showed diffuse fluid - filled distension of the small bowel with colonic wall thickening and calcifications in the colon wall and at the mesocolon , suggesting atherosclerotic changes ( fig . paralytic ileus was suspected , and the patient was initially managed with supportive care including hydration , bowel rest , and nasogastric drainage . however , a follow - up ct taken on hospital day 7 did not show any improvement in bowel distention . colonoscopy without bowel preparation performed on hospital day 8 showed diffuse bluish edematous mucosal change , multiple scarring , and loss of vascularity from the distal sigmoid to the transverse colon . there was a pinpoint stricture in the transverse colon , 65 cm from the anus , and scope passage was not possible ( fig . a biopsy taken from the stricture site showed chronic inflammation and fibrosis with mild regenerative change ( fig . a contrast - enhanced ct scan with delayed phase angiography was performed , which showed extensive calcifications along the colonic wall , mesenteric , and portal veins ( fig . fortunately , on the day after the colonoscopy , the patient 's symptoms dramatically improved , and the ileus disappeared ( fig . 1c and d ) . presumably , this was due to the dilatational effect from the scope passage attempt , or dislodgement of a fecalith . based on radiologic , endoscopic , and histologic findings , we diagnosed the patient with pc . after several days of a soft diet , the patient remained asymptomatic , and was discharged . the patient is currently symptom - free , after 2 months of follow - up . in 2000 , iwashita et al . first reported pc as a new disease entity , describing it as an ischemic lesion resulting from phlebosclerosis.5 due to the lack of pathological inflammation , iwashita et al.1 proposed the name " idiopathic mesenteric phlebosclerosis " ( imp ) in 2003 . all of the pc patients were asians , and their symptoms were insidious or abrupt and mainly occurred in the right hemicolon.2 symptoms include abdominal pain , vomiting , diarrhea , hematochezia , and constipation caused by chronic venous insufficiency and venous congestion.3 to the best of our knowledge , there have been three reported cases of pc in korea ; these cases are summarized in table 1 . abdominal radiography shows multiple thread - like or linear calcifications mainly along the right - sided colon , and abdominal ct scan shows colon wall thickening and calcification of the mesenteric vein.6 barium enema shows haustral disappearance , luminal irregularities , rigidity , narrowing , and thumb - printing.7 colonoscopy findings show rigidity of the colon wall , luminal narrowing , and ulceration with dark purple - blue mucosal change.5 this color may be caused by chronic congestion with ischemia or by toxins that stain the bowel mucosa.8 certain toxins may be absorbed by venous return from the proximal colon . therefore , most cases of pc primarily involve the right - sided colon.9 histologic findings include thickening of the venous walls and tortuous veins , fibrotic degeneration of the venous walls with calcifications , and markedly fibrous thickening in the submucosa of the colonic wall without hemorrhage or thrombosis of the mesenteric vein.2 however , it has been suggested that pc may have a relatively long subclinical stage , and calcification within the colonic wall and mesenteric veins at certain stages may not be seen.6 in our case , radiologic findings showed mesenteric vein calcifications , but endoscopic biopsy revealed no mesenteric vein calcifications . since a mucosal biopsy may not be sufficient for evaluation of submucosal vessels , we thought that it was prudent to take only a small amount of tissue , since we anticipated that delayed wound healing by venous congestion and biopsy - induced bleeding could be problematic . the underlying pathophysiology of pc is not well known , but dialysis , portal hypertension , diabetes , and vasculitis have been suggested as possible causes.34 many studies report that pc is related to herbal medicine . recently , after reviewing 25 cases of pc , hiramatsu et al.8 reported that a commonly used herbal ingredient , sansisi ( gardenia fruit ) , was correlated with pc . our patient also had a history of longterm herbal medication usage , including sansisi ( gardenia fruit ) . however , our patient had also been taking many other kinds of herbal ingredients , including zhi zi ( g. jasminoides ) , hua shi ( magnesium silicate ) , long gu ( mastodi ossis fossilia or talc ) , and mu li ( ostrea gigas ) , so it is not clear which ingredient caused pc . another study reported that stopping herbal medicines improved the patient 's symptoms.10 however , although our patient was strongly advised not to take the herbal medicines , he persistently ingested them , even during the hospital admission , due to his firm belief in the efficacy of the herbal medication . the management of pc ranges from supportive care to surgery , based on disease severity . pc may be complicated by hemorrhage , bowel obstruction , and perforation.1112 if no other signs of bowel compromise are present , supportive care may be considered . the obstructive ileus in our patient was likely caused by the recurrent ulceration of pc , and spontaneously improved after the colonoscopy examination . the exact reason is unclear , but we believe that it may have been due to dislodgement of a fecalith , or that the scope passage attempt during the colonoscopy procedure may have caused some dilatation at the stricture site , which caused improvement of ileus . since subsequent aggravation of colonic obstruction seemed probable , we recommended colectomy , but the patient refused . spontaneous improvement of ileus in a patient with pc has previously been reported.6 our patient also showed a self - limiting course after conservative care , but it is not clear whether a watchful waiting for future patients with pc should be mandatory . in conclusion , we report a case of pc with a transverse colonic stricture in a patient with chronic kidney disease who had been taking multiple kinds of herbal medication for more than 6 months . in this patient , pc was improved by supportive care . since pc is frequently associated with chronic kidney disease and contrast - enhanced ct is not feasible , early endoscopy seems to be required for early diagnosis of pc , especially if there are multiple calcifications found on the bowel wall . further clinical experience is required to establish optimal treatment plans and to elucidate the prognosis of pc . | a 57-year - old man with chronic kidney disease and a history of using numerous herbal medications visited inje university ilsan paik hospital for abdominal pain and vomiting .
an abdominal radiograph showed diffuse small bowel distension containing multiple air - fluid levels and extensive calcifications along the colon .
computed tomography showed colon wall thickening with diffuse calcification along the colonic mesenteric vein and colonic wall .
colonoscopy , performed without bowel preparation , showed bluish edematous mucosa from the transverse to the distal sigmoid colon , with multiple scar changes . at the mid transverse colon , a stricture
was noted and the scope could not pass through . a biopsy of the stricture site revealed nonspecific changes .
the patient was diagnosed with phlebosclerotic colitis .
after the colonoscopy , the obstructive ileus spontaneously resolved , and the patient was discharged without an operation .
currently , after 2 months of follow - up , the patient has remained asymptomatic .
herein , we report the rare case of an obstructive ileus caused by phlebosclerotic colitis with a colon stricture . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
chronic kidney disease ( ckd ) is one of the common causes of renal failure . it involves a progressive loss over the course of months in the structure and function of the kidneys , with or without a decreased glomerular filtration rate ( gfr ) . ckd can be diagnosed by its pathological abnormalities , changes in the levels of kidney function markers in the blood or urine , or by imaging investigations . ultrasound is the ideal imaging modality in ckd because of its non - invasiveness , and because it provides easy accessibility and visualization of the kidneys . ultrasonography is the first , and , in most cases , the only imaging investigation required in the work - up of chronic renal failure . observation of a small kidney with a thin , echogenic cortex or parenchyma indicates irreversible damage . the best screening modality to evaluate renal insufficiency in patients is sonography . as ultrasonographic findings like echogenicity , longitudinal length , parenchymal , and cortical thickness represent irreversible changes , ultrasonography is a better imaging modality when it comes to ascertaining the progression of the disease . the serum creatinine level is an endogenous serum marker that is commonly used to estimate gfr , and accordingly , the stage of ckd . the aim of our study is to correlate renal echogenicity with serum creatinine levels and to investigate the significance of renal echogenicity in identifying the progression of ckd , as well as use sonographic imaging in grading ckd . sixty patients above 30 years of age who had been diagnosed with ckd according to the guidelines of the national kidney foundation were selected . patients on kidney replacement therapy ( hemodialysis , peritoneal dialysis , and renal transplantation ) , as well as those with fatty liver and other liver diseases diagnosed on ultrasonography , were excluded . detailed information from patients regarding age , sex , duration of diabetes mellitus if diabetic , duration of hypertension if hypertensive , other causes of chronic renal failure , and treatment history was collected . using a standard b mode grayscale ultrasound ( voluson ge pro 730 ) , ultrasound of the kidneys and liver were performed by two radiologists with respective experience of 8 and 5 years using curved array transducers of 2.5t-4 mhz . speckle reduction imaging ( sri ) and low tissue harmonic imaging were applied to visualize the liver and kidney echogenicity . a manual method of adjusting the gain and time gain compensation ( tgc ) was used so that inter - observer bias could be reduced . the radiologists were blind to patients serum creatinine values , and all patients were reviewed by both radiologists . parenchymal thickness was measured from the renal hilum to the maximum convex border of the lateral renal margin . cortical thickness was measured in the sagittal plane over a medullary pyramid , perpendicular to the capsule . when there was inter - observer variation , consensus was sought . renal longitudinal size , parenchymal thickness , cortical thickness , cortical echogenicity , and corticomedullary differentiation were evaluated . in every case , the mean values of the right and left renal longitudinal size , parenchymal thickness , and cortical thickness were calculated . renal cortical echogenicity was compared and graded with the echogenicity of the liver and renal medulla , where : grade 0 : normal echogenicity less than that of the liver , with maintained corticomedullary definition [ figure 1 ] ultrasound of abdomen ( longitudinal section ) shows renal cortical echogenicity grade 0 : normal , echogenicity less than liver ( star ) , with maintained cortico - medullary definition ( arrow ) of right kidney . grade 1 : echogenicity the same as that of the liver , with maintained corticomedullary definition [ figure 2 ] ultrasound of abdomen ( longitudinal section ) shows renal cortical echogenicity grade 1 : echogenicity same as the liver ( star ) , with maintained cortico - medullary definition ( arrow ) of right kidney . grade 2 : echogenicity greater than that of the liver , with maintained corticomedullary definition [ figure 3 ] ultrasound of abdomen ( longitudinal section ) shows renal cortical echogenicity grade 2 : echogenicity more than the liver ( star ) , with maintained cortico - medullary definition ( arrow ) of left kidney . grade 3 : echogenicity greater than that of the liver , with poorly maintained corticomedullary definition [ figure 4 ] ultrasound of abdomen ( longitudinal section ) shows renal cortical echogenicity grade 3 : echogenicity more than the liver ( star ) , with poorly maintained cortico - medullary definition ( arrow ) of right kidney . grade 4 : echogenicity greater than that of the liver , with a loss of corticomedullary definition [ figure 5 ] . ultrasound of abdomen ( longitudinal section ) shows renal cortical echogenicity grade 4 : echogenicity more than the liver ( star ) , with loss of cortico - medullary definition ( arrow ) of left kidney . twenty - nine patients(48.3% ) had sonological grade 1 ckd , 21(35% ) had grade 2 ckd , 7(11.7% ) had grade 3 ckd , and 3(5% ) had grade 4 ckd ( figure 6 ) . the mean serum creatinine was 2.8 mg / dl for grade 1 ( range : 0.9 - 9.2 mg / dl ) , 3.69 mg / dl for grade 2 ( range : 1.2 - 10.3 mg / dl ) , 3.86 mg / dl for grade 3 ( range : 1.1 - 6.5 mg / dl ) , and 7.9 mg / dl for grade 4 ( range : 3.1 - 11.4 mg / dl ) [ table 1 ] . the mean longitudinal size was 101.38 mm for grade 1 ( range : 76 - 124 mm ) , 91.43 mm for grade 2 ( range : 63 - 115 mm ) , 89.43 mm for grade 3 ( range : 60 - 111 mm ) , and 78 mm for grade 4 ( range : 67 - 91 mm ) [ table 2 ] . the mean parenchymal thickness was 47.38 mm for grade 1 ( range : 37 - 61 mm ) , 41.14 mm for grade 2 ( range : 30 - 61 mm ) , 40 mm for grade 3 ( range : 21 - 50 mm ) , and 37.33 mm for grade 4 ( range : 31 - 44 mm ) [ table 3 ] . the mean cortical thickness was 15.59 mm for grade 1 ( range : 10 - 24 mm ) , 12.86 mm for grade 2 ( range : 7 - 21 mm ) , and 11.33 mm for grade 3 ( range : 9 - 14 mm ) [ table 4 ] . by definition , grade 4 involves more echogenicity than the liver , with a loss of corticomedullary definition . once corticomedullary definition is lost , cortical thickness can not be measured ; hence , [ table 4 ] includes 57 cases . pie chart displays 29 patients had sonological grade 1 ckd , 21 patients had sonological grade 2 ckd , 7 patients had sonological grade 3 ckd , and 3 patients grade 4 ckd . comparison of serum creatinine with renal cortical echogenicity ( grading determined by ultrasound features ) comparison of mean longitudinal size with renal cortical echogenicity ( grading determ ined by ultrasound features ) comparison of mean parenchymal thickness with renal cortical echogenicity ( grading determined by ultrasound features ) comparison of mean cortical thickness with renal cortical echogenicity ( grading based on ultrasound features ) a statistically significant positive correlation was observed between serum creatinine and cortical echogenicity grading ( p = 0.004 ) . there was also a statistically significant positive correlation between mean longitudinal size and renal echogenicity ( p = 0.006 ) , parenchymal thickness , and renal echogenicity ( p = 0.009 ) , and cortical thickness and renal echogenicity ( p = 0.008 ) . a statistically significant negative correlation was observed between mean longitudinal size and serum creatinine ( p = 0.085 ) ; a statistically significant negative correlation was observed between mean parenchymal thickness and serum creatinine ( p = 0.046 ) ; and a statistically significant negative correlation was observed between mean cortical thickness and serum creatinine ( p = 0.656 ) [ table 5 ] . statistical correlation between serum creatinine and mean longitudinal size , mean parenchymal thickness , and mean cortical thickness our study showed statistically significant positive correlations between serum creatinine and renal echogenicity grading ( p = 0.004 ) [ table 1 ] from grade 1 to grade 4 ckd . , showed that renal echogenicity has the strongest correlation with histologic parameters ( glomerular sclerosis , tubular atrophy , interstitial fibrosis , and interstitial inflammation ) . , showed that a highly echogenic cortex was the most common abnormality ; this was slightly more frequent in tubulointerstitial disease ( 75% ) than in glomerular disease ( 61% ) . in a previous study , hricak et al . , showed a statistically significant positive correlation between cortical echogenicity and the severity of global sclerosis , focal tubular atrophy , the number of hyaline casts per glomerulus , and focal leukocytic infiltration . our results contradict those of platt et al . , who found that renal echogenicity equal to the echogenicity of the liver is not a good indicator of disease . using speckle reduction imaging ( sri ) and low tissue harmonic imaging technology , normal renal echogenicity is less than that of liver in the normal population and shows better difference in echogenicity between the liver and renal cortex . a statistically significant positive correlation was seen between renal echogenicity grading and mean longitudinal size ( p = 0.006 ) [ table 2 ] . renal length has traditionally been considered a surrogate marker of renal function because renal length decreases with decreasing renal function . when repeating renal measurements , estimation of renal length should be preferred to renal volume . a study by mileti et al . , revealed that relative renal length ( calculated using the kidney length to body height ratio ) better represents kidney size than absolute renal length ( measurements of longitudinal renal diameter ) because it eliminates sex and height differences . there was a statistically significant positive correlation observed between renal echogenicity grading and parenchymal thickness ( p = 0.009 ) [ table 3 ] . , showed that parenchymal thickness , but not cortical thickness , correlated with tubular atrophy . there was a statistically significant positive correlation between renal echogenicity grading and cortical thickness ( p = 0.008 ) [ table 4 ] . study done by beland et al . , showed that cortical thickness measured on ultrasound appears to be more closely related to gfr than renal length . this may have occurred because , as our institution is a tertiary referral center , most cases were treated with renal replacement therapies like hemodialysis , peritoneal dialysis , and renal transplantation due to complications associated with ckd . as serum creatinine increases , are irreversible , a sonological grading of ckd can be carried out , allowing the severity of ckd to be assessed . the p value of renal echogenicity ( p = 0.004 ) was statistically more significant than the p values for mean longitudinal size ( p = 0.006 ) , mean parenchymal thickness ( p = 0.009 ) , and mean cortical thickness ( p = 0.008 ) . renal echogenicity and its grading correlates better with serum creatinine in ckd than other sonographic parameters like longitudinal size ( p = 0.085 ) , parenchymal thickness ( p = 0.046 ) , and cortical thickness ( p = 0.656 ) . as serum creatinine is an indicator of kidney function , renal echogenicity is a better parameter to estimate renal function with the added advantage of irreversibility when compared to serum creatinine , which improves with kidney replacement therapy like -hemodialysis , peritoneal dialysis , and renal transplantation in chronic kidney disease . | objective : the purpose of our study is to correlate renal echogenicity with serum creatinine in order to determine the significance of renal echogenicity when it comes to identifying the progression of chronic kidney disease ( ckd ) and for the sonographic grading of ckd.materials and methods : sixty patients above 30 years of age who had been diagnosed with ckd according to the guidelines of the national kidney foundation were included in the study .
patients on kidney replacement therapy or with fatty liver findings on ultrasonography were excluded .
ultrasounds of kidneys were performed by two radiologists who were blind to the patients serum creatinine levels .
renal cortical echogenicity was compared with serum creatinine .
statistical analysis was performed using one - way anova followed by scheffe 's test .
the relationship between serum creatinine and sonographic features was assessed by correlation coefficient analysis .
a p value less than 0.05 was considered statistically significant.results:mean serum creatinine was 2.80 mg / dl for grade 1 ( range : 0.9 - 9.2 mg / dl ) , 3.69 mg / dl for grade 2 ( range : 1.2 - 10.3 mg / dl ) , 3.86 mg / dl for grade 3 ( range : 1.1 - 6.5 mg / dl ) , and 7.90 mg / dl for grade 4 ( range : 3.1 - 11.4 mg / dl ) .
the grades being determined by cortical echogenicity on imaging a statistically significant , positive correlation was observed between serum creatinine and grading based on cortical echogenicity ( p = 0.004).conclusion : renal echogenicity and its grading correlates better with serum creatinine in ckd than other sonographic parameters such as longitudinal size , parenchymal thickness , and cortical thickness . hence , renal echogenicity is a better parameter than serum creatinine for estimating renal function in ckd , and has the added advantage of irreversibility . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 35-year - old male , diagnosed with obsessive - compulsive disorder ( ocd ) for the past 5 years was prescribed on fluoxetine up to 80 mg / day . he was receiving this treatment for the past 1 year with partial improvement of symptoms despite adequate compliance . cognitive behavior therapy was not possible due to transportation inconvenience . due to the persistence of symptoms , despite a high dose of fluoxetine , augmentation with clomipramine ( up to 100 mg / day ) after few days of the addition of clomipramine , the patient had reported dark pigmentation over face localized to both malar eminences . the dermatological consultation was sought for this hyperpigmentation ; a diagnosis of melasma was made . his routine hemogram , thyroid function test , and serum cortisol levels were within normal limits . due to poor tolerance to clomipramine ( excessive sedation and severe constipation ) , dose of clomipramine was reduced to 50 mg / day . due to the persistence of ocd symptoms , this resulted in improvement in ocd symptoms over next 3 months ; however , the skin pigmentation and severe constipation persisted . clomipramine dose was reduced to 25 mg / day for next 2 months and persistence of constipation resulted in its stoppage . assessment score on naranjo adverse drug reaction ( adr ) probability scale was six , which was suggestive of probable adr . assessment on the world health organization - uppsala monitoring centre ( who - umc ) system for standardized case causality assessment also suggestive of probable adr with clomipramine . in our patient , the pigmentation is confined to the malar eminences of the face , with sparing of rest sun - exposed areas of the body . this adverse effect of clomipramine is not life - threatening , but can be a reason of concern from cosmetic sense . in our patient , clomipramine was not acceptable due to constipation and excessive sedation , although he was worried about melasma . stoppage of clomipramine resulted in improvement of sedation , constipation as well as melasma . causality assessment is an important evaluation to establish the link between an adverse event with a particular drug . causality assessment has been done on naranjo adr probability scale and the who - umc system , which revealed probable adr ( i.e. , the adverse event followed exposure to drug and disappeared following drug discontinuation , it is unlikely attributable to disease or other drugs ) . in a study , it was found that the prevalence of severe adr being 1.4% in general ; higher with the tricyclic antidepressant ( tca ) group and lower with monoamine oxidase inhibitors and selective serotonin reuptake inhibitors . among the tcas allergic exanthematous cutaneous reactions are known with tcas . however , there is description of a single case of 60-year - old female suffering from depressive episode , who developed pigmentation over light exposed areas of the body with the use of clomipramine . there are few case reports of such pigmentation with the use of imipramine , a congener of clomipramine . this is probably the second case study , reporting the rare side effect of clomipramine . | melasma is a hyperpigmented dermatological condition common in females .
drugs such as steroids , cosmetics , and photosensitizing agents are known to cause melasma .
we report here a case of an adult male with obsessive - compulsive disorder , receiving clomipramine , who developed melasma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
trichobilharzia ( weinland , 1858 ) is a genus of blood flukes of the family schistosomatidae with more than 40 described species ( 1 ) infecting four families of freshwater snails and five orders of aquatic birds ( 2 ) . members of this genus may also cause cercarial dermatitis or swimmer s itch in human ( 3 ) . the furcocercariae of several trichobilharzia species including trichobilharzia franki ( 4 ) , t. regenti ( 5 ) , t. szidati ( 6 ) ( syn . of t. ocellata , la valette , 1855 ) and t. salmanticencis ( simon - martin and simon - vicente , 1999 ) have been recorded as the causative agents of human cercarial dermatitis in europe ( 1 , 7 ) . species of trichobilharzia have been reported from various locations in all continents ( 8) . like all highly specialized trematodes , species of this group are characterized by high morphological similarity of adults and polymorphism of cercariae ( 9 ) . the accurate recognition of some developmental stages of these species is generally problematic due to their similarities to the other trematode groups . although experimental infections have provided valuable data on schistosomatids life cycles , they have been associated with such limitations as the difficulties of isolating the intact adult trematodes from the infected birds ( 1 , 10 , 11 ) . during the past few years , dna analyses have helped scientists to clarify the systematics and status of the species within the genus trichobilharzia ( 1115 ) . these analyses have also confirmed the role of molluscan as the intermediate hosts of these digenian trematodes ( 1 , 16 ) . trichobilharzia is the only genus of the family schistosomatidae whose furcocercariae have morphologically been described from iran ( 17 ) . there also are a few reports of cercarial dermatitis caused by trichobilharzia in north and south - west of iran , typically in the areas where people swim in the rivers , canals and water reservoirs with uncovered bodies ( 16 , 18 ) . studying snails and intramolluscan stages of trematodes is important for the discovery of host - parasite interactions ( 19 , 20 ) and prediction of the infection prevalence rates in a certain area ( 9 , 21 , 22 ) . active penetration of cercariae into their intermediate hosts is an important part of the life cycle of trematodes ( 2 ) . the major snail families which are known as the intermediate hosts for trichobilharzia are lymnaeidae ( rafinesque , 1815 ) , planorbidae ( rafinesque , 1815 ) , pleuroceridae ( fischer , 1885 ) and physidae ( fitzinger , 1833 ) ( 23 , 24 ) . trichobilharzia is the only avian schistosome genus to use the snails of the family lymnaeidae as an intermediate host ( 8) and has been isolated from several lymnaeid species . neuhaus ( 6 ) reported the infection of lymnaea stagnalis with t. szidati in europe . t. franki parasitizes radix ( lymnaea ) auricularia ( 4 ) , r. ovata ( 25 ) and exceptionally , l. stagnalis ( 14 ) . ( 5 ) recorded the infection of r. peregra and r. ovate with t. regent . in iran , snails of the genera lymnaea and planorbis have been reported to be the main intermediate hosts of the causative agents of cercarial dermatitis ( 7 , 18 ) . however , to date , no molecular analysis has been performed for detection of infection with trichobilharzia species in the field - collected lymnaeid snails of the country . we aimed to apply a molecular approach to recognize if the snail l. auricularia collected from north west iran was parasitized with trichobilharzia species . field - collection of the lymnaeid snail l. auricularia was performed in four freshwater - bodies located in the suburb of urmia city , northwest iran ( fig . the snails were randomly collected and transferred alive to the laboratory of malacology of faculty of veterinary medicine , urmia university . l. auricularia was identified according to the standard keys ( 26 , 27 ) , and its identity was verified by parasitology museum of faculty of veterinary medicine , tehran university . the snails were preliminarily examined for the presence of the larval stages of trematodes by shedding method and microscopic inspection with and without snail crushing ( 28 ) . map of west azarbaijan province in northwestern iran and the positions of the study sites . osalu the soft tissues of l. auricularia were dissected , washed several times in 0.01 m phosphate - buffered saline ( pbs , ph 7.2 ) and stored at 20 c until the dna extraction . the genomic dna was extracted by the modified phenol - chloroform method using cetyl - trimethylammonium bromide ( ctab ) at 60 c for 1 hr ( 29 ) . a fragment of the ribosomal dna of trichobilharzia sp . , spanning the sequences of internal transcribed spacers 1 and 2 ( its1 , its2 ) , and 5.8s , 18s and 28s ribosomal rna ( rrna ) gene regions , was amplified using the specific primers its5trem ( 5-ggaagtaaaagtcgtaacaagg-3 ) and its4trem ( 5-tcctccgcttattgata tgc-3 ) ( 12 ) . the pcr was performed in 25l reaction containing 4 l of the genomic dna , 2.5u of taq dna polymerase ( fermentas , germany ) , 50 m of each dntps ( cinnagen , iran ) , 2 mm of mgcl2 , 2.5l of 10 pcr buffer and 0.5m of each primer . the reaction was run in a bioer xp thermal cycler ( china ) and comprised an initial dna denaturation step at 95 c for 5 min , followed by 35 cycles of dna denaturation at 95c for 60s , primer annealing at 50 c for 45s , primer extension at 72 c for 2 min , and a final extension at 72 c for 10 min . a volume of 10 l of each pcr product was analyzed by electrophoresis on 1% agarose gel at 120v for about 30 min . the snail samples showing the band patterns corresponding to the gene regions of trichobilharzia species were considered as infected . field - collection of the lymnaeid snail l. auricularia was performed in four freshwater - bodies located in the suburb of urmia city , northwest iran ( fig . the snails were randomly collected and transferred alive to the laboratory of malacology of faculty of veterinary medicine , urmia university . l. auricularia was identified according to the standard keys ( 26 , 27 ) , and its identity was verified by parasitology museum of faculty of veterinary medicine , tehran university . the snails were preliminarily examined for the presence of the larval stages of trematodes by shedding method and microscopic inspection with and without snail crushing ( 28 ) . map of west azarbaijan province in northwestern iran and the positions of the study sites . the soft tissues of l. auricularia were dissected , washed several times in 0.01 m phosphate - buffered saline ( pbs , ph 7.2 ) and stored at 20 c until the dna extraction . the genomic dna was extracted by the modified phenol - chloroform method using cetyl - trimethylammonium bromide ( ctab ) at 60 c for 1 hr ( 29 ) . a fragment of the ribosomal dna of trichobilharzia sp . , spanning the sequences of internal transcribed spacers 1 and 2 ( its1 , its2 ) , and 5.8s , 18s and 28s ribosomal rna ( rrna ) gene regions , was amplified using the specific primers its5trem ( 5-ggaagtaaaagtcgtaacaagg-3 ) and its4trem ( 5-tcctccgcttattgata tgc-3 ) ( 12 ) . the pcr was performed in 25l reaction containing 4 l of the genomic dna , 2.5u of taq dna polymerase ( fermentas , germany ) , 50 m of each dntps ( cinnagen , iran ) , 2 mm of mgcl2 , 2.5l of 10 pcr buffer and 0.5m of each primer . the reaction was run in a bioer xp thermal cycler ( china ) and comprised an initial dna denaturation step at 95 c for 5 min , followed by 35 cycles of dna denaturation at 95c for 60s , primer annealing at 50 c for 45s , primer extension at 72 c for 2 min , and a final extension at 72 c for 10 min . a volume of 10 l of each pcr product was analyzed by electrophoresis on 1% agarose gel at 120v for about 30 min . the snail samples showing the band patterns corresponding to the gene regions of trichobilharzia species were considered as infected . a total number of 320 l. auricularia snails were collected from the investigated water bodies . the cercarial shedding and microscopic examination showed that 11.25% ( 36 out of 320 ) of the l. auricularia snails were infected with the larval stages of digenian trematodes . the pcr amplified different lengths of the ribosomal dna of trichobilharzia in the examined snails . the amplified gene fragments comprised a 1330bp - long section representing the entire its1 , its2 , 5.8s , 18s and 28srrna gene regions of t. szidati , a 745bp - long its1 fragment of t. szidati , sections of 966bp and 322bp in length of the its1 and its2 gene regions of t. franki , respectively and a total length of 477bp of its1 and 5.8srdna of t. franki ( fig . 2 ) . based on the pcr patterns , 31.25% ( 100 out of 320 ) of the r. auricularia snails were infected with two trichobilharzia species , i.e. t. szidati ( 21.56% , 69/320 ) and t. franki ( 9.69% , 31/320 ) . mixed infection with both trichobilharzia species was also found in 8.44% ( 27/320 ) of the infected snails . results of the pcr for amplification of ribosomal dna of trichobilharzia species in the infected lymnaea auricularia snails . the amplified fragments comprise a 966bp - long section of the its1 of trichobilharzia franki ( lanes 2 , 3 , 4 , 5 ) , a fragment of 477bp representing the its2 and 5.8srdna of t. franki ( lanes 1 , 2 , 6 ) , a 322bp - long its2 fragment of t. franki ( lane 5 ) , an amplicon of 1330bp in length covering entire its1 , its2 , 5.8s , 18s and 28srrna gene regions of t. szidati , and 745bp - long its1 sequence of t. szidati ( lane 7 ) . m : 250bp dna size marker the infected snails were geographically distributed over three out of the four study sites . the highest infection rate in a single site ( 50% , 25 out of 50 ) was observed in osalu , while the lowest infection ( 11.76% ) was recorded in golestaneh ( fig . 1 ) . the rate of infection in plain areas was 7.81% ( 25 out of 320 ) , whereas the remaining infected snails ( 23.43% , 75/320 ) were found in the water bodies located in high altitudes ( table 1 ) . rates and geographic distribution of the infection of lymnaea auricularia with larval stages of trematodes ( microscopic observation ) and trichobilharzia species ( pcr analysis ) ( n=320 ) ts : trichobilharzia szidati , tf : t. franki , mi : mixed infection , s : seasonal , p : perennial , m : mountainous , pl : plain the taxonomy of trichobilharzia trematodes is a yet - unresolved parasitological issue mainly due to their complicated life cycle , the difficulties of their isolation and morphological recognition and lack of information on their developmental stages ( 1 , 21 ) . among the several traditional and modern techniques , used for the screening of digenian infection in their intermediate and definite hosts ( 30 ) , pcr - based analyses have had significant contribution to the accurate and specific estimation of the infection ( 5 , 8 , 9 , 20 ) . genetic analysis is particularly beneficial for specific diagnosis of trichobilharzia species as their cercariae are indistinguishable even by detailed examinations such as electron microscopy ( 12 ) . however , very few studies have used molecular tools for detection of naturally infected snails with trematodes ( 30 ) . our molecular analysis discovered the infection of the natural populations of the snail r. auricularia with the species of the genus trichobilharzia in the studied region . diverse lengths of the ribosomal dna of these trematode species were amplified in the infected snails using the specific primer set . the amplified fragments correspond to different ribosomal dna regions of two trichobilharzia species , t. szidati and t. franki ( 12 ) . thus , based on the analysis , at least two species of the genus trichobilharzia are present in the studied region , which can infect the snails and eventually , their definite hosts , i.e. , birds and human . the sequences of its1 and its2 fragments of the ribosomal dna have been found to be suitable tools for species identification in bird schistosomes of the genus trichobilharzia ( 11 , 1315 ) . however , for more accurate characterization of the trichobilharzian trematodes ; a description of their entire life cycle , developmental stages and host - parasite interactions also needs to be obtained ( 12 ) . this is the first record of the infection with trichobilharzia in the field - collected r. auricularia snails in iran . the earlier studies have mainly focused on the epidemiology of human schistosomiasis in the country . sahba and malek ( 31 ) investigated cercarial dermatitis in the iranian coastal areas of the caspian sea . schistosoma haematobium was found to be the causative agent of human schistosomiasis in southwest iran ( 18 , 31 , 32 ) . 1.1% of the examined people in southwest iran had the clinical signs of cercarial dermatitis ( 18 ) . they also estimated a 2.1% infection rate in the l. gedrosiana snails with the furcocercariae of trichobilharzia species . ( 33 ) discovered the infection with schistosome furcocercariae in the snail melanoides tuberculata from khuzestan , south iran by pcr - amplification and sequencing of the ribosomal dna of the parasites . ( 9 ) cercariae of different genetic attributes were found in individual snails , a remarkable biological feature in trichobilharzia species is their differential host preference for snail species ( 1,12 ) . for instance , while the infection rate of some snail species with trichobilharzia is reported to be as low as 0.3% ( 34 ) , it exceeded 5% in l. auricularia ( 10 ) . in europe , nearly all trichobilharzia species use lymnaeid snails as the intermediate hosts , while in north america they favor both lymnaeid and physid snails ( 8) . kock ( 25 ) suggested that the intermediate host spectrum of t. szidati is limited to the snails l. stagnalis and stagnicola palustris . ( 14 ) isolated the european t. ocellate ( a syn . of t. szidati ) from l. stagnalis . t. franki was also isolated from l. auricularia ( 13 ) and unexpectedly , from l. stagnalis ( 14 ) . l. auricularia is reported to be the second most common lymnaeid snail after l. gedrosiana in west azarbaijan , northwest iran ( 26 , 35 ) . the infection of l. auricularia with cercariae of the digenian trematodes of the genus fasciola was reported by imani - baran et al . the broad distribution of this snail and its adaptation to the local environmental conditions in northwestern iran has made it a potent transmitter of the avian schistosomes in this part of the country . northwest iran has a mediterranean climate comprising two rainy seasons , the first from march to may and the second in october november ; with plenty of water bodies , which well suited , for the completion of the life cycle of the trematodes such as trichobilharzia species . furthermore , with regard to the high cercarial production capacity of schistosomes ( 36 ) , it is predictable that the infected snails can spread these parasites across a wide range of natural habitats . in addition , the seasonal variations in the activities of the snails and the avifauna are the important factors affecting the rate of the infection with trichobilharzia species . the implemented molecular technique in this study is a fast , simple and accurate way of uncovering the infection with digenian trematodes in their intermediate and final hosts . this will eventually assist in the estimation of the infection rates in a definite region even if no apparent clue of the infection would be available . results of our molecular analysis witness the relatively high rates of infection with both t. szidati and t. franki in the l. auricularia snails in northwest iran . these results can provide a baseline for further studies and can be useful in the control programs against these parasitic trematodes . | background : the present study was carried out to detect the infection of larval stages of trichobilharzia species in the snail lymnaea auricularia in northwestern iran based on dna analysis.methods:a total number of 320 snails of l. auricularia were sampled from four water - bodies located in the suburb of urmia city , north west iran , during may to november 2011 .
the snails were first microscopically inspected for the infection with larval stages of trematodes .
genomic dna was extracted from the snails and pcr was performed to amplify a fragment of the ribosomal dna of trichobilharzia species in the infected snails.results:microscopic examinations indicated that 11.25% ( 36 out of 320 ) of the snails were infected with larval stages of trematodes , while the pcr patterns showed a much higher infection rate ( 31.25% , 100/320 ) . according to the pcr ,
the infections were caused by the larval stages of t. szidati ( 21.56% , 69/320 ) and t. franki ( 9.69% , 31/320 ) or both of them ( 8.44% , 27/320 ) .
the infected snails were observed in three out of the four studied sites .
the highest infection rate in a single site was 50% ( 25/50 ) .
only 7.81% ( 25 out of 320 ) of the infected snails were from the plain areas , while the remaining was from high altitudes.conclusion:results of this study contribute the utility of the employed technique for quick and accurate detection of the infection with trichobilharzian species in their intermediate host snails , which may have potential zoonotic role in the region . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
with the improvement of perinatal care , the frequency of infant death has reduced considerably , but the incidence of neurological disabilities related to perinatal brain damage has not decreased in western countries over the last decades [ 13 ] . perinatal brain injury due to asphyxia , cerebral ischemia , cerebral hemorrhage , or intrauterine infection is the major contributor to perinatal morbidity and mortality as the immature brain is highly susceptible to damage . injury to the newborn during the perinatal stage is the underlying etiology for a host of developmental disabilities that includes spastic motor deficits such as cerebral palsy [ 4 , 5 ] and cognitive , behavioral , attentional , socialization and learning difficulties [ 69 ] . as brain development substantially influences the progression and hallmarks of brain injury [ 10 , 11 ] , it is not possible to apply therapeutic procedures used for adult ischemia to newborns . in term newborn infants , hypoxic / ischemic ( h / i ) presently , optimal management of h / i brain injury involves prompt resuscitation , careful supportive care , and treatment of seizures . although hypothermia is a promising new therapy , and recent studies suggested that head or whole - body cooling administered within 6 hours of birth reduces the incidence of death or moderate / severe disability at 12 to 22 months , there is undeniable need for the identification of new therapeutic targets for the implementation of clinical trials to address treatment of h / i encephalopathy . accordingly , epidemiological and experimental data have allowed researchers to identify a number of potential targets for neuroprotective strategies . animal models have led to the elucidation of biochemical events involved in neurodegeneration and neuroprotection [ 1418 ] ; however , important differences among species have been described [ 19 , 20 ] . the initiation and development of injury to the neonatal brain is complex , with multiple contributing mechanisms and pathways resulting in both early and delayed injury . as in other types of acute central nervous system ( cns ) injuries , tissue damage and neurodegeneration initiate a cascade of inflammatory response depending on the nature and extent of damage , which is characterized by the involvement of damaged neurons , microglial , astrocytes , endothelial cells , and recruited blood leukocytes [ 2225 ] . microglial cells are the main nervous component of the innate immune system , playing a key role in the phagocytosis of cell debris to repair damage and maintain tissue homeostasis , but active producers of inflammatory mediators . astrocytes rapidly respond to extracellular changes and are the main cell type responsible for the restoration of blood - brain barrier , new glia limitans formation , and the establishment of a long - term glial scar . in addition , vascular damage induces massive influx of blood leukocytes , particularly monocytes and neutrophils , which are also actively involved in inflammatory processes . it is important to note that the glial and inflammatory response after perinatal brain damage differs from the mature brain due to key ongoing postnatal developmental processes . importantly , neuronal dendritic arborization , establishment of synaptic contacts , axonal growth , myelination , and glial differentiation take place during the first two - three postnatal weeks in rodents . at the molecular level , several studies have described a distinctive expression of growth factors , adhesion molecules , inhibitors of axonal growth , and cytokines [ 3335 ] , determining the neonatal brain 's particular response to injury , showing increased susceptibility to excitotoxicity [ 11 , 36 , 37 ] and to proinflammatory molecules [ 38 , 39 ] . in this regard , it becomes evident that descriptions of the glial and inflammatory cell changes in adult injury models can not be extrapolated to animal models of perinatal brain damage . in the present study we have used the experimental model of h / i - induced neonatal injury initially described by vannucci and coworkers [ 17 , 40 ] for the rat , and adapted to the mouse in several laboratories [ 14 , 18 , 41 ] with the advent and increased usage of transgenic and knock - out mice . as most studies describing detailed neuropathological and glial and inflammatory cellular changes after neonatal h / i have used the rat model , the goal of our study was to provide a neuropathological followup of tissue damage and detailed morphological and quantitative analysis of astroglial , microglial and leukocytic response following h / i to the postnatal day 7 mice at nine different survival times ranging from 3 hours after hypoxia to 100 days , focusing both on the ipsilateral and the contralateral hemispheric changes . this short- and long - term temporal description aims to help in the future design of novel experimental approaches towards the development of neuroprotective strategies . ninety - nine c57bl6 mice ( from twenty litters bred in harlan labs , france ) of different postnatal ages were used in this study . animals were housed under controlled temperature ( 22c 2c ) , with a 12 hour light cycle period and pelleted food ( global diet 2014 ) and water ad libitum . experimental procedures were approved by the ethical commission of autonomous university of barcelona ( ceeah protocol no . 811 ) . all efforts were made to minimize the number of animals and animal suffering in every step . hypoxic / ischemic ( h / i ) brain damage was induced in postnatal day 7 ( p7 ) c57/bl6 mice by permanent left carotid occlusion and exposure to hypoxia as previously described . briefly , a midline ventral skin incision was made under isoflurane anesthesia ( 4.5% v / v for induction and 2.5% v / v for maintenance , and 0.6 l / min of o2 ) ; the left carotid artery was exposed and sutured with a 8/0 silk surgical suture . after surgery , pups were returned to their dam for at least 1.5 hours to recover . later , litters were placed for 55 minutes in a hypoxic chamber containing 8% of oxygen balanced with nitrogen , with controlled humidity and temperature maintained at 37c . the mean index of postnatal mouse mortality due to surgery or hypoxia was 19.31% , with 18.46% for males and 20.00% for females , showing no statistical differences between genders . as 18 animals died during surgical procedure or hypoxia , only 81 animals were analyzed in this study . intact control mice were sacrificed at p7 , p10 , p14 , p21 , and adult . lesioned pups were sacrificed at 3 , 12 , 24 , 48 , and 72 hours , and at 7 , 14 , 30 , and 100 days after hypoxia . p7 , 3 hrs , 12 hrs , 24 hrs ; group ii p21 and/or adult , 14 days , 30 days , and 100 days . for histological and immunohisto - chemical analysis , mice were i.p . anaesthetized ( ketamine and xylazine 80/10 mg / kg ) and perfused intracardially using 4% paraformaldehyde in phosphate buffer ( pb , ph 7.4 ) . subsequently , brains were removed , postfixed for 4 hours in the same fixative , cryoprotected in 30% sucrose , frozen with dry co2 , and finally stored at 80c until use . brains were serially cut in a cryostat ( leica cm3050 s ) in 30 m thick sections and stored in 20c mounted on flex ihc slides ( dako ) . to determine the injury score , one series of parallel sections from each animal ( 610 mice / survival time ) was air dried at room temperature for an hour , rinsed and incubated with nissl solution ( 0.1% toluidine blue in walpole buffer 0,2 m and ph 4,5 ) at room temperature for 3 minutes and washed with distilled water . the degree of tissue damage was calculated following the injury score detailed on table 1 ( for 3 to 72 hrs ) and table 2 ( for 7 to 100 days ) . three animals from each control age group and four representative animals from each postlesion survival time ( injury scores = mean 2 s.d . ) were processed for the immunohistochemical demonstration of astrocytes ( by glial fibrillary acidic protein , gfap labeling ) , microglia / macrophages ( by iba-1 labeling ) , neutrophils ( by ly-6b.2 labeling ) , and t - cells ( by cd3 labeling ) . single immunohistochemistry was initiated by blocking the endogenous peroxidase ( 2% h2o2 in 70% methanol for 10 min ) and incubation of sections mounted on slides for 1 h in blocking buffer ( bb ) containing 10% fetal calf serum and 3% bovine serum albumin in tris - buffered saline ( tbs , ph 7.4 ) with 1% triton x-100 ( tbst ) at room temperature ( rt ) . slides were then incubated overnight at 4c and 1 h at rt with one of the following primary antibodies diluted in bb : hamster monoclonal anti - cd3 ( abd serotec no . mca2690 , dilution 1 : 250 ) , rabbit polyclonal anti - gfap ( dako no . z0334 , dilution 1 : 1500 ) , rabbit polyclonal anti - iba-1 ( wako no . 019 - 19741 , dilution 1 : 3000 ) , and rat monoclonal ly-6b.2 ( abd serotec no . later , sections were washed with tbst and incubated at rt for 1 h with respective biotinylated secondary antibodies : anti hamster ( vector labs no . ba9100 , dilution 1 : 500 ) , anti - rabbit ( vector labs no . ba1000 , dilution 1 : 500 ) , and anti - rat ( vector labs no . ba4001 , dilution 1 : 500 ) , followed by washes with tbst and incubation for 1 h with streptavidin peroxidase ( vector laboratories no . the peroxidase reaction was visualized by incubating the sections in 3,3-diaminobenzidine and hydrogen peroxide using the dab kit ( sk-4100 ; vector laboratories , usa ) for gfap , iba-1 and ly-6b.2 . for cd3 , slides were treated by the glucose oxidase - dab - nickel method , and the reaction was terminated by washing with 0.1 m acetate buffer ( ph 6.0 ) . finally , sections were dehydrated and coverslipped in dpx . sections were analyzed and photographed with a dxm 1200f nikon digital camera joined to a nikon eclipse 80i microscope , and plates were arranged using adobe photoshop cs . imagej software ( national institute of health ) was used for quantitative analysis of immunoreacted sections . images from 5 sections / animal were taken , representing the following regions : corpus callosum ( cc ) , caudate putamen ( cp ) , hippocampus ( h ) , neocortex ( n ) , and thalamus ( t ) ( figure 1 ) . micrographs were captured using the 40x objective ( for the cc and the hippocampus at 72 hours after hypoxia ) or the 20x objective ( rest of areas and survival times ) . in group i , ii and iii sections were 240 m apart , and bregma levels ( bls ) analyzed included ( approx . ) : anterior bl1 , 0.26 mm & bl2 , 0.02 mm ; posterior bl3 , 1.82 mm ; bl4 , 2.06 mm ; bl5 , 2.30 mm . in group iv , sections were 300 m apart , and bl analyzed included : anterior bl1 , 0.32 mm & bl2 , 0.02 mm ; posterior bl3 , 1.82 mm ; bl4 , 2.12 mm ; bl5 , 2.42 mm . image analysis was used to obtain the area occupied by glial cells , using a modification from a previously described method . initially , in each section , the mean intensity of grey ( immunoreactive labeling ) in the contralateral region was measured . subsequently , by using the mean intensity of grey as the threshold value , we measured in both hemispheres the percentage of the total area occupied by immunoreactive staining showing an intensity of grey above the threshold ( i.e. , representing reactive cells ) . all samples for demonstration of atrocytes and microglia were done simultaneously in order to reduce variability on dab intensity . the regions analysed are shown in figure 1(b ) and included the hippocampus ( h1 , h2 , h3 ) , neocortex ( n ) , caudate - putamen ( cp ) , medial third ventricle ( m3v ) , lateral third ventricle ( l3v ) median fissure ( mf ) , and thalamus ( t ) in at least 4 representative animals of each lesioned group and 3 animals / control group , with 3 sections / animal , was analysed . in groups i , ii and iii sections were 240 m apart , and counted bregma levels ( bls ) included : bl1 , 1.82 mm ; bl2 , 2.06 mm ; bl3 , 2.30 mm . in group iv , sections were 300 m apart , and counted bl included : bl1 , 1.82 mm ; bl2 , 2.12 mm ; bl3 , 2.42 mm . all data was corrected by abercrombie correction method , with an average of length ( t ) = 0,848 . all experiments were performed so as to reduce variations , and data are presented as mean s.e.m . two - way anova followed by bonferroni posthoc analysis , along with t - test , was used to determine statistical significance as required ( graphpad , prism 3 ) . analysis of toluidine blue - stained sections ( figures 2 and 4 ) was used to evaluate the extent of brain damage in both hemispheres at 3 , 12 , 24 , 48 , and 72 hours and at 7 , 14 , 30 , and 100 days after hypoxia . in general , microscopic evaluation showed mild changes in the contralateral hemisphere [ mainly in hippocampus ( hp ) and corpus callosum ( cc ) ] , and extensive tissue damage and neuronal loss in the ipsilateral hp and cc at all survival times analyzed , although the caudate putamen ( cp ) was also usually affected . damage in the cortex ( cx ) and the thalamus ( tl ) was not always seen and showed the highest variability . in order to better characterize lesion progression , a semiquantitative injury score was calculated for each region and animal ( tables 1 and 2 , figures 3 and 5 ) . from 3 to 72 hours after hypoxia , damage was characterized by neurodegeneration and increased cellularity due to gliosis , and the description of the injury score rating is depicted in table 1 . at 7 days after hypoxia , damage was mainly characterized by atrophy of gray and white matter areas , and therefore a different injury score rating was defined , which is depicted in table 2 . from 3 hours to 7 days after hypoxia , no apparent tissue damage or ventricle swelling in the contralateral hemisphere was observed using the nissl staining ( figures 2 and 4 ; right side of the panel ) . interestingly , at 14 days after hypoxia , scattered patches of neurodegeneration with a mild reduction in cellular density when compared to intact age - matched control brains were observed in the ca field of the hp ( figure 4 ) , showing a mean injury score in the contralateral hp of 0.92 0.2 ( table 2 , figure 5 ) . in addition , the contralateral cc was also damaged in the 30- and 100-day survival groups , showing approximate 40% of atrophy ( mean cc atrophy scores of 1.31 0.59 and 0.86 0.38 , resp . ) ( table 2 , figure 5 ) , accompanied by evident ventricle swelling ( figure 4 ) . no apparent changes in the contralateral dentate gyrus ( dg ) , caudate - putamen , neocortical layers and thalamus were seen . h / i injury in hippocampusas early as 3 hours after hypoxia , hippocampal tissue disruption with disorganization of ca cytoarchitecture and the presence of patches of neurodegeneration ca pyramidal neurons was observed in the ipsilateral hemisphere ( figures 2(b ) , 2(e ) and 2(f ) ) , but showing a high degree of variability between animals ( figure 3 ) . from 12 to 72 hours after hypoxia , the hippocampal ca field was visibly damaged in all animals , displaying a degenerating pyramidal cell layer with massive neuronal cell loss in ca1 and ca3 ( figures 2(i)2(af ) , left panel ) , showing a mean injury score of ca field of 3.27 0.74 between 12 and 72 hours after hypoxia ( table 1 , figures 2 and 3 ) . in addition , at 12 hours , the dentate gyrus ( dg ) also showed neuronal injury and layer disruption , which was most evident at the 12- and 24-hours survival times ( figure 2(i ) ) . at 7 days after hypoxia , massive atrophy of the hippocampus was observed , showing mean total hippocampal injury scores ranging from 5 2.2 to 10.42 1.46 ( out of 12 , table 2 ) , where the 30-day survival group showed the lowest score ( figures 4 and 5 ) . ca pyramidal neurons , but less than 50% reduction in dg neuronal density ( figures 4 and 5 ) . interestingly , only in the 33% of the animals , the ipsilateral hippocampus was observed 100 days after hypoxia . as early as 3 hours after hypoxia , hippocampal tissue disruption with disorganization of ca cytoarchitecture and the presence of patches of neurodegeneration ca pyramidal neurons was observed in the ipsilateral hemisphere ( figures 2(b ) , 2(e ) and 2(f ) ) , but showing a high degree of variability between animals ( figure 3 ) . from 12 to 72 hours after hypoxia , the hippocampal ca field was visibly damaged in all animals , displaying a degenerating pyramidal cell layer with massive neuronal cell loss in ca1 and ca3 ( figures 2(i)2(af ) , left panel ) , showing a mean injury score of ca field of 3.27 0.74 between 12 and 72 hours after hypoxia ( table 1 , figures 2 and 3 ) . in addition , at 12 hours , the dentate gyrus ( dg ) also showed neuronal injury and layer disruption , which was most evident at the 12- and 24-hours survival times ( figure 2(i ) ) . at 7 days after hypoxia , massive atrophy of the hippocampus was observed , showing mean total hippocampal injury scores ranging from 5 2.2 to 10.42 1.46 ( out of 12 , table 2 ) , where the 30-day survival group showed the lowest score ( figures 4 and 5 ) . hippocampal damage induced approximately a 1040% of remaining ca pyramidal neurons , but less than 50% reduction in dg neuronal density ( figures 4 and 5 ) . interestingly , only in the 33% of the animals , the ipsilateral hippocampus was observed 100 days after hypoxia . h / i injury in corpus callosumfrom 3 hours post - hypoxia , the ipsilateral corpus callosum showed increased cellularity ( figure 2(f ) ) and the presence of scattered apoptotic cells ( data not shown ) . the density of cells in the ipsilateral corpus callosum was notably increased at 48 and 72 hours post - hypoxia ( figures 2(v ) , 2(ad ) and 3 ) , when ventricle swelling started to become evident ( figures 2(r ) and 2(z ) ) . at 7 and 14 days post - hypoxia , increased cellularity was still observed ( figures 4(f ) and 4(n ) ) , but this was minimum from 30 days ( figure 4(v ) ) . important atrophy of the white matter accompanied by ventricle swelling was seen in all animals at 7 days after hypoxia , but it was more remarkable at 14 days after hypoxia , showing mean corpus callosum atrophy score ( 14100 days ) of 2.33 0.84 , which represented an approximate 50% tissue loss ( table 2 , figure 5 ) .
from 3 hours post - hypoxia , the ipsilateral corpus callosum showed increased cellularity ( figure 2(f ) ) and the presence of scattered apoptotic cells ( data not shown ) . the density of cells in the ipsilateral corpus callosum was notably increased at 48 and 72 hours post - hypoxia ( figures 2(v ) , 2(ad ) and 3 ) , when ventricle swelling started to become evident ( figures 2(r ) and 2(z ) ) . at 7 and 14 days post - hypoxia , increased cellularity was still observed ( figures 4(f ) and 4(n ) ) , but this was minimum from 30 days ( figure 4(v ) ) . important atrophy of the white matter accompanied by ventricle swelling was seen in all animals at 7 days after hypoxia , but it was more remarkable at 14 days after hypoxia , showing mean corpus callosum atrophy score ( 14100 days ) of 2.33 0.84 , which represented an approximate 50% tissue loss ( table 2 , figure 5 ) . h / i injury in caudate - putamen , neocortex , and thalamusat 3 hours after hypoxia , we observed increased cellularity and disorganization of white and gray matter areas , mainly in the dorsal part of caudate - putamen ( figure 3 ) , showing a mean injury score ( 372 hours ) of 1.02 0.81 corresponding to less than 40% of striatal area damaged ( table 1 , figure 3 ) , but showing important variability between animals ( figure 3 ) . at 7 to 100 days after hypoxia , there was apparent caudate - putamen atrophy ( figures 3 and 5).the neocortex and the thalamus showed mild changes , that were only apparent in a minority of animals at all times analyzed , giving very variable results ( figures 3 and 5 ) . neocortical damage , when present , was characterized by scattered radial columns of neurodegeneration and tissue damage , mainly until 12 hours after hypoxia . at 7 days after hypoxia mild cellular damage in the thalamus was even less frequent but could be observed in some animals , affecting the rostral thalamic nuclei ( figure 3 ) . however , probably as a consequence of ventricle swelling , different grades of thalamic atrophy were seen in most animals at 7 days ( table 2 , figure 5 ) .
at 3 hours after hypoxia , we observed increased cellularity and disorganization of white and gray matter areas , mainly in the dorsal part of caudate - putamen ( figure 3 ) , showing a mean injury score ( 372 hours ) of 1.02 0.81 corresponding to less than 40% of striatal area damaged ( table 1 , figure 3 ) , but showing important variability between animals ( figure 3 ) . at 7 to 100 days after hypoxia , there was apparent caudate - putamen atrophy ( figures 3 and 5 ) . the neocortex and the thalamus showed mild changes , that were only apparent in a minority of animals at all times analyzed , giving very variable results ( figures 3 and 5 ) . neocortical damage , when present , was characterized by scattered radial columns of neurodegeneration and tissue damage , mainly until 12 hours after hypoxia . at 7 days after hypoxia cellular damage in the thalamus was even less frequent but could be observed in some animals , affecting the rostral thalamic nuclei ( figure 3 ) . however , probably as a consequence of ventricle swelling , different grades of thalamic atrophy were seen in most animals at 7 days ( table 2 , figure 5 ) . astrocytes were analyzed by gfap immunostaining and studied in control intact brains from p7 , p10 , p14 , p21 and adult mice , and in the contralateral and ipsilateral hemisphere of hypoxic / ischemic brains from 3 hours to 100 days after hypoxia . the distribution and immunostaining intensity of gfap+ cells changed during postnatal development ( figures 6(a)6(c ) ) , showing increased gfap levels at earlier ages , as has been previously reported [ 4649 ] . briefly , in addition to the gfap+ radial glial processes still observed at p7 ( figure 7(g ) ) , at the p7p10 age range , the most intense gfap+ astroglial cells were found in cortical layer i , the hippocampal fissure ( figure 6(a ) ) and white matter areas including the corpus callosum ( figure 6(a ) ) , and the fimbria . at p14 , gfap immunoreactivity was generally decreased but it was maintained in cortical layer i , the hippocampal fissure and white matter tracts ( figure 6(b ) ) . by p21 in the adult pattern of gfap+ cell distribution was established , showing the strongest immunoreactivity in the astroglial endfeet surrounding blood vessels ( as in the hippocampal fissure , figure 6(c ) ) and in the white matter . an astroglial response in the contralateral hemisphere was generally observed , mainly from 3 to 72 hours after hypoxia , and being importantly decreased by 7 days and longer survival times . increase in gfap immunoreactivity due to astrogliosis was mainly seen in the hippocampal region ( mainly in the hippocampal fissure and the fimbria ) and in the cingulum region of the corpus callosum ( figures 6(d)6(f ) compared to age - matched controls in 6(a)6(c ) ) . astroglial changes in the contralateral hippocampus were maximal at 2448 hours after hypoxia ( figure 6(e ) ) . in addition , mild changes were also noted in the neocortex ( figures 7(h ) and 7(i ) ) , but no apparent changes were observed in the contralateral caudate - putamen ( figures 7(b ) and 7(c ) ) and thalamus . at 7 days after hypoxia , contralateral hemispheres showed no changes in gfap+ cell distribution when compared to age - matched controls . in this sense , it is important to note that the contralateral hippocampal and corpus callosum atrophy observed from 14 days post - hypoxia ( figure 5 ) was not accompanied by noticeable astroglial changes in these areas at late survival times . increased gfap immunostaining and changes in astroglial distribution and astrogliosis were seen in the ipsilaterally damaged hemisphere from 3 hours to the last survival time analyzed ( figures 68 ) . the most intense astroglial response was found in the damaged hippocampus although the corpus callosum , the caudate - putamen , the neocortex and the thalamus also showed noticeable astroglial reactivity . at 3 hours after hypoxia , the ipsilateral hemisphere already showed an increase in astroglial gfap labeling as well as astrogliosis when compared to the contralateral side ( figures 6(d ) and 6(g ) ) . at this survival time , and at 12 hours after hypoxia , reactive astrocytes mainly covered the hippocampal fissure , and the molecular and polymorphic layers of the ca field , but no reactive astrocytes were seen within ca pyramidal cell layer or in the dg . at these early survival times , the area occupied by reactive astrocytes was significantly increased in the il side ( figure 8) . at 24 hours , but mainly at 4872 hours after hypoxia , astroglial processes started to cover the degenerating ca1 and ca3 pyramidal layers and reactive astrocytes concentrated in the hippocampal fissure , the molecular layer and the polymorphic layer of ca1 , adjacent to the white matter ( figures 6(h)6(m ) ) . astroglial cell response was at this time also evident , to a lower extent , in the dg , mainly in the hilus ( figure 6(j ) ) . as depicted in figure 8 , the percentage of gfap+ area in the hippocampus was high and significant in il hippocampus at all survival times . at 7 days after hypoxia , an intense glial scar formed in the degenerated pyramidal layer , around the blood vessels in the hippocampal fissure and in the hippocampal limits ( figure 6(n ) ) . at 14 days after hypoxia , astroglial response in the dg was noticeably decreased although increased gfap+ cells were often seen in the hilus ( figures 6(o ) , 6(s)6(t ) ) . the glial scar was maintained until 100 days after hypoxia ( figures 6(p ) and 6(q ) ) . an increase in gfap immunostaining and cell density when compared to the contralateral side was already seen at 3 hours after hypoxia ( figure 6(d ) and 6(g ) ) , however maximum response was observed at 2472 hours after hypoxia ( figures 6(h)6(k ) ) , when reactive astrocytes presented a marked increase in gfap intensity , showing hypertrophy and increased process thickness . by 7 days , astrogliois clearly diminished ( figures 6(n ) and 6(q ) ) , and at 14 days after hypoxia , gfap immunostaining was strongly decreased and was indistinguishable from controls ( figures 6(o)6(r ) ) . it should be noted that no striking changes were observed in the quantification of the astroglial response when compared to the contralateral side ( figure 8) . an increase in astroglial gfap immunoreactivity was noted in the caudate - putamen at 3 hours after hypoxia ( figure 7(d ) ) although no changes in astroglial distribution were seen until later . from 24 hours , astroglial response was mildly increased until 72 hours , when maximum gfap labeling was reported ( figure 7(e ) ) . astroglial gfap expression was close to control values by 14 days after hypoxia ( figure 7(f ) ) , although glial scarring in the caudate - putamen remained in some animals at longer survival times , showing variability ( figure 8) . notably , the area occupied by reactive astroglial cells in the ipsilateral caudate - putamen was above contralateral values at all survival times analyzed even though variability was found in some time points ( figure 8) . in the neocortex , increased gfap expression and mild astrogliosis were first observed in layers v - vi at 312 hours after hypoxia ( figure 7(j ) ) , and it spread to upper layers from 24 to 72 hours ( figure 7(k ) ) , showing significant increases in astroglial response area ( figure 8) . at longer survival times , astrocytic response was clearly diminished ( figures 7(l ) and 8) and was practically absent by 14 days after hypoxia . in the thalamus , changes in astrocytes were not observed until 24 hours after hypoxia , showing strong variability between animals ( figure 8) . astroglial response was characterized by patches of reactive astrocytes mainly in the rostral thalamus and only until 7 days after lesion , when glial scarring was noticed . at longer survival times , it was clearly diminished . intense microglial iba-1 staining was observed at p7 and gradually decreased until adulthood . in postnatal animals , primitive ramified microglial cells were mainly found in the gray and white matter ( figures 9(a ) , 10(a ) and 10(g ) ) although some amoeboid microglial cells were seen in the cingulum of the corpus callosum , as previously reported . in the hippocampus , in addition , round - shaped iba-1 + macrophages were observed in the pia , very prominently in the medial fissure and in the ventricle linings , as has already been reported . at p10 , microglial cells were slightly more ramified , and an increase in cell density was noted , specifically in the corpus callosum , where microglial cells showed a parallel orientation to axon fibers . by p14 , microglial cells showed decreased iba-1 immunostaining ( figure 9(b ) ) and ramified resting morphology as described for the adult brain . at this age , iba-1 + macrophages were strongly diminished in the meninges and ventricles . by 21 days after birth , only highly ramified resting microglial cells were observed in the brain parenchyma , showing very low iba-1 staining ( figure 9(c ) ) . microglial activation was generally observed in several areas of the contralateral hemisphere from 3 to 48 hours after hypoxia ( figures 9(d ) and 9(e ) ) . increased expression of iba-1 and changes in microglial cell morphology towards reactive ramified cells mainly , but also amoeboid cells to a lower extent , were seen in most areas analyzed , but mainly in the hippocampus ( very prominently in the hippocampal fissure , figures 9(d ) and 9(e ) ) and the corpus callosum ( figures 9(d)9(f ) ) and other white matter tracts like the anterior commissural and external capsule , where microglial response was seen until 4872 hours after hypoxia . after 14 days fter hypoxia , only in the hippocampal fissure and corpus callosum of some animals , mild - activated microglia was observed . in the caudate - putamen ( figures 10(b ) and 10(c ) ) , neocortex ( figures 10(h ) and 10(i ) ) and thalamus ( data not shown ) , activated ramified microglial cells were seen mainly until 48 hours after hypoxia . hippocampusat 3 hours after hypoxia , microglial response in the ipsilateral hippocampus closely resembled that seen in the contralateral side ; however , reactive microglial cells tended to accumulate surrounding the blood vessels in the hippocampal fissure only in the ipsilateral hippocampus ( figure 9 , compare 9(d ) and 9(g ) ) . by 12 hours , reactive microglial cells changed to pseudopodic / ameboid morphologies and persisted in the fissure , significant differences between il and cl hippocampus were observed ( figure 11 ) . at 24 hours , increased iba-1 + macrophages were observed in the third ventricle , and the microglial response was maintained in the hippocampal fissure ( figure 9(h ) ) , but iba-1 + round - shaped microglia / macrophages started to cover the degenerating ca fields ( figure 9(h ) ) . notably , at this time , although morphological and distribution changes in the microglial response versus the contralateral hippocampus were evident ( figure 9 , compare 9(e ) and 9(h ) ) , the area occupied by reactive microglial cells did not differ significantly from the contralateral side ( figure 11 ) , probably as a consequence of the reduced total cell area of pseudopodic / ameboid cells versus ramified cells . from 48 hours to 7 days after hypoxia , a massive increase in microglia / macrophage cell intensity was evident in the fissure and ca field ( figures 9(i ) , 9(j ) , 9(l)9(n ) ) , showing a 57-fold increase in the area occupied by reactive microglia / macrophages when compared to the contralateral hippocampus ( figure 11 ) . at longer survival times , microglial response was strongly decreased , showing scattered reactive ramified and macrophages in the fissure and ca only until 14 days ( figures 9(o ) , 9(s ) , and 9(t ) ) , but no presence of reactive microglia / macrophages at 30 and 100 days ( figures 9(p ) , 9(q ) ) . it should be noted that only scattered activated microglial cells were present in the dg , and always located in the hilus , correlating with the above described astroglial response in this area which is mostly spared in this neonatal injury model as a consequence of its late development [ 53 , 54 ] .
at 3 hours after hypoxia , microglial response in the ipsilateral hippocampus closely resembled that seen in the contralateral side ; however , reactive microglial cells tended to accumulate surrounding the blood vessels in the hippocampal fissure only in the ipsilateral hippocampus ( figure 9 , compare 9(d ) and 9(g ) ) . by 12 hours , reactive microglial cells changed to pseudopodic / ameboid morphologies and persisted in the fissure , significant differences between il and cl hippocampus were observed ( figure 11 ) . at 24 hours , increased iba-1 + macrophages were observed in the third ventricle , and the microglial response was maintained in the hippocampal fissure ( figure 9(h ) ) , but iba-1 + round - shaped microglia / macrophages started to cover the degenerating ca fields ( figure 9(h ) ) . notably , at this time , although morphological and distribution changes in the microglial response versus the contralateral hippocampus were evident ( figure 9 , compare 9(e ) and 9(h ) ) , the area occupied by reactive microglial cells did not differ significantly from the contralateral side ( figure 11 ) , probably as a consequence of the reduced total cell area of pseudopodic / ameboid cells versus ramified cells . from 48 hours to 7 days after hypoxia , a massive increase in microglia / macrophage cell intensity was evident in the fissure and ca field ( figures 9(i ) , 9(j ) , 9(l)9(n ) ) , showing a 57-fold increase in the area occupied by reactive microglia / macrophages when compared to the contralateral hippocampus ( figure 11 ) . at longer survival times , microglial response was strongly decreased , showing scattered reactive ramified and macrophages in the fissure and ca only until 14 days ( figures 9(o ) , 9(s ) , and 9(t ) ) , but no presence of reactive microglia / macrophages at 30 and 100 days ( figures 9(p ) , 9(q ) ) . it should be noted that only scattered activated microglial cells were present in the dg , and always located in the hilus , correlating with the above described astroglial response in this area which is mostly spared in this neonatal injury model as a consequence of its late development [ 53 , 54 ] . corpus callosumthe corpus callosum , like other white tracts including the internal and external capsules , showed microglial response characterized by the presence of reactive ramified cells elongated in parallel to axonal tracts , from a few hours after the insult ( figure 9(g ) ) , and some ameboid microglia / macrophages observed at 2472 hours after hypoxia ( figures 9(h)9(k ) ) and until 7 days ( figure 9(n ) ) , when response diminished ( figures 9(o ) and 9(r ) ) , almost returning to basal level at 14 days after hypoxia . however , it should be noted that in this region only mild differences in relation to the contralateral side were seen , with no statistically significant differences shown in the iba-1 + area at any timepoint ( figure 11 ) , this pattern of microglial response in the ipsilateral versus contralateral white matter correlated with the mild response of astroglial cells described above although the changes in glial cells of the contralateral corpus callosum , which also results mildly atrophied , may be masking the increases in glial response in the ipsilateral side . the corpus callosum , like other white tracts including the internal and external capsules , showed microglial response characterized by the presence of reactive ramified cells elongated in parallel to axonal tracts , from a few hours after the insult ( figure 9(g ) ) , and some ameboid microglia / macrophages observed at 2472 hours after hypoxia ( figures 9(h)9(k ) ) and until 7 days ( figure 9(n ) ) , when response diminished ( figures 9(o ) and 9(r ) ) , almost returning to basal level at 14 days after hypoxia . however , it should be noted that in this region only mild differences in relation to the contralateral side were seen , with no statistically significant differences shown in the iba-1 + area at any timepoint ( figure 11 ) , this pattern of microglial response in the ipsilateral versus contralateral white matter correlated with the mild response of astroglial cells described above although the changes in glial cells of the contralateral corpus callosum , which also results mildly atrophied , may be masking the increases in glial response in the ipsilateral side . caudate - putamen , neocortex , and thalamusin general , in these areas , microglial response was also seen as early as 3 hours after hypoxia and lasted until 7 days although it showed a high degree of variability and very few significant differences in compared to the contralateral hemisphere ( figure 11 ) . reactive microglial cells mainly showed an activated ramified morphology and increased iba-1 labeling ( figures 10(d)10(f ) and 10(j)10(l ) ) although some pseudopodic / amoeboid microglial cells were seen from 12 to 72 hours after lesion , when maximum responses were seen ( figures 10(e ) and 10(k ) ) . in the caudate - putamen , iba-1 + cells have shown the higher activation in the ventral - lateral region . at 714 days after hypoxia , in all three regions , microglial response remained as patches of reactive ramified microglial cells ( figures 10(f ) and 10(l ) ) .
in general , in these areas , microglial response was also seen as early as 3 hours after hypoxia and lasted until 7 days although it showed a high degree of variability and very few significant differences in compared to the contralateral hemisphere ( figure 11 ) . reactive microglial cells mainly showed an activated ramified morphology and increased iba-1 labeling ( figures 10(d)10(f ) and 10(j)10(l ) ) although some pseudopodic / amoeboid microglial cells were seen from 12 to 72 hours after lesion , when maximum responses were seen ( figures 10(e ) and 10(k ) ) . in the caudate - putamen , iba-1 + cells have shown the higher activation in the ventral - lateral region . at 714 days after hypoxia , in all three regions , microglial response remained as patches of reactive ramified microglial cells ( figures 10(f ) and 10(l ) ) . only scattered neutrophils were seen in the medial or lateral third ventricle at p7p21 , in decreasing numbers with hardly countable cells at p21 . at these ages we also observed a few cells in blood vessels located in hippocampus and neocortex of both hemispheres ( figures 12(a)12(c ) ) . scattered neutrophils were also seen in the meninges / median fissure . in comparison to adults , neonates are known to have weakened neutrophil response and reduced tendency to extravasate from blood vessels [ 5557 ] . at 3 and 12 hours after hypoxia , some neutrophils were observed inside the blood vessels in the neocortex , caudate - putamen , and in the hippocampus , but also in the lateral side of third ventricle . by 2472 hours , neutrophil cell numbers decreased in the blood vessels of neocortex and in the third ventricle ( figure 13 ) . at 714 days after hypoxia , some neutrophils were observed in the medial third ventricle ( figure 13 ) , the neocortex , and the thalamus . at 30 and 100 days after injury , there was hardly any cell found in the brain blood vessels or the parenchyma ( figure 13 ) . hippocampusneutrophils were observed in the ipsilateral hippocampus as early as 3 hours after hypoxia ( figure 13 ) . cells were usually found distributed in the hippocampal fissure , the dentate gyrus , or the fimbria . at 12 hours after hypoxia , the number of cells increased and was localised in the ca3 region , in the parenchyma as well as inside the blood vessels . in the hippocampal fissure , the dentate gyrus and in the fimbria , most of the neutrophils were inside the blood vessels ( figure 13 ) . at 24 hours after hypoxia , neutrophils were observed throughout the hippocampus but mainly localised in ca1 region and the fimbria ( figure 13 ) . by 48 hours after hypoxia , neutrophils were not observed in the dentate gyrus though a few cells were present near ca3 and the fimbria ( figure 13 ) . neutrophils appeared to be evenly distributed throughout the hippocampus after 72 hours after hypoxia , but significantly higher density of cells were observed at 7 days after hypoxia ( figures 12(d)12(f ) and 13 ) . at this time of maximum neutrophil numbers , the cells were mostly observed near the hippocampal fissure , ca1 and ca3 region , with the majority of cells in the parenchyma , but usually concentrated near the blood vessels ( figures 12(e ) and 12(f ) ) . at 14 days after hypoxia , the amount of cells rapidly decreased although a few cells were still found , in close opposition to blood vessels in the hippocampal fissure and around the ca3 region . at 30 days after hypoxia , very few neutrophils inside the blood vessels could be identified , and at 100 days after hypoxia no neutrophils were seen inside the hippocampus . neutrophils were observed in the ipsilateral hippocampus as early as 3 hours after hypoxia ( figure 13 ) . cells were usually found distributed in the hippocampal fissure , the dentate gyrus , or the fimbria . at 12 hours after hypoxia , the number of cells increased and was localised in the ca3 region , in the parenchyma as well as inside the blood vessels . in the hippocampal fissure , the dentate gyrus and in the fimbria , most of the neutrophils were inside the blood vessels ( figure 13 ) . at 24 hours after hypoxia , neutrophils were observed throughout the hippocampus but mainly localised in ca1 region and the fimbria ( figure 13 ) . by 48 hours after hypoxia , neutrophils were not observed in the dentate gyrus though a few cells were present near ca3 and the fimbria ( figure 13 ) . neutrophils appeared to be evenly distributed throughout the hippocampus after 72 hours after hypoxia , but significantly higher density of cells were observed at 7 days after hypoxia ( figures 12(d)12(f ) and 13 ) . at this time of maximum neutrophil numbers , the cells were mostly observed near the hippocampal fissure , ca1 and ca3 region , with the majority of cells in the parenchyma , but usually concentrated near the blood vessels ( figures 12(e ) and 12(f ) ) . at 14 days after hypoxia , the amount of cells rapidly decreased although a few cells were still found , in close opposition to blood vessels in the hippocampal fissure and around the ca3 region . at 30 days after hypoxia , very few neutrophils inside the blood vessels could be identified , and at 100 days after hypoxia no neutrophils were seen inside the hippocampus . ventriclesan elevated number of cells were also present in the third ventricle , both medially and in the ipsilateral side of the third ventricle as early as 3 hours after hypoxia ( figures 12(g ) and 13 ) . at 1248 hours , the quantity of cells progressively decreased , but they were mostly distributed in the medial part ( figure 13 ) . by 7 days after hypoxia , correlating with increased numbers also in hippocampus , an increase in neutrophils both in the medial and ipsilateral side of the ventricle could be seen ( figure 13 ) . finally , by 14 to 100 days , no neutrophils were seen in the lateral side of the third ventricle although scattered cells were located in the medial part . an elevated number of cells were also present in the third ventricle , both medially and in the ipsilateral side of the third ventricle as early as 3 hours after hypoxia ( figures 12(g ) and 13 ) . at 1248 hours , the quantity of cells progressively decreased , but they were mostly distributed in the medial part ( figure 13 ) . by 7 days after hypoxia , correlating with increased numbers also in hippocampus , an increase in neutrophils both in the medial and ipsilateral side of the ventricle could be seen ( figure 13 ) . finally , by 14 to 100 days , no neutrophils were seen in the lateral side of the third ventricle although scattered cells were located in the medial part . caudate - putamen , neocortex , and thalamusfrom 3 hours to 72 hours , only a few neutrophils were located in the caudate - putamen region ( figure 13 ) . an increase in the number of cells was seen at 7 days ( figures 12(h ) and 13 ) , correlating with previously described areas . at longer survival times , no neutrophils were seen in this region.at 3 hours after hypoxia , some neutrophils were distributed in the blood vessels of different layers of the neocortex ( figure 12(i ) ) , being the time showing the highest density ( figure 13 ) . from 12 to 72 hours a reduction in neutrophil cell counts was generally observed although by 72 hours a few cells remained in the upper layers of neocortex . at 7 days after hypoxia , there was a mild increase in neutrophils located inside the cortical blood vessels in both hemispheres . at 30 and 100 days , almost no neutrophils were present in the neocortex , and if so , they were located inside the blood vessels ( figure 13).in the thalamus , very few cells were observed as compared to the other regions analysed . no neutrophils were observed from 3 to 48 hours after hypoxia , and only a few cells were seen at 72 hours , 7 and 14 days ( figures 12(j ) and 13 ) . from 30 days , neutrophils were no longer present in the thalamus ( figure 13 ) .
from 3 hours to 72 hours , only a few neutrophils were located in the caudate - putamen region ( figure 13 ) . an increase in the number of cells was seen at 7 days ( figures 12(h ) and 13 ) , correlating with previously described areas . at longer survival times , no neutrophils were seen in this region . at 3 hours after hypoxia , some neutrophils were distributed in the blood vessels of different layers of the neocortex ( figure 12(i ) ) , being the time showing the highest density ( figure 13 ) . from 12 to 72 hours a reduction in neutrophil cell counts was generally observed although by 72 hours a few cells remained in the upper layers of neocortex . at 7 days after hypoxia , there was a mild increase in neutrophils located inside the cortical blood vessels in both hemispheres . at 30 and 100 days , almost no neutrophils were present in the neocortex , and if so , they were located inside the blood vessels ( figure 13 ) . in the thalamus , no neutrophils were observed from 3 to 48 hours after hypoxia , and only a few cells were seen at 72 hours , 7 and 14 days ( figures 12(j ) and 13 ) . from 30 days , neutrophils were no longer present in the thalamus ( figure 13 ) . in the control brain and at all ages analysed , scattered lymphocytes were only located in the ventricles and meninges , although scattered single cells were sometimes seen in the hippocampus , neocortex , always inside the blood vessels ( figures 12(k ) , 12(l ) and 12(m ) ) . at all time points analysed after hypoxia , no changes were seen in the contralateral or the ipsilateral hemisphere when compared to control . in this study we have performed a detailed short and long - term analysis of neuropathological changes , astroglial , microglial response , and leukocyte recruitment following h / i to the neonatal mouse brain , describing massive damage and cellular changes in the ipsilateral hemisphere , but also not negligible changes in the contralateral side . our description of neuropathological changes in the ipsilateral hemisphere is in agreement with previous reports [ 18 , 42 , 58 , 59 ] , showing hippocampal damage as the most striking feature of hypoxic / ischemic damage in the neonatal mouse , whereas damage to caudate - putamen , neocortex , and thalamus is highly dependent on the postnatal age and the duration of the hypoxia . hippocampal damage with tissue disruption , neuronal damage , and disorganization of the ca cytoarchitecture was observed as early as 3 hours after hypoxia followed by milder damage to dg at later survival times , which is maintained relatively spared due to its postnatal development . at 7 days after hypoxia , significant atrophy of hippocampal area this temporal pattern of neurodegeneration is consistent with the observation from other studies showing that h / i damage in an immature brain evolves more rapidly than its adult counterpart [ 40 , 60 ] . we observe subcortical white matter damage and long - term atrophy , which has been described as a hallmark of neonatal h / i in preterm infants , where the oligodendrocytes in the periventricular white matter are considered one of the most vulnerable cell types to h / i damage [ 61 , 62 ] . in rodent models , neonatal h / i injury has been shown to cause axonal degeneration and disturbances in myelination [ 64 , 65 ] . following h / i in the p9 mouse , several authors have reported decreased expression levels of myelin basic protein ( mbp ) and proteolipid protein ( plp ) , decreased neurofilament expression , and the presence of apoptotic cells in the corpus callosum within 24 to 72 hours after injury [ 66 , 67 ] . white matter damage has been related to the loss of immature oligodendrocytes in the tracts as well as the loss of subventricular zone ( svz ) progenitors after h / i , inducing a depletion of oligodendrocyte precursors [ 68 , 69 ] . another area showing consistent damage and atrophy in the mouse model of h / i is the caudate - putamen , and the neocortex to a lesser extent and showing higher variability . in this regard , a recent study by selip and coworkers using the neonatal rat model have shown that rats with moderate or severe loss of mbp having significantly increased axonal degeneration in the temporal - parietal cortex , caudate - putamen , thalamus , and internal capsule . moreover , pups without evidence of severe white matter loss exhibited mild selective grey matter injury , as evidenced by mild axonal injury and neuronal degeneration , in the cortex , internal capsule , and caudate - putamen ; structures central to language processing and understanding , and motor and sensory function . injury in these regions , even if mild , may be implicated in the neurocognitive disturbances noted in preterm survivors who do not demonstrate other clinical or radiological evidence of overt periventricular white matter injury . it is interesting to note that we here describe in the mouse that caudate - putamen and cortical atrophy are mainly noted as a long - term effect but show very disperse injury scores at early survival times . moreover , the effect of h / i in the contralateral hemisphere has been studied extensively to suggest that it can not be used as an efficient control for histological assessment of brain damage in mice , in contrast to what has been described previously in the neonatal rat [ 60 , 72 , 73 ] , providing an significant difference in these species response to h / i . previous studies using the rat model of h / i have demonstrated that the blood flow to the contralateral cerebral hemisphere structures is relatively unchanged during hypoxia , and that the contralateral hemisphere , when evaluated several weeks after the injury , shows no tissue alterations or atrophy , suggesting that the contralateral hemisphere can be used as a control reference for the evaluation of the extent of damage in the ipsilateral hemisphere in the rat . some molecular changes in kinases and proinflammatory molecules have been described in both hemispheres in h / i neonatal rats [ 75 , 76 ] . also jansen and low histologically assessed a hypertrophy of the contralateral hemisphere in adult rats that had undergone perinatal h / i . in the mouse brain , several laboratories have shown that it does not suffer apparent changes during the first week following h / i as is also commonly used as a reference to evaluate the ipsilateral hemisphere . interestingly , inflammatory gene profiling in p9 mouse brain after h / i shows more than 140 genes involved in the tissue response during the first 72 hours ; however , only microglial expression of osteopontin showed an increase in contralateral subcortical white matter . while mice and rats show distinguished regional features in tissue damages , it would be interesting to analyze the molecular changes in hi - neonatal mice . nevertheless , it should be noted that we here report that analysis of the h / i mouse brain up to 3 months after the injury shows some degree of atrophy in the contralateral hippocampus and the corpus callosum , accompanied by ventricle swelling , an event that has been reported earlier . there are reports stating compensatory reorganizational changes occurring in the contralateral hemisphere in some animals following neonatal h / i brain injury and that this plasticity may be functionally advantageous . moreover , the presence of significant cognitive deficit in apparent unilateral focal brain injury also indicates towards the involvement of contralateral hemisphere . in this sense , it should be noted that h / i animals undergo systemic hypoxia , which has been shown to induce changes in gene expression and cell activity by itself . as an example , change in the expression of certain cytokines , like hypoxia inducing factor alpha ( hif ) , and p - akt to the same extent in both the ipsi as well as contralateral hemisphere showed that hypoxia is sufficient to regulate multiple mediators that may contribute , but may not be sufficient to induce long - term neuronal damage . as reviewed by sofroniew and vinters , many gray matter astrocytes in healthy cns do not express gfap at immunohistochemically detectable levels or express low levels as in neonates . in our immunohistochemically processed sections , although gfap expression was seen in control neonatal brains , an increase in gfap immunostaining was observed after h / i from early time points ( 312 hours ) in comparison to p7 age - matched control , implying an onset of astrogliosis . notably , changes in astroglial morphology by gfap immunostaining were first seen at 3 hours post - hypoxia both in the ipsilateral as well as contralateral hemisphere . in the contralateral hemisphere , increased gfap and astroglial hypertrophy showed a maximum response at 2448 hours after hypoxia but decreased at longer survival times . in the contralateral side , astroglial response was very restricted to the corpus callosum and the area of the hippocampal fissure , but never covering the ca - neuronal layer . however , in the ipsilateral h / i - damaged hemisphere , the increase in gfap expression and cell hypertrophy peaked at 14 days after hypoxia and was evident in the corpus callosum , the caudate - putamen , the neocortex , and the hippocampus , where the long - term glial scar persisted till 100 days after hypoxia . as the radial glia mature , they show gfap expression and some give rise to gfap - expressing radial neural stem cells ( nscs ) that persist in juvenile and adult forebrain , while others become astrocytes [ 8183 ] . some of these radial nscs remain constitutively active throughout life in the subventricular zone of the lateral ventricles and in the subgranular zone of the hippocampal dentate gyrus , where they are the predominant source of adult neurogenesis . this might be the reason of concentration and persistence of glial scar or gfap+ cells at 14100 days after hypoxia in hilus and hippocampal fissure in our study . notably , gfap expression after h / i was also found most highly concentrated in layers showing high content of synaptic contacts including the hippocampal fissure in the neonatal brain as seen in our study , which is in concordance with reports where astrocytes appear to influence developmental synaptic pruning by releasing signals and thereby tag them for elimination by microglia [ 84 , 85 ] . the role of reactive astrogliosis in the evolution of ischemic brain lesions especially in neonates is at present not clear , but recent studies have suggested that reactive astrocytes provide essential metabolic support to neurons during transient ischemia and that failure of astrocyte functions may contribute to neuronal degeneration [ 86 , 87 ] . additionally , in adult transgenic mice , experimental disruption of astroglial scar formation following stroke is associated with loss of barrier functions along the margins of infarcts , resulting in increased spread of inflammation and increased lesion volume . moreover , adult mice lacking gfap [ gfap(/ ) ] show attenuated reactive gliosis , reduced glial scar formation after focal brain ischemia as compared to injured developing brain where there is only an increase in the survival of newborn neurons . astrocytes also play a vital role in white matter , regulating molecules such as glutamate in the extracellular space and preventing excitotoxic damage to neighbouring oligodendrocytes and axons . consistent with previous reports , we noted an increase in gfap expression in white matter astrocytes accompanied by hypertrophy and process thickening in ipsilateral hemispheres . in control postnatal mice , we observed amoeboid and ramified microglia throughout gray and white matter from p7 to p14 mice , as has been described previously . as the brain development continues after birth , microglial cells need to adapt to the changes in the microenvironment . until p14 , we observed groups of amoeboid microglial cells which are present in the developing corpus callosum , cingulum , and fimbria . these cells are proposed to be involved in the phagocytosis of cellular debris and contribute to the axonal nerve fiber remodeling and synapsis during normal development [ 9395 ] . in the present study , we have observed morphologically activated microglia from 3 to 72 hours after hypoxia in the contralateral corpus callosum , with a peak of response at 24 hours . this microglial response to hypoxic conditions in the subcortical white matter has been extensively studied by the group of ling and coworkers , who have demonstrated that hypoxia - activated microglial cells in the developing white matter produce several inflammatory mediators including cytokines , chemokines , and reactive oxygen species which are detrimental for white matter development and oligodendrocyte survival ( reviewed in ) , which may account for the long - term contralateral corpus callosum atrophy we observe , although the microglial response in the contralateral corpus callosum is transient , in agreement with the findings of zaidi and coworkers in the p7 rat model , that did not observe activated microglia after 14 days of hypoxia in the contralateral hemisphere . interestingly , in agreement with our observations , cowell and coworkers have shown a transient contralateral microglia activation in the cortex , white matter and hippocampus after an unilateral transection of mca in neonatal rat brain . obviously , microglial response in the ipsilaterally damaged corpus callosum is very striking , showing reactive ramified and ameboid / macrophagic forms from 3 hours to 14 days after hypoxia , with a peak of response at 4872 hours . it is now evident that the developing brain is highly susceptible to hypoxic damage because of its high oxygen and energy requirements [ 99 , 100 ] , and that white matter at this developmental stage is vulnerable . moreover it have been described that the myelin from the degenerating axons is phagocytosed by microglia . in this sense , as long - term atrophied white matter is observed after microglia returns to a resting state , we may suggest that activated microglial cells may not be sufficient to complete phagocytosis and avoid the inhibition of oligodendrocyte precursors differentiation . as most of this knowledge is mainly obtained from results in rat models and several differences has been described between rodents , a more detailed description on the late effects on oligodendrocytes , their precursors , myelination and axonal degeneration in neonatal mice brain hypoxic ischemic injury is needed . interestingly , microglial response in the contralateral gray matter areas was more evident that the astroglial response , and activated microglial cells were seen as early as 3 hours after hypoxia in the hippocampus , but also in the caudate - putamen and cortex ( see figures 9 and 10 ) ; however , contralateral microgliosis was very transient and only persisted until 4872 hours depending on the regions . in the contralateral hippocampus , microglial response was mostly evident in the hippocampal fissure , and not so widespread as in the ipsilaterally damaged side , where we describe a layer - specific activation of microglia as early as 3 hours after hypoxia , with a maximum response from 48 hours to 7 days , followed by a patchy pattern at later time points . this has also been demonstrated at early time points in rat model as mentioned previously by cowell and coworkers . remarkably , hippocampal microglial response was first observed surrounding the blood vessels in the hippocampal fissure , which have been suggested to be more vulnerable to ischemic episodes than those from other hippocampal areas . interestingly , this is known to be one of the sources of microglia progenitors during late embryonic life in the rat , showing , during early postnatal development an outside - to - inside microglia distribution pattern towards the pyramidal or granular cell layers . from 24 hours onwards evident neuronal damage when evident neuronal damage takes place in the ipsilateral hippocampus and then ameboid / macrophagic phagocytic microglia populate the neurodegenerating ca areas . the association between microglia activation and injury development raises the question whether this reaction is detrimental or beneficial [ 103105 ] . however , it is now established that , as macrophages do in the periphery , microglia has two different patterns of activation and function in response to cns injury ( revised by [ 26 , 103 , 106 ] ) . opposite effects have been described in neonatal h / i mice and rats using minocycline , a tetracycline derivative that nonspecifically blocks all microglia activation . in rat brain , this treatment protects the brain tissue in some reports [ 19 , 20 ] but only have a transient protective effect in others . in contrast , tissue damaged increases in minocycline - treated h / i mice , especially in cortex , caudate - putamen and thalamus without significant effects on hippocampus . additionally , selective depletion of microglia before a transient mcao in a p7 rats does not change the volume of injury but enhances cytokines production compared to not depleted animals , suggesting a beneficial role of microglial cells . these evidences made a complete characterization of neonatal mice microglial response essential , in order to define the better window and target for protective therapies . new insides in the physiological activity of microglia ( called surveillance instead of resting ) , joined to adult mri and behaviour assessment [ 78 , 110 ] , would be beneficial to promote phagocytic and anti - inflammatory response of microglia than a complete blocking of their activation in order to obtain better outcomes of therapies applied to injured developing brain . the neonates are known to have weakened neutrophil response and reduced tendency to leukocyte extravasation from blood vessels [ 5557 ] . previous studies have demonstrated that neutrophils contribute to the long - term hypoxic / ischemic brain injury in the neonatal rat brain [ 111 , 112 ] . we here report that neutrophils appeared as early as 3 hours after hypoxia in blood vessels of most of the regions studied , especially in the neocortex and third ventricle , in agreement with previous reports showing that neutrophils are seen in brain blood vessels rather early [ 111 , 113 , 114 ] . however , there are limited studies reporting neutrophils in the neonatal parenchyma after hypoxia , and the results are variable ; we observed neutrophil recruitment to the injured mouse parenchyma ( mainly hippocampus and caudate - putamen ) after 72 hours to 7 days after hypoxia , whereas other studies have shown neutrophils accumulated in the injured rat parenchyma at 1224 hours after hypoxia , peaking at 7296 hours [ 113 , 115 ] . notably , neutrophils accumulate in the same areas of microglia / macrophage accumulation , contributing in the removal of cellular debris and the release of cytokines to further attract more immune cells to the injury site [ 114 , 116 ] . the negligible lymphocytic infiltration reported here is in accordance with previous reports where no cd3 + cells were detected in the neonatal p1 rat brain at 48 hours after hypoxia and lps induction . furthermore , there are reports of very low expression of cd3 chain of the t - cell receptor in p3 , p7 , and p14 mice brain in contrast to adult . since many investigators are using transgenic and knockout mice to determine the importance of specific molecules in the evolution of damage after brain injury , there is an urgent need to perform comparative studies on the relative vulnerability of the mouse brain in comparison to other species . a mouse model of hypoxic - ischemic encephalopathy has paved a way for the description of the specific molecular mechanisms associated with this destructive disease , by the use of genetically modified animals . our major finding describing the short- and long - term effects as well as the involvement of the contralateral hemisphere may serve as a valuable resource for functional definition of neuroprotection or damage as well as will aid in selecting the time and mode of intervention in the broad therapeutic window . to summarize , this study describes qualitatively and quantitatively the tissue damage , glial response , and inflammatory cell recruitment after brain injury induced by carotid occlusion and systemic hypoxia ( 8% o2 , 55 minutes ) to the postnatal day 7 mouse brain , analyzing changes from 3 hours to 100 days after hypoxia . in general , massive tissue injury and atrophy in the ipsilateral hippocampus , corpus callosum and caudate - putamen are consistently shown , with neutrophil recruitment and earlier microgliosis , but persistent long - term glial scarring until 100 days after hypoxia . remarkably , in the contralateral hippocampus and corpus callosum , milder atrophy is delayed in areas that show the activation of astrocytes and microglial during the first 72 hours . this study highlights that care should be taken when using the contralateral hemisphere as control while studying ipsilateral h / i injury in postnatal mouse brain . | understanding the evolution of neonatal hypoxic / ischemic is essential for novel neuroprotective approaches .
we describe the neuropathology and glial / inflammatory response , from 3 hours to 100 days , after carotid occlusion and hypoxia ( 8% o2 , 55 minutes ) to the c57/bl6 p7 mouse . massive tissue injury and atrophy in the ipsilateral ( il ) hippocampus , corpus callosum , and caudate - putamen are consistently shown .
astrogliosis peaks at 14 days , but glial scar is still evident at day 100 . microgliosis peaks at 37 days and decreases by day 14 .
both glial responses start at 3 hours in the corpus callosum and hippocampal fissure , to progressively cover the degenerating ca field .
neutrophils increase in the ventricles and hippocampal vasculature , showing also parenchymal extravasation at 7 days .
remarkably , delayed milder atrophy is also seen in the contralateral ( cl ) hippocampus and corpus callosum , areas showing astrogliosis and microgliosis during the first 72 hours .
this detailed and long - term cellular response characterization of the ipsilateral and contralateral hemisphere after h / i may help in the design of better therapeutic strategies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
torsion of the gallbladder is a rare condition . since its initial description in 1898 ( 1 ) , a 76 year old man presented to the emergency department with a six hour history of sudden onset of upper abdominal pain and vomiting . the pain was localised to the right upper quadrant , and was associated with several episodes of vomiting . his past history included ileal ulceration diagnosed on capsule endoscopy , as well as gastro - oesophageal reflux and osteoporosis . his surgical history was significant only for an appendicectomy . on examination , he was afebrile and vital signs were within normal limits . white cell count ( 7.810/l ) and c - reactive protein ( < 5mg / l ) were within the normal range . abdominal ultrasound and computed tomography revealed a large distended , low - lying gallbladder with a diffusely thickened wall ( up to 6 mm ) , pericholecystic fluid and no cholelithiasis ( figure 1 ) . computed tomography demonstrating a low - lying gallbladder with a diffusely thickened wall and pericholecystic fluid a diagnosis of acute acalculous cholecystitis was made , and the patient was referred for a cholecystectomy . at laparoscopy , he was found to have a gangrenous torted gallbladder ( figures 2 and 3 ) , with a 360 degrees clockwise torsion . the gallbladder was detorted laparoscopically and an attempt was made at laparoscopic dissection , but calot s triangle was too inflamed and suffused with blood to clearly identify the anatomy and so the procedure was converted to open . the gallbladder was safely resected , and a cholangiogram revealed normal biliary anatomy with no bile duct stones . laparoscopic view of the gangrenous gallbladder , with a 360 degrees clockwise torsion on its mesentery laparoscopic view of the gangrenous gallbladder , with a 360 degrees clockwise torsion on its mesentery histopathology confirmed the diagnosis of gangrenous cholecystitis following torsion . the frequency has been observed to increase with age , with a peak incidence between 60 and 80 years ( 3 ) . women are more frequently affected ( female to male ratio of 3:1 ) ( 4 ) ; although in children it is more common amongst boys ( ratio of 1:4 ) ( 5 ) . the exact aetiology of gallbladder torsion remains unknown , although certain anatomical variants are thought to predispose to torsion ( 6 ) . the first of these is where the gallbladder has its own mesentery ; the second occurs when the cystic duct and artery have a mesentery , and the gallbladder is free within the peritoneal cavity . given the age distribution of patients with gallbladder torsion , these congenital variants are thought to be exacerbated following liver atrophy and loss of visceral fat . pre - operative diagnosis of gallbladder torsion remains uncommon , owing to the rarity of the condition and the non - specific clinical and radiological features . the gallbladder may appear to lie below its normal anatomic fossa , and may have an echogenic conical structure ( representing the twisted pedicle ) at the gallbladder neck ( 7 ) . stones may be an incidental finding ( reported in 24.4% of cases in one study ( 8) ) , but are not thought to play any role in the aetiology of the condition . similarly , computed tomographic scans may reveal an abnormal anatomical position for the gallbladder , as well as wall thickening and pericholecystic fluid . advances in imaging techniques , particularly multidetector computed tomography ( mdct ) and magnetic resonance cholangiopancreatography ( mrcp ) , have allowed an increasing number of cases to be diagnosed pre - operatively ( 2 ) . while rare , gallbladder torsion should be considered as a differential in elderly patients with right upper quadrant pain . a high index of suspicion , combined with improved radiological techniques , allows early diagnosis . with prompt surgical management | torsion of the gallbladder is an uncommon condition that is rarely diagnosed pre - operatively . here ,
we present the case of a 76 year old male who was found to have a complete torsion of the gallbladder , and was successfully treated with cholecystectomy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatitis b virus ( hbv ) is a hepatotrophic virus that causes a major global health problem . an estimated 2 billion individuals have been infected with hbv and approximately 350 million have the chronic disease . although the mechanism of hbv pathogenesis remains elusive , host genetic factors are proposed to govern the pathology of disease progression or regression , along with viral and environmental factors . nk cells are activated in the early response to infection , and there is substantial population variability in the rates of hbv infection . killer cell immunoglobulin - like receptors ( kirs ) are members of the group of cell - surface molecules that activate or inhibit nk cell interaction with hla class i molecules on the surface of target cells . although detailed genetic and functional analyses exploring kir influences on hbv in large cohorts are lacking , accumulating evidence supports that nk cell activation contributes to inflammation and liver injury during hbv infection both in hbv transgenic mice and in hbv infected patients [ 58 ] . kirs are members of the immunoglobulin superfamily of receptors and are encoded on chromosome 19q13.4 . the kir gene cluster comprises up to 16 highly homologous and closely linked genes and pseudogenes . fourteen of them encode receptors triggering either inhibition ( 3dl13 , 2dl13 , 2dl5 ) or activation ( 3ds1 , 2ds15 ) and/or both ( 2dl4 ) , and 2 pseudogenes ( 2dp1 and 3dp1 ) do not encode cell - surface receptors . encode for cell - surface receptors , while the remaining alleles , 2ds4 * 003/4/6/7/8/9 , carry a 22-base pair deletion in exon 5 , which causes a frame shift , yielding a truncated kir2ds4 protein with loss of the transmembrane and cytoplasmic domains of the full - length kir2ds4 protein . additionally , different combinations of kir genes generate inherited haplotypes that can be divided into 2 basic groups a and b on the basis of their gene content . polymorphic kirs , which interact with hla class 1 , are largely inhibitory and exhibit substantial genetic diversity . the result is a significant variation of nk cell repertoire between individuals and also between populations . as each kir - ligand interaction may have differential effects on nk cell activation and inhibition , this diversity has important potential influences on the host response to infections . genetic studies have demonstrated associations between specific kir - ligand combinations and the pathogenesis and progression of diverse viral infectious diseases [ 1217 ] . there is still limited data on the relationship of kir genes and chronic hbv infection in the literature . additionally , to our knowledge , no analogous study has been performed in our population thus far . the aim of this study was to analyze whether inhibiting or activatory kir genes and different kir genotypes have an association in the progression of hbv infection in a turkish population . this may help to explore some of the possible immune genes that could be important in predisposition to chronic hbv infection . the patient groups consisted of 37 patients ( 17 male , 20 female ) with chronic hbv infection and 36 patients ( 15 male , 21 female ) in spontaneous remission state of hbv infection diagnosed at the department of infectious diseases of the cukurova university , balcal hospital . the diagnostic criterion for chronic hbv adopted in this study the control group consisted of 85 healthy subjects ( 38 males and 47 females ) . the ages ranged from 18 to 70 years ( mean , 43 years ) for the patients with chronic hbv , from 19 to 78 years ( mean , 42.6 years ) for the patients with spontaneous remission , and from 19 to 74 years ( mean , 42.5 years ) for the control group . all individuals included in this study were from the cukurova region of turkey and they were all matched for ethnicity . all the enrolled subjects had no serological evidence of hepatitis c virus , hepatitis d virus , and hiv infections , and had no other diseases such as diabetes , malignant tumor , or autoimmune diseases . samples were collected after informed written consent that was obtained from all participants , and the study was approved by the cukurova university ethics committee . diagnosis of chronic hbv infection was based on seropositivity for anti - hbv antibody using electrochemiluminescence immunoassay ( roche diagnostics , gmbh , mannheim , germany ) and the confirmation of hbv dna using light cycler 2.0 real - time polymerase chain reaction ( roche diagnostics , gmbh , mannheim , germany ) . dna from a venous blood sample of each subject was extracted by dna isolation kit ( qiaamp dna blood mini kit , cat no : 51104 , qiagen vertriebs gmbh , vienna , austria ) . genotyping of kir genes was performed using the multiplex kir - sso typing kit from tepnel lifecodes corporation ( ref : 545110r , ct , usa ) . this product consists of a mixture of locus - specific oligonucleotide probes coupled to color - coded microspheres ( luminex corp ) and 2 pcr reactions for the amplification of kir - exons 4 , 5 , 7 , 8 , and 9 . to type each sample , pcr was performed and the product was hybridized with the sso - probe mixture using the manufacturer s protocol . frequencies of group - a and -b kir haplotypes were deduced from the genotype data . in individuals carrying only kir3dl3 , 2dl3 , 2dl1 , 2dp1 , 3dp1 , 2dl4 , 3dl1 , 2ds4 and 3dl2 , a fixed - gene content characteristic of group - a haplotypes was considered carrying 2 copies of group - a kir haplotypes ( aa genotypes ) . if any of genes kir2dl2 , 2dl5 , 3ds1 , 2ds1 , 2ds2 , 2ds3 and/or 2ds5 were present , then the genotype was considered as having b haplotype ( bx ) . the percentage of each kir gene in the patient and control groups was determined by direct counting ( individuals positive for the gene / individuals tested per population100 ) . differences between 2 groups in the distribution of each kir gene were estimated by 2-tailed fisher s exact test and p<0.05 was considered to be statistically significant . the patient groups consisted of 37 patients ( 17 male , 20 female ) with chronic hbv infection and 36 patients ( 15 male , 21 female ) in spontaneous remission state of hbv infection diagnosed at the department of infectious diseases of the cukurova university , balcal hospital . the diagnostic criterion for chronic hbv adopted in this study the control group consisted of 85 healthy subjects ( 38 males and 47 females ) . the ages ranged from 18 to 70 years ( mean , 43 years ) for the patients with chronic hbv , from 19 to 78 years ( mean , 42.6 years ) for the patients with spontaneous remission , and from 19 to 74 years ( mean , 42.5 years ) for the control group . all individuals included in this study were from the cukurova region of turkey and they were all matched for ethnicity . all the enrolled subjects had no serological evidence of hepatitis c virus , hepatitis d virus , and hiv infections , and had no other diseases such as diabetes , malignant tumor , or autoimmune diseases . samples were collected after informed written consent that was obtained from all participants , and the study was approved by the cukurova university ethics committee . diagnosis of chronic hbv infection was based on seropositivity for anti - hbv antibody using electrochemiluminescence immunoassay ( roche diagnostics , gmbh , mannheim , germany ) and the confirmation of hbv dna using light cycler 2.0 real - time polymerase chain reaction ( roche diagnostics , gmbh , mannheim , germany ) . dna from a venous blood sample of each subject was extracted by dna isolation kit ( qiaamp dna blood mini kit , cat no : 51104 , qiagen vertriebs gmbh , vienna , austria ) . genotyping of kir genes was performed using the multiplex kir - sso typing kit from tepnel lifecodes corporation ( ref : 545110r , ct , usa ) . this product consists of a mixture of locus - specific oligonucleotide probes coupled to color - coded microspheres ( luminex corp ) and 2 pcr reactions for the amplification of kir - exons 4 , 5 , 7 , 8 , and 9 . to type each sample , pcr was performed and the product was hybridized with the sso - probe mixture using the manufacturer s protocol . frequencies of group - a and -b kir haplotypes were deduced from the genotype data . in individuals carrying only kir3dl3 , 2dl3 , 2dl1 , 2dp1 , 3dp1 , 2dl4 , 3dl1 , 2ds4 and 3dl2 , a fixed - gene content characteristic of group - a haplotypes was considered carrying 2 copies of group - a kir haplotypes ( aa genotypes ) . if any of genes kir2dl2 , 2dl5 , 3ds1 , 2ds1 , 2ds2 , 2ds3 and/or 2ds5 were present , then the genotype was considered as having b haplotype ( bx ) . the percentage of each kir gene in the patient and control groups was determined by direct counting ( individuals positive for the gene / individuals tested per population100 ) . differences between 2 groups in the distribution of each kir gene were estimated by 2-tailed fisher s exact test and p<0.05 was considered to be statistically significant . framework genes kir2dl4 , 3dl2 , 3dl3 , and 3dp1 were present in all of the samples ( figure 1 ) . among inhibitory kir genes , 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients , which were more than 78.4% . with the exception of kir2ds4 , frequencies of the remaining activating genes were all lower than 54.1% ( table 1 ) . the most frequent genotype , found in 13.5% of patients , was aa180 genotype , which consists of only 1 activating gene other patients demonstrated the presence of more than 1 activating gene and thus were considered as bx ( 67.6% ) . two different aa genotypes aa180 ( 13.9% ) and aa1 ( 8.3% ) were found in the spontaneous remission group , which consists of only one activating gene kir2ds4 ( figure 2 ) . other individuals in this group demonstrated the presence of more than 1 activating gene and thus were considered as bx ( 76.8% ) . framework genes kir2dl4 , 3dl2 , 3dl3 , and 3dp1 were also present in all of the samples ( figure 2 ) . among inhibitory kir genes , 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients , which were more than 80.6% . with the exception of kir2ds4 , frequencies of the remaining activating genes were all lower than 63.9% ( table 1 ) . in the first step , frequencies of individual kir genes were compared between chronic hbv patients and patients with spontaneous remission ( table 1 ) . in the second step , frequencies of individual kir genes were compared between the control group and the group composed of chronic hbv patients and patients with spontaneous remission ( table 2 , figure 3 ) . the rate of inhibitory kir2dl3 ( p=0.0 ) and 3ds1 ( p=0.0 ) were higher in the healthy group than the group composed of chronic hbv patients and patients with spontaneous remission . since the methods used for kir genotyping permitted distinguishing groups of alleles of activating kir2ds4 , we found that there were no statistically significant differences for 2ds4 * 001 ( full - length exon 5 ) and 2ds4 * 003/4/6/7/8/9 ( deletion in exon 5 ) alleles between the 2 groups ( p>0.05 ) . additionally , there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group ( p>0.05 ) . framework genes kir2dl4 , 3dl2 , 3dl3 , and 3dp1 were present in all of the samples ( figure 1 ) . among inhibitory kir genes , 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients , which were more than 78.4% . with the exception of kir2ds4 , frequencies of the remaining activating genes were all lower than 54.1% ( table 1 ) . the most frequent genotype , found in 13.5% of patients , was aa180 genotype , which consists of only 1 activating gene other patients demonstrated the presence of more than 1 activating gene and thus were considered as bx ( 67.6% ) . two different aa genotypes aa180 ( 13.9% ) and aa1 ( 8.3% ) were found in the spontaneous remission group , which consists of only one activating gene kir2ds4 ( figure 2 ) . other individuals in this group demonstrated the presence of more than 1 activating gene and thus were considered as bx ( 76.8% ) . framework genes kir2dl4 , 3dl2 , 3dl3 , and 3dp1 were also present in all of the samples ( figure 2 ) . among inhibitory kir genes , 2dl1 and 3dl1 had higher frequencies in all samples of chronic hbv patients , which were more than 80.6% . with the exception of kir2ds4 , frequencies of the remaining activating genes were all lower than 63.9% ( table 1 ) . in the first step , frequencies of individual kir genes were compared between chronic hbv patients and patients with spontaneous remission ( table 1 ) . there were no statistically significant differences between these 2 groups . in the second step , frequencies of individual kir genes were compared between the control group and the group composed of chronic hbv patients and patients with spontaneous remission ( table 2 , figure 3 ) . the rate of inhibitory kir2dl3 ( p=0.0 ) and 3ds1 ( p=0.0 ) were higher in the healthy group than the group composed of chronic hbv patients and patients with spontaneous remission . since the methods used for kir genotyping permitted distinguishing groups of alleles of activating kir2ds4 , we found that there were no statistically significant differences for 2ds4 * 001 ( full - length exon 5 ) and 2ds4 * 003/4/6/7/8/9 ( deletion in exon 5 ) alleles between the 2 groups ( p>0.05 ) . additionally , there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group ( p>0.05 ) . nk cells express multiple cell surface receptors , and during different infections different receptors are likely to be important . kirs have a variegated expression pattern , and their complex genetics indicate that they are involved in generating population diversity in antiviral immune response . previous studies have demonstrated several associations between various kir genes and/or their hla class i ligands in clinical progression of hbv infection [ 2022 ] and in the progression of this infection to hepatocellular carcinoma . these associations could be due to the capacity of interactions of hla class i molecules -especially hla - c and hla - b- with kirs and activation of nk cells . in the present study , we examined the genes encoding kir receptors and kir genotypes in chronic hbv patients , patients with spontaneous remission , and healthy controls in a turkish cohort . our results showed that the frequencies of both kir2dl3 and kir3ds1 genes were much higher in healthy controls than in chronic hbv patients and patients with spontaneous remission . this might indicate that the inhibitory kir2dl3 and activating kir3ds1 were possibly protector genes for hbv infection . similarly , gao et al , in their study comparing 182 chronic hbv patients with 140 healthy controls , reported that kir2dl3 : hla - c1 homozygosity was protective against hbv infection and that kir2dl1 : hla - c2 was associated with susceptibility to hbv infection . in contrast , zhi - ming et al showed that kir2ds2 and kir2ds3 are hbv - susceptive genes , whereas kir2ds1 , kir3ds1 , and kir2dl5 may be protective genes that facilitate the clearance of hbv in a han chinese population . population genetic analyses have revealed that the frequency and distribution of kir genes and haplotypes vary with ethnicity . although zhi - ming s study and ours were done in different populations , the kir3ds1 gene was found as a protector gene in both studies . in a wider study , lu et al analyzed kir genes in 150 patients with chronic hbv infection , 251 spontaneous resolvers , and 451 healthy controls . they found a lower frequency of the a haplotype and higher frequency of the b haplotype in patients exposed to hbv infection compared with healthy controls , implying a susceptibility effect of the b haplotype . in our study , there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group . additionally , in a recent study , pan et al suggested the association of a combination of full - length form and 22 bp - deleted form of kir2ds4 ( kir2ds4/1d ) with hepatocellular carcinoma incidence in patients with chronic hbv . previous studies showed that there are important similarities between inhibitory and activating kir frequencies of patients with hepatitis c and hbv infections , despite these viruses being phylogenetically unrelated . khakoo et al reported that genes encoding the inhibitory nk cell receptor kir2dl3 and its ligand , hla - c1 , influence resolution of hepatitis c virus infection in caucasians and african americans with expected low infectious doses of hcv but not in those with high - dose exposure . chronic hbv patients , patients with spontaneous remission of hbv infection , and healthy controls in our population demonstrate that kir2dl3 and kir3ds1 are important immuno - genetic markers in determining antiviral immunity . to explore the role of kirs in hbv infections , the interrelation between kir genes , genotypes , and chronic hbv infection should be investigated in many different populations . models based on both activating and inhibitory receptors and their ligand interactions could be generated for detailed genetic studies in wider groups . thus , in order to confirm the present general results obtained in this study , functional studies and investigations in different populations are still needed to better understand this mechanism . | backgroundkiller cell immunoglobulin - like receptors ( kirs ) are a family of inhibitory and activating receptors expressed by natural killer ( nk ) cells and regulate nk cell activity in the innate response against viral infections .
the aim of this study was to determine the possibility of kir genes and genotypes as a candidate for susceptibility to or protection against chronic hepatitis b virus ( hbv ) infection or spontaneous remission of the infection in a turkish cohort.material/methodsthe present study was carried out on 37 patients with chronic hbv infection , 36 patients in spontaneous remission of hbv infection , and 85 healthy subjects .
sequence - specific oligonucleotide probes analysis was used to investigate 16 kir genes .
all data were statistically analyzed by the fisher exact test.resultsthe rate of inhibitory kir2dl3 ( p=0.0 ) and 3ds1 ( p=0.0 ) were higher in the healthy group than the group composed of chronic hbv patients and patients with spontaneous remission .
there were no statistically significant differences between the rate of aa and bx genotypes of chronic hbv patients and patients with spontaneous remission and the control group ( p>0.05).conclusionsour results suggest that kir2dl3 and kir3ds1 genes could be protector genes for hbv infection and they could be important immuno - genetic markers in determining antiviral immunity in the turkish population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
memory impairment is one of the most common cognitive complaints during the course of aging . mild cognitive impairment is a condition in which people experience memory problems more often than expected for their age . however , the symptoms do not prevent them from daily activities and are not as severe as those of alzheimer 's disease . symptoms of memory decline or mild cognitive impairment usually represent a transitional state between healthy aging and alzheimer 's disease . although individuals with memory complaints do not meet criteria for dementia , they may perform poorly on episodic memory tests . in some older people , alzheimer 's disease and neurodegenerative dementias are growing health problems that affect all ethnic groups worldwide . alzheimer 's disease is characterized by widespread cortical changes , loss of neurons , and presence of senile plaques and neurofibrillary tangles . although definitive diagnosis is based on pathological examination , recent advances in imaging techniques may contribute to early diagnosis of mild cognitive impairment and alzheimer 's disease . increasing evidence from structural and functional mri studies suggests that alzheimer 's disease and mild cognitive impairment may target specific brain networks . proton magnetic resonance spectroscopy appears to be a valuable means of tracking brain metabolic changes due to cognitive impairment . structural imaging can detect the time course of brain atrophy in patients with alzheimer 's disease and may serve as a surrogate marker for pathological changes in people with suspected alzheimer 's disease . emerging magnetic resonance techniques such as diffusion tensor imaging and proton density weighted imaging , and advances in image analysis software , provide us with an efficient tool for early detection of subtle microstructural , perfusion and metabolic changes in the brain . in this review , we highlight the body of literature on brain abnormalities detected by imaging in mild cognitive impairment and alzheimer 's disease . in particular , we address the viability of mri techniques to discriminate between dementias and to measure disease progression . volumetric mri is becoming an increasingly important tool in the early detection and monitoring of people suspected to have mild cognitive impairment or alzheimer 's disease . previously , the detection of atrophy depended on the measurement of regional brain volumes , using volumetric imaging techniques . patients with alzheimer 's disease may have typical pathologic changes in cortical gray matter , characterized by the accumulation of amyloid beta plaques , formation of neurofibrillary tangles , and neuronal and synaptic loss . the vast majority of structural brain imaging studies have been based on histopathological evidence that the entorhinal cortex and hippocampus are among the first sites affected by mild cognitive impairment . similarly , in patients with alzheimer 's disease , atrophy has been found to occur in the hippocampal formation and entorhinal cortex , as demonstrated by several volumetric mri studies . to date , many imaging methods have been developed to monitor disease progression and understand the pathogenesis of dementia . mri is extensively used for the diagnosis of mild cognitive impairment and alzheimer 's disease . t1-weighted mri are useful for the assessment of the topographic distribution of cortical and subcortical atrophy . recently , three - dimensional gradient - echo sequences that allow calculation of volumes and coregistration of images during follow - up examinations have been used in clinical practice . unlike t1-weighted imaging , t2 relaxometry allows the quantitative measurement of signal changes on t2-weighted images . however , the ability of t2-weighted imaging to differentiate between patients with mild cognitive impairment or alzheimer 's disease and healthy subjects is very limited because various confounding pathologies such as brain edema , demyelination and axonal loss may also result in changes similar to those seen in alzheimer 's disease . elevated t2 values are found in the hippocampus , and these values correlate strongly with the severity of functional and cognitive impairment in patients with alzheimer 's disease . early reports used serial manual delineating of the anatomical boundaries of the hippocampus and entorhinal cortex . patients with mild cognitive impairment have a smaller entorhinal cortex and hippocampus than healthy age - matched subjects . however , patients with alzheimer 's disease may have a prominent reduction in the entorhinal cortex and hippocampus . volume reductions in patients with mild cognitive impairment appear to be intermediate , between those of healthy subjects and patients with alzheimer 's disease . mri volumetry of the entorhinal cortex , the superior temporal sulcus and the anterior cingulate cortex may also differentiate normal subjects from patients with mild cognitive impairment . although mild cognitive impairment can present with a variety of symptoms , when memory loss is the predominant symptom it is termed amnestic mild cognitive impairment and is frequently seen as a prodromal stage of alzheimer 's disease . in previous studies , patients with amnestic mild cognitive impairment were examined using high - resolution functional mri during a continuous recognition task . the authors found that structural and functional changes in the ca3/dentate region of the hippocampus contributed to the deficits in episodic memory that were observed in patients with amnestic mild cognitive impairment . another study suggested that patients with amnestic mild cognitive impairment were selectively impaired on a functional mri task that emphasized pattern separation ; the response distribution was strikingly similar for lures and repetitions . mri studies using morphometric techniques have demonstrated that the ca1 region of the hippocampus is structurally compromised early in the course of amnestic mild cognitive impairment . in addition to the examination of the hippocampi and entorhinal cortices , there is a growing interest in white matter changes in mild cognitive impairment and alzheimer 's disease . vascular risk factors such as hypertension , hypercholesterolemia , and the apolipoprotein e4 allele may occur in patients with alzheimer 's disease . although it is sometimes difficult to differentiate between vascular dementia and vascular lesions in alzheimer 's disease , vascular lesions are generally less severe in patients with alzheimer 's disease than those with vascular dementias . there are a variety of mri techniques by which to measure changes in water content . the mri t2 signal decay is sensitive to water content and has been used to measure white matter damage in patients with mild cognitive impairment and alzheimer 's disease . however , conventional mri techniques yield insufficient contrast to provide information on the microstructural integrity of white matter . diffusion tensor imaging is a promising technique that allows documentation of hydrogen - based alterations in mri signal at the microstructural level . this makes it possible to measure the restricted diffusion of water in tissue and thus produce neural tract images , instead of using the data solely for the purpose of assigning contrast or colors to pixels in a cross - sectional image . by applying diffusion weighted gradients in at least six non - collinear gradients , the technique sensitizes the mri signal to the movement of hydrogen in the micron range . using diffusion tensor imaging , it is also possible to measure the direction and magnitude of hydrogen movement and discriminate fiber tracts in the white matter . the application of diffusion tensor imaging allows examination of diffusion characteristics , irrespective of head position . cortical neuronal loss in patients with alzheimer 's disease is associated with axonal degeneration in specific white matter pathways . in patients with mild cognitive impairment , diffusion tensor imaging abnormalities are seen in various brain areas such as the hippocampus , thalamus and posterior white matter . however , variability in region of interest placement may hinder the consensus identification of white matter in alzheimer 's disease . the fiber tractography can easily parcellate the white matter tracts with the use of high - field - strength mri scanners and modern gradient coils . reduced fractional anisotropy values were detected in white matter regions using region of interest analysis in diffusion tensor imaging studies . sometimes , the splenium of the corpus callosum might also be involved , as demonstrated by diffusion tensor imaging fractional anisotropy reductions . during the past few years , the widespread application of advanced mri techniques such as diffusion tensor imaging and functional mri has detected a rapid increase in neurodegenerative disorders . a great variety of innovative methods of extracting diffusion tensor imaging data have been employed in the study of white matter changes in alzheimer 's disease and mild cognitive impairment . for most studies employing diffusion tensor imaging technology , most studies are all multiple - subject group comparison studies , usually one group of experimental subjects compared with a matched group of control subjects . region of interest and whole brain voxelwise analyses are the most commonly used approaches to analyzing mri data . the process includes either hand - drawn region of interests from negative images of individual scans , or template - based region of interests applied to scans that have been warped into a common coordinate system . it is highly operator - dependent , and a skilled operator may provide superior delineation of cerebral structures . because the operator has great control over which voxels to include , the drawing of multiple region of interests for many subjects can be laborious . more importantly , if more than one operator is constructing the region of interests , inter - operator reliability must be established . template - based region of interests have been applied to normalized scans to improve efficiency . because of individual differences in brain morphology , the accuracy of this approach is dependent upon the normalization process and relies on the alignment of different brain regions across individuals . partial voluming ( in which a voxel represents more than one tissue type ) , in either native space or normalized space , is relatively common in both region of interest approaches . the partial voluming effect means that the values extracted from the region of interests are , to some extent , averaged for the entire region of interest . compared with the region of interest approach , the whole - brain voxelwise approach has the advantage of being extremely time efficient . large numbers of scans can be processed quickly , thereby potentially increasing the power of statistical analyses . because most diffusion tensor imaging studies with statistical testing were performed in one or more of the aforementioned ways , a fast measuring approach such as whole - brain voxelwise analysis would be a great advantage . however , whole - brain voxelwise analysis also has potential weaknesses , such as mismatching between the native and normalized image due to imperfect warping algorithms , alteration of the diffusion tensor imaging values due to the effects of normalization , and possible alteration of the diffusion tensor imaging values caused by smoothing . in clinical practice , the structural properties of white matter are being increasingly investigated by diffusion tensor imaging and voxel - based approaches . diffusion tensor imaging is a relatively sensitive technique that reveals group differences between patients with alzheimer 's disease and those with mild cognitive impairment . although diffusion tensor imaging meets the requirements of many basic and clinical research purposes , the technique has several limitations . for example , water diffusion is an indicator of the underlying neuroanatomy , and there are numerous microscopic structures that may affect the diffusion . therefore , different histopathological conditions may result in similar alterations of diffusion tensor imaging - derived parameters . structural and functional mri may allow the prediction of future conversion from mild cognitive impairment to alzheimer 's disease . previous studies have suggested that alzheimer 's disease is associated with reduced anisotropy and increased diffusivity compared with healthy controls . it is prominent in widespread brain regions , most notably in the frontal and temporal lobes , corpus callosum , and posterior cingulum . recent studies have suggested that hippocampal volume predicts conversion from mild cognitive impairment to alzheimer 's disease with high accuracy . a recent study compared volumetric mri with clinical measures predicting progression from mild cognitive impairment to alzheimer 's disease . the authors measured the whole brain , and ventricular , hippocampal , and entorhinal cortex volumes , and participants were followed up with clinical and cognitive evaluations until formal criteria for alzheimer 's disease were met . of the four mri measures evaluated , only changes in ventricular or hippocampal volumes were associated with progression to alzheimer 's disease . maximal predictive accuracy using only mri measures was obtained by hippocampal volumes . in a recent study using deformation - based morphometry and principal component analysis , patterns of regional brain atrophy including the medial temporal lobes , neocortical association areas , thalamus , and basal ganglia , as well as concurrent ventricle widening , were detected . these findings may provide a clue by which to discriminate mild cognitive impairment converters from nonconverters . the vast majority of studies that employ diffusion tensor imaging to investigate white matter integrity in alzheimer 's disease and mild cognitive impairment have greatly increased during the past decade . a large number of these studies have used mean diffusivity and fractional anisotropy as markers of cerebral integrity . mean diffusivity , which is a scalar measure of the total diffusion within a voxel , is commonly used in the clinic to localize white matter lesions . although the mean diffusivity does not provide information about the directionality of diffusion , it gives essential information regarding measure of translational diffusion . previous results have suggested that mean diffusivity increases may have a significant negative correlation with cognitive performance measures . increased mean diffusivity has been observed in many parts of the brain in patients with alzheimer 's disease , including frontal lobes , temporal lobes , parietal lobes and occipital lobes . the regional distribution of increased mean diffusivity has been documented in fiber tracts that were involved in intercerebral communications . these areas include the superior longitudinal fasciculus , corpus callosum , hippocampus , parahippocampus , and cingulum . fractional anisotropy is a scalar value that describes the degree of anisotropy of a diffusion process that could provide an in vivo marker of cerebral integrity . it is commonly used in diffusion imaging and it is thought to reflect fiber density , axonal diameter , and myelination in the white matter . fractional anisotropy is an extension of the concept of eccentricity of conic sections in three dimensions and provides a measure of the directionality of diffusion . high fractional anisotropy is seen in highly organized tissue with parallel structure in white matter . therefore , any damage to the white matter may break down the organization of the anatomical structure , leading to a decrease in fractional anisotropy . fractional anisotropy changes have been reported in multiple regions including the frontal and parietal lobes in patients with mild cognitive impairment and alzheimer 's disease . however , no differences in fractional anisotropy were observed in the occipital lobes between subjects with alzheimer 's disease or mild cognitive impairment , or healthy controls . despite some conflicting findings of fractional anisotropy in alzheimer 's disease and mild cognitive impairment , there have been frequent reports of decreased fractional anisotropy in the medial temporal lobe including the hippocampus , entorhinal cortex , parahippocampal white matter , and posterior cingulum . although the substrates of mean diffusivity and fractional anisotropy may differ , alterations of these two indices can be secondary to changes in diffusion , either parallel or perpendicular to the principal direction of the tensor . tract - based spatial statistics are also useful in diffusion tensor imaging of alzheimer 's disease and mild cognitive impairment . in a recent study , significant decreases were observed in fractional anisotropy values in patients alzheimer 's disease , compared with that of controls , whereas patients with mild cognitive impairment had fractional anisotropy values between those of controls and alzheimer 's disease patients . therefore , voxel - based analysis with tract - based spatial statistics is a promising method for examining the degeneration of neurofiber tracts in alzheimer 's disease and mild cognitive impairment patients . diffusion tensor imaging is also an important tool in differentiating alzheimer 's disease from other neurological disorders . diffusion tensor imaging can be used to estimate white matter lesions in dementia patients . in a recent study , the value of diffusion tensor imaging in the diagnosis and differential diagnosis of patients with subcortical ischemic vascular dementia and alzheimer 's disease were studied . compared with normal controls and patients with alzheimer 's disease , patients with subcortical ischemic vascular dementia had lower fractional anisotropy values and higher diffusion coefficients in the genu and splenium of the corpus callosum , and in the superior longitudinal fasciculus . patients with alzheimer 's disease had lower fractional anisotropy values in the anterior frontal lobe , temporal lobe , and hippocampus , and higher diffusion coefficients in the temporal lobe and hippocampus compared with controls and patients with subcortical ischemic vascular dementia . the potential of using diffusion tensor imaging in conjunction with machine learning algorithms to automate the classification of healthy older subjects and those with mild cognitive impairment has also recently been examined . when diffusion tensor imaging measures were then used together with support vector machines , greater than 90% sensitivity and specificity was achieved using this method . in patients with mild cognitive impairment and alzheimer 's disease , a reduction in size of the hippocampal formation it is well established that the temporal lobe has higher atrophy rates in patients with mild cognitive impairment than in healthy people . a recent study suggested that diffusion tensor imaging changes in temporal lobe white matter correlate well with episodic memory , frontal changes with executive function , and parietal changes with general cognition . furthermore , patients with mild cognitive impairment may mark diffusion tensor imaging abnormalities in multiple locations along the cingulum fiber bundle , including the posterior cingulate and parahippocampal regions . recently , magnetization transfer imaging has also been used for imaging of patients with cognitive impairment . it is based on the exchange of magnetization between immobile and free protons , and is an innovative imaging method that provides essential information regarding the underlying histopathologic changes in brain tissue . furthermore , magnetization transfer imaging allows the assessment of ongoing global and regional brain damage , independent of atrophy , in patients with alzheimer 's disease . it is dependent on the concentration , surface chemistry , and biophysical characteristics of macromolecules . during the past 20 years , magnetization transfer imaging has been used regularly in the evaluation of subjects with multiple sclerosis . a decrease in the white matter magnetization a reduction in magnetization transfer ratio has also been reported in the hippocampus of early dementia patients , compared with control subjects . such studies suggest that measurements of magnetization transfer ratio may be valuable in the detection of structural damage in the hippocampus of alzheimer 's disease patients . interestingly , magnetization transfer is particularly sensitive to gray matter abnormalities and provides complementary information to conventional mri in the characterization of alzheimer 's disease by quantifying gray matter atrophy . the characteristic histopathological findings in the hippocampus of alzheimer 's disease patients include a loss of pyramidal cells accompanied by an increase in the number of astrocytes , microglia , and oligodendrocytes . although the exact mechanism for the reduction in magnetization transfer in the hippocampus of patients with alzheimer 's disease is not yet clear , such pathologic changes may decrease magnetization transfer ratio because of a decrease in the bound - proton fraction . results of studies in patients with clinically diagnosed alzheimer 's disease suggest that quantitative measurement of certain parameters using magnetization transfer imaging may serve as a potential biomarker of the disease . with the growing prevalence of cognitive impairments , functional imaging for neurodegenerative diseases proton magnetic resonance spectroscopy is a viable imaging method for tracking brain metabolic changes due to neurodegenerative diseases . in addition , proton magnetic resonance spectroscopy may also play a role in discriminating between dementias , and measuring disease progression . the amyloid plaques and neurofibrillary tangles in alzheimer 's disease present in a characteristic pattern , with early involvement of the medial temporal lobes and hippocampus . mild cognitive impairment is a transitional phase between normal cognitive aging and alzheimer 's disease . patients with mild cognitive impairment may have subjective complaints of memory loss and objective impairment on memory testing compared with normal age - matched individuals , while their activities of daily living may be generally preserved . a recent study suggested that mild cognitive impairment may be associated with widespread reduction in brain volume and changes in regional function . the technique allows monitoring of metabolic ratios such as myoinositol / creatine - phosphocreatine , choline / creatine - phosphocreatine , and n - acetyl aspartate / creatine - phosphocreatine . in patients with mild cognitive impairment or alzheimer 's disease , such metabolic ratio changes are most apparent in the left temporal lobe , the posterior cingulate cortex , and the medial occipital lobe . however , significantly lower ratios of myoinositol / creatine - phosphocreatine were seen in patients with mild cognitive impairment than in those with alzheimer 's disease . patients with mild cognitive impairment may also have a significant increase in choline / creatine - phosphocreatine ratio in the right frontal cortex and posterior cingulate , as demonstrated by proton magnetic resonance spectroscopy studies . another prominent feature of mild cognitive impairment is reduced n - acetyl aspartate / creatine - phosphocreatine ratio in the left medial temporal lobe and the right hippocampus . cross - sectional magnetic resonance spectroscopy further confirmed that metabolic abnormalities in mild cognitive impairment are transitional between normal older adults and patients with alzheimer 's disease . the observed progression of metabolic changes generally corresponds to the known early neuropathology of alzheimer 's disease . proton magnetic resonance spectroscopy studies indicate that patients with alzheimer 's disease have a reduced n - acetyl aspartate / creatine - phosphocreatine ratio , most prominently in the hippocampus and medial temporal lobe , but also in the temporal - parietal area , frontal and occipital lobes . furthermore , whole brain magnetic resonance spectroscopy has demonstrated reductions in n - acetyl aspartate in alzheimer 's disease , primarily observed in posterior gray matter . these findings of widespread reductions in n - acetyl aspartate are consistent with the progression of neurofibrillary tangles in alzheimer 's disease . in general , proton magnetic resonance spectroscopy can reproducibly distinguish between early alzheimer 's disease patients and normal subjects as well as patients with mild cognitive impairment . further studies will be needed to confirm whether changes in precuneus / posterior cingulate metabolite ratios reliably correlate with measures of function , and whether they may yet prove useful as longitudinal biomarkers in clinical trials of disease - modifying therapies . the cerebral metabolic rate of glucose consumption is a parameter that measures glucose metabolism within the brain . [ 18f]-fluorodeoxyglucose - position emission tomography can assist with the diagnosis of alzheimer 's disease at an early stage . the utility of [ 18f]-fluorodeoxyglucose - position emission tomography in alzheimer 's disease has greatly improved early diagnosis and may also be used in monitoring drug effects in the future . it is well established that by the time a patient presents with clinical symptoms of alzheimer 's disease , the cerebral metabolic rate of glucose consumption is severely reduced in some cortical regions . in patients with mild cognitive impairment , interestingly , while position emission tomography measures were not sensitive for people with early stage mild cognitive impairment , reports using [ 18f]-fluorodeoxyglucose - position emission tomography have suggested that the cerebral metabolic rate of glucose consumption was reduced in patients with more advanced mild cognitive impairment , particularly in the limbic structures , including the hippocampus , medial thalamus and posterior cingulate . a recent study suggested that combining [ 18f]-flutemetamol position emission tomography with structural mri may provide additional information for categorizing disease and potentially predicting time to progression from mild cognitive impairment to alzheimer 's disease . during the past few years , the widespread application of advanced mri techniques such as diffusion tensor imaging and functional mri has detected a rapid increase in neurodegenerative disorders . a great variety of innovative methods of extracting diffusion tensor imaging data have been employed in the study of white matter changes in alzheimer 's disease and mild cognitive impairment . for most studies employing diffusion tensor imaging technology , most studies are all multiple - subject group comparison studies , usually one group of experimental subjects compared with a matched group of control subjects . region of interest and whole brain voxelwise analyses are the most commonly used approaches to analyzing mri data . the process includes either hand - drawn region of interests from negative images of individual scans , or template - based region of interests applied to scans that have been warped into a common coordinate system . it is highly operator - dependent , and a skilled operator may provide superior delineation of cerebral structures . because the operator has great control over which voxels to include , the drawing of multiple region of interests for many subjects can be laborious . more importantly , if more than one operator is constructing the region of interests , inter - operator reliability must be established . template - based region of interests have been applied to normalized scans to improve efficiency . because of individual differences in brain morphology , the accuracy of this approach is dependent upon the normalization process and relies on the alignment of different brain regions across individuals . partial voluming ( in which a voxel represents more than one tissue type ) , in either native space or normalized space , is relatively common in both region of interest approaches . the partial voluming effect means that the values extracted from the region of interests are , to some extent , averaged for the entire region of interest . compared with the region of interest approach , the whole - brain voxelwise approach has the advantage of being extremely time efficient . large numbers of scans can be processed quickly , thereby potentially increasing the power of statistical analyses . because most diffusion tensor imaging studies with statistical testing were performed in one or more of the aforementioned ways , a fast measuring approach such as whole - brain voxelwise analysis would be a great advantage . however , whole - brain voxelwise analysis also has potential weaknesses , such as mismatching between the native and normalized image due to imperfect warping algorithms , alteration of the diffusion tensor imaging values due to the effects of normalization , and possible alteration of the diffusion tensor imaging values caused by smoothing . in clinical practice , the structural properties of white matter are being increasingly investigated by diffusion tensor imaging and voxel - based approaches . diffusion tensor imaging is a relatively sensitive technique that reveals group differences between patients with alzheimer 's disease and those with mild cognitive impairment . although diffusion tensor imaging meets the requirements of many basic and clinical research purposes , the technique has several limitations . for example , water diffusion is an indicator of the underlying neuroanatomy , and there are numerous microscopic structures that may affect the diffusion . therefore , different histopathological conditions may result in similar alterations of diffusion tensor imaging - derived parameters . structural and functional mri may allow the prediction of future conversion from mild cognitive impairment to alzheimer 's disease . previous studies have suggested that alzheimer 's disease is associated with reduced anisotropy and increased diffusivity compared with healthy controls . it is prominent in widespread brain regions , most notably in the frontal and temporal lobes , corpus callosum , and posterior cingulum . recent studies have suggested that hippocampal volume predicts conversion from mild cognitive impairment to alzheimer 's disease with high accuracy . a recent study compared volumetric mri with clinical measures predicting progression from mild cognitive impairment to alzheimer 's disease . the authors measured the whole brain , and ventricular , hippocampal , and entorhinal cortex volumes , and participants were followed up with clinical and cognitive evaluations until formal criteria for alzheimer 's disease were met . of the four mri measures evaluated , only changes in ventricular or hippocampal volumes were associated with progression to alzheimer 's disease . maximal predictive accuracy using only mri measures was obtained by hippocampal volumes . in a recent study using deformation - based morphometry and principal component analysis , patterns of regional brain atrophy including the medial temporal lobes , neocortical association areas , thalamus , and basal ganglia , as well as concurrent ventricle widening , were detected . these findings may provide a clue by which to discriminate mild cognitive impairment converters from nonconverters . the vast majority of studies that employ diffusion tensor imaging to investigate white matter integrity in alzheimer 's disease and mild cognitive impairment have greatly increased during the past decade . a large number of these studies have used mean diffusivity and fractional anisotropy as markers of cerebral integrity . mean diffusivity , which is a scalar measure of the total diffusion within a voxel , is commonly used in the clinic to localize white matter lesions . although the mean diffusivity does not provide information about the directionality of diffusion , it gives essential information regarding measure of translational diffusion . previous results have suggested that mean diffusivity increases may have a significant negative correlation with cognitive performance measures . increased mean diffusivity has been observed in many parts of the brain in patients with alzheimer 's disease , including frontal lobes , temporal lobes , parietal lobes and occipital lobes . the regional distribution of increased mean diffusivity has been documented in fiber tracts that were involved in intercerebral communications . these areas include the superior longitudinal fasciculus , corpus callosum , hippocampus , parahippocampus , and cingulum . fractional anisotropy is a scalar value that describes the degree of anisotropy of a diffusion process that could provide an in vivo marker of cerebral integrity . it is commonly used in diffusion imaging and it is thought to reflect fiber density , axonal diameter , and myelination in the white matter . fractional anisotropy is an extension of the concept of eccentricity of conic sections in three dimensions and provides a measure of the directionality of diffusion . high fractional anisotropy is seen in highly organized tissue with parallel structure in white matter . therefore , any damage to the white matter may break down the organization of the anatomical structure , leading to a decrease in fractional anisotropy . fractional anisotropy changes have been reported in multiple regions including the frontal and parietal lobes in patients with mild cognitive impairment and alzheimer 's disease . however , no differences in fractional anisotropy were observed in the occipital lobes between subjects with alzheimer 's disease or mild cognitive impairment , or healthy controls . despite some conflicting findings of fractional anisotropy in alzheimer 's disease and mild cognitive impairment , there have been frequent reports of decreased fractional anisotropy in the medial temporal lobe including the hippocampus , entorhinal cortex , parahippocampal white matter , and posterior cingulum . although the substrates of mean diffusivity and fractional anisotropy may differ , alterations of these two indices can be secondary to changes in diffusion , either parallel or perpendicular to the principal direction of the tensor . tract - based spatial statistics are also useful in diffusion tensor imaging of alzheimer 's disease and mild cognitive impairment . in a recent study , significant decreases were observed in fractional anisotropy values in patients alzheimer 's disease , compared with that of controls , whereas patients with mild cognitive impairment had fractional anisotropy values between those of controls and alzheimer 's disease patients . therefore , voxel - based analysis with tract - based spatial statistics is a promising method for examining the degeneration of neurofiber tracts in alzheimer 's disease and mild cognitive impairment patients . diffusion tensor imaging is also an important tool in differentiating alzheimer 's disease from other neurological disorders . diffusion tensor imaging can be used to estimate white matter lesions in dementia patients . in a recent study , the value of diffusion tensor imaging in the diagnosis and differential diagnosis of patients with subcortical ischemic vascular dementia and alzheimer 's disease were studied . compared with normal controls and patients with alzheimer 's disease , patients with subcortical ischemic vascular dementia had lower fractional anisotropy values and higher diffusion coefficients in the genu and splenium of the corpus callosum , and in the superior longitudinal fasciculus . patients with alzheimer 's disease had lower fractional anisotropy values in the anterior frontal lobe , temporal lobe , and hippocampus , and higher diffusion coefficients in the temporal lobe and hippocampus compared with controls and patients with subcortical ischemic vascular dementia . the potential of using diffusion tensor imaging in conjunction with machine learning algorithms to automate the classification of healthy older subjects and those with mild cognitive impairment has also recently been examined . when diffusion tensor imaging measures were then used together with support vector machines , greater than 90% sensitivity and specificity was achieved using this method . in patients with mild cognitive impairment and alzheimer 's disease , a reduction in size of the hippocampal formation it is well established that the temporal lobe has higher atrophy rates in patients with mild cognitive impairment than in healthy people . a recent study suggested that diffusion tensor imaging changes in temporal lobe white matter correlate well with episodic memory , frontal changes with executive function , and parietal changes with general cognition . furthermore , patients with mild cognitive impairment may mark diffusion tensor imaging abnormalities in multiple locations along the cingulum fiber bundle , including the posterior cingulate and parahippocampal regions . recently , magnetization transfer imaging has also been used for imaging of patients with cognitive impairment . it is based on the exchange of magnetization between immobile and free protons , and is an innovative imaging method that provides essential information regarding the underlying histopathologic changes in brain tissue . furthermore , magnetization transfer imaging allows the assessment of ongoing global and regional brain damage , independent of atrophy , in patients with alzheimer 's disease . it is dependent on the concentration , surface chemistry , and biophysical characteristics of macromolecules . during the past 20 years , magnetization transfer imaging has been used regularly in the evaluation of subjects with multiple sclerosis . a decrease in the white matter magnetization a reduction in magnetization transfer ratio has also been reported in the hippocampus of early dementia patients , compared with control subjects . such studies suggest that measurements of magnetization transfer ratio may be valuable in the detection of structural damage in the hippocampus of alzheimer 's disease patients . interestingly , magnetization transfer is particularly sensitive to gray matter abnormalities and provides complementary information to conventional mri in the characterization of alzheimer 's disease by quantifying gray matter atrophy . the characteristic histopathological findings in the hippocampus of alzheimer 's disease patients include a loss of pyramidal cells accompanied by an increase in the number of astrocytes , microglia , and oligodendrocytes . although the exact mechanism for the reduction in magnetization transfer in the hippocampus of patients with alzheimer 's disease is not yet clear , such pathologic changes may decrease magnetization transfer ratio because of a decrease in the bound - proton fraction . results of studies in patients with clinically diagnosed alzheimer 's disease suggest that quantitative measurement of certain parameters using magnetization transfer imaging may serve as a potential biomarker of the disease . with the growing prevalence of cognitive impairments , functional imaging for neurodegenerative diseases is increasingly important in clinical and research settings . proton magnetic resonance spectroscopy is a viable imaging method for tracking brain metabolic changes due to neurodegenerative diseases . in addition , proton magnetic resonance spectroscopy may also play a role in discriminating between dementias , and measuring disease progression . the amyloid plaques and neurofibrillary tangles in alzheimer 's disease present in a characteristic pattern , with early involvement of the medial temporal lobes and hippocampus . mild cognitive impairment is a transitional phase between normal cognitive aging and alzheimer 's disease . patients with mild cognitive impairment may have subjective complaints of memory loss and objective impairment on memory testing compared with normal age - matched individuals , while their activities of daily living may be generally preserved . a recent study suggested that mild cognitive impairment may be associated with widespread reduction in brain volume and changes in regional function . the technique allows monitoring of metabolic ratios such as myoinositol / creatine - phosphocreatine , choline / creatine - phosphocreatine , and n - acetyl aspartate / creatine - phosphocreatine . in patients with mild cognitive impairment or alzheimer 's disease , such metabolic ratio changes are most apparent in the left temporal lobe , the posterior cingulate cortex , and the medial occipital lobe . however , significantly lower ratios of myoinositol / creatine - phosphocreatine were seen in patients with mild cognitive impairment than in those with alzheimer 's disease . patients with mild cognitive impairment may also have a significant increase in choline / creatine - phosphocreatine ratio in the right frontal cortex and posterior cingulate , as demonstrated by proton magnetic resonance spectroscopy studies . another prominent feature of mild cognitive impairment is reduced n - acetyl aspartate / creatine - phosphocreatine ratio in the left medial temporal lobe and the right hippocampus . cross - sectional magnetic resonance spectroscopy further confirmed that metabolic abnormalities in mild cognitive impairment are transitional between normal older adults and patients with alzheimer 's disease . the observed progression of metabolic changes generally corresponds to the known early neuropathology of alzheimer 's disease . proton magnetic resonance spectroscopy studies indicate that patients with alzheimer 's disease have a reduced n - acetyl aspartate / creatine - phosphocreatine ratio , most prominently in the hippocampus and medial temporal lobe , but also in the temporal - parietal area , frontal and occipital lobes . furthermore , whole brain magnetic resonance spectroscopy has demonstrated reductions in n - acetyl aspartate in alzheimer 's disease , primarily observed in posterior gray matter . these findings of widespread reductions in n - acetyl aspartate are consistent with the progression of neurofibrillary tangles in alzheimer 's disease . in general , proton magnetic resonance spectroscopy can reproducibly distinguish between early alzheimer 's disease patients and normal subjects as well as patients with mild cognitive impairment . further studies will be needed to confirm whether changes in precuneus / posterior cingulate metabolite ratios reliably correlate with measures of function , and whether they may yet prove useful as longitudinal biomarkers in clinical trials of disease - modifying therapies . the cerebral metabolic rate of glucose consumption is a parameter that measures glucose metabolism within the brain . [ 18f]-fluorodeoxyglucose - position emission tomography can assist with the diagnosis of alzheimer 's disease at an early stage . the utility of [ 18f]-fluorodeoxyglucose - position emission tomography in alzheimer 's disease has greatly improved early diagnosis and may also be used in monitoring drug effects in the future . it is well established that by the time a patient presents with clinical symptoms of alzheimer 's disease , the cerebral metabolic rate of glucose consumption is severely reduced in some cortical regions . in patients with mild cognitive impairment , interestingly , while position emission tomography measures were not sensitive for people with early stage mild cognitive impairment , reports using [ 18f]-fluorodeoxyglucose - position emission tomography have suggested that the cerebral metabolic rate of glucose consumption was reduced in patients with more advanced mild cognitive impairment , particularly in the limbic structures , including the hippocampus , medial thalamus and posterior cingulate . a recent study suggested that combining [ 18f]-flutemetamol position emission tomography with structural mri may provide additional information for categorizing disease and potentially predicting time to progression from mild cognitive impairment to alzheimer 's disease . interest is growing in the early investigation of mild cognitive impairment and alzheimer 's disease . early identification of mild cognitive impairment is extremely important for the counseling of patients , making therapeutic decisions , and planning clinical trials . recent advances in mri scanning techniques have allowed the examination of structural changes of the hippocampus , entorhinal cortex , and gray matter structures in the medial temporal lobe . diffusion tensor imaging allows accurate depiction of white matter microstructural integrity based on the directionality of diffusion in the brain . measurements of magnetization transfer ratio may be valuable for the detection of structural damage in the hippocampus of alzheimer 's disease patients . proton magnetic resonance spectroscopy has emerged as an increasingly important tool in discriminating between dementias and measuring disease progression . cross - sectional magnetic resonance spectroscopy confirmed that metabolic abnormalities in mild cognitive impairment are transitional between normal healthy older adults and patients with alzheimer 's disease . the utility of such functional imaging techniques has greatly improved the early diagnosis of mild cognitive impairment and alzheimer 's disease . technical advances in multiple imaging modalities allow us to assess both anatomical and functional changes in alzheimer 's disease and mild cognitive impairment , thereby advancing our understanding of the pathophysiological evolution of these diseases . | the rapidly increasing prevalence of cognitive impairment and alzheimer 's disease has the potential to create a major worldwide healthcare crisis .
structural mri studies in patients with alzheimer 's disease and mild cognitive impairment are currently attracting considerable interest .
it is extremely important to study early structural and metabolic changes , such as those in the hippocampus , entorhinal cortex , and gray matter structures in the medial temporal lobe , to allow the early detection of mild cognitive impairment and alzheimer 's disease .
the microstructural integrity of white matter can be studied with diffusion tensor imaging .
increased mean diffusivity and decreased fractional anisotropy are found in subjects with white matter damage .
functional imaging studies with positron emission tomography tracer compounds enable detection of amyloid plaques in the living brain in patients with alzheimer 's disease . in this review
, we will focus on key findings from brain imaging studies in mild cognitive impairment and alzheimer 's disease , including structural brain changes studied with mri and white matter changes seen with diffusion tensor imaging , and other specific imaging methodologies will also be discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in april 2008 , fecal specimens were collected from 116 macaques ( 36 years of age ) with diarrhea on a monkey farm in people s republic of china . feces were suspended to 10% ( wt / vol ) in phosphate - buffered saline ( 0.01 m , ph 7.4 ) , and total rna was extracted from 200 l by using trizol reagent ( invitrogen , carlsbad , ca , usa ) . viral rna was dissolved in 30 l rnase - free water and stored at 80c . primers ( outside - l 5-ctagagagcttggccgtcgg-3 , outside - r 5-gtaccttctgggcatccttc-3 , inside - l 5-ggccttataccccgacttgc-3 , and inside - r 5-ggccttacaactagtgtttg-3 ) ( 12 ) were used for reverse transcription nested pcr to identify diverse hpev genotypes by amplification of a 518-bp fragment located in the 5 untranslated region ( utr ) . the expected - size dna bands were excised from an agarose gel , purified with the axyprep dna gel extraction kit ( axygen , union city , ca , usa ) , cloned into pmd-18 t vector ( takara , dalian , china ) , and sequenced ( applied biosystems 3730 dna analyzer ; invitrogen ) . the hpev sequences were compared with those of the hpev genotype reference strains by using blast ( www.ncbi.nlm.nih.gov/blast ) . five of the 6 sequences showed closest identity to the 5 utr of hpev-1 ( 90%94% ) . the viral protein ( vp)3/vp1 region of these 5 viruses was then pcr amplified and sequenced to confirm type 1 identity ( 13 ) . a 674-nt region of the 5 utr , an open reading frame ( orf ) encoding a polyprotein precursor of 2,182 aa , and a partial 3 utr of 88 nt ( 7,311 bp ) were sequenced . the near full genome showed 96% nucleotide identity with the genotype 6 reference genome ( ab252582 ) . the polyprotein encoded capsid proteins vp0 ( 312 aa ) , vp3 ( 229 aa ) , and vp1 ( 234 aa ) and nonstructural proteins 2a ( 150 aa ) , 2b ( 122 aa ) , 2c ( 329 aa ) , 3a ( 117 aa ) , 3b ( 20 aa ) , 3c ( 200 aa ) , and 3d ( 469 aa ) . the integrin binding motif arginine glycine aspartic acid was identified close to the c terminus of vp1 ( 8,14 ) . we performed phylogenetic analysis using the nearly full genome of sh6 and 17 representative hpev and related viruses ( figure ) . results confirmed that sh6 belonged to genotype 6 and clustered closely with the reference genome from japan and a strain from the netherlands ( eu077518 ) , forming an hpev-6 subgroup ( figure ) . phylogenetic tree was constructed by the neighbor - joining method with 1,000 bootstrap replicates using mega4.0 software ( www.megasoftware.net ) with an alignment of the nearly full genome isolated in this study and 17 human parechovirus ( hpev ) and related genomes . we detected hpev genotypes 1 and 6 in the feces of 6 of 116 monkeys with diarrhea . a similar analysis of a healthy monkey control group is needed to determine whether an association exists between hpev infections of monkeys and diarrhea . on the basis of the close similarities between virus feces derived sequences and hpev , these viruses might have been transmitted by the fecal oral route from humans to monkeys . | information about human parechovirus ( hpev ) infection in animals is scant . using 5 untranslated region reverse transcription pcr , we detected hpev in feces of monkeys with diarrhea and sequenced the complete genome of 1 isolate ( sh6 )
. monkeys may serve as reservoirs for zoonotic hpev transmissions and as models for studies of hpev pathogenesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
familial hypercholesterolemia ( fh ) is an autosomal dominant disorder usually caused by mutations in the lowdensity lipoprotein ( ldl ) receptor gene . untreated fh results in an accumulation of ldl cholesterol , which can lead to atherosclerosis and an increased risk of premature cardiovascular disease ( cvd ) . worldwide , > 10 million people have fh , of which 200 000 persons die of cvd each year . in the norwegian population , the estimated prevalence of heterozygous fh is 1 in 300 and 1 in 500 globally . approximately 50% of untreated men and women with heterozygous fh will develop cvd before 50 and 60 years of age , respectively . about 5% of the patients suffering a myocardial infarction before the age of 60 years have heterozygous fh . given that the prevalence of fh is 0.2% worldwide , this suggests an almost 25fold increase in the risk of myocardial infarction at an age younger than 60 years . the varying risk of death among fh patients suggests an interaction between genetic and environmental factors . reductions in allcause mortality , cancer , and coronary mortality have been observed in statintreated fh patients . for ethical reasons , randomized placebocontrolled studies of mortality and other hard end points can not be conducted among patients with fh . consequently , treatment of fh patients is based largely on a few published observational studies and results of clinical trials of lipidlowering drugs conducted in patients with other forms of hypercholesterolemia . in norway , all molecular genetic diagnosis of fh is performed at the unit for cardiac and cardiovascular genetics ( uccg ) at oslo university hospital . all diagnosed fh patients are included in the uccg registry after providing written informed consent . approximately 200 different mutations in the ldl receptor gene have been found to cause fh among patients living in norway , and 4 mutations are responsible for 47.2% of all fh cases . the aim of this study was to investigate the mortality and cause of death among all patients diagnosed with fh in norway by linking data from the uccg registry and the norwegian cause of death registry . the study was approved by the norwegian regional committee for medical and health research ethics and the norwegian data protection official at oslo university hospital . this was a registrybased study of a cohort with up to 19 years of followup ( 19922010 ) . study data was derived from the uccg registry and the norwegian cause of death registry . statistics norway was responsible for linking the 2 registries . the uccg registry consisted of 4688 patients with verified molecular genetic diagnosis of fh diagnosed in the period from 1992 to 2010 . in the same period , the norwegian cause of death registry included 823 626 deaths . molecular genetic testing for fh has been performed in norway since 1992 when the uccg registry at oslo university hospital , rikshospitalet was established . patients with verified fh are recommended lipidlowering treatment according to existing national guidelines based on the european society of cardiology guidelines . physicians are required to complete a death certificate of all reported deaths collected by this registry . the coding system used in the death certificates is the international classification of diseases ( icd ) . from 1992 to 1995 , the ninth revision ( icd9 ) was used , and since 1996 , the 10th revision ( icd10 ) has been used . since 2005 , the norwegian cause of death registry has used the computer program automatic classification of medical entities ( acme ) , developed by us national center for health statistics , to identify and secure the correct underlying cause of death according to rules and guidelines established by the world health organization ( icd ) . the norwegian cause of death registry has been validated both internal and externally . in 2011 , a norwegian autopsy study , diagnostic validity of fatal cerebral strokes and coronary deaths in mortality statistics , was published and showed substantial agreement between mortality statistics and autopsy findings for both fatal strokes and coronary deaths in the period from 1965 to 2005 in norway . data collection and the period of analysis were limited to 19922010 based on when molecular genetic testing for fh was initiated . variables from the uccg registry were date of inclusion in the registry , sex , age , type of mutation , and other demographic data . hospital records were used to extract data on coexisting diseases , clinical signs , use of lipidlowering drugs , and laboratory parameters as lipid profiles . the linkage to the norwegian cause of death registry gave data on main death diagnosis and date of death . deaths were categorized as follows : allcause mortality ( all icd10 codes ) , cvd mortality ( category block i in the main icd10 diagnosis codes ) , cancer mortality ( category block c in the main icd10 diagnosis codes ) , and othercause mortality ( all icd10 codes except cancer and cvd ) . only 3 deaths were observed before 1996 ( ie , coded with icd9 ) , and these were converted to icd10 codes . five observed deaths in the uccg registry had a main diagnosis of pure hypercholesterolemia ( e78.0 ) . because it is not possible to die of pure hypercholesterolemia , these patients likely suffered from cvd and thus were classified as cvd deaths . data on the exact inclusion date of the first 704 patients in the uccg registry were not available . because we know that all of these patients were included in the uccg registry in the period 19921995 , their inclusion year was defined as 1992 . the mortality in the uccg registry was compared with the mortality in the general norwegian population according to sex , birth year , and calendar year . the analysis was performed using spss version 19.0 ( ibm corp ) and excel 2010 ( microsoft ) . all estimations were based on time of patient inclusion in the uccg registry and the cohort to the time point the patient reached the study end point , which was defined as year of death or end of study ( ie , december 31 , 2010 ) . age at death was calculated in whole numbers , without decimal notations at the end of the actual year of death . followup time was calculated according to sex , calendar year , and year of birth . the age and calendarspecific mortality rates for men and women in the norwegian population were calculated by statistics norway . statistics norway also estimated the expected numbers of deaths and standardized mortality ratios ( smrs ) . both total and separate calculations were made for each sex and were performed for allcause mortality , cvd mortality , cancer mortality , and death by other causes . smrs were calculated by indirect standardization and derived from the ratio of the number of observed deaths ( dp ) to the number of expected deaths ( ep ) in the patient population : smr = dp / ep . the 95% cis for smr were calculated as follows : the number of expected deaths in the patient population ( ep ) was estimated by use of the formula below . all calculations were based on equal mortality , as in the general norwegian population , and were estimated by adding total time spent in the cohort ( in the patient population ) for every birth and calendar year multiplied by the mortality rate for men and women in the general norwegian population from 1992 to 2010 for all corresponding x and y values : total time spent by the patient population during calendar year y for patients born in year x was given as mp ( x , y).the mean population in year y for the population born in year x was given as follows : m(x , y)= ( l(x , y)+l(x , y+1 ) ) . l(x , y ) defined the norwegian population on january 1 of year y that were born in year x. the mortality rate of the norwegian population born in year x for year y was given as follows : r(x , y)=d(x , y)/m(x , y ) . d(x , y ) was defined as the number of observed deaths for the norwegian population born in year x in year y. the study was approved by the norwegian regional committee for medical and health research ethics and the norwegian data protection official at oslo university hospital . this was a registrybased study of a cohort with up to 19 years of followup ( 19922010 ) . study data was derived from the uccg registry and the norwegian cause of death registry . statistics norway was responsible for linking the 2 registries . the uccg registry consisted of 4688 patients with verified molecular genetic diagnosis of fh diagnosed in the period from 1992 to 2010 . in the same period , the norwegian cause of death registry included 823 626 deaths . molecular genetic testing for fh has been performed in norway since 1992 when the uccg registry at oslo university hospital , rikshospitalet was established . patients with verified fh are recommended lipidlowering treatment according to existing national guidelines based on the european society of cardiology guidelines . physicians are required to complete a death certificate of all reported deaths collected by this registry . the coding system used in the death certificates is the international classification of diseases ( icd ) . from 1992 to 1995 , the ninth revision ( icd9 ) was used , and since 1996 , the 10th revision ( icd10 ) has been used . since 2005 , the norwegian cause of death registry has used the computer program automatic classification of medical entities ( acme ) , developed by us national center for health statistics , to identify and secure the correct underlying cause of death according to rules and guidelines established by the world health organization ( icd ) . the norwegian cause of death registry has been validated both internal and externally . in 2011 , a norwegian autopsy study , diagnostic validity of fatal cerebral strokes and coronary deaths in mortality statistics , was published and showed substantial agreement between mortality statistics and autopsy findings for both fatal strokes and coronary deaths in the period from 1965 to 2005 in norway . data collection and the period of analysis were limited to 19922010 based on when molecular genetic testing for fh was initiated . variables from the uccg registry were date of inclusion in the registry , sex , age , type of mutation , and other demographic data . hospital records were used to extract data on coexisting diseases , clinical signs , use of lipidlowering drugs , and laboratory parameters as lipid profiles . the linkage to the norwegian cause of death registry gave data on main death diagnosis and date of death . deaths were categorized as follows : allcause mortality ( all icd10 codes ) , cvd mortality ( category block i in the main icd10 diagnosis codes ) , cancer mortality ( category block c in the main icd10 diagnosis codes ) , and othercause mortality ( all icd10 codes except cancer and cvd ) . only 3 deaths were observed before 1996 ( ie , coded with icd9 ) , and these were converted to icd10 codes . five observed deaths in the uccg registry had a main diagnosis of pure hypercholesterolemia ( e78.0 ) . because it is not possible to die of pure hypercholesterolemia , data on the exact inclusion date of the first 704 patients in the uccg registry were not available . because we know that all of these patients were included in the uccg registry in the period 19921995 , their inclusion year was defined as 1992 . the mortality in the uccg registry was compared with the mortality in the general norwegian population according to sex , birth year , and calendar year . the analysis was performed using spss version 19.0 ( ibm corp ) and excel 2010 ( microsoft ) . all estimations were based on time of patient inclusion in the uccg registry and the cohort to the time point the patient reached the study end point , which was defined as year of death or end of study ( ie , december 31 , 2010 ) . age at death was calculated in whole numbers , without decimal notations at the end of the actual year of death . followup time was calculated according to sex , calendar year , and year of birth . the age and calendarspecific mortality rates for men and women in the norwegian population were calculated by statistics norway . statistics norway also estimated the expected numbers of deaths and standardized mortality ratios ( smrs ) . both total and separate calculations were made for each sex and were performed for allcause mortality , cvd mortality , cancer mortality , and death by other causes . smrs were calculated by indirect standardization and derived from the ratio of the number of observed deaths ( dp ) to the number of expected deaths ( ep ) in the patient population : smr = dp / ep . the 95% cis for smr were calculated as follows : the number of expected deaths in the patient population ( ep ) was estimated by use of the formula below . all calculations were based on equal mortality , as in the general norwegian population , and were estimated by adding total time spent in the cohort ( in the patient population ) for every birth and calendar year multiplied by the mortality rate for men and women in the general norwegian population from 1992 to 2010 for all corresponding x and y values : total time spent by the patient population during calendar year y for patients born in year x was given as mp ( x , y).the mean population in year y for the population born in year x was given as follows : m(x , y)= ( l(x , y)+l(x , y+1 ) ) . l(x , y ) defined the norwegian population on january 1 of year y that were born in year x. the mortality rate of the norwegian population born in year x for year y was given as follows : r(x , y)=d(x , y)/m(x , y ) . d(x , y ) was defined as the number of observed deaths for the norwegian population born in year x in year y. mean age at inclusion in the uccg registry was 33.6 years ( range 0 to 92.4 years ) : 32.0 years for men and 35.0 years for women . mean age for both sexes at the study end point was 41.6 years ( range 0.3 to 94.7 years ) . a total of 113 deaths were observed during followup , of which all were heterozygote . cvd mortality was most common ( 52 patients , 46.0% ) , followed by cancer mortality ( 34 patients , 30.1% ) , and mortality by other causes ( 27 patients , 23.9% ) . age at inclusion , age at death , and time of followup are summarized in table 1 . selected characteristics of the 113 observed deaths in the unit for cardiac and cardiovascular genetics registry values are given as mean ( range ) . the most common mutations were in the ldl receptor gene ; however , 7 patients had mutation r3500q in the apolipoprotein b gene . mutation type among the 113 observed deaths values are given as number ( % ) . all mutations are in the ldl receptor gene except for mutation r3500q , which is in the apolipoprotein b gene . there was no significant difference in allcause mortality between the uccg registry and the general population except a significant reduced smr at age group 70 to 79 years ( table 3 ) . cvd mortality was significantly higher in the uccg registry compared with the norwegian population in all age groups younger than 70 years ( smr 2.29 , 95% ci 1.65 to 3.19 in men and women combined ; smr 2.00 , 95% ci 1.32 to 3.04 in men ; smr 3.03 , 95% ci 1.76 to 5.21 in women ) ( table 4 ) . for death by other causes , there were significantly reduced smrs in both sexes combined and in men ( table 6 ) . sixty patients ( 35 men , 25 women ) used statins ( with or without other lipidlowering drugs ) . allcause mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratio . cardiovascular disease mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratio . cancer mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratios . death by other causes in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratios . during lipidlowering treatment , mmol / l ( sd 1.5 ) ( men 6.4 mmol / l [ sd 1.5 ] ; women 7.0 mmol / l [ sd 1.6 ] ) . mmol / l ( sd 0.4 ) ( men 1.2 mmol / l [ sd 0.4 ] ; women 1.5 mmol / l [ sd 0.3 ] ) . mmol / l ( sd 1.5 ) ( men 4.4 mmol / l [ sd 1.4 ] ; women 5.0 mmol / l [ sd 1.6 ] ) . mean triglycerides were 1.5 mmol / l ( sd 0.6 ) ( men 1.6 mmol / l [ sd 0.7 ] ; women 1.4 mmol / l [ sd 0.5 ] ) . as for clinical signs of hyperlipidemia , data from hospital records were available for 88 of the 113 patients who died . fourteen patients had verified xanthelasmas and 37 patients had verified xanthomas , whereas the remaining 74 and 51 patients , respectively , did not . detailed data on preexisting diseases and mean lipid values were available for 56 of the 113 patients who died . of these 56 patients , 45 ( 32 men , 13 women ) had preexisting cvd before death , of which 23 ( 17 men , 6 women ) had former myocardial infarction . seven patients had diabetes mellitus ( 6 men , 1 woman ) , and 17 ( 11 men , 6 women ) had hypertension ( blood pressure > 140/90 mm hg ) . at the time of inclusion in the uccg registry , mmol / l [ sd 2.4 ] ; women 11.2 mmol / l [ sd 2.5 ] ) . mmol / l ( sd 0.4 ) ( men 1.1 mmol / l [ sd 0.3 ] ; women 1.4 mmol / l [ sd 0.5 ] ) . mean ldl cholesterol was 9.0 mmol / l ( sd 2.6 ) ( men 9.2 mmol / l [ sd 2.7 ] ; women 8.8 mmol / l [ sd 2.6 ] ) . mmol / l [ sd 3.7 ] ; women 1.5 mmol / l [ sd 0.7 ] ) . mean age at inclusion in the uccg registry was 33.6 years ( range 0 to 92.4 years ) : 32.0 years for men and 35.0 years for women . mean age for both sexes at the study end point was 41.6 years ( range 0.3 to 94.7 years ) . a total of 113 deaths were observed during followup , of which all were heterozygote . cvd mortality was most common ( 52 patients , 46.0% ) , followed by cancer mortality ( 34 patients , 30.1% ) , and mortality by other causes ( 27 patients , 23.9% ) . age at inclusion , age at death , and time of followup are summarized in table 1 . selected characteristics of the 113 observed deaths in the unit for cardiac and cardiovascular genetics registry values are given as mean ( range ) . the most common mutations were in the ldl receptor gene ; however , 7 patients had mutation r3500q in the apolipoprotein b gene . mutation type among the 113 observed deaths values are given as number ( % ) . all mutations are in the ldl receptor gene except for mutation r3500q , which is in the apolipoprotein b gene . there was no significant difference in allcause mortality between the uccg registry and the general population except a significant reduced smr at age group 70 to 79 years ( table 3 ) . cvd mortality was significantly higher in the uccg registry compared with the norwegian population in all age groups younger than 70 years ( smr 2.29 , 95% ci 1.65 to 3.19 in men and women combined ; smr 2.00 , 95% ci 1.32 to 3.04 in men ; smr 3.03 , 95% ci 1.76 to 5.21 in women ) ( table 4 ) . for death by other causes , there were significantly reduced smrs in both sexes combined and in men ( table 6 ) . sixty patients ( 35 men , 25 women ) used statins ( with or without other lipidlowering drugs ) . allcause mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratio . cardiovascular disease mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratio . cancer mortality in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratios . death by other causes in the unit for cardiac and cardiovascular genetics registry smr indicates standardized mortality ratios . during lipidlowering treatment , mmol / l ( sd 1.5 ) ( men 6.4 mmol / l [ sd 1.5 ] ; women 7.0 mmol / l [ sd 1.6 ] ) . mmol / l ( sd 0.4 ) ( men 1.2 mmol / l [ sd 0.4 ] ; women 1.5 mmol / l [ sd 0.3 ] ) . mmol / l ( sd 1.5 ) ( men 4.4 mmol / l [ sd 1.4 ] ; women 5.0 mmol / l [ sd 1.6 ] ) . mean triglycerides were 1.5 mmol / l ( sd 0.6 ) ( men 1.6 mmol / l [ sd 0.7 ] ; women 1.4 mmol / l [ sd 0.5 ] ) . as for clinical signs of hyperlipidemia , data from hospital records were available for 88 of the 113 patients who died . fourteen patients had verified xanthelasmas and 37 patients had verified xanthomas , whereas the remaining 74 and 51 patients , respectively , did not . detailed data on preexisting diseases and mean lipid values were available for 56 of the 113 patients who died . of these 56 patients , 45 ( 32 men , 13 women ) had preexisting cvd before death , of which 23 ( 17 men , 6 women ) had former myocardial infarction . seven patients had diabetes mellitus ( 6 men , 1 woman ) , and 17 ( 11 men , 6 women ) had hypertension ( blood pressure > 140/90 mm hg ) . at the time of inclusion in the uccg registry , mmol / l [ sd 2.4 ] ; women 11.2 mmol / l [ sd 2.5 ] ) . mmol / l ( sd 0.4 ) ( men 1.1 mmol / l [ sd 0.3 ] ; women 1.4 mmol / l [ sd 0.5 ] ) . mean ldl cholesterol was 9.0 mmol / l ( sd 2.6 ) ( men 9.2 mmol / l [ sd 2.7 ] ; women 8.8 mmol / l [ sd 2.6 ] ) . mmol / l [ sd 3.7 ] ; women 1.5 mmol / l [ sd 0.7 ] ) . no significant differences were noted in allcause mortality between the fh patients and the general norwegian population except for a significantly lower smr in the age group 70 to 79 years . it may be speculated that a selected group of survivors live very healthily . most fh patients are well aware of premature cvd in the nearest family members and have repeatedly received professional diet and lifestyle advice . the main difference was in cvd mortality , for which fh patients of both sexes had significantly higher smrs compared with the general norwegian population in the age group 0 to 69 years . in the present study , epidemiological data has indicated that the first cvd deaths among fh patients appear in the third or fourth decades of life . because the mean age at inclusion in the uccg registry was 54.8 years , the majority of the youngest age group was not included in this registry ; therefore , some of the cvd deaths in the younger patients could not be registered in the present study . if all fh patients were diagnosed and included in the uccg registry at birth , a higher cvd smr would be expected . cvd mortality among fh patients was responsible for 46% of all deaths , whereas in the norwegian population , cvd was responsible for 37% of deaths in 2010 . mean age of cvd deaths among the fh patients in the uccg registry was 62.2 years for both sexes combined , with 57.2 years for men and 67.2 years for women . according to data from the norwegian cause of death registry , the mean age of cvd deaths in the general population was much higher : 79.0 years from 1992 to 1995 and 81.0 years from 1996 to 2010 . in the same time periods , the mean age of cvd deaths was 76.0 years and 78.0 years , respectively , for men and 82.0 years and 85.0 years , respectively , for women . although it may seem that the mean age of cvd deaths is 15 to 21 years younger for fh patients compared with the norwegian population , these 2 populations are not totally comparable . the fh patient population is slightly younger ( mean age 33.6 years at inclusion in the uccg registry ) than the general norwegian population ( mean age 38.4 in 2001 ; statistics norway ) . given equal mortality rates , a lower mean age at death would be expected in a younger population . most epidemiological data suggest that longterm lipidlowering treatment with statins is not associated with the development of cancer , although data on many years of exposure are incomplete . many of the patients in the present study had used statins for > 20 years . thirty percent of them died from cancer , whereas in norway , cancer was responsible for 35% of all deaths in 2010 , suggesting that longterm use of statins does not increase the risk of death from cancer ( table 5 ) . for death from other causes , fh patients had a significantly lower smr compared with the norwegian population . it may be speculated that the fh diagnosis motivates patients to have a healthy lifestyle and regular health checks ; however , we can not rule out unknown confounding factors . in the uk cohort study with 3382 patients with heterozygote fh , smrs were calculated before and after january 1 , 1992 , by which date statins were available for prescription . from 1992 to 2006 , coronary mortality was still significantly higher in patients aged 20 to 79 years on statins compared with the general population in england and wales ( smr 2.13 , 95% ci 1.81 to 2.50 ) . there were no significant differences in stroke , but significantly lower mortality in noncoronary heart disease ( smr 0.62 , 95% ci 0.53 to 0.72 ) was noted . cancer mortality was significantly lower ( smr 0.63 , 95% ci 0.50 to 0.79 ) , and there were no significant differences in allcause mortality . the results are not totally comparable because clinical criteria for fh were used and not strict molecular genetic tests , hence some patients may have been misclassified . furthermore , the uk study presented specific types of cvd diagnosis , we included all cvd diagnosis in the mortality analysis . after the netherlands , norway has the highest percentage of genetically diagnosed fh worldwide , given an estimated prevalence of 1 in 500 ; however , only 26% of persons with fh are genetically diagnosed in norway , based on an estimated prevalence of 1 in 300 with heterozygote fh . because so many with fh are undiagnosed , the true mortality rates might be different , and even higher smrs for cvd mortality could be expected . according to the european society of cardiology guidelines for the management of dyslipidemias , < 3.5 mmol / l for children and 2.5 mmol / l for adults or , in the presence of cvd or diabetes , < 1.8 mmol / l . in our study , mean ldl cholesterol after treatment was 4.7 mmol / l , far above the recommended treatment values for fh patients . according to the world health organization , among patients with chronic illnesses , 50% do not take medications as prescribed , for various reasons . in our study , at least 12% of those who died did not take statins , and some of them did not receive statins because of endstage cancer . patients diagnosed late in life had been exposed to high ldl cholesterol levels for many years , with an increased risk of atherosclerosis . importantly , the mean age at inclusion in the uccg registry was 54.8 years for those who died compared with 33.6 years for the uccg registry in total . mean followup time in the uccg registry was 6.3 years among the 113 observed deaths compared with 8.0 years for the uccg registry in total . this finding suggests that those who died were diagnosed with fh relatively late in life . in the uccg registry , 20.4% of the patients younger than 18 years of age were on lipidlowering drugs , whereas 89.1% of those aged 18 years and older were on lipidlowering drugs in the period 19982008 . the average levels of total cholesterol were 5.7 mmol / l , whereas the average levels of ldl cholesterol were 3.9 mmol / l , and 29.0% of those on lipidlowering drugs had levels of ldl cholesterol < 3.0 mmol / l . the mean age for starting lipidlowering therapy was 33.4 years . in denmark , with a population similar to norway 's , the risk of cvd was increased 13fold among untreated fh patients and 10fold among fh patients on statins . inadequate and late start of lipidlowering treatment implied already existing severe atherosclerosis and a higher risk of cvd death . there were no differences in mutation types in the present study , and the observed deaths had the same 4 mutation types most frequently found among norwegian fh patients , suggesting that type of mutation was not important for risk of cvd death . all norwegians have a unique identification number that allows for coupling of data across nationwide health registries . important strengths of this study were the high numbers of fh patients and the complete followup . furthermore , we believe that the fh patients enrolled in the uccg registry are representative of the entire norwegian fh population . about 15 000 persons are expected to have fh in norway ; about one third of the expected fh population were in the uccg registry . because the mean age at inclusion was 33.6 years in the uccg registry , some severely affected fh patients may have died young before being diagnosed , hence even higher cvd mortality would be expected . some of the confounding factors that could influence cvd mortality were not excluded , for example , smoking habits , body mass index , and dietary habits . consequently , it is important to compare these results with similar studies from different countries and among other ethnicities . the majority of the blood samples were analyzed by the department of medical biochemistry at oslo university hospital . a few of the baseline lipid blood samples were taken by the referral doctors and analyzed at local laboratories . analyses of blood samples from different laboratories may , to a lesser extent , have influenced the results . the latest treatment lipid values were chosen , and mean values were calculated ; however , the absence of detailed data on lipids in this study limits the ability to evaluate factors associated with living longer with fh . this study did not take into consideration change of identification number or emigration to other countries . these factors would not have changed the main findings of our study because only 20 of 4688 patients ( 0.4% ) were lost to followup . some inaccuracies in the icd10 codes made it difficult to establish the exact cause of death . in our study , 2 patients had diabetes mellitus listed as the main death cause . diabetes mellitus is associated with up to 4 times increased risk of cvd , so it is likely that these 2 persons with fh and diabetes mellitus died of cvd , but it is impossible to be certain . all norwegians have a unique identification number that allows for coupling of data across nationwide health registries . important strengths of this study were the high numbers of fh patients and the complete followup . furthermore , we believe that the fh patients enrolled in the uccg registry are representative of the entire norwegian fh population . about 15 000 persons are expected to have fh in norway ; about one third of the expected fh population were in the uccg registry . because the mean age at inclusion was 33.6 years in the uccg registry , some severely affected fh patients may have died young before being diagnosed , hence even higher cvd mortality would be expected . some of the confounding factors that could influence cvd mortality were not excluded , for example , smoking habits , body mass index , and dietary habits . consequently , it is important to compare these results with similar studies from different countries and among other ethnicities . the majority of the blood samples were analyzed by the department of medical biochemistry at oslo university hospital . a few of the baseline lipid blood samples were taken by the referral doctors and analyzed at local laboratories . analyses of blood samples from different laboratories may , to a lesser extent , have influenced the results . the latest treatment lipid values were chosen , and mean values were calculated ; however , the absence of detailed data on lipids in this study limits the ability to evaluate factors associated with living longer with fh . this study did not take into consideration change of identification number or emigration to other countries . these factors would not have changed the main findings of our study because only 20 of 4688 patients ( 0.4% ) were lost to followup . some inaccuracies in the icd10 codes made it difficult to establish the exact cause of death . in our study , 2 patients had diabetes mellitus listed as the main death cause . diabetes mellitus is associated with up to 4 times increased risk of cvd , so it is likely that these 2 persons with fh and diabetes mellitus died of cvd , but it is impossible to be certain . despite access to modern dietary counseling and prescribed lipidlowering drugs , fh patients still have significantly increased cvd mortality compared with the general norwegian population . it is of great importance to perform new studies to clarify the effects of optimal lipidlowering treatment on cvd mortality in fh patients . | backgrounduntreated patients with familial hypercholesterolemia are at increased risk of premature cardiovascular death .
the primary aim of this study was to investigate whether this is also the case in the statin era.methods and resultsin this registrybased study , 4688 male and female patients from the unit for cardiac and cardiovascular genetics ( uccg ) registry with verified molecular genetic diagnosis of familial hypercholesterolemia in the period 19922010 were linked to the norwegian cause of death registry . standardized mortality ratios and 95% cis were estimated .
there were 113 deaths .
mean age of death was 61.1 years .
cardiovascular disease was the most common cause of death ( 46.0% ) , followed by cancer ( 30.1% ) . compared with the norwegian population ,
cardiovascular disease mortality was significantly higher in the uccg registry in all age groups younger than 70 years ( standardized mortality ratio 2.29 , 95% ci 1.65 to 3.19 in men and women combined ; standardized mortality ratio 2.00 , 95% ci 1.32 to 3.04 in men ; standardized mortality ratio 3.03 , 95% ci 1.76 to 5.21 in women ) .
no significant differences were found in allcause mortality or cancer mortality.conclusionsdespite prescription of lipidlowering drugs , familial hypercholesterolemia patients still had significantly increased cardiovascular disease mortality compared with the general norwegian population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatitis c virus ( hcv ) related morbidity and mortality risk is significant in patients with chronic hepatitis c ( chc ) , which affects approximately 3.2 million people in the united states ( 1% of the population).15 in patients treated with interferon ( ifn ) and ribavirin , 2560% achieved sustained virus response ( svr ) , and with the addition of first generation direct acting antivirals ( daas ) , svr was achieved in almost 80%.69 treatment with new daas led to svr rates greater than 90%.1012 african americans ( aa ) are twice as likely to be infected with hcv relative to the nonhispanic - caucasian us population and have historically had lower response rates to approved ifn based therapies.420 although fibrosis progression is less rapidly in aa compared to caucasians , it is unlikely to be a good clinical strategy to counsel aa that they are at lower risk for rapidly developing advanced liver disease.1921 thus , more specific information about the aa population is needed to better understand the progression of liver disease , especially after achieving viral clearance , and to identify optimal treatment strategies . a number of publications have compared the response and outcomes in patients treated with ifn - based therapies.2227 all studies have demonstrated that patients who achieve an svr have better outcomes with respect to cirrhosis , development of hcc , and all - cause mortality . a report by cozen et al compared outcomes for treated and nontreated patients in two representative diverse populations . the results suggested that patients who received ifn - based therapies but failed to clear hcv may be at increased risk for developing cirrhosis compared to untreated patients . overall survival was not significantly different.28 additional studies provided conflicting results , but these did not contain a significant aa population . finally , a study utilizing electronic medical records ( emrs ) from a department of veterans affairs clinical registry confirmed the value of achieving svr and found that aa were at lower risk than caucasians for all liver events.29 the aim of this prospective study was to evaluate the effect of ifn based therapies on outcomes in aa patients . the predominant population in our urban clinic is aa , and we previously described the demographics and hcv relevant disease parameters in this patient group.30 here , we identified 346 aa first seen in 19952008 and followed them for 8 years on average . our findings further the understanding of liver disease progression in aa and provide information that will specifically guide clinical management and therapy decisions in this underserved and under - investigated population . in this prospective study for outcomes , we started with screened a database of 3,800 chc patients who were seen at the wayne state university physician group ( upg ) gastroenterology clinic between 1995 and 2008 . all patients signed an institutional review board ( irb ) approved consent form . using the emr and an irb approved health insurance portability and accountability act ( hipaa ) exemption from upg and detroit medical center , we identified patients who were diagnosed with hcc between 2009 and 2013 and were in the original database . we also identified patients were seen again between january 2012 and july 2013 in order to identify patients with a significantly long follow up time . in total , we identified 346 aa patients with hepatitis c genotype 1 that were followed for 4 to 18 years . available patient information included demographic information , laboratory values , biopsies , imaging , and response to treatment . first visit and early visit indicate that the information was relevant to the initial assessment of the patients although some data was order and obtained later as part of the initial assessment . cirrhosis was diagnosed with a combination of liver biopsy , ultrasound , computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and/or esophagogastroduodenoscopy evidence of portal hypertension . since repeat biopsies were rarely performed , two well - studied markers of fibrosis were used to determine changes in fibrosis over time.3134 the aspartate amino transferase ( ast ) platelet ratio index ( apri ) was defined as ( ( ast(iu / ml)/40 iu / ml)/platelets ( count10/ml))100.33 fibrosis-4 ( fib-4 ) was defined as ( ( age(years))(ast(iu / ml)))/((platelets(count10/ml))(square root alt(iu / ml)).34 both assays are continuous variables and the literature cutoffs to define minimal vs significant fibrosis were 0.7 for apri and 1.45 for fib-4 . for cirrhosis , the response of aa to therapy was based on intent to treat ( itt ) . the sas based statistical program jmp was used for statistical analysis . to compare different groups , student s t test , analysis of variance ( anova ) , or chi - square changes between early visit and recent visit were evaluated using pairwise analysis . in order to determine the relationship between multiple factors defined in univariate analysis and outcomes , multivariate analysis ( logistic regression ) was used . in total , 346 aa patients , followed for an average of 8 years , were included in our study . the study group was 57% male , and the mean age was 54 years with a range consistent with known infection rates of individuals born between 1945 and 1965 . the mean levels of alanine aminotransferase ( alt ) and ast were elevated , but albumin and platelet levels were within normal range . the majority of patients had liver biopsy ( 257 out of 346 ( 74% ) ) , and the biopsy mean fibrosis score , as defined by the metavir , system was 1.88 . significance defined by pair wise analysis ; ns , not significant , p>0.01 ; * p<0.01 ; * * p<0.001 . all treated patients received ifn based therapies , and 147 patients ( 43% ) received at least one dose of treatment . the majority of treated patients ( 86% ) were given dual therapy of pegylated - ifn and ribavirin . the svr rate was 15% based on itt and 23% based on patients who adhered to the protocol . when patients who relapsed following treatment were included , the end of treatment response ( etr ) was 24% . when patients were stratified by treatment , there were minimal differences between various groups of patients at the first visit ( table 1 and fig . 1 ) . the largest difference , although statistically insignificant , was a reduction in hcv ribonucleic acid ( rna ) levels in patients with svr relative to other groups . in addition , the values before treatment and after treatment / no treatment for liver related laboratory values as a function of response to treatment were compared . the most improved patients were those who achieved an svr , had reversal of alt and ast elevation , and had no decline in albumin and platelet counts . apri and fib-4 were used to assess changes in fibrosis / cirrhosis.3134 we used biopsy data to validate both the apri and fib-4 in our study population . there was a strong correlation between the degree of fibrosis defined by biopsy and fibrosis as calculated by apri and fib-4 ( p<0.001 data not shown ) . also the receiver operating characteristic and the area under the receiver operating characteristic curve ( auroc ) values for the aa population were between 0.56 and 0.75 ( data not shown ) . these results are consistent with the literature , and confirm that both calculations are sensitive and specific for measuring differences in fibrosis in aa.3134 the fibrosis scores by apri ( a ) and fib-4 ( b ) are plotted as the average for paired patients between the initial visit ( 1 ) and follow - up visit ( 2 ) . n treat , nontreated ; dis , discontinued ; nonr , nonresponders ; rel , relapsed ; svr , sustained virus response . significance was defined using the paired difference test . when the apri and fib-4 were evaluated in patients at the initial visit and follow - up , there was no significant change in fibrosis in patients that were not treated ( fig . only the patients who achieved svr had a significant improvement in these fibrosis scores relative to the other groups . statistical significance was assessed using a pair - wise analysis , and there were differences in individual patients but not group averages . patients who achieved svr did not develop new cirrhosis or hcc in the follow - up period ( fig . patients who were not treated , who discontinued treatment , or who were nonresponsive to treatment developed hcc and newly identified cirrhosis . the nonresponding patients , however , had a lower incidence of hcc than untreated or discontinued treatment patients . patients achieving an etr but not svr did not develop hcc but exhibited a similar incidence of new cirrhosis as the other groups . patients were evaluated for the development of hepatocellular carcinoma ( hcc ) and new cases of cirrhosis at visits following the initial visit . the majority of patients were treated with peg - ifn + ribavirin ( 86% of treated patients ) . etr ( svr + relapse patients ) was 24% by itt and 36% by protocol . n treat , nontreated ; dis , discontinued ; nonr , nonresponders , rel , relapsed ; svr , sustained virus response . since males are more likely to develop hcc , we compared hcc development and response to therapy by gender ( fig . the response to treatment was similar for both genders ( 13% f vs. 18% m ) , although the percentage of females treated ( 46% ) was greater than males ( 38% ) . 3 , aa males were more likely to develop hcc than females , but patients achieving an svr or etr with subsequent relapse did not develop hcc regardless of gender . in addition , although males had a higher incidence of hcc , the time to development of hcc was not statistically significant between the genders ( f=9 years vs. m=8 years ) . the % of patients who developed hcc was plotted by response to treatment and gender . similar numbers of aa patients were treated ( 46% f and 38% m ) , and response rates based on intent to treat were also similar ( 15% ) . although males were more likely to develop hcc , hcc did not develop in either the svr or etr ( relapse ) patients , regardless of gender . the average time to hcc was 9 years for females and 8 years for male ( nonsignificant by chi - square ) . in order to define the natural history of the disease in aa patients the time to hcc onset ranged from 1 year to 14 years after the first visit , with 4 to 6 years being the most common timeframe ( n=24 , fig . 4 ) . there was no difference in time to hcc diagnosis between aa patients with or without cirrhosis at the time of the first visit . all patients ( n=51 ) who developed hcc were stratified by those who had cirrhosis at first visit ( hcc from cirrhotic ; n=12 ) and those who did not ( hcc - noncirrhotic ; n=39 ) . almost half ( 24/51=48% ) of patients developed hcc 47 years after the first visit but a significant number of patients ( 25% ) did not receive a diagnosis of hcc for more than 11 years . the risk of developing of hcc at the first visit was not predicted by the presence of cirrhosis , since the time to hcc distribution was similar for those with and without cirrhosis at the first visit . untreated patients who did not develop hcc were compared to those who did develop hcc in order to determine whether particular parameters at the first visit were useful predictors of hcc development . alt , ast , albumin , platelet counts , and alpha fetoprotein ( afp ) all correlated / inversely correlated with hcc development in aa ( p<0.005 , data not shown ) . fig . 5 presents the data related to fibrosis ( liver biopsy metavir scores , apri , and fib-4 ) , and all were significant predictors of hcc . fibrosis but not cirrhosis at the first visit was a significant risk factor for hcc . there was a wide range and considerable overlap in all patient parameters among patients who developed hcc and those who did not . therefore , the values could not be used to predict individual risk for developing hcc . when using multivariate analysis for all risk factors ( alt , ast , albumin , platelets , afp , stage of fibrosis , apri , fib-4 , and cirrhosis ) , no parameters were identified that were independent predictors of risk for developing hcc when subjected to logistic regression analysis . when the multivariate analysis was restricted to only fibrosis relevant independent predictors ( metavir stage , apri , and fib-4 ) , the only independent predictor of hcc was stage of fibrosis ( p<0.002 ) . individual patients were stratified by those who developed hcc or those who did not and their individual values for potential risk factors at first visit are plotted . for continuous variables , the graphs have the mean and sem and significance was defined with a student s t test ( a , b ) . for discontinuous values ( fibrosis by metavir and presence / absence of cirrhoses ) the data are presented as mosaic plots and significance was calculated using pierson chi - square ( c , d ) . the width of the plots reflect the total numbers of patients , and the various shadings represent the % of patients with each parameter ( scores of 0 - 4 or cirrhosis or no cirrhosis ) . the bar to the right of each graph reflects the % of total patients . similar results were obtained for ast , albumin , platelet counts , and afp ; and the difference at entry between hcc and no hcc was significant ( p<0.001 for all , data not shown ) . the wide variability and overlap between individuals in those assays was also similar to that shown in the figure . although patients who developed hcc were more likely to have cirrhosis at first visit , the difference was not statistically different . in this study , we followed aa patients with chc for an average of 8 years who were infected with hcv genotype 1 . chc outcomes were defined by either the development of cirrhosis , hcc , or fibrosis from the initial visit to the most recent follow up in 2012 - 2013 . as part of this study , we confirmed that a significant number of patients with early visit liver biopsy results had a good correlation with both apri and fib-4 , thus confirming them as useful surrogate markers for fibrosis in aa patients . since repeat biopsies were rarely performed , fibrosis was detected using apri and fib-4.7,3134 the study demonstrated that permanent viral elimination ( defined as svr ) with ifn based treatment in aa patients with chc protected them from cirrhosis and hcc and reversed fibrosis . although chc patients with etr who relapsed developed new cases of cirrhosis at rates similar to those of nontreated or treatment failure patients , they did not develop hcc . in contrast , patients who failed treatment or were not treated were at high risk for the development of hcc and new onset cirrhosis . this study also confirmed that aa males are at higher risk for developing hcc than aa females . the response to therapy was similar and achieving an svr reduced the risk of hcc in both genders . since a significant number of patients developed hcc , we were able to determine whether hcc risk in aa was predictable based on the first clinical visit . unlike many studies , we plotted individual patients rather than an average in order to assess the clinical value per patient . regardless of whether serum assays ( alt , ast , afp , albumin , platelets ) or fibrosis assays ( biopsy , apri , fib-4 ) were compared between patients who did or did not develop hcc , there was no reliable predictor on an individual basis . somewhat unexpected , we found that cirrhosis at first visit in aa was not predictive of hcc development . when multivariate analysis was used to determine whether there was a single independent factor that was predictive of development of hcc in aa , only fibrosis , as defined by biopsy at the first visit , was even moderately predictive . this lack of positive predictive value for factors was further confirmed by the finding that when patients who developed hcc were stratified by cirrhosis ( or no cirrhosis ) at first visit , there was no relationship between time to hcc and cirrhosis . although the number of patients achieving an svr was sufficient for analysis , we could not rule out the possibility of the development of hcc in patients who achieved an svr . there are a number of publications suggesting that the rate of hcc may be as high as 5% in patients experiencing an svr.3537 those studies are , however , primarily in asian and european populations and do not contain significant numbers of aa . the primary risk factors for developing hcc in patients with svr are males with genotype 1 and cirrhosis at the time of viral clearance . the majority of hcc cases occurred within 3 years , suggesting the presence of small precancerous lesions at the time of viral clearance . since our population contains patients with these significant risk factors and a high incidence of hcc was present in the untreated and nonresponding population , it is possible that the development of hcc in aa after clearance of the virus is considerably less likely than in the other populations studied . to a large extent , this study is prospective in nature since patients were first seen prior to 2008 and subsequently seen until 2013 or the development of hcc . patients who developed hcc were followed for 114 years , while those who did not , were seen for a minimum of 4 years and a maximum of 18 years after initial presentation . this study did not compare caucasians to aa , as the number of caucasians seen in our clinic has continued to decline and there were insufficient numbers available for statistical analyses . the incidence of hcc in aa in our study was 20% in untreated patients , which was sufficient to provide statistical and clinical relevance to our study . perhaps the most important observation of the study was that aa who did achieve svr were similar to other groups of svr patients who also had improved outcomes relative to untreated or nonresponding patients . with the advent of more effective daa therapies , possible differences in response rates between aa and caucasians are no longer an issue , and more patients should achieve an svr.12 although there are many risk factors for the development of hcc in aa patients , if patients are not successfully treated , it remains difficult to predict the development of hcc . since identification of cirrhosis at an early visit may not be a significant risk factor in aa , surveillance in patients with significant fibrosis , rather than just cirrhosis , is warranted . unfortunately in many studies to date , it is often a challenge to provide effective hcc surveillance of this population ; and thus , elimination of the virus remains the optimal goal of therapy . | background and aims : african americans ( aa ) historically have a low response rate to hepatitis c therapies , and there is limited information available for this patient population regarding the development and treatment of chronic hepatitis c ( chc ) .
the aim of this study was to evaluate liver disease progression and hepatocellular carcinoma ( hcc ) development in aa with chc .
methods : between 1995 and 2008 , 246 aa patients with chc were identified from a database of patients and followed until 2012 - 2013 ( average 8 years ) or the development of hcc after 2008 . results : viral clearance ( intent to treat ; sustained virus response ( svr ) )
was achieved in 15% of patients with interferon based therapies with or without ribavirin .
aa patients who achieved an svr ( n=22 ) did not develop hcc or new onset cirrhosis , whereas the hcc incidence in untreated aa patients was 23% ( 51/203 ) .
patients who achieved an svr also had improved fibrosis , as defined by the ast platelet ratio index ( apri ) and fibrosis-4 ( fib-4 ) score , relative to nonresponders and untreated patients .
conclusions : the severity of liver disease at the first visit ( except for cirrhosis ) correlated with the development of hcc , but because of the overlap in values between patients , these measurements were not useful for predicting individual risk .
since cirrhosis at the first visit was not a predictive factor , treatment with newer antiviral therapies is the best option for reducing the incidence of advanced liver disease and its harmful outcomes in the aa population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
behet 's disease ( bd ; mim 109650 ) is a chronic multisystem inflammatory disorder of unclear etiology , which is characterized by primary features including recurrent oral and genital ulcers as well as skin and ocular lesions . other minor manifestations of bd include arthritis , large vessel involvement ( lvi ) , and lesions of central nervous system ( cns ) and gastrointestinal ( gi ) tract . the mean age of onset of bd is in the early 30s , and the male - to - female ratio varies with ethnicity ( 1 ) . although the precise pathogenesis of bd remains a matter of some controversy , genetic , immunological , and environmental factors have been suggested to contribute to the development of bd ( 2 ) . several susceptibility variant genetic alleles , including alleles of th1 cytokine - associated genes , have been recognized for their effects on the clinical symptoms of bd . a recent study of turkish multicase families identified several bd susceptibility loci , via whole - genome linkage analysis . the loci with the strongest association with bd were detected at positions 6p22 - 24 and 12p12 - 13 ( 3 ) . tumor necrosis factor alpha ( tnf- ) is a multifunctional , pro - inflammatory cytokine , which performs a variety of functions in innate immune response , including activation of macrophages and apoptosis , which appears to be responsible for the recurrent inflammatory reactions encountered in bd patients . the promoter polymorphism of thetnfa gene , which is located on chromosome 6p21.3 , has been associated with the expression of tnf-. tnf- levels tend to be significantly elevated in active bd patients , and increased production of tnf- have been associated with clinical deterioration ( 4,5 ) . several single nucleotide polymorphisms ( snps ) in the tnfa promoter region appear to alter transcription efficiency in response to specific external stimuli ( 6 - 8 ) . excessive or insufficient tnf- production might be responsible for the variable patterns of the pathogenesis of this disease . these snps , as well as tnf- overproduction , have been associated with susceptibility to or with the severity of , both inflammatory diseases and autoimmune diseases , including rheumatoid arthritis , systemic lupus erythematosus , and crohn 's disease ( 9 ) . there is , currently , a large body of evidence from in vitro experiments which suggests that tnf- is produced at higher levels in both the monocytes and / t cells of bd patients in response to lipopolysaccharide treatment than has been observed in control subjects . however , the mechanism underlying this phenomenon remains to be determined ( 10 , 11 ) . also , infliximab ( monoclonal anti - tnf- antibody ) and etanercept ( a dimeric soluble p75 tnf receptor ) have demonstrated a high degree of therapeutic efficacy for suffers of bd coupled with uveitis , intestinal ulcers , and orogenital ulcers ( 12 , 13 ) . researchers have been attempting for several years to determine whether polymorphisms of the tnfa promoter region influence the expression of tnf- in bd or its susceptibility or its severity and clinical features . the results of these allelic and genotypic associations , however , are somewhat contradictory , as the implicated polymorphic sites and allele frequencies appear to vary substantially among ethnic groups ( 14 , 15 ) . most notably , -376g > a and -308g > a are either completely absent or quite rare among asians , including the koreans and the japanese ( 6,16,17 ) . therefore , this study was focused specifically on the haplotypic association of tnfa promoter response elements with the risks and clinical features of bd . two hundred fifty - four patients ( 130 males and 124 females ) from 16 to 66 yr of age registered at the behet 's disease specialty clinic of severance hospital at the yonsei university college of medicine and the ajou university school of medicine and 344 healthy korean controls were included in this case - control study . the youngest onset of bd was 3 yr old and the oldest onset was 58 yr old and the mean age of disease onset was 33.210.4 yr old . bd was diagnosed according to the clinical criteria of the international study group for behet 's disease or the revised criteria of behet 's disease(18 ) . genomic dna was extracted from peripheral blood by using a qiaamp blood mini kit ( quiagen , valencia , ca , u.s.a . ) . six snps in the promoter region of tnfa gene at the position of -1031 t > c , -863 c > a , -857 c > t , -376 g > a , -308 g > a and -238 g > a ( according to genbank accession no . ab088112 ) were analyzed by using polymerase chain reaction ( pcr ) and restriction fragment length polymorphism ( rflp ) methods . the -1031 t > c was amplified with pcr by using primers 5'-acaaggctgaccaagagagaa-3 ' and 5'-gtccccatactcgactttcat-3'and was digested with the bbsi restriction enzyme ( 19 ) . the -863 c > a was amplified by using primers 5'-ggctctgaggaatgggttac-3'and 5'-ctacatggccctgtcttcgttacg-3 ' and was digested with the taii restriction enzyme ( 20 ) . genotyping for -857c > t was conducted by using the forward primer 5'-aagtcgagtatggggaccccccgttaa-3'and the reverse primer 5'-ccccagtgtgtggccatatcttctt-3'which made it possible to use the restriction enzyme hincii ( 19 ) . the g > a substitution at position -376 was analyzed by the tsp509i restriction enzyme by using the primers , 5'-ccccgttttctctccctcaa-3'and 5'-tgtggtctgtttccttctaa-3'(21 ) . the polymorphic region containing the ncoi restriction site at -308 g > a was amplified by using primers 5'-aggcaataggttttgagggccat-3'and 5'-tcctccctgctccgattccg-3 ' . the g > a transition polymorphism at position -238 was examined by pcr using primers 5'-cccagaagacccccctcggaacc-3'and 5'-accttctgtctcggtttcttctccatcgc-3'and was digested with the hpaii restriction enzyme ( 19 ) . the digested pcr products were electrophoresis on an 8% or 5% polyacrylamide gel and were stained with ethidium bromide to visualize the dna fragments . the hardy - weinberg equilibrium and linkage disequilibrium coefficient lewontin 's d'(d' ) were performed with the r program v.1.9.1 ( http://cran.r-project.org ) . the statistical significance of the difference in tnfa allele frequencies between bd patients and controls was examined by the or fisher 's exact test by using sas version 8.1 ( sas institute , cary , nc , u.s.a . ) . haplotypes of each individual were inferred by using the phase program , v.2.0.1 ( 22 ) . two hundred fifty - four patients ( 130 males and 124 females ) from 16 to 66 yr of age registered at the behet 's disease specialty clinic of severance hospital at the yonsei university college of medicine and the ajou university school of medicine and 344 healthy korean controls were included in this case - control study . the youngest onset of bd was 3 yr old and the oldest onset was 58 yr old and the mean age of disease onset was 33.210.4 yr old . bd was diagnosed according to the clinical criteria of the international study group for behet 's disease or the revised criteria of behet 's disease(18 ) . genomic dna was extracted from peripheral blood by using a qiaamp blood mini kit ( quiagen , valencia , ca , u.s.a . ) . six snps in the promoter region of tnfa gene at the position of -1031 t > c , -863 c > a , -857 c > t , -376 g > a , -308 g > a and -238 g > a ( according to genbank accession no . ab088112 ) were analyzed by using polymerase chain reaction ( pcr ) and restriction fragment length polymorphism ( rflp ) methods . the -1031 t > c was amplified with pcr by using primers 5'-acaaggctgaccaagagagaa-3 ' and 5'-gtccccatactcgactttcat-3'and was digested with the bbsi restriction enzyme ( 19 ) . the -863 c > a was amplified by using primers 5'-ggctctgaggaatgggttac-3'and 5'-ctacatggccctgtcttcgttacg-3 ' and was digested with the taii restriction enzyme ( 20 ) . genotyping for -857c > t was conducted by using the forward primer 5'-aagtcgagtatggggaccccccgttaa-3'and the reverse primer 5'-ccccagtgtgtggccatatcttctt-3'which made it possible to use the restriction enzyme hincii ( 19 ) . the g > a substitution at position -376 was analyzed by the tsp509i restriction enzyme by using the primers , 5'-ccccgttttctctccctcaa-3'and 5'-tgtggtctgtttccttctaa-3'(21 ) . the polymorphic region containing the ncoi restriction site at -308 g > a was amplified by using primers 5'-aggcaataggttttgagggccat-3'and 5'-tcctccctgctccgattccg-3 ' . the g > a transition polymorphism at position -238 was examined by pcr using primers 5'-cccagaagacccccctcggaacc-3'and 5'-accttctgtctcggtttcttctccatcgc-3'and was digested with the hpaii restriction enzyme ( 19 ) . the digested pcr products were electrophoresis on an 8% or 5% polyacrylamide gel and were stained with ethidium bromide to visualize the dna fragments . the hardy - weinberg equilibrium and linkage disequilibrium coefficient lewontin 's d'(d' ) were performed with the r program v.1.9.1 ( http://cran.r-project.org ) . the statistical significance of the difference in tnfa allele frequencies between bd patients and controls was examined by the or fisher 's exact test by using sas version 8.1 ( sas institute , cary , nc , u.s.a . ) . haplotypes of each individual were inferred by using the phase program , v.2.0.1 ( 22 ) . a total of 254 korean bd patients and 344 control subjects were analyzed for six snps in the tnfa promoter region . the genotype and allele frequencies of the regulatory response element promoter polymorphisms tnfa gene of the bd patients and controls are shown in table 1 . distributions of the genotypes of both groups agree with those predicted under the conditions of hardy - weinberg equilibrium . the tnfa -1031*c , -863*a and -308*g alleles are shown to be significantly associated with bd ( p=0.030 , odds ratio [ or]=1.4 ; p=0.008 , or=1.5 ; p=0.010 , or=1.8 , respectively ) . they were significantly higher in the bd patients suffering from major symptoms ( or=1.4 - 1.9 ) and arthritis(or=1.4 - 2.9 ) than in the controls ( table 2 ) . there was no association between the presence of minor -238*a allele and the symptoms of bd except for bd with gi lesions . the age at which an individual first manifests major symptoms of the bd appears to be genetically influenced . the tnfa promoter snps influenced the age onset ( before 20 yr ) in bd . the tnfa -1031*c , -863*a and -857*c alleles were shown to have a significantly higher association among the bd patients whose onset age is younger than 20 yr old when compared with those whose onset age is after 20 yr old ( p=0.03 - 0.04 , or=1.6 - 2.5 ) . significant differences between bd and controls were observed in the distribution of tnfa -1031*c , -863*a and -857*c did show significantly higher ors in the early onset age group than the later onset age group ( or=1.6 - 2.5 ) ( fig . the tnfa-1031*t was strong associated with -863*c ( p<0.0001 ) and -857*c ( p<0.0001 ) . the -863*c was in linkage disequilibrium with the -857*c ( p=0.0003 ) . among 22 estimated haplotypes , the most common haplotype , tnfa -1031t-863c-857c-376g-308g-238 g ( 55% ) and six common tnfa haplotypes the overall haplotype distributions were found to be significantly different between the bd patients and the controls by the permutation test ( p=0.02 ) . the tnfa -1031c-863a-857c-376g-308g-238 g haplotype containing the three alleles tnfa -1031*c , -863*a and -308*g was found to be significantly associated with bd . conversely , the tnfa -1031t-863c-857c-376g-308a-238 g which did not have these alleleic polymorphisms was protective against bd ( table 4 ) . the patients were characterized by clinical features whose major / minor symptoms were oral , genital ulcers , skin , ocular lesions , arthritis , and lvi . we investigated the clinical features of the tnfa haplotypepositive individuals in terms of the frequency of the haplotype , tnfa -1031c-863a-857c-376g-308g-238 g , which contains the three alleles -1031*c , -863*a and -308*g . being compared with the controls , it was significantly over - represented among patients ( or=1.6 - 3.0 ) who suffered from oral and genital ulcers , skin and ocular lesions , arthritis and cns but not among those who suffered from lvi or gi lesions . on the other hand , the haplotype tnfa -1031t-863c-857c-376g-308a-238 g which does not carry those alleles were shown to significantly reduce the risk of bd than in controls ( p=0.029 - 0.013 , or=0.4 - 0.6 ) ( table 4 ) . frequencies of tnfa -1031t-863c-857t-376g-308g-238 g and tnfa -1031c-863c-857c-376g-308g-238a haplotypes in the patients with cns or gi lesions significantly differed from those in the controls , but the number of patients was too small for a statistical analysis ( table 4 ) . both clinical and polymorphism - focused studies have uncovered evidence suggesting that tnf- functions as a mediator in the initiation and propagation of bd . polymorphisms of the tnfa promoter region have been associated with bd in several ethnic groups , but it remains somewhat uncertain as to whether this is the results of the existence of susceptibility sites , or to the level of tnf- expression . in this study , a significant difference was observed between bd patients and controls with regard to the polymorphisms of the regulatory response promoter region of the tnfa gene . the alleles , tnfa -1031*c , -863*a and -308*g were closely associated with bd , but tnfa -376g > a and -238g > a were not significantly associated among korean sufferers of bd . the tnfa -1031*c allele was strongly association with bd in caucasian patients , in a previous study conducted in the united kingdom ( 23 ) . the other previous studies involving turkish and caucasian patients , the tnfa -376g > a , -308g > a and -238g > a alleles were not significantly associated with bd ( 15,23 - 25 ) . in studies of haplotypes of the tnfa promoter , the tnfa -1031c-863a-857c-376g-308g-238 g haplotype , which harbors the -1031*c , -863*a and -308*g alleles , was significantly associated with bd . conversely , the tnfa -1031t-863c-857c-376g-308a-238 g haplotype , which does not harbor the aforementioned allelic polymorphisms , was associated with a reduced susceptibility to bd . the same results were reported in caucasian bd patients in the united kingdom ( 23 ) . we compared the risk of bd between the early onset age group and the later onset of group , with regard to the tnfa alleles . the -1031*c , -863*a and -857*c alleles were detected with a significantly greater frequency in the former than in the latter . inflammation in cases of bd is believed to be mediated by cytokines derived from t - helper type 1 lymphocytes , including tnf-(26 ) . it appears that disease activity can be significantly associated with the secretion of pro - inflammatory mediators , as the result of the direct activation of circulating monocytes . the pro - inflammatory cytokine , tnf- , triggers a signaling cascade , converging on the activation of the nf-b transcription factor , which is also involved in a variety of features of immune response , which in turn constitutes the basis for a host of physiological and pathological processes . the enhanced / silenced expression of pro - inflammatory cytokines indicates the presence of a defect in the normal regulatory mechanisms , and this may have a genetic basis . much of the control of gene expression appears to involve transcription factors ( trans - acting ) bound to proximal promoter regulatory response sequences ( cis - acting ) . gene expression is mediated by several sets of cis - acting regulatory regions , including the core or proximal promoter region , and the response elements . the response elements modulate transcription in response to specific external stimuli , including heat shock 70 or interferon - gamma . allele - specific elements may bind the transcriptional factors , oct-1 and nf-b , in the -1031t > c , -863c > a and -857c > t of the tnfa regulatory response promoter region , which are thought to be involved in a variety of the immune response functions . although the roles of the allele - dependent binding elements of tnfa -1031 , -863 and -857 snps have yet to be precisely delineated , the susceptible sites associated with the development of bd are in the -1031t > c , -863c > a and -857c > t snps of the regulatory response promoter region , and not in -376g > a , -308g > a or -238g > a ( 6,15,28 - 30 ) . these snps also evidenced no relationship with the degree of severity of the clinical features of bd ( 15 ) . the pro - inflammatory cytokines , tnf- and mannosebinding lectin ( mbl ) , are potent inducers of inflammation . elevated levels of these cytokines are frequently associated with the activation of macrophages , thereby influencing the severity of inflammatory responses . both of these pro - inflammatory cytokines induce local inflammatory responses , and also exert systemic effects . the over - expression of these cytokines may be responsible for the pathogenesis of recurrent bd . it has been reported previously that the mbl2 hypa haplotype , which induces an elevate expression of mbl , was related to susceptibility to bd , and also to the early onset of disease ( 31,32 ) . tnf- production tended to be elevated in carriers of the tnfa -1031*c , -863*a or -857*t alleles , who also suffered from severe periodontitis ( 19 ) . the frequency with which individuals were determined to harbor both the tnfa -1031c-863a-857c-376g-308gand mbl2 hy-- ( -550*g , -221*g ) haplotypes was significantly higher in the bd patient group than among the controls ( p=0.004 ) . the elevated production of tnf- and mbl2 haplotypes might serve to accelerate recurrent inflammation , or may play a critical pathogenic role in initiating immune responses , which might also result in the development of bd . a host of genes appear to be related to bd susceptibility , and the tnfa promoter haplotypes appear to be fairly important markers with regard to their association with bd . in conclusion , the findings of this study indicate that the tnfa -1031c-863a-857c-308 g haplotype can be confidently associated with the development of bd as well as early age of onset . this haplotype was also determined to be responsible for the enhanced inflammatory reactions seen in cases of bd involving primary symptoms . | although the etiology of behet 's disease ( bd ; mim 109650 ) remains to be clearly elucidated , levels of tumor necrosis factor alpha ( tnf- ) have been reported to be significantly elevated in bd patients , and tnf- blockers have been demonstrated to exhibit some degree of therapeutic efficacy for a certain subset of bd sufferers . in this study , we have conducted an analysis of the tnfa haplotypes in the promoter response element that affect the binding affinity of specific transcription factors , in order to characterize their association with the clinical features of bd .
six polymorphisms in the promoter region of tnfa were genotyped in 254 bd patients and 344 control subjects , via the pcr - rflp technique .
tnfa -1031*c
, -863*a and -308*g alleles were associated with an increased risk of bd ( p=0.030 , or=1.4 ; p=0.008 , or=1.5 ; p=0.010 , or=1.8 , respectively )
. the sole tnfa haplotype -1031c-863a-857c-376g-308g-238 g , was associated with a 1.6 fold increase in the risk of bd , whereas the tnfa haplotype -1031t-863c-857c-376g-308a-238 g was associated with a 0.6 decreased risk of bd .
the tnfa -1031*c , -863*a , -857*c and -308*g alleles were significantly associated with bd . the findings of this study , collectively , indicate that tnfa haplotypes in the promoter response elements may exert significant influence on susceptibility to bd . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
although there is consensus ( apa , 1994 ) about dsm iv criteria for children and adolescents with autistic disorder and asperger s disorder , the largest category , pddnos , remains difficult to classify . the latter is even more true for adult patients since the dsm - iv criteria are not formulated with adult age in mind ( gillberg , 1998 ; tamtam , 1991 ; vermeulen , 2002 ) . the autism diagnostic interview revised ( adi - r , lord , rutter , & le couteur , 1994 ) and the autism diagnostic observation schedule - generic ( ados - g ; lord et al . , 2000 ) follow - up studies of adolescents and adults with autism indicate that a slow decrease in symptoms across time occurs in a small group , particularly the less severely affected patients ( seltzer , shattuck , abedutto , & greenberg , 2004 ) . however , there is a lack of knowledge about adults with mild asd , i.e. , asperger s disorder and pddnos . in light of this limited knowledge on symptom presentation in adults , the present paper reports on a pilot research - project that was done with two aims : ( a ) to test the autism spectrum quotient ( aq ; baron - cohen , wheelwright , skinner , martin , & clubley , 2001 ) as an instrument for screening adult non - mentally retarded patients for asd . we hypothesised that scores would be higher for an asd group than for two non - asd comparison groups ; ( b ) there is a clinical feeling that mild asd symptoms often mix with other disorders ( e.g. , obsessive compulsive disorder or schizoid personality disorder ) . therefore , in patients referred to an asd expertise - centre , prevalences of axis i and ii comorbid disorders were estimated to test the hypothesis that certain diagnoses are more prevalent among asd patients than non - asd patients . two groups of patients were investigated ; the first group ( n = 36 ) consisted of patients referred to the autism team north netherlands ( atn ) . the atn is the asd outpatient center of expertise for the three northern provinces of the netherlands ( 1.5 million inhabitants ) . on a yearly basis , about 80 new adult patients are referred for diagnostic evaluation and ( advice for ) treatment . since the atn is a center of expertise , all patients were referred by psychiatrists and psychologists , working in the field of adult ( but not forensic ) psychiatry . only patients with parents who were able to give the required information were included in the present study . they were 18 years or older , with an estimated iq higher than 80 . over a span of 10 months from february 2003 through october 2003 , 60 eligible patients were asked to participate , of which 35 patients and their parents consented . the patients were randomly assigned to two experienced ( child ) psychiatrists ( ck or eh ) for diagnostic assessment . the second group ( n = 369 ) consisted of patients from the same region , who were referred in this same period to the general outpatient psychiatric clinic of the university medical centre groningen . this group from the general outpatient clinic ( goc ) enabled us to compare the scores on the aq screening instrument . the clinical standardized diagnostic protocol that was used in the intake of atn - referred patients consisted of a semi - structured interview ( taken from at least one of the parents ) , and observations from the adi - r , ados - g , as well as clinical experience . actual asd symptoms were translated in the interview as much as possible to the adult - world situation . questions about the past were used to reconstruct the developmental history of the patient as adequately as possible . the information derived from the diagnostic protocol was subsequently used to score the dsm - iv criteria on asd . intelligence was assessed by using a short version of the groninger intelligentie test ( git , luteijn , 1966 ) . for classification of pddnos , the minimal amount of positive dsm - iv criteria was two , of which at least one derived from the social interaction domain . for asperger s disorder at least two items on the social domain and at least one item on the stereotypic domain needed to be present with no early delay of language . for high functioning autism at least six items were needed to be present , with at least two items on the social domain and at least one positive item on each of the other two domains , with onset of abnormal functioning before the age of three years . the reliability of the diagnostic protocol was tested by assessing a series of seven patients simultaneously by two experienced ( child ) psychiatrists ( ck and eh ) . these independent classifications differed only on one patient ( pddnos versus non - asd ) . the seven patients were not included in the present study , which started after having determined diagnostic reliability . the aq was translated in dutch and was named aq - d ( dutch ) . this self - report screening questionnaire has 50 items , which score on 5 domains of behavior : social skill , attention switching , attention to detail , communication , and imagination . each domain has a maximum score of 10 ( for details on this instrument , see baron - cohen et al . , 2001 ) internal consistency reliability estimates ( cronbach s ) for aq subscales were acceptable for the asd - group but somewhat on the lower side for the non - asd groups . averaged across the five subscales cronbach s was .67 for the asd group , .62 for the non - asd group referred to the atn , and .59 for the goc group . for the total scale internal consistency reliability was acceptable in all three groups : i.e. , .85 , .82 , and .79 , respectively . present and life - time comorbidity were assessed by using the schedules for clinical assessment in neuropsychiatry ( scan-2.1 , giel & nienhuis , 1996 ; world health organisation , 1992 ) and the international personality disorder examination ( ipde , loranger et al . , 1994 ) . iq , scan and ipde assessments were done by a psychologist ( jb ) who was blind to the outcome of the asd psychiatric diagnosis . chi - square tests and analyses of variance were conducted to analyze possible differences between the groups . two groups of patients were investigated ; the first group ( n = 36 ) consisted of patients referred to the autism team north netherlands ( atn ) . the atn is the asd outpatient center of expertise for the three northern provinces of the netherlands ( 1.5 million inhabitants ) . on a yearly basis , about 80 new adult patients are referred for diagnostic evaluation and ( advice for ) treatment . since the atn is a center of expertise , all patients were referred by psychiatrists and psychologists , working in the field of adult ( but not forensic ) psychiatry . only patients with parents who were able to give the required information were included in the present study . they were 18 years or older , with an estimated iq higher than 80 . over a span of 10 months from february 2003 through october 2003 , 60 eligible patients were asked to participate , of which 35 patients and their parents consented . the patients were randomly assigned to two experienced ( child ) psychiatrists ( ck or eh ) for diagnostic assessment . the second group ( n = 369 ) consisted of patients from the same region , who were referred in this same period to the general outpatient psychiatric clinic of the university medical centre groningen . this group from the general outpatient clinic ( goc ) enabled us to compare the scores on the aq screening instrument . the clinical standardized diagnostic protocol that was used in the intake of atn - referred patients consisted of a semi - structured interview ( taken from at least one of the parents ) , and observations from the adi - r , ados - g , as well as clinical experience . actual asd symptoms were translated in the interview as much as possible to the adult - world situation . questions about the past were used to reconstruct the developmental history of the patient as adequately as possible . the information derived from the diagnostic protocol was subsequently used to score the dsm - iv criteria on asd . intelligence was assessed by using a short version of the groninger intelligentie test ( git , luteijn , 1966 ) . for classification of pddnos , the minimal amount of positive dsm - iv criteria was two , of which at least one derived from the social interaction domain . for asperger s disorder at least two items on the social domain and at least one item on the stereotypic domain needed to be present with no early delay of language . for high functioning autism at least six items were needed to be present , with at least two items on the social domain and at least one positive item on each of the other two domains , with onset of abnormal functioning before the age of three years . the reliability of the diagnostic protocol was tested by assessing a series of seven patients simultaneously by two experienced ( child ) psychiatrists ( ck and eh ) . these independent classifications differed only on one patient ( pddnos versus non - asd ) . the seven patients were not included in the present study , which started after having determined diagnostic reliability . the aq was translated in dutch and was named aq - d ( dutch ) . this self - report screening questionnaire has 50 items , which score on 5 domains of behavior : social skill , attention switching , attention to detail , communication , and imagination . each domain has a maximum score of 10 ( for details on this instrument , see baron - cohen et al . , 2001 ) the aq - d was completed by the patient before the clinical procedure started . internal consistency reliability estimates ( cronbach s ) for aq subscales were acceptable for the asd - group but somewhat on the lower side for the non - asd groups . averaged across the five subscales cronbach s was .67 for the asd group , .62 for the non - asd group referred to the atn , and .59 for the goc group . for the total scale internal consistency reliability was acceptable in all three groups : i.e. , .85 , .82 , and .79 , respectively . present and life - time comorbidity were assessed by using the schedules for clinical assessment in neuropsychiatry ( scan-2.1 , giel & nienhuis , 1996 ; world health organisation , 1992 ) and the international personality disorder examination ( ipde , loranger et al . , 1994 ) . iq , scan and ipde assessments were done by a psychologist ( jb ) who was blind to the outcome of the asd psychiatric diagnosis . chi - square tests and analyses of variance were conducted to analyze possible differences between the groups . fifteen of the 36 patients were diagnosed with asd . in this asd - group , 10 patients classified as pddnos , 4 patients as asperger s disorder and 1 patient as high functioning autism . the number of positive dsm - iv items ranged from 2 to 8 , with an average score of 3.8 . table 1 shows gender , age , and iq of asd and non - asd patients . the significant differences between the groups were ( a ) the younger age of the asd patients relative to the other patients groups ; ( b ) the younger age of the non - asd group referred to the atn relative to the goc patients ; and ( c ) the predominance of males in the atn - referred patients compared with the goc patients . table 1characteristics of participantsdiagnosisasd ( n = 15)no asd ( n = 21)general outpatient clinic ( n = 369)male / femalem = 12 , f = 3 m = 18 , f = 3 m = 180 , f = 189 average age ( range , sd)22 years ( 1824 , 5)27 years ( 1855 , 9)35 years ( 1473 , 11)mean iq ( sd)104 ( 10)105 ( 12)difference between goc group and non - asd group ( chi - square = 14.2 , df = 1 , p < 0.0001 ) ; difference between goc group and asd group ( chi - square = 5.8 , df = 1 , p < 0.05 ) ; no difference between asd group and non - asd groupgoc group differs from non - asd group ( p < 0.01 ) and from asd group ( p < 0.0001 ) ; no difference between asd group and non - asd group characteristics of participants difference between goc group and non - asd group ( chi - square = 14.2 , df = 1 , p < 0.0001 ) ; difference between goc group and asd group ( chi - square = 5.8 , df = 1 , p < 0.05 ) ; no difference between asd group and non - asd group goc group differs from non - asd group ( p < 0.01 ) and from asd group ( p < 0.0001 ) ; no difference between asd group and non - asd group table 2 shows aq - d sub - domain and total scores for the three groups . the one significant difference was on the sub - domain communication between the asd group and the general outpatient group . further , within the asd group , average aq - d scores varied with the severity of asd : high functioning autism : 31 ( n = 1 ) ; asperger s disorder : 24 ( n = 4 ) , and pddnos : 21 ( n = 10 ) . in light of the small sample sizes the latter differences were not tested for statistical significance . table 2mean scores aq - d ( sd ) and anova tests for differences in mean scoresasd ( n = 15)no asd ( n = 21)general outpatient clinic ( n = 369)social skill5.0 ( 2.8)4.2 ( 2.6)4.1 ( 2.6)attention switching5.1 ( 2.6)5.3 ( 2.4 ) 5.3 ( 2.3 ) attention to detail3.5 ( 2.3)4.4 ( 2.2)4.2 ( 2.3)communication*4.5 ( 2.1)3.5 ( 2.2)2.8 ( 1.8)imagination4.4 ( 2.4)4.3 ( 2.0)3.5 ( 1.9)total22.5 ( 8.4)21.8 ( 7.6)19.9 ( 7.0 ) * significant difference between asd group and goc group at p < 0.01 mean scores aq - d ( sd ) and anova tests for differences in mean scores * significant difference between asd group and goc group at p < 0.01 table 3 reports axis i diagnoses in asd and non - asd patients as assessed by the scan . with one exception , there were no differences in either axis i or axis ii diagnoses between the two groups . the one exception was that more patients were diagnosed with actual psychotic disorder nos in the non - asd group than in the asd group . when we aggregated separate categories into more broad diagnostic categories , i.e. , anxiety disorders , psychotic disorders , and mood disorders , there were no differences between the two groups in past - month or lifetime diagnoses either , except for actual psychotic disorders ( results not shown ) . table 3scan - derived actual ( past month ) dsm iv axis i diagnosesasd ( n = 15)n ( % ) no asd ( n = 21)n ( % ) no disorder7 ( 47)7 ( 33)mood disorder with psychotic symptoms2 ( 13)mood disorder without psychotic symptoms2 ( 13)3 ( 14)substance abuse 3 ( 20)2 ( 10)sleep disorders4 ( 27)6 ( 29)psychotic disorder nos4 ( 19)*schizophreniasocial phobia3 ( 20)4 ( 19)panic attacks / agoraphobia2 ( 13)1 ( 5)other anxiety disorders1 ( 7)obsessive compulsive disorders1 ( 7)1 ( 5)other disorders1 ( 7)2 ( 10 ) * significant difference between asd group and no asd group at p < 0.05 scan - derived actual ( past month ) dsm iv axis i diagnoses * significant difference between asd group and no asd group at p < 0.05 table 4 reports axis ii diagnoses as assessed by the ipde . also , when we tested whether asd and non - asd groups differed with regard to the total number of patients with any complete , partial , or either of these two , axis 2 disorders ( bottom two rows , table 4 ) , we found no difference between the two groups . table 4ipde derived axis ii diagnoses by asd statusasd ( n = 15)no asd ( n = 21)completen ( % ) partialn ( % ) completen ( % ) partialn ( % ) paranod1 ( 5)schizod 1 ( 7)2 ( 13)1 ( 5)1 ( 5)schizotypical1 ( 7)antisocial1 ( 7)borderline 1 ( 7)1 ( 5)avoidant 1 ( 7)1 ( 7)2 ( 10)obsessive compulsive3 ( 14)1 ( 5)personality disorder nos1 ( 7)2 ( 13)3 ( 14)1 ( 5)any personality disorder3 ( 20)6 ( 40)8 ( 38)3 ( 14)any personality disorder partial or complete7 ( 47)10 ( 48 ) ipde derived axis ii diagnoses by asd status thus far , publications about screening instruments for adult asd use the autism - spectrum quotient ( aq ; baron - cohen et al . , 2001 ) or the autism spectrum disorder in adults screening questionnaire ( asdasq ; nylander & gillberg , 2001 ) . with the help of the latter instrument , nylander & gillberg ( 2001 ) and chang et al . ( 2003 ) estimated a 1.4 and 0.6 % asd prevalence in a general psychiatry outpatient clinic for adults . the aq was investigated by baron - cohen in 2001 in asperger s disorder or high functioning autism patients and compared with several subgroups in the general population , and was tested again in 2005 at the national diagnostic clinic for asperger s disorder ( woodbury - smith , robinson , wheelwright , & baron - cohen , 2005 ) . the aq differentiated the asd patients adequately from healthy controls , and asd patients from non - asd patients . however , our results showed that the aq - d did not differentiate between an asd group ( predominantly pddnos ) and two non - asd patient groups . only for the communication domain , the asd patients had higher scores relative to the general outpatient group . it is of interest to mention here that this domain was also one of the two domains that differentiated parents of autistic patients from healthy controls ( bishop et al . , 2004 ) . the most probable explanation of this discrepant outcome is the fact that the dutch patients were less severely affected than the british patients . the asd patients but also the non - asd patients in the baron - cohen papers had higher total mean scores on the aq ( for asd : 35.8 and 35.6 and for non - asd : 26.2 ) than our patients ( asd : 22.5 , non - asd and general outpatients : 21.8 and 19.9 ) . by comparison , british , non - psychiatric , control groups typically have total scores of around 1617 ( baron - cohen et al . , 2001 ) . interestingly , the mean score on the recent japanese version of the aq was 29.4 in asd patients and 22.2 in non - psychiatric controls ( kurita , koyoma , & osada , 2005 ) . the japanese authors , like we , reasoned that part of the japanese patients may have been less severely affected relative to the british patients . they also argued that it is possible that autistic related behavior as assessed by the aq is more prevalent in the japanese population than in the british . in the absence of the actual diagnoses of the non - asd patients in both the british and one of the dutch samples , it remains difficult to pinpoint why scores between the british and dutch non - asd patients ( 26.2 and 21.8/19.9 , respectively ) differ . the absence of differences between scores of the aq - d in the present study suggests that there might be asd - like symptoms , as felt by the patients themselves , present in the non - asd patients in the atn - referred group and in the patients of the general outpatient clinic , and revealed by self - report . indeed , the individuals in the non - asd group were referred to the atn for the possible presence of an asd diagnosis , so asd - like symptoms must have been voiced by these patients even if these could not be diagnosed as such on the basis of the standardized diagnostic protocol . in sum , although there are still many open questions , for example about differences in scores cross - culturally , the present data suggest that self - report questionnaires are not adequate for differentiating less severe asd patients from other patient groups . another study is needed to investigate the merits of an alternative approach to this problem ; i.e. , a parents / caregivers questionnaire as a screening tool for adult asd . our second aim was to look into possible differences in comorbidity of axis i and axis ii dsm iv classifications in asd and non - asd groups . this because of the notion that mild asd symptoms often mix with symptoms of other disorders such as obsessive compulsive disorder or schizoid personality disorder . there is a scarcity of research on this topic . for example , ( comorbid ) diagnoses of the british patients were not reported in the paper of woodbury - smith et al . for the dutch , atn - referred group , however , we took a systematic approach to diagnosing dsm iv axis i and ii disorders . the results indicated that , except for psychotic disorder nos which was diagnosed in roughly 20% of the non - asd group and not in the asd group , there were no significant differences in the pattern of diagnoses between the asd and non - asd patients . possibly , the difference in psychotic disorder partly accounts for the referral to the atn and for the asd - like symptoms in these patients as discussed in the above paragraph . however , the general picture indicated by our data is that clinical accounts of a relatively high prevalence and/or a specific profile of comorbid disorders in the asd group relative to the non - asd group could not be confirmed . there are important limitations to this study , among which is the small number of patients in the atn - referred group . this major drawback precludes any definite conclusions . of note is further that the asd patients in this investigation belonged to the less - severe side of the spectrum . this makes it difficult to compare results with the investigations by baron - cohen and collegues . clinical experience indicates that asd patients , compared to non - asd patients , benefit more from treatment by structuring , long - term repetitive treatment , and adaptations of the environment . this may hold even more when comorbid conditions are present . since the prevalence of patients with less severe asd is relatively high compared to the more severe asd categories , efficient and valid screening of this group and charting possible the present study provided a modest contribution in improving our knowledge in this direction ; clearly , much more research is needed . | while knowledge about symptom presentation of adults with mild asd , including comorbid psychopathology , is limited , referral of adults with suspected mild pdd is increasing .
we report on pilot research investigating whether patients diagnosed with mild asd ( n = 15 ) and patients who were not diagnosed with asd ( n = 21 ) differed in terms of ( a ) aq scores and ( b ) axis i and ii disorders , assessed by the scan and the ipde . additionally , aq scores were compared with those from non - asd patients referred to a general outpatient clinic ( n = 369 ) .
the results showed very few differences between asd patients and non - asd patients .
self - report may not differentiate mild asd patients from non - asd patients and axis i and ii disorders seem equally prevalent among these two groups . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the classical philadelphia negative chronic myeloproliferative neoplasms ( mpns ) encompass mainly essential thrombocythemia ( et ) , polycythemia vera ( pv ) , and myelofibrosis 1 . these diseases are clonal , as evidenced by mutations such as the jak2v617 , mpl , and calr
25 . the clinical mpn - phenotype is often accompanied by an inflammation - mediated comorbidity burden 6,7 . this is most clearly demonstrated by the increased frequency of cardiovascular diseases , but also several other inflammatory diseases such as psoriasis , giant cell arteritis , and crohn 's disease 8,9 . it has also been shown , that some rheumatological diseases increase the risk of hematological as well as non - hematological cancers , and that the risk of having a coincident second malignancy increases when suffering from an mpn 810 . furthermore , patients with mpns exhibit biochemical evidence of low - grade chronic inflammation as evidenced by elevated levels of c - reactive protein 11 and elevated levels of circulating ykl-40 12,13 , which is considered a biomarker of chronic inflammation 14 . to this end , several inflammatory cytokines are elevated in patients with mpns , in particular in myelofibrosis 15,16 . most recently , it has been shown that the elevated levels of cytokines are secreted by both malignant mpn - cells as well as nonmalignant cells 17 and that both subsets are affected by jak inhibition . furthermore , transcriptional profiling studies have unravelled a massive deregulation of inflammation and immune genes 1822 - all supportive of the concept that disease progression in these neoplasms may at least partly be driven by chronic inflammation 6,7,16,23 and concomitant immune deregulation 1821,24 . consequently jak - inhibitors are being extensively tested within several other areas , including dermatology and rheumatology 2527 . the rationale in mpns is the constitutively activated jak - stat signaling pathway giving rise to clonal myeloproliferation with an enhanced proinflammatory cytokine profile , excessive formation of ros , immune deregulation , and ultimately marrow fibrosis 27,28,29 . the cytokine profile is normalized in mf - patients during treatment with the jak1 - 2 inhibitor ruxolitinib , and the clinical benefits for the majority of mf - patients are prompt with resolution of constitutional symptoms within days in concert with resolution of splenomegaly within months . the rapid improvement of constitutional symptoms is most likely attributed to normalization of the cytokine - profile 3035 . a jak1 - 3 inhibitor is approved for the treatment of rheumatoid arthritis ( ra ) and phase 3 studies are ongoing investigating the role of jak - inhibition in psoriasis . furthermore , a topical form of ruxolitinib is being tested in the treatment of psoriasis , emphasizing the role for jak - inhibitors in inflammatory and autoimmune diseases as well 25,27 . in addition , a role in infectious diseases has also been suggested , indicated by the observation that ruxolitinib and tofacitinib in vitro inhibits hiv-1 36 . they are rather promiscuous in nature and both have some activity with all the 3 different jak 's , their activities applying to both mutated and wild - type jak 's . this promiscuity explains the great potential in targeting several crucial points in mpn disease and inflammation - mediated comorbidities 37 . herein , we wish to report on 3 additional patients suffering from mpn and receiving ruxolitinib , who during therapy experienced rapid and profound resolution of their non - hematological comorbidities . a 76-year - old female suffering from pmf had received treatment with hydroxycarbamide for 3 years and was started on ruxolitinib due to constitutional symptoms ( unintended weight loss ) and progressive splenomegaly . prior to the pmf - diagnosis the patient had been treated with percutaneous coronary intervention due to a stenosis and also suffered from hypertension . seven years before the diagnosis of pmf the patient was diagnosed with pct and treated with phlebotomies . within 3 months of ruxolitinib therapy the patient experienced total resolution of the pct in concert with resolution of constitutional symptoms and subsequently experienced a weight gain ( intended ) . the allelic burden declined over 2 years of therapy from 40% to 21% at last follow - up , but the thrombocytopenia was worsened reaching 27 10/l as nadir at last follow - up but without any bleeding episodes . the detrimental effect on the platelets was accompanied by an increase in the hemoglobin and the patient remained transfusion - independent . a 73-year - old male suffering from pv had received treatment with interferon - alpha2a ( ifn ) and was started on a combination therapy with ifn and ruxolitinib based on signs of progressive disease with a persisting need of phlebotomies combined with thrombocytopenia , jak2 allelic burden reaching 96% , constitutional symptoms ( unintended weight loss ) and progressive splenomegaly . thus , the patient was likely in the transitional stage between pv and mf . prior to ruxolitinib the patient had experienced deep vein thrombosis and paroxysmal atrial flutter . two years prior to ruxolitinib therapy the patient had suffered from pmr and was treated in the rheumatological setting with steroids , which were associated with partial symptomatic improvement and a normalization of the sedimentation rate . accordingly , it was concluded that the pmr was treated successfully and that the remaining symptoms ( persisting morning stiffness and aches in the shoulder region ) were due to age and not inflammatory activity . however , on treatment with ruxolitinib , the patient experienced a marked clinical improvement with disappearance of constitutional symptoms and most remarkably also total resolution of age - related rheumatism the pmr - symptoms . furthermore , both the hemoglobin levels and platelet counts initially dropped and subsequently increased during combination therapy , which was well tolerated . a 61-year - old male suffering from post - pv - mf and intolerant to hydroxycarbamide and anagrelide was started on ruxolitinib due to progressive disease with constitutional symptoms and splenomegaly . the patient was also suffering from psoriasis and pa and was treated with sulfasalazine and methotrexate ( mtx ) , but without proper disease control . the patient also suffered from severe hypertension receiving 4 different drugs to obtain normal blood - pressure . when the patient was started on ruxolitinib , the psoriasis lesions disappeared and itching virtually resolved as well . the arthritis also totally vanished within 3 weeks , and the methotrexate was discontinued without subsequent relapse of the arthritis . the splenomegaly also totally resolved within 2 months and the jak2 allelic burden was reduced from the initial 25% to 5% within 7 months . the patient obtained a complete hematologic response within 2 months and the response was sustained at last follow - up after approximately 2 years of therapy . the patient stated that the therapy was the best that ever happened to him since he had also been able to start working again , which before ruxolitinib was impossible due to the severe constitutional symptoms , but also due to the severe psoriasis lesions in his hands which now had resolved . furthermore , the patient experienced reduction of his blood - pressure , even below normal range . consequently reduction and subsequent discontinuation of several of the anti - hypertensive drugs is ongoing with the hope of discontinuing them all . a 76-year - old female suffering from pmf had received treatment with hydroxycarbamide for 3 years and was started on ruxolitinib due to constitutional symptoms ( unintended weight loss ) and progressive splenomegaly . prior to the pmf - diagnosis the patient had been treated with percutaneous coronary intervention due to a stenosis and also suffered from hypertension . seven years before the diagnosis of pmf the patient was diagnosed with pct and treated with phlebotomies . within 3 months of ruxolitinib therapy the patient experienced total resolution of the pct in concert with resolution of constitutional symptoms and subsequently experienced a weight gain ( intended ) . the allelic burden declined over 2 years of therapy from 40% to 21% at last follow - up , but the thrombocytopenia was worsened reaching 27 10/l as nadir at last follow - up but without any bleeding episodes . the detrimental effect on the platelets was accompanied by an increase in the hemoglobin and the patient remained transfusion - independent . a 73-year - old male suffering from pv had received treatment with interferon - alpha2a ( ifn ) and was started on a combination therapy with ifn and ruxolitinib based on signs of progressive disease with a persisting need of phlebotomies combined with thrombocytopenia , jak2 allelic burden reaching 96% , constitutional symptoms ( unintended weight loss ) and progressive splenomegaly . thus , the patient was likely in the transitional stage between pv and mf . prior to ruxolitinib the patient had experienced deep vein thrombosis and paroxysmal atrial flutter . two years prior to ruxolitinib therapy the patient had suffered from pmr and was treated in the rheumatological setting with steroids , which were associated with partial symptomatic improvement and a normalization of the sedimentation rate . accordingly , it was concluded that the pmr was treated successfully and that the remaining symptoms ( persisting morning stiffness and aches in the shoulder region ) were due to age and not inflammatory activity . however , on treatment with ruxolitinib , the patient experienced a marked clinical improvement with disappearance of constitutional symptoms and most remarkably also total resolution of age - related rheumatism furthermore , both the hemoglobin levels and platelet counts initially dropped and subsequently increased during combination therapy , which was well tolerated . a 61-year - old male suffering from post - pv - mf and intolerant to hydroxycarbamide and anagrelide was started on ruxolitinib due to progressive disease with constitutional symptoms and splenomegaly . the patient was also suffering from psoriasis and pa and was treated with sulfasalazine and methotrexate ( mtx ) , but without proper disease control . the patient also suffered from severe hypertension receiving 4 different drugs to obtain normal blood - pressure . when the patient was started on ruxolitinib , the psoriasis lesions disappeared and itching virtually resolved as well . the arthritis also totally vanished within 3 weeks , and the methotrexate was discontinued without subsequent relapse of the arthritis . the splenomegaly also totally resolved within 2 months and the jak2 allelic burden was reduced from the initial 25% to 5% within 7 months . the patient obtained a complete hematologic response within 2 months and the response was sustained at last follow - up after approximately 2 years of therapy . the patient stated that the therapy was the best that ever happened to him since he had also been able to start working again , which before ruxolitinib was impossible due to the severe constitutional symptoms , but also due to the severe psoriasis lesions in his hands which now had resolved . furthermore , the patient experienced reduction of his blood - pressure , even below normal range . consequently reduction and subsequent discontinuation of several of the anti - hypertensive drugs is ongoing with the hope of discontinuing them all . the highly impressive impact of ruxolitinib therapy on associated comorbidities in our patients reflects that jak1 - 2 inhibition not only dampens the strict mpn - associated state with resolution of splenomegaly and constitutional symptoms but also in general has a huge impact upon mpn - associated inflammation - driven diseases as well . thus , the common denominator for these diseases chronic systemic inflammation and immune deregulation is also being addressed by ruxolitinib therapy . importantly , the successful outcome of ruxolitinib treatment in our patient with psoriasis also emphasizes that ruxolitinib may actually improve the performance status substantially and to a degree enabling the patient to start working again . recently , this particular issue the socioeconomic consequences for mpn - patients on ruxolitinib treatment has been described 6 . furthermore , the proposed improved survival in patients with myelofibrosis treated with ruxolitinib may likely be explained by improvement in inflammation - mediated comorbidities , which should also be carefully considered and addressed in future studies 6,31,33,35 . the pct case also illustrates the association ( and in this case detrimental synergistic effect ) between the inflammatory dermatological disorder and the mpn , accounting for increased cell counts and accordingly cell - turnover , thus challenging heme - metabolism beyond its natural boundaries . this happens in a patient already being stressed by an overwhelming immune - reaction towards photo - toxic metabolites accumulated over time due to insufficiency to metabolize heme within the normal range . in this setting , ruxolitinib addresses both the myeloproliferation , thereby reducing the amount of heme that has to be metabolized and also targets the inflammatory reaction towards the remaining photo - toxic heme - metabolites . firstly , an important advantage of the anti - inflammatory potential of ruxolitinib is discontinuation or reduction in the use of disease modifying anti - rheumatic drugs ( dmard 's ) , steroids and other medication prescribed for the nonmalignant inflammatory disease(s ) accompanying mf . this is of major importance to the mf - patients since they are often thrombocytopenic and can not handle further declines in platelet counts due to methotrexate treatment which is associated with many side - effects , including thrombocytopenia . secondly , the ruxolitinib treatment is superior in regard to disease control in this patient , highlighting a possible role as 2nd line therapy in mtx - nonresponders 41 . thirdly , a possible link between cardiovascular diseases and mpn exemplified by hypertension is demonstrated and apparently addressed by ruxolitinib therapy . firstly the initial decline in platelet counts can be reversible during combination therapy even in a thrombocytopenic patient receiving 2 drugs both having myelosuppressive potential . the subsequent increase in platelets is probably due to the reduced pooling and sequestration of platelets in the enlarged spleen 42 , which resolves during ruxolitinib therapy . secondly this case also substantiates the observation that combination therapy with ruxolitinib and ifn is feasible despite the theoretical concerns regarding safety and efficacy with combined therapy 43 . in conclusion , this report highlights the ability of ruxolitinib to improve the clinical course of mf - patients by alleviating their burden of comorbidities and also serves to illustrate the association between mpns and inflammatory / autoimmune diseases . further studies are urgently needed to substantiate our observations on several inflammation - driven diseases being efficaciously addressed by a single agent . novartis had no knowledge regarding this article and consequently had no influence on the manuscript . | key clinical messagethe inflammation - mediated comorbidities in myelofibrosis ( mf ) and related neoplasms ( mpns ) likely reflect the concurrent immune deregulation and systemic inflammatory nature of the mpns , emphasizing the link between chronic systemic inflammation , immune deregulation , and the malignant clone .
jak1 - 2 inhibitors in mf - patients reduce constitutional symptoms and splenomegaly , but also taget autoimmune and inflammation - mediated comorbidities . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prostate cancer ( pca ) is the third most common male malignancy in poland with respect to incidence and mortality . taking into account the increasing health awareness in the population , the common availability of diagnostic tests for prostatic diseases , among others prostate specific antigen ( psa ) , during the so - called psa era has increased the percentage of diagnosing prostatic cancer still confined to the gland ( < t3 ) in recent years . in this connection the percentage of patients subjected to radical treatment increases . the choice of the method of management made by the patient depends not only on the oncologic efficacy , but also on the intensity of adverse effects and expected quality of life ( ql ) . the patient in cooperation with the doctor , before making the decision about the choice of treatment method , should consider the pros and cons concerning a given therapeutic option , both in the oncologic aspect and in the sphere of the ql . the physical , mental , and social status of a man and his ql play a significant role during the assessment of treatment satisfaction . the aim of this study was to determine the continent rate after rp and to analyze the factors that could play role in this subject . between march 2007 and december 2008 , nine experienced surgeons performed 132 radical prostatectomies for prostate cancer . the median age of patients was 62 years ( range 52 - 69 ) , the median of preoperative psa level was 4.2 ng / ml ( range 2.0 18 ng/ ml ) . the median duration of rp was two hours ( range 1.15 4 ) . the mean time to remove the catheter after rp was seven days ( range 6 - 45 ) . most patients ( 73% ) had the catheter removed within nine days after the rp . the prolonged duration of keeping the catheter in the bladder was associated with abnormal cystographic results ( incomplete anastomosis ) . in one case , pathological characteristics cancer staging was performed in accordance with 1997 american joint committee on cancer recommendations . diagnosis of pt3 and pt2 were present in 15 and 87 patients respectively , and no patients with pt4 were present . adjuvant hypofractionated conformal radiotherapy ( 3d - crt ) was applied from external fields to a total dose 54.6 gy in 2.6 gy fractions . the rt was started on average after three months following the rp procedure due to confirmed positive surgical margins and/or pt3 stage . arterial hypertension , under medical control , was the most common coexisting condition and was observed in 40% of the patients . all subjects underwent open anatomical radical retropubic prostatectomy , the technique that was described previously . the nerve sparing technique was not performed and one of the surgeons used magnifying glasses . two to four weeks before the planned rp , a routine informational meeting with an experienced nurse and the patient took place and it concerned the hospital stay and the planned surgery as well as its possible adverse effects and methods of their management . the patient was discharged home on the day after cystography visualizing the correct cystourethral anastomosis . not earlier than three months after the rp , a questionnaire , which assessed the condition before and after rp ( appendix 1 ) , was developed by the authors and sent to all patients operated on . it included a part concerning health status information question 1 , function in urinary domain questions 2 - 5 , rate of returning to normal activity level from before rp question 6 , and satisfaction from the treatment question 7 . the authors assigned the results of the questionnaire to three groups : full urinary continence , medium ( slight ) degree urinary incontinence , and significant urinary incontinence according to the key provided in table 2 . statistical analysis standard methods for descriptive statistics : frequency and cross tabulations and chi-2 test for rate comparisons were used . out of 132 patients to whom the questionnaire was sent , answers were obtained from 102 subjects ( 77.2% ) who were then subjected to analysis . the time elapsing from rp to filling - in of the questionnaire was three to six months in 13 patients , seven to twelve months in 50 patients , and over thirteen months in 39 cases . before rp , urinary incontinence of significant and medium degrees was present in three ( 2.9% ) and eight ( 7.8% ) patients , respectively . after rp , 35 ( 34.3% ) patients reported total urinary continence . in 12b(11.8% ) patients , significant urinary incontinence developed . in the remaining 55 ( 53.9% ) patients , urinary incontinence of medium degree was present . the most common situation when urine dripping took place was associated with abdominal muscle pressure and it occurred in 55 out of 67 patients with any degree of urinary incontinence . the forth question of the questionnaire : generally speaking , how urine dribbling disturbs your everyday life ? was answered by 44% of the patients that the ql was very good ( fig . no statistically significant effect of the adjuvant radiotherapy after rp was found on urinary continence ( p > 0.79 ) ( table 3 ) . no effect of the surgeon performing the rp was found on urinary incontinence after the procedure ( p > 0.803 ) . in 52% of the patients , the return to normal activity ( e.g. return to work , family life , or household activities ) occurred after a time period longer than four weeks following rp , in 36% after 2 - 4 weeks , and in 12% after less than two weeks . effect of the adjuvant radiotherapy after radical prostatectomy on urinary continence the answer to the question about possibly choosing the same method again for pca treatment revealed that 18 ( 15% ) patients would have not chosen the same method , looking for an alternative therapy , even at the expense of a higher risk of oncologic inefficacy , while the remaining 85% of subjects would have chosen the same method of treatment . among various methods of radical treatment of organ confined pca , radical prostatectomy is a recognized and effective way of treatment . this operation could be associated with urinary incontinence , leading to significant physical and psychological distress for patients with prostate cancer [ 5 , 6 ] . after walsh et al . carefully described the anatomy of the male pelvis , radical prostatectomy could be performed with a lower risk of urinary impairment . reported rates of incontinence following radical prostatectomy in the contemporary literature are 2.5% to 87% . factors likely accounting for this broad range of continence rates include : patient selection , the surgeon 's experience , technique and methodology of assessing continence , and the definition of continence . it is well accepted that two anatomical structures are independently involved , including the distal or external sphincter complex surrounding the membranous urethra and the proximal or internal sphincter located at the bladder neck . recently presented a survey indicating that pretreatment incontinence was reported by less than 5% of similar patients . the percentage was also similar , being 2.9% and 7.8% for urinary incontinence of significant and medium degrees , respectively . the effectiveness of the assessment of radical prostatectomy results based on patient self - reported questionnaires seems to be more reliable than an interview or data collection by phone . calais da silva and fossa et al . confirmed that patient assessment of the side effects of pca treatment and ql impact are generally more accurate than physician evaluation [ 13 , 14 ] . therefore , the use of validated self - reporting questionnaires is the optimal method for evaluating continence following radical prostatectomy . these questionnaires should capture various outcomes , such as incontinence frequency , pad requirements , and problems due to incontinence . continence rates ultimately depend on how these responses are interpreted . in order to assess urinary continence after rp the authors developed their own questionnaire . it consisted of questions about urinary continence before and after rp and a subjective assessment of the effect of rp on the patient 's life ( appendix 1 ) . in order to facilitate the interpretation of the results , the authors , based on the answers in the questionnaire , assigned one of three combined results : total urinary continence , urinary incontinence of medium degree , urinary incontinence of significant degree , according to the key included in table 1 . the questionnaire built in this way enabled obtaining simultaneous answers concerning time periods before and after rp . the authors understood the drawback of a retrospective assessment , but , in the authors opinion , this properly developed questionnaire made obtaining reliable results possible . some authors have used the number of incontinence pads ( pampers ) , large or small , used by the patients for the assessment of urinary continence . believe that patients who report using one pad daily often do so for security purposes rather than significant urinary incontinence . in their study , none of the men using one pad daily had frequent dribbling or a total lack of urinary control . more importantly , 83% of men using one pad daily had no problem or only a small one with urinary function . the use of a single pad daily describes a range of individuals from those who simply use a liner for reassurance to those who use a single absorbent garment to absorb several ounces of urine . the use of pads is also influenced by the surgeon 's efforts to discourage their use . have found that the majority of men who wore a single pad considered themselves continent , suggesting that most were wearing the pad for reassurance . in their study , three months following rp 80% of men who wore a single pad considered themselves continent . by 24 months 100% of men who wore a single pad considered themselves continent . the authors had no experience in the assessment of urinary incontinence based on other criteria , including pad test or urodynamic examinations , therefore they limited the evaluation to the self - assessment questionnaire , accepting it as the most reliable tool for real assessment of urinary continence . many technical modifications have been proposed for improving incontinence rates after prostatectomy by preserving or reconstructing sphincters . the anatomical dissection of the apical region of the prostate described by myers as well as walsh allows the preservation of the striated and smooth muscle components of the external sphincter complex [ 18 , 19 ] . some have suggested a more limited distal apical dissection with preservation of the puboprostatic ligaments to spare the external sphincter . others have attempted to preserve the external sphincter by meticulous dissection of the urethra and preserving functional urethra length by performing an individualized apical preparation strictly along anatomic landmarks . still others have proposed a tubularized bladder neck reconstruction , maintaining that continence is related to the length of the urethra . malizia et al . reported that the internal and external sphincters can be spared during radical prostatectomy without compromising cancer control and recommended that the bladder neck be preserved to improve urinary continence . the authors performed radical prostatectomy according to the technique described by walsh . no nerve sparing technique was applied . one of the surgeons used magnifying glasses during rp but , in view of a too small number of patients , the analysis of the effect of such management on urinary incontinence after rp was not possible . many authors report , that the recovery of complete urinary continence is time - dependent [ 25 , 26 ] . found a linear relationship ( decrease in consecutive measurements after three , six and twelve months ) between the value of the sum of items in the ici - q questionnaire that suggested a significant improvement in the assessment of urinary continence in consecutive measurements ( p < 0.001 ) . the percentage of men who are completely continent at three months in the literature is 47% to 81% . most patients ( 87% ) in the present study answered the questions in the questionnaire after more than six months following the rp . the authors believe that in that situation , a single assessment of urinary continence is a reliable method of evaluation of the influence of rp on urinary continence functions , and in an overwhelming majority of cases it will not be worse . in a smaller patient self - reported survey of radical prostatectomy at one hospital , moul et al . noted that operation time , blood loss , pretreatment psa , and tumor volume did not predict incontinence . in the present study the mean duration of rp ( including bilateral obturatory lymphadenectomy ) was two hours . in the authors ward over the past 10 years 810 of rp procedures the 102 operations analyzed were performed by experienced surgeons ( the number of rps performed by a given surgeon ranged from 20 to 100 ) . the authors found an absence of effect of rp duration on urinary incontinence in the analysis . in the present study , in 35 ( 34.3% ) patients total urinary continence was present after rp what meant that those patients reported no signs of urinary incontinence ( were never drip urine ! ) . in 55(54% ) patients a medium - degree urinary incontinence was present and meant that situations occurred when the patients reported a slight urinary incontinence ( question : how frequently do you drip urine ? answer : two or three times weekly or about once daily ; question : what amount of urine do you usually drip ? significant - degree urinary incontinence occurred in 12 ( 11.8% ) patients that condition was described if the patient answered even only one of the questions : how frequently do you drip urine ? answer : several times a day or all the time , or the question : what amount of urine do you usually drip ? answer : i drip urine all the time . in a population - based longitudinal cohort follow - up study up to 24 months , stanford at al . reported the proportion of men reporting total urinary control increased after surgery from 20.5% at 6 months to 31.9% by 24 months . overall , 40.2% of the patients reported occasional urinary leaking , 6.8% frequent urinary leaking , and 1.6% no urinary control 24 months after the diagnosis . analyzed 1,013 questionnaires of patients who had undergone radical prostatectomy and showed that incontinence was present in 65.6% ( any urinary leakage that warranted protection ) and had significant impact on the ql ( 818 patients evaluated ) . thirty two percent of the patients reported to wear pads or clamps to control dripping urine . sixty one percent of patients stated that they had no problem with incontinence , but 39% regarded incontinence as a problem . in the present study the significant percentage of major urinary incontinence is most probably associated with the absence of routinely performed nerve sparing technique . in spite of that , the obtained results of total urinary continence or medium urinary incontinence reaching 88.3% are comparable with the results available in the literature . of interest is the fact that in most patients no significant influence was found of urine dripping on everyday life . an evident majority of patients ( 85% ) , knowing in contrast , walsh et al . presented in their paper the results showing that 93% of the patients who underwent rp were wearing no pads at 1 year , and 98% stated that they had no significant urinary problem . attention should be paid , however , to the vast experience of the above - mentioned center in performing rps . in the present study the fact is interesting that in five patients ( 4.9% ) no malignant cells were found in the specimen material . found an incidence of no residual cancer on prostatectomy of 0.67% after ten - core positive biopsy . the increasing proportion of pt0 is connected with the so - called psa era which caused an increasing proportion of detection of minimal cancer ( lower stage disease ) . a significant percentage of the 102 analyzed patients had their diagnosis made based on trucut done beyond the hospital of the authors . a repeated examination of the trucut specimens revealed erroneous diagnosis in two cases . after the above - mentioned analysis the authors changed the schema of qualification procedure for rp at present an examination of trucut van cangh et al . in their prospective randomized study , where they evaluated 60 gy external radiation therapy administered between 3 and 4 months after radical prostatectomy for pathologically locally advanced prostate cancer , have found that the adjuvant radiotherapy had no significant influence on urinary continence . hofmann et al . in their non - randomized study reported that moderate dose of adjuvant rt ( median dose 54 gy ) after rp had a temporary effect on subjective urinary continence at four months but not at eight and twelve months . similarly , the authors of the present study found in their observation that no statistically significant effect of the adjuvant radiotherapy was found on urinary continence . it is possible that nonparticipants experienced different levels of urinary incontinence than were reported by the participants . the conduction of a retrospective analysis renders a precise assessment of the initial condition impossible . the assessment of urinary continence based on answer to one questionnaire does not allow follow - up of the effect of time after rp on urinary continence . we believe that the assessment of rp results in the aspect of incontinence rate , incontinence frequency , and patient global selfassessment makes possible a reliable presentation of the therapeutic option , i.e. rp for prostatic cancer confined to the organ . we observed a 88.2% rate of significant ( total and moderate degree ) urinary continence after this operation . the adjuvant radiotherapy and surgeons who performed rp did not affect the rate of incontinence . in order to obtain more detailed data it is recommended to conduct further studies on this topic . i have :
diabetes mellitushypertensionischemic heart disease ( coronary artery disease)discopathyneurological diseases ( e.g. parkinson 's disease)none of the above mentioned disease
how often do you drip urine ? ( please choose one answer )
neverabout once weekly or less frequentlytwo or three times a weekabout once dailyseveral times a dayall the time
what amount of urine do you usually drip ( independently of precautions , used or not)?not at allsmall amountmedium amountlarge amountgenerally speaking , how the urine dripping disturbs your everyday life ? please make a circle around a number from 0 ( not at all ) to 10 ( to a very high degree)0 1 2 3 4 5 6 7 8 9 10not at all to a very high degreewhen do you drip urine ? ( please mark all the possibilities concerning your situation )
never i do not drip urinei drip urine before i get to the toileti drip urine when i cough or sneezei drip urine during sleepi drip urine during physical activity / exercisei drip urine after miction terminationi drip urine without any evident causei drip urine all the time
please tell after how long time period following discharge from hospital have you returned to activity ( e.g. return to work , duties )
within two weeksfrom two to four weekstime period longer than four weeks
if i could choose again the method of prostatic cancer treatment :
i would choose the same surgical procedurei would choose a less mutilating treatment with the possibility of retaining greater fitness , however with the risk of ineffective oncologic treatment
i have :
diabetes mellitushypertensionischemic heart disease ( coronary artery disease)discopathyneurological diseases ( e.g. parkinson 's disease)none of the above mentioned disease
ischemic heart disease ( coronary artery disease ) neurological diseases ( e.g. parkinson 's disease ) none of the above mentioned disease how often do you drip urine ? ( please choose one answer )
neverabout once weekly or less frequentlytwo or three times a weekabout once dailyseveral times a dayall the time
about once weekly or less frequently two or three times a week what amount of urine do you usually drip ( independently of precautions , used or not ) ? generally speaking , how the urine dripping disturbs your everyday life ? please make a circle around a number from 0 ( not at all ) to 10 ( to a very high degree ) 0 1 2 3 4 5 6 7 8 9 10 not at all to a very high degree when do you drip urine ? i do not drip urinei drip urine before i get to the toileti drip urine when i cough or sneezei drip urine during sleepi drip urine during physical activity / exercisei drip urine after miction terminationi drip urine without any evident causei drip urine all the time
never i do not drip urine i drip urine before i get to the toilet i drip urine when i cough or sneeze i drip urine during sleep i drip urine during physical activity / exercise i drip urine after miction termination i drip urine without any evident cause i drip urine all the time please tell after how long time period following discharge from hospital have you returned to activity ( e.g. return to work , duties )
within two weeksfrom two to four weekstime period longer than four weeks
from two to four weeks time period longer than four weeks if i could choose again the method of prostatic cancer treatment :
i would choose the same surgical procedurei would choose a less mutilating treatment with the possibility of retaining greater fitness , however with the risk of ineffective oncologic treatment
i would choose the same surgical procedure i would choose a less mutilating treatment with the possibility of retaining greater fitness , however with the risk of ineffective oncologic treatment | radical prostatectomy ( rp ) is a recognized treatment method of organ - confined prostate cancer . among post - surgery complications ,
urinary incontinence is a major one .
the aim of this study was to determine the incontinence rate after rp and to analyze factors that might affect it . between march 2007 and december 2008 ,
132 rp 's were performed at warsaw cancer center . a questionnaire to assess the condition before and after rp was developed by the authors and sent to all treated patients .
the questionnaire focused on health status information , function in urinary domain , rate of returning to normal activity level as before rp and satisfaction from the treatment .
the median age of patients was 62 years . out of 132 patients 102 subjects ( 77.2% ) responded to the questionnaire .
of all responders , 35 patients ( 34.3% ) reported total urinary continence after rp .
after rp 35(34.3% ) patients reported total urinary continence and in 55(53.9% ) patients urinary incontinence of medium degree was present .
in 12 ( 11.8% ) patients significant urinary incontinence developed .
the most common cause of urine dripping ( 82% of patients with any degree of urinary incontinence ) was associated with abdominal muscle pressure .
no statistically significant association between urinary incontinence and adjuvant radiotherapy after rp or the surgeon performing the rp was found ( > 0.79 , > 0.803 ) .
radical prostatectomy carries a certain risk of complications .
we observed an 88.2% rate of significant ( total and moderate degree ) urinary continence .
the adjuvant radiotherapy and surgeons , who performed the rp , did not affect the rate of incontinence . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
several factors contribute to the heightened recent interest in understanding the role of home health care in the continuum of services for medicare beneficiaries . first , medicare home health agencies ( hhas ) command growing importance in the medicare budget , almost doubling expenditures from $ 1.6 billion in fiscal year ( fy ) 1983 to $ 3.2 billion in fy 1989 ( approximately 6 percent of the total expenditures ) and almost doubling again in the next 2 years to $ 5.7 billion in fy 1991 ( letsch et al . , 1992 ) . second , the increasing numbers of the very old among the medicare beneficiaries are expected to contribute to more demand beyond the 2.2 million hha clients in 1991 ( prospective payment assessment commission , 1993 ) . third , the number of medicare - certified providers also has been growing steadily over the past several years , increasing 43 percent from 1983 to 1989 to 6,100 hhas ( u. s. general accounting office , 1989 ) and leveling off at 6,000 in 1991 . this growth in the number of providers is expected to continue as hospitals continue to enter this market and as recent legal and administrative changes increase the medicare services available to medicare beneficiaries . last , the incentives of medicare 's hospital prospective payment system ( pps ) have also contributed to increased use ; shortened stays and more care needs at discharge have contributed to greater home care demand post - discharge ( noether , 1988 ) . all these factors have increased concerns about the growing expense of home care and , hence , interest in promoting its efficiency . pps and capitation systems are viewed as complimentary ways to redirect incentives from the current cost - based system , with its traditional inflationary incentives , to more cost - conscious behavior among the providers . an initial step towards promoting efficiency , either by pps , a capitated managed care system , or any other policy redirection , is to document systematically the characteristics of current hha clients , the actual services they receive , the charges for these services , and more importantly any significant associations between client characteristics and types , amount , and charges for services received . a prior analysis of the present data examined the concordance between planned and approved visits during the first 60 days of home care ( branch , goldberg , and cheh , 1991 ) . the data for this analysis were obtained in 1987 from a sample of the medicare - certified hhas that the health care financing administration ( hcfa ) had recruited in 1985 to participate in an hha prospective payment demonstration that was not implemented at that time . these agencies had been recruited within 10 states ( california , connecticut , florida , illinois , massachusetts , ohio , pennsylvania , tennessee , texas , and wisconsin ) from the universe of known hhas in those states that met three inclusion criteria ( urban location , non - government operated , and established before january 1 , 1983 ) . a total of 235 agencies met the criteria and were approached ; 127 expressed initial interest in participating in this data collection effort ; and of these , 86 agencies actually submitted data . each agency submitted copies of hcfa forms-485 and 486 ( figures 1 and 2 ) for a sample of clients who began an episode of care in 1986 and submitted copies of the agency 's medicare cost reports for 1986 . from each of the participating agencies , a systematic sample of clients was selected , designed to yield approximately 80 to 200 medicare hha clients per agency who were admitted for a new episode of care during calendar year 1986 . of those clients for whom data were received , only those who had verified medicare claim numbers ending in 0 , 4 , 5 , or 8 ( and , therefore , whose complete hha billing information would be available on the hcfa bureau of data management and strategy [ bdms ] hha 40-percent bill skeleton file ) and for whom data on allowed visits were actually received were considered conditionally eligible for this analysis ( unweighted n = 3,614 clients ) . the sampling fraction for each hha varied ; consequently , the individual responses were weighted by the inverse of the sampling fraction . the sample sizes indicated in the tables are the number of respondents ; the percents are based on the weighted data . for each client admitted to hha care , hcfa forms-485 and 486 are completed to establish medical necessity for home health care and to document treatment plans and other aspects of the case . hcfa forms-485 and 486 also include a certification from and to date . however , because of inconsistencies in agency practice , the from date on hcfa form-485 was found not necessarily to be the starting date of a new episode for every client . therefore , for this analysis , the conceptual definition of a new episode was that the client had not been receiving hha services for the preceding 60 days . the operational definition of the start of a new episode relied on the hha 40-percent bill skeleton file in the following way . date on hcfa form-485 , each patient 's billing record was examined retrospectively to identify a 60-day interval with no home health services . the day after this 60-day billing gap was designated as the episode start date for this analysis . for nearly three - fourths of the conditionally eligible clients ( 72 percent ; unweighted n = 2,615 clients ) , the episode start date thus defined was identical to the from date on hcfa form-485 ; and for another 7 percent ( unweighted n = 258 ) , the episode start date was within 5 days of the from date on hcfa form-485 . these 2,873 clients comprise the analytic group for this analysis , and their data were appropriately weighted . the end of an episode was defined as the last day of home health care following the start date that preceded another 60-day gap in the hha 40-percent bill skeleton file . treatment plans for every 60-day period following the initial end date on hcfa form-485 are recorded on a series of hcfa forms-486 for each client . the hha 40-percent bill skeleton file included all claims processed through september 1987 , which is 9 months after the start date of the last possible new episode during the study window of calendar year 1986 . however , previous experience has shown that a 6-month lag in the processing of home health claims can exist , which could cause some distortions in exceedingly long episodes and some of the episodes that began in late 1986 . table 1 presents the weighted distribution of episode lengths of stay according to this definition . more than 40 percent of the medicare hha clients completed their home care within 30 days ( 41.2 percent ) , and another one - third completed their episodes within 30 - 60 days ( 30.9 percent ) . only about 5 percent of the clients had episodes lasting 6 months or longer . although there were a few exceptions , the information provided on hcfa forms-485 and 486 is without missing data in nearly all fields . as figure 1 indicates , the variable living arrangement it was not possible to categorize household composition on 46 percent of the cases , either because their episode was short and they did not have a hcfa form-486 or because nothing the variable admission source had missing data in 1 percent of the records . for three variables ( morbidity restrictions , medications , and factual limitations ) , the category none was inferred from the absence of a response ; because 3.6 percent , 5.2 percent and 1.3 percent , respectively , of these variables was judged consistent with expected prevalence rates , any problem resulting from missing data is assumed to be negligible , with the exception of living arrangement . hcfa form-485 provided sex and age ( categorized as under 65 years of age , 65 - 74 years , 75 - 84 years , and 85 years of age or over in this analysis information ) . for the 54 percent with information on usual living arrangement , the categories were admission source had four categories : from a hospital ( medical ) , from a hospital ( surgical ) , from a nursing home , or mobility restrictions were categorized based on responses to the hcfa form-485 item indicating activities permitted ; the four categories developed for this analysis were complete bed - rest , wheelchair - bound , required cane or crutch or walker , or has none of the previous three restrictions . information from hcfa form-485 on number of medications was categorized in this analysis as none , to 1 to 3 current medications , nutritional status was obtained from the hcfa form-485 notation of physician 's orders for special diets , and each individual was categorized as needing a low sodium diet , another special diet , or no special diet . functional limitations in each of the following 11 areas were available from hcfa form-485 : endurance , ambulation , respiration , vision , hearing , mental , bowel or bladder , speech , paralysis , contracture , or amputation . the principal international classification of diseases , 9th revision , clinical modification ( icd-9-cm ) ( public health service and health care financing administration , 1980 ) diagnosis was reported on hcfa form-485 , and the 16 most common diagnoses are included in this analysis . the most common diagnosis was malignant neoplasms ( 11.5 percent of the clients ) , and the 16th most common diagnosis was chronic skin ulcers ( 2.5 percent of the clients ) . the dependent variables were allowed visits and allowed charges , both in total and by type of service for the whole episode of care . type of services included skilled nursing , home health aides , physical therapy , occupational therapy , speech therapy , medical social work , and other . rates of service use were calculated both for the total sample and for the subset who received the specific type of service . the data for this analysis were obtained in 1987 from a sample of the medicare - certified hhas that the health care financing administration ( hcfa ) had recruited in 1985 to participate in an hha prospective payment demonstration that was not implemented at that time . these agencies had been recruited within 10 states ( california , connecticut , florida , illinois , massachusetts , ohio , pennsylvania , tennessee , texas , and wisconsin ) from the universe of known hhas in those states that met three inclusion criteria ( urban location , non - government operated , and established before january 1 , 1983 ) . a total of 235 agencies met the criteria and were approached ; 127 expressed initial interest in participating in this data collection effort ; and of these , 86 agencies actually submitted data . each agency submitted copies of hcfa forms-485 and 486 ( figures 1 and 2 ) for a sample of clients who began an episode of care in 1986 and submitted copies of the agency 's medicare cost reports for 1986 . from each of the participating agencies , a systematic sample of clients was selected , designed to yield approximately 80 to 200 medicare hha clients per agency who were admitted for a new episode of care during calendar year 1986 . of those clients for whom data were received , only those who had verified medicare claim numbers ending in 0 , 4 , 5 , or 8 ( and , therefore , whose complete hha billing information would be available on the hcfa bureau of data management and strategy [ bdms ] hha 40-percent bill skeleton file ) and for whom data on allowed visits were actually received were considered conditionally eligible for this analysis ( unweighted n = 3,614 clients ) . the sampling fraction for each hha varied ; consequently , the individual responses were weighted by the inverse of the sampling fraction . the sample sizes indicated in the tables are the number of respondents ; the percents are based on the weighted data . for each client admitted to hha care , hcfa forms-485 and 486 are completed to establish medical necessity for home health care and to document treatment plans and other aspects of the case . hcfa forms-485 and 486 also include a certification from and to date . however , because of inconsistencies in agency practice , the from date on hcfa form-485 was found not necessarily to be the starting date of a new episode for every client . therefore , for this analysis , the conceptual definition of a new episode was that the client had not been receiving hha services for the preceding 60 days . the operational definition of the start of a new episode relied on the hha 40-percent bill skeleton file in the following way . date on hcfa form-485 , each patient 's billing record was examined retrospectively to identify a 60-day interval with no home health services . the day after this 60-day billing gap was designated as the episode start date for this analysis . for nearly three - fourths of the conditionally eligible clients ( 72 percent ; unweighted n = 2,615 clients ) , the episode start date thus defined was identical to the from date on hcfa form-485 ; and for another 7 percent ( unweighted n = 258 ) , the episode start date was within 5 days of the from date on hcfa form-485 . these 2,873 clients comprise the analytic group for this analysis , and their data were appropriately weighted . the end of an episode was defined as the last day of home health care following the start date that preceded another 60-day gap in the hha 40-percent bill skeleton file . treatment plans for every 60-day period following the initial end date on hcfa form-485 are recorded on a series of hcfa forms-486 for each client . the hha 40-percent bill skeleton file included all claims processed through september 1987 , which is 9 months after the start date of the last possible new episode during the study window of calendar year 1986 . however , previous experience has shown that a 6-month lag in the processing of home health claims can exist , which could cause some distortions in exceedingly long episodes and some of the episodes that began in late 1986 . table 1 presents the weighted distribution of episode lengths of stay according to this definition . more than 40 percent of the medicare hha clients completed their home care within 30 days ( 41.2 percent ) , and another one - third completed their episodes within 30 - 60 days ( 30.9 percent ) . although there were a few exceptions , the information provided on hcfa forms-485 and 486 is without missing data in nearly all fields . as figure 1 indicates , the variable living arrangement it was not possible to categorize household composition on 46 percent of the cases , either because their episode was short and they did not have a hcfa form-486 or because nothing the variable admission source had missing data in 1 percent of the records . for three variables ( morbidity restrictions , medications , and factual limitations ) , the category none was inferred from the absence of a response ; because 3.6 percent , 5.2 percent and 1.3 percent , respectively , of these variables was judged consistent with expected prevalence rates , any problem resulting from missing data is assumed to be negligible , with the exception of living arrangement . hcfa form-485 provided sex and age ( categorized as under 65 years of age , 65 - 74 years , 75 - 84 years , and 85 years of age or over in this analysis information ) . for the 54 percent with information on usual living arrangement , the categories were admission source had four categories : from a hospital ( medical ) , from a hospital ( surgical ) , from a nursing home , or unknown . mobility restrictions were categorized based on responses to the hcfa form-485 item indicating activities permitted ; the four categories developed for this analysis were complete bed - rest , wheelchair - bound , required cane or crutch or walker , or has none of the previous three restrictions . information from hcfa form-485 on number of medications was categorized in this analysis as none , to 1 to 3 current medications , nutritional status was obtained from the hcfa form-485 notation of physician 's orders for special diets , and each individual was categorized as needing a low sodium diet , another special diet , or no special diet . functional limitations in each of the following 11 areas were available from hcfa form-485 : endurance , ambulation , respiration , vision , hearing , mental , bowel or bladder , speech , paralysis , contracture , or amputation . the principal international classification of diseases , 9th revision , clinical modification ( icd-9-cm ) ( public health service and health care financing administration , 1980 ) diagnosis was reported on hcfa form-485 , and the 16 most common diagnoses are included in this analysis . the most common diagnosis was malignant neoplasms ( 11.5 percent of the clients ) , and the 16th most common diagnosis was chronic skin ulcers ( 2.5 percent of the clients ) . the dependent variables were allowed visits and allowed charges , both in total and by type of service for the whole episode of care . type of services included skilled nursing , home health aides , physical therapy , occupational therapy , speech therapy , medical social work , and other . rates of service use were calculated both for the total sample and for the subset who received the specific type of service . approximately two of every three hha clients were female ( 62.6 percent ) , and 5.7 percent were under 65 years of age , whereas 21.9 percent were 85 years of age or over . living arrangement was unknown for nearly one - half of the clients ( 45.3 percent ) ; but of the remainder , approximately one of every three lived alone ( 34 percent ) , nearly one of every two lived with a spouse ( 42 percent ) , and 24 percent lived in other arrangements . concerning the source of admission to the medicare hha , about one of every five came directly from the community ( 19.6 percent ) ; three of every four came from a hospital , with approximately one - third having been surgical patients ( 32.0 percent ) and slightly more having been medical patients ( 44.0 percent ) ; whereas 3.4 percent had been discharged from a nursing home . concerning their mobility restrictions , very few had none ( 3.6 percent ) , and the vast majority ( 79.1 percent ) relied on a cane or crutch or walker . approximately 1 of every 10 ( 11.7 percent ) relied on a wheelchair , and 1 in every 20 ( 5.6 percent ) required total bed - rest . the vast majority of clients were receiving some prescription medications ( only 5.2 percent were not ) . nearly one - half ( 46.4 percent ) had no indication of a special diet , approximately one in every four ( 28.1 percent ) required a low sodium diet , and another one in every four ( 25.5 percent ) had another type of special diet required . eleven categories of functional limitations were identified for each of the hha clients . the vast majority of the clients were reported to have endurance limitations ( 85.0 percent ) and ambulation limitations ( 80.6 percent ) . the next most common limitations were reported for approximately one in every four clients ( vision limitations for 27.4 percent and respiration limitations for 26.7 percent ) . slightly less than one of every five clients were reported to have hearing limitations ( 19.8 percent ) , mental limitations ( 18.3 percent ) , and bowel or bladder limitations ( 16.5 percent ) . the remaining four limitations were reported for less than 10 percent of the clients : 7.5 percent had speech limitation , 5.9 percent had paralysis limitations , 3.3 percent had contracture limitations , and 2.8 percent had amputation limitations . simply summing across the number of limitations that any individual hha client was reported to have , it is interesting to observe that the clients in general had multiple limitations . only 1 in every 10 ( 9.9 percent ) had only one limitation reported , and only 1.3 percent had no limitations ( these probably reflect incomplete hcfa form-485 completion ) . nearly one of every three ( 31.3 percent ) had two limitations , and approximately one - third ( 28.7 percent ) had three limitations . the last 30 percent had four limitations or more , including 4.9 percent who had six limitations or more . five to 10 percent had heart disease - other ( 8.3 percent ) , cerebrovascular diseases ( 7.8 percent ) , digestive system disease ( 6.2 percent ) , arthropathies ( 5.3 percent ) , ischemic heart disease ( 5.2 percent ) , or diabetes mellitus ( 5.0 percent ) . table 2 presents the distribution of allowed visits and charges for a total episode during 1986 for these medicare hha clients . the vast majority of hha clients received skilled nursing visits ( 90.1 percent ) , whereas approximately one of every three received care form a home health aide ( 35.2 percent ) or a physical therapist ( 32.8 percent ) . the remaining types of skilled care were provided to much smaller percents of clients , ranging from 14 percent receiving medical social work services to 2 percent receiving speech therapy . the second column of table 2 presents the mean number of visits during the whole episode by type of visit for the total sample of clients . the mean number of visits for all clients was 22.71 , with more than one - half provided by skilled nurses ( 12.62 ) and one - fourth provided by home health aides ( 5.79 ) . three of the services ( occupational therapy , speech therapy , and medical social work ) provided less than one visit on average to these clients . the next column presents the mean number of visits for the subgroup that used the specific type of visit . among users , home health aides provided the highest number of visits per regimen at 16.48 on average , followed by skilled nurses at 14.00 and speech therapists at 11.45 per regimen . both physical therapists and occupational therapists provided about 8 to 10 visits , on average , to the subset who received them . medical social work was used both by a small percent ( 13.9 percent ) and in small amounts ( 2.04 visits per regimen ) . the next column presents the mean allowed charges for all these clients , with an average total episode charge of $ 1,237.82 per client in 1986 . the mean charges by type of service for all clients in large measure reflect the mean number of visits because the charges per visit were approximately equal ( averaging $ 57 to $ 59 per visit ) in four of the major types ( skilled nursing , physical therapy , occupational therapy , and speech therapy ) . the two outliers were home health aide visits , which averaged less at $ 42 per visit , and medical social worker visits , which averaged more at $ 77 per visit . notwithstanding that medical social workers had the highest charge per visit , on average , the last column of table 2 indicates that the mean charges for a regimen of medical social work therapy was by far the least expensive service at $ 156.70 compared with the next lowest average charge for the users of a specified therapy ( $ 498.52 for those receiving occupational therapy ) . skilled nursing services had the highest mean charges at $ 819.83 for the users . table 3 presents the distribution among these medicare hha clients of allowed visits and allowed charges during a whole episode by the type of visit . inspecting the total visit column , the range varies considerably according to the type of visit the client received . the mean number of total visits among all clients was nearly 23 visits . however , those receiving speech therapy received almost 54 visits on average , with 11 to 12 visits on average from the speech therapist contributing to their increased amount . regimens of nearly 14 and 11 visits for skilled nursing and physical therapy also contributed to their 54-visit average . an occupational therapy regimen of approximately 8 to 9 visits was also the norm of those receiving either speech therapy or occupational therapy , contributing to the total mean visits of 54 for the former and 47 visits on the average for the latter group . for the 90 percent receiving skilled nursing services , their total mean visits was nearly 24 , with more than one - half their visits ( 14.00 ) provided by skilled nurses and over one - fourth ( 6.17 ) provided by home health aides . the same patterns emerge when inspecting table 3 from the perspective of allowed charges , suggesting that variation in charges were minimal , as implied by the homogeneity of charges per visit for skilled nursing and physical , occupational , and speech therapy as mentioned previously . those receiving skilled nursing services had mean allowed charges per episode of $ 1,286.56 , whereas those receiving occupational therapy and medical social work services had approximately twice the mean charges ( $ 2,665.42 and $ 2,259.49 , respectively ) , and those receiving speech therapy had even higher mean allowed charges per episode at $ 2,883.54 . table 4 presents the distribution of allowed visits during an episode according to the characteristics of the client . the patterns of allowed visits and charges as a function of the characteristics of the hha client are very similar because of the homogeneity of charges among four of the professional therapies . furthermore , the large sample size lends itself to observing frequent statistical significance between client characteristic and number of specific services , as indicated by a chi - square analysis . consequently , statistical significance is not indicated in this descriptive report , and the authors ' judgments concerning practical significance are . inspecting table 4 for differences in total visits or types of visits associated with characteristics of the client suggests some interesting patterns . the sex of the client was associated with both the number of allowed visits and the charges for an episode , with females receiving slightly more skilled nursing visits in particular and more visits in general . an exception was observed with speech therapy , for which male clients received approximately two to three times more visits than female clients . however , the prevalence of speech therapy is low even for males ( 0.39 versus 0.14 mean visits for males and females , respectively ) . the age of the client also had a moderate association with the number of allowed visits and charges . those under 65 years of age received fewer visits in general and fewer skilled nursing and home health aide visits in particular . there were few differences in type or amount of services among the age subgroups of those 65 years of age or over . those living alone received fewer total services ( 20.50 ) than either those living with spouse or in other specified households ( 24.15 and 22.89 , respectively ) . those living alone received fewer home health aide , physical therapy , occupational therapy , and speech therapy visits than the other household compositions , whereas those living with spouse received slightly more speech therapy services . there were few differences in total services or type of individual services among those admitted from the community , from hospitals as medical patients , or from hospitals as surgical patients . those whose admission source was unknown ( 1.0 percent of the clients ) had substantially lower total services ( 14.61 total mean visits versus 22.71 for the total sample ) . those admitted from nursing homes ( again , a small subgroup at only 3.4 percent ) had 50 percent more total services , on average , than the other clients ( 34.29 versus 22.71 total mean visits ) , including substantial increases in home health aide and physical therapy visits compared with the other clients . the relationship between the client 's mobility restrictions on volume and cost of allowed services was extremely variable . those with wheelchair restrictions received substantially more services ( 37.72 mean total allowed visits compared with 22.71 for the total group ; total allowed charges of $ 2,070 compared with $ 1,238 for the total group ) . as would be expected , those confined to bedrest had substantially less physical therapy visits and charges than the other clients . occupational therapy visits were also substantially associated with mobility restrictions ; those with no mobility restrictions or those confined to bed received very few occupational therapy visits , whereas those requiring the ambulatory aids of canes , crutches , or walkers or those in wheelchairs received substantially more . those with no mobility restriction received substantially more skilled nursing services as well , contributing to a higher than average total mean visits ( 31.30 versus 22.71 ) . the association between medications and the number of visits and charges was uniform and positive . those receiving no medications received 13.15 visits , on average , and had $ 789 in total approved charges . those receiving 1 to 3 medications had an average of 20.68 visits and $ 1,133 total charges . those taking 4 to 6 medications had 23.69 total mean allowed visits and $ 1,302 in total charges . those receiving 7 medications or more had 25.61 total mean visits and $ 1,356 in total charges . the nutritional status of the client also was associated with the allowed visits and charges in a uniform fashion . total visits ranged from nearly 21 , to 24 , to nearly 25 for those with no special diet , low sodium diets , and other special diets , respectively . total costs reflected the same trend , at $ 1,137 , $ 1,307 , and $ 1,346 for the three groups , respectively . the functional limitations of the clients also were associated with the allowed visits and charges for these hha clients . home health aide services were elevated for those with bowel or bladder limitations or paralysis limitations . physical therapy services were elevated for those with paralysis limitations or amputation limitations and reduced for those with respiration limitations . occupational therapy visits and charges were elevated for those with paralysis limitations or speech limitations , whereas speech therapy was elevated principally for those with speech limitations and secondarily for those with paralysis limitations . overall , there seem to be three clusters of total allowed costs among the types of reported functional limitations . six of the functional limitations were associated with total charges between $ 1,158 and $ 1,317 for the total episode ( endurance , ambulation , vision , respiration , hearing , and mental limitations ) . it is also interesting to observe that these are the six most prevalent limitations reported as well . four of the remaining limitations have total allowed episode charges that cluster between $ 1,404 and $ 1,603 ( bowel or bladder limitations , speech limitations , amputation limitations , and contracture limitations ) . the last group , those with paralysis limitations , had the most costly average episode at $ 2,154 , with elevated costs for home health aides , physical therapy , occupational therapy , and speech therapy . the number of these limitations reported per client had a slight linear association with increases in total services , with the exception that the small percent ( 1.3 percent ) who had no limitations recorded had total services at approximately 1 times the mean level for the whole group ( 34.11 visits versus 22.71 respectively ) . this finding supports the contention that those cases with missing information on functional limitations were more likely to be incomplete records than clients without limitations . excluding those without recorded limitations , the greatest increment in approved visits and charges was between those with one limitation versus those with two limitations , with total allowed visits ranging from 15.03 to 22.80 and total allowed charges ranging from $ 816 to $ 1,236 as a function of the second limitation . the association of principal diagnosis with total allowed services and allowed costs is interesting . those with a diagnosis of cerebrovascular disease had the highest total charge per episode at $ 1,791 . those with either diabetes mellitus , circulatory system disease , or malignant neoplasms as the primary diagnosis formed a cluster with the fourth most costly episode of care ranging from $ 1,353 to $ 1,404 . those with a diagnosis of heart disease - other followed at $ 1,267 per episode , followed by those with central nervous system disease at $ 1,176 per episode . a cluster of five diagnoses followed , with total episode charges between $ 1,023 and $ 1,096 ( bone fractures , hypertension , genitourinary system disease , injuries or poisoning , or chronic skin ulcers ) . the least expensive clustering had episode charges from $ 892 to $ 955 and includes those with diagnoses of ischemic heart disease , chronic obstructive pulmonary disease , digestive system disease , or arthropathies . for those with a principal diagnosis of cerebrovascular disease , the amounts of physical therapy , occupational therapy , and speech therapy were considerably elevated comparable with those with other diagnoses . those with hip fractures , arthropathies , or bone fractures also had elevated physical therapy charges compared with other diagnoses . the purpose of this analysis was to quantify systematically the characteristics of medicare home health care clients , the parameters of a total episode of care , and the bivariate associations that might exist between client characteristics and components of care . the data available for this purpose have some weaknesses that limit some of the generalizability and utility of the findings . the available data were designed to facilitate service delivery and payment , not for the exploratory research effort to which they were put . furthermore , only a third of the eligible universe ( 37 percent , 87 out of 235 hhas ) provided data for this analysis . hence , the generalizability may be limited because the data came only from hhas willing to participate in a demonstration project . checking all that apply for functional limitations requires that the analysts draw an inference from a non - response . hence , both an intended non - response and an erroneous omission can not be distinguished . the impact of this technical deficiency is presumably minimal , however , because of the low level of erroneous omissions ( i.e. , missing data ) in other items . the other example of a technical deficiency was in the wording of unusual home or social environment previously mentioned , which precluded the straightforward elicitation of living arrangement and produced missing data in 46 percent of the records . consequently , the associations reported with living arrangement must be interpreted with considerable caution . notwithstanding those technical difficulties , hcfa forms-485 and 486 are particularly helpful to this kind of policy research because these forms have continuing use in the medicare home health care program . this continuing use of hcfa forms-485 and 486 facilitate subsequent policy analyses at different times , at different sites , or with different contexts , but with the same data elements . in summary , the descriptive profile of the model client was : female , 75 - 84 years of age , living with a spouse , admitted from a hospital , used ambulation aids , took 5 prescription medications , had no special diet , had 2 functional limitations ( commonly endurance and ambulation limitations ) , and had cancer and/or heart disease . the total episode was approximately 23 visits , including 13 skilled nursing visits , 6 from home health aides , and 3 from physical therapists . the mean allowed charges for the total episode were $ 1,238 ( 1986 dollars ) . the age and sex of the client had a slight association with allowed visits and charges , with those under 65 years of age and those who were male receiving fewer allowed services per episode than those 65 years of age or over or females . those living with a spouse received more speech therapy , possibly suggesting an increased awareness of communication needs for these clients . those admitted from a nursing home had greatly increased level of services , particularly home health aide and physical therapy services . medication use exhibited a systematic linear association with total services and allowed charges for these medicare clients . nutritional status inferred from dietary requirements also was associated with hha total service use , with those on no special diet likely to receive fewer services per episode . both the specific type and the total number of limitations of the clients were associated with the total services provided per episode . with the exception of the few cases with no limitations listed , the association between total number of limitations and total services per episode was linear . although those with paralysis limitations had by far the most costly care per episode , those with bowel or bladder limitations , speech limitations , amputation limitations , or contracture limitations had less but nevertheless substantially elevated total charge per episode compared with those with endurance , ambulation , vision , respiration , hearing , or mental limitations . lastly , some of the principal diagnosis correlated with total service use , as follows . those with cerebrovascular disease as the primary diagnosis had the highest total charge per episode , followed by those with hip fractures and those with either diabetes mellitus , circulatory system disease , or malignant neoplasm . those with heart disease - other had the next most costly episodes , followed by those with diseases of the central nervous system . the second least costly episodes were found among those with primary diagnoses of either bone fracture , hypertension , genitourinary system disease , injuries or poisoning , or chronic skin disease . the lowest total charges per episode were found among those with diagnoses of ischemic heart disease , chronic obstructive pulmonary disease , digestive system disease , or arthropathies . the variability of charges and the definable service arrays among identifiable subgroup of hha clients generate cautious optimism that a multivariate case - mix model may be developed that can render subgroups of these clients homogenous with respect to charges ( branch and goldberg , 1993 ) . the next step following case modeling or identifying homogenous subgroups with respect to charges or some other utilization - based measure is to consider prospective payment models or capitation models based on characteristics of the client as he or she enters the medicare home health care program . based on the findings from these analyses in general and an inspection of the total authorized visits per episode reported in table 4 in particular , a prospective payment model to medicare hhas might incorporate the following steps : first , determine the mean total episode approved charges for an index year . second , offer a prospective payment to certified medicare hhas based on an inflation - adjusted mean charge , modified by the following client characteristics present at intake : a 33-percent increment for those admitted from a nursing home . a 33-percent decrement for those under age 65 . a 50-percent increment for those confined to a wheelchair . a 25-percent increase for those with a principal diagnosis of hip fracture . a 25-percent decrease for those with a principal diagnosis of digestive system disease . a 25-percent decrease for those with a principal diagnosis of arthropathies . third , allow the hha to exclude post facto from the modified prospective payment a predetermined percentage of outliers ( perhaps up to 3 percent ) for adjudicated fee - for - service payments . a capitation model could similarly incorporate modifiers to the basic compensation rate based on these demonstrated variations in the total episode of care , but additional analysis would be necessary to apply the modifier to the total eligible population and not just to the subset of hha users as suggested in the prospective payment model . | the purpose of this study was to present descriptive information on the characteristics of 2,873 medicare home health clients , to quantify systematically their patterns of service utilization and allowed charges during a total episode of care , and to clarify the bivariate associations between client characteristics and utilization.the model client was female , 75 - 84 years of age , living with a spouse , and frail based on a variety of indicators .
the mean total episode was approximately 23 visits , with allowed charges of $ 1,238 ( 1986 dollars ) .
specific subgroups of clients , defined by their morbidities and frailties , used identifiable clusters of services .
implications for case - mix models and implications for capitation payments under health care reform are discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mitochondria play critical
roles in cellular metabolism , including
energy production through the respiratory chain , cell signaling via reactive oxygen species production , regulation of ca homeostasis , and
the triggering of cell death . for example , under
physiological conditions , mitochondria maintain an alkaline matrix
( ph 8) reflecting proton extrusion across the inner membrane
via the respiratory electron transport chain . this
provides a proton - motive force ( h+ ) that serves
to generate atp via h - atp synthase . a breakdown in this normal function leads to the production
of reactive oxygen species ( ros ) , such as superoxide , hydroxyl radicals ,
and hydrogen peroxide , which act as signaling molecules to initiate
apoptosis . the proton - motive force further
acts to regulate ca homeostasis , which in turn modulates dehydrogenase activity associated with the
tricarboxylic acid ( tca ) cycle , adenine
nucleotide translocase , and atp synthase . not surprisingly , alterations in mitochondrial
baseline ph are
a key feature of abnormal cells . mitochondria acidification is also seen during the mitophagic elimination
( mitophagy ) of malfunctioning mitochondria through lysosomal fusion . abnormal levels of mitophagy are associated with various pathological
conditions , including cardiovascular diseases , neurodegenerative diseases , reye s syndrome , among others . thus , being able to probe in greater detail the mitochondrial ph ,
particularly changes associated with mitophagy , could provide new
insights into the central features of mitochondrial function under
both physiological and pathological conditions . to the best
of our knowledge , fluorescent chemical probes that
permit the selective monitoring of baseline mitochondrial ph values
and the specific effect of pathogenic events have yet to be reported . although classic cytosolic ph probes have been used for mitochondrial
ph measurements , their use requires conditions that restrict their
utility , such as working with isolated mitochondria or permeabilized cells . biological
systems , including green fluorescent proteins ( gfps ) modified with
mitochondrial targeting peptides , have been successfully used in certain
cases to measure mitochondrial ph in intact cells . however , complications such as improper
protein expression and misfolding into a nonfluorescent state have
been reported . moreover , in contrast
to genetically encoded probes , small fluorescent probes are expected
to be more readily applicable for use in native cells . this provides
an incentive to develop small molecule probes that would allow mitochondrial
ph levels to be monitored in living cells . in recent years ,
a number of fluorescent probes based on naphthalimide
derivatives have been reported , and their potential utility in biological
sensing and imaging established in a variety of contexts . however , to our knowledge naphthalimide derivatives
that can target mitochondria in live cells and allow mitochondrial
ph changes to be monitored directly have not hitherto been reported . here , we present a new , biocompatible ph - sensitive fluorescent
probe 1 consisting of linked piperazine naphthalimide ,
triphenylphosphonium , and benzyl chloride moieties . as illustrated
schematically in figure 1a , the cationic triphenylphosphonium
subunit was expected to facilitate the
accumulation of probe 1 in mitochondria as the result
of charge considerations resulting from the membrane electrical potential
( m ) , which makes the inner surface is negative . in addition , the benzyl chloride functionality was expected to immobilize
probe 1 within the mitochondria as the result of nucleophilic
substitution with reactive thiols present in various mitochondrial
proteins . on the basis of this dual localization
effect , it was predicted that probe 1 would remain in
the mitochondria even after acidification or membrane depolarization . finally , the piperazine - based naphthalimide group was expected to
provide a fluorescence off on signal turn on
at acidic ph through protonation - induced inhibition of the photoinduced
electron transfer ( pet ) that takes place in the neutral form . proposed
mitochondrion - specific ph sensing mechanism for probe 1 and fluorescent compounds used in this study . ( a ) as designed ,
probe 1 is expected to localize in the mitochondrial
matrix where it will be bound covalently to mitochondrial proteins
through reaction with cysteine thiol residues . the probe is expected
to give rise to a diagnostic fluorescence off on signal at
525 nm in response to a reduction in the ph . as detailed in the text
proper , this probe effect is ascribed to the quenching of the photoinduced
electron transfer ( pet ) from the piperazine ring to the naphthalimide
subunit that occurs in the neutral form . ( b ) structures of probe 1 and control systems 2 , 5 , 11 , and 13 compounds 1 , 2 , 5 , 11 , and 13 were prepared
via the synthetic routes
outlined in figures s1s4 . in this
study , compounds 2 and 5 , lacking the benzyl
chloride or triphenylphosphonium unit , were used as control systems
to verify the target specificity and immobilization of 1 to mitochondria in living cells , respectively . control systems 11 and 13(33 ) were designed
to demonstrate the proposed pet off on mechanism of 1 . the structures of all new compounds were confirmed by h- and c nmr spectroscopy , as well as esi - ms spectrometry
( figures s21s46 ) . , we investigated the ph effect on the
fluorescence
behavior of the piperazine - naphthalimide subunit present in probe 1 . it was recognized that the benzyl chloride moiety in probe 1 could interfere with the fluorescence response due to its
potential hydrolysis or reaction with other entities present in biological
milieus . therefore , compound 2 , an analogue of 1 lacking the benzyl chloride functionality , was used to probe
the effect of ph . as shown in figure 2a , as the ph decreases from 11 to 2 , the absorption
band of 2 gradually shifts from 411 to 391 nm with a
distinct isosbestic point being observed at 409 nm . the fluorescence intensity at 525 nm undergoes a concomitant
monotonic increase ( figure 2b ) . a quantitative
analysis of the fluorescence intensity at 525 nm vs ph ( figure 2c ) revealed a 21-fold ( from 143.83 6.56 to
6.99 1.01 ) increase as the ph range is lowered from 11 to 2 .
a plot of fluorescence intensity ( fi ) vs ph is linear over the ph
range of 5 to 7.5 ( r = 0.99253 ) . the pka of 2 was calculated to be 6.18 0.049
( figure s5 ) . however , in the case of control
compounds 11 and 13 , analogues of 1 and 2 that lack the piperazine ring , no fluorescence
changes are seen as a function of variations in the ph ( figures s6 and s7 ) . this supports the contention
that the ph - dependent fluorescence behavior seen in the case of 2 , and by extension 1 , is due to a pet effect
as suggested in figure 1a . suitably designed
probes containing a piperazine - naphthalimide core were thus expected
to produce the desired fluorescence response and to have the sensitivity
needed to follow mitochondrial ph changes , including those accompanying
the conversion from a physiological to a pathological state . the fluorescence spectrum of 2 was recorded
in the absence and presence of various essential metal ions ( na , k , ca , etc . , as their chloride
salts ) , as well redox substances associated with oxidative stress ,
including metabolic thiols ( gsh , cys , hcy ) and h2o2 under model physiological conditions ( pbs solution at ph
7.4 , 37 c ) . as shown in figure s8 , no noticeable changes were observed in the case of any of these
potential interferants . on this basis , we propose that probe 1 may be used to monitor intracellular ph without interference
from other biologically relevant analytes . absorption ( a ) and fluorescence ( b ) spectra of 2 ( 10.0 and 1.0 m , respectively ) recorded at different ph values
( 2.0 , 3.0 , 4.0 , 5.0 , 6.0 , 6.5 , 7.0 , 7.5 , 8.0 , 9.0 , 10.0 , 11.0 ) . ( c )
plot of fluorescence intensity ( fi ) at 525 nm vs ph . the dots are
based on the average of three separate measurements with the error
bars showing the standard deviation . all data were obtained using
an excitation wavelength of 407 nm in 33 mm buffer solution containing
1% ( v / v ) dmso at 37 c . in order to confirm the presumed mitochondrial target specificity
of 1 , colocalization experiments involving 1 were performed in hela cells using a known mitochondrion - specific
fluorescent probe , mitotracker red ( mtr ) . as expected , the fluorescence
image produced using 1 overlaps with that obtained using
mtr ( pearson s correlation coefficient : 0.87 ) ( figure 3 ) . similar findings were found in the case of 2 ( pearson s correlation coefficient : 0.82 ) ( figure s9 ) . in contrast , with 5 ,
a control system lacking the triphenylphosphonium , a poor overlap
between the fluorescence of the test compound and mtr was found ( pearson s
correlation coefficient : 0.78 ) ( figure s10 ) . it was found that probe 1 displays
negligible cytotoxicity in hela cells , as inferred from an mtt assay
( cf . colocalization experiments
involving probe 1 and mitotracker
red ( mtr ) in hela cells . the cells were incubated with 1 ( 5.0 m ) for 10 min at 37 c , and the medium was replaced
with fresh medium containing mtr ( 5.0 m ) and incubated for
10 min . images for 1 ( a ) and mtr ( b ) were then recorded
using excitation wavelengths of 488 and 633 nm , and band - path emission
filters at 500550 nm and 700750 nm , respectively . panels ( c ) and ( d ) show a merged image of ( a ) and ( b ) and the corresponding
bright field image , respectively . immobilization of 1 within the mitochondria
was believed
critical in preventing leakage of the probe from the mitochondria
under conditions of cell depolarization associated with , e.g. , a pathogenic
event . to verify immobilization of 1 to the mitochondria
in living cells , confocal microscopic experiments were performed in
the absence and presence of carbonyl cyanide m - chlorophenyl
hydrazone ( cccp ) . it can thus be used in the present context to distinguish
between cationic fluorophores that are electrophoretically accumulated
into the mitochondria as the result of a negative inner potential
m and those that are covalently bound and
thus not capable of leaking out once depolarization occurs . in terms
of experiment , hela cells were separately pretreated with media containing 1 and 2 ( 5.0 m each ) for 5 h at 37 c ,
respectively . the media were then replaced with pbs containing cccp
( 10.0 m ) and incubated for 1 and 6 h at 37 c , respectively .
as can be seen from an inspection of figure 4a , the fluorescence image produced by 1 is retained
even after 6 h incubation of cccp . in contrast , the fluorescence image
of 2 , a reference , benzyl chloride - free analogue of 1 , fades with time when the cellular incubation is carried
out in the presence of cccp . from this explicit difference , we conclude
that probe 1 is firmly immobilized within the mitochondria
in living cells ; presumably , this reflects reaction of the benzyl
chloride with endogenous nucleophiles as implied in figure 1a . fluorescent proteins , containing one or
more equivalents of the
covalently bound form of 1 , produced as the result of
this immobilization process were monitored by 2d - gel experiments . figure 4b shows the fluorescent ( typhoon ; for
the fluorescence spots ) and cbb ( coomassie brilliant blue ; for the
protein spots ) staining images of a 2d - gel used to visualize the proteins
produced after incubation with 1 . a distinct fluorescent
spot was seen on the gel when visualized at around ph 5 . this spot
is retained in the merged pseudocolored typhoon ( green ) and cbb ( red )
staining images . moreover , several proteins covalently linked to probe 1 were isolated from the gel and analyzed by esi - ms spectroscopy . the peptide sequences of atp synthase subunit beta ( 56 kda ) and heat shock ( 60 kda ) mitochondrial proteins were clearly observed ( tables s1 and s2 ) . however , in the case of untreated cells
and those incubated with the reference compound 2 , no
fluorescence proteins were observable on the gel ( figure s12 ) . in conjunction with the data presented in figures 3 and 4 , this control study
leads us to conclude that probe 1 is selectively immobilized
within the mitochondria via covalent attachment in accord with the
design expectations ( figure 1a ) . ( a ) the effect of cccp , a recognized mitochondrial uncoupler ,
on the fluorescence confocal images of compounds 1 and 2 in hela cells . ( b ) 2d - gel of proteins collected from cells incubated
with 1 for 5 h at 37 c . the dotted lines define
areas of typhoon and cbb ( coomassie brilliant blue ) staining . these
images were pseudocolored with green and red , respectively , and merged . typhoon images showing fluorescent bands were obtained
using an excitation wavelength of 457 nm . the fluorescence response
of 1 to changes in ph in
hela cells was tested using confocal microscopy ( cf . the intracellular ph was then set at values between 4 and
7 using various buffer solutions in the presence of known h / k ionophores ( nigericin and monensin ) . the fluorescence
intensity of 1 gradually increases as the cellular ph
is lowered from 7 to 4 . these finding match what was seen when 1 was tested in solution ( see figure 2 and accompanying discussion ) . the off on manner of the fluorescent
response seen upon lowering the ph leads us to suggest that probe 1 can be used to image mitochondrial ph changes associated
with pathogenic states in live cells . as a predicate to testing
the above suggestion , an effort was made
to quantify the mitochondrial ph in hela cells using 1 in conjunction with mitotracker red ( mtr ) . it is well - known that
ratiometric comparisons of two separate emission bands facilitates
accurate and quantitative measurements when using fluorescent chemosensors . to see if such an approach had merit in the present instance , several
preliminary experiments were carried out . first , we tested the effect
of ph on the fluorescence emission properties of mtr . the mtr fluorescence
at 634 nm is invariant over the 58 ph range ( figure s14 ) however , upon subjecting the cells to laser irradiation
8 time in sequence an approximately ca . 13% decrease in the effective
mtr fluorescence intensity was seen ( as judged by confocal microscopy )
( figure s15 ) . this effect is ascribed to
photobleaching of the mtr dye in the hela cells . such photobleaching
was not seen in the case of 1 . upon excitation at 488
nm , confocal fluorescence images were obtained that revealed emission
from both 1 and mtr that had its origin in both cases
in the mitochondria of hela cells ( figure s16 ) . on the other hand ,
when 1 was irradiated selectively by means of two - photon
excitation at 750 nm , only a weak image ascribable to mtr was observed . we thus rule out fret as an important deactivation mechanism ( figure s16 ) . taken in concert , these studies
lead us to conclude that coincubating cells with both 1 and mtr will provide a reliable means of monitoring mitochondrial
ph via ratiometric fluorescence studies , provided account is taken
of the photobleaching that can occur in the case of mtr . to
establish a valid intracellular ph calibration profile , as
shown in figure 5a , the fluorescence intensity
of 1 ( first row , igreen )
in cells gradually increases with decreasing ph over the 85
ph range , whereas that for mtr ( second row , ired ) remains essentially unchanged . the merged images ( third
row ) serve to confirm the colocalization of 1 and mtr
within the mitochondria . moreover , pseudocolored images , reflecting
the ratio of the green ( igreen ) and red
( ired ) emission intensities ascribed to 1 and mtr , respectively , help underscore the fact that the
probe 1 gives rise to ph - dependent signals and does so
with a linear response over the 48 ph range ( figure 5b ) . ( a ) confocal microscopy images of 1 ( 5.0 m ) and mitotracker red ( mtr ) ( 0.1 m )
in fixed cells exposed to external media fixed at ph 5 , 6 , 7 , and
8 , respectively . ( b ) intracellular ph calibration curve constructed
by plotting igreen / ired vs ph . the table provides the average ph values of the mitochondria
in intact and nutrient - deprived cells . the table lists the average ph values for the
pseudo red green color ( roi 1 and roi 3 ) and the blue purple
color ( roi 2 and roi 4 ) regions . all images were recorded
using an excitation wavelength of 488 nm , and band - path emission filters
at 500550 nm and 680750 nm . the mitochondrial ph of intact hela cells were then measured
based
on the calibration curve produced from the fixed ph experiments described
above ( figure 5b ) . merged and pseudocolored images of probe 1 and mtr obtained from live cells are
displayed in figure 5c . on the basis of the
ratio of fluorescence intensities corresponding to 1 and
mtr , the average ph value of the mitochondria in hela cells was determined
to be 7.99 0.49 ( n = 5 cells ) . this mitochondrial
ph is similar to the earlier studies ( pozzan , ph = 8.05 ; tsien , ph
= 7.98 ; both in hela cells ) . in living cells , mitochondria are expected to be heterogeneous
in terms of their ph values as the result of their functional heterogeneity . since distinct mitochondrial subsets may vary in their sensitivity
to pathogens , resistance to apoptosis , response to oxidative stress ,
susceptibility to reactive oxygen species ( ros ) , or changes in ca ion fluxes , an ability to recognize heterogeneous ph values
would be beneficial . the relatively large standard deviations
seen in the initial studies
discussed above led us to consider that ph heterogeneity could be
monitored with our probe system . toward this end , four regions of
interest ( roi ) were chosen in the merged cell images . regions roi
1 and roi 3 were characterized by an enhanced green fluorescence ascribed
to 1 . on the basis of these intensity values ,
the average ph of roi 1 and roi 3 and of roi 2 and roi 4 were estimated
to be 4.63 and 8.05 , respectively ( see figure 5b and 5c ) . these findings support the contention
that the present probe can be used to identify mitochondrial heterogeneity . to test whether probe 1 could be used to identify
mitochondrial damage associated with dysfunction and cell death , a
starvation model was employed . this leads to mitochondrial acidification ,
which in turn is correlated with an increase in mitophagy levels . hela cells were thus coincubated with probe 1 and mtr
in a serum - free medium . fluorescence intensity ratios were then acquired
via confocal microscopy . using the calibration curve shown in figure 5b , the average mitochondria ph of hela cells observed
upon nutrient deprivation was determined to be 4.87 0.35 ( n = 8 cells ) ( see also figure s17 ) . the observation of mitochondrial acidification under these conditions
is fully consistent with previous reports in the literature , namely , that cells subjected to nutrient deprivation possess mitochondria
characterized by lower ph than those present in intact cells . the above results led us to propose that probe 1 could
also have utility in the real - time monitoring of ph changes during
mitophagy , a process induced inter alia by nutrient depravation as
noted above . during mitophagy , this results first in mitochondrial acidification
followed by degradation . to test whether probe 1 could be used to monitor mitophagy , hela cells were treated with
both 1 and lysotracker red ( ltr ) in a serum - free medium
containing pepstatin a. probe 1 and ltr were expected
to allow for a visual monitoring of mitochondrial ph and acidic autolysosomes ,
respectively . pepstatin a is a protease inhibitor and was used to
delay mitochondrial degradation by proteases in the autolysosomes . as can be seen from figure 6a , the fluorescence
intensity of 1 in nutrient - deprived cells is greater
than in intact cells . in addition , the fluorescence of 1 predominantly overlaps with that of ltr in nutrient - deprived cells . real - time
monitoring of mitochondrial ph changes and lysosome fusion
in intact and nutrient - deprived hela cells . ( a ) confocal microscopy
images of hela cells treated with probe 1 ( 5.0 m )
and lysotracker red ( ltr ) ( 1.0 m ) in growth medium ( for intact
cells ) or in serum - free krh ( krebs - ringer - hepes ) buffer containing
pepstatin a ( 7.5 m ) ( for nutrient - deprived cells ) . time course
images of intact ( b ) and nutrient - deprived cells ( c ) . the images were
recorded at time points consisting of t = 0 , 90 ,
180 , 270 , and 360 s. all images were recorded using an excitation
wavelength of 488 nm and band - path emission filters at 510550
nm and 570660 nm . we also monitored the changes in the fluorescent images of 1 and ltr at 15 s intervals over a 435 s time period . the
results of this monitoring appear in figure 6b and 6c and in the supporting
information ( cf . supplementary movie 1 and figure s18 for intact cells ; cf . figure 6c shows fluorescent images of nutrient - deprived
cells recorded at 90 , 180 , 270 , and 360 s , respectively . the fluorescence
intensity ascribed to 1 gradually increases while overlapping
with that of ltr . however , in the case of intact cells in growth
medium , these time - dependent changes are not observed ( figure 6b ) . pearson s correlation also shows a little
change ( i.e. , going from 0.87 to 0.84 ) . therefore , we conclude that
probe 1 allows for the quantitative measurement of ph
changes in mitochondria , as well as the real - time monitoring of mitophagy
in living cells . the ability to study mitochondrial ph dynamics leads
us to suggest that in due course probe 1 or its analogues
could find use as potential diagnostic tools for mitochondria - related
diseases . mitochondrial ph is a potential indicator
of both normal physiology
and cellular pathology . a significant current bottleneck in exploiting
mitochondrial ph as a marker of cell status is an absence of probes
that allow for the direct and reliable measurement of mitochondrial
ph measurement in whole cells . in this study , we have successfully
developed a chemical strategy that permits the selective and effective
determination of mitochondrial ph . we have shown that the system in
question , probe 1 , permits the real time monitoring of
ph changes associated with the mitochondrial acidification and fusion
that occurs during mitophagy resulting from nutrient deprivation .
the success of our probe is ascribed to the fact that it contains
a piperazine - based naphthalimide as a pet driven fluorophore , a triphenylphosphonium
group for mitochondria targeting , and a reactive benzyl chloride subunit
that induces mitochondrial fixation . we therefore envision that in
due course this strategy will contribute to improvements in diagnostics
and testing wherein mitochondrial ph dynamics are monitored as a means
of distinguishing between physiological and pathological states or
screening potential new mitochondria - targeting drugs . all reagents , including
metal ions , thiols , h2o2 , and other chemicals
for synthesis , buffer solution preparation , and cell imaging , were
purchased from aldrich or tci and used as received . all solvents were
hplc reagent grade , and deionized water was used throughout the analytical
experiments . silica gel 60 ( sorbent , 4063 mm ) was used for
column chromatography . analytical thin layer chromatography was performed
using silicycle 60 f254 silica gel ( precoated sheets , 0.25 mm thick ) . h and c nmr spectra were collected in cdcl3 ( cambridge isotope laboratories , cambridge , ma ) on varian
400 mhz spectrometers . stock solutions of 1 , 2 , 11 , and 13 were prepared in dmso . the
biologically relevant
analytes , including chloride salts of metal ions ( na ,
k , ca , zn , mg ,
mn , cu , fe , fe ) , thiols ( gsh , cys , hcy ) , and h2o2 , were prepared
in triple - distilled water . ph buffer solutions of differing ph were
prepared using 33 mm of potassium hydrogen phthalate ( for ph 25 ) ,
potassium dihydrogen phosphate ( for ph 68 ) , sodium tetraborate
( for ph 910 ) , and sodium bicarbonate ( for ph 11 ) . the actual
ph was set by adding aliquots of 0.1 m naoh or 0.1 m hcl to the initial
buffer solutions . absorption spectra were recorded on a varian-5000
uv vis nir spectrophotometer , and fluorescence spectra
were recorded using a fl311 t spectrofluorometer ( nanolog )
equipped with a xenon lamp ( fl 1039 ) . samples for absorption and emission
measurements were contained in quartz cuvettes ( 3 ml volume ) . excitation
was effected at 407 ( for 2 ) , 450 ( for 11 ) , and 434 nm ( for 13 ) , with the excitation and emission
slit widths both set at 5 nm . a human cervical cancer cell
line ( hela ) was cultured in dulbecco s modified eagle s
medium ( dmem ) supplemented with 10% fbs ( welgene ) , penicillin ( 100
units / ml ) , and streptomycin ( 100 g / ml ) . two days before imaging ,
the cells were passed and plated on glass - bottomed dishes ( mattek ) . all the cells were maintained at 37 c in a humidified atmosphere
consisting of 5/95 ( v / v ) co2/air . for labeling , the growth
medium was removed and replaced with dmem without fbs . the cells were
treated and incubated with 5.0 m of 1 at 37 c
under 5% co2 for the specific incubation time associated
with a given experiment . the cells were washed three times with phosphate
buffered saline ( pbs , gibco ) . cell images were then recorded using
a confocal microscope ( leica , model tcs sp2 ) . | we
report here a mitochondria - targetable ph - sensitive probe that
allows for a quantitative measurement of mitochondrial ph changes ,
as well as the real - time monitoring of ph - related physiological effects
in live cells .
this system consists of a piperazine - linked naphthalimide
as a fluorescence off on signaling unit , a cationic triphenylphosphonium
group for mitochondrial targeting , and a reactive benzyl chloride
subunit for mitochondrial fixation .
it operates well in a mitochondrial
environment within whole cells and displays a desirable off on
fluorescence response to mitochondrial acidification .
moreover , this
probe allows for the monitoring of impaired mitochondria undergoing
mitophagic elimination as the result of nutrient starvation .
it thus
allows for the monitoring of the organelle - specific dynamics associated
with the conversion between physiological and pathological states . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
studies on cancer - associated venous thromboembolism ( vte ) have encompassed a variety of perspectives , including incidence rates , related risk factors , prophylaxis , and treatment , for a range of tumors . although few prospective studies have investigated the incidence of and risk factors for vte in asian patients , it is generally accepted that asian cancer patients have a lower risk of vte development compared with western patients [ 1 - 7 ] . guidelines from western countries recommend perioperative pharmacologic thromboprophylaxis for all surgical cancer patients [ 8 - 10 ] . however , given the low vte incidence in asian patients , it is not certain whether these vte guidelines are entirely applicable to asian cancer patients . therefore , the applicability of western guidelines to asian cancer patients may need to be reappraised . because the incidence of colorectal cancer ( crc ) has shown a recent rapid increase in some asian countries , the incidence and risk factors associated with surgery - related vte in asian patients with crc should be examined . therefore , we conducted this prospective study on korean crc patients who were undergoing major abdominal surgery . between september 2011 and march 2014 , 1,166 patients underwent major abdominal surgery for crc at seoul national university bundang hospital ( snubh ) . the definition of major surgery was an open or laparoscopic surgical procedure under general anesthesia that lasted > 30 minutes . the eligibility criteria were patients with pathologically confirmed adenocarcinomas of the colorectum and who had undergone major curative or palliative abdominal cancer surgery and were 20 years old . mechanical prophylaxis ( elastic stockings or bandages ) was allowed , but pneumatic compression was not used at our institution . the exclusion criteria were as follows : concurrent vte at the time of admission for crc surgery ; a previous or concomitant malignancy , with the exception of patients who were disease - free for > 5 years ; a history of vte ; a known congenital thrombophilia or hypercoagulable state ; pregnancy ; comorbidities requiring anticoagulation therapy during the perioperative period , for example , cerebrovascular infarcts or atrial fibrillations ; and a history of taking antiplatelet or other anticoagulant agents within 2 days of the crc surgery . of the 1,166 patients screened for study eligibility , 567 ( 49% ) agreed to participate in this study , and written informed consent was obtained from the patients ; however , 19 patients were ineligible to participate and 548 patients were finally included ( fig . 1 ) . when the written informed consents were obtained , all of the enrolled patients agreed to undergo postoperative doppler ultrasonography ( dus ) of the lower extremities to screen for deep vein thrombosis ( dvt ) . however , after acquiring the informed consents , some patients did not undergo the planned dus ; the main reasons for not undergoing dus were scheduling conflict or change of mind because some patients had already been discharged from hospital before the scheduled dus . therefore , cohort a ( dus cohort , n=400 ) included patients who had undergone postoperative dus , and cohort b ( observation cohort , n=148 ) included patients who had not undergone dus . data regarding patients demographics , comorbidities , and laboratory test results before surgery were collected . the d - dimer levels were determined using an immunoturbidimetry assay ( sta - liatest d - di , stago , asnires sur seine , france ) with a cutoff value of 0.5 g / ml . data regarding the surgical procedures were also collected . for patients with localized tumors ( stages 1 - 3 ) , the tumor stages were based on the final pathology reports . some rectal cancer patients who underwent preoperative chemoradiation had their tumors staged clinically . in cohort a , duplex and color dus of the lower extremities was performed routinely on all patients 5 - 14 days after the operation , regardless of the development of symptoms that were suspicious for vte . the dus examination was performed from the distal 3 - 4 cm of the external iliac vein to the distal calf vein . although patients in cohort b did not undergo postoperative dus , the other procedures performed during the study period were the same as those performed on patients in cohort a. vte - related symptoms and signs were checked during admission for surgery and during follow - up assessments in the outpatient clinic . both cohorts of patients underwent routine follow - up assessments 4 weeks ( window period , 1 week ) after surgery , and assessments were then performed every 3 - 6 months . dus or computed tomography ( ct ) angiography assessments of the lower extremities or pulmonary vasculature were performed when symptoms or signs that were suspicious for vte were detected . the primary endpoint of the study was the incidence of postoperative vte , which included asymptomatic and symptomatic cases , in cohort a. the incidence of postoperative vte was defined as cases identified with vte using routinely performed dus on postoperative days 5 - 14 plus any additional postoperative vte cases that included dvt or pulmonary embolism ( pe ) detected using dus or other imaging modalities until 4 weeks after surgery . the secondary endpoint was to determine the risk factors for postoperative vte in cohort a. assuming that the actual postoperative vte incidence would be approximately 7% and that this incidence would be < 10% with statistical significance , 400 patients were required in cohort a to attain 80% power and a two - sided significance level of 0.05 . chi - square tests or linear - by - linear association tests were used for comparison of the percentages in the cross - tabulations . logistic regression models were used for the multivariate analyses to identify risk factors associated with development of postoperative vte . this study was approved by the institutional review board at snubh ( study number : b1105/128 - 005 ) , and it was registered with clinicaltrials.gov ( nct01567917 ) . written informed consent was obtained from the patients prior to study entry , and this study was conducted in accordance with the principles of the declaration of helsinki . between september 2011 and march 2014 , 1,166 patients underwent major abdominal surgery for crc at seoul national university bundang hospital ( snubh ) . the definition of major surgery was an open or laparoscopic surgical procedure under general anesthesia that lasted > 30 minutes . the eligibility criteria were patients with pathologically confirmed adenocarcinomas of the colorectum and who had undergone major curative or palliative abdominal cancer surgery and were 20 years old . mechanical prophylaxis ( elastic stockings or bandages ) was allowed , but pneumatic compression was not used at our institution . the exclusion criteria were as follows : concurrent vte at the time of admission for crc surgery ; a previous or concomitant malignancy , with the exception of patients who were disease - free for > 5 years ; a history of vte ; a known congenital thrombophilia or hypercoagulable state ; pregnancy ; comorbidities requiring anticoagulation therapy during the perioperative period , for example , cerebrovascular infarcts or atrial fibrillations ; and a history of taking antiplatelet or other anticoagulant agents within 2 days of the crc surgery . of the 1,166 patients screened for study eligibility , 567 ( 49% ) agreed to participate in this study , and written informed consent was obtained from the patients ; however , 19 patients were ineligible to participate and 548 patients were finally included ( fig . 1 ) . when the written informed consents were obtained , all of the enrolled patients agreed to undergo postoperative doppler ultrasonography ( dus ) of the lower extremities to screen for deep vein thrombosis ( dvt ) . however , after acquiring the informed consents , some patients did not undergo the planned dus ; the main reasons for not undergoing dus were scheduling conflict or change of mind because some patients had already been discharged from hospital before the scheduled dus . therefore , cohort a ( dus cohort , n=400 ) included patients who had undergone postoperative dus , and cohort b ( observation cohort , n=148 ) included patients who had not undergone dus . data regarding patients demographics , comorbidities , and laboratory test results before surgery were collected . the d - dimer levels were determined using an immunoturbidimetry assay ( sta - liatest d - di , stago , asnires sur seine , france ) with a cutoff value of 0.5 g / ml . data regarding the surgical procedures were also collected . for patients with localized tumors ( stages 1 - 3 ) , the tumor stages were based on the final pathology reports . in cohort a , duplex and color dus of the lower extremities was performed routinely on all patients 5 - 14 days after the operation , regardless of the development of symptoms that were suspicious for vte . the dus examination was performed from the distal 3 - 4 cm of the external iliac vein to the distal calf vein . although patients in cohort b did not undergo postoperative dus , the other procedures performed during the study period were the same as those performed on patients in cohort a. vte - related symptoms and signs were checked during admission for surgery and during follow - up assessments in the outpatient clinic . both cohorts of patients underwent routine follow - up assessments 4 weeks ( window period , 1 week ) after surgery , and assessments were then performed every 3 - 6 months . dus or computed tomography ( ct ) angiography assessments of the lower extremities or pulmonary vasculature were performed when symptoms or signs that were suspicious for vte were detected . the primary endpoint of the study was the incidence of postoperative vte , which included asymptomatic and symptomatic cases , in cohort a. the incidence of postoperative vte was defined as cases identified with vte using routinely performed dus on postoperative days 5 - 14 plus any additional postoperative vte cases that included dvt or pulmonary embolism ( pe ) detected using dus or other imaging modalities until 4 weeks after surgery . the secondary endpoint was to determine the risk factors for postoperative vte in cohort a. assuming that the actual postoperative vte incidence would be approximately 7% and that this incidence would be < 10% with statistical significance , 400 patients were required in cohort a to attain 80% power and a two - sided significance level of 0.05 . chi - square tests or linear - by - linear association tests were used for comparison of the percentages in the cross - tabulations . logistic regression models were used for the multivariate analyses to identify risk factors associated with development of postoperative vte . this study was approved by the institutional review board at snubh ( study number : b1105/128 - 005 ) , and it was registered with clinicaltrials.gov ( nct01567917 ) . written informed consent was obtained from the patients prior to study entry , and this study was conducted in accordance with the principles of the declaration of helsinki . of the 548 patients enrolled in this study , 400 patients were assigned to cohort a ( dus cohort ) and 148 patients to cohort b ( observation cohort ) ( fig . approximately half of the patients had no comorbidities , and the primary tumor location was the rectum in approximately 40% of the patients . however , compared with patients in cohort b , patients in cohort a had tumors at more advanced stages ( p=0.010 ) , and underwent open abdominal surgery more frequently ( p=0.013 ) , and had longer operation times ( p=0.027 ) . although statistically insignificant , cohort a included more male patients than cohort b ( p=0.078 ) . in cohort a , the median time to discharge after surgery was 9 days ( range , 3 to 51 days ) . a , 99.5% of the patients ( 398/400 ) were followed up at 4 weeks ( window period , 1 week ) and 98.5% ( 394/400 ) were followed up at 12 weeks postoperatively . the postoperative vte incidence at 4 weeks , which was the primary endpoint , was 3.0% ( 12/400 ) ( 95% confidence interval [ ci ] , 1.6% to 5.2% ) . of the 12 patients who developed postoperative vte , only one patient ( 0.3% ) had symptomatic thrombosis . this patient had underlying congestive heart failure and showed no evidence of dvt during the initial dus performed routinely on day 6 ; however , as the edema in both lower extremities was aggravated , a repeat dus was performed , which detected thromboses in both calf veins on day 13 . regarding the locations of vte , eight patients had distal calf vein thromboses ( 7 asymptomatic cases and 1 symptomatic case ) , three patients had asymptomatic proximal dvt , and one patient had asymptomatic pe . in the patient with postoperative pe , no dvt was detected and the pe was found incidentally on an abdominal ct scan performed on postoperative day 15 to assess postoperative complications . low - molecular weight heparin ( lmwh ) was administered to three of four asymptomatic patients who had pe or proximal dvt , and one patient with an asymptomatic popliteal vein thrombosis rejected further management of dvt and was lost to follow up . of the seven patients with asymptomatic calf vein thromboses , lmwh was administered to one patient . lmwh was not administered to the six remaining patients with asymptomatic calf vein thromboses , and vte recurrence or progression was not observed during the follow - up assessments , which comprised a minimum of 29 days and a maximum of 618 days . all 148 patients in cohort b were followed up at 4 weeks ( window period , 1 week ) and 98.0% of the patients ( 145/148 ) were followed up at 12 weeks postoperatively . only one case of vte ( 0.7% ) was detected postoperatively in cohort b. this patient had stage iv rectal cancer and symptomatic pe and dvt from the left common iliac vein to the calf vein , which were detected simultaneously 12 days after pelvic exenteration . results from univariate analyses to determine the risk factors associated with postoperative development of vte in cohort a are shown in table 3 . age 70 years , increased numbers of comorbidities , white blood cell ( wbc ) counts of > 10,000/l , and elevated d - dimer levels of 0.5 g / ml had increased risk of vte development ( all p - values < 0.05 ) . the patient s sex , tumor stage , and other clinical parameters were not predictive of postoperative vte development . the first method included only the four variables that showed statistical significance in the univariate analyses ; age , number of comorbidities , wbc counts , and d - dimer levels ( table 4 ) . age 70 years ( vs. < 70 years ) ( odds ratio [ or ] , 5.61 ; 95% ci , 1.02 to 30.91 ; p=0.048 ) , two comorbidities ( vs. no comorbidities ) ( or , 13.42 ; 95% ci , 1.38 to 130.88 ; p=0.025 ) , and wbc counts > 10,000/l ( vs. 10,000/l ) ( or , 17.43 ; 95% ci , 2.76 to 109.96 ; p=0.002 ) were independent risk factors for postoperative vte . while an elevated preoperative d - dimer level was associated with increased development of postoperative vte ( or , 5.01 ) , the association was not statistically significant ( p=0.147 ) . the second method used in performing multivariate analyses included all of the clinical parameters that could be measured or examined preoperatively ( table 5 ) , and all of the variables shown in table 3 , except the operation time and the surgical outcomes ( r0 , r1 , and r2 ) , were included . the results from the second method did not differ from those generated using the first method ; hence , age 70 years , two comorbidities , and wbc counts of > 10,000/l were independent risk factors for postoperative vte . of the 548 patients enrolled in this study , 400 patients were assigned to cohort a ( dus cohort ) and 148 patients to cohort b ( observation cohort ) ( fig . approximately half of the patients had no comorbidities , and the primary tumor location was the rectum in approximately 40% of the patients . however , compared with patients in cohort b , patients in cohort a had tumors at more advanced stages ( p=0.010 ) , and underwent open abdominal surgery more frequently ( p=0.013 ) , and had longer operation times ( p=0.027 ) . although statistically insignificant , cohort a included more male patients than cohort b ( p=0.078 ) . in cohort a , the median time to discharge after surgery was 9 days ( range , 3 to 51 days ) . there was no postoperative mortality . in cohort a , 99.5% of the patients ( 398/400 ) were followed up at 4 weeks ( window period , 1 week ) and 98.5% ( 394/400 ) were followed up at 12 weeks postoperatively . the postoperative vte incidence at 4 weeks , which was the primary endpoint , was 3.0% ( 12/400 ) ( 95% confidence interval [ ci ] , 1.6% to 5.2% ) . of the 12 patients who developed postoperative vte , only one patient ( 0.3% ) had symptomatic thrombosis . this patient had underlying congestive heart failure and showed no evidence of dvt during the initial dus performed routinely on day 6 ; however , as the edema in both lower extremities was aggravated , a repeat dus was performed , which detected thromboses in both calf veins on day 13 . regarding the locations of vte , eight patients had distal calf vein thromboses ( 7 asymptomatic cases and 1 symptomatic case ) , three patients had asymptomatic proximal dvt , and one patient had asymptomatic pe . in the patient with postoperative pe , no dvt was detected and the pe was found incidentally on an abdominal ct scan performed on postoperative day 15 to assess postoperative complications . low - molecular weight heparin ( lmwh ) was administered to three of four asymptomatic patients who had pe or proximal dvt , and one patient with an asymptomatic popliteal vein thrombosis rejected further management of dvt and was lost to follow up . of the seven patients with asymptomatic calf vein thromboses , lmwh was administered to one patient . lmwh was not administered to the six remaining patients with asymptomatic calf vein thromboses , and vte recurrence or progression was not observed during the follow - up assessments , which comprised a minimum of 29 days and a maximum of 618 days . all 148 patients in cohort b were followed up at 4 weeks ( window period , 1 week ) and 98.0% of the patients ( 145/148 ) were followed up at 12 weeks postoperatively . only one case of vte ( 0.7% ) was detected postoperatively in cohort b. this patient had stage iv rectal cancer and symptomatic pe and dvt from the left common iliac vein to the calf vein , which were detected simultaneously 12 days after pelvic exenteration . results from univariate analyses to determine the risk factors associated with postoperative development of vte in cohort a are shown in table 3 . age 70 years , increased numbers of comorbidities , white blood cell ( wbc ) counts of > 10,000/l , and elevated d - dimer levels of 0.5 g / ml had increased risk of vte development ( all p - values < 0.05 ) . the patient s sex , tumor stage , and other clinical parameters were not predictive of postoperative vte development . the first method included only the four variables that showed statistical significance in the univariate analyses ; age , number of comorbidities , wbc counts , and d - dimer levels ( table 4 ) . age 70 years ( vs. < 70 years ) ( odds ratio [ or ] , 5.61 ; 95% ci , 1.02 to 30.91 ; p=0.048 ) , two comorbidities ( vs. no comorbidities ) ( or , 13.42 ; 95% ci , 1.38 to 130.88 ; p=0.025 ) , and wbc counts > 10,000/l ( vs. 10,000/l ) ( or , 17.43 ; 95% ci , 2.76 to 109.96 ; p=0.002 ) were independent risk factors for postoperative vte . while an elevated preoperative d - dimer level was associated with increased development of postoperative vte ( or , 5.01 ) , the association was not statistically significant ( p=0.147 ) . the second method used in performing multivariate analyses included all of the clinical parameters that could be measured or examined preoperatively ( table 5 ) , and all of the variables shown in table 3 , except the operation time and the surgical outcomes ( r0 , r1 , and r2 ) , were included . the results from the second method did not differ from those generated using the first method ; hence , age 70 years , two comorbidities , and wbc counts of > 10,000/l were independent risk factors for postoperative vte . to the best of our knowledge , this is the largest prospective study of the incidence of vte following major abdominal surgery in asian crc patients . our findings clearly demonstrate that the incidence of postoperative vte in korean crc patients is lower than that in western patients . without thromboprophylaxis , the vte incidence , which is based on objective diagnostic screening for asymptomatic dvt , is approximately 15%-40% among western patients who undergo general surgery , and even with pharmacologic thromboprophylaxis , the postoperative vte incidence is approximately 10% or more in western crc patients who undergo surgery . when limited to cases with symptomatic or proximal dvt and pe , the latest american college of chest physicians ( accp ) guideline estimates a vte incidence of 3%-6% among western crc patients who undergo major abdominal surgery ( moderate to high risk for postoperative vte development ) . the incidence of postoperative vte in asian cancer patients is generally known to be lower than that in western patients [ 1 - 7 ] . the incidence of postoperative vte in crc patients ranged from 0.18% to 0.85% in retrospective single - institution studies conducted in korea and hong kong [ 4 - 6,16 ] . it has been assumed that most vte cases detected in these retrospective studies [ 4 - 7,16 ] were symptomatic dvt or pe cases . the ninth accp guideline classifies surgical patients according to very low- ( < 0.5% ) , low- ( approximately 1.5% ) , moderate- ( approximately 3.0% ) , and high - risk ( approximately 6.0% ) groups , depending on the estimated baseline incidence of postoperative vte , which includes proximal or symptomatic dvt plus pe , without thromboprophylaxis . the guideline recommends perioperative pharmacologic thromboprophylaxis for surgical patients who are at moderate - to - high risks for vte . in this study , the rates of symptomatic vte were 0.3% in cohort a and 0.7% in cohort b , which are within the ranges reported from previous asian retrospective studies [ 4 - 7,16 ] , and are much lower than the vte rate of 3% at which routine perioperative pharmacologic thromboprophylaxis is recommended . the eighth accp guideline recommends perioperative thromboprophylaxis when the incidence of postoperative vte is expected to be 10% , based on objective diagnostic screening for asymptomatic dvt in patients who were not administered thromboprophylaxis . again , in this study , the postoperative vte incidence , which included asymptomatic cases in cohort a , was only 3.0% ( 95% ci , 1.6% to 5.2% ) , significantly lower than the recommended vte incidence level for perioperative pharmacologic thromboprophylaxis in the eighth accp guideline . although the suboptimal sensitivity of dus as a dvt screening modality may have underestimated the postoperative dvt incidence compared with venography , no additional cases of vte were detected during the 3-month follow - up period in our study . in addition , dus has been used increasingly to screen for dvt in recent studies ; therefore , we do not think that using dus to screen for postoperative dvt was a flaw in our study . although western guidelines recommend perioperative pharmacologic thromboprophylaxis for all surgical cancer patients [ 8 - 10 ] , the findings of the current study suggest that routine perioperative pharmacologic thromboprophylaxis is not required by all asian crc patients who are undergoing major surgery . in this study , all patients routinely received mechanical prophylaxis using elastic stockings or bandages . therefore , mechanical prophylaxis is thought to be sufficient for prevention of postoperative vte in korean crc patients . our findings strongly suggest that the risk - stratified use of perioperative pharmacologic thromboprophylaxis is required for asian cancer patients who are undergoing surgery . the risk - stratified use of perioperative pharmacologic thromboprophylaxis was also suggested by the findings from our previous study of korean patients with gastric cancer . in the current study , age 70 years , two comorbidities , and increased wbc counts of > 10,000/l independently predicted the increased risk of development of postoperative vte in crc patients . older age [ 8 - 10,17 ] , comorbidities , and leukocytosis are well - known risk factors for vte in cancer patients . previous studies have proposed d - dimer as a biomarker that can predict development of vte in cancer patients . reported that preoperative plasma d - dimer was a predictor of postoperative dvt in danish patients with crc . however , in the current study , an elevation of the d - dimer level was predictive of postoperative vte in the univariate analysis , but its statistical significance was not proven in the multivariate analysis . given the high or of 5.01 for patients with high preoperative d - dimer levels of 0.5 g / ml , the lack of statistical significance relating to the d - dimer levels in our patient cohort may be attributed to the lower numbers of vte events in our study compared with those in the danish study . an advanced tumor stage is generally considered a risk factor for vte , but there was no association between the tumor stage and development of postoperative vte in our patient cohort , which might be explained by an insufficient sample size for verification of the real differences in the vte rates among patients with tumors at different stages . it remains controversial whether laparoscopic surgery for crc influences the risk of postoperative vte compared with open surgery . in our study , the postoperative vte rates did not differ between patients who underwent laparoscopic surgery and those who underwent open surgery ( table 3 ) , and this finding concurs with the conclusion from a previous meta - analysis . one recent prospective japanese study investigated the vte incidence following laparoscopic surgery for gastrointestinal cancer . of 71 patients enrolled , 35 patients had crc and neoadjuvant treatment ( chemotherapy or chemoradiotherapy ) was associated with development of postoperative vte . however , preoperative chemotherapy or chemoradiotherapy was not predictive of postoperative vte in our study . therefore , more studies are necessary to verify risk factors related to postoperative vte in asian crc patients . although this study was conducted at a single institution , which could be considered a limitation , because most cancer surgeries are performed at several tertiary high - volume centers in korea , the situation at other korean institutions is likely similar to that reported here . however , caution must be exercised . while the findings from several investigations conducted in other asian countries concur with those of our study , some studies have reported development of postoperative vte in the absence of perioperative thromboprophylaxis in considerable numbers of crc patients , even in asian countries [ 21 - 24 ] . recent prospective studies have reported that the vte incidence after abdominal surgery in japanese patients is not low , compared with western patients ; in these japanese studies , which enrolled patients with crc or other gastrointestinal or pelvic cancers , the incidence of postoperative vte was 18%-24% . however , most cases with postoperative vte had asymptomatic calf vein thromboses [ 21 - 24 ] , for which the necessity of anticoagulation therapy is controversial . as mentioned above , in our study , among seven patients who developed asymptomatic calf vein thromboses , six patients did not receive anticoagulation therapy and vte progression was not observed during follow - up ( table 2 ) . suggested that westernized dietary habits and lifestyle , trends of more extensive surgeries performed in aged patients , and frequent use of indwelling central venous catheters might be underlying mechanisms of increasing tendency toward vte formation in japanese patients . one recent study also demonstrated a yearly increasing incidence of vte in the korean population . therefore , the incidence of vte may be influenced by socioeconomic or public health status even in the same society or nation . in addition , given the genetic heterogeneity among the populations that are of asian ethnicity , susceptibility to vte may vary among the different asian ethnic groups . in conclusion , the incidence of postoperative vte , which included asymptomatic cases , was only 3.0% in korean crc patients who were not administered pharmacologic thromboprophylaxis . old age , comorbidities , and increased preoperative wbc counts were predictive of an increase in postoperative development of vte . for asian patients with crc , risk - stratified administration rather than routine administration of perioperative pharmacologic thromboprophylaxis | purposepharmacologic thromboprophylaxis is routinely recommended for western cancer patients undergoing major surgery for prevention of venous thromboembolism ( vte ) .
however , it is uncertainwhetherroutine administration of pharmacologic thromboprophylaxis is necessary in all asian surgical cancer patients .
this prospective study was conducted to examine the incidence of and risk factors for postoperative vte in korean colorectal cancer ( crc ) patients undergoing major abdominal surgery.materials and methodsthis study comprised two cohorts , and none of patients received perioperative pharmacologic thromboprophylaxis . in cohort
a ( n=400 ) , patients were routinely screened for vte using lower - extremity doppler ultrasonography ( dus ) on postoperative days 5 - 14 . in cohort b ( n=148 ) , routine dus was not performed , and imaging was only performed when there were symptoms or signs that were suspicious for vte .
the primary endpoint was the vte incidence at 4 weeks postoperatively in cohort a.resultsthe postoperative incidence of vte was 3.0% ( n=12 ) in cohort a. among the 12 patients , eight had distal calf vein thromboses and one had symptomatic thrombosis .
age 70 years ( odds ratio [ or ] , 5.61 ) , 2 comorbidities ( or , 13.42 ) , and white blood cell counts of > 10,000/l ( or , 17.43 ) were independent risk factors for postoperative vte ( p < 0.05 ) . in cohort
b , there was one case of vte ( 0.7%).conclusionthe postoperative incidence of vte , which included asymptomatic cases , was 3.0% in korean crc patients who did not receive pharmacologic thromboprophylaxis .
perioperative pharmacologic thromboprophylaxis should be administered to asian crc patients on a risk - stratified basis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
melanotic neuroectodermal tumor of infancy ( mnti ) is a rare clinical condition , which occurs in infants within the first 6 months of life . mnti is usually a benign tumor of neural crest origin composed of relatively primitive pigment producing cells . krompecher made the first description of this tumor in 1918 as a congenital melanocarcinoma . in 1966 , borello and gorlin reported a case characterized by a high urinary excretion of vanillylmandelic acid ( vma ) , classically found in a pheochromocytoma as well as in other neuroblastic tumors , suggesting a neuroectodermal origin of the lesion . alternative terminologies for mnti are pigmented neuroectodermal tumor of infancy , melanotic prognoma , retinal anlage tumor , pigmented epulis of infancy , melanotic adamantinoma , pigmented ameloblastoma , melanotic epithelial odontoma , retinal choristoma , pigmented teratoma , atypical melanoblastoma . it is well - known to be locally aggressive which may result in tooth displacement as the tumor cells invade the surrounding bone . this was a case report of a 4-month - old patient who presented with the complaint of swelling in the right back tooth region of the upper jaw reported to the department of pedodontics and preventive dentistry , kamineni institute of dental sciences , narketpally , nalgonda district . a swelling was observed for the first time when the child was 2 months old which rapidly increased in size , which caused disfigurement of face [ figure 1 ] . pre - operative extra - oral view on clinical examination , the swelling was diffuse , extending from the maxillary right second primary molar region to the canine region anteroposteriorly and caused expansion of the buccal cortical plate and palate up to the midline , but did not cross the midline . the rapid increase in the size of the swelling suggested a malignant nature of the enlargement . hence the lymph nodes were checked for any metastasis , but found none . pre - operative intra - oral view normal radiographic examination ( occlusal radiograph ) showed a diffuse osteolytic radiolucent lesion in the right maxilla and showed displacement and dysmorphic changes in the developing primary tooth buds . plain and contrast enhanced computerized tomographic analysis of the para nasal sinuses performed on a 64 slice computed tomography ( ct ) scanner , with coronal reconstructions revealed evidence of an expansile lytic lesion arising from right maxillary sinus showing cortical defects with associated soft - tissue components and calcific densities within . the lesion measured 3.2 cm 2.1 cm 2.3 cm ( anterio - posterior ( ap ) trans height ) , which displaced the primary teeth inferiorly . pre - operative computed tomography scan image frontal view pre - operative computed tomography scan image lateral view initial wedge biopsy was planned and performed to aid in proper diagnosis . the histopathological report revealed nests of cells arranged in alveolar pattern and small basophilic neuroblast like cells arranged in clusters . wide surgical excision with removal of the tooth buds involved in the lesion to avoid local recurrence was performed under general anesthesia . the histopathological analysis revealed , tumor cells arranged in alveolar pattern within a delicate fibrous connective tissue stroma . large epithelioid cells containing pigment ( melanocyte like cells ) are arranged peripherally in the clusters enclosing central small basophilic neuroblast like cells . infiltration of these cells into the surrounding bone and in between developing tooth buds is appreciated . the biphasic tumor cell population arranged in a background of fibrous connective tissue stroma is suggestive of mnti involving the cancellous bone [ figures 5 and 6 ] . low power microscopic view showing tumor cells arranged in alveolar pattern high power magnification view showing epithelioid cells containing pigment ( melanocyte like cells ) early diagnosis and treatment of any pathological condition is the key to avoid serious sequelae . mnti is a rare clinical condition . according to the literature , only around 365 cases though very rare , good knowledge about lesions like mnti is crucial because of its early age of involvement and rapidity of its spread . delay in the diagnosis may lead to rapid encroachment of the tumor onto the adjacent vital structures , which may necessitate a radical resection , leading to increased morbidity . liu et al . in 2004 explained the possibility of obstruction of infant airway by fairly aggressive expansion of the lesion . in 90% of the instances , no gender predilection was reported by stowens and lim ( 1974 ) and lopez ( 1976 ) , but a male to female ratio of 1.48 was given by kruse - losler in 2006 after a review of 140 cases . other sites reported were mandible , brain , skull , epididymis , shoulder , scapula , fontanelle , mediastenum and uterus . mnti is described in literature as a benign , rapidly growing , non - ulcerated , locally aggressive tumefaction . though it is a pigmented tumor , the pigmentation can not always be observed through the overlying tissues . it is considered as a tumor of neural crest origin composed of primitive pigment producing cells . krompecher suggested that this tumor derives from epithelial islands trapped during embryonic fusion of facial buds . halpert , was of the opinion that the tumor arises from retinal anlage by a process of pinching - off of the neuroectoblast eye . similarity in the tissue organization between mnti and fetal pineal gland suggested a pineal origin . borello and gorlin suggested the term mnti which has now been universally accepted . they observed increase in urinary vma , which is a major catabolite of the catecholamines . its free form when found in great quantity is regarded as a marker of the neuroectodermal tumors . they proved this by showing decreased vma levels after the surgical excision of the tumor . however , the diagnosis of mnti is not necessarily correlated with the increase in the serum levels of vma . a significant number of cases of mnti have been reported with normal levels of vma . dehner et al . in 1979 described various stages of melanocytes and neuroblast like cells within the tumor , suggesting its neuroectodermal origin . immuno - histochemical markers in different studies suggest that mnti is a primitive neuroectodermal tumor with polyphenotypic expression of neural and epithelial markers , melanin production , occasional rhabdomyoblastic , glial , ganglionic and osseous differentiation and no photoreceptor differentiation . it probably represents a dysembryogenetic neoplasm that recapitulates the retina at 5 weeks of gestation . differential diagnosis of mnti includes various pediatric small round cell neoplasms such as neuroblastoma , ewing 's sarcoma , peripheral neuroepithelioma , rhabdomyosarcoma , peripheral primitive neuroectodermal tumor , desmoplastic small round cell tumor , malignant melanoma and lymphoma . post - operatively the present case was followed - up for 6 months , which revealed no evidence of recurrence and the child was healthy [ figure 7 ] . although the prognosis of benign mnti is excellent after complete surgical excision , long - term follow - up is mandatory as the course of the disease can not be predicted by morphological findings . | melanotic neuroectodermal tumor of infancy ( mnti ) is a relatively uncommon osteolytic - pigmented neoplasm that primarily affects the jaws of infants .
the early onset and its rapid disfiguring spread necessitate early diagnosis . a 4-month - old male child reported with the complaint of swelling in the right back tooth region of the upper jaw , which rapidly increased in size causing disfigurement of the face .
radiographic examination showed a diffuse osteolytic radiolucent lesion in the right maxilla and displacement and dysmorphic changes in the developing primary tooth buds .
wide surgical excision was performed under general anesthesia .
histopathological report revealed characteristic large pigmented epitheloid cells ( melanocyte like cells ) .
the biphasic tumor cell population arranged in a background of fibrous connective tissue stroma is suggestive of mnti involving the cancellous bone .
early diagnosis and management of such aggressive tumors precludes significant morbidity of the patient . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
fixed dose combinations of drugs , are combinations of two or more active drugs in a single form . the food and drug administrationdefines a combination product as a product composed of any combination of drug and a device or a biological product and a drug or a device and a biological product . the basic aim of drug therapy was to treat the ailment with minimal drugs that are safe and effective . fixed dose combinations rationality are usually based on certain criteria , i.e. the drug in the combination state acts by different mechanisms , the pharmacokinetics should not be widely different , the combination should not have any supra - additive toxicity of the ingredients . the main concern of fixed dose combinations includes adverse consequence of drugs and adverse interactions of drugs . usually , in dental colleges , during their routine practice prescribe antibiotics and pain killers to relieve suffering from dental pain . unfortunately , many fixed dose combinations that are available in the market are irrational . without adequate knowledge , prescribing these drugs can result in adverse drug reactions ; therefore , adequate knowledge should be imparted to all medical and dental professionals right from their graduation and postgraduation itself . there are only a few studies that have been conducted to assess the knowledge , attitude , and practices among medical and dental students , and no study has been done so far on dental postgraduate students . keeping this in view , the present study was conducted to evaluate the knowledge , attitude and practices about prescribing fixed dose combinations among postgraduate dental students in coastal andhra pradesh . to assess the knowledge , attitude , and practices of fixed dose combination drugs among post graduate dental college students in coastal andhra pradesh , india . to assess the knowledge , attitude , and practices of fixed dose combination drugs among post graduate dental college students in coastal andhra pradesh , india . a descriptive cross - sectional study has been carried out on postgraduate dental students of dental colleges in coastal andhra pradesh . among them data was collected from the specialities of oral medicine and radiology , oral surgery , endodontics , pedodontics , periodontics , and public health dentistry who prescribe medicines frequently . sample size was calculated based on a previous study to be 90 postgraduate students ; the study was carried out in the month of july 2015 over a period of one month . ethical clearance was obtained from the institutional ethical board of sibar institute of dental sciences , and informed consent was taken from all the participants . a pretested proforma containing a structured questionnaire with both open - ended and closed - ended questions was used in the study . a modified questionnaire was prepared from previous studies , and validity of the questionnaire was checked using cronbach 's alfa ( 0.7 ) . the questionnaire was distributed to the postgraduate students , and sufficient time was given to complete the form . cross verification was done by the investigator to confirm that all the questions were answered . the collected data was entered in the microsoft excel sheet and analyzed using the statistical package for the social sciences version 20.0 statistical package ( ibm , usa ) . a pretested proforma containing a structured questionnaire with both open - ended and closed - ended questions was used in the study . a modified questionnaire was prepared from previous studies , and validity of the questionnaire was checked using cronbach 's alfa ( 0.7 ) . the questionnaire was distributed to the postgraduate students , and sufficient time was given to complete the form . cross verification was done by the investigator to confirm that all the questions were answered . the collected data was entered in the microsoft excel sheet and analyzed using the statistical package for the social sciences version 20.0 statistical package ( ibm , usa ) . the present study was carried out among postgraduate dental students of various departments of the two teaching dental hospitals in andhra pradesh . a total of 90 postgraduate students , which included 33 ( 36.7% ) males and 57 ( 63.7% ) females ; of which , 33 ( 36.7% ) were in the first year , 29 ( 32.2% ) in the second year , and 28 ( 31.1% ) in the third year . figure 1 shows the distribution of study participants according to speciality in postgraduation with higher percentage of participants from the department of oral medicine . distribution of subjects according to speciality in post - graduation while only 35.6% of the participants responded that they were aware of essential medical list , 54.4% were aware of fixed dose combinations [ table 1 ] , and the difference observed was not significant . table 2 shows awareness on the essential medical list and fixed dose combinations according to the year of study and the difference was observed to be statistically significant . first year ( 47.5% ) and third year students ( 63.3% ) believed patient compliance as advantage of prescribing fixed dose combinations ; second year students believed that enhanced drug effect ( 54.5% ) to be an advantage of prescribing fixed dose combinations ; the difference observed was not statistically significant [ table 3 ] . distribution of participants according to specialty on awareness of who essential medical list ( eml ) and fixed dose combinations ( fdc ) distribution of participants according to year of study on awareness of who essential medical list ( eml ) and fixed dose combinations ( fdc ) distribution of responses on disadvantages of fixed dose combinations according to the year of study all the students believed that multiple formulations , increased cost , difficulty in dose adjustment , and adverse drug reactions are the common disadvantages of fixed dose combinations [ table 4 ] . distribution of responses on advantages of fixed dose combinations according to the year of study figure 2 shows commonly prescribed drugs by postgraduate students . most commonly prescribed drug was amoxicillin and clavulanic acid ( 73.3% ) followed by ofloxacin and ornidazole ( 54.4% ) and the least was sulfamethoxazole and trimethoprim ( 0.6% ) . distribution of commonly prescribed drugs by post graduate students it was observed that medical representatives are playing a key role on information regarding fixed dose combinations 43 ( 47.8% ) , followed by internet 39 ( 43.3% ) , while reliance on continuing dental education ( cde ) programmes for information was the least [ figure 3 ] . the triad of knowledge , attitude , and practices are useful for finding the areas where deficiencies are present , and working on those areas help in awareness creation , as it will allow the study to be carried out according to the needs of community . who introduced the concept of essential drug list in 1977 and updates the list every year ; the government of india under the ministry of health and family welfare also recommended the list of essential medicines in india . the present study observed that only 35.6% of the participants were aware of essential medical list , with postgraduate students from oral medicine and radiology ( 61.1% ) being the most aware . it was observed that 57.1% of third year postgraduate students were aware of fixed dose combinations given in eml but they could not name the number of fixed dose combinations given in the list . as the year of study increases , knowledge also increases , which might be the reason why third year students were more aware of fixed doe combinations . knowledge about essential medical list helps in rationally prescribing drugs for better treatment outcome ; however , this lack of sensitization of doctors may be the one of the important factor for errors . it was observed that none of the postgraduate students could name a single band fixed dose combination in india , which is in contrast to the study conducted by goswami et al . and kopal sharma et al . knowledge about the banned fixed dose combination is very important as lack of this knowledge and prescribing these agents may lead to serious , adverse drug reactions . recently , the government of india has banned 333 fixed dose combination drugs available in the market . it was observed in the present study that improved patient compliance and enhances drug effect were the most commonly reported advantages of fixed dose combinations . it was observed that 39.8% believed that multiple formulation , increased cost , difficulty in dose adjustments , and adverse drug reactions were most common disadvantages of fixed dose combinations . it has been observed in the present study that only two fixed dose combination drugs out of all commonly prescribed drugs were in accordance with the who essential medical list . when the rationality in prescribing fixed dose combinations in dentistry was questioned , none of them could explain the rationality . ampicillin / amoxicillin are effective against gram negative bacilli but not against beta lactamase producing staphylococci , whereas cloxacilline is antistreptococcal penicillin with no effect on gram negative bacilli , because these infections rarely co - exist combining them is irrational . adding paracetamol to non - steroidal anti - inflammatory drugs , such as ibuprofen and aceclofenac , does not offer additional benefit but increases the chances of nephrotoxicity . fixed dose combinations such as diclofenac plus seratiopeptidase has no added benefit above the single drugs regardless of the assertion that seratiopeptidase promotes quick resolution of inflammation . in spite of which patient are at higher risk of gastro intestinal irritation and bleeding from unknown peptic ulceration . fixed dose combinations of quinolones and nitromidazoles ( ofloxacin with ornidazole ) have not been recommended by any standard books but continue to be heavily prescribed drugs in gastrointestinal infections , pelvic inflammatory diseases , and dental infections . injudicious practice of fixed dose combination antibiotics results in development of resistant strains that is a serious in health care problem in our country . because peptic ulcer is not always in association with vomiting , it is not advisable to prescribe an antiemetic in combination with peptic ulcer drugs ( h2 blockers and proton pump inhibitors ) . in the present study it was observed that almost all the drugs except ( amoxicillin + clavlonic acid and sulfamethoxazole + trimethoprim ) were irrational and not according to the essential medical list . most commonly prescribed drug was amoxicillin + clavlonic acid by all the postgraduate student of all the departments which was rational . it was observed prescribing irrational combinations such as ofloxacin with ornidazole more in dental infections and similar finding were observed in tudie conducted by kopal sharma et al . most common answers given by the students regarding source of information on fixed dose combinations were medical representatives and internet and the least common were essential medical list and cde programmes . medical and dental college students as well as faculty and practitioners were under continuous influence by persuasive behavior of medical representative , which eventually leads to an irrational use of medicines . this shows that medical representatives are influencing the doctors and marketing their irrational products in the indian market . probable limitation of this study is that it was carried out in a particular area of the country involving few dental college students . in the future a larger study can be carried out on large sample involving all the dental college student throughout the country , and based on results regulation can be framed by the government to avoid irrational prescription of fixed dose combinations . probable limitation of this study is that it was carried out in a particular area of the country involving few dental college students . in the future a larger study can be carried out on large sample involving all the dental college student throughout the country , and based on results regulation can be framed by the government to avoid irrational prescription of fixed dose combinations . irrational prescription of fixed dose combinations not only results in adverse drug effect , drug interactions , and impose unnecessary financial burden but also pose a problem to those practitioners who cultivate the habit of prescribing such combinations , which may lead to controversy when subjected to litigation in consumer forum . time has arrived to think and act about this issue as patients ' health lies in the hands of health care professionals . creating awareness among resident doctors is very vital regarding the advantages , disadvantages , and rationality in prescribing of fixed dose combinations , and it should be started from the undergraduate level of teaching . | aim : to assess the knowledge , attitude , and practices of fixed dose combination drugs among postgraduate dental students.materials and methods : a cross - sectional study was carried out among postgraduate dental students of dental colleges in coastal andhra pradesh .
three colleges were randomly selected and students of all the three years were included .
data was collected from the specialities of oral medicine and radiology , oral surgery , endodontics , pedodontics , periodontics , and public health dentistry .
the total sample was 90 postgraduate students ; informed consent was obtained from the participants , and a pretested questionnaire was distributed to them .
data was analyzed using the statistical package for the social sciences version 20 software.results:out of 90 postgraduates , 33 were males and 57 were females .
thirty - five percent were aware of the essential medical list ( eml ) , among them 11% were from oral medicine and radiology and 6.7% were from pedodontics
. however , most of them were unaware of the number of fixed dose combination drugs present in the world health organization eml . none of them were able to name at least a single banned fixed dose combination drug .
most of them were unaware of the advantages and disadvantages of using fixed dose combination drugs .
amoxicillin with clavulanic acid was the most common drug prescribed by students ( 73.3% ) followed by ofloxacin with ornidazole ( 54.4% ) , ibuprofen with paracetamol ( 53.3% ) , and sulfamethoxazole with trimethoprim ( 6% ) .
most of them were unaware of the rationality in using fixed dose combination drugs .
common sources of information were medical representatives 43 ( 47.8% ) , internet 39 ( 43.3% ) , and 12 ( 13.3% ) reported using who eml.conclusion:there is an urgent need to improve knowledge on the rationality for using fixed dose combination , eml , and banned fixed dose combination in india to the promote rational use of fixed dose combination . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
healthcare providers should be familiar with post - cardiac ablation complications as this procedure is now widespread and frequently performed . a 52 year - old male underwent atrial fibrillation ablation and developed severe mid - sternal chest pain the following day with electrocardiographic findings suggestive of acute myocardial infarction , and underwent coronary angiography , a left ventriculogram , and 2d transthoracic echocardiogram , all of which were unremarkable without evidence of obstructive coronary disease , wall motion abnormalities , or pericardial effusions . after diagnosis , the patient 's presenting symptoms resolved with treatment including nonsteroidal anti - inflammatory agents and colchicine . electrocardiographic findings were classic for an acute myocardial infarction ; however , coronary angiography and left ventriculogram demonstrated no acute coronary occlusion or ventricular wall motion abnormalities . healthcare professionals must remember that the electrocardiographic findings in pericarditis are not always classic and that pericarditis can occur status post cardiac ablation . regional pericarditis remains an elusive and a difficult to diagnosis condition and is likely under - diagnosed . most of the studies regarding regional pericarditis are in the setting of status post acute myocardial infarction ( ami ) . regional pericarditis presents secondary to localized pericardial inflammation resulting in localized st - segment elevation that can mimic ami . pericarditis is typically diagnosed with the presence of at least two of the following :
chest pain;pericardial effusion;friction rub ; andcharacteristic electrocardiographic ( ecg ) changes . however , friction rub and pericardial effusion are often not present and diagnostic criteria including these two findings would result in under - diagnosis . stage 1 lasts several days to weeks and is characterized by widespread concave st - segment elevations less than 5 mm , with reciprocal depression in leads avr and v1 . except for leads avr and v1 , the pr - segment is usually depressed , reflecting abnormal atrial repolarization secondary to inflammation . stage 2 lasts several days to weeks as well and results in the normalization of the st - segment and pr - segment towards an isolelectric status . stage 3 typically begins in the third week and may last for several weeks at which time the t - waves may become inverted . in contrast , there is currently no ecg or medical criteria for the diagnosis of regional pericarditis but rather it is a diagnosis of exclusion . a 52-year - old male with a past medical history significant for paroxysmal atrial fibrillation , dyslipidemia , and hypertension presented to our facility for an elective atrial fibrillation ablation after his atrial fibrillation became increasingly symptomatic and refractory to medical therapy . electrocardiogram at time of elective ablation revealed a normal sinus rhythm with heart rate of 79 beats per minute and a normal early repolarization pattern with no other findings [ figure 1 ] . after a transesophageal echocardiogram ( tee ) revealed no identifiable thrombus , the patient underwent the procedure . the patient underwent cryoablation of the pulmonary veins and the posterior wall of the left atrium . the left isthmus was ablated without successful bidirectional block despite aggressive ablation of the endocardial and epicardial region . the patient tolerated the procedure well , with the maintenance of the activated clotting time ( act ) greater than 300 with heparin that was reversed with protamine sulfate after the procedure with removal of the right femoral vein sheaths . the patient was discharged later that day with sotalol 80 mg orally twice daily , clopidogrel 75 mg orally daily , and aspirin 325 mg orally daily . ecg revealing normal sinus rhythm with heart rate of 79 beats per minute and a normal early repolarization pattern prior to undergoing atrial fibrillation catheter ablation the following day , the patient returned to the emergency department with nine out of ten chest pain that was mid - sternal in location . electrocardiogram at time of presentation revealed normal sinus rhythm with heart rate 78 beats per minute with anterolateral st - segment elevations in leads i and avl and v2 -v4 , reciprocal inferior st - segment depressions in leads iii and avf and subtle pr - segment depressions [ figure 2 ] . serum troponin i was 17.2 ng / ml , with a creatinine concentration of 0.97 mg / dl and hemoglobin level of 15 g / dl . because of the evidence of st - segment myocardial infarction ( stemi ) , the patient underwent emergent coronary angiography . coronary angiography revealed no significant coronary artery disease ( < 50% luminal stenosis ) , with a left ventriculogram revealing an estimated left ventricular ejection fraction ( lvef ) of 60% and no mitral valve regurgitation or regional wall motion abnormalities . ecg status - post atrial fibrillation catheter ablation revealed normal sinus rhythm with anterolateral st - segment elevations in leads i and avl and v2-v4 , reciprocal inferior st - segment depressions in leads iii and avf and subtle pr - segment depressions a 2d transthoracic echocardiogram ( tte ) was performed the day following the left heart catheterization to evaluate for pericardial effusion , revealing a lvef of 55 - 60% , normal left ventricular diastolic filling , and a normal pericardium with no evidence of pericardial effusion . it was thought that patient was suffering from regional post - procedural pericarditis and treated with colchicine 0.6 mg orally and aspirin 325 mg orally with resolution of chest pain . the patient was then discharged the following day with colchicine 0.6 mg orally daily for 30 days , hydrocodone / acetaminophen 5 mg/325 mg orally every 8 hours as needed for pain , aspirin 325 mg orally daily , clopidogrel 75 mg orally daily , sotalol 80 mg orally twice daily , and pantoprazole 40 mg orally daily with resolution of chest pain . our case report identifies the difficulty of further distinguishing regional pericarditis and stemi . in this particular case , the ecg was considerably compelling for an acute anterior myocardial infarction despite pre - procedural ischemic evaluation that was negative prior to cardiac ablation . in the emergency department , a differential diagnosis of complications post - atrial fibrillation catheter ablation responsible for this ecg were considered , including coronary embolization from a left atrial thrombus , left circumflex artery damage from ablation , stress - induced cardiomyopathy , and pericardial effusion . although , complications post atrial fibrillation catheter ablation have steadily decreased , physicians should know and understand the possible complications and include regional pericarditis as a differential diagnosis . in contrast to the findings of rechenmacher et al . , our case revealed an even more difficult diagnosis in that the ecg findings revealed reciprocal st - segment depressions in inferior leads iii and avf that is atypical to previous ecg findings in cases diagnosed with regional pericarditis . although there are currently no ecg criteria for the diagnosis of regional pericarditis , the absence of inverted t - waves may be suggestive of regional pericarditis in the right clinical setting , as once t - waves invert due to an ami , they should remain inverted for weeks to months . as regional pericarditis becomes more recognized , healthcare providers will be able to make a rapid and accurate diagnosis that is imperative to provide appropriate management with patient satisfaction and avoid potential harmful therapies . written informed consent was obtained from the patient for publication of this case report and any accompanying images . | context : regional pericarditis is elusive and difficult to diagnosis .
healthcare providers should be familiar with post - cardiac ablation complications as this procedure is now widespread and frequently performed .
the management of regional pericarditis differs greatly from that of acute myocardial infarction.case report : a 52 year - old male underwent atrial fibrillation ablation and developed severe mid - sternal chest pain the following day with electrocardiographic findings suggestive of acute myocardial infarction , and underwent coronary angiography , a left ventriculogram , and 2d transthoracic echocardiogram , all of which were unremarkable without evidence of obstructive coronary disease , wall motion abnormalities , or pericardial effusions .
ultimately , the patient was diagnosed with regional pericarditis .
after diagnosis , the patient 's presenting symptoms resolved with treatment including nonsteroidal anti - inflammatory agents and colchicine.conclusion:this is the first reported case study of regional pericarditis status post cardiac ablation .
electrocardiographic findings were classic for an acute myocardial infarction ; however , coronary angiography and left ventriculogram demonstrated no acute coronary occlusion or ventricular wall motion abnormalities .
healthcare professionals must remember that the electrocardiographic findings in pericarditis are not always classic and that pericarditis can occur status post cardiac ablation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
uterine mesenchymal neoplasia is a broad category and includes smooth muscle tumors , endometrial stromal tumors ( est 's ) , homologous sarcomas , heterologous sarcomas , sarcomas of uncertain histogenesis , and mixed epithelial and mesenchymal tumors , including uterine tumor resembling ovarian sex cord tumor ( utrosct ) . est 's represent the second most common of these , but are still relatively rare , with malignant subtypes accounting for < 10% of uterine sarcomas and < 1% of primary uterine malignancies ( conklin and longacre , 2014 ) . the recently revised world health organization ( 2014 ) classification scheme of this entity defines four categories based on morphologic resemblance to proliferative - phase endometrial stroma , clinical behavior , and specific genetic translocations . endometrial stromal nodule ( esn ) and low - grade endometrial stromal sarcoma ( lg - ess ) demonstrate sheets of cells with uniform oval nuclei , scant cytoplasm , minimal cytologic atypia , and variable mitotic activity . permeative tongue - like growth into the myometrium and lymphovascular invasion set lg - ess apart from esn . high - grade ess ( hg - ess ) demonstrates cytologic atypia beyond that of lg - ess but not so extreme as to abrogate its resemblance to benign proliferative endometrial stroma . hg - ess is further characterized by the unique translocation t(10;17 ) not seen in other uterine mesenchymal tumors . esn and lg - ess may focally demonstrate variant morphology including smooth muscle differentiation , fibromyxoid change , sex cord - like differentiation , and endometrioid - type glands . these understandably create diagnostic challenges , especially when the variant is extensive , as in the present case . a 56-year - old woman presented to her gynecologist with postmenopausal bleeding . past medical history is insignificant . family history included one sister with uterine cancer in her twenties without a history of obesity . endometrial dilation and curettage revealed a fragmented mesenchymal lesion with mixed spindled and epithelioid cells suggestive of utrosct . the patient underwent exploratory laparotomy with total abdominal hysterectomy , bilateral salpingo - oophorectomy , pelvic and paraaortic lymphadenectomy , omentectomy , and abdominopelvic washings . operative findings included an enlarged uterus ( 15-weeks ) with a retroverted fundus and a normal - appearing cervix . her post - operative course was uncomplicated , and she was followed at our institution for six months . no adjuvant treatment was given , and she remained disease - free during her follow - up period . the hysterectomy specimen consisted of a 280 g uterus with a smooth serosal surface distorted anteriorly by a mass . sectioning revealed a partially cystic tan to yellow lesion within the myometrium that was 5.1 4.6 4.5 cm ( fig . 1 ) . while the mass appeared circumscribed , areas of myometrium distant from the main lesion contained infiltrative , worm - like extensions of tumor . 1 ) . the most striking feature was overwhelming sex cord - like differentiation , namely sheets and nodules of large polygonal cells with abundant eosinophilic foamy cytoplasm , central round nuclei , and prominent nucleoli , suggestive of leydig cell differentiation and interspersed cords and tubules resembling sertoli cell tumor . intimately associated with the sex cord - like areas were glands lined by colonic - type epithelium with columnar absorptive cells interspersed with goblet cells . a minor component of uniform round cells with scant cytoplasm and minimal cytologic atypia , mimicking proliferative endometrial stroma , was present in the background . irregular permeative growth into surrounding myometrium was identified , and there was focal lymphovascular invasion that included both endometrial stromal and sex cord - like elements . altogether , the sex cord - like areas and heterologous elements comprised > 60% of the tumor volume . the bilateral adnexa , all eighteen lymph nodes , and omentum were free of metastatic disease as were concurrent abdominopelvic washings . the lg - ess was positive for er , pr , cd10 , vimentin , cd56 , and calretinin ( focal , weak ) and negative for inhibin , pan - cytokeratin ( pan - ck ) , epithelial membrane antigen ( ema ) , and placental alkaline phosphatase ( plap ) . the sertoli - like tubules were positive for cd10 , vimentin , cd56 , calretinin , inhibin , and pan - ck ( dot - like perinuclear pattern ) and negative for er , pr , ema and plap . the foamy cells were positive for vimentin , cd56 , calretinin , and inhibin and negative for cd68 , er , pr , ema , and plap ( fig . this immunoprofile supports the impression of an endometrial stromal neoplasm involved by sertoli- and leydig cell - like elements . the colonic - type glands were strongly and diffusely positive for ck20 and cdx2 and negative for er . the endometrial glands were strongly and diffusely positive for ck7 and er and negative for ck20 . fluorescent in - situ hybridization ( fish ) analysis of the tumor did not demonstrate rearrangement of the jazf1 , phf1 , or ywhae genes . the final diagnosis was that of lg - ess with extensive sex cord differentiation and heterologous elements ( figo stage ib ) with concurrent complex atypical hyperplasia of overlying endometrium . lg - ess is a malignant mesenchymal tumor resembling proliferative - phase endometrial stroma . by definition , permeative invasion into the myometrium and/or lymphovascular invasion ten - year survival for early - stage disease approaches 90% whereas survival for stages iii and iv is only 66% . however , late recurrences are common , even for early - stage disease ( up to 56% ) , and an estimated 1525% of patients die of recurrent disease ( rauh - hain and del carmen , 2013 ) . lg - ess typically presents in premenopausal women ( mean age 52 years ) as an intracavitary polypoid mass or intramural mass ( who classification of tumours of female reproductive organs , 2014 ) . cut surfaces are soft , yellow to tan , and may be cystic , hemorrhagic , or necrotic . ill - defined borders with overt myometrial invasion are the norm , and macroscopically appreciable worm - like plugs of tumor within myometrial and parametrial veins are frequent . microscopically , lg - ess is composed of a dense monotonous proliferation of small oval cells with scant cytoplasm , round nuclei , inconspicuous nucleoli , and only mild cytologic atypia . mitotic activity is usually low ( < 5 mitotic figures per 10 high power fields ) , but higher mitotic counts do not preclude a diagnosis of lg - ess . most but not all cases are marked by strong and diffuse immunoreactivity to cd10 , vimentin , er , and pr . sex cord - like differentiation within lg - ess recapitulates ovarian granulosa cell or sertoli cell tumors as nests , cords , trabeculae , or tubules of epithelioid cells with variable amounts of cytoplasm , round nuclei , small nucleoli , and minimal mitotic activity . the extent of sex cord - differentiation within a lg - ess is variable and not well characterized in the literature . clement and scully originally described uterine tumors with sex cord - like elements in 1976 . they reported six group 1 tumors ( est with sex cord - like elements [ estscle ] ) in which the sex cord - like elements occupied 1040% of tumor volume . subsequent studies have reported similar findings ( clement and scully , 1976 ) . in most cases , sex cord - like areas stain with typical sex cord - stromal markers , including inhibin and calretinin ( conklin and longacre , 2014 , who classification of tumours of female reproductive organs , , oliva , 2014 ) . most lg - ess 's demonstrate recurrent genetic translocations by fish and , of these , 80% harbor the jazf1-suz12 fusion gene ( t7;17 ) . a rearranged phf1 gene is identified in the majority of the remaining cases ( lee and nucci , 2014 ) . a subset of lg - ess 's without demonstrable genetic rearrangements have been reported , and these are thought to represent variant translocations . utrosct represents the historical group ii tumors described in the original 1976 paper on the subject , and is defined as an endometrial or myometrial neoplasm composed entirely of sex cord - like elements ; endometrial stromal neoplasia is necessarily lacking ( clement and scully , 1976 ) . similar to ovarian sertoli - leydig cell tumors , utrosct 's may rarely exhibit heterologous elements , usually enteric epithelium . while estrogen elaboration by ovarian sertoli - leydig cell tumors with consequent endometrial hyperplasia has been described , the co - occurrence of utrosct with endometrial hyperplasia is less well established . the presentation of utrosct is similar to that of lg - ess , but post - operative management differs as utrosct typically has a benign course with limited potential for recurrence ( conklin and longacre , 2014 , blake et al . , therefore , the distinction between the two entities is important . in cases of utrosct , thorough sampling furthermore , utrosct is almost always well - circumscribed and lacks the extensive myoinvasion typical of lg - ess . lymphovascular invasion is rare in utrosct , and the delicate arteriolar pattern of lg - ess is not present . immunohistochemistry is not of great utility in the differential , but molecular studies have shown utrosct lacks rearrangements of jazf1 and phf1 genes ( staats et al . , 2009 , nucci et al . , 2014 ) . to our knowledge , this case represents a previously unreported occurrence of extensive sex cord - like differentiation within a lg - ess with concomitant heterologous elements and complex atypical endometrial hyperplasia . while the gross impression of tumor plugs throughout the myometrium strongly favored ess over utrosct , thorough sampling was required to confirm areas of stromal neoplasia in a tumor predominated by sex cord - like and heterologous elements . the usual degree of sex cord differentiation within ess is not well reported ; however , a pubmed.gov search revealed only two prior cases wherein the sex cord elements represented a majority of the tumor volume ( fukunaga et al . , 1997 ) . an additional striking feature of this case was the complex atypical hyperplasia of overlying endometrium . while it is possible that the hyperplasia was an incidental synchronous finding , we believe it more likely that the extensive sex cord - like areas produced sufficient unopposed estrogen to locally influence the endometrium . | highlightsendometrial stromal sarcoma ( ess ) may have sex cord differentiation , usually focal.diagnosis of ess is difficult when variant morphology predominates.prognosis differs between ess and utrosct ; therefore , distinction is critical.extensive tumor sampling is mandatory to identify neoplastic endometrial stroma.sex cord differentiation may be associated with endometrial hyperplasia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
on november 9 , 2005 , a 17-year - old man who arrived at the airport in newark , new jersey , united states , had symptoms consistent with measles . the man was part of a group of 148 refugees from the eastleigh community in nairobi , kenya , who arrived in the united states from november 3 through 15 . genotype b3 ( subgroup b3.1 ) was identified from virus samples from this patient ; the sequence was identical to sequences from measles viruses collected in nairobi and machakos , kenya , in october 2005 ( figure ) . all but 1 of the 6 viruses collected from nairobi ( figure , mvi / nairobi.ken.xx.05 ) were from patients from the eastleigh area of nairobi , where an outbreak of measles had been reported in the somali and ethiopian communities ( 6 ) . a ) dendrogram showing the relationships among the measles reference strains representing the 23 known measles genotypes ( b3 has 2 reference strains ) . clade b ( circled ) is expanded in panel b. b ) midpoint - rooted maximum parsimony tree of nucleoprotein genes ( 450 nt ) of measles viruses from patients in the united states , mexico , the netherlands , canada , and kenya during 2005 and 2006 . the unrooted tree includes sequences from nigeria in 2005 , germany in 2006 , cte d'ivoire in 2004 , and benin in 2005 ( sequences in bold , this study ) as well as selected b3 sequences available from genbank for comparison . the identical sequences from the " kenya outbreak group " are represented by genbank accession number dq888751 , mvi / new jersey.usa/45.05 . the genbank numbers for the sequence from benin ( ben ) and the 3 sequences from cte d'ivoire ( civ ) are ef031461 , ef031458 , ef031459 , and ef031460 . * collected from the dagoretti area of nairobi ; the other nairobi sequences were from cases in the eastleigh area . also in november 2005 , this patient had visited new york city , returned to the netherlands on november 15 , noted a rash on november 23 , and was hospitalized with pneumonia and fever on november 24 . the initial investigation focused on potential settings where exposure may have occurred in new york city . the source of infection was traced to an unrecognized exposure to the patient in new jersey only after analysis of the netherlands viral sequence demonstrated complete identity with the new jersey genotype b3 virus . the possibility of an epidemiologic link between the 2 cases led to the discovery that the dutch visitor had arrived at the newark airport on november 9 and waited in the arrival area for 1 h , along with the group of refugees from nairobi . subsequently , genotype b3 was identified from patients who had had measles during december 2005 in texas , canada , and mexico . in texas , during the first 2 weeks of december , 3 cases of measles were reported in members of a family from houston . the patients had flown directly from houston to the resort area of cabo san lucas , mexico , where they stayed from november 22 through 27 . in mexico , health authorities reported 5 cases of measles beginning on december 12 among baggage handlers and other airport workers at the mexico city airport . although the earlier cases in new jersey and in the netherlands could be traced directly to the outbreak in kenya , the sources of the cases in texas , canada , and mexico were unknown . however , the sequences from texas , canada , and mexico were identical to the sequences directly linked to the outbreak in kenya ( figure ) . measles viruses in the same chain of transmission have identical sequences ( 7,8 ) , which indicates that the source of the virus for the cases in texas , mexico , and canada was likely to have been the outbreak in kenya . virus transmission may have occurred through contact with international travelers in airports or during transit because epidemiologic investigations did not detect other measles cases in cabo san lucas or texas . the exception to possible air travel related exposure was the single case that occurred in canada . this patient had traveled by car , although investigations found no measles cases in the areas visited : bangor , maine ( december 2 ) ; boston , massachusetts ( december 36 ) ; and portsmouth , new hampshire ( december 6 ) . they entered massachusetts on november 10 , 2005 , and by 21 days after arrival , measles had not developed . however , a measles outbreak was detected in southern germany in january 2006 ( 9 ) , and the viral sequence matched that of the kenya outbreak virus ( figure ; mvs / stuttgart.deu/4.06 ) , which indicates that the source of this outbreak was also likely to have been kenya . therefore , b3 viruses with identical sequences could have been introduced into texas , mexico , or canada by travelers infected with b3 virus in europe . although genotype b3 has been the most frequently detected measles genotype in western and central africa ( 4,1012 ) , ours is the first report of the detection of genotype b3 in kenya . moreover , the sequence from a virus isolated in nigeria in june 2005 ( figure ; mvs / yola.nie/25.05 ) was identical to the sequences in the kenya outbreak group . although a link has not been established between nigeria and kenya , a survey of measles genotypes in kenya in 2002 detected only genotype d4 viruses ( 13 ) . sequences of viruses isolated during 2004 and 2005 from cte d'ivoire and benin ( this study ) were included in our analysis ( figure ) because these b3 sequences represent closely related viruses from western africa . the analysis and dissemination of viral sequences from measles cases led to the identification of an unrecognized epidemiologic link at an airport and linked sporadic cases in 4 countries that do not have endemic measles to an ongoing outbreak in kenya . . timely communication of sequence data among epidemiologists and microbiologists is critical for identifying possible links among sporadic cases of measles . the potential for rapid transmission of measles during brief encounters with international travelers underscores the importance of global surveillance of measles virus . | surveillance of measles virus detected an epidemiologic link between a refugee from kenya and a dutch tourist in new jersey , usa .
identical genotype b3 sequences from patients with contemporaneous cases in the united states , canada , and mexico in november and december 2005 indicate that kenya was likely to have been the common source of virus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the strong association between abdominal fat and increased risk of cardio - metabolic risk suggests that measures of central fat distribution such as waist circumference ( wc ) and whr may be better than measures of general obesity , such as bmi , in predicting type 2 diabetes . this may be particularly important in the elderly population in whom bmi is known to be a weaker indicator of obesity because visceral fat increases and muscle mass declines with age . the national heart lung and blood institute recommends the use of wc as an additional means of assessing the risks associated with excessive adiposity . although several prospective studies have shown wc to be a better predictor of diabetes than bmi [ 48 ] , the results are inconclusive [ 913 ] . indeed , in a recent meta - analysis based on 32 studies , bmi , wc and whr were all shown to have similar associations with risk of incident type 2 diabetes , suggesting that all measures are important in predicting the risk of diabetes . however , this meta - analysis did not stratify analyses by sex , which may be a potentially important omission . furthermore , few studies have compared the use of these anthropometric markers in older individuals and determined whether the use of bmi combined with measures of body fat distribution ( wc or whr ) improves the ability to predict diabetes . this is an important clinical question as the greatest relative increase in type 2 diabetes prevalence in developed countries in the next 25 years will be in those aged over 65 years . uncertainties also remain about the best combination of anthropometric measures to use in men and women and the optimal cut - off points , particularly in older people . we have examined the predictive power of bmi , wc and whr in predicting incident diabetes and evaluated wc cut - off points to assess diabetes risk in a prospective study of men and women aged 6079 years . we have also examined the combined use of bmi and measures of fat distribution ( wc and whr ) in predicting type 2 diabetes . data from the british regional heart study and the british women s heart and health study were used . the british regional heart study is a prospective study of cardiovascular disease involving 7,735 british men drawn from general practices in 24 british towns and cities who were followed up from 1978 to 1980 [ 16 , 17 ] . in 19982000 , all surviving men , now aged 6079 years , were invited for a 20th year follow - up examination ; 4,252 men ( 77% of survivors ) attended for examination . in 19992001 , a parallel study of 4,286 women ( 60% of those invited ) of the same age and drawn from 22 of the same 24 towns and cities was established , with the addition of one more study city ( bristol ) . the study population was predominantly ( > 95% ) described as white by examining nurses . similar protocols for data collection were used in both studies . in both studies , nurses administered questionnaires , made physical measurements and collected fasting venous blood samples , from which serum was stored at 70c for subsequent analysis . men and women completed detailed questionnaires on : medical history ; medication ; and lifestyle , including cigarette smoking , alcohol consumption and physical activity . details of measurement and classification methods for smoking status , physical activity , social class , blood pressure and blood lipids in the two cohorts have been described elsewhere [ 1821 ] . all participants provided written informed consent to the investigation and ethical approval was provided by all relevant local research ethics committees . fasting glucose measurements were available in 3829 women ( 89% ) and 4032 men ( 95% ) . we excluded all men and women with prevalent diabetes ( defined as the presence of a diagnosis by a doctor of diabetes and/or a fasting glucose of 7 mmol / l ) ( n = 481 men , n = 377 women ) and four women whose diabetes status could not be determined . we further excluded those with missing bmi , waist and hip measurements ( n = 32 men ; n = 44 women ) . after these exclusions , a total of 3519 non - diabetic men and 3404 non - diabetic women were eligible for the current study . height was measured with a holtain ( crosswell , uk ) stadiometer to the last complete 0.1 cm and weight was measured with a soehnle ( waagen , murrhardt , germany ) digital electronic scale to the last complete 0.1 kg . body mass index ( weight / height in kg / m ) was calculated for each individual . waist and hip circumferences were measured in duplicate with an insertion tape ( cms , london , uk ) ; hip circumference was measured at the point of maximum circumference over the buttocks . the waist measurement was taken from the midpoint between the iliac crest and the lower ribs measured at the sides . follow - up all men and women were followed up for all - cause mortality , cardiovascular morbidity and development of type 2 diabetes . losses to follow - up remained exceptionally low ( < 3% ) in both cohorts . the analysis is based on follow - up from re - screening ( 19982000 ) to june 2006 in men and from 19992001 to september 2007 in women , a mean follow - up period of 7 years ( 68 years ) . information on the incidence of new events has been obtained from the combination of regular two yearly reviews of patients notes ( including hospital and clinic correspondence ) through to the end of the study period and from personal questionnaires to surviving participants , repeated since the initial examination , asking whether a doctor had ever told them that they had diabetes , the year of diagnosis and reported use of medications specifically for diabetes . self - report of doctor - diagnosed diabetes has shown to be a valid measure of recording diabetes in the present study . the medical - record review was compared with the patient 's recall of doctor - diagnosed diabetes . in 97% of men who reported a doctor diagnosis of diabetes on the questionnaire , statistical analysis the study population was stratified into sex - specific quartiles of bmi , wc and whr . a cox proportional hazards model was used to assess age - adjusted and multivariate - adjusted hazard ratio ( hr ) . age , systolic blood pressure , log triacylglycerol and log fasting glucose were fitted as continuous variables in the multivariate analysis . physical activity , smoking , parental history of diabetes , manual social class , pre - existing chd and alcohol intake were fitted as categorical variables . finally , receiving - operating characteristic ( roc ) curve analyses and the respective auc were used to compare the predictive power of baseline wc , whr , and bmi on risk of type 2 diabetes in men and women . during follow - up , there were 165 incident cases of type 2 diabetes in the 3,519 men ( 7.15/1,000 person - years ) and 128 cases in the 3,404 women ( 5.40/1,000 person - years ) . bmi correlated most strongly with wc in both men and women ( r = 0.87 and r = 0.83 , respectively ) and correlated more with whr in men than in women ( r = 0.53 and r = 0.35 ) . sex - specific baseline characteristics of the study sample are shown in table 1 . compared with the women , men were more physically active and had higher rates of smoking , consumption of alcohol and pre - existing chd , but lower rates of family history of diabetes . table 1baseline characteristics in men and women with no prevalent diabetescharacteristicmen ( n = 3,519)women ( n = 3,404)p valueage ( years)68.6 ( 5.5)69.3 ( 5.5)<0.0001bmi ( kg / m)26.7 ( 3.5)27.3 ( 4.8)<0.0001wc ( cm)96.5 ( 10.0)85.4 ( 11.7)<0.0001hip circumference ( cm)102.1 ( 6.9)104.6 ( 10.0)<0.0001whr0.94 ( 0.06)0.81 ( 0.07)<0.0001inactive , % ( n)32.6 ( 1109)63.0 ( 2065)<0.0001current smokers , % ( n)13.0 ( 455)11.05 ( 376)0.0127parental history of diabetes , % ( n)5.5 ( 195)9.3 ( 318)<0.0001manual social class , % ( n)50.7 ( 1784)48.9 ( 1518)0.1439systolic blood pressure ( mmhg)148.5 ( 23.9)146.2 ( 24.9)0.0001hdl - cholesterol ( mmol / l)1.34 ( 0.34)1.67 ( 0.45)<0.0001triacylglycerol ( mmol / l)1.58 ( 1.13 , 2.15)1.62 ( 1.2 , 2.16)0.0549glucose ( mmol / l)5.55 ( 5.52 , 5.91)5.68 ( 5.4 , 6)<0.0001pre - existing chd , % ( n)10.7 ( 375)15.3 ( 515)<0.0001daily and weekend drinking , % ( n)63.6 ( 2192)38.89 ( 1216)<0.0001data are mean values ( sd ) unless otherwise statedincident cases of diabetes : 165incident cases of diabetes : 128geometric mean ( interquartile range ) baseline characteristics in men and women with no prevalent diabetes data are mean values ( sd ) unless otherwise stated incident cases of diabetes : 165 incident cases of diabetes : 128 geometric mean ( interquartile range ) the relationships between wc , whr and bmi and risk of type 2 diabetes in men and women are shown in table 2 . all indicators were strongly and significantly associated with risk of type 2 diabetes in both men and women after adjustment for potential confounders including age , social class , alcohol intake , smoking status , physical activity , parental history of diabetes and pre - existing chd . further adjustment for systolic blood pressure , hdl - cholesterol and log plasma glucose reduced the associations , but they remained significant . in men bmi and wc showed similar associations ; whr was the weakest predictor . table 2age - adjusted and multivariate - adjusted hazard ratios and 95% ci for type 2 diabetes according to quartiles of anthropometric indicators in menvariablecasesrate/1,000 person - yearsage - adjustedadjustedadjustedadjustedadjustedall men1657.15quartiles bmi ( kg / m ) < 24.38111.941.001.001.001.001.00 24.38223.761.94 ( 0.944.00)1.85 ( 0.893.81)1.72 ( 0.833.57)1.40 ( 0.672.92)1.43 ( 0.682.99 ) 26.42386.403.29 ( 1.686.43)3.04 ( 1.555.96)2.21 ( 1.114.39)1.88 ( 0.923.83)1.57 ( 0.773.23 ) 28.719416.828.90 ( 4.7616.6)7.35 ( 3.9013.84)4.71 ( 2.459.03)3.36 ( 1.567.21)2.48 ( 1.145.42 ) p trend quartiles<0.001<0.001<0.001<0.0010.014 wc ( cm ) < 90.1132.231.001.001.001.001.00 90.1274.602.08 ( 1.074.02)1.95 ( 1.003.78)1.52 ( 0.782.97)1.48 ( 0.762.89)1.27 ( 0.652.48 ) 96.5406.863.1 ( 1.665.8)2.84 ( 1.525.33)1.93 ( 1.023.65)1.69 ( 0.893.24)1.31 ( 0.682.54 ) 102.58515.357.06 ( 3.9412.65)5.89 ( 3.2610.65)3.53 ( 1.926.48)2.17 ( 1.084.37)1.59 ( 0.773.26 ) p trend quartiles<0.001<0.001<0.0010.0260.214 whr < 0.907162.71.001.001.001.001.00 0.907356.002.25 ( 1.254.07)2.03 ( 1.123.69)1.64 ( 0.92.97)1.53 ( 0.842.79)1.26 ( 0.682.3 ) 0.95427.232.74 ( 1.544.88)2.41 ( 1.354.32)1.75 ( 0.983.15)1.46 ( 0.811.27)1.20 ( 0.662.19 ) 0.987213.135.10 ( 2.978.78)4.38 ( 2.537.59)2.76 ( 1.584.82)2.25 ( 1.273.98)1.65 ( 0.922.95 ) p trend quartiles<0.001<0.001<0.0010.030.069adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes and pre - existing chdadjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c and log blood glucoseadjusted for age and bmi / wcadjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c , log blood glucose and bmi / wc age - adjusted and multivariate - adjusted hazard ratios and 95% ci for type 2 diabetes according to quartiles of anthropometric indicators in men adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes and pre - existing chd adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c and log blood glucose adjusted for age and bmi / wc adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c , log blood glucose and bmi / wc the positive association between bmi and the risk of type 2 diabetes remained strong even after adjustment for whr in both men and women ( p for trend < 0.0001 for both sexes ; tables 2 , 3 ) . in men bmi was a significant predictor of diabetes after adjustment for age and wc and remained significant even after additional adjustment for other potential confounders and possible mediators ( p = 0.01 ) . however , in women bmi was not a predictor of diabetes when adjustments were made for age and wc alone . by contrast wc remained significantly associated with diabetes in women in the fully adjusted model that included adjustment for bmi . in men adjustment for bmi attenuated the association between wc and diabetes in men and this association was not significant after adjustment for potential confounders and mediators . adjustment for bmi attenuated the association between whr and diabetes in men but made little difference in women . table 3age - adjusted and multivariate - adjusted hazard ratio and 95% ci for type 2 diabetes according to quartiles of anthropometric indicators in womenvariablecasesrate/1,000 person - yearsage - adjustedadjustedadjustedadjustedadjustedall women1285.40quartiles bmi ( kg / m ) < 24.07122.031.001.001.001.001.00 24.07122.010.98 ( 0.442.17)0.99 ( 0.442.20)0.86 ( 0.381.92)0.64 ( 0.291.44)0.64 ( 0.281.44 ) 26.65264.352.14 ( 1.084.23)2.01 ( 1.014.00)1.64 ( 0.823.28)0.94 ( 0.461.94)0.92 ( 0.441.91 ) 29.787813.36.46 ( 3.5211.88)5.80 ( 3.1110.81)4.10 ( 2.167.79)1.34 ( 0.612.92)1.27 ( 0.572.82 ) p trend quartiles<0.001<0.001<0.0010.1620.231 wc ( cm ) < 77.150.841.001.001.001.001.00 77.1132.162.60 ( 0.937.28)2.54 ( 0.907.12)2.30 ( 0.816.46)2.40 ( 0.856.76)2.22 ( 0.796.29 ) 84.05233.864.68 ( 1.7812.3)4.34 ( 1.6411.44)3.83 ( 1.4410.16)4.00 ( 1.4910.77)3.60 ( 1.339.73 ) 92.38715.1218.34 ( 7.4445.16)16.64 ( 6.7041.35)12.18 ( 4.8330.74)13.68 ( 5.1136.66)10.82 ( 3.9829.37 ) p trend quartiles<0.001<0.001<0.001<0.001<0.001 whr < 0.77101.641.001.001.001.001.00 0.77121.991.25 ( 0.542.9)1.24 ( 0.542.88)1.08 ( 0.462.54)1.05 ( 0.452.43)0.95 ( 0.42.24 ) 0.81335.613.61 ( 1.787.32)3.29 ( 1.626.69)2.85 ( 1.45.82)2.56 ( 1.255.23)2.3 ( 1.124.74 ) 0.867312.838.39 ( 4.3316.27)7.36 ( 3.7814.36)5.61 ( 2.8411.09)5.38 ( 2.7510.52)4.25 ( 2.138.47 ) p trend quartiles<0.001<0.001<0.001<0.001<0.001adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes and pre - existing chdadjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c and log blood glucoseadjusted for age and bmi / wcadjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c , log blood glucose and bmi / wc age - adjusted and multivariate - adjusted hazard ratio and 95% ci for type 2 diabetes according to quartiles of anthropometric indicators in women adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes and pre - existing chd adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c and log blood glucose adjusted for age and bmi / wc adjusted for age , smoking , physical activity , alcohol intake , parental history of diabetes , pre - existing chd , systolic blood pressure , hdl - c , log blood glucose and bmi / wc there was no significant interaction between age or parental history and adiposity measures with risk of diabetes and no significant interaction was seen between wc and bmi and diabetes in men or women ( p = 0.49 and p = 0.77 for men and women , respectively ) . unadjusted roc analyses indicate that bmi and wc were similar in predicting type 2 diabetes in men ; whr was the weakest ( fig . 1 ) . in men , the auc was 0.726 for bmi , 0.713 for wc ( p = 0.20 for differences in auc for wc vs bmi ) and auc = 0.656 for whr . addition of wc to bmi did not improve prediction in men ( difference in auc = 0.001 p = 0.73 ) . when stratified by bmi levels ( < 25 kg / m , 2529.9 kg / m and 30 + kg / m ) , wc did not improve prediction of diabetes in any of the bmi groups . in women , wc was the best predictor of type 2 diabetes ( auc = 0.780 ) and was significantly better than bmi ( auc = 0.733 , p = 0.002 ) and whr ( auc = 0.728 , p = 0.005 ) . wc improved prediction within all bmi groups , particularly those who were not obese ( bmi < 30 kg / m ) . the addition of bmi or whr to wc did not improve prediction in women ( difference in auc = 0.0007 , p = 0.73 for adding bmi ; difference in auc = 0.008 , p = 0.63 for adding whr ) . 1the roc curves ( unadjusted ) for bmi , wc and whr for ( a ) men and ( b ) women . roc area in women : bmi 0.733 ; whr 0.728 ; wc 0.780 the roc curves ( unadjusted ) for bmi , wc and whr for ( a ) men and ( b ) women . roc area in women : bmi 0.733 ; whr 0.728 ; wc 0.780 we also assessed the improvement of prediction of the anthropometric measures when age and parental history were included in the model . in both men and women bmi and wc this increased significantly to 0.73 with the addition of bmi and 0.71 with wc ( for all differences in auc p < 0.0001 ) . for women the auc for age and parental history was 0.60 and this improved significantly with the addition of bmi ( auc = 0.75 ) or wc ( auc = 0.79 ; for all differences in auc p < 0.0001 ) . the addition of wc to the model with age , parental history and bmi improved the prediction in women ( auc = 0.79 , p = 0.01 ) . we also assessed the optimal cut - off points for bmi and wc for identifying diabetes in men and women . table 4 shows the sensitivity , specificity and positive predictive value for the various cut - off points for bmi and wc in men and women . for women , 92 cm appeared to be the optimal wc cut - off point in terms of the sum of the sensitivity and specificity ; for men , the optimal cut - off point for wc was 100 cm . for bmi the optimal cut - off point for men was between 28 and 29 kg / m and for women the optimal cut - off point was between 29 and 30 kg / m . table 4sensitivity , specificity and positive predictive value ( ppv ) and percentage of cases identified using sex - specific cut - off points for bmi and wc to predict diabetes over 7 yearsvariablemen ( n = 3,519)women ( n = 3,404)ncases%sensitivityspecificityppv ( % ) ncases%sensitivityspecificityppv ( % ) bmi ( kg / m)252,38214767.789.133.46.2227011466.789.134.25.0261,96813955.984.245.57.1191610756.383.644.85.6271,50612342.874.558.88.215839946.177.354.76.3281,1079931.560.069.98.912909237.971.963.47.1297998922.753.978.811.110248430.165.671.38.2305197114.743.086.613.78127823.960.977.69.6waist ( cm)802,18912064.393.836.85.5812,07111860.892.240.45.7821,94911657.390.644.06.0831,83311253.987.547.56.1841,71211050.385.951.16.4851,59710946.985.254.66.8861,49410443.981.357.67.0871,38910140.878.960.77.3881,2839837.776.663.87.6891,1749634.575.067.18.2901,0719331.572.770.18.7919759228.671.973.09.4928908926.169.575.510.0937998523.566.478.210.6942,11013860.083.641.26.57237621.259.480.310.5951,96913355.980.645.36.86607419.457.882.111.2961,82612851.977.649.47.0971,67612347.674.553.67.3981,49911942.672.158.87.9991,33511237.967.963.58.41001,20210634.264.267.38.81011,0719930.460.071.09.21029319126.555.275.09.8 sensitivity , specificity and positive predictive value ( ppv ) and percentage of cases identified using sex - specific cut - off points for bmi and wc to predict diabetes over 7 years in this study of older men and women , aged 6079 years , both general adiposity ( bmi ) and the common measures of regional adiposity ( wc and whr ) strongly and independently predicted incident diabetes in both men and women after adjusting for potential confounders and risk factors , including plasma lipids , plasma glucose and blood pressure . our study confirms previous studies showing that both overall and abdominal adiposity play an important role in diabetes [ 414 ] and extends these findings to older adults . there has been much discussion of which anthropometric measure best predicts diabetes and the usefulness of wc or whr over bmi . our study also provides new information regarding the possible optimal range of clinical utility for wc in predicting future diabetes in older adults . by analysis of roc curves we have shown that in men , wc and bmi showed similar associations with incident diabetes ; whr was the weakest predictor . however , in women the wc was a significantly better indicator of diabetes risk than bmi or whr , and enhanced prediction of diabetes beyond bmi . previous prospective studies comparing wc , bmi and whr for predicting diabetes risk have been inconsistent [ 413 ] . indeed , in a recent meta - analysis of 32 studies worldwide it was concluded that these three obesity indicators have similar associations with incident diabetes . most of the studies included were carried out in populations with wide age - ranges and analyses but , critically , the analyses were not stratified by sex or age group . our finding that wc is a better predictor of diabetes than bmi or whr in older women but not in older men is consistent with and extends data from several other prospective studies . the iowa women s health study of postmenopausal women ( aged 5569 years ) showed those in the top quintile of the wc distribution to be associated with the largest relative risk compared with the top quintile of bmi and whr . in the monica / kora augsburg cohort study , wc emerged as the stronger predictor of type 2 diabetes in women but in men bmi appeared to be the stronger predictor , as was seen in our study . in the nurses health study of women aged 3055 years , wc was the strongest predictor of diabetes when compared with bmi and whr . in the health professionals follow - up study of men aged 4075 years , bmi and wc showed similar associations ; whr was the weakest predictor . in the epic - potsdam study of men and women aged 3565 years wc was a better predictor of incident diabetes than bmi among women but not among men . in the atherosclerosis risk in communities ( aric ) study of adults aged 4064 years , bmi and wc showed similar associations in men , with whr being the weakest predictor , in close agreement with our findings . however , in female aric participants all anthropometric measures showed similar associations with diabetes risk , in contrast to our findings . taken together , the results of these studies and our data suggest that the measure of obesity that best predicts diabetes may be dependent on age and sex , and that waist circumference is a better predictor of diabetes in women . the measurement of wc is recommended in the us national institutes of health clinical guidelines for the assessment or management of obesity . however , its utility in clinical practice has been questioned because of the training required to ensure that reliable wc data are collected ; other weaknesses , including lack of consensus regarding the best thresholds for defining obesity in different populations , have been discussed . of the few prospective studies which have assessed whether the combined use of general obesity with measures of body fat distribution can improve prediction of diabetes , some have suggested that combined use does not provide additional information beyond any single measure [ 9 , 13 ] , as was observed in this study . in older men , there is no evidence that measurement of wc provides additional clinical information beyond that provided by bmi , and vice versa in women . the finding that wc is a far better predictor of diabetes than bmi in older women lends support to the use of wc in older women ( and perhaps in women in general ) to identify those at high risk of developing diabetes . further study would be required , however , before this could be done reliably in clinical practice . the cut - off point for wc recommended for use in clinical practice remains controversial . the atp iii criteria define abdominally obese as wc > 88 cm for women and > 102 cm for men . however , in the present study , roc curve analysis showed that wc thresholds of about 92 and 100 cm in women and men , respectively , provided optimal discrimination for diabetes , at least as defined in terms of the sum of sensitivity and specificity . however , for women sensitivity would be substantially lowered if this method for defining optimal threshold was applied and a higher threshold of 92 cm was used . the threshold of 88 cm yielded 76% sensitivity ( specificity 63% ) whilst a threshold of 92 cm would yield a sensitivity of under 70% but a specificity of 75% . by contrast in men , the results suggest that for diabetes prediction the current recommended wc guidelines of 102 cm could be lowered to 100 cm for identifying diabetes risk , supporting the findings of wang et al . . this method of calculating optimal cut - points gives equal weighting to the notion of sensitivity and specificity and may not be ideal for the assessment of screening thresholds for diabetes in clinical practice . it is likely that optimal thresholds will depend on weighing the issues of cost as well as maximising the identification of those at high risk . we appreciate the need for replication of our findings in independent studies before changes to thresholds are made . it was carried out in an older , predominantly white , european population ; we can not generalise our findings to younger populations or to other ethnic groups , in which the relations between anthropometric measurements and diabetes risk are clearly different . the determination of diabetes incidence in this study relied on documented doctor - diagnosed cases of diabetes , which inevitably results in under ascertainment of cases . this may also influence the performance of anthropometric measurements as bmi is the more routine marker measured in clinical practice . however , if anything , wc emerges as the far stronger predictor in women and this argument would bias against wc being a better predictor . conversely it might be argued that since markers of central obesity ( wc or whr ) have been shown to be more strongly associated with chd risk than bmi in women in several studies [ 7 , 26 ] , women with higher wc are more likely to have health problems and more contact with their doctors and thus are more likely to be diagnosed . to address this possible bias we examined cross - sectionally the relationship of wc , bmi and hyperglycaemia ( fasting glucose concentration wc was a significantly stronger predictor of hyperglycaemia than bmi in women , but in men wc and bmi showed similar predictive power . these findings suggest ascertainment bias is unlikely to explain wc being a better predictor of clinically diagnosed diabetes in women . the stronger association between wc and fasting blood glucose ( a strong determinant of diabetes ) compared with bmi in women may contribute to explaining why wc is a better predictor of diabetes than bmi . however , wc remained a significantly better predictor than bmi after adjustment for fasting blood glucose . finally , our study can not determine why wc should be a better predictor of diabetes in elderly women compared with elderly men , but suggests this as an area for future investigation . both overall and central adiposity indices are strong predictors of type 2 diabetes in older adults . bmi is as strong as wc in predicting type 2 diabetes in men . in women , however , wc was a significantly better measure for the identification of diabetes risk . the use of bmi combined with wc does not improve identification of type 2 diabetes risk beyond single measures of bmi ( in men ) or wc ( in women ) . current recommended guidelines for wc in men of 102 cm could be lowered to identify diabetes risk , whereas those for older women could be increased . finally , future simple diabetes - prediction algorithms could usefully include wc in those applicable to women , though for changes to clinical practice one would need to ensure that better prediction in research settings is not negated by poorer reliability of the measurement in routine practice . | aims / hypothesisthe aim of this study was to examine whether waist circumference ( wc ) or whr improve diabetes prediction beyond body mass index in older men and women , and to define optimal cut - off points.methodsin this prospective study , non - diabetic men ( n = 3,519 ) and women ( n = 3,404 ) aged 6079 years were followed up for 7 years .
there were 169 and 128 incident cases of type 2 diabetes in men and women , respectively.resultsbmi , wc and whr all showed strong associations with incident type 2 diabetes independent of potential confounders . in men ,
the adjusted relative risks ( top vs lowest quartile ) were 4.71 ( 95% ci 2.459.03 ) for bmi , 3.53 ( 95% ci 1.926.48 ) for wc and 2.76 ( 95% ci 1.584.82 ) for whr . for women , the corresponding relative risks were 4.10 ( 95% ci 2.167.79 ) , 12.18 ( 95% ci 4.8330.74 ) and 5.61 ( 95% ci 2.8411.09 ) for bmi , wc and whr , respectively .
receiver - operating characteristic curve analysis revealed similar associations for bmi and wc in predicting diabetes in men ( auc = 0.726 and 0.713 , respectively ) ; whr was the weakest predictor ( auc = 0.656 ) . in women ,
wc was a significantly stronger predictor ( auc = 0.780 ) than either bmi ( auc = 0.733 ) or whr ( auc = 0.728 ; p < 0.01 for both )
. inclusion of both wc and bmi did not improve prediction beyond bmi alone in men or wc alone in women .
optimal sensitivity and specificity for the prediction of type 2 diabetes was observed at a wc of 100 cm in men and 92 cm in women.conclusions/interpretationin older men , bmi and wc yielded similar prediction of risk of type 2 diabetes , whereas wc was clearly a superior predictor in older women . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hpmc e-15 , polyvinyl alcohol and propylene glycol ( pg ) and polyethylene glycol 400 ( peg400 ) were purchased from sigma chemicals . oral thin strip with varied mixture composition of hpmc e15 and pva were prepared by casting drug dispersion in water and subsequent evaporation of solvent in an open glass mould and dried at 40c for 9 hrs . propylene glycol ( 10% w / w ) was added as a plasticizer and citric acid as saliva stimutating agent , aspartame as sweetner . solvent was evaporated slowly at room temperature and controlled evaporation was assured by covering glass mould with an inverted funnel . after complete removal of the solvent , film were removed and kept in desiccators till further use . oral thin strip with varied mixture composition of hpmc e15 and pva were prepared by casting drug dispersion in water and subsequent evaporation of solvent in an open glass mould and dried at 40c for 9 hrs . propylene glycol ( 10% w / w ) was added as a plasticizer and citric acid as saliva stimutating agent , aspartame as sweetner . solvent was evaporated slowly at room temperature and controlled evaporation was assured by covering glass mould with an inverted funnel . after complete removal of the solvent , hence various cellulose derivatives namely hpmc , hpc , cmc , gelatin , pva , were used as primary film former . various trials were taken to formulate the quick dissolving films ( qdf ) where in all the polymers at different concentrations were assessed . film containing hpmc and pva were transparent where as hpc , gelatin and cmc films were opaque in their appearance . as all batches do not have uniform amount of ingredients in it , hence their weight and thickness were varied . levocetirizine dihydrochloride in combination with hpmc e-15 and pva produced smooth , flexible and transparent oral thin strip . prepared strips were evaluated for different parameter like weight uniformity , folding endurance , % drug content , % drug release . from the result , it was observed that all the formulation shows good weight uniformity and % drug content . as concentration of polymer increase , decrease in folding endurance . hpmc e 15 alone shows lesser folding endurance 1555.5 . while only polyvinyl alcohol containing film shows greater folding endurance 452 3.2 . as concentration of polymer increase , drug release was decreased . only hpmc e15 containing film shows 92% drug release in 3 min . while only pva containing film showed 93% drug release in 3 min . maximum drug release of 98.32% 0.35 in 30sec was shown by patch containing 2:1 ratio of pva : hpmc in combination . the fast dissolving films containing levocetirizine dihydrochloride were prepared with an aim to have rapid onset of action and increased bioavailability in allergic conditions . various cellulose derivatives were employed for their film forming properties of which hpmc and pva showed promising physicochemical properties as compare to all other grades therefore , it was selected for further studies . prepared films were transparent with smooth surface and acceptable mechanical properties . it can be concluded that oral thin strip of levocetirizine dihydrochloride can prepared using the polymer combinations of hpmc e15 : pva ( 1:2 ) . when the concentration of polymer increase drug release decreases . | the aim of present research was to develop a fast releasing oral polymeric film , with good mechanical properties , instant disintegration and dissolution , producing an acceptable taste when placed on tongue .
solvent casting method was used to prepare oral films .
levocetirizine dihydrochloride , an antihistaminic was incorporated to relieve the symptoms of allergic rhinitis .
the polymers selected were hpmc e 15 and pva .
propylene glycol was the plasticizers used .
nine batches of films with drug were prepared using different combinations of polymers and plasticizer concentration .
the resultant films were evaluated for weight variation , content uniformity , folding endurance , thickness , surface ph , in vitro disintegration and in vitro dissolution .
the optimized films which disintegrated in less than 30 sec , releasing 85 - 98% of drug within 2 minutes .
the percentage release was varying with concentration of plasticizer and polymer .
the films made with hpmc : pva ( 1:2 ) released 96% of drug in 1 min , which was the best release amongst all . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
molecular docking is a computational method that predicts how a ligand interacts with a receptor . hence , it is an important tool in studying receptor - ligand interactions and plays an essential role in drug design . particularly , molecular docking has been used as an effective virtual screening tool and successfully applied in a number of therapeutic programs at the lead discovery stage . previously , we developed a linux cluster - based application termed dovis , which runs in parallel on hundreds of central processing units ( cpus ) , uses autodock 3.05 as the docking engine , and docks large numbers ( millions ) of ligands to a target receptor . it automatically partitions input ligands , prepares parameter files for autodock , launches parallel autodock runs , parses results , and saves a set of top - ranking docked ligands . dovis removes many technical complexities and organizational problems associated with large - scale high - throughput virtual screening . during the execution of a number of large - scale virtual screening campaigns using the dovis software , we identified four critical areas in which to enhance the software : 1 ) improving parallelization efficiency , 2 ) minimizing file operations on a common file system , 3 ) interfacing with other modeling programs , and 4 ) facilitating rescoring of ligand - receptor complexes using third - party software . first , in our original parallelization scheme , ligands are evenly distributed to each cpu , i.e. , each available cpu receives a number of ligands to dock that is equal to the total number of ligands divided by the number of cpus requested in the batch - queuing job . this scheme is not efficient if the queuing system does not make all cpus available at the same time , as in jobs submitted under the " job - array " queuing option , or if the computational time that it takes to dock a ligand is systematically biased because of compound differences , resulting in unbalanced load distribution for each computer node . therefore , a scheme that automatically balances computational loads across all available cpus is highly desirable . second , during docking of each ligand , the original autodock program reads the associated energy grids into the corresponding cpu . for large - scale screening jobs , this scheme generates large amounts of input / output ( i / o ) file operations , which slows down the entire cluster system . it would be ideal to load all energy grids only once to dock an entire block of ligands instead of repeating the i / o file operation for each ligand . third , we find that directly interfacing docking results with other programs using the native autodock pdbq - format is potentially problematic . although it is possible to convert a pdbq - formatted file into other file formats by openbabel or other programs , the converted structures are not guaranteed to preserve bond order , as this information is not recorded in pdbq files . preservation of bond order and atom sequence among input and output files would not only keep the integrity of a molecule but also make it easier for users to compare docked structures with results from other modeling programs . last , we note that enrichment of known ligands from virtual screening can be improved by rescoring the docked ligands with additional scoring functions . hence , it would be beneficial to have an automated protocol in the dovis software that is capable of rescoring docked ligands and selecting top - ranking ligands based on these new scores . accordingly , we enhanced the dovis software along the four directions discussed above by : 1 ) developing a new parallelization scheme that automatically balances the computational load during runtime ; 2 ) modifying the latest autodock source code to reduce i / o file operations ; 3 ) coding algorithms to output docked ligands and bond information in sd - file format ; and 4 ) providing a wrapper script interface to rescore docked ligands with third - party scoring functions . this last functionality also includes a hierarchical clustering method to cluster and save docked ligands based on user - selected scores . in addition , we upgraded the dovis software to use autodock 4.0 as the docking engine . compared to autodock 3.05 , autodock 4.0 has a wider range of force - field atom types , including different atom types for both polar and non - polar hydrogens . this allows a user to better select the appropriate atomic resolution when studying receptor - ligand interactions or performing large - scale docking campaigns . therefore , we provide three choices for autodock hydrogen models in dovis : one all - atom model and two polar - hydrogen models . the significance of the new dovis 2.0 software implementation compared with the previous version lies in its improved performance and usability . the previous version of dovis made it possible to run large - scale virtual screening in parallel on linux clusters . the new version makes the computation highly efficient by automating load balancing , significantly reducing the file i / o operations , providing outputs that conform to industry standard sd - file format , and providing a general wrapper - script interface for rescoring of docked ligands . finally , the dovis 2.0 software , including autodock 4.0 , is freely available to the public under the gnu general public license ( gpl ) . to manage chemical information in dovis 2.0 , we applied the c++ libraries from openbabel and setup a molecular data structure as a c++ object in our program . this makes handling of molecular structures ( e.g. , atoms and bonds ) transparent between applications and outputs consistent chemical information . we coded the new parallelization scheme , the functions to manage autodock runs , and the algorithm to process docking results in c++ . we used perl scripts to control the work flow , compute energy grids , and link third - party scoring programs to dovis . besides autodock and openbabel , python scripts in autodock tools are also used by dovis to prepare receptor and ligand parameter files . dovis is run through a sequential two - step process : ( 1 ) setting up a dovis project directory and ( 2 ) executing a dovis docking run . the calculations indicated in the shaded area are run in parallel on multiple central processing units . the dovis input file formats for receptors / proteins are either in pdb- or mol2-file format , whereas ligands / small molecules are specified using the sd - file format . the output files contain the docked ligand structure and any auxiliary information in the sd - file format . as shown in figure 1 , a dovis run involves a sequential two - step process . initially , a dovis project directory is created that contains subdirectories and appropriate parameter files , either generated with default parameters or cloned from an existing project . then , the energy grid calculations and the parallel docking processes are launched ; the docked ligand - receptor complexes are generated and scored ; and lastly , the top - ranking results are saved in the final output . detailed usage of dovis is documented in the user 's manual distributed with the software . the components in the shaded area in figure 1 are run in parallel on the assigned cpus . we have developed a new parallelization scheme for these components to remove computational bottlenecks identified in the previous version of dovis . this scheme implements dynamic job control capabilities and achieves dynamic load balancing without a dedicated master cpu . thus , before the parallel docking step , input ligands in sd - file format are partitioned into blocks of n ligands , where n is specified by the user . during parallel docking , each cpu copies the energy grids and other required files to its own temporary directory and requests a block of ligands through a file - lock mechanism . this ensures that each cpu gets one unique set of ligands to work with at a time . after completing a block of ligands , each cpu registers the finished job and updates the top - ranking ligands to the project directory . this process is iterated until all ligand blocks are processed . finally , an assessment script verifies whether all assignments were successfully completed . any requested but unfinished ligand block is added back to the original list of blocks to be reprocessed . users are notified whether all original jobs were successfully completed or a restart is required to complete the docking project . since each cpu works on one ligand block at a time and these blocks are continuously requested by the available cpus during a dovis run , by using small block sizes ( n < < total number of ligands ) this scheme can provide an effective mechanism for automated , dynamic load balancing . in addition , we provide a mechanism to halt one or more cpus after their current ligand block is completed . the number of cpus needed for a restart run the current release package provides three approaches to start parallel docking calculations : multithreading , secure shell ( ssh ) , and queuing system . multithreading is suited for shared - memory linux clusters whereas ssh is suited for distributed - memory linux clusters . for the queuing system approach , by design , , we provide an integration with the load sharing facilities ( lsf ) , platform computing inc . ( ontario , canada ) , queuing system . however , users may use our integration with lsf as an example to code equivalent cpu management functionalities based on other queuing systems . because queuing systems may impose runtime limits on jobs , we implemented a mechanism to estimate if there is enough runtime left in a cpu to process another ligand block every time a new block is requested . an assessment script monitors the overall progress of the docking jobs and , should runtime limits be exceeded , it notifies the user that a restart is required . in the autodock program , only one ligand is docked at a time in a docking run , and at each time the associated energy grid files corresponding to every atom type in the ligand are loaded into the corresponding cpu . depending on the size of the energy grid and the number of atom types , approximately 10 mb of data are loaded at every docking run for each ligand . most of the energy grids , however , can be reused from ligand to ligand . hence , to improve runtime efficiency and reduce i / o file operations , we modified the autodock 4.0 source code to load the energy grid files only once , while docking multiple ligands in a single run . in this mode , energy grids of all atom types are loaded and a block of n ligands are sequentially docked to a receptor . in dovis 2.0 , we use the sd - file format as the ligand i / o format to represent ligand information and associated data . this format increases the portability of the docking results to other modeling software , as most modeling programs are adopting the sd - file format . using the sd - file format , we can embed the estimated autodock binding free energy and our converted autodock 4.0 score ( the corresponding pki value at 298 k ) with each docked ligand . the reason we use the molecular data structure , a c++ object , from openbabel 's c++ library is to be able to manage chemical information and keep the consistency between input and output chemical structures . in contrast , if we were to use the openbabel file - conversion program to convert pdb - files into sd - files , the bonds and bond orders would not be guaranteed to be correct in the converted files . this is because bond information typically does not exist in a pdb - file , and because an agreed - upon , reliable method to consistently predict a bond based purely on inter - atomic distance is not available . instead , we implemented an algorithm that traces input ligand information , processes autodock results , and maps docked ligand atoms back to the input ligand structure . because an output ligand sd - file is based on the information from a corresponding input ligand sd - file , all atomic information , including bond connectivity , if an all - atom model is used ( see below , hydrogen options ) , the atoms in the input and the output ligand sd - files have identical sequences . thus , all atoms including non - polar hydrogens can be explicitly modeled during docking . however , the scoring function in autodock 4.0 was developed based on receptor - ligand complexes with only polar hydrogens . in principle , it is necessary to reparameterize the scoring function for the all - hydrogen model . to test the tolerance of the provided default parameters , we docked a set of receptor - ligand complexes using all - atom and polar - hydrogen models . therefore , we provide both models as options in dovis 2.0 . in addition , we coded another option that uses the polar - hydrogen model for docking and then adds non - polar hydrogens to docked ligands for rescoring . this option combines the best of using the original autodock scoring function and the high resolution of all - atom modeling . this also makes it convenient to compute pairwise root mean square deviation ( rmsd ) values between docked and reference ligand structures . it is still recommended that users provide ligands with all hydrogens as inputs even when the polar - hydrogen model is used for docking , as the protonation state of a ligand is clearly represented only when each hydrogen atom is specified . when the autodock parameter file is prepared for a ligand , non - polar hydrogens are removed , and their partial charges are combined with the charge of the attached heavy atom . similarly , receptor energy grids are computed based on either the all - atom or the polar - hydrogen model . it is common practice to apply additional scoring functions to docked ligands after an initial docking run . to facilitate this capability , we provide a wrapper script interface that enables the rescoring of docked ligands with third - party scoring programs . the interface passes a set of predefined parameters , including the working directory , the receptor pdb - file , the docked ligand sd - file , and the name of the scored ligand sd - file to a wrapper script . it also passes customized parameters directly from the dovis input file to a wrapper script . this allows users to prepare a wrapper script to drive a scoring program of choice that is linked to dovis through the dovis input file , where the wrapper script commands are specified . after rescoring , a separate hierarchical clustering algorithm is available to cluster docked ligand poses based on scores from third - party scoring programs . user - selected scores are employed to determine the cluster centers and to save top - ranking ligands . the components in the shaded area in figure 1 are run in parallel on the assigned cpus . we have developed a new parallelization scheme for these components to remove computational bottlenecks identified in the previous version of dovis . this scheme implements dynamic job control capabilities and achieves dynamic load balancing without a dedicated master cpu . thus , before the parallel docking step , input ligands in sd - file format are partitioned into blocks of n ligands , where n is specified by the user . during parallel docking , each cpu copies the energy grids and other required files to its own temporary directory and requests a block of ligands through a file - lock mechanism . this ensures that each cpu gets one unique set of ligands to work with at a time . after completing a block of ligands , each cpu registers the finished job and updates the top - ranking ligands to the project directory . this process is iterated until all ligand blocks are processed . finally , an assessment script verifies whether all assignments were successfully completed . any requested but unfinished ligand block is added back to the original list of blocks to be reprocessed . users are notified whether all original jobs were successfully completed or a restart is required to complete the docking project . since each cpu works on one ligand block at a time and these blocks are continuously requested by the available cpus during a dovis run , by using small block sizes ( n < < total number of ligands ) this scheme can provide an effective mechanism for automated , dynamic load balancing . in addition , we provide a mechanism to halt one or more cpus after their current ligand block is completed . the number of cpus needed for a restart run can also be changed from run to run . the current release package provides three approaches to start parallel docking calculations : multithreading , secure shell ( ssh ) , and queuing system . multithreading is suited for shared - memory linux clusters whereas ssh is suited for distributed - memory linux clusters . for the queuing system approach , by design , dovis is capable of running under any queuing system . in this release , we provide an integration with the load sharing facilities ( lsf ) , platform computing inc . however , users may use our integration with lsf as an example to code equivalent cpu management functionalities based on other queuing systems . because queuing systems may impose runtime limits on jobs , we implemented a mechanism to estimate if there is enough runtime left in a cpu to process another ligand block every time a new block is requested . an assessment script monitors the overall progress of the docking jobs and , should runtime limits be exceeded , it notifies the user that a restart is required . in the autodock program , only one ligand is docked at a time in a docking run , and at each time the associated energy grid files corresponding to every atom type in the ligand are loaded into the corresponding cpu . depending on the size of the energy grid and the number of atom types , most of the energy grids , however , can be reused from ligand to ligand . hence , to improve runtime efficiency and reduce i / o file operations , we modified the autodock 4.0 source code to load the energy grid files only once , while docking multiple ligands in a single run . in this mode , energy grids of all atom types are loaded and a block of n ligands are sequentially docked to a receptor . in dovis 2.0 , we use the sd - file format as the ligand i / o format to represent ligand information and associated data . this format increases the portability of the docking results to other modeling software , as most modeling programs are adopting the sd - file format . using the sd - file format , we can embed the estimated autodock binding free energy and our converted autodock 4.0 score ( the corresponding pki value at 298 k ) with each docked ligand . the reason we use the molecular data structure , a c++ object , from openbabel 's c++ library is to be able to manage chemical information and keep the consistency between input and output chemical structures . in contrast , if we were to use the openbabel file - conversion program to convert pdb - files into sd - files , the bonds and bond orders would not be guaranteed to be correct in the converted files . this is because bond information typically does not exist in a pdb - file , and because an agreed - upon , reliable method to consistently predict a bond based purely on inter - atomic distance is not available . instead , we implemented an algorithm that traces input ligand information , processes autodock results , and maps docked ligand atoms back to the input ligand structure . because an output ligand sd - file is based on the information from a corresponding input ligand sd - file , all atomic information , including bond connectivity , is preserved . if an all - atom model is used ( see below , hydrogen options ) , the atoms in the input and the output ligand sd - files have identical sequences . thus , all atoms including non - polar hydrogens can be explicitly modeled during docking . however , the scoring function in autodock 4.0 was developed based on receptor - ligand complexes with only polar hydrogens . in principle , it is necessary to reparameterize the scoring function for the all - hydrogen model . to test the tolerance of the provided default parameters , we docked a set of receptor - ligand complexes using all - atom and polar - hydrogen models . therefore , we provide both models as options in dovis 2.0 . in addition , we coded another option that uses the polar - hydrogen model for docking and then adds non - polar hydrogens to docked ligands for rescoring . this option combines the best of using the original autodock scoring function and the high resolution of all - atom modeling . this also makes it convenient to compute pairwise root mean square deviation ( rmsd ) values between docked and reference ligand structures . it is still recommended that users provide ligands with all hydrogens as inputs even when the polar - hydrogen model is used for docking , as the protonation state of a ligand is clearly represented only when each hydrogen atom is specified . when the autodock parameter file is prepared for a ligand , non - polar hydrogens are removed , and their partial charges are combined with the charge of the attached heavy atom . similarly , receptor energy grids are computed based on either the all - atom or the polar - hydrogen model . it is common practice to apply additional scoring functions to docked ligands after an initial docking run . to facilitate this capability , we provide a wrapper script interface that enables the rescoring of docked ligands with third - party scoring programs . the interface passes a set of predefined parameters , including the working directory , the receptor pdb - file , the docked ligand sd - file , and the name of the scored ligand sd - file to a wrapper script . it also passes customized parameters directly from the dovis input file to a wrapper script . this allows users to prepare a wrapper script to drive a scoring program of choice that is linked to dovis through the dovis input file , where the wrapper script commands are specified . after rescoring , a separate hierarchical clustering algorithm is available to cluster docked ligand poses based on scores from third - party scoring programs . user - selected scores are employed to determine the cluster centers and to save top - ranking ligands . we used eight receptor - ligand complexes from the protein data bank ( pdb ) to evaluate docking results using both all - atom and polar - hydrogen models with the default autodock 4.0 scoring function . the energy grid center was defined as the geometrical center of the bound ligand in the x - ray receptor - ligand complex . the volume of the energy grid was defined as the volume of the bound ligand in the x - ray complex plus the additional volume mapped out by extending the molecular surface by 4.0 in each direction . other autodock parameters were set as follows : five genetic algorithm ( ga ) runs , each with population size of 150 , one million energy evaluations , and a maximum of 27,000 generations per ga run . pairwise rmsd values were calculated between docked ligand poses and the corresponding x - ray ligand . table 1 lists the rmsd values and associated autodock 4.0 scores of the docked ligand poses with the lowest rmsd for each of the eight complexes . the rmsd values of the all - atom model and of the polar - hydrogen model are similar for all eight complexes . for all complexes , except 4dfr ( rmsd > 5.00 ) , the program found ligand poses close to the experimentally determined ligand pose . table 1 also indicates that , except for 1rbp , where the score of the all - atom model is much lower ( predicting less binding affinity ) than the score of the polar - hydrogen model , both models produce similar scores . figure 2 shows the x - ray ligand and the docked ligand poses from the complexes of 1stp and 1rbp . in the case of 1rbp , we believe that van der waals ( vdw ) clashes between the receptor and ligand atoms in the all - atom model caused the difference between the two scores , because , as shown in figure 2 , the binding site of 1rbp is very cramped . in fact , the vdw radii in autodock 4.0 were enlarged to compensate for missing non - polar hydrogens . although our tests suggest that the docking results of both models are generally similar , even when the provided default parameters are used , users should be cautious about using the all - atom model with the default parameters . for a more accurate representation , users should scale down the vdw radii and re - parameterize the autodock 4.0 scoring function when applying the all - atom model . root mean square deviation ( rmsd ) values were calculated between the docked ligand poses and the x - ray ligand based on heavy atoms . the entries in the table show the lowest rmsd values and associated autodock 4.0 scores for docked ligand poses of eight pdb complexes . typically , the difference in rmsd between the all - atom and the polar - hydrogen model is very small ; the average absolute difference is 0.20 . autodock 4.0 score superimpositions of the x - ray ligand and docked ligand poses to the 1stpand 1rbpcomplexes . the x - ray ligand is shown in green ; the docked ligand using the all - atom model is shown in orange ; and the docked ligand position derived from the polar - hydrogen model is shown in cyan , where the non - polar hydrogens were artificially added in the representation . as discussed above , we modified the autodock 4.0 source code to implement a strategy where multiple ligands are docked by loading the energy grids only once . the effect on the performance of the file system resulting from this enhancement is dramatic . for a block of 100 ligands , this strategy results in a reduction of more than 95% in data traffic , which is equivalent to a reduction of one gigabyte of i / o data . thus , when hundreds of cpus are engaged in a virtual screening calculation , the overall impact on transfer rates in the file system is significant . for example , previously on our linux cluster , we had to use the local disk drive at each computing node to minimize excessive i / o operations . using the proposed strategy , we may now use more than 256 cpus of a large cluster to run dovis and access data on the cluster 's central disk drive without degrading the performance of the file system for other applications . in addition , we tested the time needed for dovis to dock a set of 10,000 ligands with varying numbers of cpus . we performed tests with up to 256 cpus on a linux cluster . with the enhancements in the current version of dovis , we observed a near - linear speedup up to the 256 cpus tested using the cluster 's central disk drive . this is in contrast with the previous version of dovis , which was capable of near - linear speedup to no more than 128 cpus using the local disk drive . as an illustration of the technical performance of dovis 2.0 , using a total of 256 cpus this estimate was derived from a virtual screening calculation of 2.3 million ligands from the zinc database ( version 6 ) against a 259-amino acid protein target . the related autodock parameters were set as follows : 10 ga runs , each with population size of 150 , 250,000 energy evaluations , and a maximum of 27,000 generations per ga run . the enhanced dovis software will take multiple conformations of a receptor , automatically set up multiple sets of energy grids , dock ligands into each receptor conformation , and process the results . we have enhanced the dovis software by improving its performance , screening capability , and usability . dovis 2.0 incorporates the most - recent release of autodock , autodock 4.0 , implements a more efficient parallelization scheme , allows for rescoring with user - provided scoring programs , and outputs results in the sd - file format . furthermore , the software comes with an automatic installer and is available to the public under the gnu gpl . the opinions and assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the u.s . department of defense high performance computing modernization program , under the high performance computing software applications institutes initiative . | backgroundsmall - molecule docking is an important tool in studying receptor - ligand interactions and in identifying potential drug candidates .
previously , we developed a software tool ( dovis ) to perform large - scale virtual screening of small molecules in parallel on linux clusters , using autodock 3.05 as the docking engine .
dovis enables the seamless screening of millions of compounds on high - performance computing platforms . in this paper , we report significant advances in the software implementation of dovis 2.0 , including enhanced screening capability , improved file system efficiency , and extended usability.implementationto keep dovis up - to - date , we upgraded the software 's docking engine to the more accurate autodock 4.0 code .
we developed a new parallelization scheme to improve runtime efficiency and modified the autodock code to reduce excessive file operations during large - scale virtual screening jobs .
we also implemented an algorithm to output docked ligands in an industry standard format , sd - file format , which can be easily interfaced with other modeling programs .
finally , we constructed a wrapper - script interface to enable automatic rescoring of docked ligands by arbitrarily selected third - party scoring programs.conclusionthe significance of the new dovis 2.0 software compared with the previous version lies in its improved performance and usability .
the new version makes the computation highly efficient by automating load balancing , significantly reducing excessive file operations by more than 95% , providing outputs that conform to industry standard sd - file format , and providing a general wrapper - script interface for rescoring of docked ligands .
the new dovis 2.0 package is freely available to the public under the gnu general public license . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
urinary catheterization , either indwelling or intermittent , is often utilized for the treatment of chronic voiding dysfunction associated with multiple sclerosis ( ms ) . to the outside observer , unfortunately , for patients with ms and other neurologic conditions refusing to catheterize is not an option . to date our unit previously demonstrated significant rates of satisfaction with the evaluation and treatment of bladder and bowel dysfunction in patients with ms . recent efforts to increase patient , family , and clinician awareness regarding the importance of pelvic floor issues appear to be positively received by most ms patients and to favorably impact their qol . the goal of this study was to determine the prevalence of urinary catheterization among men and women with ms using a large community - dwelling population sample . the impact of this urinary catheterization on ms patient qol , including positive versus negative responders , was also assessed . the consortium of multiple sclerosis centers ( http://www.mscare.org/ ) administer the largest registry in north america of ms patients who agree to participate in research related activities , called the north american research committee of multiple sclerosis ( narcoms ) registry . the narcoms registry captures self - reported demographic and clinical information from patients with ms at enrollment and semiannually thereafter , via questionnaires administered either online or by mail , per participant preference . the registry is the largest self - report database of patients with ms worldwide , with more than 16,000 active participants , and is approved by the western institutional review board ( irb ) and the irb at the university of alabama at birmingham . deidentified data from the fall 2010 questionnaire was supplied for analysis by narcoms in the form of an excel spreadsheet with a data dictionary . at enrollment in narcoms , each semiannual narcoms questionnaire includes an assessment of disability status and quality of life ( qol ) . the patient determined disease steps ( pdds ) measures disability based on self - report and has been validated in large ms populations against the physician - scored expanded disability status scale [ 36 ] . it is scored from 0 to 8 , with 0 defined as no disability and 8 as bed bound ( barriers ) . respondents are also evaluated for bladder and spasticity disability using standardized questionnaires . in the fall of 2010 the authors collaborated with the staff of the narcoms database to create a short 2-page questionnaire for inclusion in the fall 2010 questionnaire regarding pelvic floor disorders . specifically , patients were asked their degree of bother with urinary / bladder , bowel , and sexual problems based on a 4-point scale ( 1 not at all bothered , 4 severely bothered ) . patients were queried as to whether their health care provider ( hcp ) had inquired about each type of pelvic floor complaint in the last 12 months ( yes versus no ) . patients were further asked to rate on a 5-point likert scale ( 1 not at all , 5 completely ) their satisfaction with the care they received for each complaint . finally , they were asked if their quality of life had changed with treatment ( 7-point likert scale , 1 much better , 7 much worse ) . utilization of any form of urinary catheterization was assessed , including type of catheter used ( intermittent self - catheterization ( isc ) , suprapubic catheterization ( sc ) , and transurethral foley catheterization ( tfc ) ) . medication usage , evaluation by a urologist , and correlation with disability as measured by pdds score were also evaluated . , cary , n.c . ) and descriptive statistics , chi - square tests for frequency data and calculation of correlation coefficients and 95% confidence intervals were constructed as appropriate . in the fall of 2010 , the biannual narcoms questionnaire was delivered to 14268 participants of which 9397 ( 66% ) responses were returned . respondents were primarily white ( 89% ) , women ( 77.4% ) , with an average age of 55 ( sd 10.5 ) years ( table 1 ) . significant disability , defined as a pdds score 3 ( representing gait disability or worse ) was reported by 6070 ( 64.6% ; 95% ci [ 63.6 , 65.5 ] ) respondents . moderate to severe bladder disability scores were reported by 2743 ( 29.2% ; 95% ci [ 28.3 , 30.1 ] ) of respondents , with 281 ( 3% ; 95% ci [ 2.7 , 3.4 ] ) reporting total loss of bowel and bladder control . overall , 12.8% of all respondents reported current urinary catheterization use ( table 2 ) . the types of catheters used by respondents included intermittent self - catheterization , foley catheter ( indwelling ) , and suprapubic . intermittent catheterization was by far the most commonly used method reported by patients ( p < 0.005 ) . patients who reported urinary incontinence were more likely to utilize urinary catheterization . greater than fifty percent of all respondents ( 5143 ( 54.7% ) ) reported some current urinary leakage complaints . among these incontinent patients , 1201 ( 23.4% ) reported current catheter use . urinary catheter use had an unpredictable impact on qol , although most patients reported the impact to be positive . among the current catheter users ( n = 1193 ) , 629 ( 52.4% ) respondents reported catheterization having a positive impact on qol , 304 ( 25.3% ) reported a negative impact , and 260 ( 21.8% ) reported neutral impact ( table 3 ) . type of catheter used did not appear to predict impact qol , as equal numbers of patients reporting positive , negative or neutral impact of catheterization on qol used each form of catheter ( table 3 , p = 0.631 ) . the majority of patients reported a positive impact of catheter use on their qol ( table 4 ) . using a 7-point likert scale , patients graded the impact of urinary catheterization on their qol . the largest proportion of patients reported a very positively / positively / slightly positively increasing degree of physical disability did not predict positive , negative , or neutral impact of catheter use on qol . using a pdds score of > 3 as a marker of significant disability , equal numbers of patients reported positive , negative or neutral impact of catheter use on their qol ( table 3 ) . however , as patient disability continued to progress ( pdds score 35 versus 68 ) , greater numbers of patients reported using urinary catheterization as a treatment method and tended to be satisfied with their care for this complaint ( p = 0.004 and p < 0.001,table 5 ) . age did not appear to impact satisfaction rates with respondents 55 years compared to > 55 years of age who reported a similar level of satisfaction ( very / completely ) for bladder complaints ( p = 0.202 ) . among the ms patient population , urinary catheterization is common . given that 2556% of ms patients suffer from obstructive phase voiding dysfunction , catheterization remains a useful and necessary treatment choice for patients and their providers . while some studies have evaluated qol in and barriers to catheter use in nonspecific patient populations , little attention has been awarded to the patient - oriented impact of catheter use in the ms population . our large database of ms patients with a questionnaire response rate of 66% allows specific investigation into the question of catheterization and qol in ms . large proportions of catheterized ms patients report either negative or positive changes in qol associated with urinary catheterization , suggesting that there is no clear positive or negative impact of this treatment . patients with higher bladder distress symptom and spasticity scores tended to report a negative impact on qol , although this difference could be related to their more severe ms disease state , higher ms relapse rate , or both . similar findings were noted by bolinger et al . reporting that patients with reduced manual dexterity had increased difficulty with intermittent catheter insertion and dissatisfaction with this therapy . in general , more severely affected patients may tend to report increasingly negative impact on qol . patient pdds scores demonstrated a trend towards significance with regards to positive versus negative impact of catheterization on qol . again , the more severely affected patients tended to report a higher pdds score ( more severe disease state ) . consistently , as pdds scores increased , more patients appeared to view catheterization as a helpful treatment ( positive qol impact ) . urinary catheterization does not appear to have the universally negative impact on patient qol that is often assumed to accompany this treatment . given the importance of urinary catheterization to the management of daily lives of a significant proportion of ms patients , closer examination of the predictors of positive or negative qol an improved understanding of how to optimize a catheterizing patient 's qol can assist healthcare providers in delivering a higher quality of care . more specific predictors as well as patient opinions associated with catheter use in ms patients should be explored to further delineate contributions to negative or positive qol . | background . multiple sclerosis ( ms )
healthcare providers ( hcp ) have undergone considerable educational efforts regarding the importance of evaluating and treating pelvic floor disorders , specifically , urinary dysfunction
. however , limited data are available to determine the impact of catheterization on patient quality of life ( qol ) . objectives . to describe the use of urinary catheterization among ms patients and determine the differences between those who report positive versus negative impact of this treatment on qol . methods .
patients were queried as part of the 2010 north american research committee on multiple sclerosis survey ; topics included 1 ) urinary / bladder , bowel , or sexual problems ; 2 ) current urine leakage ; 3 ) current catheter use ; 4 ) catheterizing and qol . results .
respondents with current urine leakage were 5143 ( 54.7% ) , of which 1201 reported current catheter use ( 12.8% ) .
the types of catheters ( intermittent self - catheterization and foley catheter ( indwelling and suprapubic ) ) did not differ significantly .
of the current catheter users , 304 ( 25.35% ) respondents reported catheterization negatively impacting qol , 629 ( 52.4% ) reported a positive impact on qol , and 223 ( 18.6% ) reported neutral qol . conclusions . a large proportion of catheterized ms patients report negative or positive changes in qol associated with urinary catheterization .
urinary catheterization does not appear to have a universally negative impact on patient qol . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
diabetes mellitus ( dm ) is a clinical syndrome characterized by inappropriate hyperglycemia caused by absolute or relative deficiency of insulin or resistance to the action of insulin at the cellular level . dm is one of the most common endocrine and metabolic disorders of the 21st century , and a major threat to healthcare worldwide . world health organization ( who ) suggests that the global population is in the midst of a diabetes epidemic and the number of cases for diabetes that is currently 171 million is predicted to reach 366 million by the year 2030 . majority of patients with diabetes have type 2 or non - insulin - dependent diabetes while the remainder has type 1 or insulin dependent diabetes . although the two types have distinct pathogenesis , hyperglycemia and various life - threatening complications resulting from long - term hyperglycemia are the most common features . the complications of diabetes are associated with elevated levels of plasma triglycerides and cholesterol ( due to an increase in plasma concentration of vldl and ldl ) . these play significant roles in the accelerated development of arteriosclerotic vascular disease . since the major cause of diabetes is a defect in insulin , it is then required to develop pharmacological agents that could prevent beta - cell destruction or promote beta cell regeneration in the pancreas . this has led to the continued search for new antidiabetic drugs in the folklore / ayurvedic medicine with the aim of getting less expensive and safer management options . a plant commonly used for its antidiabetic activity is cryptolepis sanguinolenta containing cryptolepine , an indoloquinoline alkaloid . cryptolepis sanguinolenta is a thin - stemmed twining and scrambling shrub up to 8 m long , containing yellow - orange juice which becomes red upon drying . the plant is native to west africa and is found in countries like ghana , cote divoire , guinea , guinea - bissau , mali , nigeria , senegal , sierra leone , angola , congo , uganda , and cameroon . it is a medicinal plant used by some traditional herbalist in the treatment of fever , urinary , and upper respiratory tract infections . the use of this plant as a medical therapy has increased as it has been proposed that the root and leave extracts have hypotensive , antipyretic , anti - inflammatory , antidiarrhoeal , in vitro antibacterial and antimalarial effects . it is commonly called nibima , kadze , gangamau , or yellow - die root . studies have documented the antidiabetic potentials of cryptolepis sanguinolenta;[1012 ] however , there is still a dearth of information in the open scientific literature on the studies that evaluated the effect of the cryptolepis sanguinolenta on intestinal glucose absorption and transport . therefore , we decided to bridge this gap and provide scientific information on the role of glucose absorption and transport as a mechanism of the antidiabetic activity of cryptolepis sanguinolenta . stem of cryptolepis sanguinolenta were obtained from ojurin akobo- olorunda road , oyo , oyo state , nigeria . the plant was authenticated by ugbogu . a , chukwuma e.c , and shasanya o.s of the forest herbarium , ibadan , nigeria , where a voucher specimen ( fhi 108847 ) was deposited . the dried stem was broken into pieces and beaten into smaller sizes using mortar and pestle before being pulverized . the powder formed after pulverization was weighed and stored until required . the extract was filtered using clothen sieve and was evaporated at 40c . from the viscous solution gotten , a 0.1 m solution of extract was prepared by dissolving 5 ml of viscous solution of extract in 45 ml of distilled water . wistar albino rats weighing 130 - -170 g were obtained from the animal house of the department of physiology , ladoke akintola university of technology , ogbomoso , nigeria . the rats were housed in standard plastic cages , with 12-hour light -- dark cycle . animals in the test groups ( 1 , 2 , and 3 ) were orally fed using oral cannula once daily with 50 mg / kg , 150 mg / kg , and 250 mg / kg body weight of extract respectively . all animals received humane care in compliance with the institution 's guideline and criteria for humane care as outlined in the national institute of health guidelines for the care and use of laboratory animals . the blood samples used for the glucose test were obtained by pricking the tip of the tail of the rat . the blood was collected into edta bottles , spinned with centrifuge for 5 minutes , and the plasma was separated for lipid profile analysis . the animals were fasted for a 12-hour period and the initial fasting blood glucose were taken for the four groups on the day one of the experiment using glucometer . the blood taken from the tail tip the final blood glucose of the rats was taken after an about 24-hour fasting period after administering the extract for 21 days . after an overnight fast , each animal was anesthetized using urethane ( 0.6 ml of 25% w / v of urethane per 100 g body weight ) . the intestine was gently pushed out without much massage and two intestinal segments ( 15 - -20 cm long ) were identified for consistency ; it was always ensured that the first segment was just distal to the ligament of trez while the other was just proximal to the ileo -- cecal junction . the segments were opened at both ends and washed by syringe irrigation with kreb 's bicarbonate solution the excess fluid being removed by gently forcing air under low pressure through the segment . each segment was thereafter filled with 4 ml of kreb 's bicarbonate solution containing 5.6 mm glucose and 2 g / l polyethylene glycol ( peg ) after which the ends were ligated . the segments were replaced in the abdominal cavity , which was closed with a clamp . each study lasted for an hour , after which the two segments were removed from each animal . the samples were then analyzed for glucose with the use of glucose strip and glucometer . the abdomen was opened and the whole of the small intestine taken out and flushed with kreb 's bicarbonate solution . polyethylene tubing , closed at one end , was inserted and tied at one end of the intestinal loop ; through this , the gut was everted and placed in kreb 's bicarbonate solution . four segments ( 5 - -8 cm ) were prepared for eat animal , one of the ends being tied with a thread and the other ends encircled by a ligature of trez 0.5 ml of kreb 's bicarbonate solution and a bubble of 95% 5% o2/c02 mixture was introduced into each sac through a syringe and the loose ligature tied . the sac was then placed in the fest tube containing 10 ml of kreb 's bicarbonate solution kept at 37c and aerated continuously . after 30 minutes of incubation , the sacs were removed and the contents emptied for the determination of glucose concentration using glucometer and glucometer strips . after the experiment period , the animals were killed and blood was taken via cardiac puncture . the blood was collected in edta bottles , spinned , and the plasma was collected from the whole blood . the plasma was used for lipid analysis which includes tests for triglyceride ( tg ) , total cholesterol ( tc ) , and high - density lipoprotein ( hdl ) using a reagent kit from randox laboratory ltd . , uk . low - density lipoprotein ( ldl ) was calculated using friedewald 's equation which is given as : ldl = tc hdl tg/ 50 . after the 21st day , the animals were killed through cervical dislocation and opened up . five micrometer thick sections were prepared and mounted on slides and stained with hematoxylin and eosin ( h&e ) . values for blood glucose before and after treatment were analyzed using a paired t - test , while those for the lipid profile were analyzed using an unpaired t - test to compare each test group and control . all analyses were done using the statistical package for social sciences ( spss inc . , chicago , il , usa ) . stem of cryptolepis sanguinolenta were obtained from ojurin akobo- olorunda road , oyo , oyo state , nigeria . the plant was authenticated by ugbogu . a , chukwuma e.c , and shasanya o.s of the forest herbarium , ibadan , nigeria , where a voucher specimen ( fhi 108847 ) was deposited . the dried stem was broken into pieces and beaten into smaller sizes using mortar and pestle before being pulverized . the powder formed after pulverization was weighed and stored until required . the extract was filtered using clothen sieve and was evaporated at 40c . from the viscous solution gotten , a 0.1 m solution of extract was prepared by dissolving 5 ml of viscous solution of extract in 45 ml of distilled water . wistar albino rats weighing 130 - -170 g were obtained from the animal house of the department of physiology , ladoke akintola university of technology , ogbomoso , nigeria . the rats were housed in standard plastic cages , with 12-hour light -- dark cycle . animals in the test groups ( 1 , 2 , and 3 ) were orally fed using oral cannula once daily with 50 mg / kg , 150 mg / kg , and 250 mg / kg body weight of extract respectively . all animals received humane care in compliance with the institution 's guideline and criteria for humane care as outlined in the national institute of health guidelines for the care and use of laboratory animals . the blood samples used for the glucose test were obtained by pricking the tip of the tail of the rat . the blood was collected into edta bottles , spinned with centrifuge for 5 minutes , and the plasma was separated for lipid profile analysis . the animals were fasted for a 12-hour period and the initial fasting blood glucose were taken for the four groups on the day one of the experiment using glucometer . the blood taken from the tail tip the final blood glucose of the rats was taken after an about 24-hour fasting period after administering the extract for 21 days . after an overnight fast , each animal was anesthetized using urethane ( 0.6 ml of 25% w / v of urethane per 100 g body weight ) . the intestine was gently pushed out without much massage and two intestinal segments ( 15 - -20 cm long ) were identified for consistency ; it was always ensured that the first segment was just distal to the ligament of trez while the other was just proximal to the ileo -- cecal junction . the segments were opened at both ends and washed by syringe irrigation with kreb 's bicarbonate solution the excess fluid being removed by gently forcing air under low pressure through the segment . each segment was thereafter filled with 4 ml of kreb 's bicarbonate solution containing 5.6 mm glucose and 2 g / l polyethylene glycol ( peg ) after which the ends were ligated . the segments were replaced in the abdominal cavity , which was closed with a clamp . each study lasted for an hour , after which the two segments were removed from each animal . the samples were then analyzed for glucose with the use of glucose strip and glucometer . the everted intestinal sac technique was used . after an overnight fast , animals were killed by ether anesthesia . the abdomen was opened and the whole of the small intestine taken out and flushed with kreb 's bicarbonate solution . polyethylene tubing , closed at one end , was inserted and tied at one end of the intestinal loop ; through this , the gut was everted and placed in kreb 's bicarbonate solution . four segments ( 5 - -8 cm ) were prepared for eat animal , one of the ends being tied with a thread and the other ends encircled by a ligature of trez 0.5 ml of kreb 's bicarbonate solution and a bubble of 95% 5% o2/c02 mixture was introduced into each sac through a syringe and the loose ligature tied . the sac was then placed in the fest tube containing 10 ml of kreb 's bicarbonate solution kept at 37c and aerated continuously . after 30 minutes of incubation , the sacs were removed and the contents emptied for the determination of glucose concentration using glucometer and glucometer strips . after the experiment period , the animals were killed and blood was taken via cardiac puncture . the blood was collected in edta bottles , spinned , and the plasma was collected from the whole blood . the plasma was used for lipid analysis which includes tests for triglyceride ( tg ) , total cholesterol ( tc ) , and high - density lipoprotein ( hdl ) using a reagent kit from randox laboratory ltd . , uk . low - density lipoprotein ( ldl ) was calculated using friedewald 's equation which is given as : ldl = tc hdl tg/ 50 . after the 21st day , the animals were killed through cervical dislocation and opened up . five micrometer thick sections were prepared and mounted on slides and stained with hematoxylin and eosin ( h&e ) . values for blood glucose before and after treatment were analyzed using a paired t - test , while those for the lipid profile were analyzed using an unpaired t - test to compare each test group and control . all analyses were done using the statistical package for social sciences ( spss inc . , chicago , il , usa ) . there were significant ( p<0.05 ) reductions in the blood glucose concentrations in the treated groups [ figure 1 ] . there were also significant ( p<0.05 ) reductions in the fasting plasma levels of tc , tg , and ldl cholesterol in the treated groups . the changes seen were dose related . effects of graded doses of cryptolepis sanguinolenta stem ethanolic extract on plasma glucose and lipid profile in normoglycaemic rats . bars carrying letter different on each parameter are significantly different at p<0.05 similarly , intestinal glucose absorption and transport were also significantly ( p<0.05 ) reduced in all treated animals in a dose - dependent manner [ figures 2 and 3 ] . effect of graded doses of cryptolepis sanguinolenta stem ethanolic extract on intestinal glucose absorption ( in vivo ) in normoglycaemic rats . bars carrying different letters on each minute are significantly different at p<0.05 effect of graded doses of cryptolepis sanguinolenta stem ethanolic extract on glucose transport ( in vitro ) in normoglycaemic rats . bars carrying different letters on each minute are significantly different at p<0.05 a microscopic study showed an increase in the sizes of islet of langerhans and altered -cells counts [ figure 4 ] . ( a ) the slide above shows the normal size of the islet of langerhans and normal count of the -cells . ( b ) there are increased sizes of the islet of langerhans and the number of -cells equally increased . the number of -cells is much but the count is reduced compared to the count seen in the control group . ( d ) the langerhans are enlarged compared to other groups and the -cells count has been reduced to about 28 counts . along with hyperglycemia and abnormalities in serum lipids , diabetes is usually associated with microvascular and macrovascular complications which are the major causes of morbidity and mortality in diabetic individuals . therefore , the search for more effective and safer hypoglycemic agents from plants and other natural sources has continued to be an area of interest for many researchers . plants are a major source of drugs and many currently available drugs have been directly or indirectly obtained from botanicals . phytochemical screening helps to reveal the chemical constituents of the plant extract and the one that predominates over the others . it is also used to search for bioactive agents for starting products used in the synthesis of some useful drugs . results from the phytochemical analyses of cryptolepis sanguinolenta have shown the presence of cryptolepine , an indoloquinoline alkaloid , as its major alkaloids.[1922 ] crude extracts of cryptolepis sanguinolenta and their fractions , as well as indoquinoline alkaloids isolated from the plant , have been shown to have antidiabetic activity . various studies have linked its antidiabetic activity to its effects on pancreas and glucose transport , but none has associated it with glucose intestinal absorption . this study thus documents the influence of cryptolepis sanguinolenta on intestinal glucose absorption and transport in relation to its antihyperglycemic potentials . in the present study , we noticed dose - related reductions in plasma glucose in cryptolepis sanguinolenta - treated normoglycemic rats . similarly , the extract reduced total cholesterol , triglyceride , and ldl cholesterol in treated rats when compared to the control . the level of serum lipids is usually raised in diabetes , and such an elevation represents a risk factor for coronary heart diseases . the alterations in plasma glucose and lipid profile seen in treated animals could be beneficial in preventing diabetic complications as well as in improving lipid metabolism in diabetics . the findings of this experimental animal study also showed that cryptolepis sanguinolenta significantly depressed intestinal glucose absorption and transport in the normoglycemic rats in a dose - related manner . the depression of glucose absorption and transport observed may account for the antihyperglycemic effect of the botanical with resultant enhancement of lipid profile . this is in tandem with previous study that reported that cryptolepis sanguinolenta reduced glucose transport and caused hypoglycemia . observations in this study also showed that cryptolepis sanguinolenta treatment led to increased cell sizes . the fundamental mechanism underlying hyperglycemia involves overproduction ( excessive hepatic glycogenolysis and gluconeogenesis ) and decreased utilization of glucose by the tissues . the hypertrophied cells might be responsible for enhanced insulin production and activity with resultant hypoglycemia . the reduction in the blood glucose levels of the treated animals confirms the hypoglycemic effect of cryptolepis sanguinolenta stem extract . the findings in this study revealed that the extract acted via several mechanisms such as slowing down the absorption and transport of glucose from the guts , and increasing insulin production by the pancreas from possibly the hypertrophied cells . these mechanisms of action corroborates other mechanisms previously reported such as increase glucose uptake by 3t3-l1 cells,[1012 ] and enhancement of insulin - mediated glucose disposal . the hypoglycemic activity of the extract seen in the present study could be attributed to its alkaloid constituents . alkaloids have been reported to improve insulin resistance in mice and high fat - fed rats . they can activate amp - activated protein kinase in 3t3-l1 adipocytes and l6 myotubes and facilitate glut4 translocation in l6 myotubes in a phosphatidylinositol 3-kinase - independent manner . they have also been reported to promote glucose uptake in hepg2 and 3t3-l1 cells independent of insulin action . in addition , it effectively inhibits sucrase and maltase activities to the same extent as acarbose does in caco-2 intestinal cells and possibly inhibit -glucosidase activities to reduce glucose absorption . it has also been documented to significantly reduce serum il-6 with insulin sensitivity improvement.[3032 ] this study provides a new mechanism of action of the hypoglycemic activity of alkaloids - containing cryptolepis sanguinolenta stem extract . based on our findings , we lend credence to the use of cryptolepis sanguinolenta in the management of diabetes mellitus . the hypoglycemic activity of cryptolepis sanguinolenta is associated with its influence to reduce intestinal glucose absorption and transport . | objective : extracts from various morphological parts of cryptolepis sanguinolenta are widely used traditionally in folklore medicine in many parts of the world for the management , control , and/or treatment of a plethora of human ailments , including diabetes mellitus . in order to scientifically appraise some of the ethnomedical uses of cryptolepis sanguinolenta , the present study was undertaken to investigate its influence at varying doses on intestinal glucose absorption and transport in relation to its hypoglycemic and hypolipidemic effects in rat experimental paradigms.materials and methods : the animals used were divided into four groups .
control animals received 2 ml of distilled water , while treated groups received 50 , 150 , and 250 mg / kg bw of cryptolepis sanguinolenta extract per oral respectively daily for 21 days.results:cryptolepis sanguinolenta led to a significant decrease in glucose transport and absorption .
it also caused significant reductions in plasma glucose , total cholesterol , triglyceride , and ldl cholesterol .
biochemical changes observed were suggestive of dose dependence .
histopathological studies also showed increased sizes of cells of the pancreas.conclusion:the findings in these normoglycemic laboratory animals suggest that cryptolepis sanguinolenta has hypoglycemic and hypolipidemic activities , possibly by reducing glucose absorption and transport , and enhancing the structural and functional abilities of the cells .
this is the first study to report the effect of cryptolepis sanguinolenta on intestinal glucose absorption .
this effect could be attributed to its major bioactive principle , cryptolepine , an indoloquinoline alkaloid .
this study thus lends credence to the use of cryptolepis sanguinolenta in the management of diabetes mellitus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
between september 2000 and january 2006 , 35 nonuremic type 1 diabetic patients received an islet cell transplant under atg induction therapy and maintenance immune suppression with mycophenolate mofetil ( mmf ) and tacrolimus . they were all c - peptide negative , had large within - subject variation of fasted glycemia ( coefficient of variation of prebreakfast glycemia [ cvfg ] > 25% ) , and one or more signs of diabetic lesions ( hypoglycemic unawareness , microalbuminuria , or retinopathy ) . the first 24 patients had been included in a phase 1 graft - dose finding study and the last 11 patients in a protocol that aims to assess influence of tapering of tacrolimus after month 12 . graft survival with this immune - suppressive regimen informed consent had been obtained from all candidate recipients before they were listed as such by the eurotransplant foundation . selection for transplantation occurred on basis of listing date , bloodgroup compatibility with the available graft , and health status . at the time of transplantation , analysis for cytomegalovirus ( pcr and serology ) and hepatitis a , b , and c ( serology ) at baseline excluded active disease . two patients tested positive for complement - binding hla antibodies pretransplantation , two patients that discontinued immune suppression during the first 6 months and one patient that died from a cerebral hemoraghe at 18 weeks posttransplant . for all islet cell grafts used , a sample was taken before transplantation and analyzed for its insulin synthesis capacity in the absence and presence of glucose ( 10 mmol / l ) . they all fulfilled the set criteria for function ( i.e. , minimally 20 pmol insulin synthesized per 2 h per million -cells ) . preparations were analyzed for their cellular composition and combined to grafts before being infused into the portal vein using either a laparoscopic ( n = 16 ) ( 21 ) or subcutaneous transhepatic approach ( n = 14 ) ( 22 ) . induction therapy consisted of rabbit atg ( fresenius hemocare , redmond , wa ) initiated 14 days before transplantation . a first dose of 9 mg / kg body wt was followed by 3 mg / kg for 6 days ; no injection was given on days with a t - cell count < 50 cells / mm . maintenance immunesuppression consisted of mmf ( 2,000 mg / day cellcept starting on the day of the first atg injection ; gift of roche , brussels , belgium ) and tacrolimus ( prograft , starting 1 day before the last atg injection , fujisawa ) . tacrolimus troughlevels were maintained between 8 and 10 ng / ml during the first 3 months after an islet cell transplantation and 68 ng / ml thereafter . this mmf - tacrolimus treatment was continued when a second islet cell transplant was given , without additional antibody course , but with one injection of 500 mg methylprednisolone 3 h before transplantation . anticoagulant therapy was started 1 day after infusion and consisted of acetylsalycilic acid 100 mg once daily in all patients and additional low molecular weight heparin at preventive dosage in 18 subjects ( 0.3 ml fraxiparin once daily ) . efficacy and safety criteria were examined weekly during the first 6 weeks posttransplant , every 2 weeks between posttransplant week 6 and 12 , and monthly thereafter . plasma c - peptide ( trfia ; perkin - elmer , turku , finland ) with corresponding glycemia , a1c levels ( hplc ; pharmacia biotech , upsala , sweden ) , and autoantibodies [ islet cell antibody , ia2a , gad antibody , and i(a)a ] were assayed in the central laboratory of the belgian diabetes registry ( 23 ) . there was also a central measurement of lymphocyte subsets cd3 + , cd4 + , cd8 + , cd19 + , and nk cells ( cd3cd16+cd56 + ) ( epicsxl flow cytometer ; beckman coulter , miami , fl ) . the majority of patients ( n = 24 ) were treated with a subcutaneous insulin pump for at least 2 months prior to transplantation . in one patient , insulin tapering was only considered in patients with plasma c - peptide values 1.0 ng / ml ( at glycemia 120220 mg / dl ) , cvfg < 25% , and mean fasting glycemia < 125 mg / dl and was started after month 2 at a rate of 2 iu every 35 days or faster when patients experienced hypoglycemic episodes ( < 70 mg / dl ) . baseline t - cell autoreactivity to islet cell antigens was assessed at the leiden university medical center and data analyzed blinded from clinical outcome . blood was drawn before the first atg administration , and peripheral blood mononuclear cells were isolated and processed as described before ( 24 ) . briefly , 150,000 fresh peripheral blood mononuclear cells were cultured in triplicate in 96-well round - bottomed plates in iscove 's modified dulbecco 's medium with 2 mmol / l glutamine ( life technologies , paisley , scotland ) and 10% pooled human serum in presence of islet autoantigens ia-2 ( 10 g / ml ) or gad65 ( 10 g / ml ) , of interleukin-2 ( 35 units / ml ) , or of medium alone . after 5 days , h - thymidine ( 0.5 ci / well ) was added and its incorporation measured after 16 h. data were expressed as a stimulation index ( si ) by comparison with the medium alone value . an si 3 for any of the two antigens was considered a sign of t - cell autoreactivity against an islet cell antigen . in three patients , cellular autoreactivitiy could not be assessed because autoantigens were not available for testing of baseline samples . in one patient , a third islet cell preparation was injected at posttransplant week 60 . during the laparoscopically guided infusion , immunohistochemistry was performed on semiconsecutive paraffin - embedded sections using a rabbit insulin antibody ( raised by dr c. van schravendijk , vrije universiteit brussels , brussels , belgium ) and monoclonal cd3 ( neomarkers , freemont , ca ) and cd20 ( dako , glostrup , denmark ) antibodies . human tonsils and pancreas was used as control . for epitope retrieval , sections were heated to 98c with citrate buffer , ph 6.0 . all values are expressed as median and interquartile range ( iqr ) , unless indicated otherwise . baseline and postransplant characteristics were related with status of insulin independence at month 6 as well as -cell graft function and glycemic variability during the first 6 months . to assess differences between subgroups , we used nonparametric mann - whitney u test for continuous data and fisher 's exact test for categorical data . correlations between baseline characteristics and cvfg or mean c - peptide during the first 6 months after transplantation were assessed by calculating pearson 's correlation coefficient . to determine independent predictor ability of the variables , we used forward stepwise binary logistic regression analysis for insulin independence and a stepwise linear regression model for both cvfg and mean c - peptide . all analysis were performed using spps ( version 16.0 ) , and graphics were computed by graphpad prism ( version 4.0 ) . all reported p values are two sided , and p < 0.05 was considered significant . between september 2000 and january 2006 , 35 nonuremic type 1 diabetic patients received an islet cell transplant under atg induction therapy and maintenance immune suppression with mycophenolate mofetil ( mmf ) and tacrolimus . they were all c - peptide negative , had large within - subject variation of fasted glycemia ( coefficient of variation of prebreakfast glycemia [ cvfg ] > 25% ) , and one or more signs of diabetic lesions ( hypoglycemic unawareness , microalbuminuria , or retinopathy ) . the first 24 patients had been included in a phase 1 graft - dose finding study and the last 11 patients in a protocol that aims to assess influence of tapering of tacrolimus after month 12 . graft survival with this immune - suppressive regimen informed consent had been obtained from all candidate recipients before they were listed as such by the eurotransplant foundation . selection for transplantation occurred on basis of listing date , bloodgroup compatibility with the available graft , and health status . at the time of transplantation , analysis for cytomegalovirus ( pcr and serology ) and hepatitis a , b , and c ( serology ) at baseline excluded active disease . two patients tested positive for complement - binding hla antibodies pretransplantation , two patients that discontinued immune suppression during the first 6 months and one patient that died from a cerebral hemoraghe at 18 weeks posttransplant . for all islet cell grafts used , a sample was taken before transplantation and analyzed for its insulin synthesis capacity in the absence and presence of glucose ( 10 mmol / l ) . they all fulfilled the set criteria for function ( i.e. , minimally 20 pmol insulin synthesized per 2 h per million -cells ) . preparations were analyzed for their cellular composition and combined to grafts before being infused into the portal vein using either a laparoscopic ( n = 16 ) ( 21 ) or subcutaneous transhepatic approach ( n = 14 ) ( 22 ) . induction therapy consisted of rabbit atg ( fresenius hemocare , redmond , wa ) initiated 14 days before transplantation . a first dose of 9 mg / kg body wt was followed by 3 mg / kg for 6 days ; no injection was given on days with a t - cell count < 50 cells / mm . maintenance immunesuppression consisted of mmf ( 2,000 mg / day cellcept starting on the day of the first atg injection ; gift of roche , brussels , belgium ) and tacrolimus ( prograft , starting 1 day before the last atg injection , fujisawa ) . tacrolimus troughlevels were maintained between 8 and 10 ng / ml during the first 3 months after an islet cell transplantation and 68 ng / ml thereafter . this mmf - tacrolimus treatment was continued when a second islet cell transplant was given , without additional antibody course , but with one injection of 500 mg methylprednisolone 3 h before transplantation . anticoagulant therapy was started 1 day after infusion and consisted of acetylsalycilic acid 100 mg once daily in all patients and additional low molecular weight heparin at preventive dosage in 18 subjects ( 0.3 ml fraxiparin once daily ) . efficacy and safety criteria were examined weekly during the first 6 weeks posttransplant , every 2 weeks between posttransplant week 6 and 12 , and monthly thereafter . plasma c - peptide ( trfia ; perkin - elmer , turku , finland ) with corresponding glycemia , a1c levels ( hplc ; pharmacia biotech , upsala , sweden ) , and autoantibodies [ islet cell antibody , ia2a , gad antibody , and i(a)a ] were assayed in the central laboratory of the belgian diabetes registry ( 23 ) . there was also a central measurement of lymphocyte subsets cd3 + , cd4 + , cd8 + , cd19 + , and nk cells ( cd3cd16+cd56 + ) ( epicsxl flow cytometer ; beckman coulter , miami , fl ) . the majority of patients ( n = 24 ) were treated with a subcutaneous insulin pump for at least 2 months prior to transplantation . in one patient , insulin tapering was only considered in patients with plasma c - peptide values 1.0 ng / ml ( at glycemia 120220 mg / dl ) , cvfg < 25% , and mean fasting glycemia < 125 mg / dl and was started after month 2 at a rate of 2 iu every 35 days or faster when patients experienced hypoglycemic episodes ( < 70 mg / dl ) . baseline t - cell autoreactivity to islet cell antigens was assessed at the leiden university medical center and data analyzed blinded from clinical outcome . blood was drawn before the first atg administration , and peripheral blood mononuclear cells were isolated and processed as described before ( 24 ) . briefly , 150,000 fresh peripheral blood mononuclear cells were cultured in triplicate in 96-well round - bottomed plates in iscove 's modified dulbecco 's medium with 2 mmol / l glutamine ( life technologies , paisley , scotland ) and 10% pooled human serum in presence of islet autoantigens ia-2 ( 10 g / ml ) or gad65 ( 10 g / ml ) , of interleukin-2 ( 35 units / ml ) , or of medium alone . after 5 days , h - thymidine ( 0.5 ci / well ) was added and its incorporation measured after 16 h. data were expressed as a stimulation index ( si ) by comparison with the medium alone value . an si 3 for any of the two antigens was considered a sign of t - cell autoreactivity against an islet cell antigen . in three patients , cellular autoreactivitiy in one patient , a third islet cell preparation was injected at posttransplant week 60 . during the laparoscopically guided infusion , immunohistochemistry was performed on semiconsecutive paraffin - embedded sections using a rabbit insulin antibody ( raised by dr c. van schravendijk , vrije universiteit brussels , brussels , belgium ) and monoclonal cd3 ( neomarkers , freemont , ca ) and cd20 ( dako , glostrup , denmark ) antibodies . human tonsils and pancreas was used as control . for epitope retrieval , sections were heated to 98c with citrate buffer , ph 6.0 . all values are expressed as median and interquartile range ( iqr ) , unless indicated otherwise . baseline and postransplant characteristics were related with status of insulin independence at month 6 as well as -cell graft function and glycemic variability during the first 6 months . to assess differences between subgroups , we used nonparametric mann - whitney u test for continuous data and fisher 's exact test for categorical data . correlations between baseline characteristics and cvfg or mean c - peptide during the first 6 months after transplantation were assessed by calculating pearson 's correlation coefficient . to determine independent predictor ability of the variables , we used forward stepwise binary logistic regression analysis for insulin independence and a stepwise linear regression model for both cvfg and mean c - peptide . all analysis were performed using spps ( version 16.0 ) , and graphics were computed by graphpad prism ( version 4.0 ) . all all 30 recipients became c - peptide positive after transplantation ; 1 of them returned to c - peptide negativity before posttransplant month 6 . at posttransplant month 6 , 15 patients were insulin independent while the other 15 were on lower - dose insulin therapy ( table 1 ) . both groups had similar a1c concentrations and fasting mean glucose levels ( table 1 ) . however , insulin - independent recipients had significantly higher basal c - peptide levels and exhibited a lower variability of fasting glycemia ( table 1 ) . fasting glycemia was measured at home , and within - subject variation of fasted glycemia ( cvfg ) was calculated during the preceding month . no differences between both patient groups were noticed in terms of graft characteristics ( table 2 ) ; respectively , 87 and 80% of their subjects had received at least 2 milion -cells per kg body wt in the first graft . graft and recipient characteristics according to insulin need at 6 months posttransplantation data are medians ( iqr ) . * statistical analysis was done with mann - whitney u test for continues variables , fisher exact test for dichotomous variables . these variables were confirmed as independently associated with insulin independence by multivariate analysis ( binary logistic regression ) . baseline recipient characteristics such as age , sex , body weight bmi , duration of disease , autoantibody positivity , metabolic control , and insulin dose were also similar ( table 2 ) ; a tendency to higher a1c concentrations was noticed in patients who did not become insulin independent ( p = 0.054 ) . after first transplantation , 14 patients who would achieve insulin independence continued treatment with insulin pump for a median time of 15 weeks ( iqr 1018 ) . among patients not achieving insulin independence , seven were treated with insulin pump during the 6-month follow - up . in four patients , insulin pump was discontinued after a median of 20 weeks because of low daily insulin need and replaced by subcutanuous injections four times a day . metabolic control during the first 2 months did not differ between groups with median a1c values of 5.0% ( iqr 4.45.9 ) in insulin - independent subjects vs. 5.2% ( iqr 4.75.9 ) in insulin - requiring patients ( p = 0.48 ) . the number of patients treated with low molecular weight heparin after transplantation did not differ between groups . on the other hand , a significant difference was observed in the baseline immune state ( before atg treatment ) , as expressed by the absolute number of lymphocytes , of cd3 + cells , and of cd19 + cells , with higher initial counts in the recipient group that would not become insulin independent ( table 2 ) . of four patients with a baseline lymphocyte count > 3,000 cell / mm ( range 3,0053,455 ) , the higher initial number of t - cells in the insulin - dependent group was associated with a higher number of cd8 + cells ( 547/mm [ iqr 462657 ] vs. 393/mm [ 305503 ] in insulin - independent patients ; p = 0.021 ) but not of cd4 + t - cells ( 850/mm [ 7421,134 ] and 716/mm [ 570936 ] , respectively ; p = 0.093 ) or of nk cells ( 184/mm [ 147302 ] vs. 174/mm [ 144271 ] , respectively ; p = 0.72 ) . at the day of islet infusion , b - cell and t - cell autoreactivity were not measured at the day of islet infusion . at the time of a second infusion ( table 3 ) it is important to note that in these 17 patients we still observed a significant difference in lymphocyte subsets in samples taken before atg administration . there were no differences in immune profile and reactivity between patients receiving one or two grafts . immune status before first and second islet infusion according to insulin need at 6 months posttransplantation among recipients receiving two islet grafts data are median ( iqr ) . * statistical analysis was done with mann - whitney u test for continues variables , fisher exact test for dichotomous variables . this in vitro test could be performed in 27 of 30 subjects listed in table 2 . in the group that did not become insulin independent , 12 of 14 patients scored positive for ia2 and/or gad65 , whereas this was only the case in 6 of 13 patients who would become insulin independent ( p = 0.046 ; table 2 ) . the role of baseline t - cell autoreactivity remained confined to a subgroup of recipients receiving amounts of -cells below the median , as we previously reported ( 18 ; online appendix 2 ) . on the other hand , no difference was seen in baseline autoantibody status or in the presence of multiple autoantibodies prior to transplantation ( table 2 ) . of 19 patients positive for ia2 and/or gad65 antibodies at baseline , 10 became insulin independent , whereas this was the case for 5 of 10 patients that were negative for these antibodies ( p = 1.0 by fisher 's exact test ) . the number of hla mismatches did not differ between groups ( data not shown ) . the observed correlation between baseline immune status of the recipient and the achievement of insulin independence at posttransplant month 6 was further examined by multivariate analysis ( table 4 ) . baseline b - cell count and t - cell autoreactivity were found to be independently correlated with the ability to achieve insulin independence ( odds ratio 0.989 [ 95% ci 0.9790.999 ] and 0.101 [ 0.0091.067 ] , respectively ) . of nine patients without t - cell autoreactivity at start , seven became insulin independent , whereas this was only the case for 6 of 18 patients that tested positively ( fig . when these patients were further stratified according to their baseline b - cell count ( i.e. , under or above the 50th percentile [ 259 b - cells / mm ] ) , insulin independence was seen in seven of eight patients without baseline t - cell autoreactivity and a b - cell count < p50 , while only 1 of 11 patients with t - cell autoreactiviy and a b - cell count > p50 became insulin independent ( p = 0.001 by fisher 's exact test ) . univariate and multivariate analysis of recipient characteristics associated with clinical outcome * mann - whitney u test for continuous variables , fisher exact test for categorical data . pearson 's correlation for continuous variables and mann - whitney u test for categorical variables . independent predictor ability of the variables studied by stepwise linear regression analysis , inclusion criteria p < 0.05 . t- and b - cell count at baseline and during 6 months after transplantation ( a ) in islet graft recipients gaining insulin independence ( solid line ) and remaining insulin independent ( dotted line ) . b : gain of insulin independence according to baseline in vitro t - cell reactivity against islet autoantigens . the lower panel shows gain of insulin independence in three different groups according to both t - cell autoreactivity and baseline b - cell count . in univariate analysis , similar correlations were found with other clinical outcome parameters , such as the average coefficient of variation of prebreakfast glycemia ( cvfg ) and the mean plasma c - peptide levels during the first 6 months ( table 4 ) . after multivariate analysis , baseline positivity for t - cell autoreactivity and total lymphocyte counts correlated positively with the values of cvfg and negatively with the mean c - peptide levels ( fig . a correlation with leukocytes at the day of infusion was maintained after multivariate analysis for cvfg but not c - peptide . recipients with baseline t - cell reactivity had significantly higher cvfg ( 24% [ iqr 2035 ] ) and lower c - peptide ( 1.0 ng / ml [ 0.51.3 ] ) than those without ( 18% [ 1524 ] , p = 0.014 , and 1.9 ng / ml [ 1.32.2 ; p = 0.001 ] , respectively ) ( fig . these differences became more pronounced when a further stratification was made according to presence or absence of a baseline total lymphocyte count > p50 . thus , a negative test for t - cell autoreactivity and a lymphocyte count < p50 was associated with a lower cvfg and a higher c - peptide , whereas a positive test and a count > p50 appeared to predispose for a high cvfg and a low c - peptide ( fig . the number of -cells transplanted per kilogram bodyweight in the first graft had a tendency to correlate with cvfg in univariate analysis ( r = 0.34 ; p = 0.07 ) but not with c - peptide levels during the first 6 months posttransplant ( r = 0.27 ; p = 0.15 ) . this could not be retained when it was added to the multivariate model ( p = 0.56 and p = 0.42 , respectively ) . the total number of -cells transplanted or the number of donors used did not affect cvfg nor c - peptide levels . the effect of baseline total lymphocyte count ( a ) , in vitro t - cell reactivity against islet autoantigens or both ( b ) on glycemic stability and c - peptide release . one week after start of the immune therapy , the number of cd3 + cells had markedly dropped in both groups , reaching similar low values that were maintained until posttransplant month 6 ( fig . on the other hand , baseline cd19 + counts did not decrease during the first week , thus remaining higher in the patient group that did not become insulin independent ( fig . 1a ) ; at later time points , cd19 + counts had decreased to similar levels in both groups . total atg dose in insulin - independent patients was similar to that used in insulin - requiring patients ( 21.9 mg / kg body wt [ iqr 20.024.7 ] and 23.6 mg / kg body wt [ 22.026.2 ] , respectively , p = 0.11 ) . mean tacrolimus trough levels ( 9.2 ng / ml [ 8.69.5 ] and 9.2 ng / ml [ 7.49.7 ] ) and mmf dose ( 2,000 mg / day [ iqr 1,5002,000 ] and 2,000 mg / day iqr [ 1,5002,000 ] ) during the first 6 months posttransplant were also comparable between both groups ( p = 0.66 and p = 0.45 , respectively ) . a similar observation was made for cvfg and mean c - peptide levels during the first 6 months ( data not shown ) . we were unable to demonstrate any correlations between posttransplant immune measures and clinical outcome in the first 6 months posttransplant ( table 2 ) . interestingly , we observed a clear difference between subjects showing t - cell reactivity posttransplant when these results were combined with baseline t - cell reactivity . in eight subjects where t - cell reactivity was present both at baseline and during the first 6 months , only one achieved insulin independence . c - peptide levels were low in these patients ( mean 0.74 ng / ml ) and cvfg high ( mean 33% ) . however , among five recipients who only tested positive after transplantation , four achieved insulin independence ( p = 0.03 ) with mean c - peptide levels of 1.9 ng / ml ( p = 0.01 ) and low mean cvfg ( 20% ; p = 0.02 ) . among 10 recipients with baseline t - cell autoreactivity who where negative during the first 6 months posttransplant , results were intermediate . five reached insulin independence ; c - peptide levels were 1.1 ng / ml with cvfg 24% . highest c - peptide levels ( 1.7 ng / ml ) and lowest cvfg ( 18% ) were seen in four patients who never presented t - cell autoreativity . a liver biopt was available from a patient who had received two intraportal islet cell injections > 1 year earlier . endocrine cell clusters were identified by their positivity for chromogranin , proinsulin , and insulin ( fig . they were surrounded by cd20 + and cd3 + cells ; there were only few cd8 + cells detected . the patient had not become insulin independent , and his posttransplant month 6 mean plasma c - peptide was low ( 0.62 ng / ml ) and cvfg high ( 32% ) . at baseline , he did present a cellular autoreactivity against ia2 , a high total lymphocyte count ( 3,393/mm ) with a b - cell count ( 536/mm ) above the 50th percentile of the recipient population before treatment ( 259 b cells / mm ) ; despite > 1 year of immune suppressive treatment , the mean b - cell count until the time of the biopsy ( 412/mm ) was still above this 50th percentile . interestingly , we did not observe a dominant cd20 + infiltrate in a liverbiopsy done in the patient who died 18 weeks posttransplant of cerebral hemorrhage . this patient had lower numbers of total lymphocytes ( 1,776/mm ) and b - cells ( 188 cell / mm ) at baseline . last circulating cd19 + cell count was 30 cells / mm and mean c - peptide level 2.2 ng / ml in the last 4 weeks before she died . semiconsecutive sections of islet two show inflammatory cells located around the graft , which are dominated by cd20 + b - cells . ( a high - quality digital representation of this figure is available in the online issue . ) all 30 recipients became c - peptide positive after transplantation ; 1 of them returned to c - peptide negativity before posttransplant month 6 . at posttransplant month 6 , 15 patients were insulin independent while the other 15 were on lower - dose insulin therapy ( table 1 ) . both groups had similar a1c concentrations and fasting mean glucose levels ( table 1 ) . however , insulin - independent recipients had significantly higher basal c - peptide levels and exhibited a lower variability of fasting glycemia ( table 1 ) . fasting glycemia was measured at home , and within - subject variation of fasted glycemia ( cvfg ) was calculated during the preceding month . no differences between both patient groups were noticed in terms of graft characteristics ( table 2 ) ; respectively , 87 and 80% of their subjects had received at least 2 milion -cells per kg body wt in the first graft . graft and recipient characteristics according to insulin need at 6 months posttransplantation data are medians ( iqr ) . * statistical analysis was done with mann - whitney u test for continues variables , fisher exact test for dichotomous variables . these variables were confirmed as independently associated with insulin independence by multivariate analysis ( binary logistic regression ) . baseline recipient characteristics such as age , sex , body weight bmi , duration of disease , autoantibody positivity , metabolic control , and insulin dose were also similar ( table 2 ) ; a tendency to higher a1c concentrations was noticed in patients who did not become insulin independent ( p = 0.054 ) . after first transplantation , 14 patients who would achieve insulin independence continued treatment with insulin pump for a median time of 15 weeks ( iqr 1018 ) . among patients not achieving insulin independence , seven were treated with insulin pump during the 6-month follow - up . in four patients , insulin pump was discontinued after a median of 20 weeks because of low daily insulin need and replaced by subcutanuous injections four times a day . metabolic control during the first 2 months did not differ between groups with median a1c values of 5.0% ( iqr 4.45.9 ) in insulin - independent subjects vs. 5.2% ( iqr 4.75.9 ) in insulin - requiring patients ( p = 0.48 ) . the number of patients treated with low molecular weight heparin after transplantation did not differ between groups . on the other hand , a significant difference was observed in the baseline immune state ( before atg treatment ) , as expressed by the absolute number of lymphocytes , of cd3 + cells , and of cd19 + cells , with higher initial counts in the recipient group that would not become insulin independent ( table 2 ) . of four patients with a baseline lymphocyte count > 3,000 cell / mm ( range 3,0053,455 ) , the higher initial number of t - cells in the insulin - dependent group was associated with a higher number of cd8 + cells ( 547/mm [ iqr 462657 ] vs. 393/mm [ 305503 ] in insulin - independent patients ; p = 0.021 ) but not of cd4 + t - cells ( 850/mm [ 7421,134 ] and 716/mm [ 570936 ] , respectively ; p = 0.093 ) or of nk cells ( 184/mm [ 147302 ] vs. 174/mm [ 144271 ] , respectively ; p = 0.72 ) . at the day of islet infusion , b - cell and t - cell autoreactivity were not measured at the day of islet infusion . at the time of a second infusion ( table 3 ) it is important to note that in these 17 patients we still observed a significant difference in lymphocyte subsets in samples taken before atg administration . there were no differences in immune profile and reactivity between patients receiving one or two grafts . immune status before first and second islet infusion according to insulin need at 6 months posttransplantation among recipients receiving two islet grafts data are median ( iqr ) . * statistical analysis was done with mann - whitney u test for continues variables , fisher exact test for dichotomous variables . this in vitro test could be performed in 27 of 30 subjects listed in table 2 . in the group that did not become insulin independent , 12 of 14 patients scored positive for ia2 and/or gad65 , whereas this was only the case in 6 of 13 patients who would become insulin independent ( p = 0.046 ; table 2 ) . the role of baseline t - cell autoreactivity remained confined to a subgroup of recipients receiving amounts of -cells below the median , as we previously reported ( 18 ; online appendix 2 ) . on the other hand , no difference was seen in baseline autoantibody status or in the presence of multiple autoantibodies prior to transplantation ( table 2 ) . of 19 patients positive for ia2 and/or gad65 antibodies at baseline , 10 became insulin independent , whereas this was the case for 5 of 10 patients that were negative for these antibodies ( p = 1.0 by fisher 's exact test ) . the number of hla mismatches did not differ between groups ( data not shown ) . the observed correlation between baseline immune status of the recipient and the achievement of insulin independence at posttransplant month 6 was further examined by multivariate analysis ( table 4 ) . baseline b - cell count and t - cell autoreactivity were found to be independently correlated with the ability to achieve insulin independence ( odds ratio 0.989 [ 95% ci 0.9790.999 ] and 0.101 [ 0.0091.067 ] , respectively ) . of nine patients without t - cell autoreactivity at start , seven became insulin independent , whereas this was only the case for 6 of 18 patients that tested positively ( fig . 1b ) . when these patients were further stratified according to their baseline b - cell count ( i.e. , under or above the 50th percentile [ 259 b - cells / mm ] ) , insulin independence was seen in seven of eight patients without baseline t - cell autoreactivity and a b - cell count < p50 , while only 1 of 11 patients with t - cell autoreactiviy and a b - cell count > p50 became insulin independent ( p = 0.001 by fisher 's exact test ) . univariate and multivariate analysis of recipient characteristics associated with clinical outcome * mann - whitney u test for continuous variables , fisher exact test for categorical data . pearson 's correlation for continuous variables and mann - whitney u test for categorical variables . independent predictor ability of the variables studied by stepwise linear regression analysis , inclusion criteria p < 0.05 . t- and b - cell count at baseline and during 6 months after transplantation ( a ) in islet graft recipients gaining insulin independence ( solid line ) and remaining insulin independent ( dotted line ) . b : gain of insulin independence according to baseline in vitro t - cell reactivity against islet autoantigens . the lower panel shows gain of insulin independence in three different groups according to both t - cell autoreactivity and baseline b - cell count . in univariate analysis , similar correlations were found with other clinical outcome parameters , such as the average coefficient of variation of prebreakfast glycemia ( cvfg ) and the mean plasma c - peptide levels during the first 6 months ( table 4 ) . after multivariate analysis , baseline positivity for t - cell autoreactivity and total lymphocyte counts correlated positively with the values of cvfg and negatively with the mean c - peptide levels ( fig . a correlation with leukocytes at the day of infusion was maintained after multivariate analysis for cvfg but not c - peptide . recipients with baseline t - cell reactivity had significantly higher cvfg ( 24% [ iqr 2035 ] ) and lower c - peptide ( 1.0 ng / ml [ 0.51.3 ] ) than those without ( 18% [ 1524 ] , p = 0.014 , and 1.9 ng / ml [ 1.32.2 ; p = 0.001 ] , respectively ) ( fig these differences became more pronounced when a further stratification was made according to presence or absence of a baseline total lymphocyte count > p50 . thus , a negative test for t - cell autoreactivity and a lymphocyte count < p50 was associated with a lower cvfg and a higher c - peptide , whereas a positive test and a count > p50 appeared to predispose for a high cvfg and a low c - peptide ( fig . the number of -cells transplanted per kilogram bodyweight in the first graft had a tendency to correlate with cvfg in univariate analysis ( r = 0.34 ; p = 0.07 ) but not with c - peptide levels during the first 6 months posttransplant ( r = 0.27 ; p = 0.15 ) . this could not be retained when it was added to the multivariate model ( p = 0.56 and p = 0.42 , respectively ) . the total number of -cells transplanted or the number of donors used did not affect cvfg nor c - peptide levels . the effect of baseline total lymphocyte count ( a ) , in vitro t - cell reactivity against islet autoantigens or both ( b ) on glycemic stability and c - peptide release . one week after start of the immune therapy , the number of cd3 + cells had markedly dropped in both groups , reaching similar low values that were maintained until posttransplant month 6 ( fig . on the other hand , baseline cd19 + counts did not decrease during the first week , thus remaining higher in the patient group that did not become insulin independent ( fig . 1a ) ; at later time points , cd19 + counts had decreased to similar levels in both groups . total atg dose in insulin - independent patients was similar to that used in insulin - requiring patients ( 21.9 mg / kg body wt [ iqr 20.024.7 ] and 23.6 mg / kg body wt [ 22.026.2 ] , respectively , p = 0.11 ) . mean tacrolimus trough levels ( 9.2 ng / ml [ 8.69.5 ] and 9.2 ng / ml [ 7.49.7 ] ) and mmf dose ( 2,000 mg / day [ iqr 1,5002,000 ] and 2,000 mg / day iqr [ 1,5002,000 ] ) during the first 6 months posttransplant were also comparable between both groups ( p = 0.66 and p = 0.45 , respectively ) . a similar observation was made for cvfg and mean c - peptide levels during the first 6 months ( data not shown ) . we were unable to demonstrate any correlations between posttransplant immune measures and clinical outcome in the first 6 months posttransplant ( table 2 ) . interestingly , we observed a clear difference between subjects showing t - cell reactivity posttransplant when these results were combined with baseline t - cell reactivity . in eight subjects where t - cell reactivity was present both at baseline and during the first 6 months , only one achieved insulin independence . c - peptide levels were low in these patients ( mean 0.74 ng / ml ) and cvfg high ( mean 33% ) . however , among five recipients who only tested positive after transplantation , four achieved insulin independence ( p = 0.03 ) with mean c - peptide levels of 1.9 ng / ml ( p = 0.01 ) and low mean cvfg ( 20% ; p = 0.02 ) . among 10 recipients with baseline t - cell autoreactivity who where negative during the first 6 months posttransplant , results were intermediate . five reached insulin independence ; c - peptide levels were 1.1 ng / ml with cvfg 24% . highest c - peptide levels ( 1.7 ng / ml ) and lowest cvfg ( 18% ) were seen in four patients who never presented t - cell autoreativity . a liver biopt was available from a patient who had received two intraportal islet cell injections > 1 year earlier . endocrine cell clusters were identified by their positivity for chromogranin , proinsulin , and insulin ( fig . 3 ) . they were surrounded by cd20 + and cd3 + cells ; there were only few cd8 + cells detected . the patient had not become insulin independent , and his posttransplant month 6 mean plasma c - peptide was low ( 0.62 ng / ml ) and cvfg high ( 32% ) . at baseline , he did present a cellular autoreactivity against ia2 , a high total lymphocyte count ( 3,393/mm ) with a b - cell count ( 536/mm ) above the 50th percentile of the recipient population before treatment ( 259 b cells / mm ) ; despite > 1 year of immune suppressive treatment , the mean b - cell count until the time of the biopsy ( 412/mm ) was still above this 50th percentile . interestingly , we did not observe a dominant cd20 + infiltrate in a liverbiopsy done in the patient who died 18 weeks posttransplant of cerebral hemorrhage . this patient had lower numbers of total lymphocytes ( 1,776/mm ) and b - cells ( 188 cell / mm ) at baseline . last circulating cd19 + cell count was 30 cells / mm and mean c - peptide level 2.2 ng / ml in the last 4 weeks before she died . semiconsecutive sections of islet two show inflammatory cells located around the graft , which are dominated by cd20 + b - cells . ( a high - quality digital representation of this figure is available in the online issue . ) the outcome of islet cell transplantation in type 1 diabetic recipients is variable , ranging from rapid failure to return of insulin independence . this variation can be caused by differences in graft and in recipient characteristics , some of which can be anticipated such as an inadequate size and/or viability of the donor -cell mass and some being more difficult to distinguish . we have reduced graft variability by standardizing the composition of cultured islet cell grafts ( 17,20 ) . in a series of 30 c - peptide negative recipients of such graft , we retrospectively searched for possible recipient characteristics that are associated with an inadequate outcome during the first 6 months posttransplantation . the present data show a correlation with the baseline immune status at the time of the implantation . a higher blood b - cell count was associated with an inability to induce an insulin - independent state , as was also the case for a baseline t - cell autoreactivity against islet antigens , both characteristics being independent variables after multivariate analysis . a higher total lymphocyte count and a baseline t - cell autoreactivity were correlated with lower plasma c - peptide levels and a higher variability in fasting blood glucose . of 11 patients with a baseline b - cell count > p50 and a t - cell autoreactivity , only 1 became insulin independent , while this occurred in 7 of 8 with a b - cell count < p50 and negativity for t - cell autoreactivty . in 1 of these 10 patients with elevated baseline immune status and inadequate graft outcome , a biopt of the implant during posttransplant year 2 showed massive b - cell accumulations in the vicinity of insulin - positive cell aggregates ; cd3 + cells were also present but less abundant , at least in the examined sections . throughout follow - up , this patient had maintained a mean b - cell count above the 50th percentile of the recipient population before treatment . interestingly , no such infiltrate was observed around the graft of a patient who died 18 weeks posttransplant with a well - functioning graft and low b - cell counts . in animal models of diabetes , b - cells appear implicated in the destruction of -cells ( 2529 ) . however , their role in the development of human disease is uncertain . that type 1 diabetes can occur in a patient with severe hereditary b - cell deficiency is seen as evidence that the disease can occur without participation of b - cells ( 30 ) but does not exclude their involvement in other patients . in islet cell transplantation , it is not yet clear whether b - cells play a role through production of antibodies and/or through antigen presentation . islet cell autoantibodies have been correlated to recurrence of autoimmunity and clinical outcome ( 8,3134 ) , but this was not confirmed by others ( 18,20 ) or by the present study ; we did not detect a correlation between the presence or titer of autoantibodies and the number of circulating b - cells . on the other hand , alloantibodies can mediate rejection of organ transplants and islet cell grafts have been found to induce alloantibody formation ( 3537 ) . alloantibodies after transplantation were detected in only two recipients in the current study , one of which became insulin independent . besides being a source of antibodies , b - cells can also operate as antigen - presenting cells that activate auto- and/or alloimmunity ( 3841 ) . this mechanism has been proposed in rejecting kidneys with a b - cell infiltration ( 42,43 ) . whether b - cells can interfere with engraftment and/or early graft function of intraportal islet cell grafts by one of these mechanisms intravenous injection of the donor cells can nevertheless be expected to immediately subject them to influences of circulating lymphocytes and more so to populations that are more abundant and/or rapidly activated by -cell autoantigens . it is then also conceivable that an early local activation of b - cells may result in their sustained presence in the islet microenvironement as was noticed in the biopt . to replace speculation by evidence , an immune therapy protocol will be needed in which b - cell depletion is achieved just before and during the first posttansplant weeks . in a study in nonhuman primates , liu et al . ( 44 ) demonstrated that b - cell directed immunotherapy promotes long - term islet allograft survival in nonhuman primates that also received t - cell depleting atg antibodies and a maintenance dose of rapamycin . it would thus be interesting to examine whether addition of rituximab , which selectively targets cd20 + b - cells , to our atg - based protocol increases the percent recipients that become insulin independent . islet culture is known to help survival in rat allograft by enriching islet isolates in endocrine cells ( 45 ) , but this has not yet been demonstrated in humans . furthermore , islet culture can be expected to reduce inflammatory and/or immune reactivity in the implant in rodents ( 46 ) . we systematically used islet culture , and a comparative study between freshly isolated and cultured islet cells has not yet been possible . therefore , we are unable to assess whether these factors may have influenced graft survival , but it can not be excluded . our data confirm in a larger cohort the previously reported correlation between a baseline t - cell reactivity against islet cell antigens and the failure of the implant to induce an insulin - independent state ( 18 ) . they extend this correlation to other signs of inadequate graft function such as low plasma c - peptide levels and a high variability in fasting glycemia . as we previously reported , this correlation is confined to recipients receiving lower numbers of -cells . the role of autoreactive t - cells in -cell destruction is well accepted ( 4749 ) . it is conceivable that the atg - mediated lymphopenia induces a proliferation of autoreactive memory t - cells ( 50 ) , which appear present or more abundant at baseline in a number of patients and might therefore predispose to a more rapid or extensive immune destruction . patients rejecting a pancreas transplant were also found to present memory cd4 + t - cells that were specific for the islet autoantigen gad65 ( 51 ) . indeed , we were able to demonstrate in the current study that in those patients where baseline t - cell autoreactivity persisted in the first 6 months posttransplant , clinical outcome was very poor . although recipients who lost baseline - detectable t - cell reactivity after transplantation had slightly better outcome , both are still in contrast with the well - functioning grafts in recipients where t - cell autoreactivity was only detectable after transplantation . our data demonstrate an important predictive role for immune measures taken at baseline , before initiation of immunosuppression , but not for samples from the day of islet infusion . however , we did not measure b - cell and t - cell autoreactivity at the day of infusion . we could therefore not fully assess the correlations between those parameters at the day of infusion and clinical outcome , although the available data point in the same direction . however , it is evident that b - cells are more abundant in insulin - dependent patients in the peritransplant period , which , we suggest , may impair graft function via mechanisms we mention above . in a severe lymphopenic environment such as during atg treatment , assessment of t - cell reactivity is impossible because the frequency of circulating lymphocytes is too low ( 24 ) . yet , t - cell autoreactivity remains present at a later time point , demonstrating the insufficient irradication of autoreactive t - cells , which may be susceptible to proliferation by lymphopenia - induced homeostatic proliferation ( 50 ) . in conclusion , this study correlates circulating characteristics of the baseline immune state with the metabolic outcome of intraportal islet cell transplants in type 1 diabetic patients . a higher number of total and of b - cell and a t - cell reactivity against -cell antigens are associated with a lower return to insulin independence , lower plasma c - peptide levels , and/or a higher variability in fasting glycemia ; in the one case where a liver biopt was available ( > 1 year after the transplant ) b - cells were predominantly present around the -cell aggregates . these data support the rationale of targeting also b - cells during the induction phase of immune therapy . | objectivethe metabolic outcome of islet cell transplants in type 1 diabetic patients is variable .
this retrospective analysis examines whether differences in recipient characteristics at the time of transplantation are correlated with inadequate graft function.research design and methodsthirty nonuremic c - peptide negative type 1 diabetic patients had received an intraportal islet cell graft of comparable size under an atg - tacrolimus mycophenolate mofetil regimen .
baseline patient characteristics were compared with outcome parameters during the first 6 posttransplant months ( i.e. , plasma c - peptide , glycemic variability , and gain of insulin independence ) .
correlations in univariate analysis were further examined in a multivariate model.resultspatients that did not become insulin independent exhibited significantly higher counts of b - cells as well as a t - cell autoreactivity against insulinoma - associated protein 2 ( ia2 ) and/or gad . in one of them ,
a liver biopsy during posttransplant year 2 showed b - cell accumulations near insulin - positive -cell aggregates .
higher baseline total lymphocytes and t - cell autoreactivity were also correlated with lower plasma c - peptide levels and higher glycemic variability.conclusionshigher total and b - cell counts and presence of t - cell autoreactivity at baseline are independently associated with lower graft function in type 1 diabetic patients receiving intraportal islet cells under atg - tacrolimus mycophenolate mofetil therapy .
prospective studies are needed to assess whether control of these characteristics can help increase the function of islet cell grafts during the first year posttransplantation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is essential that a high index of clinical suspicion is maintained together with prompt aggressive treatment in a multidisciplinary environment to prevent worsening physical and psychological sequelae . a 59 year old lady presented to the clinic with a large palpable mass in the right breast . she was otherwise very well , had never smoked and was overweight with a bmi of 30 . this correlated both mammographically and with ultrasound , confirming an irregular 50 mm mass suspicious of carcinoma . a core biopsy was performed revealing invasive carcinoma with lobular features . following a multidisciplinary discussion , the patient consented to treatment with a simple mastectomy , sentinel lymph node ( sln ) biopsy with per - operative assessment using osna ( sysmex corp ) and axillary dissection ( and ) if the sln proved positive . this was performed , and was accompanied by a level i+ii axillary clearance as the sln was positive . the operation used a standard technique and 2 vacuum drains were placed ( one to the chest wall and one to the axilla ) . she made an uneventful postoperative recovery and was discharged 5 days later with the chest wall drain in situ . the patient presented to clinic 2 days following discharge for a routine drain review . at this time blood cultures taken day 9 post - op grew coagulase negative staphylococci with a wound swab taken day 12 post - op revealing mixed coliforms and skin flora . due to clinical deterioration and a high suspicion of a necrotising wound infection the decision was made to widely debride the remaining inflamed tissue on day 14 post - op . the histology of the primary tumour revealed a 45 mm area of lobular carcinoma , with extensive lymphovascular invasion but excellent margins of clearance . histology from the mastectomy skin flaps revealed severe acute inflammation with necrosis involving the subcutaneous tissue . over the next 6 weeks , the wound underwent regular debridement with hydrogen peroxide washes and triangulation as shown in figure 1 to progressively reduce the surface area of the wound . initially the wound was packed with povidone iodine soaked gauze rolls and then replaced by the application of a low pressure vac dressing , first in the hospital setting and then in the community . debrided wound illustrating triangulation . the wound was eventually grafted with a split skin graft taken from the thigh 7 weeks later achieving a near 100% take ( figure 2 ) . necrotising fasciitis characteristically does not involve the underlying muscle ( as in this case ) and usually follows trauma , surgery or drug injections , often associated with advanced age , chronic renal failure , obesity , peripheral vascular disease or diabetes . the first case of necrotising fasciitis affecting the breast two other cases have also been reported in the absence of primary breast interventions , the first in a steroid dependant patient and the second in the absence of another predisposing factor ( 2 ) . two cases occurred , as in this instance , following mastectomy ( 3 ) one following breast reduction surgery ( 4 ) and one following a core biopsy ( 5 ) . three broad types of necrotising fasciitis have been identified , ranging from the fulminant form which presents with shock and is often fatal to the subacute form which can be clinically indistinguishable from cellulitis until it progresses to necrosis needing extensive debridement . clinically the patient may present with minimal signs apart from severe pain . as the condition progresses this often is associated with marked oedema , erythema and purulent discharge . as in this case , the progression from a well healing wound to severe soft tissue infection is often extremely rapid and therefore a high index of suspicion is vital . blistering and necrosis of the skin can follow together with septic shock , renal failure and disseminated intravascular coagulation . debridement is essential and needs to be extensive enough to ensure healthy bleeding tissue in all directions . the use of the vac system , which utilises a low pressure suction effect across a sealed wound using a reticulated foam surface , aims to increase local oxygenation and promote fibroblast stimulation and granulation formation although it s actions are contentious . in this case malignancy is known to be a positive risk factor and the presence of extensive lymphovascular invasion may well have played a part . in addition , the increased operative time due to osna ( 50 mins ) , and the prolonged placement of the chest wall drain were possibly important . despite the drain being a theoretical closed system the mortality rate of patients with necrotising soft tissue infections ranges from 25%-73% ( 6 ) but can be reduced by early recognition and effective management . in cases such as this where the patient has already had the trauma of cancer with a mastectomy , it is vital that this potentially disastrous condition is picked up and treated immediately to prevent further physical and emotional morbidity . also early recognition and surgical intervention prevented a significant delay in starting adjuvant therapy for breast cancer . | necrotising fasciitis is a rare but rapidly progressive soft tissue disease which can lead to extensive necrosis , systemic sepsis and death . including this case ,
only 7 other cases have been reported in the world literature with only 2 others affecting the patient post mastectomy.this 59 year old caucasian lady presented with severe soft tissue infection soon after mastectomy , which was successfully treated with a combination of debridement , triangulation , vac dressing and skin grafting.necrotising soft tissue infections following mastectomy are rapidly progressive and potentially extremely serious .
it is essential that a high index of clinical suspicion is maintained together with prompt aggressive treatment in a multidisciplinary environment to prevent worsening physical and psychological sequelae . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is a significant cause of morbidity and mortality in human immunodeficiency virus ( hiv)-infected subjects . verrucous carcinoma refers to a clinicopathologic concept implying a locally aggressive , clinically exophytic , low - grade , slow - growing , well - differentiated squamous cell carcinoma ( scc ) with minimal metastatic potential . there are very few cases of verrucous carcinoma of penis in hiv - positive patients reported in the literature . we report a case of verrucous carcinoma of penis in an hiv - positive patient which was treated with partial penectomy . a 60-year - old unmarried male patient presented with complaint of urethral discharge of 3 weeks duration which was yellowish , copious and non - foul smelling . he was being treated for multiple pruritic lesions over both upper and lower limbs for 7 months prior to onset of his present complaint . the patient was referred to urology where a dorsal slit of the prepuce was done which revealed an ulceroproliferative growth measuring 3 cm 3 cm arising from prepuce and involving glans [ figure 1 ] . venereal disease research laboratory was nonreactive and enzyme linked immunosorbent assay for hiv was positive . biopsy from the growth in the prepuce showed ulcerated dysplastic keratinized stratified squamous epithelium with hyperkeratosis , acanthosis , and papillomatosis . the base of the tumor was broad and had pushing border infiltrating the subepithelial stroma and showed dense lymphoplasmacytic infiltrate [ figure 2b ] . features were suggestive of verrucous carcinoma of penis ( prepuce ) infiltrating the subepithelial connective tissue . fine needle aspiration cytology of the inguinal lymph nodes showed features consistent with reactive lymphadenitis . dorsal slit of the prepuce showing an ulceroproliferative growth arising from prepuce and involving glans ( a ) histopathology of tumor in the prepuce showing dysplastic keratinized stratified squamous epithelium with hyperkeratosis , acanthosis and papillomatosis . tumor cells are well - differentiated with numerous keratin pearls ( h and e , 100 ) . ( b ) higher magnification showing broad tumor base with a pushing border infiltrating the subepithelial stroma ( h and e , 400 ) scc of the penis is itself rare and represents 0.3 - 0.5% of male malignancies in europe and the united states of america . verrucous carcinoma is a slow - growing variant of epidermoid carcinoma with low incidence of metastasis . the reported frequency of penile verrucous carcinoma is low and accounts for 3 - 20% of all penile cancers . the verrucous carcinoma lesion manifests as a verrucous , exophytic , or endophytic mass that typically develops at sites of chronic irritation and inflammation . it may be locally destructive and can penetrate deeply into the skin , fascia , and even bone . pai et al reported a case of verrucous carcinoma over the penis presenting as a nail - like cutaneous horn in an immunocompetent patient . the majority of cancers affecting hiv - infected subjects are those established as acquired immunodeficiency syndrome ( aids)-defining : kaposi 's sarcoma , non - hodgkin 's lymphoma , and invasive cervical cancer . however , other types of cancer , such as hodgkin 's disease , anal cancer , lung cancer and testicular germ cell tumors appear to be more common among hiv - infected subjects compared to the general population . many hiv - associated malignancies affect sites that are in contact with the outside environment ( e.g. , cervix , lung , oral cavity , skin , and anus ) . the increased density of immune cells and coincident elevated concentration of hiv-1 at these sites could lead to local compromised immune defenses and the subsequent development of malignancies at these sites . risk factors for penile verrucous carcinoma seem to be similar as for penile cancer in general , which are poor hygiene , phimosis and chronic inflammation . there seems to be a striking relationship between lack of circumcision and verrucous carcinoma of the glans penis . lack of circumcision and poor hygiene along with compromised local immunity could have been the risk factors in our patient . guiguet et al investigated the incidence of both aids - defining cancers and non - aids - defining cancers in 52,278 patients and found that the risk of both aids - defining cancers and non - aids - defining cancers increased with decreasing cd4 cell counts . our patient also had low absolute cd4 t helper cell count ( 29 cells / mm ) . absolute lymphocyte count in our patient was 800 cells / mm . in a study of the spectrum of mucocutaneous manifestations in hiv - infected patients conducted by fernandes and verrucous carcinoma is generally managed with wide surgical excision and glansectomy for carcinoma limited to the glans , with or without adjunctive chemotherapy , and tissue - sparing options such as mohs surgery , co2 laser surgery , liquid nitrogen cryosurgery for smaller lesions , either alone or in combination with topical 5-fu , and systemic or intralesional interferon- therapy in combination with surgical shaving . a surgical approach is usually preferred , as it shows excellent treatment outcomes and allows thorough histologic sampling and search for focal scc . thodore et al reported a case of a 37-year - old man who was hiv 1 positive who earlier was treated for condylomatous balanitis and subsequently developed scc of the glans penis which despite surgical excision metastasized to bilateral inguinal lymph nodes and lungs . patient is on regular follow - up with no evidence of local recurrence or inguinal lymph node metastasis 2 years postsurgery . there are very few cases of verrucous carcinoma of penis in hiv - positive patients reported in the literature . hence this case is being reported . as the number of hiv - infected patients continues to increase a high index of suspicion and early biopsy are crucial in the management of penile malignancies . managing hiv - positive patients with malignancy remains a challenge because of drug interactions , potential effect of chemotherapy on cd4 count and hiv-1 viral load . moreover , treatment compliance by hiv - infected patients with cancer may be poor , possibly because of the increased responsibility of taking drugs for both diseases with associated increased rate of compounded side effects . | cancer is a significant cause of morbidity and mortality in human immunodeficiency virus - infected subjects .
verrucous carcinoma is a peculiarly slow evolving , but relentlessly expanding variant of epidermoid carcinoma that is extremely reluctant to metastasize . a 60-year - old unmarried male patient presented with urethral discharge of 3 weeks duration .
dorsal slit of the prepuce revealed an ulceroproliferative growth measuring 3 cm 3 cm arising from prepuce and involving glans .
biopsy from the growth in the prepuce showed histopathological features of verrucous carcinoma .
partial amputation of the penis was done .
human papillomavirus dna by polymerase chain reaction was negative .
the patient was started on antiretroviral therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
castleman s disease or angiofollicular lymphoid hyperplasia is a rare cause of lymph node enlargement . it is divided into 2 types : localized , which is usually asymptomatic and presents with a mass lesion ; and multicentric , which is characterized by chills , anemia , generalized lymphadenopathy and hepatosplenomegaly . the most common site of involvement ( in both types ) is the mediastinum and hilum of the lung . extrathoracic sites of involvement are uncommon , such as the mesentery of the intestines , axilla and pelvis . herein , we present an unusual case of castleman s disease of the porta hepatis with atypical recurrence in the liver . physical examination was normal and there was no significant finding noted in her medical history . hematologic studies revealed normal complete blood count ( cbc ) and a high erythrocyte sedimentation rate ( esr ) of 110 mm / h . biochemical analysis showed : total protein of 10.3 gr / dl , albumin of 3.6 gr / dl , and globulin of 6.7 gr / dl . liver function tests , including alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) , were normal . immunoelectrophoresis showed an igg level of 4750 gr / dl ; other fractions were decreased . abdominal ct scan showed several lymphadenopathies ( lap ) in the hilum of the liver . very enlarged lymph nodes were noted in the porta hepatis ( each almost 3 cm ) . microscopic examination of the lymph nodes showed lymphoid follicles with small germinal centers bearing resemblance to hassall s corpuscles of the thymus . hyaline deposits were present within the germinal centers ( figure 1 ) . with the diagnosis of castleman s disease ( hyaline vascular type ) , the patient was discharged from the hospital and followed with laboratory tests . after less than a month , she was completely free of symptoms ; esr and serum protein levels returned to normal . she remained well for 2 years when her symptoms of easy fatigability and loss of well - being returned . laboratory findings showed hypergammaglobulinemia and high esr , but this time liver enzymes that included alt ( 40 iu / l ) were also mildly elevated ( normal < 28 iu / l ) . imaging studies were unremarkable and no sign of lap was detected in the thorax and abdomen . the microscopic section of the liver was unremarkable except for 2 to 3 scattered large lymphoid follicles with germinal center(s ) ( figure 2 ) . serial cut sections were performed to determine characteristic findings of castleman s disease , but the histologic picture was the same . immunohistochemical studies of the liver showed follicles with cd20 + centrocytes and some centroblastic lymphocytes . no hyaline deposit or any angiofollicular hyperplasia was noted . with the diagnosis of giant reactive lymphoid nodular hyperplasia ( lnh ) , possibly secondary to recurrence of castleman s disease , the patient was treated with steroids . she showed dramatic response to treatment , and after less than 2 weeks , had relief from all physical signs and symptoms . after 2 months , the patient is currently on steroids ( 5 mg / day ) and to be followed by imaging and laboratory tests . castleman s disease has been first described by castleman et al . in 1954 . it is a benign lymphoproliferative disorder most commonly located in the mediastinum . it is also called angiofollicular hyperplasia , giant lymph node hyperplasia , and lymph node hamartoma . the disease is histologically divided in two major types : i ) hyaline vascular ( 90% ) and ii ) plasma cell . castleman s disease can be both localized and solitary ( 80% ) , or less often , multicentric . patients presenting with the hyaline vascular type are usually asymptomatic , however the plasma cell type is often symptomatic . in the hyaline vascular variant , constitutional symptoms may occur , which are most frequently secondary to compression of the surrounding organs such as the tracheobronchial area . abdominal castleman s disease presenting as a hepatic hilar mass is very uncommon.2 ,
6 ,
7
our patient presented with constitutional symptoms and a hepatic hilar mass which was diagnosed as castleman s disease after surgical excision and pathological studies . after surgery , she was completely well for 2 years when she developed easy fatigability , high esr , hypergammaglobulinemia , and abnormal lft . although there was no definite histopathological finding of castleman s disease , but the absence of any other positive autoimmune marker or lap , and similarity of the signs and symptoms to her previous episode guided us to the possibility of a recurrence of castleman s disease . we considered liver lnh as a possible evidence for the recurrence of castleman s disease , which has not been previously reported before ; overall recurrence in castleman s disease is very rare.8 ,
9
in previous reports , disease recurrence was similar to the first episode and until now , no case of hepatic lnh has been reported after castleman s disease . there was just one report of a patient with liver lnh with angiofollicular hyperplasia that mimicked castleman s disease and was treated with surgical excision .
in conclusion , we consider our case to be a recurrence of castleman s disease that mimicked lnh or association of these two diseases , which benefited from steroid therapy . both of these possibilities have not been reported and should be considered in patients who have reactive lnh in the liver and castleman s disease . | castleman s disease is an uncommon cause of lymph node enlargement that mostly involves the mediastinum and lung hilum .
it is divided into 2 types : localized , which is usually asymptomatic and presents with a mass lesion ; and multicentric , which is characterized by chills , anemia , generalized lymphadenopathy and hepatosplenomegaly .
an extrathoracic site of involvement is very uncommon , and may be located in the mesentery of the intestines , axilla , and pelvis .
hepatic localization of this disease is a rare event .
herein , we report our experience with a symptomatic case of castleman s disease in the porta hepatis who has been treated successfully by excision of the hilar lymph nodes , but recurred after 2 years with the same clinical picture plus abnormal liver function tests .
however , at the time of recurrence , no lymphadenopathy was detected and liver biopsy showed giant lymphoid follicles with germinal centers .
she was treated with steroids and showed a dramatic response . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we obtained clinical samples and background information from 15 glanderous equids in punjab , pakistan from 1999 through 2007 ( table ;
appendix table ) . research on equine subjects was approved by the synopsis scrutiny committee and animal ethics committee , faculty of veterinary science , university of agriculture , faisalabad , pakistan . samples were plated on brain - heart infusion ( bhi ) agar with 4% glycerol and incubated for 2430 hours at 37c . individual colonies were inoculated into bhi broth containing 4% glycerol and were incubated with shaking for 36 h at 37c . an aliquot of broth ( 1.5 ml ) was centrifuged at 13,000 rpm for 15 min . genomic dna was extracted from the resulting pellets using standard digestion buffer and phenol - chloroform extraction protocols ( 6 ) . samples from equines with similar histories were assigned to the same epidemiologic group ( e.g. , group 1 , group 2 ) . subgroups were defined based on vntr data ; samples with identical vntr genotypes were assigned to the same subgroup ( e.g. , prl11 and prl13 in group 1b ) . data are comparing subgroups 3a and 3b to each other ( prl1 and prl41 ) and excluding subgroup 3c ( prl7 ) . data are comparing subgroups 3a and 3b combined ( prl1 with prl41 ) to subgroup 3c ( prl7 ) . for genotyping , we screened 23 loci ( appendix table ) from a previously established 32-marker multiple locus variable number of tandem repeats ( vntr ) analysis system designed for b. pseudomallei and b. mallei ( 7 ) . in silico genotyping of the same loci was also performed for 10 whole genome sequences ( wgs ) of b. mallei ( 8 ; appendix table ) . vntr markers have higher mutation rates than other genetic markers which make them inappropriate for determining deep levels of evolutionary relatedness , however vntrs are appropriate for 1 ) discrimination between closely related isolates , 2 ) determination of the degree of relatedness among isolates , and 3 ) discernment of population structure on a spatial scale ( 7,9,10 ) . this utility is especially important for b. mallei because it is a recently emerged clone of b. pseudomallei and has been shown to be genetically monomorphic with typing methods such as multilocus sequence typing ( 11 ) . to compare the genetic diversity of our punjab isolates to that of sequenced strains , we performed a phylogenetic analysis on the 23 loci using the neighbor - joining algorithm in paup * 4.0b ( 9 ) . to determine the genetic relationships among the punjab population itself , we performed the same analysis using only the punjab isolates and polymorphic loci ( n = 15 loci ) . combined analysis of the punjab isolates and wgs showed that the punjab isolates are phylogenetically distinct from wgs ( figure 1 ) . this finding was also demonstrated in the values for average pairwise distance ( apd ) , where the apd among punjab isolates is 2 lower than the apd calculated for either the entire phylogeny or the wgs alone ( figure 1 ) . the punjab isolates represent only a small amount of the genetic diversity demonstrated in this pathogen . phylogenetic analysis of the punjab isolates alone placed 14 of the 15 samples into 3 distinct clades with 1 sample standing alone ( figure 2 ) . most samples ( 9/15 ) belong to clade a , whose isolates are both temporally and geographically diverse , suggesting that this lineage is ecologically established in punjab . unrooted neighbor - joining tree based on 23 variable number tandem repeat loci demonstrating that the punjab isolates ( black text and prl-20 ) are genetically distinct from and less diverse than available whole genome sequences ( wgs , red text ) ( 8) . statistical supports for branches based on 1,000 bootstrap iterations are shown . sample prl-20 is shown in red text because it is also available as a whole genome sequence ; therefore , it was used in all 3 situations where an average pairwise distance ( apd ) was calculated . among 10 wgs , the average pairwise distance was 0.607 ; between 10 wgs and punjab isolates , average pairwise distance was 0.627 ; and among 15 punjab isolates , average pairwise distance was 0.312 . these results indicate that the punjab isolates are more closely related to each other than to the sequenced strains because the apd among punjab isolates is 2 lower than the apd calculated in the other 2 situations . unrooted neighbor - joining tree showing phylogenetic relationships among 15 samples of burkholderia mallei from the punjab province , pakistan . sample names are color - coded to match their district of origin in reference to the inset map of the punjab province . approximate linear distances between districts are faisalabad to lahore 120 km , faisalabad to sargodha 84 km , lahore to sargodha 168 km . because of the limited sample size , many of the patterns observed from these data may result from sampling bias . however , even a limited amount of genotypic data can be useful in formulating hypotheses regarding the dispersal of b. mallei . for example , the presence of samples from faisalabad in each clade suggests that this district may be a center of diversity in the province ( figure 2 ) but this does not indicate a lesser degree of diversity in other districts where fewer samples were collected . the diversity seen in the district of faisalabad may result from either 1 ) the industrial nature of faisalabad or 2 ) from high endemism of b. mallei in the region . currently , the district has 10,000 horses and mules and > 44,000 donkeys , plus other transient equines ( 12 ) . many equines move through and work in the city , potentially introducing strains from surrounding regions . because horses and mules can be positive but asymptomatic for glanders ( 13 ) , many hosts are available to maintain strains throughout the region . communal stables and water troughs are common throughout the district and b. mallei has been isolated from these water troughs ( a. naureen , unpub . furthermore , b. mallei can remain viable in contaminated stables for up to 6 weeks ( 14 ) and in sterile tap water for up to 4 weeks ( 15 ) , which provides an environment for establishment and retention of b. mallei populations in faisalabad . combining phylogenetic with epidemiologic data for example , epidemiologic data suggests that 2 horses from a farm in the district of sargodha ( prl3 and prl4 ) contracted glanders while at a polo club in the lahore district . this is supported by vntr data , as these 2 isolates clustered phylogenetically with one of the samples obtained from an outbreak that occurred at the same polo club 3 months prior ( groups 5 and 6 , table ) . furthermore , at the time of the prl3 and prl4 infections , a co - resident mule with no previous travel history ( prl44 ) was negative for glanders , making it unlikely that these horses acquired glanders from their farm . this mule was positive for glanders 1.5 years later , and the isolate obtained from its infection clustered phylogenetically with the samples from the polo club and sargodha horses . therefore , we hypothesize that the infected horses either directly transferred the disease to the mule or they contaminated a source on the farm which subsequently led to the mules infection . environmental sampling would be required to identify the original infection source for the horses and subsequent transmission route to the mule . nevertheless , this case shows a strain that was transferred a distance of 168 km , demonstrating that human - mediated movement of equines can influence the distribution of b. mallei genotypes . other cases in the province demonstrate that infections either stem from similar strains or are caused by multiple strains . for example , samples that were placed in the same epidemiologic group cluster together phylogenetically ( groups 1 , 2 , and 4 ; table ) , indicating communal infections similar to the cases described above . in contrast , epidemiologic group 5 ( prl19 and prl20 ) was separated into 2 distinct clades ( figure 2 ) , indicating that this outbreak was caused by multiple strains . therefore , it should not be assumed that an outbreak of glanders is always caused by a single strain . our study suggests that numerous lineages of burkholderia mallei are present in punjab , pakistan , and that these lineages persist across geographic space and time . despite this the economics and use of equines likely contribute to the persistence of glanders in this region because modern methods for control of this disease ( monitoring and euthanasia ) are not viable options . we suggest that a focus on finding methods to improve the sanitary conditions of communal water troughs and stables may lead to a practical solution for disease reduction and containment . finally , our study demonstrates the utility of vntrs paired with extensive epidemiologic data for analyzing the distribution of b. mallei genotypes throughout endemic regions . epidemiologic and 23-locus vntr data for 15 isolates of burkholderia mallei from the punjab province , pakistan , and 9 burkholderia mallei whole genome sequences * | we collected epidemiologic and molecular data from burkholderia mallei isolates from equines in punjab , pakistan from 1999 through 2007 .
we show that recent outbreaks are genetically distinct from available whole genome sequences and that these genotypes are persistent and ubiquitous in punjab , probably due to human - mediated movement of equines . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
anabolic androgenic steroids ( aass ) represent a large group of synthetic derivatives of testosterone , produced to maximize anabolic effects and minimize the androgenic ones [ 1 , 2 ] . the most common oral and injectable aass with their chemical structures are reported in table 1 . androgens act by binding to the nuclear androgen receptor ( ar ) in the cytoplasm and then translocate into the nucleus . this binding results in sequential conformational changes of the receptor affecting the interaction between receptor and protein , and receptor and dna . the basic structure of all steroids is a perhydro - cyclopentano phenanthrene ring system that can be modified in order to obtain several designed chemical modifications . the most important chemical modification , in which the basic structure can undergo , is reported in fig . 1 . anabolism is defined by kuhn as any state in which nitrogen is differentially retained in lean body mass , either through stimulation of protein synthesis and/or decreased breakdown of protein anywhere in the body . skeletal muscle can be considered as the main target tissue for the anabolic effects of aas , which are mediated by ars which after exposure to aass are up - regulated and their number increases with body building . therefore , aass determine an increase in muscle size as a consequence of a dose - dependent hypertrophy resulting in an increase of the cross - sectional areas of both type i and type ii muscle fibers and myonucleardomains . moreover , it has been reported that aass can increase tolerance to exercise by making the muscles more capable to overload therefore shielding them from muscle fiber damage and improving the level of protein synthesis during recovery . despite some therapeutic use of aass ( severe burns , primary or secondary hypogonadism , short stature , hiv wasting syndrome etc . ) there is also wide abuse among athletes especially bodybuilders in order to improve their performances and to increase muscle growth and lean body mass , taking into account the significant anabolic effects above reported . not by chance , these substances fall within the vast group of performance - enhancing drugs , which also include : stimulants , painkillers , sedatives and anxiolytics , diuretics , blood boosters and masking drugs . a high - dose regimen is stacked by combining numerous oral and injectable aass , which are self - administered in drug cycles which last from 4 to 12 weeks [ 7 - 9 ] . furthermore , aas users frequently associate other substances to aass , the so called steroid - accessory drugs , such as ephedrine , growth hormone , insulin , diuretics , ghb etc [ 10 - 15 ] for several reasons . the prolonged misuse and abuse of aass can determine several adverse effects , some of which may be even fatal especially on the cardiovascular system because they may increase the risk of sudden cardiac death ( scd ) , myocardial infarction , altered serum lipoproteins , and cardiac hypertrophy . 2 . the aim of this review is to focus on deaths related to aas abuse , trying to evaluate the autoptic , histopathological and toxicological findings in order to investigate the pathophysiological mechanism that underlines this type of death , which is still obscure in several aspects . some databases , from 1975 to june 2014 , were searched : medline , cochrane central , scopus , web of science , science direct , embase and google scholar , using the following keywords : anabolic androgenic steroid , death , cardiovascular effects , toxicity , side / adverse effects . the main key word anabolic androgenic steroid was individually searched in association to each of the others . the 189 sources found after the initial screening in order to exclude duplicate sources and retrospective studies , were selected according to the inclusion criteria , which allowed the identification of 10 sources . a comprehensive flow diagram with inclusion criteria the review of the literature using the flow diagram reported in fig . 3 allowed us to identify 19 fatal cases between 1990 and 2012 . the most important autoptic , histopathological findings and circumstantial data are reported in table 2 , while the toxicological findings are reported in table 3 . of the 19 cases , 17 ( 89.5% ) were males whereas only 2 ( 10.5% ) were females . the age ranged from 18 to 37 years ( mean age : 28 4.4 ) . among the 19 fatal cases , in 14 bodies ( 12 males and 2 females ) the data available allowed to calculate the body mass index ( bmi ) and the results are reported in table 4 . in none of the cases the bmi was lower than 24.9 , which is considered the upper limit of the normal healthy weight . for all cases the autopsy excluded extracardiac causes of death , only in one case a bilateral pulmonary embolism from deep venous thrombus of lower extremities was found ( table 2 ) . toxicological investigation performed mainly on urine samples but also in blood and hair samples , by using several screening tests and analytical methods revealed in 12 cases [ 16 , 18 , 20 - 25 ] the presence of aass and/or their metabolites in urine specimens ; in one case nandrolone was detected in blood , whereas in another case stanozolol was found in hair . in the remaining 6 cases in which the toxicological analysis was negative , circumstantial data and evidences reported by relatives and friends of the deceased highlighted a previous prolonged use of aass . the chronic use of aass can cause various pathological alterations , which are related to dose , frequency and patterns of use . taking into account that numerous organs and apparatus are the target of aass , several adverse effects can involve the liver , cardiovascular , reproductive , musculoskeletal , endocrine , renal , immunologic and hematological systems as well as some psychological effects ; a schematic representation is reported in fig . 19 fatal cases are reported ; although only single case report or small series of cases were included , whereas retrospective studies and other papers that did not fulfill the inclusion criteria were not taken into account , some consideration can be formulated ; in all cases the autopsy findings together with the histological examination have highlighted cardiac causes of death . only in one case a mechanical cardiovascular cause of death was found ( a bilateral pulmonary embolism from deep venous thrombus of lower extremities ) . in numerous cases [ 16 , 18 , 19 , 22 , 25 ] , a common finding was a left ventricular hypertrophy , frequently associated with fibrosis and myocytolisis . a myocardial hypertrophy was not found in the 4 cases reported by fineschi et al in two different reports [ 21 , 23 ] . what is the significance that could be attributed to the myocardial hypertrophy ? a vigorous training in young athletes can determine a left ventricularhypertrophy , independently of the use of aass ( the so called athlete 's heart ) [ 25 - 28 ] . melchert and welder categorized the effects of aas on the cardiovascular system into four groups of activities : vasospastic , atherogenic , thrombotic and direct myocardial injuries . aas can induce adverse cardiovascular effects such as left ventricular hypertrophy ( lvh ) , hypertension , impaired diastolic filling , arrhythmia , erythrocytosis , thrombosis and altered lipoprotein profiles . abnormalities in cardio - vascular reflex control of the cardiovascular system [ 31 - 35 ] and in vascular reactivity [ 36 - 40 ] have also been reported . studies on isolated hearts from rats treated chronically with nandrolonedecanoate ( nd ) have also shown a raise in myocardial susceptibility to ischemia / reperfusion injuries [ 41 , 42 ] . nandrolone abuse combined with vigorous exercise training may lead to impaired diastolic function and concentric hypertrophy of the left ventricular ( lv ) wall . vigorous weight lifting itself would also cause lv wall mass and thickness increase but cardiac function would not be affected . however , when combined with aas abuse pathological cardiac hypertrophy could be caused . in another study , rats were treated with nd for 6 weeks ( total dose 30 mg /kg ) . rocha et al . studied the effects on cardiac function in rats undergoing swimming training and those not undergoing it . they investigated that swimming training combined with high doses of nandrolone ( 5 mg / kg per injection , equal to 10 mg / kg per week ) sharpens cardiac hypertrophy with interstitial fibrosis . without a doubt . an explanation might be the change of the sympathetic autonomic activity modulated by the renin - angiotensin - system ( ras ) . experiments have shown that ras plays a significant role in the development of lvh and myocardial fibrosis . angiotensin ii type 1 receptor s ( at1r s ) stimulation is associated with the regulation of cell growth and proliferation of vascular smooth muscle cells , cardiomyocytes and endothelial cells involved in endothelial dysfunction , atherosclerotic vascular phenomena , congestive heart failure and myocardial infarction . marques neto et al . pointed out that the treatment with supraphysiological , chronic doses of aass induce cardiac parasympathetic disturbances in ventricular depolarization in both exercised and sedentary rats . unambiguously , it has been shown that the blockage of the ras , and in particular of at1r by losartan , obstructs qt prolongation . down - regulation of ion channel subunits , kchip2 , kv1.4 and kv4.3 , could explain the autonomic dysfunction and cardiac repolarization disturbances caused by chronic treatment with supraphysiological doses of nd . moreover , prolonged qt intervals and ventricular action potential could be explained by the reduced density of the transient outward potassium . no augmentation in tissue collagen content or in the mrna expression of types i and iii collagens have been shown by histological analysis the previously mentioned unconformity could be attributed to the duration of treatment with nd and the age of rats used . participation of the potassium ( k ) current in the generation of prolonged qt and potential action duration has been noticed . ito is the transient outward k+ current which is one of the main repolarizing currents in the mammalian myocardium and is generally believed to flow through kv1.4 , kv4.2 and kv4.3 channels in rats [ 49 , 50 ] . in heart hypertrophic cases ito is down - regulated [ 51 - 53 ] . low ito density , kv1.4 and kv4.3 down - regulation in the left ventricle and prolonged action was noticed in the group treated with nandrolone compared to the control group . homogenous distribution of kv4.3 channel in the rat s ventricular wall , higher kv4.2 in the epicardial and lower in the endocardial ventricular wall have been observed [ 49 , 50 ] . these differences may partially explain the up - regulation of kv4.2 and prolonged qtc interval and action potential . the expression of kchip2 is considerably decreased in heart failure and hypertrophy [ 54 , 55 ] . kchip2 was found to be significant for ito expression in the human heart and the correlation between kchip2 absence and a total loss of ito together with an increased susceptibility to ventricular arrhythmias in mice has been shown . according to riezzo the following effects were produced in physically trained mice intramuscularly treated with nd : moderate increase of heart weight , morphologically extensive cardiac hypertrophy and a wide colliquative myocytolysis which together could result in a significant heart failure . medei et al . found approximately 25% less nuclei and higher cardiomyocyte nuclei diameter in the ventricles of the group treated with nd . lower nuclei suggests a toxic effect of nd which may involve a pro - apoptotic mechanism . tanno et al found that nd treatment whether combined with resistance training or not induced pathological concentric hypertrophy , re - expression of fetal genes , systolic and diastolic function impairment and an incremented myocardial collagen content leading to lvh . increased relative left ventricle wall thickness ( rwt ) was observed as a consequence of intensive physical training in rats treated with nd compared to the respective non - trained ones . in addition , the non - trained nandrolone treated group also produced higher rwt compared to the non - trained treated group . increased interventricular septum thickness in the end - diastole ( ivsdia ) was noticed in both the non - trained nandrolone treated and trained vehicle - treated groups , compared to the non - trained vehicle treated rats . a considerable lower ratio of maximum early to late transmitral flow velocity ( e / a ratio ) was observed in the trained groups , in comparison with non - trained groups . nandrolone - treated groups ( both trained and non - trained ) showed lower e / a ratio in comparison with the respective vehicle - treated groups . moreover , significant decrease in the expression of alpha - myosin heavy chain ( -mhc ) mrna and beta - myosin heavy chain ( -mhc ) mrna in the left ventricle was induced by nandrolone and resistance training respectively . . found that short - term nd treatment induces an overexpression of 2-adrenoceptors without cardiac hypertrophy . increment in cardiovascular mortality has been associated to an imbalance of ( ans ) activity . aass can acutely inhibit the reuptake of catecholamines into extraneuronal tissue and consequently the increment of catecholamine concentrations at receptor sites occurs . although , the neuronal catecholamine transporter is normally responsible for the reuptake of noradrenaline , it has also been proved responsible for nonexocytotic release of noradrenaline from sympathetic nerve terminals during ischemia . an increased release of noradrenaline has been implicated in ischemia - induced arrhythmia [ 63 , 64 ] . an increased activity of 6-phosphogluconate dehydrogenases and glucose-6-phosphate was observed in rat hearts , also nd activated isocitrate dehydrogenase and malic enzyme , which are other nadp - linked dehydrogenases . during the same study a significantly increased heart weight it was shown that treatment with nd causes small qrs complex extension that might slightly reduce the spreading rate of the action potential through the heart ventricles , possibly because of the greater heart mass . it is known that administration of doses higher than normal ( supraphysiological ) of nd impair exercise - induced cardioprotection in treadmill - exercised rats . chaves et al . were the first to say that enhanced levels of antioxidant enzyme levels produced after exercise are impaired with nd treatment ( 10mg / kg for 8 weeks ) , a fact which is well correlated to the cardiac injurious effects of the drug . it was observed that the hearts of animals treated with nandrolone and having undergone training ( dt group ) showed lower glutathione peroxidase ( gpx ) , superoxide dismutase ( sod ) and glutathione reductase ( gr ) activities compared with controls and trained groups of animals ( ct ) . the latter observation indicates that nandrolone could act through blocking or down regulating the mechanisms implicated in the improvement of antioxidant defenses in dt animals , which might explain the lower percentage of left ventricular developed pressure and augmented infarct size in dt group . it has been shown , in other researches on rats that exercise training improves myocardial resistance to reperfusion injury / ischemia [ 67 - 69 ] since physiological cardiac hypertrophy amends the sensitiveness of that heart making it more resistant to the previously mentioned disorders in vivo rat hearts . notwithstanding the strenuous research efforts , the molecular mechanism(s ) involved in exercise - induced cardio protection is still debatable . the numerous studies above reported in animal models , especially in rats , have called into question several pathophysiological mechanisms , which may explain some of the macroscopic and microscopic finding regarding the 19 cases here reported ; however , we have to underline that these cases are single case report or small series of cases and not experimental studies . moreover , the users of these substances frequently associate numerous steroids , in different forms , singularly and in several temporal combinations and cycles , and commonly , various steroid - accessory drugs are also used . therefore , the interpretation of the postmortem findings is particularly difficult and no comprehensive conclusions can be done . finally , a brief remark must be placed regarding the bmi which was in all cases ( 12 males and 2 females ) higher than 25 . although according to the bmi ranges from an overweight ( 9 cases ) to a very severely obese ( 2 cases ) were found , however , the bmi is not a direct measure of body fatness and bmi is calculated from an individual 's weight which includes both muscle and fat . as a result , some subjects such as highly trained athletes may have a high bmi because of increased muscularity rather than increased body fatness ; therefore , these results should be evaluated with caution . the relationship between aas abuse , vigorous exercise training , and cardiac death can be evaluated only by the application of an investigative protocol , which must include a rigorous methodology covering : a complete autopsy with a special regard to aas target organs and apparatus ( the cardiovascular system in primis ) . a broad toxicological investigation , preceded by a careful evaluation of clinico - anamnestic data , in order to confirm an aas consumption ( including type of aass , concentration and interval of exposure ) and the possible detection of other substances which could have contributed to the fatal outcome . for this purpose , different matrices can be used ; urine is the most common , because it provides a prolonged detection time window , but also several other matrices such as : blood , serum , plasma , hair , oral fluid and nails can be used . the comparison of the cases reported here , allows us to support the hypothesis that the combined effects of strong workout , the prolonged / chronic or previous abuse of aass in different forms and combinations , have predisposed these subjects to develop different patterns of myocardial injuries and consequent sudden cardiac death [ 21 , 23 ] . therefore , the authors would strengthen the warning already expressed in previous reports [ 21 , 23 ] against the use / abuse of these substances among professional and non - professional athletes . moreover , only through a careful examination of all suspicious cases of aas related deaths with the application of a rigorous investigative protocol , these cases can be identified and they could provide further information and data that may increase the knowledge of this type of deaths . | anabolic androgenic steroids ( aass ) represent a large group of synthetic derivatives of testosterone , produced to maximize anabolic effects and minimize the androgenic ones .
aas can be administered orally , parenterally by intramuscular injection and transdermally .
androgens act by binding to the nuclear androgen receptor ( ar ) in the cytoplasm and then translocate into the nucleus .
this binding results in sequential conformational changes of the receptor affecting the interaction between receptor and protein , and receptor and dna.skeletal muscle can be considered as the main target tissue for the anabolic effects of aas , which are mediated by ars which after exposure to aass are up - regulated and their number increases with body building .
therefore , aass determine an increase in muscle size as a consequence of a dose - dependent hypertrophy resulting in an increase of the cross - sectional areas of both type i and type ii muscle fibers and myonuclear domains .
moreover , it has been reported that aass can increase tolerance to exercise by making the muscles more capable to overload therefore shielding them from muscle fiber damage and improving the level of protein synthesis during recovery.despite some therapeutic use of aass , there is also wide abuse among athletes especially bodybuilders in order to improve their performances and to increase muscle growth and lean body mass , taking into account the significant anabolic effects of these drugs.the prolonged misuse and abuse of aass can determine several adverse effects , some of which may be even fatal especially on the cardiovascular system because they may increase the risk of sudden cardiac death ( scd ) , myocardial infarction , altered serum lipoproteins , and cardiac hypertrophy .
the aim of this review is to focus on deaths related to aas abuse , trying to evaluate the autoptic , histopathological and toxicological findings in order to investigate the pathophysiological mechanism that underlines this type of death , which is still obscure in several aspects .
the review of the literature allowed us to identify 19 fatal cases between 1990 and 2012 , in which the autopsy excluded in all cases , extracardiac causes of death . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
peritoneal dialysis ( pd ) is an underutilized dialysis modality in the united states , especially in urban centers with diverse patient populations . overall , excluding patients who may have difficulty performing the procedure ( e.g. , stroke , poor vision , and previous abdominal surgery ) , as many as 85% of stage 5 chronic kidney disease ( ckd ) patients are medically eligible for peritoneal dialysis . however , patients on pd comprise only 10% of the entire end - stage renal disease ( esrd ) population and the percentage of african - american and hispanic esrd patients treated with peritoneal dialysis has been consistently lower than that of white dialysis patients . surveys show that only two - thirds of esrd patients beginning maintenance dialysis are presented with peritoneal dialysis as an option . african - americans comprise 37% of the esrd population but comprise only 25% of the patients receiving pd . hispanic patients comprise 17% of the total esrd population but only 13% of pd patients . the reasons for this disparity are complex and are the subject of ongoing study . several studies have identified the physician 's role in dialysis choice ; however physician bias is difficult to gauge [ 4 , 5 ] . one reason that is clear from the data is that if the physician does not believe that patients have sufficient family or social support then they are referred to pd at significantly lower rates . this suggests that the physician 's assessment of the probability of technique retention is a major factor in encouraging one modality over another , and presumably this disproportionately affects patients who are resource - poor in urban settings . when technique failure does occur in pd unfortunately , there have been only a handful of dated reports that have examined this issue in - depth . previous reports suggest that age , gender , comorbid diabetes , and low socioeconomic factors are independently associated with technique failure [ 8 , 9 ] . we sought to examine technique survival and the particular reasons for pd withdrawal among incident patients in an urban , racially diverse practice setting near downtown houston , texas . approval from the human subjects irb at baylor college of medicine and authorization from the dialysis center ( satellite health / wellbound of houston ) were obtained prior to the conduct of this study . records of all adult patients from january 2009 ( when the unit began to recruit patients ) to march 2014 were abstracted for demographic information , technique duration , and the reasons for withdrawal . patients were classified as african - american , hispanic - latino , white , asian , and native american based on what was indicated on center for medicare and medicaid services ( cms ) reporting forms . catheter malfunction , peritonitis , and exit site infection were assessed as well as kidney transplantation . technique failure was defined as discontinuation of pd for more than 6 weeks , but this did not include patients who were transplanted or recovered renal function . patients who expired , were transplanted or recovered kidney function were censored in the analysis and all others were considered as treatment failure ( events ) . kaplan - meier plots were generated to indicate time to treatment failure , log - rank test was used to compare time to event between groups , and cox proportional hazards regression was used to evaluate associations between age , race , and gender with risk of treatment failure . death and transplant were explored as competing risks but did not change the results and were not included in the analysis . there were 128 incident esrd patients included in the study and their characteristics are listed in table 1 and the reasons for pd withdrawal in figure 1 . the principle reasons for pd withdrawal were repeated peritonitis ( 30% ) ; catheter dysfunction ( 18% ) ; ultrafiltration failure ( 16% ) ; patient choice or lack of support ( 16% ) ; or hernia , leak , or other surgical complications ( 6% ) ; and a total of 6 patients died during this period . of the patients who did not expire and were not transplanted , 51% transferred to in - center hemodialysis and 8% to home - hemodialysis at the same center . not included in the calculation were 12 patients ( 17% of discharges ) who were transplanted and 8 patients ( 12% of discharges ) who changed pd units . the median technique survival was 781 days ( 2.1 years ) during the study window . figure 2 shows the aggregate kaplan - meier time to technique failure among all the patients analyzed . of the 128 patients , a total of 54 patients were classified as technique failure ( excluding transplant , renal recovery , and death ) during the study window and the mean length of technique survival in this group who withdrew from pd was 344 days . race is not associated with time to technique failure ( p = 0.548 ) when race has 5 categories ( african - american , asian , hispanic , native american , and white ) . when grouping asian and native american together race still was not associated with time to technique failure ( p = 0.7233 ) ( figure 3 ) . categories of age by quartiles were not associated with technique failure ( p = 0.904 ) . bmi by quartiles was also not associated with time to technique failure ( p = 0.974 ) . when bmi was defined by weight categories ( underweight : bmi < 18.5 ; normal : 18.525 ; overweight : 2530 ; obese : > 30 ) , it was also not associated with time to technique failure ( p = 0.3794 ) ( figure 4 ) . when limited to 3 major categories and other , there was no significant difference in survival by cause of esrd ( p = 0.885 ) ( figure 5 ) . from the cox proportional hazards model individual or combined , none of the variables examined were significantly associated with hazard of technique failure . in our analysis , peritonitis is the primary cause of transfer from pd , and we acknowledge that although peritonitis is a leading precipitating event for transfer , we speculate that the genuine reason may be patient burn - out , noncompliance , inadequate dialysis , a request based on lifestyle , or a persistent exit site infection . although our sample size may be too small to make definitive conclusions , factors such as gender , bmi , and esrd diagnosis did not make a difference in technique survival and african - american and hispanic patients compare favorably to other groups . the merits of peritoneal dialysis are apparent , including safety , cost , and quality of life . there are no differences in peritoneal transport characteristics and likelihood of achieving adequacy among varying racial groups . furthermore , technique survival and the reasons for technique failure are not appreciably different in this population comprised of mostly african - american and hispanic patients in prior surveys that have been performed . a report by korbet et al . and tanna et al found that pd may be associated with better long - term patient survival in african - americans [ 12 , 13 ] . still other studies found that sociodemographic factors , such as fewer years of education , employment , and us minority status , are associated with lower technique survival . suggests that there may be differences in the way patients and families of different backgrounds make informed treatment choices , and a better understanding of these differences can help dialysis providers more effectively facilitate decisions related to dialysis choice . in light of the present study and the ones that have been reported previously pd as technique should be supported in all eligible populations . this study does have its limitations including a relatively small sample size and lack of exit surveys in the methodology , which may have enhanced understanding of the results . a regional analysis of incident and prevalent patients in urban pd programs that have a critical mass of patients and that collected center specific data ( e.g. , physician , nursing experience , etc . ) would be an ideal design . our findings suggest that there are a number of causes of pd failure and measures to limit peritonitis should be a primary focus in order to promote technique retention . other measures such as ensuring patient support to avoid burn - out and coordinating with surgeons to ensure proper catheter function and limiting surgical complications may also contribute to technique retention . more focused education about home - hemodialysis as an option , 8% in our analysis , may present an opportunity for those on pd who are beginning to demonstrate signs of technique failure to stay on home therapy . lastly , concentrated efforts to educate and offer peritoneal dialysis to hispanic and african - american could result in a higher proportion choosing pd as a treatment option . | background . peritoneal dialysis ( pd )
is an underutilized dialysis modality in the united states , especially in urban areas with diverse patient populations .
technique retention is a major concern of dialysis providers and might influence their approach to patients ready to begin dialysis therapy . methods .
records from january 2009 to march 2014 were abstracted for demographic information , technique duration , and the reasons for withdrawal .
results .
the median technique survival of the 128 incident patients during the study window was 781 days ( 2.1 years ) .
the principle reasons for pd withdrawal were repeated peritonitis ( 30% ) ; catheter dysfunction ( 18% ) ; ultrafiltration failure ( 16% ) ; patient choice or lack of support ( 16% ) ; or hernia , leak , or other surgical complications ( 6% ) ; and a total of 6 patients died during this period .
of the patients who did not expire and were not transplanted , most transferred to in - center hemodialysis and 8% transitioned to home - hemodialysis .
conclusions .
our findings suggest measures to ensure proper catheter placement and limiting infectious complications should be primary areas of focus in order to promote technique retention .
lastly , more focused education about home - hemodialysis as an option may allow those on pd who are beginning to demonstrate signs of technique failure to stay on home therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pulmonary fibrosis results from injury to the lung and an ensuing fibrotic response that leads to thickening of the alveolar walls and the obliteration of alveolar air spaces . if the etiology is unknown , the condition is designated as idiopathic pulmonary fibrosis ( ipf ) . there are also several groups of xenobiotics or environmental toxins known to cause pulmonary fibrosis , for example , the antineoplastic agent bleomycin , the class iii antiarrhythmic agent amiodarone , gamma - irradiation , silicon dust , and asbestos . the main histological features of the fibrotic lung are persistent and unrepaired epithelial damage , proliferation and accumulation of fibroblasts and myofibroblasts , and increased collagen deposition . this section will discuss evidence that lung - derived angiotensinogen ( agt ) plays an important role in lung fibrogenesis . numerous studies support the existence of local angiotensin ( ang ) systems in various organs and tissues . for example , the ang ii concentrations in the interstitial compartment of heart and eye were found to be 5100 fold higher ( about 50500 pm ) than that in plasma ( ~510 pm ) [ 4 , 5 ] . the higher interstitial levels of ang ii compared to the circulating level could not be explained by diffusion and/or receptor - mediated uptake of circulating angiotensin ii . these results thereby suggest that tissue angiotensin ii is largely , if not completely , synthesized locally . furthermore , cultured cells from various organs including heart , vascular endothelium , brain [ 810 ] , and lung were shown to express the ang system components such as agt , ang ii , and their corresponding converting enzymes and angiotensin receptors . in contrast to the classical endocrine renin - angiotensin - aldosterone system ( raas ) in which the octapeptide angiotensin ii is enzymatically cleaved from agt by the actions of renin and angiotensin - converting enzyme ( ace ) , local angiotensin systems are categorized as either intrinsic ( independent of the endocrine raas ) or extrinsic ( relying on the endocrine raas for some of its components ) . an important distinction between the endocrine and local tissue ang systems is the fact that many local ang systems have been shown to be independent of renin and ace , but rather depend on other enzymes such as cathepsin d , tonin , cathepsin g , or chymase , for the enzymatic conversion of agt to angii . this concept as it applies to the lung will be discussed further below ; in light of the discussion to follow , in this paper the local pulmonary system described here will be referred to as an ang system rather than an raas because it is not dependent on either renin or aldosterone , at least as far as our current knowledge has elucidated . first , however , the evidence that lung - derived angiotensinogen is involved in pulmonary fibrosis will be described . it has been shown that two cell types in the lung produce agt : injured alveolar epithelial cells ( aecs ) and myofibroblasts . primary cultures of aecs exposed to apoptosis inducers synthesize and secrete agt and the processed peptide ang ii in response to fas ligand , tnf - alpha , or bleomycin . primary cultures of myofibroblasts isolated from fibrotic human lungs ( ipf biopsies ) also expressed agt mrna and expressed and secreted the agt protein as well as the processed peptide angii , strongly suggesting that human lung myofibroblasts synthesize agt in the intact lung . studies of myofibroblasts isolated from the heart showed that these abnormal cells express the aspartyl protease cathepsin d , which , like renin , also cleaves agt to angi albeit at a lower ph optimum ; this topic will be discussed further below . in addition to these cell culture studies , there is in vivo evidence demonstrating the existence of lung - derived agt . endogenous agt mrna within lung tissue ( perfused immediately before harvesting to remove blood ) was upregulated in vivo as early as 3 hours after bleomycin instillation into rat lungs ; this was demonstrated by rtpcr , in situ hybridization and immunohistochemistry . in the rat model , agt mrna and angiotensin peptides were localized in alveolar wall cells within the alveolar corners , the location of type ii pneumocytes . these markers also colocalized with alpha - smooth muscle actin ( -sma ) , the standard marker of lung myofibroblasts . those data were the first to suggest that bleomycin activated the production of the local angiotensin systems in vivo . moreover , they were consistent with the previous finding of epithelial cell death in the vicinity of alpha - sma - positive myofibroblasts in fibrotic human lung . in light of the earlier demonstration that angii is an inducer of apoptosis in aecs , this finding thus supports the theory that alveolar epithelial death adjacent to myofibroblasts is caused , at least in part , by the ang peptides they release . furthermore , in biopsy specimens obtained from the lungs of patients with idiopathic pulmonary fibrosis ( ipf ) , agt mrna and protein were 21-fold and 3.6-fold more abundant , respectively , in ipf biopsies relative to biopsies of normal human lung . the data from the ipf lung biopsies are consistent with data from bleomycin - induced rat lung fibrosis models . recently our research group demonstrated that intratracheal administration of antisense oligonucleotides against agt mrna prevented bleomycin - induced lung cell apoptosis and lung fibrogenesis by blockade of the synthesis of lung - derived agt . two important aspects of that study were the findings that fluorescently tagged antisense , when administered intratracheally , were taken up exclusively by the lungs , but less than 5% was taken up by liver or kidney . consistent with that finding , the antisense oligos completely blocked the bleomycin - induced increase in lung tissue agt , but had no effect on serum - borne agt or circulating angii . those data strongly implicated organ - specific transcription of lung - derived agt as a critical determinant of lung fibrogenesis . investigations of primary cultures of aecs and lung explant cultures demonstrated some of the many factors capable of inducing agt expression in lung tissue . agt mrna expression in primary aecs and the human aec cell line a549 is upregulated by , and functional agt mrna is required for , the apoptotic response to fas l , tnf- , bleomycin , and amiodarone ; this was shown by the demonstration that the apoptosis of primary aecs and a549 cells caused by these agents was blocked by the same agt antisense oligos used in the preceding paragraph , but not by scrambled - sequence control oligonucleotides of the same base composition as the antisense . in another model of cultured lung explants , in which the endocrine raas is not active , bleomycin - induced collagen accumulation ex vivo also required agt gene expression ; the agt antisense oligos also blocked collagen deposition in this model . other considerations support the notion that local transcription of agt , as well as converting enzymes synthesized locally rather than derived from the endocrine raas , comprises an intrinsic ang system that is upregulated in lung injury but independent of the endocrine raas . in the whole animal model , circulating levels of angiotensinogen are known to be approximately equal to the michaelis constant ( km ) of renin for its substrate ( about 1 um ) . therefore , the rate of angiotensin ii synthesis can be regulated by changes in angiotensinogen levels . since the normal concentration of agt is near the km for its cleavage by renin , one might expect any change in agt levels to be accompanied by parallel changes in the formation and actions of ang ii . published findings support this concept ; for instance , transgenic mice overexpressing the rat agt gene are hypertensive and mice underexpressing the agt gene are hypotensive . in addition , for any given level of renin activity , angiotensin ii synthesis can be altered by changes in the concentration of available agt . for example , upregulation of agt in tissue can alter tissue concentrations of angiotensin ii , particularly , in tissues which are not subjected to systemic short - loop or long - loop feedback control . in the bleomycin - induced pulmonary fibrosis model , agt expression furthermore , intratracheal delivery of antisense oligos against agt mrna blocked apoptosis of alveolar epithelial cells and subsequent collagen deposition , both of which are consistent with the result that the antisense oligos decreased local ang ii generation . whether the circulating angii contributes to the local pulmonary angii that mediates lung fibrogenesis is unlikely , for several reasons . first , the concentration of angii in the serum is extremely low , on the order of 15 pm , due to the many peptidases in the serum that rapidly degrade the octapeptide . measurements of tissue angii by marshall et al . suggest that lung tissue angii concentration is much higher , especially after lung injury that activates the local lung ang system . moreover , uptake from the circulation can be quantified by measuring steady - state tissue and plasma levels of 125i - labelled ang i and ii during 125i - angi and ii infusion . results obtained from pigs [ 4 , 28 ] showed that i25i - ang ii , but not 125i - ang i , accumulated in tissues like heart , kidney , and adrenal gland . the absence of significant tissue 125 i - ang i accumulation indicated that the presence of tissue ang i , at least in those organs , can not be attributed to uptake from circulation . accumulation of 125 i - ang ii at tissue sites was largely prevented by pretreatment with an at1 receptor antagonist , suggesting that uptake of ang ii is mediated via at 1 receptor - dependent endocytosis . it is unlikely that at2 receptors play a role in this process since at2 receptors do not internalize ang ii . similar conclusions about that at1 receptor mediates internalization of ang ii were drawn from ang ii infusion studies in rats [ 31 , 32 ] . however , comparison of the 125 i - labelled and endogenous angiotensin levels revealed that , despite the significant uptake of 125i - ang ii in various tissues , the majority ( > 90% ) of tissue instead , it is synthesized from locally generated ang i . in the lung angii uptake may not exist as treatment with losartan increased rather than decreased pulmonary ang ii concentration . moreover , several lines of evidence argue that enzymes other than renin and ace are involved in local angii generation from lung - derived agt , in contrast to the endocrine raas which is dependent on these two enzymes . first , the angii - dependent apoptosis of alveolar epithelial cells that results from exposure to bleomycin was shown to require cathepsin d , an aspartyl protease that serves the same function as renin , although at a lower ( ~6.0 ) ph optimum . the induction of apoptosis both activated and upregulated cathepsin d and agt within the target cell itself and also promoted their release into the extracellular space [ ibid ] . the latter may be particularly important in light of the relatively low ph within the aqueous extracellular environment immediately above the type ii alveolar epithelial cell in vivo . this region , known as the alveolar hypophase or subphase , is an aqueous layer immediately above the epithelial cell but below the surfactant phospholipid monolayer . experiments with microelectrodes have shown this microenvironment to have a ph of about 6.66.9 , due to proton pumps and na+/k+-atpases on the aec which function in unidirectional energy - dependent water movement out of the alveoli . thus , aec - derived agt and cathepsin d are released from aecs after lung injury into a microenvironment with a ph favorable for cathepsin d - mediated cleavage of agt to ang i. indeed , even if renin were sequestered from the serum , the low ph in this microenvironment would be predicted to favor cathepsin d activity over that of renin . in addition , cathepsin d was shown to be upregulated in fibrotic human lung and in rat lung epithelial cells undergoing apoptosis in vitro in response to advanced glycation end products . likewise , inhibitors of chymase , one of the other enzymes known to have the same ability as ace to convert angi to angii , have been shown to inhibit paraquat - induced lung injury and fibrosis in mice and bleomycin - induced lung fibrosis in hamsters . thus , the presence of renin or ace in the local pulmonary ang system is not necessary for conversion of agt to angii . taken together , our results and those of other groups strongly suggest that the local ang system described here does not require enzymes from the endocrine raas and that expression of agt de novo in the lung is the most likely rate - limiting step for angiotensin ii generation within the extravascular compartment of the lung parenchyma . the human angiotensinogen gene is located on chromosome 1q42-q43 and contains 5 exons/4 introns showing organization similar to other serine protease inhibitors ( serpins ) superfamily to which agt belongs . the human agt gene encodes the human angiotensinogen molecule , an 2-globulin protein ( 485 amino acid ) , with a molecular weight of about 61 kda . exon 1 of the human agt gene encodes for a short 37 bp 5 untranslated tract , with the second exon encoding the initiation methionine , signal peptide , and the majority of the mature protein [ 40 , 41 ] . agt abundance is regulated at the transcriptional level through hormonal and cell - type - specific regulators . the human angiotensinogen core promoter element 1 ( agce1 ) site , located between the tata box and transcription initiation site , was shown to be a critical regulator of agt transcription by binding to human angiotensinogen core promoter binding factor 1(agcf1 ) in the human hepatoma cell line hepg2 cells . agce1 was also shown to be required for the activity of an upstream agt enhancer , atf - like element ( ale ) . in addition to agce1 , yanai et al . also describes two agce2 sites , located upstream and downstream of the transcription initiation site that show a possible cell - type - dependent function . the hepatocyte nuclear factor 4 ( hnf4 ) was also shown to potentiate human agt ( hagt ) promoter activity in hepg2 cells . other cell type - dependent elements controlling agt transcription are direct repeat sequences ( dr ) in agt promoter that contribute 50 or > 95% to agt transcription in liver or kidneys , respectively , whereas the same sequences are not required in the heart and brain , and a 3-downstream enhancer that binds an ap-3-related factor and human angiotensinogen enhancer factor-1 ( haef-1 ) . in kidney cells , intrarenal agt expressed in renal proximal tubular cells was shown to be regulated by nuclear factor-b ( nf-b ) binding to an nf-b - binding site in the hagt promoter region . inducible human agt transcription has been studied in response to several factors . in hepg2 cells , interleukin- ( il- ) 6 induces agt transcription via stat3 binding to one of three acute - phase response elements ( apres ) present between 350 and 122 upstream of transcription start site . recently , jain et al . suggested that three transcription factors , glucocorticoid receptor ( gr ) , stat-3 , and hnf-1 , bind to the apres region of the hagt gene promoter and are responsible for il-6-induced promoter activity of this gene in liver cells . upregulation of human agt gene transcription in hep3b hepatocytes by interferon - gamma was shown to involve stat1-binding motif in the agt promoter between 271 and 279 in a mechanism separate from il-6 upregulation of agt by stat3 . other inducers of agt transcription include estrogen , through an estrogen responsive element near tata box of the promoter . in a study suggesting relation between adipose agt secretion in obesity and elevated blood pressure , agt gene expression and secretion in adipose tissue were found to be stimulated by cyclic amp via increased dna cyclic amp - responsive element- ( cre- ) binding activity . , where finb , a multiple zinc finger protein , was reported to repress transcription of the agt gene via binding of two elements in the 5 flanking region of the human agt promoter . expression of agt gene was also shown to be repressed in hepg2 cells in response to bile acids via the small heterodimer partner ( shp ) acting on the binding site of hepatocyte nuclear factor-4 ( hnf-4 ) on the agt gene promoter . as angiotensinogen is the precursor protein for the angii peptide , the regulation of agt gene expression in the lung under fibrotic conditions has been studied by our research group in response to profibrotic and proapoptotic inducers . in cultured pulmonary epithelial cells , the antiarrhythmic drug amiodarone , which is fibrogenic for the lungs at therapeutic doses , induced agt transcription through the ap-1 site present between the tata box and transcription start site . transforming growth factor - beta1 ( tgf-1 ) , the prototype mediator of extracellular matrix deposition in the lungs and other tissues , mechanisms for this regulation required binding of both the ap-1 family transcription factor jund and hypoxia inducible factor-1 alpha ( hif-1 ) to the agt core promoter ; the significance of these factors , especially hif-1 , is discussed further in the following paragraphs . it is notable that hypoxia inducible factors have been previously suggested to be involved in the pathogenesis of lung fibrosis . in alveolar epithelial cells , hypoxia was found to induce apoptosis of primary cultures of alveolar epithelial type ii cells in a manner comparable to the effects of angii on these cells . overexpression was detected in the so - called hyperplastic epithelium of fibrotic lungs , which is found in the same regions immediately adjacent to the myofibroblast foci in which the apoptotic epithelia described above were found . moreover , the activation of hif pathways results in epithelial - mesenchymal transition and fibrosis [ 61 , 62 ] . on the other hand , in lung fibroblasts the overexpression of von hippel - lindau protein ( pvhl ) that targets hif for degradation failed to decrease hif signaling , and the tgf-1 that mediates transition of fibroblasts to myofibroblasts increases the nuclear abundance of hif-1 protein . in light of our demonstration that the transcription of agt in response to tgf-1 is mediated by the hypoxia - signaling transcription factor hif-1 , these findings suggest a molecular mechanism linking hypoxia - signaling and fibrogenic stimuli in the lungs by modulation of the levels of the angii peptide precursor agt [ 58 , 59 ] . as discussed above , the severity of fibrotic diseases in the heart and kidney is influenced by angii . in the heart , angii plays a role in the hypertrophy of cardiomyocytes , fibroblast hyperplasia , and interstitial cardiac fibrosis . the progression of congenital hepatic fibrosis is mediated through the increase of angiotensin - converting enzyme ( ace ) , angii , and tgf-1 . this was also reflected in the disease progression of liver injury following chronic hepatitis c infection , in which liver fibrosis severity was highly associated with genotypes leading to higher expression of tgf-1 and agt . as discussed above , local expression of agt is a requirement for the experimental induction of lung fibrogenesis [ 1 , 16 ] ; additionally , angii is a mediator of the fibroproliferative response in acute lung injury activated epithelial cells and myofibroblasts are sources of angii . the profibrotic effect of angii is mediated through the stimulation of tgf-1 and the induction of epithelial mesenchymal transition ( emt ) resulting in the differentiation of epithelial cells , in addition to normal fibroblasts , into myofibroblasts . recent work showed that agt mrna and protein are constitutively expressed in human lung myofibroblasts in response to autocrine loops most important for the following discussion is that the upregulation of agt by tgf-1 is mediated through the agt core promoter , which contains three single nucleotide polymorphisms ( snps ) , a-20c , c-18 t , and g-6a [ 43 , 58 , 67 ] . in fibrosis of organs other than the lungs , interindividual variability in the progression or severity of fibrotic disease is correlated with genetic variants in agt at those three genetic loci . in a spanish ipf cohort , it was demonstrated that the aa genotype of g-6a snp was significantly associated with disease progression as measured by changes in the alveolar - arterial oxygen gradient over time . this same genotype was also linked to an increase in hepatic fibrosis in people with chronic hepatitis c infections and in advanced liver fibrosis in the severely obese [ 66 , 69 ] . in the heart , g-6a and a-20c snps are associated with an increase in mean carotid intimal - medial thickening ( imt ) in females . in a similar manner , both of these snps displayed a significant relationship in liver cirrhosis in patients with chronic hepatitis b . the g-6a snp is found in partial linkage disequilibrium with a-20c and c-18 t . as a consequence , a higher frequency of g-6a is found with c alleles at the 20 and 18 positions . due to the scarcity of the c-18 t genotype in the human population , the progression of fibrosis is exacerbated when variants in agt are inherited in conjunction with variants in other genes . for example , the inheritance of variants in tgf-1 and agt together is associated with increased staging of hepatic fibrosis . individually , these variants are correlated with higher stages of fibrosis ; however , the inheritance of both the arginine / arginine genotype in codon 25 of tgf-1 and the aa genotype in 6 of agt , together , led to more progressive fibrosis than either variant alone [ ibid ] . this effect was also associated with advanced hepatic fibrosis in obese patients with nonalcoholic fatty liver disease . the interaction of a-6c of agt with the i allele of ace leads to an increase in the mean imt in the population as a whole . based on these studies , it is hypothesized by our research group that the progression and/or severity of collagen deposition in ipf may be predicted by a risk haplotype in the agt gene . the theorized risk haplotype that will be found to predict ipf severity is cca ( 20 , 18 , and 6 , resp . ) . in addition , it is predicted that inheritance of this variant with the arginine / arginine genotype in codon 25 of tgf-1 and/or the d allele of ace , which also has been associated with more severe lung fibrosis , will further intensify the progression or severity of ipf . given the widespread use and relative safety of inhibitors of the ang system in cardiovascular diseases , the potential of these inhibitors in the therapeutic management of patients with lung fibrosis is of high interest . initial attempts to find therapeutic benefit of ace inhibitors through retrospective analyses of clinical data from individuals receiving ace inhibitors for other comorbid conditions did not find therapeutic improvement of lung fibrosis [ 72 , 73 ] . however , these studies were not designed as prospective tests of lung fibrosis alone nor were the subjects chosen randomly . moreover , the above discussion of ace - independent pathways of angii formation in local tissue ang systems argues against the prospect of therapeutic benefit through inhibition of ace . indeed , a recent study of the counter regulatory ace-2/angiotensin 1 - 7/mas axis has shown that ace inhibitors might , at least theoretically , prove to be counterproductive through their potential reduction of the inhibitory peptide angiotensin 17 . this heptapeptide , which is the product of angii degradation by ace-2 , inhibits the actions of angii and is normally present in much higher levels than the profibrotic angii [ ibid ] . on the other hand , significant published data support the potential efficacy of at1 receptor antagonists in animal models ( see previous discussion ) , and several clinical trials of at1 receptor blockers in ipf are currently underway . an alternate therapeutic strategy might be the reduction of lung - specific agt transcription through antisense oligonucleotides delivered specifically to the lungs . activation of the local ang system in lung tissue is now known to be a required event in the pathogenesis of experimental lung fibrosis . data from lung biopsies obtained from patients with idiopathic pulmonary fibrosis ( ipf ) are consistent with the hypothesis that a local lung ang system also is activated in human lung fibrosis . transcription of the angiotensinogen ( agt ) gene is the rate - limiting step in this activation , and antisense oligonucleotides against agt mrna prevent both lung epithelial cell apoptosis and the accumulation of lung collagens . single nucleotide polymorphisms ( snps ) in the agt gene , some of which are known to be significantly associated with essential hypertension and higher rates of agt gene transcription , have been shown to associate with more rapid progression of ipf . it is hoped that the further analysis of additional snps in the agt gene will reveal an ipf risk haplotype in agt that might hold significant predictive value in the treatment of ipf and possibly other lung diseases that are influenced by lung agt expression . | an established body of literature supports the hypothesis that activation of a local tissue angiotensin ( ang ) system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis .
transcriptional activation of the angiotensinogen ( agt ) gene is believed to be a critical and necessary step in this activation .
this paper summarizes the data in support of this theory and discusses transcriptional regulation of agt , with an emphasis on lung agt synthesis as a determinant of fibrosis severity .
genetic data linking agt polymorphisms to the severity of disease in idiopathic pulmonary fibrosis are also discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
overweight and obesity predispose to various pregnancy complications , such as preeclampsia ( pe ) . pe is a potentially life - threatening syndrome of hypertension , proteinuria , generalized vasoconstriction , and platelet consumption , complicating 26% of first pregnancies . its exact pathogenesis remains unclear , but both genetic and environmental factors seem to play a role . studies have shown links between the pathologic characteristics of the metabolic syndrome , gestational diabetes and type 2 diabetes ( t2 dm ) , and those of pe ( e.g. , obesity , hyperinsulinemia , hypertriglyceridemia , thrombotic and proinflammatory changes , endothelial dysfunction , and sympathetic overactivity ) [ 46 ] . many of the metabolic abnormalities appear to persist several years postpartum [ 710 ] . in line with these findings , patients with prior pe seem to be at elevated risk of developing impaired glucose tolerance or t2 dm in later life [ 11 , 12 ] . genome - wide association studies in several ethnic populations have shown a common variant of the highly polymorphic obesity and fat mass - related fto gene , rs9939609 ( t / a ) , located on chromosome 16q2 , to be associated with obesity and t2 dm [ 13 , 14 ] . while the mechanisms of this association are not known , the effect of fto variants on the risk of t2 dm is mediated by the effect of fto on the body - mass index ( bmi ) . recent studies have revealed linkages between fto variants and gestational diabetes , the polycystic ovary syndrome ( pcos ) as well as the metabolic syndrome and hyperandrogenism in pcos women [ 17 , 18 ] . the a - allele of rs9939689 has also been associated with elevated blood pressure in finnish women and french canadians [ 19 , 20 ] . as pe is linked to many of the above - mentioned conditions associated with fto variants , we decided to investigate whether the snp rs9939609 is associated with the risk of pe in a finnish study population . we genotyped the fto snp rs9939609 in 485 finnish women with prior pe in a singleton pregnancy and 449 control women who had given birth after a normotensive singleton pregnancy . all subjects provided a written informed consent , and all study protocols were approved by the appropriate local ethical committees . in addition , the approval of the finnish ministry of social affairs and health was obtained for the population - based study ( data set 1 ) . systolic blood pressure 160 mmhg and/or diastolic blood pressure 110 mmhg was classified as severe pe . the criteria for severe pe used in this study do not include the severity of proteinuria as quantitative measurements of proteinuria were not available for all cases . prepregnancy weight and height were obtained from the antenatal care records , where they are in most cases recorded as reported by the mother at the first maternity clinic visit , usually before 12 weeks of gestation . body mass index ( bmi ) was defined as the prepregnancy weight in kilograms divided by height in meters squared ( kg / m ) . bmi 25 kg / m was classified as overweight and bmi 30 kg / m as obese . small - for - gestational age ( sga ) was defined as relative birth weight under 2.0 sd units ( z score ) according to finnish standards . the cases and controls for the population - based data set pregnant women are registered in the national register of blood group and blood group antibodies of pregnant women at the finnish red cross blood service , from which 100.000 consecutive pregnant women were identified during 1997 - 1998 . of these , 1084 had an international classification of diseases ( icd-10 ) code for pe or eclampsia in the national hospital discharge register maintained by the national research and development centre for welfare and health . first , 665 women with pe diagnosis were invited to the study , and 411 ( 62% ) participated . after checking the case records and excluding multiple pregnancies , 226 cases with singleton pregnancies fulfilled the criteria for pe . in addition to pe patients , a random sample of women without pregnancy complications ( n = 1930 ) were invited to the study , and 843 ( 44% ) participated . of these , 346 women with singleton full - term pregnancies without hypertensive complications , matched as closely as possible with the cases for the province of residence , parity , and maternal age , served as controls in this study . all participants were of finnish ethnic origin , gave blood samples for the study , and filled out questionnaires to supplement the data obtained from medical records . pe was defined as systolic blood pressure 140 mmhg and diastolic blood pressure 90 mmhg with new - onset proteinuria ( 0.3 g / l or 0.5 g/24 hours or dipstick + representing values 0.3 g / l ) after 20 weeks of gestation in a previously normotensive woman ( slightly modified from acog criteria ) [ 22 , 23 ] . , we identified women who had developed severe pe and given birth in helsinki university central hospital between january 1988 and april 1998 . blood samples were collected between january 1997 and april 1998 after the index pregnancy . during the same period , blood samples were collected from control subjects with singleton deliveries in the same hospital after uncomplicated pregnancies . in total , 129 preeclamptic women and 103 normotensive healthy controls with no pregnancy complications were recruited . among the pe cases , 102 women had a systolic blood pressure 160 mmhg and/or a diastolic blood pressure 110 mmhg , and 61 patients had proteinuria of at least 5 g per 24-hour urine collection . all subjects were of finnish ethnic origin , lived in southern finland , and had been healthy before their first pregnancy , without evidence of renal or autoimmune diseases . at 12 weeks postpartum , the diagnostic criteria of pe used were systolic blood pressure 140 mmhg and diastolic blood pressure 90 mmhg with new - onset proteinuria ( 0.3 g/24 hours ) after 20 weeks of gestation in a previously normotensive woman . the blood pressure was confirmed by two measurements taken at least 6 hours apart . the samples of this data set were collected retrospectively from women with prior pe when primiparous who delivered at kuopio university hospital between january 1994 and december 1998 . pe patients were identified from the birth registry of the city of kuopio , contacted by telephone , and asked to participate in the study and sign a consent form . patients with multiple pregnancies were excluded . in total , samples obtained from 130 women with prior pe in a singleton pregnancy were analyzed . in this study , pe was defined as the development of hypertension and new - onset proteinuria ( 300 mg of urinary protein per 24 hours ) . hypertension was defined as 140 mmhg systolic and/or 90 mmhg diastolic pressure , when measured on two consecutive occasions at least 24 hours apart . the fto snp ( rs9939609 ) was genotyped using an abi taqman allele discrimination predesigned snp genotyping assay ( applied biosystems ) . polymerase chain reaction ( pcr ) amplification was carried out according to the manufacturer 's instructions . an abi 7500 real - time thermocycler ( applied biosystems ) was used to perform plate reading . automated allele calling was performed by allelic discrimination plots using applied biosystems 7500/7500 fast real - time pcr software v.2.0 . the hardy - weinberg equilibrium calculator of the genetic online encyclopedia ( http://www.oege.org/software/hardy-weinberg.shtml ) was used to test for deviations in genotype distributions from the hardy - weinberg equilibrium . power analysis was performed assuming a pe prevalence of 3% , high - risk allele ( a ) frequency of 0.3272 , genotypic relative risk of 1.5 for at , and 2.0 for aa . with these assumptions , a sample size of 263 pe cases differences of the background characteristics between cases and controls were analyzed using the student 's t - test or the mann - whitney test ( continuous variables ) and the chi - square test or the fisher 's exact test ( frequencies for discrete variables ) . of the continuous variables , the bmi had a right - skewed distribution , and the birth weight in grams had a left - skewed distribution . the bmi was log transformed to attain normality for the logistic regression analyses of table 3 . differences in the frequencies of genotypes and alleles were analyzed using the chi - square test . logistic regression analysis was used for the calculation of crude and adjusted odds ratios ( or ) . linear regression analysis was used to determine the association of continuous variables with the risk allele . one - way analysis of variance ( anova ) and the bonferroni post hoc test were used to compare the means of continuous variables among the different genotype groups and data sets . the statistical software used was pasw statistics 18.0 and prism for windows , version 4.03 , grappad software inc , la jolla , calif , usa . the combined background characteristics of the three study populations used in this study are presented in table 1 . expectably , the cases had a higher mean bmi than the controls although the difference was statistically significant only among the primipara . in addition , the cases delivered earlier and their infants had a lower birth weight . pregestational and gestational diabetes were slightly more common among the primiparous pe cases than among the primiparous control women . when the pe cases of the three data sets were studied separately , significant differences in the background characteristics and risk factors were found between the data sets . the mean bmi values among the pe cases in data sets 1 , 2 , and 3 were 24.3 kg / m , 22.4 kg / m , and 24.8 kg / m , respectively , with the difference between data set 2 and the other two data sets being statistically significant ( p < 0.001 ) . in data sets 1 and 2 , the mean systolic blood pressure used to define pe in cases was similar , 170.2 mmhg and 170.9 mmhg , respectively , but in data set 3 , it was significantly lower , 161.0 mmhg ( p < 0.001 ) . correspondingly , the mean diastolic blood pressure values used to define pe in data sets 1 and 2 were 106.1 mmhg and 107.2 mmhg , but in data set 3 , the mean was 102.9 mmhg ( p = 0.016 and p = 0.002 for data set 3 versus data sets 1 and 2 , resp . ) . the mean gestational age at delivery was higher among the pe cases of data set 1 ( 36.6 weeks gestation ) compared with those of data sets 2 ( 34.4 weeks gestation ) and 3 ( 35.1 weeks gestation ) ( p < 0.001 and p = 0.001 , resp . ) . also the relative birth weight was higher among the offspring of cases of data set 1 ( 1,0 sd units ) compared with those of data set 2 ( 1.6 sd units ) and data set 3 ( 1.4 sd units ) ( p = 0.001 and 0.017 , resp . ) . well - established risk factors of pe such as bmi ( odds ratio [ or ] for each kg / m increase in bmi = 1.07 ; 95% ci : 1.04 , 1.11 ; p < 0.001 ) , primiparity ( or = 1.37 ; 95% ci : 1.05 , 1.79 ; p = 0.020 ) , and pregestational diabetes ( or = 6.16 ; 95% ci : 1.38 , 27.4 ; p = 0.017 ) were associated pe also in this study population when all three data sets were combined . when the data sets were analyzed separately , prepregnancy bmi was associated with pe ( or = 1.11 ; 95% ci : 1.061.15 ; p < 0.001 ) and severe pe defined by hypertensive criteria only ( or : 1.10 ; 95% ci : 1.061.16 ; p < 0.001 ) in data set 1 but not in data set 2 ( or = 0.95 ; 95% ci : 0.87 , 1.03 ; p = 0.172 ; and or = 0.963 ; 95% ci : 0.89 , 1.05 ; p = 0.963 , resp . ) . overall , 17.9% of all study subjects were overweight and 7.5% were obese . in data sets 1 , 2 , and 3 , the percentages of overweight and obese patients were 19.1% and 7.0% , 12.1% and 4.3% , and 23.1% and 15.4% , respectively . no difference in the frequency of overweight or obesity was found between subjects homozygous for the a - allele of rs9939609 and those homozygous for the t - allele ( p = 0.406 and p = 0.134 , resp . ) . in the entire study population , each additional a - allele corresponded to an increase in bmi of 0.145 kg / m , but the result was statistically nonsignificant ( 95% ci : 0.245 , 0.535 , p = 0.446 ) . among the cases and the controls , ( p = 0.791 , 95% ci : 0.526 , 0.690 ) and 0.025 kg / m ( p = 0.923 , 95% ci : 0.474 , 0.523 ) , respectively . in data sets 1 , 2 , and 3 , the bmi - changes per each additional a - allele were 0.197 ( 95% ci : 0.291 , 0.685 ; p = 0.427 ) , 0.412 ( 95% ci : 1.043 , 0.219 , p = 0.200 ) , and 1.409 ( 95% ci : 0.034 , 2.852 ; p = 0.056 ) , respectively . the mean bmi for the genotypes tt , at , and aa were 23.2 , 23.5 , and 23.5 for data set 1 , 23.1 , 22.5 , and 22.3 for data set 2 and 24.2 , 24.9 , and 27.5 for data set 3 , respectively , with all differences between groups being statistically nonsignificant . the rs9939609 genotypes and allele frequencies among the pe cases and controls are presented in table 2 . the genotype distributions did not deviate from the hardy - weinberg equilibrium among the cases or the controls . no evidence of an association between snp rs9939609 of fto and pe was found in this study . the prevalences of genotypes aa , at , and tt were 15% , 53% , and 32% , respectively , among the pe cases , and 16% , 47% , and 37% , respectively , among the controls ( p = 0.199 ) . the crude and adjusted odds ratios for the association of fto with pe , severe pe , and the delivery of a small - for - gestational - age ( sga ) infant are presented in table 3 . although overweight is a major risk factor of pregnancy - induced hypertension and pe , we were unable to demonstrate an association between the obesity - predisposing rs9939609 of fto and pe in this study . to the best of our knowledge , no reports on this subject have been published previously . the study population used in this study can be considered fairly representative of the finnish population as it is composed of a population - based sample as well as subjects recruited from hospitals with geographically based catchment areas in both eastern and southern finland . the a - allele frequency among this study population is somewhat higher than that reported by another finnish study but in line with the frequency demonstrated in other european populations . one of the weaknesses of the data sets used in this study was the lack of information on lifestyle factors , which could have influenced the association of rs9939609 with bmi . past studies regarding the interaction of physical activity and the effect of the fto genotype on bmi have been somewhat conflicting . karasawa et al . studied the effect of energy expenditure for moderate to high - intensity physical activity on the association of rs9939609 of the fto with obesity . the group found bmi to be significantly higher and obesity more frequent in the group with genotype aa and low physical activity , but not in the group with genotype aa and high physical activity . other researchers have also reported the effect of fto on obesity to be exacerbated by low physical activity [ 3033 ] . on the contrary , a study by jonsson et al . with a sample of 15925 swedish and 2511 finnish nondiabetic adults did not support the notion that physical activity modifies the effects of the fto rs9939609 variant on obesity . furthermore , lappalainen et al . found no association between fto variant and the magnitude of weight reduction achieved by a long - term lifestyle intervention in the finnish diabetes prevention study ( dps ) among middle - aged subjects with impaired glucose tolerance . . however , the lack of male study subjects should not be behind the lack of bmi association as previous studies have consistently shown the a - allele of rs9939609 to predispose to obesity independent of sex . the few studies that have reported sex differences have demonstrated a stronger effect among women [ 35 , 36 ] . it is unlikely that the mean age of the study populations would conceal the bmi - effect because the association of the rs9939609 of fto with bmi has been clearly shown among both children and adults [ 13 , 28 ] . hardy et al . have , however , demonstrated the effect to peak at 20 years and then weaken with progressing age . the present study population was relatively lean , with the mean bmis ranging from 22.4 to 24.8 in the three data sets analysed . however , the prepregnancy body weight was self - reported by the study subjects and thus might be somewhat underreported . nevertheless , the leanness of the study population might be one factor contributing to the lack of association of fto with bmi in this study . this is supported by the fact that the fto - bmi effect per one a - allele was the largest and approached statistical significance among the subjects of data set 3 , which included more overweight and obese subjects than the other data sets . the results of jacobsson et al . also suggested that the impact of fto on obesity may be less prominent in lean populations . on the other hand , the fto - bmi association was clear in the alspac study population , which was composed of women of reproductive age with a mean bmi comparable to the one reported in the present study . the differences in the background characteristics of the three pe data sets could explain why no association was demonstrated between the rs9939609 of fto and bmi or pe in this study . the pe cases in data set 2 suffered predominantly from the severe , earlier - onset form of pe with high proteinuria , whereas in data sets 1 and 3 , the severity of pe among the cases varied . in data set 2 , the cases were the leanest , bmi was not associated with an increased risk of pe , and the gestational age at delivery was the lowest . this is in line with the hypothesis that the early - onset pe is characterized by abnormal placentation and a stronger genetic component , while the role of maternal metabolic predisposition is more significant in the late - onset form of the disease . we found no evidence of an association between the fat - mass - associated snp rs9939609 and pe . it is possible that risk factors other than obesity dominate among patients manifesting severe , early - onset pe compared to those with a milder , later - onset form of the disease . our cases were dominated by the more severe end of the disease spectrum , and therefore we are unable to exclude an association in particular with the less severe , later - onset forms of the disease . the possible association of the fat - mass - associated snp rs9939609 and pe should be further investigated with larger sample sizes and with possibilities of stratifying the sample according to the degree of severity and the gestation weeks at the onset of the disease . | previous studies have demonstrated a common variant of the obesity and fat mass - related fto gene , rs9939609 , to be associated with obesity , type 2 diabetes , and elevated blood pressure .
we investigated whether the fto snp rs9939609 is associated with the risk of preeclampsia ( pe ) in a finnish study population .
485 women with prior pe and 449 women who had given birth after a normotensive pregnancy were genotyped ( taqman ) for the snp rs9939609 .
the prevalences of genotypes aa , at , and tt were 15% , 53% , and 32% , respectively , among the pe cases , and 16% , 47% , and 37% , respectively , among the controls ( p = 0.199 ) .
we found no evidence of an association between the fto snp rs9939609 and pe .
however , our cases were dominated by severe , early - onset pe .
thus , we are unable to exclude an association with the milder , later - onset form of the disease in which the role of maternal metabolic predisposition could be more significant . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
non - variceal upper gastrointestinal bleeding ( nvugib ) is a common gastrointestinal cause of hospital admission and generates significant morbidity and mortality despite advancements in endoscopic and acid - suppressive therapy ( 1 ) . recent studies have identified rebleeding as a significant predictor of mortality ( 2 - 6 ) . thus , prediction of rebleeding within 30 days helps to differentiate high- from low - risk patients . a recently reported international consensus on nvugib recommended that patients who are at low risk for rebleeding , on the basis of clinical and endoscopic criteria , may be discharged promptly after endoscopy ( 7 ) . therefore , clinical parameters that predict rebleeding should be identified ; these must be easily accessible , accurate , and equally effective in various ethnic groups . some studies have reported risk factors for rebleeding , and several risk scoring models to improve medical decision - making have been developed . however , the risk factors vary widely among reports due to significant heterogeneity in study design . most scoring systems were designed to predict mortality or a combination of mortality and rebleeding rather than only rebleeding ( 5 ) . to deal with the disparity in the quality of studies of nvugib , we attempted to follow these recommendations by applying the suggested clinical and endoscopic criteria , and by including key baseline characteristics . the aims of this study were 1 ) to describe clinical characteristics , endoscopic findings , and clinical outcomes and 2 ) to identify predictive factors for 30-day rebleeding in patients admitted to the emergency unit for nvugib . all adult patients ( older than 18 yr ) presenting with symptoms or signs of gastrointestinal bleeding at keimyung university dongsan hospital in daegu , korea , between april 2010 and january 2012 were enrolled prospectively in a previously designed database . patients with bleeding from esophageal or gastric varices or lower gastrointestinal causes and those who did not complete an at least 30-day follow - up period were excluded from the analysis . all endoscopic procedures were performed within 24 hr after arrival at the hospital by experts who had experience with more than 1000 endoscopy cases . variables included demographic data , clinical manifestations of bleeding ( hematemesis , melena , hematochezia , and anemia of acute onset ) , tobacco use , alcohol consumption ( heavy consumption was defined as > 40 g per day and > 60 g per day for women and men , respectively , for > 5 yr ) ( 9 ) , and the use of non - steroidal anti - inflammatory drugs ( nsaids ) , anti - platelet agents ( aspirin , clopidogrel , and cilostazol ) , steroids , and proton pump inhibitors ( ppi ) . comorbidities , such as diabetes mellitus , hypertension , heart failure , cirrhosis , chronic kidney disease ( ckd ) ( ckd was defined as patients with an estimated glomerular filtration rate < 60 ml / min for 3 months calculated using the four - variable modification of diet in renal disease study equation ) ( 10 ) , cerebrovascular disease , peripheral vascular disease , and metastatic malignancy , were registered . past history of gastrointestinal bleeding or peptic ulcer disease and hemodynamic instability ( pulse>100 beats / min , hypotension with a systolic pressure<90 mmhg at admission and during the hospital stay ) were recorded . laboratory data including hemoglobin , platelets , prothrombin time , and blood urea nitrogen were collected . in order to avoid the risk of potential multi - collinearity between variables , we used blatchford score12 and rockall score5 as variables for the logistic regression analysis of rebleeding ( 11 , 12 ) . the presence of blood in the stomach when no specific lesion was visualized was classified as bleeding of unidentified cause ( 13 , 14 ) . in all patients , stigmata of recent hemorrhage at the mucosal lesion were classified according to the forrest classification ( 15 ) . active bleeding ( forrest i ) , exposed vessel ( forrest iia ) , and adherent clot ( forrest iib ) were regarded as high - risk endoscopic stigmata . all endoscopic appearances were reviewed and corrected by two expert endoscopists to improve inter - observer agreement . all active bleeding was controlled by endoscopic treatments , including hemoclipping , epinephrine injection , electrocoagulation , or argon plasma coagulation ( apc ) . although the lesions with high - risk stigmata were instructed to be endoscopically treated by a strict hospital protocol , the decision to perform therapeutic endoscopy was at the discretion of the individual endoscopist . survey of gastric biopsies for helicobacter pylori was not performed routinely , but frequencies of practice and detection were recorded . a 30-day rebleeding was defined as new onset of hematemesis , coffee - ground vomitus , or hematochezia with hypovolemic shock or a decrease in blood hemoglobin of more than 2 g / dl after a 24-hr period of stable vital signs following successful endoscopic treatment ( 13 , 16 ) within 30 days of the index bleeding episode . categorical variables were compared using pearson 's chi - square test or the fisher 's exact test . a two - tailed p value of less than 0.05 was considered to indicate statistical significance . this study protocol was reviewed and approved by the institutional review board of keimyung university dongsan hospital ( no 11 - 294 ) . categorical variables were compared using pearson 's chi - square test or the fisher 's exact test . a two - tailed p value of less than 0.05 was considered to indicate statistical significance . this study protocol was reviewed and approved by the institutional review board of keimyung university dongsan hospital ( no 11 - 294 ) . bleeding was due to esophageal or gastric varices in 71 patients , and lower gastrointestinal bleeding in 56 patients . therefore , 176 ( 56.4% ) patients with nvugib were included in the study ( fig . the mean age of the patients was 59.7 yr with a male predominance ( 80.1% ) . the proportions of positive ng aspiration and digital rectal examination results were 69.2% ( 117/169 ) and 68.4% ( 117/171 ) , respectively . a past history of gastrointestinal bleeding was found in 49 ( 27.8% ) , and of peptic ulcer disease in 57 ( 32.4% ) . the most frequent comorbidity was hypertension ( 43.8% ) , followed by diabetes mellitus ( 23.8% ) . the percentages of current smokers and heavy drinkers of alcohol were 37.5% and 38.1% , respectively . thirty - five patients ( 19.9% ) were taking nsaids . over half of the patients ( 101 , 57.4% ) had a severe - bleeding - related symptom ( hematemesis or hematochezia ) as the presenting symptom . tachycardia ( pulse>100 beats / min ) and hypotension ( systolic blood pressure<90 mmhg ) during the hospital stay were found in 33.5% and 22.2% of patients , respectively . one - hundred and thirty - seven patients ( 77.8% ) had peptic ulcer disease , which was the most frequent source of bleeding . the causes of bleeding in the other 39 patients were as follows : mallory - weiss syndrome ( 12.5% ) , stomach cancer ( 1.1% ) , angiodysplasia ( 1.1% ) , and hemorrhagic gastritis ( 0.6% ) . high - risk endoscopic stigmata , such as forrest classifications i , iia , and iib , were documented in 93 ( 52.9% ) patients . overall , rebleeding occurred in 37 ( 21.0% ) patients during the median follow - up period of 192 days ( interquartile range 65 - 380 ) ; rebleeding within 1 week and 30 days of admission occurred in 21 ( 11.9% ) and 27 ( 15.3% ) patients , respectively ( table 2 ) . male gender ( p=0.019 ) , a positive ng tube aspiration result ( p=0.001 ) , past history of peptic ulcer disease ( p=0.019 ) , ckd ( p<0.001 ) , blatchford score12 ( p=0.037 ) , lesion location in the body ( p<0.001 ) , high - risk endoscopic stigmata ( p<0.001 ) , and tachycardia ( pulse>100 beats / min ) during admission ( p < however , only the following parameters were independent predictors of 30-day rebleeding in the multivariate analysis : ckd ( or , 10.29 ; 95% ci , 2.84 - 37.33 ; p<0.001 ) , tachycardia ( pulse>100 beats / min ) during the hospital stay ( or , 3.79 ; 95% ci , 1.25 - 11.49 ; p=0.019 ) , and high - risk endoscopic stigmata ( or , 6.14 ; 95% ci , 1.36 - 27.66 ; p=0.018 ) ( table 4 ) . male gender ( p=0.019 ) , a positive ng tube aspiration result ( p=0.001 ) , past history of peptic ulcer disease ( p=0.019 ) , ckd ( p<0.001 ) , blatchford score12 ( p=0.037 ) , lesion location in the body ( p<0.001 ) , high - risk endoscopic stigmata ( p<0.001 ) , and tachycardia ( pulse>100 beats / min ) during admission ( p < however , only the following parameters were independent predictors of 30-day rebleeding in the multivariate analysis : ckd ( or , 10.29 ; 95% ci , 2.84 - 37.33 ; p<0.001 ) , tachycardia ( pulse>100 beats / min ) during the hospital stay ( or , 3.79 ; 95% ci , 1.25 - 11.49 ; p=0.019 ) , and high - risk endoscopic stigmata ( or , 6.14 ; 95% ci , 1.36 - 27.66 ; p=0.018 ) ( table 4 ) . in this study , we identified factors that were independently associated with the risk of 30-day rebleeding in a cohort of 176 patients presenting with nvugib . we found that ckd ; tachycardia ( pulse>100 beats / min ) during the hospital stay ; and high - risk endoscopic stigmata of forrest classifications i , iia , and iib were independently associated with rebleeding within 30 days . these risk factors are easy to identify following the initial bleeding event , are valuable for predicting clinical outcomes , and may be useful for guiding clinical management of patients with nvugib . identifying patients at high risk for rebleeding is important for cost - effective management of nvugib . many risk stratification schemes use both clinical and endoscopic criteria ( 2 , 4 , 17 , 18 ) . the rockall score is the best known of all risk - stratification tools for upper gastrointestinal bleeding . it includes three non - endoscopic ( age , shock , and comorbidity ) , and two endoscopic ( endoscopic diagnosis and presence or absence of endoscopic stigmata of recent hemorrhage ) variables ( 2 ) . the blatchford score , another risk stratification system , does not include an endoscopic parameter , but uses only clinical ( systolic blood pressure , heart rate , melena and/or syncope , hepatic disease and/or cardiac failure ) and laboratory ( blood urea nitrogen and hemoglobin ) variables to predict the need for treatment ( 3 ) . recently reported international consensus recommendations have emphasized the importance of early risk stratification using prognostic scales , such as the rockall or blatchford score ( 7 ) . although univariate analysis showed that only blatchford scores was significantly correlated with 30-day rebleeding in patients with nvugib , it failed to show statistical significance after adjustment for other variables in a multivariate analysis . this result corresponds with other studies , that the rockall score is unsatisfactory for the prediction of rebleeding ( 19 , 20 ) . also , there are discrepancies in the accuracy of the blatchford score system ( 21 ) . some studies were unable to demonstrate a high specificity for the blatchford score in discriminating high- and low - risk patients with upper gastrointestinal bleeding ( 21 , 22 ) . furthermore , this score was originally designed not to assess risk of rebleeding but to determine whether patients with upper gastrointestinal bleeding require treatment to manage their bleeding ( 23 ) . therefore , it remains to be seen that the rockall and the blatchford score are effective tools for prediction of rebleeding in nvugib . in this study , nvugib patients with ckd had a high risk of rebleeding , which is similar to other reports ( 6 , 24 , 25 ) . it seems that an acquired defect of primary hemostasis caused by platelet dysfunction and an altered platelet - vessel wall interaction is responsible for hemorrhagic tendencies ( 26 , 27 ) . in cheung 's study , end stage renal disease ( esrd ) requiring dialysis was an independent predictor of peptic ulcer rebleeding , and there was no difference in rebleeding between patients with non - dialysis - dependent ckd and a normal control group ( 25 ) . it is possible that some of these patients used anticoagulants routinely ( e.g. , heparin ) during hemodialysis , exhibited accumulation of medications due to poor clearance , and had impaired healing of ulcers caused by sporadic circulation variability in the gastrointestinal tract during hemodialysis ( 28 ) . in the present study , of 27 patients who had ckd , only nine had esrd ( hemodialysis or peritoneal dialysis for > 6 months ) . in the context of these results , patients with ckd , not only esrd but a recent study also reported that non - dialysis - dependent ckd patients rebled more frequently than the control group , indicating a significant rebleeding risk in patients with ckd after initial nvugib ( 24 ) . therefore , patients with both esrd and ckd who do not require dialysis might need intensive endoscopic hemostasis combined with ppis and a longer hospital stay under close monitoring , than those without . hemodynamic instability has been reported to be a significant risk factor for rebleeding and mortality . a systolic blood pressure < 90 mmhg , tachycardia > 100 beats / min , and peripheral signs of shock indicate hemodynamic instability and were evaluated at admission in most studies ( 5 ) . we also evaluated systolic blood pressure , diastolic blood pressure , and pulse rate at admission . however , none of these factors was significantly associated with increased 30-day rebleeding in the present study . this discrepancy between studies might be attributed to differences in the populations and methods used . we found that patients who had tachycardia during the hospital stay had a high risk of 30-day rebleeding ( or , 3.79 ; 95% ci , 1.25 - 11.49 ; p=0.019 ) . although hemodynamic instability after diagnostic endoscopy might limit its applicability as a prognostic variable for deciding early additional measures , it emphasizes the importance of close monitoring for patients with nvugib . it is well known that the outcome of bleeding from peptic ulcer is dependent partly on the endoscopic stigmata of bleeding as described by forrest ( 15 ) , and endoscopic hemostatic therapy is indicated for patients with high - risk stigmata ( active bleeding or a visible vessel in an ulcer bed ) ( 29 ) . the role of endoscopic therapy for ulcers with an adherent clot ( forrest classification iib ) is controversial ( 7 ) . the risk of rebleeding with adherent clots after washing without endoscopic therapy can be low or high , depending on the presence of concurrent illnesses ( 30 - 32 ) . in the present study , we did not try to shave adherent clots with the snare technique , and usually used water irrigation . therefore , lesions with clots resistant to vigorous irrigation could not be distinguished from ulcers with exposed vessels . therefore , we included forrest iib among the high - risk bleeding stigmata . in our study , patients with forrest classifications i , iia , and iib had a significantly higher risk of rebleeding ( or , 6.14 ; 95% ci , 1.36 - 27.66 ; p=0.018 ) . this suggests that particularly in patients with high risk endoscopic stigmata ( including forrest classification iib ) , careful management with close monitoring for the recurrent bleeding according to the guidelines is essential . the strengths of this study were as follows : it was of a prospective observational design , and we evaluated many variables that have been recommended as key baseline characteristics for comparisons across studies ( 8) . in addition , risk scoring systems , including rockall and blatchford scores , were calculated . in all cases , endoscopy to evaluate the cause of bleeding was performed within 24 h. limitations of the study include its small size and performance in a single center . hence , the findings should be considered within the context of these limitations . in conclusion , in patients with nvugib , the risk of rebleeding is significantly increased with ckd ; forrest classification i , iia , or iib ; and the occurrence of tachycardia ( > 100 beats / min ) during the hospital stay . however , rockall and blatchford scores are not relevant to the prognosis . in these high - risk patients , emergency endoscopic hemostasis , intensive pharmacological therapy , and a longer hospital | the results of studies that evaluated predictive factors for rebleeding in non - variceal upper gastrointestinal bleeding are inconsistent .
the aim of this study was to investigate predictive factors for 30-day rebleeding in these patients . a consecutive
312 patients presenting symptoms and signs of gastrointestinal bleeding were enrolled in this prospective , observational study .
clinical and demographic characteristics and endoscopic findings were evaluated for potential factors associated with 30-day rebleeding using logistic regression analysis .
overall , 176 patients were included ( male , 80.1% ; mean age , 59.716.0 yr ) .
rebleeding within 7 and 30 days occurred in 21 ( 11.9% ) and 27 ( 15.3% ) patients , respectively .
we found that chronic kidney disease ( ckd ) ( or , 10.29 ; 95% ci , 2.84 - 37.33 ; p<0.001 ) , tachycardia ( pulse>100 beats / min ) during the admission ( or , 3.79 ; 95% ci , 1.25 - 11.49 ; p=0.019 ) , and forrest classes i , iia , and iib ( or , 6.14 ; 95% ci , 1.36 - 27.66 ; p=0.018 ) were significant independent predictive factors for 30-day rebleeding .
however , neither rockall nor blatchford scores showed statistically significant relationships with 30-day rebleeding in a multivariate analysis .
ckd , hemodynamic instability during hospitalization , and an endoscopic high - risk appearance are significantly independent predictors of 30-day rebleeding in patients with non - variceal upper gastrointestinal bleeding
. these factors may be useful for clinical management of such patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
epigenetics refers to biochemical modifications of chromatin that do not change the sequence but regulate gene expression and may be inherited . several different types of epigenetic modifications exist , such as dna methylation , histone modification , and nucleosome positioning , and they can regulate a variety of processes , including transcription and protein binding to dna . dna methylation occurs mostly in regions containing a high frequency of cpg dinucleotides , called cpg islands . in most cases , dna methylation is associated with gene silencing and is mediated by a family of enzymes called dna methyltransferases ( dnmts ) . histones have unstructured n - terminal tails , which undergo posttranslational modifications , including acetylation , methylation , phosphorylation , ubiquitination , and sumoylation , at certain positions . there are many enzymes that write or erase these modifications : a few examples are methyltransferases , demethylases , histone acetyltransferases ( hats ) , and histone deacetylases ( hdacs ) . some histone marks , such as h3k27ac and h3k9ac are associated with actively transcribed genes , whereas others , like h3k27me3 and h4k27me3 , keep genes in an inactive state . in addition , the position of nucleosomes affects transcription by preventing transcription factors or the polymerase complex from binding or inhibiting elongation . there are several complexes that can remove or shift nucleosomes , such as swi / snf ( 1 ) . epigenetic features have been shown to be predictive of genome - wide gene expression ( 2 ) . hiv and herpesviruses , including kaposi s sarcoma - associated herpesvirus ( kshv ) and epstein - barr virus ( ebv ) , establish lifelong latent infections in their host cells . kshv , ebv , herpes simplex virus 1 ( hsv-1 ) , and hiv latency and reactivation are controlled by epigenetic modifications ( 38 ) . viruses and bacteria have developed diverse mechanisms to directly affect host cell epigenetics , driving pathogenesis and oncogenesis ( 3 , 914 ) . this review will focus on bacterium - promoted epigenetic modifications on viral genomes that regulate the switch between latency and active viral replication and examples of combined bacterial and viral disease . in the oral cavity , active viral replication and shedding occur , indicating that viruses do not remain latent . kaposi s sarcoma - associated herpesvirus ( kshv ) is the causative agent of kaposi s sarcoma , an aids - defining tumor that can be found in the mouth ( 15 , 16 ) . the incidence of oral lesions associated with hiv has decreased since the introduction of highly active antiretroviral therapy ( haart ) ; however , they still cause significant morbidity and are indicative of progression to aids ( 1719 ) . the transition to viral reactivation or oncogene expression requires epigenetic reprogramming ( fig . 1 ) , illustrated by the hypermethylation of active kshv promoters ( 20 ) . epigenetic reprogramming of both the host and viral genomes can be initiated by oral bacteria . bacterial infection leads lymphoid cells , which may harbor inactive viruses ( e.g. , ebv and kshv ) , to be recruited to the oral epithelium . this places virus - infected cells and bacteria and their end products in close proximity . bacteria are present in the oral cavity in abundance , with 20 billion microbes present in our mouths at any given time ( 21 ) . activating epigenetic marks on tumor virus promoters can stimulate the transcription of viral oncogenes , driving cellular transformation , or lead to reactivation of a latent virus and production of new virions . one of several bacteria commonly found in the mouth is porphyromonas gingivalis , a widely studied bacterium in the phylum bacteroidetes . the bacteria colonize in a highly site - specific fashion , so the bacterial load can be extremely high at a very discrete site . gingivalis secretes a number of products , including lipopolysaccharide ( lps ) , gingipains , outer membrane vesicles ( omvs ) , and short - chain fatty acids ( scfas ) ( 2226 ) . within gingival pockets , accumulation of scfas , including butyrate and lps , can be detected in association with p. gingivalis infection ( 27 ) . bacterial butyric acid levels can be up to 20 mm within the gingival pocket ( 25 , 28 , 29 ) . our group and others have suggested that products secreted by p. gingivalis , including butyrate , induce acetylation of histones within neighboring cells ( 25 , 30 , 31 ) . gingivalis metabolites , but not those of gram - positive organisms , were able to enhance kshv replication . to further explore the mechanism behind these changes , bcbl-1 cells , which are latently infected with kshv , were treated with fusobacterium nucleatum or p. gingivalis culture medium and exposed to specific inhibitors of signal transduction pathways . we determined that bacterium - mediated induction of lytic kshv infection was not prevented by inhibition of phosphatidylinositol 3-kinase ( pi3k ) or protein kinase c ( pkc ) but was significantly reduced by inhibition of the p38 mitogen - activated protein kinase ( mapk ) pathway . bacterium - mediated kshv reactivation coincided with increased global acetylation of h3 and h4 , suggesting the bacterial supernatant contains hdac inhibition properties . furthermore , p38 inhibition by multiple inhibitors prevented h3 hyperacetylation and subsequent viral reactivation ( 31 ) . hdac inhibition is also critical to the antiviral interferon response ( 32 , 33 ) . the polymicrobial environment may potentiate viral reactivation by decreasing the innate antiviral response and enhancing viral pathogenesis . studies linking bacterium - induced epigenetic modifications on viral genomes to human disease are emerging . periodontitis is highly prevalent in humans , but its etiology is still poorly understood ( 34 ) . while periodontitis is primarily associated with infection by pathogenic bacteria , such as actinobacillus actinomycetemcomitans and p. gingivalis , herpesviruses have also been implicated ( 3537 ) . multiple studies have shown that in patients with periodontal and endodontic disease , herpes group viruses , including human cytomegalovirus ( hcmv ) , ebv , and hsv-1 , are readily detected and are associated with the presence of bacteria ( 3843 ) . levels of viral detection were lower in those with less gum disease ( 44 ) . moreover , a viral contribution helps explain some symptoms of periodontal disease , such as remission , bilateral symmetry , and why periodontitis often only affects a few teeth , with neighboring teeth exhibiting much less tissue loss ( 35 ) . bacterial and viral coinfection was also detected in two - thirds of acute apical abscesses , although the role of the viruses or any interaction between the pathogens in this form of periodontitis is unclear ( 45 ) . epigenetic modification of herpesviruses by p. gingivalis ( discussed below ) helps explain the link between viruses and bacteria in the pathogenesis of periodontitis . one protein controlling ebv reactivation is zebra , a lytic gene transactivator and the product of the bzlf1 gene . in daudi cells latently infected with ebv , zebra expression was increased by p. gingivalis spent medium , triggering viral reactivation . the virulence factors lps , fimbriae , or gingipains alone had no effect on zebra expression . among the various scfas produced by p. gingivalis , including butyric , isobutyric , propionic , acetic , and valeric acids , only butyric acid treatment led to induction of zebra . after treatment with p. gingivalis culture supernatant or butyric acid , binding of h3ac , a mark of active chromatin , to the bzlf1 promoter increased , while binding of hdacs 1 , 2 , and 7 decreased . zebra expression also requires chromatin remodeling , as treatment with novobiocin , a topoisomerase ii inhibitor , blocks p. gingivalis - induced zebra production ( 46 , 47 ) . butyrate is an hdac inhibitor and has been implicated in the reactivation of hiv and ebv ( 46 , 48 , 49 ) . however , butyrate may not be the only p. gingivalis product involved in epigenetic regulation , as differences were found between cellular epigenetic changes induced by p. gingivalis and f. nucleatum , another bacteroidete anaerobe whose primary end product is butyrate . while global h3k4me3 decreased with p. gingivalis , h3k4me3 did not decrease in gingival cells incubated with f. nucleatum ( 50 ) . in addition , p. gingivalis produces lps , and lps - induced toll - like receptor ( tlr ) signaling leads to widespread changes in the epigenetic profiles of tlr - responsive genes ( 51 , 52 ) . gingipains , omvs , and other scfas , such as propionic and isobutyric acids , are also produced by p. gingivalis and may affect epigenetics ( 2326 ) . p. gingivalis also elicits changes in the expression of enzymes that regulate epigenetics , which could lead to global changes in epigenetic profiles for both the virus and the host . for example , exposure of keratinocytes to p. gingivalis lps downregulated expression of dnmt1 , hdac1 , and hdac2 , all enzymes that promote epigenetic events ( 53 ) . gingivalis uses epigenetic means to modulate the immunoregulatory proteins -defensin2 and ccl20 and increases promoter methylation for a number of growth control and inflammatory genes ( 50 ) . in addition , oral bacteria associated with periodontal disease , such as p. gingivalis , induce oxidative stress , a process central to epigenetic modification ( 54 , 55 ) . in addition to tobacco and alcohol use , periodontitis has been associated with oral cancer and premalignant lesions , which in turn are associated with human papillomavirus ( hpv ) . one study found that patients with periodontal disease have an increased risk for oral cancer and premalignant lesions , but only for current smokers ( 56 ) . a later study from the same group looking at head and neck squamous cell carcinoma ( hnscc ) found a significantly increased risk of cancer in patients with alveolar bone loss . an increased risk was found even for nonsmokers with chronic periodontitis , but smokers had a higher risk . in addition , patients with periodontitis were significantly more likely to have poorly differentiated hnscc ( 57 ) . hpv , particularly subtype 16 , has been associated with hnscc , as well as cervical cancer ( 58 ) . in one study , approximately 40% of hnsccs were positive for hpv16 , and alveolar bone loss increased the odds of hpv - positive tumor status , with a stronger association in oropharyngeal scc than in oral or laryngeal scc ( 59 ) . in base of tongue cancer , hpv16 was found in 70% of tumors , and the patients with hpv16-positive tumors had significantly worse periodontitis than patients with hpv - negative tumors , as measured by alveolar bone loss ( 60 ) . in addition , it has been suggested that streptococci in the oral cavity promote the development of hpv - associated hnscc through stimulation of the host inflammatory response and production of carcinogenic metabolites , such as acetaldehyde ( 61 ) . the bacterial pathogens that cause periodontal disease are known to cause epigenetic modifications to the genomes of ebv , kshv , and hiv and may modify other viral genomes as well . hpv16 transcription , mediated by the e2 protein , is reduced by cpg methylation of the e2 binding sites in cervical epithelial cells ( 62 ) . hpv hypomethylation is associated with cervical cancer progression , as progressively less methylation was seen in patients with carcinoma than in patients with precancerous lesions and asymptomatic infection ( 63 ) . furthermore , cell lines derived from hpv - associated hnsccs have increased dnmt3a expression and cellular dna methylation in regions containing genes and line 1 elements compared to cell lines from hpv - negative hnsccs ( 64 ) . taken together , these studies suggest an additional link between bacteria and hpv - associated cancer . several locations in the body are colonized by many microbes that can influence each other as well as their host , sometimes leading to disease . not only can interactions occur between pathogenic bacteria and viruses , but opportunistic or commensal microbes may also come into play , particularly in immunosuppressed individuals ( fig . 2 ) . it has been suggested that periodontal disease ( p. gingivalis ) and opportunistic bacteria that are associated with hiv immune suppression may in turn contribute to aids progression by producing butyric acid and leading to hiv reactivation through hdac inhibition ( 65 , 66 ) . furthermore , aids - related immune suppression can lead to an increase in opportunistic bacterial load , which could further reactivate hiv , hastening aids progression ( 65 ) ( fig . 2 ) . the gut is another major site of polymicrobial colonization and infection . in early stages of hiv infection , the composition of the gut microbiota changes , and increased inflammation in the gastrointestinal ( gi ) tract leads to damage of the mucosal barrier ( 67 ) . breakdown of the intestinal barrier allows microbial lps to enter the blood and results in chronic immune activation , a commonly observed feature of hiv infection and a contributor to the progression to aids ( 68 , 69 ) . in the vagina , increased risk of hiv acquisition , transmission , and hiv reactivation have been linked to bacterial vaginosis ( 7074 ) . recent studies indicate the importance of the microbiota in multiple body compartments to the development of aids . one known mechanism by which bacteria influence viruses is through epigenetic modifications . in hiv - positive individuals the human figure is by mikael haggstrom ( public domain ) , via wikimedia commons . in the mouth , p. gingivalis - induced histone modifications have been shown to increase transcription of both integrated and nonintegrated hiv ( 49 , 75 ) . gene expression and replication of nonintegrating hiv-1 were increased in vitro upon exposure to histone deacetylase inhibitors in the form of various short - chain fatty acids ( scfas ) known to be endogenously produced by normal microbial gut flora . the increased expression of integrated hiv was attributed particularly to butyric acid produced by the bacteria , not any virulence factor ( lps , fimbriae , or gingipain ) or other scfa ( 75 ) . integrated hiv is silenced by a number of repressive epigenetic modifications , including hdac recruitment , methylated h3 ( h3k9me3 , h3k27me3 , and h3k9me2 ) , and binding of polycomb repressive complex 2 members ( 7 ) . p. gingivalis and butyric acid were found to increase h3 and h4 acetylation and binding of polymerase ii to the hiv long terminal repeat ( ltr ) . these treatments also decreased binding of two repressors of gene expression : hdac1 and ap-4 . p. gingivalis - mediated hiv transcription was diminished by novobiocin , a topoisomerase ii inhibitor , indicating dependence on chromatin remodeling ( 75 ) . hiv gene expression is stimulated by p. gingivalis , and epigenetic changes are critical . in addition to the oral cavity , several studies have focused on hiv reactivation in the gut and vagina . gene expression and replication of nonintegrated hiv were notably increased in vitro upon exposure to various short - chain fatty acids ( scfas ) endogenously produced by gut bacteria ( 49 ) . hiv can be reactivated by supernatant from other butyric acid - producing bacteria , including f. nucleatum , clostridium cochlearium , erythema multiforme , and anaerococcus tetradius . f. nucleatum is commonly found in the mouth and gut , c. cochlearium and e. multiforme in the gut , and a. tetradius in the vagina , indicating that hdac inhibition caused by bacterial butyric acid may be able to reactivate hiv in multiple body compartments . both h3ac levels and hiv gene expression were positively correlated with the amount of butyrate produced by these bacterial species . supernatant from f. nucleatum , c. cochlearium , and a. tetradius cultures reduced binding of hdac1 and increased binding of rna polymerase ii ( rnapii ) to the hiv ltr . these epigenetic changes were not observed when the culture media were heat treated to remove scfa or when the cells were treated with novobiocin , a topoisomerase ii inhibitor ( 48 ) . nab treatment led to increases in the activating marks h3k4me2 , h3ac , and h4ac and decreases in the repressive mark h3k9me3 on the hiv ltr . in monocyte - derived macrophages , hiv replication that was diminished by the integrase inhibitor raltegravir was partially restored by the scfas propionic , valproic , and heptanoic acids ( 49 ) . both present in the gut , helicobacter pylori and ebv although the majority of gastric cancers are associated with h. pylori , up to 10% of gastric cancers contain ebv . ebv - associated gastric cancers , h. pylori - associated cancers , and coinfected cancers have different characteristics ( 76 , 78 ) . cancers with only h. pylori express bcl-2 , while coinfected or uninfected cancers do not . in addition , c - myc and bax expression was detected more often in h. pylori - only cancers than in coinfected ones ( 78 ) , indicating double infection may modulate disease characteristics and possibly outcome . in addition to these two infectious agents , increased cpg methylation has been suggested as an early event in and risk factor for the development of gastric cancer ( 79 , 80 ) . in the context of gastric cancer , h. pylori infection has been linked to cpg hypermethylation of several tumor suppressor genes . one gene frequently observed to be silenced by methylation in gastric cancers is the gene coding for runx3 . runx3 methylation has been correlated with age , tumor location , and h. pylori infection ( 81 ) . h. pylori causes methylation of runx3 by stimulating nitric oxide production by macrophages ( 82 ) . another of these genes is the gene coding for e - cadherin , a transmembrane adhesion protein whose loss is involved in invasion and metastasis ( 83 ) . e - cadherin mutations have been observed in diffuse gastric cancers , and methylation of the e - cadherin promoter may be a second hit in patients with heterozygous mutation ( 84 , 85 ) . e - cadherin methylation was associated with h. pylori infection in patients with dyspepsia and gastric cancer , with loss of e - cadherin protein observed by immunohistochemical staining in gastric cancer biopsy specimens ( 86 ) . furthermore , treatment to eliminate h. pylori in dyspepsia patients reversed e - cadherin methylation by 6 weeks ( 87 ) . hypermethylation of the e - cadherin and two other tumor suppressor promoters , dapk and p16 , was found to be increased in normal gastric mucosa of gastric cancer patients compared to healthy controls and may be a marker for increased risk of cancer ( 88 ) . methylation of cpg islands in p16 , lox , flnc , hrasls , hand1 , thbd , and p41arc was also increased in h. pylori - positive individuals ( 89 ) . ebv - associated transformation and tumorigenesis in gastric and other cancers have been linked to latency ( 90 ) . latent ebv is highly methylated , and expression of the ebv - encoded nuclear antigens ( ebnas ) is silenced by cell - type - dependent methylation ( 91 , 92 ) . however , zebra , an ebv transactivator that is increased in cells treated with p. gingivalis spent medium in association with histone acetylation ( 46 ) , preferentially binds to the methylated form of its ap-1-like binding sites in the brlf1 and brrf1 promoters , increasing transcription ( 91 , 93 ) . zebra and the products of brlf1 and brrf1 are all transcription factors involved in the switch to viral lytic replication ( 93 ) . like h. pylori , ebv has been implicated in high levels of cpg methylation of cellular genes associated with gastric cancer , including those coding for p14 , p16 , pten , rassf1a , gstp1 , mgmt , and mint2 ( 9496 ) . ebv infection was correlated with overexpression of the dna methyltransferase dnmt1 in gastric cancers , which was in turn correlated with cpg methylation of the hmlh1 and thbs-1 genes ( 97 ) . given the documented effects of epigenetic modifications on ebv gene expression , the ability of ebv and gut bacteria such as h. pylori to induce epigenetic changes in cells , and the strong link between gastric cancer and cpg methylation , it is plausible that coinfections may heighten gastric cancer risk . in the oral cavity , active viral replication and shedding occur , indicating that viruses do not remain latent . kaposi s sarcoma - associated herpesvirus ( kshv ) is the causative agent of kaposi s sarcoma , an aids - defining tumor that can be found in the mouth ( 15 , 16 ) . the incidence of oral lesions associated with hiv has decreased since the introduction of highly active antiretroviral therapy ( haart ) ; however , they still cause significant morbidity and are indicative of progression to aids ( 1719 ) . the transition to viral reactivation or oncogene expression requires epigenetic reprogramming ( fig . 1 ) , illustrated by the hypermethylation of active kshv promoters ( 20 ) . epigenetic reprogramming of both the host and viral genomes can be initiated by oral bacteria . bacterial infection leads lymphoid cells , which may harbor inactive viruses ( e.g. , ebv and kshv ) , to be recruited to the oral epithelium . this places virus - infected cells and bacteria and their end products in close proximity . bacteria are present in the oral cavity in abundance , with 20 billion microbes present in our mouths at any given time ( 21 ) . activating epigenetic marks on tumor virus promoters can stimulate the transcription of viral oncogenes , driving cellular transformation , or lead to reactivation of a latent virus and production of new virions . one of several bacteria commonly found in the mouth is porphyromonas gingivalis , a widely studied bacterium in the phylum bacteroidetes . the bacteria colonize in a highly site - specific fashion , so the bacterial load can be extremely high at a very discrete site . gingivalis secretes a number of products , including lipopolysaccharide ( lps ) , gingipains , outer membrane vesicles ( omvs ) , and short - chain fatty acids ( scfas ) ( 2226 ) . within gingival pockets , accumulation of scfas , including butyrate and lps , can be detected in association with p. gingivalis infection ( 27 ) . bacterial butyric acid levels can be up to 20 mm within the gingival pocket ( 25 , 28 , 29 ) . our group and others have suggested that products secreted by p. gingivalis , including butyrate , induce acetylation of histones within neighboring cells ( 25 , 30 , 31 ) . gingivalis metabolites , but not those of gram - positive organisms , were able to enhance kshv replication . to further explore the mechanism behind these changes , bcbl-1 cells , which are latently infected with kshv , were treated with fusobacterium nucleatum or p. gingivalis culture medium and exposed to specific inhibitors of signal transduction pathways . we determined that bacterium - mediated induction of lytic kshv infection was not prevented by inhibition of phosphatidylinositol 3-kinase ( pi3k ) or protein kinase c ( pkc ) but was significantly reduced by inhibition of the p38 mitogen - activated protein kinase ( mapk ) pathway . bacterium - mediated kshv reactivation coincided with increased global acetylation of h3 and h4 , suggesting the bacterial supernatant contains hdac inhibition properties . furthermore , p38 inhibition by multiple inhibitors prevented h3 hyperacetylation and subsequent viral reactivation ( 31 ) . hdac inhibition is also critical to the antiviral interferon response ( 32 , 33 ) . the polymicrobial environment may potentiate viral reactivation by decreasing the innate antiviral response and enhancing viral pathogenesis . studies linking bacterium - induced epigenetic modifications on viral genomes to human disease are emerging . periodontitis is highly prevalent in humans , but its etiology is still poorly understood ( 34 ) . while periodontitis is primarily associated with infection by pathogenic bacteria , such as actinobacillus actinomycetemcomitans and p. gingivalis , herpesviruses have also been implicated ( 3537 ) . multiple studies have shown that in patients with periodontal and endodontic disease , herpes group viruses , including human cytomegalovirus ( hcmv ) , ebv , and hsv-1 , are readily detected and are associated with the presence of bacteria ( 3843 ) . levels of viral detection were lower in those with less gum disease ( 44 ) . moreover , a viral contribution helps explain some symptoms of periodontal disease , such as remission , bilateral symmetry , and why periodontitis often only affects a few teeth , with neighboring teeth exhibiting much less tissue loss ( 35 ) . bacterial and viral coinfection was also detected in two - thirds of acute apical abscesses , although the role of the viruses or any interaction between the pathogens in this form of periodontitis is unclear ( 45 ) . epigenetic modification of herpesviruses by p. gingivalis ( discussed below ) helps explain the link between viruses and bacteria in the pathogenesis of periodontitis . one protein controlling ebv reactivation is zebra , a lytic gene transactivator and the product of the bzlf1 gene . in daudi cells latently infected with ebv , zebra expression was increased by p. gingivalis spent medium , triggering viral reactivation . the virulence factors lps , fimbriae , or gingipains alone had no effect on zebra expression . among the various scfas produced by p. gingivalis , including butyric , isobutyric , propionic , acetic , and valeric acids , only butyric acid treatment led to induction of zebra . after treatment with p. gingivalis culture supernatant or butyric acid , binding of h3ac , a mark of active chromatin , to the bzlf1 promoter increased , while binding of hdacs 1 , 2 , and 7 decreased . zebra expression also requires chromatin remodeling , as treatment with novobiocin , a topoisomerase ii inhibitor , blocks p. gingivalis - induced zebra production ( 46 , 47 ) . butyrate is an hdac inhibitor and has been implicated in the reactivation of hiv and ebv ( 46 , 48 , 49 ) . however , butyrate may not be the only p. gingivalis product involved in epigenetic regulation , as differences were found between cellular epigenetic changes induced by p. gingivalis and f. nucleatum , another bacteroidete anaerobe whose primary end product is butyrate . while global h3k4me3 decreased with p. gingivalis , h3k4me3 did not decrease in gingival cells incubated with f. nucleatum ( 50 ) . in addition , p. gingivalis produces lps , and lps - induced toll - like receptor ( tlr ) signaling leads to widespread changes in the epigenetic profiles of tlr - responsive genes ( 51 , 52 ) . gingipains , omvs , and other scfas , such as propionic and isobutyric acids , are also produced by p. gingivalis and may affect epigenetics ( 2326 ) . gingivalis also elicits changes in the expression of enzymes that regulate epigenetics , which could lead to global changes in epigenetic profiles for both the virus and the host . for example , exposure of keratinocytes to p. gingivalis lps downregulated expression of dnmt1 , hdac1 , and hdac2 , all enzymes that promote epigenetic events ( 53 ) . gingivalis uses epigenetic means to modulate the immunoregulatory proteins -defensin2 and ccl20 and increases promoter methylation for a number of growth control and inflammatory genes ( 50 ) . in addition , oral bacteria associated with periodontal disease , such as p. gingivalis , induce oxidative stress , a process central to epigenetic modification ( 54 , 55 ) . in addition to tobacco and alcohol use , periodontitis has been associated with oral cancer and premalignant lesions , which in turn are associated with human papillomavirus ( hpv ) . one study found that patients with periodontal disease have an increased risk for oral cancer and premalignant lesions , but only for current smokers ( 56 ) . a later study from the same group looking at head and neck squamous cell carcinoma ( hnscc ) found a significantly increased risk of cancer in patients with alveolar bone loss . an increased risk was found even for nonsmokers with chronic periodontitis , but smokers had a higher risk . in addition , patients with periodontitis were significantly more likely to have poorly differentiated hnscc ( 57 ) . hpv , particularly subtype 16 , has been associated with hnscc , as well as cervical cancer ( 58 ) . in one study , approximately 40% of hnsccs were positive for hpv16 , and alveolar bone loss increased the odds of hpv - positive tumor status , with a stronger association in oropharyngeal scc than in oral or laryngeal scc ( 59 ) . in base of tongue cancer , hpv16 was found in 70% of tumors , and the patients with hpv16-positive tumors had significantly worse periodontitis than patients with hpv - negative tumors , as measured by alveolar bone loss ( 60 ) . in addition , it has been suggested that streptococci in the oral cavity promote the development of hpv - associated hnscc through stimulation of the host inflammatory response and production of carcinogenic metabolites , such as acetaldehyde ( 61 ) . the bacterial pathogens that cause periodontal disease are known to cause epigenetic modifications to the genomes of ebv , kshv , and hiv and may modify other viral genomes as well . hpv16 transcription , mediated by the e2 protein , is reduced by cpg methylation of the e2 binding sites in cervical epithelial cells ( 62 ) . hpv hypomethylation is associated with cervical cancer progression , as progressively less methylation was seen in patients with carcinoma than in patients with precancerous lesions and asymptomatic infection ( 63 ) . furthermore , cell lines derived from hpv - associated hnsccs have increased dnmt3a expression and cellular dna methylation in regions containing genes and line 1 elements compared to cell lines from hpv - negative hnsccs ( 64 ) . taken together several locations in the body are colonized by many microbes that can influence each other as well as their host , sometimes leading to disease . not only can interactions occur between pathogenic bacteria and viruses , but opportunistic or commensal microbes may also come into play , particularly in immunosuppressed individuals ( fig . 2 ) . it has been suggested that periodontal disease ( p. gingivalis ) and opportunistic bacteria that are associated with hiv immune suppression may in turn contribute to aids progression by producing butyric acid and leading to hiv reactivation through hdac inhibition ( 65 , 66 ) . furthermore , aids - related immune suppression can lead to an increase in opportunistic bacterial load , which could further reactivate hiv , hastening aids progression ( 65 ) ( fig . 2 ) . the gut is another major site of polymicrobial colonization and infection . in early stages of hiv infection , the composition of the gut microbiota changes , and increased inflammation in the gastrointestinal ( gi ) tract leads to damage of the mucosal barrier ( 67 ) . breakdown of the intestinal barrier allows microbial lps to enter the blood and results in chronic immune activation , a commonly observed feature of hiv infection and a contributor to the progression to aids ( 68 , 69 ) . in the vagina , increased risk of hiv acquisition , transmission , and hiv reactivation have been linked to bacterial vaginosis ( 7074 ) . recent studies indicate the importance of the microbiota in multiple body compartments to the development of aids . one known mechanism by which bacteria influence viruses is through epigenetic modifications . in hiv - positive individuals the human figure is by mikael haggstrom ( public domain ) , via wikimedia commons . in the mouth , gingivalis - induced histone modifications have been shown to increase transcription of both integrated and nonintegrated hiv ( 49 , 75 ) . gene expression and replication of nonintegrating hiv-1 were increased in vitro upon exposure to histone deacetylase inhibitors in the form of various short - chain fatty acids ( scfas ) known to be endogenously produced by normal microbial gut flora . the increased expression of integrated hiv was attributed particularly to butyric acid produced by the bacteria , not any virulence factor ( lps , fimbriae , or gingipain ) or other scfa ( 75 ) . integrated hiv is silenced by a number of repressive epigenetic modifications , including hdac recruitment , methylated h3 ( h3k9me3 , h3k27me3 , and h3k9me2 ) , and binding of polycomb repressive complex 2 members ( 7 ) . p. gingivalis and butyric acid were found to increase h3 and h4 acetylation and binding of polymerase ii to the hiv long terminal repeat ( ltr ) . these treatments also decreased binding of two repressors of gene expression : hdac1 and ap-4 . p. gingivalis - mediated hiv transcription was diminished by novobiocin , a topoisomerase ii inhibitor , indicating dependence on chromatin remodeling ( 75 ) . hiv gene expression is stimulated by p. gingivalis , and epigenetic changes are critical . in addition to the oral cavity , several studies have focused on hiv reactivation in the gut and vagina . gene expression and replication of nonintegrated hiv were notably increased in vitro upon exposure to various short - chain fatty acids ( scfas ) endogenously produced by gut bacteria ( 49 ) . hiv can be reactivated by supernatant from other butyric acid - producing bacteria , including f. nucleatum , clostridium cochlearium , erythema multiforme , and anaerococcus tetradius . f. nucleatum is commonly found in the mouth and gut , c. cochlearium and e. multiforme in the gut , and a. tetradius in the vagina , indicating that hdac inhibition caused by bacterial butyric acid may be able to reactivate hiv in multiple body compartments . both h3ac levels and hiv gene expression were positively correlated with the amount of butyrate produced by these bacterial species . supernatant from f. nucleatum , c. cochlearium , and a. tetradius cultures reduced binding of hdac1 and increased binding of rna polymerase ii ( rnapii ) to the hiv ltr . these epigenetic changes were not observed when the culture media were heat treated to remove scfa or when the cells were treated with novobiocin , a topoisomerase ii inhibitor ( 48 ) . nab treatment led to increases in the activating marks h3k4me2 , h3ac , and h4ac and decreases in the repressive mark h3k9me3 on the hiv ltr . in monocyte - derived macrophages , hiv replication that was diminished by the integrase inhibitor raltegravir was partially restored by the scfas propionic , valproic , and heptanoic acids ( 49 ) . both present in the gut , helicobacter pylori and ebv have each been linked to gastric cancer ( 76 , 77 ) . although the majority of gastric cancers are associated with h. pylori , up to 10% of gastric cancers contain ebv . ebv - associated gastric cancers , h. pylori - associated cancers , and coinfected cancers have different characteristics ( 76 , 78 ) . in addition , c - myc and bax expression was detected more often in h. pylori - only cancers than in coinfected ones ( 78 ) , indicating double infection may modulate disease characteristics and possibly outcome . in addition to these two infectious agents , increased cpg methylation has been suggested as an early event in and risk factor for the development of gastric cancer ( 79 , 80 ) . in the context of gastric cancer , h. pylori infection has been linked to cpg hypermethylation of several tumor suppressor genes . one gene frequently observed to be silenced by methylation in gastric cancers is the gene coding for runx3 . runx3 methylation has been correlated with age , tumor location , and h. pylori infection ( 81 ) . h. pylori causes methylation of runx3 by stimulating nitric oxide production by macrophages ( 82 ) . another of these genes is the gene coding for e - cadherin , a transmembrane adhesion protein whose loss is involved in invasion and metastasis ( 83 ) . e - cadherin mutations have been observed in diffuse gastric cancers , and methylation of the e - cadherin promoter may be a second hit in patients with heterozygous mutation ( 84 , 85 ) . e - cadherin methylation was associated with h. pylori infection in patients with dyspepsia and gastric cancer , with loss of e - cadherin protein observed by immunohistochemical staining in gastric cancer biopsy specimens ( 86 ) . furthermore , treatment to eliminate h. pylori in dyspepsia patients reversed e - cadherin methylation by 6 weeks ( 87 ) . hypermethylation of the e - cadherin and two other tumor suppressor promoters , dapk and p16 , was found to be increased in normal gastric mucosa of gastric cancer patients compared to healthy controls and may be a marker for increased risk of cancer ( 88 ) . methylation of cpg islands in p16 , lox , flnc , hrasls , hand1 , thbd , and p41arc was also increased in h. pylori - positive individuals ( 89 ) . ebv - associated transformation and tumorigenesis in gastric and other cancers have been linked to latency ( 90 ) . latent ebv is highly methylated , and expression of the ebv - encoded nuclear antigens ( ebnas ) is silenced by cell - type - dependent methylation ( 91 , 92 ) . however , zebra , an ebv transactivator that is increased in cells treated with p. gingivalis spent medium in association with histone acetylation ( 46 ) , preferentially binds to the methylated form of its ap-1-like binding sites in the brlf1 and brrf1 promoters , increasing transcription ( 91 , 93 ) . zebra and the products of brlf1 and brrf1 are all transcription factors involved in the switch to viral lytic replication ( 93 ) . like h. pylori , ebv has been implicated in high levels of cpg methylation of cellular genes associated with gastric cancer , including those coding for p14 , p16 , pten , rassf1a , gstp1 , mgmt , and mint2 ( 9496 ) . ebv infection was correlated with overexpression of the dna methyltransferase dnmt1 in gastric cancers , which was in turn correlated with cpg methylation of the hmlh1 and thbs-1 genes ( 97 ) . given the documented effects of epigenetic modifications on ebv gene expression , the ability of ebv and gut bacteria such as h. pylori to induce epigenetic changes in cells , and the strong link between gastric cancer and cpg methylation , it is plausible that coinfections may heighten gastric cancer risk . there is extensive evidence demonstrating the critical role of bacterial products in the modulation of viral epigenomes ( summarized in table 1 ) . regardless of tumor virus type or cell type , bacteria are associated with enhanced viral replication , and there is significant modulation of processes associated with epigenetic regulation both in vitro and in vivo . in the case of latent viruses , epigenetic modifications may lead to lytic reactivation of the virus , production of virions , and spread of the virus . epigenetic modifications to the promoters of virus encoded oncogenes could increase production of these proteins and promote cancer progression ( fig . 1 ) . recent work has shown that hdac inhibition activity is central to bacterium - mediated activation of viral epigenomes , including hiv ( 49 ) and herpes group viruses ( 31 , 46 ) . in addition , gut bacteria can modulate cpg methylation , an important regulator of ebv gene expression , and the presence of all three is a risk factor for gastric cancer ( 76 , 77 , 79 , 80 ) . these results suggest that epigenetic modifications are common to bacterium - mediated reactivation , but the rigorous testing needed to understand the exact epigenetic mechanisms has not been done . first , what are the mechanisms of chromatin modification on tumor viral promoters , and are these modifications sufficient to drive viral gene activation ? second , what are the bacterium - mediated modifiers that deregulate the host antiviral response ? third , are there disease - relevant associations between bacterial infection and viral epigenetic modification within various body cavities ? finally , do bacterium - mediated chromatin modifications affect cellular genes that are critical to viral pathogenesis ? summary of bacterium - mediated epigenetic modifications to viruses there is strong evidence of enhanced pathogenesis in bacterium - virus coinfections . extensive use of epigenetics to direct viral gene expression and emerging data on epigenetic regulation of hiv and herpesviruses by bacteria suggest epigenetic modification in polymicrobial interactions may be a generalizable principle contributing to a wide variety of diseases . further studies may provide information on host and viral molecules key to disease progression that can be translated into high - impact novel therapies that consider multiple pathogens . the treatment that may emerge would be highly significant because of the high incidence of polymicrobial diseases , particularly in immunocompromised hosts . importantly , the implications may be far - reaching , as similar interactions may occur in all mucosally coinfected compartments . without an understanding of the environmental factors that modulate these critical viral epigenetic modifications , our ability truly to eradicate these virus - associated disorders remains compromised . | abstractthe human body plays host to a wide variety of microbes , commensal and pathogenic .
in addition to interacting with their host , different microbes , such as bacteria and viruses , interact with each other , sometimes in ways that exacerbate disease .
in particular , gene expression of a number of viruses , including kaposi s sarcoma - associated herpesvirus ( kshv ) , epstein - barr virus ( ebv ) , and human immunodeficiency virus ( hiv ) , is known to be regulated by epigenetic modifications induced by bacteria .
these viruses establish latent infection in their host cells and can be reactivated by bacterial products .
viral reactivation has been suggested to contribute to periodontal disease and aids .
in addition , bacterium - virus interactions may play a role in cancers , such as kaposi s sarcoma , gastric cancer , and head and neck cancer .
it is important to consider the effects of coexisting bacterial infections when studying viral diseases in vivo . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the latest study on the therapeutic value of statins in pneumonia adds further support to the association between statin use and improved patient outcomes . the role of statins in the management of sepsis has been increasingly studied but remains contentious . animal studies of statin use in sepsis have shown a significant benefit with respect to mortality but a plethora of observational studies have come to conflicting conclusions . many mechanisms have been postulated to explain why statins may influence sepsis , and it is possible some of these may be of particular benefit in pneumonia [ 6 - 8 ] . statins are taken by millions of people around the world and pneumonia represents one of the most common infections seen in clinical practice . this provides an opportunity to review a large number of cases of pneumonia that involve coincidental statin use . as would be expected for a drug targeting vascular disease and hypercholesterolaemia , statin users have different comorbidities and risk profiles to those patients that do not take statins . therefore , observational and retrospective studies are potentially confounded by both an unhealthy user effect ( a cohort often older with more coexisting cardiovascular disease ) and the ' healthy user ' effect . the recent study by nielsen and colleagues is a well conducted , large , observational study . the authors provide extensive detail on coexisting diseases in each of the cohorts in an effort to reveal hidden confounders that plague database interrogation . this paper adds another observational study to a large bank that already exists addressing the outcome from pneumonia in statin users [ 10 - 13 ] . it serves to remind us that while again suggesting a possible therapeutic role for these agents in pneumonia , it does not prove a clear cause and effect relationship . firstly , it defined ' current use ' as one prescription filled in the past 125 days . while the results suggest the improvement in pneumonia outcome was associated with current and not former statin users , a huge variation in timing of statin administration in relation to onset of infection is possible within these definitions . in addition to the timing of administration , the impact of one statin over another or drug dosage remains unclear . finally , large registry databases pose other challenges . as was highlighted recently , both the consistent use of a diagnostic category over time and the motivations for recording specific diagnosis can further confound the validity of results from large national or administrative databases . it is fortuitous that prevalence has provided the opportunity to observe statin use in pneumonia patients . these observations have provided the impetus to investigate statins as a potential adjuvant therapy for severe lung injury . two randomised controlled trials are currently underway : statins for acutely injured lungs from sepsis ( sails ) and hydroxymethylglutaryl - coa reductase inhibition with simvastatin in acute lung injury to reduce pulmonary dysfunction ( harp 2 ) . in contrast , harp-2 will compare 80 mg simvastatin to placebo . whilst these may be equipotent doses in the management of hypercholesterolaemia , it remains unknown what effects these agents at these doses will have in acute lung injury . these two drugs have pharmacokinetic differences , including lipid solubility , volume of distribution , metabolism and potency . without an explanation of how statins may benefit patients with lung injury , predicting compared to the general population , the pharmacokinetics of atorvastatin differs in critical illness , and perhaps with sepsis in particular . exploring commonly used statin pharmacology in critically ill patients with pneumonia would better define dose - response relationships on varied biological endpoints and this may provide some valuable insights into mechanisms that could explain an association with improved patient outcomes . in addition to statin use possibly being associated with a reduction in the severity of infection , a second intriguing possibility is that statins may reduce the risk of infection . a post hoc analysis of the jupiter trial suggested a modest reduction in the incidence of pneumonia in patients randomised to receive 20 mg of rosuvastatin . a nested case control study has also suggested a reduced incidence of pneumonia in statin users . the recent study by nielsen and colleagues again suggests a decrease in the risk of hospitalization for pneumonia with statin use , but only after adjustment for potential confounding variables . pneumonia represents an illness with known risk factors and the administration of statins as preventative therapy could be prospectively explored in this patient population in an effort to avoid confusion from uncontrolled or unknown factors . rather than question what can be learned from observational data while the results of randomised trials are awaited , perhaps we can use all these research methods to better inform our clinical practice . whilst observational studies to date are far from conclusive , it is hard to see how randomised controlled trials will resolve a complex debate that is still in its infancy . it is more likely that a multipronged approach with retrospective large databases , smaller biological studies and randomised trials will help complete the biological puzzle of statin use and its role in patients with pneumonia . harp 2 : hydroxymethylglutaryl - coa reductase inhibition with simvastatin in acute lung injury to reduce pulmonary dysfunction ; sails : statins for acutely injured lungs from sepsis . | several studies have investigated the use of statins as an adjunct in the treatment of pneumonia , some with conflicting conclusions .
the most recent of these large observational studies again suggests statin use is associated with an improved outcome for patients with pneumonia .
how best to incorporate these findings into current practice is of great interest .
hidden confounders plague database interrogation and so cast doubt on the real or causal nature of observed associations .
data from large , observational studies must be complemented by smaller biological studies and randomised controlled trials in an effort to complete missing pieces in the biological puzzle of the use of statins in patients with pneumonia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hypertension , dyslipidemia and diabetes are well - known risk factors for cardiovascular disease ( cvd ) . according to the world diabetes atlas , the prevalence of diabetes averaged 16% in urban india and only 3% in rural india . the prevalence of hypertension in india is reported as ranging from 10% to 30.9% , respectively . at an underestimate , there are 31.5 million hypertensives in rural and 34 million in urban populations . large - scale clinical trials have shown that pharmacological treatment can reduce the morbidity and mortality associated with cvd and that long - term or lifelong treatment is often indicated . given the lack of symptoms for the presence of disease , medication adverse effects become an important factor in non - compliance and non - persistence . patient compliance or adherence is defined as the extent to which a person 's behavior coincides with health - related advice . according to the world health organization , non - compliance with long - term medication for chronic conditions in addition , it has also been identified as the predominant reason for the failure of medical therapy and disease progression . patient dissatisfaction with the doctor , poor doctor - patient relationship , or long waiting times to obtain appointments increase the risk of non - compliance . multiple drug therapy and multiple frequency of dosing also increase the risk of non - compliance . the lack of a patient - friendly , flexible health care system has also been identified as the primary reason for non - compliance . with this background in mind , the study was designed to determine treatment compliance among patients with hypertension and type 2 diabetes mellitus and to determine the factors responsible for non - compliance in a south indian population . in addition , assessment of the applicability of the rule of halves pertaining to hypertension was the secondary objective for the current study . the cross - sectional community - based survey was carried out in the field practice area of department of community medicine , of a medical college , which is situated along the coastal area in the southern part of karnataka , india . the field practice area covers a population of 45,587 living in 7164 families spread out in 11 villages , along the coastline . modern medicine facilities are easily accessible to the people in the area , both government and private . in addition , the department of community medicine provides primary health care to the population , through rural maternity and child welfare ( rmcw ) homes , which is provided at no cost to the patients . the subjects of the study were already diagnosed cases , identified from a prevalence study on type 2 diabetes mellitus and hypertension in the community . the diagnosis of hypertension and diabetes was based on patient records , i.e. , when the subjects had already been diagnosed with the disease and were taking medications for the same from a physician , they were considered to be cases for the study and no other diagnostic criteria was applied . institutional ethical committee clearance was obtained prior to the initiation of the study . written informed consent was obtained from all the subjects . during house visits , data were collected by personal face - to - face interview using a pre - tested structured questionnaire . main domains of the questionnaire were : socio - demographic details , nature of treatment , source of health care , regularity of taking prescribed medicines . no scoring system was used . the tool was pilot tested and validity was appraised by experts ( consensual validity ) . compliance to treatment was determined by indirect methods , which included interviews and self - reporting by the patients . non - adherence was assessed using patients self - reports of how they had been taking their medication in the week preceding the interview . patients who reported taking less than 80% of their prescribed medicines were considered to be non - compliant to treatment . a chi - square test was used to compare the compliance considering the different demographic and socio - economic categories . unadjusted odds ratio ( or ) with the 95% confidence interval ( 95% ci ) were calculated for the various socio - demographic characteristics against treatment compliance . the same variables were included for multiple logistic regression analysis using the forward conditional method , with treatment compliance as the dependent variable and the socio - demographic characteristics as the independent variables . all statistical analysis was performed using statistical package for social sciences ( spss ) version 15.0 from spss south asia bangalore , india . the cross - sectional community - based survey was carried out in the field practice area of department of community medicine , of a medical college , which is situated along the coastal area in the southern part of karnataka , india . the field practice area covers a population of 45,587 living in 7164 families spread out in 11 villages , along the coastline . modern medicine facilities are easily accessible to the people in the area , both government and private . in addition , the department of community medicine provides primary health care to the population , through rural maternity and child welfare ( rmcw ) homes , which is provided at no cost to the patients . the subjects of the study were already diagnosed cases , identified from a prevalence study on type 2 diabetes mellitus and hypertension in the community . the diagnosis of hypertension and diabetes was based on patient records , i.e. , when the subjects had already been diagnosed with the disease and were taking medications for the same from a physician , they were considered to be cases for the study and no other diagnostic criteria was applied . institutional ethical committee clearance was obtained prior to the initiation of the study . written informed consent was obtained from all the subjects . during house visits , data were collected by personal face - to - face interview using a pre - tested structured questionnaire . main domains of the questionnaire were : socio - demographic details , nature of treatment , source of health care , regularity of taking prescribed medicines . the tool was pilot tested and validity was appraised by experts ( consensual validity ) . compliance to treatment was determined by indirect methods , which included interviews and self - reporting by the patients . non - adherence was assessed using patients self - reports of how they had been taking their medication in the week preceding the interview . patients who reported taking less than 80% of their prescribed medicines were considered to be non - compliant to treatment . a chi - square test was used to compare the compliance considering the different demographic and socio - economic categories . unadjusted odds ratio ( or ) with the 95% confidence interval ( 95% ci ) were calculated for the various socio - demographic characteristics against treatment compliance . the same variables were included for multiple logistic regression analysis using the forward conditional method , with treatment compliance as the dependent variable and the socio - demographic characteristics as the independent variables . all statistical analysis was performed using statistical package for social sciences ( spss ) version 15.0 from spss south asia bangalore , india . the subjects of the study were already diagnosed cases , identified from a prevalence study on type 2 diabetes mellitus and hypertension in the community . this comprised of 426 subjects , 287 and 139 hypertensive and diabetic patients respectively . among the hypertensive patients 236 ( 82.2% ) were taking regular treatment . among the individuals on regular medication , 88 ( 37.3% ) of them this conveys that although the compliance was good , blood pressure control was still far beyond the optimal target . among the known cases of diabetes , compliance to treatment was 83.6% ( 116 ) and of these 73.5% ( 86 ) had random blood sugar ( rbs < 200 mg / dl ) levels at the time of examination . target for glycemic control have been set for fasting and post prandial blood glucose levels , but there are no set targets for random blood glucose ( rbs ) level . hence , the cut - off level of rbs < 200 mg / dl , was chosen for the present study . the other reason for selecting this particular cut - off was based on the investigator 's convenience as rbs was estimated at the time of the interview for all subjects including diabetics , but irrespective of their rbs values , were not tested further . as fasting and post prandial blood glucose levels were not estimated , standard guidelines were not used to assess treatment compliance . individuals aged 60 years comprised the major proportion 174 ( 60.6% ) of known hypertensives , among whom , 28 ( 16% ) were not taking their medications regularly , as shown in table 1 . influence of socio - demographic characteristics on treatment compliance among hypertensive patients ( n=287 ) eighty patients ( 27.5% ) were both diabetic and hypertensive . among the hypertensives , not on regular treatment , 18 ( 35.3% ) had controlled blood pressure , while among the non - compliant diabetics , 16 ( 69.6% ) had rbs < 200 mg / dl . compliance to hypertension treatment was better among females as compared to males ( 87.4% vs. 72.2% ) and this difference was noted to be statistically significant ( = 10.15 , p < 0.05 , adjusted or = 2.66 , 95% ci = 1.44 - 1.94 ) . similar significant difference was also noted with respect to diabetes treatment , as depicted in table 2 . influence of socio - demographic characteristics on treatment compliance among diabetic patients ( n=139 ) literacy status and socio - economic background did not have any bearing on adherence to treatment , in our study . compliance to therapy was more among housewives as compared to other occupation groups , with respect to both hypertension and type 2 diabetes mellitus [ tables 1 and 2 ] . univariate analysis of different variables affecting compliance showed that the odds of treatment compliance was higher for hypertensive treatment among housewives , and the odds of compliance was poor among males for both hypertension and diabetes . high cost of treatment for hypertension 20 ( 39.3% ) and diabetes 07 ( 30.4% ) and asymptomatic nature of the disease were the most common reasons cited for not taking regular medications [ table 3 ] . nearly , half 11 ( 47.8% ) of the diabetics and 18 ( 35.3% ) of the hypertensives , presumed that the disease was under control , as they had no signs and symptoms and therefore were not taking medicines . in the present study , compliance to hypertension treatment was found to be 82.2% , while 83.6% of individuals with type 2 diabetes mellitus were on regular medication . high cost of treatment for hypertension ( 39.3% ) and diabetes ( 30.4% ) and asymptomatic nature of the disease were the most common reasons cited for not taking regular medications . treatment adherence for hypertension in the present study was 82% , which is similar to the compliance rate of 88.6% reported among hypertensives attending a hypertension clinic in kuwait . the methods employed in assessing the compliance and the health care delivery system could partly explain the differing rates of compliance . contrary to report that diabetic patients are non - adherent to their treatment , the present study demonstrated 83.6% of the subjects to be compliant to treatment . sweileh et al . also noted that diabetic patients had better overall rate of compliance than hypertensive patients . compliance was 91.5% to anti - diabetic treatment among 59 diabetics , as against 47% to anti - hypertensive treatment among 207 hypertensives , in a cross - sectional study conducted on 560 participants in delhi . for example , most of the elderly have memory problems related to age . furthermore , most elderly patients have vision and hearing problems that might increase the potential of mistakes in taking medications . another problem with elderly is that most of them have several diseases and take several drugs at the same time which might be confusing . women were found to be more compliant to treatment than men in our study , but gender was not identified as a significant variable in other studies . illiterate patients can not read or distinguish their medications which increases the risk of errors and non - compliance . however , it was noted that people with education up to secondary level and those with skilled jobs to be non - adherent as compared to other education and occupation groups , while other studies have reported formal education to be influential on patient 's rate of compliance . this could be partly explained by the overall good literacy rate among this coastal population . the rule of halves for hypertension states that : half the people with high blood pressure are not known , half of those known are not treated and half of those treated are not controlled. if this rule is valid , then only one in eight of the hypertensive population would be receiving the optimal treatment . an attempt was made to assess the applicability of the rule of halves in the current study . among the hypertensive subjects , 23% were aware of the condition , of whom 82% of them were on treatment and of these , only 37.3% had their blood pressure under control , which represents 31% of the total hypertensive group . thus , the rule of halves seems to be valid for hypertension in the community , which is concurrent with the findings of another urban south indian population . it has taken 30 - 40 years of sustained effort to substantially improve hypertension detection and control in western countries , and the rates are still far from optimal . that is to say , in a country like india we have a long way to go , to attain optimum levels of treatment compliance . patients receiving treatment for chronic conditions often hold reservations about their drugs and make active decisions about continuing to use them . among the various reasons for non - compliance , affordability for the drugs , asymptomatic nature of the disease , and side - effects of drugs have been commonly documented . the present study findings too were in agreement with the existing literature , with respect to reasons for non - compliance . the current study was designed to provide an insight into treatment adherence among patients with hypertension and diabetes . though the study was able to identify factors contributing to lack of compliance , in terms of patient - related ( disinterest ) , condition - related ( asymptomatic nature of the disease ) , therapy - related ( cost of drugs ) , and socio - economic factors ( affordability ) , in - depth review of non - compliance was not done . the other limitation of the study was that only patient 's response with respect to treatment adherence was taken and not the ideal pill count method for assessment . the investigators believe the results reported by the subjects are not falsified , as modern medicine facilities are easily accessible to the people in the area . in addition , the department of community medicine provides primary health care at no cost to the patients , through rmcw homes . in these centers , hence , they have to come the following week , if they need medicines . in this regard , this could be the contributing factor for the high level of compliance in the present study . high cost of treatment was cited by the subjects as a deterring factor , indicating that in spite of medicines being provided to the patients , the complex nature of the disease requires multiple drug combinations , some of which patients will have to buy on their own . to summarize , although treatment compliance is good , from the perspective of achieving desirable clinical outcomes , the negative effect of therapeutic non - compliance needs to be minimized and more detailed studies on factors influencing compliance need to be done to fill in the knowledge gap and contribute to formulating strategies for countering non - compliance . compliance to hypertension and type 2 diabetes mellitus treatment was found to be good in the current study . high cost of treatment and asymptomatic nature of the disease were the most common reasons cited for not taking regular medications . to address these issues , it may be recommended that health care professionals involved in the management of hypertension and diabetes need to create greater awareness among their patients in order to foster better control of the disease and improve health outcomes , while the pricing of medications is beyond the control of the treating physician . | background : hypertension and diabetes are major risk factors for cardiovascular and cerebrovascular disease .
adherence is a primary determinant of the effectiveness of treatment because poor adherence attenuates optimum clinical benefit and paves the way for complications.methods:the cross - sectional community - based survey was carried out among men and women aged 30 years and above in the field practice area of a medical college to assess treatment compliance with respect to hypertension and type 2 diabetes mellitus .
the study comprised of 426 subjects , already diagnosed with hypertension ( 287 ) and type 2 diabetes mellitus ( 139 ) . during house visits ,
data were collected by personal face - to - face interview using a pre - tested structured questionnaire .
compliance was determined by indirect methods , which included self - reporting and interviews with the patients.results:compliance to hypertension treatment was found to be 82.2% , while 83.6% of individuals with type 2 diabetes mellitus were on regular medication . among the individuals on regular medication , 88 ( 37.3% ) of them had controlled blood pressure . although the compliance was good , blood pressure control was not optimal .
adherence was better among females as compared with males .
literacy status and socio - economic background were not found to be associated with treatment compliance .
high cost of treatment for hypertension ( 39.3% ) and diabetes ( 30.4% ) and asymptomatic nature of the disease were the most common reasons cited for not taking regular medications.conclusions:adherence to hypertension and diabetes treatment was good .
high cost of medications and asymptomatic nature of the disease were the reasons identified among the non - adherent patients . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.