text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
bisphosphonates ( bps ) , a class of drugs that inhibit osteoclast - mediated bone resorption , are used to treat skeletal diseases that increase bone resorption , such as paget 's disease or multiple myeloma . bps can also counteract the hypercalcemia of malignancies and carcinomas metastatic to the bone , including breast cancer , and are well known for the management of osteoporosis1 . food and drug administration ( fda ) approved the use of etidronate as a bone disease agent to treat paget 's disease . bp uses were extended to additional diseases after the fda recognized the clinical use of nitrogen - containing bps in 19942 . bisphosphonate - related osteonecrosis of the jaw ( bronj ) was first reported by marx3 in 2003 and ruggiero et al.4 in 2004 . marx3 described patients who received intravenous bp zoledronic acid treatment and subsequently developed osteonecrosis of the jaw . ruggiero et al.4 described clinical symptoms , radiological features and guidelines for diagnosis in 63 patients with bp oral administration who developed osteonecrosis . impediment of osteoclast activity , decreased blood flow , direct toxicity to tissues , and imbalance of wound treatment , inflammation and infection have been considered567 . however , evidence suggests that bps have pharmacokinetic characteristics that hinder osteoclast activity and lead to onj from the imbalance of blood flow8 . the risk factors of bronj are mainly diabetes mellitus , intake of corticosteroids , malignancies , alcohol consumption , immunosuppressant treatment , autoimmune diseases , hematopoietic diseases , peripheral vascular diseases and renal disorders9 . diabetes is a high risk factor for bronj because it may bring ischemic changes in microvessels , decline in endothelial cell activity , bone cells destruction , and a reduced metabolism10 . patients who take chemotherapy with a cell division suppressant , corticosteroids and stem cell transfusion are more vulnerable to developing bronj than others due to the decreased immunity and blood flow supply caused by bone marrow transformation101112 . conservative treatments are preferred to manage bronj , including medication to reduce pain , mouth rinsing for improved hygiene , and prescription of antibiotics for inflammation with removal of sharp bone edges that might stimulate soft tissues131415 . discontinuation of bp administration , hyperbaric oxygen therapy , and low - level laser therapy have also been introduced161718 . however , those applications do not directly treat the necrosis of the jaw and surrounding soft tissues , and patients risk continuous bone exposure without full recovery of the mucous membrane in the jaw . stanton and balasanian2 , on the other hand , described debridement that could bring temporary recovery of pain and infection due to bronj and fully solve the aggravation of osteonecrosis . lopes et al.19 and stockmann et al.20 reported a success rate of more than 80% through sequestrectomy of bronj cases . carlson and basile21 performed surgical management through the complete resection of necrotic bone in the mandible and maxilla on 95 bronj patients and healed them with an acceptable prognosis . we collected and reviewed general information on the patients and assessed bronj risk factors for their influence on outcome after surgical management as well as the pathogenesis of bronj . a biopsy was performed on the extracted bones in all cases and common histological characteristics were analyzed with respect to the pathogenesis of bronj . the objective was to suggest a standard for bronj surgical management taking systemic factors into account . written informed consent was obtained from the patients for the publication of this report and any accompanying images . the total of 54 bronj patients who received surgical therapy and a bone biopsy between january 2008 to july 2015 at dankook university dental hospital ( cheonan , korea ) were included . patients who received radiation treatment in the head and neck or were diagnosed with osteopetrosis or florid osseous dysplasia after biopsy were excluded . the following data were collected : ( 1 ) sex , ( 2 ) age , ( 3 ) osteonecrosis site , ( 4 ) bronj stage at first examination , ( 5 ) etiologic factors , ( 6 ) underlying disease requiring bp medication , and ( 7 ) surgery type . classification of bronj stage at the first examination was done according to the position paper of the american association of oral and maxillofacial surgeons ( aaoms ) released in 2007 . ( 1 ) stage 0 : nonspecific clinical findings and symptoms such as jaw pain or osteosclerosis but no clinical evidence of exposed bone , ( 2 ) stage 1 : exposed , necrotic bone or fistula that probes to bone . no symptoms or evidence of infection , ( 3 ) stage 2 : exposed , necrotic bone or fistula that probes to bone , associated with infection , pain , and erythema in the regions of the exposed bone . purulent drainage may also be present , and ( 4 ) stage 3 : exposed , necrotic bone or fistula that probes to bone in patients with pain , infection , and 1 or more of the following ; pathologic fracture , extraoral fistula , oral antral / oral nasal communication , and osteolysis extending to the mandibular inferior border or sinus floor . for outcome , cases were classified after surgery according to clinical symptoms during outpatient follow - up : ( 1 ) normal tissue regeneration on surgical site , ( 2 ) delayed recovery on surgical site , and ( 3 ) recurrences on surgical site and other sites . delayed recovery cases included patients with wound dehiscence and bone exposure for more than 3 months during periodic follow - up after surgery . recurrence cases included patients with osteonecrosis on the surgical site and other sites after surgery requiring additional surgical management . a patient scoring system was adopted to capture systemic pathology features in 3 categories according to the following criteria . if a patient had none among the three items mentioned above , then he or she was scored as 0 . if a patient had a feature described above , then he or she was scored as 1 . if a patient had two features , then he or she was scored as 2 . we also applied the muconns ( modified university of connecticut osteonecrosis numerical scale ) scoring system described by reich et al.22 , which weighs each disease differently . depending on the assessed severity of the osteonecrosis of the jaw , each disease is scored differently . osteoporosis scores as 1 , diabetes mellitus as 2 , steroid oral administration as 2 , breast cancer and prostate cancer among other malignancies as 3 , and chemotherapy as 5.(table 1 ) we adopted the weighted factor for each criterion and summed up all for an index score for each patient . we looked at 36 patients for whom the complete bp medication period was confirmed as well as 44 patients who discontinued their bp medication before bronj surgery respectively . the c - terminal cross - linking telopeptide ( ctx ) value , or bone resorption index , was also collected from 28 patients who received blood screening . the presence of microorganisms in bone biopsies and impressions of necrotic bone and adjacent sites were evaluated by optical microscopy . statistical analysis was performed using linear by linear association and nonparametric kruskal - wallis tests with ibm spss statistics version 21.0 program ( ibm co. , armonk , the age distribution varied from 61 to 86 years ( mean , 73.95.27 years ) . there were 11 patients in their 60s , 35 in their 70s , and 8 in their 80s . the osteonecrosis sites were divided into the maxilla , mandible , and maxilla and mandible simultaneously . osteonecrosis occurred in the mandible in 37 patients , the maxilla in 15 patients and the maxilla and mandible simultaneously in 2 patients . according to the aaoms bronj categories described above , one patient was classified as stage 1 , 44 as stage 2 , and 9 patients as stage 3 . trauma due to inappropriate dentures resulted in bronj in four patients , dental implants in three patients and periodontal treatment in one patient . the majority of the patients , 50 out of 54 , had taken bp medication for treatment or prevention of osteoporosis . patients with malignancies ( three breast cancer and one prostate cancer ) received bp medication to prevent bone diseases . saucerization was performed in 50 cases , together with 1 simple curettage , 2 partial maxillectomies , and 1 segmental mandibulectomy.(table 2 ) based on prognoses after surgical therapy , 32 of the 54 patients ( 59.3% ) showed normal recovery , 16 patients ( 29.6% ) were diagnosed with delays at surgical sites , and recurrence of bronj at surgical and other sites was observed in 6 patients ( 11.1% ) . there were two cases of recurrence at the same surgical site and four cases of recurrence at surgical and other sites.(fig . 1 ) a total of 19 patients took bp medication without a diagnosis of diabetes mellitus , steroid medication , or malignancy . among the other 35 patients , 11 had diabetes , 22 received steroid medications and seven were diagnosed with malignancies . there were 8 diabetes mellitus patients without other diseases , 19 patients who took only steroid medications , and 3 patients who were diagnosed with malignancies at other sites without any complications . six patients were diagnosed with more than two diseases or received more than two types of medication . two patients had diabetes and a malignancy and two patients were taking steroid medications and had malignancies at other sites . 2 ) four of the patients with malignancies were diagnosed with breast or prostate cancer . three other patients had received chemotherapy for carcinomas at other sites . using the first scoring system mentioned in materials and methods , 19 patients scored 0 , 29 scored 1 , and 6 patients scored 2 ( fig . 3 . a ) , for a mean score of 0.760.64 . using the second scoring system , adopted from muconns , the minimum value was 1 and the maximum was 8 , with a mean score of 2.871.94.(fig . b ) in the statistical analysis , each systemic predisposing factor was assessed individually after eliminating other influencing factors . the 19 bronj patients with no systemic predisposing factors mentioned above were used as a control group . patients with more than two factors were excluded and the difference in prognosis after surgery was compared between patients with and without each factors . for example , in the diabetes mellitus category , 8 of the 12 patients were included in the experimental group ; the remaining 4 patients were excluded.(fig . 2 ) patients who took steroid medication due to malignancies at other sites were also excluded . there was a statistically significant difference in prognosis according to the presence of diabetes mellitus ( p<0.05 ) . moreover , the administration of steroids was significantly associated with prognosis ( p<0.05 ) , while the presence of malignancies at other sites was not ( p>0.05).(table 3 ) when each patient was scored using systemic medical history criteria ( the first scoring system ) , patients with higher scores showed significantly worse prognosis after surgical therapy ( p<0.05 ) . prognosis after surgical therapy was also significantly correlated with the muconns scores ( the second scoring system ) ( p<0.05).(table 4 ) a total of 47 patients received bp medication orally and seven received periodic intravenous administration of bp medication . the bp medication duration in the 36 patients for whom such information was available was 1 to 20 years ( mean , 4.783.84 years ) . according to an aaoms position paper published in 2007 , treatment protocol differed between patients who received bp medication for less than and more than 3 years ( number of patients , 21 and 15 , respectively , in this study ) . in this study , thirty patients stopped their bp medication for less than 3 months and 14 patients for 3 months or more . patients who received intravenous bp medication had significantly worse prognosis after surgical management than those who took their medication orally ( p<0.05 ) . the bp medication duration in the 36 patients for whom such information was available was divided into less than and more than 3 years . in addition , the bp medication duration in the 36 patients for whom such information was available was divided into less than and more than 3 months . there was also no significant difference between these two groups ( p>0.05).(table 5 ) the ctx value was determined after a morning fast 7 days before surgery . among the 28 subjects with a ctx value available , the range was 30 to 747 pg / ml ( mean , 186159 pg / ml ) . marx et al.16 evaluated bronj severity according to ctx value prior to invasive dental surgery . patients were categorized into three major groups : more than 150 pg / ml ( low - risk group , n=15 ) , 100 to 150 pg / ml ( intermediate - risk group , n=6 ) , and less than 100 pg / ml ( high - risk group , n=7 ) , according to the standard proposed by marx et al.16 . we found no significant difference in prognosis according to ctx value ( p>0.05).(table 6 ) microorganisms were detected in 24 of the 54 samples . the presence of microorganisms was not associated with prognosis after surgery ( p>0.05).(table 7 ) bone biopsy results were typical of necrotic bone . cell components and blood vessels were not found and the new bone formed around the osteocystic lacunae was destroyed . from the pathological point of view , bps are an analogue of pyrophosphonate and hinder bone resorption activity mediated by osteoclasts . when bone resorption occurs , bps are separated from bone and adhere to newly formed bone or undergo phagocytosis by osteoclasts . bp lacking nitrogen is metabolized by osteoclasts and transformed into adenosine triphosphate ( atp ) . this process hampers adenosine diphosphate ( adp)/atp aminotransferase activity , and triggers extinction of osteoclasts . nitrogen - containing bp ( n - bp ) resists bone resorption . in this case , osteoclasts resorb bone and n - bp , and exhibit cholesterol synthesis . during this process , farnesyl disphosphate is found in the mevalonate stage , and n - bp disturbs the synthesis of this enzyme , which hampers osteoclast activity . n - bp has a greater suppressive effect on bone resorption than bp12324 . in addition , if osteoclasts function normally , n - bp reduces the sites of bone metabolism . the pathogenesis of bronj is controversial because of the ambiguous effects of n - bp . how much bp is metabolized and how much accumulates at membrane sites to influence wound treatment we examined each patient 's systemic medical history to look for factors that affect the prognosis of surgical management of bronj . diabetes mellitus increases the incidence of bronj due to its systemic effect . osteonecrosis is caused by microvascular ischemia in bones , dysfunction of endothelial cells and decreased bone metabolism in patients with diabetes mellitus102526 . patients with diabetes show delayed full recovery after periodontal tissue destruction due to reduced immunity ; this may lead to osteonecrosis27 . bronj patients with diabetes mellitus exhibited significantly greater rates of osteonecrosis recurrence and aggravation than those without diabetes mellitus , in agreement with previous reports910 . however , diabetes type or hba1c range , which can confirm blood glucose management , were not measured . steroid medication improves the prognosis of bronj surgical therapy , but there is a strong correlation between steroid treatment and osteonecrosis , particularly that caused by bps . however , previous studies focused on patients who took bp medication to treat or prevent malignancies such as breast cancer , prostate cancer , multiple myeloma , or bone metastasis . treatment of these diseases generally includes oral administration of corticosteroids with intravenous bp medication and chemotherapy as needed2 . malignancies influence the bone system irrespective of bp medication , and may cause osteonecrosis irrespective of their effect on osteoclast activity8 . thus , the results indicate the effect of steroid medication alone on the prognosis of bronj surgical management . few patients with malignancies were included in this study , however , and further research is warranted . based on the scoring systems we applied , patients with more systemic disease factors and higher muconns scores had worse prognosis after bronj surgical therapy . this finding suggests that prognosis can be predicted preoperatively using systemic factors . because the variables used were limited , we were unable to suggest a statistical processing standard such as a receiver - operating characteristic ( roc ) curve patients on a high dose of potent bp medication had a high incidence of bronj and aggravated bronj symptoms . the aaoms position paper in 2007 classified patients who had taken bp medication for more than 3 years as at high risk for bronj kos et al.31 suggested a hypothesis regarding bronj stage classification : osteonecrosis may occur without bone exposure . if bone exposure occurred in the absence of clinical symptoms , it would be difficult to include such patients as subjects in studies of bronj . in this context , this hypothesis is strongly persuasive . of the patients , 58% had been taking bp medication for less than 3 years . they were assumed to be moderately safe in terms of bronj risk , but most were diagnosed with bronj stage ii or iii at the first medical examination . thus , the majority of individuals were in progressive stages of osteonecrosis , in agreement with the hypothesis of kos et al.31 . therefore , bp medication duration was not predictive of the development of bronj or prognosis after surgery . the prognosis according to time of bp discontinuation before surgery was determined in this study . ruggiero et al.4 reported a positive treatment effect in patients who had discontinued bp medication at least two months before surgery . after that , the manual to cease bp medication before bronj treatment has been considered as standard by many clinicians and led to the recommendation in the 2007 aaoms position paper to discontinue bps three months prior to surgery . however , this approach was based only on experimental data , and bps have a long half - life . the time of bp discontinuation before surgery was not significantly associated with prognosis after surgery in this study . these findings suggest that discontinuation of bp medication before bronj surgical management is a non - optimal treatment protocol . further studies are required to identify the optimum time at which bp medication should be discontinued in bronj patients2 . the carboxy - terminal collagen crosslinks , also known as ctx , is a telopeptide generated during bone resorption . the c - terminal telopeptide is a metabolic product of bone resorption , mostly metabolized by collagen type 1 . serum ctx level is highly correlated with bone turnover rate and so is used to detect various diseases , as well as to predict the prognosis of osteoporosis , the risk of bone metastasis and diagnose rheumatoid arthritis . in the serum test , the distribution of ctx is used as a biomarker of bronj severity163233 . the ctx value is affected by various factors , such as the age and sex of the patient , smoking , alcohol consumption , and underlying conditions such as diabetes mellitus , corticosteroid medication and fasting before the test . since marx et al.16 reported ctx level as a biomarker of bronj severity , many studies have analyzed the association between ctx value and bronj . several have reported that the ctx level not associated with bronj , in agreement with our findings343536 . kunchur et al.35 reported that ctx value alone can not determine the risk of osteonecrosis , because the jaw has 10-fold stronger metabolism than other parts of the skeleton and so changes in jaw metabolism do exert much influence on the ctx value . berger et al.37 reported that the serum ctx level does not play a key role in diagnosing osteonecrosis due to differences in peripheral blood distribution . although this finding is based on necrosis in the thigh bones , not the jaw , it supports a reduced relevance for ctx in bronj . ganguli et al.38 reported that hydroxyapatite covered with n - bp harbored a 60-fold greater number of bacteria than hydroxyapatite without n - bp . kos et al.39 elucidated that this congregation of bacterial community is due to the ammonia in n - bp . microorganisms were not detected in all biopsy specimens in this study , and may have been removed during decalcification for processing of the first biopsy sample . the presence of microorganisms was confirmed at osteonecrosis sites and surrounding tissue by biopsy of soft tissues.(fig . b ) therefore , even if the presence of microorganisms is not confirmed in a bone biopsy , microorganisms adjacent to the osteonecrosis sites and surrounding tissue may cause clinical symptoms . to identify the microorganisms , gram , gms and dpas staining were performed and a filamentous form observed . the anaerobic gram - positive bacterium actinomyces israelli causes actinomycosis in the mouth and is also found in the respiratory system and digestive system . it can not pass through the oral mucosa , but physical pressure during mastication and iatrogenic stimulations such as exodontia or injuries from denture use may facilitate its penetration of the jaw , possibly leading to actinomycosis . naik and russo42 reported that the actinomyces species differ according to bronj stages and staining methods used to detect them . types of bacteria other than actinomyces related to bp in bronj cases have been investigated . therefore , the presence of actinomyces species can be used as an index of bronj clinical symptoms with infection caused by other bacteria44 . this leads to infection using osteonecrosis as a medium , which results in clinical symptoms of pain and infection845 . so osteonecrosis of the jaw can be regenerated although once appropriate treatment is made if subsequent effects of bp medication on osteoclasts and blood supply last . in such cases , the remnants of bacteria can act as a new medium and lead to recurrence of bronj , further complicating the determination of prognosis after surgery . in cases of purulent osteomyelitis not related to bps , this condition indicates a natural immune reaction to resist bacterial penetration and is not related to the osteoclast - killing effect of bps45 . 4 ) neither cell components for blood vessels were found , and osteocytes and new bone formed adjacent to the sites have disappeared . the type of osteonecrosis mentioned in this paper is highly related to bronj pathogenesis due to osteoclast extinction and decreased blood flow . the features of bronj described in this paper coincide with those reported by marx and tursun45 . bones provide blood flow to the periosteum and mucous membranes . based on the bone biopsy results , bp medication decreases the blood flow in mucous membranes and the periosteum , leading directly to ischemic necrosis and ultimately bone exposure . we evaluated whether different prognoses were associated with systemic medical history , the administration method of bp medication , bp medication duration and discontinuation duration , serum ctx value , and the presence of microorganism colonies during bone biopsy . bronj occurred more than twice as much in the mandible as in the maxilla and most patients were bronj stage ii or iii in which symptoms could be detected . osteonecrosis occurred most often after tooth extraction and osteoporosis was the main underlying indication for bp medication . 2 . there were 32 cases ( 59.3% ) of satisfactory recovery after bronj surgery among a total of 54 cases . delayed recovery for more than three months occurred in 16 cases ( 29.6% ) and recurrence of bronj happened in 6 cases ( 11.1% ) requiring re - operation . diabetes mellitus , steroid medication and malignancies at other sites were evaluated as factors from the systemic medical history . we confirmed that diabetes mellitus and steroid medication were correlated to the prognosis of surgery . to sum up these factors and consider the weight of each factor in the scoring system , patients who took bp medication for less than 3 years made up 58% of the total . according to the aaoms position paper in 2007 , these patients should be segregated as a moderately safe group . however , most were at bronj stage ii and iii during the clinical examination , indicating that osteonecrosis was already under way . accordingly , the risk of bronj occurrence should not be assessed exclusively on bp medication duration . patients with oral administration had better recovery , while bp medication duration and discontinuation duration before surgery were not statistically significant factors in prognosis . microorganism colonies were found during bone biopsy in 24 out of 54 cases ( 44.4% ) . the presence of microorganism colonies in biopsy samples was not significantly associated with prognosis after surgery . it may be that the microorganisms were destroyed in the process of preparing the samples or that the microorganism groups were manifested on surrounding soft tissues rather than bone tissues . new bone formation near the osteocytic lacunae sites was lost and destruction of the howship 's lacunae occurred , which are typical forms of osteonecrosis . this type of necrotic bone is highly related to bronj pathogenesis because of osteoclast extinction and decreased blood flow . based on these findings , prognosis after surgery can be predicted by checking a patient 's medical history before bronj surgical treatment . patients with diabetes , steroid medication usage or intravenous bp medication may be more likely to show delays in recovery after surgery or bronj recurrence . based on necrotic bone biopsies , typical changes in bone metabolism caused by bp medication were observed , and we confirmed that those changes caused osteonecrosis . | objectivesthis study examined the statistical relevance of whether the systemic predisposing factors affect the prognosis of surgical treatment of bisphosphonate - related osteonecrosis of the jaw ( bronj ) .
all cases had undergone bone biopsies to determine the characteristics of the mechanisms of bronj by optical microscopy.materials and methodsthe data included 54 bronj cases who underwent surgery and in whom bone biopsies were performed .
the results of surgery were evaluated and the results were classified into 3 categories : normal recovery , delayed recovery , and recurrence after surgery .
the medical history , such as diabetes mellitus , medication of steroids , malignancies on other sites was investigated for an evaluation of the systemic predisposing factors in relation to the prognosis .
the three factors involved with the medication of bisphosphonate ( bp ) were the medication route , medication period , and drug holiday of bp before surgery .
the serum c - terminal cross - linking telopeptide ( ctx ) value and presence of microorganism colony in bone biopsy specimens were also checked .
statistical analysis was then carried out to determine the relationship between these factors and the results of surgery.resultsthe group of patients suffering from diabetes and on steroids tended to show poorer results after surgery .
parenteral medication of bp made the patients have a poorer prognosis after surgery than oral medication .
in contrast , the medication period and drug holiday of bp before surgery did not have significance with the results of surgery nor did the serum ctx value and presence of microorganism colony .
necrotic bone specimens in this study typically showed disappearing new bone formation around the osteocytic lacunae and destroyed howship 's lacunae.conclusionalthough many variables exist , this study could in part , predict the prognosis of surgical treatment of bronj by taking the patient 's medical history . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is a complex group of diseases that stems from the accumulation of mutations in genes that control fundamental biological processes , such as cell growth , proliferation , survival and migration . the study of model organisms has provided several seminal contributions to our understanding of cancer , originating with theodor boveri 's hypothesis drawn from sea urchin - based studies in the early 1900s that cancer arises because of chromosomal abnormalities . in more recent times , mutations in dozens of genes have been shown to contribute to the genesis of different cancers and their discovery has been facilitated by various approaches : isolation of oncogenic viruses ; close examination of familial cancer ; cytogenetics ; positional cloning ; genetic screens in model organisms followed by analysis of mutation status of human homologs in cancerous cells ; genome - wide analysis of gene expression and copy number changes ; and high - throughput sequencing and genome - wide association studies . drosophila melanogaster has proved to be a very valuable organism for the discovery of novel signaling proteins and pathways that control various biological processes . a major tool in the armory of drosophila biologists has been forward genetic screens . over time , many different mutation and screening strategies have been used by drosophila biologists , with great success . one such screening approach , the so - called flp recombinase / flp recombinase target ( flp / frt ) clonal screen , has facilitated the discovery of many new growth regulators by several laboratories , predominantly in the late 1990s and early 2000s . essentially , the flp / frt technique allows the creation of patches of homozygous mutant tissue in a heterozygous animal . thus , growth - regulatory genes that normally cause pre - adult lethality when homozygous were recovered using such screens . subsequently , many of the human homologs of genes that regulate growth in drosophila were linked to the genesis of human cancers . these included several regulators of the insulin and target of rapamycin ( tor ) pathways , the ubiquitin ligase archipelago ( ago ) and a novel signaling pathway , the salvador / warts / hippo ( swh ) pathway . deregulation of the insulin and tor pathways has well described links to human cancer ; for example , pten , which represses activity of the insulin pathway , is one of the most commonly mutated human tumor suppressor genes . following its discovery in 2001 , the human ortholog of ago has been shown to be mutated at varying frequencies in a wide range of human cancers , including ovarian cancer , colon cancer and t cell acute lymphoblastic leukemia . several lines of evidence have also linked altered activity of different swh pathway components to human cancer , although the degree to which deregulation of this pathway contributes to the genesis of different human cancers is still being determined . most drosophila flp / frt screens were designed to isolate genes that restrict tissue growth . the screen originally used by the hafen laboratory was designed in such a way that it could capture both growth suppressors and genes required to promote growth . two such growth - promoting genes were bunched ( bun ) and mlf1 adapter molecule ( madm ) , which were isolated based on the fact that tissue harbouring mutations in these genes exhibited a growth deficiency . the mechanism of action and function of neither gene has been well characterized in flies or mammals . there are four mammalian bun homologs , one of which , transforming growth factor--stimulated clone 22 ( tsc22d1 ) , has been hypothesized to be a tumor suppressor gene from its ability to repress growth and survival of cultured cells . however , its precise function , and that of its three homologs , has not been well characterized in vivo in mammals . the bun gene encodes variant gene products , and only the long bun proteins ( such as buna ) seem to promote growth , whereas shorter isoforms have been shown to antagonize longer bun isoforms . although madm was first isolated using its ability to bind the myeloid leukemia factor 1 ( mlf1 ) oncoprotein , the work by gluderer et al . in this issue of journal of biology the findings of gluderer et al . suggest that bun and madm form a novel growth - controlling complex ( figure 1 ) . their work highlights the power of combining multiple experimental approaches ( in this case genetics and biochemistry ) to elucidate protein function . madm was isolated as a buna - interacting partner by affinity purification and mass spectrometry , and , in parallel , it was isolated in the above - described flp / frt growth screen . the combined approach provided complementary validation for the function of madm and also provided a hint at mechanism : that bun and madm control growth tissue growth in partnership . they appear to do so in an obligate fashion as overexpression of both bun and madm is required to induce tissue overgrowth . the major challenges arising from this discovery are to define the mechanism by which buna and madm promote growth and to explore the role of their mammalian homologs in normal tissue growth and in cancer . the bun - madm growth - regulatory complex . long isoforms of bun ( such as buna ) promote tissue growth in partnership with madm . short bun isoforms ( bunb - e , collectively denoted buns ) can antagonize buna , thus inhibiting its function . the existence of other unknown proteins ( question marks ) , such as a transmembrane receptor protein , that function either upstream or downstream of the buna - madm complex is currently unclear ( dashed lines ) . the mechanism by which the buna - madm complex is regulated probably involves buna phosphorylation ( p ) . have proposed a number of possible mechanisms by which buna and madm promote tissue growth . one possibility is that buna and madm are components of an existing growth - regulatory pathway . tissues lacking bun or madm show some similarities to the phenotypic characteristics of tissues with compromised insulin or tor pathway activity , such as small cell size and reduced cell number . however , gluderer et al . previously showed that bun is unlikely to control insulin or tor pathway activity . if this is the case , an obvious question is how a bun / madm pathway would interface with other growth pathways to coordinately modulate tissue growth , particularly during development , when patterning cues and nutrient signals need to be orchestrated to specify organ and organism size . the exact molecular steps by which buna and madm promote tissue growth also remain mysterious . bun has been proposed to be a transcription factor and therefore might stimulate expression of a growth - promoting transcriptional program , but so far no such target genes have been identified . loss - of - function mutations in bun were recovered lacking the carboxyl terminus , which includes the dna - binding tsc box of buna and the leucine zipper . to establish whether buna - mediated transcription is essential for buna - madm to drive growth , it would be desirable to determine whether a buna protein that is incapable of binding dna as a result of tsc - box missense mutations that abrogate dna binding can rescue bun deficiency . buna and madm both localize to the golgi , and madm has been shown to affect transport from the endoplasmic reticulum to golgi . in addition , rnai - mediated repression of either madm or bun was found to inhibit protein secretion in cultured cells , although it is unclear whether buna and madm regulate secretion in a cooperative manner . it is also unclear whether the ability of buna and madm to control protein secretion is linked to their role as regulators of tissue growth . have proposed a number of possible mechanisms by which buna and madm promote tissue growth . one possibility is that buna and madm are components of an existing growth - regulatory pathway . tissues lacking bun or madm show some similarities to the phenotypic characteristics of tissues with compromised insulin or tor pathway activity , such as small cell size and reduced cell number . however , gluderer et al . previously showed that bun is unlikely to control insulin or tor pathway activity . if this is the case , an obvious question is how a bun / madm pathway would interface with other growth pathways to coordinately modulate tissue growth , particularly during development , when patterning cues and nutrient signals need to be orchestrated to specify organ and organism size . the exact molecular steps by which buna and madm promote tissue growth also remain mysterious . bun has been proposed to be a transcription factor and therefore might stimulate expression of a growth - promoting transcriptional program , but so far no such target genes have been identified . loss - of - function mutations in bun were recovered lacking the carboxyl terminus , which includes the dna - binding tsc box of buna and the leucine zipper . to establish whether buna - mediated transcription is essential for buna - madm to drive growth , it would be desirable to determine whether a buna protein that is incapable of binding dna as a result of tsc - box missense mutations that abrogate dna binding can rescue bun deficiency . buna and madm both localize to the golgi , and madm has been shown to affect transport from the endoplasmic reticulum to golgi . in addition , rnai - mediated repression of either madm or bun was found to inhibit protein secretion in cultured cells , although it is unclear whether buna and madm regulate secretion in a cooperative manner . it is also unclear whether the ability of buna and madm to control protein secretion is linked to their role as regulators of tissue growth . the regulation of buna and madm is another important outstanding issue that will need to be addressed in future studies . for example , it will be important to identify the proteins that function upstream and downstream of buna - madm , as well any potential transmembrane receptor proteins regulating their activity ( figure 1 ) . buna is phosphorylated in a conserved amino - terminal domain and this is likely to modulate its activity . identification of kinases and phosphatases that regulate buna , and examination of a role for madm in mediating buna phosphorylation , should shed light on the regulation of growth by these proteins . madm has been postulated to regulate the activity of mlf1 by controlling its nuclear access and may exert similar control over buna . transcriptional control of the bun gene offers another potential mode of regulation of the buna - madm complex . in cultured mammalian cells , tsc22d1 transcription is controlled by tgf , but it is unclear whether this mode of transcriptional control is conserved for bun genes across diverse species . in addition , as described by gluderer et al . , the bun locus gives rise to long and short bun proteins and the short bun proteins have been shown to antagonize the longer isoforms , possibly by heterodimerization and subsequent disruption of growth - promoting buna complexes . modulation of bun transcription under utilization of different promoters that yield discrete bun isoforms might therefore modulate the net growth - regulatory output of the bun locus . there is a high degree of conservation between growth control programs that function in flies and in mammals . a major unresolved question regarding the bun - madm growth control complex is whether deregulation of their human homologs contributes to the genesis of cancer . the short isoform of tsc22d1 was initially hypothesized to be a tumor suppressor , but the growth - regulatory role of long tsc-22 isoforms and of madm in mammals remains unresolved . assuming that the function of buna and madm is conserved between flies and mammals , the loss of madm or of one of the four tsc22 family genes might be expected to impair tissue growth and therefore not to be tumor - promoting . in addition , given that genetic studies in drosophila have shown that buna and madm promote growth in an obligate partnership , human homologs of both genes would need to be overexpressed or amplified in order to promote tumorigenesis , which is unlikely to be a common event . the most likely tumor - promoting effect of this complex might be reduced expression of short isoforms of the tsc22 gene family , which might alleviate tsc-22-madm repression . while these possibilities are being investigated in mammalian cells , studies in drosophila are likely to continue to lead the way in unraveling the mechanism by which the newly identified bun - madm complex controls tissue growth . | by combining drosophila genetics and proteomics gluderer et al . report in this issue of journal of biology the isolation of a novel growth - regulatory complex consisting of bunched and madm
. future study of this complex will address the precise mechanism of growth control , regulation of complex activity , the interface with other growth pathways and a potential role in human cancer.see research article at http://jbiol.com/content/9/1/9 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
significant effort is being made in multiple laboratories to elaborate new intervention procedures aimed at inducing juvenile - like neural plasticity in the adult brain . in addition to the theoretical relevance of these studies in a basis research perspective , they may have a great impact also on clinical practice : promoting plasticity in the adult nervous system , indeed , could pave the way for the development of innovative therapies for brain disorders for which a suitable treatment is still not available in adulthood ( bavelier et al . , 2010 ) . in animal models , the amblyopic condition can be induced by long - term md starting during the cp and protracted until adulthood . new experimental protocols successfully employed as strategies for enhancing adult brain plasticity can be classified in two categories on the basis of the general approach followed ( figure 1 ) . recent data have documented a previously unsuspected high potential of neuronal plasticity in the adult visual cortex . in animal models , plasticity can be elicited either by pharmacological treatment with chronic administration of antidepressants ( fluoxetine ) , valproic acid ( an inhibitor of histone deacetylases ) , or chondroitinase abc ( which degrades the extracellular matrix chondroitin sulfate proteoglycans ) , and by exposure to environmental enrichment , housing in complete darkness , or caloric restriction . in humans , emerging clinical studies point to active visual stimulation obtained with perceptual learning or playing video games as a promising strategy for treating amblyopia in adulthood . an increased ratio between excitation and inhibition owing to a reduced intracortical inhibitory tone is thought to be a central hub triggering plasticity in the adult visual cortex . on the one hand , pharmacological manipulations of functional and structural brakes limiting plasticity to the cp have been shown to restore normal visual functions in adult amblyopic animals . several studies pointed to intracortical inhibition as a key factor for defining the boundaries of plasticity , suggesting that a reduction of transmission in interneurons that release gaba ( -aminobutyric acid ) could be a crucial step for the restoration of plasticity processes in adulthood ( for review , see hensch , 2005 and baroncelli et al . , the most direct demonstration that inhibitory transmission limits plasticity in the adult brain derives from a recent study reporting that pharmacological reduction of intracortical inhibition is sufficient to reopen a window of plasticity in the visual cortex well after the closure of the cp ( harauzov et al . , first studies in animal models of amblyopia reported that the administration of anti - inhibitory compounds leads to a substantial restoration of the input from the deprived eye to the visual cortex ( duffy et al . , 1976 ) . despite its theoretical appealing , reducing inhibition levels with direct pharmacological treatments can raise concerns about the effective clinical value , since some gabaergic transmission antagonists are of very limited utility for their pro - convulsive action , while others have not been approved by the fda . brainstem neuromodulatory systems , such as those containing noradrenalin , serotonin , and acetylcholine , project to the cortex targeting gabaergic interneuron and specifically affecting the output of these cells ( bacci et al . , 2005 ) . thus , an alternative way for adjusting the balance between excitatory and inhibitory transmission to levels favorable for plasticity may be an artificial regulation of the endogenous release of these transmitters . about 30 years ago , it has been reported that an increase in the local availability of noradrenalin enhances neuronal plasticity , accelerating cortical recovery from the effects of prior md ( kasamatsu , 1982 ) . in agreement with this previous finding , we recently demonstrated that chronic administration of fluoxetine , a selective serotonin reuptake inhibitor enhancing extracellular serotonin and noradrenalin levels , reactivates cortical plasticity in adulthood promoting a full recovery of visual functions in amblyopic animals through a reduction of inhibitory transmission ( maya vetencourt et al . , 2008 ) . treating amblyopia with fluoxetine is a promising approach if one considers that this substance is a fda - approved drug widely prescribed in the treatment of depression and for which a very good knowledge of both beneficial and side effects is available . interestingly , the permissive action of neuromodulatory transmitters on brain plasticity is developmentally regulated by increased levels of molecules that limit cerebral circuit reorganization in adulthood . it has been shown , indeed , that the expression of lynx1 , an endogenous prototoxin which directly binds to nicotinic receptors reducing their sensitivity to acetylcholine , increases after the closure of the cp and that the genetic removal of the molecular brake provided by this protein restores visual cortex plasticity in adult animals ( morishita et al . , 2010 ) . another molecular factor recently linked to the control of cortical plasticity levels is histone acetylation . acetylation of histones h3 and h4 is developmentally down - regulated by an experience - dependent process related to the closure of the cp for visual cortex plasticity ( putignano et al . , 2007 ) . a pharmacological epigenetic treatment increasing histone acetylation ( i.p . injection of valproic acid , vpa ) emerged to be effective in adult rats in reversing visual acuity deficits induced by long - term md ( silingardi et al . , 2010 ) . to date , no effects on the inhibitory transmission have been documented following manipulations of the epigenetic machinery . however , since prenatal exposure to inhibitors of histone deacetylases decreases the number of parvalbumin - positive inhibitory neurons in the neocortex of adult mice , it has been proposed that one mechanism of action for drugs targeting histone acetylation may be an adjustment of the excitatory moving from the intracellular to the extracellular milieu , it has been shown that infusion in the mature cortex of amblyopic rats of an enzyme ( chondroitinase abc ) that degrades chondroitin sulfate proteoglycans ( cspgs ) , an essential component of the brain extracellular matrix ( ecm ) , produces a marked reinstatement of both visual acuity and binocularity . since most cspg - containing nets are localized around the soma of inhibitory interneurons , the permissive action of ecm degradation on cortical plasticity could occur through a direct structural and functional remodeling of inhibitory synapses ( pizzorusso et al . , 2006 ) . on the other hand , pronounced improvements in visual functions have been obtained by experimental paradigms based on the manipulation of environmental stimulation levels . a recent study reported that exposing adult animals to complete darkness can induce vision recovery in amblyopic rats , providing evidence that the enhanced cortical plasticity is related to a shift in the balance between excitation and inhibition toward juvenile - like levels ( he et al . , 2007 ) . clinical translation of this treatment , however , remains uncertain , since a long dark exposure is likely to be disruptive for most people . the goal of ee is to improve the animals quality of life by providing them with a combination of multi - sensory / cognitive stimulation , increased physical activity and enhanced social interactions . ee is a gain - of - function paradigm allowing the study of the influence elicited by increased levels of environmental stimulation on brain plasticity ( van praag et al . we showed that ee is highly effective for treating amblyopia in adulthood : a brief exposure of adult amblyopic rats to ee promotes a complete recovery of both visual acuity and ocular dominance . recovery of plasticity in enriched animals is paralleled by a marked reduction of the visual cortex inhibitory tone , for which we demonstrated a causal role in the enhancement of plasticity induced by ee ( sale et al . , 2007 ) . an alternative approach for modulating physiological brain function has been shown to be the regulation of caloric intake . nutrition is a fundamental component of the environment playing a key role in prenatal and postnatal visual development ( brmond - gignac et al . , 2011 ) . it has been recently reported that a short - term protocol of food restriction starting in adulthood is able to restore neural plasticity in the visual system , renewing the capability of recovery from amblyopia in long - term deprived animals . also in this case the effects on cortical plasticity were associated with a marked reduction of gabaergic inhibition ( spolidoro et al . , 2011 ) . the picture emerging from this brief survey of the most recent literature in animal models is that the ratio between excitation and inhibition is a critical factor controlling the possibility to induce recovery from amblyopia in the adult . given the morphological and functional complexity of inhibitory circuitries in the vertebrate brain , the precise role of gabaergic inhibition in limiting plasticity in the adult cortex is still under debate . neural circuits , indeed , rely on inhibition mediated by diverse classes of interneurons with distinct morphologies , physiological properties , and subcellular innervation patterns . moreover , gabaergic transmission fulfills multiple functions going from regulation of synaptic integration and timing of action potential generation to control of network oscillations ( huang et al . , 2007 ) . parvalbumin - positive basket cells innervating the soma of target neurons with synapses containing the 1 subunit of gabaa receptors are currently considered critical for visual cortex plasticity regulation ( hensch , 2005 ) . it has been suggested that reducing inhibition promotes adult visual cortical plasticity by increasing the capability of the cortex to relay incoming patterns of activity to the supragranular layers ( kirkwood and bear , 1994 ; rozas et al . , 2001 ) . in agreement with this hypothesis , infusion of mpa or picrotoxin in the adult visual cortex enhances the possibility to induce activity - dependent long - term potentiation ( ltp ) of synaptic efficacy , but not long - term depression , both in layers ii iii and iv ( harauzov et al . , 2010 ) . thus , a reduction of gabaergic activity would favor recovery from amblyopia by facilitating a potentiation of the excitatory inputs from the undeprived eye . even if the prevailing consensus is that the major functional effects of vision deprivation in one eye result from plasticity at excitatory connections in the visual cortex , recent research has brought attention to the alternative possibility that intracortical inhibition of deprived - eye inputs could also increase , leading to a suppression of the visual responses evoked by the deprived eye ( for review , see smith and bear , 2010 ) . however , dissecting the role of plasticity at both excitatory and inhibitory synapses in the amblyopic condition deserves further investigation . it is also worth stressing that , to our knowledge , amblyopia has been never associated with a depolarizing and excitatory action of gaba , which has been instead reported for other pathological conditions , including epilepsy ( cohen et al . , 2002 ; huberfeld et al . , 2007 ) , neuropathic pain ( coull et al . , 2005 ) , inflammatory hyperalgesia and allodynia ( funk et al . , 2008 ) , and alzheimer s disease ( lagostena et al . , 2010 ) . at the clinical level , biological manipulations effective in restoring neural plasticity in the mature brain should be translated into feasible and safe interventions in order to represent a significant advance in the field of amblyopia treatment . a growing number of recent clinical studies pointed to perceptual learning ( pl ) as a very promising strategy for treating amblyopia in adulthood ( figure 1 ) . pl refers to any change in perceptual ability as a result of practice and can be observed in all sensory modalities . in the visual system , practice with procedures of specific sensory enrichment improves performance in a variety of tasks , such as grating , texture , hyperacuity , or stereoscopic discrimination ( for review , see fine and jacobs , 2002 ; fahle , 2004 , 2005 ) . this form of neural plasticity does not seem to be an exclusive prerogative of a physiologically normal visual system , since it has been repeatedly observed also in adult people with amblyopia . as early as 1970s , campbell et al . ( 1978 ) reported that passive stimulation of the amblyopic eye with high - contrast square - wave rotating gratings of different spatial frequencies induced a substantial improvement in high - frequency contrast sensitivity and grating acuity in children . the method used in this seminal work , usually referred to as the cambridge stimulator or cam treatment , can be considered as a first example of a very simple pl procedure applied to the treatment of amblyopia . after a successive period of criticism in which the validity of this concept has been challenged by a number of negative results , in the last 15 years numerous papers have started to document various and robust beneficial effects on visual functions elicited by pl in adult amblyopes whose age was always higher than the 7-years cut - off classically considered the limit for a successful intervention . importantly , no correlation between population age and functional outcome of the treatment has been ever reported in these studies ( e.g. , polat et al . , 2004 ; chen et al . , 2008 ) . moreover , a comparative inspection of the obtained results has allowed noticing that the age of the subjects enrolled in the various tested experimental procedures is not the main factor accounting for the variance across studies ( see levi and li , 2009a ) . while it is undisputed that pl involves changes on high cognitive levels of visual information processing , it also relies at least partly on modifications on earlier levels ( fahle , 2004 ) . it has been reported , indeed , that pl has the ability to elicit plastic changes in the visual cortex , as shown by yotsumoto et al . ( 2008 ) who observed a change in blood - oxygen - level dependence ( bold ) signal in human primary visual cortex ( v1 ) following visual pl . in the same line , we recently observed that visual pl is accompanied by ltp of thalamo - cortical and cortico cortical synaptic responses in the rat v1 ( sale et al . , 2011 ) , a direct demonstration that pl results in v1 neural plasticity . accordingly , cooke and bear ( 2010 ) reported that repeated presentation of a sinusoidal grating stimulus over days induces ltp in the v1 of awake mice . since it is currently believed that alterations in neural responses in the early visual cortex are the primary cause of vision dysfunction in amblyopia ( kiorpes , 2006 ; levi , 2006 ) , the possibility to promote v1 plasticity in a totally non - invasive manner with pl is very promising in the context of amblyopia treatment . on the other side , since pl also occurs at early stages of visual processing , it may show a striking selectivity for the stimulus parameters . this raises one caveat to its therapeutic value in the treatment of amblyopia , because the achievable improvements might be limited to the selected trained stimulus , condition , or task ( levi and li , 2009b ) . however , differently from what found in healthy subjects , the available results reported until nowadays do not show such a narrow specificity for the trained task in amblyopic patients . indeed , even if the published studies adopted training tasks as various as practicing vernier acuity ( levi and polat , 1996 ; levi et al . , 1997 ) , , 2005 , 2007 , 2008 ) , contrast detection ( polat et al . , 2004 ; zhou et al . , 2006 ) , and letter identification ( levi , 2005 ; chung et al . , 2008 ) this property is essential for amblyopia treatment , because the main deficit in amblyopia is reduced visual acuity and a substantial improvement in this basic visual function is required for a real advance of the patient quality of life . it has been suggested that one reason why pl is so effective in reversing amblyopia in adult people might be that it requires subjects to make fine visual discriminations using their amblyopic eye under conditions of active visual system stimulation ( levi , 2005 ) . thus , visual attention may be a fundamental component of the therapeutic potential of pl . a recent study in non - amblyopic subjects provided indirect support to the important role of visual attention in driving visual cortex plasticity , showing that normal - sighted people trained with action - based video games have robust improvements in basic visual functions ( li et al . , 2009 ) . the same effect was not observed after playing non - action video games that were equally engaging and visually complex , but operated at a slower pace and did not require precise visually guided actions . the effectiveness of this approach has promoted further research aimed at testing the value of active visual stimulation in amblyopic subjects . a substantial improvement in a wide range of visual functions including visual acuity , positional acuity , and stereopsis were also found in adults with amblyopia after a period of playing an action video game ( li et al . vision recovery was also triggered by playing a non - action version of the games , leading to the interpretation that the threshold to elicit plasticity in a defective amblyopic visual eye might be lower than that required to achieve further improvement under conditions of normal vision ( bavelier et al . , 2010 ) . as reviewed in the previous section , experiments made on rodent models of amblyopia have underscored a pivotal role of cortical gabaergic inhibition in limiting plasticity and amblyopia recovery in adulthood . interestingly , the balance between excitation and inhibition has been suggested to be impaired during development also in amblyopic human subjects and cortical over - inhibition could underlie the degradation of spatial vision abilities ( polat , 1999 ; levi et al . , 2002 ; wong et al . , 2005 ) . in agreement with this hypothesis , repetitive transcranial magnetic stimulation ( rtms ) , which increases cortical excitability , transiently improves contrast sensitivity in adult amblyopes , likely acting on the excitation / inhibition balance ( thompson et al . , 2008 ) . a reduction of intracortical inhibition after rtms has been also demonstrated in the motor cortex for both 1 and 10 hz stimulations ( pascual - leone et al . , it remains unknown whether the beneficial effects elicited by pl on amblyopia recovery are linked to changes in levels of brain inhibition . preliminary experiments in our laboratory suggest a decrease of gabaergic inhibition in adult amblyopic rats that recover their visual functions in an active visual pl task . it is possible that the attention level required to perform pl tasks or to play video games might finally engage neuromodulatory systems of the brainstem , which may favor plasticity by increasing the excitatory / inhibitory ratio ( kasamatsu , 1991 ; maya vetencourt et al . future studies should help further elucidate whether the molecular and cellular factors triggering brain plasticity in animal models are also crucial for a successful recovery of visual functions in human amblyopic subjects . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | amblyopia is the most common form of impairment of visual function affecting one eye , with a prevalence of about 15% of the total world population .
this pathology is caused by early abnormal visual experience with a functional imbalance between the two eyes owing to anisometropia , strabismus , or congenital cataract , resulting in a dramatic loss of visual acuity in an apparently healthy eye and various other perceptual abnormalities , including deficits in contrast sensitivity and in stereopsis .
it is currently accepted that , due to a lack of sufficient plasticity within the brain , amblyopia is untreatable in adulthood .
however , recent results obtained both in clinical trials and in animal models have challenged this traditional view , unmasking a previously unsuspected potential for promoting recovery after the end of the critical period for visual cortex plasticity .
these studies point toward the intracortical inhibitory transmission as a crucial brake for therapeutic rehabilitation and recovery from amblyopia in the adult brain . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in 1996 , the classical whitney numbers of the second kind wm(n , k ) of dowling lattices was introduced by benoumhani . other fundamental properties of these numbers were already established by benoumhani in [ 1 , 2 ] . the numbers wm(n , k ) can be shown to be a kind of generalization of the famous stirling numbers of the second kind s(n , k ) when the parameter m equals to 1 . recently , a translated version of the whitney numbers of the second kind was introduced by belbachir and bousbaa which they named translated whitney numbers of the second kind , denoted by w~()(n , k ) . w~()(n , k ) actually counts the number of partitions of a set with n elements into k subsets such that the elements of each subset can mutate in ways , except the dominant one . to compute the first few values of these numbers , the classical stirling numbers of the second kind can also be obtained from these numbers when = 1 . on the otherhand , the classical dowling numbers dm(n ) that is , ( 4)dm(n)=k=0nwm(n , k ) and can be computed using the explicit formula : ( 5)dm(n)=1e1/mk0mk+1nmkk!.dm(n ) is known to be a generalization of the classical bell numbers which is the sum of the stirling numbers of the second kind s(n , k ) . in this paper , we will define the translated dowling numbers as the sum of w~()(n , k ) . , we will introduce some basic properties for the numbers w~()(n , k ) . in section 3 , we will define the translated dowling polynomials and numbers and derive some of their basic properties . in section 4 , we investigate convexity and integral representation of the translated dowling polynomials and numbers . in section 5 , more properties of translated dowling polynomials and numbers are presented , and in section 6 , we obtain the hankel transform of the translated dowling numbers . interesting properties of w~()(n , k ) can also be obtained parallel to those done in . for instance , by induction on n , the following horizontal generating function can easily be obtained through the aid of the recurrence relation in ( 3 ) . the translated whitney numbers of the second kind satisfy the following horizontal generating function : ( 6)tn=k=0nw~(n , k)t k , where ( t)k = i=0(t i ) is the generalized factorial of t of increment .
the translated whitney numbers of the second kind satisfy the following horizontal generating function : ( 6)tn=k=0nw~(n , k)t k , where ( t)k = i=0(t i ) is the generalized factorial of t of increment . also , note that ( 6 ) can be written as ( 7)tn=k=0nw~()(n , k)ktk , where ( t/)k is the falling factorial of t/ of order k. by replacing t with k , we have ( 8)kn=j=0nw~()(n , j)jkj,=j=0nkjw~()(n , j)jkjkj . finally , applying the binomial inversion formula ( see ) ( 9)fk=j=0kkjgjgk=j=0k1kjkjfj gives us the following explicit formula . the translated whitney numbers of the second kind can be expressed as ( 10)w~()(n , k)=1kk!j=0k1kjkjjn . the translated whitney numbers of the second kind can be expressed as ( 10)w~()(n , k)=1kk!j=0k1kjkjjn . note that when = 1 in ( 10 ) , we have ( 11)w~1n , k=1k!j=0k1kjkjjn = s(n , k ) , which is the known explicit formula of the stirling numbers of the second kind . the numbers w~()(n , k ) satisfy ( 12)nkw~()(n , k)znn!=1k!ek1k .
proofmultiplying both sides of ( 8) by z / n ! and summing over n , gives us ( 13)n0tnznn!=n0 k=0nw~n , kktkznn!=k0knkw~()(n , k)znn!tk . now , note that ( 14)n0tnznn!=1+ez1t=k=0ttkez1k=k=0tez1kk!tk . the proof is completed by comparing the coefficients of ( t)k in ( 13 ) and ( 14 ) . multiplying both sides of ( 8) by z / n ! and summing over n , gives us ( 13)n0tnznn!=n0 k=0nw~n , kktkznn!=k0knkw~()(n , k)znn!tk . the proof is completed by comparing the coefficients of ( t)k in ( 13 ) and ( 14 ) . in 2010 , mez , introduced the r - whitney numbers of the second kind wm , r(n , k ) as coefficients in the expansion of ( 15)mx+rn=k=0nmkwm , r(n , k)xk . these numbers actually are equivalent to the ( r , )-stirling numbers nkr, defined by corcino et al . . that is , ( 16)w,r(n , k)=nkr,. moreover , we have ( 17)w1,0(n , k)=s(n , k),w1,r(n , k)=n+rk+rr , wm,0(n , k)=wm(n , k),w,0(n , k)=w~()(n , k ) , where n+rk+rr is the r - stirling numbers of the second kind by broder . this means that the identities ( 6 ) , ( 10 ) , and ( 12 ) for the numbers w~()(n , k ) appear to be special cases of wm , r(n , k ) ( see [ 5 , 8 ] ) . the well - known bell polynomials bn(x ) is defined by the sum ( 18)bn(x)=k=0ns(n , k)xk which consequently yields the bell numbers bn when x = 1 . in line with this definition 4 . for nonnegative integers n , k , and , the translated dowling polynomials are defined as ( 19)d~()(n;x)=k=0nw~()(n , k)xk . when x = 1 , ( 20)d~()(n;1)=d~()(n)=k=0nw~()(n , k ) and is called the translated dowling numbers .
for nonnegative integers n , k , and , the translated dowling polynomials are defined as ( 19)d~()(n;x)=k=0nw~()(n , k)xk . when x = 1 , ( 20)d~()(n;1)=d~()(n)=k=0nw~()(n , k ) and is called the translated dowling numbers . now , from ( 19 ) and ( 12 ) , ( 21)n0d~n;xznn!=n0 k=0nw~()(n , k)znn!xk=k0ez1kk!kxk = ex(ez1)/. hence , we have the following theorem . the following exponential generating functions hold : ( 22)n0d~()(n;x)znn!=expxez1;(23)n0d~()(n)znn!=expez1.
the following exponential generating functions hold : ( 22)n0d~()(n;x)znn!=expxez1;(23)n0d~()(n)znn!=expez1.
remark 6 . when = 1 in ( 22 ) and ( 23 ) , we have ( 24)n0d~(1)(n;x)znn!=exez1;n0d~(1)(n)znn!=eez1 , which are the exponential generating functions of the classical bell polynomials and numbers , respectively .
when = 1 in ( 22 ) and ( 23 ) , we have ( 24)n0d~(1)(n;x)znn!=exez1;n0d~(1)(n)znn!=eez1 , which are the exponential generating functions of the classical bell polynomials and numbers , respectively . since w~()(n , k ) represents the number of partitions of a set with n elements into k subsets such that the elements of each subset can mutate in ways , except the dominant one , then d~()(n ) is the number of partitions of a set with n elements such that the elements of each subset can mutate in ways , except the dominant one . the following theorem contains an explicit form for the polynomials d~()(n;x ) and numbers d~()(n ) . proofcombining the explicit formula in ( 10 ) with ( 19 ) yields ( 27)d~()(n;x)=j0 kj1jkjkjnk!nkxk . reindexing the sums and by further simplification , ( 28)d~n;x=j0xjjj!i0inxiii!n = ex/i0ini!xi . equation ( 26 ) is obtained by letting x = 1 .
combining the explicit formula in ( 10 ) with ( 19 ) yields ( 27)d~()(n;x)=j0 kj1jkjkjnk!nkxk . reindexing the sums and by further simplification , ( 28)d~n;x=j0xjjj!i0inxiii!n = ex/i0ini!xi . equation ( 26 ) when = 1 in ( 25 ) and ( 26 ) , we have ( 29)d~(1)(n;x)=1exi0ini!xi = bn(x);d~(1)(n)=1exi0ini!=bn , which are the known dobinski identities .
when = 1 in ( 25 ) and ( 26 ) , we have ( 29)d~(1)(n;x)=1exi0ini!xi = bn(x);d~(1)(n)=1exi0ini!=bn , which are the known dobinski identities . to close this section , we will cite the r - dowling polynomials dm , r(n , x ) of cheon and jung defined by ( 30)dm , r(n , x)=k=0nwm , r(n , k)xk . properties of dm , r(n , x ) were already established in and were further studied by rahmani . we note that the polynomials dm , r(n , x ) coincide with the ( r , )-bell polynomials gn,,r(x ) of r. b. corcino and c. b. corcino . moreover , ( 31)d1,0(n , x)=bn(x ) , d1,r(n , x)=bn , r(x),d,0(x)=d~()(n;x ) , where bn , r(x ) is the r - bell polynomials in . a real sequence vk , k = 0,1 , 2 , is called convex on an interval [ a , b ] , where [ a , b ] contains at least 3 consecutive integers , if ( 32)vk12vk1+vk+1 , k[a+1,b1 ] convexity , among others , is an example of interesting global behaviours of combinatorial sequences of integers . the following theorem shows that the polynomials d~()(n , x ) obey the convexity property . multiplying both sides by ( x/)(1/k ! ) and summing over i yields ( 35)i0kn+1i!xi 12i0kni!xi+i0kn+2i!xi . finally , multiplying both sides by e and using ( 25 ) completes the proof .
since k 0 , then ( 34)01k2012(k)+k22k1+k22kn+1kn+kn+2kn+112kn+kn+2 . multiplying both sides by ( x/)(1/k ! ) and summing over i yields ( 35)i0kn+1i!xi 12i0kni!xi+i0kn+2i!xi . finally , multiplying both sides by e and using ( 25 ) completes the proof . the following beautiful integral representation of the bell numbers bn was first obtained by cesro : ( 36)bn=2n!eim0eeeisin(n)d. this expression was generalized by mez using a kind of generalization of the classical bell numbers called r - bell numbers bn , r . equation ( 36 ) and mez 's identity appears to be special cases of the integral representation of the ( r , )-bell polynomials gn,,r(x ) by r. b. corcino and c. b. corcino . that is gn,1,r(1 ) = bn , r and gn,1,0(1 ) = bn , respectively . the translated dowling polynomials have the following integral representation : ( 37)d~()(n;x)=2n!ex/im0expxeeisin(n)d , where i=-1 . the translated dowling polynomials have the following integral representation : ( 37)d~()(n;x)=2n!ex/im0expxeeisin(n)d , where i=-1 . prooffrom , we have the following integral identity : ( 38)im0ejeisin(n)d=2jnn!. hence , combining this with the explicit formula in ( 10 ) yields ( 39)21n!w~n , k = 1kk!j=0k1kjkj2jnn ! = 1kk!j=0k1kjkj iiiiim0ejeisin(n)d = 1kk ! im0j=0k1kjkjeeijsinnd = im0eei1kkk!sin(n)d. furthermore , we have ( 40)k0w~n , kxk = 2n!im0k0eei1kk!xksinnd = 2n!ex/im0expxeeisin(n)d , which is the desired result .
from , we have the following integral identity : ( 38)im0ejeisin(n)d=2jnn!. hence , combining this with the explicit formula in ( 10 ) yields ( 39)21n!w~n , k = 1kk!j=0k1kjkj2jnn ! = 1kk!j=0k1kjkj iiiiim0ejeisin(n)d = 1kk ! im0j=0k1kjkjeeijsinnd = im0eei1kkk!sin(n)d. furthermore , we have ( 40)k0w~n , kxk = 2n!im0k0eei1kk!xksinnd = 2n!ex/im0expxeeisin(n)d , which is the desired result . clearly , the integral representation in ( 37 ) boils down to cesro 's in ( 36 ) when = 1 and x = 1 . now , applying the explicit formula in ( 25 ) gives us the following . the following identity holds : ( 41)j0jnj!xj = 2n!im0expxeeisin(n)d.
the following identity holds : ( 41)j0jnj!xj = 2n!im0expxeeisin(n)d. it is known that the nth exponential moment of a poisson random variable x , denoted by e[x ] , is related to the bell polynomials bn( ) through the dobinski 's formula . also , the nth factorial moment of x with mean , denoted by e[(x)n ] , is given by ( 43)e[xn]=n . r. b. corcino and c. b. corcino obtained a generalization of ( 42 ) using the ( r , )-bell polynomials as ( 44)e/x+rn = gn,,r(x ) when = 1 and r = 0 . we note that identities ( 42 ) , ( 43 ) , and ( 44 ) can be shown to be particular cases of the generalized factorial moments by mangontarum and corcino given by ( 45)ex+ n = ei0i+ ni!i , e(x )n = ei0i ni!i , by suitable assignments of the parameters , , , and . the following lemma is analogous to ( 42 ) . the following identity holds : ( 46)exn=1ej0jnj!j , where x is a poisson random variable with mean .
the following identity holds : ( 46)exn=1ej0jnj!j , where x is a poisson random variable with mean .
prooffrom ( 8) , ( 47)xn=k=0nw~()(n , k)kxk . hence by ( 43 ) , ( 48)exn = ek=0nw~()(n , k)kxk=k=0nw~()(n , k)kexk=k=0nw~()(n , k)kk . using the explicit formula in ( 10 ) and simplifiying further completes the proof .
from ( 8) , ( 47)xn=k=0nw~()(n , k)kxk . hence by ( 43 ) , ( 48)exn = ek=0nw~()(n , k)kxk=k=0nw~()(n , k)kexk=k=0nw~()(n , k)kk . using the explicit formula in ( 10 ) and simplifiying further completes the proof . if the mean of the poisson random variable x is / , then we have ( 49)e/xn = d~()(n; ) . now , ( 50)d~n;=e/1+x+1n=k=0nnk1nke/x+1k=k=0nnk1nkgk,,1( ) . using the explicit formula of the ( r , )-bell polynomials ( 51)gn,,r(x)=1ex/k0x/kk!k+rn yields ( 52)d~()(n;)=k=0nnk1nk1e/j0/jj!j+1k the following identities hold : ( 53)d~()(n;)=k=0nnk1nk1e/j0j+1kjj!j;d~()(n;1)=k=0nnk1nkd(k ) , where d(k ) is the classical dowling numbers . the following identities hold : ( 53)d~()(n;)=k=0nnk1nk1e/j0j+1kjj!j;d~()(n;1)=k=0nnk1nkd(k ) , where d(k ) is the classical dowling numbers . the next theorem is easily deduced from ( 22 ) and ( 46 ) . the following exponential generating functions hold : ( 54)n0exnznn!=e(ez1);n0e/xnznn!=n0d~()(n;x)znn!;n0e1/xnznn!=n0d~()znn!.
the following exponential generating functions hold : ( 54)n0exnznn!=e(ez1);n0e/xnznn!=n0d~()(n;x)znn!;n0e1/xnznn!=n0d~()znn!. the hankel matrix is a matrix whose entries are symmetric with respect to the main diagonal of the matrix . it had been previously studied by some mathematicians as well as its connections in some areas of mathematics , physics , and computer science . among these mathematicians were de sainte - catherine and viennot , garcia - armas and sethuraman , tamm , and vein and dale . further theories and applications of this matrix had been established including the hankel determinant and hankel transform . the determinant of the hankel matrix is called hankel determinant , while the sequence of hankel determinants is called hankel transform as defined by aigner . the hankel determinants had been previously studied by some mathematicians , for instance , radoux and ehrenborg . on the other hand , the hankel transform was first introduced in sloane 's sequence a055878 and was first studied by layman . a similar identity was obtained by mez for the hankel transform of the r - bell numbers . in a recent paper , established the hankel transform of the noncentral bell numbers which is identical to that of the bell and r - bell case . a more general case of hankel transform can also be seen in , namely , the hankel transform of the ( r , )-bell numbers . in this section , we are going to establish the hankel transform of the translated dowling numbers by using aigner 's method . let = ( am , k ) be the infinite lower triangular matrix defined recursively by ( 55)am , k = am1,k1+k+1am1,k+k+1am1,k+1 , where m 1 , a0,0 = 1 , a0,k = 0 if k > 0 , and am , k = 0 if m < k. using the reccurence relation in ( 55 ) , we obtain ( 56)m=0am , kzm1(m1 ) ! = m=0am1,k1zm1m1!+k+1 m=0am1,kzm1(m1 ) ! + (k+1)m=0am1,k+1zm1(m1)!. this implies that ( 57)kz=k1(z)+(k+1)k(z ) + (k+1)k+1(z ) . with ( 58)k(z)=e(ez1)/ez1kkk ! , the right - hand side of ( 57 ) yields ( 59)k1(z)+(k+1)k(z)+(k+1)k+1(z ) = e(ez1)/ez1k1k1k1 ! + ( k+1)e(ez1)/ez1kkk ! + (k+1)e(ez1)/ez1k+1k+1(k+1 ) ! = e(ez1)/ez1k1k1k1 ! + e(ez1)/ez1k1(ez1)k1k1 ! + e(ez1)/ez1kkk ! + e(ez1)/ez1k(ez1)kk ! = e(ez1)/ez1k1k1k1 ! + e(ez1)/ez1k1ezk1(k1 ) ! e(ez1)/ez1k1k1k1 ! + e(ez1)/+zez1kkk!. while the left hand side of ( 57 ) yields ( 60)kz = e(ez1)/ez1k1kk!kez + e(ez1)/ez1kkk!1ez = e(ez1)/+zez1k1k1k1 ! + e(ez1)/+zez1kkk!. this implies that the function ( 61)e(ez1)/ez1kkk ! , where k 0 , is a unique solution to the differential equation in ( 57 ) . hence , the exponential generating function of the kth column of is given by ( 62)k(z)=e(ez1)/ez1kkk!. hence , we have the following . let k(z ) be the exponential generating function of the kth column of matrix . that is , ( 63)k(z)=m=0am , kzmm!. then ( 64)k(z)=e(ez1)/ez1kkk ! , where k 0 and 0(z)=m=0d~mzm / m!. that is , the 0-column entries of are the numbers d~()(m ) , m = 0,1 , 2,3 . let k(z ) be the exponential generating function of the kth column of matrix . that is , ( 63)k(z)=m=0am , kzmm!. then ( 64)k(z)=e(ez1)/ez1kkk ! , where k 0 and 0(z)=m=0d~mzm / m!. that is , the 0-column entries of are the numbers d~()(m ) , m = 0,1 , 2,3 . remark 16 . when k = 0 in ( 64 ) , we have ( 65)0(z)=expez1 which is the exponential generating function in ( 23 ) .
when k = 0 in ( 64 ) , we have ( 65)0(z)=expez1 which is the exponential generating function in ( 23 ) . the next lemma is useful in establishing an identity for some matrices whose entries are d~()(m ) . let sm be the mth row of = ( am , k ) . define ( 66)smsn=k0am , kan , kkk!. then ( 67)smsn = am+n,0=d~()(m+n ) , for all nonnegative integers m and n.
let sm be the mth row of = ( am , k ) . define ( 66)smsn=k0am , kan , kkk!. then ( 67)smsn = am+n,0=d~()(m+n ) , for all nonnegative integers m and n.
proofby induction of m , if m = 0 we have ( 68)s0sn=k0a0,kan , kkk!. since a0,k = 0 k > 0 , ( 69)s0sn = a0,0an,000!=a0+n,0 n0 . suppose that slsn = al+n,0 holds for l m 1 and all n. then by ( 55)(70)smsn=k0am , kan , kkk!=k0am1,k1+k+1am1,kiiiiiiiii+(k+1)am1,k+1an , kkk!=k0am1,k1an , kkk!+k0k+1am1,kan , kkk ! + k0(k+1)am1,k+1an , kkk!. reindexing the summation yields ( 71)smsn=k1am1,kan , k+1k+1(k+1 ) ! + k0(k+1)am1,kan , kkk ! + k0am1,kan , k1kk!=k0an , k1+k+1an , kiiiiiiiii+k+1an , k+1am1,kkk!. by ( 55 ) , ( 72)smsn=k0an+1,kam1,kkk!. from the inductive hypothesis , ( 73)smsn = a(n+1)+(m1),0=an+m,0=d~()(m+n ) , which is pricisely ( 67 ) .
by induction of m , if m = 0 we have ( 68)s0sn=k0a0,kan , kkk!. since a0,k = 0 k > 0 , ( 69)s0sn = a0,0an,000!=a0+n,0 n0 . suppose that slsn = al+n,0 holds for l m 1 and all n. then by ( 55)(70)smsn=k0am , kan , kkk!=k0am1,k1+k+1am1,kiiiiiiiii+(k+1)am1,k+1an , kkk!=k0am1,k1an , kkk!+k0k+1am1,kan , kkk ! + k0(k+1)am1,k+1an , kkk!. reindexing the summation yields ( 71)smsn=k1am1,kan , k+1k+1(k+1 ) ! + k0(k+1)am1,kan , kkk ! + k1kam1,kan , k1k1k1!=k0am1,kan , k+1k+1k+1 ! + k0k+1am1,kan , kkk ! + k0am1,kan , k1kk!=k0an , k1+k+1an , kiiiiiiiii+k+1an , k+1am1,kkk!. by ( 55 ) , ( 72)smsn=k0an+1,kam1,kkk!. from the inductive hypothesis , ( 73)smsn = a(n+1)+(m1),0=an+m,0=d~()(m+n ) , which is pricisely ( 67 ) . we are now ready to state the following hankel transform of the translated dowling numbers . the numbers d~()(m ) have the hankel transform ( 74)d~()(0)d~()(1)d~()(2)d~()(m)d~()(1)d~()(2)d~()(3)d~()(m+1)d~()(m)d~()(m+1)d~()(m+2)d~()(2 m ) = r=0mrr!=m+12r!!.
the numbers ( 74)d~()(0)d~()(1)d~()(2)d~()(m)d~()(1)d~()(2)d~()(3)d~()(m+1)d~()(m)d~()(m+1)d~()(m+2)d~()(2 m ) = r=0mrr!=m+12r!!.
prooflet m be the lower triangular submatrix of consisting of the rows and columns numbered 0 to m. then m is a matrix with diagonal 1 . this implies the determinant of the transpose of m is one ; that is , detm = 1 . let ^m=rr!ai , r0i , rm . then ( 75)det^m=r=0mrr!. by ( 67 ) , ( 76)^mmt = bi , r0i , rm , where bi , r=k=0mai , kar , krr!=ai+r,0=d~()(i+r ) . that is , ( 77)^mmt = d~i+r0i , rm . let m be the lower triangular submatrix of consisting of the rows and columns numbered 0 to m. then m is a matrix with diagonal 1 . this implies the determinant of the transpose of m is one ; that is , detm = 1 . let ^m=rr!ai , r0i , rm . then ( 75)det^m=r=0mrr!. by ( 67 ) , ( 76)^mmt = bi , r0i , rm , where bi , r=k=0mai , kar , krr!=ai+r,0=d~()(i+r ) . that is , ( 77)^mmt = d~i+r0i , rm . note that when = 1 , we recover from ( 74 ) the hankel transform of the classical bell numbers of aigner , the hankel transform of the r - bell numbers of mez , and the hankel transform of the noncentral bell numbers in . , the hankel transform of the ( r , )-bell numbers appears to be analogous to the hankel transform of the translated dowling numbers in ( 74 ) . note that when = 1 , we recover from ( 74 ) the hankel transform of the classical bell numbers of aigner , the hankel transform of the r - bell numbers of mez , and the hankel transform of the noncentral bell numbers in . this makes ( 74 ) a generalization of the previously mentioned hankel transforms . also , the hankel transform of the ( r , )-bell numbers appears to be analogous to the hankel transform of the translated dowling numbers in ( 74 ) . it is interesting to establish more properties for these polynomials and numbers parallel to the properties of the bell polynomials and numbers , and their generalizations . the results in this paper might be extended to translate r - dowling polynomials and numbers using the translated r - whitney numbers of the second kind . obtained the asymptotic formulas for the r - whitney numbers of the second kind as well as the range of validity of each formula . it would be compelling to do the same to the translated whitney numbers of the second kind . | more properties for the translated whitney numbers of the second kind such as horizontal generating function , explicit formula , and exponential generating function are proposed . using the translated whitney numbers of the second kind
, we will define the translated dowling polynomials and numbers .
basic properties such as exponential generating functions and explicit formula for the translated dowling polynomials and numbers are obtained .
convexity , integral representation , and other interesting identities are also investigated and presented .
we show that the properties obtained are generalizations of some of the known results involving the classical bell polynomials and numbers .
lastly , we established the hankel transform of the translated dowling numbers . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ovarian hyperstimulation syndrome ( ohss ) , a potentially life - threatening condition , is an iatrogenic complication of ovarian stimulation with exogenous gonadotropins . although the prevalence of severe ohss is low , with reported values ranging from 0.2% to 1.2% , the syndrome remains a serious problem for infertility specialists due to its potentially fatal outcome . the clinical manifestations of ohss are ovarian enlargement , ascites , oliguria , abdominal pain , electrolyte imbalance , hemoconcentration , and thrombosis in severe cases . the pathogenesis of ohss is currently unknown . the primary pathophysiological mechanism underlying the development of ohss is hypothesized to be an acute imbalance in the renin - angiotensin system . moreover , increased levels of cytokines ( interleukins and tumor necrosis factor- ) , endothelin-1 , and vascular endothelial growth factor have also been implicated in ohss . human chorionic gonadotropin ( hcg ) , either exogenously administered or as a result of endogenous pregnancy - derived hcg stimulation , is believed to play a critical role in the development of severe ohss . several strategies have been proposed to reduce the incidence of ohss during controlled ovarian hyperstimulation , including cycle cancellation , coasting , and modification of the ovulation triggering agents by decreasing the dose of hcg or employing gnrh agonist triggering . garcia - velasco reported that agonist triggering combined with oocyte vitrification and embryo transfer in a subsequent natural cycle prevented ohss in at - risk patients and resulted in excellent cycle outcomes . in high - risk patients , the embryo transfer should be cancelled prior to the transfer on the fifth day . in the case of severe ohss , the present case report is of a female with spontaneous ohss ( sohss ) during a twin pregnancy after a thawed embryo transfer cycle . the severe sohss in the present case was not resolved until 6 weeks after delivery . a 32-year - old nulligravida female presented with a two - year history of primary infertility . polycystic ovaries were identified by transvaginal ultrasound and she was diagnosed with polycystic ovarian syndrome according to the 2003 rotterdam consensus criteria . her height was 155 cm , weight 44 kg , and body mass index ( bmi ) 18.31 kg / m . no other history of illnesses or operations was noted . following two cycles of ovulation induction and timed intercourse with clomiphene citrate and recombinant fsh , controlled ovarian hyperstimulation for assisted reproduction recombinant fsh ( 150 iu ) was started on day three of the menstrual cycle and cetrorelix acetate ( 0.25 mg ) was started on day seven . the fsh and e2 levels on day three were 5.4 miu / ml and 29 pg / ml , respectively , and the total duration of stimulation was 9 days . 250 g of recombinant human choriogonadotropin ( r - hcg ) was used to trigger ovulation ; 27 follicles were aspirated and 25 oocytes were retrieved . freezing of all embryos was performed because of high e2 levels ( 8,492 pg / ml ) that were noted on day nine . in total , six out of 18 embryos developed to blastocysts and were vitrified using the previously described electron microscope grid method . three months later , following the identification of normalized ovaries , a hormonally manipulated artificial thawing embryo transfer cycle was conducted . oral estradiol valerate ( 4 mg / day ) was used ( progynova , schering korea , seoul , korea ) beginning on day three of the cycle . on the fifteenth day of the cycle , vaginal progesterone ( 600 mg / d ; utrogestan , hanhwa pharmaceuticals , seoul , korea ) was prescribed . two embryos were transferred into the uterine cavity 5 days following the start of progesterone administration . eleven days after the embryo transfer , serum -hcg levels were > 1,000 miu / ml . a viable twin pregnancy was confirmed by transvaginal ultrasonography at 7 weeks gestation . during antenatal care , both ovaries abruptly became enlarged and cul - de - sac fluid was observed by transvaginal ultrasonography at 11 weeks gestation ( figure 1a ) . the patient was hospitalized with marked enlargement of the ovaries , ascites , and dyspnea , and a provisional diagnosis of ohss was made . the fsh receptor ( fshr ) gene was sequenced and one intron variation ( c.374 + 69 c > t in intron 4 ) and two exon 10 variations ( c.919 g > a ala307thr and c.2039 g > a ser680asn ) were identified ( figure 2 ) . the ovaries gradually enlarged to greater than 27 cm12 cm and 26 cm11 cm , respectively ( figure 1b ) . cyst aspiration and paracentesis were performed at 13 , 14 , 16 , and 20 weeks of gestation due to severe dyspnea from the massive ascites and large ovaries . at 21 weeks and 3 days gestation , preterm labor developed , but was controlled with ritodrine ( lavopa jw pharmaceuticals , seoul , korea ) . there were no other causes of preterm labor except increased abdominal pressure due to excessively enlarged ovaries and massive ascites . the fetuses appeared grossly normal on transabdominal and transvaginal ultrasonography , but the cervical length was shortened to < 2.2 cm . at 22 weeks and 2 days the preterm uterine contractions were not controlled with ritodrine ( lavopa , jw pharmaceuticals , seoul , korea ) . the tocolytic agent nifedipin ( niferon cr , elysonpharm , seoul , korea ) was given . the labor continued to progress , and atosiban was prescribed ( tractocile , ferring korea , limhamn , sweden ) . in spite of these efforts to prevent a preterm delivery , bilateral ovarian enlargement was noted ( figure 3 ) . the pregnancy resulted in the live birth of a male weighing 1,050 g , and a female weighing 970 g. the apgar scores of the male were 1 at 1 minute , 3 at 5 minutes , and 7 at 10 minutes and the apgar scores of the female were 1 at 1 minute , 3 at 5 minutes , and 6 at 10 minutes . a postpartum follow - up ultrasound revealed that the hyperstimulated ovaries had improved , but they did not resolve until 6 weeks postpartum ( figure 1c ) . normal ovaries were noted following transvaginal ultrasonography at 6 months postpartum ( figure 1d ) . ohss is an iatrogenic complication during the luteal phase or / and early stages of pregnancy following treatment with ovulation - inducing agents . severe ohss is considered a life - threatening condition and occurs in 0.2%-1.2% of stimulated cycles . the incidence of ohss continues to increase and fatal cases involving associated cerebral infarction , pulmonary thromboembolism , and massive pulmonary edema have been reported . a recent report suggested that in the netherlands maternal mortality rates from ohss were three deaths per 100,000 ivf cycles . therefore , it is very important to prevent and treat ohss during treatment with ovulation - inducing agents . according to the european society of human reproduction and embryology ( eshre ) guidelines , treatment with gonadotropins moreover , cycle cancellation , coasting , modification of the ovulation - triggering agent , administration of macromolecules , and cryopreservation of all embryos should be considered as secondary prevention . this strategy consists of optimizing ovarian stimulation , including gnrh agonist triggering in a gnrh antagonist cycle ( segment a ) , optimal cryopreservation methods for oocyte or embryo vitrification ( segment b ) , and embryo replacement in a receptive , non - stimulated endometrium in a natural cycle or artificial endometrial preparation ( segment c ) . although ohss after spontaneous pregnancy is rare , it has been reported in pregnant women with hypothyroidism , in women with polycystic ovarian disease , molar pregnancies , pituitary adenomas , and in women with mutations in folliclestimulating hormone receptors . the present report details a severe case of sohss that was not resolved until after delivery despite extensive efforts to prevent ohss by using embryo vitrification and embryo transfer in a non - stimulated endometrium with artificial endometrial preparation . extremely enlarged ovaries may have been the cause of increased abdominal pressure and preterm labor . we attempted to decrease the ovarian size through reduction of the cyst by transvaginal ultrasound - guided aspiration , but the ovarian size increased again following aspiration . we investigated further to identify the cause of sohss , but only the thr307/asn680 ( tn ) allelic variant of the fsh receptor gene was present . the genotypic variance of the fsh receptor has been described , including the impact of the fsh receptor genotypes at position 680 on ovarian responses to fsh stimulation . patients with asn in position 680 frequently respond well to exogenous fsh and are predisposed to respond quite intensely to exogenous gonadotropins . perez mayorga et al . showed that the fsh genotype in position 680 predicts severity in ohss patients . daelemans et al . reported that an increased ohss risk was noted in patients with the ser680 allele in a study using a caucasian control population . interestingly , they found that among patients who developed iatrogenic ohss , the more severe cases were women with the asn680 variant . therefore , the fshr genotype in position 680 can not predict the onset of ohss , but rather may be a predictor of severity . of most interest in the present case , in addition to the occurrence of ohss in a pregnancy following a thawed embryo transfer cycle , is that the onset of ohss was not until 11 weeks of gestation and that the syndrome was still present several weeks after delivery . this case highlights the fact that although ohss with a spontaneous pregnancy is rare , a twin pregnancy characterized by elevated -hcg levels , bilaterally enlarged ovaries , ascites , and other physical findings suggestive of intravascular depletion may be the result of ohss , and a corresponding diagnosis should be considered . females with a history of ohss may have an elevated risk for sohss , but sohss remains a rare event . the present case demonstrates the importance of an early diagnosis and the role of observation and supportive care in the resolution of a potentially lethal syndrome . we suggest that single embryo transfer may decrease the probability of the development of severe ohss in cases in which freezing of all embryos is used to prevent ohss . | this article reports a case of spontaneous ovarian hyperstimulation syndrome ( ohss ) following a thawed embryo transfer cycle .
ohss , a potentially life - threatening condition , is an iatrogenic complication of controlled ovarian stimulation ; therefore , it is very important to prevent and treat ohss during treatment with ovulation - inducing agents . despite our efforts to prevent ohss , in this case
, severe spontaneous ohss occurred , which resulted in uncontrolled preterm labor and a preterm delivery and also persisted for 6 weeks after delivery . freezing all embryos can not entirely prevent the development of ohss because ohss can occur spontaneously . although spontaneous ohss remains a rare event , females with a history of ohss may have an elevated risk for spontaneous ohss .
we suggest closely monitoring cases of pregnancy following thawed embryo transfer for early diagnosis of spontaneous ohss and the use of conservative management . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
total knee replacement ( tkr ) is one of the most successful and commonly performed orthopedic surgeries.1 the reporting of outcomes was traditionally focused on implant survivorship and objective outcomes such as range of motion , knee stability , and radiographic alignment . survivorship analysis is limited because it fails to include dissatisfied patients with a poor outcome who either have contraindications to revision surgery or chose not to undergo revision surgery . when these patients are included in survivorship analysis , results were not excellent.2 objective outcomes , such as range of motion , are also limited because it is not the only factor that contributes to physical function . the basis of surgeon - based outcome measures was that patients and clinicians have a common view point about the outcome of this surgery , but it is not true . patients and doctors had differing perceptions of all domains of outcome , especially subjective quality of life domains such as emotions and social functioning.3 similarly , a lack of correlation has been demonstrated between surgeon and patient assessment about outcomes and satisfaction.4 this was due to the differing priorities of the two groups . surgeons judge the success of surgery based on joint alignment and stability , but patients may evaluate outcome in terms of ability to return to valued daily activities . this discrepancy between patient and clinician ratings of health these tools allow patients to rate their own health , and here the patient is the center of the outcome assessment . the more subjective surgeon - based outcome measures , such as the knee society clinical rating system , represent the early moves toward outcome assessment based on the patient.5 we have conducted this study at the government medical college , kozhikode , which is a tertiary care center catering four districts in the northern part of kerala state . as most of our patients are from low and medium socioeconomic status and manual laborers , their expectations about tkr will be very much different from that of patients from high socioeconomic status / developed countries . they may want to continue their job and to use the squat toilet ( a toilet used by squatting ) without difficulty . however , it may not be possible and most of the patients are not aware of this aspect before surgery . in such a situation , tkr becomes a failure from patient s point of view , although the surgeon was happy about the surgical outcome.6 hence , we think that preoperative education of the patient regarding postoperative functional outcome of tkr is very important . patients expectations regarding surgery are defined as their anticipation of certain events happening during or after the surgery.7 patient dissatisfaction may result from inappropriate expectations due to misinterpretation or lack of information regarding the likely outcome of surgery . often the surgeon is unaware of this dissatisfaction as technically the surgery was successful . in this study , we tried to find out the expectations of indian patients regarding tkr and assess the level of satisfaction among our patients from their view point using focus group discussion ( fgd ) and whether these expectations have an impact on outcomes and patient satisfaction . this study was conducted in the department of orthopedics , government medical college , kozhikode , kerala , india , in november 2014 , after getting institutional research committee and ethics committee approval from the institutional research committee ( government medical college , kozhikkode ) . all patients between the ages 60 and 65 years who have completed at least 3 years after tkr were included after getting written informed consent . those patients with inflammatory arthritis , secondary osteoarthritis ( oa ) of knee following trauma , and tkr after high tibial osteotomy and patients with any medical disorder that restricted them from walking were excluded from our study . those patients who have undergone total all patients underwent surgery through similar approach and same implants , and it was done by the same surgical team . an fgd is an effective way to bring people from similar backgrounds or experiences together to discuss a specific topic of interest . responses in a focus group are typically spoken , open ended , relatively broad , and qualitative.8,9 focus groups are a good way to gather in - depth information about a community s thoughts and opinions on a topic.10 a total of 50 patients were selected . in total , 42 patients gave consent to participate in this study . after each fgd , a transcript of the discussion was made in patients own words . on the basis of these domains , additional questions were added in the next fgd . all the data from four fgds were analyzed together by two persons to avoid bias . a total of 50 patients were selected for fgd . among them , 42 patients participated in the fgd . with regard to their occupation , five were manual laborers , four farmers , eight house wives , and seven were doing sedentary jobs . four patients were found to have a fair score , and only one had a poor score ( figures 24 ) . preoperatively , patients were mainly concerned about the severe pain , deformity , cosmetic appearance , and inability to flex the knee . as one patient told , walking causes severe pain which restricted me to my home and i was unable to squat in toilet . social disabilities caused by oa knee are far more than the symptoms . majority of the patients were restricted to home . most of the patients needed help of their children to climb upstairs or walk a long distance . in severe cases , using toilet was very difficult . both of the above two problems caused depression and mental stress to the patients . the next big problem was loss of earnings due to inability to go for work . most of the patients assessed their level of satisfaction after surgery by the following criteria :
pain relief;increased range of movements ; andsocial independence walk alone and climb stairs; go for work; use indian toilet ; and do prayers . increased range of movements ; and walk alone and climb stairs ; use indian toilet ; and most of them told that they have pain even after surgery , but that pain was very much less than the preoperative pain . pain is persisting , but it is far better than the pain of the arthritic knee . most of them told there was not much difference in the preoperative and postoperative range of movements . but as they got some pain relief , it is not hindering their activities of daily living . most of them were happy after surgery because they could walk and climb stairs alone . some of the patients expected that they could use squat toilet and they could go back to their work ( manual laborers ) . their satisfaction level was low as they could not go back to work , and they were forced to use special chair or western type of toilet . their satisfaction level was very high , although their pain is still persisting and the range of movements is the same as that of the preoperative level . they were not keen on continuing postoperative exercise protocol at home because it was taught to them by junior doctors and not the operating surgeon . some of them refused to flex the knee in the fear that something wrong might happen to their implant . as their range of movements did not improve , their satisfaction level was very low . one patient reported :
i was told to flex my knee on day 3 . i was planning to flex the knee after the pain relief but now i am unable to flex the knee more than 50. i was told to flex my knee on day 3 . i was planning to flex the knee after the pain relief but now i am unable to flex the knee more than 50. another patient said , if they explained properly my expectation would have been far lower . this is the first qualitative study that tried to assess the satisfaction level achieved by patients who had undergone tkr from the indian subcontinent using fgd . most of the time , surgeons assess the problem of oa knee with clinical findings and radiographs . but socioeconomic impact of oa knee is worse than clinical and radiological severity of the disease . similarly , attitudes and beliefs of patients have an influence on the outcome . in a study conducted by al - taiar et al,11 when the participants were asked about their expectations from the surgery satisfaction level is high with respect to pain relief , pain free movements , and social independence and low with respect to their ability to go back to work and to do daily activities requiring full flexion of knee . preoperative functional limitations , severity of pain , mental health score , and other comorbidities before tkr are more likely to have a worse outcome.12 older patients had the worst disease at the time of surgery and made least health gain , although their overall outcome was good . those with the most severe disease at the time of operation made greater gains than those with less disease.13 short - term pain relief was very good after tkr , especially in patients with severe disease . the body weight did not influence adversely the outcome of tkr in short term.14 preoperative psychological distress is associated with worst 1-year outcome and quality of life in patients undergoing tkr 1 year after surgery.15 racial and ethnic variations do exist in disparity of utilizing tkr ; these disparities are probably most explained by the level of patient education , improved health literacy regarding joint replacement , and the patient surgeon relationship leading to improved trust.16 according to street et al , patients and providers often differ in their beliefs , about the need for , risk of , and benefit of tkr , and these differences can affect patient satisfaction and commitment to treatment.17 patient s willingness to consider tkr varies by sex , race , and socioeconomic status as a result of systematic difference in knowledge and beliefs about the procedure.18 in a study conducted to test whether specific information given prior to surgery can help patient to obtain better pain relief after tkr , it was found that preoperative information does influence the experience of pain after surgery and related psychological factors.19 similarly in our study , most of the patients suggested that surgeon pros and cons of this surgery and the need for postoperative rehabilitation should be explained because this is a major determining factor in achieving good satisfaction level for their patients . traditionally , the results of knee arthroplasty have been determined with the use of surgeon - based measures such as the knee society scoring system . but recently , the outcome and quality of life measures have shifted toward a greater emphasis on patient - based evaluation . currently , there is no gold standard that optimally reflects the status of the knee and the patient prior to and following tkr.20 in 2012 , noble et al developed a new scoring system for tkr to better characterize the expectations , satisfaction , and physical activities of the younger , more diverse population of tkr patients . their validation was based on the perspectives of both the surgeon ( the objective score ) and the patient ( the subjective score).21 in our study , it was found that patients with a successful surgery based on the knee society scoring system have a low satisfaction level based on our fgds . similarly , there is another group of patients who have a low knee society score but with reasonable satisfaction with their surgery . traditional methods of assessment of outcome after tkr do not contribute to the patient satisfaction or subjective functional outcome . hence , a patient - reported functional outcome and assessment of level of satisfaction are needed . similarly , there is a difference in the satisfaction level achieved depending on socioeconomic , geographic , and cultural characteristics . there are differences in the expectations and perception of satisfaction between developed and developing countries . hence , instead of a universal method of assessment , newer methods of tkr outcome assessment combining radiological outcome , surgeon - based assessment , and patient satisfaction based on their socioeconomic status and cultural characteristics should be developed for different populations . socioeconomic aspects did you require help from others for your routine activities before surgery and has it changed now ? did you able to continue your job ? did you feel any depression due to this disabling disease ? can you give a reason why you selected this surgery as a last option although many of you have been told that surgery is the only curative treatment ? satisfaction level achieved how do you feel about this surgery at present ? what were your expectations ? did you get enough benefit from the money you spent ? what is your opinion regarding doing surgery in the opposite knee if you have same complaint in that knee ? socioeconomic aspects did you require help from others for your routine activities before surgery and has it changed now ? did you able to continue your job ? did you feel any depression due to this disabling disease ? can you give a reason why you selected this surgery as a last option although many of you have been told that surgery is the only curative treatment ? satisfaction level achieved how do you feel about this surgery at present ? what were your expectations ? did you get enough benefit from the money you spent ? what is your opinion regarding doing surgery in the opposite knee if you have same complaint in that knee ? | backgroundtotal knee replacement ( tkr ) results in an excellent outcome in terms of pain relief .
the reporting of outcomes was traditionally focused on implant survivorship and objective outcomes such as range of motion , knee stability , and radiographic alignment .
however , patients and doctors had differing perceptions of all domains of outcome , especially subjective quality of life domains such as emotions and social functioning . in this study , we tried to find out the expectations of indian patients regarding tkr and assess the level of satisfaction among our patients from their view point using focus group discussion ( fgd ) , and whether these expectations have an impact on outcomes and patient satisfaction.materials and methodsthis study was conducted in the department of orthopedics , government medical college , kozhikode , kerala , india , in november 2014 .
patients between the ages 60 and 65 years who met inclusion criteria were selected .
a total of 50 patients were selected for fgds . among them , 42 patients participated in fgd .
the remaining eight did not appear for the discussion .
a total of four fgd sessions were conducted.results and discussionit was found that there is a discrepancy between the satisfaction levels of patient and surgeon .
there is a difference in satisfaction level achieved depending on socioeconomic , geographic , and cultural characteristics.conclusionnewer methods of tkr outcome assessment combining radiological outcome , surgeon - based assessment , and patient satisfaction based on their socioeconomic status and cultural characteristics should be developed for different populations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a wild - type human rheb gene tagged with a flag sequence at the nh2-terminus was introduced downstream of the rat insulin promoter . mice carrying the lethal yellow agouti ( a ) mutation were generated by breeding r3 transgenic mice with kk - a strain mice . the obtained f1 littermates carrying the a mutation with or without a flag - rheb transgene on c57bl/6 and a kk hybrid background ( designated a / rheb and a ) were analyzed . this study was performed according to the guidelines of the animal ethics committee of kobe university graduate school of medicine . islets were isolated by collagenase digestion followed by centrifugation over histopaque medium ( sigma - aldrich , st . cultured islets were extracted in buffer a ( 20 mmol / l tris - hcl , ph 7.4 , 120 mmol / l nacl , 1 mmol / l edta , 5 mmol / l egta , 50 mmol / l -glycerophosphate , 50 mmol / l naf , 0.3% chaps , 1 mmol / l dithiothreitol , 4 g / ml leupeptin , and 4 g / ml aprotinin ) , and the supernatants were analyzed by immunoblotting with the indicated antibodies . the following antibodies were purchased from cell signaling technologies ( beverly , ma ) : anti phospho - s6 ribosomal protein ( ser235/236 ) , anti phospho-4ebp1 ( thr37/46 ) , anti phospho-4ebp1 ( thr70 ) , anti phospho - p70 s6 kinase ( thr389 ) , anti - pkb , anti phospho - pkb ( ser473 ) , anti phospho - p44/42 mitogen - activated protein ( map ) kinase ( thr202/tyr204 ) , and anti anti - rheb antibody was kindly provided by n. oshiro ( biosignal research center , kobe university , kobe , japan ) . mice were deprived of food for 16 h , and blood was collected from the tail vein after an oral injection ( 2 g / kg ) or intraperitoneal injection ( 3 g / kg ) of glucose . for insulin tolerance testing , mice fed ad libitum were injected with 0.75 units / kg body wt of human regular insulin . immunostaining for insulin and glucagon was performed using guinea pig antibodies against insulin and rabbit antibodies against glucagon ( dako japan , kyoto , japan ) . the immune complexes were detected with secondary antibodies conjugated with cy3 or fluorescein isothiocyanate , respectively ( jackson immunoresearch laboratories , west grove , pa ) . for immunostaining of flag , phosphorylated s6 , or ki-67 , after antigen retrieval by autoclave at 121c for 15 min in 10 mmol / l sodium citrate ( ph 6.0 ) and quenching of endogenous peroxidase with 3% h2o2for 10 min , the sections were incubated with the anti - flag antibody ( dykddddk tag antibody ; cell signaling ) , anti phospho - s6 ribosomal protein ( ser235/236 ) , or anti immunocomplexes were detected with a secondary antibody conjugated with horseradish peroxidase followed by incubation in diaminobenzidine peroxidase substrate solution . for quantification of -cell and -cell area , images of - or -cells and of the entire pancreas were obtained using a digital camera ( bz-8000 ; keyence , osaka , japan ) and analyzed using winroof software ( mitani , fukui , japan ) . the percentage of - or -cell area was calculated as the area of all insulin- or glucagon - positive cells based on the total pancreatic area surveyed . the relative -cell size was calculated by dividing the -cell area by the number of -cell nuclei in the insulin - stained sections . apoptotic -cells were analyzed by immunostaining of insulin and terminal deoxynucleotidyl transferase dutp nick - end labeling ( tunel ) assay using an apoptag fluorescein in situ apoptosis detection kit ( chemicon international , temecula , ca ) according to the manufacturer 's protocol . eight - week - old transgenic mice and wild - type littermates were injected intraperitoneally for 5 consecutive days with streptozotocin ( 40 mg / kg or 50 mg / kg ) dissolved just before injection in 0.1 mol / l citrate buffer . mice were injected intraperitoneally with rapamycin ( 2 mg / kg ) dissolved in 0.2% sodium carboxymethylcellulose and 0.25% tween 80 or control vehicle three times a week from 5 to 8 weeks of age . data are expressed as the means se and were analyzed using the mann - whitney nonparametric u test . islets were isolated by collagenase digestion followed by centrifugation over histopaque medium ( sigma - aldrich , st . cultured islets were extracted in buffer a ( 20 mmol / l tris - hcl , ph 7.4 , 120 mmol / l nacl , 1 mmol / l edta , 5 mmol / l egta , 50 mmol / l -glycerophosphate , 50 mmol / l naf , 0.3% chaps , 1 mmol / l dithiothreitol , 4 g / ml leupeptin , and 4 g / ml aprotinin ) , and the supernatants were analyzed by immunoblotting with the indicated antibodies . the following antibodies were purchased from cell signaling technologies ( beverly , ma ) : anti phospho - s6 ribosomal protein ( ser235/236 ) , anti phospho-4ebp1 ( thr37/46 ) , anti phospho-4ebp1 ( thr70 ) , anti phospho - p70 s6 kinase ( thr389 ) , anti - pkb , anti phospho - pkb ( ser473 ) , anti phospho - p44/42 mitogen - activated protein ( map ) kinase ( thr202/tyr204 ) , and anti anti - rheb antibody was kindly provided by n. oshiro ( biosignal research center , kobe university , kobe , japan ) . mice were deprived of food for 16 h , and blood was collected from the tail vein after an oral injection ( 2 g / kg ) or intraperitoneal injection ( 3 g / kg ) of glucose . for insulin tolerance testing , mice fed ad libitum were injected with 0.75 units / kg body wt of human regular insulin . immunostaining for insulin and glucagon was performed using guinea pig antibodies against insulin and rabbit antibodies against glucagon ( dako japan , kyoto , japan ) . the immune complexes were detected with secondary antibodies conjugated with cy3 or fluorescein isothiocyanate , respectively ( jackson immunoresearch laboratories , west grove , pa ) . for immunostaining of flag , phosphorylated s6 , or ki-67 , after antigen retrieval by autoclave at 121c for 15 min in 10 mmol / l sodium citrate ( ph 6.0 ) and quenching of endogenous peroxidase with 3% h2o2for 10 min , the sections were incubated with the anti - flag antibody ( dykddddk tag antibody ; cell signaling ) , anti phospho - s6 ribosomal protein ( ser235/236 ) , or anti immunocomplexes were detected with a secondary antibody conjugated with horseradish peroxidase followed by incubation in diaminobenzidine peroxidase substrate solution . for quantification of -cell and -cell area , images of - or -cells and of the entire pancreas were obtained using a digital camera ( bz-8000 ; keyence , osaka , japan ) and analyzed using winroof software ( mitani , fukui , japan ) . the percentage of - or -cell area was calculated as the area of all insulin- or glucagon - positive cells based on the total pancreatic area surveyed . the relative -cell size was calculated by dividing the -cell area by the number of -cell nuclei in the insulin - stained sections . apoptotic -cells were analyzed by immunostaining of insulin and terminal deoxynucleotidyl transferase dutp nick - end labeling ( tunel ) assay using an apoptag fluorescein in situ apoptosis detection kit ( chemicon international , temecula , ca ) according to the manufacturer 's protocol . eight - week - old transgenic mice and wild - type littermates were injected intraperitoneally for 5 consecutive days with streptozotocin ( 40 mg / kg or 50 mg / kg ) dissolved just before injection in 0.1 mol / l citrate buffer . mice were injected intraperitoneally with rapamycin ( 2 mg / kg ) dissolved in 0.2% sodium carboxymethylcellulose and 0.25% tween 80 or control vehicle three times a week from 5 to 8 weeks of age . data are expressed as the means se and were analyzed using the mann - whitney nonparametric u test . we confirmed the integration of the transgene in three independent founder lines ( r3 , r20 , and r35 ; accession no . immunoblotting of total cellular extracts from pancreatic islets using the anti - rheb antibody demonstrated that the transgene product was detected at a slightly higher level than endogenous rheb on sds - page ( fig . similar results were observed when flag - tagged rheb was expressed transiently in hek293 cells ( data not shown ) , suggesting that the addition of a flag sequence to rheb lowers the mobility of the polypeptide on sds - page . immunoprecipitation with the anti - flag antibody followed by immunoblotting with the same antibody failed to detect the expression of flag - rheb in the hypothalamus , muscle , or liver , indicating that the expression of flag - rheb is specific to the pancreatic -cells ( fig . islets isolated from mice of each genotype were incubated either in 50% rpmi medium without fcs ( a , b , and d ) or in rpmi medium ( c ) , or they were stimulated with 100 nmol / l igf-1 ( b ) or 15% fcs ( d ) as indicated . the same amounts of cellular extracts were analyzed by immunoblotting with the antibodies to rheb , phospho - s6 ribosomal protein ( ser235/236 ) , s6 ribosomal protein , phospho-4ebp1 ( thr37/46 or thr70 ) , phospho - p70 s6 kinase ( thr389 ) , p70 s6 kinase , phospho - pkb ( ser473 ) , pkb , phospho - p44/42 map kinase ( thr202/tyr204 ) , p44/42 map kinase , or irs2 . a representative experiment is shown . the bottom panel in a shows the same blot as the top panel , except that it was exposed longer to detect the endogenous rheb ( end - rheb ) . e : relative quantification of phospho - s6 ( ser235/236 ) , phospho-4ebp1 ( t37/46 or t70 ) , phospho - pkb ( ser473 ) , phospho - p44/42 map kinase ( thr202/tyr204 ) , and irs2 . the immunoblots were scanned , and the optical density for r3 with igf1 or fcs stimulation ( a , b , and d ) or the optical density for r3 ( c ) was set to 100% . f : immunoprecipitation with the anti - flag antibody was performed using lysates of the hypothalamus , muscle , or liver isolated from mice of each genotype and analyzed by immunoblotting with the same antibody . wt , wild type . to confirm the effect of the overexpression of rheb in -cells , we examined the phosphorylation of the downstream effectors for mtorc1 , ribosomal protein s6 , and 4ebp1 . because the mtorc1 pathway is regulated in a nutrient - dependent manner , the ability of rheb to activate the mtorc1 pathway is most easily visualized in nutrient - depleted conditions in vitro . therefore , isolated islets were incubated for 2 h in 50% rpmi medium that was made by mixing rpmi with krebs - ringer bicarbonate buffer without fcs . phosphorylation of s6 ( ser235/236 ) was clearly higher in islets prepared from transgenic mice than in those prepared from wild - type littermates ( fig . the immunoreactivity of the anti phospho - s6 antibody appeared to parallel the abundance of flag - rheb . phospho-4ebp1 ( thr37/46 ) antibody increased in the islets prepared from transgenic mice in the same manner . when islets were stimulated with igf-1 , the immunoreactivities of the anti phospho - s6 and anti phospho-4ebp1 ( thr37/46 and thr70 ) antibodies were increased in islets prepared from wild - type littermates , but the extent of immunoreactivity was still higher in islets from transgenic mice ( fig . the immunoreactivity of the anti phospho - pkb ( ser473 ) was increased by igf-1 stimulation in both wild - type and transgenic islets ; however , the stimulation was greater in wild - type than in transgenic islets . the amount of irs2 appeared to be relatively reduced in the transgenic islets compared with their wild - type littermates ( fig . this might be caused by a possible negative feedback mechanism induced by the activated p70 s6 kinase . serum stimulation also induced phosphorylation of s6 and 4ebp1 , but the stimulation was still greater in transgenic mice than in wild - type mice ( fig . phosphorylation of mapks also increased after serum stimulation , but the stimulation was similar in both wild - type and transgenic islets . the rate of increase in body weight was not significantly different between the r3 and r20 lines of transgenic mice and their wild - type littermates ( fig . metabolic parameters , including plasma triglycerides , free fatty acids , and leptin , were not significantly different between r3 transgenic mice and wild - type littermates either ( table 1 ) . in contrast , r20 transgenic mice had significantly lower blood glucose concentrations in the fed state at 8 and 50 weeks compared with wild - type littermates ( 127.9 4.24 vs. 145.6 5.35 mg / dl at 8 weeks and 128.7 6.16 vs. 147.9 5.68 mg / dl at 50 weeks ) ( fig . the plasma insulin levels in r20 mice were 1.43-fold those of wild - type littermates at 8 weeks ( fig . 2c ) . although no significant differences in blood glucose concentrations were observed between r3 transgenic mice and wild - type littermates , the concentration tended to be lower in the transgenic mice , and this tendency was maintained to 50 weeks . oral glucose tolerance testing at 8 weeks revealed that both the r3 and r20 lines of transgenic mice had improved glucose tolerance compared with wild - type littermates ( fig . 2d ) . although fasting blood glucose concentrations were not significantly different between transgenic mice and wild - type littermates , both the r3 and r20 lines of transgenic mice had significantly lower blood glucose levels after glucose loading . insulin release in response to glucose loading was significantly higher in transgenic mice than in wild - type littermates , with a 2.6-fold difference in r20 transgenic mice and a 1.7-fold difference in r3 transgenic mice at 15 min after injection ( fig . similarly improved glucose tolerance was also observed at 40 weeks with the r20 transgenic mice ( fig . in contrast , both r20 ( fig . 2 g ) and r3 transgenic mice ( data not shown ) demonstrated similar insulin responsiveness after intraperitoneal injections of insulin . then , intraperitoneal glucose tolerance testing was performed to measure the in vivo glucose - stimulated insulin secretion in the early and late phases ( fig . although glucose concentration did not differ significantly between transgenic mice and wild - type littermates in the early phase , the glucose concentration was significantly lower in the transgenic mice in the late phase . insulin secretion was similar in transgenic mice and their wild - type littermates in the early phase , but it was significantly higher in transgenic mice than in their wild - type littermates in the late phase . taken together , these results indicate that the improved glucose tolerance in the transgenic mice can be attributable mainly to a greater ability to secrete insulin in the late phase . metabolic effects of overexpression of rheb in pancreatic -cells . a : growth curves of r3 or r20 lines of transgenic mice ( ) and their wild - type littermates ( ) . b : blood glucose concentrations were measured in r3 and r20 transgenic mice and their wild - type littermates in the fed state at 8 and 50 weeks . c : plasma insulin concentrations were measured in r3 and r20 transgenic mice and their wild - type littermates in the fed state at 8 weeks . d and e : oral glucose tolerance tests were performed in r3 or r20 transgenic mice ( ) and their wild - type littermates ( ) at 8 weeks . f : oral glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) at 40 weeks . g : intraperitoneal insulin tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) . h : intraperitoneal glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) . data are the means se of values from six ( a ) , six to eight ( b ) , eight ( c ) , five ( d and e ) , six ( f ) , nine ( g ) , and six ( h ) animals from each genotype . metabolic characteristics of the transgenic mice and their wild - type littermates data are means se of values from 710 animals from each genotype at 8 weeks for plasma triglycerides and leptin or at 10 weeks for plasma free fatty acids . hematoxylin and eosin staining of the sections revealed that the pancreatic islet architecture was grossly unchanged in mice from ages 8 to 90 weeks ( fig . immunostaining of the sections with the anti - flag antibody confirmed the expression of flag - rheb in the islets of transgenic mice from ages 8 to 90 weeks ( fig . immunostaining with the anti phospho - s6 antibody appeared lower in the islet areas than in the exocrine acinar areas . however , the dark - staining cells in the islets appeared more abundant in transgenic mice than in the wild - type littermates ( fig . the ratio of the number of the dark staining cells to the number of nuclei in the islets was significantly higher in transgenic mice than in wild - type littermates ( 19.48 3.23 vs. 6.76 1.14% ) . increased -cell mass and cell growth in transgenic mice . a : hematoxylin and eosin staining of representative pancreatic sections from 8-week - old r3 transgenic mice and their wild - type littermates . b and c : immunostaining with the anti - flag antibody ( b ) and anti phospho - s6 ( ser235/236 ) antibody ( c , upper panels ) of representative pancreatic sections from 8-week - old r3 transgenic mice and wild - type littermates . ratio of the number of dark staining cells to the total number of nuclei in islets from transgenic mice and wild - type littermates is shown ( c , lower panels ) . d : hematoxylin and eosin ( h - e ) staining and immunostaining with the anti - flag antibody of representative pancreatic sections from 90-week - old r3 transgenic mice and their wild - type littermates . e : immunostaining with the anti - insulin ( red ) and the anti - glucagon ( green ) antibodies of representative pancreatic sections from 8-week - old r3 transgenic mice and their wild - type littermates . f : quantification of - and -cell area as a percentage of total pancreatic area in transgenic mice and their wild - type littermates . h : the relative size of -cells in the transgenic mice and their wild - type littermates was calculated . ki-67 antibody of representative pancreatic sections from 9-week - old r3 transgenic mice and their wild - type littermates . data are the means se of values from four ( c ) , five ( f ) , four ( g ) , and five ( h ) animals from each genotype . ( a high - quality digital representation of this figure is available in the online issue . ) . immunostaining with the anti - insulin and anti - glucagon antibodies also demonstrated the grossly unchanged structures of pancreatic islets ( fig . 3e ) . quantitative determination of -cell area relative to pancreatic area in insulin - stained sections revealed that the -cell area was significantly higher ( 1.46-fold ) in r3 transgenic mice than in wild - type littermates ( 0.581 0.048 vs. 0.399 0.040% ) ( fig . , the -cell area did not differ significantly between the r3 transgenic and wild - type littermates ( 0.144 0.028 vs. 0.134 0.018% ) . -cell mass was also significantly increased in r3 transgenic mice compared with wild - type littermates ( 1,070 63.6 vs. 712.5 60.9 g ) ( fig . 3 g ) . the relative -cell size was significantly increased at 1.30-fold in the transgenic mice compared with wild - type littermates ( 253.7 14.56 vs. 197.6 5.0 m ) ( fig . 3h ) . to evaluate the involvement of -cell proliferation in the increase of -cell mass in the transgenic mice , immunostaining with the anti as shown in table 2 , we did not observe significant differences in the proportion of ki-67positive nuclei in the islets between wild - type and transgenic mice . to evaluate the involvement of apoptotic -cells , tunel assay was performed but could not detect significant amounts of apoptotic cells at the basal state . numbers of total and ki-67positive nuclei in islets data are means se of values from four animals from each genotype . pancreatic sections were immunostained with the anti ki-67 antibody followed by counterstaining with hematoxylin as shown infig . numbers of all nuclei and of ki-67positive nuclei in the islets of wild - type and transgenic mice were counted . to determine whether rheb overexpression in pancreatic -cells prevented hyperglycemia in pathophysiological conditions , we used two models of experimentally induced diabetes : streptozotocin - induced and obesity - induced . first , r3 line transgenic mice and wild - type littermates were subjected to intraperitoneal injections of streptozotocin at 40 or 50 mg / kg for 5 consecutive days . monitoring of blood glucose levels in the fed state revealed that wild - type littermates had significant hyperglycemia by 1 or 3 weeks after starting injections at doses of 50 or 40 mg / kg , respectively . by contrast , r3 transgenic mice remained resistant to hyperglycemia ( 175.5 13.5 vs. 135.3 8.87 mg / dl at 40 mg / kg , and 327.0 2.27 vs. 156.8 7.52 mg / dl at 50 mg / kg 4 weeks after injection ) ( fig . r20 line transgenic mice also exhibited the same resistance to hyperglycemia induced by streptozotocin as the r3 transgenic mice ( fig . the insulin level of the wild - type and transgenic mice decreased to 25.3 and 33.4% , respectively , of the levels in the nontreated wild - type and transgenic mice of the same age ( fig . however , the glucose - to - insulin ratio differed significantly between transgenic mice and their wild - type littermates 4 weeks after injection ( 4.79 0.51 10 wt / wt vs. 16.34 4.93 10wt / wt ) ( fig . because the insulin sensitivity did not differ between wild - type and transgenic mice , as described above , the significant difference in the glucose - to - insulin ratios suggests that the amount of insulin secreted in response to blood glucose concentration differed between groups . oral glucose tolerance testing demonstrated clearly that transgenic mice were able to secrete more insulin than wild - type littermates in response to glucose loading ( fig . 4e ) , although the maximum production of insulin was reduced even in transgenic mice when compared with the results shown infig . consistent with the decrease in the serum insulin levels , immunohistological analysis demonstrated that -cell areas were decreased in both transgenic mice and wild - type littermates compared with nontreated mice . however , the -cell area was significantly higher in transgenic mice than in wild - type littermates ( 0.340 0.025 vs. 0.243 0.030% ) ( fig . 4f and g ) . tunel staining of the pancreatic sections showed no significant difference in the extent of apoptosis in -cells 1 week after administration with streptozotocin ( fig . a : doses of 40 mg / kg or 50 mg / kg streptozotocin were administered to r3 line transgenic mice ( ) or wild - type littermates ( ) for 5 consecutive days ( arrows in the figure ) . data are the means se of values from four ( 40 mg / kg ) or five ( 50 mg / kg ) animals from each genotype . b : a dose of 50 mg / kg streptozotocin was administered to r20 transgenic mice ( ) or wild - type littermates ( ) , and blood glucose concentrations were monitored with mice in the fed state . c and d : plasma insulin concentration ( c ) and glucose - to - insulin ratio ( d ) after administration with or without 50 mg / kg streptozotocin as shown in a. e : oral glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) 4 weeks after streptozotocin administration as shown in b. glucose and insulin concentrations are shown . f : immunostaining with the anti - insulin ( red ) and anti - glucagon ( green ) antibodies of representative pancreatic sections from r3 transgenic mice ( r3 ) and their wild - type littermates ( wt ) 4 weeks after 50 mg / kg streptozotocin administration as shown in a. g : quantification of -cell area as a percentage of total pancreatic area in transgenic mice and their wild - type littermates 4 weeks after administration with or without 50 mg / kg streptozotocin as shown in a. h : immunostaining with anti - insulin ( red ) antibody and tunel assay ( green ) of representative pancreatic sections from the transgenic mice and their wild - type littermates 1 week after 50 mg / kg streptozotocin administration . values represent the means se . * p < 0.05 ; * * p < 0.01 . ( a high - quality digital representation of this figure is available in the online issue . ) . numbers of insulin- and tunel - positive nuclei in islets data are means se of values from five animals from each genotype . pancreatic sections were double - stained with the anti - insulin antibody and tunel assay 1 week after 50 mg / kg streptozotocin administration as shown infig . numbers of all nuclei and of tunel - positive nuclei in the insulin - positive cells of wild - type and transgenic mice were counted . second , as a model of obesity - induced diabetes , we generated r3 transgenic mice with the lethal yellow agouti ( a ) mutation by breeding r3 transgenic mice with kk - a mice . for analysis we used f1 offspring littermates carrying the a mutation with or without a flag - rheb transgene on a c57bl/6 and kk mouse strain hybrid background ( designated a / rheb and a , respectively ) the rate of increase in body weight was not significantly different between a / rheb and a mice ( 35.5 0.94 vs. 37.5 1.06 g at 10 weeks ) . oral glucose tolerance testing revealed that the a / rheb mice had improved glucose tolerance ( fig . 5a ) . although blood glucose concentrations in the fasting state were not significantly different between a / rheb and a mice , the a / rheb mice had significantly lower blood glucose levels at 60 and 120 min after glucose loading . thus , the glucose concentration in a mice remained at 424 39.8 mg / dl at 60 min and 363.4 47.9 mg / dl at 120 min , whereas that in a / rheb mice was 210 46.6 mg / dl at 60 min and returned to 116.2 17.91 mg / dl at 120 min . the improved glucose tolerance in a / rheb mice was attributable to higher insulin release , with a significant 2.2-fold level at 15 min and a 1.9-fold level at 30 min after glucose loading compared with a mice . oral glucose tolerance tests were performed in a / rheb mice ( ) and alittermates ( ) . b : elimination of the effect of rheb expression in -cells after administration with rapamycin . oral glucose tolerance tests were performed in rapamycin - treated transgenic mice ( ) and their rapamycin - treated wild - type littermates ( ) . data are the means se of values from five ( a and b ) animals from each genotype . c : islets were prepared from rapamycin- or vehicle - treated mice of each genotype and incubated for 1 h in rpmi , and the same amounts of cellular extracts were analyzed by immunoblotting with the antibodies to phospho - s6 ribosomal protein ( ser235/236 ) , phospho-4ebp1 ( thr37/46 ) , or s6 ribosomal protein . wt , wild type . to examine whether the phenotypes observed above are dependent on the mtorc1 pathway , mice were injected intraperitoneally with mtorc1 inhibitor rapamycin from 5 to 8 weeks of age , and glucose tolerance testing was performed at 8 weeks ( fig . min after glucose loading , blood glucose concentration was 50 mg / dl higher in rapamycin - treated mice than in untreated mice . notably , glucose tolerance was similar in rapamycin - treated transgenic mice and in rapamycin - treated wild - type littermates . in addition , the improved insulin secretion in transgenic mice was eliminated completely to the level observed in their wild - type littermates . immunoblot analysis of the islets prepared from rapamycin- or vehicle - treated mice demonstrated that phosphorylation of s6 and 4ebp1 were reduced by rapamycin administration in both transgenic mice and wild - type littermates , indicating that the effect of rapamycin was achieved by suppression of mtorc1 activity ( fig . we confirmed the integration of the transgene in three independent founder lines ( r3 , r20 , and r35 ; accession no . immunoblotting of total cellular extracts from pancreatic islets using the anti - rheb antibody demonstrated that the transgene product was detected at a slightly higher level than endogenous rheb on sds - page ( fig . similar results were observed when flag - tagged rheb was expressed transiently in hek293 cells ( data not shown ) , suggesting that the addition of a flag sequence to rheb lowers the mobility of the polypeptide on sds - page . immunoprecipitation with the anti - flag antibody followed by immunoblotting with the same antibody failed to detect the expression of flag - rheb in the hypothalamus , muscle , or liver , indicating that the expression of flag - rheb is specific to the pancreatic -cells ( fig . islets isolated from mice of each genotype were incubated either in 50% rpmi medium without fcs ( a , b , and d ) or in rpmi medium ( c ) , or they were stimulated with 100 nmol / l igf-1 ( b ) or 15% fcs ( d ) as indicated . the same amounts of cellular extracts were analyzed by immunoblotting with the antibodies to rheb , phospho - s6 ribosomal protein ( ser235/236 ) , s6 ribosomal protein , phospho-4ebp1 ( thr37/46 or thr70 ) , phospho - p70 s6 kinase ( thr389 ) , p70 s6 kinase , phospho - pkb ( ser473 ) , pkb , phospho - p44/42 map kinase ( thr202/tyr204 ) , p44/42 map kinase , or irs2 . a representative experiment is shown . the bottom panel in a shows the same blot as the top panel , except that it was exposed longer to detect the endogenous rheb ( end - rheb ) . e : relative quantification of phospho - s6 ( ser235/236 ) , phospho-4ebp1 ( t37/46 or t70 ) , phospho - pkb ( ser473 ) , phospho - p44/42 map kinase ( thr202/tyr204 ) , and irs2 . the immunoblots were scanned , and the optical density for r3 with igf1 or fcs stimulation ( a , b , and d ) or the optical density for r3 ( c ) was set to 100% . f : immunoprecipitation with the anti - flag antibody was performed using lysates of the hypothalamus , muscle , or liver isolated from mice of each genotype and analyzed by immunoblotting with the same antibody . wt , wild type . to confirm the effect of the overexpression of rheb in -cells , we examined the phosphorylation of the downstream effectors for mtorc1 , ribosomal protein s6 , and 4ebp1 . because the mtorc1 pathway is regulated in a nutrient - dependent manner , the ability of rheb to activate the mtorc1 pathway is most easily visualized in nutrient - depleted conditions in vitro . therefore , isolated islets were incubated for 2 h in 50% rpmi medium that was made by mixing rpmi with krebs - ringer bicarbonate buffer without fcs . phosphorylation of s6 ( ser235/236 ) was clearly higher in islets prepared from transgenic mice than in those prepared from wild - type littermates ( fig . the immunoreactivity of the anti phospho - s6 antibody appeared to parallel the abundance of flag - rheb . phospho-4ebp1 ( thr37/46 ) antibody increased in the islets prepared from transgenic mice in the same manner . when islets were stimulated with igf-1 , the immunoreactivities of the anti phospho - s6 and anti phospho-4ebp1 ( thr37/46 and thr70 ) antibodies were increased in islets prepared from wild - type littermates , but the extent of immunoreactivity was still higher in islets from transgenic mice ( fig . the immunoreactivity of the anti phospho - pkb ( ser473 ) was increased by igf-1 stimulation in both wild - type and transgenic islets ; however , the stimulation was greater in wild - type than in transgenic islets . the amount of irs2 appeared to be relatively reduced in the transgenic islets compared with their wild - type littermates ( fig . this might be caused by a possible negative feedback mechanism induced by the activated p70 s6 kinase . serum stimulation also induced phosphorylation of s6 and 4ebp1 , but the stimulation was still greater in transgenic mice than in wild - type mice ( fig . phosphorylation of mapks also increased after serum stimulation , but the stimulation was similar in both wild - type and transgenic islets . the rate of increase in body weight was not significantly different between the r3 and r20 lines of transgenic mice and their wild - type littermates ( fig . metabolic parameters , including plasma triglycerides , free fatty acids , and leptin , were not significantly different between r3 transgenic mice and wild - type littermates either ( table 1 ) . in contrast , r20 transgenic mice had significantly lower blood glucose concentrations in the fed state at 8 and 50 weeks compared with wild - type littermates ( 127.9 4.24 vs. 145.6 5.35 mg / dl at 8 weeks and 128.7 6.16 vs. 147.9 5.68 mg / dl at 50 weeks ) ( fig . the plasma insulin levels in r20 mice were 1.43-fold those of wild - type littermates at 8 weeks ( fig . 2c ) . although no significant differences in blood glucose concentrations were observed between r3 transgenic mice and wild - type littermates , the concentration tended to be lower in the transgenic mice , and this tendency was maintained to 50 weeks . oral glucose tolerance testing at 8 weeks revealed that both the r3 and r20 lines of transgenic mice had improved glucose tolerance compared with wild - type littermates ( fig . although fasting blood glucose concentrations were not significantly different between transgenic mice and wild - type littermates , both the r3 and r20 lines of transgenic mice had significantly lower blood glucose levels after glucose loading . insulin release in response to glucose loading was significantly higher in transgenic mice than in wild - type littermates , with a 2.6-fold difference in r20 transgenic mice and a 1.7-fold difference in r3 transgenic mice at 15 min after injection ( fig . similarly improved glucose tolerance was also observed at 40 weeks with the r20 transgenic mice ( fig . in contrast , both r20 ( fig . 2 g ) and r3 transgenic mice ( data not shown ) demonstrated similar insulin responsiveness after intraperitoneal injections of insulin . then , intraperitoneal glucose tolerance testing was performed to measure the in vivo glucose - stimulated insulin secretion in the early and late phases ( fig . although glucose concentration did not differ significantly between transgenic mice and wild - type littermates in the early phase , the glucose concentration was significantly lower in the transgenic mice in the late phase . insulin secretion was similar in transgenic mice and their wild - type littermates in the early phase , but it was significantly higher in transgenic mice than in their wild - type littermates in the late phase . taken together , these results indicate that the improved glucose tolerance in the transgenic mice can be attributable mainly to a greater ability to secrete insulin in the late phase . metabolic effects of overexpression of rheb in pancreatic -cells . a : growth curves of r3 or r20 lines of transgenic mice ( ) and their wild - type littermates ( ) . b : blood glucose concentrations were measured in r3 and r20 transgenic mice and their wild - type littermates in the fed state at 8 and 50 weeks . c : plasma insulin concentrations were measured in r3 and r20 transgenic mice and their wild - type littermates in the fed state at 8 weeks . d and e : oral glucose tolerance tests were performed in r3 or r20 transgenic mice ( ) and their wild - type littermates ( ) at 8 weeks . f : oral glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) at 40 weeks . g : intraperitoneal insulin tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) . h : intraperitoneal glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) . data are the means se of values from six ( a ) , six to eight ( b ) , eight ( c ) , five ( d and e ) , six ( f ) , nine ( g ) , and six ( h ) animals from each genotype . metabolic characteristics of the transgenic mice and their wild - type littermates data are means se of values from 710 animals from each genotype at 8 weeks for plasma triglycerides and leptin or at 10 weeks for plasma free fatty acids . hematoxylin and eosin staining of the sections revealed that the pancreatic islet architecture was grossly unchanged in mice from ages 8 to 90 weeks ( fig . immunostaining of the sections with the anti - flag antibody confirmed the expression of flag - rheb in the islets of transgenic mice from ages 8 to 90 weeks ( fig . immunostaining with the anti phospho - s6 antibody appeared lower in the islet areas than in the exocrine acinar areas . however , the dark - staining cells in the islets appeared more abundant in transgenic mice than in the wild - type littermates ( fig . the ratio of the number of the dark staining cells to the number of nuclei in the islets was significantly higher in transgenic mice than in wild - type littermates ( 19.48 3.23 vs. 6.76 1.14% ) . increased -cell mass and cell growth in transgenic mice . a : hematoxylin and eosin staining of representative pancreatic sections from 8-week - old r3 transgenic mice and their wild - type littermates . b and c : immunostaining with the anti - flag antibody ( b ) and anti phospho - s6 ( ser235/236 ) antibody ( c , upper panels ) of representative pancreatic sections from 8-week - old r3 transgenic mice and wild - type littermates . ratio of the number of dark staining cells to the total number of nuclei in islets from transgenic mice and wild - type littermates is shown ( c , lower panels ) . d : hematoxylin and eosin ( h - e ) staining and immunostaining with the anti - flag antibody of representative pancreatic sections from 90-week - old r3 transgenic mice and their wild - type littermates . e : immunostaining with the anti - insulin ( red ) and the anti - glucagon ( green ) antibodies of representative pancreatic sections from 8-week - old r3 transgenic mice and their wild - type littermates . f : quantification of - and -cell area as a percentage of total pancreatic area in transgenic mice and their wild - type littermates . h : the relative size of -cells in the transgenic mice and their wild - type littermates was calculated . ki-67 antibody of representative pancreatic sections from 9-week - old r3 transgenic mice and their wild - type littermates . data are the means se of values from four ( c ) , five ( f ) , four ( g ) , and five ( h ) animals from each genotype . ( a high - quality digital representation of this figure is available in the online issue . ) . immunostaining with the anti - insulin and anti - glucagon antibodies also demonstrated the grossly unchanged structures of pancreatic islets ( fig . 3e ) . quantitative determination of -cell area relative to pancreatic area in insulin - stained sections revealed that the -cell area was significantly higher ( 1.46-fold ) in r3 transgenic mice than in wild - type littermates ( 0.581 0.048 vs. 0.399 0.040% ) ( fig . , the -cell area did not differ significantly between the r3 transgenic and wild - type littermates ( 0.144 0.028 vs. 0.134 0.018% ) . -cell mass was also significantly increased in r3 transgenic mice compared with wild - type littermates ( 1,070 63.6 vs. 712.5 60.9 g ) ( fig . 3 g ) . the relative -cell size was significantly increased at 1.30-fold in the transgenic mice compared with wild - type littermates ( 253.7 14.56 vs. 197.6 5.0 m ) ( fig . 3h ) . to evaluate the involvement of -cell proliferation in the increase of -cell mass in the transgenic mice , immunostaining with the anti ki-67 antibody was performed ( fig . as shown in table 2 , we did not observe significant differences in the proportion of ki-67positive nuclei in the islets between wild - type and transgenic mice . to evaluate the involvement of apoptotic -cells , tunel assay was performed but could not detect significant amounts of apoptotic cells at the basal state . numbers of total and ki-67positive nuclei in islets data are means se of values from four animals from each genotype . pancreatic sections were immunostained with the anti ki-67 antibody followed by counterstaining with hematoxylin as shown infig . numbers of all nuclei and of ki-67positive nuclei in the islets of wild - type and transgenic mice were counted . to determine whether rheb overexpression in pancreatic -cells prevented hyperglycemia in pathophysiological conditions , we used two models of experimentally induced diabetes : streptozotocin - induced and obesity - induced . first , r3 line transgenic mice and wild - type littermates were subjected to intraperitoneal injections of streptozotocin at 40 or 50 mg / kg for 5 consecutive days . monitoring of blood glucose levels in the fed state revealed that wild - type littermates had significant hyperglycemia by 1 or 3 weeks after starting injections at doses of 50 or 40 mg / kg , respectively . by contrast , r3 transgenic mice remained resistant to hyperglycemia ( 175.5 13.5 vs. 135.3 8.87 mg / dl at 40 mg / kg , and 327.0 2.27 vs. 156.8 7.52 mg / dl at 50 mg / kg 4 weeks after injection ) ( fig . r20 line transgenic mice also exhibited the same resistance to hyperglycemia induced by streptozotocin as the r3 transgenic mice ( fig . the insulin level of the wild - type and transgenic mice decreased to 25.3 and 33.4% , respectively , of the levels in the nontreated wild - type and transgenic mice of the same age ( fig . however , the glucose - to - insulin ratio differed significantly between transgenic mice and their wild - type littermates 4 weeks after injection ( 4.79 0.51 10 wt / wt vs. 16.34 4.93 10wt / wt ) ( fig . because the insulin sensitivity did not differ between wild - type and transgenic mice , as described above , the significant difference in the glucose - to - insulin ratios suggests that the amount of insulin secreted in response to blood glucose concentration differed between groups . oral glucose tolerance testing demonstrated clearly that transgenic mice were able to secrete more insulin than wild - type littermates in response to glucose loading ( fig . 4e ) , although the maximum production of insulin was reduced even in transgenic mice when compared with the results shown infig . consistent with the decrease in the serum insulin levels , immunohistological analysis demonstrated that -cell areas were decreased in both transgenic mice and wild - type littermates compared with nontreated mice . however , the -cell area was significantly higher in transgenic mice than in wild - type littermates ( 0.340 0.025 vs. 0.243 0.030% ) ( fig . 4f and g ) . tunel staining of the pancreatic sections showed no significant difference in the extent of apoptosis in -cells 1 week after administration with streptozotocin ( fig . a : doses of 40 mg / kg or 50 mg / kg streptozotocin were administered to r3 line transgenic mice ( ) or wild - type littermates ( ) for 5 consecutive days ( arrows in the figure ) . data are the means se of values from four ( 40 mg / kg ) or five ( 50 mg / kg ) animals from each genotype . b : a dose of 50 mg / kg streptozotocin was administered to r20 transgenic mice ( ) or wild - type littermates ( ) , and blood glucose concentrations were monitored with mice in the fed state . c and d : plasma insulin concentration ( c ) and glucose - to - insulin ratio ( d ) after administration with or without 50 mg / kg streptozotocin as shown in a. e : oral glucose tolerance tests were performed in r20 transgenic mice ( ) and wild - type littermates ( ) 4 weeks after streptozotocin administration as shown in b. glucose and insulin concentrations are shown . f : immunostaining with the anti - insulin ( red ) and anti - glucagon ( green ) antibodies of representative pancreatic sections from r3 transgenic mice ( r3 ) and their wild - type littermates ( wt ) 4 weeks after 50 mg / kg streptozotocin administration as shown in a. g : quantification of -cell area as a percentage of total pancreatic area in transgenic mice and their wild - type littermates 4 weeks after administration with or without 50 mg / kg streptozotocin as shown in a. h : immunostaining with anti - insulin ( red ) antibody and tunel assay ( green ) of representative pancreatic sections from the transgenic mice and their wild - type littermates 1 week after 50 mg / kg streptozotocin administration . values represent the means se . * p < 0.05 ; * * p < 0.01 . ( a high - quality digital representation of this figure is available in the online issue . ) . numbers of insulin- and tunel - positive nuclei in islets data are means se of values from five animals from each genotype . pancreatic sections were double - stained with the anti - insulin antibody and tunel assay 1 week after 50 mg / kg streptozotocin administration as shown infig . numbers of all nuclei and of tunel - positive nuclei in the insulin - positive cells of wild - type and transgenic mice were counted . second , as a model of obesity - induced diabetes , we generated r3 transgenic mice with the lethal yellow agouti ( a ) mutation by breeding r3 transgenic mice with kk - a mice . for analysis we used f1 offspring littermates carrying the a mutation with or without a flag - rheb transgene on a c57bl/6 and kk mouse strain hybrid background ( designated a / rheb and a , respectively ) the rate of increase in body weight was not significantly different between a / rheb and a mice ( 35.5 0.94 vs. 37.5 1.06 g at 10 weeks ) . oral glucose tolerance testing revealed that the a / rheb mice had improved glucose tolerance ( fig . 5a ) . although blood glucose concentrations in the fasting state were not significantly different between a / rheb and a mice , the a / rheb mice had significantly lower blood glucose levels at 60 and 120 min after glucose loading . thus , the glucose concentration in a mice remained at 424 39.8 mg / dl at 60 min and 363.4 47.9 mg / dl at 120 min , whereas that in a / rheb mice was 210 46.6 mg / dl at 60 min and returned to 116.2 17.91 mg / dl at 120 min . the improved glucose tolerance in a / rheb mice was attributable to higher insulin release , with a significant 2.2-fold level at 15 min and a 1.9-fold level at 30 min after glucose loading compared with a mice . oral glucose tolerance tests were performed in a / rheb mice ( ) and alittermates ( ) . b : elimination of the effect of rheb expression in -cells after administration with rapamycin . oral glucose tolerance tests were performed in rapamycin - treated transgenic mice ( ) and their rapamycin - treated wild - type littermates ( ) . blood glucose and plasma insulin concentrations are shown . data are the means se of values from five ( a and b ) animals from each genotype . c : islets were prepared from rapamycin- or vehicle - treated mice of each genotype and incubated for 1 h in rpmi , and the same amounts of cellular extracts were analyzed by immunoblotting with the antibodies to phospho - s6 ribosomal protein ( ser235/236 ) , phospho-4ebp1 ( thr37/46 ) , or s6 ribosomal protein . * to examine whether the phenotypes observed above are dependent on the mtorc1 pathway , mice were injected intraperitoneally with mtorc1 inhibitor rapamycin from 5 to 8 weeks of age , and glucose tolerance testing was performed at 8 weeks ( fig . min after glucose loading , blood glucose concentration was 50 mg / dl higher in rapamycin - treated mice than in untreated mice . notably , glucose tolerance was similar in rapamycin - treated transgenic mice and in rapamycin - treated wild - type littermates . in addition , the improved insulin secretion in transgenic mice was eliminated completely to the level observed in their wild - type littermates . immunoblot analysis of the islets prepared from rapamycin- or vehicle - treated mice demonstrated that phosphorylation of s6 and 4ebp1 were reduced by rapamycin administration in both transgenic mice and wild - type littermates , indicating that the effect of rapamycin was achieved by suppression of mtorc1 activity ( fig . to examine the role of the mtorc1 pathway in pancreatic -cells in vivo , we produced transgenic mice that express rheb under the control of the rat insulin promoter . rheb is unique in that it maintains basal levels of gtp charging much higher than those of ras because of its lower intrinsic gtpase activity . with a limiting level of endogenous rheb gtpase - activating activity established by the tsc complex , even wild - type rheb takes an active gtp form when it is overexpressed ( 21 ) . when isolated islets were incubated in nutrient - limited media , phosphorylation levels of ribosomal protein s6 and of 4ebp1 were clearly augmented in transgenic -cells compared with wild - type -cells , in parallel with the abundance of flag - rheb . moreover , immunostaining of the pancreas sections with the anti phospho - s6 antibody revealed an increase in s6 phosphorylation in the transgenic -cells . these results indicate that the mtorc1 pathway is upregulated in the pancreatic -cells of transgenic mice in vivo as well as in vitro . we found that these transgenic mice had improved glucose tolerance because of a higher capacity to secrete insulin in response to glucose loading . we also found that the increase in insulin secretion was mediated mainly by the increased secretion in the late phase . morphometry proved that the increase in the capacity to produce insulin could be attributed to an increase in the -cell mass , which was accompanied by increased -cell size . these results are consistent with previous reports that overexpression of rheb as well as loss - of - function mutations of the genes encoding tsc1 or tsc2 results in enlarged cell size ( 2328,36 ) . overexpression of rheb might induce dysfunction of -cells because inappropriate activation of the tsc / rheb pathway leads to the downregulation of the insulin / igf-1 signaling system as a result of degradation of irs1 and -2 ( 3741 ) . moreover , constitutive activation of the mtor pathway by loss of the tsc1 or tsc2 genes in cell lines and tumors causes endoplasmic reticulum stress , resulting in inhibition of insulin action and an increase in vulnerability to apoptosis ( 42 ) . ( 43 ) demonstrated that mice deficient in tsc2 in pancreatic -cells developed progressive hyperglycemia after 40 weeks of age , although the mice also exhibited hypoglycemia and hyperinsulinemia when young , suggesting that downregulation of insulin action or endoplasmic reticulum stress might occur with aging . by contrast , transgenic mice tended to have lower glucose levels and improved glucose tolerance even at 4050 weeks . the histological analysis of islets of even 90-week - old mice confirmed no adverse effect on pancreatic -cells . although the irs2 level appeared to be relatively reduced in transgenic islets , the extent of the mtorc1 activation might not be strong enough to induce adverse effects on the -cells in these transgenic mice . upregulation of irs2 and akt or deletion of pten induces an increase in -cell mass and resistance to hyperglycemia ( 6,7,44 ) . a similar phenotype has been reported for the downregulation of more distal negative mediators of akt , foxo1 , and p27 ( 15,16,45 ) . these phenotypes are mediated by increased proliferation of -cells as well as an increase in -cell size . reciprocally , mice deficient for p70s6k or knock - in mice whose s6 protein contains alanine substitutions at all five phosphorylatable serine residues sites show reduced insulin secretion in response to glucose caused by diminished -cell size ( 5,17 ) . because rheb has been reported to be required for both cell cycle progression and cell growth in drosophila ( 28 ) , and because mtorc1 is involved in cell proliferation in some mammalian cells such as cancer cells , it might be premature to conclude only from ki-67 staining that cell proliferation is not involved in our mouse model . it should be noted that transgenic mice exhibited resistance to hyperglycemia induced by low - dose streptozotocin as well as by obesity . although streptozotocin administration induced a reduction of -cell areas by 4345% in both wild - type and transgenic mice , insulin secretion in response to glucose loading was much higher in transgenic mice than in wild - type littermates . this suggests that the residual -cell function in transgenic mice might be higher than that in wild - type littermates . we can not exclude completely the possibility that overexpression of rheb might affect intracellular signals other than mtorc1 pathways . rheb has been reported to inhibit the raf - dependent mapk pathway through the interaction of the ras - binding domain of braf or craf in a rapamycin - insensitive manner ( 4648 ) . however , serum stimulation of mapk phosphorylation did not appear to decrease in the transgenic islets compared with their wild - type littermates . in addition , rapamycin administration eliminated the improved insulin secretion in the transgenic mice completely to the level observed in wild - type littermates . given that mapks are not affected significantly by rapamycin , these results suggest that the rapamycin - sensitive mtorc1 pathway plays a crucial role in this mouse model . in conclusion , our findings highlight the importance of the role of the mtorc1 pathway in pancreatic -cells . activation of the mtorc1 pathway by rheb led to an increase in -cell mass and protection from hyperglycemia induced by -cell injury and by insulin resistance . further elucidation of the intracellular signaling mediated by rheb in pancreatic -cells might thus provide a basis for the development of new therapeutic strategies to improve insulin secretion and thereby prevent the development of diabetes . | objectivecomponents of insulin / igf-1 receptor mediated signaling pathways in pancreatic -cells have been implicated in the development of diabetes , in part through the regulation of -cell mass in vivo .
studies in vitro have shown that the protein ras homolog enriched in brain ( rheb ) plays a key role as a positive upstream regulator of the mammalian target of rapamycin complex 1 ( mtorc1 ) pathway in integrating inputs from nutrients and growth factors for cell growth . our objective was to investigate the role of the mtorc1 pathway in the regulation of -cell mass in vivo.research design and methodswe generated transgenic mice that overexpress rheb in -cells .
we examined the activation of the mtorc1 pathway and its effects on -cell mass , on glucose metabolism , and on protection against hyperglycemia.resultsimmunoblots of islet extracts revealed that the phosphorylation levels of ribosomal protein s6 and eukaryotic initiation factor 4e binding protein 1 , downstream effectors for mtorc1 , were upregulated in transgenic -cells .
immunostaining of the pancreatic sections with anti phospho - s6 antibody confirmed upregulation of the mtorc1 pathway in -cells in vivo .
the mice showed improved glucose tolerance with higher insulin secretion .
this arose from increased -cell mass accompanied by increased cell size .
the mice also exhibited resistance to hyperglycemia induced by streptozotocin and obesity.conclusionsactivation of the mtorc1 pathway by rheb led to increased -cell mass in this mouse model without producing obvious unfavorable effects , giving a potential approach for the treatment of -cell failure and diabetes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
gastrointestinal stromal tumours ( gists ) are the most common mesenchymal neoplasms arising in the gastrointestinal tract . however , rectal gists only account for 5% of gists , whilst stomach and small bowel account for 8095% . complete surgical resection remains the optimal treatment in primary localized lesion [ 2 , 3 ] . for recurrent , metastatic gists or unresectable tumours presentation of these large pelvic tumours remains a diagnostic challenge for all involved in pelvic surgery . we describe a case of a locally advanced gist situated in the rectum , presenting under urology , treated by neoadjuvant imatinib mesylate followed by radical surgery . an elderly man in his seventies presented to the urology department with two episodes of acute urinary retention . he underwent a laser transurethral resection of prostate during which a large palpable pelvic mass was noted . the subsequent urgent mr pelvis revealed a large tumour in the mesorectum arising from the anterior rectum 10 8.5 cm ( figs 1 and 2 ) . a transrectal ultrasound and biopsy were performed ; histology revealed a spindle cell tumour , with positive immunostains for cd117 and dog1 with 5 mitoses per 50 high power fields . figure 1:t2-weighted sagittal image demonstrating a large mass ( m ) anterior to the sacrum ( s ) and posterior to the bladder . figure 2:t2-weighted axial showing the same mass lying adjacent to the anterior wall of the rectum ( * ) . t2-weighted sagittal image demonstrating a large mass ( m ) anterior to the sacrum ( s ) and posterior to the bladder . t2-weighted axial showing the same mass lying adjacent to the anterior wall of the rectum ( * ) . repeat mr pelvis and staging pet ct abdomen , thorax and pelvis were then performed . these showed a large extra - luminal tumour with downsizing in tumour bulk ( 6 5.7 5.4 cm ) ( figs 35 ) but in close approximation with the right seminal vesicle . figure 3:axial fused pet - ct image pre - treatment , demonstrating that the mass has avid peripheral tracer uptake and a hypometabolic , tracer inavid centre .
figure 4:t2-weighted sagittal images after 3 months of imatinib mesylate therapy . the mass has shown a significant reduction in size ( mass = m , sacrum = s ) . figure 5:t2-weighted axial images after 3 months of imatinib mesylate therapy . the mass has shown a significant reduction in size ( white star ) . axial fused pet - ct image pre - treatment , demonstrating that the mass has avid peripheral tracer uptake and a hypometabolic , tracer inavid centre . t2-weighted sagittal images after 3 months of imatinib mesylate therapy . the mass has shown a significant reduction in size ( mass = m , sacrum = s ) . t2-weighted axial images after 3 months of imatinib mesylate therapy . intraoperatively a large tumour in close proximity to the posterior bladder and seminal vesicles was found . although there was no evidence of invasion , dissection of the plane between the gist and posterior bladder was not possible , thus cystectomy and prostatectomy were performed with an ileal conduit and urostomy . the sigmoid colon and rectum were resected leaving an end colostomy as planned . in the postoperative period the patient developed signs of sepsis . the patient returned to theatre , the anastomosis was taken down and a double barrel ileostomy sited . operative histology revealed reduced mitotic activity and downgrading of tumour activity with clear r0 resection margins . gists arise from the interstitial cells of cajal , and over 90% of these tumours demonstrate a mutation in the tyrosine kinase proto - oncogene , cd117(c - kit ) . diagnosis is dependent on the morphology of either spindle cell or epitheloid , and immunohistological identification of cd117 and cd34 [ 1 , 2 ] . incidental diagnosis during per rectal or endoscopic examination has been reported in a few cases [ 1 , 2 ] . locoregional lymphatic spread is extremely rare , and local spread of the tumour tends to displace adjacent organs rather than invade tissue [ 1 , 2 , 4 ] . over 70% of gists present with a tumour over 5 cm in diameter , with those over 10 cm having a poor 5-year prognosis . curative surgery ( r0 ) is associated with an optimal outcome in those with localized primary disease [ 1 , 2 ] . rectal gists can demonstrate close proximity to the pelvic floor , and are often of large size , therefore representing a challenge for sphincter preserving surgery . the most common surgical resections include anterior and abdominoperineal resection , although mesorectal clearance is not usually required due to unlikely lymphatic invasion . for those with metastatic disease , tumours deemed inappropriate for resection or recurrent disease tyrosine kinase inhibitors ( imatinib mesylate ) are an alternative treatment [ 3 , 4 ] . primary gists > 5 cm may benefit from 8 to 12 weeks of neoadjuvant treatment prior to surgery with no adverse effect . given the rarity of rectal gists this may help to improve sphincter - preserving surgery in giant ( > 10 cm ) rectal gists . neoadjuvant treatment prior to surgical resection in primary locally advanced gists show an improved overall survival and progression - free survival . this benefit is more apparent in high - risk giant gists > 10 cm for downsizing of tumour and hence a less aggressive surgery which is most apparent with pelvic presentations . neoadjuvant therapy may help to improve resectability of the tumours ; this is particularly important in the confines of the pelvis . however , we only depict one case and treatment option . similar cases would need a tailored multidisciplinary approach to investigation and treatment . | gastrointestinal stromal tumour ( gist are the most common mesenchymal tumours ; however , rectal gists account for < 5% . in the pelvis
they represent a diagnostic challenge with giant gists likely to be malignant
. they may present with urological , gynaecological or rectal symptoms .
sphincter - preserving surgery can be aided by neoadjuvant therapy .
we present an uncommon case of giant rectal gist masquerading as acute urinary retention . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
three intensive care units selected from two university hospitals ( a and b ) , were participated in this study . feedings used in this study , were prepared in the main kitchen of each hospital by chef under nutritionist supervision . all tube feeding ingredients ( egg , milk , meat , etc . ) were cooked and mixed ( blenderized ) to provide appropriate calories . the feeds were prepared daily in quantities that would allow feeding patients for about 24 hours . the feedings were shipped to the wards every day ( between 11 - 12 am ) in closed containers and stored in refrigerator for 24 hours . in the period between october 2005 and september 2006 , a total number of 152 samples were collected ( 46 , 46 and 60 samples from hospital a - central icu , hospital a - trauma icu and hospital b - neurosurgery icu , respectively ) . feeding samples were marked and 50ml of feeds were collected in two occasions , immediately and 18 hours following preparation , for microbial analysis . all samples were transported to the food microbiology laboratory in school of public health of isfahan university of medical sciences in an icebox for microbiological analysis . standard plate count , coliform count and staphylococcus aureus count for all samples were conducted . the number of aerobic bacteria , coliforms and s. aureus were determined using pure plate technique.14 for total count , coliform count and s. aureus quantification , ten - fold serial dilutions were prepared in 0.1% sterile buffered peptone water ( oxoid ) . from each dilution a 1ml aliquot was added to nutrient agar ( na , merck , germany ) , violet red bile agar ( vrba , merck ) and baird - parker agar ( bpa , merck ) . colony counts per ml of feed were done after incubation at 37c for 24 - 48 hours . typical colonies on vrba and bpa were also examined using suitable biochemical tests.12 results are expressed as colony forming units ( cfu)/ ml of food . samples were analyzed for the presence of listeria spp . and in particular for listeria monocytogenes using selective enrichment and isolation protocol , recommended by united states department of agriculture ( usda).15 twenty five grams of a sample was aseptically taken , homogenized for 2 minutes in 225ml of uvm listeria enrichment broth ( uvm i ) ( difco , america ) and incubated at 30c for 24 hours . one ml of primary enrichments were transferred to 9ml of uvm ii ( fraser broth ) ( amyl media , australia ) and incubated at 35c for 48 hours . secondary enrichments were streaked on oxford agar ( merck ) and palcam agar ( merck ) and incubated at 37c for 48 hours . the plates then examined for typical listeria colonies ( black colonies with black sunken ) and at least 3 suspected colonies were sub cultured on trypton soy agar supplemented with 0.6% of yeast extract ( tsaye ) and incubated at 37c for 24 hours . all isolates were subjected to standard biochemical tests such as gram s stain , catalase test , motility at 25c and 37c , acid production from glucose , manitol , rhamnose , xylose , - methyl- d- manoside , and nitrate reduction , hydrolysis of esculin and mr / vp test . for further confirmations of listeria spp . , other biochemical reactions , - haemolytic activity , and camp test were performed according to the bergey s manual of systematic bacteriology.16 samples were also examined for the presence of salmonella spp . by the reference method ( no 1810 ) recommended by the iranian standard organization for the isolation of salmonella.17 briefly a 25 g portion of each sample was weighed aseptically in a sterile stomacher bag containing 225ml sterile buffered peptone water ( bpw ) and shaken for 2 minutes . one ml of the pre - enriched sample was then inoculated into 10ml of modified rappaport - vassiliadis ( rv , merck ) broth and 9ml of selenite cystine ( sc , merck ) broth and was incubated at 42c and 37c respectively for 24 hours . xylose lysine deoxycholate ( xld , merck ) medium was used as selective isolation media and incubated at 37c for 24 hours . at least three characteristic colonies were picked from each plate and purified by streaking on tryptone soy agar ( tsa , merck ) . cultures were further subjected to analysis for gram s stain , motility , onpg , urease , lysine decarboxylase and reaction on triple sugar iron agar . statistical analyses were conducted after computing log cfu / g and by using spss package , version 13.0.18 wilcoxon signed ranks test was used to determine a statistically significant difference between onset and 18 hours after food preparation . statistical analyses were conducted after computing log cfu / g and by using spss package , version 13.0.18 wilcoxon signed ranks test was used to determine a statistically significant difference between onset and 18 hours after food preparation . statistical analyses were conducted after computing log cfu / g and by using spss package , version 13.0.18 wilcoxon signed ranks test was used to determine a statistically significant difference between onset and 18 hours after food preparation . at the time of food preparation , there were the range of total viable counts , coliform count and s. aureus count among 23 samples of food in hospital a - trauma icu , 23 samples in hospital a - central icu and 30 samples in hospital b - neurosurgery icu . there were significant increases in counts 18 hours after food preparation ( p value < 0.001 ) . bacterial contamination of hospital - prepared tube feeding samples in three intensive care units , at the time of food preparation and 18 hrs after preparation as indicated in table 2 , in first sampling , out of total 76 samples taken from three wards of two hospitals at the time of food preparation , 53 samples ( 70% ) had coliform contamination , 87% of the contaminated samples had counts greater than 10 cfu / g . out of samples collected immediately after preparation , 68 samples ( 90% ) had s. aureus contamination greater than 10 cfu / g . in standard plate count , 74 samples ( 97% ) had counts greater than 10 cfu / g , while 54 samples ( 71% ) had counts greater than 10 cfu / g . in a second sampling occasion , 18 hours after preparation , out of total 76 samples , 68 samples ( 90% ) had coliform contamination , 84% of these contaminated samples had counts greater than 10 cfu / g . also , 72 samples ( 95% ) had s. aureus contamination , 98.6% of these contaminated samples had counts greater than 10 cfu / g . in standard plate count , l. monocytogenes were detected from any samples at the time of preparation and 18 hours after storage in the wards . number of contaminated hospital - prepared tube feeding samples in three intensive care units , at the time of food preparation and 18 hrs after preparation in recent years , there has been a significant shift in the use of enteral nutrition over parenteral nutrition.1922 using enteral nutrition can greatly impact the functional and structural integrity of the gastrointestinal tract.2023 one potential complication of enteral feeding , is microbial contamination of the solution . enteral feeding solutions support the growth of a wide variety of microorganisms , creating a risk factor for many patients . many studies have associated nosocomial infections , namely diarrhea , bacteremia and pneumonia to contamination of enteral feeding . due to the increasing amounts of nosocomial infections occurring as a result of contaminated tube feeding formulas , recent guidelines of food and drug administration ( 2006 ) regarding microbial quality of medical foods , including tube feeding formulas , stated that action must be taken if any such products contain more than 10 cfu / g or if three or more samples exceeded 10 cfu / g . also they limit the acceptable level of coliforms to 3 organisms / gram.24 according to the parenteral and enteral nutrition group of british dietetic association , the critical limit for total microbial counts of tube feeding samples is 10 cfu / g at the start of administration and less than 10 cfu / g at the end.25 the spanish legislation limits the s. aureus count to 10 organisms / gram.6 using a definition of unacceptable contamination as a standard plate count greater than 10 cfu / g , the results of present study show that 98.6% of the foods were unacceptably contaminated at the time of preparation and 18 hours after preparation . also , 72% and 92% of all samples had unacceptable counts for coliforms and s. aureus , respectively ( table 2 ) . similar study on bacterial contamination of hospital - prepared tube feeding formulas in saudi arabia indicated that nearly all samples had aerobic plate counts greater than 10 cfu / g . it also reported maximum coliform counts of about 50 cfu / g.13 the results of the present study show much higher maximum level of coliform contamination of about 4.110 cfu / g at the time of administration ( table 1 ) . poor hand hygiene and handling procedures are identified as the main source of microbial contamination.26 the occurrence of coliforms in tube feeding samples receiving heat treatment indicates poor hygienic condition.1427 the presence of high s. aureus counts ( maximum count of 4.210 cfu / g ) in sample may also indicates poor hygienic condition of the personnel . in the philippines , 75% to 96% of blenderized tube feeding samples were reported to have standard plate counts greater than 10 cfu / g.1228 these results are also similar to our finding . the results of this study show significant increase in bacterial counts in the period of storing at wards ( table 1 ) . the maximum level of standard plate counts , coliform and s. aureus counts significantly increased 18 hours after preparation and reached to 1.110 cfu / g , 1.510 cfu / g and 4.210 cfu / g , respectively , which indicates the poor hygienic conditions or more contamination of feeds during storage in the wards . temperature abuse of feeds during storage in the wards is the other possibility which may allow exponential growth of bacteria in feeds . regular measurement of refrigerator temperature ( results are not shown ) in three wards indicates that average temperature was above 9.9c . note that 0 to 7c has been suggested as a proper temperature of domestic refrigerator.14 moreover , in some occasions , the feeds kept outside refrigerator for a long time . similarly , other studies have also demonstrated substantial increase in bacterial counts over time ( baseline of 10 -10 cfu / ml , increasing to 10 -10 cfu / ml over 8 hrs).329 in the present study , an attempt also was made to isolate two important foodborne pathogens . listeria monocytogenes which is considered as a foodborne pathogen is able to cause meningitis , encephalitis , septicemia , endocarditis , abortion , premature birth , abscesses and local petulant lesions.30 although listeriosis occurs infrequently , the mortality rate is high , up to 75% in high risk persons such as immunocompromised people suffering from cancer , aids , etc.31 although , the presence of l. monocytogenes has been reported in a wide variety of foods in iran,32 we were not able to isolate any listeria from food samples . as far as our knowledge , similar to our findings , listeria has not been yet detected from tube feeding formulas . salmonella is a causative agent of foodborne diarrheal disease worldwide.33 salmonellosis remains a major public health problem in many parts of the world34 including iran.35 salmonella enteritidis contamination of enteral tube feeding has been already reported.36 in contrast , we were not able to detect salmonella from 152 tube feeding samples anderton et al ( 1993 ) highlighted both the main sources of contamination and possible determinal effects of administrating contaminated feeds to patients . main sources of food contamination include the feed ingredients , administration systems and their design , mishandling during assembly of systems , inadequate cleaned equipments , kitchen and ward environment , personnel and patients themselves.37 recently , mathus - viegen et al ( 2006 ) also studied sites of bacterial contamination of enteral feeding system.38 in order to reduce microbial contamination of enteral tube feeding , various multidisciplinary approaches have been used.3940 for example , hazard analysis critical control points ( haccp ) system is internationally recognized as the best method of assuring product safety by controlling foodborne safety hazards . in a study , haccp system was implemented for improvement of microbial quality of enteral tube feeding in a hospital , and when the control measures applied and monitored , the bacterial counts in feeds reduced from 10 cfu / ml to < 10 cfu / ml.41 the results of present study indicate that the microbial quality of the majority of blenderized enteral tube feedings in both hospitals is not within published guidelines for safety . it is also important to note that there are no microbiological criteria or recommendation for tube feeding formula in iran . the data we presented , demonstrate that it is urgent to assure strict hygienic methods including the development of protocols for clean techniques in the preparation , handling and storage of feeds and cleaning and sanitization of preparation equipments . in addition , recommendations for microbial quality of enteral tube feeding need to be made by authorities . in conclusion the implementation of haccp system will be required in a near future for better quality control of enteral nutrition formulas . the use of commercial products may also provide an additional margin of safety for hospitalized patients . mj carried out the design and coordinated the study , participated in most of the experiments and prepared the manuscript . | background : hospital - prepared tube feedings from three intensive care units of two hospitals in isfahan , iran were analyzed for microbial contamination.methods:a total number of 152 samples ( 76 samples each at the time of preparation and 18 hours following preparation ) were collected .
standard plate count , coliform count and staphylococcus aureus count for all samples were conducted .
samples were analyzed also for the presence of salmonella spp . and
listeria spp.results:at the time of food preparation , out of 76 samples , 53 samples ( 70% ) had coliform contamination and 87% of these contaminated samples had counts greater than 101 cfu / g . also , 68 samples ( 90% ) had s. aureus contamination greater than 101 cfu / g .
in standard plate count , 74 samples ( 97% ) had counts greater than 103 cfu / g , while 54 samples ( 71% ) had counts greater than 104 cfu / g . in second sampling occasion ,
out of 76 samples , 68 samples ( 90% ) had coliform contamination and 84% of these contaminated samples had counts greater than 101 cfu / g . also , 72 samples ( 95% ) had s. aureus contamination , 98.6% of these contaminated samples had counts greater than 102 cfu / g . in standard plate count , 74 samples ( 97% ) had counts greater than 104 cfu / g .
no salmonella or listeria was detected from samples.conclusions:the results indicated that a majority of the blenderized enteral tube feedings in those hospitals are not safe . in comparison to the standard limits , these enteral tube feedings
are highly contaminated and posed substantial risk for developing a foodborne disease or nosocomial infection . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
kawasaki disease ( kd ) is an acute inflammatory illness that affects young children and is characterized by persistent fever , various kinds of rashes , conjunctivitis , inflammation of mucous membranes , swollen erythematous hands and feet , and cervical lymphadenopathy ( 1 , 2 ) . the cause of kd is unknown ; epidemiologic data suggest it may be an infectious agent , but intensive searches for such an agent have been unsuccessful . the use of intravenous immunoglobulin ( ivig ) with aspirin is standard treatment and in most patients diminishes inflammation and vasculitis rapidly enough to prevent the development of coronary artery lesions ( 3 ) . coronary artery abnormalities such as aneurysms or ectasia develop in 3 - 5% of patients following treatment with ivig and high - dose aspirin ( 4 , 5 ) . without proper treatment , coronary artery aneurysms or ectasia the administration of high - dose ivig reduces both the duration of fever and the incidence of coronary artery aneurysms , but approximately 10 - 20% of patients have persistent or recurrent fever despite ivig ( 8 , 9 ) . some clinicians advocate re - treatment with ivig or administration of pulsed steroids in children with persistent and recurrent fever or worsening echocardiography ( 8 , 9 ) . we retrospectively analyzed all children admitted with kd to determine the occurrence and variables associated with the initial ivig treatment failure , and categorized differences in clinical characteristics between responders and nonresponders to initial ivig treatment . patients who were admitted to the department of pediatrics , kyung hee university hospital , seoul , korea between march 1995 and april 2004 and who satisfied the criteria for kd ( 10 ) were enrolled in this study . we included patients whose fever persisted more than 3 days who met other criteria , even though they did not meet all the clinical criteria initially . all patients were initially treated with 2 g / kg ivig during a 10 - 12 hr period , and aspirin ( 80 - 100 mg / kg / day in divided doses ) was administered until the second week of treatment or until the fever subsided , after which it was reduced to 3 - 5 mg / kg / day . group a included patients who received a single dose of ivig treatment and responded ( defined as defervescence by 48 hr after ivig and no return of fever ( > 37.8 ) for at least 7 days after ivig , with marked improvement or normalization of principal clinical findings ) ( 8 , 9 ) . group b included 18 patients who received more than two doses of ivig due to failure of the initial treatment . this nonresponse was defined as the return of fever and one or more of the initial symptoms that led to the diagnosis of kd within 2 to 7 days of treatment with ivig ( 8 , 9 ) . eighteen patients who were admitted to our hospital between march 1995 and april 2004 were included in group b. we reviewed the clinical characteristics of kd patients in groups a and b , and we also analyzed laboratory parameters measured before and after the use of ivig in both groups . these tests were repeated approximately at 1 - 2 weeks and at 7 - 10 weeks after diagnosis . definitions of coronary dilatation and aneurysm were based on published criteria ( 11 , 12 ) : 1 ) a coronary artery luminal diameter of at least 3 mm in a child < 5 yr old , or at least 4 mm in a child 5 yr ; 2 ) an internal diameter of a segment at least 1.5 times as large as that of an adjacent segment ; or 3 ) a clearly irregular lumen . the differences between the two groups were assessed by using an unpaired t - test and the mann - whitney u test , using spss 12.0 for windows . patients who were admitted to the department of pediatrics , kyung hee university hospital , seoul , korea between march 1995 and april 2004 and who satisfied the criteria for kd ( 10 ) were enrolled in this study . we included patients whose fever persisted more than 3 days who met other criteria , even though they did not meet all the clinical criteria initially . all patients were initially treated with 2 g / kg ivig during a 10 - 12 hr period , and aspirin ( 80 - 100 mg / kg / day in divided doses ) was administered until the second week of treatment or until the fever subsided , after which it was reduced to 3 - 5 mg / kg / day . group a included patients who received a single dose of ivig treatment and responded ( defined as defervescence by 48 hr after ivig and no return of fever ( > 37.8 ) for at least 7 days after ivig , with marked improvement or normalization of principal clinical findings ) ( 8 , 9 ) . group b included 18 patients who received more than two doses of ivig due to failure of the initial treatment . this nonresponse was defined as the return of fever and one or more of the initial symptoms that led to the diagnosis of kd within 2 to 7 days of treatment with ivig ( 8 , 9 ) . eighteen patients who were admitted to our hospital between march 1995 and april 2004 were included in group b. we reviewed the clinical characteristics of kd patients in groups a and b , and we also analyzed laboratory parameters measured before and after the use of ivig in both groups . these tests were repeated approximately at 1 - 2 weeks and at 7 - 10 weeks after diagnosis . definitions of coronary dilatation and aneurysm were based on published criteria ( 11 , 12 ) : 1 ) a coronary artery luminal diameter of at least 3 mm in a child < 5 yr old , or at least 4 mm in a child 5 yr ; 2 ) an internal diameter of a segment at least 1.5 times as large as that of an adjacent segment ; or 3 ) a clearly irregular lumen . the differences between the two groups were assessed by using an unpaired t - test and the mann - whitney u test , using spss 12.0 for windows . a total of 51 patients were enrolled in our study . of these 51 , 34 ( 66.7% ) were boys . there were 33 patients in group a who received a single dose of ivig , and 18 patients in group b who required more than two doses of ivig . in group b , 4 patients did not initially respond and 14 others had return of fever and symptoms ( 2 - 7 days after initial treatment ) . fifteen ( 83.3% ) of the 18 patients in group b who required the second dose of ivig responded well . the mean duration of fever in group a was 10.368.24 hr after initial treatment , whereas it was 120.7280.26 hr in group b. the mean duration of fever before initial treatment in group a was 150.9179.41 hr , and in group b it was 123.5855.92 hr . as we expected , the mean duration of fever after initial treatment in group b was significantly longer than it was in group a. laboratory results on admission for both groups are listed in table 2 . there were no differences between the groups in age , sex , hemoglobin , hematocrit , total leukocyte count , erythrocyte sedimentation rate ( esr ) , c - reactive protein ( crp ) , total protein , albumin , alanine aminotransferase ( alt ) , or the harada score before ivig treatment . although the total numbers of white blood cells ( wbc ) and hemoglobin values were not different between groups , group b had a higher percentage of polymorphonuclear cells ( pmn ) ( 80.8310.24% , p=0.003 ) , and a lower platelet count ( 326.67100.68 10/l , p=0.043 ) when compared with those ( 69.114.7% , 393.64114.42 10/l , respectively ) of group a. group b also had a higher serum total bilirubin level ( 2.752.13 mg / dl , p=0.000 ) when compared with that ( 1.261.24 mg / dl ) of group a. group b also had higher serum aspartate aminotransferase ( ast ) values ( 138.59165.81 iu / l , p=0.027 ) when compared with that of group a ( 65.4581.44 -glutamyl transpeptidase ( -gtp ) and lactate dehydrogenase ( ld ) levels were excluded because the data in group b were insufficient . in our retrospective series of 18 patients in group b , we report that higher bilirubin , ast , pmn ( % ) , and lower platelet values at baseline are independent predictors of persistent or recurrent fever in patients with kd . laboratory results from both groups usually 48 hr after ivig treatment are listed in table 3 . contrary to the laboratory results before ivig treatment , there were no differences between the groups in platelet count , ast , alt , and crp after the ivig treatment . after ivig treatment , group b had lower hemoglobin , higher total leukocyte counts , higher percentages of pmn , higher esrs , lower total protein and albumin levels , and higher bilirubin levels . somewhat contrary to previous studies , it seems that in both groups a higher percentage of pmn , lower platelet count , higher bilirubin level , and higher ast value were associated with the requirement for more than two doses of ivig , before ivig was administered . the high platelet count , a characteristic laboratory finding in kd , is not likely to be associated with additional ivig treatment . coronary artery abnormalities that developed during the acute phase and subacute phase were found in 8 patients ( 44.4% ) in group b and in two patients ( 6.1% ) in group a. in five of eight patients in group b , the abnormality developed in the acute phase , and in the other three it developed in the subacute phase . the remaining one patient did not receive a follow - up echocardiographic examination , and another patient still had a coronary aneurysm . there were two patients in group a who developed coronary artery aneurysms , and both returned to normal in the convalescent phase . since first reported in 1972 , the number of cases of kd has increased continuously , including two epidemics , and thus kd is now recognized as an important and common childhood illness in our country ( 13 ) . the average incidence of 86.4/100,000 children < 5 yr old in south korea is second only to that of 134.2 in japan ( 14 ) . in spite of the effectiveness of ivig treatment in the acute phase of kd ( 4 , 5 , 15 ) , approximately 10 - 20% of patients experience a persistent or recurrent fever despite initial ivig treatment ( 8 , 9 ) . despite the use of standard ivig regimens , fever persists for more than 3 days after treatment in 20 - 30% of children ( 5 ) . these cases have been referred to as " nonresponders to ivig " , or " initial treatment failure " , or " ivig resistance " , or " the re - treatment group " ( 4 , 8 , 15 - 20 ) . the patients with persistent or recurrent fever could be at greatest risk of developing coronary artery aneurysms . it is certain that the febrile phase of the disease is significantly longer in children with coronary aneurysms ( 21 , 22 ) . if we could identify the factors related to patients with nonresponse to ivig at admission , we could predict the need for subsequent re - treatment or the risk of subsequent development of aneurysm . we found that there were 18 patients who did not respond to initial doses of ivig . the average proportion of nonresponders to ivig in our study was 7.1% ( 2.2 - 11.5% ) from 2001 to 2004 . ( 18 ) in 2003 ( 11.6% ) . a multicenter , retrospective study ( 16 ) concluded that persistent or recrudescent fever after the first course of ivig was associated with an increased risk of treatment failure . the other definition of treatment failure , that of wallace et al . ( 19 ) , is the return of fever and one or more of the initial symptoms that led to the diagnosis of kd within 2 to 7 days of treatment with ivig . coronary artery abnormalities that developed during the acute phase and subacute phase were found in eight patients ( 44.4% ) among the nonresponders to ivig ( group b ) and in two patients ( 6.1% ) among the responders to ivig ( group a ) . these percentages are somewhat high compared with those in a previous paper ( 19 ) that reported that nearly 23% of patients with kd may require re - treatment and 8% may develop coronary aneurysm . however , hashino et al . ( 15 ) in 2001 reported a high probability ( 48.6% ) of developing coronary artery lesions in ivig nonresponders , and fukunishi et al . ( 17 ) in 2000 reported that the incidence of coronary artery aneurysm among nonresponders was 38.5% . there was no difference in age , sex , duration of symptoms prior to treatment , initial crp , esr , or the presence of an abnormal initial echocardiogram between initial responders and nonresponders ( 18 , 19 , 21 ) . these findings are somewhat similar to our results in that there were no significant differences in age , sex , body - weight , and duration of fever before administration of ivig between responders and nonresponders to ivig . it is a natural result that the duration of fever after the initial ivig administration was much longer in the nonresponding group than in the responding group . an interesting finding , which we did not analyze statistically , was the unusually high occurrence ( 94.4% ) of cervical lymph node enlargement in the nonresponding group in spite of the fact that cervical lymphadenitis is the least common of the principal clinical features of kd . we report that a higher bilirubin level , higher ast level , higher percentage of pmn , and a lower platelet count those that of the responding group at baseline were all independent predictors of persistent or recurrent fever in patients with kd . these patients could be given more ivig . after ivig treatment , group b had lower hemoglobin , higher total leukocyte counts , higher percentages of pmn , higher esrs , lower total protein and albumin levels , and higher bilirubin levels . these significant differences in group b could be related to the suggestion of additional risk findings of the occurrence of coronary artery lesions . many authors ( 4 , 18 , 23 ) have agreed that increased white blood cell and neutrophil counts and increased crp concentration after ivig treatment are risk factors for coronary artery lesions . however , we found no association of crp concentration , which measured at admission and usually 48 hr after ivig treatment , with failure of initial ivig treatment . these results maybe associated with shorter febrile days before ivig treatment compared with previous papers ( 17 , 18 , 29 , 30 ) because of more or less low crp levels . we found also no correlation between age , gender , and days since starting ivig treatment , with failure of the initial ivig treatment . in the present study , a lower platelet count in the nonresponding group at baseline was an independent predictor of persistent or recurrent fever with possible coronary complications . ( 24 ) explained that the reason thrombocytopenia is associated with kd is that the increased platelet turnover occurs during the activation of coagulation in the early phase of the disease . other parameters of anemia , left shift , and low platelet count secondary to increased platelet turnover presumably reflect increased release of inflammatory mediators and worsened vascular inflammation ( 25 , 26 ) . ( 17 ) first reported that biliary tract - associated parameters such as total bilirubin and -gtp , which probably reflect inflammation of the bile duct , were not previously found to be associated with a high risk for development of coronary artery lesions . also , the levels of ast / alt were higher in nonresponders , but this was not clinically statistically significant . although we did not examine -gtp and lactate dehydrogenase levels , we found significantly elevated serum ast activity , and elevated direct and total bilirubin levels in the nonresponding group at the baseline examination . we found that serum alt was elevated , but this difference was not statistically significant . serum alt activity was elevated in approximately one - third of kd patients , and 18% had levels exceeding 100 u / l . a case - comparison study ( 27 ) reported that elevated serum alt activity was much more frequently observed at the time of initial evaluation and diagnosis of kd . a nationwide epidemiologic study in japan ( 28 ) demonstrated a relationship between the level of serum transaminase and the development of cardiac disorders . the elevation of the alt in kd patients is associated with the development of cardiac disorders . the proportion of those without cardiac disorders with an alt of 50 iu / i or more was 36% . an alt of 50 iu / i or more was noted in 49% of the patients with transient cardiac conditions and 52% of those with persistent cardiac disorders . it was proved that the elevation of the serum alt at the initial examination was related to the complications of both transient and persistent cardiac disorders . in conclusion , we found that a higher bilirubin level , higher ast level , higher percentage of pmn , and lower platelet count than those of the responder group at baseline were independent predictors of persistent or recurrent fever in patients with kd . the patients who did not respond to initial ivig treatment had a higher probability ( 44.4% ) of developing coronary artery abnormalities . the optimal re - treatment dose of ivig and treatment guidelines should be determined for this small group of nonresponders to ivig . | the aims of this study were to determine the occurrence and variables associated with the initial intravenous immunoglobulin ( ivig ) treatment failure in kawasaki disease ( kd ) and to categorize differences in clinical characteristics between responders and nonresponders to initial ivig treatment .
patients were classified into two groups .
group a included 33 patients who received a single dose of ivig treatment and responded .
group b included 18 patients who received more than two doses of ivig due to failure of the initial treatment .
the mean duration of fever after initial treatment in group b was significantly longer than it was in group a. in group b , we found that higher bilirubin , aspartate aminotransferase ( ast ) , polymorphonuclear cells ( pmn ) ( % ) , and lower platelet values at baseline were independent predictors of persistent or recurrent fever in patients with kd .
coronary artery abnormalities were found in 8 patients ( 44.4% ) in group b and in two patients ( 6.1% ) in group a. we found that abnormal liver function tests and a lower platelet count at baseline were possible predictors of nonresponders to ivig in patients with kd .
there is a need for a prospective study focused on baseline hepatobiliary parameters . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it has been recognized that cardiac autonomic nervous system activity is of great significance in the initiation and maintenance of atrial fibrillation ( af ) . stimulation or inhibition of selective extracardiac neural structures may be a useful therapeutic option for cardiac arrhythmias , including af , and other abnormalities . as the major part of the intrinsic cardiac autonomic nervous system , most cardiac ganglionated plexus ( gps ) embedded in the fat pad around 4 pulmonary veins ( pvs ) , play an important role in the early stage of af.1 increased gp activity can induce the increase of both parasympathetic and sympathetic activity , which promotes rapid focal firing in the pv myocardium.2 , 3 clinical evidence also suggests that additional gp ablation to pv isolation could increase success rates in eliminating af.4 , 5
as a tetrodotoxinresistant periphery nerve voltagegated sodium channel , nav1.8 ( encoded by scn10a ) plays a significant part in the upstroke of action potential in neurons , and is responsible for repetitive firing.6 it is found primarily expressed in small and mediumdiameter nociceptive sensory neurons , which mediate pain perception.7 genomewide association study highlights the role of nav1.8 in cardiac conduction and arrhythmic diseases . in addition to the canonical cardiac sodium channel nav1.5/scn5a , nav1.8 is recently considered a new cardiac sodium channel.8
scn10a is adjacent to scn5a on the same chromosome , and there is 70.4% of similarity in the amino acid sequence between these 2 sodium channels . our previous research shows nav1.8 could physically interact with nav1.5 by using coimmunoprecipitation when both are expressed in vitro.9 others prove that nav1.8 could modulate the activity and expression of nav1.5 at the transcriptional level , which may be intermediated by tbx3/5.10 , 11
increasing evidence indicates that nav1.8/scn10a plays a critical role in af . both common and rare variants of scn10a were associated with the risk of af.12 , 13 some rare scn10a variants have been identified in patients with earlyonset af ( rs141207048 , rs202143516 , rs202192818 , rs139861061 , et al ) , and the relevant mechanism implied by functional study in vitro might be through the modulation of peak sodium current ( ina , p ) and late sodium current ( ina , l ) of nav1.8.14 certain common variants , such as rs6795970 , have been proved to be related to af susceptibility.12 , 13 one recent study has suggested that blockade of nav1.8 suppresses vagalmediated af most likely by inhibiting the neural activity of gp.15 however , the exact electrophysiological role of nav1.8 in af , especially at the early stage of acute af , is uncertain , and the relevant mechanisms still need to be assessed . in this study , we aim to explore the expression of nav1.8 and nav1.5 in canine cardiac ganglia , and to evaluate the role of the nav1.8 blocker a803467 in cardiac gp in an acute af canine model . we have further investigated the changes of the channel density and kinetic characteristics in the presence of a803467 when the scn5a and scn10a coexpressed in vitro , which might provide the potential mechanism to explain its effect in a canine af model . experiments were approved by the animal ethics committee of wuhan university under approval number 20150072 and followed the guidelines outlined by the care and use of laboratory animals of the national institutes of health . sixteen mongrel dogs weighing from 20 to 25 kg were included in this study . surgeries were performed under anesthesia with sodium pentobarbital with an initial dose of 50 mg / kg and an additional dose of 2 mg / kg per hour . bilateral thoracotomy was conducted at the fourth intercostal space , as previously described16 , 17 ( figure 1a and 1b ) . in brief , multielectrode catheters were sutured to obtain recordings at the surface of the atrium and pvs and to pace at the left atrial appendage ( laa ) . all recordings were displayed on a computerized bard electrophysiology system ( cr bard inc , billerica , ma ) . highfrequency stimulation ( 20 hz , 0.1 ms duration , square waves ) was applied at the fat pad to identify gps by a bipolar electrode stimulator ( grasss88 ; astromed , west warwick , ri ) . anterior right ganglionated plexi ( argp ) was located at the rspvatrial junction and superior left ganglionated plexi ( slgp ) at the left superior pv ( lspv)atrial junction . a successful gp stimulation was marked at the 50% sinus rate slowing or second or thirddegree atrioventricular block developing . schematic catheter positions in the atria and pulmonary veins and representative traces . a , left thoracotomy approach . electrode catheters were sutured to the left superior pulmonary vein ( lspv ) , left inferior pulmonary vein ( lipv ) , left atrium ( la ) , left atrial appendage ( laa ) , right superior pulmonary vein ( rspv ) , right inferior pulmonary vein ( ripv ) , right atrium ( ra ) , and right atrial appendage ( raa ) . argp indicates anterior right ganglionated plexi ; ilgp , inferior left ganglionated plexi ; irgp , inferior right ganglionated plexi ; ivc , inferior vena cava ; lpa , left pulmonary artery ; lv , left ventricle ; slgp , superior left ganglionated plexi ; svc , superior vena cava ; rv , right ventricle . c and d , representative traces in the electrophysiological study before and after administrating a803467 at ganglionated plexus . two groups were set in this study based on injecting saline ( 0.5 ml per gp ) or the selective nav1.8 blocker a803467 ( 1 mol/0.5 ml per gp ) into both argp and slgp . after drug administrating , rap was delivered at the laa ( 20 hz , 10 diastolic threshold ) for 6 hours . at the end of rap , targeted parameterseffective refractory period ( erp ) and window of vulnerability ( wov ) were evaluated as previously described.16 , 18 briefly , we measured erp by using s1s1 programmed stimulating at 330 ms interval and s1s2 interval from 150 ms with decrementing at 10 and 1 ms when approaching the refractory period ( s1:s2=8:1 , 10 th ) . to delineate af inducibility , erp dispersion was assessed as the coefficient of variation of erp at all 8 recording sites . af was defined as irregular atrial rates related with irregular atrioventricular conduction at more than 500 bpm lasting at least 5 seconds . af cycle length was measured as the averaged first 10 fibrillation waves at the onset of af . the number of af episodes and averaged af duration were also recorded at each group . representative traces in the electrophysiological study before and after administrating a803467 at gps are shown in figure 1c and figure 1d . cardiac ganglia were quickly obtained from 3 canine heart fat pads located at the atria posterior wall . after that , they were placed into normal krebs solution in ice , dissected under a stereomicroscope , and put into liquid nitrogen for flash freezing . cryosections from embedded ganglia tissue were fixed in 4% paraformaldehyde for 10 minutes , permeabilized in 0.3% triton x100 in pbs for 15 minutes , and all blocked in 5% donkey serum for 30 minutes at room temperature . tissue sections were incubated at 4c overnight with primary antibody specific for rabbit polyclonal antinav1.8 ( alomone labs , jerusalem , israel ) , rabbit polyclonal antinav1.5 ( alomone labs , jerusalem , israel ) , goat polyclonal antipgp9.5 ( abcam , cambridge , ma ) , goat polyclonal anticholine acetyltransferase ( chat , chemicon international , temecula , canada ) , and mouse monoclonal antityrosine hydroxylase ( th , alpha diagnostic international , san antonio , tx ) . alexa 488conjugated secondary antibody was then added according to a different source of primary antibody and incubated for 90 minutes at room temperature . stained samples were visualized under an olympus fluoview laser scanning confocal microscope ( olympus , orangeburg , ny ) . tsa201 cells transfected with scn5a , scn10a , and scn3b plasmids were used for patch clamp study . a plasmid encoding egfp was used to identify transfected cells . briefly , transient transfection using fugene 6 ( roche diagnostics , indianapolis , indiana ) was carried out with scn10a , scn5a , and scn3b with a molar ratio of 5:5:1 ( for a total of 2.25 g of dna ) . 15140 ] , life technologies ) on polylysinecoated 35 mm culture dishes ( cell+ , sarstedt , newton , nc ) . cells were placed in a 5% co2 incubator at 37c for 24 to 48 hours prior to patch clamp study . all recordings were obtained at room temperature ( 2022c ) using an axopatch 200b amplifier equipped with a cv201a head stage ( axon instruments inc./molecular devices , union city , ca ) . currents were filtered with a 4pole bessel filter at 5 khz and digitized at 50 khz . series resistance was compensated at around 80% to assure that the command potential was reached within microseconds with a voltage error < 2 mv . cells were allowed to stabilize for 10 minutes after establishment of the wholecell configuration before current was measured . macroscopic wholecell na+ current was recorded by using bath solution perfusion containing ( in mmol / l ) 140 nacl , 4 kcl , 1.8 cacl2 , 1 mgcl2 , 10 hepes , and 10 dextrose ( ph 7.35 with naoh ) . osmolarity was adjusted to 310 mmol / kg with sucrose . patch pipettes were fabricated from 1.5 mm od borosilicate glass capillaries ( fisher scientific inc , hampton , nh ) . they were pulled using a gravity puller ( model pp830 , narishige international usa , inc , east meadow , ny ) to obtain resistances between 0.8 and 2.2 m when filled with a pipette solution containing ( in mmol / l ) 10 naf , 105 csf , 20 cscl , 2 egta , and 10 hepes with a ph of 7.35 adjusted with csoh and an osmolality of 300 mmol / kg with sucrose . specific voltageclamp protocols assessing channel activation and fast inactivation were used , as depicted in the figure insets . cardiac sodium channel current ( ina ) was elicited by depolarizing pulses ranging from 90 to + 40 mv in 5 mv increments with a holding potential of 120 mv . peak currents ( ina , p ) were measured and ina densities ( pa / pf ) were attained by dividing the obtained cell capacitance . activation properties were determined from i / v relationships by normalizing ina , p to driving force and maximal ina , and plotting normalized conductance versus vm . voltage dependence of steadystate inactivation was obtained by plotting the normalized ina , p ( 40ms test pulse to 0 mv after a 1000ms conditioning pulse from 140 to 10 mv with the holding potential of 120 mv ) versus vm . the steadystate channel availability and inactivation curves were fitted to the boltzmann equation , i / imax=1/(1+exp((vv1/2)/ ) ) , to determine the membrane potential for halfmaximal activation / inactivation ( v1/2 ) and the slope factor ( ) . pulses for recovery from inactivation were of 100 ms duration for p1 and 50 ms for p2 . the peak current elicited during the second pulse was normalized to the value obtained during the initial test pulse . it was analyzed by fitting data to a double exponential function : i(t)/imax = af(1exp(t/f))+as(1exp(t/s ) ) , where af and as are the fractions of fast and slow inactivating components , respectively , and f and s are their time constants . all data acquisition and analysis were performed using pclamp version 9.2 ( molecular devices , sunnyvale , ca ) , excel ( microsoft , redmond , wa ) , and origin 7.5 ( microcal software , ge healthcare , pittsburgh , pa ) . experiments were approved by the animal ethics committee of wuhan university under approval number 20150072 and followed the guidelines outlined by the care and use of laboratory animals of the national institutes of health . sixteen mongrel dogs weighing from 20 to 25 kg were included in this study . surgeries were performed under anesthesia with sodium pentobarbital with an initial dose of 50 mg / kg and an additional dose of 2 mg / kg per hour . bilateral thoracotomy was conducted at the fourth intercostal space , as previously described16 , 17 ( figure 1a and 1b ) . in brief , multielectrode catheters were sutured to obtain recordings at the surface of the atrium and pvs and to pace at the left atrial appendage ( laa ) . all recordings were displayed on a computerized bard electrophysiology system ( cr bard inc , billerica , ma ) . highfrequency stimulation ( 20 hz , 0.1 ms duration , square waves ) was applied at the fat pad to identify gps by a bipolar electrode stimulator ( grasss88 ; astromed , west warwick , ri ) . anterior right ganglionated plexi ( argp ) was located at the rspvatrial junction and superior left ganglionated plexi ( slgp ) at the left superior pv ( lspv)atrial junction . a successful gp stimulation was marked at the 50% sinus rate slowing or second or thirddegree atrioventricular block developing . schematic catheter positions in the atria and pulmonary veins and representative traces . a , left thoracotomy approach . electrode catheters were sutured to the left superior pulmonary vein ( lspv ) , left inferior pulmonary vein ( lipv ) , left atrium ( la ) , left atrial appendage ( laa ) , right superior pulmonary vein ( rspv ) , right inferior pulmonary vein ( ripv ) , right atrium ( ra ) , and right atrial appendage ( raa ) . argp indicates anterior right ganglionated plexi ; ilgp , inferior left ganglionated plexi ; irgp , inferior right ganglionated plexi ; ivc , inferior vena cava ; lpa , left pulmonary artery ; lv , left ventricle ; slgp , superior left ganglionated plexi ; svc , superior vena cava ; rv , right ventricle . c and d , representative traces in the electrophysiological study before and after administrating a803467 at ganglionated plexus . two groups were set in this study based on injecting saline ( 0.5 ml per gp ) or the selective nav1.8 blocker a803467 ( 1 mol/0.5 ml per gp ) into both argp and slgp . after drug administrating , rap was delivered at the laa ( 20 hz , 10 diastolic threshold ) for 6 hours . at the end of rap , targeted parameterseffective refractory period ( erp ) and window of vulnerability ( wov ) were evaluated as previously described.16 , 18 briefly , we measured erp by using s1s1 programmed stimulating at 330 ms interval and s1s2 interval from 150 ms with decrementing at 10 and 1 ms when approaching the refractory period ( s1:s2=8:1 , 10 th ) . to delineate af inducibility , erp dispersion was assessed as the coefficient of variation of erp at all 8 recording sites . af was defined as irregular atrial rates related with irregular atrioventricular conduction at more than 500 bpm lasting at least 5 seconds . af cycle length was measured as the averaged first 10 fibrillation waves at the onset of af . the number of af episodes and averaged af duration were also recorded at each group . representative traces in the electrophysiological study before and after administrating a803467 at gps are shown in figure 1c and figure 1d . cardiac ganglia were quickly obtained from 3 canine heart fat pads located at the atria posterior wall . after that , they were placed into normal krebs solution in ice , dissected under a stereomicroscope , and put into liquid nitrogen for flash freezing . cryosections from embedded ganglia tissue were fixed in 4% paraformaldehyde for 10 minutes , permeabilized in 0.3% triton x100 in pbs for 15 minutes , and all blocked in 5% donkey serum for 30 minutes at room temperature . tissue sections were incubated at 4c overnight with primary antibody specific for rabbit polyclonal antinav1.8 ( alomone labs , jerusalem , israel ) , rabbit polyclonal antinav1.5 ( alomone labs , jerusalem , israel ) , goat polyclonal antipgp9.5 ( abcam , cambridge , ma ) , goat polyclonal anticholine acetyltransferase ( chat , chemicon international , temecula , canada ) , and mouse monoclonal antityrosine hydroxylase ( th , alpha diagnostic international , san antonio , tx ) . alexa 488conjugated secondary antibody was then added according to a different source of primary antibody and incubated for 90 minutes at room temperature . stained samples were visualized under an olympus fluoview laser scanning confocal microscope ( olympus , orangeburg , ny ) . tsa201 cells transfected with scn5a , scn10a , and scn3b plasmids were used for patch clamp study . a plasmid encoding egfp was used to identify transfected cells . briefly , transient transfection using fugene 6 ( roche diagnostics , indianapolis , indiana ) was carried out with scn10a , scn5a , and scn3b with a molar ratio of 5:5:1 ( for a total of 2.25 g of dna ) . 15140 ] , life technologies ) on polylysinecoated 35 mm culture dishes ( cell+ , sarstedt , newton , nc ) . cells were placed in a 5% co2 incubator at 37c for 24 to 48 hours prior to patch clamp study . all recordings were obtained at room temperature ( 2022c ) using an axopatch 200b amplifier equipped with a cv201a head stage ( axon instruments inc./molecular devices , union city , ca ) . currents were filtered with a 4pole bessel filter at 5 khz and digitized at 50 khz . series resistance was compensated at around 80% to assure that the command potential was reached within microseconds with a voltage error < 2 mv . cells were allowed to stabilize for 10 minutes after establishment of the wholecell configuration before current was measured . macroscopic wholecell na+ current was recorded by using bath solution perfusion containing ( in mmol / l ) 140 nacl , 4 kcl , 1.8 cacl2 , 1 mgcl2 , 10 hepes , and 10 dextrose ( ph 7.35 with naoh ) . osmolarity was adjusted to 310 mmol / kg with sucrose . patch pipettes were fabricated from 1.5 mm od borosilicate glass capillaries ( fisher scientific inc , hampton , nh ) . they were pulled using a gravity puller ( model pp830 , narishige international usa , inc , east meadow , ny ) to obtain resistances between 0.8 and 2.2 m when filled with a pipette solution containing ( in mmol / l ) 10 naf , 105 csf , 20 cscl , 2 egta , and 10 hepes with a ph of 7.35 adjusted with csoh and an osmolality of 300 mmol / kg with sucrose . specific voltageclamp protocols assessing channel activation and fast inactivation were used , as depicted in the figure insets . cardiac sodium channel current ( ina ) was elicited by depolarizing pulses ranging from 90 to + 40 mv in 5 mv increments with a holding potential of 120 mv . peak currents ( ina , p ) were measured and ina densities ( pa / pf ) were attained by dividing the obtained cell capacitance . activation properties were determined from i / v relationships by normalizing ina , p to driving force and maximal ina , and plotting normalized conductance versus vm . voltage dependence of steadystate inactivation was obtained by plotting the normalized ina , p ( 40ms test pulse to 0 mv after a 1000ms conditioning pulse from 140 to 10 mv with the holding potential of 120 mv ) versus vm . the steadystate channel availability and inactivation curves were fitted to the boltzmann equation , i / imax=1/(1+exp((vv1/2)/ ) ) , to determine the membrane potential for halfmaximal activation / inactivation ( v1/2 ) and the slope factor ( ) . pulses for recovery from inactivation were of 100 ms duration for p1 and 50 ms for p2 . the peak current elicited during the second pulse was normalized to the value obtained during the initial test pulse . it was analyzed by fitting data to a double exponential function : i(t)/imax = af(1exp(t/f))+as(1exp(t/s ) ) , where af and as are the fractions of fast and slow inactivating components , respectively , and f and s are their time constants . all data acquisition and analysis were performed using pclamp version 9.2 ( molecular devices , sunnyvale , ca ) , excel ( microsoft , redmond , wa ) , and origin 7.5 ( microcal software , ge healthcare , pittsburgh , pa ) . as shown in figure 2 , adult canine cardiac ganglias were partially dissected and labeled by neuron marker pgp9.5 , th , and chat . both adrenergic and cholinergic neurons can be found in those ganglias ( figure 2 g through 2j ) . staining of nav1.8 and nav1.5 separately proved their expression on canine gp ( figure 2a through 2d ) . the 2 sodium channels can be observed in both membrane and cytoplasm under high magnification and no significant differences were found in regard to the channel distribution in adrenergic and cholinergic neurons ( data not shown ) . immunochemical study of nav1.8 , nav1.5 , pgp9.5 , anticholine acetyltransferase ( chat ) , and antityrosine hydroxylase ( th ) in partial dissected intracardiac ganglia . protein expression of nav1.8 ( a and b ) , nav1.5 ( c and d ) , pgp9.5 ( e and f ) , chat ( g and h ) , and th ( i and j ) present in intracardiac ganglia . calibration bars in ( a through d ) are 20 m and in ( e through j ) are 50 m . representative traces in the electrophysiological study before and after administrating a803467 at gps are displayed in figure 1c and figure 1d . mean erp at baseline between the control and a803467 groups was similar at all 8 recording sites ( 97.986.86 versus 97.957.30 ms , p>0.05 , 10x threshold ) . after administrating saline or a803467 , respectively , to the 2 groups at argp and slgp , rapid pacing was implemented at laa . the erps were reevaluated at the end of 6hour rap by the same protocol . compared with the control group , the shortening of erp at all pv and atrial sites was suppressed in the a803467 group ( figure 3 , p<0.05 ) . mean effective refractory period ( erp ) values are shown at all 8 recording sites in 2 study groups . at all sites ( a through h ) , mean erp decreased significantly after 6 hours of rap ( not significant [ ns ] , p>0.05 ; * p<0.05 , vs rap+saline at the same time point ) . la indicates left atrium ; lipv , left inferior pulmonary vein ; lspv , left superior pulmonary vein ; ra , right atrium ; raa , right atrial appendage ; ripv , right inferior pulmonary vein ; rspv , right superior pulmonary vein . erp dispersion and cumulative wov ( wov ) were calculated and af inducibility was compared between the 2 groups before and after rap . no baseline differences at erp dispersion or wov were found between the 2 groups before rap ( erp dispersion : 0.150.15 versus 0.140.13 ms ; wov : 19.303.51 versus 18.132.34 ms ; p>0.05 [ figure 4d and 4e ] ) . after 6hour rap , both erp dispersion and wov were significantly increased in the control group . however , injecting a803467 at gps attenuated the increase in erp dispersion and wov apparently at all sites , underlying the decrease in af inducibility ( figure 4d and 4e , erp dispersion : 0.290.15 versus 0.150.13 , wov : 180.7020.47 versus 21.645.84 ms ; p<0.01 ) . changes in programmed stimulating parameters in 2 groups before and after 6hour rapid atrial pacing ( rap ) . a through c , atrial fibrillation ( af ) duration , cycle length , and episodes after 6hour rap . d and e , effective refractory period ( erp ) dispersion and cumulative window of vulnerability ( wov ) changes at baseline ( 0 hour ) and after 6hour rap . not significant ( ns ) , p>0.05 ; * p<0.05 ; * * p<0.01 vs rap+saline at the same time point . in rap+saline , rap resulted in significant decreases in erp and increases in erp dispersion , wov , and af inducibility . in rap+a803467 , however , these changes were significantly attenuated . after 6hour rap , spontaneous af occurred in 7 dogs in the control group ( n=8 ) , whereas it occurred in only 2 dogs in the a803467 group ( n=8 ) , with an incidence of 87.50% versus 25.0% ( figure 4c ) . in addition , administrating a803467 can also shorten af duration and prolong af cycle length in contrast to that in the control group ( af duration : 47.0510.45 seconds versus 18.186.59 seconds , p<0.05 ; af cycle length : 79.211.24 versus 129.7717.41 ms , p<0.05 [ figure 4a and 4b ] ) . previous reports have shown the abundant expression of 3 subunit ( scn3b ) in dorsal root ganglion neurons and have emphasized that the 3 subunit can promote the trafficking of nav1.8 and help its expression on membrane in comparison to other subunits without changing gating properties.19 , 20 based on that , scn5ascn10ascn3bwt was cotransfected into tsa201 cells in the present study to depict the electrophysiological characteristics of the sodium channel composed of scn5ascn10a under 100 nmol / l a803467 . a significant reduction was shown with 100 nmol / l a803467 on the currentvoltage relationship , whereas no difference was found at the same concentration with scn5ascn3bwt ( figure 5a ) . other and our previous results have reported the extremely low current density when scn10a was transfected into tsa201 cells , with or without sodium subunit.9 , 21 hence , the blocking effect of a803467 was not performed on scn10ascn3bwt transfected tsa201 cells . electrophysiological effect of a803467 at 100 nmol / l on scn10ascn5ascn3b coexpressed tsa201 cells . a , representative in
a , p traces in scn5awt
+ scn3bwt transfected cells , and scn10awt
+ scn5awt
+ scn3bwt cotransfected cells with and without 100 nmol / l a803467 separately . b and c , currentvoltage relationship and in
a , p current density depicting in
a , p recording from coexpression of scn10awt
+ scn5awt
+ scn3bwt before and after perfusing with 100 nmol / l a803467 . d , representative traces and blocking effect of 100 nmol / l a803467 on in
a , l , as the percentage of in
a , p . * p<0.05 compared 2 groups . e , comparison of normalized current of in
a , p and in
a , l between the control and a803467 100 nmol / l groups . a803467 reduced maximum ina , p by 45% ( ina , p , from 758.77173.48 to 414.7592.44 pa / pf , n=8 ; p<0.01 ) with similar iv curve ( ina , p amplitudes at 35 mv ) between the control and a803467 groups ( figure 5b and 5c ) . in addition , ina , l was measured under 100 nmol / l a803467 between 295 and 300 ms by the test pulse at 20 mv from hp of 120 mv at the rate of 0.2 hz ( figure 5d ) . relative ina , l ( percentage of ina , p ) decreased from 0.52% to 0.20% . the inhibitions of ina , p and ina , l under the same protocol were also compared . both the ina , p and ina , l in control conditions were regarded as 100% . as presented in figure 5e , after applying a803467 , a more pronounced inhibition with ina , l than ina , p was shown : ina , p was decreased 42.023.88% and ina , l was decreased 68.575.86% ( n=8 for each group , p=0.02 ) . figure 6a shows a hyperpolarized shift of steadystate inactivation by the influence of 100 nmol / l a803467 under a 100 ms prepulse to various potentials in 10 mv step followed by a 20 ms test pulse to 0 mv . a803467 caused a prominent negative shift of the v1/2 of inactivation from 83.762.38 to 95.773.20 mv ( n=12 , p<0.05 ) , predicting less availability of channels open at physiological resting potential or sustained depolarization with the drug . as shown in figure 6b and the table , there was no significant difference in steadystate activation before and after applying the drug ( v1/2 : 49.522.74 and 51.951.38 mv , n=12 [ p=0.44 ] ; : 5.210.48 and 5.780.24 , n=12 [ p=0.30 ] ) . effect of a803467 at 100 nmol / l on the kinetics of scn10ascn5ascn3b coexpressed tsa201 cells . a , steadystate inactivation curves for the control and a803467 groups . administrating a803467 can hyperpolarize the inactivation curve by 10 mv ( p<0.05 ) . boltzmann analysis showed that the slope factor ( ) and the halfactivation potential did not differ significantly between groups . c , representative recovery traces elicited from 120 mv holding potential to 100 ms inactivating pulse followed by variable duration ( 11480 ms ) to allow the recovery with and without a803467 . d , effects of a803467 on recovery from inactivation between the 2 groups by 2 exponential fitting . both fast and slow time constants were increased after applying a803467 . effects of a803467 on the kinetics gating parameters in scn10ascn5ascn3b coexpression tsa201 cells parameters of inactivation and activation were calculated from the boltzmann function . v1/2 is the voltage for halfmaximal availability or activation and is the slope factor . recovery from inactivation was also assessed before and after drug administration by using a standard 2pulse protocol : first test 10 mv for 100 ms then recovering at 120 mv for a various duration before a second pulse at 10 mv for 50 ms . as displayed in the representative traces ( figure 6c ) , both the fast ( f ) and slow ( s ) time constants were much slower in the presence of 100 nmol / l a803467 ( f : 2.870.38 versus 6.460.58 , n=14 [ p<0.01 ] ; s : 20.510.61 versus 64.3715.47 , n=14 [ p=0.01 ] , figure 6d , table ) . for further study , usedependent block ( udb ) was investigated in the absence and presence of a803467 via a series of 40 pulses to 20 mv from 120 mv holding potential at the rate of 1 , 2 , and 10 hz . the proportion of the 40th and first current amplitudes was compared between control and drug conditions under these 3 different frequencies . for the control group , the proportions of ina , p were 97.38% , 95.80% , and 93.89% , and for the drug were 95.95% , 89.81% , and 83.96% , at the rate of 1 , 2 , and 10 hz , respectively ( figure 7b ) . the inhibition effect of a803467 was more evident at faster rates ( reduction at 1/2/10 hz was 3.68%/6.06%/12.78% , n=9 [ p<0.01 ] ) . both traces of the 2 conditions were positioned at the same scale so that the noticeable reduction under drug influence was more obvious in comparison . together with the inhibition of recovery from inactivation , a803467 may interact with the inactivated state of these sodium channels . figure 7d shows the relative current proportion of ina , l at 20 mv in the rate of 2 hz . in the control condition l than that in ina , p , with 68.993.67% versus 95.801.75% remaining after the 40th pulse . when the drug was applied , the value of ina , l and ina , p decreased to 60.643.98% and 89.432.06% ( reduced rate of ina , l versus ina , p ; 1204% versus 62% , n=8 for each group [ p=0.04 ] ) . the result indicates preferential udb of a803467 on ina , l than ina , p . usedependent block ( udb ) in the control and a803467 100 nmol / l groups . pulse duration was 20 ms , and the holding potential was 120 mv and given at a rate of 0.1 seconds ( 10 hz ) . c , udb of in
a , p in the control and a803467 groups at 1 , 2 , and 10 hz . d , udb of in
a , l in the control and a803467 groups at 2 hz . as shown in figure 2 , adult canine cardiac ganglias were partially dissected and labeled by neuron marker pgp9.5 , th , and chat . both adrenergic and cholinergic neurons can be found in those ganglias ( figure 2 g through 2j ) . staining of nav1.8 and nav1.5 separately proved their expression on canine gp ( figure 2a through 2d ) . the 2 sodium channels can be observed in both membrane and cytoplasm under high magnification and no significant differences were found in regard to the channel distribution in adrenergic and cholinergic neurons ( data not shown ) . immunochemical study of nav1.8 , nav1.5 , pgp9.5 , anticholine acetyltransferase ( chat ) , and antityrosine hydroxylase ( th ) in partial dissected intracardiac ganglia . protein expression of nav1.8 ( a and b ) , nav1.5 ( c and d ) , pgp9.5 ( e and f ) , chat ( g and h ) , and th ( i and j ) present in intracardiac ganglia . calibration bars in ( a through d ) are 20 m and in ( e through j ) are 50 m . representative traces in the electrophysiological study before and after administrating a803467 at gps are displayed in figure 1c and figure 1d . mean erp at baseline between the control and a803467 groups was similar at all 8 recording sites ( 97.986.86 versus 97.957.30 ms , p>0.05 , 10x threshold ) . after administrating saline or a803467 , respectively , to the 2 groups at argp and slgp , rapid pacing was implemented at laa . the erps were reevaluated at the end of 6hour rap by the same protocol . compared with the control group , the shortening of erp at all pv and atrial sites was suppressed in the a803467 group ( figure 3 , p<0.05 ) . mean effective refractory period ( erp ) values are shown at all 8 recording sites in 2 study groups . at all sites ( a through h ) , mean erp decreased significantly after 6 hours of rap ( not significant [ ns ] , p>0.05 ; * p<0.05 , vs rap+saline at the same time point ) . la indicates left atrium ; lipv , left inferior pulmonary vein ; lspv , left superior pulmonary vein ; ra , right atrium ; raa , right atrial appendage ; ripv , right inferior pulmonary vein ; rspv , right superior pulmonary vein . erp dispersion and cumulative wov ( wov ) were calculated and af inducibility was compared between the 2 groups before and after rap . no baseline differences at erp dispersion or wov were found between the 2 groups before rap ( erp dispersion : 0.150.15 versus 0.140.13 ms ; wov : 19.303.51 versus 18.132.34 ms ; p>0.05 [ figure 4d and 4e ] ) . after 6hour rap , both erp dispersion and wov were significantly increased in the control group . however , injecting a803467 at gps attenuated the increase in erp dispersion and wov apparently at all sites , underlying the decrease in af inducibility ( figure 4d and 4e , erp dispersion : 0.290.15 versus 0.150.13 , wov : 180.7020.47 versus 21.645.84 ms ; p<0.01 ) . changes in programmed stimulating parameters in 2 groups before and after 6hour rapid atrial pacing ( rap ) . a through c , atrial fibrillation ( af ) duration , cycle length , and episodes after 6hour rap . d and e , effective refractory period ( erp ) dispersion and cumulative window of vulnerability ( wov ) changes at baseline ( 0 hour ) and after 6hour rap . not significant ( ns ) , p>0.05 ; * p<0.05 ; * * p<0.01 vs rap+saline at the same time point . in rap+saline , rap resulted in significant decreases in erp and increases in erp dispersion , wov , and af inducibility . in rap+a803467 , however , these changes were significantly attenuated . after 6hour rap , spontaneous af occurred in 7 dogs in the control group ( n=8 ) , whereas it occurred in only 2 dogs in the a803467 group ( n=8 ) , with an incidence of 87.50% versus 25.0% ( figure 4c ) . in addition , administrating a803467 can also shorten af duration and prolong af cycle length in contrast to that in the control group ( af duration : 47.0510.45 seconds versus 18.186.59 seconds , p<0.05 ; af cycle length : 79.211.24 versus 129.7717.41 ms , p<0.05 [ figure 4a and 4b ] ) . previous reports have shown the abundant expression of 3 subunit ( scn3b ) in dorsal root ganglion neurons and have emphasized that the 3 subunit can promote the trafficking of nav1.8 and help its expression on membrane in comparison to other subunits without changing gating properties.19 , 20 based on that , scn5ascn10ascn3bwt was cotransfected into tsa201 cells in the present study to depict the electrophysiological characteristics of the sodium channel composed of scn5ascn10a under 100 nmol / l a803467 . a significant reduction was shown with 100 nmol / l a803467 on the currentvoltage relationship , whereas no difference was found at the same concentration with scn5ascn3bwt ( figure 5a ) . other and our previous results have reported the extremely low current density when scn10a was transfected into tsa201 cells , with or without sodium subunit.9 , 21 hence , the blocking effect of a803467 was not performed on scn10ascn3bwt transfected tsa201 cells . electrophysiological effect of a803467 at 100 nmol / l on scn10ascn5ascn3b coexpressed tsa201 cells . a , representative in
a , p traces in scn5awt
+ scn3bwt transfected cells , and scn10awt
+ scn5awt
+ scn3bwt cotransfected cells with and without 100 nmol / l a803467 separately . b and c , currentvoltage relationship and in
a , p current density depicting in
a , p recording from coexpression of scn10awt
+ scn5awt
+ scn3bwt before and after perfusing with 100 nmol / l a803467 . * p<0.05 compared 2 groups . d , representative traces and blocking effect of 100 nmol / l a803467 on in
a , l , as the percentage of in
a , p . * p<0.05 compared 2 groups . e , comparison of normalized current of in
a , p and in
a , l between the control and a803467 100 nmol / l groups . a803467 reduced maximum ina , p by 45% ( ina , p , from 758.77173.48 to 414.7592.44 pa / pf , n=8 ; p<0.01 ) with similar iv curve ( ina , p amplitudes at 35 mv ) between the control and a803467 groups ( figure 5b and 5c ) . in addition , ina , l was measured under 100 nmol / l a803467 between 295 and 300 ms by the test pulse at 20 mv from hp of 120 mv at the rate of 0.2 hz ( figure 5d ) . relative ina , l ( percentage of ina , p ) decreased from 0.52% to 0.20% . the inhibitions of ina , p and ina , l under the same protocol were also compared . both the ina , p and ina , l in control conditions were regarded as 100% . as presented in figure 5e , after applying a803467 , a more pronounced inhibition with ina , l than ina , p was shown : ina , p was decreased 42.023.88% and ina , l was decreased 68.575.86% ( n=8 for each group , p=0.02 ) . figure 6a shows a hyperpolarized shift of steadystate inactivation by the influence of 100 nmol / l a803467 under a 100 ms prepulse to various potentials in 10 mv step followed by a 20 ms test pulse to 0 mv . a803467 caused a prominent negative shift of the v1/2 of inactivation from 83.762.38 to 95.773.20 mv ( n=12 , p<0.05 ) , predicting less availability of channels open at physiological resting potential or sustained depolarization with the drug . as shown in figure 6b and the table , there was no significant difference in steadystate activation before and after applying the drug ( v1/2 : 49.522.74 and 51.951.38 mv , n=12 [ p=0.44 ] ; : 5.210.48 and 5.780.24 , n=12 [ p=0.30 ] ) . effect of a803467 at 100 nmol / boltzmann analysis showed that the slope factor ( ) and the halfactivation potential did not differ significantly between groups . c , representative recovery traces elicited from 120 mv holding potential to 100 ms inactivating pulse followed by variable duration ( 11480 ms ) to allow the recovery with and without a803467 . d , effects of a803467 on recovery from inactivation between the 2 groups by 2 exponential fitting . effects of a803467 on the kinetics gating parameters in scn10ascn5ascn3b coexpression tsa201 cells parameters of inactivation and activation were calculated from the boltzmann function . v1/2 is the voltage for halfmaximal availability or activation and is the slope factor . recovery from inactivation was also assessed before and after drug administration by using a standard 2pulse protocol : first test 10 mv for 100 ms then recovering at 120 mv for a various duration before a second pulse at 10 mv for 50 ms . as displayed in the representative traces ( figure 6c ) , a803467 inhibited the process of recovery from inactivation . a 2exponential equation was used for fitting , and time constants were compared . both the fast ( f ) and slow ( s ) time constants were much slower in the presence of 100 nmol / l a803467 ( f : 2.870.38 versus 6.460.58 , n=14 [ p<0.01 ] ; s : 20.510.61 versus 64.3715.47 , n=14 [ p=0.01 ] , figure 6d , table ) . for further study , usedependent block ( udb ) was investigated in the absence and presence of a803467 via a series of 40 pulses to 20 mv from 120 mv holding potential at the rate of 1 , 2 , and 10 hz . the proportion of the 40th and first current amplitudes was compared between control and drug conditions under these 3 different frequencies . for the control group , the proportions of ina , p were 97.38% , 95.80% , and 93.89% , and for the drug were 95.95% , 89.81% , and 83.96% , at the rate of 1 , 2 , and 10 hz , respectively ( figure 7b ) . the inhibition effect of a803467 was more evident at faster rates ( reduction at 1/2/10 hz was 3.68%/6.06%/12.78% , n=9 [ p<0.01 ] ) . both traces of the 2 conditions were positioned at the same scale so that the noticeable reduction under drug influence was more obvious in comparison . together with the inhibition of recovery from inactivation , a803467 may interact with the inactivated state of these sodium channels . figure 7d shows the relative current proportion of ina , l at 20 mv in the rate of 2 hz . in the control condition , there was more inhibition of ina , l than that in ina , p , with 68.993.67% versus 95.801.75% remaining after the 40th pulse . when the drug was applied , the value of ina , l and ina , p decreased to 60.643.98% and 89.432.06% ( reduced rate of ina , l versus ina , p ; 1204% versus 62% , n=8 for each group [ p=0.04 ] ) . the result indicates preferential udb of a803467 on ina , l than ina , p . usedependent block ( udb ) in the control and a803467 100 nmol / l groups pulse duration was 20 ms , and the holding potential was 120 mv and given at a rate of 0.1 seconds ( 10 hz ) . c , udb of in
a , p in the control and a803467 groups at 1 , 2 , and 10 hz . d , udb of in
a , l in the control and a803467 groups at 2 hz . in this study , we demonstrate that , in a canine acute af model , pharmacological inhibition of nav1.8 on gp can prevent electrical remodeling at pv and atrial myocardium and further reduce the incidence of paroxysmal af . sodium channel properties were obviously affected by the nav1.8 blocker when scn5ascn10ascn3bwt coexpressed in vitro , which indicates a possible underlying mechanism of our animal model results . the transfected sodium channel complex with 100 nmol / l a803467 displayed decreased ina , and faster inactivation , slower recovery , and stronger udb on both ina , p and ina , l in contrast to the characteristics before the drug . one study by nattel and colleagues22 , 23 verified that gps played a vital role in the experimental af related to atrial tachycardia remodeling . compared with small effect on af vulnerability by pv isolation , gp ablation could reduce af vulnerability and attenuate af maintenance by prolonging erp , reducing af duration and dominant frequency of fibrillatory activity . in addition , gp stimulation increases vagal and sympathetic tone , which induces early afterrepolarization formation , enhances ca transient facilitating trigger activity , and shortens action potential duration , especially at pv myocardium , increasing heterogeneous repolarization and prompting substrate and reentry within atria.3 , 24 , 25 rap can shorten erp and increase erp dispersion and wov , which were all reversed after gp ablation . implementing gp ablation or autonomic blockers ( atropine or propranolol ) followed by rap can prevent induced spontaneous af and atrial electrical remodeling.26 , 27 in our study , administrating a803467 can effectively attenuate erp shortening and suppress increased erp dispersion and wov , indicating a pharmacological denervation effect by this selective nav1.8 blocker . voltagegated sodium channels are responsible for generating and propagating action potentials and are critical in neuronal firing and excitability . therefore , our results suggest that blocking nav1.8 can decrease gp firing , inhibit its activity , and prevent the initiation and maintenance of rapinduced af . similar findings were observed by qi and colleagues.15 they applied a different afinduced model by vagus nerve stimulation ( vns ) to evaluate cardiac conduction and af inducibility after injecting a803467 on argp and inferior right ganglionated plexi at the same concentration . they concluded that blockade of nav1.8 could suppress the effect of vns on sinus rate , pr interval , and ventricular rate when af occurred during vns . the values of erp in the control group after gp injection were lower than ours probably because of vns . previous study demonstrated that argp and slgp in the intrinsic cardiac autonomic nerve system collected the nerve from both vagosympathetic trunk as integration center , and either argp or slgp ablation could eliminated erp shortening during vagosympathetic trunk stimulation . it identified that argp and slgp are the main connections in the neural pathway to control intrinsic autonomic activity in af.28 therefore , ablation ( drug denervation ) of argp and slgp could be sufficient to show the effect of af prevention . in the present study , we chosen argp and slgp for injection and applied 6hour rap after injection to assess the effect of blocking nav1.8 on acute af directly . decreased erps were found in all atrium and pulmonary recording sites , which were suppressed when a803467 were administrated in advance . this could suggest that blocking nav1.8 could avoid functional substrate forming in pv myocardium , probably as a result of inhibiting gp function and atrial electrical remodeling . although we could not deny the fact that sodium pentobarbital has been reported vagolytic and may increase the erp value when applying,29 , 30 the effect of a803467 on erp in the present study is still established , since both groups were treated equally with the anesthetic to eliminate bias between groups , and the minimum dosage was used to reduce the possibility of unnecessary influence , as in our previously published studies.18 , 26 , 31 , 32
scherlag et al33 injected lidocaine into gps , leading to the loss of af inducibility in 6 of 7 dogs . our results displayed an apparent inhibition with 25.0% af incidence when applying a803467 , compared with 87.5% in the control group ( odds ratio=21.00 ) . as a class i antiarrhythmic drug and local anesthetic , lidocaine proved to have a pronounced effect in inhibiting nav1.8 current , enhancing udb , and regulating gating properties.34 a803467 , as a selective nav1.8 blocker , is used in alleviating nav1.8involved neuropathic pain . in recombinant hek293 cells , a803467 was blocked human nav1.8 ( ic50=8 nmol / l ) , and was > 100fold selective versus human nav1.2 , nav1.3 , nav1.5 , and nav1.7 ( ic50 > 1 mol / l).35 in the present study , tsa201 cells were transfected with scn5ascn10ascn3b , a803467 at 100 nmol / l potently inhibited ina , p by 42.02% , and it suppressed more in ina , l by 68.57% . gating properties were also changed under a803467 with hyperpolarized steadystate inactivation and delayed recovery from inactivation . interestingly , the leftshifted steadystate inactivation was quite consistent with the effect of a803467 in isolated mouse intracardiac neurons delineated by verkerk et al.36 like other sodium channel blockers , our results support that a803467 might block sodium channels in an inactivated state and the number of trapped inactivated sodium channels might be increased during repeated stimulation . obvious delay of recovery was displayed as 2 times slower in f and more than 3 times in s . the changes in gating properties , together with udb , indicate reduced availability of the sodium channel under sustained depolarization or repetitive stimulation , especially in a rapinduced af model . in the present study , we utilized the scn5ascn10ascn3b cotransfected model to analyze the effect of a803467 on sodium current and gating properties to provide a possible explanation for the results we found in animal experiments . compared with scn5ascn3b transfected tsa201 cells , the current density was significantly increased and was sensitive to a803467 when scn10a were added together with scn5ascn3b . since others ' and our studies have reported the extremely low current density in scn10ascn3b transfected cell lines,9 , 21 it is reasonable to deduce that the increased current is not an arithmetic addition of current component produced by scn10a . it implies that scn10a might interact with scn5a as a new sodium complex ( figure 8) , and a803467 could have an effect on scn10ascn5a complex , as indicated in our patch clamp study . although the complicated protein network of this new complex needs to be further explored , this model cells might be help us to understand the electrophysiological role of nav1.8 in arrhythmias . our previous results demonstrated the association between nav1.8 and nav1.5 at the protein level when expressed separately ex vivo.9 in the present study , a803467 have apparent effects on current density and gating kinetics when coexpressed sodium complex of scn10ascn5ascn3b , which indirectly show the functional interaction between the 2 alpha sodium units . the detailed components of the complicated sodium complex in the cytoplasm need to be specifically explored . given their proximity to one another , scn5a and scn10a may be subject to common regulatory mechanisms , such as transcriptional control by tbx3 and tbx5 . many association studies have discovered the intensive relationship between scn10a variants and af phenotype or incidence . in addition to the significant effect on gp , nav1.8 might directly influence the electrophysiological characteristics of cardiac tissue with suppressed trigger activity and reduced substrate during af ( figure 8) . the decreased current in ina , p by a803467 might prolong erp in atrium by virtue of postrepolarization refractoriness and reduce excitability at the fast rate due to udb . the significantly reduced ina , l seen in our study might suppress the incidence of early afterrepolarization during af . yang et al21 also showed that 30 nmol / l a803467 can remarkably reduce ina , l in mouse and rabbit myocytes with less effect on ina , p . in addition , the inhibition of sodium channel by a803467 can reduce na in myocytes during repolarization , which may prevent the ca loading to inhibit delay after repolarization . the suppressed trigger activity and reduced substrate could also be potential mechanisms for inhibiting af initiation and maintenance . several independent loci of scn10a were indicated to increase pr and/or qrs intervals , which were regarded as intermediate phenotypes , suggesting the risk of conduction disease and arrhythmia susceptibility.37 , 38 there is an increased number of studies that focus on the relationship of scn10a / nav1.8 with cardiac diseases . in spite of several disputes such as the expression of nav1.8 in the heart,36 , our previous study first reported 17 putative pathogenic scn10a variants in 25 of 150 brugada syndrome probands with a positive proband yield of 16.7% , approaching our historical yield of 20.1% for scn5a . subsequent studies from others also emphasize the importance of scn10a in both rare and common variants in brugada syndrome.9 one recent study concluded that rs6795970 might be associated with cardiac conduction abnormalities in patients with hypertrophic cardiomyopathy.40 therefore , it has come a long way as the new cardiac sodium channel , and the exact roles of nav1.8 in arrhythmia still have a long way to go . it can be considered as a novel target in understanding cardiac electrophysiology , and its selective blocker or other relative drug might be promising in scn10arelated arrhythmias . we did not record gp activity directly in our rapinduced canine af model in the absence or presence of a803467 . however , previous studies have demonstrated that blocking gp activity can inhibit rapinduced atrial electrical remodeling and af inducibility . after we administrated a803467 in gps , the shortening of the erp in all recording sites and the increase in erp dispersion and wov were all attenuated , potently indicating the suppressed gp activity under the effect of a803467 . since neurotransmission is not static and circumscribed , the nav1.8 blockade within the gps on af can have effects throughout the cardiac neuraxis . due to the plasticity in the nervous system , based on present data , we can not deduce that the observed effects may be limited only to the gps . meanwhile , our previous study showed the colocalization of nav1.5 and nav1.8 when we transfected their cdna separately into tsa201 cells . it would be more desirable if we could demonstrate this relationship in canine gp directly . however , our patch clamp study displayed that scn5a could evidently increase scn10a current in tsa201 cells , which can be blocked by a803467 . we did not record gp activity directly in our rapinduced canine af model in the absence or presence of a803467 . however , previous studies have demonstrated that blocking gp activity can inhibit rapinduced atrial electrical remodeling and af inducibility . after we administrated a803467 in gps , the shortening of the erp in all recording sites and the increase in erp dispersion and wov were all attenuated , potently indicating the suppressed gp activity under the effect of a803467 . since neurotransmission is not static and circumscribed , the nav1.8 blockade within the gps on af can have effects throughout the cardiac neuraxis . due to the plasticity in the nervous system , based on present data , we can not deduce that the observed effects may be limited only to the gps . meanwhile , our previous study showed the colocalization of nav1.5 and nav1.8 when we transfected their cdna separately into tsa201 cells . it would be more desirable if we could demonstrate this relationship in canine gp directly . however , our patch clamp study displayed that scn5a could evidently increase scn10a current in tsa201 cells , which can be blocked by a803467 . in the present study , we found that the nav1.8 selective inhibitor could decrease the incidence of acute af with suppressed electrical remodeling of atrial and pv myocardium in a rapinduced af model . nav1.8 could be a promising target in early af , as gp activity were more important in early electrical remodeling process of af begets af compared with progressed stages with prominent fibrosis and structural remodeling . in addition , we displayed that nav1.8 could probably interact with nav1.5 , which may form a novel functional complex affecting cardiomyocyte and ( or ) cardiac gp properties , as shown in figure 8 . and it could be supported by our electrophysiological study with noticeable changes in ina and gating kinetics under a803467 . this study was supported by national natural science foundation of china ( no . 81670304 ) , china ; independent research project of wuhan university ( no . 2042016kf0138 ) , china ; national natural science foundation of china ( no . 81530011 ) , china ; and the masons of new york , florida , massachusetts , connecticut , maryland , wisconsin , and rhode island , usa . | backgroundganglionated plexus have been developed as additional ablation targets to improve the outcome of atrial fibrillation ( af ) besides pulmonary vein isolation .
recent studies implicated an intimate relationship between neuronal sodium channel nav1.8 ( encoded by scn10a ) and af .
the underlying mechanism between nav1.8 and af remains unclear .
this study aimed to determine the role of nav1.8 in cardiac electrophysiology in an acute af model and explore possible therapeutic targets.methods and resultsimmunohistochemical study was used on canine cardiac ganglionated plexus .
both nav1.5 and nav1.8 were expressed in ganglionated plexus with canonical neuronal markers .
sixteen canines were randomly administered either saline or the nav1.8 blocker a803467 .
electrophysiological study was compared between the 2 groups before and after 6hour rapid atrial pacing .
compared with the control group , administration of a803467 decreased the incidence of af ( 87.5% versus 25.0% , p<0.05 ) , shortened af duration , and prolonged af cycle length .
a803467 also significantly suppressed the decrease in the effective refractory period and the increase in effective refractory period dispersion and cumulative window of vulnerability caused by rapid atrial pacing in all recording sites .
patch clamp study was performed under 100 nmol / l a803467 in tsa201 cells cotransfected with scn10awt , scn5awt , and scn3bwt . in
a ,
p was reduced by 45.34% at 35 mv , and in
a , l by 68.57% at 20 mv .
evident fast inactivation , slow recovery , and usedependent block were also discovered after applying the drug.conclusionsour study demonstrates that nav1.8 could exert its effect on electrophysiological characteristics through cardiac ganglionated plexus .
it indicates that nav1.8 is a novel target in understanding cardiac electrophysiology and scn10arelated arrhythmias . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the world health organization reported the reemergence of cholera as a major infectious disease which posed a global threat to public health , especially in developing countries . in 2009 , cholera recorded a fatality rate of 2.24% from a total of 221,226 reported cases . sporadic outbreaks of cholera can happen in any areas with inadequate supply of water , sanitation , food safety , and hygiene practices . outbreaks of cholera have been reported since the dawn of ancient civilization in the ganges delta , india . although vibrio cholerae is the causal agent for cholera , it is noteworthy that only a small number of v. cholerae are capable of producing cholera toxin which causes the clinical symptom presented as acute diarrhea , commonly known as rice water stool . water is recognised as the main mode of cholera transmission in areas where clean and adequate water supply is limited . in countries where potable water is available v. cholerae have been reported to cause several outbreaks which implicated food contaminated with v. cholerae ol , but person - to - person transmission is uncommon . outbreaks have been reported to be associated with the consumption of raw or undercooked seafood , and this has been recognized to be a very important factor contributing to foodborne cholera . however , other food such as contaminated cooked rice and fresh produce had also been reported [ 8 , 9 ] . ready - to - eat ( rte ) foods can be contaminated with vibrio following poor hygiene practices by food handlers [ 1012 ] , and the organism can multiply rapidly at ambient temperatures . rice is a staple food in the southeast asian countries and is thus a main source for v. cholerae contamination . there is currently very little known regarding the survivability of v. cholerae in various types of cooked rice and beverages that are commonly found in malaysia . our previous study had reported on the survival pattern of v. cholerae o1 on three types of rice kept in an opened container , and the current study aims to investigate the survivability of v. cholerae o1 in different preparations of cooked rice , as well as the common beverages tea and coffee , along with other ingredients in an enclosed container . this study will provide useful information with regards to v. cholerae behaviour in food and beverages that are common in malaysia . as such , the intervention and proper practices can be determined to reduce the risk of cholera outbreak by food handlers , especially street foods . the bacterium was kept in glycerol stock ( 20c ) and was used throughout this study . v. cholerae o1 from a stock culture was streaked onto tcbs agar and incubated at 37c for 24 h. isolated v. cholerae colony was inoculated into alkaline peptone water and incubated in shaker incubator ( 150 rpm ) ( infors ht ecotron , basel , switzerland ) at 37c for 22 h. the culture was centrifuged , and the bacterial pellet was resuspended in phosphate - buffered saline ( pbs ) . absorbance of the bacterial suspension at 625-nm wavelength was adjusted to a reading of 1.89 , which corresponded to about 5 10 cfu / ml . each dilution was plated in triplicates , and the plates were incubated at 37c for 24 h. yellow colonies on replicate plates were counted and expressed as mean v. cholerae cfu per ( g / ml ) . plain rice was prepared using 5 g of white rice washed twice with 10 ml of sterile distilled water . the washed rice was transferred to a large test tube , then 8 ml of sterile distilled water was added , and the mixture was cooked in a beaker with boiling water . the cooked rice with coconut milk was prepared using 5 ml of distilled water together with 3 ml of coconut milk while the cooked rice with ginger used 8 ml of distilled water together with 0.1 g of ginger . the time taken to cook the rice in boiling water was about 15 min for the white rice . all cooked rice preparations were left in an incubator ( infors ht ecotron ) to cool down to 27c . plain coffee was prepared by adding 1 g of instant coffee powder into 100 ml of boiled distilled water . coffee with sucrose ( hereafter referred to as sugar ) was prepared using 1 g of instant coffee powder with 7 g of sugar in 100 ml of boiled distilled water , while coffee with condensed milk was prepared using 1 g of instant coffee powder with 15 g of condensed milk in 100 ml of boiled distilled water . all the coffee preparations were left in the incubator ( infors ht ecotron ) to cool down to 27c . plain tea was prepared by adding 1 g of loose black tea to 100 ml of boiled distilled water . tea with sugar was prepared using 1 g of loose black tea together with 5 g of sugar in 100 ml of boiled distilled water , while tea with condensed milk was prepared using 1 g of loose black tea together with 15 g of condensed milk in 100 ml of boiled distilled water . all the tea preparations were left in the incubator ( infors ht ecotron ) to cool down to 27c . three grams of the cooked rice was transferred to each of the five universal bottles . an estimated 1 10 cfu of v. cholerae in 20 l of pbs was dispensed randomly as small droplets on each of the rice clumps for incubation time of 0 , 1 , 3 , 6 , and 24 h at 27c in the incubator ( infors ht ecotron ) . the bottles were loosely capped . immediately after the last sample was inoculated ( 0 h exposure ) , 5 ml of pbs was added to the bottle and the rice grains in it were mixed by vortex for 1 min . determination of viable counts of v. cholerae was performed with 100 l of serial diluted rice suspension on tcbs agar . the same procedure was performed with the remaining inoculated samples after 1 , 3 , 6 , and 24 h of incubation time . v. cholerae inoculated into empty bottles were kept under similar conditions to serve as control . ten millilitres of the prepared coffee ( or tea ) was transferred to each of the five universal bottles . an estimated 1 10 cfu of v. cholerae in 20 l of pbs was inoculated into the coffee ( or tea ) for incubation time of 0 , 1 , 3 , and 6 h at 27c in incubator ( infors ht ecotron ) . immediately after the last sample was inoculated ( 0 h exposure ) , the sample was mixed by vortex for 1 min . determination of viable counts of v. cholerae was performed with 100 l of serial diluted coffee ( or tea ) suspension on tcbs agar . the same procedure was performed with the remaining inoculated samples after 1 , 3 , and 6 h of incubation time . v. cholerae inoculated into 10 ml of sterile distilled water was kept under similar conditions and served as a control . four replicated experiments were performed on each coffee ( or tea ) preparation . the ph and aw of cooked rice , coffee , and tea were taken using ph 211 microprocessor ph meter ( hanna instrument , india ) and hygrolab 3 bench ( rotronic instrument corp . the data were analyzed using kruskal - wallis one - way analysis of variance and mann - whitney u test . figure 1 shows the survival of v. cholerae inoculated onto three types of cooked rice . v. cholerae survived well in the enclosed empty bottle which was used as the control where its survivability was stable up to 6 h before declining significantly ( p < 0.05 ) after 24 h incubation . there was no statistically significant difference up to 6 h incubation for all test samples ( control , plain rice , rice with coconut milk , and rice with ginger ) . there was significant growth ( p < 0.05 ) of v. cholerae on plain rice , rice with coconut milk , and rice with ginger after 24 h incubation . however , there was no significant difference of v. cholerae survivability with regards to the ingredients added . the mean ph recorded for the plain rice , rice with coconut milk , and rice with ginger was 5.34 0.02 , 5.63 0.02 and 5.28 0.02 , respectively . mean aw recorded for the plain rice , rice with coconut milk , and rice with ginger were all 0.99 0.00 . the survival of v. cholerae inoculated in three types of coffee preparation is shown in figure 2 . v. cholerae survived poorly in the control sterile distilled water with no detectable v. cholerae after 1 h incubation . an immediate inactivation of v. cholerae was observed in plain coffee with no detection of the organism at 0 h. v. cholerae was only detected at 0 h in coffee with sugar while longer survival ( up to 3 h ) was observed in coffee with condensed milk . there was no v. cholerae detected after 6 h incubation in all preparations of coffee . the mean ph recorded for the plain coffee , coffee with sugar , and coffee with condensed milk was 4.68 0.02 , 4.81 0.01 , and 6.01 0.02 , respectively . an immediate inactivation of v. cholerae was observed in plain tea with no detection of the organism at 0 h. v. cholerae was only detected at 0 h in tea with sugar while longer survival ( up to 6 h ) was observed in tea with condensed milk . the mean ph recorded for the plain tea , tea with sugar , and tea with condensed milk was 5.18 0.01 , 5.29 0.01 , and 6.10 0.02 , respectively , whereas the mean aw recorded for the three tea preparations were 0.99 0.00 . this study revealed that v. cholerae o1 was able to survive in street food and beverages commonly found in malaysia . studies have shown that poor food handling had resulted in numerous cases of food contamination with pathogens which eventually resulted in outbreaks . our previous study had shown that rice was able to support the growth of v. cholerae o1 . several reports also showed the relationship between rice and cholera outbreaks [ 9 , 1416 ] . nasi lemak is a popular local food that uses coconut milk and ginger as the ingredients for cooking the rice , and it has been implicated in several cholera outbreaks in malaysia . studies have reported that zingerone and shogaols in ginger have antimicrobial properties against staphylococcus aureus , streptococcus pyogenes , salmonella enterica serovar typhi , and v. cholerae [ 1719 ] . however , the amount of ginger that has been added to the rice sample may be too small to show any significant inhibition of v. cholerae in the present study . in the present study , plain coffee showed instant inactivation of v. cholerae o1 , and this may be due to the acidic nature of coffee . according to the public health agency of canada , v. cholerae can grow very fast under optimum conditions which include ph from 5.00 to 9.60 and water activity of approximately 0.97 to 0.99 . other factors that could inhibit the growth of v. cholerae o1 in plain coffee may be the presence of antimicrobial components such as caffeine , volatile and nonvolatile organic acid , phenols , and other aromatic compounds [ 2224 ] . studies have shown that the coffee extracts were capable of inhibiting bacteria such as escherichia coli , s. aureus , and streptococcus mutans [ 2224 ] . reported that instant coffee possessed high antimicrobial compound in which the acid extract of coffee during roasting process showed significant antibacterial properties . the relative survival of v. cholerae o1 was affected by the addition of sugar in the coffee . v. cholerae o1 survived up to 1 h in the coffee added with sugar that contains 99.5 to 99.9% pure sucrose . felsenfeld reported that the presence of sucrose is favourable for the survival of the vibrios . however , the survival of v. cholerae o1 in coffee with sugar did not exceed one hour . in contrast , v. cholerae o1 survived up to 3 hours period in the coffee added with condensed milk . an increase in ph to 6.01 of coffee with condensed milk might contribute to the better survival of v. cholerae as studies discovered that the near - neutral ph facilitates the survival and multiplication of v. cholerae with increasing ph . tea has been well known for its antioxidant and antimicrobial properties [ 20 , 27 , 28 ] . the antimicrobial properties of tea are found in its polyphenol fractions , in particular the compounds epicatechin gallate ( ecg ) and epigallocatechin gallate ( egcg ) . v. cholerae was not detected after inoculation into the plain tea probably because of the antimicrobial properties of the tea itself [ 20 , 27 , 28 ] . rabbani and greenough iii discussed the physicochemical characteristics of foods that support the survival and growth of v. cholerae o1 which include neutral or an alkaline ph , low temperature , and high - organic content . this was proven in this study as v. cholerae was not detectable in the acidic condition ( ph 5.18 ) of the tea samples . nevertheless , the addition of sugar and condensed milk in tea had improved the survival of v. cholerae in the tea as observed in this study . as a conclusion , this study clearly showed that v. cholerae is able to survive for an extended period of time in rice and coffee or tea that has been prepared with condensed milk , which are popular street food and beverages in malaysia . poor hygiene in food and beverage preparations by food handlers may result in cross - contamination that is made worse as the contaminated food ( especially rice ) is usually held at ambient temperatures for long periods of time , thereby allowing the pathogens to multiply rapidly before the detectable spoilage sign is observed . | this study aimed to investigate the survival of vibrio cholerae o1 in 3 types of preparation for cooked rice , oryza sativa l. , ( plain rice , rice with coconut milk , and rice with ginger ) ; coffee , coffea canephora , ( plain coffee , coffee with sugar , and coffee with sweetened condensed milk ) ; and tea , camellia sinensis , ( plain tea , tea with sugar , and tea with sweetened condensed milk ) held at room temperature ( 27c ) .
the survival of v. cholerae o1 was determined by spread plate method on tcbs agar .
initial cultures of 8.00 log cfu / ml were inoculated into each food sample .
after 6 h incubation , significant growth was only detected in rice with coconut milk ( 9.67 log cfu / ml ; p < 0.05 ) . however , all 3 types of rice preparation showed significant growth of v. cholerae after 24 h ( p < 0.05 ) . for coffee and tea preparations ,
v. cholerae survived up to 6 h in tea with condensed milk ( 4.72 log cfu / ml ) but not in similar preparation of coffee .
this study showed evidence for the survivability of v. cholerae in rice , coffee , and tea .
thus , holding these food and beverages for an extended period of time at room temperature should be avoided . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the program was funded by the australian government department of health and aging , and developed and implemented by trauma , disaster and health promotion experts from the australian centre for posttraumatic mental health ( acpmh ) , the mater hospital brisbane and beyondblue as part of the victorian government s bushfire psychosocial recovery plan . key activities of the program included : formation of expert advisory and reference groups comprised of key government and non - government stakeholders to provide oversight and advice on the development and implementation of the program , including integration with other initiatives and existing resources extensive consultation with disaster recovery experts and key personnel from government and non - government organizations to assist with developing the program the target audience was lay people from the general community including people with a high community profile such as those working in disaster support and recovery roles , and members of local sporting and community organizations . the learning objectives for participants were : to improve their knowledge of different psychological responses , common mental health problems , and individual , family and community - level reactions following disaster to increase confidence in their abilities to detect clues that someone may be having difficulties coping , to ask questions and listen to that person , and to provide support to them to improve their knowledge of how and when to refer people to professional support and of local services and supports . the face - to - face training sessions were educational and provided an opportunity for discussion , reflection , and skill development . versions of the program that were available were of 90 , 120 , and 180 min duration . the structure and duration of the program was designed to best meet the needs of community members , many of whom were dealing with demanding practical issues . following the training , participants were supported via newsletters and emails for a further three to six months to reinforce key competencies and information about available services . the program materials developed included : a facilitator manual which included advice on preparing to run a session and engaging with local communities , session plans and schedules , and sample responses to frequently asked questions a participant manual which included useful information on disaster recovery and mental health supports participant handouts to provide advice on recovery from disaster audiovisual materials , including powerpoint slides and a dvd of interviews with survivors of previous bushfires posters and other promotional materials a webpage with training session dates and resources . the promotion of the program within disaster - affected communities relied upon a community development approach that included proactive and sensitive engagement and collaboration with key community agencies such as local recovery committees , primary health services , and community and sporting clubs . nine facilitators were recruited and formally trained and accredited in a single day to prepare them to run the training sessions . facilitator prerequisites were a tertiary mental health qualification ; two years minimum experience as a mental health practitioner ; and previous experience of facilitating training sessions in community settings . prior to each training session , the project manager , facilitator and local host held a teleconference to brief the facilitator on local issues and the planned session . a meal was often provided to create an opportunity for community members to meet others in an informal way . following each training session , the project manager contacted the facilitator to review proceedings and offer support and advice . participants learnt about common psychological and relationship problems ( including risk and protective factors ) following disaster , with the aim of reducing stigma and improving understanding and empathy for others in the community . in order to develop greater confidence and better skills to listen to and assist others , the program encouraged participants to consider and rehearse what they would say and do when approaching someone . the focus for participants was on assisting others , including active listening and encouraging them to seek professional help if necessary , rather than becoming experts in mental health diagnosis or treatment . some simple tips discussed with participants to help them initiate and manage a conversation with another person included : start with practical questions such as how is the clean - up coming along ? try to normalize the person s distress to encourage them to talk , for example you could say how are you managing ? choose a time to talk when you are less likely to be interrupted and when you are available to spend some time with the person there is no right thing to say , but try not to talk too much about yourself or use conversation stoppers such as you should think yourself lucky , it could have been worse if you identify that the person needs extra help , such as showing signs of a mental health problem , then the priority is to refer them to local services for assistance . participants were given the opportunity to rehearse opening lines when approaching someone , and were encouraged to incorporate these simple tips when initiating conversations with fellow community members . to evaluate the effectiveness of the program , participants were asked to complete an anonymous survey to obtain pre and post - training self - report ratings by participants on key competencies tied to the learning objectives of the training session , and post - training ratings on the quality of the session and materials . ratings of key competencies were provided on a four - point scale : 1 = very little or none , 2 = a little , 3 = quite a bit , and 4 = a great deal . paired samples t - tests were conducted to compare pre- and post - training participant ratings , and cohen s d was calculated as a measure of the standardized difference between rating means at the two time - points . in total , 51 training sessions were attended by 909 community members from april 2009 to december 2010 . surveys were completed by 462 ( 80.1% ) of 577 eligible people who attended one of 39 sessions run between august 2009 and october 2010 . the mean age of participants was 48.1 y ( sd = 12.9 ) and the majority ( 60.4% ) were women . thirty - three ( 84.6% ) of the training sessions delivered were of 180 min duration . comparisons between community members pre- and post - training ratings showed substantial and significant increases in knowledge of post - disaster reactions and mental health problems ; confidence in abilities to detect difficulties coping in others and to provide assistance ; and knowledge of available services and supports and how and when to refer someone ( see table 1 ) . cohen s d values ranged from 0.55 to 0.75 which are indicative of moderate to large effect sizes . the similarity of scores for all items at both respective time - points may be indicative of response bias , such as the general tendency to avoid extreme response options . in addition , a typical pre - training mean score of 2.5 on a four - point scale may have inadvertently led to a ceiling effect on the post - training ratings . note . sd , standard deviation ; scores for items 1 to 8 ranged from 1(very little or none ) to 4 ( a great deal ) . the large majority of community members who attended the program rated the quality of the program and materials highly , with at least 98% indicating that they agreed or strongly agreed with the following : the session was interesting ; the information was clearly provided ; the discussion was useful ; there was enough time for questions ; the participant manual was user - friendly ; and a willingness to recommend the program to others . the study findings provide support for the community support training program as a beneficial , acceptable and feasible community - level intervention as part of a coordinated and early mental health response to communities affected by the 2009 victorian bushfires . reports from community members indicated that the program increased key competencies to help them recognize when others may be having difficulties coping and to provide them with care and assistance . in addition , the quality of the program was rated very highly by the large number of people who attended local training sessions in the aftermath of a natural disaster . the acceptability of the program is further supported by the finding that almost all participants reported that they would recommend the program to others . a limitation of the study is the lack of follow - up data to determine whether or not the training resulted in sustained improvement of participants competencies , and whether or not the training program resulted in participants providing more or improved assistance to others at risk of mental health problems . to address this limitation , we are seeking to undertake a more extensive evaluation of the program that incorporates more direct assessment of community members competencies and helping behaviors at follow - up . ideally , more sophisticated testing of the effectiveness of the training program would include a control or comparison group using an experimental research design . first , the program demonstrated that there are excellent opportunities for governments to partner with non - government agencies and local communities on disaster mental health training programs for community members . second , the delivery of the program used a community development approach that relied upon collaboration with existing community networks and recovery systems in order to facilitate delivery of the program by local trainers . this type of approach is consistent with wider efforts to protect and develop the adaptive capacities of disaster - affected communities . third , quality assurance measures for this program included governance arrangements to ensure coordination and integration with other disaster recovery initiatives and existing resources ; design of the training sessions and materials by an expert group comprised of trauma , disaster and health promotion experts ; and recruitment of trainers who met minimum prerequisite mental health and training qualifications . fourth , the program met minimum standards of disaster mental health training programs by making explicit the objectives , target audience , training topic and focus , means of delivery , measurable outcomes , and evaluation procedures . finally , the study used quantitative measures of participants competencies to make comparisons between the pre - and post - training time - points . since the implementation of the program as part of the psychosocial response to the 2009 victorian bushfires , the program has been modified for use in the aftermath of other types of natural disaster , and has subsequently been delivered in several other disaster - affected regions across australia with an expanded pool of facilitators . the program was funded by the australian government department of health and aging , and implemented as part of the victorian government s bushfire psychosocial recovery plan . | this study reports data on a disaster mental health training program to enhance the capacity of lay people from disaster - affected communities , to provide assistance to others following a bushfire disaster .
local facilitators conducted training sessions which were actively promoted within communities .
participants were asked to complete an anonymous pre- and post - training survey to obtain data on the impact and quality of the training program .
responses from 462 ( 80% ) of 577 people who attended 39 sessions showed substantial and significant increases in key competencies including confidence in their abilities to detect difficulties coping in others and to provide assistance .
the quality of the program and materials were rated highly .
the findings of the evaluation provide support for the program as a beneficial , acceptable and feasible community - level intervention following disaster . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the past decade has shown remarkable advances in our knowledge of micrornas ( mirnas ) and their functional importance in a wide range of developmental and physiological processes . these small endogenous non - coding rnas , which post - transcriptionally regulate the expression of several hundred genes , have recently been shown to have an important role in various human cancers . there is growing evidence that mirnas are critical in cancer predisposition , initiation and progression , with several mirnas demonstrating oncogenic and/or tumor suppressor properties . in the past decade , several studies have focused on exploring the connection of mirnas with tumor proliferation , invasion , migration and stem - cell behavior . because of the widespread dysregulation of mirnas in all types of tumors , their expression profiles are useful diagnostic and prognostic signature classifiers . mirna expression analysis has confirmed that specific mirnas show differential expression patterns among normal and tumor tissues . for example , the mirna mir-10b is specifically overexpressed only in metastatic breast cancers but downregulated in primary breast tumors , and mir-335 and mir-126 are lost in relapsed breast cancers with distal metastasis . thus , specific mirnas are involved in different phenotypes of aggressive cancers , providing an important rationale for their investigation as therapeutic targets . a recent study published in science signaling by stinson et al . identified mir-221 and mir-222 as regulators of epithelial - to - mesenchymal transition ( emt ) using high - throughput analysis and a human in vitro cell culture model . the study reported mir-221/222 to be specifically expressed in basal - like breast cancer and to act downstream of the oncogenic ras - raf - mek pathway . these mirnas mediate metastasis through increased invasion and migration by targeted repression of tricho - rhino - phalangeal syndrome type 1 protein ( trps1 ) , which in turn increases the abundance of the emt - promoting protein zinc finger e - box - binding homeobox 2 ( zeb2 ) . further explore the involvement of mirnas in promotion of clinically aggressive metastatic breast cancer ( figure 1 ) . involvement of mir-221/222 as downstream effectors of the egfr - ras - raf - mek pathway in progression of metastatic transformation of breast cancer tumors . egfr , epidermal growth factor receptor ; emt , epithelial - to - mesenchymal transition ; er , estrogen receptor ; erk , extracellular signal - regulated kinase ; fosl1 , fos - like antigen 1 ; grb2 , growth factor receptor - bound protein 2 ; mek , mitogen - activated protein / extracellular signal - regulated kinase kinase ; p27 , cyclin - dependent kinase inhibitor p27 ; sos , son of sevenless homolog ; trps1 , tricho - rhino - phalangeal syndrome type 1 ; zeb , zinc finger e - box - binding homeobox . the study by stinson and colleagues is significant because it substantiates the concept that specific mirnas can promote transformation to more aggressive cancer phenotypes with poor prognosis . the authors performed mirna microarray screening using multiple cell lines representing luminal - like and basal - like subtypes of breast cancer , and identified mir-221/222 to be differentially expressed . the overexpression of mir-221/222 in estrogen receptor ( er)-negative breast cancer has been reported previously , implying a role of mir-221/222 in predisposition of er status in aggressive breast cancers . transfection of mir-221/222 synthetic mimetics into an immortalized and nontransformed mammary cell line ( mcf10a ) resulted in a significant enrichment of genes involved in emt and the ras pathway . mir-221/222 induced emt - like characteristics , with enhanced invasion and migration , increased levels of the mesenchymal marker vimentin and reduced levels of the epithelial marker e - cadherin . consequently , treatment of mda - mb-231 cells ( a metastatic basal - like breast cancer cell line ) with mir-221/222 inhibitors induced a reverse phenotype with mesenchymal - to - epithelial transition ( met)-like characteristics . the reversal to met by inhibiting mir-221/222 is an important finding that can be therapeutically exploited , but more in vivo studies will be required before any significance can be established . in addition , the authors confirmed the correlation between increased mir-221/222 levels and vimentin and e - cadherin expression in primary breast cancer samples . previous reports have established that mir-200 family members ( mir-200a , mir-200b , mir-200c , mir-141 and mir-429 ) are downregulated in aggressive breast cancers . thus , a combination of a mir-221/222 and mir-200 signature with other emt markers such as vimentin and e - cadherin can provide a clinical predictive model for identifying patients with poor prognosis . the authors further studied the regulation of mir-221/222 and reported a novel association between mirna and the emt - promoting ras - raf - mek signaling pathway . they identified an upstream binding site for fosl1 , a member of the fos family of transcription factors and , using chromatin immunoprecipitation and luciferase assays , they showed that the transcription of mir-221/222 is regulated by fosl1 . they identified mir-221/222 as downstream of the epidermal growth factor receptor ( egfr)-ras - raf - mek pathway by showing that treatment with egfr and mek inhibitors knocked down the expression of both the mirnas and fosl1 . trps1 , a transcription factor with decreased abundance in clinically aggressive breast cancers , was identified as the direct target of mir-221/222 ; and in turn , trps1 targeted the emt - suppressor protein zeb2 . thus , repression of trps1 by mir-221/222 caused an increase in the levels of zeb2 , which directly inhibits e - cadherin and upregulates vimentin , promoting emt . these results together reveal an intricate association between mir-221/222 and the egfr - ras - raf - mek cascade ( figure 1 ) . in addition , the paper highlights the functional significance of mirnas in the process of emt and stem - cell formation in breast cancer . the role of mir-335 , mir-206 and mir-126 in suppressing breast cancer metastasis was initially described by tavazoie et al . , who reported that selective loss of mirna expression induced metastatic potential . other studies reported increased expression of mir-10b , mir-21 , mir-9 and mir-29b in malignant breast cancers , whereas the mir-200 family is downregulated in metastatic cancers . these mirnas function at different stages of the multistep metastatic cascade , by acting as direct downstream effectors of oncogenes , sensitizing tumor cells to signals from the tumor microenvironment , or altering expression of emt - related markers , such as e - cadherin and vimentin . the study by stinson et al . elucidates a further layer of regulation that controls the emt - driven cellular phenotype . the study provides a logical association between the earlier studies demonstrating the importance of mir-221/222 in metastatic breast cancers and drug resistance . an initial study by zhao et al . showed that mir-221/222 directly targeted er and that their overexpression in breast cancer contributed to progression of the more aggressive er - negative basal phenotype in a subset of breast cancers . mir-221/222 have also been shown to act as oncogenes by repressing cell cycle inhibitor proteins p27/kip1 and p57 and thus facilitating cell proliferation and self - renewal . these functions of mir-221/222 both contribute to tamoxifen resistance in basal - type breast cancers . 's study adds an additional aspect to the story and links the basal - subtype - specific expression of mir-221/222 with increased abundance of mesenchymal markers and an enhanced emt phenotype . it positions mir-221/222 downstream of the ras pathway , targeting trps1 and thus increasing the abundance of emt - promoter zeb2 ; this provides a clearer picture of the mechanism of mir-221/222 in promoting aggressive breast cancer phenotypes with chemoresistance and poor prognosis . finally , another important finding is the involvement of different mirnas in different phenotypes of breast cancer . previous studies have demonstrated that mir-200 family mirnas act as emt repressors by inhibiting zeb1 protein ; their expression levels are greatly reduced in metastatic breast cancers compared with normal tissues , and a negative feedback loop connects mir-200 family expression , zeb1 expression and emt occurrence . discuss possible involvement of the mir-221/222 family in this feedback inhibition of mir-200 family members : they may act by relieving the trps1-mediated repression of zeb2 protein and committing cells to emt . thus , regulation of the mir-200 and mir-221/222 families reflects a fine balance linking mirnas as stimulators and inhibitors of metastasis and identifies important molecular targets that could potentially control a specific tumor behavior . in conclusion , these new findings add yet another significant dimension to the regulation of the emt phenomenon . the report presents a critical link between the emt - related mirnas mir-221 and mir-222 and the process of emt and metastasis in aggressive breast cancers . 's paper rests in the identification of clinically useful mirnas that act as regulators of emt and represent not only a novel therapeutic strategy for the treatment of advanced breast cancer , but also potential use as biomarkers for clinically aggressive breast cancers with poor prognosis . direct functional screens of global mirna expression profiles in transformed tumor cells might help illuminate involvement of other mirnas in emt . furthermore , the in vivo phenotypic consequences of mir-221/222 gain and loss of function in mouse models will help evaluate the practicality of mir-221/222 expression manipulation for therapy of human breast cancers . identification of the as yet unknown targets for mir-221/222 also remains a key objective for the design of novel - mirna - based therapy . overexpressed mirnas can be effectively inhibited in vivo using antisense oligonucleotides with specific modifications , such as cholesterol - conjugated antagomirs , locked nucleic acid oligonucleotides or 2'-o - methyl modifications . however , several challenges regarding the stability and delivery strategies of these anti - mirs still need to be answered before they can be useful as therapeutic agents . more experimental evidence establishing that correction of a specific mirna alteration can re - establish homeostasis and stabilize tumorigenesis is required . in this regard , the potential consequences of inducing met in normal tissues during the course of mir-221/222 therapy also need to be determined . thus , mirnas hold great potential as therapeutic targets for new drug development ; however , more insights into the functional consequences and efficiency of mirna inhibition for patient survival need to be addressed . er : estrogen receptor ; egfr : epidermal growth factor receptor ; emt : epithelial - to - mesenchymal transition ; met : mesenchymal - to - epithelial transition ; trps1 : tricho - rhino - phalangeal syndrome type 1 ; zeb : zinc finger e - box - binding homeobox . gac is supported as a fellow at the university of texas md anderson research trust , and as a fellow of the university of texas system regents research scholars program . work in gac 's laboratory is supported in part by nih grant 1r01ca135444 , by a dod breast cancer idea award , by developmental research awards in breast cancer , ovarian cancer and leukemia spores , by a cll global research foundation grant , by a us / european alliance for therapy of cll grant and by a 2009 seena magowitz - pancreatic cancer action network - aacr pilot grant . we would like to thank sunita patterson ( department of scientific publications , md anderson cancer center ) for her help with the editing of this article . | micrornas ( mirnas ) are crucial in the initiation and progression of tumors .
a recent study has reported that the mirnas mir-221 and mir-222 are involved in the promotion of an aggressive basal - like phenotype in breast cancer , functioning downstream of the ras pathway and triggering epithelial - to - mesenchymal transition .
these new insights into the roles of mir-221/222 in breast cancer metastasis , drug resistance and ras pathways could potentially have applications in medical practice . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
treatment by all - trans retinoic acid ( atra ) followed by anthracycline - arac chemotherapy has improved the outcome of acute promyelocytic leukemia.1 ) atra is usually well tolerated , but a few major side effects can be observed.2 - 4 ) retinoic acid syndrome ( ras ) often occurs during the induction chemotherapy of acute promyelocytic leukemia . in ras , myocarditis has been rarely documented . we reports a very rare case of fully recovered myocarditis as a result of ras related to atra administration during induction treatment of acute promyelocytic leukemia which documented by echocardiographic evidence . a 39-year - old woman was admitted to our hospital due to dyspnea and dizziness . the patient had been well until approximately 8 weeks earlier , when dyspnea and dizziness developed . she was physically active and did not have a history of hypertension , diabetes , hospitalizations , surgical procedures , or allergic reactions to drugs . the blood pressure and heart rate were 130/80 mmhg , 84 beats per minute , each other , and the respiratory rate 20 breaths per minute . the physical examination of the head , ears , eyes , nose , and throat were otherwise normal . the genitourinary , cutaneous , and neurologic examinations were normal , as was examination of his arms and legs . the initial complete blood counts showed hemoglobin of 3.3 g / dl ; white blood cell count of 2.16 10/l ; platelets count of 18 10/l . examination of the peripheral - blood smear revealed pancytopenia and a few immature cells with auer rods . examination of the biopsy specimen showed that the bone marrow was hypercellular ( > 95% ) and replaced by abnormal large cells with auer rods and cytoplasmic dense large granules . on the smear of the aspirate , on cytochemical staining , the promyelocytes were positive for myeloperoxidase , sudan black b stain and periodic acid stain . real - timepolymerase chain reaction ( pcr ) revealed a promyelocytic leukemia - retinoic acid receptor ( pml / rara ) rearrangement . she received induction therapy ( atra 45 mg / m from day 1 to complete remission , and idarubicin 12 mg / m iv on day 2 , 4 , 6 and 8) and supportive therapy with platelet and plasma transfusion . screening echocardiography was performed before induction therapy and showed normal wall motions and 60% of ejection fraction . however , the patient complained mild chest pain and dyspnea on day 18 and febrile sense on day 20 . but body temperature was 40.2. physical examination showed no abnormalities except mild pretibial pitting edema . the electrocardiogram revealed low qrs amplitudes without newly developed q wave or st segment change . laboratory findings showed a white blood cell count of 1.06 10/l , a creatine kinase of 52 iu / l ( 21 - 232 ) , ck - mb of 2.5 ng / ml ( 0.0 - 5.0 ) , a brain natriuretic peptide of 1430 pg / ml ( 0 - 100 ) , troponin - i of 2.39 ng / ml ( 0.0 - 0.05 ) , and positive troponin - t 0.14 ng / ml ( 0.0 - 0.03 ) . the echocardiography revealed decreased lv systolic function ( left ventricular ejection fraction 38% ) with mildly enlarged lv chamber size ( 56/43 mm ) , increased left atrial volume index ( 36.9 ml / m ) and moderate mitral and tricuspid regurgitation ( grade ii ) . diastolic property was restrictive lv filling pattern ( mitral e velocity 1.07 m / s , mitral a velocity 0.42 m / s , deceleration time,125 ms , ea ratio ; 2.59 ) and e / em was elevated ( 13.4 ) ( fig . lv apex and lateral and inferior wall thickening were normal . comparing baseline lv global radial strain , global radial strain was decreased -19.2% into -14.5% and color - coded strain pattern form anterior to lateral segmental at mid lv wall was decreased ( fig . 64-channel multidetector ct - coronary angiography for exclusion of ischemic coronary artery disease revealed that there was no significant obstructive epicardial coronary artery disease or anatomic variances ( fig . a diagnosis of ras was made on day 22 because of pretibial pitting edema , mild chest pain with dyspnea and unexplained fever ( 40.2 ) . echocardiography repeated on day 37 ( when the patient was fully recovered ) revealed normalized chamber size of left ventricle and left atrium . lv systolic function and diastolic function was normalized without wall motion abnormality . the patient achieved molecular complete remission after induction therapy , which was sustained through the consolidation therapy . atra has a central role in the treatment of acute promyelocytic leukemia because addition of atra to anthracyclines has been shown to improve disease - free survival and overall survival compared to chemotherapy alone.1 ) since the promyelocytic leukemia - retinoic acid receptor fusion gene product that is resulted from the balanced translocation t ( 15;17 ) , characteristic for acute promyelocytic leukemia , has a unique sensitivity to atra , atra induces the differentiation of leukemic promyelocytes into mature cells . though atra therapy is considered to be safe and cause mild adverse effects , it can be complicated severely by the ras , which was first documented by frankel et al.2 ) ras occurs in up to 25% of patients treated with atra.1)3 ) the ras is characterized by development of fever , pulmonary infiltrates and effusions , pericardial effusions , hypotension , dyspnea , and renal dysfunction . the morbidity and mortality of ras is significant and reported mortality rate was as high as 9% . the diagnosis of ras is by at least three of the followings : weight gain , respiratory distress , unexplained fever , interstitial pulmonary infiltrates , pleural or pericardial effusions . in patient described above , she was diagnosed as ras because of pretibial pitting edema , mild chest pain and dyspnea and unexplained fever ( 40.2 ) . and the patient 's clinical symptoms and signs ware disappeared after discontinuation of atra and there was no recurrence of symptoms after atra resuming . the stress induced cardiomyopathy was ruled out because of there were no evidence of newly developed electrocardiographic abnormalities despite transient left ventricular wall motion abnormalities and absence of obstructive coronary artery disease . the pathogenesis of the atra syndrome is not yet fully understood , but it is thought to be due to leukocyte infiltration and cytokine release causing endothelial damage and extravasation of apl cells upon maturation induction by atra treatment.4 ) common cardiac manifestation of ras is pericardial effusion ( 19% ) and fatal pericardial tamponade may be occur.5)6 ) but myocarditis is rare complication . to our knowledge , only four cases of atra - induced generalized myocarditis with cardiac involvement has been reported.7 - 10 ) in our case , patient had symptoms of myocarditis with laboratory evidence of elevated b - type natriuretic peptide level and transient cardiac troponin after induction of atra treatment . the evidence for myocarditis - transient reversible lv dysfunction was also documented by echocardiogram . in conclusion , we present a case of atra - induced , myocarditis that was diagnosed by serologic and echocardiographic evidence . the patient recovered completely without sequale and was subsequently retreated with atra without recurrence of the myocarditis . | treatment by all - trans retinoic acid ( atra ) followed by anthracycline - arac chemotherapy has improved the outcome of acute promyelocytic leukemia .
atra is usually well tolerated , but a few major side effects can be observed .
retinoic acid syndrome ( ras ) often occurs during the induction chemotherapy of acute promyelocytic leukemia .
a pericardial effusion is a common cardiac manifestation but myocarditis has been rarely documented .
here we reports a very rare case of fully recovered myocarditis as a result of ras related to atra administration during induction treatment of acute promyelocytic leukemia which documented by echocardiographic evidence . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatitis c virus ( hcv ) infection causes acute hepatitis , chronic hepatitis , cirrhosis and hepatocellular carcinoma [ 1 , 2 ] . the number of liver transplantations associated with hcv is also growing in japan . in japan , the rates of hcv genotypes 1b , 2a and 2b are approximately 70 , 20 and 10% , respectively , with genotype 1a being very rare [ 4 , 5 ] . since the end of 2013 , the hcv ns3/4a inhibitor simeprevir , together with peginterferon ( peg - ifn ) plus ribavirin , has been available in japan for the treatment of hcv genotype 1 patients . in treatment - nave patients , previous treatment relapsers and null responders , respectively , this treatment results in 8992 , 96100 and 3639% sustained virological response ( svr ) . however , it is known that hyperbilirubinemia is one of the common side effects of simeprevir . recently , stine et al . reported that 2 patients developed marked hyperbilirubinemia out of proportion to their aminotransferase levels , despite clearance of hcv rna . in the present report , we show a case re - treated by simeprevir with peg - ifn -2a plus ribavirin who experienced elevated alanine aminotransferase ( alt ) without hyperbilirubinemia . despite stopping her treatment at 8 weeks , she achieved svr . to avoid serious results from adverse events , careful follow - up should be performed in the clinical use of protease inhibitors for hcv - infected patients , even if they have no advanced fibrosis . in addition , even after the introduction of interferon - free regimens , which have strong effects for the eradication of hcv rna , careful follow - up of patients may still be needed in daily clinical practice . a 64-year - old japanese woman was infected with hcv genotype 1b , 7.4 log iu / ml of viral load , and tg of il28b rs8099917 . in another hospital 8 years earlier , she was diagnosed with chronic hcv infection , liver biopsy was performed , and mild portal fibrosis ( f1 ) and mild activity of inflammation ( a1 ) were observed . she was subsequently treated with peg - ifn -2b plus ribavirin for 72 weeks , but she relapsed in spite of being a late virological responder . the patient 's weight , height and body mass index were 46 kg , 1.55 m and 18.9 kg / m , respectively . although she had undergone surgery for tongue cancer 15 years before , she looked healthy and was taking no medications for other diseases . additional laboratory data were aspartate aminotransferase ( ast ) 24 iu / l , alt 21 iu / l , -glutamyltransferase ( g - gtp ) 23 iu / l , total bilirubin 0.8 mg / dl , total cholesterol 236 mg / dl , -fetoprotein 2.5 ng / ml , prothrombin time 123% , hemoglobin 14.0 g / dl and platelet count 16.5 10/mm . she was classified as having child - turcotte - pugh class a. ultrasonography showed no findings of hepatic mass , cirrhosis or splenomegaly . transient elastography ( fibroscan ) indicated 4.4 kpa , showing that she had no advanced liver disease . as she was a previous treatment relapser despite il28b of minor genotype , she was re - treated with simeprevir 100 mg daily with peg - ifn -2a 180 g weekly and ribavirin 400 mg daily . rapid virological response , defined as undetectable hcv rna at week 4 , was achieved . at week 7 iu / l , respectively ) . although hcv rna was undetectable at week 8 , ast and alt levels were mildly elevated ( 83 and 68 , she complained of fatigue and appetite loss , and her laboratory data showed hepatic injury ( ast 506 iu / l , alt 528 iu / l , g - gtp 52 iu / l , total bilirubin 1.2 mg / dl , prothrombin time 126% , hemoglobin 12.1 g / dl and platelet count 8.6 10/mm ) despite hcv rna being undetectable . the treatment with simeprevir 100 mg daily with peg - ifn -2a 180 g weekly plus ribavirin 400 mg daily was immediately stopped , and stronger neo - minophagen c 100 ml was used daily for 2 weeks to lower the alt level . loxoprofen sodium hydrate ( 60 mg for single use ) and domperidone ( 10 mg for single use ) used for interferon - related fever and appetite loss , respectively , were also ceased immediately . alt levels were 24 and 11 iu / l , respectively , at week 4 and 12 after the end of treatment . at week 24 thus , although her treatment duration was only 8 weeks , she achieved svr . during and after the treatment , hyperbilirubinemia was not observed ( maximum total bilirubin 1.2 mg / dl ) ( fig . 1 ) . drug lymphocyte stimulation testing was performed , but the result was negative for simeprevir , ribavirin , loxoprofen sodium hydrate and domperidone . loxoprofen sodium hydrate and domperidone as well as ribavirin had been used in the previous treatment 8 years earlier . as drug toxicity by self - medication was also excluded , we diagnosed her as drug - induced liver injury by simeprevir with peg - ifn -2a plus ribavirin . in the current report we presented a 64-year - old hcv - infected patient who was a previous treatment relapser with il28b minor genotype . despite 8-week treatment of simeprevir with peg - ifn -2a plus ribavirin , she achieved svr at 24 weeks after the end of treatment , providing support for the strong effects of simeprevir on hcv replication . our case also points out the possibility of the combination of simeprevir with peg - ifn -2a plus ribavirin leading to liver injury without hyperbilirubinemia , as liver dysfunction improved immediately after stopping this treatment and other causes were excluded , despite there being no overt signs of drug - induced injury , such as eosinophilia . according to the patient 's decision , we did not perform a liver biopsy . during the treatment of peg - ifn -2a plus ribavirin , despite hcv rna negativity , a transient elevation in alt levels was observed , although the alt levels were < 200 acute exacerbation with elevation of alt levels was occasionally observed during the course of chronic hepatitis c , but these were improved in most cases if svr was achieved by antiviral treatment . it is also known that hcv is a rare cause of acute liver failure . in japan , the hcv ns3/4a inhibitor telaprevir with peg - ifn -2b plus ribavirin was approved in 2011 and in 2014 for hcv genotype 1 and 2 infection , respectively . despite adverse events including dermatological side effects , one of the second - wave first - generation hcv ns3/4a inhibitors , simeprevir , together with peg - ifn plus ribavirin , was also approved in 2013 for hcv genotype 1 infection in japan . compared to telaprevir , the adverse events of simeprevir with peg - ifn plus ribavirin have become less . it has been reported that they are fairly similar to those of peg - ifn plus ribavirin therapy , although hyperbilirubinemia without alt elevation is occasionally observed . in general , a mild , isolated and reversible increase in serum bilirubin was reported in patients treated with simeprevir , and bilirubin returned to baseline levels promptly after patients had completed the simeprevir regimen . hyperbilirubinemia was pronounced with simeprevir 150 mg daily , although we used simeprevir 100 mg daily in japan . reported that there were no concomitant increases in serum alt or alkaline phosphatase associated with bilirubin elevations in the pillar study . in the present report , despite a strong antiviral effect of simeprevir , we observed liver injury during the simeprevir with peg - ifn -2a plus ribavirin treatment , supporting a previous report that simeprevir may cause liver injury in patients with cirrhosis , leading to hepatic decompensation . in our case , drug - induced liver injury caused by peg - ifn -2a could not be completely ruled out , although the previous use of peg - ifn -2b had not caused liver injury . in conclusion , to avoid serious results from adverse events , careful attention and follow - up are necessary in the clinical use of protease inhibitors for hcv - infected patients , and especially for those with advanced hepatic fibrosis . until newer , safer , direct - acting antivirals against hcv , including hcv ns3/4a inhibitors , are introduced , we need to pay strict attention to these matters in the use of direct - acting antivirals against hcv . tatsuo kanda received lecture fees from chugai pharmaceutical , msd , tanabe - mitsubishi , ajinomoto , bristol - myers squibb , daiichi - sankyo , janssen pharmaceutical and glaxosmithkline . makoto arai received lecture fees from chugai pharmaceutical , eisai , astrazeneca , daiichi sankyo and tsumura . osamu yokosuka received grant support from chugai pharmaceutical , bayer , msd , daiichi - sankyo , tanabe - mitsubishi , bristol - myers squibb , taiho pharmaceutical and gilead sciences . the other authors declare that they have no conflict of interests regarding the publication of this paper . | direct - acting antivirals with or without peginterferon ( peg - ifn ) plus ribavirin are now available for the treatment of hepatitis c virus ( hcv ) infection .
direct - acting antivirals are potent inhibitors of hcv replication , but some of them occasionally possess serious adverse events . we experienced a 64-year - old female with chronic hcv genotype 1b infection who showed elevated alanine aminotransferase of 528 iu / l at week 9 after the commencement of treatment of simeprevir with peg - ifn -2a plus ribavirin .
however , she achieved sustained virological response at week 24 after the end of treatment . in japan
, we also have to treat elderly patients infected with hcv and/or advanced hepatic fibrosis . until an effective interferon - free regimen is established
, direct - acting antivirals with peg - ifn plus ribavirin may still play a role in the treatment for certain patients . to avoid
serious results from adverse events , careful attention and follow - up will be needed in the treatment course of simeprevir with peg - ifn plus ribavirin for chronic hcv infection . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mice ( fvb ) were maintained on a 12-h dark / light cycle and fed a normal diet . all animals were 810 weeks old at the time of the experiments . for clearance studies , wild - type fvb , adiponectin - null fvb , and fvb ob characterization and description of the mice overexpressing adiponectin from the liver is currently in progress ( k.d . and p.e.s . , unpublished data ) . the high - fat diet consisted of 60 e% from fat ( research diets , new brunswick , nj ) . the institutional animal care and use committee of the university of texas southwestern medical center and the albert einstein college of medicine approved all animal experimental protocols . the irdye800cw and 700cw infrared n - hydroxisuccinimide ester dyes were purchased from licor biotechnology ( lincoln , ne ) . wild - type and cysteine 39 adiponectin were produced as previously described ( 7,12 ) . to isolate hmw , lmw , and trimer isoforms , adiponectin levels in the different fractions were then analyzed by western blotting , and the fractions containing the individual complexes were collected and concentrated to a final protein concentration of 1 mg / ml . validation of the enrichment of the different isoforms showed that we were able to isolate fractions highly enriched in the various isoforms ( fig . wild - type and cysteine 39 adiponectin , hmw , lmw , and trimer were derivatized with the irdye 800cw , and iggs were labeled with irdye 700cw at a dye : protein 1:1 molar ratio , according to the manufacturer 's instructions . a : upper panel shows the fluorescent signal from the injected labeled adiponectin gel scan of 1.5 l serum separated on sds - page over time . b : clearance curve for wild - type adiponectin in male and female fvb mice as well as native adiponectin and igg . the clearance of native adiponectin was determined by injecting wild - type serum into adiponectin - null mice . c : clearance curves for male fvb mice fed a normal as well as high - fat diet , male ob / ob fvb mice , and male fvb mice fasted 24 h. d : to isolate the three forms of adiponectin , recombinant adiponectin containing all three forms ( upper panel ) were subjected to gel filtration to create elutions containing the individual isoforms . the lower panel shows a subsequent analysis of the complex distribution of the isolated fractions . e : the clearance curve of isolated hmw , lmw , trimer , and cysteine 39 adiponectin in male fvb mice . f : the calculated half - life for wild - type adiponectin in male , female , pregnant female , 24-h fasted male , ob / ob mice , high - fat diet fed mice , isolated hmw , isolated lmw , isolated trimer , and for the cysteine 39 adiponectin in male mice . n = 4 per group . * p < 0.05 vs. clearance rate of male wild - type fvb mice . the circulating half - life of adiponectin was determined in the following settings : 8-week - old male and female fvb mice , in females pregnant at day 18 , in males fasted for 48 h , in 8-week - old ob / ob male fvb mice , and in male fvb mice fed a high - fat diet for 6 weeks . in addition , the circulating half - life of hmw , lmw , trimer , and cysteine 39 adiponectin were determined in 8-week - old male fvb mice . we and others have previously determined adiponectin levels under these various conditions in combs et al . for all conditions , the clearance was determined by injecting 0.05 g labeled adiponectin / g body wt into the tail vein and by collecting blood samples at the indicated time points in heparinized capillary tubes . a total of 1.5 l plasma was subsequently mixed with 19 l tbs and 5 l 5 laemmli buffer . after separation on a 10% bis - tris gel ( invitrogen , carlsbad , ca ) , the labeled proteins were directly visualized in the gel on the licor odyssey infrared imaging system in the 700- and 800-nm channels , without any prior staining techniques or transfers . following scanning , the gel was stained with commassie blue stain , and the igg light - chain band was quantified as loading control . the 32-kda adiponectin band obtained from the gel scans and the 25-kda igg light - chain band from the coommassie stain the clearance of endogenous adiponectin was studied by injecting 200 l serum from wild - type mice into 8-week - old adiponectin - null mice . the levels of circulating adiponectin at the various time points in the adiponectin - null mice were determined by enzyme - linked immunosorbent assay ( millipore ) . the circulating half - life of adiponectin was defined as the time it took to remove 50% of the injected material from circulation . prior to injection of the labeled material , chest and abdominal hair was removed with nair hair remover ( church & dwight ) . all scans were performed under anesthesia ( aerrane , baxter , il ) using an ez-2000 microflex small - animal anesthesia system ( ez systems , palmer , pa ) . once under full anesthesia , the mice were transferred to an odyssey infrared scanner ( li - cor biosciences , lincoln , ne ) with an odyssey mousepod connected to the anesthesia apparatus . the full - body scans were performed with a resolution of 169 m , a focal plane lifted 4 mm , and the fluorescence was measured in the 700- and 800-nm channels . wild - type and cysteine 39 adiponectin and iggs were given at 0.05 g / g body wt in a total volume of 200 l . for the control experiments , wild - type adiponectin was denatured and reduced by boiling for 15 min with the presence of 1% sds and 1 mmol / l dtt in a total volume of 50 l . at the indicated time points , the mice were scanned and the liver signals were quantified using the odyssey version 2.1 software . to remove residual labeled material in the blood stream , the mice were perfused ( 3.6 ml / min ) with 20 ml pbs by entry into the left ventricle and exit through the right atrium . the target organs were excised and scanned on the odyssey infrared scanner in the 800-nm channel . following the scan , tissues were snap frozen . to further process samples , they were homogenized in tnet buffer ( 50 mmol / l tris , ph 7.5 ; 150 mmol / l nacl ; 5 mmol / l edta ; and 1% triton x-100 ) with protease inhibitors and centrifuged at 14,000 rpm for 15 min at 4c . the protein concentration of the supernatants was measured with the bicinchoninic assay ( pierce ) , and 20 l were spotted directly on to a nitrocellulose membrane . the signals on the membranes were directly quantified ( without any washing ) with the odyssey infrared scanner . to visualize exogenously administered adiponectin , 8-week - old adiponectin - null mice were administered 0.5 g / g body wt wild - type and cysteine 39 adiponectin or pbs . after 2 h and 20 min , the mice were perfusion fixed with 10% formalin . for detection of endogenous adiponectin , 8-week - old adiponectin - null and wild - type mice were perfusion fixed in 10% formalin . in both experiments , the liver , kidney , spleen , and gastrocnemius muscle were excised and processed for histology . tissue sections were decorated with an antibody targeting the nh2-terminal region of adiponectin , anti - k8/18 , and 4,6-diamidino-2-phenylindole . the same set of image processing steps was applied to both the control and the experimental images . all statistical analysis was performed in sigmastat 2.03 ( sysstat software , point richmont , ca ) . 1b were determined by the two - way anova for repeated measures . for comparison between two independent groups , wild - type and cysteine 39 adiponectin were produced as previously described ( 7,12 ) . to isolate hmw , lmw , and trimer isoforms , adiponectin levels in the different fractions were then analyzed by western blotting , and the fractions containing the individual complexes were collected and concentrated to a final protein concentration of 1 mg / ml . validation of the enrichment of the different isoforms showed that we were able to isolate fractions highly enriched in the various isoforms ( fig . wild - type and cysteine 39 adiponectin , hmw , lmw , and trimer were derivatized with the irdye 800cw , and iggs were labeled with irdye 700cw at a dye : protein 1:1 molar ratio , according to the manufacturer 's instructions . a : upper panel shows the fluorescent signal from the injected labeled adiponectin gel scan of 1.5 l serum separated on sds - page over time . b : clearance curve for wild - type adiponectin in male and female fvb mice as well as native adiponectin and igg . the clearance of native adiponectin was determined by injecting wild - type serum into adiponectin - null mice . c : clearance curves for male fvb mice fed a normal as well as high - fat diet , male ob / ob fvb mice , and male fvb mice fasted 24 h. d : to isolate the three forms of adiponectin , recombinant adiponectin containing all three forms ( upper panel ) were subjected to gel filtration to create elutions containing the individual isoforms . the lower panel shows a subsequent analysis of the complex distribution of the isolated fractions . e : the clearance curve of isolated hmw , lmw , trimer , and cysteine 39 adiponectin in male fvb mice . f : the calculated half - life for wild - type adiponectin in male , female , pregnant female , 24-h fasted male , ob / ob mice , high - fat diet fed mice , isolated hmw , isolated lmw , isolated trimer , and for the cysteine 39 adiponectin in male mice . n = 4 per group . * p < 0.05 vs. clearance rate of male wild - type fvb mice . the circulating half - life of adiponectin was determined in the following settings : 8-week - old male and female fvb mice , in females pregnant at day 18 , in males fasted for 48 h , in 8-week - old ob / ob male fvb mice , and in male fvb mice fed a high - fat diet for 6 weeks . in addition , the circulating half - life of hmw , lmw , trimer , and cysteine 39 adiponectin were determined in 8-week - old male fvb mice . we and others have previously determined adiponectin levels under these various conditions in combs et al . for all conditions , the clearance was determined by injecting 0.05 g labeled adiponectin / g body wt into the tail vein and by collecting blood samples at the indicated time points in heparinized capillary tubes . a total of 1.5 l plasma was subsequently mixed with 19 l tbs and 5 l 5 laemmli buffer . after separation on a 10% bis - tris gel ( invitrogen , carlsbad , ca ) , the labeled proteins were directly visualized in the gel on the licor odyssey infrared imaging system in the 700- and 800-nm channels , without any prior staining techniques or transfers . following scanning , the gel was stained with commassie blue stain , and the igg light - chain band was quantified as loading control . the 32-kda adiponectin band obtained from the gel scans and the 25-kda igg light - chain band from the coommassie stain the clearance of endogenous adiponectin was studied by injecting 200 l serum from wild - type mice into 8-week - old adiponectin - null mice . the levels of circulating adiponectin at the various time points in the adiponectin - null mice were determined by enzyme - linked immunosorbent assay ( millipore ) . the circulating half - life of adiponectin was defined as the time it took to remove 50% of the injected material from circulation . analysis of the adiponectin complex distribution was performed as described in schraw et al . ( 12 ) using a rabbit polyclonal anti - mouse adiponectin primary antibody . prior to injection of the labeled material , chest and abdominal hair was removed with nair hair remover ( church & dwight ) . all scans were performed under anesthesia ( aerrane , baxter , il ) using an ez-2000 microflex small - animal anesthesia system ( ez systems , palmer , pa ) . once under full anesthesia , the mice were transferred to an odyssey infrared scanner ( li - cor biosciences , lincoln , ne ) with an odyssey mousepod connected to the anesthesia apparatus . the full - body scans were performed with a resolution of 169 m , a focal plane lifted 4 mm , and the fluorescence was measured in the 700- and 800-nm channels . following the initial prescan , wild - type and cysteine 39 adiponectin and iggs were given at 0.05 g / g body wt in a total volume of 200 l . for the control experiments , wild - type adiponectin was denatured and reduced by boiling for 15 min with the presence of 1% sds and 1 mmol / l dtt in a total volume of 50 l . at the indicated time points , the mice were scanned and the liver signals were quantified using the odyssey version 2.1 software . to remove residual labeled material in the blood stream , the mice were perfused ( 3.6 ml / min ) with 20 ml pbs by entry into the left ventricle and exit through the right atrium . the target organs were excised and scanned on the odyssey infrared scanner in the 800-nm channel . following the scan , tissues were snap frozen . to further process samples , they were homogenized in tnet buffer ( 50 mmol / l tris , ph 7.5 ; 150 mmol / l nacl ; 5 mmol / l edta ; and 1% triton x-100 ) with protease inhibitors and centrifuged at 14,000 rpm for 15 min at 4c . the protein concentration of the supernatants was measured with the bicinchoninic assay ( pierce ) , and 20 l were spotted directly on to a nitrocellulose membrane . the signals on the membranes were directly quantified ( without any washing ) with the odyssey infrared scanner . to visualize exogenously administered adiponectin , 8-week - old adiponectin - null mice were administered 0.5 g / g body wt wild - type and cysteine 39 adiponectin or pbs . after 2 h and 20 min , the mice were perfusion fixed with 10% formalin . for detection of endogenous adiponectin , 8-week - old adiponectin - null and wild - type mice were perfusion fixed in 10% formalin . in both experiments , the liver , kidney , spleen , and gastrocnemius muscle were excised and processed for histology . tissue sections were decorated with an antibody targeting the nh2-terminal region of adiponectin , anti - k8/18 , and 4,6-diamidino-2-phenylindole . the same set of image processing steps was applied to both the control and the experimental images . all statistical analysis was performed in sigmastat 2.03 ( sysstat software , point richmont , ca ) . 1b were determined by the two - way anova for repeated measures . for comparison between two independent groups , the derivatized molecule retained its multimeric conformation ( online appendix fig . 1 [ available at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1750/dc1 ) and maintained its bioactivity as judged by its ability to induce a glucose - lowering effect in vivo if injected at 0.5 g / g body wt ( data not shown ) . to determine the clearance rate for adiponectin during different physiological as well as pathophysiological conditions , we injected these preparations intravenously into mice and frequently sampled plasma levels over the next 3 h. figure 1a ( upper panel ) shows the fluorescence derived from the labeled adiponectin after separation on sds - page containing plasma from mice injected with labeled adiponectin . the lower panel shows the 25-kda igg light - chain band of a subsequent coommassie stain of the same gel , serving as a loading control . while females tend to have significantly higher levels of adiponectin in circulation , wild - type adiponectin clears plasma with a rate of 75 min in both male and female fvb mice ( fig . to validate that our labeled recombinant adiponectin behaves similar to native adiponectin in circulation , we injected 200 l serum from wild - type mice into adiponectin - null mice and measured clearance of adiponectin levels by enzyme - linked immunosorbent assay over the next 3 h ( fig . no differences could be observed between the endogenous ( native ) adiponectin and the recombinant , purified adiponectin . next , we wanted to know whether conditions characterized by altered adiponectin levels also had differences in clearance rates . we have previously shown that long - term fasting causes adiponectin levels to increase significantly . comparing clearance rates between ad libitum fed mice and mice fasted for 24 h did not reveal any differences at the level of clearance ( fig . we have also shown that during pregnancy , adiponectin levels drop significantly , in line with the decreased systemic insulin sensitivity in the mothers ( 16 ) . however , clearance rates between female control mice and a cohort of pregnant females did however not reveal any differences , suggesting that a reduction of adiponectin production is the major driving force behind the systemic reduction ( fig . even more striking is our observation that the half - life of adiponectin is significantly extended in ob / ob mice or in wild - type mice exposed to a high - fat diet compared with wild - type controls fed a standard diet ( fig . the decreased plasma levels found under these conditions are therefore primarily due to the reduced production rate in these animals . the hmw form of adiponectin has been shown to correlate better to insulin sensitivity than total levels ( 6 ) . we therefore wondered if the clearance of the individual adiponectin complexes differed in regards to clearance rate . the three isoforms were isolated by gel filtration of recombinant adiponectin and labeled at the ratio of one dye per trimeric subunit ( fig . interestingly , the half - life did in fact diverge between hmw , lmw , and the trimer isoform , such that hmw has the slowest clearance ( 83.3 7 min ) , followed by lmw ( 54.5 3.7 min ) and trimer ( 32.4 1.2 min ) . surprisingly , the much more bioactive cysteine 39 mutant protein cleared the system with a half - life of < 10 min ( 6.8 0.3 min ) . preparations of the wild - type protein and the cysteine 39 mutant were injected intravenously into wild - type mice , and the distribution of the labeled protein was followed longitudinally in real time using a licor infrared detector unit highly sensitive to emission wavelengths in the infrared range . detection at these very long wavelengths has the advantage that there are very low levels of autofluorescence caused by tissues . also , these wavelengths are associated with deeper penetration into the tissues compared with wavelengths within the visible spectrum . upon injection , both the wild - type ( fig . , the injection of quenched dye alone causes clearance through the kidney and elimination from the system through urine as judged by the bright appearance of the bladder ( fig . 2c ) . in line with the differential clearance rates , the cysteine 39 mutant accumulates with considerably faster kinetics than wild - type protein a quantification of the total signal in the liver and its changes over time are shown in fig . this highlights the fact that the signal for the cysteine 39 mutant peaks as early as 30 min , whereas the signal for the wild - type protein takes up to 4 h to accumulate the highest signal intensity . both proteins seem to get degraded , and the fluorescent label can ultimately be found in the bladder as well . at this stage , however , the protein is no longer full length , and labeled adiponectin can only be detected as a broad heterogeneous smear when urine samples are separated on sds - page ( fig . although the different kinetics of liver signal between the wild - type and cysteine 39 adiponectin are in it self highly suggestive of a specific signal and not just a fluid - phase uptake phenomenon , we performed two additional control experiments . first , we wanted to test the outcome if we disrupt the original structure of the recombinant protein by boiling the preparation in the presence of 1% sds and 1 mmol / l dtt . even though some of this material may partially refold in vivo , this preparation accumulated to a different extent and with completely different kinetics in the liver and displayed a clearance rate comparable to that of the cysteine 39 adiponectin ( online appendix figs . in addition , we wanted to compete the liver binding of labeled adiponectin with increased levels of endogenous adiponectin . for this purpose , we used a transgenic mouse model engineered to express adiponectin from the liver under the control of the transthyretin promoter . these mice have a fourfold increase in circulating adiponectin compared with wild - type mice ( k.d . similar to the denatured material , the injected adiponectin bound the liver with radically different kinetics ( online appendix figs . 3 and 4 ) . importantly , in both cases we set the maximal level to 100% to display the kinetics of clearance in relative terms . it is difficult to assess the absolute levels of tissue accumulation between different injections in quantitative terms , but the signal intensity in the liver was distinctly lower with both denatured adiponectin as well as in the overexpressing mice relative to injection of native protein into wild - type mice . visualization of injected labeled mammalian produced wild - type adiponectin ( a ) , cysteine 39 adiponectin ( b ) , and quenched irdye800 without conjugation to protein by the licor infrared scanner ( c ) . wild - type ( wt ) and cysteine 39 adiponectin were injected ( 0.05 g / g body wt ) and the mice scanned 30 min , 1 , 2 , 3 , 4 , 5 , 6 , and 24 h postinjection . d : the liver signals from a and b were quantified and plotted over time . * p < 0.05 between the wild - type and cysteine 39 protein . e : sds - page analysis of labeled adiponectin in the urin and in the plasma . the detection of labeled adiponectin in the intact animal offers the advantage of monitoring the distribution of the protein in real time . while powerful from a global perspective , this suffers from the inherent disadvantage that some organs may appear selectively more intense due to the closer proximity to the detection unit . to overcome this bias , organs were excised upon injection of wild type ( 4 h ) and cysteine 39 mutant ( 1.5 h ) post injection . organs were harvested and protein lysates were prepared and quantified by dot - blot analysis ( fig . when the protein lysates were separated on sds - page , the adiponectin could only be visualized as a smear in all cases ( data not shown ) , indicating a rapid degradation once the molecule is taken up inside the cell . surprisingly , we also found a significant signal in the spleen , whereas we detected only very low signal in gastrocnemius , heart , small intestine , colon , pancreas , white adipose tissue , or testis . these observations were confirmed by scanning whole organs directly on the infrared scanner ( fig . 3b ) . even though we saw a relatively high intensity signal in spleen , we were unable to demonstrate that this is a specific signal . upon analysis of the spleens from mice injected with boiled and reduced adiponectin , we observed the same signal ( data not shown ) , suggesting that the signal in the spleen is unspecific . importantly however , even though the organs we examined displayed relatively low or no specific signal for adiponectin , we can not rule out that a small subset of cells within a given tissue bind and take up adiponectin avidly . low levels of signal in an organ should not be taken to rule out uptake of adiponectin by a small subset of cells , rather it indicates that a particular tissue is not a major contributor to clearance as a whole . a : dot - blot analysis of injected wild - type ( wt ) adiponectin in different organ lysates 4 h postinjection . epi , epididymal white adipose tissue ; gast , gastrocnemius muscle ; kid , kidney ; liv , liver ; mes , mesenteric white adipose tissue ; pan , pancreas ; sol , soleus muscle ; subq , subcutaneous white adipose tissue . given the high intensity of signal in the liver , we wondered whether we could develop an imaging method that would enable us to monitor the uptake of injected adiponectin into hepatocytes . to that end , we injected nonlabeled wild - type and cysteine 39 adiponectin ( 0.5 g / g body wt ) intravenously into adiponectin - null mice and sampled livers at 20 min and 2 h. in line with the more rapid kinetics of the cysteine 39 mutation , the adiponectin signal in the hepatocyte was prevalent at the early 20-min time point , whereas the wild - type adiponectin signal at this stage was located in the surrounding microvessels as evident by a colocalization with k8/18 ( fig . two hours after injection , adiponectin can be seen intracellularly in the hepatocytes for both wild - type and cysteine 39 adiponectin ( fig . as these images were obtained by immunofluorescence , we do not known whether the signal arises from full - length or degraded adiponectin . as for kidney , wild - type adiponectin could only be detected weakly in the kidney sections 20 min after injection , whereas the more active cysteine 39mutated adiponectin was abundantly apparent intracellularly at this time point as well . after 2 h , the cysteine 39 signal in the kidney was already markedly decreased as suspected by the short half - life . levels of wild - type adiponectin , however , were increased compared with 20 min ( fig . notably , the adiponectin detected in the kidney is mostly in the tubules with more limited signal in the glomeruli and appears to be mostly intracellular . no signal could be detected in the spleen or in gastrocnemius muscle ( data not shown ) . the lack of signal in the spleen confirms the nonspecific nature of the signal in this tissue , as discussed above . a : wild - type ( wt ) and cysteine 39 adiponectin were injected ( 0.5 g / g body wt ) into adiponectin - null mice and the liver processed for histology . the exogenous adiponectin was next visualized in the liver using an antiadiponectin antibody 20 min and 2 h postintravenous injections . as a control , k8/18 was used as an endothelial marker , and dapi was used to visualize the nuclei . b : adiponectin and dapi stain in the kidney 20 min and 2 h after intravenous injection of adiponectin into adiponectin - null mice . ( a high - quality digital representation of this figure is available in the online issue . ) to further validate that the exogenous material behaved comparably to endogenous adiponectin , we visualized endogenous adiponectin in liver sections from wild - type and adiponectin - null mice . this , of course , represents a steady - state level of adiponectin as compared with the bolus injection described above . as seen for the exogenous adiponectin , endogenous adiponectin can be located to larger vessels in the liver ( fig . 5a ) , which is in accordance with previously published data ( 17 ) . in addition , we were able to detect adiponectin surrounding the individual hepatocytes with a distinct plasma membrane stain ( fig . intracellular adiponectin was also detected , although at much lower frequency and much weaker than that observed with injected adiponectin , confirming that in the steady - state adiponectin ( or at least the epitope that we use for visualization with our antibodies ) is degraded rapidly . as with the liver , we were able to detect adiponectin signal in the blood vessels of the kidney ( fig . interestingly , when we probed the gastrocnemius muscle for endogenous adiponectin , we detected a sarcolemal signal ( fig . there is still only weak evidence available arguing for an in vivo action of adiponectin on muscle . it remains unclear whether adiponectin plays a physiological role in muscle and what the sarcolemmal signal indicates . a : k8/18 ( endothelial marker ) , adiponectin , and dapi stain of 8-week - old wild - type ( wt ) and adiponectin - null livers . b : adiponectin and dapi stain of kidney and gastrocnemius muscle from wild - type and adiponectin - null mice . ( a high - quality digital representation of this figure is available in the online issue . ) the derivatized molecule retained its multimeric conformation ( online appendix fig . 1 [ available at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1750/dc1 ) and maintained its bioactivity as judged by its ability to induce a glucose - lowering effect in vivo if injected at 0.5 g / g body wt ( data not shown ) . to determine the clearance rate for adiponectin during different physiological as well as pathophysiological conditions , we injected these preparations intravenously into mice and frequently sampled plasma levels over the next 3 h. figure 1a ( upper panel ) shows the fluorescence derived from the labeled adiponectin after separation on sds - page containing plasma from mice injected with labeled adiponectin . the lower panel shows the 25-kda igg light - chain band of a subsequent coommassie stain of the same gel , serving as a loading control . while females tend to have significantly higher levels of adiponectin in circulation , wild - type adiponectin clears plasma with a rate of 75 min in both male and female fvb mice ( fig . to validate that our labeled recombinant adiponectin behaves similar to native adiponectin in circulation , we injected 200 l serum from wild - type mice into adiponectin - null mice and measured clearance of adiponectin levels by enzyme - linked immunosorbent assay over the next 3 h ( fig . no differences could be observed between the endogenous ( native ) adiponectin and the recombinant , purified adiponectin . next , we wanted to know whether conditions characterized by altered adiponectin levels also had differences in clearance rates . we have previously shown that long - term fasting causes adiponectin levels to increase significantly . comparing clearance rates between ad libitum fed mice and mice fasted for 24 h did not reveal any differences at the level of clearance ( fig . we have also shown that during pregnancy , adiponectin levels drop significantly , in line with the decreased systemic insulin sensitivity in the mothers ( 16 ) . however , clearance rates between female control mice and a cohort of pregnant females did however not reveal any differences , suggesting that a reduction of adiponectin production is the major driving force behind the systemic reduction ( fig . even more striking is our observation that the half - life of adiponectin is significantly extended in ob / ob mice or in wild - type mice exposed to a high - fat diet compared with wild - type controls fed a standard diet ( fig . the decreased plasma levels found under these conditions are therefore primarily due to the reduced production rate in these animals . the hmw form of adiponectin has been shown to correlate better to insulin sensitivity than total levels ( 6 ) . we therefore wondered if the clearance of the individual adiponectin complexes differed in regards to clearance rate . the three isoforms were isolated by gel filtration of recombinant adiponectin and labeled at the ratio of one dye per trimeric subunit ( fig . interestingly , the half - life did in fact diverge between hmw , lmw , and the trimer isoform , such that hmw has the slowest clearance ( 83.3 7 min ) , followed by lmw ( 54.5 3.7 min ) and trimer ( 32.4 1.2 min ) . surprisingly , the much more bioactive cysteine 39 mutant protein cleared the system with a half - life of < 10 min ( 6.8 0.3 min ) . preparations of the wild - type protein and the cysteine 39 mutant were injected intravenously into wild - type mice , and the distribution of the labeled protein was followed longitudinally in real time using a licor infrared detector unit highly sensitive to emission wavelengths in the infrared range . detection at these very long wavelengths has the advantage that there are very low levels of autofluorescence caused by tissues . also , these wavelengths are associated with deeper penetration into the tissues compared with wavelengths within the visible spectrum . upon injection , both the wild - type ( fig . in contrast , the injection of quenched dye alone causes clearance through the kidney and elimination from the system through urine as judged by the bright appearance of the bladder ( fig . 2c ) . in line with the differential clearance rates , the cysteine 39 mutant accumulates with considerably faster kinetics than wild - type protein a quantification of the total signal in the liver and its changes over time are shown in fig . this highlights the fact that the signal for the cysteine 39 mutant peaks as early as 30 min , whereas the signal for the wild - type protein takes up to 4 h to accumulate the highest signal intensity . both proteins seem to get degraded , and the fluorescent label can ultimately be found in the bladder as well . at this stage , however , the protein is no longer full length , and labeled adiponectin can only be detected as a broad heterogeneous smear when urine samples are separated on sds - page ( fig . although the different kinetics of liver signal between the wild - type and cysteine 39 adiponectin are in it self highly suggestive of a specific signal and not just a fluid - phase uptake phenomenon , we performed two additional control experiments . first , we wanted to test the outcome if we disrupt the original structure of the recombinant protein by boiling the preparation in the presence of 1% sds and 1 mmol / l dtt . even though some of this material may partially refold in vivo , this preparation accumulated to a different extent and with completely different kinetics in the liver and displayed a clearance rate comparable to that of the cysteine 39 adiponectin ( online appendix figs . 2 and 5 ) . in addition , we wanted to compete the liver binding of labeled adiponectin with increased levels of endogenous adiponectin . for this purpose , we used a transgenic mouse model engineered to express adiponectin from the liver under the control of the transthyretin promoter . these mice have a fourfold increase in circulating adiponectin compared with wild - type mice ( k.d . similar to the denatured material , the injected adiponectin bound the liver with radically different kinetics ( online appendix figs . 3 and 4 ) . importantly , in both cases we set the maximal level to 100% to display the kinetics of clearance in relative terms . it is difficult to assess the absolute levels of tissue accumulation between different injections in quantitative terms , but the signal intensity in the liver was distinctly lower with both denatured adiponectin as well as in the overexpressing mice relative to injection of native protein into wild - type mice . visualization of injected labeled mammalian produced wild - type adiponectin ( a ) , cysteine 39 adiponectin ( b ) , and quenched irdye800 without conjugation to protein by the licor infrared scanner ( c ) . wild - type ( wt ) and cysteine 39 adiponectin were injected ( 0.05 g / g body wt ) and the mice scanned 30 min , 1 , 2 , 3 , 4 , 5 , 6 , and 24 h postinjection . d : the liver signals from a and b were quantified and plotted over time . * e : sds - page analysis of labeled adiponectin in the urin and in the plasma . the detection of labeled adiponectin in the intact animal offers the advantage of monitoring the distribution of the protein in real time . while powerful from a global perspective , this suffers from the inherent disadvantage that some organs may appear selectively more intense due to the closer proximity to the detection unit . to overcome this bias , organs were excised upon injection of wild type ( 4 h ) and cysteine 39 mutant ( 1.5 h ) post injection . organs were harvested and protein lysates were prepared and quantified by dot - blot analysis ( fig . as expected from the whole- body images , the liver and kidneys are responsible for the major adiponectin signal intensity . when the protein lysates were separated on sds - page , the adiponectin could only be visualized as a smear in all cases ( data not shown ) , indicating a rapid degradation once the molecule is taken up inside the cell . surprisingly , we also found a significant signal in the spleen , whereas we detected only very low signal in gastrocnemius , heart , small intestine , colon , pancreas , white adipose tissue , or testis . these observations were confirmed by scanning whole organs directly on the infrared scanner ( fig . 3b ) . even though we saw a relatively high intensity signal in spleen , we were unable to demonstrate that this is a specific signal . upon analysis of the spleens from mice injected with boiled and reduced adiponectin , we observed the same signal ( data not shown ) , suggesting that the signal in the spleen is unspecific . importantly however , even though the organs we examined displayed relatively low or no specific signal for adiponectin , we can not rule out that a small subset of cells within a given tissue bind and take up adiponectin avidly . low levels of signal in an organ should not be taken to rule out uptake of adiponectin by a small subset of cells , rather it indicates that a particular tissue is not a major contributor to clearance as a whole . a : dot - blot analysis of injected wild - type ( wt ) adiponectin in different organ lysates 4 h postinjection . epi , epididymal white adipose tissue ; gast , gastrocnemius muscle ; kid , kidney ; liv , liver ; mes , mesenteric white adipose tissue ; pan , pancreas ; sol , soleus muscle ; subq , subcutaneous white adipose tissue . given the high intensity of signal in the liver , we wondered whether we could develop an imaging method that would enable us to monitor the uptake of injected adiponectin into hepatocytes . to that end , we injected nonlabeled wild - type and cysteine 39 adiponectin ( 0.5 g / g body wt ) intravenously into adiponectin - null mice and sampled livers at 20 min and 2 h. in line with the more rapid kinetics of the cysteine 39 mutation , the adiponectin signal in the hepatocyte was prevalent at the early 20-min time point , whereas the wild - type adiponectin signal at this stage was located in the surrounding microvessels as evident by a colocalization with k8/18 ( fig . two hours after injection , adiponectin can be seen intracellularly in the hepatocytes for both wild - type and cysteine 39 adiponectin ( fig . as these images were obtained by immunofluorescence , we do not known whether the signal arises from full - length or degraded adiponectin . as for kidney , wild - type adiponectin could only be detected weakly in the kidney sections 20 min after injection , whereas the more active cysteine 39mutated adiponectin was abundantly apparent intracellularly at this time point as well . after 2 h , the cysteine 39 signal in the kidney was already markedly decreased as suspected by the short half - life . levels of wild - type adiponectin , however , were increased compared with 20 min ( fig . notably , the adiponectin detected in the kidney is mostly in the tubules with more limited signal in the glomeruli and appears to be mostly intracellular . no signal could be detected in the spleen or in gastrocnemius muscle ( data not shown ) . the lack of signal in the spleen confirms the nonspecific nature of the signal in this tissue , as discussed above . a : wild - type ( wt ) and cysteine 39 adiponectin were injected ( 0.5 g / g body wt ) into adiponectin - null mice and the liver processed for histology . the exogenous adiponectin was next visualized in the liver using an antiadiponectin antibody 20 min and 2 h postintravenous injections . as a control , k8/18 was used as an endothelial marker , and dapi was used to visualize the nuclei . b : adiponectin and dapi stain in the kidney 20 min and 2 h after intravenous injection of adiponectin into adiponectin - null mice . ( a high - quality digital representation of this figure is available in the online issue . ) to further validate that the exogenous material behaved comparably to endogenous adiponectin , we visualized endogenous adiponectin in liver sections from wild - type and adiponectin - null mice . this , of course , represents a steady - state level of adiponectin as compared with the bolus injection described above . as seen for the exogenous adiponectin , endogenous adiponectin can be located to larger vessels in the liver ( fig . 5a ) , which is in accordance with previously published data ( 17 ) . in addition , we were able to detect adiponectin surrounding the individual hepatocytes with a distinct plasma membrane stain ( fig . intracellular adiponectin was also detected , although at much lower frequency and much weaker than that observed with injected adiponectin , confirming that in the steady - state adiponectin ( or at least the epitope that we use for visualization with our antibodies ) is degraded rapidly . as with the liver , we were able to detect adiponectin signal in the blood vessels of the kidney ( fig . interestingly , when we probed the gastrocnemius muscle for endogenous adiponectin , we detected a sarcolemal signal ( fig . there is still only weak evidence available arguing for an in vivo action of adiponectin on muscle . it remains unclear whether adiponectin plays a physiological role in muscle and what the sarcolemmal signal indicates . a : k8/18 ( endothelial marker ) , adiponectin , and dapi stain of 8-week - old wild - type ( wt ) and adiponectin - null livers . b : adiponectin and dapi stain of kidney and gastrocnemius muscle from wild - type and adiponectin - null mice . ( a high - quality digital representation of this figure is available in the online issue . ) to our knowledge , this is the first study that addresses the in vivo fate of adiponectin and determines its half - life in circulation under both physiological and pathophysiological conditions . this clearance state is relatively stable and shows no difference between the sexes , with long - term fasting , or during pregnancy ( all situations known to alter the circulating levels of adiponectin ) . that said , however , both genetically ( ob / ob mice ) and diet - induced obesity resulted in slower clearance rates of adiponectin . thus , the lower adiponectin levels observed under these conditions must be a result of diminished secretion rather than an increased clearance . at this stage , there is very limited evidence to whether the three different adiponectin complexes have similar functions or work in concert with each other . the fact that hmw adiponectin levels are more tightly correlated with insulin sensitivity than total adiponectin suggests that there might be differences . here , we show that hmw , lmw , and trimer adiponectin are cleared differentially , in such that hmw is cleared slowest ( t1/2 85 min ) and trimer fastest ( t1/2 32 min ) . at this stage , we can only speculate as to why the hmw form is cleared more slowly than the other two isoforms . the hmw form may serve as a storage compartment for trimeric subunits that get locally generated upon reduction of the hmw form . alternatively , exit of the hmw form from circulation may be slowed down due to its size . the time in circulation for trimeric adiponectin can be even further reduced to 10 min by mutating cysteine 39 to alanine . we do not believe that this shortened half - life is a reflection of an unfolded or generally unstable recombinant protein for several reasons . second , we have generated transgenic mice that overexpress this mutant in adipocytes . while the synthesis and release of this protein occurs at levels comparable to wild - type protein , the steady - state levels of the mutant are < 1% of wild - type levels , consistent with a very short half - life of this protein in circulation ( k.d . the cysteine 39 mutant adiponectin is physiologically more active as determined by its ability to lower glucose . this implies that the intratrimer disulfide bond ( the only difference between wild - type trimer and cysteine 39 mutant ) plays a key role . the intratrimeric disulphide bond may maintain the wild - type protein in a spring - loaded configuration that conveys a conformational change throughout the protein upon reduction . it is interesting to note that the potently bioactive cysteine 39 mutant is also the form with the fastest clearance . combined with the delayed clearance of adiponectin in the high - fat diet and ob / ob models , this suggests that rapid clearance goes hand in hand with high bioavailability and activity , whereas delayed clearance is an indicator of metabolic dysfunction . importantly , however , these are only correlations , and we are focusing here at clearance only and do not want to imply that clearance equates bioactivity under all circumstances . these differential effects on clearance of adiponectin raise the important question as to how the clearance of this protein is mediated . like adiponectin , insulin has a profound effect on the liver . after binding to the insulin receptor on the hepatocyte , the receptor - protein complex gets internalized into the endosome where the insulin - degrading enzyme breaks down the insulin ( 18 ) . while insulin has a much shorter half - life than adiponectin , it may be possible that adiponectin ( similar to insulin ) is extracted every time it passes through the liver . the detection methods used to date are not sensitive enough to measure a gradient across the splanchnic bed , but a combination of more robust assays coupled with a focus on the measurement of the different complexes individually may enable us to measure such a gradient in the future . our histological analysis of both acutely administered exogenous adiponectin as well as steady - state endogenous levels have revealed several interesting observations . in all the organs investigated , adiponectin can be visualized in larger blood vessels . this is especially the case for visualization of endogenous adiponectin whose steady - state distribution is a reflection of adiponectin at various stages of degradation . in contrast , our pulsed administration of recombinant adiponectin allows us to follow a much more homogenous population . the staining of the vessels is consistent with a possible role of the adiponectin - binding protein t - cadherin ( 8) . the lack of an intracellular signaling motif makes this protein an unlikely candidate as a signal transducer . instead , t - cadherin may function to tether adiponectin to the vessel wall where a possible reductase may cleave the full - length adiponectin into the trimer . accessibility to the hepatocytes is increased with the cysteine 39 mutant , suggesting that this 90-kda complex may have more efficient access across the endothelium and the sinusoidal fenestrae as opposed to the wild - type protein that can be as big as 500 kda to 1 megadalton . we have not addressed the question whether the published adiponectin receptors adipor1 and adipor2 are critically involved in this process . it is also interesting to note that we detect a significant amount of signal in the kidney where it is primarily in the tubules . whether clearance in the kidney is a phenomenon that is also relevant for native adiponectin or whether it is a secondary site that clears a liver - derived degradation product is not clear . however , an important role of the kidneys for adiponectin levels has been reported in several cases in patients with chronic kidney disease ( 19 ) . it remains intriguing that an abundant plasma protein such as adiponectin is cleared at such a rapid rate . this results in a very high biosynthetic rate in the adipocytes . despite a high level of production and rapid clearance , it is surprising that the steady - state levels in circulation are remarkably stable and fluctuate with minimal diurnal variability . this implies that a communication axis between the different adipocytes , as well as among the different adipose pads , must be strictly maintained . furthermore , plasma adiponectin is extremely stable , since it can be stored for 36 h without any significant losses due to degradation , suggesting that clearance - based mechanisms are the predominant method of elimination rather than degradation in plasma ( 20 ) . in summary , we have shown here for the first time the clearance rate for the key metabolic hormone adiponectin . we have furthermore shown that the clearance varies for the different isoforms of adiponectin , with hmw being cleared the slowest and the trimer the fastest . finally , we demonstrate that the liver is the main site of clearance and the kidney only excretes final degradation products . | objectivethe adipocyte - derived secretory protein adiponectin has been widely studied and shown to have potent insulin - sensitizing , antiapoptotic , and anti - inflammatory properties .
while its biosynthesis is well understood , its fate , once in circulation , is less well established.research design and methodshere , we examine the half - life of adiponectin in circulation by tracking fluorescently labeled recombinant adiponectin in the circulation , following it to its final destination in the hepatocyte.resultsdespite its abundant presence in plasma , adiponectin is cleared rapidly with a half - life of 75 min .
a more bioactive version carrying a mutation at cysteine 39 is cleared within minutes .
even though steady - state levels of adiponectin differ between male and female mice , we failed to detect any differences in clearance rates , suggesting that differences in plasma are mostly due to differential production rates . in a metabolically
challenged state ( high - fat diet exposure or in an ob / ob background ) , adiponectin levels are reduced in plasma and clearance is significantly prolonged , reflecting a dramatic drop in adiponectin production levels.conclusionscombined , these results show a surprisingly rapid turnover of adiponectin with multiple fat pads contributing to the plasma levels of adiponectin and clearance mediated primarily by the liver .
it is surprising that despite high - level production and rapid clearance , plasma levels of adiponectin remain remarkably constant . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
phlebosclerotic colitis , a rare disease entity of ischemic colitis , is known to be characterized by the thickening of the colonic wall due to fibrotic sclerosis of the colono - mesenteric vein and fibrous degeneration of the submucosal layer of involved colon , resulting in the disturbed venous return from the colon ( 1 , 2 ) . the pathophysiologic mechanism of this disease remains unclear although several reports have suggested that it might be related to portal hypertension secondary to liver cirrhosis or other chronic liver diseases ( 2 , 3 ) . the diagnosis is usually achieved to be based on a combination of radiologic , endoscopic , and histologic findings along with clinical manifestations . there are several cases about this disease entity those have been reported in authorized medical journals around the world but rare in korea ( 4 - 11 ) . here we report the first case of phlebosclerotic colitis confirmed surgically in a 61-yr - old cirrhotic patient with portal hypertension in korea . a 61-yr - old man was admitted to hospital because of right lower quadrant abdominal pain and bloody stool for one month . he had a medical history of regular follow - up for alcoholic liver cirrhosis since four years ago . he had experienced the endoscopic histoacryl injection sclerotherapy for gastric varix with bleeding eight months ago . at the time of admission , laboratory tests showed a white blood cell count of 2,990/l , hemoglobin of 11.6 g / dl , platelet count of 119,000/l , but there were no other abnormal findings in the blood chemistry with liver tests , electrolytes , and prothrombin time . tumor markers such as alpha - fetoprotein , carcinoembryogenic antigen ( cea ) , and ca19 - 9 were within normal limit . a colonoscopy revealed multiple , geographic , and circumferential ulcerations in the distal ascending and transverse colon and could not get through further proximal portion of ascending colon due to luminal narrowing with fibrotic stenosis ( fig . a follow - up colonoscopy performed one month later showed still remained multiple ulcerations in the transverse colon . the ascending colon was not observed because of no more further advance of endoscopy due to marked stenosis ( fig . 1b ) . abdominal computed tomography ( ct ) demonstrated cirrhotic liver with splenomegaly and multiple porto - systemic venous collaterals . the proximal to mid ascending colon were thick - walled with increased density in the surrounding fatty tissue and diffuse vascular engorgement ( fig . superior mesenteric angiography revealed no occlusion of main branch at arterial phase , but indicated venous pooling along the ascending colon at the delayed phase ( fig . the right lower abdominal pain of the patient was progressively worsening even though the conservative treatments with total parenteral nutrition for 10 days after admission . finally , the marked dilatation of small bowel caused by colonic obstruction was observed on ct scan ( fig . 4 ) and the passage of stool was not identified . a right hemicolectomy was performed because of the colonic obstruction . gross findings of operation specimen showed approximately 75 cm sized ulcerating mass - like wall thickening of the cecum and the proximal ascending colon ( fig . microscopic examination showed chronic ulcerative inflammation , fibrous degeneration of the submucosal layer , and thickening of the venous wall in the mesentery with no evidence of malignancy ( fig . 5b - d ) . on the basis of these radiologic , endoscopic , and histologic findings mentioned above , we diagnosed as a phlebosclerotic colitis occurred during regular follow - up of cirrhotic patients with portal hypertension . until now , eight months after right hemicolectomy , the patient is being followed in the status of compensated liver cirrhosis without any gastrointestinal symptoms . phlebosclerotic colitis , first coined by yao et al . in 2000 ( 6 ) , is a rare type of ischemic colitis and has different clinicopathologic presentations from the classic type of ischemic colitis . while ischemic colitis is usually caused by insufficient perfusion of mesenteric arterial blood flow and involves left side colon , especially hepatic flexure or sigmoid regions where are known to be watershed area within the colonic blood supply , phlebosclerotic colitis occurs when sclerotic obstruction of veins in the colonic wall and adjacent mesentery produces chronic congestion of affected colon , and involves the right hemicolon preferentially ( 5 - 8 ) . the present case also shows the typical manifestations of phlebosclerotic colitis such as fibrous thickening of affected colono - mesenteric vein and wall thickening of right hemicolon . the pathogenesis of this disease still remains unknown , but there are several clinical conditions , diabetes mellitus , hyperlipidemia , cardiac disease , angiitis , crest syndrome , churg - strauss syndrome , lymphocytic phlebitis and portal hypertension , those might be related to phlebosclerotic colitis ( 6 , 12 - 15 ) . in the presented case , in korea , to our knowledge , a similar case has been reported previously as a term of idiopathic mesenteric phlebosclerosis ( 11 ) , first described by iwashita et al . in 2003 ( 12 ) , known to be a synonym of phlebosclerotic colitis . clinical symptoms include abdominal pain and bloody diarrhea , as our case presented , nausea , vomiting , constipation and ileus , and depend on the severity of the disease ( 16 ) . although this disease usually has long duration of illness indicating chronic nature of the disease , progression to mechanical ileus resulting from intestinal obstruction is not common . surgical intervention , as we did in our case , is not usually necessary unless intestinal obstruction , perforation or massive bleeding occur as postischemic complications ( 8 , 12 ) . colonoscopy usually reveals dark purple and edematous mucosa , erosion , ulceration and luminal narrowing . saito et al . ( 4 ) endoscopically observed a patient of phlebosclerotic colitis for three years and considered deep circumferential ulceration on colonoscopy as the aggressive nature of this disease . in our case , the first colonoscopy showed multiple circumferential ulcerations and luminal narrowing , and could not get through the lesion due to stenosis and fibrosis , which have been worsening in the follow - up colonoscopic finding one month later . the imaging findings of phlebosclerotic colitis are as follow ( 1 , 4 - 6 ) : multiple thread - like or linear calcifications mainly along the right hemicolon on plain radiographs of abdomen ; thickening of the affected colonic wall with calcification of intramural and mesenteric veins on ct scans ; haustral disappearance , luminal irregularities , rigidity , narrowing , and thumb - printing on barium enema ; and venous pooling and obstruction of the affected colonic wall with dilated collateral flow on angiography ( 1 , 5 ) . in the present case , contrast - enhanced dynamic ct , virtual ct colonography and superior mesenteric angiography also showed typical radiologic features of phlebosclerotic colitis those were described above , except calcification of involved colonic and adjacent mesenteric veins . histopathologic characteristics include , macroscopically , dark brown appearance of the right hemicolon and thickening of the colonic wall , and microscopically , thickening of the venous walls and tortuous veins , fibrotic degeneration of the venous walls with calcifications and markedly fibrous thickening in the submucosa of colonic wall ( 6 ) . recently , kusanagi et al . ( 2 ) considered calcification of the venous wall to increase gradually over the time and reported the case without definite calcification of the venous wall on radiologic and histologic finding as the early stage of phlebosclerotic colitis . in this case , microscopy revealed submucosal fibrosis of the colonic wall and thickening of venous wall in the mesentery without calcification . it is considered that this change was induced by ischemic colitis due to disturbance in venous return from the colonic wall associated with portal hypertension . here we report the first case of surgically confirmed phlebosclerotic colitis , that was in the early stage but showed the aggressive nature , in cirrhotic patients with portal hypertension in korea . | phlebosclerotic colitis is a rare form of ischemic colitis characterized by the thickening of the wall of the affected colon due to fibrous degeneration of submucosal layer of colon and fibrotic obstruction of the colono - mesenteric vein , resulting in the disturbance of venous return from the colon .
the pathogenic mechanism of this entity remains unknown but chronic liver disease with portal hypertension is maybe thought to be one of the speculated mechanisms .
here we first report the case of surgically confirmed phlebosclerotic colitis , that was in the early stage but showed the aggressive nature , in a 61-yr - old cirrhotic patients with portal hypertension in korea . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the human body is very sensitive to changes in temperature , humidity , wind , air pressure , insolation , precipitation , positive or negative ionization of air , particularly when these factors increase or decrease ( 3 ) . with the increasing number of publications and increasingly rigorous studies , it became clear that the period of spring and early summer is the period with most frequent occurrence of suicides ( 4 , 5 ) . statistically significant variation with neurotic disorders and stress disorders is most prominent in the spring ( 7 ) . the cooperation between meteorologists and doctors initiated a specific subset of weather prognosis the bio prognosis . meteropathy term comes from the greek word meteoron ( celestial phenomenon ) and pathos ( disease ) ( 3 ) . meteoropaths are the persons which emergence of health problems or a deterioration of basic disease are regularly associated with poor weather conditions ( 5 , 6 ) . it is widely believed that weather conditions affect human mood and many people believe that they are happier when the days are longer with sunny intervals , rather when the days are shorter , darker and rainy . season of certain psychological disorders is a theory that has for long been pushed forward and has been particularly linked with affective disorders and tragic consequences of them - suicides ( 5 , 6 ) . the fact that certain physiological and psychopathological processes are significantly altered during certain times of year or season , suggesting a direct exposure to climatic variables . however , it can also be an expression of autonomous biorhythm and the question of whether climatic conditions and climatic variables have an impact on the mental state of humans remains ( 6 ) . contemporary definitions define climate as a dynamic system in which both participate and influence each other the atmosphere , oceans , lithosphere , ice and snow cover and biosphere including human impact ( 7 , 8) . some weather parameters in a certain way determine the number of patients with stress - induced disorders as compared to subjects with other psychiatric disorders admitted to the clinic at certain seasons during the 2010 and 2011 . determine whether the seasons and the weather factors influence the increase in admission rates of subjects with neurotic and somatoform disorders and disorders caused by stress during the 2010 and 2011 . determine whether a specific weather parameters affect the increased incidence of stress disorders ( correlation ) . this study was conducted in the period from january 1 2010 to december 31 2011 at the psychiatric clinic , clinical center of sarajevo university and includes respondents selected randomly . forming a total sample of 2355 respondents , aged 5 to 89 years , 1316 males and 1039 females . during the 2010 female respondents in 2010 was 486 ( 42% ) and in 2011553 ( 46% ) . within total number of respondents in the study period ( n-2355 ) , the most frequent age was 51 - 60 years ( 35% ) , followed by age group 41 - 51 years ( 29% ) . respondents aged 31 - 40 years makes 14% , and 19 - 30 years 8% . over 60 years of age of the total respondents 38% were unemployed , 36% were employed , 18% are retired and the smallest group was students with 7% . as the survey instrument was used structured psychiatric interview and the diagnosis conducted study is clinical , retrospective - prospective , based on observation and analysis of the variables present , the processing of diagnostic entities , and their grouping . made is the comparison of the incidence of neurotic and somatoform disorders and stress caused disorders by the admission rates in regard to specific seasons and weather factors , with the aim of finding a possible correlation between the occurrence of certain disorders and the seasons . determined is a correlation between certain weather parameters ( temperature , humidity , barometric pressure , and precipitation ) and increased admission rates to psychiatric clinic patients with these disorders . also are collected data from the federal hydrometeorological institute in sarajevo on the values of climatic parameters for 2010 and 2011 year that were relevant to the research ( air temperature , atmospheric pressure , humidity and precipitation ) and the total climatological analysis for that period . also were collected data from the same institute about the climatological analysis of the situation in that year and listed observations . the data after statistical analysis ( software stigmastat 3.5 and microsoft office excel 2007 ) are shown in tables . statistical significance between the groups was tested by chi - square test and spearman rank correlation test . from table 1 it is evident that with the diagnosis f40-f48 most respondents were admitted in the winter 29% , then fall with 28% , 23% in the spring and summer 20% . chi - square test revealed statistically significant differences in the prevalence of certain diagnostic groups according to the seasons of 2010 at the confidence level of 99% or p<0.01 . table 2 shows that most patients with diagnoses with diagnosis f40-f48 most patients were admitted during the winter or 32% . chi - square test revealed statistically significant differences in the prevalence of certain diagnostic groups according to the seasons of 2011 at the confidence level of 99% or p<0.01 . so , the most commonly diagnosed in the period of 2010 and also 2011 are diagnosis from group f40-f48 with 33% in 2010 and 29% in 2011 . the second most common diagnoses were f20-f29 with 29% during the 2010 and 28% during the 2011 . the third most common diagnoses were f30-f39 with 23% during the 2010 and 22% during the 2011 year . diagnoses from the group f10-f19 are the fourth most common with 5% during the 2010 and 4% during the 2011 year . analysis by chi - square test confirmed the above differences and indicates statistical significance at p<0.05 . the table 3 shows that the percentage of subjects with diagnoses f40-f48 in the month of january 2011 is 12% and for the same period 2010 is 8% . in the month of march there were no statistically significant differences in the number of respondents who were admitted by months of 2010 and 2011 with the diagnosis from the group f40-f48 ( p>0.05 ) . the weather parameters , whose influence has been studied in the course of the study with their values for all months of 2010 , as well as an increase or decrease the number of patients during the month in which significant changes were observed . so it is established that for diagnosis f40-f48 increase in number of patients was in march and october and a decrease in may . for diagnoses f40-f48 increase was recorded in january and march , while a decrease in july . in relation to weather parameters and seasons of the 2010 respondents with a diagnosis of f40-f48 was mostly seeking treatment during winter 29% , then fall 28% , spring 23% and summer 20% , while during 2011 most of the patients seeks treatment during the winter 32% . statistical analysis by spearman rank correlation coefficient shows that in the case of the diagnostic group f40-f48 was found a strong correlation with the months of the year which indicates a greater number of hospitalizations in the second half of the year ( july - december ) . by analyzing and processing the collected data showed that the frequency of admission at the clinic during the two studied years are patients with diagnoses f40-f48 , neurotic and somatoform disorders and stress induced disorders . the total number of patients with diagnoses f40-f48 , which were admitted during the 2010 , was 385 . during the 2011 the temperature values were then lower than the average , precipitation was higher than the average , with normal humidity and the air pressure was slightly lower than normal values . the temperature then was higher than average as well as precipitation and humidity , while air pressure was normal . the temperature was increased , with precipitation , humidity and atmospheric pressure within normal values . during the 2011 the majority of patients the temperature was higher than average as well as precipitation and humidity , while atmospheric pressure was lower than average . in the month of march air temperature was increased as well as the amount of precipitation , with normal air pressure and humidity . the smallest number of respondents was admitted in july or 19 , when the air temperature was lower than average as well as precipitation with normal pressure and humidity . from the obtained data we can say that the information on certain weather parameters were the same for 2010 and 2011 when it comes to increase in the number of admission , but only for two months , for other months when there has been an increase in admission did not come to the same changes in weather parameters and it can be concluded that there is not a specific , constant form which could explain why patients with these diagnoses are seeking more treatment just in certain months or circumstances of some weather parameters . therefore , for the diagnostic group neurotic and somatoform disorders and stress induced disorders , during the 2010 the majority of patients were admitted during the winter 29% , fall 28% , spring 23% and 20% during summer . during the 2011 the majority of patients were admitted during the winter 32% , 26% during fall , spring 24% and summer 18% . conflicting results have proven other authors who have investigated the correlation of environmental and climatic factors in relation to the admission rates of patients with psychiatric disorders in a period of two years : most patients was with bipolar disorders , while neurotic disorders and stress induced disorders are with lowest incidence . however , our results are similar with respect to a larger number of patients with stress induced disorders in winter ( 10 ) . a group of authors has found that the highest rate of admissions is in the spring and summer ( 11 ) . our results showed a similarity to results of group of authors who investigated the prevalence of ptsd and climatic factors and found that it is also the highest in the winter months , but in early spring ( 12 ) . the authors investigated whether the seasons are linked to suicide in patients with psychiatric disorders . the study included a period of five years in sweden , so that is observed increased suicidality in certain seasons . proven is significantly increase of the suicide rate in patients with neurotic and stress related disorders , as well as somatoform disorders ( f40 - 48 ) in spring and early summer . in male subjects ( n=9902 ) was most prevalent depression and in female subjects ( n=4128 ) had history of neurotic , somatoform and stress related disorders . similar results were reported in denmark where the authors found that the association of suicidality is in relation to the seasons in patients with stress induced disorders , but also in subjects without any psychiatric disorder ( 14 ) . opposite results found the authors , who found no association with neurotic and stress - related disorders in relation to the seasons and climate factors ( 15 ) . statistically significant variation in relation to seasons was found for neurotic disorders , as well as several other disorders with the highest frequency in the spring ( 16 ) . in second place were diagnoses f20-f29 ( schizophrenia , schizophrenia like disorders and mad states ) . in third place were diagnoses from group f30-f39-mood disorders , which include episodes of mania , bipolar disorders , depression , recurrent depressive disorder , persistent mood disorders and other mood disorders . based on the data presented above can be drawn the following conclusions :
somatoform and stress related disorders are at the first place by the incidence both during the 2010 and 2011.data analysis showed that there is an increased of admissions of patients with these disorders during the winter.statistical analysis spearman rank correlation coefficient indicates that the climate and climatic factors have a statistically significant effect on the admission rate of patients from diagnostic group of stress induced disorders.due to the lack of research in this field so far the results of these studies and those in the scientific literature induce the need for such studies in future . somatoform and stress related disorders are at the first place by the incidence both during the 2010 and 2011 . data analysis showed that there is an increased of admissions of patients with these disorders during the winter . statistical analysis spearman rank correlation coefficient indicates that the climate and climatic factors have a statistically significant effect on the admission rate of patients from diagnostic group of stress induced disorders . due to the lack of research in this field so far the results of these studies and those in the scientific literature | introduction : psychiatric disorders have been considered to have seasonal variation for a long time.goal:the goal of this research is to study the admissions rate of neurotic and somatoform disorders , as well as stress induced disorder in relation to season and climatic factors during 2010/2011.material and method : the research was conducted at the psychiatric clinic , clinical center of university in sarajevo . randomly selected subjects ( aged 5 - 89 years , 1316 males and 1039 females ) n=2355 , were interviewed by the structural clinical interview ( scid ) which generated dsm - iv diagnoses . in this retrospective - prospective ,
clinical - epidemiological study subjects were divided into groups according to type of disorders .
correlation between the impact of seasons and the rate of admissions to a psychiatric clinic was analyzed .
certain data were taken from federal hydrometeorological institute in sarajevo about the climatic situation for period of the study.results and conclusions : from the total number of subjects who were admitted to the clinic in the period of 2010/2011 the most common diagnoses were f10-f19 , f20-f29 , f30-f39 , f40-f48 , and the suicide attempts as the separate entity .
it was found the correlation between certain seasons and the effects of the certain weather parameters at an increased admission rate of subjects with the neurotic , somatoform and stress induced disorders . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in our first review,1 we emphasised the phenotypic feature of the type of ventricular septal defect which is defined as being perimembranous within the classification now established by the association for european paediatric cardiology.23 at the same time , we highlighted the potential anatomic discrepancies that exist between this classification and the one promoted by the society of thoracic surgeons.4 the defect characterised by fibrous continuity between the leaflets of the arterial and atrioventricular valves , however , although the type most frequently encountered during surgical repair , is just one of the anatomical variants of the holes which can be found between the ventricles . in this review these are defects which have an exclusively muscular rim when viewed from their right ventricular aspect , and those defects which have fibrous continuity between the leaflets of the aortic and pulmonary valves . as with the perimembranous defect , understanding the system of classification our review will commence , therefore , by revisiting the normal morphology , paying particular reference to the features that are of importance in appreciating defects with exclusively muscular rims , and those roofed by fibrous continuity between the leaflets of the arterial valves . only a small part , which is integrated into the aortic root , is made of fibrous tissue . this fibrous component is the so - called membranous septum.5 it is located inferiorly to the inter - leaflet triangle that fills the space between the ascending hinges of the non - coronary and right coronary leaflets of the aortic valve ( fig.1 ) . the membranous septum is found at the base of the inter - leaflet triangle which interposes between the right coronary and non - coronary leaflets of the aortic valve when transilluminated from the right atrioventricular aspect , it can be seen , in most cases , to be crossed by the hinge of the tricuspid valve , thus dividing it into atrioventricular and interventricular components . it is then the position of the hinge which determines the proportions which are atrioventricular as opposed to interventricular6 ( fig.2 ) . trans - illumination from the left ventricle shows how the right atrioventricular aspect of the membranous septum is crossed by the hinge of the tricuspid valve . the atrioventricular component of the septum is itself pierced by the atrioventricular conduction axis as it passes from the apex of the triangle of koch to reach the crest of the muscular septum.5 . our first review emphasised that the normal ventricular septum came apart between its muscular and fibrous components in the presence of a defect which had fibrous continuity between the leaflets of the arterial and atrioventricular valves . with the exception of hearts with straddling and overriding of the tricuspid valve , this feature explains why the conduction axis is always found in postero - inferior position when these perimembranous defects are found in the setting of concordant atrioventricular connections ( fig.3 ) . a perimembranous septal defect , showing the fibrous postero - inferior rim of the defect penetrated by the conduction axis in terms of the variants seen with this particular lesion , the arrangement of the muscular septum , and particularly its relationship with the free - standing muscular subpulmonary infundibulum , are of crucial importance , as deficiencies of the muscular septum can be found opening to different parts of the right ventricle . to differentiate between these various defects , therefore , we find it helpful to relate their location relative to the components of the right ventricle , namely its inlet , outlet , and apical trabecular parts . as we will see , defects with exclusively muscular rims can also open into any of these components . in the normal heart , however , it is incorrect to imagine that the subpulmonary outlet component is separated from the subaortic outlet of the left ventricle by a discrete muscular septum , albeit that this is the impression given in some earlier works.7 in reality , in the normal heart , the leaflets of the pulmonary valve are supported by a sleeve of free - standing muscular infundibulum ( fig.4 ) . a normal heart showing the relationship of the great arteries . the pulmonary trunk is lifted away from the base of the heart by a free - standing muscular infundibulum this sleeve lifts the leaflets of the pulmonary valve away from the base of the ventricular mass . a discrete extracardiac tissue plane is to be found between the offset hinges of the two arterial valves which contains fibroadipose tissue , and which separates the posterior aspect of the subpulmonary infundibulum from the aortic valvar sinuses . this arrangement continues to be seen in anomalies such as tetralogy of fallot ( fig.5 ) . the attachment of the hinge points ( blue dots ) of the aortic ( ao ) , and the pulmonary valves ( pv ) , are off - set , with an extracardiac tissue plane separating the two arterial trunks . the situation is illustrated here in the setting of tetralogy of fallot appreciation of this arrangement is particularly important for those seeking to understand the structure of the defect which is roofed by fibrous continuity between the leaflets of the two arterial valves . in fact , this defect , which we describe as being doubly committed and juxtaarterial , can not exist in the setting of the normal heart . it has far more in common with hearts possessing a common arterial trunk than it does with those having normal outflow components.8 the key feature when distinguishing between defects , as we emphasised in our first review,1 is to identify the right ventricular borders of the septal deficiency.9 we choose this viewpoint since this is now the most frequent approach taken by the surgeon during surgical correction , albeit often seen through the tricuspid valve . on this basis the majority possess , as their hallmark , fibrous continuity between the leaflets of the aortic and tricuspid valves in the postero - inferior rim of the defect ( fig.6 ) . it is continuity between the leaflet of the aortic and tricuspid valves in the postero - inferior margin which is the hallmark of a perimembranous ventricular septal defect these are the defects we describe as being perimembranous . the second group has in common the fact that the defects within it have entirely muscular borders , regardless of their position relative to the components of the right ventricle . the third group of defects is characterised by fibrous continuity between the leaflets of the two arterial valves , or else the presence of a common truncal valve . with such defects , which we call doubly committed and juxtaarterial , there is usually a muscular bar postero - inferiorly that separates the hinges of the leaflets of the aortic and tricuspid valves , or else interposes between the truncal and tricuspid valves . an important variation seen with these doubly committed defects , however , is for the septal deficiency to extend postero - inferiorly to abut on the area of fibrous continuity between the arterial and atrioventricular valves , thus making the defect also perimembranous . they can be multiple , or can co - exist with perimembranous or doubly committed defects , and their size can vary considerably . their phenotypic feature , nonetheless , is the presence of exclusive muscular boundaries as seen from the right ventricle , even when there is overriding of the leaflets of an arterial valve ( fig.8 ) . this diagrammatic representation shows the possible locations of muscular ventricular septal defects , and their relationship to the conduction axis.(tv= tricuspid valve , pv= pulmonary valve ) when viewed from the right ventricle , this ventricular septal defect has a complete muscular rim , despite the overriding of the aortic valve defects that open to the inlet of the ventricle are closely related to the septal leaflet of the tricuspid valve ( fig . 910 ) . both of these ventricular septal defects are closely related to the tricuspid valve . ( pv= pulmonary valve , p - vsd= perimembranous ventricular septal defect ) from the left ventricular aspect , the defect under the mitral valve ( mv ) is seen to have a muscular rim . this other defect is perimembranous ventricular septal defect ( p - vsd ) being roofed by fibrous continuity between the aortic valve ( ao ) and the atrioventricular valves those opening between the apical trabecular components of the ventricles can take various forms and guises . the apical muscular septum itself is covered on its right ventricular aspect by a coarse meshwork of apical trabeculations . these include the moderator band , which arises as one of a series of septoparietal trabeculations from the prominent septomarginal trabeculation ( fig.11 ) . this view of the right ventricular aspect of the normal heart shows the septomarginal trabeculation , which gives rise to the moderator band the presence of these trabeculations influences markedly the nature of deficiencies within the apical muscular septum . those defects which are large and solitary are usually seen in mid - ventricular position , located either immediately posterior to ( fig.12 ) or anterior ( fig.13 ) to the body of the septomarginal trabeculation . this muscular ventricular septal defect is posterior to the septomarginal trabeculation this muscular ventricular septal defect is anterior to the septomarginal trabeculation defects opening to the right ventricle anterior to the septomarginal trabeculation , but located closer towards the ventricular apex , however , are often crossed by the septoparietal trabeculations . in other instances , an apical defect can be crossed by the septomarginal trabeculation itself . because of this , the obviously solitary defect as seen from the left ventricle ( fig.14 ) can have multiple openings as viewed from the right ventricle ( fig.15 ) . this muscular ventricular septal defect , viewed from its left ventricular aspect , is seen to be a solitary defect from the right ventricular aspect , the defect is crossed by the septomarginal trabeculations giving the appearance of multiple defects the precise nature of these types of defect has been called into question recently by suggestions that the hole extends between the apex of the left ventricle and the infundibulum of the right ventricle.1011 this argument depends entirely on the definition used for the infundibulum of the right ventricle . in our opinion , the infundibulum is simply the free - standing muscular sleeve supporting the leaflets of the pulmonary valve , seen even in anomalous situations such as tetralogy of fallot ( fig.16 ) . muscular infundibulum raises the attachment of the pulmonary valve ( pv ) away from that of the aorta ( ao ) this is the structure that is removed by the surgeon when preparing the pulmonary autograft for use in the ross procedure . the very fact that the pulmonary valve can be removed in this manner ( fig.17 ) shows clearly that the infundibulum has no relationship with the apical component of the septum . although we differ with regard to the definition of the infundibulum , the points of clinical significance made with relation to these defects are of considerable importance . thus , unless the presence of multiple right - sided orifices , but with a solitary left - sided opening , is appreciated , then complete surgical repair can be difficult , with the potential for leaving residual defects.11 the pulmonary trunk has been resected in this normal heart , along with the free - standing muscular infundibulum . the dissection has not encroached upon the cavity of the left ventricle although in this case the defect is strictly a solitary hole , other variants , particularly towards the apex can exist . the apical muscular septum can be sponge - like , and truly multiple defects produce the so - called swiss - cheese septum . this represents failure of compaction of the apical septum , such that multiple tracks now persist between the ventricles . as a result the final type of muscular defect is the one that opens to the right ventricular outlet . this can take the form of a defect , usually small , which opens immediately beneath the free - standing muscular subpulmonary infundibulum ( fig.18 ) . alternatively , muscular outlet defects can be associated with overriding of the leaflets of the aortic valve , either in the setting of tetralogy of fallot ( fig.19 ) , or with an unobstructed subpulmonary outlet ( fig.20 ) . an outlet muscular defect , showing its relationship to the pulmonary valve ( pv ) a heart with tetralogy of fallot , with overriding of the aortic valve ( ao ) , which is connected to both ventricles , and separated from the tricuspid valve ( tv ) by a muscle bar of the septomarginal trabeculation ( smt ) this specimen has deviation of the of the muscular outlet septum , but with an unobstructed pulmonary outflow tract when categorising these defects , it is important to appreciate that , although the direct extension of the plane of the muscular ventricular septum transects the leaflets of the overriding arterial valve , with part of the aortic valve unequivocally supported by right ventricular structures , ( fig.21 ) the septal defect still has exclusively muscular borders when viewed from its right ventricular aspect ( fig.22 ) . significantly , a well - formed muscular bar interposes between the leaflets of the aortic and tricuspid valves , thus providing protection for the branching components of the atrioventricular conduction axis ( fig.23 ) . sectioning the heart shown in fig.20 reveals that the aortic valve overrides the crest of the ventricular septum viewed from the right ventricular aspect , the defect , seen in figs . 20 & 21 , has a complete muscular border the section shows the muscular bar which separates the aorta ( ao ) from the tricuspid valve ( tv ) , thus protecting the conduction bundle it is proper recognition of the location of the muscular defects relative to the septomarginal trabeculation that provides the information necessary to predict their relationship relative to the ventricular conduction tissues . inlet defects are posterior and inferior to the conduction axis , but can be closely related to the conducting bundles if positioned adjacent to the medial papillary muscle . apical defects posterior to the septomarginal trabeculation are also behind the right bundle branch , which descends within the substance of the septomarginal trabeculation . those anterior to the trabeculation , and those opening to the right ventricular outlet , are in front of the bundle . although such defects are well distant from the branching bundle , it is important to respect the integrity of the septomarginal trabeculation . this is because trauma to the right ventricular aspect can produce haemorrhage that can track along the insulating sheath surrounding the right bundle branch.12 such haemorrhage and oedema can then infiltrate the more proximal segments of the conduction axis , with the potential to produce complete atrioventricular block . with defects that open to the ventricular outlet , it is the size of the muscular bar interposing between the leaflets of the aortic and tricuspid valves that is the key feature relative to the vulnerability of the conduction tissues . when substantial , sutures can be inserted within the musculature without fear of damaging the conducting bundles . if flimsy , however , then sutures could pass directly into the conduction axis and induce iatrogenic heart block . as we have emphasised , in the right ventricle of the normal heart , the leaflets of the pulmonary valve are supported by the sleeve of free - standing subpulmonary infundibulum ( figs.4,17 ) . this raises the valve away from the body of the right ventricle , and also separates it from the leaflets of the aortic valve ( fig.24 ) . the essence of the doubly committed defect , however , is fibrous continuity between the leaflets of the aortic and pulmonary arterial valves , which are now at the same level in the roof of the defect ( figs.25 ) . due to the semilunar nature of their hinges , the leaflets can be offset to some degree if one of the aortic sinuses is wedged between two of the leaflets of the pulmonary valve ( fig.26 ) . in the normal setting , and seen here in tetralogy of fallot , the arterial valves are separated by a free standing muscular infundibulum , so the hinge - point attachment of the pulmonary valve ( pv ) is raised away from the aortic root.(ao ) with doubly committed defects , the arterial valves are at the same level , with fibrous continuity between the leaflets of the aortic and pulmonary valves although this defect is doubly committed , the arterial valves are still off - set so the doubly committed defect , therefore , exists where there is absence of formation of a completely muscular infundibulum within the right ventricle . because of this lack of infundibulum , the orifice of one ( fig.25 ) , or sometimes both ( fig.26 ) , of the arterial valves can override the crest of the ventricular septum . this is the arrangement seen with common arterial trunk , in which the septal defect is again doubly committed and juxtaarterial ( fig.27 ) . by its very nature , the defects seen with common arterial trunk , is doubly committed and juxtaarterial , and is seen here arising overriding the venticular septum typically , the common trunk arises astride the ventricular septum , with the septal defect having exclusively muscular rims as seen from its right ventricular aspect ( fig.28 ) . with all these defects , the key to the vulnerability of the conduction axis is once more the nature of the postero - inferior rim . usually this is muscular , and providing the muscle bundle is substantial ( figs.28,29 ) , it will protect the conduction axis . should the muscular tissue become attenuated , or disappear , so that the doubly committed defect extends to become perimembranous , ( fig.30 ) then the conduction axis is at risk in the postero - inferior margin . in this heart with common trunk , there is a muscular postero - inferior rim ( yellow dots ) , separating the truncal valve from the tricuspid valve the postero - inferior rim of the defect is usually muscular in doubly committed defects in contrast , the doubly committed defect in this heart extends to become perimembranous , with fibrous contunity between the leaflets of the aortic and tricuspid valves , as well as between the aortic and pulmonary valves the doubly committed defect is frequently encountered in asian countries.13 the crucial phenotypic feature of this defect is the altered morphology of the arterial trunks with respect to the normally structured heart . this defect can only exist in absence of the septal component of the free - standing infundibular sleeve which normally supports the pulmonary trunk , a trait seen in hearts with common arterial trunk . it is no coincidence , therefore , that both these lesions are found in the setting of 22q11 deletion , pointing to their similar genetic background which itself is more prevalent in far - eastern populations.81415 the likelihood of spontaneous closure of any ventricular septal defect depends largely on its location . it is usually thought that the majority of defects that close are perimembranous , followed by muscular defects . it is also likely that many small muscular defects do not come to the attention of the cardiologist , the defects being present during fetal life , yet closing during the neonatal period16 and first year of life . similarly , the classical murmur of the maladie du roger is probably due to small , isolated , muscular defects that close with time . in contrast , defects sufficiently large enough to warrant referral to a tertiary centre , show no correlation between the probability of closure and the size of the defect . thus , du et al17 found solitary muscular defects were larger than multiple ones , yet the former were more likely to close spontaneously . large defects found in the apical region of the septum are most likely to remain open . conversely , spontaneous closure of doubly committed defects is not at all common.18 when it does occur , it is due to prolapse of the aortic valve leaflets , so it is not necessarily a good thing . in this respect , the timing of surgical or interventional repair to prevent prolapse of the relatively unsupported leaflets of the arterial valves is of the essence . the intense mechanical stresses due to a high - pressure environment at the ventriculoarterial junction greatly increase the risk of prolapse of the leaflets of the aortic valve . the valvar tissues become exposed to increased velocities , and are then subject to progressive mechanical weakness . the uncertain integrity of the arterial valves , leads many centres to recommend early surgical treatment of the doubly committed defect.1921 in the extensive study by tohyama and colleagues,22 it was noted that seven - tenths of patients aged up to 35 years developed prolapse of the aortic valve , all involving the right coronary leaflet , and a third of the total developed overt aortic regurgitation . early diagnosis and repair of the doubly committed defect has been suggested to prevent the onset of aortic regurgitation . offsetting of the arterial valves has also been thought to be a factor in the formation of aneurysm of the right coronary sinus of valsalva . these can exist at any location within the muscular septum , and can be viewed as opening into any part of the right ventricle . when attention is paid to the borders of the hole as viewed from the right ventricle , then all defects can be placed in one of three phenotypic groups . early diagnosis for such defect using echocardiography is now routine , even in early fetal life.23 the phenotypic features we have suggested for diagnosis are just as valid in this setting as in postnatal life . with exact fetal diagnosis , it will almost certainly prove possible to identify those defects that are the most likely to close , as opposed to those which will require interventional or surgical treatment . for those requiring treatment , use of this information for anatomic categorisation permits an accurate assessment of any individual defect relative to the atrioventricular conduction axis , knowledge that is essential to the surgeon in order to achieve successful closure without fear of inducing atrioventricular block . thus , proper diagnosis , particularly of the doubly committed defect , should now be the prelude to timely successful management , and hopefully a normal post - interventional or post - operative outcome . | in our previous review of the phenotypic features of ventricular septal defects , we concentrated on the perimembranous variant , showing how its distinguishing feature , as viewed from the right ventricle , was fibrous continuity in its postero - inferior rim between the leaflets of the aortic and tricuspid valves . in this second review ,
we focus on the morphology of those defects which have exclusively muscular rims when viewed from their right side , and the variant with the phenotypic feature of fibrous continuity between the leaflets of the two arterial valves . as with the defects described as being perimembranous , once they have been characterised , it is the position of the defect relative to the components of the morphologically right ventricle that is the primary determinant of the options and strategies for treatment .
therefore , clarification of the morphology is the key to establishing the related risks for each particular defect . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the united states alone , about one third of the 200,000 men who are diagnosed with prostate cancer each year will undergo primary radiotherapy ( rt ) with external beam or brachytherapy [ 1 , 2 ] . failure rates vary according to the failure definition , rt modality and dose , duration of follow - up time , and clinicopathologic characteristics , but generally average 30%40% ( range : 10%40% ) [ 37 ] . after rt for prostate cancer , it has been demonstrated that up to one third of patients with biochemical failure will have a positive biopsy . currently , there are four salvage options with curative intent : radical prostatectomy , brachytherapy , high - intensity focused ultrasound , and cryoablation . each treatment choice has varying oncologic outcomes , side - effect profiles , and complication rates . relative to the most aggressive and definitive approach of salvage prostatectomy , cryoablation seeks to strike a balance between cancer control and toxicity . first - generation cryosurgical systems in the 1960s utilized liquid nitrogen to create an ice ball , which suffered from imprecise control and monitoring , resulting in a high complication rate . today s third - generation cryounits have transitioned to argon / helium based systems according to the joule - thompson principle to create precisely controlled isotherms through ultrathin needles . ultrasound imaging has coevolved with cryotechnology , now incorporating the routine use of multitemperature sensing probes , double freeze these revolutionary technical advances along with improvements in technique have led to dramatic reductions in toxicity and more favorable outcomes . cryotherapy has been used for primary whole gland and focal treatment , salvage whole gland and focal ablation , and local recurrence after radical prostatectomy . while there are no standardized criteria for the selection of patients for salvage cryotherapy , treatment is generally recommended for men with a rising prostate - specific antigen ( psa ) after rt who have a positive prostate biopsy and negative metastatic work - up [ 10 , 11 ] . according to the 2008 american urological association ( aua ) best practice consensus statement , ideal candidates for salvage cryoablation also should have absence of seminal vesicle invasion , a psa less than 10 ng / ml ( preferably < 4 ng / ml ) , a psa doubling time of 16 months or more , and at least a 10-year life expectancy [ 12 , 13 , 14 ] . because up to 30% of high - risk patients may harbor micrometastatic disease to the lymph nodes , a lymph node dissection may be indicated [ 12 ] . other factors such as gland volume larger than 50 to 60 cm or prior transurethral resection may exclude patients in some cases [ 12 ] . although a history of brachytherapy may complicate needle placement , it is generally not considered to be a contraindication to salvage cryosurgical ablation . a rim of psa - producing periurethral tissue will invariably remain after salvage cryoablation . as a result of these remnant cells , a zero psa ( ie , undetectable ) is unlikely to be achieved , and therefore , a post - treatment biopsy may be the most definitive determination of treatment failure after salvage cryoablation . although some authors have suggested a biopsy for patients with various post salvage cryotherapy psa values or in the setting of a persistently increasing psa , we recommend routine biopsy in every patient ( table 1 ) . however , this practice is unpopular with patients , has potential complications , and is subject to sampling error . thus , at most institutions , this is not a per protocol routine . among the few series that have engaged in this practice , positive biopsy rates after salvage cryoablation have ranged from 0% to 37% ( table 1 ) . among one of the largest series , chin and colleagues [ 16 ] biopsied more than 95% of patients ( table 1oncologic outcomes of recent whole - gland salvage cryotherapy trialsstudypatients , nfollow - up , mocryounit / cyclescstage at rtgleason at cryomed pre - rt , and precryo psa , ng / mlfailure definitionadtpost - treatment biopsy,% + bned,%williams et al . [ 16]18790candella , cryocare , ft 2x t2 : 86.1% ; t3 : 13.9%gs 67 : 60.7% ; gs 8 : 39.3%11.0 , 4.9phoenix71% neo , 32% adjuvant6 , 12 , 24 mo ( n = 178 ) : 16.764 dss ( 10 y ) ; 39 dfs ; 87 ospisters et al . 27921.6cryocarenrgs 67 : 51.2% ; gs 8 : 43.7%nr , 7.6astro & phoenix50.9% neo , 8.2% adjuvantmd discretion , ( n = 46 , 16.5% ) : 46nrmulti t2 : 86.9% ; t3 : 13%gs 67 : 58.7% ; gs 8 : 41.3%19.2 , 5.6nadir + 0.2 2x or > 1.015.2% neomd discretion ( n = nr)~50 ( 3.3 y)ismail et al . 10033.5cryocare , seednet t2 : 70% ; t3 : 30%gs 67 : 63.0% ; gs 8 : 37.0%nr , 5.4astro & psa < 0.5 ng / ml22% neo , 24% adjuvantpsa progression59 ( 3 y)cheetham et al . 511212nd or 3rd generation ft 2xunknown in 90.2%gs 67 : 53.2% ; gs 8 : 46.8%nr , 6.4astro & phoenixnrnrnrspiess et al . 45040.8nr t2 : 67% ; t3 : 33%gs 67 : 82.7% ; gs 8 : 17.3%2.2 ( mean ) , 7.8 ( mean)psa > 0.5 ng / ml38.1% neo , 0% adjuvantnr34bahn et al . 5982.3nr , ft 2x t2:69% ; t3 : 29%gs 67 : 71% ; gs 8 : 29%nr , 5.6increase in psa 0.5 ng / ml ; 1.0 ng / ml0% adjuvant6 , 12 , 24 , 60 mo if psa rise or psa > 0.5 ng / ml ( n = 38 , 64.4% ) : 059 ( 0.5 ng / ml ) , 69 ( psa 1.0 ng / ml)han and belldegrun 29nrseednet , ft 2xnrnrnr , nrpsa 0.4nr12 mo72.2eisenberg et al . 1518seednet , ft 24x t2 : 82.4% ; t3 : 17.6%gs 67 : 63.2% ; gs 8 : 36.8%nr , 3.3astro & phoenixnr12 mo ( n = 66.7% ) : 1050 , 79 ( 3 y)hemiablationmanufactured by galil medical , arden hills , mnadt androgen deprivation therapy , astro american society for therapeutic radiology and oncology , bned biochemical no evidence of disease , cryo cryotherapy , dfs disease - free survival , dss disease - specific survival , ft freeze / thaw , gs gleason score , md medical doctor , nr not reported , os overall survival , psa prostate - specific antigen , rt radiotherapy oncologic outcomes of recent whole - gland salvage cryotherapy trials manufactured by galil medical , arden hills , mn adt androgen deprivation therapy , astro american society for therapeutic radiology and oncology , bned biochemical no evidence of disease , cryo cryotherapy , dfs disease - free survival , dss disease - specific survival , ft freeze / thaw , gs gleason score , md medical doctor , nr not reported , os overall survival , psa prostate - specific antigen , rt radiotherapy absent biopsy information , no standardized definition of treatment success or failure has been established . instead , a variety of psa - based definitions of failure have been adopted from radiation oncologists as a surrogate for treatment efficacy . whether or not a definition based on radiobiology instead of cryobiology is valid remains to be determined with any certainty . the aua best practice statement indicated that the presence of persistent disease on biopsy or a psa value less than 0.5 ng / ml are commonly used outcome end points . perhaps the most widely used definitions of failure are : 1 ) the american society for therapeutic radiology and oncology ( astro ) definition : three consecutive increases after the nadir psa level ; 2 ) the phoenix definition : psa nadir after rt + 2 ng / ml ; and , 3 ) psa of 2 or higher above post salvage cryotherapy nadir . previously identified pretreatment prognostic variables that correlate with salvage cryotherapy failure include serum psa level of above 10 ng / ml , a psa doubling time of 16 months or less , postcryotherapy psa nadir above 0.1 ng / ml , clinical stage higher than t3 , and biopsy gleason score of the local recurrence higher than 9 [ 14 , 1720 ] . recently , a large multi - institutional study comprising a pool of 450 salvage patients was published by spiess and colleagues with the intent to create a pretreatment nomogram . at a median follow - up of 3.4 years , the overall rate of biochemical failure was 66% ( psa > 0.5 ng / ml ) . significant multivariate predictors of biochemical failure included serum psa at diagnosis ( 1 unit increases in the log - log of the serum psa [ or 3.8 ] ) and gleason score at diagnosis ( gleason 8 [ or 2.9 ] ) . biochemical failure rates vary not only according to the definition of failure , but also due to the generation of the cryounit , cycling parameters , clinicopathologic characteristics , and length of follow - up . across most definitions , table 1 lists a more specific breakdown of oncologic variables and outcomes in recent series . reported a 59% to 69% ( 0.5 ng / ml definition and 1.0 ng / ml , respectively ) biochemical disease - free survival over a median follow - up of 6.9 years . most failures occurred before 3 years , and late failures beyond 48 months were not observed during the study follow - up . cheetham and colleagues provided survival data for 51 patients who underwent salvage treatment , reporting prostate cancer death in 8 of 51 ( 15.7% ) patients at a median time of 6.8 years after cryoablation . [ 16 ] reported an 87% 10-year overall survival rate in men undergoing salvage cryoablation ; the disease - specific survival and disease - free survival were 64% and 39% , respectively . in terms of prognostic factors , they found a psa nadir above 1.0 ng / ml was significantly associated with poor prognosis . a major concern with the use of less aggressive tissue - preserving ( eg , urethra ) strategies is incomplete treatment of cancerous foci in remnant locations . a report that may temper enthusiasm for salvage ablative therapy was published from huang and colleagues , who documented the distribution of cancerous foci on whole mount sectioning after salvage radical prostatectomy . among 46 patients with a median post - rt psa of 4.3 ( 94% ct2 , and 68% gleason 6 to 7 ) , extracapsular extension was present in 43% and seminal vesicle invasion ( svi ) in 28% . periurethral tumors were noted in 67% of cases , with 7% of tumors in direct contact with the urethra . this information is sobering for the cryosurgeon who relies on the thermoprotection of the urethral warming catheter and apical thermocouples to balance the challenge of complete treatment of the apex with the risk of cryoinjury to the urethral sphincter . one must keep in mind that critical temperatures of 20c are not achieved at the perimeter of the iceball . if failure after salvage prostatectomy is chiefly due to micrometastatic disease , the higher failure rates after salvage ablative therapy must also include svi and residual foci of cancer outside the iceball s kill zone . in addition , there is some evidence that hormone - resistant prostate cancer cells are more resistant to cryo - induced cell death , questioning the frequent use of prolonged androgen deprivation therapy before cryotherapy . multiparametric endorectal magnetic resonance imaging ( mri ) , ultrasound technology , and molecular imaging continue to improve their discriminatory power to map the precise anatomic location of tumors . concurrently , biopsy technique is becoming less user - dependent with technologies including mri / ultrasound fusion [ 26 ] and the artemis device ( eigen corporation , grass valley , ca ) . the net result of these technological advancements is enhanced patient selection and increased accuracy for salvage ablative treatment . while whole - gland salvage cryoablation is the standard treatment template , some centers are exploring the use of partial salvage cryoablation ( ie , hemiablation , focal ablation ) in an effort to minimize complication rates , . free survival rates of 89% ( astro ) and 79% ( phoenix ) for patients undergoing salvage hemi - ablation . on 12-month follow - up biopsy , 1 of 10 patients had residual disease , notably in the contralateral lobe and seminal vesicle . in addition , in this series , three patients went on to develop metastatic disease . although clearly investigational at this time , in highly selected patients ( eg , unilateral , low - volume , low - grade disease ) unwilling to undergo more definitive treatment , focal salvage ablation may be a guarded option . unfortunately , most cryoablation studies lump functional outcomes along with complications rather than reporting objective validated instrument - based health - related quality of life ( hrqol ) information obtained at baseline and long - term follow - up . ideally , urologists should establish baseline , short - term , and long - term urinary , sexual , and bowel function utilizing patient - reported questionnaires such as the international prostate symptom score and sexual health inventory for men . abdelhady and colleagues [ 28 ] published , in abstract form , a hrqol survey based on the expanded prostate cancer index composite questionnaire after salvage cryosurgery in 155 men . while no baseline information was reported , among the 68% of men who responded , the average post - treatment aua symptom score was 11.1 ( moderate symptoms ) , with adequate satisfaction among respondents . in a prospective study of patients undergoing salvage cryoablation , robinson and colleagues followed men at regular intervals to 24 months after treatment . based on the european organization for research and treatment of cancer qlq - c30 and ucla ( university of california , los angeles ) prostate cancer index instruments , both sexual and urinary bother significantly increased between baseline ( 35.6% and 0% , respectively ) and 24-month follow - up ( 51.9% and 29% , respectively ) . although now over a decade old , in perhaps the largest hrqol study among salvage cryotherapy patients , 72% of men reported some degree of dribbling or leakage at a mean follow - up of 16.7 months . nguyen and colleagues found a weighted average incontinence rate of 36% among salvage studies performed between 1990 and 2002 ; however , definitions of incontinence were heterogeneous and not all series included the use of urethral warming catheters . the weighted average for the more up - to - date series listed in table 2 is about 21.7% across multiple definitions of incontinence table 2functional outcomes and complications of salvage cryoablation seriesstudypatients , nfollow - up length , moage , yincontinencebaseline ed,%potency,%rectal / urethral fistula,%stricture,%uti,%hematuria,%luts,%persistent perineal pain / proctitis,%aur,%two procedures , % ng et al . 187nr70.9 ( median)mild - moderate : 37% ; severe : 3%nrnr201011transient : 39 ; persistent : 1014218pisters et al . 27921.670.0 ( mean)any pads @ 12 mo : 4.4% ; any leakage : 10.2%69.2nr1.2nrnrnrnrnr6.83.2perrotte et al . 15016.768.064% 1 pad , 72% any leakage5915.2 @ mean 16.7 monrnrnrnrnr44 ( some degree of chronic perineal pain)nrnrdonnelly et al . 151871 ( mean)6.7% required padsnr4006.7nrnrnrnrnrnramong prepotent menhemiablationaur acute urinary retention , ed erectile dysfunction , luts lower urinary tract symptoms , nr not reported , uti urinary tract infection functional outcomes and complications of salvage cryoablation series aur acute urinary retention , ed erectile dysfunction , luts lower urinary tract symptoms , nr not reported , uti urinary tract infection levy recently reported a correlation between thermocouple temperatures and voiding function after prostate cryoablation . in this retrospective series of 58 patients , overall , 37.9% of patients had altered voiding function consisting of a significant change in voiding pattern ( eg , urgency , frequency , postvoid residual ) . among patients with a mean external sphincter temperature less than 23c , 55% suffered from altered voiding compared with 25% of patients who achieved nadir sphincteric temperatures above this threshold . however , on multivariate analysis , an external sphincter temperature of 23c or less was significantly associated with altered voiding function ( or 6.26 ; p = 0.012 ) . among salvage patients , 50% experienced abnormal voiding , although this was not statistically significant due to small sample size . patients undergoing salvage cryoablation tend to have a significantly higher complication rate compared with men undergoing primary treatment due to the retreatment of irradiated , poorly vascularized , anatomically altered tissue [ 30 , 32 , 33 ] . utilized seer ( surveillance , epidemiology , and end results)-medicare linked data among patients who had undergone salvage cryotherapy , reporting a 30% prevalence of an incontinence diagnosis compared with 25.0% of men undergoing primary cryotherapy . in another series that included primary and salvage groups , anastasiadis and colleagues reported incontinence rates of 5.9% and 10% , respectively , and erectile dysfunction rates of 86% and 90% , respectively . thus , while the salvage patients generally tend to have higher complication rates and worse functional outcomes , the magnitude of the difference is much less in modern series . baseline erectile dysfunction rates are high after rt at study entry for most cryoablation series , especially in light of possible hormonal use , ranging from about 60% to 80% ( table 2 ) . in addition , the use of phosphodiesterase-5 inhibitors and injection therapy often are unclear in many reports . however , some general trends can be extracted from the literature . utilizing validated questionnaires , perotte and colleagues found , among the 41% of prepotent men before salvage cryotherapy , only 15.2% were able to achieve penetration after treatment ; an additional 23.9% of men had partial erections . ismail et al . found 6 of 14 ( 42.9% ) prepotent men retained their baseline function . yin et al . reported a 44% prevalence of an erectile dysfunction diagnosis compared with 38.2% of men undergoing primary cryotherapy . whether or not the continuous administration of phosphodiesterase-5 inhibitors improves erectile function following salvage cryoablation awaits prospective randomized data . historically , with first - generation liquid nitrogen based systems , lack of urethral warmers , and thermocouples , the most feared complications such as rectal fistula , urethral sloughing , and urinary incontinence were encountered at an unacceptable rate . today , with third - generation cryounits , smaller probes with variable isotherm contours , advanced imaging , multitemperature thermocouples to precisely monitor temperatures near critical structures , and urethral warmers , complication rates have improved dramatically . in the salvage setting , regardless of the treatment modality , the observed complication rates are higher than for primary treatment [ 12 , 13 , 17 , 30 ] . however , overall contemporary complication rates for salvage cryoablation have trended down to reasonable levels . particularly for the older comorbid patient who is not an ideal candidate for mainstay salvage prostatectomy , cryoablation may be an acceptable option . tremendous technological inroads have led to the firm establishment of salvage cryosurgery as a viable treatment option with curative intent for radio - recurrent prostate cancer . | potentially curative salvage options for radio - recurrent prostate cancer include prostatectomy , brachytherapy , high - intensity focused ultrasound , and cryotherapy .
salvage cryoablation technology , surgical technique , oncologic outcomes , and complication rates have improved dramatically over the past few decades , shifting this treatment modality from investigational status to an established therapeutic option . in this review ,
we focus on the most up - to - date oncologic and functional outcomes , as well as complications of salvage cryotherapy for radiation - recurrent prostate cancer . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
india is home to approximately 2.5 million people living with human immunodeficiency virus ( hiv ) , the third largest number of cases of any country in the world , and is recognized as the source of increasing hiv prevalence among its south asian neighbors . recently released national hiv prevalence estimates for india indicate that 0.22% of women and 0.36% of men aged 1549 years are infected.[13 ] about 70% of the individuals affected with hiv usually have one or more respiratory illnesses during the course of their hiv disease . pulmonary complications of the hiv infection study demonstrated that respiratory symptoms are a common complaint among the hiv - infected individual and increasingly frequent as cd4 counts declined to less than 200 cells / mm . respiratory symptoms may result from a wide spectrum of pulmonary illness that includes hiv - related opportunistic infections and neoplasm . chest radiography is the corner stone of the diagnostic evaluation of respiratory symptoms in hiv infected patients , because each of the hiv - related opportunistic infections and neoplasm has a characteristic radiographic presentation , the radiograph ( combined with information delivered from history and physical examination and selected lab tests ) can narrow the diagnostic possibilities and suggest a diagnostic approach . tuberculosis can present with a variety of chest radiographic findings , including upper lung zone infiltrates often with cavitations , middle or lower zone consolidation mimicking bacterial pneumonia , miliary , nodule(s ) , pleural effusion , and intrathoracic adenopathy . in case of tuberculosis , noncavitory infiltrates and a wide clinicoradiological spectrum of tuberculosis was seen among hiv patients , in consonance with their varying immune status . with the conventional sputum positivity and tuberculin test not providing an adequate diagnostic help , familiarity with the clinicoradiological spectrum of tuberculosis and coexisting opportunistic infections is absolutely necessary . this study makes an attempt to correlate the chest x - ray and cd4 counts as it will help in better understanding this deadly duo of hiv and tuberculosis . the present study was done as a prospective cohort study in a tertiary care hospital of south india from august 2009 to july 2011 . 100 hiv - positive female patients and 100 hiv - positive males , who satisfy the inclusion criteria , were the subjects of the study . all patients above the age of 18 with confirmed hiv infection as per naco guidelines were the subjects of the study . all the hiv - positive patients satisfying the inclusion criteria were registered in the study group . this included detailed clinical history including presenting symptoms , past history , disease diagnosis , and complete physical examination followed by appropriate baseline and specific laboratory tests . the chest radiography was taken for all the patients and detailed evaluation of the radiograph was done . mean age among males was 37.4 years and among females was 35.3 years , respectively . maximum number of patients belonged to age group of 3140 years in both males and females , 55% in males and 63% in females , respectively . in the age group of 2630 , females were more compared to males ( 22% females and 13% males ) , whereas in the age group of 4150 males were more in number as compared to females 26% males and 11% females . 80% of males and 88% of females had education up to high school or less . maximum number of the study population had education up to high school ( 45% among males and 69% among females ) . in this study , maximum number of patients belonged to unskilled work group ( 49% among males and 54% among females ) , most of them were manual laborers . skilled workers included drivers , clerks , and others and males dominate over females in this group , 34% males and 18% females . cd4 at the time of diagnosis : 11% of females had cd4 count of less than 50 in comparison with 1% of males who had cd4 of less than 50 . among cd4 range of 100 - 150 , males ( 31% ) 71% of males had cd4 less than 200 , whereas 65% of females had cd4 less than 200 at the time of diagnosis [ figure 1 ] . cd4 count at the time of diagnosis pulmonary tuberculosis was diagnosed with sputum afb in 54 patients ( 29 males and 25 females ) . various patterns of chest x - ray presentations with respect to cd4 counts as follows . in patients with cd4 of less than 200 , infiltration [ figure 2 ] was seen among 18 ( 39% ) followed by consolidation in 14 ( 30% ) . lymphadenopathy [ figure 3 ] 4 ( 9% ) , pleural effusion 4 ( 9% ) , copd 4 ( 9% ) , and miliary 3 ( 7% ) also seen in lesser number . cd4 of above 200 had infiltration in 3 ( 37.5% ) , miliary in 2 ( 25% ) , and cavity in 2 ( 25% ) chest radiographs . generalized lymphadenopathy with tb lymphadenitis - cd4 count 110 diffuse nodular infiltration in hiv - tb coinfection females with sputum - positive pulmonary tb with hiv with cd4 of less than 200 had following findings . infiltration was seen in 11 ( 55% ) , cardiomegaly in 5 ( 25% ) , lymphadenopathy in 4 ( 20% ) . consolidation was observed in 3 ( 15% ) and 2 ( 10% ) had cavity . cd4 of above 200 had 2 ( 40% ) cavitatory and infiltration lesion each in chest x - ray . pleural effusion and miliary mottling was seen among 1 ( 20% ) each . in males with cd4 count of less than 200 with pulmonary tb showed consolidation in 11 ( 42% ) followed by infiltration in 5 ( 19% ) . cavity , miliary , and pleural effusion were 3 ( 12% ) each in number . cd4 of more than 200 had one ( 33% ) each of consolidation , miliary , infiltration , and pneumothorax each [ figure 4 ] . cd4 and chest x - ray correlation of hiv with tb on the right side , all - zone involvement was observed in 18 ( 42% ) of them , whereas middle and lower lobe involvements were observed in 15 ( 35% ) of the chest radiographs . on left side , all - zone involvement was seen among 22 ( 50% ) middle and lower were seen in 13 ( 29.5% ) of them . upper zone involvement was seen in 2 ( 0.05% ) . among patients with hiv and pulmonary tb coinfection , bilateral lung involvement was observed among 37 ( 68.5% ) of the chest radiographs . among patients with cd4 count less than 200 , oral candidiasis was observed among 55.9% patients , pulmonary tuberculosis in 33% , cmv retinitis in 8% , and tb lymphadenitis among 7% of them . pneumocystis carinii pneumonia was diagnosed among 16% of patients and all had cd4 count less than 200 . pulmonary tuberculosis was diagnosed with sputum afb in 54 patients ( 29 males and 25 females ) . various patterns of chest x - ray presentations with respect to cd4 counts as follows . in patients with cd4 of less than 200 , infiltration [ figure 2 ] was seen among 18 ( 39% ) followed by consolidation in 14 ( 30% ) . lymphadenopathy [ figure 3 ] 4 ( 9% ) , pleural effusion 4 ( 9% ) , copd 4 ( 9% ) , and miliary 3 ( 7% ) also seen in lesser number . cd4 of above 200 had infiltration in 3 ( 37.5% ) , miliary in 2 ( 25% ) , and cavity in 2 ( 25% ) chest radiographs . generalized lymphadenopathy with tb lymphadenitis - cd4 count 110 diffuse nodular infiltration in hiv - tb coinfection females with sputum - positive pulmonary tb with hiv with cd4 of less than 200 had following findings . infiltration was seen in 11 ( 55% ) , cardiomegaly in 5 ( 25% ) , lymphadenopathy in 4 ( 20% ) . consolidation was observed in 3 ( 15% ) and 2 ( 10% ) had cavity . cd4 of above 200 had 2 ( 40% ) cavitatory and infiltration lesion each in chest x - ray . pleural effusion and miliary mottling was seen among 1 ( 20% ) each . in males with cd4 count of less than 200 with pulmonary tb showed consolidation in 11 ( 42% ) followed by infiltration in 5 ( 19% ) . cavity , miliary , and pleural effusion were 3 ( 12% ) each in number . cd4 of more than 200 had one ( 33% ) each of consolidation , miliary , infiltration , and pneumothorax each [ figure 4 ] . on the right side , all - zone involvement was observed in 18 ( 42% ) of them , whereas middle and lower lobe involvements were observed in 15 ( 35% ) of the chest radiographs . on left side , all - zone involvement was seen among 22 ( 50% ) middle and lower were seen in 13 ( 29.5% ) of them . upper zone involvement was seen in 2 ( 0.05% ) . among patients with hiv and pulmonary tb coinfection , bilateral lung involvement was observed among 37 ( 68.5% ) of the chest radiographs . among patients with cd4 count less than 200 , oral candidiasis was observed among 55.9% patients , pulmonary tuberculosis in 33% , cmv retinitis in 8% , and tb lymphadenitis among 7% of them . pneumocystis carinii pneumonia was diagnosed among 16% of patients and all had cd4 count less than 200 . tuberculosis , unlike other hiv - associated opportunistic infections , may occur at relatively high levels of cd4 counts , although its frequency markedly increases in patients with more severe immunosuppression hiv - tb cases have been observed to have severe immunosuppression at presentation , with several studies reporting cd4 counts of less than 200 . in patients with mild immunosuppression , chest x - ray typically shows upper lobe and/or bilateral infiltrates , cavitation , pulmonary fibrosis , and shrinkage . the clinical picture often resembles postprimary pulmonary tuberculosis , and the sputum smear is usually positive . in severely immunosuppressed patients , . the sputum smear can often be negative and chest x - ray shows interstitial infiltrates , especially in the lower zones , with no features of cavitation and fibrosis . unilateral or bilateral infiltrates are seen more often in the lower lobes than in the upper lobes and typical cavities are seen in only 25% of patients.[68 ] in our study , pulmonary tuberculosis was diagnosed with sputum afb in 54 patients ( 29 males and 25 females ) . various patterns of chest x - ray presentations with respect to cd4 counts as follows . in patients with cd4 of less than 200 , infiltration was seen among 18 ( 39% ) , followed by consolidation in 14 ( 30% ) . lymphadenopathy 4 ( 9% ) , pleural effusion 4 ( 9% ) , copd 4 ( 9% ) , and miliary 3 ( 7% ) were also seen in lesser number . in a study by pearlman et al . infiltrates were seen among 52% , lymphadenopathy in 30% , interstitial disease in 27% , pulmonary nodule in 18% , cavity in 7% , and pleural effusion in 7% . cd4 of above 200 had infiltration in 3 ( 37.5% ) , miliary in 2 ( 25% ) , and cavity in 2 ( 25% ) chest radiographs . in a study by pearlman et al . , infiltrates were seen among 67% , lymphadenopathy in 7% , interstitial disease in 17% , pulmonary nodule in 20% , cavity in 20% , and pleural effusion in 10% . correlation analysis of chest x - ray findings with cd4 count in another study by maniar et al . , infiltration was seen among 62.5% , hilar lymphadenopathy in 17.5% , pleural effusion in 16.5% , and consolidation in 7.5% . chest x - ray abnormalities are even more non - specific in hiv - infected patients than in hiv - negative patients , which may result in under diagnosis . typical pulmonary lesions are seen only in about one third of the hiv - infected patients with clinical tuberculosis . among patients with hiv and pulmonary tb , we observed that tuberculosis involvement of lungs was atypical as there was all - zone involvement in most of them or middle and lower lobe involvement in the remaining majority . on the right side , all - zone involvement was observed in 18 ( 42% ) of them , whereas middle and lower lobe involvement in 15 ( 35% ) of the chest radiographs . on left side , all - zone involvement seen among 22 ( 50% ) , middle and lower lobe involvement in 13 ( 29.5% ) of them . tuberculosis classically involves the upper lobes usually unilaterally . among patients with hiv and pulmonary tuberculosis coinfection , bilateral lung involvement was observed among 37 ( 68.5% ) of the chest radiographs , suggesting that diffuse involvement is more common in patients with hiv and tb coinfection . in a study by maniar et al . , in patients with hiv and tb coinfection , upper zone involvement was seen among 3.7% , middle zone involvement among 62.5% , lower zone involvement in 33.8% . in our study , most common radiological presentation of tuberculosis was parenchymal infiltration followed by consolidation , cavity , cardiomegaly , lymphadenopathy , pleural effusion , copd , and miliary shadows . in males , involvement of lung field in tuberculosis was atypical as evidenced by bilateral lung involvement ; middle and lower zone or diffuse involvement . comparison of cd4 count with chest x - ray revealed miliary shadows and pericardial effusion significantly increased among cd4 less than 200 . | background : fight against human immunodeficiency virus ( hiv ) is incomplete without addressing problems associated with difficult diagnosis of tuberculosis in hiv - tuberculosis coinfected patients . chest x - ray is a primary tool to evaluate tuberculosis in hiv.aim:to assess and compare various radiological patterns of pulmonary tuberculosis in hiv patients and compare these patterns in relation to cd4 counts.materials and methods : prospective cohort study was conducted in a tertiary hospital in south india from september 2009 to july 2011 with 200 hiv positive patients . who guidelines were used for diagnosis of hiv and tuberculosis.results:27% of the patients had sputum positive pulmonary tuberculosis , with higher incidence ( 33% ) among cd4 less than 200 as compared to cd4 more than 200 ( 14% ) . infiltration ( 39% ) followed by consolidation ( 30% ) , cavity ( 11% ) , and lymphadenopathy ( 9% ) seen with cd4 less than 200 .
infiltration ( 37.5% ) followed by cavity ( 25% ) and miliary ( 25% ) with cd4 above 200 .
bilateral ( 68.5% ) and mid and lower zones or all zone involvement more commonly seen.conclusion:in patients with cd4 lower than 200 noncavitory infiltration and consolidation predominated . involvement of lungs was atypical ; diffuse or mid and lower zone involvement than classical upper lobe involvement .
a high index of suspicion is necessary for the accurate and timely diagnosis of tuberculosis in hiv positive patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
recent work
shows that diffusion magnetic resonance imaging ( dmri )
can help recovering
complex white matter fiber bundles . however this is
still an open problem due
to the structural complexity of the fiber bundles ,
which can have crossing
configurations . diffusion tensor imaging ( dti )
is restricted in these
conditions due to the hypothesis that the diffusion within
a voxel follows a
gaussian distribution , a model that can not
model intravoxel crossings . q - ball
imaging ( qbi ) ,
a recent high - angular resolution diffusion imaging ( hardi )
technique , overcomes this limitation by
reconstructing a diffusion orientation
distribution function ( odf ) , a spherical
function that has its maxima agreeing
with the underlying fiber populations . the odf reconstruction from qbi is
attractive because it is model - free and has
been recently shown possible with a
regularized and analytical solution
,
which produces a robust and very fast
odf reconstruction . in fact , the odf estimation is ,
in practice , as fast as a
standard least - square diffusion tensor ( dt ) estimation . efficient segmentation of fiber tracts in dmri images
is an important problem in neuroimaging
problem because it has many potential
applications . for example , it could
potentially provide important information
on diseases that affect fiber tracts . alteration of the fiber tracts may
provide new biomarkers in white matter
pathologies and segmentation of these
tracts can also improve our understanding of
the functional role these tracts
have and the cognitive consequences of their disruption . the goal of this work is to provide a segmentation
method that can separate the main white
matter fiber bundles in the brain . we
propose a new method that can segment fiber
bundles and deal with fiber crossings
while also requiring a minimum number of hypothesis
from the data and a small
number of algorithmic parameters . spectral
embedding and clustering methods
have recently proved to be effective in image segmentation
[ 4 , 5 ] . however ,
classical approaches require restrictive hypotheses
that are difficult to meet
in real applications . for instance , n - cuts
and
laplacian eigenmaps
require data within each cluster to be
uniformly sampled , which produces
artifacts when this hypothesis is not met . moreover , classical approaches for
image segmentation also assume that the scale
within each cluster is the same
using a single - scale parameter for the whole dataset .
in order to overcome
these limitations this method looses the dependence on the
sampling of the elements to
cluster . moreover , we propose to use an
adaptive scale - space parameter in order
to deal with space - scale differences across
different clusters . finally , we
propose two approaches to automatically
determine the number of clusters by
analyzing the spectra of the image embedding . another contribution of this paper is to show that the
q - ball odf clustering using diffusion maps
can reproduce the dt clustering
using n - cuts on simple synthetic images
without crossings . on more complex data
with crossings , we show that our method
succeeds to separate fiber bundles and
crossing regions on synthetic data , where
the dt - based methods generate
artifacts and exhibit wrong number of clusters . finally , we successfully
segment the fiber bundles in a real - human
brain dataset in different regions
with fibers crossing . the main goal
of this work is to produce a segmentation
algorithm able to segment white
matter fiber bundles from dmri data .
in order to represent intravoxel
crossings with the odf , we need at least 15
real coefficients when a spherical
harmonic basis is used [ 3 , 8 , 9 ] . this leads to 3d
images with a high dimensional
element at each voxel . this high dimensionality
makes previous diffusion
imaging segmentation approaches based on level
set methods such as [ 1012 ]
computationally expensive . moreover , these methods
require an initialization
step . in order to perform the segmentation
in an initialization - free manner and
with a lower - dimensionality image ,
we use spectral clustering methods
[ 4 ,
5 ]
which perform dimensionality reduction
before performing the segmentation and
do not need initialization .
the segmentation is then performed on the
statistics within each cluster and the fiber
crossings can be identified . in this section , we present the three main parts of
our algorithm . first , the estimation of the
q - ball diffusion odf and its
compact representation using spherical harmonics . second , the metric used to
measure distances between q - ball odfs . last , the diffusion aps spectral
clustering technique used to segment the
odf image into the background and the
different fiber bundles . qbi
reconstructs the diffusion odf directly from the
hardi measurements on a single
sphere by the funk - radon transform ( frt ) .
in practice , the frt value at a given
spherical point is the great circle integral of
the signal on the sphere
defined by the plane through the origin with
normal vector . the odf is
intuitive because it has its maximum(a )
aligned with the underlying population
of fiber(s ) . however , computing statistics
on a large number of discrete odf
values on the sphere is computationally heavy
and infeasible to integrate into a
segmentation algorithm of the whole brain .
a more compact representation of the
odf is thus needed . in [ 3 , 8 , 9 , 13 ] a
simple analytic spherical harmonic ( sh )
reconstruction of the odf is proposed .
for completeness of the article , we now
review and develop the main parts of our
regularized analytical odf
reconstruction solution . the idea is to
first estimate hardi signal on the
sphere with a regularized spherical harmonics
approximation and then do a
simple linear transformation of the
harmonics to obtain the desired regularized
odf . the sh ,
normally indicated by ym ( denotes the order and m the phase
factor ) , are a basis for complex functions on the unit sphere . explicitly , they
are given as follows :
( 1)ym(,)=2+14(m)!(+m)!pm(cos)eim ,
where ( , ) obey physics
convention ( [0,],[0,2 ] ) and pm is an
associated legendre polynomial . for k=0,2,4, , and m=k, ,0, ,k , we define the new index j:=j(k , m)=(k2+k+2)/2+m and define our
modified basis y with elements yj such that
( 2)yj={2re(ykm)if km<0,yk0if m=0,2img(ykm)if 0<mk ,
where re(ym ) and img(ym ) represent the real and imaginary parts of ym , respectively . symmetry is
ensured by choosing only even order sh and the ratios in front of each term
also ensure that the modified basis is real and orthonormal with respect to the
inner product f , g=f*gd , where denotes
integration over the unit sphere and f * is the complex
conjugate of f for f and g complex
functions on the sphere . we thus approximate the signal at each of the n gradient
directions i as
( 3)s(i,i)=j=1rcjyj(i,i ) ,
where r=(+1)(+2)/2 is the number
of terms in the modified sh basis y of order . letting s be the n 1 vector
representing the input signal for every encoding gradient direction , c the r 1 vector of
sh coefficients cj , and b is the n r matrix constructed
with the discrete modified sh basis
( 4)b=(y1(1,1)y2(1,1)yr(1,1)y1(n,n)y2(n,n)yr(n,n ) ) . we can write
the set of equations as an overdetermined linear system s = bc . we want to solve for the sh series coefficients cj , where cj=s(,)yj(,)d. at this point , instead of simply evaluating the
integrals directly as done in or performing a straightforward least - squared
minimization as in [ 15 , 16 ] ,
we add local regularization directly into our
fitting procedure . this is to be able to
use a high - order estimation without
overmodeling the small perturbations due
to noise in the input diffusion mri
signal . we thus define a measure , e , of the deviation from smoothness of a
function f defined on the
unit sphere as e(f)=(bf)2d , where b is the
laplace - beltrami operator . using the orthonormality of the modified sh basis ,
where we have yi(,)yj(,)d=ij , the above functional e can be
rewritten straightforwardly [ 3 , 13 ] as
( 5)e(f)=b(pcpyp)b(qcqyq)d=j=1rcj2(j)2((j)+1)2=ctlc ,
where l is simply the rr matrix with
entries (j)2((j)+1)2 along the
diagonal ( (j ) is the order associated with the jth coefficient ,
that is , for j=1,2,3,4,5,6,7, (j)=0,2,2,2,2,2,4 , ) . therefore , the
quantity we wish to minimize can be expressed in matrix form as
( 6)m(c)=(sbc)t(sbc)+ctlc ,
where is the weight
on the regularization term . the coefficient vector minimizing this expression
can then be determined just as in the standard least - squares fit ( =0 ) from which we obtain the generalized expression
for the desired spherical harmonic series coefficient vector
( 7)c=(btb+l)1bts .
from this sh
coefficient vector we can recover the signal on the q - ball for any ( , ) as s(,)=j=1rcjyj(, ) . intuitively ,
this approach penalizes an approximation function for having higher - order terms
in its modified sh series . this eliminates most of the higher - order terms due to
noise while leaving those that are necessary to describe the underlying
function . however , obtaining this balance depends on choosing a good value for
the parameter . we use the l - curve numerical method and
experimental simulations to determine a good smoothing parameter [ 3 , 13 , 18 ] .
here , =0.006 is used as in [ 3 , 13 , 18 ] . the true
diffusion orientation distribution function ( odf ) in a unit direction u , (u ) , is given by the radial projection of the probability
distribution function ( pdf ) of the diffusing water molecule . tuch showed
that this diffusion odf could be estimated directly from the raw hardi signal s on a single
sphere of q - space by the funk - radon transform ( frt ) ( figure 1 ) . in [ 3 , 13 ] , we showed how this frt can be evaluated
analytically with an elegant corollary to the funk - hecke theorem . the
final odf reconstruction on the sphere then becomes a simple linear
transformation of the sh coefficients cj describing the
input hardi signal s ,
( 8)(,)=j=1r2p(j)(0)cjfjyj(, ) ,
where fj are the sh
coefficients describing the odf and p(j)(0)=(1)/2(135((j)1)/246(j ) ) because (j ) is always even
in our modified sh basis . we see that the shs are eigenfunctions of the
funk - radon transform with eigenvalues depending only on the order of the sh
series . hence , by using an sh estimation of the hardi signal ,
we have showed that the qbi can be solved analytically . this was also showed in
[ 8 , 9 ] . an important contribution in favor of our approach is that this solution
can be obtained while imposing a well - defined regularization criterion . the
accuracy of the modified sh series approximation with the laplace - beltrami
smoothing was established in and our regularized odf solution was also
shown to have better fiber detection properties and shown to be more robust
to noise than similar solutions [ 8 , 9 ] . once the odf
are computed , we want to capture similarities and
dissimilarities between two
odfs , that is , two spherical functions ,s2 that can be
represented by real - sh vectors of length r , f={f1, ,fr } and f={f1, ,fr}r , as shown in ( 8) in the previous section . since
the odfs come from real physical diffusion
measurements they are bounded and
form an open subset of the space of real - valued 2 spherical
functions with an inner product , defined as
( 9),=(,)(,)d=(i=1rfiyi(,)j=1rfjyj(,))d.
again , because
of the orthonormality of the spherical harmonic basis , the cross - terms cancel
and the expression is simply
( 10),=j=1rfjfj.
therefore , the
induced 2 norm =, giving us the
distance metric between two odfs is
( 11)=j=1r(fjfj)2 . the euclidean
distance was also used successfully for odf segmentation in and for dti
segmentation in even though more appropriate metrics exist such as the
j - divergence [ 11 , 20 ] and riemannian geodesic distances . for instance , since the odf
can be viewed as a probability distribution function ( pdf ) of fiber
orientations , one can use the kullback - leibler distance between two pdfs , as
done in . however , in that case the problem quickly blows up computationally
because one needs to use all n discrete hardi
data on the sphere instead of the r sh coefficients
( rn ) . we now want to
segment white matter fiber bundles in a q - ball image . one of the open questions
in q - ball image analysis and clustering is
that which metric should be used to
compare q - ball odfs . here , we describe a
clustering algorithm that infers an
embedding and a metric to compare odf images . we derive an affinity measure
incorporating the euclidean distance and the spatial
location distance between
odfs . as
mentioned in ,
the euclidean distance within this embedding actually
represents an intrinsic metric of the data ,
which can be used to perform
statistics in the embedded space and can thus be used to
segment q - ball odf
images into white matter fiber bundles . in recent
years , spectral manifold learning and clustering techniques [ 4 , 6 , 2123 ]
have become one of the most popular modern clustering
family of methods . they
are simple to implement ,
they can be solved efficiently by standard linear
algebra software , and they very often outperform
traditional manifold learning
and clustering algorithms such as the classical principal component
analysis
( pca ) and k - means algorithms . moreover , due to the dimensionality
reduction properties , they are especially well suited to work with
high - dimensional data . these techniques have been recently used to cluster
various types of images [ 4 ,
5 ] and white matter fiber tracts . in our case ,
we perform the spectral clustering for two different types of elements : the dt
and the odf . in the dt case , the element is represented by a 6-dimensional
vector corresponding to the upper ( or lower )
triangular part of the dt 33
symmetric matrix . in the odf case , the element is represented by the 15-dimensional
vector corresponding to the 4th - order spherical
harmonic odf estimation . each element
to be clustered is represented as a
node in a graph and the edges joining the
vertex are a measure of affinity
between the elements . this affinity measure lies between 0 and 1 , 0 being the less
affine case . a spectral decomposition of this
graph is taken by calculating the
eigenvalue decomposition ( evd ) of the graph
laplacian . then a
low - dimensional euclidean manifold embedding is inferred from this decomposition . preservation of
the distance relationship : after a distance is defined between elements , the
learned manifold should preserve the distance relation.uniform
sampling of the elements : the density of the extracted elements changes if and
only if these elements belong to anatomically different bundles.convexity of
the elements : if two elements are in the dataset , almost all of the
intermediate tracts obtained by the interpolation that can be inferred from the
metric used to build the affinity matrix are in the dataset .
preservation of
the distance relationship : after a distance is defined between elements , the
learned manifold should preserve the distance relation . uniform
sampling of the elements : the density of the extracted elements changes if and
only if these elements belong to anatomically different bundles . convexity of
the elements : if two elements are in the dataset , almost all of the
intermediate tracts obtained by the interpolation that can be inferred from the
metric used to build the affinity matrix are in the dataset . it is not easy to guarantee that the data to be
embedded and clustered will adhere to these hypotheses . donoho and grimes , in ,
analyze when a spectral embedding algorithm is
able to recover the true
parameterization of a set of images . as medical images represent the
discretization of a continuous space ,
hypotheses 1 and 3 are plausible . however , there is no indication that
within a fiber bundle the
distribution of the elements ( dt or odf ) are
uniformly sampled . moreover , in it is shown that different sampling
frequencies within one cluster leads the n - cuts and
laplacian eigenmaps methods
to subdivide the cluster in several parts . in order
to overcome this limitation
and to be resilient to sampling frequency
differences within a cluster , we use
the diffusion maps spectral embedding technique . we now describe the three
steps involved in the diffusion maps algorithm in turn . step 1 ( computing the affinity matrix).letting x represent the
set of all odf elements to cluster , the main idea is to look for a
representation between the elements of x that is more
representative than r ( recall that
odfs are r ) and reduces
the dimensionality of the problem . with keeping this in mind ,
a fairly good way of
representing any set of elements with an affinity function a : xx>0 , is a weighted graph , g(x , e , w( ) ) , where the
weight of the edge between two vertices represents the affinity of the elements
connected by this edge . more formally , for an edge ,
e=(fi , fj)e , the weight of the edge is w(e)=a(fi , fj ) . hence , each element of the adjacency matrix of g or conversely
the affinity matrix of ( x , a( ) ) is
( 12)aij = a(fi , fj ) .
taking this in
account , the weighted graph g(x , e , w( ) ) can be also
noted as g(x , a ) . letting x represent the
set of all odf elements to cluster , the main idea is to look for a
representation between the elements of x that is more
representative than r ( recall that
odfs are r ) and reduces
the dimensionality of the problem . with keeping this in mind ,
a fairly good way of
representing any set of elements with an affinity function a : xx>0 , is a weighted graph , g(x , e , w( ) ) , where the
weight of the edge between two vertices represents the affinity of the elements
connected by this edge . more formally , for an edge ,
e=(fi , fj)e , the weight of the edge is w(e)=a(fi , fj ) . hence , each element of the adjacency matrix of g or conversely
the affinity matrix of ( x , a( ) ) is
( 12)aij = a(fi , fj ) .
taking this in
account , the weighted graph g(x , e , w( ) ) can be also
noted as g(x , a ) . usually , a distance function d( ) instead of an
affinity function is given . the distances can be easily converted into
affinities by applying a kernel to the distance function
( 13)a(fi , fj)=e(d(fi , fj)2/ij2 ) ,
where is an adaptive
scale - space parameter that may depend on the elements fi and fj . in this work , the adaptive scale - space parameter is
taken following .
a neighbor - number k is given as
parameter to the algorithm and then ij2=d(fi , fik)d(fj , fjk ) , where fik is the kth closest
neighbor according to the distance function d(, ) of element fi . this choice of a scaling parameter for each point
allows self - tuning of the point - to - point distances according to the local
statistics of the neighborhoods surrounding points i and j. as in image segmentation , the spatial position of each
element is important , the spatial dependency should be incorporated into the
affinity matrix . following [ 5 ,
31 ] , we use markovian relaxation to incorporate this
information . in order to represent the affinity of all the elements that can be
reached within one spatial step , the affinity matrix is modified in the
following way :
( 14)a1={aijif coords(fi)coords(fj)21,0 in any other case ,
where coords ( f ) are spatial
coordinates of element f in the image
( 15)p1=1maxld(a1)ll{maxld(a1)lld(a1)iiif i = j , a1 in any other case ,
where d(a1 ) is a diagonal
matrix with d(a1)ii=ja1ij , usually called the row - sum or
degree matrix of a1 . then , obtaining the affinities of elements that can be
reached within s spatial steps
is enough to elevate p1 to the power of s , ps=(p1)s as stated in . moreover , s can be chosen
to be the smallest positive integer which results in nonzero elements in the
whole matrix in order to represent the weakest connected induced graph . the
diagonal adjustment forces the inherent random walk to a uniform steady state ,
hence every part of the markov field will be explored at the same speed . for
the sake of clarity , ps will be
referred to as affinity matrix a in the rest of the
paper . step 2 ( performing the embedding).the algorithm
must embed the elements of x into an n - dimensional
euclidean space y(x ) . this is done by applying eigenvalue decomposition to
the laplacian of the affinity matrix . as in [ 6 , 7 , 27 ] , this is done by performing the
spectral decomposition of the graph laplacian of the graph induced by a ,
( 16)=d(a)a|x||x| ,
where |x| is number of
elements to be clustered.in order to overcome the necessity of hypothesis 2 ,
we prenormalize the affinity matrix as done in
. this is done by normalizing the weight of each edge of the graph ,
aij , by the probability density of both elements relating
through the edge ,
( 17)(ap)ij = aijp(i)p(j ) ,
where p( ) , the probability density function of the elements in x , is not known but can be approximated up to a
multiplication factor by(18)p(i)=kaik=kaki.due to the necessity of having a uniform behavior of
the clustering algorithm without minding the scale of the affinity measure
taken , a doubly stochastic matrix normalization is performed :
( 19)ads = d(ap)1/2apd(ap)1/2 |x||x| .
as ads is a double
stochastic symmetric matrix , the eigenvalue decomposition
of ( 16 ) can
be calculated by taking the singular value decomposition ( svd )
( 20)vsvt = ads|x||x| .
finally , the euclidean coordinates yi of an element fix in the n - dimensional
embedding manifold are
( 21)y(fi)=yi=1vi0(1vi1, ,nvin)t , fix ,
where
( 22)v=(v0v|x|1)|x||x|
is the
eigenvector column matrix and the corresponding eigenvalues are , 1=01|x|10 . the first eigenvector v0 is not taken into account as a component in the
embedding because it is constant and hence meaningless as shown in [ 6 , 7 , 27 ] . the algorithm
must embed the elements of x into an n - dimensional
euclidean space y(x ) . this is done by applying eigenvalue decomposition to
the laplacian of the affinity matrix . as in [ 6 , 7 , 27 ] , this is done by performing the
spectral decomposition of the graph laplacian of the graph induced by a ,
( 16)=d(a)a|x||x| ,
where |x| is number of
elements to be clustered . in order to overcome the necessity of hypothesis 2 ,
we prenormalize the affinity matrix as done in
. this is done by normalizing the weight of each edge of the graph ,
aij , by the probability density of both elements relating
through the edge ,
( 17)(ap)ij = aijp(i)p(j ) ,
where p( ) , the probability density function of the elements in x , is not known but can be approximated up to a
multiplication factor by(18)p(i)=kaik=kaki . due to the necessity of having a uniform behavior of
the clustering algorithm without minding the scale of the affinity measure
taken , a doubly stochastic matrix normalization is performed :
( 19)ads = d(ap)1/2apd(ap)1/2 |x||x| .
as ads is a double
stochastic symmetric matrix , the eigenvalue decomposition
of ( 16 ) can
be calculated by taking the singular value decomposition ( svd )
( 20)vsvt = ads|x||x| . finally , the euclidean coordinates yi of an element fix in the n - dimensional
embedding manifold are
( 21)y(fi)=yi=1vi0(1vi1, ,nvin)t , fix ,
where
( 22)v=(v0v|x|1)|x||x|
is the
eigenvector column matrix and the corresponding eigenvalues are , 1=01|x|10 . the first eigenvector v0 is not taken into account as a component in the
embedding because it is constant and hence meaningless as shown in [ 6 , 7 , 27 ] . step 3 ( clustering).once the
embedding has been performed , several techniques have been proposed for the
clustering step [ 4 , 6 , 32 ] . once the
embedding has been performed , several techniques have been proposed for the
clustering step [ 4 , 6 , 32 ] . the first step in this process is to determine the
number of clusters , this can be done in two ways . the first , as in , is
choosing the number of clusters according to the elbow . for instance , if the slope of the eigenvalue plot changes
noticeably at eigenvector i , the number of clusters should be i+1 . the second way is reordering the affinity matrix
rows and columns following the second eigenvector as proved in , which
shows the block structure of the matrix as squared blocks along the matrix
diagonal . their commended
number of dimensions for the embedding is the same as the number of clusters . finally , the clustering is performed by running a k - means clustering algorithm
on the space spanned by y(x ) . a formal justification for this approach can be
found in [ 6 , 32 ] . synthetic datawe generate
synthetic hardi data using the multitensor model which is simple and leads to
an analytical expression of the odf [ 2 , 18 ] . for a given b - factor and
noise level , we generate the diffusion - weighted signal
( 23)s(ui)=k=1n1nexp(b uitdk()ui)+noise ,
where ui is the ith gradient direction on the
sphere , n is the number
of fibers , and 1/n is the volume
fraction of each fiber . in practice , we use n=81 from a 3rd - order tessellation of the
icosahedron , b=3000 s / mm , and n=1 or 2 . dk( ) is the
diffusion tensor with standard eigenvalues [ 3,3,1.7 ] 10 mm / s oriented in direction , which agree with reported physiological values . finally , we add complex gaussian noise with standard
deviation of 1/35 , producing a signal with signal - to - noise ratio of 35 . we generate
synthetic hardi data using the multitensor model which is simple and leads to
an analytical expression of the odf [ 2 , 18 ] . for a given b - factor and
noise level , we generate the diffusion - weighted signal
( 23)s(ui)=k=1n1nexp(b uitdk()ui)+noise ,
where ui is the ith gradient direction on the
sphere , n is the number
of fibers , and 1/n is the volume
fraction of each fiber . in practice , we use n=81 from a 3rd - order tessellation of the
icosahedron , b=3000 s / mm , and n=1 or 2 . dk( ) is the
diffusion tensor with standard eigenvalues [ 3,3,1.7 ] 10 mm / s oriented in direction , which agree with reported physiological values . finally , we add complex gaussian noise with standard
deviation of 1/35 , producing a signal with signal - to - noise ratio of 35 . we generate three synthetic data example , two simple
examples : one with a ring of sinusoidal - shaped
fibers , one with fibers with
different sizes and scales , and the other with complex crossing areas simulating
the u-fibers ( corticocortical fibers )
that can occur in the brain . these
synthetic datasets help understand the behavior of the different spectral
clustering methods when confronted with simple and complex fiber geometries . human brain datadiffusion - weighted data and high - resolution t1-weighted images
were acquired on a
whole - body 3 tesla magnetom trio scanner
( siemens , erlangen ) equipped with an
8-channel head array coil
.
the spin - echo echo - planar - imaging sequence , te=100 ms , tr=12 s , 128 128 image matrix ,
fov = 220 220 mm ,
consists of 60 diffusion
encoding gradients
with a b - value of 1000 s / mm . seven images without any
diffusion weightings are placed at the beginning
of the sequence and after each
block of 10 diffusion - weighted images as anatomical
reference for offline
motion correction . the measurement of 72 slices
with 1.7 mm thickness ( no gap )
covered the whole brain . random variations
in the data were reduced by
averaging 3 acquisitions ,
resulting in an acquisition time of about 45 minutes . additionally , fat saturation was employed
and we used 6/8 partial fourier imaging ,
a hanning window filtering , and
parallel acquisition ( generalized autocalibrating
partially parallel
acquisitions , reduction factor = 2 ) in the axial plane . diffusion - weighted data and high - resolution t1-weighted images
were acquired on a
whole - body 3 tesla magnetom trio scanner
( siemens , erlangen ) equipped with an
8-channel head array coil
.
the spin - echo echo - planar - imaging sequence , te=100 ms , tr=12 s , 128 128 image matrix ,
fov = 220 220 mm ,
consists of 60 diffusion
encoding gradients
with a b - value of 1000 s / mm . seven images without any
diffusion weightings are placed at the beginning
of the sequence and after each
block of 10 diffusion - weighted images as anatomical
reference for offline
motion correction . the measurement of 72 slices
with 1.7 mm thickness ( no gap )
covered the whole brain . random variations
in the data were reduced by
averaging 3 acquisitions ,
resulting in an acquisition time of about 45 minutes . additionally , fat saturation was employed
and we used 6/8 partial fourier imaging ,
a hanning window filtering , and
parallel acquisition ( generalized autocalibrating
partially parallel
acquisitions , reduction factor = 2 ) in the axial plane . the brain is peeled from the t1-anatomy , which was
aligned with the talairach stereotactical coordinate
system . the 21 images
without diffusion weightings distributed
within the whole sequence were used to
estimate motion correction parameters
using rigid - body transformations
,
implemented in .
the motion correction for the 180 diffusion - weighted
images was combined with a global registration
to the t1 anatomy computed with
the same method . the
registered images were interpolated to the new
reference frame with an isotropic voxel
resolution of 1.72 mm and the 3
corresponding acquisitions and gradient
directions were averaged . distance functions between elements to clusterin order to
implement the diffusion maps
spectral clustering method a distance function for
each data type is chosen . this distance
function is used to calculate the
affinity matrix as expressed by
( 13 ) .
in the dt case , following ,
we use the riemannian tensor distance . in the odf case we use the distance
shown in ( 11 ) . in order to
implement the diffusion maps
spectral clustering method a distance function for
each data type this distance
function is used to calculate the
affinity matrix as expressed by
( 13 ) .
in the dt case , following ,
we use the riemannian tensor distance . in the odf case diffusion maps versus n - cutsthe first
experiment shows the difference in performance
between the diffusion maps and
n - cuts approach . the n - cut algorithm does not
perform the sampling - based
normalization described by
( 17 ) and is thus
sensitive to sampling frequency differences
within the clusters . in order to
show this sampling hypothesis problem ,
we used a ring fiber bundle with
different sampling frequencies . within the
ring , the fibers have a sinusoidal
shape and the frequency of the modulating sine
function is 4 times bigger in
the lower half of the ring . more formally ,
the fibers follow the angular
function o()=+(1/8)sin(),0<2 , where =8 for the upper
half of the ring and =32 for the lower
half . the results of
both clustering techniques are shown in figure 2 , where the background
has been masked out . figure 2(a )
shows the plot of the first 10
eigenvalues for the n - cuts method , shown in
figures 2(b ) and 2(c ) , and
the slope between the line joining 0 and 1 and the line
joining 1 and 2 changes
drastically . figure 2(d )
shows the plot of the first 10
eigenvalues for the diffusion maps method whose clustering results are shown in
figure 2(e ) . the n - cuts exhibits frequency - dependent clustering
artifacts while the diffusion maps method clearly shows two clusters . in the
diffusion maps , the clustering has correctly
segmented the background and the
ring . the first
experiment shows the difference in performance
between the diffusion maps and
n - cuts approach . the n - cut algorithm does not
perform the sampling - based
normalization described by
( 17 ) and is thus
sensitive to sampling frequency differences
within the clusters . in order to
show this sampling hypothesis problem ,
we used a ring fiber bundle with
different sampling frequencies . within the
ring , the fibers have a sinusoidal
shape and the frequency of the modulating sine
function is 4 times bigger in
the lower half of the ring . more formally ,
the fibers follow the angular
function o()=+(1/8)sin(),0<2 , where =8 for the upper
half of the ring and =32 for the lower
half . the results of
both clustering techniques are shown in figure 2 , where the background
has been masked out . figure 2(a )
shows the plot of the first 10
eigenvalues for the n - cuts method , shown in
figures 2(b ) and 2(c ) , and
the slope between the line joining 0 and 1 and the line
joining 1 and 2 changes
drastically . figure 2(d )
shows the plot of the first 10
eigenvalues for the diffusion maps method whose clustering results are shown in
figure 2(e ) . the n - cuts exhibits frequency - dependent clustering
artifacts while the diffusion maps method clearly shows two clusters . in the
diffusion maps , the clustering has correctly
segmented the background and the
ring . odf versus dt imagesin figure 3 , a single
fiber scenario with no fiber crossing is
shown . the dt - based and odf - based image clustering
produce the same results . hence , odf clustering reproduces dt - based
results on a simple fiber population
example.finally , figure 4
shows a fiber crossing
scenario with two overlapping fiber bundles
that have different geometries .
segmentation was performed over the dt
and the odf image shown in
figure 5 . moreover , the odf n - cuts
segmentation exhibits artifacts not
present in the odf diffusion maps segmentation . the odf diffusion maps
effectively identify the two different
fiber bundles as well as the fiber
crossing areas . in figure 3 , a single
fiber scenario with no fiber crossing is
shown . the dt - based and odf - based image clustering
produce the same results . hence , odf clustering reproduces dt - based
results on a simple fiber population
example . finally , figure 4
shows a fiber crossing
scenario with two overlapping fiber bundles
that have different geometries . segmentation was performed over the dt
and the odf image shown in
figure 5 . moreover , the odf n - cuts
segmentation exhibits artifacts not
present in the odf diffusion maps segmentation . the odf diffusion maps
effectively identify the two different
fiber bundles as well as the fiber
crossing areas . the real - data
experiment presented in this section shows the
segmentation and labeling of a
cropped axial and coronal slice . the cropped
slices were chosen by an expert in
regions of known fiber crossings where the dt
model is normally limited . hence , our segmentation
algorithm is confronted with elements that
have different orientation and
different diffusion characteristics . in order to show that odf data segments the white
matter fiber bundles better than the dt data in
real cases , we analyze the
evolution of the affinity matrix as the scale - space parameter changes in the
axial cropped slice shown in
figure 6 . affinity matrices were computed
with varying scale - space parameter between 1/5 , 1/10 , 1/20 , and 1/40 of the quantity
of elements ( |x| ) to cluster , respectively . in order to show the block
structure of the affinity matrices , it can be seen in figure 7
that as
the scale diminishes , the dt data shows a
high correlation between all the
elements of the slice . this makes clustering
very difficult because the blocks
are small and highly correlated .
on the other hand , this block structure shows a high
correlation of the elements within
each block and a low interblock
correlation , giving a much better input to
the clustering algorithm than the dt
data . in figure 6 , the location of the
cropped axial slice is shown in the axial slice , figure 6(a ) , and coronal slice , figure 6(b ) . as it can be seen in the segmented
and labeled axial slice , figure 8 ,
the segmentation also allows to identify and label some of the
main white matter structures , corpus callosum ( cc ) , anterior
corona radiata ( acr ) , forceps major ( fmajor ) and forceps minor
( fminor ) . in figure 9 , the location of the
cropped coronal slice is shown in the axial slice , figure 9(a ) , and coronal slice , figure 9(b ) . as it can be seen in the segmented
and labeled coronal slice , figure 9(c ) , the segmentation allows to identify and label main
white matter structures : corpus callosum ( cc ) , cingulum ( cg ) ,
corona radiata ( cr ) , superior longitudinal fasciculus ( slf ) . note
that the segmentation is resilient to crossing areas such as seen
at the interface between cr and cc . we have presented
an algorithm to perform q - ball imaging segmentation of
white matter fiber
bundles . the proposed method combines state - of - the - art
hardi reconstruction and
state - of - the - art spectral clustering techniques . our algorithm is
initialization - free and has only two parameters .
a scale - space parameter and
the number of regions ( clusters ) are to be found .
regarding this number of clusters
parameter , we have proposed to estimate it automatically . we have introduced a
spectral embedding technique that does not
require uniform sampling of the
elements . to do so , the affinity measure used
incorporates an euclidean distance
measure between the spherical harmonic
coefficients describing the q - ball odfs
and also incorporates the spatial location distance
between odfs . the affinity
measure and the metric induced in the embedded
space is then used to cluster
q - ball odf images into multilabel segmentation
representing the fiber bundles . spectral embedding has already been applied to
dmri ( e.g. , ) .
however , to our knowledge , this is the first work
using the diffusion maps that avoids the high
dependence on element sampling . we have illustrated that the odfs are the desirable
elements to use for clustering in the white
matter because the classical dt
model is limited in regions of fiber crossings . the odf is even more attractive
because of the recent analytical spherical
harmonic solution to the odf
reconstruction [ 3 , 8 , 9 , 13 ] . the analytical solution is in
fact as fast as a
standard dt least - square estimation . in this work ,
we believe that we have used
the state - of - the - art odf reconstruction method , which is regularized ,
robust and very simple to implement . the spectral embedding performed by the diffusion maps
technique is at the heart of our segmentation
algorithm . whereas other spectral
embedding techniques have a tendency to produce
artifacts in the presence of
different sampling characteristics within a
cluster , the technique used in this
work greatly reduces this tendency by
performing the simple linear algebra
calculation shown in ( 17 ) . spectral embedding techniques produce a representation
of the embedded data based on element - to - element affinities . this leads to the
fundamental issue : how to choose the affinity measure ? it is a challenge to
find a measure that incorporates similarities
between elements as well as the
spatial location difference between elements .
for similarities between
elements , we chose the euclidean distance between
spherical harmonic
coefficients describing the odfs . this approach is simple and very efficient
because it allows to process the odfs
directly on the sh coefficients . the
euclidean distance has also been used
successfully in a level set segmentation
framework
and it would be interesting to compare our spectral clustering
approach against it . for spatial location
difference , we chose markovian
relaxation in order to be consistent
with the graph theoretical representation
of the diffusion maps technique . although this way of representing the distance
involves an artificial elimination of
all the nonneighboring relations of the
odf elements in the affinity matrix and an
adjustment of the diagonal elements ,
we believe that the resulting affinity
relations represent the affinity
better . the affinity of two neighboring
elements at the beginning of the
markovian relaxation algorithm is
represented by a function of the euclidean
distance between them . this affinity
can be interpreted as the probability that
a random walker has of going from the
first element to the second . the affinity
of two elements at the end of the
relaxation is the probability of a random
walker starting from one element and
reaching the second in a certain number of
steps . we believe that
there is room for improvement in this last
part of the algorithm . in the first
place , the k - means algorithm needs an
explicit number of clusters to find . this
can be heuristically determined by analyzing
the eigenvalue plot or the
reordered affinity matrix structure , as shown in
this work . however , an
automatic method that could find the
number of clusters would considerably
improve the algorithm . in the second place ,
the k - means algorithm and its
variants , for instance , k - medians , k - medioids ,
search for isotropic clusters in
the embedding space . this could also improve
the last clustering phase of our
algorithm finally , in order to analyze the importance of the
difference between our diffusion maps
algorithm and the widely used n - cuts , we
used synthetic simulations .
in these simulations , we generated a synthetic
image with a single cluster within which the
sampling of the elements changed . we showed that when this sampling changes , the
n - cuts algorithm produces
artifacts while our diffusion maps method
does not . as uniform sampling within
a cluster is a difficult property to guarantee in the
white matter fiber
bundles , our diffusion maps method is
better suited for this task . we thus
believe that diffusion maps are the right clustering method to be used on dmri
processing problems . ,
we have shown that in order to
perform spectral clustering on complex
dmri with crossing fiber bundles , an
hardi technique such as q - ball imaging is better
than the classical dti
technique . this is because the odf reconstructed from
qbi is able to recover
multiple crossing fiber populations . second , a diffusion maps - based technique
for image segmentation was introduced to
reduce artifacts arising from the
widely used n - cuts image segmentation . we have illustrated the advantages of
the odf diffusion maps segmentation algorithm ,
and showed on a real dataset
that our algorithm is able to identify important
and complex white matter fiber
bundles . finally , the diffusion maps technique has been shown
to be more robust to sampling frequency
variations within each object to be
segmented . in order to cluster the elements , we have used an adaptive
scale - space parameter and we have used
markovian relaxation in order to
incorporate spatial dependencies . overall , the approach is theoretically sound
with the graph - based representation which
lies at the heart of spectral
clustering methods . therefore , we have an algorithm to perform fiber
bundle clustering for a single brain . it is now important to study the behavior
over several subjects in order to assess
the reproducibility of the algorithm .
in time , this will enable to perform
multisubject statistics within bundles in
the embedded space . this will help characterize
the white matter fiber bundles
of several subjects and study if the alteration of these segmented tracts can
provide new biomarkers for white matter diseases . | white matter fiber clustering aims to get insight about anatomical structures in order to generate
atlases , perform clear visualizations , and compute statistics across subjects , all important and current
neuroimaging problems . in this work
, we present a diffusion maps clustering method applied to diffusion
mri in order to segment complex white matter fiber bundles .
it is well known that diffusion
tensor imaging ( dti ) is restricted in complex fiber regions with crossings and this is why recent
high - angular resolution diffusion imaging ( hardi ) such as q - ball imaging ( qbi ) has been introduced
to overcome these limitations .
qbi reconstructs the diffusion orientation distribution function ( odf ) ,
a spherical function that has its maxima agreeing with the underlying fiber populations . in this paper ,
we use a spherical harmonic odf representation as input to the diffusion maps clustering method .
we
first show the advantage of using diffusion maps clustering over classical methods such as n - cuts and
laplacian eigenmaps . in particular , our odf diffusion maps
requires a smaller number of hypothesis
from the input data , reduces the number of artifacts in the segmentation , and automatically exhibits the
number of clusters segmenting the q - ball image by using an adaptive scale - space parameter .
we also
show that our odf diffusion maps clustering can reproduce published results using the diffusion tensor
( dt ) clustering with n - cuts on simple synthetic images without crossings . on more complex data with
crossings ,
we show that our odf - based method succeeds to separate fiber bundles and crossing regions
whereas the dt - based methods generate artifacts and exhibit wrong number of clusters .
finally , we show
results on a real - brain dataset where we segment well - known fiber bundles . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there are three basic concepts associated with the radiation dose : the absorbed dose , equivalent dose , and effective dose . the absorbed dose is used to describe the amount of x - ray energy absorbed by a unit mass ( total weight ) of tissue . the equivalent dose is used to compare the biologic effect of different types of radiation on tissue or an organ . the si unit is sievert ( sv ) . for a diagnostic x - ray examination , the abosorbed dose is equal to the equivalent dose , that is , 1 gray equals 1 sievert . for the estimation of radiation risk , which is the possibility of biological consequences after radiation exposure to human beings , the effective dose is a measurement of the degree of harmful effects on the human body of one kind of radiation . the si unit for the effective dose is the sievert , but in practice , milli- or micro - sievert is often used . to determine the effective dose , the phantom can be made with a real human skull covered with soft tissue - equivalent materials or only made with bone- and soft tissue - equivalent materials . the phantom usually comprises nine sections and in each section there are holes in the places where the tissues are being measured . thermoluminescent dosimeters ( tlds ) , optically stimulated luminescent dosimeters ( osls ) , or radiophotoluminescence glass dosimeters can be positioned in the holes for the measurement of the absorbed dose of the corresponding tissue . the tissues measured can include the bone marrow , thyroid gland , esophagus , salivary glands , skin , bone surface , brain , pituitary , and eyes , and in most studies,1 - 14 tlds are used for the mesasurement of the radiation dose ( fig . it is worth noticing that at this stage only the absorbed dose is measured . in order to determine the effective dose , which is used to estimate the risk in human beings , the absorbed dose for individual organs must be translated to an equivelant dose and then multiplied with a weighting factor defined by the international commission on radiological protection ( icrp ) for the specific organ . later , the effective doses of these organs are summed up to obtain a total effective dose . the total dose is used to represent the potential risk of the whole body exposed to radiation . we have thus shown that the effective dose is a representation of the potential risk of radiation dose to the patient , and in most studies , the effective dose is drived from absorbed dose , which is measured with tlds by the use of an anthropomorphic phantom . thus , in the following discussion , only the reported effective dose derived from a phantom is addressed . many studies have been performed to estimate the effective doses of different cbct units . however , a simple comparison can not be made since , as one researcher has noted , " significant differences in dose for the same examination have been reported for different cbct units , and significant differences in dose have been reported for different examinations or techniques with the same unit"13 and another has observed that " the results are often difficult to compare when a number of different phantoms and dosimeters have been used together with different assumptions."15 to avoid these research limitations , ludlow et al5 and pauwels et al14 investigated the effective dose of 8 and 14 cbct units , respectively , by using the same phantom and tld dosimeters . although the phantoms and dosimeters employed in the two studies were different , from table 1 we can still see that the effective dose is quite different from one cbct unit to another , irrespective of the size of the field of view ( fov ) used . the highest effective dose is 1073 sv for cb mercuray with a large fov scanning for maxillofacial region , while the lowest effective dose is only 19 sv for the kodak 9000 3d with a scanning area of the front region of the upper jaw . this is a difference of almost 500 times between the highest and lowest effective doses . when we look futher into the data in table 1 , we can see that the effective dose is closely related to the protocol used for scanning . since a protocol is a combination of kvp , mas , and voxel sizes and other factors , the effective dose is in reality closely related to the chosen exposure parameters . in the study performed by ludlow et al , the effective dose for maximum quality cb mercuray ( 1073 sv ) is almost twice that of standard quality cb mercuray ( 569 sv ) , the effective dose for cbct unit galileos obtained at the default exposure ( 70 sv ) is almost half of that obtained at maximum exposure ( 128 sv ) , and the effective dose for standard and high resolution images from the prexion 3d were 189 sv and 388 sv , respectively . the later data also indicate that with an increase in the spatial resolution , the effective dose is increased as well . this is also confirmed by the study conducted by davies et al.16 field of view ( fov ) is another factor that plays an important role in the assessment of the effective dose of one cbct examination . when the exposure parameters such as the kvp and mas are maintained at the same level , the larger the fov used , the higher the effective dose obtained . this is substantiated by the effective doses for cb mercuay in table 1 , where the effective dose is 1073 sv for a large fov with maximum quality , 560 sv for a medium fov , and 407 sv for a small fov . the exposure parameters for all of the three fov examinations were kept at 120 kvp and 150 mas . a study by qu et al13 further discloses the positive relationship between the fov and effective dose . in this study , 12 protocols that combined different patient size , fov , kvp , ma , and exposure times were employed for the estimation of effective doses of the promax 3d cbct unit . while holding all of the other exposure parameters constant , the researchers found that for a scanning area of full volume height with a full volume diameter ( 8 cm8 cm ) , the effective dose ( 298 sv ) is much higher than the effective doses obtained from used other scanning fovs , specifically , half the volume height ( upper jaw ) with a full volume diameter ( 4 cm8 cm , 131 sv ) , half the volume height ( lower jaw ) with a full volume diameter ( 4 cm8 cm , 171 sv ) , a full volume height with half the volume diameter ( anterior region , 8 cm4 cm , 127 sv ) , and a full volume height with half the volume diameter ( posterior region , 8 cm4 cm , 197 sv ) . the above demonstrates that the effective dose is different from one cbct unit to another and closely related to the exposure parameters used for scanning ; for a given model of a cbct unit , the larger the fov used for scannning , the higher the effective dose derived when all the other exposure parameters are kept at the same level . similarly , the higher the spatial resolution chosen for scanning , the higher the effective dose is . there are few studies focusing on the direct comparison of the effective doses obtained from cbct and conventional dental radiography . the results from the direct comparison studies were summarized in table 2 , where the effective dose for panoramic radiography is about 22.0 sv , for lateral cephalometric examination about 4.5 sv and for cbct examnation the effective dose is 61 - 134 sv . no study has performed a direct comparison of the effective dose from intraoral and cbct examinations . in the guidelines19 provided by the european academy of dento - maxillofacial radiology , other studies20 - 26 that exclusively estimated the effective dose of conventional dental radiography have demonstrated that the range of the effective dose for a panoramic radiograph is 3.85 - 38.0 sv ( table 3 ) , for a lateral cephalometric examination is 1.1 - 5.6 sv ( table 4 ) , for posteroanterior cephalometric radiograph , 5.1sv , and for one introal examination , 0.65 - 9.5 sv ( table 5 ) . these data indicate that the effective dose of cbct is several to hundreds of times higher than the effective dose from a conventional dental radiographic examination . more attention is paid to the effective dose of cbct and multislice ct ( msct ) since both techniques provide three dimensional images . the effective doses from the literature on cbct and msct are shown in table 6 . however , in some of the studies , the scanning area , i.e. the fov was not well defined . to avoid the effect of the fov on the assessment of effective dose , qu et al13 strictly defined the scanning area for both msct and cbct examinations in their study . the results showed that the effective doses of mscts are about several to ten times higher than those of cbcts . for example , when scaning both the maxilla and mandible , the effective dose is about 94.9 sv for cbct newtom 9000 , 249.1 sv for cbct dct - pro , and 1066.1 for ge 8-slice msct . however , it should be borne in mind that although the effective dose of msct is much higher than that of cbct , the image qualities for the two techniques are quite different . for hard tissue , such as bone and tooth , the image quality of cbct is equal to or better than the image quality of msct , but for soft tissues , the image from cbct is not satisfactory due to the inherent drawbacks of the technique . many studies have been performed to estimate the effective doses of different cbct units . however , a simple comparison can not be made since , as one researcher has noted , " significant differences in dose for the same examination have been reported for different cbct units , and significant differences in dose have been reported for different examinations or techniques with the same unit"13 and another has observed that " the results are often difficult to compare when a number of different phantoms and dosimeters have been used together with different assumptions."15 to avoid these research limitations , ludlow et al5 and pauwels et al14 investigated the effective dose of 8 and 14 cbct units , respectively , by using the same phantom and tld dosimeters . although the phantoms and dosimeters employed in the two studies were different , from table 1 we can still see that the effective dose is quite different from one cbct unit to another , irrespective of the size of the field of view ( fov ) used . the highest effective dose is 1073 sv for cb mercuray with a large fov scanning for maxillofacial region , while the lowest effective dose is only 19 sv for the kodak 9000 3d with a scanning area of the front region of the upper jaw . this is a difference of almost 500 times between the highest and lowest effective doses . when we look futher into the data in table 1 , we can see that the effective dose is closely related to the protocol used for scanning . since a protocol is a combination of kvp , mas , and voxel sizes and other factors , the effective dose is in reality closely related to the chosen exposure parameters . in the study performed by ludlow et al , the effective dose for maximum quality cb mercuray ( 1073 sv ) is almost twice that of standard quality cb mercuray ( 569 sv ) , the effective dose for cbct unit galileos obtained at the default exposure ( 70 sv ) is almost half of that obtained at maximum exposure ( 128 sv ) , and the effective dose for standard and high resolution images from the prexion 3d were 189 sv and 388 sv , respectively . the later data also indicate that with an increase in the spatial resolution , the effective dose is increased as well . this is also confirmed by the study conducted by davies et al.16 field of view ( fov ) is another factor that plays an important role in the assessment of the effective dose of one cbct examination . when the exposure parameters such as the kvp and mas are maintained at the same level , the larger the fov used , the higher the effective dose obtained . this is substantiated by the effective doses for cb mercuay in table 1 , where the effective dose is 1073 sv for a large fov with maximum quality , 560 sv for a medium fov , and 407 sv for a small fov . the exposure parameters for all of the three fov examinations were kept at 120 kvp and 150 mas . a study by qu et al13 further discloses the positive relationship between the fov and effective dose . in this study , 12 protocols that combined different patient size , fov , kvp , ma , and exposure times were employed for the estimation of effective doses of the promax 3d cbct unit . while holding all of the other exposure parameters constant , the researchers found that for a scanning area of full volume height with a full volume diameter ( 8 cm8 cm ) , the effective dose ( 298 sv ) is much higher than the effective doses obtained from used other scanning fovs , specifically , half the volume height ( upper jaw ) with a full volume diameter ( 4 cm8 cm , 131 sv ) , half the volume height ( lower jaw ) with a full volume diameter ( 4 cm8 cm , 171 sv ) , a full volume height with half the volume diameter ( anterior region , 8 cm4 cm , 127 sv ) , and a full volume height with half the volume diameter ( posterior region , 8 cm4 cm , 197 sv ) . the above demonstrates that the effective dose is different from one cbct unit to another and closely related to the exposure parameters used for scanning ; for a given model of a cbct unit , the larger the fov used for scannning , the higher the effective dose derived when all the other exposure parameters are kept at the same level . similarly , the higher the spatial resolution chosen for scanning , the higher the effective dose is . there are few studies focusing on the direct comparison of the effective doses obtained from cbct and conventional dental radiography . the results from the direct comparison studies were summarized in table 2 , where the effective dose for panoramic radiography is about 22.0 sv , for lateral cephalometric examination about 4.5 sv and for cbct examnation the effective dose is 61 - 134 sv . no study has performed a direct comparison of the effective dose from intraoral and cbct examinations . in the guidelines19 provided by the european academy of dento - maxillofacial radiology other studies20 - 26 that exclusively estimated the effective dose of conventional dental radiography have demonstrated that the range of the effective dose for a panoramic radiograph is 3.85 - 38.0 sv ( table 3 ) , for a lateral cephalometric examination is 1.1 - 5.6 sv ( table 4 ) , for posteroanterior cephalometric radiograph , 5.1sv , and for one introal examination , 0.65 - 9.5 sv ( table 5 ) . these data indicate that the effective dose of cbct is several to hundreds of times higher than the effective dose from a conventional dental radiographic examination . more attention is paid to the effective dose of cbct and multislice ct ( msct ) since both techniques provide three dimensional images . the effective doses from the literature on cbct and msct are shown in table 6 . however , in some of the studies , the scanning area , i.e. the fov was not well defined . to avoid the effect of the fov on the assessment of effective dose , qu et al13 strictly defined the scanning area for both msct and cbct examinations in their study . the results showed that the effective doses of mscts are about several to ten times higher than those of cbcts . for example , when scaning both the maxilla and mandible , the effective dose is about 94.9 sv for cbct newtom 9000 , 249.1 sv for cbct dct - pro , and 1066.1 for ge 8-slice msct . however , it should be borne in mind that although the effective dose of msct is much higher than that of cbct , the image qualities for the two techniques are quite different . for hard tissue , such as bone and tooth , the image quality of cbct is equal to or better than the image quality of msct , but for soft tissues , the image from cbct is not satisfactory due to the inherent drawbacks of the technique . to perform one medical x - ray examination , three main factors must be taken into account : the x - ray unit , patient for examination , and receptor used for capturing the image of the patient . therefore , when an x - ray examination is indicated for a patient , the patient dose can be reduced by the reduction of the x - ray intensity emitted from the employed x - ray unit , increasing of the imaging receptor capturing speed and collimation , or shielding of the x - ray beam to the patient . this section will only focus on the shielding devices for the reduction of the radiation dose . the shielding devices include a leaded thyroid collar for the protection of the thyroid gland , leaded glasses for the protection of the eye lens , a leaded hat for the protection of the brain , and a leaded apron for the protection of the body trunk . it is well known that a thyroid collar is effective for the protection of the thyroid gland in an intraoral examination . however , for a cbct examination , is it still effective when the x - ray unit rotates around the patient ? with this question in mind , two studies were conducted . one study was mainly aimed to identify the effectiveness of a thyroid collar on the dose redution of the thyroid gland.28 in this study , five conditions were tested as follows : 1 ) without a collar around the neck ; 2 ) with one collar loosely on the front of the neck ; 3 ) with two collars loosely on the front and back of the neck ; 4 ) with one collar tightly on the front of the neck ; and 5 ) with two collars tightly on the front and back of the neck . the results showed that when the thyroid collars were used loosely around the neck , no effective organ dose reduction was observed . when one thyroid collar was used tightly on the frontof the neck , the effective organ dose to the thyroid gland and esophagus were reduced to 15.9 sv ( 48.7% reduction ) and 1.4 sv ( 41.7% reduction ) , respectively . a similar organ dose reduction ( 46.5% and 41.7% ) was achieved when cbct scanning was performed with two collars tightly affixed to the front and back of the neck . the study supported the use of a thyroid collar during a cbct scan . in a subsequent study , different oral and maxillofacial regions were scanned with the phantom tightly wearing one or two thyroid collars.29 the results also supported the use of thyroid collars ( 61% thyroid dose reduction for a large view examination , 72% thyroid dose reduction for a medium fov , and 70% thyroid dose reduction for a small fov ) and further disclosed that the total effective dose for medium and small fov examinations were also significantly reduced by the use of a thyroid collar . the use of leaded glasses during a cbct examinaiton was also investigated.30 in the study peformed by prins et al , three phantoms representing an adult male , an adult female , and a child were employed . the results showed that the radiation dose to the eye lens could be reduced by over 60% without having a deleterious effect on the image quality in the area of clinical significance for dental imaging . considering the above , one conclusion that could be drawn was that a thyroid collar and leaded glasses should be used during a cbct examination , given that diagnostic information and image quality are not reduced . the effective dose of cbct , conventional dental radiography , and multislice ct and the effect of a thyroid collar and leaded glasses on the dose reduction was presented in this paper . based on the above analysis , we can conclude the following :
the patient radiation dose is much lower for cbct than for helical ct;the patient radiation dose is closely related to the fov and exposure parameters used for a cbct examination . without alteration of any other exposure parameters , the larger the fov used for scanning , the higher the radiation dose is;compared with conventional dental radiography , the effective dose of cbct is several to hundreds of times higher;to reduce the patient dose to the greatest possible extent , the chosen cbct scanning protocol should be in accordance with the dignostic task at hand;a thyroid collar should be used for cbct scanning ; wearing leaded glasses is recommended when it does not detract from imaging quality . the patient radiation dose is much lower for cbct than for helical ct ; the patient radiation dose is closely related to the fov and exposure parameters used for a cbct examination . without alteration of any other exposure parameters , the larger the fov used for scanning , the higher the radiation dose is ; compared with conventional dental radiography , the effective dose of cbct is several to hundreds of times higher ; to reduce the patient dose to the greatest possible extent , the chosen cbct scanning protocol should be in accordance with the dignostic task at hand ; a thyroid collar should be used for cbct scanning ; wearing leaded glasses is recommended when it does not detract from imaging quality . | after over one decade development , cone beam computed tomography ( cbct ) has been widely accepted for clinical application in almost every field of dentistry . meanwhile , the radiation dose of cbct to patient has also caused broad concern . according to the literature , the effective radiation doses of cbcts in nowadays market fall into a considerably wide range that is from 19 sv to 1073 sv and closely related to the imaging detector , field of view , and voxel sizes used for scanning .
to deeply understand the potential risk from cbct , this report also reviewed the effective doses from literatures on intra - oral radiograph , panoramic radiograph , lateral and posteroanterior cephalometric radiograph , multi - slice ct , and so on .
the protection effect of thyroid collar and leaded glasses were also reviewed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this prospective study was approved by the institutional review board of our hospital ( a tertiary referral center for cerebral palsy ) , and informed consent was obtained from patients or legal guardians . the study included consecutive patients with spastic cerebral palsy who were able to walk ( gross motor function classification system [ gmfcs ] level i - iii)9 ) and communicate effectively with other people ( communication function classification system [ cfcs ] level i - iii),10 ) registered at our hospital between june 2009 and january 2010 . the exclusion criteria applied were as follows : ( 1 ) a neuromuscular disease in addition to cerebral palsy and ( 2 ) previous surgery that might cause a change in the patellar height , such as patellar tendon advancement and supracondylar extension osteotomy of the femur . demographic information was collected , including data on gender , age , extent of involvement ( bilateral vs. unilateral ) , and gmfcs level.9 ) physical examination was performed by an orthopedic surgeon with 8 years of experience , and it included the assessment of knee flexion contracture , unilateral popliteal angle , and bilateral popliteal angle in the supine position . knee flexion contracture was defined as the angle between the long axis of the thigh and that of the lower leg when the examiner gently and passively extended the knee . while measuring the popliteal angle , the test limb was flexed to 90 at the hip and the knee was extended passively with the contralateral hip and knee in extension . the angle between the longitudinal axis of the lower leg and the vertical line passing through the thigh was defined as the unilateral popliteal angle . the same measurement was performed in the contralateral hip in 90 of flexion , and this was referred to as the bilateral popliteal angle . angles were measured by a research assistant using a standard goniometer with an arm length of 18 cm in one degree increments . the patients included in the study could act as effective sender and receiver with either familiar or unfamiliar partners in communication ( cfcs level i - iii ) . all patients were questioned regarding the presence of anterior knee pain , which was evaluated in terms of walking pain , resting pain , and provocative pain . provocative anterior knee pain was examined by performing a patellar compression test , whereby the examiner compressed the patella into the trochlear groove of the femur . the presence of anterior knee pain was assessed using visual analogue scale ( vas).11 ) patellar height was evaluated on lateral knee radiographs that were taken at 70 kvp and 7 mas using a ut 2000 unit ( philips , eindhoven , the netherlands ) in approximately 30 of knee flexion at a source - to - image distance of approximately 100 cm . all radiographic images were digitally acquired using a picture archiving and communication system ( pacs ; impax , agfa , antwerp , belgium ) , and assessments were subsequently carried out using the pacs software . a previous report demonstrated that the insall - salvati ( is)12 ) and the koshino - sugimoto ( ks)13 ) methods have reasonable reliability and validity with respect to depicting the patellar height in children and adolescents,14 ) and therefore , is and ks ratios were used to determine the patellar height . on lateral knee radiographs , the is method was used to measure patellar tendon length relative to patellar bone length , and the ks method was to measure the ratio of the distance between the proximal tibial physis and the center of the patella to the distance between the distal femoral physis and the proximal tibial physis . patella alta was defined as an is ratio of > 1.20 or a ks ratio of > 1.33.12,13 ) consensus building and reliability sessions were held before taking radiographic measurements . the two observers ( both orthopedic surgeons with 10 and 8 years of experience , respectively ) agreed on the definitions of radiographic landmarks and measurements . reliabilities were determined using intraclass correlation coefficients ( iccs ) , and the assessment was performed using 51 randomly selected joints of 51 subjects after performing the required sample size calculation . interobserver reliability was determined between the two orthopedic surgeons who individually measured the is and ks ratios , and were unaware of each other 's findings . intraobserver reliability was determined by having one of the observers repeat the above radiographic measurements 3 weeks later . using an icc target value of 0.8 , bonett 's approximation was used in the setting of 0.2 as a width of 95% confidence interval ( ci ) for the two raters.15 ) the minimal sample size was calculated as 51 . associations between risk factors and anterior knee pain were assessed using the generalized estimating equation ( gee)16 ) models to calculate adjusted odds ratios ( ors ) and 95% cis . this procedure takes into account the correlation between the left and right knees in subjects . multivariate analysis using gee models was used to identify the risk factors that significantly affected anterior knee pain . univariate analysis using gee models was performed initially in order to reduce the number of variables entered into the multivariate analysis . variables significant at the p < 0.1 level in the univariate study and clinically important factors were included as potential risk factors in the multivariate analysis . chicago , il , usa ) , and statistical significance was accepted for p < 0.05 . demographic information was collected , including data on gender , age , extent of involvement ( bilateral vs. unilateral ) , and gmfcs level.9 ) physical examination was performed by an orthopedic surgeon with 8 years of experience , and it included the assessment of knee flexion contracture , unilateral popliteal angle , and bilateral popliteal angle in the supine position . knee flexion contracture was defined as the angle between the long axis of the thigh and that of the lower leg when the examiner gently and passively extended the knee . while measuring the popliteal angle , the test limb was flexed to 90 at the hip and the knee was extended passively with the contralateral hip and knee in extension . the angle between the longitudinal axis of the lower leg and the vertical line passing through the thigh was defined as the unilateral popliteal angle . the same measurement was performed in the contralateral hip in 90 of flexion , and this was referred to as the bilateral popliteal angle . angles were measured by a research assistant using a standard goniometer with an arm length of 18 cm in one degree increments . the patients included in the study could act as effective sender and receiver with either familiar or unfamiliar partners in communication ( cfcs level i - iii ) . all patients were questioned regarding the presence of anterior knee pain , which was evaluated in terms of walking pain , resting pain , and provocative pain . provocative anterior knee pain was examined by performing a patellar compression test , whereby the examiner compressed the patella into the trochlear groove of the femur . patellar height was evaluated on lateral knee radiographs that were taken at 70 kvp and 7 mas using a ut 2000 unit ( philips , eindhoven , the netherlands ) in approximately 30 of knee flexion at a source - to - image distance of approximately 100 cm . all radiographic images were digitally acquired using a picture archiving and communication system ( pacs ; impax , agfa , antwerp , belgium ) , and assessments were subsequently carried out using the pacs software . a previous report demonstrated that the insall - salvati ( is)12 ) and the koshino - sugimoto ( ks)13 ) methods have reasonable reliability and validity with respect to depicting the patellar height in children and adolescents,14 ) and therefore , is and ks ratios were used to determine the patellar height . on lateral knee radiographs , the is method was used to measure patellar tendon length relative to patellar bone length , and the ks method was to measure the ratio of the distance between the proximal tibial physis and the center of the patella to the distance between the distal femoral physis and the proximal tibial physis . patella alta was defined as an is ratio of > 1.20 or a ks ratio of > 1.33.12,13 ) consensus building and reliability sessions were held before taking radiographic measurements . the two observers ( both orthopedic surgeons with 10 and 8 years of experience , respectively ) agreed on the definitions of radiographic landmarks and measurements . reliabilities were determined using intraclass correlation coefficients ( iccs ) , and the assessment was performed using 51 randomly selected joints of 51 subjects after performing the required sample size calculation . interobserver reliability was determined between the two orthopedic surgeons who individually measured the is and ks ratios , and were unaware of each other 's findings . intraobserver reliability was determined by having one of the observers repeat the above radiographic measurements 3 weeks later . reliability was determined using iccs and a two - way random effect model . when iccs were calculated , single measurement and absolute agreement were assumed . using an icc target value of 0.8 , bonett 's approximation was used in the setting of 0.2 as a width of 95% confidence interval ( ci ) for the two raters.15 ) the minimal sample size was calculated as 51 . associations between risk factors and anterior knee pain were assessed using the generalized estimating equation ( gee)16 ) models to calculate adjusted odds ratios ( ors ) and 95% cis . this procedure takes into account the correlation between the left and right knees in subjects . multivariate analysis using gee models was used to identify the risk factors that significantly affected anterior knee pain . univariate analysis using gee models was performed initially in order to reduce the number of variables entered into the multivariate analysis . variables significant at the p < 0.1 level in the univariate study and clinically important factors were included as potential risk factors in the multivariate analysis . statistical analyses were conducted using spss ver . 15.0 ( spss inc . , chicago , il , usa ) , and statistical significance was accepted for p < 0.05 . one hundred and twenty - seven ambulatory patients ( 254 knees ) with spastic cerebral palsy were finally included in this study . mean patient age was 14.5 years ( standard deviation , 7.9 years ) , and there were 89 male and 38 female patients . thirty - three patients had unilateral anterior knee pain and 94 patients had bilateral anterior knee pain . thirty - nine patients were classified as gmfcs level i , 65 patients were classified as gmfcs ii , and 23 patients were classified as gmfcs iii ( table 1 ) . seventy - seven patients were found to have patella alta based on the radiographic measurements ( 60.6% ) . of these , the interobserver reliabilities of is and ks were 0.910 ( 95% ci , 0.821 to 0.956 ) and 0.889 ( 95% ci , 0.801 to 0.940 ) , respectively , and the intraobserver reliabilities of is and ks were 0.947 ( 95% ci , 0.894 to 0.974 ) and 0.922 ( 95% ci , 0.840 to 0.963 ) , respectively . six patients had abnormal radiographic findings of the knee other than that of patella alta . the abnormal radiographic findings were as follows : inferior pole fragmentation in two cases , ossicles on the tibial tuberosity in two cases , superior pole fragmentation in one case , and elongated patella in one case . ten patients ( six patients with unilateral anterior knee pain and four patients with bilateral anterior knee pain ) had anterior knee pain while walking ( 7.9% ) and six patients ( three patients with unilateral anterior knee pain and three patients with bilateral anterior knee pain ) had anterior knee pain while resting ( 4.7% ) . thirteen patients ( five patients with unilateral anterior knee pain and eight patients with bilateral anterior knee pain ) had provocative anterior knee pain during the patellar compression test . overall , sixteen patients ( 12.6% ) had either unilateral or bilateral anterior knee pain . of these , six patients showed a vas 3 , nine patients showed 3 < vas 7 , and one patient showed a vas > 7 . with respect to walking pain , age ( p = 0.013 ) and patella alta ( p = 0.997 ) were the potential risk factors , and they were further analyzed in the multivariate analysis . on performing the multivariate analysis with gee , age was found to be a significant risk factor for anterior knee pain while walking , with an or of 1.08 ( 95% ci , 1.02 to 1.14 ) ( table 2 ) . with respect to resting pain , age ( p = 0.008 ) , knee flexion contracture ( p = 0.078 ) , and patella alta ( p = 0.622 ) were the potential risk factors . in the multivariate analysis with gee , age was a significant risk factor with an or of 1.09 ( 95% ci , 1.03 to 1.15 ) ( table 3 ) . with respect to provocative pain , age ( p = 0.131 ) , knee flexion contracture ( p = 0.024 ) , and patella alta ( p = 0.150 ) were the potential risk factors . in the multivariate analysis , knee flexion contracture was a significant protective factor with an or of 0.92 ( 95% ci , 0.85 to 0.98 ) ( table 4 ) . approximately 12.6% of ambulatory children and young adults with spastic cerebral palsy were found to have anterior knee pain in our hospital - based cohort study . age was found to be a significant risk factor for anterior knee pain while walking and resting . although knee flexion contracture was found to be a significant protective factor for provocative anterior knee pain , its clinical implication was not clarified because of the small difference in knee flexion contracture between the patients with and without pain ( approximately 1.5 ) . before discussing the clinical implications of the results of this study , its limitations should be mentioned . first , this was a hospital - based cohort study , and the patients included were children and young adults . therefore , care should be taken while generalizing our results to patients with cerebral palsy . second , patients with previous surgeries affecting knee biomechanics were excluded , because it was believed that these patients were more likely to have anterior knee pain . therefore , this exclusion may have caused a selection bias . third , age was found to be the most important factor for the development of anterior knee pain in patients with cerebral palsy . therefore , a longitudinal study with a long - term follow - up is warranted to investigate the factors that contribute to anterior knee pain . in our study population , the presence of patella alta is believed to cause weakness of the knee extensor apparatus by diminishing the lever arm function,17 ) and it may also be importantly associated with various knee problems . therefore , patella alta needs to be defined and measured appropriately . a recent study showed that the methods commonly used to measure the patellar height are not applicable to children and adolescents due to the different degrees of ossification of bony landmarks.14 ) in the present study , patellar height was measured using two different methods ( is and ks ) rather than using a single uniform method considering the applicability of the methods . therefore , the definition of patella alta used in this study is believed to be more accurate than that used in previous studies.17,18 ) in addition , the gee model considering the correlation between the right and left knee within a subject is believed to support the study results . in the present study , anterior knee pain was evaluated in terms of walking pain , resting pain , and provocative pain . it was interesting to note that the significant risk factors differed slightly according to these three pain characteristics . the most important risk factor for walking and resting anterior knee pain was the patient age . in view of the study design and results , walking and resting anterior knee pain provocative anterior knee pain has more objective characteristics , but no treatable risk factors were identified in children and adolescents with cerebral palsy . in the present study , six patients had abnormal radiographic findings of the knee extensor apparatus other than patella alta , including inferior pole fragmentation in two cases , ossicles on the tibial tuberosity in two cases , superior pole fragmentation in one case , and elongated patella in one case . this finding is somewhat at odds with a previous study , in which abnormal radiographics were found among patients with intractable anterior knee pain.19 ) another study reported that the radiographic findings were usually chronic in patients with cerebral palsy , and required no treatment,18 ) which concurs with the findings of this study . therefore , a further study with a longitudinal design including comprehensive risk factors is needed to investigate the risk factors for anterior knee pain in patients with cerebral palsy . although this study included a relatively large number of patients and data were analyzed using the gee model , only children and adolescents were included . furthermore , because a small number of patients with anterior knee pain were included , the risk factors for anterior knee pain identified in this study may not be generalizable . a longitudinal study that includes older patients and investigates candidate risk factors , such as torsional alignment of the limb , postural and rotational position of the foot , and gait parameters , more comprehensively is needed . | backgroundthe aim of this study was to identify the risk factors for anterior knee pain in patients with cerebral palsy.methodsthis prospective study investigated the risk factors for anterior knee pain in 127 ambulatory patients with spastic cerebral palsy in terms of walking pain , resting pain , and provocative pain .
demographic data analysis and physical examination for measuring the knee flexion contracture and unilateral and bilateral popliteal angles were performed .
patellar height was measured on radiographs , and patella alta was identified .
the risk factors for anterior knee pain were analyzed using multivariate analysis with a generalized estimating equation.resultsseventy-seven patients were found to have patella alta based on the radiographic measurements ( 60.6% ) .
overall , sixteen patients ( 12.6% ) had either unilateral or bilateral anterior knee pain . of these , 6 patients showed a visual analogue scale ( vas ) 3 , 9 patients showed 3 < vas 7 , and one patient showed a vas > 7 .
age was found to be a significant risk factor for walking pain and resting pain with odds ratios ( ors ) of 1.08 ( 95% confidence interval [ ci ] , 1.02 to 1.14 ) and 1.09 ( 95% ci , 1.03 to 1.15 ) , respectively . in the multivariate analysis ,
knee flexion contracture was a significant protective factor with an or of 0.92 ( 95% ci , 0.85 to 0.98).conclusionsapproximately 12.6% of ambulatory patients with spastic cerebral palsy were found to have anterior knee pain in our hospital - based cohort study .
age was found to be a significant risk factor for anterior knee pain while walking and resting . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
attention deficit hyperactivity disorder ( adhd ) is a widespread neurological / behavioral disorder predominantly affecting boys that is characterized by inattention or hyperactivity and impulsivity , or combined symptomatology [ 15 ] . children diagnosed with adhd are predisposed to aberrant or compromised growth and development functionally linked to complex symptomatological factors [ 69 ] . from nutritional and physiological perspectives , children diagnosed with adhd are predisposed to irregular and/or impulsive eating patterns , often leading to compromised physical condition , high body mass indices ( bmis ) , and , later in life , to associated metabolic disorders such as type ii diabetes . a 2005 meta - analysis of stratified clinical data attempted to statistically evaluate the prevalence of overweight subjects within populations of children diagnosed with adhd . subsequently , a similar analysis indicated that a study population of children and adolescents diagnosed with add / adhd and not currently being treated with psychostimulant medication had an approximately 50% greater risk of being overweight in comparison to healthy control subjects . interestingly , a cohort of children and adolescents diagnosed with add / adhd and currently treated with psychostimulant medication had an approximately 60% greater risk of being underweight in comparison to healthy control subjects , indicating the necessity for additional research to elucidate longitudinal and pharmacologic factors that influence the relationship between adhd and weight status in affected children and adolescents . a 2006 study attempted to establish functional linkages between childhood exposure to television , adhd , and obesity and concluded that obesity and adhd demonstrate significant comorbidity . proposed overlapping mechanisms of these comorbid conditions suggested that nutritional excess contributes to adhd and that cognitive hyperstimulation contributes to obesity . a subsequent study cited behavioral impulsivity as a common underlying neurobiological mechanism linking obesity and adhd . in light of the above , the present study was designed to identify and elucidate potentially important patterns of eating behaviors , nutritional quality of dietary constituents , and lifestyle factors associated with mixed adhd symptomatology in a cohort of boys . previous research suggests there may be a 3:1 to 9:1 ratio in occurrence of adhd among boys and girls [ 1517 ] . although there is no clear agreement on the existence and the origin of the gender effect in adhd , most current clinical studies focus predominantly on boys with adhd . one reason may be the lower occurrence of adhd in girls in clinical populations . in the present study we focused only on boys with adhd due to the low number of girls with adhd identified in our clinical samples ; thus , it would not be possible to statistically control gender effects . data sets were obtained from structured interviews of parents of 100 boys ( aged 610 years ) previously diagnosed with combined type adhd according to dsm - iv criteria ( dsm - iv , 1994 ) and parents of 100 age - matched male control subjects . additionally , we utilized a score of conner s scale version 3 for parents and teachers > 2 sd . for children diagnosed with adhd , exclusion criteria included the presence of comorbid psychiatric , neurological , or somatic disorders . importantly , all subjects were currently free from psychostimulant medication for treatment of adhd symptoms . the subjects in the control group were required to meet the same exclusion criteria , absence of adhd symptoms , and a score on conner s scale version 3 for parents and teachers < 1 sd . inclusion and exclusion criteria in both cohorts of subjects were evaluated by a certified physician and a clinical psychologist after the subjects received thorough clinical examinations . the study was approved by the ethics commission of the first faculty of medicine , charles university , prague , and the general hospital in prague . all parents of the subjects received oral and written information about the study , which complied with the declaration of helsinki , before they provided written informed consent . eating habits were assessed with a structured interview for parents , focused on eating habits and related lifestyle phenomena based on previous research [ 68 ] . the use of reporting by parents in adhd children , as well as in other child psychopathology , is currently considered as one of the most important sources for research as well as clinical use . there are limitations to this source of information ( e.g. , the report may be biased by parent opinion or wishes ) but it still is a much more reliable source of information , especially in description of behavioral manifestations , than a description provided by adhd children who may not perceive their own behavior . we decided to use a structured interview based on our previous research because there is no standardized questionnaire suitable for the purpose of the study . we also studied occurrence and frequency of specific behavior that may be evaluated by specific questions with no need of standardized instruments . randomization of interviewed parents was assured by stratification according to medical , educational , and socioeconomic criteria . statistical evaluation of data sets was achieved by pearson s chi - squared analysis using the statistical package spss 12 . for further statistical analysis , the structured interview we used to collect data was constructed with the use of category - based answers . thus , we decided to use pearson s chi - squared analysis , as it is one of the most suitable statistical methods for this kind of data . first , we calculated frequency distribution of answers within each category and then we used chi - squared analysis to determine how well the data obtained from the adhd and control groups matched in distribution . data sets were obtained from structured interviews of parents of 100 boys ( aged 610 years ) previously diagnosed with combined type adhd according to dsm - iv criteria ( dsm - iv , 1994 ) and parents of 100 age - matched male control subjects . additionally , we utilized a score of conner s scale version 3 for parents and teachers > 2 sd . for children diagnosed with adhd , exclusion criteria included the presence of comorbid psychiatric , neurological , or somatic disorders . importantly , all subjects were currently free from psychostimulant medication for treatment of adhd symptoms . the subjects in the control group were required to meet the same exclusion criteria , absence of adhd symptoms , and a score on conner s scale version 3 for parents and teachers < 1 sd . inclusion and exclusion criteria in both cohorts of subjects were evaluated by a certified physician and a clinical psychologist after the subjects received thorough clinical examinations . the study was approved by the ethics commission of the first faculty of medicine , charles university , prague , and the general hospital in prague . all parents of the subjects received oral and written information about the study , which complied with the declaration of helsinki , before they provided written informed consent . eating habits were assessed with a structured interview for parents , focused on eating habits and related lifestyle phenomena based on previous research [ 68 ] . the use of reporting by parents in adhd children , as well as in other child psychopathology , is currently considered as one of the most important sources for research as well as clinical use . there are limitations to this source of information ( e.g. , the report may be biased by parent opinion or wishes ) but it still is a much more reliable source of information , especially in description of behavioral manifestations , than a description provided by adhd children who may not perceive their own behavior . we decided to use a structured interview based on our previous research because there is no standardized questionnaire suitable for the purpose of the study . we also studied occurrence and frequency of specific behavior that may be evaluated by specific questions with no need of standardized instruments . randomization of interviewed parents was assured by stratification according to medical , educational , and socioeconomic criteria . statistical evaluation of data sets was achieved by pearson s chi - squared analysis using the statistical package spss 12 . for further statistical analysis , the structured interview we used to collect data was constructed with the use of category - based answers . thus , we decided to use pearson s chi - squared analysis , as it is one of the most suitable statistical methods for this kind of data . first , we calculated frequency distribution of answers within each category and then we used chi - squared analysis to determine how well the data obtained from the adhd and control groups matched in distribution . statistical analysis indicated specific and statistically significant differences in eating habits of adhd children compared to the control group . the differences were found in quantitative characteristics of eating habits ( e.g. , the number of daily meals ) as well as in qualitative characteristics ( e.g. , structure of food and beverage intake ) . as table 1 shows , there are significant differences in the number of meals per day between control and adhd groups . adhd children frequently skip meals breakfast ( p<0.004 ) , lunch ( p<0.007 ) , and dinner ( p<0.001 ) more often than control children . however , adhd children eat more than 5 times a day ( p<0.001 ) . compared with the control group , they eat less regularly , but more often . this fact may also be associated with the difference in weight parameters and body fat percentage between the 2 groups . as table 2 shows , another important finding is that adhd children drink statistically significantly more sweetened beverages than do control children ( p<0.003 ) . thirteen percent of parents of adhd children reported that their children eat fruits and vegetables only about once a week , compared to none of the parents of children in the control group ( p<0.003 ) . the results show less regular physical activity in adhd children and more hours spent watching television or a computer . in the control group , the average time spent on sports activities was 8 hours a week and in the adhd group it was 6 hours , which is 2 hours a week less than in controls ( table 4 ) . finally , we found that the duration of breast - feeding provided to a child can play a significant role in their later diet . our results indicated a statistically significant difference in duration of breastfeeding between control and adhd children : 70% of control children were breastfed for more than 6 months , but only 42% ( p<0.003 ) of adhd children were breastfeed for more than 6 months . these significant differences can also affect later differences in physical development between the groups ( table 5 ) . we found significant differences in eating habits and related lifestyle phenomena in adhd children compared to the control group . according to information provided by parents , children with adhd skip meals , especially breakfast and dinner , significantly more often than children in the control group ; however , adhd children eat more often than 5 times a day . adhd children eat less fruits and vegetables than control children , but they drink more sweetened beverages . control group children spend on average 2 hours more time each day on sports activities than children with adhd . obviously , lack of regularity in eating , lack of fruits and vegetables , high percentage of sweetened beverages in daily fluid intake , and , on the other hand , less sports activities in adhd children may affect body weight and body fat percentage and can be associated with overweight or even obesity . children with adhd may be a risk group for the development of obesity , thus attention should be directed towards these problematic behaviors , including eating habits . obesity significantly complicates the lives of both adults and children , not only in the physical , but also in the psychological aspects of health . obese individuals , whether children or adults , have more difficulties with self - confidence and self - assertion , and are far more to likely experience serious disorders such as depression and anxiety . in children , these problems can significantly disrupt other aspects of psychological development . according to altafas , almost half of obese adults this is in agreement with results of strimas , who found that adhd symptoms are significantly associated with overeating . davis et al . reported that the relationship between adhd and overeating was statistically significant . it was previously described that higher incidence of obesity in adhd patients can be caused by more serious problems with losing weight , due to less self - control in eating . it was mentioned previously that higher prevalence of obesity among children with adhd can also be associated with more serious difficulty in reducing body weight , diet plan compliance , and control of eating . according to the current knowledge and clinical practice , medication by stimulants can cause decreased appetite and cause weight loss . lower percentage of fat , decreased weight , and shorter height were found in medicated children with adhd . therefore , stimulant therapy for adhd may be contraindicated in some under - weight patients , especially those with anorexia nervosa . however , the decreased appetite and weight loss during stimulant medication can be caused just by the moderation of the symptoms of adhd and perhaps impulsivity in eating behavior . finally , an important finding is that children with adhd were breastfed for significantly less time than the children in the control group . several studies suggest that breastfeeding for at least 6 months reduces the risk of later obesity . it is obvious that the short duration of breastfeeding may influence subsequent higher indicators of nutritional status in children with adhd . some authors have even reported that breast - feeding can be a possible environmental risk factor for symptoms of adhd . were these children breastfed for shorter periods because of their behavior ( e.g. , inattention ) or for other reasons that could affect the potential development of some symptoms of adhd ? these are new questions that at present can not be clearly answered and probably will not be answered even many studies later , as in the case of issues related to adhd in general . adhd is a complex disorder ; it is necessary to approach its study with this complexity in mind . the results of the present study point to several significant differences in eating habits and lifestyle in adhd children compared to the control group . these findings offer partial explanation of previously described differences in body weight , fat percentage , and higher occurrence of overweight or even obesity in adhd children . detailed research and analysis that can bring new information about these connections could lead to breakthroughs in treatment and prevention of adhd . | backgroundattention deficit hyperactivity disorder ( adhd ) is a neurological / behavioral disorder characterized by inattention or hyperactivity and impulsivity , or combined symptomatology .
children with adhd are predisposed to irregular and/or impulsive eating patterns often leading to compromised physical condition .
the goal of the present study was to statistically evaluate parental scoring of patterned eating behaviors and associated lifestyles within a cohort of 100 boys diagnosed with adhd in comparison to age - matched male controls.material/methodsthe study population consisted of 100 boys aged 610 years diagnosed with mixed type adhd by dsm - iv criteria and 100 aged - matched healthy male control subjects .
patterns of eating behaviors and associated lifestyles were scored by structured parental interviews using a nominal rating scale.resultsinterview scores indicated statistically significant differences in patterned eating behaviors in subjects with adhd in comparison to healthy controls .
notably , subjects diagnosed with adhd exhibited markedly diminished adherence to a traditional breakfast , lunch , and dinner schedule , which was linked to a significantly higher frequency ( > 5/day ) of irregular eating times . in the adhd cohort , disruptive patterns of eating behaviors were associated with diminished nutritional value of ingested food ( expressed as lowered content of fruits and vegetables ) and increased consumption of sweetened beverages.conclusionsdisruptive patterns of eating behaviors , metabolically unfavorable nutritional status , and diminished physical activities of male children diagnosed with adhd are linked to compromised growth and development and appearance of metabolic diseases in adulthood . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the study design was approved by the ethics committee of iran university of medical sciences . patients with > 6 months of follow - up after the second agv surgery were enrolled . demographic data as well as best - corrected visual acuity ( bcva ) , iop ( measured by calibrated goldmann applanation tonometry ) , slit lamp biomicroscopy , funduscopic findings ( using 78 diopter lens ) , and number of glaucoma medications ( including topical and oral agents preoperatively ) and complications ( if any ) at the preoperative and every postoperative follow - up visits were recorded . the primary outcome measure was surgical success defined in terms of iop control using two criteria : ( 1 ) 5 iop 21 mmhg with at least 20% reduction in iop without glaucoma medication ( complete success ) or with no more than 2 medications ( qualified success ) and ( 2 ) similar to previous criterion with the exception of 16 mmhg being the iop cut - off point . according to criterion 1 , the surgery was classified as failure when iop was < 5 mmhg or more than 21 mmhg and according to criterion 2 , when iop was < 5 mmhg or more than 16 mmhg in at least two consecutive visits 3 months after the surgery . incidence of hypertensive phase ( hp ) , bcva , number of medications , and postoperative complications were analyzed as secondary outcome measures . in this study , hp was defined as iop measurement > 21 mmhg during the first 3 months after surgery not as a result of tube obstruction , retraction , or valve malfunction . in all cases , a single surgeon ( naveed nilforushan ) performed all second operations with a standard technique . a fornix - based conjunctival flap was fashioned in superonasal or inferotemporal quadrant , based on the availability of healthy conjunctiva and preference of the surgeon . mitomycin c ( 0.2 mg / ml ) was then applied by weck - cel sponges under the conjunctiva for 2 min . the agv ( model fp7 , new world medical , rancho cucamonga , ca , usa ) was primed , and its plate was secured to the sclera with 8 - 0 nylon suture , 10 - 11 mm behind the limbus . the anterior part of the tube was secured to the sclera using 10.0 nylon suture and was subsequently covered with donor scleral patch graft . postoperatively , all patients were prescribed ciprofloxacin eye drops 4 times a day for approximately 2 weeks and betamethasone eye drops every 2 h for 2 weeks which was then tapered over the next 68 weeks . patients were examined on the postoperative day 1 , then at least weekly for 4 weeks , and then every 13 months , based on the clinical judgment . iop lowering medications were initiated on discretion of the surgeon when the preset target pressure was not reached . meier survival analysis was used to determine the probability of surgical success based on two criteria . statistical analysis was performed using spss software version 20 for windows ( ibm corp , armonk , new york , usa ) . for analysis , paired t - test and wilcoxon test were used to compare baseline and outcome variables . statistical significance was determined using two - tailed t - test ( p 0.05 ) . in all cases , the first agv had been implanted in superotemporal quadrant . a single surgeon ( naveed nilforushan ) performed all second operations with a standard technique . a fornix - based conjunctival flap was fashioned in superonasal or inferotemporal quadrant , based on the availability of healthy conjunctiva and preference of the surgeon . mitomycin c ( 0.2 mg / ml ) was then applied by weck - cel sponges under the conjunctiva for 2 min . the agv ( model fp7 , new world medical , rancho cucamonga , ca , usa ) was primed , and its plate was secured to the sclera with 8 - 0 nylon suture , 10 - 11 mm behind the limbus . the anterior part of the tube was secured to the sclera using 10.0 nylon suture and was subsequently covered with donor scleral patch graft . postoperatively , all patients were prescribed ciprofloxacin eye drops 4 times a day for approximately 2 weeks and betamethasone eye drops every 2 h for 2 weeks which was then tapered over the next 68 weeks . patients were examined on the postoperative day 1 , then at least weekly for 4 weeks , and then every 13 months , based on the clinical judgment . iop lowering medications were initiated on discretion of the surgeon when the preset target pressure was not reached . kaplan meier survival analysis was used to determine the probability of surgical success based on two criteria . statistical analysis was performed using spss software version 20 for windows ( ibm corp , armonk , new york , usa ) . for analysis , paired t - test and wilcoxon test were used to compare baseline and outcome variables . statistical significance was determined using two - tailed t - test ( p 0.05 ) . thirty - six eyes of 34 patients ( 15 men ) who had undergone the second agv implantation in the same eye with follow - up of at least 6 months were enrolled in this study . the mean age of the patients was 32.7 years ( sd 18.7 , range 465 ) , and the mean duration of follow - up was 21.4 months ( sd 21.7 , median 12 , range 696 ) . the time interval between the first and second agv implantation was on average 4.05 years ( range 110 ) . preoperatively , the mean iop was 26.94 mmhg ( sd 7.03 ) , and the patients were using 2.8 glaucoma medications on average ( sd 0.9 ) . the mean iop and number of medications decreased significantly to 13.28 mmhg ( sd 3.59 ) and 1.4 ( sd 1.1 ) at the last postoperative visit , respectively ( p = 0.00 in both ) . tonometric failure detected at last follow - up was occurred in 9 ( 25% ) and 11 ( 30% ) eyes according to criteria 1 and 2 , respectively [ table 2 ] . however , with regard to incomplete follow - up for many of the individuals in this study , kaplan meier approach was utilized to estimate the cumulative incidence of surgical failure [ figs . 2 and 3 ] . according to criterion 1 , 6 , 12 , 18 , and 42 months success rate ( 95% confidence intervals ) was 94% ( 87 , 100 ) , 85% ( 72 , 99 ) , 80% ( 63 , 96 ) , and 53% ( 21 , 85 ) , respectively . median time to failure was 60 ( 26 , 94 ) months . according to criterion 2 , 6 , 12 , 18 , and 42 months success ( 95% confidence intervals ) was 94% ( 87 , 100 ) , 85% ( 72 , 99 ) , 75% ( 57 , 93 ) , and 45% ( 16 , 75 ) , respectively . success at last follow - up based on criterion 1 and 2 ( n=36 ) intraocular pressure changes during the postoperative 3-year period . + p values on the basis of comparison with preoperative values using paired t - test , # p values on the basis of comparison with preoperative values using wilcoxon test . agm : the number of antiglaucoma medication ; iop : intraocular pressure success of the second ahmad glaucoma valve in refractory glaucoma based on criterion 1 . meier analysis , where the dotted lines indicate the 95% confidence intervals and the hatch marks indicate censored subjects ( eyes ) . the 6 , 12 , 18 , and 42 months success ( 95% confidence intervals ) was 94% ( 87 , 100 ) , 85% ( 72 , 99 ) , 80% ( 63 , 96 ) , and 53% ( 21 , 85 ) , respectively . median time to failure was 60 ( 26 , 94 ) months success of second ahmad glaucoma valve in refractory glaucoma based on criterion 2 . success was calculated using kaplan meier life table analysis , where the dotted lines indicate the 95% confidence intervals and the hatch marks indicate censored subjects ( eyes ) . the 6 , 12 , 18 , and 42 months success ( 95% confidence intervals ) was 94% ( 87 , 100 ) , 85% ( 72 , 99 ) , 75% ( 57 , 93 ) , and 45% ( 16 , 75 ) , respectively . median time to failure was 42 ( 14 , 70 ) months the right eye of a patient with the second ahmed glaucoma valve implantation in superonasal quadrant of the conjunctiva . the first ahmed glaucoma valve was implanted in superotemporal quadrant no significant intraoperative complication was determined and also , there was no case of endophthalmitis , or retinal detachment postoperatively . in addition , three patients underwent needling of the encapsulated bleb around the plate ( one with adjunctive mitomycin c ) 310 weeks after surgery . . it did not change significantly 6 months postoperatively ( 0.94 , p = 0.19 ) and at the last visit ( 0.93 , p = 0.18 ) . hp was detected in 22 patients ( 61.11% ) during the first 3 months of surgery for whom iop - lowering medication was started . in 13 cases ( 59.09% ) , hp occurred within 1 month after surgery ( 4 of them in the first 2 weeks ) . we also divided the patients to those with preoperative iop 21 mmhg and preoperative iop > 21 mmhg for comparison . this showed that out of 30 eyes with preoperative iop > 21 mmhg , according to criteria 1 and 2 , 7 ( 23% ) and 9 ( 30% ) eyes were failed , respectively . moreover , out of 6 eyes with preoperative iop 21 , 2 ( 33% ) eyes were failed according to both criteria . no significant difference was found between subgroups with preoperative iop 21 and preoperative iop > 21 mmhg ( p > 0.99 , fisher exact test ) . of 11 cases with failure according to criterion 2 , in three cases , medical treatment was continued ; in two cases , cyclophotocoagulation was performed ; and in the rest , we did not have further follow - up records to report herein . mean iop at final exam was 13.28 mmhg , a reduction of 13.66 mm hg or 50% from preoperative values even though patients were on fewer glaucoma medications . no major complication occurred and the mean best corrected visual acuity did not show a statistically significant reduction . during the last decade , several studies have addressed the success rate of various secondary shunt implantation such as agv , molteno , baerveldt , krupin and schocket in adults , and children [ table 3 ] with reported success rates of 50 - 93% . but a comparison of the overall success rate in these case series is not literally feasible not only because of different mix of glaucoma types studied , various lengths of follow - up and different definitions of surgical success ; but even more notably because these studies are all relatively small in sample size and consequently a relatively wide confidence interval straddles their point estimates of surgical success . evaluated patients who had undergone 2 glaucoma drainage device surgeries ( exclusively agv ) in a retrospective case series and found 84.2% overall success ( comparable with success definition of our study according to criterion 1 ) in a follow - up of at least 1 year . the reported success rate was apparently more than that of the present study ( 75% ) . this difference may be accounted for by longer follow up in the present study ( up to 96 months ) in comparison with smith 's study ( up to 80 months ) . surgical results of secondary shunt implantation in eyes with failed prior shunts in our study age , gender , laterality of studied eyes , preoperative iops , preoperative number of medications and glaucoma type of individual patients did not differ significantly between success and failure groups of patients ( results of t - test and fisher 's exact test not shown here ) . 21 participants showed that patients with preoperative iop 21 mm hg benefited more from second agv implantation than those with lower iops but in our study we did not found a significant difference in this regard . hp in this study occurred in relatively similar rates as reported in the literature ( 59.4 % at first 3 month after surgery ) that is close to the findings of smith et al . with the rate of 61% . wu sc et al . reported occurrence of hp in 63.2% of their patients , 49.3% of them experienced hp at 1 month and the rest at 2 months after the operation . it occurred after a mean of 5.0 weeks ( median , 4 weeks ; range , 1 - 13 weeks ) . besides the retrospective and noncomparative design of this study and including nonuniform types of glaucoma , the other limitation of the present study is a relatively small sample of patients for analyzing the success rate after 3 years post - agv re - implantation . although the wide confidence interval for measured success rate after 3 years of the surgery makes it difficult to predict the long - term prognosis , a practical conclusion can be extracted from the present body of evidence , i.e. , until a better option emerges , glaucoma specialists can offer secondary shunt implantation instead of cyclodestructive procedures to patients with failed primary shunts with a considerable hope of tonometric success with or without medications . repeated agv implantation seems to be a safe modality of treatment with acceptable success rate in cases of failed previous agv surgery . | purpose : to evaluate the outcome of the second ahmed glaucoma valve ( agv ) surgery in eyes with failed previous agv surgery.design:retrospective case series.patients and methods : following chart review , 36 eyes of 34 patients with second agv implantation were enrolled in this study .
the primary outcome measure was surgical success defined in terms of intraocular pressure ( iop ) control using two criteria : success was defined as iop 21 mmhg ( criterion 1 ) and iop 16 mmhg ( criterion 2 ) , with at least 20% reduction in iop , either with no medication ( complete success ) or with no more than two medications ( qualified success ) .
kaplan
meier survival analysis was used to determine the probability of surgical success.results:the average age of the patients was 32.7 years ( range 465 ) , and the mean duration of follow - up was 21.4 months ( range 696 ) .
preoperatively , the mean iop was 26.94 mmhg ( standard deviation [ sd ] 7.03 ) , and the patients were using 2.8 glaucoma medications on average ( sd 0.9 ) .
the mean iop decreased significantly to 13.28 mmhg ( sd 3.59 ) at the last postoperative visit ( p = 0.00 ) while the patients needed even fewer glaucoma medications on average ( 1.4 1.1 , p = 0.00 ) .
surgical success of second glaucoma drainage devices ( kaplan meier analysis ) , according to criterion 1 , at 6 , 12 , 18 , and 42 months was 94% , 85% , 80% , and 53% respectively , and according to criterion 2 , was 94% , 85% , 75% , and 45% , respectively.conclusion:repeated agv implantation seems to be a safe modality of treatment with acceptable success rate in cases with failed previous agv surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
antenatal care relates to the care of women during pregnancy with an ultimate target to achieve a healthy mother and a healthy child at the end of pregnancy . however , antenatal care encompasses not only clinical examinations / laboratory investigations but also the mental conditioning of the women before arrival of the child . in fact , adequate time and opportunity should be given to pregnant women to clear all the fears , myths , and misconceptions associated with pregnancy or delivery . worldwide , depression has been acknowledged as one of the major public health problems that is almost twice as common in women during the childbearing age than in men , and is expected to become the second most prevalent of all general health problems globally by the year 2020 . depression is widely prevalent among women in the child - bearing age , especially during the antenatal and postnatal period . in fact , different studies done across variable settings have reflected presence of antenatal and postnatal depression among both women and their husbands . however , these estimates do not reveal the exact picture , as most of the cases remain undiagnosed / unreported due to the absence of international agreement on screening . this depression deserves more attention as this period is a time of intense change ( viz . physiologically / appearance - wise / socially / mentally ) and transition for women , that essentially necessitates adaptation and family support . generally , the postpartum period is a time for the occurrence of anxious and depressive events ( viz . fatigue , anxiety , disordered sleeping , changing mood , irritability , feelings of loss and sadness , and sometimes even loss of self - esteem ) . globally , post - partum depression has been reported in almost 10% to 20% of mothers , and it can start from the moment of birth , or may result from depression evolving continuously since pregnancy . thus , screening of pregnant females has been recommended using different predictive tools to facilitate early detection of depression . however , while planning corrective strategies there is a need to develop strategies based on the local settings ( viz . in developing countries , most of the deliveries are conducted at home without much antenatal care , while in developed nations where antenatal checkup and care is the routine norm ) . a wide range of potential risk factors ranging from socio - demographic parameters , family dynamics , antenatal determinants , medical illness and pregnancy related outcomes , and health sector related attributes have been attributed to the causation of depression among women as mentioned in table 1 . similarly , parameters such as suicidal ideation among mothers ; unemployment status ; fewer biological children ; poor marital relationship quality ; first - time parenting ; lack of awareness about postnatal depression ; lack of social support or a limited circle of friends ; and concurrent stressful life events ; have been identified in precipitating depression among husbands . potential risk factors for causation of antenatal / postnatal depression on analysis of all the determinants , the most important contributor in causation of antenatal / postnatal depression is because of the absence of family support . presence of a healthy and supportive family environment , especially support from the husband can virtually neutralize all the triggering factors . however , the share of inefficient health care delivery system is also extremely crucial especially in low - resource settings . the presence of depression among women has gained a lot of attention not only because of the rising incidence or worldwide distribution , but also because of the serious negative impact on personal , family and child developmental outcomes . from the child 's perspective , parental depression has shown a negative impact on cognition , emotional and physical development of the infant and behavioral disturbances . as far as mothers are concerned , onset of depression tends to affect the quality of the relationship with the spouse and on other social relationships ; brings about an alteration in the manner in which mother takes care of the baby ; negatively influence the quality of life ; prevents mother from resuming her job and thus affects the economic productivity of women and family . in fact , depression during antenatal / postnatal period even influences the men in their ways of fathering ( viz . feeling that partner 's depression led to significant physical and/or psychological maternal absence as well as a fracturing of the family unit ) . furthermore , antenatal depression has also been associated with pre - term onset of labor , risk of preterm birth , low birth weight , and intrauterine growth restriction . avon longitudinal study of parents and children ) revealed that prenatal depression is an important determinant of the childhood conduct problems , suicidal ideation in the kids , and early onset of adult depression . in an another mother - child cohort study impact of maternal antenatal conditions on reproductive outcomes , infant and child neurodevelopment and behavior , child development , and postnatal depression of the mothers , has been explored . similar sort of impact on child neurodevelopment has been observed in another mother and child cohort study . although multiple gaps have been identified in the existing health set - up / policies , however the most cost - effective and easily implementable intervention will be improving the quality of services offered to an antenatal mother during her pregnancy and in her postnatal period . this does not require any major pooling of resources and can be delivered to the women / family members without bringing about any major health reform . in fact , the physician / attending health care professionals can actively screen mothers / fathers for their stressors , guide them to deal with the stress of pregnancy ( viz . ensuring support of family members , medication , removal of triggering factors ) , and even extend referral services , if needed . furthermore , it has been recommended that medical practitioners should have a high index of suspicion , and assess the mother for the presence of depression during their health center visits . indirectly , to maximize the output of services in the antenatal period there is a need of sensitizing health care professionals regarding the need to facilitate early detection of depression ; addressing communication skills of the physicians ; motivating health staffs to understand the familial dynamics ; and ensuring involvement of husband during antenatal and postnatal period . the next most important intervention can be to design a comprehensive public health policy ( including a mental health strategy ) , to ensure that universal psychosocial assessment in perinatal women is undertaken within the primary health care system . in addition , acknowledging the importance of maternal depression on different aspects - personal , child , and familial life , implementation of other interventions such as analysis of women 's needs prior to formulation of policies ; promoting rationale use of predictive tools during antenatal period to facilitate early detection ; extending psychosocial and psychological support ; promoting adoption of antenatal emotional self - management training programs / group cognitive behavior therapy ; encouraging women for dietary supplements / exercise ; and conducting online cognitive behavior training programs for mothers who are reluctant to approach health centers ; can also be planned in a strategic manner to counter the problem of depression during antenatal / postnatal period . depression is widely prevalent among women in the child - bearing age , especially during the antenatal and postnatal period . in fact , different studies done across variable settings have reflected presence of antenatal and postnatal depression among both women and their husbands . however , these estimates do not reveal the exact picture , as most of the cases remain undiagnosed / unreported due to the absence of international agreement on screening . this depression deserves more attention as this period is a time of intense change ( viz . physiologically / appearance - wise / socially / mentally ) and transition for women , that essentially necessitates adaptation and family support . generally , the postpartum period is a time for the occurrence of anxious and depressive events ( viz . fatigue , anxiety , disordered sleeping , changing mood , irritability , feelings of loss and sadness , and sometimes even loss of self - esteem ) . globally , post - partum depression has been reported in almost 10% to 20% of mothers , and it can start from the moment of birth , or may result from depression evolving continuously since pregnancy . thus , screening of pregnant females has been recommended using different predictive tools to facilitate early detection of depression . however , while planning corrective strategies there is a need to develop strategies based on the local settings ( viz . in developing countries , most of the deliveries are conducted at home without much antenatal care , while in developed nations where antenatal checkup and care is the routine norm ) . a wide range of potential risk factors ranging from socio - demographic parameters , family dynamics , antenatal determinants , medical illness and pregnancy related outcomes , and health sector related attributes have been attributed to the causation of depression among women as mentioned in table 1 . similarly , parameters such as suicidal ideation among mothers ; unemployment status ; fewer biological children ; poor marital relationship quality ; first - time parenting ; lack of awareness about postnatal depression ; lack of social support or a limited circle of friends ; and concurrent stressful life events ; have been identified in precipitating depression among husbands . potential risk factors for causation of antenatal / postnatal depression on analysis of all the determinants , the most important contributor in causation of antenatal / postnatal depression is because of the absence of family support . presence of a healthy and supportive family environment , especially support from the husband can virtually neutralize all the triggering factors . however , the share of inefficient health care delivery system is also extremely crucial especially in low - resource settings . the presence of depression among women has gained a lot of attention not only because of the rising incidence or worldwide distribution , but also because of the serious negative impact on personal , family and child developmental outcomes . from the child 's perspective , parental depression has shown a negative impact on cognition , emotional and physical development of the infant and behavioral disturbances . as far as mothers are concerned , onset of depression tends to affect the quality of the relationship with the spouse and on other social relationships ; brings about an alteration in the manner in which mother takes care of the baby ; negatively influence the quality of life ; prevents mother from resuming her job and thus affects the economic productivity of women and family . in fact , depression during antenatal / postnatal period even influences the men in their ways of fathering ( viz . feeling that partner 's depression led to significant physical and/or psychological maternal absence as well as a fracturing of the family unit ) . furthermore , antenatal depression has also been associated with pre - term onset of labor , risk of preterm birth , low birth weight , and intrauterine growth restriction . avon longitudinal study of parents and children ) revealed that prenatal depression is an important determinant of the childhood conduct problems , suicidal ideation in the kids , and early onset of adult depression . in an another mother - child cohort study impact of maternal antenatal conditions on reproductive outcomes , infant and child neurodevelopment and behavior , child development , and postnatal depression of the mothers , has been explored . similar sort of impact on child neurodevelopment has been observed in another mother and child cohort study . although multiple gaps have been identified in the existing health set - up / policies , however the most cost - effective and easily implementable intervention will be improving the quality of services offered to an antenatal mother during her pregnancy and in her postnatal period . this does not require any major pooling of resources and can be delivered to the women / family members without bringing about any major health reform . in fact , the physician / attending health care professionals can actively screen mothers / fathers for their stressors , guide them to deal with the stress of pregnancy ( viz . ensuring support of family members , medication , removal of triggering factors ) , and even extend referral services , if needed . furthermore , it has been recommended that medical practitioners should have a high index of suspicion , and assess the mother for the presence of depression during their health center visits . indirectly , to maximize the output of services in the antenatal period there is a need of sensitizing health care professionals regarding the need to facilitate early detection of depression ; addressing communication skills of the physicians ; motivating health staffs to understand the familial dynamics ; and ensuring involvement of husband during antenatal and postnatal period . the next most important intervention can be to design a comprehensive public health policy ( including a mental health strategy ) , to ensure that universal psychosocial assessment in perinatal women is undertaken within the primary health care system . in addition , acknowledging the importance of maternal depression on different aspects - personal , child , and familial life , implementation of other interventions such as analysis of women 's needs prior to formulation of policies ; promoting rationale use of predictive tools during antenatal period to facilitate early detection ; extending psychosocial and psychological support ; promoting adoption of antenatal emotional self - management training programs / group cognitive behavior therapy ; encouraging women for dietary supplements / exercise ; and conducting online cognitive behavior training programs for mothers who are reluctant to approach health centers ; can also be planned in a strategic manner to counter the problem of depression during antenatal / postnatal period . to conclude , depression during pregnancy and in the postnatal period is a serious public health issue , which essentially requires continuous health sector support to eventually benefit not only the woman , but also the family , the community , and health care professionals . | depression is widely prevalent among women in the child - bearing age , especially during the antenatal and postnatal period .
globally , post - partum depression has been reported in almost 10% to 20% of mothers , and it can start from the moment of birth , or may result from depression evolving continuously since pregnancy . the presence of depression among women has gained a lot of attention not only because of the rising incidence or worldwide distribution , but also because of the serious negative impact on personal , family and child developmental outcomes . realizing the importance of maternal depression on different aspects - personal , child , and familial life , there is a crucial need to design a comprehensive public health policy ( including a mental health strategy ) , to ensure that universal psychosocial assessment in perinatal women is undertaken within the primary health care system . to conclude , depression during pregnancy and in the postnatal period is a serious public health issue , which essentially requires continuous health sector support to eventually benefit not only the woman , but also the family , the community , and health care professionals . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
five to ten percent of asthma patients have in spite of relevant treatment severe asthma with chronic inflammation causing airway remodelling and persistent loss of lung function . the gina guidelines recommended a stepwise treatment approach , which at step 4 includes short - acting beta - agonist ( saba ) , inhaled glucocorticosteroids ( ics ) in combination with long - acting inhaled beta2-agonist ( laba ) , as well as oral theophyllin . however , in severe cases with poor controlled asthma , although maximally treated , additional treatment with oral glucocorticosteroids ( ocs ) is needed , even though side effects of long - term treatment are health damaging . although , the gina guidelines try to be covering the entire field , some suggest that it might be to superficial and not cover all possibilities . thus different types of immunosuppressive drugs have been tested [ 5 , 6 ] in order to gain disease control severe persistent asthma . the commonly used immunomodulatory therapy is primary azathioprine ( atz ) or methotraxate ( mtx ) ; however in dermatology they have shifted from these drugs to other therapeutic possibilities with a more acceptable profile with fewer side effects . one of these are mycophenolat mofetil ( mmf ) , and this drug could also be a possible drug of choice in asthma treatment as mmf has several immunosuppressant actions in animal models and in in vitro trials : it inhibits the proliferation of t- and b - lymphocytes , increases apoptosis in t - lymphocytes , inhibits initiation of and suppresses ongoing immunoglobulin production , interferes with the maturation process of dendritic cells , inhibits the adhesion and penetration of monocytes and t - lymphocytes by the inflammatory site , and inhibits the inducible nitric oxide ( inos ) . it is believed that t - lymphocytes play an important role in asthma and that t - lymphocytes resistant to corticosteroids can be suppressed by other immunosuppressive agents , for example , by mmf [ 7 , 8 ] . furthermore , mmf is also expected to decrease the production of the inflammatory promoters tnf alpha and interleukin 1 [ 9 , 10 ] . besides the immunosuppressive mechanisms , mmf seems to have an antiproliferative effect , for example , on the smooth muscle cells , endothelial cells , and fibroblasts , which could help preventing the airway remodelling of severe asthma . so far mmf has mostly been used for prevention of acute and chronic allograft rejection , but indications such as diabetic nephropathy ( animal trials ) , lupus nephritis ( human trials ) , rheumatoid arthritis ( human trials ) , ocular inflammation ( human trials ) , myasthenia gravis ( human trials ) , several skin diseases ( human trials ) , and cytomegalovirus infections ( human trials ) have been suggested [ 911 ] . lastly , two studies have shown that mmf is able to suppress inflammatory activity in leukocyte cultures from asthma patients [ 7 , 8 ] and seems to be relatively safe , the main adverse events being gastrointestinal inconvenience and mild reversible bone - marrow suppression [ 811 ] . however , little is known about the long - term effects and side effects . a 54-year - old woman , known with asthma for ten years , was referred to a department of respiratory medicine because of severe asthma , which was difficult to treat . she had no allergies , had two family members with severe asthma , and worked as an office assistant with no work - related toxic exposure . her asthma had been difficult to control in spite of relevant treatment , she had had five oral courses of glucocorticosteroid within the last six months prior to referral to the university hospital , and she had been on a part - time sick leave for approximately six months prior to referral . she had gained in weight over a ten - year period from 59 kg to 110 kg . her fev1 had varied between 1.4 l ( 53% ) and 1.7 l ( 64% ) in the last six months at her gp . her daily treatment included ics ( budesonid 640 g ) , laba , short acting anticholinergica , and saba 812 times daily , when needed . basic evaluations were performed , such as chest x - ray , electrocardiogram , echocardiography , alpha1-antitrypsine , and allergy tests which all were normal . the computer tomography ( ct ) scan showed discreet lung emphysema , indicating hyperinflation . her lung function was measured , and fev1 increased from 1.35 l ( 50% ) to 1.85 ( 70% ) after four puffs of beta2-agonist ; the post bronchodilator fvc was 2.57 ( 81% ) and fev1/fvc ratio was 92% . initially , her ics dose was changed to mometason furoat ( 800 g ) combined with laba twice daily and theophyllin ( 300 mg ) as well as long - acting muscarine antagonist ( lama ) was added . after two months of follow - up at the out - patient clinic her lung function had further deteriorated as fev1 was 1.22 ( 46% ) and one month later as low as 0.96 l ( 36% ) . due to the further deterioration in lung function , her treatment with ics was switch back to budesonide as well as increased in dosis and oral corticosteroid was added . after four months of unsuccessful asthma treatment azathioprine ( 100 mg ) was added but after two months of treatment it was withdrawn again due to intolerable adverse events ( nausea , vomiting , diarrhoea ) and furthermore , lack of effect on the asthmatic disease . the ocs dose was during this period fluctuating between 25 mg and 12.5 mg daily . after six months of follow - up , on high doses of ics , continued doses of ocs , theophyllin , lama , laba , saba , and nebulised saba when needed still without having controlled her asthma we decided to start her on another immunosuppressive treatment and we wanted to explore the effect of mmf treatment . prior to mmf treatment the patient had a fiberoptic bronchoscopia performed with mucosa biopsies and bronchial lavage , she had her eno and lung function measured , and blood samples taken including blood cell count , eosinophilic chemotacktic protein ( ecp ) , and alpha-1-antitrypsine , all of them were close to normal . on oral corticosteroid treatment , the bronchial mucosal biopsies were normal , apart from mild oedemas , and the lavage fluid showed few neutrophiles but no eosinophiles . all other blood samples were normal , and eno was not increased . a dose of 500 mg mmf was initiated . within the first week the patient 's fev1 rose from 1.38 ( 52% ) to 2.03 ( 76% ) in spite of a decreased ocs dose to 15 mg daily . her peak flow increased from 284 ( 73% ) to 417 ( 107% ) , her symptoms diminished , her night time symptoms disappeared , and she had less need of saba . mmf was further increased to 1000 mg bid , and ocs was kept on 15 mg daily . since the beginning of mmf treatment she has experienced better asthma control . she has during the last year had one exacerbation with pulmonary infection , high fever , and deterioration in lung function , after which her mmf doses were reduced to 750 mg bid . but in general , her asthma is now well controlled , with few asthma symptoms and hardly any use of extra saba . her fev1 has been unchanged ( 60%70% ) , pef has stabilised on 400 l / sec , very few extra puffs of saba are needed , and her systemic steroid has been kept on 5 mg , and mmf on 750 mg bid . since the start of mmf and the reduction in ocs , she has lost 20 kg in weight and have takenup her work at 50% or more . she is having few , if any , seek leave days from work due to asthma and she have started physical rehabilitation . this case shows an example of severe nonatopic asthma , which was difficult to control with conventional therapy due to treatment failure and adverse events . drugs such as tacrolismus , azathioprin , methrotraxat , cyclosporine , and mmf are all immunosuppressive agents that have been suggested for the treatment of severe refractory asthma , but none of them have been tested for this purpose . we decided to explore the effect of mmf because it at least in theory furthermore , a substantial shift to mmf in dermatology , when treating severe uncontrolled atopic eczema in adults , has occurred . uncontrolled asthma could besides being difficult to treat , be caused by low adherence to the antiasthmatic treatment . adherence is a big issue in asthma treatment , as it is well known at least in the adolescents , and the young adults are having an adherence rate of 40%70% . however the present patient had gain almost 60 kg in weight during a period of 10 years and repetitive steroid courses . furthermore , she has deterioration in lung function and was threaded of losing her job , and her family was anxious of her severe exacerbations twice a month . although we never in clinical practise in adult outpatients clinics count the use of inhaled steroid puffs , we do believe that she was rather adherent . in this patient , we saw an immediate effect of mmf with a decrease in subjective symptoms and saba requirement as well as a substantial rise in fev1 . the basic pathology in asthma behind this immediate effect is unknown , but knowledge from the use of mmf in preventing graft rejection supports a quick onset of action of the drug but it is difficult to predict exactly which of the anti - inflammatory mechanisms is responsible for this . we can not explain this immediate effect , and although the mechanism behind this is unknown , it has been a stable improvement with fewer and minor exacerbation than prior to mmf . furthermore , on a longer term , the drug was able to stabilize the patients ' asthma on a substantially reduced dose of ocs , followed by a weight reduction of 20 kg , with only one exacerbation during the year of follow - up , and there have been no detectable adverse events . since this observation is based on only one case study , it is possible that the improvement after initiating mmf is due to an effect of frequent visit and personal caretaking or a regression towards the mean . it is also possible that an increase in compliance could have played a part in the variations of her lung function and symptoms , although this patient was followed closely during the entire followup period , had a good inhalation technique , and was motivated to follow the different treatment changes from the start . furthermore , azathioprine did not show the same effect but caused adverse events in this patient . on the other hand , during the entire period of mmf treatment there had been no gastrointestinal side effects , and furthermore no signs of bone - marrow depression . when the mmf treatment was initiated in this patient this can be explained by her constant ocs treatment , which probably partly suppressed the inflammation but could also be that this patient had a neutrophilic asthma which probably would show a lower level of eno . from this case , no predictions regarding the long - term effects or side effects of mmf , the glucocorticosteroid - sparing ability , can be made . nevertheless , since the theory supports specific effect of mmf , this case indicates an effect of the drug , and due to a great need for alternative treatments , it seems interesting to examine the use of mmf for severe refractory asthma further clinical studies and basic cellular trials . | background . some patients with severe nonallergic asthma can be difficult to treat with conventional therapy .
mycophenolat mofetil ( mmf ) is an immunosuppressive drug with multiple mechanisms .
there is theoretical support of specific effect of mmf on severe asthma , in difficult to treat patients .
the aim of the present case was to explore whether mmf had an effect in one case of severe refractory asthma . the patient .
this case deals with one patient with very severe nonallergic treatment refractory asthma who experienced treatment failure on ordinary antiasthmatic treatment and severe adverse events to conventional immunosupressive treatment .
she was then treated with mmf .
results .
the patient experienced a gain in fev1 and a reduction in the need for oral glucocorticosteroids as well as seldom need of when needed bronchodilator both during daytime and night .
it therefore seems very interesting to examine the use of mmf for severe refractory asthma with further clinical studies and basic cellular trials . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
behet 's disease ( bd ) was first described by behet in 1937 as a chronic recurrent disease characterized by recurrent oral ulceration , genital ulceration and ocular involvement1 ) , additional involvement of many other organs has been reported including : joints , skin , blood vessels , the nervous system and gastrointestinal tract2 ) . reports on invasion into the gastrointestinal tract vary depending on country , however , it has been reported to be present in three to 60% of bd patients3 ) . for these patients , medical treatment is the primary approach to therapy , however , additional surgical treatment is necessary for cases with complications such as , perforation , intractable pain and hemorrhage . however , lesions frequently recur after surgical treatment and the incidence of more than one surgical procedure is high ; such cases may be untreatable and lead to death . recently , cases of bd with gastrointestinal involvement have been treated with tumor necrosis factor alpha ( tnf- ) antibody ( infliximab)4 , 5 ) , however , there is no prior case of such treatment reported in korea . we treated a patient with recurrent intestinal ulcer who underwent right hemicolectomy due to uncontrolled intestinal bleeding with infliximab . a 47 years old male patient was admitted to the hospital due to severe abdominal pain for five days . the past medical history was significant for recurrent oral and genital ulceration over the past 20 years . he underwent right hemicolectomy due to uncontrolled intestinal bleeding caused by intestinal behet 's ulceration 10 years previously . subsequently , he was treated by conventional medical therapy including corticosteroids , sulfasalazine and azathioprine . however , intestinal behet 's ulceration recurred at the anastomosis site and the patient required several subsequent hospitalizations due to repeated abdominal pain and intestinal bleeding . the physical examination showed an acutely ill patient with a blood pressure of 120/70 mmhg , a pulse rate of 94 times / min , a respiratory rate of 24 times / min and a temperature of 38.5. the abdomen was flat with mild tenderness ; the bowel sounds were normal . the laboratory test results showed a white blood cell count , 540/mm ; hemoglobin , 7.2 g / dl ; hematocrit , 28% ; platelet count , 47,000/mm ; total protein , 5.7 g / dl ; and erythrocyte sedimentation rate ( esr ) was increased to 60 mm / h and c - reactive protein ( crp ) was increased to 70 mg / l . the crohn 's disease activity index ( cdai)6 ) at the time of admission was 183 and the harvey - bradshaw index ( hbi)7 ) was 10 . the computed tomography showed a suspicious large deep ulcer with bowel wall thickening at the right hemicolectomy site but no obstruction or fistula was observed ( figure 1 ) . a colonoscopy showed the right hemicolectomy and a well demarcated large deep ulcer with a clear ulcer bed at the stomal site ( figure 2 ) . colonic biopsies showed ulceration with necrotic fibrin debris , an inflammatory infiltrate with neutrophils predominating but no granuloma ( figure 3 ) . because of the uncontrolled continuous abdominal pain , infliximab ( 5 mg / kg ) was started . there were no observed side effects from the infliximab ; two weeks after the treatment was started , the symptoms improved dramatically . after one month , the laboratory testing showed a white blood cell count , 4,470/mm ; hemoglobin , 12.3 g / dl ; hematocrit , 36.8% and a platelet count , 168,000/mm . the esr and crp were decreased to 11 mm / h and 6.7 mg / l , respectively and the cdai and hbi were decreased to 88 and 2 , respectively . follow up colonoscopy showed a well demarcated marginal ulcer with granulation tissue at the stomal site , however , the ulcer size was decreased compared to the prior study ( figure 4 ) . a second infliximab ( 5 mg / kg ) treatment was administered one month after the first . the symptoms continued to improve and the abdominal pain resolved completely four months after the second injection of infliximab . the crp and esr were maintained in the normal range and the value of cdai and hbi continued to decrease . when intestinal ulceration occurs in patients with bd it is found predominately in the ileocecal region , however , ulcers may be found throughout the entire colon . colonoscopy findings usually show deep punched out ulcerations with nodular margins and converging folds ; the histological findings show a non specific inflammation . intestinal bd may be associated with a significant morbidity and mortality which results from the high complication rate8 , 9 ) . although the exact pathogenesis of bd is not completely understood , it has been suggested that the disease is due to an abnormal immune response to environmental factors such as microbial agents in genetically susceptible individuals10 ) . the presence of autoantibodies , a decrease in the t4/t8 ratio and an increased number of circulating natural killer cells and + t cells also suggest an autoimmune etiology of disease10 , 11 ) . in patients with active bd an increase of tnf in the blood and an increase of + t cells producing tnf have been observed12 ) . improvement of symptoms has been reported after the administration of tnf blockers in patients unresponsive to conventional therapy13 ) . therefore , tnf has been considered to play an important role in the inflammation observed in bd patients and this may account for the response to infliximab . conventional medical therapeutic options include : corticosteroids , mesalamine , thalidomide , bowel rest , total parenteral nutrition and immunosuppressive agents such as azathioprine2 ) . however , surgery is generally required due to resistance to medications , frequent recurrence of lesions and complications such as intestinal perforation and fistula formation . according to cha et al.14 ) , the rate of surgery over five years has been reported to be approximately 47% . recurrent ulcers after surgery are commonly found near the anastomosis site , as in this case ; the ulcers appear as deep multiple aphthous ulcers or as cutaneous intestinal fistula . when these ulcers are present , the recurrence rate has been reported to be as high as 40~80%15 ) . in our case , 10 years prior to the admission , the patient meet the criteria for the diagnosis of bd recommended by international study group for behet 's disease16 ) . based on repeated oral and genital ulceration as well as a positive pathergy test , severe abdominal pain and uncontrolled intestinal bleeding , the patient was diagnosed with intestinal bd and underwent a right hemicolectomy . despite conventional medical treatment , he had recurrent intestinal ulceration and intractable abdominal pain , therefore , another treatment modality was required . infliximab has been effective for induction and maintenance treatment in patients with bd and has been particularly successful for treatment of cases with severe mucocutaneous17 ) , gastrointestinal4 , 5 ) and ocular18 ) manifestations of bd . for patients with intestinal bd , in cases treated with infliximab , the standard dose of infliximab has not yet been established , however , treatment according to the dose and protocol used for crohn 's disease5 ) or based on the symptoms of the patient4 , 19 ) have been reported . the disease activity of the patient was evaluated before and after treatment , the cdai and hbi were used for behet 's disease because there is no activity index established to date . in our case , infliximab ( 5 mg / kg ) was administered at 0 and 4 weeks and symptomatic complete remission was observed at the 12 month follow up , in addition , endoscopic improvement was also observed . this case illustrates that for patients with bd who fail to respond to conventional treatment , infliximab may be a safe and effective new therapeutic option . | behet 's disease ( bd ) is a chronic relapsing multisystem disease characterized by oral ulceration , genital ulceration and ocular lesions .
gastrointestinal involvement is rare , often difficult to treat and associated with a high mortality rate .
we treated a 47-year - old korean man with bd who had a recurrent intestinal ulcer with tumor necrosis factor antibody ( infliximab ) ; he initially underwent right hemicolectomy due to uncontrolled intestinal bleeding . for patients with intestinal bd who fail to respond to conventional treatment
, infliximab may be a safe and effective new therapeutic option . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an estimated 9 million people developed tb worldwide , and 1.5 million patients died from the disease . in japan in 2013 , the incidence of tb per 100,000 people was 18 ( http://www.who.int/tb/country/data/profiles/en/ ) . a combination of four anti - tb agents isoniazid ( inh ) , rifampicin , pyrazinamide , and ethambutol has been recommended as the best treatment regimen for patients with tb . however , drug - induced liver injury ( dili ) is one of the most common adverse drug reactions in patients receiving anti - tb treatment . however , the treatment must be restarted , leading to a high prevalence of reoccurrence of dili and a longer course of anti - tb therapy ( > 6 months ) . therefore , the frequent occurrence of dili may affect the continuation of anti - tb agent administration that leads to delayed completion or failure of the treatment . inh is primarily metabolized to n - acetyl inh by hepatic n - acetyltransferase 2 ( nat2 ) . hydrazine , which is generated from inh , is believed to be the cause of hepatotoxicity . because nat2 also metabolizes hydrazine to n - acetyl hydrazine , tb patients with decreased nat2 activity show higher levels of hydrazine in their blood and are at a higher risk of developing dili . these adverse effects on the liver in tb patients are usually accompanied by hospitalization and adjustment of the anti - tb regimen that is usually less effective and requires a longer treatment duration than the standard short treatment course for tb . underlying differences in nat2 enzyme activity have been explained by haplotypes composed of several single - nucleotide polymorphisms ( snps ) in the coding region of exon 2 of the nat2 gene . patients are classified into rapid , intermediate , and slow acetylators based on the codominant expression of the rapid and slow acetylator alleles . intermediate acetylators carry the nat2 * 4/*5b , * 4/*6a , or * 4/*7b diplotypes , whereas slow acetylators are individuals who do not carry either of the rapid acetylator alleles ( nat2 * 4 or nat2 * 13 ) . although several recent case control association studies in japanese tb patients have reported that nat2 slow acetylators have a significantly higher risk of dili caused by anti - tb drugs compared with nat2 rapid and intermediate acetylators , the true - positive rates were < 33% when the nat2 genotypes were used as biomarkers to predict the risk of dili . in this study , the genetic and clinical data from 366 japanese patients with tb ( 73 patients with and 293 without dili ) were used to develop a system to predict the risk of dili by anti - tb agents . this study was approved by the institutional review boards of fukujuji hospital , riken yokohama institute , and the university of tokyo . all patients who participated in this study japanese tb patients who received anti - tb agents according to the world health organization category i treatment regimen ( 2hrze/4hr ) were enrolled in this study from fukujuji hospital ( 73 patients diagnosed with dili and 293 tolerant controls ) . dili was defined according to the world health organization toxicity classification standards , that is , elevation of aspartate aminotransferase and/or alanine aminotransferase and/or total bilirubin levels more than 3 times the upper normal limit with signs and symptoms of hepatitis . genomic dna was extracted from peripheral blood by a commercial laboratory ( srl , tokyo , japan ) . we sequenced four snps of the nat2 gene that cover the nat2 haplotypes commonly found in the japanese population : rs1041983 ( 282c > t ) , rs1799929 ( 481c > t ) , rs1799930 ( 590g > a ) , and rs1799931 ( 857g > a ) . pcr amplification was carried out in a 20-l reaction mixture containing 10 ng of genomic dna , 0.5 u of tks gflex dna polymerase ( takara bio , otsu , japan ) , gflex pcr buffer ( containing 1 mmol / l of mg and 200 mol / l of dntp ) , and 4 pmol of each forward and reverse primer using a geneamp pcr system 9700 ( applied biosystems , foster city , ca , usa ) . the following pcr conditions were used : initial denaturation at 94 c for 2 min , 40 cycles at 98 c for 10 s , 60 c for 15 s , 68 c for 2 min , and a final extension at 68 c for 5 min . direct sequencing of the pcr products was performed on an abi 3730xl dna analyzer ( applied biosystems ) using the bigdye terminator v.3.1 cycle sequencing kit according to the manufacturer s protocol . the haplotype analysis was performed using snpalyze software , version 8.0.1 ( dynacom , chiba , japan ) . nonparametric tests ( test and mann whitney u - test ) were used to detect significant associations between patients characteristics and the risk of dili caused by anti - tb agents . to identify independent factors associated with dili , we performed a logistic regression analysis with a stepwise selection of variables . all analyses were performed using ibm spss statistics software , version 22 ( ibm , armonk , ny , usa ) . this study was approved by the institutional review boards of fukujuji hospital , riken yokohama institute , and the university of tokyo . all patients who participated in this study japanese tb patients who received anti - tb agents according to the world health organization category i treatment regimen ( 2hrze/4hr ) were enrolled in this study from fukujuji hospital ( 73 patients diagnosed with dili and 293 tolerant controls ) . dili was defined according to the world health organization toxicity classification standards , that is , elevation of aspartate aminotransferase and/or alanine aminotransferase and/or total bilirubin levels more than 3 times the upper normal limit with signs and symptoms of hepatitis . genomic dna was extracted from peripheral blood by a commercial laboratory ( srl , tokyo , japan ) . we sequenced four snps of the nat2 gene that cover the nat2 haplotypes commonly found in the japanese population : rs1041983 ( 282c > t ) , rs1799929 ( 481c > t ) , rs1799930 ( 590g > a ) , and rs1799931 ( 857g > a ) . pcr amplification was carried out in a 20-l reaction mixture containing 10 ng of genomic dna , 0.5 u of tks gflex dna polymerase ( takara bio , otsu , japan ) , gflex pcr buffer ( containing 1 mmol / l of mg and 200 mol / l of dntp ) , and 4 pmol of each forward and reverse primer using a geneamp pcr system 9700 ( applied biosystems , foster city , ca , usa ) . the following pcr conditions were used : initial denaturation at 94 c for 2 min , 40 cycles at 98 c for 10 s , 60 c for 15 s , 68 c for 2 min , and a final extension at 68 c for 5 min . direct sequencing of the pcr products was performed on an abi 3730xl dna analyzer ( applied biosystems ) using the bigdye terminator v.3.1 cycle sequencing kit according to the manufacturer s protocol . the haplotype analysis was performed using snpalyze software , version 8.0.1 ( dynacom , chiba , japan ) . nonparametric tests ( test and mann whitney u - test ) were used to detect significant associations between patients characteristics and the risk of dili caused by anti - tb agents . to identify independent factors associated with dili , we performed a logistic regression analysis with a stepwise selection of variables . all analyses were performed using ibm spss statistics software , version 22 ( ibm , armonk , ny , usa ) . the patient profiles are shown in table 1 . in total , 73 tb patients were diagnosed with dili and 293 were tolerant controls . we identified four nat2 haplotypes from the four snps in the japanese tb patients ( table 2 and supplementary table s1 ) . nat2 * 4 is a wild - type allele with a frequency of 70.6% in the present study ; the other nat2 alleles show decreased metabolic activity . among the three slow acetylator alleles , nat2 * 6a had the highest frequency ( 18.4% ) , followed by nat2 * 7b ( 8.7% ) and nat2 * 5b ( 2.2% ) . the distribution of the nat2 alleles was significantly different between the dili and tolerant control groups ( table 2 ) . nat2 * 6a was significantly associated with a risk of dili ( odds ratio 1.77 , 95% confidence interval 1.152.72 , p value=1.1910 ) . diplotype estimation revealed 10 diplotypes composed of the four alleles ( table 3 ) , thereby demonstrating that the frequency of the variant diplotype , nat2 * 6a/*6a , was significantly higher in the dili group ( 8.2% ) than in the controls ( 1.4% , odds ratio 6.47 , 95% confidence interval 1.7823.6 , p value=5.5810 ) . in addition , a higher frequency of nat2 * 6a/*7b was observed in the dili group ( 5.5% ) as compared with the tolerant controls ( 1.7% ) , but this finding was not significant ( table 3 ) . when the nat2 diplotypes were classified into nat2 rapid , intermediate , and slow acetylators , the dili group showed a significantly higher frequency of slow acetylators ( 17.8% ) compared with the tolerant controls ( 4.8% , odds ratio 4.32 , 95% confidence interval 1.939.66 , p value=5.5610 ) , whereas there were no significant differences in the frequency of intermediate acetylators between the dili and the control groups ( table 4 ) . the following baseline clinical factors were significantly associated with dili : age , aspartate aminotransferase , and alanine aminotransferase . when we included all the factors significantly associated with dili in the logistic regression analysis , age and nat2 slow acetylator status were identified as independent predictors of the risk of dili due to anti - tb agents ( table 5 ) . furthermore , the area under the curve for the receiver - operating characteristic curve was 0.717 , with a true - positive rate of 93.2% and a false - positive rate of 58.4% ( supplementary figure s1 ) . after the prevalence of dili due to anti - tb agents in japanese patients ( 6.9% ) was incorporated , the positive predictive value and negative predictive value of the model were 0.11 and 0.99 , respectively . the population attributable risk was calculated by subtracting the incidence of dili due to anti - tb agents in the nonrisk patients from the incidence in all the patients ( risk and nonrisk ) . the population attributable risk percent , calculated by dividing the population attributable risk by the incidence of dili due to anti - tb agents in all the patients , was 82.5% . therefore , the probability of developing dili can be calculated using the following prediction formula :
logodds(dili)=3.900 + 0.040age+1.940nat2slowacetylator in the present study , we observed four nat2 haplotypes in a study population of 366 japanese tb patients . three of the four nat2 * 5b , nat2 * 6a , and nat2 * 7b are classified as slow acetylator alleles . a significant association was observed between the nat2 slow acetylators ( individuals without nat2 * 4 ) and dili risk ( table 4 ) . these findings confirm that the slow acetylator status of nat2 is a significant risk factor for dili caused by anti - tb agents . the frequency of nat2 * 6a/6a was significantly higher in the dili group ( 8.2% ) compared with the tolerant controls ( 1.4% ) , whereas there was a higher frequency of the nat2 * 6a/*7b haplotype in the dili group ( 5.5% ) compared with the controls ( 1.7% ) , although the difference was not significant ( table 3 ) . in previous reports , subjects with the nat2 * 6a/*6a and nat2 * 6a/*7b haplotype demonstrated lower n - acetyltransferase activity compared with the other slow acetylator haplotypes . investigated the risk of bladder cancer associated with nat2 dyplotypes and found that nat2 * 6a/*6a , nat2 * 6a/*7b , and nat2 * 7b/*7b should be classified as ultra - slow acetylators , according to their in vivo caffeine n - acetyltransferase activity compared with other slow acetylators . in the present study , tb patients with the nat2 * 6a/*6a haplotype showed a higher odds ratio and a lower p value compared with patients with the nat2 * 6a/*7b haplotype , indicating that nat2 * 6a might be superior as a biomarker to other nat2 alleles ; however , this finding is not conclusive because of the small sample size . future studies using meta - analysis will be conducted to compare the nat2 ultra - slow acetylators in other ethnic groups . in addition , we will conduct a pharmacokinetic study to examine the correlation between the nat2 diplotypes and the levels of inh and hydrazine in the plasma of patients with tb . although nat2 slow acetylator status would be expected to be the best predictor for the risk of dili , true - positive rates were reported to be < 33% when the nat2 genotypes were used as biomarkers to predict dili in japanese tb patients . the inclusion of baseline clinical data should improve the true - positive rate for the prediction of dili . in this study , we demonstrated that age was a clinical predictive factor for dili due to anti - tb agents and developed a simple predictive model incorporating age and genetic variables . the model improved the true - positive rate from 17.8% ( when applied only nat2 slow acetylator status ) to 93.2% . in addition , the population attributable risk percent values of the models using the two variables and of the model using only the nat2 slow acetylator status were 82.5% and 12.9% , respectively . this indicates that there is a higher potential impact of the model using the clinical and genetic variables compared with the model using only the genetic variable . the calculated positive predictive value ( 0.11 ) indicated that the prediction system could identify 11 patients at high risk of dili by anti - tb agents per 100 japanese tb patients , and the estimated number needed to test was 9 . whether this number needed to test is high or low depends on many factors , such as the cost of genetic testing . therefore , in the future , an economic evaluation should be conducted from the perspective of a national health insurance system in japan . in addition , the cost of genetic testing should be taken into consideration to determine whether both nat2 status and age information are necessary for the prediction formula ; however , a higher true - positive rate is more desirable from the viewpoint of patient safety . for patients with the inh - resistant strain of mycobacterium tuberculosis , levofloxacin another new drug , betaquiline , has been approved in many countries , and an application has been filed for approval in japan . therefore , these drugs may be used as an alternative to inh for patients at high risk of liver injury . in addition to the use of alternative drugs , the results of the dili risk predictions suggest that dosing stratification of inh may be beneficial for tb patients . in conclusion , we confirmed that the nat2 alleles significantly contribute to susceptibility to dili due to anti - tb agents in a japanese population . we also developed a predictive model incorporating genetic and clinical risk factors to assess dili risk . . these trials will provide clinical evidence for inh dosage adjustment and lead to a reduction in the incidence of dili and improvement in the efficacy of anti - tb treatment . | drug - induced liver injury ( dili ) is a common adverse drug reaction in patients receiving antituberculosis ( anti - tb ) treatment . among the anti - tb agents ,
isoniazid ( inh ) is the primary drug that causes hepatotoxicity in tb patients with dili .
previous reports in several populations have consistently demonstrated an association between polymorphisms in the n - acetyltransferase 2 ( nat2 ) gene , which is responsible for inh hepatic metabolism , and a risk of dili in tb patients . in this study , the genetic and baseline clinical data from 366 japanese patients with tb ( 73 patients with dili and 293 without dili ) were used to develop a system to predict dili risk due to anti - tb agents .
the distribution of the nat2 acetylator status among the tb patients with dili was 31 ( 42.5% ) , 29 ( 39.7% ) , and 13 ( 17.8% ) for rapid , intermediate , and slow acetylators , respectively .
a significant association was observed between nat2 slow acetylators and dili risk ( odds ratio 4.32 , 95% confidence interval 1.939.66 , p value=5.56104 ) . a logistic regression model based on age and nat2 genotype revealed that the area under the curve for the receiver - operating characteristic curve was 0.717 .
the findings demonstrated that slow nat2 acetylator status is a significant predictor of the risk of dili by anti - tb agents , and a personalized anti - tb treatment approach may aid in making treatment decisions and reducing the incidence of dili . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
parasites of the genus orientobilharzia belong to platyhelminthes , trematoda , digenea , schistosomatidae , and the type species is orientobilharzia turkestanicum ( 1 , 2 ) . adult worms of o.turkestanicum live in portal veins , lungs or intestinal veins of cattle , sheep , goat and large numbers of other mammals ( 5 , 6 ) . the body size of male and female worm is 210 mm and 28 mm respectively ( 7 ) . this parasite causes orientobilharziasis infection ( 6 ) reported in many parts of the world such as kazakhstan , china , pakistan , mongolia , india , iraq and iran in asia , and russia and turkey in europe ( 2 , 3 , 4 , 7 , 8) . despite animals such as dogs and birds , which did not show any sign of infection , this parasite causes harmful effects on venous systems and mucous membranes in sheep and goat ( 9 ) . cattle and sheep that are infected with o. turkestanicum often display a chronic disease , presenting the syndrome of emaciation , anemia and diarrhea , and may have deciduous mucosa and blood in the feces . the female animals may suffer from abortion , and the young animals grow slowly ( 10 ) . more importantly , the cercariae of o. turkestanicum can also infect humans and often cause cercarial dermatitis ( 11 ) and are considered the major pathogen of cercarial dermatitis in the caspian sea area of iran ( 12 ) and several provinces of the people s republic of china ( 6 ) posing significant public health problem in a number of countries ( 10 ) . according to previous studies many species of orientobilharzia have been reported named o. bomfordi ( 13 ) , o. cheni ( 14 ) , o. turkestanicum ( 2 ) , o. dattai ( 15 ) , o. harinasutai ( 16 ) and o. turkestanicum var.tiberculata ( 17 ) . traditional classification and understanding of phylogenetic relationships among schistosomatidae is based on geographic distribution , morphological characteristics of adult parasites and eggs , transmission and pathogenesis as well . today , it has becoming a common practice to use dna sequencing for inferring evolutionary relationship among parasites . the present study was done to sequence the mitochondrial cytochrome c oxidase subunit1 and nicotinamide adenine dinucleotide dehydrogenase subunit1 genes of o. turkestanicum from sheep isolates in iran and compare them with corresponding sequences of orientobilharzia spp . , available in genbank for any probable variations and examine the phylogenetic relationships of o. turkestanicum with other members of the schistosomatidae using the nucleotide sequences of cox1 and nad1 mtdna . the o. turkestanicum isolate used in present study was from mazandaran province in iran , 2014 . adult blood fluke of o. turkestanicum was obtained from the portal and mesenteric veins of sheep ( fig . 1 ) , washed extensively in physiological saline , identified based on morphological characters according to existing keys and descriptions ( 18 ) , and fixed in 70% ( v / v ) ethanol until use . for confirmation of diagnosis , 5 trematodes fixed in alcohol 70 % with a little glycerin were sent to british natural museum . the specimen deposited in british natural museum as o. turkestanicum with the code of bm ( 2013.04.18.15 ) . orientobilharzia turkestanicum in mesenteric veins in a sheep infected ( left ) and adult male & female of orientobilharzia turkestanicum isolated from infected sheep ( right ) total genomic dna was extracted from a mixture of five males and five females by qiaamp dna mini kit according to the manufacturer s instructions ( qiagen ) . the dna sample was stored at 20 c until further use . to obtain mtdna sequences , fragments of approximately 1,100 bp and 525 bp of mitochondrial cytochrome c oxidase sununit 1 ( cox1 ) and nicotinamide adenine dinucleotide dehydrogenase subunit 1 ( nad1 ) genes were amplified respectively using forward primer p1 ( 5- ggcgggtttataggtttag -3 ) and altered reverse primer p2 ( 5- cttatttaatgaataaccaactata - 3 ) for cox1 gene reported by li , 2008 and forward primer p3 ( 5- agattcgtaaggggcctaata -3 ) and reverse primer p4 ( 5- accactaact - aattcactttcgga -3 ) for nad1 gene ( li , 2008 ) . the pcr mixture was carried out in 50 l volumes containing 2 l of sample dna ( 100 ng ) , 1 pcr buffer , 2 mm mgcl2 , 240 m dntp mix 200 nm of each primers and 1.5 unit taq dna polymerase , in an automated thermocycler . the pcr was performed using the following protocol : 3 minutes incubation at 94 c to denature the double stranded dna , then 35 cycles of a 1 min at 94 c ( denaturing step ) , 45 s at 53 c ( annealing step ) , and 45 s at 72 c ( extension step ) . finally , the pcr was completed with an additional extension step for 10 min for cox1 . for nad1 , pcr protocol was as 3 minutes incubation at 94 c , then 35 cycles of a 1 min at 94 c ( denaturing step ) , 45 s at 50 c ( annealing step ) , and 45 s at 72 c ( extension step ) , followed by final extension at 72 c for 10 min . the pcr products were analyzed on 1.5% agarose gels in 0.5 tbe buffer and visualized using gel documentation system ( kodak gel logic 200 imaging system ) . the pcr product was purified using a quick pcr product purification kit ( roche ) according to the manufacturer s recommendations . the sequence chromatograms were analyzed using the chromas version 3.1 software and compared to those registered in genbank using the basic local alignment search tool ( blast ) . then the nucleotide sequences were aligned using the clstalw method of mega - lign ( dna star ) and mega5 programs . phylo - genetic analyses were performed using the maximum parsimony method utilizing the mega5 program . a correspondent nucleotide sequence of fasciola hepatica ( genbank accission aj628039 for cox1 gene and aj630405 for nad1 gene ) was used as an out - group . the o. turkestanicum isolate used in present study was from mazandaran province in iran , 2014 . adult blood fluke of o. turkestanicum was obtained from the portal and mesenteric veins of sheep ( fig . 1 ) , washed extensively in physiological saline , identified based on morphological characters according to existing keys and descriptions ( 18 ) , and fixed in 70% ( v / v ) ethanol until use . for confirmation of diagnosis , 5 trematodes fixed in alcohol 70 % with a little glycerin were sent to british natural museum . the specimen deposited in british natural museum as o. turkestanicum with the code of bm ( 2013.04.18.15 ) . orientobilharzia turkestanicum in mesenteric veins in a sheep infected ( left ) and adult male & female of orientobilharzia turkestanicum isolated from infected sheep ( right ) total genomic dna was extracted from a mixture of five males and five females by qiaamp dna mini kit according to the manufacturer s instructions ( qiagen ) . the dna sample was stored at 20 c until further use . to obtain mtdna sequences , fragments of approximately 1,100 bp and 525 bp of mitochondrial cytochrome c oxidase sununit 1 ( cox1 ) and nicotinamide adenine dinucleotide dehydrogenase subunit 1 ( nad1 ) genes were amplified respectively using forward primer p1 ( 5- ggcgggtttataggtttag -3 ) and altered reverse primer p2 ( 5- cttatttaatgaataaccaactata - 3 ) for cox1 gene reported by li , 2008 and forward primer p3 ( 5- agattcgtaaggggcctaata -3 ) and reverse primer p4 ( 5- accactaact - aattcactttcgga -3 ) for nad1 gene ( li , 2008 ) . the pcr mixture was carried out in 50 l volumes containing 2 l of sample dna ( 100 ng ) , 1 pcr buffer , 2 mm mgcl2 , 240 m dntp mix 200 nm of each primers and 1.5 unit taq dna polymerase , in an automated thermocycler . the pcr was performed using the following protocol : 3 minutes incubation at 94 c to denature the double stranded dna , then 35 cycles of a 1 min at 94 c ( denaturing step ) , 45 s at 53 c ( annealing step ) , and 45 s at 72 c ( extension step ) . finally , the pcr was completed with an additional extension step for 10 min for cox1 . for nad1 , pcr protocol was as 3 minutes incubation at 94 c , then 35 cycles of a 1 min at 94 c ( denaturing step ) , 45 s at 50 c ( annealing step ) , and 45 s at 72 c ( extension step ) , followed by final extension at 72 c for 10 min . the pcr products were analyzed on 1.5% agarose gels in 0.5 tbe buffer and visualized using gel documentation system ( kodak gel logic 200 imaging system ) . the pcr product was purified using a quick pcr product purification kit ( roche ) according to the manufacturer s recommendations . the sequence chromatograms were analyzed using the chromas version 3.1 software and compared to those registered in genbank using the basic local alignment search tool ( blast ) . then the nucleotide sequences were aligned using the clstalw method of mega - lign ( dna star ) and mega5 programs . phylo - genetic analyses were performed using the maximum parsimony method utilizing the mega5 program . a correspondent nucleotide sequence of fasciola hepatica ( genbank accission aj628039 for cox1 gene and aj630405 for nad1 gene ) was used as an out - group . the cox1 and nad1 pcr products showed an expected fragment of nearly 1,100 bp and 500 bp in length respectively . the sequences were analyzed by multiple alignments with reported reference sequences for the orientobilharzia genotype . the phylogenetic relationship between the isolated sequences and various genotypes of orientobilharzia based on cox1 and nad1 genes were shown in fig . phylogenic relationship between the isolated sequences and various members of schistosomatidae by maximum parsimony method based on the nad1 sequences . the various members of the schistosomatidae used were consist of : orientobilharzia cheni ( af289088 ) , schistosoma haematobium ( nc_008074 ) , schistosoma mansoni ( af216698 ) , schistosoma malayensis ( af295106 ) and schistosoma mekongi ( af217449 ) phylogenic relationship between the isolated sequences and various members of schistosomatidae by maximum parsimony method based on the cox1 sequences . the various members of the schistosomatidae that used were consist of schistosoma bovis ( ay157212 ) , schistosoma intercalatum ( ay157208 ) , schistosoma leiperi ( ay157207 ) , schistosoma haematobium ( ay157209 ) , schistosoma mattheei ( ay157211 ) , schistosoma margrebowiei ( ay157206 ) , schistosoma mansoni ( u82265 ) , schistosoma rodhaini ( ay157202 ) , orientobilharzia turkestanicum ( ay157200 ) , schistosoma malayensis ( ay157198 ) , schistosoma mekongi ( ay157199 ) , schistosoma japonicum ( u82264 ) , gigantobilharzia huronensis ( ay157188 ) , trichobilharzia regenti ( ay157190 ) , dendritobilharzia pulverulenta ( ay157187 ) , bilharziella polonica ( ay157186 ) , austrobilharzia variglandis ( ay157196 ) , orientobilharzia canaliculata ( ay157194 ) phylogenetic analyses done in present study placed o. turkestanicum within the schistosoma genus , and indicates that o. turkestanicum was phylogenetically closer to the african schisto - some group than to the asian schistosome group . the sequencing results of cox1 and nad1 genes of o. turkestanicum from sheep isolates of iran were registered in genbank under the fallowing accession numbers : kc456231 , kc456232 , kc456233 , kc456234 for cox1 and kc456227 , kc456228 , kc456229 , kc456230 for nad1 . limited surveys have been performed on the genotypes of o. turkestanicum originating from sheep around the world , and the present study is the first comprehensive strain characterization of sheep isolates in iran . some other related schistosoma are distributed throughout some regions of iran ( 20 ) and in a latest study which was performed by razi vaccine and serum research institute , o. turkestanicum cercaria was detected by nested - pcr in intermediate snail , in iran(9 ) . the present study is the first genotype analysis of o. turkestanicum from sheep isolates in iran . mitochondrial genome is one of the best targets for discriminating between strains , so cox1 and nad1 genes provided valuable information for detection of variants of orientobilharzia ( 6 ) as present study used nad1 and cox1 mitochondrial genes for molecular characterization of o. turkestanicum . traditional classification of schistosomes based on different factors such as geographical distributions , intermediate and definitive hosts and morphological characteristics of adult parasites and eggs ( 10 ) is not a reliable method for systematic studies of schistosomes . so , dna sequences of mitochondrial genes can be used as genetic markers for reliable systematic studies ( 21 ) . comparison of nad1 sequences of o. turkestanicum obtained in the present study with corresponding sequences available in genbank ( accession number af289088 ) revealed that there were few sequence variations at sequence position 112 ( t to a ) for kc456227 , sequence position 276 ( t to c ) for kc456227 , kc456228 , kc456229 and kc456230 , sequence position 327 ( g to a ) for kc456227 , kc456228 and kc456229 . also comparison of the cox1 representing the o. turkestanicum samples examined in the present study with the corresponding sequence available in genbank ( accession number ay157200 ) revealed that there were also sequence variations at sequence positions 196 ( gto a ) , 233 ( g to a ) and 441 ( g to a ) for kc456233 , sequence positions 233 ( g to c ) and 325 ( g to a ) for kc456232 and sequence position 233 ( g to a ) for kc456234 . these variations showed that o. turkestanicum parasite like echinococcus granulosus genotypes g1 may have microvariants as reported in iran ( 22 ) , prue ( 23 ) and turkey ( 24 ) . phylogenetic relationship of the schistosomes has been the focus of several recent studies using different genetic makers and approaches ( 2529 ) , and some of these studies placed o. turkestanicum within the genus schistosoma . in the present study , the partial cox1 and nad 1 dna of o. turkestanicum were amplified and sequenced used to re - construct the phylogenetic relationships of o. turkestanicum with other members of the schistosomatidae using maximum parsimony method . phylogenetic analyses performed in present study placed o. turkestanicum within the schistosoma genus , and indicates that o. turkestanicum was phylogenetically closer to the african schistosome group than to the asian schistosome group ; it was in common with the study of wang et al . for the phylogenetic position of o. turkestanicum within the family of schistosomatidae ( 10 ) . though orientobilharzia species are now considered as important zoonotic agents , studies on their biochemistry , histochemistry , immunopathology and molecular biology are lacking and limited compare was performed to s. japonicum and s. mansoni . orientobilharziasis is an important and severe disease in several mammals , and cercarial dermatitis caused by orientobilharzia spp . therefore , it is important to evaluate in detail the impact of orientobilharzia species on human and animal health from a global perspective and intensive studies are needed in order to better control of human and animal infections with orientobilharzia species ( 10 ) . the present study is the first comprehensive genotypic analysis of o. turkestanicum infecting sheep by using pcr analysis and dna sequencing in iran and provided evidence for presence of microvarients . the present study is the first comprehensive genotypic analysis of o. turkestanicum infecting sheep by using pcr analysis and dna sequencing in iran and provided evidence for presence of microvarients . | background : adult worms of orientobilharzia turkestanicum live in the portal veins , or intestinal veins of cattle , sheep , goat and many other mammals causing orientobilharziasis .
orientobilharziasis causes significant economic losses to livestock industry of iran .
however , there is limited information about genotypes of o. turkestanicum in iran.methods:in this study , 30 isolates of o. turkestanicum obtained from sheep were characterized by sequencing mitochondrial cytochrome c oxidase subunit 1 ( cox1 ) and nicotinamide adenine dinucleotide dehydrogenase subunit 1 ( nad1 ) gene .
the mitochondrial cox1 and nad1 dna were amplified by polymerase chain reaction ( pcr ) and then sequenced and compared with o. turkestanicum and that of other members of the schistosomatidae available in gen-bank.results:phylogenetic relationships between them were re - constructed using the maximum parsimony method .
phylogenetic analyses done in present study placed o. turkestanicum within the schistosoma genus , and indicates that o. turkestanicum was phylogenetically closer to the african schistosome group than to the asian schistosome group.conclusion:comparison of nad1 and cox1 sequences of o. turkestanicum obtained in this study with corresponding sequences available in genbank revealed some sequence variations and provided evidence for presence of microvarients in iran . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
anatomic reduction of the articular surface of distal radius is the primary goal while treating intraarticular fractures of distal radius.1 restoration of the articular congruency plays an important role in the prevention of posttraumatic arthritis.12 nearly 91% of the fractures with some degree of residual step - off and 100% of those with a step - off of 2 mm or more develop radio - carpal arthritis.1 the risk of this complication decreases when the final step - off after reduction is less than 1 mm.23 appropriate assessment of intraarticular reduction is difficult while performing open reduction and internal fixation without opening the joint capsule . although radiographs have been the traditional method to assess intraarticular step - off , these studies represent a two - dimensional evaluation of a three - dimensional structure in such a way that fragments and step - offs seem to be reduced in the antero - posterior view , while they are displaced in the lateral projection . fluoroscopy can be more reliable on a three - dimensional assessment ; however , the resolution and quality of the images may be poor.4 furthermore , fluoroscopy as the only method to evaluate articular reduction is inadequate , especially in the presence of significant comminution.5 it has been demonstrated that almost 33% of the apparent good reductions obtained with fluoroscopy and plain films actually have an intraarticular displacement of more than 1 mm confirmed by arthroscopy.6
arthroscopic evaluation provides excellent direct visualization of the entire articular surface , ligaments , and triangular fibrocartilage complex ( tfcc ) , thereby facilitating joint debridement and correction of gaps and step - offs with minimal disruption of soft tissues.4789101112 under the arthroscopic and fluoroscopic guidance , the fragments can be elevated , reduced , and fixed ; moreover , concomitant ligamentous injuries and tfcc injuries can also be treated in the same sitting.78910111213141516 blood , debris , and small loose bodies that are undetectable on standard films can be identified and removed with arthroscopy . associated injuries are commonly found in intraarticular distal radius fractures : 68% to 98% involve wrist ligaments and 32% present with chondral lesions.1718 tfcc along with the ulnar styloid process ( 26 - 78% ) is most commonly injured while scapho - lunate ligament ( 19 - 54% ) and luno - triquetral ligament ( 9% ) are also common.171819 concomitant lesions are present in 21% of the patients.17 studies have shown that there is no correlation between the fracture pattern and the type of ligament injury,18 however , other authors have observed that ligament injuries are commonly seen when the lunate facet is involved.17 this study focuses on technique and results after arthroscopic - assisted stable fixation for distal radial fractures and also delineates the advantages of using arthroscopy as an adjunct . we retrospectively evaluated 27 consecutive patients with distal radial fractures , who satisfied the inclusion criteria of articular injuries in young and high - demand patients and who were managed with arthroscopic - assisted stable fixation of distal radius . as per the ao classification,20 there were 9 c1 , 12 c2 [ figures 1a and 2a ] , 2 c3 , 3 b1 , 1 b2 . there were 16 men and 11 women with an average age of 41 ( range : 18 - 68 years ) . mechanism of injury was fall on an outstretched hand ( n = 14 ) , motor vehicle accident ( n = 6 ) , fall from height ( n = 3 ) , and sport related injuries ( n = 4 ) . different treatment strategies were chosen as per the fracture morphology and associated injuries found during wrist arthroscopy . open reduction and internal fixation with a volar fixed angle locking plate ( dvr plate , depuy orthopaedics ) was done in 17 cases [ figures 1b and 2b ] . three patients with severe comminution were managed with an external fixator and unthreaded 1.5 mm kirschner wires , while fragment - specific fixation with kirschner wires was used in seven patients ( two combined with a 4 mm lag screw ) . one patient had an associated scaphoid fracture , which was fixed with a compression screw ( acutrak standard screw , acumed ) . all the patients from this series underwent endoscopic carpal tunnel release in the same sitting . ( a ) radiographs showing preoperative wrist posteroanterior and lateral views of patient 1 showing an intraarticular c2 type distal radial fracture , ( b ) postoperative radiograph of wrist showing posteroanterior and lateral views of the same patient , following stable fixation of distal radial fracture with a volar fixed angle locking plate , ( c ) photograph showing wrist arthroscopic views . a shaver is being used for clearing the hematoma and debris in the joint , while the articular reduction is confirmed , ( d - f ) clinical photographs showing range of motion at the final followup ( a ) preoperative radiographs of wrist showing posteroanterior and lateral views of patient 2 with an intraarticular distal radial fracture . ( b ) postoperative radiographs showing posteroanterior and lateral views of wrist of patient 2 , following stable fixation of distal radial fracture with a volar fixed angle locking plate . ( c ) photograph of arthroscopic view of wrist showing joint debridement in progress and assessment of the articular reduction in patient 2 . ( d - f ) clinical photographs of patient 2 showing range of motion of wrist at the final followup the patient was placed in the supine position and a shoulder support was secured to the surgical table on the ipsilateral side of the injured wrist . a regional block , using the three nerve blocking technique at the elbow level was preferred in order to prevent complications caused by axillary block.2122 once anesthetized , wrist was held in supination and a nonsterile tourniquet was applied to the upper arm , along with a strap to provide countertraction . the upper extremity was prepared , draped , and then exsanguinated with an esmarch bandage and the tourniquet was inflated to 250 mmhg . intravenous sedation is used for tourniquet pain . as a part of our surgical protocol , endoscopic carpal tunnel release using the single portal technique [ figure 3 ] ( microaire , carpal tunnel release system , charlottesville , va ) was performed routinely at this time.2324 however , if the displacement and deformity were severe , the carpal tunnel was released after the fracture reduction , to facilitate placement of endoscope in the canal . once the fracture was preliminarily fixed , longitudinal wrist traction was given by placing finger traps on the index and middle fingers along with 10 pound of weight suspended through a pulley system , which was secured to the shoulder holder . an 18-gauge needle was then used to identify the radio - carpal joint , because lister 's tubercle is usually displaced and hence can not be used as an anatomic landmark [ figure 4a and b ] . fluid ingress was obtained by gravity and an esmarch bandage was used to avoid soft tissue infiltration . a 2.9 mm full radius shaver placed through the 4 - 5 or 6r portal was used to remove blood clots and small intraarticular debris [ figure 5a ] . photograph showing endoscopic carpal tunnel release ( a ) photograph showing insufflation of radiocarpal joint with saline after putting the wrist on longitudinal traction , ( b ) photograph showing arthroscopic evaluation of wrist after stable fixation of the distal radial fracture , with wrist in longitudinal traction ( a ) photograph showing arthroscopic debridement of the radiocarpal joint , ( b ) photograph showing preliminary fixation using the kirschner wire under a fluoroscopic view , ( c ) fluoroscopic images showing lunate fossa reduction under arthroscopic guidance we first obtained fluoroscopic postero - anterior and lateral wrist views to evaluate fracture reduction and implant positioning [ figures 5b and c ] . then , a systematic careful arthroscopic inspection of the radio - carpal joint including the articular surface of the distal radius and the intraarticular soft tissue structures was performed , in order to judge and rectify if required , the reduction observed by fluoroscopy and not to miss any ligamentous lesion . a 2.9 mm full radius shaver was used for removing the blood clots and debris [ figures 1c and 2c ] and a small probe was used to palpate the joint surface in search for articular gaps and step - offs and to test the indemnity of the carpal ligaments and the tfcc [ figure 6a ] . thorough evaluation of the midcarpal joint was also carried out to identify scapho - lunate [ figure 6b ] , luno - triquetral injuries , and other midcarpal instabilities . severe ligament injuries detected through midcarpal portal have to be treated by aggressive debridement and fluoroscopic assisted pinning of the involved bones . arthroscopic views showing ( a ) contused scapholunate ligament being treated with thermal ligamentoplasty and repair of peripheral tear of tfcc using pds suture , ( b ) ( mid - carpal view ) showing scapholunate diastasis type ib tears26 of the tfcc were usually seen in significant fracture displacement . small ones could be managed with debridement while larger tears with loss of the trampoline effect require percutaneous suture repair by suture welding technique.27 to obtain maximum distal radio - ulnar joint ( druj ) congruency and ensure proper rehabilitation , tears are repaired while holding the wrist in supination.27 thorough irrigation of the joint through the scope was carried out once all concomitant lesions have been identified and treated . after arthroscopic confirmation of the articular congruency , the volar plate positioning was again checked under fluoroscopy . immediate finger motion was started and then wrist rehabilitation protocol was tailored according to the type of fixation . a below elbow cast was given for 4 to 8 weeks depending upon the fracture pattern and associated tfcc and ligamentous injuries . in the absence of significant associated injuries , 4 weeks of cast was given following which active range of motion exercises and strengthening exercises were started and continued for further 4 to 8 weeks . for associated tfcc injury , immediately after surgery , a sugar tong splint was given with wrist in supination for initial 1 week , which was followed by 5 weeks of immobilization in a muenster type cast in order to permit some elbow flexion and extension , while restricting supination and pronation at wrist . cast removal was followed by 4 to 8 weeks of physical therapy with active range of motion and strengthening exercises . for associated intercarpal ligament injuries , arthroscopic debridement and kirschner wire fixation was done and wrist maintained in a thumb spica cast for 8 weeks . at 8 weeks , the pins were removed and active range of motion and strengthening exercises were continued for further 6 to 8 weeks . all the patients were followedup for a minimum period of 24 months ( average followup being 26 months ) and final clinical evaluation was done using the modified mayo wrist scoring system.28 the patient was placed in the supine position and a shoulder support was secured to the surgical table on the ipsilateral side of the injured wrist . a regional block , using the three nerve blocking technique at the elbow level was preferred in order to prevent complications caused by axillary block.2122 once anesthetized , wrist was held in supination and a nonsterile tourniquet was applied to the upper arm , along with a strap to provide countertraction . the upper extremity was prepared , draped , and then exsanguinated with an esmarch bandage and the tourniquet was inflated to 250 mmhg . intravenous sedation is used for tourniquet pain . as a part of our surgical protocol , endoscopic carpal tunnel release using the single portal technique [ figure 3 ] ( microaire , carpal tunnel release system , charlottesville , va ) was performed routinely at this time.2324 however , if the displacement and deformity were severe , the carpal tunnel was released after the fracture reduction , to facilitate placement of endoscope in the canal . once the fracture was preliminarily fixed , longitudinal wrist traction was given by placing finger traps on the index and middle fingers along with 10 pound of weight suspended through a pulley system , which was secured to the shoulder holder . an 18-gauge needle was then used to identify the radio - carpal joint , because lister 's tubercle is usually displaced and hence can not be used as an anatomic landmark [ figure 4a and b ] . fluid ingress was obtained by gravity and an esmarch bandage was used to avoid soft tissue infiltration . a 2.9 mm full radius shaver placed through the 4 - 5 or 6r portal was used to remove blood clots and small intraarticular debris [ figure 5a ] . photograph showing endoscopic carpal tunnel release ( a ) photograph showing insufflation of radiocarpal joint with saline after putting the wrist on longitudinal traction , ( b ) photograph showing arthroscopic evaluation of wrist after stable fixation of the distal radial fracture , with wrist in longitudinal traction ( a ) photograph showing arthroscopic debridement of the radiocarpal joint , ( b ) photograph showing preliminary fixation using the kirschner wire under a fluoroscopic view , ( c ) fluoroscopic images showing lunate fossa reduction under arthroscopic guidance we first obtained fluoroscopic postero - anterior and lateral wrist views to evaluate fracture reduction and implant positioning [ figures 5b and c ] . then , a systematic careful arthroscopic inspection of the radio - carpal joint including the articular surface of the distal radius and the intraarticular soft tissue structures was performed , in order to judge and rectify if required , the reduction observed by fluoroscopy and not to miss any ligamentous lesion . a 2.9 mm full radius shaver was used for removing the blood clots and debris [ figures 1c and 2c ] and a small probe was used to palpate the joint surface in search for articular gaps and step - offs and to test the indemnity of the carpal ligaments and the tfcc [ figure 6a ] . thorough evaluation of the midcarpal joint was also carried out to identify scapho - lunate [ figure 6b ] , luno - triquetral injuries , and other midcarpal instabilities . severe ligament injuries detected through midcarpal portal have to be treated by aggressive debridement and fluoroscopic assisted pinning of the involved bones . arthroscopic views showing ( a ) contused scapholunate ligament being treated with thermal ligamentoplasty and repair of peripheral tear of tfcc using pds suture , ( b ) ( mid - carpal view ) showing scapholunate diastasis type ib tears26 of the tfcc were usually seen in significant fracture displacement . small ones could be managed with debridement while larger tears with loss of the trampoline effect require percutaneous suture repair by suture welding technique.27 to obtain maximum distal radio - ulnar joint ( druj ) congruency and ensure proper rehabilitation , tears are repaired while holding the wrist in supination.27 thorough irrigation of the joint through the scope was carried out once all concomitant lesions have been identified and treated . after arthroscopic confirmation of the articular congruency , the volar plate positioning was again checked under fluoroscopy . immediate finger motion was started and then wrist rehabilitation protocol was tailored according to the type of fixation . a below elbow cast was given for 4 to 8 weeks depending upon the fracture pattern and associated tfcc and ligamentous injuries . in the absence of significant associated injuries , 4 weeks of cast was given following which active range of motion exercises and strengthening exercises were started and continued for further 4 to 8 weeks . for associated tfcc injury , immediately after surgery , a sugar tong splint was given with wrist in supination for initial 1 week , which was followed by 5 weeks of immobilization in a muenster type cast in order to permit some elbow flexion and extension , while restricting supination and pronation at wrist . cast removal was followed by 4 to 8 weeks of physical therapy with active range of motion and strengthening exercises . for associated intercarpal ligament injuries , arthroscopic debridement and kirschner wire fixation was done and wrist maintained in a thumb spica cast for 8 weeks . at 8 weeks , the pins were removed and active range of motion and strengthening exercises were continued for further 6 to 8 weeks . all the patients were followedup for a minimum period of 24 months ( average followup being 26 months ) and final clinical evaluation was done using the modified mayo wrist scoring system.28 five patients needed modification of the reduction and fixation after performing wrist arthroscopy for joint evaluation . in two patients who received a volar plate for fracture fixation , it was necessary to remove one of the distal pegs to correct a step off of about 2 mm , which was detected by arthroscopy . this peg was placed again in both the cases after reduction was achieved . in three other patients , arthroscopy showed significant depression of small fragments , especially on the volar - ulnar aspect of the distal radius . these fragments needed to be elevated and finally held in place by supplementary unthreaded 1.5 mm kirchner wires . ligamentous lesions and tfcc injuries were found during wrist arthroscopy in 26 patients [ table 1 ] . five patients had combined injuries i.e. tfcc tear , scapholunate ligament injury and/or lunotriquetral ligament injury . one associated scaphoid fracture which was diagnosed preoperatively by radiograph was treated by percutaneous acutrak screw under fluoroscopic and arthroscopic guidance . associated injuries detected during wrist arthroscopy radiographic parameters evaluated at the average followup of 26 months ( range 24 - 52 months ) showed 21 of radial inclination ( range 18-22 ) , 2 of palmar tilt ( range 0-10 ) and 0.7 mm of ulnar variance ( range 0 - 1.5 mm ) . there were 20 excellent [ figures 1d f and 2d f ] , 3 good , and 4 fair results as per the modified mayo wrist scoring system.28 the complications encountered in our series included two patients with pin tract infection and two patients with extensor carpi ulnaris tendonitis ( which resolved with a local cortisone infiltration ) . one patient who was treated with 2 kirschner wires developed a complex regional pain syndrome ( type i ) , which resolved due to timely , aggressive treatment based on pain medication and occupational therapy without any stellate ganglion blocks . several studies have shown that restoration of articular congruency is the most important factor in determining the functional outcome of intraarticular distal radius fractures123512 intraarticular step - offs of less than 1 mm reduce the possibility of developing posttraumatic osteoarthritis.12312 arthroscopic evaluation is a minimally invasive procedure that proves to be the best modality to assess the joint surface and residual step - offs once reduction and fixation have been obtained , when compared to radiographs and fluoroscopy.3567121314 wrist arthroscopy for distal radius fractures is indicated in young adults and high demand middle - aged patients , especially with intraarticular involvement secondary to high energy trauma , where there is a suspicion of associated soft tissue injuries.4789101119 the classic colle 's fracture , in an elderly and low - demand patient with osteopenic bone , does not require joint evaluation.9
compartment syndrome , open fractures , and irreducible carpal dislocations are relative contraindications for performing wrist arthroscopy for distal radius fractures.919 it has also been recommended to wait for 48 hours after the injury to avoid bleeding from the fracture site ; however , fragment manipulation can be difficult after 7 days of the fracture.4
edward et al.,6 reported 15 intraarticular distal radius fractures treated with closed reduction and percutaneous fixation . they found that in 5 ( 33% ) patients , the ideal reduction achieved with fluoroscopy and radiographs had an articular step of more than 1 mm detected by adjuvant arthroscopy . wrist motion , grip strength , and final radiographic parameters have been shown to be superior with arthroscopic - assisted reduction as compared to open reduction.1213 ruch et al.,29 in a prospective cohort study showed that the patients who underwent assisted arthroscopic procedures had a greater degree of supination , flexion , and extension than the patients undergoing only fluoroscopic - assisted surgery . wrist arthroscopy improves the diagnosis and treatment of ligament injuries and tfcc injuries that are so frequently associated with intraarticular distal radius fractures.7891011121819 arthroscopy has also been demonstrated to be more reliable for the diagnosis of these injuries even when compared to cine - arthrography30 and mri;31 furthermore , these injuries can be treated in the same surgical sitting with minimal disturbance of the soft tissues.491011123233 lindau et al.,32 in a prospective case series of 51 patients with displaced distal radius fractures assessed with arthroscopic evaluation found complete or partial tfcc tears in 43 patients ( 24 peripheral tears , 10 central perforations , and 9 combined tears ) . at 1 year followup , 10 patients with complete peripheral tfcc tears and 7 with partial tears had druj instability . shih et al.,33 reported their results using arthroscopy to treat 33 patients of distal radius fractures with associated soft tissue injuries . they found tfcc tears in 18 patients and 6 patients had scapholunate ligament tear with instability . all the peripheral tfcc tears were repaired and scapholunate instabilities were treated by arthroscopic debridement and transfixation of the scapholunate joint with kirschner wires . at the final followup , 11 patients achieved excellent results . osterman and vanduzer34 in their series of 56 patients treated with arthroscopic - assisted distal radial fixations reported restoration of 95% of rotational arc at 5 years of followup . varitimidis et al.,12 reported a better clinical result with arthroscopic assisted distal radial fixation as compared to fluoroscopy alone . furthermore , they reported tfcc injury in 60% patients , scapholunate ligament tear in 45% and luno - triquetral tear in 20% of patients in the arthroscopically treated group . in our series , arthroscopy as an adjunct not only provided useful information regarding the intraarticular pathologies and management of these soft tissue injuries , but also ensured accurate reduction of the fracture fragments . tfcc injuries were seen in 63% of our patients , whereas scapholunate ligament disruption and luno - triquetral ligament disruption were seen in 30% and 4% of patients respectively in our series . patient satisfaction and objective scores in our series are also similar to those mentioned in the literature . hence , we conclude that radiocarpal and midcarpal arthroscopy is a useful adjunct to stable fixation of distal radial fractures in young adults and high - demand older population . | background : many studies in literature have supported the role of wrist arthroscopy as an adjunct to the stable fixation of unstable intraarticular distal radial fractures . this article focuses on the surgical technique , indications , advantages , and results using wrist arthroscopy to assess articular reduction and evaluates the treatment of carpal ligament injuries and triangular fibrocartilage complex ( tfcc ) injuries in conjunction with the stable fixation of distal radial fractures.materials and methods : we retrospectively evaluated 27 patients ( 16 males and 11 females ) , who underwent stable fixation of intraarticular distal radial fractures with arthroscopic evaluation of the articular reduction and repair of associated carpal injuries .
as per the ao classification , they were 9 c 1 , 12 c2 , 2 c3 , 3 b 1 , and 1 b2 fractures .
the final results were evaluated by modified mayo wrist scoring system .
the average age was 41 years ( range : 18 - 68 years ) .
the average followup was of 26 months ( range 24 - 52 months).results : five patients needed modification of the reduction and fixation after arthroscopic joint evaluation .
associated ligament lesions found during the wrist arthroscopy were tfcc tears ( n=17 ) , scapholunate ligament injury ( n=8 ) , and luno - triquetral ligament injury ( n=1 ) .
five patients had combined injuries i.e. included tfcc tear , scapholunate and/or lunotriquetral ligament tear . there were 20 excellent , 3 good , and 4 fair results using this score.conclusion:the radiocarpal and mid carpal arthroscopy is a useful adjunct to stable fixation of distal radial fractures . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hypertension is established as a major risk factor for cardiovascular disease , and antihypertensive treatments are necessary to prevent the cardiovascular events . we have already various and effective antihypertensive agents . however , it is also true that our antihypertensive treatments could not achieve the optimal blood pressure levels [ 2 , 3 ] . among the unmet prevention for hypertensive cardiovascular events , early morning blood pressure elevation is known to be associated with cardiovascular events [ 4 , 5 ] . recent several studies have suggested that morning surge should be a crucial target of the treatments for hypertension [ 68 ] . there are so much various factors to cause morning surge [ 4 , 5 ] , and , among the factors , sympathoexcitation and baroreflex dysfunction are closely associated with blood pressure elevation in the early morning . sympathetic nerve activity is mediated by brain , especially by rostral ventrolateral medulla ( rvlm ) known as vasomotor center [ 10 , 11 ] . in the aspects of sympathoexcitation , we and other investigators have demonstrated that brain oxidative stress in the rvlm causes sympathoexcitation [ 1218 ] and that blockade of angiotensin ii type 1 receptor ( at1r ) in the rvlm decreases blood pressure with sympathoinhibition and improvement of baroreflex sensitivity via reduction of oxidative stress [ 12 , 17 , 18 ] . from these backgrounds , the aim of the present study was to investigate whether central at1r blockade attenuates the excess blood pressure elevation in early active phase ( mimicking early morning surge ) with sympathoinhibition and improvement of baroreflex in hypertensive rats and if so to determine whether the benefit was independent of depressor response or not . the study protocol was reviewed and approved by the committee on the ethics of animal experiments at the kyushu university graduate school of medical sciences and conducted according to the guidelines for animal experiments of kyushu university . experiments were performed on male stroke - prone spontaneously hypertensive rats ( shrsp ) as a hypertensive model with sympathoexcitation ( 14 to 18 weeks old , slc japan , hamamatsu , japan ) . shrsp were divided into 3 groups , treated with intracerebroventricular infusion ( icv ) of at1r receptor blocker ( arb , n = 5 ) , treated with oral administration of hydralazine ( hyd , n = 5 ) , and treated with icv of vehicle ( veh , n = 5 ) for 2 weeks . in arb , losartan ( 1 mgkgday ) in artificial cerebrospinal fluid ( acsf ) was infused at 0.5 l / h for 14 days by using an osmotic minipump ( alzet 2002 , durect corporation , cupertino , ca ) into the right lateral cerebral ventricle of the brain , as described previously [ 17 , 19 ] . in hyd , mg / l ) was administered in the drinking water . in veh , only acsf was infused at 0.5 l / h for 14 days by using an osmotic minipump . mean blood pressure ( mbp ) and heart rate ( hr ) were measured using the ua-10 radiotelemetry system ( data sciences international , saint paul , mn , usa ) as described previously [ 12 , 17 , 18 , 20 ] . telemetric mbp of 5 minutes three times every one hour was sampled and averaged at the first 2 hours at dark - active ( early morning , em ) , mid 2 hours at dark - active ( after morning , am ) , and mid 2 hours at light - rest phase ( night , nt ) . we assessed sympathoexcitation by spectral analysis using an adaptive autoregressive model to provide power spectra for systolic blood pressure ( sbp ) . the low - frequency power of sbp ( integrating the spectra between 0.04 and 0.15 hz ) was computed by matlab ( mathworks , usa ) , and sympathoexcitation is presented as the normalized unit of the low - frequency component of sbp ( lfnusbp ) , as previously done in our and other studies [ 17 , 2022 ] . we assessed baroreflex sensitivity by spontaneous sequence method , as done in our and other previous experiments [ 17 , 20 , 23 , 24 ] . in brief , we measured baroreflex sensitivity by using spontaneous sequence method . about 10-minute rest period was obtained in all subjects to allow for stabilization of blood pressure or hr . for analysis of about 5-minute hemodynamic recordings from telemetry system , we selected all sequences of three or more successive heart beats in which there was concordant increase ( up sequence ) or decrease ( down sequence ) in arterial systolic blood pressure and peak - to - peak systolic blood pressure interval change . a linear regression was applied to each of the sequences , and an average regression slope was calculated for the sequences . the threshold values for including beat - to - beat systolic blood pressure and its interval changes in a sequence are set at 1 mmhg and 2 milliseconds , respectively . at em , mbp was significantly lower in arb to a greater extent than in hyd compared to veh , though mbp at am was the same in arb and hyd ( figure 1 ) . at nt , mbp was also significantly lower in arb than in hyd ( figure 1 ) . throughout a day , hr was significantly lower in arb than in hyd and veh ( figure 2 ) . am , and nt , lfnusbp was significantly lower in arb than in hyd and veh . in hyd , lfnusbp did not differ compared to veh . throughout em , am , and nt , baroreflex sensitivity was significantly higher in arb than in hyd and veh ( figure 4 ) . in hyd , baroreflex sensitivity did not differ compared to veh ( figure 4 ) . ( 1 ) at em and nt , mbp was decreased in arb to a greater extent than in hyd . ( 3 ) throughout em , am , and nt , lfnusbp was significantly lower in arb than in veh and hyd , and ( 4 ) baroreflex sensitivity was improved in arb , but not in hyd . these results suggest that central at1r blockade would attenuate the excess blood pressure elevation in early active phase and continuous blood pressure elevation during rest phase independent of depressor response in hypertension and that these benefits of central at1r blockade on dairy blood pressure variability might be due to sympathoinhibition with baroreflex improvement . the most impressive results were that central at1r blockade attenuates the excess blood pressure elevation in early active phase . dairy blood pressure variability and/or morning surge is associated with abnormal regulation of sympathetic nerve activity , and we have demonstrated that central at1r blockade causes depressor response with sympathoinhibition [ 12 , 17 , 18 ] . considering these backgrounds , moreover , in the present study , mbp at am was the same in arb and hyd , although mbp in hyd was significantly higher at em and nt than at am . we consider the blood pressure variability of veh as nondipper type and that of hyd as riser type . these results strongly indicate that benefit of central at1r blockade on mbp at em was not due to depressor response itself . interestingly , the benefit at em was also determined during rest . in the clinical aspects , we should assess dairy blood pressure variability , especially mbp at em and nt , not only at active phase . in the aspects of mechanisms , we also consider that central infusion of losartan could improve baroreflex sensitivity , resulting in the improvement of blood pressure variability . previously we demonstrated that central infusion of at1r blocker improved the impaired baroreflex sensitivity with sympathoinhibition and antioxidant effect in the brain of hypertensive rats . at1r - induced oxidative stress in the brain causes sympathoexcitation [ 17 , 18 ] , and reduction of central oxidative stress significantly improves baroreflex sensitivity in hypertensive rats [ 17 , 20 ] . considering those studies , at1r - induced oxidative stress in the brain should worsen blood pressure variability via sympathoexcitation with baroreflex dysfunction . to determine these aspects , we calculated baroreflex sensitivity by spontaneous sequence method and demonstrated that baroreflex sensitivity was significantly higher in central losartan - treated shrsp than in hydralazine- or vehicle - treated shrsp throughout em , am , and nt . these results strongly support the conclusion that central at1r blockade improves blood pressure variability via sympathoinhibition with improvement of baroreflex . although we showed that central application ( intracerebroventricular infusion ) of at1r blocker is beneficial to abnormal blood pressure elevation , as previously shown in our and other works [ 17 , 19 ] , we had not determined angiotensin ii content or at1r expression in cardiovascular center and do not have the data of angiotensin ii content and at1r expression in rvlm in early morning , after morning , and night . previous reports indicated that systemic circulatory and tissue renin - angiotensin system are significantly higher at active than at rest phase and that these abnormal circadian rhythms are attenuated by at1r blocker [ 2527 ] . moreover , a previous study reported that central at1r has circadian rhythm . considering these results , central infusion of losartan blocked at1r in cardiovascular center strongly at angiotensin ii - at1r activated phase ( night - active ) and would improve the abnormal circadian rhythm of blood pressure . however , to assess more concrete mechanisms in which intracerebroventricular infusion of losartan improves blood pressure variability , it would be necessary in further examination to determine whether angiotensin ii content and at1r expression in cardiovascular center have circadian rhythm or not . we had better focus on the central at1r as the suitable target of the treatment with at1r blockers . recently , we have suggested that the beneficial effects on central at1r were different among oral - administered at1r blockers . to archive the optimal quality and quantity of blood pressure in hypertension central at1r blockade potentially attenuated excess blood pressure elevation in early active phase and continuous blood pressure elevation during rest phase via sympathoinhibition with improvement of baroreflex , independent of depressor response in hypertensive rats . | abnormal blood pressure ( bp ) elevation in early morning is known to cause cardiovascular events .
previous studies have suggested that one of the reasons in abnormal dairy bp variability is sympathoexcitation .
we have demonstrated that brain angiotensin ii type 1 receptor ( at1r ) causes sympathoexcitation .
the aim of the present study was to investigate whether central at1r blockade attenuates the excess bp elevation in rest - to - active phase in hypertensive rats or not .
stroke - prone spontaneously hypertensive rats ( shrsp ) were treated with intracerebroventricular infusion ( icv ) of at1r receptor blocker ( arb ) , oral administration of hydralazine ( hyd ) , or icv of vehicle ( veh ) .
telemetric averaged mean bp ( mbp ) was measured at early morning ( em ) , after morning ( am ) , and night ( nt ) . at em , mbp was significantly lower in arb to a greater extent than in hyd compared to veh , though mbp at am was the same in arb and hyd . at nt , mbp was also significantly lower in arb than in hyd .
these results in mbp were compatible to those in sympathoexcitation and suggest that central at1r blockade attenuates excess bp elevation in early active phase and continuous bp elevation during rest phase independent of depressor response in hypertensive rats . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
thus , the immediate loading technique , which allows dental graft masticatory function soon after the surgical procedure , is preferred because it avoids the need to wait for complete osteointegration . this procedure is both safe and comfortable for patients , who can depend on receiving a fixed prosthetic piece shortly after surgery . immediate implant loading after tooth extraction not only reduces the number of surgical sessions , but also achieves rapid soft tissue remodeling around the implant . some studies report that placing temporary prostheses maintains the tissue in dimensions identical to those of the extracted tooth . one of the major prerequisites for treatment success is high primary stability of the implant , which requires a high insertion torque of the implant between 35 and 45 ncm . this torque can be reliably generated by choosing patients with sufficient bone quality and quantity , adequately sized implants and surfaces , and using a minimally traumatic surgical technique . periodontal evaluation before extraction is of fundamental importance and should include the following clinical details : the smile type ( low , medium , and high ) , periodontal biotype ( fine , medium , and thick ) , presence of interproximal negro triangles , any asymmetric gingival contour , any periodontal bags , malpositioned teeth , average line deviation , relative positions of the anterior - superior teeth to the lower lip , and the aesthetic goals . gingival conditioning is considered one of the most satisfying and simple clinical procedures optimizing the aesthetic outcome . regardless of the procedure , the temporary prostheses are critical to the success of gingival conditioning . surgical and prosthetic planning is important in ensuring successful dental rehabilitation in implantodonty . by using surgical planning software and computed tomography data , a three - dimensional surgical simulation can be created , which provides a detailed study of the surgical site . the present report describes a clinical case of immediate implant loading using the natural crown of the extracted central incisor to obtain an excellent aesthetic result . a 50-year - old male patient had a low smile line , dental misalignment , and dental occlusion on initial presentation . clinical and radiographic exams revealed buccal bone loss and a grade 3 mobility at tooth 21 , indicating the need for its extraction [ figure 1 ] . in addition , the prosthetic space was lost at the site ; therefore , minimal orthodontic movement of the neighboring teeth was indicated . the patient immediately after periodontal treatment the stabilization , surgical , and prosthesis were virtually planned . based on the simulation , the implant dimensions ( 13 mm length and 55 mm diameter ) and positioning were determined [ figures 2 and 3 ] . to minimize orthodontic movement , the mesial surfaces of teeth 11 and 22 and the proximal crown of the tooth to be extracted were slightly worn down . virtual surgical and prosthetic planning virtual surgical and prosthetic planning during the extraction , care was taken to maintain the alveolus and soft tissue integrity without creating a gingival flap . later , the implant was loaded at a 45 ncm torque , and the temporary abutment , which was covered with an opaque resin [ figure 4 ] , was screwed onto the implant . abutment with opaque resin the buccal crown surface of the extracted tooth was secured onto the implant with a small amount of nonpolymerized composite resin . once the crown was correctly positioned on the dental arch , the resin was polymerized . the assembly ( surface and temporary abutment ) was removed [ figure 5 ] , and a photopolymerizable resin was filled into the space between the surface and metallic cylinder to establish a temporary profile [ figure 6 ] . initially , a small cervical diameter profile was used , which was later resized after the initial tissue cicatrization . the crown profile was finished and polished , and the crown was placed [ figure 7 ] . the decision to perform immediate or delayed implantation following extraction is controversial . a previous systematic review reports that both immediate and delayed implantation techniques show similar clinical outcomes . others assert that immediate implantation better preserves the soft tissue and bone architecture , prevents postextraction collapse , limits bone reabsorption , and consequently , minimizes the inherent esthetic losses . in the present case , the surgical and prosthetic plan was designed in advance using surgical planning software , which allowed visualization of the available bone and simulated the implant position . the lack of instrumentation at the surgical bed was crucial for achieving the high insertion torque necessary for primary implant stability . placing a temporary crown over the implant not only enhanced the aesthetic and functional outcomes , but also enabled monitoring of the tissue architecture to ensure a well - fitted cervical design in the final prosthesis . using the buccal crown surface of the extracted tooth was a simple procedure with excellent esthetic results . although this therapeutic strategy did not resolve the preexisting defect in the cervical gingival contour , the clinical result met the expectations of both the clinician and patient . manufacturing a temporary tooth using the natural surface of the extracted tooth was a simple , fast , and low cost procedure that produced an excellent esthetic result . | the present report describes a case of implant loading with an immediate temporary crown .
the buccal crown surface was removed from the extracted tooth to obtain an aesthetically satisfactory result .
after periodontal treatment , tooth 21 appeared proclined and showed grade 3 mobility , indicating the need for its extraction .
the remaining bone was imaged using computed tomography , and virtual surgical planning was performed using these results .
the implant was immediately loaded postextraction into the fresh alveolus without a graft and flap procedure .
the temporary tooth , which was manufactured using the extracted buccal surface , was a simple , fast , and low cost procedure that produced an excellent esthetic outcome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the major obstacle of allogeneic transplantation is the allograft rejection due to mismatched major histocompatibility complex ( mhc ) antigens [ 1 , 2 ] . induction of immune tolerance across mhc barrier is an ideal approach for preventing allograft rejection . it has been demonstrated that steady - state cell apoptosis during self - renewal plays an important role in maintaining immune tolerance to self - antigens [ 3 , 4 ] . in line with this , we have successfully induced immune tolerance to alloantigens between two different mouse strains through injection of ultraviolet b- ( uvb- ) irradiated immature dendritic cells ( uvb - idcs ) and infusion of idcs without uvb irradiation mounts potent immune response to alloantigens [ 5 , 6 ] . using this approach , we were able to significantly prevent graft - versus - host disease in a mouse model of allogeneic hematopoietic stem cell transplantation . however , how this uvb - idc - induced tolerance is maintained remains to be determined . the interaction of programmed death-1 ( pd-1 ) and its ligand ( pd - l1 ) has been proposed to be involved in the modulation of both central and peripheral tolerance . studies showed that pd-1/pd - l1 interaction was required for both induction and maintenance of t cell tolerance [ 810 ] . in an alloantigen tolerance induction model , it was shown that pd-1/pd - l1 plays an important role in maintaining long - term allogeneic tolerance induced by infusion of ethylene carbodiimide - fixed allogeneic splenocytes . in our previous study , we demonstrated a significantly prolonged survival in the recipients receiving bone marrow and spleen cells from donor mice tolerant to alloantigens induced by infusion of uvb - idcs in an allogeneic hematopoietic stem cell transplantation mouse model , suggesting that uvb - idc - induced immune tolerance to allogeneic mhc antigens could be long lasting . in this study , we firstly addressed whether uvb - idcs treatment - induced alloantigen tolerance could be maintained after induction . secondly , we addressed whether pd-1/pd - l1 played a role in maintaining this tolerance . 810-week - old balb / c ( h-2d ) and c3h ( h-2k ) were purchased from charles river animal facility ( beijing , china ) and housed in the animal care facility at xuanwu hospital , capital medical university , beijing . all mice were used following the chinese governmental and capital medical university guidelines for animal welfare . all mice used in this study were euthanized in a co2 chamber with a co2 meter connected to it to control co2 flow as 1.5 l / min . balb / c bone marrow derived immature dendritic cells ( bm - idcs ) were cultured and irradiated by ultraviolet b ( uvb ) ( 1200 mj / cm ) following the protocol we reported previously [ 5 , 6 ] . after being irradiated , idcs would initiate the process of apoptosis because of the dna crosslinking induced by uvb irradiation . in our observation , 6070% of uvb - irradiated idcs underwent apoptosis 8 h after irradiation and almost all cells died 24 h after irradiation . therefore , to avoid infusion of apoptotic cells at different stages of apoptosis , the irradiated idcs were either injected immediately after irradiation or put on ice to stop biological activities of the cells and injected within 2 h. as previously reported [ 5 , 6 ] , c3h male mice received intravenous injection of uvb - irradiated balb / c idcs ( 2 10 cells / mouse ) or pbs once a week for 4 weeks and then plasma anti - donor antibodies were measured by flow cytometry ( fcm , canto , bd ) following the protocol described previously to confirm that the tolerance was successfully induced . six weeks later , we challenged the mice with intravenous injection of 2 10/mouse balb / c spleen cells once a week for two weeks . thereafter , we measured the anti - donor antibody levels using the method we reported previously [ 5 , 6 ] with mild modifications . in brief , the anti - donor antibody assay was a flow cytometric analysis of plasma levels of antibodies against donor cells . donor spleen cells ( 1 10 ) in 60 l of pbs were incubated with 40 l of plasma collected from mice in different experimental groups as indicated and anti - cd4-percp antibodies at room temperature for 30 min . then , the cells were washed twice with pbs and resuspended in 100 l pbs and incubated with secondary antibody , anti - mouse igg - fitc at room temperature for 30 min . samples with anti - mouse igg - fitc staining positive were considered positive for anti - donor antibodies . using cd4 t cell staining to represent spleen cells was for the purpose of eliminating the false positivity caused by fc binding of mouse plasma igg in antigen - presenting cells , mainly b cells . for cd4 + t cell transfer studies , cd4 + t cells from c3h mice from two different groups used for the above experiments were prepared by negative selection with cd4 + t cell isolation kit ( easysep kit ) according to the protocol from the manufacturer ( stemcell biotech ) . 5 10 purified cd4 + t cells were adoptively transferred to nave c3h mice via tail vein injection . after the injection , all recipient c3h mice were challenged with two weekly transfusions of 2 10 balb / c spleen cells . one week after the second challenge , plasma samples were prepared and assayed for antibodies against balb / c wbcs . in the above experiments , the mice were monitored twice a week until the endpoint of the experiments and then euthanized as described in section 2.1 . tolerant c3h mice received balb / c spleen cells ( 1.5 10/mouse ) prelabeled with carboxyfluorescein diacetate succinimidyl ester ( cfse , from invitrogen ) . in the meantime , 100 g of purified anti - mouse pd - l1 mab ( biolegend , clone 10f.9g2 ) or control igg ( rat igg , sigma ) was injected intraperitoneally ( i.p . ) into these mice , respectively . nontolerant nave c3h mice receiving injection of cfse - labeled balb / c spleen cells served as an additional control group . twenty - four hours later , peripheral blood mononuclear cells ( pbmncs ) of all recipient mice were prepared and stained by anti - cd4-percp antibody ( bd bioscience , clone rm4 - 5 ) . the percentage of cfse+cd4 + t cells in total cd4 + t cells served as a readout to demonstrate the acceptance of donor cells . for examining the maintenance of humoral immune tolerance , the tolerant recipient c3h mice 6 weeks after tolerance induction received intravenous injection of balb / c spleen cells ( 2 10/mouse ) along with injection of anti - mouse pd - l1 mab ( 100 g ) or control igg ( 100 g ) , once a week for two weeks . thereafter , plasma samples were prepared and assayed for antibodies against balb / c wbcs as described above . in assessing how pd-1/pd - l1 interaction in tolerant c3h mice affected alloantigen - responding t cells from nave c3h mice , balb / c spleen cells ( 1 10/mouse ) ( as alloantigens ) and cfse - labeled nave c3h spleen cells ( 1 10/mouse ) were injected intravenously ( i.v . ) into tolerant mice with anti - mouse pd - l1 mab ( 100 g / mouse ) or control igg ( 100 g / mouse ) at day 1 and day 3 . nave c3h mice receiving injection of both types of cells served as an additional control . on day 4 , the recipient mice were sacrificed and inguinal lymph node cells were prepared and stained with anti - cd4 and anti - cd8 fluorescent antibodies , and cfse - labeled cd4 + and cd8 + t cell proliferation was examined by flow cytometry and analyzed using fcs express software ( de novo software , vancouver , canada ) . recipient c3h mice were prepared with four weekly infusions of uvb - idcs from balb / c mice or pbs as described above . to assess the maintenance of tolerance , we performed skin transplantation 6 weeks after finishing tolerance induction . syngeneic skin transplantation in balb / c mice was also performed to ensure the success of our surgical procedure . the surgical procedure is as follows : donor skin grafts were from the ears of balb / c mice . the donor ears were surgically removed and placed in pbs on ice and then split and the dorsal flap was retained for transplant . c3h allogeneic and balb / c syngeneic recipient mice were anesthetized and placed in lateral position . the transplant area was wetted with 75% alcohol ; then the hairs were shaved and the operation area was cleaned with alcohol swab . in the area of skin preparation , 1 cm diameter circular flap was surgically removed and placed on the preprepared graft bed . the recipient mice were wrapped by a sterile bandage around the body to completely cover the surgical area and placed in a clean cage . all recipient animals were monitored on a daily basis . at day 6 after transplant , the bandage was removed and the graft was examined for the success of surgery and graft survival . when a graft showed signs of scabbing or contraction , skin graft rejection was considered . all mice in these experiments were euthanized using co2 as described in section 2.1 at the endpoint of the experiment . our previous study showed that four weekly transfusions of uvb - idcs to allogeneic recipient mice induced tolerance to alloantigens . in our allogeneic hematopoietic stem cell transplantation model , it appeared that this tolerance was maintained in the recipient mice 3 months after transplantation . in these experiments , we sought to determine whether this tolerance could be maintained for a period of time after tolerance induction . we followed the same protocol reported previously , but , instead of performing assessment 1 week after the last treatment , we evaluated tolerance 6 weeks after finishing tolerance induction through alloantigen challenge by intravenous injection of allogeneic balb / c spleen cells . we found that c3h mice tolerized by balb / c uvb - idc treatment remained tolerant to alloantigen challenge ( figures 1(a ) , 1(b ) , and 1(c ) ) , whereas nontolerant c3h mice pretreated by injection of pbs developed high - level anti - balb / c antibodies in response to balb / c alloantigen challenge ( figures 1(a ) , 1(b ) , and 1(c ) ) . similar to the results reported previously that cd4 + t cells from the tolerant mice could transfer tolerance , we found that this long - lasting immune tolerance could also be transferred to syngeneic nave c3h mice through adoptive transfer of cd4 + t cells from the tolerant mice , demonstrating that cd4 + t cells from tolerant mice markedly suppressed alloantigen - induced anti - donor antibody development compared to cd4 + t cells transferred from immunized mice ( figures 2(a ) , 2(b ) , and 2(c ) ) . the above findings suggest that uvb - idcs infusion - induced alloantigen immune tolerance can be maintained for long term , and cd4 + t cells play an important role for the maintenance of alloantigen tolerance . to further address the strength and maintenance of alloantigen - specific tolerance induced by uvb - idc treatment , we performed allogeneic skin transplantation in tolerant and pbs - treated c3h mice 6 weeks after tolerance induction . the results shown in figures 3(a ) and 3(b ) demonstrated that skin graft survival was significantly prolonged in tolerant mice compared to nontolerant mice . the skin grafts were eventually rejected from the tolerant recipients ( figure 3(b ) ) , suggesting that the tolerance was not sufficient in sustaining allogeneic skin graft survival in this most difficult organ transplantation model . as expected , syngeneic skin grafts were all survived ( figure 3 ) , indicating no technical difficulty concurring in our skin transplantation experiment . to determine whether pd-1/pd - l1 pathway plays a role in uvb - idc - induced allogeneic tolerance , we employed anti - mouse pd - l1 antibodies to block the pd-1 signaling in the mice with long - lasting tolerance during alloantigen challenge . we intravenously injected fluorescent dye , cfse - labeled balb / c spleen cells into c3h mice tolerant to balb / c alloantigens , with treatment of anti - pd - l1 antibody , or control igg . nontolerant nave c3h mice receiving injection of cfse - labeled balb / c spleen cells served as an additional control . in nontolerant control mice , all cfse - labeled cells were rejected within 24 h after injection ( figures 4(a ) and 4(b ) ) . fair numbers of cfse - labeled cells remained in the tolerant recipient mice receiving control igg treatment , whereas these numbers were significantly reduced upon pd-1/pd - l1 blockade by the treatment of anti - pd - l1 antibodies with a complete rejection in one of three mice ( figures 4(a ) and 4(b ) ) . further , we assessed how pd-1/pd - l1 blockade affected anti - alloantigen antibody development upon alloantigen challenge . we showed that tolerant mice receiving control igg treatment failed to develop any levels of anti - alloantigen antibodies upon alloantigen challenge ( figures 5(a ) and 5(b ) ) . however , tolerant mice receiving anti - pd - l1 treatment developed relatively high levels of anti - alloantigen antibodies , which nonetheless were still lower than nontolerant mice challenged with alloantigens based on mean fluorescent intensity ( mfi ) ( figure 5(c ) ) . this result is consistent with the result shown above that there were still certain numbers of cfse - labeled cells remaining in some of tolerant mice receiving anti - pd - l1 treatment ( figures 4(a ) and 4(b ) ) . these findings suggest that pd-1/pd - l1 plays an important role in maintaining alloantigen tolerance in the tolerant mice . the results shown above suggest that tolerant t or b cells can be reinvigorated by alloantigen stimulation under pd-1/pd - l1 blockade . it is of interest to learn whether pd-1/pd - l1 interaction is essential in tolerant mice for controlling alloantigen - responding t cells that potentially arise later and never experience alloantigens . those t cells could lead to allograft rejection or graft - versus - host disease if left unchecked in allogeneic transplantation . to assess whether pd-1/pd - l1 in those alloantigen tolerant mice keeps the alloantigen - responding t cells in check , we adoptively transferred cfse - labeled nave c3h spleen cells ( syngeneic ) along with balb / c spleen cells ( alloantigen ) to the tolerant c3h mice or nave c3h mice . thereafter , anti - pd - l1 or control igg was administered to two groups of tolerant mice at day 1 and day 3 , respectively . four days later , we sacrificed the mice and prepared cells from inguinal lymph nodes and assessed the proliferation of injected cfse - labeled c3h syngeneic cd4 + and cd8 + t cells not preexperiencing alloantigen , in response to injected balb / c spleen cells ( alloantigen ) in vivo . in comparison to control igg - treated mice , cd4 + and cd8 + t cell proliferation in response to in vivo alloantigen stimulation was significantly enhanced in anti - pd - l1 treated mice , which was similar to the t cell proliferation levels in nave recipient mice ( figure 6 ) . the above findings indicate that , in tolerant mice , pd-1/pd - l1 interaction plays an important role in keeping potentially arising alloantigen - responding t cells in check and preventing them from being activated . we previously reported that transfusion of uvb - idcs was able to induce immune tolerance across mhc barriers and this tolerance was associated with regulatory cd4 + t cells [ 5 , 6 ] . however , it is unknown whether this tolerance state can be maintained for long term , which is highly desirable for allogeneic transplantation . in the present study , we assessed the tolerance maintenance 6 weeks after finishing tolerance induction . we found that tolerant mice failed to produce any levels of antibodies against alloantigens upon two weekly alloantigen challenges ( figure 1 ) . these results are the same as those observed in the tolerant mice undergoing alloantigen challenge immediately after tolerance induction . these findings suggest that uvb - idc infusion - induced alloantigen tolerance could be maintained for at least 6 weeks after tolerance induction without any loss . consistent with these results , we also observed that the tolerant mice failed to reject the intravenously injected cfse - labeled traceable balb / c allogeneic spleen cells , which were completely rejected in nontolerant nave mice ( figure 4 ) through flow cytometric assessment of peripheral blood . in addition , we found those injected cfse - labeled allogeneic spleen cells homed to host lymph nodes and spleen in tolerant mice , which did not take place in nontolerant mice ( data not shown ) . this tolerance assessment is a sensitive assay for evaluating allogeneic tolerance in vivo by looking at cfse - labeled cells in the peripheral blood and could be a feasible method for future clinical evaluation of immune tolerance in allogeneic transplantation patients . allogeneic skin transplantation is usually employed to test allogeneic tolerance . to assess whether tolerant mice 6 weeks after tolerance induction were able to accept allogeneic skin grafts , we performed allogeneic skin transplantation in tolerant and nontolerant mice . it is noted that , without any immunosuppression , the survival of allogeneic skin grafts was significantly prolonged in tolerant mice in contrast to that in nontolerant mice ( figure 3 ) . these data further support that uvb - idc - induced alloantigen tolerance is quite strong and durable . we demonstrated previously that , among cd4 + t cells in tolerant mice , there were significantly increased il-10-producing and foxp3 + regulatory t cells , which may play a crucial role in maintaining tolerance . in the current study , we assessed whether cd4 + t cells in the mice with long - lasting tolerance remained functioning to maintain immune tolerance to alloantigens . we found that the tolerance was transferrable with adoptive cd4 + t cell transfer to syngeneic nave recipient mice , showing that mice receiving cd4 + t cells from tolerant mice failed to produce antibodies against alloantigens upon alloantigen challenge ( figure 2 ) . interestingly , the results shown in figures 1 and 2 are quite similar , indicating that cd4 + t cells exert critical effect on tolerance maintenance . those cd4 + t cells with regulatory function are likely to be foxp3 + tregs and il-10-producing tr1 cells [ 5 , 12 ] . pd-1/pd - l1 interaction has been considered playing an essential role in maintaining peripheral tolerance [ 7 , 8 , 13 , 14 ] . blocking pd-1/pd - l1 interaction can drastically accelerate allograft rejection [ 1517 ] . it was also reported that pd-1/pd - l1 interaction is crucial for maintaining anti - cd3 treatment - induced immune tolerance to islet cell antigens in nonobese diabetic mouse model . administration of ethylene carbodiimide- ( ecdi- ) fixed allogeneic splenocytes failed to induce alloantigen tolerance in pd - l1 deficient mice , suggesting that pd-1/pd - l1 is required for alloantigen tolerance induced by ecdi - treated allogeneic splenocytes . in the current study , we were interested in learning whether pd-1/pd - l1 was required for maintaining alloantigen tolerance induced by uvb - idc treatment . we employed our reliable and reproducible methods and tested the influence of pd-1/pd - l1 blockade by anti - pd - l1 antibodies on immune tolerance to alloantigens upon alloantigen challenge . we showed that pd-1/pd - l1 blockade by anti - pd - l1 antibodies significantly promoted the rejection of infused cfse - labeled allogeneic spleen cells ( figure 4 ) compared to control igg antibody - treated tolerant mice . as expected , the nontolerant nave mice completely rejected the infused cfse - labeled allogeneic spleen cells . in line with this finding , the levels of antibodies against alloantigens in response to alloantigen challenge in tolerant mice were largely recovered by the treatment of anti - pd - l1 antibodies but failed to reach the levels of nontolerant nave mice challenged with alloantigens ( figure 5 ) . the above findings indicate that pd-1/pd - l1 interaction actively participates in maintaining allogeneic tolerance induced by uvb - idc treatment . incomplete recovery of immune response to alloantigen challenge might be attributed to incomplete blockade of pd-1/pd - l1 interaction because we only utilized one dose ( 100 g / mouse ) , which might not be the optimal dose to completely block pd-1/pd - l1 interaction . a dose study for anti - pd - l1 antibodies or pd - l1 deficient mouse model may be needed to address whether pd-1/pd - l1 is the only factor to be involved in maintaining the tolerance induced by uvb - idc treatment . finally , we investigated how the tolerance state in tolerant mice affected alloantigen - responding t cells that never experienced alloantigens and whether pd-1/pd - l1 interaction was also involved in this process . we injected cfse - labeled syngeneic spleen cells from nave c3h mice into tolerant c3h recipients to serve as responder cells , with simultaneous injection of allogeneic balb / c spleen cells as allogeneic stimulators . one group was treated with anti - pd - l1 antibodies and the other group received control igg treatment . as shown in figure 6 , blockade of pd-1/pd - l1 interaction significantly increased the proliferation of injected cfse - labeled cd4 + and cd8 + t cells , suggesting that pd-1/pd - l1 plays an important role in keeping alloantigen - responding t cells in check . this effect may be through induced alloantigen - specific regulatory t cells as described in our previous study . our data show that cd4 + t cells from uvb - idc - treated mice express higher levels of pd-1 ( supplemental figure 1 , in supplementary material available online at http://dx.doi.org/10.1155/2016/2419621 ) , and those cd4 + t cells might gain regulatory function . thus , uvb - idc treatment - induced alloantigen - specific regulatory t cells may control the potential alloantigen - specific effector t cells through pd-1/pd - l1 interaction [ 20 , 21 ] . collectively , the present study demonstrates that uvb - idc infusion - induced allogeneic immune tolerance is long lasting , and pd-1/pd - l1 interaction plays an important role in the maintenance of immune tolerance . | our previous study demonstrated that transfusion of ultraviolet b - irradiated immature dendritic cells ( uvb - idcs ) induced alloantigen - specific tolerance between two different strains of mice . programmed death-1
( pd-1 ) and programmed death ligand-1 ( pd - l1 ) have been suggested to play an important role in maintaining immune tolerance . in the present study
, we seek to address whether pd-1/pd - l1 plays a role in the maintenance of uvb - idc - induced tolerance .
we first observe that the uvb - idc - induced alloantigen - specific tolerance can be maintained for over 6 weeks .
supporting this , at 6 weeks after tolerance induction completion , alloantigen - specific tolerance is still able to be transferred to syngeneic nave mice through adoptive transfer of cd4 + t cells .
furthermore , skin transplantation study shows that the survival of allogeneic grafts is prolonged in those tolerant recipients .
further studies show that pd-1/pd - l1 interaction is essential for maintaining the induced tolerance as blockade of pd-1/pd - l1 by anti - pd - l1 antibodies largely breaks the tolerance at both cellular and humoral immunological levels .
importantly , we show that pd-1/pd - l1 interaction in tolerant mice is also essential for controlling alloantigen - responding t cells , which have never experienced alloantigens .
the above findings suggest that pd-1/pd - l1 plays a crucial role in maintaining immune tolerance induced by uvb - idcs , as well as in actively controlling effector t cells specific to alloantigens . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
short - term urinary incontinence is a major cause of morbidity associated with both the open and standard robotic / laparoscopic radical prostatectomy . although fewer than 510% of patients have long - term effects after one year , the incidence of early post - operative incontinence varies widely , with 4476% of patients requiring two or more pads per day at three months [ 13 ] . despite the transient nature in most cases , quality - of - life studies have revealed that short - term incontinence is severely bothersome to most men . recent studies have attempted to preserve early continence by anatomically restoring the urethral vesical junction [ 59 ] . although early data suggests that some of these techniques may improve early urinary control , some are technically demanding and may prolong operative times for less experienced surgeons . the most effective and efficient method to improve early return of urinary control following ralp remains to be established . in an effort to improve short - term urinary control we developed a simplified approach to combined posterior reconstruction and anterior suspension using a single anastomotic stitch ( prass ) . herein , we prospectively evaluated recovery of urinary control in a single - surgeon - series of patients undergoing prass and compared them with a cohort who underwent standard ralp . following approval from the uci internal review board , data were collected prospectively by patient reported self - administered questionnaires obtained during preoperative and three month post - operative visits following ralp . all cases were performed by a single surgeon ( dko ) between november 2003 and may 2008 . in the first 231 procedures the urethral vesical anastomosis was completed using the standard van velthovan stitch as previously described without any additional anti - incontinence procedures . in july of 2007 , fifty consecutive patients were evaluated ( case # 275324 ) and compared with 50 consecutive patients who underwent standard ralp ( control group ; case # 182231 ) . baseline patient characteristics are shown in table 1 . at three months , follow - up data were available for 39 patients ( 78% ) in the control group and 35 patients ( 70% ) in the prass group . follow - up data were not available for 11 control and 15 prass patients because these patients had returned to their local urologist for follow - up care . there was no significant difference in baseline characteristics of the patients with and without three month follow - up data.table 1baseline characteristic of ( a ) patients with and without three months follow - up data and ( b ) patients in the control and prass groupspatient with 3 month follow - up datapatients without 3 month follow - up data
p - value
n
mean
n
mean(a ) age ( years)7263.52862.30.45bmi6628.22728.40.79prostate volume ( cc)5852.92150.40.66shim pre - surgery7119.72818.60.64aua ss pre - surgery719.72811.60.32epic sum at baseline727.6246.90.36controlprass
p value(b ) age ( years)63.862.60.41bmi29.828.60.53prostate volume ( cc)53.051.40.75pre - surgery shim20.518.30.32pre - surgery auass10.79.80.57pre - surgery epic sum7.67.30.64nerve sparing ( % ) 70701.0positive margins ( % ) 11.612.50.9 baseline characteristic of ( a ) patients with and without three months follow - up data and ( b ) patients in the control and prass groups baseline patient characteristics ( age , aua symptom score , shim score , nerve sparing procedure , bmi , prostate weight , positive surgical margin rate ) were analyzed to assess for preoperative differences between groups ( table 1 ) . post - operative continence was evaluated by using questions 15 from the epic-26 questionnaire : over the past 4 weeks how often have you leaked urine?which of the following best describes your urinary control during the last 4 weeks?how many pads or adult diapers per day did you usually use to control leakage?how big a problem if any has dripping or leaking urine been for you during the last 4 weeks?overall , how big a problem has urinary function been for you during the last 4 weeks ? over the past 4 weeks how often have you leaked urine ? which of the following best describes your urinary control during the last 4 weeks ? how many pads or adult diapers per day did you usually use to control leakage ? how big a problem if any has dripping or leaking urine been for you during the last 4 weeks ? overall , how big a problem has urinary function been for you during the last 4 weeks ? all responses were scored from a low of one for a favorable response ( e.g. , no problem ) to a high of four or five for an unfavorable response ( e.g. , significant problem ) . response codes were thus reversed for questions 1 and 2 and modified to range from 14 and 15 for questions 3 and 4a , respectively , rather than 03 or 4 . a weighted sum of all responses was calculated so that the highest score ( 4 or 5 ) received equal weight for each question . data were compared between groups at baseline and at three month follow - up using two - group t - tests for continuous variables and pearson s chi - squared tests for categorical variables . unadjusted epic summary scores were compared between groups using two - group t - tests . to adjust for possible baseline differences in individuals and to adjust for co - variables independently associated with return to continence , repeated measures analysis of variance model was used . epic summary score at baseline and at three month follow - up were used as the within - group repeated measure . independent covariates which are constant across trials included age , nerve sparing , baseline aua symptom scores , and shim scores . a significant difference between surgical groups in the time by group interaction reflects a difference in the change in continence over time between the two groups . using a repeated measures analysis of variance model , we tested for differences between surgical groups in change in continence from baseline to the three month follow - up time point . epic summary score was the within - group repeated measure and surgical procedure was the grouping factor . age , pre - surgery aua symptoms scores , and pre - surgery shim scores were found to be significantly correlated with continence at three months as assessed using the epic summary score . thus these covariates were included in the final repeated measures model to increase precision and adjust for any initial imbalances between groups related to these factors . nerve sparing , bmi , and prostate volume were not significantly correlated with continence at three months and were excluded from the multivariate and repeated measures model . baseline patient characteristics ( age , aua symptom score , shim score , nerve sparing procedure , bmi , prostate weight , positive surgical margin rate ) were analyzed to assess for preoperative differences between groups ( table 1 ) . post - operative continence was evaluated by using questions 15 from the epic-26 questionnaire : over the past 4 weeks how often have you leaked urine?which of the following best describes your urinary control during the last 4 weeks?how many pads or adult diapers per day did you usually use to control leakage?how big a problem if any has dripping or leaking urine been for you during the last 4 weeks?overall , how big a problem has urinary function been for you during the last 4 weeks ? over the past 4 weeks how often have you leaked urine ? which of the following best describes your urinary control during the last 4 weeks ? how many pads or adult diapers per day did you usually use to control leakage ? how big a problem if any has dripping or leaking urine been for you during the last 4 weeks ? overall , how big a problem has urinary function been for you during the last 4 weeks ? all responses were scored from a low of one for a favorable response ( e.g. , no problem ) to a high of four or five for an unfavorable response ( e.g. , significant problem ) . response codes were thus reversed for questions 1 and 2 and modified to range from 14 and 15 for questions 3 and 4a , respectively , rather than 03 or 4 . a weighted sum of all responses was calculated so that the highest score ( 4 or 5 ) received equal weight for each question . data were compared between groups at baseline and at three month follow - up using two - group t - tests for continuous variables and pearson s chi - squared tests for categorical variables . unadjusted epic summary scores were compared between groups using two - group t - tests . to adjust for possible baseline differences in individuals and to adjust for co - variables independently associated with return to continence , repeated measures analysis of variance model was used . epic summary score at baseline and at three month follow - up were used as the within - group repeated measure . independent covariates which are constant across trials included age , nerve sparing , baseline aua symptom scores , and shim scores . a significant difference between surgical groups in the time by group interaction reflects a difference in the change in continence over time between the two groups . using a repeated measures analysis of variance model , we tested for differences between surgical groups in change in continence from baseline to the three month follow - up time point . epic summary score was the within - group repeated measure and surgical procedure was the grouping factor . age , pre - surgery aua symptoms scores , and pre - surgery shim scores were found to be significantly correlated with continence at three months as assessed using the epic summary score . thus these covariates were included in the final repeated measures model to increase precision and adjust for any initial imbalances between groups related to these factors . nerve sparing , bmi , and prostate volume were not significantly correlated with continence at three months and were excluded from the multivariate and repeated measures model . baseline patient characteristics ( age , aua symptom score , shim score , nerve sparing procedure , bmi , prostate weight , positive surgical margin rate ) were analyzed to assess for preoperative differences between groups ( table 1 ) . post - operative continence was evaluated by using questions 15 from the epic-26 questionnaire : over the past 4 weeks how often have you leaked urine?which of the following best describes your urinary control during the last 4 weeks?how many pads or adult diapers per day did you usually use to control leakage?how big a problem if any has dripping or leaking urine been for you during the last 4 weeks?overall , how big a problem has urinary function been for you during the last 4 weeks ? over the past 4 weeks how often have you leaked urine ? which of the following best describes your urinary control during the last 4 weeks ? how many pads or adult diapers per day did you usually use to control leakage ? how big a problem if any has dripping or leaking urine been for you during the last 4 weeks ? overall , how big a problem has urinary function been for you during the last 4 weeks ? all responses were scored from a low of one for a favorable response ( e.g. , no problem ) to a high of four or five for an unfavorable response ( e.g. , significant problem ) . response codes were thus reversed for questions 1 and 2 and modified to range from 14 and 15 for questions 3 and 4a , respectively , rather than 03 or 4 . a weighted sum of all responses was calculated so that the highest score ( 4 or 5 ) received equal weight for each question . data were compared between groups at baseline and at three month follow - up using two - group t - tests for continuous variables and pearson s chi - squared tests for categorical variables . unadjusted epic summary scores were compared between groups using two - group t - tests . to adjust for possible baseline differences in individuals and to adjust for co - variables independently associated with return to continence , repeated measures analysis of variance model was used . epic summary score at baseline and at three month follow - up were used as the within - group repeated measure . independent covariates which are constant across trials included age , nerve sparing , baseline aua symptom scores , and shim scores . a significant difference between surgical groups in the time by group interaction reflects a difference in the change in continence over time between the two groups . using a repeated measures analysis of variance model , we tested for differences between surgical groups in change in continence from baseline to the three month follow - up time point . epic summary score was the within - group repeated measure and surgical procedure was the grouping factor . age , pre - surgery aua symptoms scores , and pre - surgery shim scores were found to be significantly correlated with continence at three months as assessed using the epic summary score . thus these covariates were included in the final repeated measures model to increase precision and adjust for any initial imbalances between groups related to these factors . nerve sparing , bmi , and prostate volume were not significantly correlated with continence at three months and were excluded from the multivariate and repeated measures model . after adjusting for age and baseline aua symptom score and shim score , subjects who received the prass procedure had significantly better urinary control at three months . 90.9% of patients in the prass group required one or fewer pads per day compared with 48.2% in the control group ( p = 0.014 , table 2 ) . of patients undergoing ralp with the prass procedure 42% were pad - free at three months compared with only 20.6% of patients undergoing standard ralp ( p = 042).table 2multivariate analysis results comparing ( a ) 01 pads per day and 0 pads per day ( epic question 3 ) in prass and control ( ralp ) groups at three months post - prostatectomy after controlling for age , and baseline aua and shim scores , and ( b ) epic sum score results adjusted for baseline epic score , age , baseline aua symptom score , and baseline shim scorepercent using 01 pads ( % )
p - value(a ) control42.80.014prass90.9percent using 0 pads ( % ) control20.60.042prass42.0group
n
meanse
p - value(b ) standard group ( control)3416.00.890.013prass3712.80.85 multivariate analysis results comparing ( a ) 01 pads per day and 0 pads per day ( epic question 3 ) in prass and control ( ralp ) groups at three months post - prostatectomy after controlling for age , and baseline aua and shim scores , and ( b ) epic sum score results adjusted for baseline epic score , age , baseline aua symptom score , and baseline shim score the unadjusted epic score at three months was not statistically different between the prass and ralp groups ( p - value 0.96 ) however , when adjusted for baseline epic score , age , aua symptom score at baseline , and shim at baseline the difference was statistically different ( p - value 0.013 ; table 2b ) . there were no clinically significant urine leaks or early bladder neck contractures in either of the groups . in all patients two patients ( 4% ) in the prass group developed urinary retention that resolved after reinsertion of the foley catheter for one week . urinary incontinence is a major health related quality - of - life concern for patients undergoing open or robotic / laparoscopic radical prostatectomy . immediately following a radical prostatectomy estimates of patients experiencing incontinence vary widely from 8 to 47% [ 2 , 3 ] . after approximately 1218 months the majority of these patients will have regained urinary continence [ 1 , 11 ] . despite favorable long - term outcomes , the duration until full recovery of continence is a significant concern to patients . quality - of - life studies suggest that even early transient incontinence itself is more bothersome to patients than impotence . urodynamic studies have demonstrated post - prostatectomy incontinence to be primarily because of intrinsic sphincteric deficiency [ 1216 ] . multiple attempts have been made to modify walsh s anatomic radical prostatectomy to prevent injury to , or to repair , the rhabdo - urinary sphincter . rocco and coworkers described a technique for reconstruction of the posterior musculofascial plate and recreation of the pre - existing continuity between the denonvilliers fascia and the posterior rhabdosphincter . the rationale for this maneuver is to provide support to the urethra and restore it to a more anatomic position . in follow - up , the group undergoing the posterior reconstruction had a significantly higher continence rate , defined as 01 pads per day , compared with a historical group undergoing a standard walsh prostatectomy at 3 days ( 62.4 vs. 14% ) , 30 days ( 74 vs. 30% ) , and 90 days ( 85.2 vs. 46% ) , p < 0.001 . a follow - up report in 2007 also showed that this technique is feasible by a laparoscopic approach , demonstrating improvements in urinary control at 30 days , with 83.8% of patients with reconstruction having control versus 32.3% of those undergoing a standard laparoscopic prostatectomy ( p = 0.0001 ) . in 2008 , nguyen et al . obtained similar good results for patients undergoing either laparoscopic or robotic prostatectomy . in this series , urethral length was restored to 89% of its baseline compared with 78% without the posterior reconstruction , providing objective data to explain the improvement in continence rates . in 2008 tewari and coworkers evaluated a group of patients undergoing anterior reconstruction alone versus anterior and posterior reconstruction versus a historical control group and found that both types of reconstruction were significantly better than no reconstruction in terms of time to continence , defined as 0 pads per day or a single pad for security reasons only . at three months , the control group had a continence rate of 50% whereas the anterior reconstruction group and the combined anterior and posterior reconstruction groups had a continence rate of 77 and 91% , respectively , at three months . a much more extensive reconstruction was used in this study than that described here , with multiple interrupted sutures used to reapproximate the posterior urethral plate and a running suture used to reapproximate the arcus tendineus and puboprostatic plate to the bladder neck . interestingly , a prospective randomized study by menon et al . in 2008 found there was no difference in early continence ( < 30 days ) between patients undergoing ralp with periprostatic tissue reconstruction and those undergoing a standard single - layer anastamosis . in this study we compared the continence rates at three months in two groups of patients undergoing ralp one with a posterior reconstruction and anterior suspension with single anastomotic suture ( prass ) and a cohort without these modifications . unlike previous studies with anterior and/or posterior repairs requiring extensive reconstruction and multiple sutures the posterior repair was performed by using the initial passes of the van velthoven suture consisting of 2 3 - 0 monocryl sutures to reapproximate the posterior rhabodosphincter of the urethra ( fig . the anterior suspension stitch was performed at the end of the urethral vesical anastomosis . after the anastomosis was completed and tied , one of the two arms of the van velthoven suture was used to suspend the urethra from the posterior side of the pubic symphysis . the stitch was secured with a single lapra - ty ( ethicon ) clip ( fig . 1b).fig . a the posterior repair is performed by using the initial passes of the van velthoven suture to reapproximate the posterior rhabodosphincter of the urethra . b the anterior reconstruction is performed by using one of the two arms of the van velthoven suture to suspend the urethra from the posterior side of the pubic symphysis . the stitch was secured with a single lapra - ty ( ethicon ) clip illustrations showing the prass reconstruction . a the posterior repair is performed by using the initial passes of the van velthoven suture to reapproximate the posterior rhabodosphincter of the urethra . b the anterior reconstruction is performed by using one of the two arms of the van velthoven suture to suspend the urethra from the posterior side of the pubic symphysis . the stitch was secured with a single lapra - ty ( ethicon ) clip in our study , multivariate analysis demonstrated that , after adjusting for age and baseline aua symptoms scores and shim scores , subjects who underwent prass repair had significantly improved urinary control at three months compared with those undergoing a standard ralp . ninety - one percent ( 90.9% ) of the patients undergoing the prass repair were using 01 pad per day at three months versus 48.2% in the control group ( p = 0.014 ) . this continence rate is comparable with that described by other groups using more extensive reconstructions , both posterior alone and anterior and posterior . the mechanism of improved continence with our technique is restoration of the anatomic configuration of the urethra created with the anterior and posterior reinforcement , as has been successfully done with other , more extensive reconstructions . this eliminates multiple knots making it simpler and therefore potentially quicker and more available to less experienced surgeons compared with similar , previously described , techniques . a potential limitation of our study is that it is a case - controlled study rather than a prospective randomized trial . we believe that three months is a relevant time point and that longer follow - up will not alter the conclusions of this report because , in general , once men regain continence following surgery they do not lose it again . of course longer term follow - up is needed to determine the true , long term continence rate . in addition , all the men in the prass group underwent both an anterior and a posterior repair , making it hard to determine the impact of either the anterior or posterior stitch alone . this is similar to findings in other studies in which reconstruction of any kind was superior to no reconstruction . men in our study have not undergone urodynamic studies which could be an objective method to measure continence , avoiding the problems inherent to any questionnaire . last , imaging studies such as mri could be used to evaluate the impact of our repair on factors such as urethral length . despite these potential limitations , this technique does show considerable promise for improving the time to continence in men undergoing robot - assisted laparoscopic prostatectomy . our technique is simple and easy to perform and has resulted in a significant improvement in continence three months following ralp . we have developed a novel , simplified technique for reconstruction of the anterior and posterior support of the urethra to improve time to continence in men undergoing robotic - assisted laparoscopic prostatectomy . patients who had posterior reconstruction and anterior suspension with single anastomotic suture ( prass ) had higher continence rates at three months using this procedure . | post - prostatectomy urinary incontinence is a major cause of morbidity from radical prostatectomy .
efforts have been made to develop techniques to hasten return of urinary control .
several authors have demonstrated improved early continence with anterior , posterior , or combined reconstruction of the urethral pelvic attachments . in this study , we compare three - month urinary function and continence data for patients who underwent ralp with posterior reconstruction and anterior suspension with single anastomotic suture ( prass ) .
a prospective cohort of 50 patients underwent ralp with prass reconstruction and were compared to 50 control patients who underwent standard ralp .
continence was defined as use of 01 urinary pads and was evaluated at each follow - up visit using the epic-26 questionnaire .
a weighted summary score was created and group differences were compared using a repeated measures analysis of variance model . after adjusting for age , baseline aua symptom score , and shim scores , which were found to correlate with continence , patients who underwent the prass reconstruction had significantly improved urinary control at three months compared with the control group ; 90.9% of the patients in the prass group wore 01 pads per day versus 48.2% in the control group ( p = 0.014 ) . of the patients undergoing the standard
prostatectomy 20.6% were totally pad - free compared with 42% of the patients undergoing the prass procedure ( p = 0.042 ) . in conclusion , the prass technique resulted in statistically significant improvement in urinary control three months post - operation .
the prass reconstruction is technically straightforward , requires no additional sutures , and is a simple technique that is easily learned and adaptable to other robotic surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we report a 45-year - old man with systemic lymphoma whose initial manifestation was sudden - onset leukoencephalopathy , mimicking stroke . this patient , who was eventually diagnosed with diffuse large b - cell lymphoma , initially presented with sudden cognitive impairment and gait disturbance . the presented case indicates that diffuse large b - cell lymphoma may initially appear as a treatable leukoencephalopathy . lymphoma and leukemia are systemic diseases that affect many organs , including the central nervous system ( cns).1 these cancers may affect the cns directly via the production of intraparenchymal or extra - axial mass lesions , or meningeal infiltration , or indirectly by coagulopathy , metabolic disturbance , or paraneoplastic antibody production.1 atypical infections , such as john cunningham ( jc ) virus or toxoplasmosis , can lead to the development of brain lesions in lymphoma patients.2 paraneoplastic leukoencephalopathy as an initial manifestation of systemic malignancy is rare , but several reports have described its intriguing clinical course and possible pathomechanism.3,4 although biopsy sampling is mandatory for a definitive diagnosis , it is often impossible to perform due to the location or size of the lesion , or patient refusal . the recent considerable progress in imaging technologies has provided a noninvasive modality for assessing intracranial lesions in lymphoma patients . we present herein a case of a man with sudden gait disturbance and cognitive impairment who was initially diagnosed with cerebral infarction , but was subsequently diagnosed with paraneoplastic encephalopathy associated with systemic lymphoma . a 48-year - old man was admitted to our hospital due to sudden gait disturbance . one month prior to the admission , he suddenly began to experience difficulty performing simple calculations and dressing himself . he had worked as a tax accountant for 20 years . this patient visited a local hospital , where he was diagnosed with cerebral infarction and treated with anticoagulation therapy ; no relevant disease , medication , smoking , or alcohol history was noted . he had lost 8 kg in the 6 months prior to this event , and he was easily fatigued and experienced night sweating and general weakness . he was apathetic , showed right / left disorientation , and had difficulty performing simple calculations and writing . cognitive functioning was assessed using the mini - mental state examination ( mmse ) , on which he scored 18 points out of a possible 30 ; he lost 5 points on the calculation item , 3 points on memory recall , 2 points on time orientation , 1 point on writing , and 1 point on the interlocking pentagons item . his motor power was symmetric and preserved in all four extremities , but all muscles were moderately hypertonic . he showed symmetric and intact responses to all sensory stimuli and his cortical senses were intact . the patient 's blood pressure was 107/75 mmhg , and his heart rate was 90 beats / min . brain mri showed multiple lesions with high signal intensity in the white matter of the bilateral hemisphere on fluid - attenuated inversion recovery and diffusion - weighted imaging ( dwi ) , and magnetic resonance angiography showed normal intracerebral and carotid arteries ( fig . 1a ) . apparent diffusion coefficient ( adc ) mapping and enhanced t1-weighted imaging were not included in the mri analyses . blood test results showed increased liver enzymes , but serology findings were negative for hepatitis b and c viruses , the venereal disease research laboratory test , and human immunodeficiency virus . a coagulation panel disclosed normal prothrombin and activated partial thrombin times , but the levels of c and s proteins were markedly decreased , ranging from only 30% of the normal value . he was negative for serum autoantibodies , including antinuclear antibody , lupus anticoagulant , and antineutrophil cytoplasmic antibody . this revealed multiple ill - defined , low - attenuation lesions , and multifocal , patchy , arterial , high - attenuation lesions in both lobes of the liver , with splenomegaly and bilateral adrenal gland enlargement , suggesting lymphoma . brain mri performed 4 weeks after the initial mri showed enlargement of multifocal confluent subcortical lesions , with increased signal on adc maps , suggesting an inflammatory lesion such as demyelinating disease , rather than an acute infarction ( fig . whole - body 18f - fluorodeoxyglucose ( fdg ) and positron - emission tomography ( pet ) revealed multiple hypermetabolic lesions in the bilateral adrenal glands , liver , and lymph nodes , as shown in fig . a lumbar puncture study was performed to exclude cns infection or leptomeningeal involvement of lymphoma . this showed normal opening pressure with a clear color , and two white blood cells were found , with markedly increased levels of protein ( 191.2 mg / dl ) and glucose ( 92 mg / dl ; serum glucose , 136 mg / dl ) . polymerase chain reaction studies against viral genes , including human herpes virus types 1 - 6 and jc virus were all negative . there was no evidence of tuberculosis , lyme disease , or fungal infection in staining and culture studies of a lumbar puncture specimen . the presence of paraneoplastic autoantibodies was not evaluated and a biopsy of the brain lesion was not undertaken . the patient was diagnosed with paraneoplastic leukoencephalopathy due to diffuse large b - cell lymphoma and was treated with systemic chemotherapy , including cyclophosphamide , doxorubicin , vincristine , and prednisone . his cognitive impairment and gait disturbance gradually improved over the next 2 months , he regained the ability to calculate and write letters , his mmse score improved to 28 , and he regained the ability to walk and to articulate when speaking . the final brain mri showed that the extent of the lesion had markedly decreased ( fig . this case signifies the diversity of cns manifestations , which include cerebral infarction , lymphoma invasion , atypical infectious encephalitis , and paraneoplastic encephalopathy,1,2,5,6 in a patient with systemic lymphoma . the presenting sudden - onset focal neurologic deficit and high - signal - intensity lesion on dwi suggested an initial diagnosis of cerebral infarction . the combined systemic symptoms , including progressive weight loss , night sweating , and general weakness , were suggestive of systemic disease , but they were neglected . it is unlikely that a patient with cerebral infarction would have a progressive clinical course after symptom onset and slow - growing lesions on brain mri . it is therefore highly unlikely that this lesion was the result of acute infarction given that the latter exhibits a high signal value on dwi and a low adc value during the acute stage as a result of isotropically restricted water diffusion by cytotoxic edema.7 brain lymphoma usually presents as a single or multiple enhancing lesions in immunocompetent patients.8 however , intravascular infiltration of large b - cell lymphoma shows different mri findings , typically involving the white matter , with minimal enhancement after contrast administration and little mass effect , and is typically referred to as intravascular lymphomatosis.5 it has been reported that the adc values of cns lymphomas are lower than those of other intracerebral tumors and are close to those seen in acute infarction.9 intravascular infiltration of large b - cell lymphoma shows low adc values due to combined ischemic brain injuries.10 however , this patient had a lesion with high signal values on adc mapping . fdg pet allows the evaluation of metabolic activity and provides additional information that aids in the differentiation between lymphoma and nonneoplastic conditions , including cns lymphoma.11 the brain lesion in our patient did not show increased metabolism , suggesting that it was not neoplastic . cytologic evaluation of repeated lumbar puncture specimens did not show malignant cells , and the protein level was markedly increased , suggesting an active inflammatory or demyelinating process . lumbar puncture specimens were checked repeatedly for the presence of viral genes , and the results were consistently negative against jc virus and other infectious pathogens . the findings of brain mri , fdg pet , and lumbar puncture studies strongly suggested that the brain lesion in our patient did not involve direct lymphoma invasion or infectious disease , but rather resulted from an active inflammatory disease such as demyelinating encephalopathy . our patient showed a good response to systemic chemotherapy , suggesting paraneoplastic leukoencephalopathy as the most probable diagnosis . there have been a few reported cases of combined demyelinating cns lesions in patients with systemic malignancy.3,4 there has been one report of diffuse encephaloradiculopathy involving the cerebrum , brainstem , cerebellum , and peripheral nerves in a patient with silent hepatocellular carcinoma.3 tumor - associated immunological interruption was suggested as a possible mechanism underlying diffuse demyelination of the nervous system.3 another case report describes acute multifocal cns demyelination as the initial presentation of lung adenocarcinoma without cns metastasis.4 the pathomechanism may involve paraneoplastic autoantibodies or immunomodulation by the malignancy itself and/or by treatment . brainstem or temporal lobar involvement in systemic malignancy is more commonly reported than cerebral white - matter involvement , a condition known as limbic encephalitis , which is often associated with several autoantibodies , including the anti - hu antibody.4 however , self - limiting , acute , disseminated encephalomyelitis can not be excluded as a possible diagnosis in this case.12 the findings of this case suggest that systemic lymphoma involves the cns in the form of paraneoplastic encephalopathy . it must be differentiated from cerebral infarction , direct lymphoma invasion , and atypical infection in order to determine the therapeutic plan and accurately forecast the prognosis . this case also suggests that systemic malignancy must be considered in the differential diagnosis of young patients with sudden - onset neurological deficits due to brain lesions involving multifocal white matter . | backgroundsystemic lymphoma can be difficult to recognize due to its diverse manifestations .
paraneoplastic leukoencephalopathy has rarely been reported in the context of lymphoma.case reportwe report a 45-year - old man with systemic lymphoma whose initial manifestation was sudden - onset leukoencephalopathy , mimicking stroke .
this patient , who was eventually diagnosed with diffuse large b - cell lymphoma , initially presented with sudden cognitive impairment and gait disturbance .
radiological studies suggested a paraneoplastic leukoencephalopathy .
chemotherapy for lymphoma resulted in clinical and radiological improvement.conclusionsthe presented case indicates that diffuse large b - cell lymphoma may initially appear as a treatable leukoencephalopathy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there is evidence to show that catheter ablation can be safely performed even in very small children.1 the process in children is even more challenging than that in adults on account of the small size of the patients and their fragile cardiac tissues . the most problematic cases for ablation are patients with abnormal cardiac positions or univentricular hearts as well as patients after complex cardiac surgeries . we present three cases of accessory pathway ( ap ) ablation in difficult anatomies and further review the literature . a 7-year - old girl , weighing 21 kg , presented with frequent palpitations and documented narrow complex tachycardia . her electrocardiogram during sinus rhythm showed a manifest left lateral ap ( figure 1a ) . in the past , she had been diagnosed to have tricuspid atresia ( type iib ) with d - transposition of the great arteries , a large ventricular septal defect , and pulmonary hypertension ( figure 1b ) . she had undergone pulmonary artery banding , followed by glenn shunt , and was awaiting total cavopulmonary connection . we conducted an electrophysiological study and documented both an orthodromic atrioventricular reentrant tachycardia and atrial tachycardia with a rapid conduction over the ap . there was no direct access to the right ventricle , and the ventricular catheter was placed via the right atrium into the left atrium and through the atrial septal defect before it was positioned in the left ventricle . we mapped the mitral annulus again during sinus rhythm : no good signals could be recorded and , thus , no energy was delivered there . we successfully carried out the ablation of the sub - epicardial ap in the coronary sinus near the origin of the middle cardiac vein ( figure 1c ) . interestingly , atrial tachycardia was easily inducible before ablation , but it could not be induced after the elimination of the ap ( figure 1d ) . the p - wave morphology during atrial tachycardia was in favor of a left atrial origin . the procedure time was 120 minutes , and the fluoroscopy time was 35 minutes . a 9-year - old girl , weighing 30 kg , presented with recurrent palpitations . electrocardiography during sinus rhythm revealed a manifest posteroseptal ap ( figure 2c ) . in the past , she had been diagnosed to have tricuspid atresia ( type ib ) with normally - related great arteries , a small ventricular septal defect , and pulmonary stenosis . she had previously undergone extracardiac total cavopulmonary connection and was awaiting fenestration closure with device ( because of cyanosis ) . there were two approaches to the ventricle : 1 ) from the inferior vena cava into the intracardiac tunnel , fenestration , atria , and left ventricle , respectively ; and 2 ) via the retrograde aortic approach . we opted to ablate the ap via the retrograde approach on account of its less complexity but failed to obtain appropriate signals , containing atrial electrogram . we were , therefore , obliged to resort to the antegrade approach and pass the ablation catheter through the fenestration ( figure 2a and figure 2b ) . we subsequently ablated the left posteroseptal ap from the atrial aspect of the annulus ( figure 2d ) . the procedure time was 90 minutes , and the fluoroscopy time was 22 minutes . a 14-year - old boy , weighing 42 kg , presented with recurrent drug ( propranolol and later amiodarone ) refractory tachycardia . resting electrocardiogram was normal . in the past , he had been diagnosed to have situs inversus totalis with dextrocardia , common atrioventricular canal , and pulmonary stenosis , for which extracardiac total cavopulmonary connection was performed ( figure 3a ) . orthodromic atrioventricular reentrant tachycardia was documented ( figure 3b ) , and the retrograde aortic approach was selected ( figure 3c ) . the procedure lasted for 60 minutes , and the fluoroscopy time was 12 minutes . in all the cases , the ap was ablated on the atrial aspect of the annulus , using stinger m , curve d , 7f , 4-mm tip catheters ( c.r . , ma , usa ) with a power of 20 30 watts in the first case and 40 watts in the others , and a temperature of 55 60 c . the patients were observed for 15 minutes after ablation , and electrophysiological studies were repeated to confirm the abolition of the recurrence of the substrate . a 7-year - old girl , weighing 21 kg , presented with frequent palpitations and documented narrow complex tachycardia . her electrocardiogram during sinus rhythm showed a manifest left lateral ap ( figure 1a ) . in the past , she had been diagnosed to have tricuspid atresia ( type iib ) with d - transposition of the great arteries , a large ventricular septal defect , and pulmonary hypertension ( figure 1b ) . she had undergone pulmonary artery banding , followed by glenn shunt , and was awaiting total cavopulmonary connection . we conducted an electrophysiological study and documented both an orthodromic atrioventricular reentrant tachycardia and atrial tachycardia with a rapid conduction over the ap . there was no direct access to the right ventricle , and the ventricular catheter was placed via the right atrium into the left atrium and through the atrial septal defect before it was positioned in the left ventricle . we mapped the mitral annulus again during sinus rhythm : no good signals could be recorded and , thus , no energy was delivered there . we successfully carried out the ablation of the sub - epicardial ap in the coronary sinus near the origin of the middle cardiac vein ( figure 1c ) . interestingly , atrial tachycardia was easily inducible before ablation , but it could not be induced after the elimination of the ap ( figure 1d ) . the p - wave morphology during atrial tachycardia was in favor of a left atrial origin . electrocardiography during sinus rhythm revealed a manifest posteroseptal ap ( figure 2c ) . in the past , she had been diagnosed to have tricuspid atresia ( type ib ) with normally - related great arteries , a small ventricular septal defect , and pulmonary stenosis . she had previously undergone extracardiac total cavopulmonary connection and was awaiting fenestration closure with device ( because of cyanosis ) . there were two approaches to the ventricle : 1 ) from the inferior vena cava into the intracardiac tunnel , fenestration , atria , and left ventricle , respectively ; and 2 ) via the retrograde aortic approach . we opted to ablate the ap via the retrograde approach on account of its less complexity but failed to obtain appropriate signals , containing atrial electrogram . we were , therefore , obliged to resort to the antegrade approach and pass the ablation catheter through the fenestration ( figure 2a and figure 2b ) . we subsequently ablated the left posteroseptal ap from the atrial aspect of the annulus ( figure 2d ) . a 14-year - old boy , weighing 42 kg , presented with recurrent drug ( propranolol and later amiodarone ) refractory tachycardia . resting electrocardiogram was normal . in the past , he had been diagnosed to have situs inversus totalis with dextrocardia , common atrioventricular canal , and pulmonary stenosis , for which extracardiac total cavopulmonary connection was performed ( figure 3a ) . orthodromic atrioventricular reentrant tachycardia was documented ( figure 3b ) , and the retrograde aortic approach was selected ( figure 3c ) . in all the cases , the ap was ablated on the atrial aspect of the annulus , using stinger m , curve d , 7f , 4-mm tip catheters ( c.r . , ma , usa ) with a power of 20 30 watts in the first case and 40 watts in the others , and a temperature of 55 60 c . the patients were observed for 15 minutes after ablation , and electrophysiological studies were repeated to confirm the abolition of the recurrence of the substrate . some forms of congenital heart diseases such as ebstein s anomaly , corrected transposition of the great vessels , and tricuspid atresia are associated with a higher incidence of aps.2 , 3 up to a third of patients with wolff - parkinson - white syndrome followed up from birth have associated congenital heart diseases.4 cardiac arrhythmias , either due to a congenital substrate or secondary to corrective surgeries , complicate the management of patients with structural heart diseases insofar as they are poorly tolerated hemodynamically and drugs prescribed to control them pose problems intrinsic to them.5 in this subset of patients , radiofrequency ablation should be attempted prior to complete surgical correction whenever possible on account of the fact that the corrective surgeries could eliminate the access to the cardiac chambers of interest.6 , 7 in case 1 , we ablated inside the coronary sinus because the endocardial approach had failed . ablation inside the coronary sinus has been described earlier , albeit not in a complex anatomy.8 catheter - based ablation of aps in complex congenital heart diseases can be successfully performed by an experienced electrophysiologist au fait with the anatomy of complex cardiac lesions . in surgical modalities that could eliminate the intracardiac access | catheter ablation is an accepted , highly effective modality of treatment for cardiac arrhythmias in children .
the success rate depends on the operator s experience , especially in cases involving complex anatomies .
we hereby report our recent experience of successful ablation of accessory pathways in three children with complex congenital heart diseases.the first case was a 7-year - old girl with tricuspid atresia and a previous glenn shunt , in whom a sub - epicardial overt accessory pathway was successfully ablated via the coronary sinus .
the second case , a 9-year - old girl , received accessory pathway ablation via the fenestration of an extracardiac fontan pathway .
the third case was a 14-year - old boy with dextrocardia , common atrium , common ventricle , and a previous extracardiac fontan operation , in whom ablation of a concealed accessory pathway was carried out retrogradely from the aorta .
all the ablations were done in rajaie cardiovascular , medical and research center , tehran , and all the patients were discharged from the hospital without any complication . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
comparison of multiple sequence alignments ( msa ) leads to a significant increase in the quality of detecting relationships between remote protein homologs ( 13 ) . analysis of msas of two protein families , in the form of numerical profiles ( 4 ) or hidden markov models ( 5 ) , can reveal similar sequence patterns that reflect the evolutionary constraints dictated by common structural folds or functions . these patterns often remain detectable long after individual protein sequences diverge beyond recognition . in recent years , methods for profile profile ( 2,611 ) and hmm - hmm ( 1,3,12 ) comparison , often featured on public web servers ( 1317 ) , have become a powerful addition to other web - based tools for predicting protein structure and function [ e.g. ( 1821 ) ] . suggested as a generalization of psi - blast ( 22 ) , compass is a method for remote homology detection that generates numerical profiles , constructs optimal profile profile alignments and estimates the statistical significance of the corresponding alignment scores ( 2 ) . compass has been successfully used by our group and other researchers for both prediction of protein structure and function [ e.g. ( 23,24 ) ] and evolutionary analysis [ e.g. ( 12,25,26 ) ] . the compass web server has been publicly available since 2007 ( 15 ) . based on user experiences , we have identified three major directions of further development in methodology , implementation and user interface . first , we improved the accuracy of statistical significance estimates ( e - values ) and the corresponding ranking of detected similarities by introducing a more realistic random model of profile comparison ( 27 ) . this model is based on an accurate statistical description of msa comparison that captures the essential features of protein families , as opposed to traditional models originally derived for the comparison of individual sequences . second , we increased the computational speed by developing a parallelized version of compass that runs on multiple processors . third , we designed a new interface for a more comprehensive analysis of produced results . unlike similar tools , the new compass server allows for a fast and easy mapping and inspection of the specific regions of protein structure predicted by profile alignments . as a result , the presented server is a more accurate and fast tool for remote homology detection and structure prediction , with improved output that facilitates manual analysis and discovery of intricate protein relationships . given a sequence or msa , compass generates the query profile and compares it against a specified database of protein family profiles . the server 's front page ( figure 1a ) allows the user to upload the query , select the database [ pfam ( 28 ) , cog , kog ( 29 ) , or psi - blast alignments produced from pdb70 ( 30 ) or scop40 ( 31 ) representatives ] , and adjust the search parameters and output options . the main section allows the user to submit the query ( as msa or a single sequence ) , choose the database , and enter the email address to receive results ( optional ) . in the section of input processing , the user can require an additional psi - blast run enriching the query profile and define the parameters of profile construction . the sections of search and output options contain controls of the main parameters of the search and of the output format . as a separate control , a brief explanation of each option can be viewed by clicking on the option 's name . the links to more detailed documentation and to a downloadable standalone package are on the bottom of the page . ( b ) example of output alignment sections with matched structural fragments displayed in jmol , graphic schemas of alignments and additional links . although these domains belong to different scop folds , they all share an hth motif that becomes apparent when matched fragments are displayed . ( c ) ribbon diagram of casp target t0473 ( pdb i d 2k53 , nmr model 1 ) . the two c - terminal -helices ( yellow and orange - red ) form the hth motif . ( d ) ribbon diagram of the only full - length template of t0473 ( pdb i d 2fi0a ) , protein sp0561 of unknown function classified in scop as a unique sp0561-like fold . the main section allows the user to submit the query ( as msa or a single sequence ) , choose the database , and enter the email address to receive results ( optional ) . in the section of input processing , the user can require an additional psi - blast run enriching the query profile and define the parameters of profile construction . the sections of search and output options contain controls of the main parameters of the search and of the output format . as a separate control , a brief explanation of each option can be viewed by clicking on the option 's name . the links to more detailed documentation and to a downloadable standalone package are on the bottom of the page . ( b ) example of output alignment sections with matched structural fragments displayed in jmol , graphic schemas of alignments and additional links . although these domains belong to different scop folds , they all share an hth motif that becomes apparent when matched fragments are displayed . ( c ) ribbon diagram of casp target t0473 ( pdb i d 2k53 , nmr model 1 ) . the two c - terminal -helices ( yellow and orange - red ) form the hth motif . ( d ) ribbon diagram of the only full - length template of t0473 ( pdb i d 2fi0a ) , protein sp0561 of unknown function classified in scop as a unique sp0561-like fold . the output of the search includes a list of the most significant hits and their corresponding optimal profile profile alignments . according to comprehensive evaluations by our group ( 32 ) and others ( 3,12,33 ) , compass is among the top - performing methods for sequence - based homology detection and local alignment construction . the presented web server features several major modifications to improve detection quality , speed and availability of specific structure predictions for visual analysis . the server features our novel approach to statistical modeling of msa comparison ( 27 ) that provides a more accurate discrimination between biologically meaningful protein similarities and spurious hits . the elegant theoretical model ( 34 ) developed for single sequence comparison assumes an absence of correlation between amino - acid content at individual positions . as a result , the statistical significance can be estimated using extreme value distribution ( evd ) ( 35,36 ) . this model corresponds to a randomization of profiles by shuffling positions , which allows for generation of potentially unlimited statistical samples and , therefore , precise analysis of resulting score distributions . an alternative empirical approach of comparing real unrelated proteins ( 3,6,7,10,11 ) requires an additional calibration on a database of diverse protein representatives , and can generate only a limited random sample of similarity scores , which hinders the precise analytical fitting of the empirical score distribution . we developed a new modeling approach that combines a realistic representation of essential protein features with a precise mathematical description . this approach is based on ( i ) a biologically meaningful modeling of the secondary structure and of the resulting correlations between sequence positions and ( ii ) a precise analytical description of the empirical statistics ( 27 ) . in particular , we found that the score distribution for the comparison of unrelated profiles can be realistically modeled by reproducing major classes of real proteins ( such as all , all , / and + classes in the scop classification ) and by mimicking the types , lengths and sequence diversity ( thickness ) of real profile fragments corresponding to secondary structure elements ( 27 ) . since the resulting simulated score distributions do not follow evd , we proposed a novel distribution , power evd ( 27 ) , that yields statistically perfect agreement with the data . in an evaluation based on a set of existing protein families with known structure , our model surpassed currently available models in the accuracy of detecting remote protein similarities . in addition , this model has a realistic statistical accuracy , i.e. the closeness between predicted and actual numbers of false positives that are assigned a given e - value ( 27 ) . the server uses the new statistical model by default ; however , the old model is also available . the type of statistics is selected by switching the corresponding radio button on the front page . to speed up the computationally costly process of constructing profile profile alignments in brief , comparisons of the query to database entries are distributed among multiple processors , so that each processor works on a subset of the database profiles . data about the most significant hits are sent to the manager node , which accumulates the hit list . when the size of the growing list exceeds the user - defined number of hits to display , the manager modifies the e - value cutoff used by the worker nodes to decide whether the hit is significant enough to be sent to the manager . this cutoff is set to the worst e - value in the current hit list , so that the worker nodes do not spend time on reporting hits that will not be displayed . this implementation increases the computational speed by approximately an order of magnitude , so that a typical running time is within a minute . this time may increase when the server is heavily loaded or when the user requires generation of the query profile by psi - blast search , which may take longer for queries with a large number of homologs in the sequence database . in structure prediction , it is important to visualize the exact structural region of the potential homolog that is predicted to be similar to the query . in most currently available public servers , the structure of the detected homolog is not displayed at all ; when it is displayed , the full protein chain is shown . however , local sequence alignments often reveal similarity restricted to a single structural domain , subdomain , or even functional motif . this information is especially important when a query detects multiple homologs with highly divergent structures that share only locally similar regions ( see an example below ) . in such cases , the consistency of structure predictions would not be apparent if one views only full - chain homolog structures . in all current servers for homology detection , a user wishing to visualize the actual region of predicted structural similarity has to retrieve the full 3d structure of the detected homolog and then manually map the aligned sequence part on the structure . the improved compass server automates this important yet tedious process . for the top significant hits in databases of proteins with known 3d structure first , a jmol ( http://jmol.sourceforge.net ) panel is used to interactively display the c - alpha trace of the structural fragment covered by the compass alignment . the user can rotate , move and zoom this fragment ; position numbers and residue names can be viewed by moving the mouse over the residues . second , the user can analyze the structure in more detail , either by downloading the fragment as an all - atom pdb file , or by clicking on the pymol link , which generates and launches a pymol ( http://pymol.sourceforge.net ) script to show , in a separate window , the full structure of the potential homolog , with the aligned region highlighted . in this window , the user can employ the full functionality of pymol to view sidechains , ligands , protein surface , atom atom distances , etc . third , the additional links to databases allow viewing the information about the protein structure in pdb , scop , cath and ncbi repository . finally , a simple graphical schema shows the location of aligned sequence regions with respect to the full sequences of the query and subject . full query and subject msas can be viewed by clicking on either the bars representing the profiles in the schema or the highlighted sequence names in the profile profile alignment . the ability to view and compare on the fly multiple predicted regions of structural similarity simplifies the manual analysis of search results . as shown in the example below , this feature helps visualize important structural and functional features of the query that could be missed otherwise . the server features our novel approach to statistical modeling of msa comparison ( 27 ) that provides a more accurate discrimination between biologically meaningful protein similarities and spurious hits . the elegant theoretical model ( 34 ) developed for single sequence comparison assumes an absence of correlation between amino - acid content at individual positions . as a result , the statistical significance can be estimated using extreme value distribution ( evd ) ( 35,36 ) . this model corresponds to a randomization of profiles by shuffling positions , which allows for generation of potentially unlimited statistical samples and , therefore , precise analysis of resulting score distributions . an alternative empirical approach of comparing real unrelated proteins ( 3,6,7,10,11 ) requires an additional calibration on a database of diverse protein representatives , and can generate only a limited random sample of similarity scores , which hinders the precise analytical fitting of the empirical score distribution . we developed a new modeling approach that combines a realistic representation of essential protein features with a precise mathematical description . this approach is based on ( i ) a biologically meaningful modeling of the secondary structure and of the resulting correlations between sequence positions and ( ii ) a precise analytical description of the empirical statistics ( 27 ) . in particular , we found that the score distribution for the comparison of unrelated profiles can be realistically modeled by reproducing major classes of real proteins ( such as all , all , / and + classes in the scop classification ) and by mimicking the types , lengths and sequence diversity ( thickness ) of real profile fragments corresponding to secondary structure elements ( 27 ) . since the resulting simulated score distributions do not follow evd , we proposed a novel distribution , power evd ( 27 ) , that yields statistically perfect agreement with the data . in an evaluation based on a set of existing protein families with known structure , our model surpassed currently available models in the accuracy of detecting remote protein similarities . in addition , this model has a realistic statistical accuracy , i.e. the closeness between predicted and actual numbers of false positives that are assigned a given e - value ( 27 ) . the server uses the new statistical model by default ; however , the old model is also available . the type of statistics is selected by switching the corresponding radio button on the front page . to speed up the computationally costly process of constructing profile profile alignments , we developed a parallelized version of compass based on the mpi platform . in brief , comparisons of the query to database entries are distributed among multiple processors , so that each processor works on a subset of the database profiles . data about the most significant hits are sent to the manager node , which accumulates the hit list . when the size of the growing list exceeds the user - defined number of hits to display , the manager modifies the e - value cutoff used by the worker nodes to decide whether the hit is significant enough to be sent to the manager . this cutoff is set to the worst e - value in the current hit list , so that the worker nodes do not spend time on reporting hits that will not be displayed . this implementation increases the computational speed by approximately an order of magnitude , so that a typical running time is within a minute . this time may increase when the server is heavily loaded or when the user requires generation of the query profile by psi - blast search , which may take longer for queries with a large number of homologs in the sequence database . in structure prediction , it is important to visualize the exact structural region of the potential homolog that is predicted to be similar to the query . in most currently available public servers , the structure of the detected homolog is not displayed at all ; when it is displayed , the full protein chain is shown . however , local sequence alignments often reveal similarity restricted to a single structural domain , subdomain , or even functional motif . this information is especially important when a query detects multiple homologs with highly divergent structures that share only locally similar regions ( see an example below ) . in such cases , the consistency of structure predictions would not be apparent if one views only full - chain homolog structures . in all current servers for homology detection , a user wishing to visualize the actual region of predicted structural similarity has to retrieve the full 3d structure of the detected homolog and then manually map the aligned sequence part on the structure . the improved compass server automates this important yet tedious process . for the top significant hits in databases of proteins with known 3d structure first , a jmol ( http://jmol.sourceforge.net ) panel is used to interactively display the c - alpha trace of the structural fragment covered by the compass alignment . the user can rotate , move and zoom this fragment ; position numbers and residue names can be viewed by moving the mouse over the residues . second , the user can analyze the structure in more detail , either by downloading the fragment as an all - atom pdb file , or by clicking on the pymol link , which generates and launches a pymol ( http://pymol.sourceforge.net ) script to show , in a separate window , the full structure of the potential homolog , with the aligned region highlighted . in this window , the user can employ the full functionality of pymol to view sidechains , ligands , protein surface , atom atom distances , etc . third , the additional links to databases allow viewing the information about the protein structure in pdb , scop , cath and ncbi repository . finally , a simple graphical schema shows the location of aligned sequence regions with respect to the full sequences of the query and subject . full query and subject msas can be viewed by clicking on either the bars representing the profiles in the schema or the highlighted sequence names in the profile profile alignment . the ability to view and compare on the fly multiple predicted regions of structural similarity simplifies the manual analysis of search results . as shown in the example below , this feature helps visualize important structural and functional features of the query that could be missed otherwise . as an illustration , we describe detection of distant sequence similarities that leads to structure prediction and reveals an evolutionarily conserved functional motif in a target protein from the recent casp8 ( critical assessment of techniques for protein structure prediction ) . target t0473 , an all - alpha protein from clostridium thermocellum , is a member of a tight sequence family with unknown function . psi - blast , up to five iterations , could not detect significant sequence similarities to proteins with solved 3d structures . when a psi - blast alignment of t0473 was used as a query in a compass search against the database of scop representatives , a domain of known structure ( pdb i d 2fi0 ) was easily detected with a low e - value of 10 ( figure 1d ) . this homolog , aligned to the query over the whole domain length , is a hypothetical protein sp0561 of unknown function classified in scop as a unique sp0561-like fold . this prediction was additionally confirmed by other profile profile comparison servers , such as hhsearch ( assigned a high probability of 99% ) . after the structure of this casp target was released ( pdb i d 2k53 ) , it proved to be highly similar to the template ( figure 1c ) . although this structure prediction is relatively straightforward , it does not provide much information about the potential function and evolutionary history of this protein : the only template covering the whole domain is a hypothetical protein . however , this domain contains an important functional motif that can be easily detected with the new compass feature of displaying precise structural fragments that match the query in potential homologs . the presence of the motif becomes apparent when viewing multiple hits in the scop database with e - values below and slightly above the significance cutoff ( figure 1b ) . in these otherwise highly divergent domains from different scop folds , the query consistently matches a helix - turn - helix ( hth ) motif that is easily recognized in structure panels of the corresponding alignment sections ( figure 1b ) . all structural fragments have the characteristic helix orientation and positioning of the connecting turn , and include conserved residues typical of hth ( figure 1b ) . inspection of the query 's structure confirmed that the last two -helices ( yellow and orange - red , figure 1c ) form the hth motif , readily recognizable by an almost perpendicular orientation of the two helices and a long extended turn that positions the n - terminus of the second helix close to the middle of the first helix . the 49-gly - ile - asp-51 in t0473 is a very typical sequence for an hth turn , and ala44 , four residues before gly49 , is a conserved small residue to make room for packing of the second hth helix ( 37 ) . however , the similarity is restricted to only the hth part : the way it is completed is quite different among more distant homologs . the rest of the structure is unique and shared only with the closest homologs , the detected full - chain template 2fi0 and another casp8 target t0469 ( pdb i d 2k5e ) . this n - terminal segment is structured as three helices and completes the hth core in a manner similar to the packing of a single n - terminal helix against the hth in a classic three - helical bundle fold . thus t0473 is an unusual helix - turn - helix ( hth ) containing protein , which suggests its functional role in nucleic acid or protein binding . as another indication of a potential regulatory function , compass detects profile similarity to cog2846 in the cog database ( not shown ) , which is predicted to be a regulator of cell morphogenesis and no signaling. national institutes of health [ grant gm67165 to nvg ] . funding for open access charge : howard hughes medical institute . | compass is a profile - based method for the detection of remote sequence similarity and the prediction of protein structure .
here we describe a recently improved public web server of compass , http://prodata.swmed.edu/compass .
the server features three major developments : ( i ) improved statistical accuracy ; ( ii ) increased speed from parallel implementation ; and ( iii ) new functional features facilitating structure prediction .
these features include visualization tools that allow the user to quickly and effectively analyze specific local structural region predictions suggested by compass alignments . as an application example , we describe the structural , evolutionary and functional analysis of a protein with unknown function that served as a target in the recent casp8 ( critical assessment of techniques for protein structure prediction round 8) .
url : http://prodata.swmed.edu/compass |
You are an expert at summarizing long articles. Proceed to summarize the following text:
linezolid ( lzd ) is a member of the oxazolidinone class of synthetic antimicrobial agent against the gram - positive bacteria responsible for methicillin - resistant staphylococcus aureus and vancomycin - resistant enterococcus . lzd utilizes a novel mechanism of antibiotic activity ; it has the ability to bind to the bacterial 50s ribosomal subunit and inhibit the formation of the 70s functional initiation complex and ultimately , protein synthesis , thereby exerting its antibiotic effects . since lzd is taken into the body and metabolized nonenzymatically , neither liver metabolism nor renal excretion affects its metabolism . therefore , dosage adjustments and intervals are not important regardless of the degree of liver damage , renal function , or severity of infectious diseases . a previous study reported that lzd has serious side effects including lzd concentration - dependent thrombocytopenia and anemia . furthermore , the risk of thrombocytopenia in patients with renal impairment was found to be increased by elevations in the trough concentration of lzd and area under the concentration curve . the incidence of thrombocytopenia has become a major issue in patients with renal impairment who are being treated with lzd because it is higher than in patients with normal renal function ( nrf ) , and thrombocytopenia results in the interruption of treatments with lzd . gerson et al . demonstrated that reductions in platelet counts were caused by the toxicity - induced suppression of platelet production by bone marrow and hematopoietic cells . on the other hand , bernstein et al . showed that lzd - induced thrombocytopenia was not caused by bone marrow suppression , but by the direct destruction of platelets by an immune reaction with a specific antibody . however , these findings were obtained from clinical specimens , and other factors causing thrombocytopenia ( e.g. , concomitant drugs causing thrombocytopenia other than lzd , severity of underlying diseases , and platelet counts before the administration of lzd ) were not excluded . in addition , a basic study on the mechanism responsible for thrombocytopenia has not yet been performed in an in vivo model . therefore , we herein clarified the relationship between renal function , reductions in platelet counts , and the mechanism underlying lzd - induced thrombocytopenia using a chronic renal disease ( crd ) mouse model . five - week - old male icr mice were purchased from japan slc , inc . ( shizuoka , japan ) and housed under standardized light - dark cycle conditions ( lights on and off at 7:00 and 19:00 , respectively ) at a room temperature of 24c 1c and humidity of 50% 10% with free access to food and water . all animal handling protocols and surgical procedures were reviewed and approved by the animal experiment committee at university of toyama ( a2012pha-45 ) . after a 1-week acclimatization period , we measured blood urea nitrogen ( bun ) levels in all mice as a renal function index using a 10 plate colorimetric detection kit ( arbor assays , ann arbor , michigan , united states ) . thirty - six mice were treated separately and subsequently divided into a nrf group ( n = 18 ) or crd model group ( n = 18 ) , and renal impairment was induced by 5/6 nephrectomy as a model of crd . in the first surgery , two - thirds of the left kidney was removed by excising the upper pole and lower pole under pentobarbital anesthesia . in the second surgery , the right kidney was completely removed , and 5/6 nephrectomy was performed 1 week after the first surgery . twenty - eight days after the second surgery , bun levels in the crd and nrf groups were measured again to evaluate renal function . these two groups were further divided into the following three subgroups ( n = 6 per group ) : the nrf group : ( a ) control ( administered solvent ) , ( b ) administered 25 mg / kg lzd , and ( c ) administered 100 mg / kg lzd and the crd model group : ( d ) control ( administered solvent ) , ( e ) administered 25 mg / kg lzd , and ( f ) administered 100 mg / kg lzd . lzd at 25 mg / kg or 100 mg / kg was administered intraperitoneally to the nrf ( b and c ) and crd ( e and f ) groups once every day for 28 days , with the first day of the administration of lzd being defined as day 1 . lzd solvent solution was administered to the nrf ( a ) and crd ( d ) control groups once every day for 28 days . on days 0 , 7 , 14 , 21 , and 28 of the lzd administration protocol , , platelet counts were measured using the brecher - cronkite method with the hemocytometer bacteria a161 ( sunlead glass corporation , saitama , japan ) . we measured white blood cell ( wbc ) counts and hematocrit ( hct ) levels with a microcell counter model f-520 ( sysmex , hyogo , japan ) . we added another group , ( g ) nontreated control mice , to this evaluation . on day 28 , we diluted 2-c - thymidine ( 0.185 mbq ) in 0.2 ml of isotonic saline and administrated it at a dose of 0.2 ml to the crd model control group ( d ) , 25 mg / kg administered group ( e ) , 100 mg / kg administered group ( f ) , and nontreated control group ( g ) . mice were sacrificed 1 h after the tail vein injection of 2-c - thymidine and then rapidly frozen in dry ice and acetone . we removed the hind leg surgically from the hip joint using clippers and exposed the femur and tibia . twenty micrometer - thick serial sections were made through the sagittal plane of each mouse with the tape - sectioning method using a cryo polycut cryostat ( reichert - jung , nussloch , germany ) at 20c . sections on adhesive tape ( yu - ki ban , nitto medical co. , ltd . , osaka , japan ) were desiccated and placed on a bas - ms2040 imaging plate ( fujifilm co. , ltd , tokyo , japan ) for 1 day . whole - body macroautoradiographs were processed digitally with an fla7000 image analyzer ( fujifilm co. , ltd ) . data were analyzed using spss software version 18 ( ibm , tokyo , japan ) , and graphical analyses were performed by r ( version 3.2.2 ) . bun levels in the nrf ( a , b , and c ) and crd ( d , e , and f ) groups were analyzed using an unpaired t - test . platelet counts , wbc counts , and hct levels were analyzed by a one - way analysis of variance and dunnett 's test . we defined the number of mice on day 0 as n = 18 because we collected blood samples before the administration of lzd before grouping . on the other hand , we defined the number of mice on days 7 , 14 , 21 , and 28 as n = 6 because the administration of lzd had already started , namely , after grouping . day 0 and the control were defined as the control group in dunnett 's test . moreover , we calculated the correlation coefficient with wbc counts and lzd in the crd group on day 28 using pearson 's product - moment correlation . five - week - old male icr mice were purchased from japan slc , inc . ( shizuoka , japan ) and housed under standardized light - dark cycle conditions ( lights on and off at 7:00 and 19:00 , respectively ) at a room temperature of 24c 1c and humidity of 50% 10% with free access to food and water . all animal handling protocols and surgical procedures were reviewed and approved by the animal experiment committee at university of toyama ( a2012pha-45 ) . after a 1-week acclimatization period , we measured blood urea nitrogen ( bun ) levels in all mice as a renal function index using a 10 plate colorimetric detection kit ( arbor assays , ann arbor , michigan , united states ) . thirty - six mice were treated separately and subsequently divided into a nrf group ( n = 18 ) or crd model group ( n = 18 ) , and renal impairment was induced by 5/6 nephrectomy as a model of crd . in the first surgery , two - thirds of the left kidney was removed by excising the upper pole and lower pole under pentobarbital anesthesia . in the second surgery , the right kidney was completely removed , and 5/6 nephrectomy was performed 1 week after the first surgery . twenty - eight days after the second surgery , bun levels in the crd and nrf groups were measured again to evaluate renal function . these two groups were further divided into the following three subgroups ( n = 6 per group ) : the nrf group : ( a ) control ( administered solvent ) , ( b ) administered 25 mg / kg lzd , and ( c ) administered 100 mg / kg lzd and the crd model group : ( d ) control ( administered solvent ) , ( e ) administered 25 mg / kg lzd , and ( f ) administered 100 mg / kg lzd . lzd at 25 mg / kg or 100 mg / kg was administered intraperitoneally to the nrf ( b and c ) and crd ( e and f ) groups once every day for 28 days , with the first day of the administration of lzd being defined as day 1 . lzd solvent solution was administered to the nrf ( a ) and crd ( d ) control groups once every day for 28 days . on days 0 , 7 , 14 , 21 , and 28 of the lzd administration protocol to evaluate the toxicity of lzd , platelet counts were measured using the brecher - cronkite method with the hemocytometer bacteria a161 ( sunlead glass corporation , saitama , japan ) . we measured white blood cell ( wbc ) counts and hematocrit ( hct ) levels with a microcell counter model f-520 ( sysmex , hyogo , japan ) . we added another group , ( g ) nontreated control mice , to this evaluation . on day 28 , we diluted 2-c - thymidine ( 0.185 mbq ) in 0.2 ml of isotonic saline and administrated it at a dose of 0.2 ml to the crd model control group ( d ) , 25 mg / kg administered group ( e ) , 100 mg / kg administered group ( f ) , and nontreated control group ( g ) . mice were sacrificed 1 h after the tail vein injection of 2-c - thymidine and then rapidly frozen in dry ice and acetone . we removed the hind leg surgically from the hip joint using clippers and exposed the femur and tibia . twenty micrometer - thick serial sections were made through the sagittal plane of each mouse with the tape - sectioning method using a cryo polycut cryostat ( reichert - jung , nussloch , germany ) at 20c . sections on adhesive tape ( yu - ki ban , nitto medical co. , ltd . , osaka , japan ) were desiccated and placed on a bas - ms2040 imaging plate ( fujifilm co. , ltd , tokyo , japan ) for 1 day . whole - body macroautoradiographs were processed digitally with an fla7000 image analyzer ( fujifilm co. , ltd ) . data were analyzed using spss software version 18 ( ibm , tokyo , japan ) , and graphical analyses were performed by r ( version 3.2.2 ) . bun levels in the nrf ( a , b , and c ) and crd ( d , e , and f ) groups were analyzed using an unpaired t - test . platelet counts , wbc counts , and hct levels were analyzed by a one - way analysis of variance and dunnett 's test . we defined the number of mice on day 0 as n = 18 because we collected blood samples before the administration of lzd before grouping . on the other hand , we defined the number of mice on days 7 , 14 , 21 , and 28 as n = 6 because the administration of lzd had already started , namely , after grouping . day 0 and the control were defined as the control group in dunnett 's test . moreover , we calculated the correlation coefficient with wbc counts and lzd in the crd group on day 28 using pearson 's product - moment correlation . mean ( standard deviation [ sd ] ) bun levels were 22.1 ( 3.5 ) and 50.4 ( 12.6 ) mg / dl in the nrf ( a , b , and c ) and crd ( d , e , and f ) groups , respectively , and were significantly higher in the crd group ( p < 0.05 ) . in the nrf ( a , b , and c ) group , platelet counts in the 100 mg / kg lzd administration group ( c ) were significantly lower than platelet counts on day 28 compared with day 0 [ figure 1 ] . platelet counts after the administration of linezolid to ( a ) normal renal function ( a , b , and c ) and ( b ) chronic renal disease ( d , e , and f ) groups . day 0 is n = 18 , and other symbols represent the mean standard deviation ( n = 6 ) moreover , platelet counts were also significantly lower in the 25 mg / kg lzd administration group ( b ) on days 14 and 28 , and in the 100 mg / kg lzd administration group ( c ) on days 28 than control ( p < 0.05 ) . in the crd ( d , e , and f ) group , platelet counts in the control group ( d ) were significantly lower than platelet counts on days 7 , 14 , and 28 compared with day 0 . platelet counts were also significantly lower in the 25 mg / kg lzd administration group ( e ) on days 14 , 21 , and 28 , and in the 100 mg / kg lzd administration group ( f ) on days 7 , 14 , 21 , and 28 than on day 0 . on days 21 and 28 , platelet counts were significantly lower in the 25 mg / kg lzd administration group ( e ) than in the control group ( d ) . similarly , platelet counts on days 21 and 28 were significantly lower in the 100 mg / kg lzd administration group ( e ) than in the control group ( d ) ( p < 0.05 ) [ figure 1 ] . wbc counts in the crd ( d , e , and f ) group were measured at the same time as platelet counts [ figure 2 ] . wbc counts did not change throughout the administration of lzd to crd ( d , e , and f ) mice . moreover , no significant difference was observed in wbc counts between the control group and 25 mg / kg ( e ) or 100 mg / kg ( f ) lzd administration group ( d ) . no dose - dependent reductions were observed in wbc counts ( p = 0.062 , r = 0.448 ) . hct levels were also measured in the crd ( d , e , and f ) group at the same time as platelet counts [ figure 2 ] . white blood cell counts and hematocrit levels after the administration of linezolid to the chronic renal disease ( d , e , and f ) group . ( a ) white blood cell counts and ( b ) hematocrit levels after the administration of linezolid to the chronic renal disease ( d , e , and f ) group no significant changes were noted in hct levels in any of the lzd - administered crd ( d , e , and f ) mice from day 0 . moreover , no significant differences were observed in hct levels between the 25 mg / kg ( e ) or 100 mg / kg ( f ) lzd administration group and control group ( d ) . figure 3 shows the results of whole - body macroautoradiograms taken 1 h after the administration of 2-c - thymidine . c - radioactivity is indicated by color : regions in red , yellow , green , and blue show decreasing amounts in that order . however , radioactivity was not observed in other tissues in any of the mice examined . radioactive levels in bone marrow were not significantly different between the ( a ) control group ( d ) and ( b ) crd mice administered 100 mg / kg lzd ( f ) . whole - body autoradiography of chronic renal disease ( a , b , and c ) mouse and a nontreated control mouse ( d ) . 2-c - thymidine was injected into the tail veins of a control chronic renal disease model mouse ( a ) , a chronic renal disease model mouse that was administered 25 mg / kg linezolid for 28 days continuously ( b ) , a chronic renal disease model mouse that was administered 100 mg / kg linezolid for 28 days continuously ( c ) , and a nontreated control mouse ( d ) and the results of whole - body autoradiography 1 h later were shown mean ( standard deviation [ sd ] ) bun levels were 22.1 ( 3.5 ) and 50.4 ( 12.6 ) mg / dl in the nrf ( a , b , and c ) and crd ( d , e , and f ) groups , respectively , and were significantly higher in the crd group ( p < 0.05 ) . in the nrf ( a , b , and c ) group , platelet counts in the 100 mg / kg lzd administration group ( c ) were significantly lower than platelet counts on day 28 compared with day 0 [ figure 1 ] . platelet counts after the administration of linezolid to ( a ) normal renal function ( a , b , and c ) and ( b ) chronic renal disease ( d , e , and f ) groups . day 0 is n = 18 , and other symbols represent the mean standard deviation ( n = 6 ) moreover , platelet counts were also significantly lower in the 25 mg / kg lzd administration group ( b ) on days 14 and 28 , and in the 100 mg / kg lzd administration group ( c ) on days 28 than control ( p < 0.05 ) . in the crd ( d , e , and f ) group , platelet counts in the control group ( d ) were significantly lower than platelet counts on days 7 , 14 , and 28 compared with day 0 . platelet counts were also significantly lower in the 25 mg / kg lzd administration group ( e ) on days 14 , 21 , and 28 , and in the 100 mg / kg lzd administration group ( f ) on days 7 , 14 , 21 , and 28 than on day 0 . on days 21 and 28 , platelet counts were significantly lower in the 25 mg / kg lzd administration group ( e ) than in the control group ( d ) . similarly , platelet counts on days 21 and 28 were significantly lower in the 100 mg / kg lzd administration group ( e ) than in the control group ( d ) ( p < 0.05 ) [ figure 1 ] . wbc counts in the crd ( d , e , and f ) group were measured at the same time as platelet counts [ figure 2 ] . wbc counts did not change throughout the administration of lzd to crd ( d , e , and f ) mice . moreover , no significant difference was observed in wbc counts between the control group and 25 mg / kg ( e ) or 100 mg / kg ( f ) lzd administration group ( d ) . no dose - dependent reductions were observed in wbc counts ( p = 0.062 , r = 0.448 ) . hct levels were also measured in the crd ( d , e , and f ) group at the same time as platelet counts [ figure 2 ] . white blood cell counts and hematocrit levels after the administration of linezolid to the chronic renal disease ( d , e , and f ) group . ( a ) white blood cell counts and ( b ) hematocrit levels after the administration of linezolid to the chronic renal disease ( d , e , and f ) group no significant changes were noted in hct levels in any of the lzd - administered crd ( d , e , and f ) mice from day 0 . moreover , no significant differences were observed in hct levels between the 25 mg / kg ( e ) or 100 mg / kg ( f ) lzd administration group and control group ( d ) . figure 3 shows the results of whole - body macroautoradiograms taken 1 h after the administration of 2-c - thymidine . c - radioactivity is indicated by color : regions in red , yellow , green , and blue show decreasing amounts in that order . however , radioactivity was not observed in other tissues in any of the mice examined . radioactive levels in bone marrow were not significantly different between the ( a ) control group ( d ) and ( b ) crd mice administered 100 mg / kg lzd ( f ) . whole - body autoradiography of chronic renal disease ( a , b , and c ) mouse and a nontreated control mouse ( d ) . 2-c - thymidine was injected into the tail veins of a control chronic renal disease model mouse ( a ) , a chronic renal disease model mouse that was administered 25 mg / kg linezolid for 28 days continuously ( b ) , a chronic renal disease model mouse that was administered 100 mg / kg linezolid for 28 days continuously ( c ) , and a nontreated control mouse ( d ) and the results of whole - body autoradiography 1 h later were shown previous case reports have been published on the mechanism underlying lzd - induced thrombocytopenia . however , due to the nature of case reports , the mechanism responsible has not yet been elucidated in detail . we herein investigated the mechanism underlying the onset of lzd - induced thrombocytopenia as well as the relationship between renal impairment and lzd - induced thrombocytopenia using crd ( d , e , and f ) mice , in which a number of factors may be excluded . significantly higher bun levels were observed in mice subjected to 5/6 nephrectomy than in the nrf ( a , b , and c ) group . we subsequently performed experiments under these conditions to elucidate the mechanism underlying lzd - induced thrombocytopenia . platelet counts were significantly lower on days 14 and 28 than on day 0 in the crd control group ( d ) . a previous study reported that thrombocytopenia occurs in a drug - independent manner in patients with renal impairment . a significant decrease in platelet counts from day 0 was observed after day 14 in the 25 mg / kg lzd administration group ( e ) and after day 7 in the 100 mg / kg lzd administration group ( f ) . furthermore , a significant difference was observed in platelet counts between the 25 mg / kg ( e ) and 100 mg / kg lzd administration groups ( f ) and control group ( d ) . in contrast , in the nrf ( a , b , and c ) group , a significant difference was only observed on day 28 in the 100 mg / kg lzd administration group ( c ) compared with day 0 and day 14 and 28 in the 25 mg / kg lzd administration group ( b ) and day 28 in the 100 mg / kg lzd administration group ( f ) compared with control . although a significant decrease in platelet counts in the nrf ( a , b , and c ) group , it was mild compared with crd ( d , e , and f ) group . therefore , the incidence of lzd - induced thrombocytopenia may be higher in a state of renal impairment than in nrf . loo et al . reported that two mechanisms were responsible for drug - induced thrombocytopenia : nonimmune - mediated thrombocytopenia caused by the suppression of platelet production by bone marrow and immune - mediated thrombocytopenia caused by an immune reaction inducing the suppression of platelet production or acceleration of platelet destruction . each mechanism is characteristic for the duration from the start of antimicrobial therapy to the occurrence of thrombocytopenia . the occurrence of nonimmune - mediated thrombocytopenia gradually increases from the start of antimicrobial therapy to 23 weeks after . on the other hand , the occurrence of immune - mediated thrombocytopenia has been reported from the start of antimicrobial therapy to 714 days after . gerson et al . found that nonimmune - mediated thrombocytopenia due to the suppression of bone marrow was related to the drug administration period and did not occur before days 1014 from the start of antimicrobial therapy . furthermore , immune - mediated thrombocytopenia was shown to occur earlier than nonimmune - mediated thrombocytopenia . in the present study , platelet counts were significantly lower on day 7 than on day 0 in the crd ( d , e , and f ) group , suggesting that the mechanism underlying lzd - induced thrombocytopenia was not caused by the suppression of platelet production by bone marrow . platelets are produced from the cytoplasm of megakaryocytes , which differentiate from hematopoietic stem cells . if bone marrow suppression - induced nonimmune - mediated thrombocytopenia occurs , it suggests that decreasing hematopoietic stem cell - related pancytopenia is the cause of thrombocytopenia . on the other hand , platelet - specific reductions have been reported in immune - mediated thrombocytopenia induced by antiplatelet autoantibodies . if lzd - induced thrombocytopenia is caused by a nonimmune - mediated mechanism , it is expected to be accompanied by decreased wbc counts and hct levels . the results of the present study indicated that wbc counts on day 28 in each group did not differ significantly . although platelet - specific reductions were observed in the present study , wbc counts and hct levels did not significantly change from those on day 0 in the lzd - administered crd ( e and f ) group , suggesting that the mechanism underlying lzd - induced thrombocytopenia was not caused by a decrease in platelet production by nonimmune - mediated bone marrow suppression . moreover , we added a complementary treatment for this result , an image analysis using whole - body macroautoradiography . the uptake of nucleic acid precursors is necessary for the synthesis of dna . thymidine uptake ability increases in tissue , in which the synthesis of dna is actively occurring . in the present study , thymidine uptake ability i.e. , dna synthesis ability of bone marrow was different in each group . however , thymidine uptake ability did not significantly differ between any of the groups examined , indicating that dna synthesis ability was not altered by the administration of lzd to mice in each group . these results suggest that bone marrow inhibition is not the cause of lzd - induced thrombocytopenia and may be shown in an in vivo model . we were unable to measure lzd blood concentrations for the identification of lzd - induced thrombocytopenia . some clinical researchers have reported that lzd blood concentrations are higher in patients with renal impairment than in those with nrf and suggest that this increase is the cause of thrombocytopenia although we intended to measure lzd blood concentrations , the paucity of mouse blood samples prevented this . another limitation is that we were unable to observe the differentiation process from hematopoietic stem cells to megakaryocytes or megakaryocytic differentiation , which is necessary for elucidating the mechanism underlying lzd - induced thrombocytopenia . however , based on blood analyses and whole - body macroautoradiography , we suggest that lzd - induced thrombocytopenia is caused by specific reductions in platelet counts and immune - mediated reactions . lzd - induced thrombocytopenia was caused by impaired renal function from the nrf state in vivo . based on measurements of wbc counts , hct levels , and thymidine uptake ability , we demonstrated that lzd - induced thrombocytopenia was caused by specific reductions in platelet counts . moreover , we revealed that the mechanism underlying lzd - induced thrombocytopenia did not involve nonimmune - mediated bone marrow suppression . | objective : to investigate the relationship between renal function and linezolid ( lzd)-induced thrombocytopenia and elucidate the underlying mechanism using a chronic renal disease ( crd ) mouse model.materials and methods : crd was induced in 5-week - old male institute of cancer research ( icr ) mice by 5/6 nephrectomy .
after this procedure , lzd ( 25 and 100 mg / kg ) was administered intraperitoneally once every day for 28 days .
platelet counts , white blood cell ( wbc ) counts , and hematocrit ( hct ) levels were measured every 7 days
. 2 - 14c - thymidine ( 0.185 mbq ) was administrated intravenously to lzd - administered mice to evaluate the thymidine uptake ability of bone marrow.results:platelet counts were significantly lower in the lzd - administered crd group than in the lzd - nonadministered groups at 14 , 21 , and 28 days ( p < 0.05 ) ; however , these changes were not observed in lzd - administered mice with normal renal function , regardless of the duration of lzd administration .
no significant changes were observed in wbc counts or hct levels in any lzd - administered crd mouse .
moreover , radioactive levels in bone marrow were not significantly different in each group.conclusions:these results indicate that lzd - induced decreases in platelet counts were enhanced by renal impairment in vivo , suggesting that lzd - induced thrombocytopenia is not caused by nonimmune - mediated bone marrow suppression . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
with the increasing public health challenge of dementia and cognitive impairment throughout the world , the identification of a modifiable risk factor would be critical in the prevention of dementia.1 previous studies have indicated that hyperlipidemia may be a risk factor for dementia and alzheimer s disease ( ad).24 however , although earlier results suggested a link between high midlife cholesterol levels and increased dementia risk,58 later studies found no association between midlife cholesterol and subsequent dementia.912 in addition , studies on late - life cholesterol levels conflicted with some studies reporting that low late - life cholesterol was associated with increased dementia risk , although others found no association.2,13,14 one potential explanation for the inconsistencies in the relationship between cholesterol and cognitive function is that it may be due to a confounding treatment effect . most previous studies were from developed countries in which individuals with high cholesterol levels had been aggressively treated with lipid - lowering medications , some of which have been shown to be potentially protective of dementia risk.3 thus , cholesterol levels , particularly those measured in late - life , may reflect a combination of the detrimental effect of high cholesterol and the protective effect of lipid - lowering medications , making it more difficult to untangle the two opposite effects in such populations . another potential explanation for the conflicting results on cholesterol and cognition is the failure to control for other relevant risk factors . one recent meta - analysis based on cohort studies found that higher levels of homocysteine were associated with increased dementia risk,15 but no studies to date have considered potential interactions between cholesterol and homocysteine on cognitive function . we hypothesize that a clear relationship between cholesterol and cognitive function may be observed in populations in which few individuals take cholesterol - lowering medications and in which other biomarkers are measured . in this article , we report results from a cross - sectional study of cholesterol , homocysteine , and cognitive function in a rural , elderly chinese cohort . participants for this study were recruited on two occasions . between december 2003 and may 2005 , 2,000 individuals aged 65 years and over from four counties in the people s republic of china were enrolled . two counties were from sichuan province in southwestern people s republic of china and the other two counties were from shandong province in eastern people s republic of china . cognitive assessment was conducted at baseline , and at 2.5 years and 7 years after baseline . of the 2,000 participants enrolled during 20032005 , a second enrollment was conducted between 2010 and 2012 , approximately 7 years after the baseline study was conducted . individuals from the four original study sites who had since turned 65 years old , and who were not enrolled in the original cohort , were invited to participate in the study . eight - hundred - and - eight individuals were enrolled during the second enrollment wave ; thus 2,056 participants underwent cognitive assessment during 20102012 . the study was approved by the indiana university ( iu ) institutional review board and the institute for environmental health and related safety , chinese center for disease control and prevention . details of the study were described previously.16 blood samples were collected during the 20102012 evaluation . of 2,056 individuals evaluated with fasting blood samples were collected in the morning using 10 ml purple top ( containing ethylenediaminetetraacetic acid ) vacutainer tubes manufactured in the united states . serum homocysteine , triglycerides , low - density lipoprotein ( ldl ) , and high - density lipoprotein ( hdl ) were measured using roche diagnostic kits and a hitachi automatic biochemistry analyzer 9700 . total cholesterol levels were calculated using the sum of the ldl and hdl plus one - fifth of triglyceride levels . apoe genotype was determined by the multiplex tetra - primer amplification refractory mutation system polymerase chain reactions.17 cognitive assessment was conducted in face - to - face interviews using nine cognitive tests : the community screening instrument for dementia ( csid ) ; the consortium to establish a registry for alzheimer s disease ( cerad ) ten - word list learning ; word list recall;18 iu story recall;19 animal fluency test;20 boston naming test;21 stick design ; delayed stick design;22 and the iu token test.23,24 the csid was developed as a screening tool for dementia in populations with various cultural backgrounds and literacy levels . details of the instrument have been published elsewhere.25 the csid cognitive assessment items measure the following functions in a short interview with the study participants : memory ; abstract thinking ; judgment ; and other disturbances of higher cortical function ( aphasia , apraxia , agnosia , and constructional difficulty ) . the csid has demonstrated both good 2-week test retest reliability and interrater reliability , in addition to good validity in detecting dementia in various populations.25,26 csid has 30 items and scores range from 030 . the cerad word list learning test is one of the measures from the cerad neuropsychological assessment battery , which was designed to assess cognitive skills in the elderly.18 it consists of a ten - item , three - trial word list in which free recall is taken after each learning trial and after a brief delay ( approximately 5 minutes ) . the score is the total number of words recalled across the three learning trials ( range : 030 ) and at delay ( range : 010 ) . the iu story recall task19 was created by the research team to be suitable to the chinese culture and the rural population . the examiner reads the story out loud to the subject , who then attempts to recall the story verbatim . the story has 14 units of information that are gist scored ( range : 014 ) , meaning a recalled answer is deemed correct if the main point is recalled , in contrast to verbatim . the story was tested in 1,500 elderly chinese adults in a previous pilot study and was found to be acceptable to the villagers ; it produced a normally distributed range of scores.27 the animal fluency test is a measure of executive function in which a subject names as many animals as possible in 60 seconds.20 the iu token test is a brief measure of language comprehension and working memory ( 12 items ; range : 024).23 the validity of the csid , cerad word list learning and recall , and the animal fluency test have been previously established in the chinese population and elsewhere.28 in this analysis , a standardized score for each cognitive test was created by subtracting the sample mean and dividing it by the sample standard deviation ( sd ) . a composite cognitive z - score was derived using the average of standardized scores of the nine cognitive tests . other information collected during the interview included age , sex , whether the participant attended school and years of schooling , marital status , household composition , alcohol consumption and smoking history , as well as a history of cancer , parkinson s disease , diabetes , hypertension , stroke , heart attack , head injury , and bone fracture . for each reported medical condition none of the participants reported hyperlipidemia , and none reported taking medication for this condition . participants height , weight , and blood pressure ( measured twice ) were measured during the interview . univariate analysis of covariance ( ancova ) models using the composite cognitive z - score as the dependent variable and each participant s characteristics as the independent variables were used to select potential covariates associated with cognitive score . to detect potential nonlinear relationships between biomarker measures and cognitive scores , we divided biomarker values into quartile groups and used quartile groups in both univariate and multivariate ancova models . we also examined interactions among significant markers in multivariate models and conducted a stratified analysis when significant interactions were detected . in addition , we explored potential interactions between apoee4 carrier status and each of the biomarkers . participants for this study were recruited on two occasions . between december 2003 and may 2005 , 2,000 individuals aged 65 years and over from four counties in the people s republic of china were enrolled . two counties were from sichuan province in southwestern people s republic of china and the other two counties were from shandong province in eastern people s republic of china . cognitive assessment was conducted at baseline , and at 2.5 years and 7 years after baseline . of the 2,000 participants enrolled during 20032005 , a second enrollment was conducted between 2010 and 2012 , approximately 7 years after the baseline study was conducted . individuals from the four original study sites who had since turned 65 years old , and who were not enrolled in the original cohort , were invited to participate in the study . eight - hundred - and - eight individuals were enrolled during the second enrollment wave ; thus 2,056 participants underwent cognitive assessment during 20102012 . the study was approved by the indiana university ( iu ) institutional review board and the institute for environmental health and related safety , chinese center for disease control and prevention . fasting blood samples were collected in the morning using 10 ml purple top ( containing ethylenediaminetetraacetic acid ) vacutainer tubes manufactured in the united states . serum homocysteine , triglycerides , low - density lipoprotein ( ldl ) , and high - density lipoprotein ( hdl ) were measured using roche diagnostic kits and a hitachi automatic biochemistry analyzer 9700 . total cholesterol levels were calculated using the sum of the ldl and hdl plus one - fifth of triglyceride levels . apoe genotype was determined by the multiplex tetra - primer amplification refractory mutation system polymerase chain reactions.17 cognitive assessment was conducted in face - to - face interviews using nine cognitive tests : the community screening instrument for dementia ( csid ) ; the consortium to establish a registry for alzheimer s disease ( cerad ) ten - word list learning ; word list recall;18 iu story recall;19 animal fluency test;20 boston naming test;21 stick design ; delayed stick design;22 and the iu token test.23,24 the csid was developed as a screening tool for dementia in populations with various cultural backgrounds and literacy levels . details of the instrument have been published elsewhere.25 the csid cognitive assessment items measure the following functions in a short interview with the study participants : memory ; abstract thinking ; judgment ; and other disturbances of higher cortical function ( aphasia , apraxia , agnosia , and constructional difficulty ) . the csid has demonstrated both good 2-week test retest reliability and interrater reliability , in addition to good validity in detecting dementia in various populations.25,26 csid has 30 items and scores range from 030 . the cerad word list learning test is one of the measures from the cerad neuropsychological assessment battery , which was designed to assess cognitive skills in the elderly.18 it consists of a ten - item , three - trial word list in which free recall is taken after each learning trial and after a brief delay ( approximately 5 minutes ) . the score is the total number of words recalled across the three learning trials ( range : 030 ) and at delay ( range : 010 ) . the iu story recall task19 was created by the research team to be suitable to the chinese culture and the rural population . the examiner reads the story out loud to the subject , who then attempts to recall the story verbatim . the story has 14 units of information that are gist scored ( range : 014 ) , meaning a recalled answer is deemed correct if the main point is recalled , in contrast to verbatim . the story was tested in 1,500 elderly chinese adults in a previous pilot study and was found to be acceptable to the villagers ; it produced a normally distributed range of scores.27 the animal fluency test is a measure of executive function in which a subject names as many animals as possible in 60 seconds.20 the iu token test is a brief measure of language comprehension and working memory ( 12 items ; range : 024).23 the validity of the csid , cerad word list learning and recall , and the animal fluency test have been previously established in the chinese population and elsewhere.28 in this analysis , a standardized score for each cognitive test was created by subtracting the sample mean and dividing it by the sample standard deviation ( sd ) . a composite cognitive z - score was derived using the average of standardized scores of the nine cognitive tests . other information collected during the interview included age , sex , whether the participant attended school and years of schooling , marital status , household composition , alcohol consumption and smoking history , as well as a history of cancer , parkinson s disease , diabetes , hypertension , stroke , heart attack , head injury , and bone fracture . for each reported medical condition none of the participants reported hyperlipidemia , and none reported taking medication for this condition . participants height , weight , and blood pressure ( measured twice ) were measured during the interview . univariate analysis of covariance ( ancova ) models using the composite cognitive z - score as the dependent variable and each participant s characteristics as the independent variables were used to select potential covariates associated with cognitive score . to detect potential nonlinear relationships between biomarker measures and cognitive scores , we divided biomarker values into quartile groups and used quartile groups in both univariate and multivariate ancova models . we also examined interactions among significant markers in multivariate models and conducted a stratified analysis when significant interactions were detected . in addition , we explored potential interactions between apoee4 carrier status and each of the biomarkers . this analysis included 1,889 participants with both biomarker measures and cognitive test scores . in table 1 , we present data on the patients demographic characteristics and on the medical history of the participants . the mean age ( sd ) of the participants in the analysis was 73.5 years ( 5.9 years ) , with 53.9% being female . the average number of years ( sd ) of education was low at 2.4 years ( 3.0 years ) , and the average bmi ( sd ) was 23.1 ( 3.8 ) , which was within the normal weight range . in table 2 , we present summary data on the cognitive tests in calculating the composite z - score . in table 3 , we present the summary data of biomarker measures . approximately one - half of the participants ( the first [ q1 ] and second [ q2 ] quartile groups ) had homocysteine levels in the normal range ( < 14 mol / l ) , and three - quarters of the participants ( the first three quartile groups , q1q3 ) had cholesterol levels in the normal range ( < 200 mg / dl ) . of all biomarkers considered in univariate models , total cholesterol , ldl , and homocysteine levels were significantly related to composite cognitive scores ( p<0.0001 ) . hdl , triglyceride , glucose , or apoe status were not significantly associated with cognitive function . since ldl and total cholesterol were highly correlated , we concentrated on describing the results using cholesterol quartile groups in the final multivariate models . results for ldl were similar . in the multivariate model adjusting for age , sex , years of education , bmi , smoking , and history of heart disease , we found a significant interaction between the homocysteine quartile group and the cholesterol quartile group ( p=0.0478 ) , indicating that the association between cholesterol levels and cognitive scores depends on homocysteine levels . in table 4 , we present ancova models for the relationship between cholesterol levels and cognitive scores stratified by homocysteine quartile groups , while adjusting for other covariates . an inverse u - shaped relationship between cholesterol level and cognitive scores was observed in the group with the lowest homocysteine level . using the highest cholesterol group as the reference , participants in the lowest cholesterol group had significantly lower cognitive scores ( p=0.0166 ) , and those in the third cholesterol quartile group ( q3 ) had significantly higher cognitive scores ( p=0.0148 ) than those in the reference group . it is worth noting that participants in the q3 group with cholesterol levels ranging from 154.6186.7 mg / dl had the highest cognitive scores . for participants in the middle two homocysteine quartile groups ( q2 and q3 ) with levels from 11.82 mol / l , those with the lowest cholesterol levels had significantly lower cognitive scores than the highest cholesterol group . for participants in the highest homocysteine group ( q1 ) , however , there was no significant association between cholesterol and cognitive scores . figure 1 displays predicted mean cognitive z - scores in the four cholesterol groups stratified by homocysteine quartile groups . a curvilinear relationship between cholesterol and cognitive score can be observed in the first homocysteine quartile group , but not in the other homocysteine groups . there were 804 participants with homocysteine in the normal range ( 14 mol / l).29 a similar inverse u - shape was detected when we fitted another ancova model that was restricted to these participants with normal homocysteine . to ensure that significant associations found in this analysis were not due to poor nutritional status of participants with prevalent dementia or cognitive impairment , we repeated the multivariate ancova models shown in table 3 by excluding participants in the bottom 10% of the composite cognitive z - scores . in this rural elderly chinese population , we found that the relationship between cholesterol levels and cognitive function is homocysteine - dependent . in participants with normal homocysteine levels , an inverse u - shaped relationship between total cholesterol levels and cognitive score was found indicating that both low and high cholesterol levels were associated with lower cognitive scores . our results suggest that as far as cognitive function is concerned , the optimal cholesterol level for individuals with normal homocysteine levels was centered at 170 mg / dl , below the standard treatment cutoff point of 200 mg / dl for hyperlipidemia . in participants with high homocysteine levels , few previous studies on the association between cholesterol levels and cognitive scores included both cholesterol and homocysteine in identical models , or considered nonlinear trends . no studies to date have explored the interaction between these two vascular risk markers . of the studies focusing on cholesterol alone , conflicting results have been reported on the relationship between cholesterol , dementia , and cognition.3,4 in studies measuring cholesterol in those aged 65 years or older , high cholesterol levels were reported to be associated with ad30,31 or cognitive impairment.32 however , others found that low cholesterol levels were associated with ad,33 dementia,14,34 or cognitive decline,35 although some studies reported no association between cholesterol levels and dementia risk.12,36 the inconsistency in results was often attributed to the age - related cholesterol decline.9 however , unless it can be shown that the age - related decline in cholesterol differentiates between those with cognitive impairment and those with normal cognition , age - related decline in cholesterol can not explain the observed discrepancy in results . another less often mentioned contributing factor to the inconsistency in results may be the confounding effect of statins and other lipid - lowering medications widely used in the elderly population . given the potential protective effects of some lipid - lowering medications on cognition,3 analysis without the appropriate adjustment to medications may fail to detect meaningful associations between cholesterol levels and cognitive function . in this chinese cohort , few participants took regular medications ; therefore , the measured cholesterol levels were probably not associated with the confounding effects from lipid medications . most previous studies focused on a linear relationship between cholesterol levels and cognitive function , and many did not consider other potential biomarkers . our results suggest a more complex relationship between cholesterol and cognition that is homocysteine - dependent . in participants with normal homocysteine levels , in addition , our models indicated that optimal cognitive scores are achieved with cholesterol levels centered at 170 mg / dl for participants with normal homocysteine . however , in those with high homocysteine , the effect of high homocysteine on cognition was overwhelming regardless of cholesterol levels . there are several plausible mechanisms that may underlie a homocysteine - dependent relationship between cholesterol and cognitive function . in animal studies , brain barrier leakage , which could contribute to the deterioration of cognitive function.37 high levels of homocysteine have been associated with increased risk for both cardiovascular disease and all - cause mortality,38,39 but the association between homocysteine and dementia or cognitive decline has not been consistently shown.40 animal , cellular , and autopsy studies have concluded that cholesterol plays an important role in brain function through synapse formation , membrane organization , amyloid- production and deposition , and inflammation ; thus , it is essential to maintain a certain cholesterol level for normal functioning.3 under normal homocysteine levels , where the blood brain barrier is intact , cholesterol levels are maintained to achieve optimal cognitive function . further , studies on cardiovascular disease risk have found a homocysteine and lipid interaction showing that higher homocysteine levels increased disease risk regardless of lipid levels ; however , a low level of plasma cholesterol did not seem to confer protection against the risk associated with increased plasma homocysteine.41 our study has many strengths . the study cohort was relatively large , allowing for the investigation of potential interactions among biomarker measures . a comprehensive set of cognitive measures was used in our study , ensuring robust results in grouping participants according to their composite cognitive scores . the cohort was unusual because few studies with cognitive and biomarker measures have been conducted in rural elderly chinese populations . our analysis is a cross - sectional study , and thus the observed association could be subject to reverse causation . however , similar results were found after we excluded participants with the worst cognitive scores , which indicates that reverse causation is unlikely . nevertheless , longitudinal studies will be valuable to confirm our results , and may lead to potential interventions for cognitive impairment because both cholesterol and homocysteine can be effectively controlled by current medications . another potential limitation is that our study was conducted in a population with a low level of education and with average bmi scores . in conclusion , we found that the relationship between cholesterol levels and cognitive function depends on homocysteine levels , which suggests an interactive role between cholesterol and homocysteine in cognitive function in the elderly population . further research is required to confirm our findings in other populations and to explore potential mechanisms underlying the lipid | introductionprevious studies have identified hyperlipidemia as a potential risk factor for dementia and alzheimer s disease .
however , studies on cholesterol measured in late - life and cognitive function have been inconsistent .
few studies have explored nonlinear relationships or considered interactions with other biomarker measures.methodsa cross - sectional sample of 1,889 participants from four rural counties in the people s republic of china was included in this analysis .
serum total cholesterol , high - density lipoprotein , triglycerides , and homocysteine levels were measured in fasting blood samples .
a composite cognitive score was derived based on nine standardized cognitive test scores .
analysis of covariance models were used to investigate the association between biomarker measures and the composite cognitive scores.resultsthere was a significant interaction between the homocysteine quartile group and the cholesterol quartile group on cognitive scores ( p=0.0478 ) . in participants with normal homocysteine levels ,
an inverse u - shaped relationship between total cholesterol level and cognitive score was found , indicating that both low and high cholesterol levels were associated with lower cognitive scores . in participants with high homocysteine levels ,
no significant association between cholesterol and cognition was found.conclusionthe relationship between cholesterol levels and cognitive function depends upon homocysteine levels , suggesting an interactive role between cholesterol and homocysteine on cognitive function in the elderly population .
additional research is required to confirm our findings in other populations , and to explore potential mechanisms underlying the lipid
homocysteine interaction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the development of liposomes capable of targeting cells has been an objective since the 80s [ 1 , 2 ] . the most prevalent method is to conjugate antibodies or antibody - based constructs ( e.g. , fragments or single chain fv ) directly on their surface ( i.e. , immunoliposomes ) . however , the ability of immunotargeted liposomes to deliver high doses of drugs or radioactivity to tumor cells in vivo remains to be demonstrated , partly because it is difficult to include all necessary features , that is , long circulation times , stable drug encapsulation or radiolabeling with high activities , and efficient antibody targeting in the liposomes preparation . other antibody constructs , such as bispecific antibodies , provide an alternative way to specifically target liposomes to cancer cells . it recognizes both a tumor - specific antigen and a small molecule ( the hapten ) used as a tag to the liposome membrane . the pretargeting system presents the advantage of using a stable bispecific antibody and liposomes that can be loaded extemporaneously with drugs or radionuclides , whereas stability and loading of immunoliposomes may be a problem . we have developed a liposomes radiolabeling method which is based on an active - loading approach for obtaining high specific activity - labeled liposomes . thus , the use of liposome as delivery systems represents an attractive alternative to vehicle important quantities of radionuclides . recent formulations of liposomes prevent their opsonization by serum proteins and thus enhance residence time in the bloodstream . this is obtained by the addition of peg functionalized lipids in their composition [ 68 ] . different pegylated liposomes formulations bearing the dtpa - indium hapten at their surface have been tested . such pegylated liposomes , also referred to as stealth liposomes , containing doxorubicin and a few other drugs have been approved for marketing . pe - peg were analysed for blood clearance over 24 h after injection in mice . the experiment showed identical half life and clearance ( 13,06 h and 0.16 ml / h or 13,89 h and 0.20 ml / h , resp . ) for 5 and 8% dspe - peg , indicating that 5% dspe - peg is sufficient to obtain a maximum blood residence time . nevertheless , preliminary in vivo results have shown an improvement by only a factor of 1.7 between passive tumor targeting ( absence of bispecific antibody ) and active targeting of the liposomes by prior injection of a bispecific antibody binding carcinomembryonic antigen ( cea ) on one arm and the dtpa - indium hapten on the other , in a model of cea - positive tumor xenografts in the mouse . passive targeting of the liposomes through the well - known enhancement permeability and retention effect is very significant , and , therefore , to be interesting , active targeting of the liposomes to the tumor sites must be more efficient than what we observed with these hapten - tagged pegylated liposomes . it is long known that pegylation can hinder specific recognition between immunoliposomes and target cells . steric hindrance may also be the reason for the poor enhancement of tumor uptake caused by the bispecific antibody . since this phenomenon has never been studied in a quantitative manner , we decided to use surface plasmon resonance ( spr ) to characterize the specific interactions between the antihapten antibody and hapten - tagged liposome as a model of specific immunologic interaction at the liposome surface in the presence of varying amounts of pegylated lipids and various peg chain lengths . spr is a technique that is frequently applied for measuring binding rate constants between two interacting entities , generally proteins . its most obvious advantages over other techniques are : direct and rapid determination of association and dissociation rates of binding process and no need of labeling liposomes . several studies have demonstrated that the technique is sensitive enough to monitor interactions between solutes and lipid bilayers like liposomes . artificial bilayer lipid membranes ( blms ) have been extensively used to mimic biological cell membranes for studying membrane processes such as signal transduction , ligand - receptor interactions , and ion transport through cell membranes [ 1113 ] . recent advances in the preparation of stable membrane - like surfaces and the commercialization of sensor chips has enabled widespread use of spr in analyzing these protein - membrane interactions in an environment that closely resembles our in vivo situation [ 1416 ] . in this study , tethered bilayer membrane on cm5 chips and nonfused liposomes immobilized on l1 chips have been used to monitor by spr the binding of antibodies to conventional and pegylated dtpa - indium - tagged liposomes . we compared several liposomes formulations composed of distearoylphosphatidylcholine ( dspc ) , cholesterol ( chol ) , dspe - dtpa that varied in their peg content and molecular weight ( 2000 , 1000 , or 750 ) . binding kinetics of a specific anti - indium - dtpa antibody ( clone 734 ) were monitored using the biacore system and the kinetic parameters were calculated by curve fitting . the purified mab 734 igg , with binding specific for the dtpa - indium complex , was kindly provided by ibc pharmaceuticals ( morris plains , nj ) . all chemicals were dissolved in sterile water ( versol or versylene , fresenius , france ) . phosphate buffered saline ( pbs 9.55 gl , pbs dulbecco ) was supplied by biochrom ag , ( berlin , germany ) . 0.4 m n - ethyl - n-(3-dimethylaminopropyl)-carbodiimide hydrochloride and 0.1 m n - hydroxysuccinimide ( nhs ) were obtained from ge healthcare . dimyristoyl - l--phosphatidylethanolamine ( dmpe ) , triton - x100 ( t - octylphenoxypolyethoxyethanol ) and stable indium-115 chloride ( in ) were purchased , respectively , from sigma - aldrich and sigma ultra . radioactive indium-111 chloride ( in ) other phospholipids used to prepare liposomes were : 1,2-distearoyl - sn - glycerol-3-phophoethanolamine - n-[methoxy(polyethylene glycol)-2000 ] m.w : 2805.54 ( dspe - peg2000 ) , 1,2-distearoyl - sn - glycerol3-phophoethanolamine - n-[methoxy(polyethylene glycol)-1000 ] m.w : 1631.37 ( dspe - peg1000 ) , 1,2-distearoyl - sn - glycerol-3-phophoethanolamine - n-[methoxy(polyethylene glycol)-750 ] m.w : 1528 ( dspe - peg750 ) , and 1,2-distearoyl - sn - glycerol-3-phophoethanolamine - n-[methoxy(polyethylene glycol)-550 ] m.w : 1351.78 ( dspe - peg550 ) were purchased from avanti polar lipids ( alabaster , al , usa ) . ( dspe - dtpa ) was synthesized by ecole nationale suprieure de chimie de rennes ( france ) . polycarbonate membranes for vesicle extrusion ( 100 nm or 200 nm pore size , nucleopore ) were from whatman . all phospholipids were dissolved in 9 : 1 chloroform / methanol mixture ( hplc grade , carlo erba and fisher scientific , resp . ) . avidin - coated tubes saturated with bovine serum albumin ( bsa ) were used for equilibrium affinity constant determinations of the anti - dtpa - indium antibody ( mab 734 ) in competition experiments between dtpa - in as a tracer and stable dtpa - metal complexes . briefly , 1 ml of a 50 ng / ml solution of biotinylated mab 734 fab fragment was incubated overnight at 4c in the avidin coated tubes . just before use dtpa ( 0.1 nmol ) was labeled with commercial indium-111 chloride ( 5 10 cpm ) and used as a tracer ( 15000 cpm in a total incubation volume of 0.3 ml ) . incubation with varying concentrations of stable dtpa - metal or edta - metal competitors was performed overnight at 4c in pbs supplemented with bsa . tubes were then counted after two rapid washes with 2 ml of nacl - tween . dimyristoyl - l--phosphatidylethanolamine ( dmpe ) was thoroughly mixed with pbs containing 1% triton - x100 ( t - octylphenoxypoly - ethoxyethanol ) to a final concentration of 1 mgml , followed by at least three freeze - thaw cycles , ultrasonication , and incubation at 55c . for vesicles preparation , the desired phospholipids ( dspc ) in organic solvent chcl3/meoh ( 9 : 1 ) were transferred to a 10 ml round bottom flask and the solvent was evaporated to dryness . pbs was then added to the lipid film for a final lipid concentration of 20 molml . large unilamellar vesicles ( luvs ) composed of dspc , dspc / dspe - dtpa ( 98 : 2 molar ratio ) or dspc / chol / dspe - dtpa ( 68 : 30.5 : 1.5 molar ratio ) were prepared according to the lipid film hydration method followed by extrusion . typically , for the nonfused liposomes , 13.5 mol of phospholipids , 6.6 mol of cholesterol , and 0.3 mol of phospholipids coupled to the chelating agent ( dtpa ) were dissolved in chloroform / methanol ( 9 : 1 v / v ) in a 10 ml round bottom flask . dspe - peg2000 ( 0.5 mol% , 1.5 mol% , 2.5 mol% , 3.5 mol% , or 5 mol% ) were included in the preparation according to the necessity of experimentation . a thin dry film of lipids was obtained by evaporation of the solvents in a rotary evaporator . hydration of the dry lipids was accomplished by addition of 1 ml of aqueous phase and maintained above the gel crystal transition temperature of the lipids during all the hydration procedure . to this effect , the flask containing the liposomes suspension was mixed during 2 h on a rotary evaporation system without vacuum , at room temperature for conventional liposomes ( dspc ) , and 74c for dspc / chol / dspe - dtpa pegylated liposomes . typically , the final concentration of the liposomes suspension was 20 mol of lipids per ml of aqueous phase . to obtain small and homogeneous vesicles , the liposomes suspension was sonicated times to time in a bath - type sonicator then 20 times extruded through nucleopore 100 nm polycarbonate filters using a manual thermostat heated extrusion device at room temperature for conventional liposomes and at 74c for pegylated liposomes . the size and polydispersity of the vesicles were measured by dynamic laser light - scattering system using a malvern high performance particle sizer ( hpps - et , instrument sa , uk ) . the mean size were 101 4 nm ( polydispersity index < 0.1 ) for conventional liposomes and 107 3 nm ( polydispersity index < 0.1 ) for pegylated liposomes with all concentrations of peg2000 . dtpa functionalized liposomes were prepared in citrate ( 0.10 m)/acetate ( 0.15 m ) buffer , ph = 5.3 . nonradioactive indium ( in ) chloride in hcl 0.02 n was added with a ratio of 10 indium molar equivalents per mole of lipids , and the mixture was incubated for 2 hours at 37c . then , in - loaded liposomes were separated from free indium by gel filtration chromatography using a pd-10 column eluted in pbs . freely accessible terminal carboxyl groups of the dextran layer were activated with n - ethyl - n'-(3-dimethylaminopropyl)-carbodiimide hydrochloride ) ( edc ) and n - hydroxysuccinimide ( nhs ) . the primary amine of dimyristoyl - l--phosphatidylethanolamine ( dmpe ) was then reacted with the activated succinimide esters overnight at 55c . this reaction yields the proximal monolayer of the lipid membrane that is covalently attached to the dextran layer on the gold surface . then , the dmpe - coated surface was thoroughly rinsed with distilled water and the chip was docked again in the biacore instrument . all flow cells were washed three times with 30 l 100 mm naoh ( flow rate 30 l / min ) . dmpe coupling provides the highly hydrophobic surface necessary for the subsequent functionalization of the tethered membrane by spontaneous vesicle spreading . lipid vesicles or liposomes were then spread on the dmpe layer to constitute the bilayer . briefly , liposomes ( 1 mg / ml in pbs ) were injected over the hydrophobic surface for four to ten minutes at a flow rate of 10 l / min . the biacore 3000 instrument equipped with the l1 chip was used for surface plasmon resonance measurement of antibody binding to nonfused liposomes . the surface of the chip was conditioned with three consecutive injections for 1 min at 30 l / min of isopropanol/50 mm naoh ( 2/3 , v / v ) . liposomes ( 1 mg / ml in pbs ) were deposited on three flow cells for 10 min at flow rate of 5 l / min . the liposomes surface was washed with naoh 100 mm for 1 min at 30 l / min . bound liposomes could be removed from the l1 surface at the end of the experiments by two 1-minute injections of 50 mm naoh : isopropanol ( 2/3 , v / v ) followed by two injections of chaps 2% ( w / v ) . a multitask afm cp was used for afm imaging in the tapping mode and topographic measurements . typically for the analysis , we observed the presence of a tethered lipid bilayer modified area and a nonmodified surface . for all measurements , the flow rate was fixed at 60 l / min . serial two - fold dilutions of mab 734 were prepared ( 750 nm to 0.78 nm ) and injected over on either the tethered planar bilayer on cm5 sensor chip or nonfused liposomes immobilized on the l1 sensor chip . dilutions of mab 734 were injected from low to high concentration in a single - cycle kinetic ( sck ) mode with association phases monitored for 3 min at 60 l / min and allowing 4 min dissociation phases . the resulting sensorgrams were fitted using a mathematical program based on single cycle kinetic model implemented in biaeval 4.1 software ( biacore ) . the mab 734 was originally screened for its binding to soluble dtpa - indium complex . competition experiments ( figure 1 ) using tubes coated with mab 734 allowed the equilibrium dissociation constant to be determined as 0.3 nm at 4c . dmpe was used for the setup of tethered artificial membranes by chemical coupling of the primary amino groups with succinimide esters of the dextran carboxylate groups . then , the three formulations of liposomes , pegylated , and conventional were spread on the dmpe monolayer after rinsing with pbs . this value is in agreement with the expected ru of the second monolayer coating of the cm5 sensor chip functionalized with dmpe . figure 3 emphasizes that ( a ) dspc - containing lipid vesicles spread and formed a 900 ru tethered planar bilayerand ( b ) dspc / dspe - dtpa - indium - containing lipid vesicles also spread but formed a 1100 ru tethered planar bilayer whereas ( c ) dspc / dspe - dtpa - indium / dspe - peg2000-containing lipid vesicles were not able to spread on the dmpe - monolayer . our formulation ( dspc / dspe - dtpa - indium - containing lipid vesicles ) induced a gain of 200 ru compared to the standard formulation ( dspc - containing lipid vesicles ) ( figures 3(a ) and 3(b ) ) . although conventional liposomes ( non - pegylated ) gave satisfactory results , it was not possible to create a lipid planar bilayer with the pegylated liposomes ( figure 3(c ) ) . this can be explained by the fact that peg - chains constitute a barrier against spreading on the dmpe layer . a cm5 sensor chip coated with the model bilayer obtained by fusing conventional liposomes to the dmpe layer was examined with an atomic force microscope ( afm ) . images clearly showed the topographical structure of lipid planar bilayers overlaying the dextran matrix and no liposomes stuck to the dextran as single particles confirming previous findings on either the characterization of planar supported bilayers or the behavior adopted by liposomes adsorbed on cm5 and l1 sensor chips with modified dextran matrix [ 15 , 21 ] . we could assume that liposomes fuse to form a lipid planar bilayer on the top of the dextran matrix which is the upper component of cm5 chips . moreover , it has already been demonstrated that liposomes adsorbed on l1 chips surfaces may remain as intact single vesicles . the affinity of mab 734 to the dtpa - indium functionalized lipid planar bilayer was tested on a biacore 3000 instrument in a single cycle kinetic model . the antibody bound the dtpa - indium hapten coupled to the dspe layer without binding to the control dspc layer . the binding was followed in real - time by a sensorgram resulting from the single - cycle kinetics assays on the functionalized bilayer after subtraction of the control dspc flow cell . the association and dissociation rate constants were calculated using the single cycle kinetics model also called titration kinetics model . the kinetic constants for mab 734 binding to the dtpa - indium - functionalized bilayer calculated using this procedure of global fitting are listed in table 1 . the ratio of the kinetic constants ( koff / kon ) provided a kd value , 1.6 nm , similar to those determined in the equilibrium binding experiments . a control surface was prepared by loading vesicles without dtpa - indium on the first flow cell of a l1 sensor chip , resulting in the deposition of 15000 ru . as indicated in figure 4 , conventional and pegylated liposomes were properly adsorbed on the sensor chip with approximately the same level of absorbance ( 1516000 ru ) . it was not possible to rule out vesicle fusion on the surface of the l1 chip by a direct observation with the afm . in addition , previous published data strongly suggested that vesicles remain intact once bound to the lipophilic anchors on the surface of l1 chips [ 22 , 23 ] . this finding has been confirmed by the characterization of calcein - loaded immobilized liposomes . then , mab 734 binding kinetics to the surface of l1 chip which has been coated with different types of liposomes ( dspc / chol / dspe - dtpa ( 68 : 30.5 : 1.5 ) , dspc / chol / dspe - dtpa / dspe - peg2000 ( 63 : 30.5 : 1.5 : 5 ) ) was monitored as above . the calculated affinity constant ( kd = 1.6 10 m ) for conventional liposomes was exactly the same as the value obtained with planar bilayer formed by conventional liposomes on cm5 ( table 1 ) . the surface of the first flow cell coated with vesicles without dtpa - indium was used as a nonspecific binding control . in addition , antibody binding was observed only on liposomes surfaces functionalized with dtpa loaded with indium ( data not shown ) . the binding responses shown in figure 5 illustrate that dtpa - indium - functionalized liposomes prepared with dspe - peg2000 at various concentrations ( 0.5%1.5%2.5%.5% ) bound the antibody with an affinity that strongly decreased with the dspe - peg2000 fraction ( mab 734 antibody - binding responses were normalized for the level of liposomes captured on each surface , making it possible to compare the binding results directly ) . this effect was observed when the dtpa - indium hapten was directly coupled to dspe ( dspe - dtpa ) . using the same fitting procedure ( sck model ) , the kinetic constants for mab734 binding were calculated for the different percentages of pegylated lipid in the liposomes preparations ( table 2 ) . thus , the higher affinity was observed for the non - pegylated liposomes . when the concentration of dspe - peg2000 was increased from 0 to 3.5% , kon reduced about 40 times while koff increased about 3 times . the rmax value seems to follow the same decrease as the association rate . from these findings , we can assume that the dtpa - indium haptens are masked by the pegylated chains of dspe - peg2000 . more precisely , the diminution of association rate constant and rmax can be almost totally explained by the steric effects of the pegylated chains that reduce the diffusion factor . the faster dissociation rates may be attributed to a decrease of rebinding during the dissociation phase that can also be explained by steric hindrance . both effects combined in increasing the dissociation constant from 1.6 nm in the absence of dspe - peg to over 1 m with 3.5% of dspe - peg2000 . the binding responses shown in table 3 emphasize that dtpa - indium - functionalized liposomes prepared with dspe - peg at various sizes ( dspe - peg750dspe - peg1000 ) bound the antibody with a much higher affinity for dspe - peg750 compared to dspe - peg2000 at the same concentration ( 2.5% of dspe - peg ) . the antibody was also able to bind the liposomes with a higher concentration of dspe - peg750 ( 6% and 8% of dspe - peg ) . liposomes pegylated with peg1000 gave an affinity which was intermediate but higher than the one obtained with dspe - peg2000 . the fundamental properties of unconjugated liposomes ( e.g. , size , surface charge , pegylation , and membrane fluidity ) that largely determine their fate in vivo have been identified [ 10 , 25 ] , and their effect on liposomes biodistributions and pharmacokinetics has been studied and understood to a great extent . however , the presence of surface conjugated - ligands ( antibodies , protein fragments , and haptens ) in targeted liposomes introduces additional complexities in their interactions with the biological milieu . a better understanding of these interactions will result in better targeted liposomes for maximum targeting specificity . at this point , it is clear that addition of peg to the liposomes surface is needed to prevent opsonisation , fast uptake of the liposomes in the liver , and rapid clearance . introducing immunospecific ligands in the liposome membrane can target the liposomes and their content , but peg chains interfere with antibody recognition . this steric hindrance is observed when an antibody is attached to the liposomes surface but also , as shown in this paper , when the liposome is tagged with a small molecular weight ligand to be recognized by an antibody or , as described by cao and suresh , by a bispecific antibody . this study also demonstrates that biosensors and spr may be used to quantify this phenomenon of steric hindrance as a function of the fraction of pegylated lipids added to the liposomes and as a function of the length of the peg chains . using cm5 chips , tethered bilayers cm5 chip provides us with the development of a tethered bilayer obtained by the spreading of non - pegylated liposomes that yielded us to determine information on kinetics and thermodynamics . this model offered the advantages of controlling more precisely the bilayer formation and above all the quantity and the saturation degree of hapten used for the calculation of binding rates . the antihapten antibody then binds to the hapten coupled to phospholipids and incorporated into the liposomes preparation . the binding kinetics between mab 734 and the indium - dtpa hapten bound to these non - pegylated phospholipid bilayers showed specific binding with an affinity value of 1.6 10 m , close to that measured in a completely different system of immobilized antibody and soluble radiolabeled indium - dtpa hapten , which may be considered as a mirror situation . this first experiment provides us with reference - binding rates and dissociation constants obtained both by kinetics and equilibrium measurements . unfortunately , dpse - peg containing liposomes appeared not to bind and fuse on the surface of these cm5 chips . this may be easily explained by the hydrophilic barrier created by peg chains at the surface of the liposomes preventing the interaction with the hydrophobic surface of the chip . thus , l1 chips were used and shown capable of binding both conventional and pegylated liposomes , independently of the dspe - peg2000 molar ratio , peg chain length , and the addition of hapten - bearing phospholipids . although afm could not demonstrate directly that the liposomes attached to the l1 chips remain intact , indirect evidence has been published in the literature in favor of this hypothesis [ 2224 ] . l1 chips were coated with liposomes prepared with different lipid compositions to very similar ru signals . it is difficult to ascertain that this means that the number of liposomes or the number of indium - dtpa molecules attached to the chip is identical with pegylated and non - pegylated liposomes . besides , the kinetic analysis used to derive binding constants is not dependent on this number . these differences in binding affinities must reflect steric hindrance from the peg chains and not a problem of liposomes capture . thus binding of preformed liposomes of various compositions to l1 chips provides a robust and versatile system for in vitro binding studies of antibodies directed against liposome - bound antigens , using spr . the incorporation of pegylated lipids in the liposome membrane hinders antibody binding in a pegylated lipid fraction - dependent manner . the concentration and results from these binding studies show that hapten - tagged vesicles prepared with dspe - peg2000 at a ratio equal to or greater than 5% are poorly recognized by the antihapten antibody . the relative affinity of the antibody for hapten - bearing liposomes decreased from 1.6 10 m to 1.1 10 m when the pegylated lipid percentage increased from 0% to 5% . we have looked into the variations of speed and diffusion coefficients in real - time . rate constants measured by spr revealed decreased diffusion coefficients of the antibody with vesicles containing various concentrations of dspe - peg2000 that translated in kon values decreasing with the peg concentration . all these phenomena could be physically explained by the relative pliability and flexibility of peg chain and its unspecific interactions in equilibrium with the positive charge molecules present at the surface of liposomes . peg chain with a relatively long size induces a steric hindrance , a diffusing difficulty of the antibodies to the hapten site . the masking of these haptens results in kon decreasing value and a decrease of rmax . nevertheless , once the antibodies are bound to their haptens the intensity of the interactions is not modified and only the rebinding capacity is diminished , that is traduced by a less increasing of koff value . liposomes prepared with shorter peg chains dspe - peg750 or dspe - peg1000have more tightly bound the anti - hapten antibody , thus showing less steric hindrance . the shorter the chain , the easier the antibody mab 734 diffuses , the higher the kon , and the higher the affinity for the antibody - hapten interaction . these three effects may be the result of two phenomena : peg chain sweeping is influenced by the chain length and the formation of a tight mesh of peg chains is influenced by the peg concentration . clearly , size and concentration of peg chains limit the mass transfer of antibodies to their binding sites . shorter peg chains even at high concentrations should improve in vivo targeting because the affinity decreased only to 2.5 10 m and 5.5 10 m with , respectively , 8% of dspe - peg750 or 6% of dspe - peg1000 . as the shorter peg chains are more rigid , they are less capable of sweeping and unspecifically interacting with the liposomes . the less peg chain interfere with the diffusion of antibodies and the masking of haptens , the less kinetics constant are modified and the more peg concentration could be increased without loss in affinity . the first in vivo pretargeting experiments , with pegylated radiolabeled liposomes prepared with 5% of dspe - peg2000 and bispecific antibodies , showed encouraging but insufficient results with a tumor uptake increased by a factor of 1.7 , compared to passive targeting of conventional liposomes . the results of this study by spr reveal and quantify a large loss of hapten - antibody affinity with such a formulation . the pharmacokinetic parameters of the other formulations have been evaluated ( data not shown ) showing reasonably long circulation times , particularly with liposomes containing 6% or 8% of shorter peg chains ( 750 or 1000 ) . antibody interactions , they will be tested for pretargeted delivery of radionuclides to tumors in vivo . spr biosensors , such as biacore , are most often used to measure the binding kinetics and affinity constants of molecular interactions . we describe here an application that could have a significant impact on the study of antibody / liposome interactions . earlier studies demonstrated the feasibility of biosensor simulation for acquiring binding data and predicting targeting performance . the study of pegylated liposome formulations with variable peg 2000 fractions and different peg chain sizes ( peg 1000 and peg 750 ) by spr prompted us to perform further pharmacokinetics experiments to obtain the necessary information to improve immunotargeting in vivo . | targeted pegylated liposomes could increase the amount of drugs or radionuclides delivered to tumor cells .
they show favorable stability and pharmacokinetics , but steric hindrance of the peg chains can block the binding of the targeting moiety . here
, specific interactions between an antihapten antibody ( clone 734 , specific for the dtpa - indium complex ) and dtpa - indium - tagged liposomes were characterized by surface plasmon resonance ( spr ) .
non - pegylated liposomes fused on cm5 chips whereas pegylated liposomes did not .
by contrast , both pegylated and non - pegylated liposomes attached to l1 chips without fusion .
spr binding kinetics showed that , in the absence of peg , the antibody binds the hapten at the surface of lipid bilayers with the affinity of the soluble hapten .
the incorporation of pegylated lipids hinders antibody binding to extents depending on pegylated lipid fraction and peg molecular weight .
spr on immobilized liposomes thus appears as a useful technique to optimize formulations of liposomes for targeted therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prostate cancer is prevalent throughout the world . it is the most common cancer in european men and the second most common in american men . in the united states , prostate cancer presents a significant health challenge ; each year , 200,000 new cases are reported and 32,000 men die of the disease . historically , there has been a shift toward early stage diagnosis of prostate tumors using the prostate - specific antigen test . in addition , owing to limitations associated with the prostate - specific antigen test , its use is controversial and in many instances no longer recommended . the current standard therapy for patients with metastatic or recurrent prostate cancer involves the reduction of androgen levels . under this androgen - deprivation therapy , tumor progression can be stopped for several years , but eventually disease progression resumes , albeit more slowly . this castration - resistant prostate cancer ( crpc ) is notoriously heterogeneous in terms of response to treatment and patient survival . therefore , a better understanding of the disease and its response to treatments is urgently required . studying tumor tissue from patients with metastatic prostate cancer is challenging , as it tends to spread to the bone , making biopsies difficult . even the primary tumors themselves are small and mixed in with stromal tissue , and so precise dissection is challenging . despite these obstacles , researchers have undertaken whole - exome and whole - genome sequencing studies of crpc cases in an effort to reveal the genetics changes in these patients . studies such as these found no single gene mutated across all prostate cancers , but did find alterations such as the fusion ( tmprss2-erg ) between the transmembrane protease , serine 2 gene ( tmprss2 ) and the ets related gene ( erg ) in about half of the tumors . additionally , low overall somatic point mutation rates were consistently observed when compared with other tumors such as glioblastomas . because acquiring tumor tissue is problematic , these assays are only minimally invasive , do not require intricate dissections and are , therefore , more straightforward in their standardization , allowing for repeated sampling over time . studies using whole blood have shown that mrna expression signatures can be used to group patients with crpc into high- and low - risk groups . circulating tumor cells ( ctcs ) are rare in the peripheral blood of patients with cancer , including those with metastatic prostate cancer . these cells have been isolated and used to identify molecular markers of prostate cancer , as well as its response to treatments . while informative , these studies are limited by their reliance on the isolation of ctcs through the expression of epithelial cell adhesion molecule . therefore , this technique requires additional expenses involving reagents and equipment beyond just a simple blood draw . in addition , any ctcs that are epithelial cell adhesion molecule - negative will be missed by this assay . fragments of circulating tumor dna ( ctdna ) , 140 base pairs ( bp ) to 170 bp long , have been found at low numbers in the blood of patients with tumors . analysis of this plasma dna provides a new option for the analysis of tumor genomes . previously , ctdna from ovarian cancer has been amplified and sequenced using a tagged amplicon method called tam - seq . this technique had excellent sensitivity as demonstrated by its ability to sequence dna regions present in a single copy of ctdna . altogether , this ' liquid biopsy ' approach shows great potential and , with standardization and a reduction in price , could revolutionize personal genomics in cancer management . to bring the power of whole - genome analysis to a more routine clinical benchtop setting , heitzer et al . have now developed an improved technique that profiles cell - free plasma dna from patients ( figure 1 ) . this new method , which the authors name plasma - seq , uses shallow sequencing ( depth of about 0.1 ) with a benchtop high - throughput instrument ( illumina miseq ; illumina , inc . , san diego , ca , usa ) to examine the tumor genomes of patients with metastasized prostate cancer . before implementing plasma - seq on samples from these patients , heitzer et al . thoroughly tested their approach on different samples , including fragmented dna from a colon cancer cell line and samples from pregnancies with trisomies of distinct chromosomes . plasma - seq was consistently able to identify the extra chromosome segments in the trisomy cases , demonstrating the robustness of this technique . blood is drawn from the patient , plasma prepared and the plasma dna is isolated . shallow sequencing of the plasma dna using an illumina miseq machine takes about 12 hours to perform . finally , alignment of the dna sequences and analysis of the resulting data take between 2 and 3 hours . the authors then progressed to whole - genome sequencing of plasma samples from individuals without cancer and those with cancer . these experiments revealed many copy number differences that were previously associated with prostate cancer . among these changes were the tmprss2-erg fusion , losses of chromosome 8p , gains of chromosome 8q , and gains of the androgen receptor . all of this information was obtained at a very reasonable cost and in only two days . to further demonstrate the effectiveness of plasma - seq one patient had their primary tumor completely removed 13 years prior to the plasma analyses . because the primary tumor was predicted to be heterogeneous , it was divided into six sections and whole - genome sequencing was performed for each region . consistent with the prediction , whole - genome sequencing revealed different copy number changes in different regions . plasma samples were taken three different times over a 9-month period , 13 years after tumor resection to analyze secondary tumors in a castration resistant patient . plasma - seq identified multiple chromosomal rearrangements that had not been present in the original primary tumor . additionally , the results at each of the three distinct time points were virtually the same , suggesting that one dominant clone released dna into circulation . these results demonstrate the utility of plasma - seq not only for prostate cancer , but also in tracking changes in any metastatic cancer . this is the first whole - genome sequencing analysis from plasma dna of patients with prostate cancer . showed that analysis of plasma dna from a patient could be used as a noninvasive method of tumor cell genotyping that can be repeated over time and used to monitor tumor responsiveness to therapy . the authors show that plasma - seq is both reliable and robust through various controls and comparisons with other methods . plasma - seq is faster and cheaper than previously used protocols , while still being reliable , making it more advantageous for use in a clinical setting . it also requires less specialized equipment than what is normally required for circulating tumor cell analysis . one disadvantage of plasma - seq is that the limited coverage makes structural chromosomal rearrangements difficult to identify with high confidence . this suggests that it is excellent for finding previously identified mutations , but perhaps not as useful for the identification of new mutations involved in prostate cancer metastasis . given its dramatically reduced cost and time of analysis , plasma - seq will undoubtedly be more widely applied in different clinical settings in the near future . bp : base pair ; crpc : castration - resistant prostate cancer ; ctcs : circulating tumor cells ; ctdna : circulating tumor dna . | personalized genomics will only be useful for monitoring the prognosis of patients with cancer when it becomes much more cost - effective and quicker to apply .
a recent study brings this closer to reality with the development of plasma - seq , a rapid , low - cost method that sequences the circulating dna present in the peripheral blood of patients with cancer .
the power of this technique is demonstrated with the examination of tumor genomes from patients with prostate cancer.see related research article : http://genomemedicine.com/content/5/4/30 |
You are an expert at summarizing long articles. Proceed to summarize the following text:
background and importance : some of the frequently reported possible consequences of burnout among emergency medicine practitioners are decreased career satisfaction , low job performance and high prevalence of mental problems such as anxiety , depression , and suicide are ( 15 ) . furthermore , in residency training programs , burnout reduces the quality of residents education by decreasing motivation and job involvement , and leads them to leave their career ( 6 , 7 ) . burnout is defined as a state of excessive physical , emotional , and mental fatigue and frustration caused by chronic involvement in emotionally demanding situations ( 8) . it can be measured reliably by the maslach burnout inventory , in its three subscales : emotional exhaustion ( feeling of being emotionally exhausted and tired with work ) , depersonalization ( an impersonal feeling about clients which leads to a callous or dehumanized perception towards them ) , and a low sense of personal accomplishment ( decreased feeling of competency and dissatisfaction with one s work ) ( 3 , 9 ) . emergency physicians are reported to have high intensity and unhealthy stress in their work environment ( 2 , 3 , 10 ) . sleep disturbances , high patient load , insufficient administrative support , perceived inadequacy of resources , emergent decision making based on ambiguous information , fear of malpractice and litigation issues are some of the factors associated with burnout among emergency physicians ( 2 , 10 ) . american college of emergency physicians ( acep ) has reported five factors as most stressful for emergency physicians : 1 ) irregular schedule , 2 ) unreasonable patient demands , 3 ) fear of making mistakes , 4 ) threat of malpractice , and 5 ) problems with nursing staff ( 2 ) . kuhn et al reported a model for predicting burnout in emergency physicians and found that high anxiety caused by anticipating bad outcomes is the strongest predictor ( 11 ) . some additional factors are reported in residents such as : younger age and low experience , lack of role clarity , economic difficulties , safety issues , dealing with difficult patients , bureaucracy , dysfunctional systems , and political issues ( 6 , 7 , 12 , 13 ) . in spite of the significant consequences of burnout , both on emergency physicians themselves and on the quality of care they deliver to their patients , few studies have investigated predictive stressors in burnout development and efficient ways to prevent it . emergency medicine is a relatively young specialty in iran . since the establishment of emergency medicine residency training program in 2001 , no data is available about work related problems of this specialty in iran . we designed this study to investigate the prevalence of burnout in iranian emergency medicine practitioners and its correlation with their demographic characteristics and work related factors . moreover , we tried to assess a model of stressor predictors of high burnout in our population . identifying the major predictors of burnout among emergency physicians can be the first step to develop protective strategies . this was a questionnaire - based cross sectional study of all iranian emergency medicine residents and practitioners . all residents and practitioners of emergency medicine in iran ( except the first and second authors ) were eligible for this cross - sectional study ( 188 physicians ) . the main part of data ( 84% ) was collected by attending work place of emergency physicians , mainly during their weekly conferences . after a brief explanation about the study purpose , informed consent was obtained , and the participants were then asked to answer the questionnaires . for other practitioners ( 16% ) they were called and after receiving some explanation about the study , were asked to sign the consent form , complete and mail back the questionnaires . all data was collected in march and april of 2008 , to avoid any seasonal bias . all gathered information was confidential , the names and specifications were substituted by unique codes , and participation was completely voluntary . this study was approved by the ethics committee of tehran university of medical sciences in 2008 . a 75-item self - administered questionnaire , comprised of 3 sections was prepared by the authors : the first part was socio - demographic ( i.e. age , sex , marital status , smoking , exercise ) and work - related items ( i.e. resident or not , number of shift hours in emergency department during previous week , mean shift hours per week in previous 6 month , weeks off work in previous year ) . a list of all possible stressors was developed based on a review of medical literature and a focus group discussion with emergency medicine residents and practitioners in tehran university of medical sciences ( 1 - 7,10 - 13 ) . participants were asked to rate the frequency of experiencing each stressor on a likert - type scale ranging from 1 ( not at all ) to 5 ( in every shift ) . each stressor was written as a statement such as i am worried about making mistake in my practice or terminally ill patients make problem for me . the face validity of the questionnaire was assessed by three experts prior to administration , and it was implemented in a sample of 20 residents of internal medicine , as a pilot study to find and resolve any problem . mbi has been found to be reliable , valid and easy to use ( 9 ) . it has22 statements which measure the three burnout components : nine for emotional exhaustion ( ee ) , eight for personal accomplishment ( pa ) , and five for depersonalization ( dp ) . each statement is a sentence like i feel like i m at the end of my rope and participants are asked to rate the frequency of experiencing such feeling on a seven - point scale from never ( 0 ) to every day ( 6 ) . the score of each subscale is calculated by summing up the scores of its items . high , moderate , or low levels of burnout are determined according to standard cutoffs for medical staff . these three dimensions ( ee , pa , dp ) can not be combined and shown in one score ( 9 ) . the term burnout was avoided in the questionnaire and explanation to prevent any bias . the validity and reliability of the persian translation of mbi has been previously proved by filian ( 14 ) . for stressor questionnaire , we tested correlation between all 38 stressor items and combined them based on their correlation coefficient ( significant at p - value<0.05 , more than 0.5 ) and their content ; making 19 final categories for stressors , explained in the result section . the three dimensions of burnout were calculated for each participant and ranked as high , moderate , or low . the correlation between demographic and work - related factors with burnout level , also association between stressors with the score of burnout , was investigated using univariate analysis . to find the best model to predict high burnout level , logistic regression model was used to predict level of burnout for each dimension separately ( high vs. low or moderate ) . only significant factors in univariate analysis ( which had significant association with score or level of burnout ) were entered in the regression model . from 188 eligible residents and graduates , 165 participated in this study ( response rate : 88% ) . the score for each subscale of mbi was considered as missing if only one question related to that subscale has been left unanswered . demographic and work - related characteristics of participants table 2 shows the list of 19 categories of stressors ( reduced from a 38-item list ) , the mean score calculated for each item for all respondents , and for residents and graduates , separately . for all stressors , the stress score for residents was higher than for graduates , except patients economic problems , from which graduated emergency physicians reported experiencing more stress from . mean scores reported for work related stressors , based on frequency of experience , listed in descending order in total population . the minimum and maximum possible score for each stressor were 1 ( never experiencing ) and 5 ( experiencing in every shift ) by comparing stressors scores between the first , second and third year residents and graduated physicians , we found that first year residents reported to experience stress from 8 sources significantly more frequently than other participants , including fear of malpractice , relationship with other services , care of the old or terminally ill patients , insufficient skills , difficulties to balance professional and private life , violence in ed , educational issues ( morning reports , teaching rounds , etc . ) , and having to deal with new technologies . five items were reported significantly more frequent by first and second year residents in comparison with third year residents and graduated physicians ; these included work overload , physical environment at work , shortage of equipment , consultant unavailability , and work related fatigue . finally , 2 factors were similar in all residents and significantly higher than graduates : insecurity about future career in field of emergency medicine , and text needed to be read overload . the number of completely answered questionnaire was 158 for emotional exhaustion ( ee ) , 160 for depersonalization ( dp ) , and 155 for personal accomplishment ( pa ) . the mean score for the ee subscale was 22.94 ( sd=13.6 ; 95% ci=20.78 - 25.01 ; range from 19 - 26 is considered as moderate ) , the mean score for dp was 9.3 ( sd=6.8 , 95% ci=8.24 - 10.36 ; a score between 5 and 10 is considered as moderate and above 10 is high ) , and the mean score for pa was 31.47 ( sd=9.9 , 95% ci=29.87 - 33.07 ; scores below 33 is considered low ) . on individual level , 39% of the respondents had high depersonalization ( 95%ci : 31%-47% ) , 37% had high emotional exhaustion ( 95% ci : 29%-45% ) , and 46% had high burnout in personal accomplishment ( 95%ci : 38%-54% ) . some of the demographic and work - related factors had significant relationship with high level of burnout in each dimension . table 3 and 4 show the relationship of high burnout in three subscales and these demographic and work related factors . relative risk ( rr ) of demographic and work related factors for high burnout in emotional exhaustion ( ee ) , depersonalization ( dp ) and personal accomplishment ( pa ) subscales . ed : emergency department mean of work and demographic factors in high burnout group in emotional exhaustion ( ee ) , depersonalization ( dp ) and personal accomplishment ( pa ) subscales . mean age is higher for moderate and low dp ; and more weeks off work is associated with lower ee and dp table 5 shows correlation between stressors and score of burnout in each dimension . all stressors had a significant relationship with higher score of ee and dp , except for patients economic problems with dp . twelve out of nineteen stressors had significant correlation with the lower score of pa subscale ; although the strength of correlation between stressors and pa score was lower than of dp and ee scores . the model was significant for predicting high burnout in this subscales ( hosmer and lemeshow test p - value=0.609 ) . the model was also significant for dp ; but none of the variables had a significant odds ratio . the significant predictors for high ee were work overload , economic problems and insecurity of future career in field of emergency medicine , and difficulties to balance professional and private life . perception of more stress from new information technologies had a protective effect on high emotional exhaustion . together these factors explained 50% of the total variance in reporting a high degree of ee . correlation between stressors score and burnout score in three subscales ; for ee ( emotional exhaustion ) and dp ( depersonalization ) , higher score means higher burnout ; for pa ( personal accomplishment ) , lower score means higher burnout significant factors ( p - value<0.05 ) in predicting high level of emotional exhaustion the results of this study showed that a high percentage of these physicians are suffering from moderate to high degrees of burnout ( 56% of on emotional exhaustion , 66% on depersonalization , and 78% on personal accomplishment subscale ) . other studies from different countries reported almost the same percentage ( 1 , 15 , 16 ) ; for example a study found 60% of moderate to high burnout in a large population of 1,272 american emergency medicine practitioners ( 10 ) . in a nationwide survey in romania , the level of occupational stress and burnout in emergency medicine professionals was reported to be the highest among all medical specialties ( 17 ) . considering the serious adverse effects of burnout on physician s health and job satisfaction , and its effect on quality of care for patients , also new establishment of emergency medicine and possibility for amendment in its future development , it is essential to pay more attention to its predicting factors in order to find ways to prevent it . the highest percentage of reported burnout is on personal accomplishment level and then depersonalization subscale . more severe burnout on depersonalization dimension has been reported in previous studies on emergency physicians ( 1 , 2 , 15 ) . it is suggested that the nature of emergency medicine , which involves a short - term relationship between physician and patient , may contribute to the development of this problem higher depersonalization or it may result from use of this attitude as a protective defense mechanism ( 2 ) . some researchers have proposed the probability that some other factors , apart from burnout , may contribute to this negative impersonalized attitude towards patients ( 18 ) . the importance of this attitude is even more obvious when considering the reports of its association with self - reported sub - optimal care of patients ( 19 ) . the feeling of low personal accomplishment among emergency medicine practitioners may reflect the perception of emergency medicine in relation to other specialties , which leads to low satisfaction and sense of not being efficient enough . since the specialty is very new , this may be a temporary problem that will be resolved in future . when analyzing the association between high burnout and demographic and work - related factors , results showed that high ee was not associated with any of the demographic factors . however , higher dp was found in men , younger physicians , and those who were living alone . on pa dimension , generally our results are consistent with previous studies ( 5 , 10 ) , which have reported no relationship between age , gender , and marital status with level of burnout . however , higher levels of burnout had been reported in those physicians who were smoking and not doing exercise . comparing different years of residency , higher level of ee and dp were found in first year and higher level of burnout on pa was seen in third year residents . higher level of stress in first year of residency had been reported in previous studies ( 20 ) . on the other hand , third year of emergency medicine residency may be a crucial time for residents to evaluate themselves and get ready to leave education setting and enter job market , where they are supposed to work independently ( 7 ) . low sense of personal accomplishment in third year residents may reflect their stress and low self esteem in evaluating themselves . interestingly , number of weeks off work is significantly associated with lower level of burnout in ee and dp subscale . considering no official off weeks has been considered in residency program and curriculum , this may be a required change that may be effective . overall the strongest stressors were shortage of equipment , problems with work environment , and relationship with other services ( including nursery , lab and other medical services ) . again , considering the recent establishment of this specialty in iran , it could reflect the organizational and financial problems of these new departments . difficulties to balance professional and private life , work overload and fatigue associated with it , and fear of malpractice had strongest relationship with high ee , while image of emergency medicine in media and perceived stress from violence in emergency department were stronger in physicians with higher dp . our result is consistent with previous studies which reported anticipated process failure ( 6 ) , patient load , interaction with patients and families , and lack of administrative support ( 21 ) , number of shifts per month ( 10 ) , insufficient staffing and work load ( 22 ) , economic and financial issues , individual malpractice ( 23 ) , quality of team work and work - family conflict ( 24 ) to have association with high burnout . generally , these factors were found to create higher score of stress in residents , compare to graduates ; this indicates the importance of more support for residents . our model for predicting burnout showed that the strongest predictors for high ee were work overload , economic problems and insecurity of future career in field of emergency medicine , and difficulties to balance professional and private life . interestingly , after controlling for other stressors , participants who perceived more stress in dealing with new technologies had less probability of being highly emotionally exhausted . this may reflect that more available sources of information and technology , or putting pressure on residents to search and use the latest information , can lead to tiredness with work . in summary , we can list the predictors of high burnout as follow : economic problems , personal life and work overload , and fear of having not enough skills in emergency departments . as a result , any intervention to prevent burnout in our population should focus mainly on these components . even though the results of our study reflects the situation in emergency physicians and residents in iran , not only the methodology and approach can be generalized , but also the results can be used to predict and overcome short - comings and problems in establishment of emergency medicine specialty , which is a very new specialty in developing world and expected to grow and be established in other countries in the future . limitations : our study is a cross sectional study and can not assess any change in variables over time . moreover , it can not prove cause - and - effect relationship between associated variables . thus , we could not assess whether , for example , high dp is a result of living alone , or is its cause , as these people prefer to live alone ; or it is not clear whether high burnout is consequences of stressors or people who are exhausted and frustrated perceive more stress from the environment . although we conducted our study in all iranian emergency physicians and residents and had a high response rate , our sample size was too small to assess our predictive model of burnout in residents and graduates separately . in addition , because of a small percentage of women practitioners in our study , our results should be regarded with caution in this population . we used a validated outcome in the maslach burnout inventory , but the predictors have not been similarly validated , although we piloted them and their face validity was checked . additionally we utilize multivariable logistic regression modeling to evaluate for associations with burnout , but considering the number of predictors , our sample size was inadequate for the number of predictor variables . our results suggest an alarming high rate of burnout ; especially in residents in recently established emergency medicine specialty in iran . since this is the first study performed to investigate burnout in physicians and residents in iran , it can contribute to improvement of health care quality , resident education efficacy and patient satisfaction by preventing burnout . our result can also be utilized to adjust the interventions suggested by previous studies in other countries to be more effective in iranian medical education system . we also determined some major stressors that interventions can be focused on ; these interventions can include improving organizational relationship with other services , stronger financial , emotional and educational support for residents and training them how to make a balance between life and work . the next step will be evaluating em residents and practitioners personality traits and coping mechanisms used by them in stressful situations and the impact of these factors on preventing burnout . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | abstractbackgroundemergency physicians are at risk of burnout , which can affect their mental health , as well as patient care .
we assessed burnout level among iranian emergency physicians and investigated demographic , work - related factors and stressors associated with higher burnout.methodsin a cross - sectional study , we surveyed all 188 emergency medicine residents and practitioners in iran .
we measured burnout using 22-item maslach burnout inventory assessing emotional exhaustion , depersonalization and personal accomplishment , also demographic factors , work related factors and sources of stress in emergency department using anonymous self - administered questionnaire . descriptive analysis , univariate analysis to evaluate association with higher score of burnout , and multivariate logistic regression analysis to predict high burnout in 3 subscales was performed.resultstotally , 165 questionnaires were filled ( response rate : 88% ; mean age : 33.6 years , 91% male ) .
mean burnout scores were 22.94 for emotional exhaustion ( 95% ci=20.78 - 25.01 ; moderate ) , 9.3 for depersonalization ( 95% ci=8.24 - 10.36 ; moderate to high ) , and 31.47 for personal accomplishment ( 95% ci=29.87 - 33.07 ; moderate to high ) .
frequent reported sources of stress were shortage of equipment , problem with work physical environment , and relationship with other services .
all 19 sources of stress were associated with higher score of emotional exhaustion and depersonalization ; while twelve out of 19 were significantly associated with lower level of personal accomplishment . in logistic regression model ,
the significant predictors for high emotional exhaustion were work overload , feeling of insecurity for future career and difficulties to balance professional and private life.conclusionburnout is high among iranian emergency medicine practitioners and some interventions can be proposed to reduce stress . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
traumatic spinal subarachnoid hemorrhage ( ssah ) and spinal subdural hemorrhage ( ssdh ) are very rare . most cases occur as a complication of spinal procedures such as spinal anesthesia and are often associated with blood coagulation abnormalities , such as anticoagulation therapy or thrombocytopenia.2 ) traumatic ssah or ssdh can occur at the site of the spinal injury , but several cases of traumatic ssah or ssdh that was supposed to be migration of intracranial traumatic subarachnoid hemorrhage ( sah ) or subdural hemorrhage ( sdh ) without direct spinal injuries were reported.12368 ) of them , reports of traumatic ssah migrated from intracranial traumatic sah are extremely rare.2 ) here , we report a case of ssah migrated from traumatic intracranial sah in a patient without direct spinal injury . he had hit his head on the corner of a desk and had lost his consciousness a few seconds an hour before . he did not complain of pain in other parts of his body except for his headache . on neurological examination , he had had a history of tbi and had undergone bilateral craniotomy and removal of epidural hematoma ( edh ) 5 years prior . he had no previous medical problems and took no medication . a brain computed tomography ( ct ) scan revealed edh in the right frontal lobe and traumatic sah in the ambient cistern ( figure 1 ) . due to his stable clinical condition two days after tbi , he complained of pain and numbness in the bilateral buttock and posterior thigh . his pain and numbness progressively worsened . on the next day , he could not sit or stand due to severe pain and numbness . a foley catheter was placed and 500 cc of urine was drained . on neurological examination , a follow - up brain ct scan showed a slight decrease in the thickness of edh , and sah was much resolved ( figure 2 ) . lumbar spine magnetic resonance imaging ( mri ) revealed a fusiform lesion within the dorsal part of the spinal canal at the l5 and s1 level . the lesion had low signal intensity in the t2-weighted image ( wi ) and iso - signal intensity in the t1-wi , suggestive of acute hemorrhage ( figure 3 ) . a diagnosis of cauda equina syndrome due to intraspinal hemorrhage was made and emergent operation was performed . after a partial laminectomy of s1 , the dural sac was exposed and no edh was found . the dural sac was tense on palpation . when opening the dura , sdh was not found . on incision of the arachnoid membrane , dark reddish fluid gushed out with high pressure . no blood clot and no definite bleeding point he had gradual improvement in his voiding function . at his 1-year - follow - up traumatic intracranial hemorrhage can cause intraspinal hemorrhage in patients without any direct injury to the spine as in the present case.12368 ) ssdh can occur in patients with traumatic intracranial sdh.168 ) because of the anatomic continuity between the intracranial and spinal subdural spaces , redistribution or migration of the intracranial sdh to the spinal subdural space can occur.16 ) if an arachnoid tear exists , this might facilitate spontaneous resolution and migration of intracranial sdh by a dilutional and " water hammer " like effect of cerebrospinal fluid ( csf ) that leaks from the subarachnoid space to the subdural space through the arachnoid tear.8 ) furthermore , raised intracranial pressure due to intracranial sdh can push the hematoma directly into the skull base and spinal canal through the subdural space.4 ) although not a traumatic etiology , cases of ssdh occurring in patients with intracranial sah have been reported.47 ) sah under high pressure can tear the intact arachnoid membrane , extravasate the sah into the subdural space , and cause intracranial sdh or ssdh.4 ) if an arachnoid tear already exists , intracranial sah might migrate into the subdural space through the arachnoid tear , and this can develop into intracranial sdh or ssdh.4 ) cerebral contusion can also cause ssah . there was a case report of ssah in a patient with cerebral contusion in the temporal lobe.3 ) one day after admission , the patient complained of neck pain , followed by severe right hemiparesis , dysphagia , and hoarseness . ct scan revealed progression of the contusion and intraspinal hemorrhage extending to the c3 level with the brain stem and the spinal cord displaced contralaterally . ssah was detected intraoperatively and the authors suggested that the progression of the initial temporal lobe contusion made the blood spread into the adjacent subarachnoid spaces . the cisterns of the posterior cranial fossa include the prepontine , interpeduncular , cerebellopontine , premedullary , cerebellomedullary , quadrigeminal , superior cerebellar cisterns , and the cisterna magna . the anterior and posterior spinal cisterns communicate with cisterns of the posterior cranial fossa through the foramen magnum . therefore , intracranial sah can migrate to the spinal subarachnoid space.3 ) this migration occurs with higher probability in patients with a large amount of sah or after early ambulation of the patient.3 ) ssah can occur in patient with traumatic intracranial sah as in the present case . chen et al.2 ) reported a case of ssah in a patient with traumatic sah within the left sylvian cistern . after admission , the patient began complaining of numbness in the left posterior thigh and a heavy sensation in the legs . lumbar spine mri 9 days after the initial trauma showed a fusiform lesion located at the l5 and s1 level . during surgery , the authors hypothesized that migration of blood could have occurred from the intracranial subarachnoid space to the subarachnoid space at the most caudal part of the spinal canal.2 ) in the present case , the patient complained of no low back or buttock pain immediately after the trauma . intracranial sah was much resolved and no traumatic lesion in the lumbosacral spine was found in the radiologic evaluation when the patient began complaining of pain . therefore , we hypothesize that the ssah might have been related to progressive migration of intracranial sah in the ambient cistern to the most dependent area of the lumbosacral subarachnoid space through the above mentioned pathways . contrary to chen et al.'s2 ) report , we found uncoagulated dark red blood rather than an old blood clot intraoperatively . in our opinion , this might have resulted from the different timing of the operation . in the present case , operation was performed 3 days after the initial trauma , as compared to surgery being performed 9 or more days after the trauma in chen et al.'s2 ) report . ssah rarely forms a hematoma owing to the continuous diluting or " washing " effect of the csf.25 ) interestingly , migration of the blood can occur in reverse direction , that is , from the spine to the brain.910 ) although not a traumatic etiology , there were reports in which intracranial sah or sdh was found later during the workup for ssdh or ssah.910 ) in the present case , although the onset of symptoms was delayed , the deterioration of symptoms was rapid , as in other reports.138 ) therefore , a suspicion of intraspinal hemorrhage and prompt radiologic workup should be performed in patients with traumatic intracranial sah or sdh who present with delayed pain or neurologic deficit . we suggest that delayed intraspinal hemorrhage may occur in patients with tbi . in particular , patients who have traumatic intracranial sah or sdh and who present with delayed pain or neurological deficits should be evaluated for ssah or ssdh promptly , even when the patients had no history of direct spinal injury and had no apparent symptoms related to the spinal injury in the initial period of trauma . | very rarely , spinal subarachnoid hemorrhage ( ssah ) can occur without any direct spinal injury in patients with traumatic intracranial sah .
a-59-year - old male with traumatic intracranial subarachnoid hemorrhage ( sah ) presented with pain and numbness in his buttock and thigh two days after trauma .
pain and numbness rapidly worsened and perianal numbness and voiding difficulty began on the next day .
magnetic resonance imaging showed intraspinal hemorrhage in the lumbosacral region .
the cauda equina was displaced and compressed .
emergent laminectomy and drainage of hemorrhage were performed and ssah was found intraoperatively .
the symptoms were relieved immediately after the surgery .
patients with traumatic intracranial hemorrhage who present with delayed pain or neurological deficits should be evaluated for intraspinal hemorrhage promptly , even when the patients had no history of direct spinal injury and had no apparent symptoms related to the spinal injury in the initial period of trauma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
avascular necrosis ( avn ) of the femoral head is a painful and disabling condition . avn is mostly idiopathic , but it may also be associated with alcohol , corticosteroid abuse , hemoglobinopathies , coagulopathies and certain renal , hepatic and skin disorders . various hypotheses like vascular interruptions or abnormalities , elevated bone marrow pressure , cellular toxicity , fat emboli etc . have been proposed , but none of them clearly explains its exact aetiopathogenesis . early clinical and radiological diagnosis is usually difficult , but if done in time , it may prevent further collapse of the femur head and is important for the favorable outcome of the disease . the ficat grading system that is based on the plain x - rays is the most commonly used classification in clinical practice . in the initial stages of the disease , the head preserving surgeries , which aim at reducing the intraosseous pressure and enhancing the vascular supply of the femur head , are preferred . among these , the core decompression of the femur head is the preferred treatment in ficat stage i and iia . core decompressions reduce intraosseous pressure and thus decrease the pain , but it does not enhance the vascularization of necrosed head adequately , especially in an advanced stage of the disease . therefore , it is better supplemented with various bone grafting or muscle pedicle grafting techniques , to enhance vascularity and healing of the lesion . there are several techniques described to enhance the vascularization of the femur head , like core decompression with vascularized and non - vascularized bone grafting , various types of muscle pedicle grafts , etc . we present 40 cases ( in 53 hips ) of core decompression of the femoral head along with sartorius pedicle bone graft . the procedure involved creating a cortical window at the head and neck junction ( light bulb technique ) , curettage of sclerotic dead bone and fixation of the muscle pedicle bone graft in the cortical window of the neck with cannulated cancellous screws ( for ficat s stage iia , iib and iii avn ) . in this retrospective study , we analysed 47 cases of avn of femoral head treated with core decompression and sartorius pedicle bone graft . seven patients were lost to follow - up and hence were excluded from this study . we had included 40 cases with 53 hips affected with avn of femur head ( of ficat stage iia , iib and iii ) , occurring due to alcoholism , corticosteroid abuse , post - traumatic and idiopathic . we had excluded the cases due to hemoglobinopathies ( sickle cell disease and other blood disorders ) , and ficat stages i and iv osteonecrosis cases . in all the cases , surgery was performed by the senior author ( r.v . ) . in bilateral cases , post - operatively active and passive range of exercises was started on the second post - operative day , and early non - weight bearing mobilization with a walking aid was allowed . the harris hip score was evaluated at the final follow - up in all 40 patients . the patient was positioned supine on a fracture table so that image intensifier can be easily used . lateral femoral cutaneous nerve of the thigh was identified first , in the deep fascia medial to the anterior superior iliac spine ( asis ) and protected with a rubber tape ( fig . the ascending branch of the lateral circumflex femoral artery was identified , as it may be injured in this approach . a 2 2 cm rectangular bone from asis was osteotomized with the help of an oscillating saw , along with the attached sartorius muscle . the capsule was exposed and incised to reach the hip joint . a rectangular window ( slightly smaller than the harvested bone graft ) was created in the anterior cortex of neck of the femur , at head and neck junction known as light bulb procedure. the exact position of the cortical window was confirmed on the image intensifier . the drill holes were carefully made only in the anterior cortex , so as to avoid the stress riser on the posterior neck . also , special care was taken to preserve a safe distance for 810 mm from the infero - medial part of the neck . multiple drill holes were done with 4.5-mm drill bit into the necrosed area of the femur head through the window , under image intensifier control , and necrotic bone was curetted out with angled curettes ( fig . the harvested sartorius muscle pedicle was lifted along with a block of asis and was delivered beneath the straight head of rectus femoris into the window . the graft was secured temporarily with two guide wires and then fixed with , one or two , 4 mm cannulated cancellous screws . precaution was taken to avoid violating the medial cortex of the femur and the region around calcar . the placement of screws was done 810 mm lateral to the medial cortex . 1.anterior approach to hip ( smith - petersen ) , lateral femoral cutaneous nerve of thigh retracted with rubber tape medial to the anterior superior iliac spine . 2.a 3.2-mm drill bit is used for core decompression through window at head neck junction under image intensifier guidance . anterior approach to hip ( smith - petersen ) , lateral femoral cutaneous nerve of thigh retracted with rubber tape medial to the anterior superior iliac spine . a 3.2-mm drill bit is used for core decompression through window at head neck junction under image intensifier guidance . we had analysed 53 femoral head in 40 operated patients with avn , out of which 27 were unilateral ( 17 right sides and 10 left sides ) ( fig . there were 32 males and eight females in this study , with an average age of 31.8 years ( range 2453 years ) . the main underlying cause of avn was alcoholism ( 19 cases ) , followed by corticosteroid abuse ( 8 cases ) and post - traumatic ( 7 cases ) . in 6 cases , the cause was undetermined ( idiopathic ) ( table i ) . the operated femoral heads , according to ficat s staging were 24 in stage iia ( 45.3% ) , 22 in stage iib ( 41.5% ) and 7 in stage iii ( 13.2% ) ( table ii ) . the average duration of surgery was 85 min ( range : 55130 min ) . the total duration of follow - up was average 4.2 years ( range : 2.215 years ) ( fig . it was excellent ( > 90 ) in 18 hips ( 33.96% ) , good ( 8089 ) in 24 hips ( 45.28% ) , fair ( 7079 ) in 9 hips ( 17% ) and poor ( < 70 ) in 2 hips ( 3.7% ) ( table iii ) . the correlation between the ficat s stages and harris hip score have shown that the majority of hips were showing excellent and good scores belonged to stage iia and b while the hips with fair and poor score mainly belonged to stage iii and iib ( table iv ) . to test the hypothesis whether the patient s harris s hip score is independent of their ficat s stage at 0.05 significance level . we got p values of 0.004204 and as the p values is less than the 0.05 significance level , we reject the hypothesis that the patients harris s hip score is independent of their ficat s stage ( i.e. they are dependent or related ) . from the above table , it is clear that higher percentage of patients with ficat s stage iia reported excellent score ( 54.2% ) as compared with patients with ficat s stage iib ( 22.7% ) and with ficat s stage iii ( 0% ) . 3.x - ray pelvis ap view showing ficat s iia stage of avn in left femoral head . 4.ap view showing 2-year follow - up of the avn of left femur head operated with sartorius muscle pedicle bone graft . idiopathic615.0
table ii.distribution of study cases according to ficat s stagingficat s staging of avnno . of hipspercentageiia2445.3iib2241.5iii0713.2 table iii.evaluation of harris hip score in study casesharris s hip scoreresultno . of hipspercentage90100excellent1833.968089good2445.287079fair916.98<70poor23.7 table iv.correlation of ficat s stage with the harris s hip scoreficat stagesexcellent score ( no . of hips)good score ( no . of hips)fair score ( no . of hips)poor score ( no . of hips)iia131010iib51241iii0241 x - ray pelvis ap view showing 2-year follow - up of the avn of left femur head operated with sartorius muscle pedicle bone graft . distribution of study cases according to etiology distribution of study cases according to ficat s staging evaluation of harris hip score in study cases correlation of ficat s stage with the harris s hip score in only two femoral heads ( 3.77% ) , the avn progressed from stage iib and staged iii to stage iv , after this surgical procedure . the most common complication of the surgery was an injury to the lateral cutaneous nerve of the thigh which was transient in four cases and recovered fully within three months . there was no case of wound dehiscence , infection or iatrogenic fracture neck of the femur . in two patients , the avn progressed from stages iib and iii , respectively to stage iv ( table v ) . table v.complications in study cases and their frequency distributioncomplicationsno . of casespercentagetransient injury to lateral cutaneous of thigh47.54permanent injury to lateral cutaneous of thigh11.88infection / wound dehiscence00.00fracture neck of femur00.00progression to osteoarthritis ( stage iv)23.77 complications in study cases and their frequency distribution avn of the femoral head is a major musculoskeletal problem of younger individuals ( figs . 5 and 6 ) [ 10 , 11 ] . if it is left untreated it may progresses to subchondral collapse of the femoral head and secondary hip joint arthritis . the natural progression of the disease is inevitable after the subchondral collapse , and joint space reduction has happened . therefore , early diagnosis and treatment of avn may result in the favorable outcome of this disease ( figs . 7 and 8) . medical management of avn is usually ineffective , although some studies have shown the efficacy of bisphosphonates in the early avn with the small necrotic lesion . in early stages of the disease , various head preserving surgeries have been described but no treatment has proved completely effective in arresting the disease process . in the advanced stages of avn , the only satisfactory option remains is total hip arthroplasty ( tha ) . fig . 5.x - ray pelvis ap view showing avn femoral head , right side with ficat s stage iia and left side with ficat s iib . 7.x - ray pelvis ap view showing 3-year follow - up of avn both femur head operated with sartorius muscle pedicle bone graft . 8.x - ray r hip ap view showing 15-year follow - up of avn femoral head operated with sartorius muscle pedicle bone graft . x - ray pelvis ap view showing avn femoral head , right side with ficat s stage iia and left side with ficat s iib . x - ray pelvis ap view showing 3-year follow - up of avn both femur head operated with sartorius muscle pedicle bone graft . x - ray r hip ap view showing 15-year follow - up of avn femoral head operated with sartorius muscle pedicle bone graft . the etiology of avn has been described to be multi - factorial and may be associated with various risk factors . in this study , the associated risk factors of alcoholism was found to be ( 47.5% ) while corticosteroid abuse in ( 20% ) , traumatic ( 17.5% ) , idiopathic ( 15% ) . alcoholism ( consuming up to 400 ml per week ) has been reported as a major risk factor for avn of the femoral head . exposure to alcohol consumption and corticosteroid account for 90% of all causes of avn has been reported in . the sickle cell hemoglobinopathy is a microangiopathic disease that causes necrosis of the femur head due to occlusion of the intraosseous blood vessels by the sickle - shaped red blood cells . also , the disease causes obstruction of the small vessels of the surrounding soft tissue and muscles , thus reducing the effectiveness of the surrounding muscle pedicle grafts and hence sickle cell disease patients were excluded from our study . the classification or the staging system of avn of the femoral head is important to plan its treatment . we have used ficat s classification since it is simple , easy to use and has good reproducibility . the aim of treatment in early stages of avn of the femoral head is to perform the head - preserving procedure by reducing the intraosseous pressure and enhancing the vascular supply of the femur head . a commonly done procedure of core decompression of the head was reported with a promising result , initially by hungerford . it is done with the aim , to decrease the intraosseous pressure in the early disease process , but its results are much less predictable in more advanced disease ( stages iib and iii).the effectiveness of core decompression has always been a controversy in the literature . the long - term results have shown that core decompression gives only temporary relief in pain but does not prevent the progression of the collapse of femoral head . hence , its use , in isolation , to revascularize the femoral head in avn is questionable and can not rely upon . buckley et al . have reported good outcomes , with the use of cortico - cancellous bone graft along with core decompression in ficat stages i and iia . however , they have shown poor outcome in advanced stage ( iia and iii ) . also , these are associated with complications like perforation of the subchondral bone during drilling or graft impaction , injury to the common peroneal nerve . various free vascularized grafts for the treatment of avn of femoral head have been described to achieve adequate vascularization in the necrosed femoral head . urbanaik et al . have used fibula ( with peroneal vascular pedicle ) , while babulkar et al . they have shown good clinical and radiological outcome with free vascularized bone grafts have in ficat stages iib , iii and iv . however , these procedures are technically demanding , tedious and time - consuming and may not be feasible bilaterally , in one sitting . to overcome the shortcomings of vascularized grafts , various types of muscle pedicle grafting procedures , ( after core decompression ) these procedures have shown favorable outcomes in early stages of the disease , with revascularization of the femoral head and prevention of collapse . the described muscle pedicle graft technique includes meyer s procedure ( using quadratus femoris muscle pedicle along with free cancellous bone graft ) . this technique has good outcome in early stages but has a poor outcome in advanced stages . moreover , use of cancellous bone graft does not provide structural support to the subchondral bone . baksi s procedure uses tensor fascia lata graft along with iliac crest bone graft , after decompression of necrosed femur head with multiple holes . the shortcoming of graft slippage has been reported in other studies as it does not include fixation of the graft . sartorius muscle pedicle bone graft for the revascularization of the necrosed femur head is relatively unknown technique in the literature and has only been studied by li et al . . in this study , we found that sartorius muscle pedicle bone graft is an effective and easy surgery to perform . additionally , the bilateral hip can be operated at the same sitting , and no changing of position is required after operating one side hip , this significantly reduces operating time . sartorius muscle has a good blood supply , in the form of series of equal size and segmental pedicles that enter the muscle along its course . therefore , transposition of the muscle flap along with bone chip of asis does not hamper its blood supply and provide an adequate vascular bed to the femur head . also , adequate length of the muscle flap can be transposed without any tension on its arteries ( table vi ) . the core decompression was done through the cortical window created at head and neck junction known as light bulb procedure was introduced by rosenwasser et al . , who attempted to perform this procedure of curettage and grafting through neck head junction . multiple drilling provides decompression of the avascular lesion and removal of the necrotic bone in order to interrupt the cycle of ischaemia and interosseous hypertension . intra - operative image intensifier along with clinical judgment is used is to check the extent of necrotic bone removal . table vi.pros and cons of various muscle pedicle grafts around the hipsartotiustensor fascia lataquadrtus femorisharvesting of grafteasytedioustediouslength of the graftgoodjust sufficientjust sufficientnature of graftcorticalcorticalcancellouscomplication ratelowaveragenot documented pros and cons of various muscle pedicle grafts around the hip this allowed sufficient decompression by adequate removal of the necrotic subchondral bone of the head of the femur at the weight bearing area . another distinguishing feature reported in our study is the fixation of the graft with one or two 4-mm cannulated cancellous screws ; this prevents slippage of the graft from the femoral neck window and has not been discussed in any other studies of the muscle pedicle bone graft ( table vii ) . the procedure provides decompression of the avascular lesion and removal of the necrotic bone in order to interrupt the cycle of ischaemia and interosseous hypertension . grafting of the defect with sartorius muscle pedicle bone introduces a scaffold for repair and remodeling of subchondral bone . this procedure has been more appealing than that of a vascularized graft because it is less technically demanding and may reduce donor - site morbidity . table vii.comparison of studies done for muscle pedicle graft in avn of femur headstudiesgraft usedresults excellent to goodpoor resultsmeyer et
al.quadratusfemoris muscle pedicle graft57% success rate ( harris hip score was not used)not mentionedbakshi et al.tfl muscle pedicle bone graftexcellent : 31%poor : 6%good : 53%fair : 10.3%(harris hip score was not used)li et al.sartorius muscle pedicle iliac bone graftexcellent : 33%poor : 2.9%good : 48.5%fair : 14.7%urbanaik et al.free vascularized fibular graftavg . harris hip score improved in all case ( p 0.0001 ) compared with pre - operative values.not mentionedvaishya et al . ( present series)sartorius muscle pedicle iliac bone graftexcellent : 33.96%poor : 3.7%good : 45.28%fair : 16.98% comparison of studies done for muscle pedicle graft in avn of femur head the newer techniques describing the use of autologous stem cells from the iliac crest and platelet - rich plasma , for the necrosed area of the femoral head , have shown very good results in early stages ( pre - collapse ) of the disease . there results in advanced stage ( post - collapse ) of the disease are unsatisfactory . a randomized control study is needed to compare their result with other treatment modalities in avn of the femoral head . due to ethical and biological reasons the clinical application of the progenitor cells in musculoskeletal system is limited to autologous stem cells while the totipotent embryonic stem cells are used only in experimental studies . although tha has been shown to give excellent results in the late stages of avn , the limited life span of these prostheses in younger patients with avn remains a cause for concern . thus , a revascularizing procedure that can help preserve the head will help postpone or alleviate the need for tha ( fig . improved diagnostic modalities , more and more patients are being diagnosed with early stage avn where the head preserving surgeries can have a definite role . thus , the identification of an ideal procedure for the early stage avn can help in decreased morbidity and improved outcomes . to conclude , sartorius pedicle graft in avn of femur head after drilling through cortical window is characterized by simple surgical technique , low incidence of complication and a short duration of operation . it has the advantage of addressing both the issues of decompression of femoral head as well as providing vascularized bone graft . 9.mri of right hip showing intact muscle pedicle with viable femoral head in a 15-year follow - up patient . mri of right hip showing intact muscle pedicle with viable femoral head in a 15-year follow - up patient . | avascular necrosis ( avn ) of femoral head needs to be addressed early in the course of the disease , to prevent progression to osteoarthritis .
a revascularizing procedure which can help preserve the head should be considered in young adults to alleviate the need for total hip arthroplasty .
we included 40 cases ( 53 hips ) of avn of femoral head operated with sartorius muscle pedicle iliac bone grafting , done by the senior author .
early post - operative rehabilitation was done .
the weight bearing was delayed for 6 weeks .
all the patients were followed clinically and radiologically at regular intervals .
the operated femoral heads , were grouped according to ficat s staging : 24 in stage iia ( 45.3% ) , 22 in stage iib ( 41.5% ) and 07 in stage iii ( 13.2% ) .
the average duration of surgery was 85 min ( range : 55130 min ) .
the total duration of follow - up was average 4.2 years ( range : 2.215 years).the harris hip score was excellent ( > 90 ) in 18 hips ( 33.96% ) , good ( 8089 ) in 24 hips ( 45.28% ) , fair ( 7079 ) in 9 hips ( 17% ) and poor ( < 70 ) in 2 hips ( 3.7% ) .
avn of the femoral head is a painful and disabling condition in young adults .
sartorius muscle pedicle bone graft technique allows adequate decompression , re vascularization and osteogenesis of the femur head in ficat s stage iia , iib and iii , in young adults .
this is an effective and easy technique to adopt with excellent to good results in 80% cases and is associated with only minimal complications . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in order to isolate neuraminidase inhibitors , the fruiting bodies of p. igniarius were extracted using methanol for 2 days at room temperature . the methanolic extract was concentrated under reduced pressure , and the resultant residue was partitioned twice with ethyl acetate . the ethyl acetate - soluble layer was subjected to sephadex lh-20 column chromatography ( pharmacia , uppsala , sweden ) eluted with methanol to yield two active fractions . one active fraction was further purified by sephadex lh-20 column chromatography eluted with 70% aqueous methanol to provide compound 1 . the other fraction was subjected to sephadex lh-20 column chromatography with 70% aqueous methanol as the eluting solvent to yield compound 2 . the chemical structures of compounds 1 and 2 were determined via electrospray ionization ( esi)-mass and proton nuclear magnetic resonance ( h nmr ) spectrum measurements . the molecular weight of compound 1 was 474 on esi - mass measurement , where it exhibited a quasimolecular ion peak at m / z 475 [ m+h ] . the h nmr spectrum of 1 in dmso - d6 demonstrated seven methine protons at 8.24 , 7.85 , 7.47 , 6.97 , 6.61 , 6.15 , and 6.09 and one methyl signal at 2.50 . based on literature review , compound 1 was identified as phelligridin e ; the molecular weight and h chemical shift values were in good agreement with those previously reported for phelligridin e . the chemical structure of compound 2 was also determined via esi - mass and h nmr spectrum measurements . the molecular weight of compound 2 was 594 on esi - mass measurement , and it demonstrated a quasi - molecular ion peak at m / z 595 [ m+h ] . the h nmr spectrum of compound 2 in dmso - d6 showed three aromatic methine signals assignable to a 1,2,4-trisubstituted benzene moiety at 7.17 ( d , j = 2.1 hz ) , 7.10 ( dd , j = 8.2 , 2.1 hz ) , and 6.79 ( d , j = 8.2 hz ) , two olefinic methine peaks attributable to a trans-1,2-disubstituted double bond at 7.54 ( d , j = 16.2 hz ) and 7.10 ( d , j = 16.2 hz ) , and seven methine singlets at 8.28 , 7.86 , 7.48 , 7.01 , 6.64 , 6.25 , and 6.02 . these spectral data were consistent with those of phelligridin g previously reported in the literature . therefore , compounds 1 and 2 were identified as phelligridin e and phelligridin g , respectively , as shown in fig . 1 . the inhibitory activity of compounds 1 and 2 against neuraminidases from recombinant rvh1n1 , h3n2 , and h5n1 influenza viruses was evaluated . neuraminidase inhibition assay was performed in 96-well plates as previously described , with some modifications . briefly , the substrate , 50 l of 0.2 mm munana ( 2-(4-methylumbelliferyl)--d - n - acetylneuraminic acid sodium salt ; sigma , st . louis , mo , usa ) , was mixed with 90 l of 50 mm tris buffer ( containing 200 mm nacl , 5 mm cacl2 , ph 7.5 ) at room temperature . ten microliters of the sample and 50 l of h1n1 neuraminidase ( 50 ng / ml ) were added to each well . the mixture was then recorded at the excitation and emission wavelengths of 365 nm and 445 nm , respectively , using a polar optima ( bmg labtech , ortenberg , germany ) . in the case of h3n2 and h5n1 neuraminidases , 25 mm mes buffer ( containing 500 mm nacl , 5 mm cacl2 , ph 6.5 ) and 50 mm mes buffer ( containing 500 mm nacl , 5 mm cacl2 , ph 6.5 ) were used , respectively , and h5n1 required an activation period of 24 hr at 37 before assay . compounds 1 and 2 showed h3n2 neuraminidase inhibition activity with an ic50 value of 6.7 m , respectively , in a dose - dependent manner . inhibitory activity of compounds 1 and 2 against h1n1 and h5n1 neuramanidases were also evaluated . these compounds significantly inhibited the h1n1 and h5n1 neuramanidases with ic50 values in the range of 8.0~1.0 m in a dose - dependent manner ( table 1 ) . to study the mode of inhibition , dixon plots were used to distinguish the mechanism of neuraminidase enzyme action and to confirm the inhibition constant ( ki ) . compounds 1 and 2 displayed noncompetitive inhibitory activity , as indicated by a decrease in vmax while km remained stable at increasing inhibitor concentrations . the inhibition constant ( ki ) values of compounds 1 and 2 were 7.1 0.3 and 6.9 0.3 , respectively ( fig . | during our ongoing investigation of neuraminidase inhibitors from medicinal fungi , we found that the fruiting bodies of phellinus igniarius exhibited significant inhibitory activity against neuraminidase from recombinant h3n2 influenza viruses .
two active compounds were isolated from the methanolic extract of p. igniarius through solvent partitioning and sephadex lh-20 column chromatography .
the active compounds were identified as phelligridins e and g on proton nuclear magnetic resonance ( 1h nmr ) and electrospray ionization mass measurements .
these compounds inhibited neuraminidases from recombinant rvh1n1 , h3n2 , and h5n1 influenza viruses , with ic50 values in the range of 0.7~8.1 m . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
they are firm encapsulated benign tumors and total surgical removal can be achieved in most of the cases with an excellent outcome . the study included 21 patients in the pediatric age group ( < 18 years ) of spinal schwannomas who underwent surgery over 10 years from january 1998 to april 2008 in the department of neurosurgery , national institute of mental health and neurosciences , bangalore . the demographic profile , clinical features , radiological findings , operative procedures , postoperative complications , and outcome were noted and analyzed . there were a total of 21 patients with an age range of 6 - 18 years with a median age of 16 years . the duration of symptoms ranged from 1 month to 36 months with average duration of 5 months . six patients had bladder disturbances ( 29% ) and six patients had associated neurofibromatosis . among these , five had neurofibromatosis type i with multiple caf - au - lait spots and multiple subcutaneous swellings , and one had neurofibromatosis type ii with bilateral vestibular schwannomas . this patient underwent emergency decompression of the tumor and was put on ventilator . gradually the patient was weaned off from the ventilator support and made significant improvement . the predominant location was the cervical region in 10 cases ( 47% ) , followed by dorsal in 8 cases ( 38% ) . in three patients , four of the 21 patients had dumbbell schwannomas . among the 21 patients , 18 underwent laminectomy , 3 underwent laminotomy and microsurgical excision of the tumor . twenty patients underwent gross total excision and one underwent partial excision in view of tight adherence to multiple nerve roots in cervical region . the follow - up period ranged from 4 months to 56 months with average follow - up period of 38 months . motor deficits improved by at least one grade in 6 patients and by 2 grades in 10 patients . of the six patients who had bladder symptoms , four patients made improvement in urinary symptoms and two patients were on intermittent self - catheterization . x - rays of the spine was performed at follow - up and showed no signs of instability in any of the patients . follow - up mri at last follow - up revealed no recurrence in any of the patients . there were a total of 21 patients with an age range of 6 - 18 years with a median age of 16 years . the duration of symptoms ranged from 1 month to 36 months with average duration of 5 months . six patients had bladder disturbances ( 29% ) and six patients had associated neurofibromatosis . among these , five had neurofibromatosis type i with multiple caf - au - lait spots and multiple subcutaneous swellings , and one had neurofibromatosis type ii with bilateral vestibular schwannomas . this patient underwent emergency decompression of the tumor and was put on ventilator . gradually the patient was weaned off from the ventilator support and made significant improvement . the predominant location was the cervical region in 10 cases ( 47% ) , followed by dorsal in 8 cases ( 38% ) . in three patients , among the 21 patients , 18 underwent laminectomy , 3 underwent laminotomy and microsurgical excision of the tumor . twenty patients underwent gross total excision and one underwent partial excision in view of tight adherence to multiple nerve roots in cervical region . the follow - up period ranged from 4 months to 56 months with average follow - up period of 38 months . motor deficits improved by at least one grade in 6 patients and by 2 grades in 10 patients . of the six patients who had bladder symptoms , four patients made improvement in urinary symptoms and two patients were on intermittent self - catheterization . x - rays of the spine was performed at follow - up and showed no signs of instability in any of the patients . follow - up mri at last follow - up revealed no recurrence in any of the patients . spinal cord tumors are a relatively rare diagnosis and account for 1% to 10% of all pediatric central nervous system tumors . this is in contrast with adults where they constitute about 25% of primary intradural tumors . however , some studies indicate a higher incidence of spinal schwannomas in males , as reported by hori et al . ( 57% ) , and this percentage corresponds to our study in which 67% of schwannomas appeared in the female population . in our study , the majority of the patients presented with progressive compressive myelopathy ( 86% ) . the frequency of motor involvement and localized pain was much higher in our study compared with the available literature where it has ranged from 40% to 60% . the autonomic ( bowel and bladder ) involvement in our study was 29% compared to 10 - -20% in the literature . ( five had nf i and one had nf ii . ) the most common spinal tumors in nf i are neurofibromas . paraspinal neurofibromas including dumbbell - shaped tumors are commonly found in asymptomatic patients , especially at younger age groups . the most common location was the cervical region ( 47% ) followed by the dorsal region in 38% of the cases [ figure 1 ] . this differs from the available literature in which the majority of the tumors are located in the cervical and lumbar regions . according to the available literature 70 - -80% of spinal schwannomas are intradural in location and those extending through the dural aperture as the dumbbell mass involving both intradural as well as extradural space account for another 15% . intramedullary schwannomas are extremely rare . in our study , 17 patients had intradural schwannomas ( 80% ) and 4 patients ( 20% ) had dumbbell schwannomas . preoperative magnetic resonance imaging cervical spine ( post contrast- sagittal ) showing well - defined contrast enhancing intradural extradural lesion all our patients underwent surgery and excision of the tumor ( gte in 20 and ste in 1 ) ; [ figures 2 and 3 ] the outcome is comparable to the available literature and correlates with the preoperative neurological status of the patient . preoperative magnetic resonance imaging ( mri ) cervical spine ( post contrast - axial ) showing well - defined contrast enhancing intradural extradural lesion with the cord pushed to the left ( arrow ) postoperative magnetic resonance imaging ( mri ) cervical spine ( t2-weighted ) showing complete excision spinal cord tumors are a relatively rare diagnosis and account for 1% to 10% of all pediatric central nervous system tumors . this is in contrast with adults where they constitute about 25% of primary intradural tumors . however , some studies indicate a higher incidence of spinal schwannomas in males , as reported by hori et al . ( 57% ) , and this percentage corresponds to our study in which 67% of schwannomas appeared in the female population . in our study , the majority of the patients presented with progressive compressive myelopathy ( 86% ) . the frequency of motor involvement and localized pain was much higher in our study compared with the available literature where it has ranged from 40% to 60% . the autonomic ( bowel and bladder ) involvement in our study was 29% compared to 10 - -20% in the literature . ( five had nf i and one had nf ii . ) the most common spinal tumors in nf i are neurofibromas . paraspinal neurofibromas including dumbbell - shaped tumors are commonly found in asymptomatic patients , especially at younger age groups . the most common location was the cervical region ( 47% ) followed by the dorsal region in 38% of the cases [ figure 1 ] . this differs from the available literature in which the majority of the tumors are located in the cervical and lumbar regions . according to the available literature 70 - -80% of spinal schwannomas are intradural in location and those extending through the dural aperture as the dumbbell mass involving both intradural as well as extradural space account for another 15% . intramedullary schwannomas are extremely rare . in our study , 17 patients had intradural schwannomas ( 80% ) and 4 patients ( 20% ) had dumbbell schwannomas . preoperative magnetic resonance imaging cervical spine ( post contrast- sagittal ) showing well - defined contrast enhancing intradural extradural lesion in our study , the majority of the patients presented with progressive compressive myelopathy ( 86% ) . the frequency of motor involvement and localized pain was much higher in our study compared with the available literature where it has ranged from 40% to 60% . the autonomic ( bowel and bladder ) involvement in our study was 29% compared to 10 - -20% in the literature . ( five had nf i and one had nf ii . ) the most common spinal tumors in nf i are neurofibromas . paraspinal neurofibromas including dumbbell - shaped tumors are commonly found in asymptomatic patients , especially at younger age groups . the most common location was the cervical region ( 47% ) followed by the dorsal region in 38% of the cases [ figure 1 ] . this differs from the available literature in which the majority of the tumors are located in the cervical and lumbar regions . according to the available literature 70 - -80% of spinal schwannomas are intradural in location and those extending through the dural aperture as the dumbbell mass involving both intradural as well as extradural space account for another 15% . intramedullary schwannomas are extremely rare . in our study , 17 patients had intradural schwannomas ( 80% ) and 4 patients ( 20% ) had dumbbell schwannomas . preoperative magnetic resonance imaging cervical spine ( post contrast- sagittal ) showing well - defined contrast enhancing intradural extradural lesion all our patients underwent surgery and excision of the tumor ( gte in 20 and ste in 1 ) ; [ figures 2 and 3 ] the outcome is comparable to the available literature and correlates with the preoperative neurological status of the patient . preoperative magnetic resonance imaging ( mri ) cervical spine ( post contrast - axial ) showing well - defined contrast enhancing intradural extradural lesion with the cord pushed to the left ( arrow ) postoperative magnetic resonance imaging ( mri ) cervical spine ( t2-weighted ) showing complete excision | objective : the objective was to analyze the demography , clinical presentation , and management of spinal intradural schwannomas in pediatric population.materials and methods : this retrospective study includes 21 pediatric patients ( under 18 years of age ) who underwent surgery for spinal intradural schwannomas from january 1998 to april 2008 .
the medical records were reviewed retrospectively and the information regarding clinical presentation , tumor location , operative findings , and postoperative status and functional outcome were analyzed.results:a total of 21 patients ( 14 females and 7 males ) were operated for spinal schwannomas .
six patients had associated neurofibromatosis ( five were nf i and one was nf ii ) at presentation .
the most common presenting symptom was progressive myelopathy ( 86% ) .
the tumor location was either cervical or dorsal in 18 cases .
all patients underwent surgery .
gross total excision was achieved in 20 cases .
the median follow - up was 38 months .
all the patients had neurological improvement in both power and bladder symptoms.conclusion:pediatric spinal neurofibromas / schwannomas are an uncommon but completely treatable group of tumors .
complete surgical excision gives excellent outcome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
although hemangioma is considered one of the most common soft tissue tumors of the head and neck , it is relatively rare in the oral cavity and uncommonly encountered by the clinicians . they may be cutaneous , involving skin , lips and deeper structures ; mucosal , involving the lining of the oral cavity ; intramuscular , involving masticator and perioral muscles ; or intra - osseous , involving mandible and/or maxilla . though previously termed angiomas or vascular birthmarks , vascular anomalies are divided into two main categories : vascular tumors and vascular malformations . infantile hemangiomas comprise the majority of vascular anomalies and are considered the predominant vascular tumor type composed of rapidly proliferating endothelial cells . blood vessel architecture is incomplete and surrounded by hyperplastic cells in hemangiomas and other vascular tumors . in contrast , vascular malformations do not contain hyperplastic cells , but consist of progressively enlarging aberrant and ectatic vessels composed of a particular vascular architecture such as veins , lymphatic vessels , venules , capillaries , arteries or mixed vessel type . the latter comprises lymphangiomas or lymphatic malformations which are congenital collections of ectatic lymph vessels that form endothelial lined cystic spaces . occasionally , channels may be filled with blood , a mixed hemangiolymphangioma , an uncommon developmental anomaly with a propensity to invade underlying tissues and to recur locally , distinguishing it from the simple lymphangioma or hemangioma . although histologically it is a benign disorder , local invasion into the muscle , bone , and underlying tissue can lead to severe deformity . management of hemangiomas and the treatment of choice depend on several factors including the age of the patient and the size and extent of the lesions , as well as their clinical characteristics . an 18-year - old male patient , reported to department of oral and maxillofacial surgery , trivandrum , kerala , india , in may 2011 , with the complaint of reddish swelling over left side of the upper lip with occasional bleeding while brushing since last 3 - 4 years . patient noticed swelling over the left side of upper lip region 3 - 4 years back . patient had repeated episodes of bleeding while brushing teeth or on mechanical trauma to the lesion . patient visited private hospital , where he was kept on vitamin tablets and no other medications as history suggested by patient . the swelling was initially small papular which increased slowly to a size of 21 cm approximately in greatest dimension in last 2 years , after that there was no further change in swelling . at the time of reporting patient local examination revealed reddish multiple papular lesion over left side of buccal mucosa extending from 1 cm behind the left corner of mouth in relation to 24 , 25 of size approximately 21 cm [ figure 1 ] . there was no ulceration . on palpation the lesion was soft in consistency , non - tender , with smooth borders and was pulsatile in nature . provisional diagnosis of hemangioma left buccal mucosa was made . to rule out intracranial and bony involvement ct head and orthopantomogram ( opg ) was taken , subsequently no abnormalities has been detected [ figures 2 and 3 ] . gross specimen was soft in consistency and reddish in color and approximately of size 1.51 cm [ figure 4 ] . hematoxyline and eosine stain section shows hyperplastic stratified squamous epithelium which is extensively proliferating in to underlying moderately collagenous connective tissue stroma . there are numerous endothelail line vascular spaces through the stroma and extending in to submucosa . clinically reddish multiple papular lesion left buccal mucosa ct head with no detected abnormality hematoxyline and eosine stained section showing features of hemangiolympangioma hemangiomas are a common soft tissue tumor that often congenital or develop in the neonatal period and grow rapidly . they usually cover a large site , may be macular or raised and usually resolve progressively in childhood . they may occur in the oral and maxillofacial region including gingiva , palatal mucosa , lips , jawbone , and salivary glands . the occurrence of hemangioma with its primary location on gingival tissues seems to be extremely rare . there are many clinical features of capillary hemangioma such as asymmetry of the face , spontaneous bleeding , pain , mobility of teeth , blanching of tissue , pulsation , expansion of bone , paresthesia , early exfoliation of primary teeth , delayed eruption , root resorption , and missing teeth . hemangiomas are associated with various syndromes , rendu - osler - weber syndrome ( autosomal dominant inheritance , multiple telengiectasias , occasional gi tract involvement , occasional cns involvement ) , sturge - weber - dimitri syndrome ( non - inherited and non - familial , portwine stain , leptomeningeal angiomas ) , von hippel - lindau syndrome ( genetic transmission variable , hemangiomas of cerebellum or the retina , and cyst of the viscera ) . in present case intracranial and bony involvement is ruled out by ct head and opg . the differential diagnosis of hemangiomas includes pyogenic granuloma , chronic inflammatory gingival hyperplasia ( epulis ) , epulis granulomatosa , varicocell , talengectasia , and even with squamous cell carcinoma . this is a reactive lesion that develops rapidly , bleeds easily and is usually associated with inflammation and ulceration . clinically , it is often lobulated , pedunculated and red to purple and it may be hormone sensitive . histopathologically , hemangioma exhibits a progression from a densely cellular proliferation of endothelial cells in the early stages to a lobular mass of well - formed capillaries in the mature phase , often resembling the pyogenic granuloma without the inflammatory features . diagnosis is given according to predominant component , e.g. ; hemangiolymphangioma and/or lymphangiohemangioma , this particular terminology is also true in case of lymphangiomas . as in our case there were intermingled lymphatic channels , but predominant component was of hemangioma , so diagnosis of hemangiolymphangioma was made . precise diagnosis of the type of vascular lesion is important because it may influence treatment considerably . angiographic studies are not strictly demonstrated for diagnosis of hemangiomas , and are utilized only to define the size and the extent of the lesion . these are more complicated procedures than histopathological evaluation , have a higher morbidity , and may cause undesirable side - effects . ct and mri of these lesions have more recently been demonstrated , and have been successfully utilized for the diagnosis of hemangiomas , as for other lesions of soft tissues . in the case presented here , treatment of the hemangiolymphangioma was done by wide surgical excision and primary closure . in present case post - operative uneventful healing various treatment modalities has been advocated , e.g. ; surgical excision , for those lesions not amenable to surgery other therapy such as intralesional injection of fibrosing agents , interferon a-2b , radiation , electrocoagulation , cryosurgery , and laser therapy , embolization may be used . attempts to remove hemangiomas using surgical excision may lead to serious medical problems such as heavy bleeding . bogdan et al . aimed a study to evaluate the efficacy of the 980 nm diode laser and er : yag laser for photocoagulation treatment of oral and maxillofacial hemangioma and vascular malformations . seventy consecutive patients with either hemangioma or low - flow vascular malformations of the head and neck treated with laser photocoagulation were comprised in the study . long - term follow - up demonstrated regression of the lesion in all patients with good aesthetic results . the range of reduction in size varied between 45% and 95% and no complications or reperfusion of the lesions was noted . photocoagulation with diode laser or er : yag laser of hemangioma and vascular malformations is an effective treatment for correctly selected patients . they concluded that properly applied , these techniques can achieve reduction in size of these lesions without compromising function and cosmetics . conducted an observational retrospective study , reviewing medical records with clinical diagnosis of haemangioma between 1990 and 2006 at the children 's maxillofacial surgery service of the hospital universitario la fe , valencia . the study included 28 patients ( 19 females and 9 males ) with a mean age of 4.27 years ( range 0 - 14 years ) . the most frequent location of oral haemangioma was in the lip with 23 cases , followed by three cases in the tongue and 2 in the buccal mucosa . the mean diameter of the lesion was 1.67 cm ( range 1 - 3 cm ) . the mean duration of the lesion was 6.3 months ( range 1 month to 5 years ) . of the 28 haemangiomas , 13 were surgically removed , 2 were treated with embolization and 13 disappeared spontaneously . they have a predilection for females . they are uncommon in the oral cavity . in the oral region , plasma knife ( pk ) is a new treatment modality for excision of these lesions . pk technology provides an electrically conducting site by means of obtaining the use of controlled radiofrequency energy , and by using the intra and extracellular fluid . the active zone on the device dense kinetic energy divides , demolishes and evaporates the constructional element tissue . during this procedure , there is very little thermal damage to the surrounding tissue . because it requires no additional saline supply for the operation according to the thermal procedure pk is developed for tonsillectomy , adenoidectomy , uvulopalatopharyngoplasty , thyroidectomy and excisions of the head and neck masses . they used a 90% coagulation and 10% cut mode choice for the pk excision of the haemangioma of the tongue . this method is consequently a safe and suitable surgical choice to be applied for superficial and small sized haemangiomas of the tongue . in their case the experience that we gained from this case is that the pk surgery would be a suitable treatment modality for the localized and superficial haemangiomas of the tongue . pk can also be combined with other treatment modalities in larger lesions . in conclusion hemangiomas all suspected cases should be properly evaluated to rule out intracranial , bony and systemic involvements . patient should be followed postoperatively to rule out complication and further long - term follow - up to rule out recurrence . as in present case | hemangiomas are lesions that are not present at birth .
they manifest within first month of life , exhibit a rapid proliferative phase , and slowly involute to non - existent .
hemangiomas of the oral cavity are not common pathological entities , but the head and neck are common sites .
furthermore some time histologically lymphatic channels may be evident in hemangiomas , and then it will be categorized according predominant component , e.g. ; hemangiolymphangiomas or lymphangiohemangiomas , vice versa is true for lymphangiomas .
most true hemangiomas involute with time , but 10 - 20% of true hemnagioma in completely involute and required post- adolescent ablative treatment . in the present article we are reporting a case of hemangiolypmangiomas of left buccal mucosa in an 18-year - old male patient .
we have also reviewed various treatment modalities and their clinical implication . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
infant vaccination programmes have been highly successful in reducing severe disease and childhood deaths due to pertussis . despite these substantial gains , pertussis continues to circulate in all populations and most often affects very young , unimmunized or incompletely immunized infants , with a rising incidence in adolescents and adults [ 1 , 2 ] . family members have been implicated as important sources of pertussis for unprotected infants who are at highest risk of complications and death [ 14 ] . high coverage of infant pertussis vaccination has been longstanding in southeast asian countries ( ranging from 82% to 99% coverage in 2009 ) . although few data are available describing the epidemiology of pertussis disease in asian countries , the available evidence suggests that , as in other countries with high pertussis vaccine coverage in infants and young children , pertussis continues to circulate in adolescents and adults . in taiwan , a seroprevalence study found that adolescents and adults remain at risk of pertussis despite successful immunization programmes , and a surveillance study of patients with cough lasting more than 1 week estimated an incidence of up to 21% , with pertussis disease especially prevalent in adolescents and adults [ 6 , 7 ] . another seroprevalence study in singapore also showed pertussis to be prevalent in adults . although adults rarely die from pertussis infection , the medical costs and morbidity associated with pertussis in this age group can be considerable . possible complications of adult pertussis include secondary pneumonia , rib fractures and incontinence . in a hospital - based study of confirmed pertussis cases in taiwan the complication rate was 304% , of which pneumonia was most common ( 923% ) . an analysis of the 20112012 pertussis outbreak in england estimated an overall loss in quality of life of 0097 quality - adjusted life years ( qalys ) for pertussis patients , and 00365 qalys for coughing household contacts . findings from such epidemiological studies justify the need for pertussis vaccination in adolescents and young adults . we performed a cross - sectional study to determine the prevalence of serologically confirmed pertussis in adults in malaysia , taiwan and thailand with prolonged cough . pertussis vaccination schedule for these countries is shown in table 1 [ 1214 ] . table 1.pertussis vaccination schedule in malaysia , taiwan and thailandcountryprimary dosesbooster dosesmonth 2month 4month 6month 1846 years1112 yearsmalaysiadtap - hib - ipvdtap - hib - ipvdtap - hib - ipv*dtap - hib - ipvtaiwandtap - hib - ipvdtap - hib - ipvdtap - hib - ipvdtap - hib - ipvtdap - ipvthailanddtwp - hibdtwp - hibdtwp - hibdtwpdtwp(or dtap)(or dtap)(or dtap)(or dtap)(or dtap)tdapdark grey cells ( ) indicate optional vaccine . light grey cells ( ) indicate epi / nip vaccine.dtap , diphtheria , tetanus , pertussis ( acellular ) vaccine ; hib , haemophilus influenzae type b vaccine ; ipv , inactivated poliomyelitis vaccine ; dtwp , diphtheria , tetanus , pertussis ( whole cell ) vaccine ; dtap / tdap , diphtheria , tetanus , and pertussis ( acellular ) vaccine [ reduced antigen(s ) ] . epi , expanded programme on immunization ; nip , national immunization program.*month 5.after 5 years of age and before entering elementary school . pertussis vaccination schedule in malaysia , taiwan and thailand dark grey cells ( ) indicate optional vaccine . dtap , diphtheria , tetanus , pertussis ( acellular ) vaccine ; hib , haemophilus influenzae type b vaccine ; ipv , inactivated poliomyelitis vaccine ; dtwp , diphtheria , tetanus , pertussis ( whole cell ) vaccine ; dtap / tdap , diphtheria , tetanus , and pertussis ( acellular ) vaccine [ reduced antigen(s ) ] . this cross - sectional study was conducted between 20 june 2012 and 2 may 2013 according to the declaration of helsinki and good clinical practice guidelines . written informed consent or assent was obtained from subjects ( or parent / legally acceptable representative in taiwan and thailand where the age of consent is 20 years ) prior to enrolment . adult patients aged at least 19 years with prolonged cough were recruited from two centres in malaysia ( international medical university and university of malaya medical centre ) , three centres in thailand ( phramongkutklao hospital , srinagarind hospital and songklanagarind hospital ) and two centres in taiwan ( china medical university hospital and chang gung memorial hospital ) . these participating hospitals provide ambulatory primary healthcare facilities and treatment for outpatients besides accepting referral cases from other primary healthcare practitioners . all patients with prolonged cough ( present for 14 days ) were screened for eligibility . patients with known pulmonary disease causing chronic cough ( including pulmonary tuberculosis , chronic obstructive airways disease , bronchiectasis , asthma ) and patients with suspected or known immunodeficiency were excluded . patients treated with angiotensin - converting enzyme inhibitors within the previous 4 weeks prior to enrolment were also excluded from participation . demographic information ( age at enrolment , gender ) , medical history including vaccination history for pertussis , pneumococcal disease and influenza , and as well as information on clinical symptoms and treatments received were documented and a physical examination was performed . health - related quality of life [ euroqol-5d ( eq-5d ) ] and structured health economic questionnaires were administered by study staff to individuals at the time of enrolment . patients ' medical records were reviewed approximately 30 days after enrolment to re - validate the diagnosis and record the clinical outcome and results of additional medical procedures . a blood sample was collected from each patient for anti - pertussis toxin ( anti - pt ) level of igg antibodies testing . anti - pt was measured by elisa ( euroimmun , germany ) according to the manufacturer 's instructions at a laboratory designated by gsk vaccines with an assay cut - off for sensitivity of 10 iu / ml . sera were classified into four categories , based on manufacturer 's instructions , previous experience in the available literature [ 1517 ] and the absence of vaccination against pertussis in the last 12 months : a seronegative patient had an anti - pt igg level below the sensitivity limit of the assay ( < 10 iu / ml ) ; a seropositive patient had an anti - pt igg level 10 iu / ml ; an anti - pt igg 625 iu / ml was considered serological evidence of pertussis infection in the last 12 months ; and an anti - pt igg level 100 iu / ml was considered indicative of active or recent infection . health - related quality of life was assessed using the eq-5d questionnaire , which comprises five dimensions ( mobility , self - care , usual activities , pain / discomfort , anxiety / depression ) , with three levels of severity within each dimension . there are 245 possible health states , for which a mapping of utility scores can be conducted and the range of results is [ 0 ; 1 ] where 0 = death and 1 = perfect health . health economic impact such as absenteeism from work or school and associated income loss of the subjects or family members , healthcare resource utilization , and direct costs ( including medical costs and transportation costs ) were recorded using a standardized questionnaire . all costs were adjusted to 2012 us$ using the historical yearly mean exchange rate from www.oanda.com / currency / historical - rates/. statistical analyses were performed using sas v. 9.2 ( sas institute inc . , usa ) . previous studies have demonstrated a prevalence of pertussis of between 10% and 20% in adults with prolonged cough [ 19 , 20 ] . considering a 10% pertussis prevalence , 139 subjects would provide 5% precision on the estimate . considering a prevalence of pertussis of 18% assuming a drop - out rate of 10% , we therefore aimed to enrol 154 subjects in thailand and at least 78 subjects in malaysia and taiwan . the according - to - protocol ( atp ) cohort included all subjects with valid laboratory test results and excluded those subjects vaccinated with pertussis vaccines within 1 year before the blood sample . prevalence of pertussis infection with exact 95% confidence intervals ( cis ) was determined by the number of patients with laboratory evidence suggestive of pertussis infection in all subjects presenting with prolonged cough . in addition , clinical characteristics ( such as cough paroxysms , whoop , night cough , post - tussive vomiting , cyanosis , fever , etc . ) , contact with people with coughing disease before onset , comorbidities , antibiotic treatment and laboratory results of subsets of patients with and without serological evidence of pertussis , were assessed . the health economic impact in terms of absenteeism from work , healthcare resource utilization , and direct costs were described only for subjects with serologically confirmed pertussis . there were 337 patients enrolled in the study , of whom 25 ( 74% ) were excluded from the analysis leaving 312 subjects in the atp cohort ( fig . 1 ) . of the 312 subjects included in the analysis , 296 ( 949% ) had anti - pt igg levels below the pre - defined cut - off of 625 iu / ml , including 208 ( 6667% ) seronegative subjects ( anti - pt antibodies igg < 10 iu / ml ) . the other 16 of the 312 subjects ( 513% , 95% ci 296819 ) had serological evidence of pertussis infection in the last 12 months ( anti - pt 625 iu / ml ) : 6/76 ( 79% , 95% ci 2951640 ) in malaysia , 1/89 in taiwan ( 11% , 95% ci 003610 ) and 9/147 ( 61% , 95% ci 2841130 ) in thailand . four of these 16 subjects ( overall 13% , 4/312 , 95% ci 035325 ) had anti - pt antibodies 100 iu / ml indicative of active or recent infection . the demographic characteristics of enrolled patients with and without serological evidence of pertussis infection ( anti - pt 625 iu / ml ) are shown in table 2 . pertussis cases were distributed across all age groups , and were highest in age groups 5059 years ( 98% , 5/51 , 95% ci 3262141 ) and 1929 years ( 76% , 5/66 , 95% ci 2511680 ) ( figs . 2 , 3 ) . serological evidence of active pertussis ( anti - pt igg 100 iu / ml ) was most commonly observed in the 1929 years age group ( 30% , 2/66 , 95% ci 0371052 ) . the median duration of cough was not significantly different between patients with and without serological evidence of pertussis ( anti - pt igg 625 iu / ml ) : 43 days ( range 15120 ) vs. 31 days ( range 141682 ) , respectively ( p = 01 ) . duration of cough was > 90 days in 3/16 ( 188% ) of patients with serological evidence of pertussis compared to 40/296 ( 135% ) patients without ( table 3 ) . the most frequently reported duration of cough was longer in patients with serological evidence of pertussis ( 3160 days ) compared to those without ( 1430 days ) . a greater proportion of patients with serological evidence of pertussis ( 750% , 12/16 ) than those without ( 483% , 143/296 ) reported paroxysms ( p = 004 ) . breathlessness / chest pain was reported by 625% ( 10/16 ) of patients with serological evidence of pertussis vs. 358% ( 106/296 ) of patients without ( p = 003 ) . no other significant differences in clinical symptoms presence were observed between the two groups ( table 3 ) . the most commonly recorded comorbid conditions were categorized as other non - respiratory tract diseases ; however , there was no difference between those with / without serological evidence of pertussis in terms underlying medical conditions [ 1/16 ( 63% ) vs. 36/296 ( 122% ) , respectively , p = 070 , fisher 's exact test ] . 2.proportion of subjects in each age group with serological evidence of pertussis in the previous 12 months ( anti - pt igg 625 iu / ml ; according - to - protocol cohort ) . 3.distribution of anti - pt igg concentrations by ( a ) age and ( b ) cough duration ( according - to - protocol cohort ) . table 2.demographic characteristics of enrolled patients with and without evidence of pertussis in the last 12 months ( anti - pt igg 625 iu / ml)categoryanti - pt 655 iu / ml ( n = 16)anti - pt < 655 iu / ml ( n = 296)age ( years)mean ( sd)407 ( 133)431 ( 155)range21631983age group , years , n ( % ) 19295 ( 313)61 ( 206)30393 ( 188)86 ( 291)40492 ( 125)50 ( 169)50595 ( 313)46 ( 155)601 ( 63)53 ( 179)genderfemale , n ( % ) 8 ( 50)202 ( 682)male , n ( % ) 8 ( 50)94 ( 318)n , number of subjects ; n , number of subjects in a given category ; s.d . , standard deviation .
table 3.clinical signs and symptoms of chronic cough by status of pertussis infection by anti - pt levels ( according - to - protocol cohort)clinical symptomswith serological evidence ( anti - pt 655 iu / ml ) ( n = 16)without serological evidence ( anti - pt < 655 iu / ml ) ( n = 296)p valueduration of cough , days , median ( range)43 ( 15120)31 ( 141682)cough duration , days , n ( % ) 14304 ( 250)142 ( 480)<00131607 ( 438)74 ( 250)61902 ( 125)40 ( 135)>903 ( 188)40 ( 135)fever since onset of cough , n ( % ) yes5 ( 313)74 ( 25)056presence of at least one of the following symptoms , n ( % ) yes13 ( 813)258 ( 872)045whoop2 ( 125)18 ( 61)027paroxysm12 ( 750)143 ( 483)004post - tussive vomiting6 ( 375)72 ( 243)024apnoea03 ( 10)100cyanosis00coughing up phlegm6 ( 375)180 ( 608)006sneezes6 ( 375)111 ( 375)100wheezes3 ( 188)34 ( 115)042cough at night11 ( 688)211 ( 713)078episodes of being unable to stop coughing7 ( 438)140 ( 473)078breathlessness / chest pain10 ( 625)106 ( 358)003n , number of subjects.fisher's exact test p value. test p value . proportion of subjects in each age group with serological evidence of pertussis in the previous 12 months ( anti - pt igg 625 iu / ml ; according - to - protocol cohort ) . distribution of anti - pt igg concentrations by ( a ) age and ( b ) cough duration ( according - to - protocol cohort ) . demographic characteristics of enrolled patients with and without evidence of pertussis in the last 12 months ( anti - pt igg 625 iu / ml ) n , number of subjects ; n , number of subjects in a given category ; s.d . , standard deviation . clinical signs and symptoms of chronic cough by status of pertussis infection by anti - pt levels ( according - to - protocol cohort ) n , number of subjects . chest x - ray was performed on 212/312 ( 679% ) patients ( seven with serological evidence of pertussis ) . the majority of chest x - rays [ 714% ( 5/7 ) in serologically confirmed and 863% ( 177/205 ) in patients with anti - pt igg < 625 polymerase chain reaction ( pcr ) was only performed in one patient without serological evidence of pertussis and failed to identify a pathogen . there were 94 ( 301% , 94/312 ) patients with suspected tuberculosis ; all of whom had negative examination results of sputum for acid - fast bacilli . one patient ( without serological evidence of pertussis ) had pleural tuberculosis confirmed by pleural biopsy ( post - enrolment and was included in study analyses ) . contact with a household or workplace member with known or suspected whooping cough was reported by 1/16 ( 63% ) patient with serological evidence of pertussis vs. 29/296 ( 98% ) of subjects without pertussis . contact with a household or workplace member with persistent cough was reported by 4/16 ( 250% ) pertussis patients and 109/296 ( 368% ) patients without pertussis , and contact with a household or workplace member who developed a cough subsequently was reported by 6/16 ( 375% ) and 106/296 ( 358% ) subjects , respectively . of the 16 patients with serological evidence of recent pertussis infection , three ( 188% ) were employed as teachers and one reported having contact with an infant aged < 1 year either at home or the workplace . of the 16 patients with serological evidence of pertussis , 10 ( 625% ) reported not receiving any previous dose of pertussis vaccine , with a further five ( 313% ) patients unable to recall their vaccination status . of the 296 patients without serological evidence of pertussis , 87 ( 294% ) reported not receiving any previous dose of pertussis vaccine while 114 ( 385% ) were unable to recall their vaccination status . the remaining 95 ( 321% ) patients reported previous pertussis vaccination history : 50 ( 526% ) received 45 doses , two ( 21% ) received 23 doses , and 43 ( 453% ) received one dose . however none of the patients ' vaccination histories could be verified . in patients with serological evidence of pertussis , the number of days absent from work ranged from 0 to 30 , with a median of 0 and a mean of 24 ( standard deviation 80 ) . one patient from malaysia reported lost income due to missing work , with an average daily income loss > us$97.5 . pertussis infection was associated with a median of 25 visits ( range 110 ) to healthcare professionals ( general practitioner , emergency room , or specialist ) . the median total direct medical cost of pertussis per episode in public hospitals ( including consultations with physicians and/or emergency room visits ) was us$13 ( range us$1316 ) or 40 myr ( range 4050 myr ) in malaysia ; us$83 ( or 2450 ntd ) in taiwan ( one patient ) and us$26 ( range us$12168 ) or 800 thb ( range 3605200 thb ) in thailand . the median time spent seeking medical care was 4 h ( range 02529 h ) . of subjects with serological evidence of pertussis infection , two patients ( 2/16 , 125% ) had problems with mobility , 6/16 ( 375% ) had problems in performing usual activities , 6/16 ( 375% ) suffered from pain / discomfort and 7/16 ( 438% ) suffered from anxiety / depression . we found serological evidence of pertussis infection in the last 12 months in 513% of adults presenting to hospitals with cough of at least 2 weeks ' duration in malaysia , taiwan and thailand . this is comparable with a prevalence of pertussis of 72% in taiwanese adults with cough duration 1 week tested by serology ( anti - pt ) or pcr , and 117% of adults with prolonged cough illness in the united states , denmark and korea tested for elevated anti - pt levels in non - outbreak settings ( reviewed in ) . in addition , two thirds of the subjects had no evidence of immunity against pertussis meaning they remain at risk of contracting infection . pertussis disease in adults is frequently difficult to diagnose because of the absence of classical clinical features such as the inspiratory whoop that are typically associated with disease in unvaccinated children . therefore , raising awareness in healthcare providers to consider pertussis in the differential diagnosis of cough illness in older individuals can help to improve the diagnostics . this may be particularly important as few clinical features were identified in our study that might facilitate differential diagnosis in this age group . bordetella pertussis is a fastidious organism that is difficult to culture , and while pcr improves pertussis detection rates compared to culture , these techniques are both expensive and not readily available in many asian laboratories . in addition , pcr is optimally sensitive during the first 3 weeks of cough , meaning patients in our study may have missed this window for detection . further difficulty in performing routine testing in asian countries is represented by the specialist training , experience and specific sample storage and transportation media required for the collection and processing of nasopharyngeal samples for pcr or culture . a single acute - phase serum sample , as used in our study , this method is also supported by kinetic studies showing that anti - pt antibodies decline rapidly in all age groups after infection . none of the patients with serological evidence of pertussis in the previous 12 months in our study received a diagnosis of pertussis . this suggests low awareness of pertussis in healthcare professionals and the potential for transmission of undetected pertussis to vulnerable infants . an increasing number of countries are adopting measures to reduce infant pertussis by vaccinating adults : this includes cocooning strategies and periodic booster doses at defined ages . of more recent interest is the potential to prevent infant pertussis through maternal immunization , with early evidence from the uk suggesting that high uptake and decreases in infant pertussis deaths are possible [ 24 , 25 ] . recent pertussis infection was associated with a reduced quality of life in our study , with over one third of subjects reporting pain / discomfort and problems conducting routine activities ( e.g. work , study , housework , family or leisure activities ) . moderately anxious. the median eq-5d score for subjects with recent pertussis infection was 072 suggesting that subjects with suspected pertussis perceived an impact on their quality of life . the direct medical costs associated with pertussis episodes in our study varied between countries and was likely related to individual healthcare systems . the 2012 average monthly wage was us$623 in malaysia , us$1546 in taiwan and us$359 in thailand . this means that pertussis - associated medical costs represented around 2% of the monthly wage in malaysia , 55% in taiwan and over 7% in thailand . patients recruited from secondary and tertiary hospitals could possibly have more severe conditions than those seen by primary healthcare physicians . this could result in either over- or under - estimation of the true pertussis burden . even though the patients were enrolled from primary healthcare centres within the hospitals , these patients may not be representative of patients seeking primary healthcare in general practitioners ' or family physicians ' clinics . however , both the pertussis positive and negative patients provided the information without the knowledge of the serological test results and thus were not likely to be biased by the diagnosis . in addition , pcr has not been widely used in laboratories of many asian countries for the diagnosis of pertussis . the diagnosis of pertussis in this study was based on serology , which could have resulted in an underestimation of the pertussis burden . furthermore , patients may not be fully aware of government subsidy levels for healthcare expenses , or they could be reluctant to share income information , resulting in an underestimation of the true health economic impact . in conclusion , approximately 5% of adult patients in malaysia , taiwan and thailand presenting to hospitals with cough of at least 2 weeks ' duration showed serological evidence of pertussis infection , while over two - thirds had no evidence of existing immunity . hence , pertussis should be considered in patients with prolonged or paroxysmal cough in the previous 12 months . pertussis infection posed a significant health economic burden and moderate impact on the health - related quality of life of the affected patients . increased awareness of pertussis by physicians and improved capacity of local laboratories is needed to improve early diagnostics and reduce the transmission of pertussis to children especially vulnerable young infants who are at the highest risk of severe disease and death . | summarysurveillance data on the burden of pertussis in asian adults are limited .
this cross - sectional study evaluated the prevalence of serologically confirmed pertussis in adults with prolonged cough in malaysia , taiwan and thailand .
adults ( 19 years ) with cough lasting for 14 days without other known underlying cause were enrolled from outpatient clinics of seven public and/or private hospitals .
single blood samples for anti - pertussis toxin antibodies ( anti - pt igg ) were analysed and economic impact and health - related quality of life ( eq-5d ) questionnaires assessed . sixteen ( 513% ) of the 312 chronically coughing adults had serological evidence of pertussis infection within the previous 12 months ( anti - pt igg titre 625 iu / ml ) .
three of them were teachers .
longer duration of cough , paroxysms ( 75% seroconfirmed , 48% non - seroconfirmed ) and breathlessness / chest pain ( 63% seroconfirmed , 36% non - seroconfirmed ) were associated with pertussis ( p < 004 ) . of the seroconfirmed patients , the median total direct medical cost per pertussis episode in public hospitals ( including physician consultations and/or emergency room visits ) was us$13 in malaysia , us$83 in taiwan ( n = 1 ) and us$26 in thailand
. the overall median eq-5d index score of cases was 072 ( range 042100 ) .
pertussis should be considered in the aetiology of adults with a prolonged or paroxysmal cough , and vaccination programmes considered . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ecthyma gangrenosum ( eg ) is a characteristic vesicular and necrotic skin manifestation of systemic sepsis commonly caused by pseudomonas aeruginosa . it was first described in association with pseudomonas septicemia by barker in 1897 and was later given the name it is usually seen in critically ill patients with neutropenia or underlying immune deficiency who present with skin lesions that begin as an erythematous , nodular or hemorrhagic vesicles that turn into necrotic ulcers with eschar formation . it initially appears as a painless round erythematous macule , which rapidly turns into a pustule with surrounding erythema . a hemorrhagic bulla appears in the center of the lesion , which spreads peripherally evolving into a gangrenous ulcer with a central black or gray eschar surrounded by a characteristic erythematous halo . patients often present with fever a few days prior to developing eg . children with eg may develop diarrhea ( 30% ) before onset of cutaneous lesions . eg is usually seen in immunocompromised patients with leukemia , lymphoma , other malignant diseases , severe burns , organ transplants , or in people receiving immunosuppressive therapy . however a few case reports describe the development of eg in previously healthy patients without any of the unrecognized risk factors such as intraabdominal abscess , recent viral illness , antimicrobial treatment for neutropenia or hypogammaglobulinemia . it had been considered to be pathognomonic of pseudomonas sepsis until it was described in cases with infections caused by group a streptococcus , aeromonas hydrophila , escherichia coli , candida albicans , aspergillus species , and mucor species . the mechanism of action of tissue destruction by pseudomonas is due to exotoxin a , which inhibits protein synthesis ; elastase , which degrades elastin in blood vessel wall ; phospholipase c , which degrades phospholipids in cell membrane and pyocyanin that generates reactive oxygen species . eg may appear at any location on the body but predominantly affects anogenital and axillary areas . frequency of distributions - gluteal / perineal ( 57% ) , extremities ( 30% ) , trunk ( 6% ) , and face ( 6% ) . our case of eg is over the periorbital region in an immunocompetent healthy woman without bacteremia . a previously healthy 35-year - old woman was admitted with a 2 weeks history of a crusted ulcer around left eye . the lesion started at outer canthus of the left eye as a painless erythematous pustular lesion with surrounding edema , which later spread in the next 78 days to involve upper and lower eyelids along with swelling of the cheek on the left side . there were multiple hemorrhagic bullae that ruptured to form a gangrenous ulcer with an overlying eschar [ figure 1 ] . crusted and gangrenous plaque around left eye patient complained of watering from her left eye along with gradual diminution of vision as a result of orbital swelling obscuring the vision . the patient did not give any past history of diabetes mellitus or chronic respiratory illness or any abnormal bleeding . there was no significant drug history , or history of insect bite , or intimate contact with cattle . general examination showed no pallor , icterus , cyanosis , clubbing , or pedal edema . local examination showed a crusted ulcer situated at the left periorbital region of size 9 cm 5 cm with irregular shape , ragged margins , raised hyperpigmented border , and floor filled with slough and necrotic tissue . blood investigations such as complete hemogram , blood sugar , serum urea and creatinine , liver function test , and serum electrolytes were within normal limits . swab taken from the ulcer showed growth of p. aeruginosa in both blood agar and macconkey agar media . punch skin biopsy from the margin of the ulcer stained with hematoxylin and eosin showed necrosis of the epidermis and the upper dermis , covered on the surface by necrotic exudates [ figure 2 ] . the deeper dermis and subcutaneous fibroadipose tissue also showed necrotic areas surrounded by inflammatory cells with a predominance of polymorphonuclear neutrophils . h and e 10 : necrosis of the epidermis with necrotic exudate in the dermis h and e 40 : necrotic fibroadipose tissue with predominance of polymorphonuclear neutrophils systemic antipseudomonan antibiotic with injection piperacillin and tazobactam 4.5 g thrice daily was started after obtaining the wound swab culture sensitivity report . the lesion completely resolved with subsidence of orbital swelling within 14 days of antibiotic therapy . the patient regained vision in her left eye completely at the end of treatment [ figure 4 ] . healed lesion after antipseudomonal antibiotic considering the clinical findings , laboratory investigations and therapeutic response to antipseudomonas antibiotics the case was diagnosed as ecthyma gangrenosum without bacteremia . it is well known that eg is a rare cutaneous lesion of systemic infection caused most commonly by p. aeruginosa . it is characterized by round or oval lesions with erythematous halo and a necrotic center representing where the organism invades blood vessels and causes infarctions . it is observed commonly in patients with any kind of immunodeficiency . although the commonest site of eg lesions is the gluteal or perineal region ( 57% ) , a few atypical sites may be involved such as extremities , trunk , face , and rarely periorbital region . in our case , majority of eg were reported in patients with septicemia and immunocompromised status such as leukemia , lymphoma , other malignant diseases , severe burns , organ transplant , or in people receiving immunosuppressive therapy or recent antibiotic therapy for neutropenia or hypogammaglobulinemia . in our case there are a few case reports that eg can present as localized skin eruptions that are not accompanied by bacteremia or systemic infection . the source of infection in this patient could not be determined with certainty , but it is possible that the patient presented with erysipelas , which was later colonized and superinfected with p. aeruginosa and then developed eg . negative blood culture suggests that eg developed as a primary lesion at the mentioned site . the commonest causative organism of eg is p. aeruginosa , but other organism such as group a streptococcus , staphylococcus aureus , escherichia coli , aeromonus hydrophila , serratia marcescens , and so on can also cause eg . in our case although bacteremia was not detected but the wound swab showed growth of pseudomonas . although usual outcome is poor , rapid diagnosis , and aggressive appropriate systemic treatment of eg can lead to successful outcome . effective intravenous antipseudomonas therapy ( beta - lactam antibiotic with or without an aminoglycoside ) is appropriate for treatment of both bacteremic and nonbacteremic eg . patients with pseudomonas bacteremia have been reported to have a mortality rate of 38% . on the other hand only two patients ( 15% ) died in a review of 13 patients with eg without bacteremia . in another study , the mortality rate was 7.5% in the group of patients with skin lesions considered to be primary and 20% in the group of patients with skin lesions considered to be secondary to bacteremia . factors that are associated with higher mortality include neutropenia , septic shock , inappropriate or delayed antibiotic therapy , and resistant microorganisms . our case is unique in the sense that it occurred in an immunocompetent healthy female , not associated with bacteremia and the site was periorbital region , which is not a common site of the disease described in the literature . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . | ecthyma gangrenosum ( eg ) is a cutaneous lesion classically associated with potentially fatal pseudomonas septicemia in immunocompromised patients .
other bacterial and fungal pathogens have also been implicated .
although eg typically occurs in immunocompromised or neutropenic patients , it may occasionally affect a previously healthy person .
the cutaneous findings are characteristic with small indurated papulovesicles progressing rapidly to necrotic ulcers with surrounding erythema and a central black eschar .
while lesions can occur at any site , most are commonly found over the buttocks , perineum , limbs , and axillae .
we describe a case of eg in periorbital region in a previously healthy woman who responded to appropriate antibiotic treatment for pseudomonas .
it is very important to establish the diagnosis early so that appropriate systemic antibiotic therapy can be initiated to reduce morbidity and potential mortality . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cocaine is a potent stimulant of the central nervous system which causes vasoconstriction and can damage all organ systems . it blocks presynaptic sympathetic reuptake of norepinephrine ( ne ) , causing accumulation in synaptic clefts . ne induces alpha - adrenergic stimulation and vasoconstriction which is the underlying culprit in organ damage . we herein present a case of cocaine - induced splenic rupture with a review of the literature . a 39-year - old white male with history of cocaine and heroin abuse , presented to the emergency department with chief complaint of left flank pain . physical exam revealed the patient to be stable , alert and oriented , however , diaphoretic . laboratory data showed leukocytosis of 15 000 and a hemoglobin and hematocrit of 12.6 g / dl and 38.5% . contrast enhanced ct of the abdomen and pelvis showed blood extravasating from the superior aspect of the spleen with a large hemoperitoneum ( fig . the patient then underwent ct angiography with coil embolization of the proximal splenic artery ( fig . 2 ) . the repeat hemoglobin revealed a drop to 6.0 g / dl , but responded to transfusion . .
figure 2:splenic artery angiogram after placement of embolization coil showing patency of flow , no active extravasation . splenic artery angiogram after placement of embolization coil showing patency of flow , no active extravasation . repeat ct showed a collection in the left upper quadrant with partially necrotic areas within the spleen ( fig . figure 3:the islands of preserved spleen lit up with iv contrast surrounded by a large collection of old blood and devitalized tissue . the islands of preserved spleen lit up with iv contrast surrounded by a large collection of old blood and devitalized tissue . the patient then underwent ct guided drainage of the collection which was positive for methicillin - sensitive staphylococcus aureus ( fig . splenic rupture is a rare but serious complication from cocaine abuse . given the ubiquitous prevalence of abuse and the potential for death from intraperitoneal bleeding , the prompt diagnosis and treatment of cocaine - induced disease including splenic rupture is essential . cocaine attains high concentrations within the spleen and the associated vasoconstriction has been shown to transiently reduce splenic volume on average by 20% . splenic hemorrhage may occur from arteriolar rupture from accelerated hypertension or from infarction and subsequent hemorrhage following resolution of vasospasm [ 1 , 3 ] . the current management for the majority of splenic injury is a non - operative approach with adjunctive transcatheter splenic artery embolization ( tsae ) which is effective for non - operative management in 90% of blunt splenic trauma two general methods for tsae of splenic injuries have been advocated . one option is coil embolization of the proximal splenic artery , which decreases arterial pressure in the spleen but allows continued perfusion through collateral arteries . the other method is superselective embolization of the bleeding arterial branch . to arrest the hemorrhage from splenic injury and to minimize infarct due to embolization , it is important to select appropriate method of tsae on the basis of the features of arterial injuries [ 46 ] . our patient was managed with coil embolization of the proximal splenic artery and subsequently maintained partial perfusion of splenic tissue . a study conducted over an 11-year period reports that minor complications of fever , left - sided pleural effusions , and coil migration occur in 34% of patients while major complications of splenic abscess , infarction , cyst , and contrast induced renal insufficiency occur in 14% of patients who undergo tsae . of the patients in the study , of patients with major complications had undergone distal embolization , defined as distal to the main splenic artery trunk . during the post - procedure course , our patient was noted to have minor complications of fever and left - sided pleural effusion as well as a major complication of intra - abdominal abscess . it is generally recommended that patients who undergo emergent splenectomy receive pneumococcal , meningococcal and h. influenzae ( hib ) vaccinations 2 weeks postoperatively , however , the guidelines are unclear regarding post- tsae patients . 99.2% of active trauma surgeons immunize their postsplenectomy patients , whereas only 15.4% of surgeons immunize those who undergo splenorrhaphy and 8.4% immunize patients who are managed nonoperatively . it has been proposed that the decision to vaccinate be based on splenic function post - tsae . based on ct volumetric analysis , coil embolization of the main splenic artery resulted in only a mild degree of splenic volume loss over the long term , with a mean of 15% decrease in volume . patients that underwent distal tsae demonstrated a 21% volume reduction while patients with proximal tsae demonstrated a 4% reduction . our patient was vaccinated given that post - procedure ct showed the spleen to be partially necrotic with only two islands of well - perfused , preserved spleen depicting > 15% decrease in splenic volume . | abstractsplenic rupture is a rare but serious complication from cocaine abuse . given the ubiquitous prevalence of abuse and the potential for death from intraperitoneal bleeding , the prompt diagnosis and treatment of cocaine - induced disease including splenic rupture is essential .
the management for splenic rupture from traumatic and atraumatic etiology has shifted from emergent laparotomy and splenectomy to non - operative approach with transcatheter splenic artery embolization .
we report a 39-year - old male with a significant substance abuse history who presented with atraumatic splenic rupture .
he was managed nonoperatively with adjunctive transcatheter splenic artery embolization .
his post - procedure course was complicated by an intra - abdominal abscess requiring drainage via interventional radiology guided pigtail catheter placement and intravenous antibiotics .
this case report is intended to raise awareness of the potentiating effects of cocaine use in this patient population and highlight questions raised during this patient 's management . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
worldwide , over 200,000 new cases of kidney cancer are diagnosed and approximately 100,000 deaths occur from this disease each year . renal cell carcinoma ( rcc ) constitutes up to 85% of renal malignancies in adults . despite the established role of radical or partial nephrectomy as a standard of treatment , a fair number of patients with localized tumors , ranging from 20% to 40% , will experience disease relapse . in patients with recurrent rcc , the clinical course can vary , and survival can be stratified by an objective parameter called the memorial sloan - kettering cancer center risk score , which includes time to recurrence , lactate dehydrogenase , hemoglobin , corrected calcium , and performance status . however , limited information is available on clinical characteristics , prognostic factors , and outcomes in patients with late - recurring rcc . in this study , we evaluated patients with disease recurrence after radical nephrectomy with respect to clinicopathological characteristics and focused on determining the predictive factors affecting different cancer - free intervals . from january 1990 to may 2012 , a total of 363 patients underwent radical or partial nephrectomy for rcc with curative intent at kyung hee university medical center . we defined clinically localized rcc as pathologically proven rcc of t stage 1a-2b without lymph node enlargement or metastasis at diagnosis . the pathologic stage was reassigned according to the 2009 union internatinale contre le cancer and the american joint committee on cancer tnm staging system . patients were generally followed every 3 to 6 months for the first 2 years following surgery , every 6 months from the 3rd through the 5th year , and annually thereafter . follow - up evaluation consisted of history taking , physical examination , routine blood tests with serum metabolic panels , and imaging evaluation . abdomen and chest computerized tomography scans , bone scintigraphy , and brain imaging were conducted in clinically indicated cases . cause of death ( cancer - specific death ) was determined by chart review or death certificate . of 321 patients who underwent radical nephrectomy for localized rcc , 29 patients experienced recurrence . these patients were divided into two groups according to the recurrence - free period after nephrectomy . patients who were diagnosed with recurrence within 5 years after radical nephrectomy ( n=20 ) were grouped into the ' early recurrence ' group . patients with recurrence more than 5 years after radical nephrectomy ( n=9 ) were included into the ' late recurrence ' group . mean recurrence - free survival was 22.1 months ( range , 1 to 56 months ) in the early recurrence group and 113.3 months ( range , 64 to 166 months ) in the late recurrence group . among 292 patients without disease recurrence , 95 patients with more than 5 years of follow - up the mean follow - up period for the control group patients was 114.1 months ( range , 61 to 237 months ) . in comparing demographics and clinicopathological data among the three groups , analysis of variance logistic regression analysis was applied to define clinicopathological factors affecting time to recurrence after radical nephrectomy . 20.0 ( ibm co. , armonk , ny , usa ) . reported p - values are two sided and p<0.05 was considered statistically significant . from january 1990 to may 2012 , a total of 363 patients underwent radical or partial nephrectomy for rcc with curative intent at kyung hee university medical center . we defined clinically localized rcc as pathologically proven rcc of t stage 1a-2b without lymph node enlargement or metastasis at diagnosis . the pathologic stage was reassigned according to the 2009 union internatinale contre le cancer and the american joint committee on cancer tnm staging system . patients were generally followed every 3 to 6 months for the first 2 years following surgery , every 6 months from the 3rd through the 5th year , and annually thereafter . follow - up evaluation consisted of history taking , physical examination , routine blood tests with serum metabolic panels , and imaging evaluation . abdomen and chest computerized tomography scans , bone scintigraphy , and brain imaging were conducted in clinically indicated cases . cause of death ( cancer - specific death ) was determined by chart review or death certificate . of 321 patients who underwent radical nephrectomy for localized rcc , 29 patients experienced recurrence . these patients were divided into two groups according to the recurrence - free period after nephrectomy . patients who were diagnosed with recurrence within 5 years after radical nephrectomy ( n=20 ) were grouped into the ' early recurrence ' group . patients with recurrence more than 5 years after radical nephrectomy ( n=9 ) were included into the ' late recurrence ' group . mean recurrence - free survival was 22.1 months ( range , 1 to 56 months ) in the early recurrence group and 113.3 months ( range , 64 to 166 months ) in the late recurrence group . among 292 patients without disease recurrence , 95 patients with more than 5 years of follow - up the mean follow - up period for the control group patients was 114.1 months ( range , 61 to 237 months ) . in comparing demographics and clinicopathological data among the three groups , analysis of variance was used for continuous variables and post hoc analysis was conducted with bonferroni method . logistic regression analysis was applied to define clinicopathological factors affecting time to recurrence after radical nephrectomy . 20.0 ( ibm co. , armonk , ny , usa ) . reported p - values are two sided and p<0.05 was considered statistically significant . of a total of 321 patients who underwent radical nephrectomy for localized rcc , 29 patients were diagnosed with cancer recurrence . of these , 20 patients ( 6.1% ) were diagnosed with recurrence within 5 years after radical nephrectomy ( early recurrence ) and 9 patients ( 2.8% ) were diagnosed with recurrence more than 5 years after radical nephrectomy ( late recurrence ) . tables 1 , 2 list the demographic and histopathological characteristics of the three patient groups . according to our data , there were no significant differences in age , gender , body mass index , or histological subtypes among the three groups . tumor necrosis was statistically significantly different between the late recurrence group and the recurrence - free group ( fisher exact test , p=0.046 ) . on the other hand , tumor necrosis was not significant in the early recurrence group ( fisher exact test , p=0.113 ) . hematuria at presentation ( chi - square test , p=0.045 ) was statistically significantly different between the early recurrence group and the recurrence - free group but was not significant in the late recurrence group . fuhrman grade ( fisher exact test , p=0.012 ) , tumor size , and pt stage were statistically significant in both the early ( fuhrman grade : fisher exact test , p=0.021 ; tumor size : bonferroni test , p=0.001 ; t stage : fisher exact test , p<0.001 ) and late ( fuhrman grade : fisher exact test , p=0.046 ; tumor size : bonferroni test , p=0.006 ; t stage : fisher exact test , p=0.002 ) recurrence groups compared with the recurrence - free group . however , there was no statistically significant difference in any clinicopathological variables between the early and late recurrence groups . in the univariate logistic regression analysis , tumor necrosis ( odds ratio [ or ] , 4.629 ; 95% confidence interval [ ci ] , 1.106 to 19.379 , p=0.036 ) and pt stage > 1 ( or , 7.232 ; 95% ci , 1.727 to 30.280 ; p=0.007 ) were risk factors of late recurrence . in multivariable logistic regression analysis , pt stage > 1 ( or , 7.143 ; 95% ci , 1.706 to 29.912 ; p=0.007 ) was associated with late recurrence . regarding early recurrence , initial symptoms at diagnosis ( univariate analysis [ or , 3.414 ; 95% ci , 1.262 to 9.238 ; p=0.016 ] , multivariable analysis [ or , 3.609 ; 95% ci , 1.298 to 10.032 ; p=0.014 ] ) and pt stage > 1 ( univariate analysis [ or , 3.115 ; 95% ci , 1.058 to 9.172 ; p=0.039 ] , multivariable analysis [ or , 2.920 ; 95% ci , 1.028 to 8.298 ; p=0.044 ] ) were statistically significant in both the univariate and multivariable logistic regression analyses ( table 3 ) . the sites of recurrence were diverse , and we found a predominance of unusual sites , other than lung , liver , or bone , in the late recurrence group ( chi - square test , p=0.012 ; table 4 ) . of a total of 29 patients with recurrence , 6 patients ( 30.0% ) and 3 patients ( 33.3% ) had multiple sites of metastasis in the early and late recurrence groups , respectively . in the early recurrence group , lung ( n=11 , 36.7% ) was the most frequent site of recurrence , followed by bone ( n=7 , 23.3% ) , liver ( n=4 , 13.3% ) , lymph node ( n=3 , 10.0 % ) , muscle ( n=2 , 6.67% ) , contralateral kidney ( n=1 , 3.3% ) , spleen ( n=1 , 3.3% ) , and peritoneum ( n=1 , 3.3% ) . in the late recurrence group , on the other hand , more diverse distribution of metastasis was observed in the late recurrence group : brain ( n=3 , 14.3% ) , contralateral kidney ( n=2 , 9.5% ) , pancreas ( n=1 , 4.8% ) , gall bladder ( n=1 , 4.8% ) , stomach ( n=1 , 4.8% ) , colon ( n=1 , 4.8% ) , duodenum ( n=1 , 4.8% ) , pleura ( n=1 , 4.8% ) , muscle ( n=1 , 4.8% ) , lymph node ( n=1 , 4.8% ) , liver ( n=1 , 4.8% ) , and bone ( n=1 , 4.8% ) . of a total of 321 patients who underwent radical nephrectomy for localized rcc , 29 patients were diagnosed with cancer recurrence . of these , 20 patients ( 6.1% ) were diagnosed with recurrence within 5 years after radical nephrectomy ( early recurrence ) and 9 patients ( 2.8% ) were diagnosed with recurrence more than 5 years after radical nephrectomy ( late recurrence ) . tables 1 , 2 list the demographic and histopathological characteristics of the three patient groups . according to our data , there were no significant differences in age , gender , body mass index , or histological subtypes among the three groups . tumor necrosis was statistically significantly different between the late recurrence group and the recurrence - free group ( fisher exact test , p=0.046 ) . on the other hand , tumor necrosis was not significant in the early recurrence group ( fisher exact test , p=0.113 ) . hematuria at presentation ( chi - square test , p=0.045 ) was statistically significantly different between the early recurrence group and the recurrence - free group but was not significant in the late recurrence group . fuhrman grade ( fisher exact test , p=0.012 ) , tumor size , and pt stage were statistically significant in both the early ( fuhrman grade : fisher exact test , p=0.021 ; tumor size : bonferroni test , p=0.001 ; t stage : fisher exact test , p<0.001 ) and late ( fuhrman grade : fisher exact test , p=0.046 ; tumor size : bonferroni test , p=0.006 ; t stage : fisher exact test , p=0.002 ) recurrence groups compared with the recurrence - free group . however , there was no statistically significant difference in any clinicopathological variables between the early and late recurrence groups . in the univariate logistic regression analysis , tumor necrosis ( odds ratio [ or ] , 4.629 ; 95% confidence interval [ ci ] , 1.106 to 19.379 , p=0.036 ) and pt stage > 1 ( or , 7.232 ; 95% ci , 1.727 to 30.280 ; p=0.007 ) were risk factors of late recurrence . in multivariable logistic regression analysis , pt stage > 1 ( or , 7.143 ; 95% ci , 1.706 to 29.912 ; p=0.007 ) was associated with late recurrence . regarding early recurrence , initial symptoms at diagnosis ( univariate analysis [ or , 3.414 ; 95% ci , 1.262 to 9.238 ; p=0.016 ] , multivariable analysis [ or , 3.609 ; 95% ci , 1.298 to 10.032 ; p=0.014 ] ) and pt stage > 1 ( univariate analysis [ or , 3.115 ; 95% ci , 1.058 to 9.172 ; p=0.039 ] , multivariable analysis [ or , 2.920 ; 95% ci , 1.028 to 8.298 ; p=0.044 ] ) were statistically significant in both the univariate and multivariable logistic regression analyses ( table 3 ) . the sites of recurrence were diverse , and we found a predominance of unusual sites , other than lung , liver , or bone , in the late recurrence group ( chi - square test , p=0.012 ; table 4 ) . of a total of 29 patients with recurrence , 6 patients ( 30.0% ) and 3 patients ( 33.3% ) had multiple sites of metastasis in the early and late recurrence groups , respectively . in the early recurrence group , lung ( n=11 , 36.7% ) was the most frequent site of recurrence , followed by bone ( n=7 , 23.3% ) , liver ( n=4 , 13.3% ) , lymph node ( n=3 , 10.0 % ) , muscle ( n=2 , 6.67% ) , contralateral kidney ( n=1 , 3.3% ) , spleen ( n=1 , 3.3% ) , and peritoneum ( n=1 , 3.3% ) . in the late recurrence group , lung was also the most frequent organ of recurrence ( n=6 , 28.6% ) . on the other hand , more diverse distribution of metastasis was observed in the late recurrence group : brain ( n=3 , 14.3% ) , contralateral kidney ( n=2 , 9.5% ) , pancreas ( n=1 , 4.8% ) , gall bladder ( n=1 , 4.8% ) , stomach ( n=1 , 4.8% ) , colon ( n=1 , 4.8% ) , duodenum ( n=1 , 4.8% ) , pleura ( n=1 , 4.8% ) , muscle ( n=1 , 4.8% ) , lymph node ( n=1 , 4.8% ) , liver ( n=1 , 4.8% ) , and bone ( n=1 , 4.8% ) . disease recurrence in patients with localized rcc after curatively intended radical nephrectomy can occur at any time . however , late recurrence after radical nephrectomy is not common . the reason we determined 5 years as a cutoff value was because surveillance patterns change at 5 years after curative treatment for rcc . also , some have suggested that surveillance after 5 years is no longer necessary for cost - effectiveness in low - risk patients . nevertheless , about 10% to 20% of patients with disease recurrence develop late recurrence more than 5 years after nephrectomy . the final objective of our study was to determine the risk factors predictive of late recurrence , at the point of radical nephrectomy , which could thus be incorporated into the postoperative surveillance guideline . in our studies , of a total of 104 patients with follow - up for more than 5 years after radical nephrectomy for localized rcc , 9 patients ( 9.1% ) developed late recurrence . to date , several studies have been conducted to determine the differential characteristics of late recurrence of localized rcc after radical nephrectomy . however , on the basis of the current medical literature , no consensus has been reached about the parameters predicting late recurrence of localized rcc because of the small patient numbers [ 2 - 16 ] . according to the study by adamy et al . , which was conducted with 44 patients with late recurrence ( beyond 5 years after nephrectomy ) , patients with late recurrence tended to have fewer initial symptoms , smaller tumor size , and less aggressive disease ( pt1 ) compared with patients with early recurrence . adamy et al . also suggested that patients with late recurrence tend to be in an mskcc favorable risk group . park et al . evaluated 41 patients with late recurrence ( beyond 5 years after nephrectomy ) and suggested that old age and high high - sensitivity c - reactive protein levels at the time of operation were independent predictive factors for late recurrence . brookman - may et al . studied a total of 310 patients with cancer recurrence more than 5 years after radical nephrectomy and compared the characteristics of these patients with recurrence - free patients . they proved that lymphovascular invasion , fuhrman grade 3 - 4 , and pt stage > pt1 were significantly associated with late recurrence . ha et al . evaluated 14 patients with disease recurrence more than 5 years after radical or partial nephrectomy among 423 patients with pathologically confirmed stage t1 clear cell rcc and showed that symptoms at diagnosis and pt stage were independent predictive factors for late recurrence . in the present study , unlike in previous studies , we tried to determine the factors that affected time to recurrence after radical nephrectomy and to discover the differential characteristics of patients in the early and late recurrence groups , respectively . we found that tumor necrosis was associated with late disease recurrence and initial clinical symptoms were associated with early recurrence . large tumor size , advanced pathologic stage , and advanced fuhrman nuclear grade were associated with both early and late recurrence . we also evaluated the correlation of tumor size and tumor necrosis in all the patients involved in this study . according to the logistic regression analysis , tumor size was shown to be a risk factor of tumor necrosis ( or , 1.261 ; 95% ci , 1.086 to 1.463 ; p=0.002 ) . tumor necrosis was initially recognized in the 1970s as a predictor of aggressive rcc behavior . confirmed that histological tumor necrosis is a statistically significant prognostic factor in patients with nonmetastatic clear cell rcc . kim et al . suggested that the survival rate of patients with tumor necrosis was significantly lower than that of patients without tumor necrosis . according to the previously published medical literature , the definitions for tumor necrosis are diverse . however , most investigators have defined histological necrosis , as a prognostic factor , as the presence of any microscopic coagulative tumor necrosis , without consideration of degenerative changes such as hyalinization , hemorrhage , and fibrosis . we also determined tumor necrosis as the presence of microscopic coagulative tumor necrosis . as we showed in tables 2 , 3 , in consideration of the hypothesis that rapid tumor cell growth outgrows its own blood supply and subsequently creates a hypoxic condition and resultant tumor necrosis , this result might be contradictory . however , in several recent reports , a high proliferation index or insufficient oxygen supply ( hypoxia inducible factor-1 , or hif-1a ) and high ki-67 ( a proliferation marker ) expression were not interchangeable with tumor necrosis . some medical literature suggests that host immunologic factors , such as differential expression of chemokines , may be involved in tumor necrosis . although the exact nature of immunologic triggers and tumor necrosis remain to be clarified , there might be a kind of ' time - related function ' between ' tumor necrosis ' and a ' tumor dormancy state ' . this study also showed the diversity of the recurrence site in the late recurrence group . the lung , liver , and bone are known as the usual recurrence organs of malignant neoplasms , including rcc , and we found such a tendency in the early recurrence group . however , there was a predominance of cancer recurrence at other sites in the late recurrence group , such as the lymph node , brain , pancreas , gall bladder , stomach , duodenum , colon , muscle , contralateral kidney , and pleura . the question of differences in metastasis site according to recurrence - free interval remains to be answered . suggested that organ - specific metastasis localization can be predicted by specific genomic aberrations in primary colorectal cancer . . showed that cancer antigen 125 levels varied among the different sites of metastasis in breast cancer . koo et al . reported that metastatic breast cancer showed different phenotypes of estrogen receptor , progesterone receptor , and human epidermal growth factor receptor 2 according to the different recurrence sites . there was no standardized postoperative follow - up protocol and the quality of imaging modality has improved substantially during the past 30 years . furthermore , the small number of patients who were evaluated in a single institution might have affected our study data . for this reason , we are planning to conduct a multicenter study with a large patient pool to minimize these biases . this study suggested that the presence of microscopic coagulative necrosis in the resected specimen may be a predictive factor of late recurrence after radical nephrectomy for localized rcc . also , clinical symptoms such as hematuria , flank pain , and a palpable mass at diagnosis may predict disease recurrence in a short period after radical nephrectomy . large tumor size , advanced pathologic stage , and advanced fuhrman nuclear grade may be risk factors for both early and late recurrence . therefore , we suggest that patients with tumor necrosis may need to undergo long - term , thorough surveillance after radical nephrectomy for localized rcc . | purposethe objective of this study was to determine the factors affecting the time to recurrence after radical nephrectomy for localized renal cell carcinoma.materials and methodswe retrospectively evaluated 321 patients who received radical nephrectomies for localized renal cell carcinoma ( pt1a - pt2b n0m0 ) .
of 29 patients with disease recurrence , 9 had recurrence more than 5 years after radical nephrectomy .
we evaluated the clinicopathological factors , with the use of a retrospective study design.resultstumor necrosis was statistically different between the late recurrence group and the recurrence free group ( fisher exact test , p=0.046 ) .
hematuria at diagnosis ( chi - square test , p=0.045 ) was statistically significant in early recurrence . in the univariate logistic regression analysis , tumor necrosis ( odds ratio [ or ] , 4.629 ; 95% confidence interval [ ci ] , 1.106 to 19.379 ; p=0.036 ) and pt stage>1 ( or , 7.232 ; 95% ci , 1.727 to 30.280 ; p=0.007 ) were risk factors of late recurrence . in the multivariable logistic regression analysis ,
pt stage>1 ( or , 7.143 ; 5% ci 1.706 to 29.912 , p=0.007 ) was associated with late recurrence .
regarding early recurrence , initial symptoms at diagnosis and pathologic t stage>1 were statistically significant in both univariate and multivariable logistic regression analysis . in terms of recurrence site , patients with late recurrence tended to have unusual metastasis sites other than lung , liver or bone ( chi - square test , p=0.012).conclusionsthese data suggest that tumor necrosis may affect late disease recurrence .
patients with initial symptoms and hematuria at diagnosis are vulnerable to recurrence in a shorter period after nephrectomy .
patients with late recurrence showed a tendency to have unusual metastasis site other than lung , liver or bone . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
poor quality drug or substandard product encounters a major stringent issue for the global health system and it can not be ignored . in most streamlined regions of the globe like japan , canada , australia , new zealand , the united states of america and most of the european union , hardly 1% of the market value products are counterfeit , developing countries like africa , latin america and many parts of asia may markedly be the seller and producer of sffc medicines . russia , china , india , brazil , mexico , pakistan , southeast asian and middle eastern countries are considered as the chief operators in distribution and manufacturing of counterfeit drugs . a decade ago , it was examined by who that 10% of the global medicines were counterfeit . however , contrary to its previous communicated data who - impact pointed out that data was not much authentic . now , it is questionable that what are the causes and influences of this problem . in turn , one reason is poverty and other is ignorance and these could contribute to the demand for counterfeit and substandard drugs . moreover , ignorance of poor quality , unregistered medicines , lenient penalties , inadequate enforcement of laws are some of the significant causes which provoke the situation . day by day , public trust in health system may deteriorate as the consumption of substandard drugs by patients increase due to availability and lack of detection of sffc or nsq medicine in the market . consumption of sffc medicines can be responsible for failure of treatment or even death . unbelievably , 0.20 to 0.30 million people die every year in china just because of counterfeit and substandard drug product . no such data is available in india , yet many patients are dying every year . according to a report revealed by international policy network , globally 0.70 million deaths were reported for malaria and tuberculosis because of counterfeit drugs . this data reveals the loop holes in the regulatory system and the cautions for avoiding the poor quality medicines . india is the largest manufacturer of generic drugs and probably 12 - 25% of the medicines supplied globally are contaminated , substandard and counterfeit . being the world 's largest manufacturers of active pharmaceutical ingredients and finished products , it is likely that india along with china could be the major contributors to spurious medications as per patrick lukulay , vice president of us pharmacopoeial convention 's global health programs . in a report , it has been declared by the european commission that 75% of the global cases of sffc medicines originate from india . indian government officials initiated an investigation to scrutinize the drugs product which are supplying by india to nigeria when india was accused along with other 29 asian countries as the main originator of counterfeit drugs . on one side , india extensively interacts with the african countries in providing quality medicine at affordable prices , while on other side predictive blames were imposed on india and china for exporting the fake or substandard quality of antimalarial , antibiotics and contraceptives drug product to uganda and tanzania . in turn , indian drug regulatory authority has taken various steps against the causes and they have put all their efforts to improve the drug regulation in the country . however , no authentic evidences exist against the country according the data provided by the government and non government agencies of india . many researchers have investigated only individual drugs or narrow range of drug preparations and formulations . currently , no large randomized studies of drugs quality have been done in india . in the year 2000 , it has been stated that around 35.0 , 23.1 and 13.3% global sales of counterfeit medicines come from india , nigeria and pakistan , respectively and counterfeiting includes all therapeutic classes of drug and mainly antibiotics . a decade ago , indian government officials estimated that 9% of the drug products were of substandard quality . although according to indian press media , 30 - 40% of the total marketed drugs are considered as spurious , but this data is without any scientific confirmation . under laboratory analysis in a survey accomplished in 2007 by south east asia region pharmaceutical ( searpharm ) forum , a group of pharmaceutical associations of international pharmaceutical federation ( fip ) and who , 10 743 samples were collected from 234 retail outlets . about 3.1% were estimated as spurious and 0.3% were out of pharmacopoeial standard . in 2007 , 294 fixed drug combinations ( fdcs ) products were unlawfully available in the market since these were not approved by the drugs controller general of india ( dcgi ) . in 2008 , out of 1 83 020 chemist shops , 8418 chemist licenses were suspended or cancelled by the state drugs control organizations on behalf of their trade with spurious drugs . according to cdsco , estimation of the data during 2003 - 2008 indicates 6.3 - 7.5% of the samples were of substandard quality and 0.16 - 0.35% were encountered as spurious . in 2009 , cdsco reported that in 1995 - 96 , 10.64 and 0.30% tested samples out of 32 770 were substandard and spurious , respectively , while in 2007 - 2008 , 6.42 and 0.16% tested sample out of 42 354 were substandard and spurious , respectively . nevertheless , in 2009 , 24 136 samples of 62 brands of drugs product were collected in a nationwide survey to find those products which are covertly manufactured and thus to explore the extent of spurious drug in india . samples were drawn from over 100 pharmacy outlets from various regions of india , which were belong to nine therapeutic categories of 30 manufacturers . supplementary information revealed by the state drugs control departments declared 1146 ( 4.75% ) products were of substandard quality . hereby , it can be observed from the government data that spurious drugs are at same level while there is a great decline in the number of substandard drugs from 10.64% in 1995 - 96 to 5.75% in 2008 - 09 as shown in fig . these kinds of inspections and surveys by the government officials are some driving steps for the public safety . however , stringent actions are yet to be taken for the betterment of public health . overlaying the effects of inferior manufacturing standards , deterioration with inactive or toxic fillers , relabeling of time expired drugs and degradation during storage are closely associated with drug quality , which must be checked regularly by fast and efficient techniques . manufacturing of spurious and substandard quality drug products is a fraudulent activity and their availability in the market is the life threatening issue for the public health . in 2008 , a pilot study performed in two major cities of india , delhi and chennai to explore the extent of substandard and counterfeit drugs available in market , under which it was estimated that 12 and 5% samples from delhi and chennai , respectively , were of substandard quality . in 2007 - 08 maximum instances were from maharashtra and in 2008 - 09 kerala was the leading manufacturer of the spurious and substandard drugs . in 2007 four deaths were reported in maharashtra related to spurious drugs . while more serious results came in news when it was reported that 300 infant died in 2012 in kashmir because of ceftriaxone substandard quality product which was used to treat pneumonia . no absolute and entire data is reported for substandard and spurious drugs after 2010 by cdsco , non government organizations or any individual research . for last 3 years , government has noticed several cases of spurious and substandard drugs importation . in 2009 , at chennai sea port , cdsco officials caught 3 cases of unregistered bulk drugs originating from china . cases related to the substandard quality drug product importation in india showed 35 , 35 , 34 cases for 3 consecutive years 2009 - 2010 , 2010 - 2011 and 2011 - 2012 , respectively . on a surprise inspection by the cdsco officials , 85 sales outlets out of 130 were trafficking with the banned drugs in delhi and bhiwandi city . it is highly recommended to investigate individually every drug product that is available in the domestic market . reports on substandard and spurious drugs defrauds in india from 2002 - 2004 considering the expansion of the pharmaceutical industry and the degree of potentially mortal diseases , any amount of substandard or spurious medicines is unacceptable because it rises the morbidity and mortality . only few published data admit the extent of the problem and its influence on the public health . thus , there is requirement of immediate attention and research by the regulatory authority towards this public safety issue . indian pharmaceutical industry exists at third rank in volume and thirteenth in terms of value of worth us $ 20 billion . focusing on the accessibility and affordability of the drug products in the country , india excels as the pharmacy of the developing world. indian government instructed to all central government hospitals and central government health scheme ( cghs ) dispensaries to prescribe generic medicines in large extent as possible . department of pharmaceutical , ministry of chemical and fertilizers , in collaboration with the state government commenced nationwide jan aushdhi generic drug stores in the government hospitals and supply of generic medicine through central pharma public sector undertaking . till mid of 2012 , government has already opened 122 jan aushdhi stores , where about 231 generic medicines are being marketed . to scrutinize the complications of the sffc or nsq drug in india , government has acquired numerous steps which are , 1 . amendment of drug and cosmetic act , 1940 in 2008 for making penal provisions and reset certain offences as perceptible and non bailable . when adulterated or spurious drug cause death then imprisonment imposed for not less than ten years or for lifetime with penalty of not less than one million indian rupees ( inr ) or three times the value of the drugs confiscated whichever is more ; in order to make restraint for illegal practices . in 2008 , there were 111 sanctioned posts and 64 officers in position while in 2012 there were 310 posts and 121 officers in position , which included 65 drug inspectors . 3 . for trial of offences related to adulterated and spurious drugs product , drug and cosmetic ( amendment ) act , 2008 accredited establishment of special designated courts , and nationally 14 states / union territories already introduced such courts . 4 . for effective regulatory surveillance throughout the country , hyderabad and ahmadabad have upgraded from sub zone to full zone while bangalore , chandigarh and jammu have established as new sub zones under the direction of cdsco . cdsco publishes monthly a list of drugs , medical devices and cosmetics that are evaluated and declared as not of standard quality / spurious / adulterated / misbranded . enhancement of central drug laboratories with new sophisticated testing equipment set up and creation of a new testing laboratory at hyderabad . 7 . to ensure proper traceability of those manufacturing units , which are situated abroad , from where drugs product are imported in india , new scheme for regular overseas inspection has been introduced . 8 . to encourage attentive public participation in exploring the detection of spurious drug product , a whistle blower scheme is initiated . under this scheme , if accurate information on the movement of spurious drugs product provided to the regulatory authorities , informers is suitably rewarded and 9 . at state level , tamil nadu and kerala government undertake drug quality evaluation services by tamil nadu medical service corporation limited and kerala medical service corporation limited , respectively ; and regularly report the nsq products , which they fetched from government hospitals . for minimizing sffc or nsq drugs at national or states level , still there is an urgent requirement of more rigid and stringent regulations , policies and legal actions against the problem . poor quality drugs affect the health of the public . spurious or counterfeit drugs are involved in both generic and branded products of every category throughout the world , which is growing and expanding its roots and thus emerging as menace . standard quality obligations are related to a number of factors , including drug pricing , competition between sponsors , employment and market transparency . responding to the spreading public health crisis of spurious or substandard drugs india is improving and achieving its mission in drug regulation process on account of decline in number of sffc or nsq drugs cases and by taking several important initiatives and preventive steps in the country and stringent penalties as well to fight against the poor quality drugs for protecting and promoting the public health . it is now the time to explore this matter more vigorously in the times to come in order to safeguard the interests of the patient at large . | globally , every country is the victim of substandard or spurious drugs , which result in life threatening issues , financial loss of consumer and manufacturer and loss in trust on health system .
the aim of this enumerative review was to probe the extent on poor quality drugs with their consequences on public health and the preventive measures taken by the indian pharmaceutical regulatory system .
government and non - government studies , literature and news were gathered from journals and authentic websites .
all data from 2000 to 2013 were compiled and interpreted to reveal the real story of poor quality drugs in india . for minimizing spurious
/ falsely - labelled / falsified / counterfeit drugs or not of standard quality drugs , there is urgent requirement of more stringent regulation and legal action against the problem .
however , india has taken some preventive steps in the country to fight against the poor quality drugs for protecting and promoting the public health . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
abdominal pregnancy is a rare type of ectopic pegnancy with an estimated incidence being 1 in 8,000 births and 1.4 % of all ectopic pregnancies . most commonly , the site of implantation in an abdominal pregnancy is pelvic , but very rarely it may implant in the upper abdomen . the authors report such a case of primary hepatic pregnancy on account of its rarity and the therapeutic dilemmas . a 25-year - old g2p1l1 woman with a 3-month history of amenorrhea presented to casualty with right hypochondriac pain and vomiting for the past 1 week her pulse rate was 96/min , blood pressure was 90/54 mmhg and she appeared mildly anemic . the uterus was anteverted , bulky , mobile , and nontender , and bilateral fornices were free . the uterus was found to be enlarged with an endometrial thickness of 10 mm ; bilateral adnexae were normal and free fluid was present in the abdomen . a sac with a live fetus corresponding to 17- to 18-week gestational age was seen attached to the inferior surface of the liver [ figure 1 ] . her blood investigations showed hb 9.4 g% , tlc 6000 , platelets 237 10 , and inr 1.18 . ultrasound showing the gestation sac below the liver laparotomy was carried out with a midline vertical incision which was extended subcostally on the right side , and 500 cc of hemoperitoneum was drained . on exposing the liver , a 10-cm sac was seen on the undersurface of the right lobe [ figure 2 ] . after rupturing the sac through an avascular area , a 300-g fetus [ figure 3 ] was extracted and the umbilical cord was ligated . the placenta was left in situ and attempts were made to secure the bleeding area with hemostatic sutures , but without any success . finally , the area was packed and the abdomen was closed in a single layer . perioperatively , there was a total blood loss of 2.5 l and four units of blood were transfused . postoperatively , the patient was transferred to icu on inotropes and ventilatory support . however , the patient continued to bleed through the dressings , and after consultation with the gastrointestinal surgeon and interventional cardiologist , a decision was made to proceed with embolization . the patient continued to bleed despite embolization and further laparotomy was carried out to remove the packs to avoid the risk of sepsis . peroperative picture showing the gestation sac attached to the undersurface of the liver 18 weeks fetus being extracted at the time of the laparotomy , the abdomen was full of blood . packs were removed slowly , but there was diffuse bleeding from the undersurface of the liver . the patient remained unstable , and it was decided to pack the abdomen again and to replace blood . she received a total of 76 units of blood and blood products at regular intervals . on the fourth postoperative day , patient 's urine output decreased markedly , coagulation became deranged , and the vitals were unstable despite the use of inotropes . a decision was made to proceed with liver resection but the patient was too unstable and sadly she passed away on the fifth postoperative day due to multiorgan failure secondary to hemorrhage . primary hepatic pregnancy is a type of abdominal pregnancy which is extremely rare where the site of implantation is in the liver and it is associated with a very high mortality rate . the criteria for diagnosing primary abdominal pregnancy was first given by studdiford which include ( 1 ) normal tubes and ovaries with no evidence of recent or remote injury ; ( 2 ) absence of any evidence of uteroplacental fistula ; ( 3 ) presence of pregnancy related exclusively to peritoneal surface ; and ( 4 ) pregnancy recent enough to eliminate the possibility of secondary implantation following nidation in tubes . mri can help in the definition of the regional anatomy in greater details and is ideal in the identification of the placental implantation and can help in taking the decision whether to leave or remove placenta at the time of laparotomy . in almost all cases reported , the placenta was attached to the inferior surface of the right lobe of the liver . however in our case , the placental site was already bleeding so we had no option but to leave it . management reported in the literature varies from conservative management , i.e. , leaving placenta and the use of methotrexate to cases of wedge resection and right hepatic lobectomy . the insertion of arterial catheters just prior to surgery for embolization is also given as an option . bleeding from the membrane edges was controlled by interlocking sutures and the use of gauze packs , which were removed after 48 h. the postpartum period in their case was uneventful . the present case was taken up for surgery by senior experienced personnel taking all measures such as the use of gel foam , packing , and hemostatics to control bleeding as well as timely replacement of blood and blood products . methotrexate was given in the postoperative period and hepatic artery embolization was done within 18 h of primary surgery . in retrospect , the authors conclude that a hepatic embolization could have been done before proceeding to surgery although its efficacy is doubtful . second , a partial hepatic resection could have been done at the first instance when the patient condition was stable . | a 25-year - old g2p1l1 woman with 18-week pregnancy presented with right hypochondriac pain and vomiting for the past 1 week .
she had borderline vitals and a diffusely tender abdomen .
ultrasound revealed a live 18-week fetus attached to the undersurface of the liver with moderate ascites .
laparotomy was carried out which revealed 500 cc of hemoperitoneum with a primary hepatic pregnancy of the right lobe of liver and bleeding from the placental site . after extracting the fetus ,
the placenta was left inn situ and the abdomen was packed to control the bleeding as other hemostatic measures failed .
hepatic artery embolization was done after surgery followed by relaparotomy but the abdomen had to be repacked again as the patient was unstable with uncontrollable bleeding .
the patient succumbed to dic despite adequate replacement .
in retrospect , the authors conclude that embolization could have been done before surgery and partial hepatic resection attempted in the first instance . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the most widely used definition of metabolic syndrome is that of the third report of the american national cholesterol education program . three or more of the following risk factors , which are easily mesured , must be present for diagnosis : abdominal obesity ( > 102 cm/40 in men , > 88 cm/35 in women ) , triglycerides 150 mg / dl , low high density lipoprotein ( hdl ) cholesterol ( < 40 mg / dl men , < 50 mg / dl women ) , high blood pressure 130/ 85 mmhg and raised fasting glucose 110 mg / dl . obesity alone may result in sleep apnoea , congestive cardiac failure , spine and joint degenerative conditions , and depression . in south east asia , obesity rates are among the lowest in the world , but are increasing quickly along with unprecedented economic growth . the asian consensus meeting on metabolic surgery indications include obesity with a body mass index ( bmi ) of 35 kg / m , or 32 kg / m with co - morbidities , or 30 kg / m with 2 or more of : raised triglycerides , abdominal obesity ( waist > 80 cm in females and > 90 cm in males ) , reduced hdl cholesterol , hypertension , and raised fasting plasma glucose levels . between 2004 and 2009 , a 449% increase in bariatric surgical procedures was noted among 11 asian countries . weight control via dietary modifications and increased physical activity remain the primary and most cost - effective initial interventions for obesity . lipid lowering drugs have a central role in prevention of atherogenesis , coronary artery disease and cerebrovascular disease . however , for the majority of patients with moderate to severe type ii diabetes and obesity , intensive medical therapy including lifestyle changes does not provide sufficient reduction in the glycated haemoglobin level to effectively reverse diabetes ( hba1c < 6.0 ) . surgery has come to the fore in metabolic syndrome following the success of bariatric procedures . an improvement in type ii diabetes , observed in addition to weight reduction , has been demonstrated . the ongoing expansion from bariatric into metabolic surgery for sleeve gastrectomy reflects international recognition of its role in the correction of co - morbidities in the moderately obese , particularly insulin resistance diabetes . the inclusion of bariatric surgery in the algorithm of the international diabetic federation for type ii diabetes consolidates the evidence . sleeve gastrectomy , which involves laparoscopic removal of approximately 75% of the stomach , is regarded as a restrictive bariatric procedure , with a considerable calorie restriction effect on bmi . alterations in the secretion of hormones like ghrelin , peptide - yy ( pyy ) , leptin , glucagon - like peptide 1 ( glp-1 ) , glucose dependent insulinotropic peptide ( gip ) , decrease in insulin resistance , long - term weight loss and alterations in gut microbiota together contribute to optimal glucose homeostasis after surgery , . the role of incretins in the promotion of insulin production is frequently postulated as a mechanism for the success of metabolic surgery . two main incretins , glp-1 and gip , are produced from the small intestine epithelium in response to intestinal glucose concentrations . a comparative analysis of gut hormones after sleeve gastrectomy and gastric bypass found that both exerted influence on glp-1 , gip , obestatin and leptin , and bypass had an additional duodenal effect on cholecystokinin . exaggerated glp after gastric bypass has been associated with increased pancreatic beta cell function although causality remains uncertain . insulin secretion happens in two phases , the first of which is restored considerably following sleeve gastrectomy . basso et al . in their study reported a gastric hypothesis for this restoration of 1 phase insulin secretion , which improves glycaemic control . they proposed that a decrease in hydrochloric acid - stimulated , vagally - innervated , antral mucosa secretion of gastrin releasing peptide ( grp ) in turn stimulated glp-1 release . faster gastric emptying was demonstrated scintigraphically in 11 patients at 6 months from surgery , and then compared to pre - operative testing . the time from the end of meal until the beginning of emptying into the duodenum was reduced from 19.2 to 9.5 minutes . gastric emptying half - time decreased from 94.3 to 47.6 minutes , indicating a quicker transit through the stomach . quicker entry of food to the distal small bowel directly stimulates the l - cells for the 2 phase of glp-1 peptide release , . another study by tzovaras et al . supported this theory when they demonstrated symptoms suggestive of dumping syndrome after provocation in patients post - sleeve , reinforcing the notion that sleeve is not a purely restrictive procedure . ghrelin , an appetite stimulant , produces orexigenic effects via stimulation of neuropeptide y from the hypothalamus . ghrelin is mainly produced by the oxyntic cells of the stomach , and has been implicated in obesity and metabolic syndrome . sleeve gastrectomy significantly lowers fasting ghrelin despite weight loss , with suppression of ghrelin after meals , compared with no change from baseline fasting or post - prandial ghrelin levels after gastric bypass . the reduction in serum ghrelin levels persists at 5 year follow - up of sleeve gastrectomy . pyy is co - secreted with glp 1 from the distal intestine after meals , and increases insulin sensitivity and also inhibits the hypothalamic production of neuropeptide y. pyy levels are increased after either sleeve gastrectomy or gastric bypass . pharmacological glp-1 agonists have been approved by the united states food and drug administration ( fda ) , as have inhibitors of dipeptidyl peptidase 4 ( dpp 4 ) , a protease which degrades glp-1 and gip . while such medications may control hyperglycaemia in diabetes , and even produce slight weight loss and hypertension reduction , the effects are not comparable to metabolic surgery . the fourth international consensus summit on sleeve gastrectomy in new york , 2012 included a survey of 46,133 sleeve gastrectomy cases , among 130 surgeons , at an average of 5 years after surgery . excess weight loss was 59% at 1 year , gradually falling to 50% at 6 years . low complication rates were noted : high leak 1.1% , haemorrhage 1.8% and stenosis 0.9% . as weight loss plays a key role in metabolic syndrome outcomes after sleeve gastrectomy , for excess weight loss , increasing numbers of trials reported the percentage excess weight loss ( ewl ) after sleeve gastrectomy as 77.5% and 57.3% at 3 and 6 years , respectively . among super obese patients , the reported mean ewl is 52% , 43% and 46% at 72 , 84 and 96 months follow up , respectively . although widely considered safe and effective , post - operative complications do remain a feature of this surgery , though fewer and earlier in comparison to other procedure , with leak rates of 2.2% in a meta - analysis of 9,991 cases . direct comparison of medical versus bariatric surgical management of obesity and diabetes was performed in the stampede prospective randomised controlled trial at the cleveland clinic . gastric bypass ( roux en y ) or sleeve gastrectomy provided a mean of 29.4 kg and 25.1 kg ewl , respectively , versus 5.4 kg in the intensive medical group . regarding diabetes , the success rate for reduction in hba1c to 6.0% at 12 months was over 3 times greater after sleeve gastrectomy or gastric bypass surgery ( 42% and 37% versus 12% , respectively ) . as a result , lesser medications for diabetes , hypertension and hyperlipidaemia need composite improvement in all parameters of metabolic syndrome . long - term follow up of sleeve gastrectomy patients at 68 years showed a 77% improvement or remission of diabetes . a systematic analysis of 33 studies comprising 3,997 patients demonstrated reduction in hypertension in 75% of cases , with resolution in 58% , at an average follow up of 16.9 9.8 months . reduced left ventricular mass , septum and posterior wall thickness , were demonstrated in the study by cavarretta et al . ; lipid profile improvement , specifically hdl and triglyceride levels , total cholesterol / hdl and triglyceride / hdl ratios at 1 year follow - up have been reported without lowering of total cholesterol and ldl levels after sleeve gastrectomy . the asian population in general is known to develop metabolic syndrome at lower bmis in comparison to their caucasian counterpart and hence , studies have reported outcomes from asia in this cohort . in asian populations with type ii diabetes and non - morbid obesity ( bmi , 2535 kg / m ) , sleeve gastrectomy has demonstrated up to 50% resolution in diabetes at 1 year . the principal mechanism is thought to be related to calorie restriction and weight loss , and c - peptide levels returning to > 3 ng / ml appears to be the most reliable marker of resolution . in subjects with moderate obesity ( 36 + / 2 kg ) and uncontrolled type ii diabetes , an extension of the stampede trial has shown restoration of pancreatic -cell function , in contrast to intensive medical therapy or sleeve gastrectomy . however , in asia , where expertise regarding metabolic procedures and their long term management is limited , widespread promotion of a malabsorptive procedure without equipping the masses with the necessary knowledge may prove detrimental for this field and for patients . a procedure with risk and benefit between sleeve gastrectomy has been shown to have greater excess weight loss , and improvement in diabetes , than gastric band . indeed , sleeve is a successful revision procedure following failure of gastric band , with concomitant band removal at sleeve gastrectomy , and 53% excess weight loss at one year . food tolerance and gastrointestinal quality of life after sleeve gastrectomy are comparable to pre - surgery controls . the food tolerance questionnaire and the gastrointestinal quality of life index ( giqli ) at 2 and 4 years found sleeve gastrectomy superior to adjustable gastric band , and roux - en - y gastric bypass . at 6 years from sleeve gastrectomy , sleeve gastrectomy can be employed for obese patients with metabolic syndrome who are at high risk of developing complications after malabsorptive procedures , including chronic smokers and non - steroidal anti - inflammatory drug users . it is a valuable option for patients who are elderly and those with inflammatory bowel disease . the simple thought of taking less medications or being free from taking them is a joy . a retrospective study of sleeve gastrectomy in morbidly obese individuals reported a mean excessive bmi loss of 79.9% after 2 years . after surgery , 83.3% of patients with type ii diabetes discontinued their hypoglycaemic medication after 1 month . antihypertensive drugs were discontinued by 6 months , and medications for hypertriglyceridemia after 3 months . a significant reduction in glucose , triglyceride levels , triglyceride / hdl ratio and increased hdl levels were noted and these changes were maintained under normal ranges for at least 2 years . alternative procedures including gastric band , laparoscopic roux - en - y gastric bypass and gastric balloon insertion may be performed . the relative technical simplicity of sleeve gastrectomy , low morbidity , endoscopic access to the gastrointestinal tract , absence of anastomoses , minimal nutritional deficiencies , excellent weight loss with control of associated comorbidities , and the possibility to convert to other procedures , place sleeve gastrectomy at an advantage over other bariatric procedures . gastric bypass has a long history and long - term results support its efficacy in treating obese patients with metabolic disorders . it is an established fact that there are mechanisms beyond weight loss that are responsible for the excellent metabolic outcomes of gastric bypass and that these are related to bypassing the foregut . to maximize the scope of sleeve gastrectomy as a metabolic procedure , innovative procedures with the benefits of both sleeve gastrectomy and gastric bypass are being employed . the sleeve duodenojejunal bypass surgery ( lsg / djb ) , single - anastomosis duodenojejunal bypass with sleeve gastrectomy ( sadjb - sg ) , sleeve gastrectomy with loop bipartition , and loop duodenojejunal bypass with sleeve gastrectomy , are all largely based on manipulation of foregut . the short term outcomes have been promising ; however , they are still considered experimental as both intermediate and long term data are awaited . loop duodenal bypass in combination with sleeve gastrectomy for type ii diabetes in individuals with bmi 2138 kg / m has shown promising early results , with 91% achieving hba1c of 7.0 g / dl at 6 months from surgery . laparoscopic roux - en - y gastric bypass prohibits visualisation of the excluded stomach . for populations with a high risk of gastric cancer , including japan , endoscopic visualisation is paramount . in obese individuals with risk factors such as helicobacter pylori infection , atrophic gastric mucosa including intestinal metaplasia , or a family history of gastric cancer , kasama et al . the procedure was found to be feasible , and safe , with similar ewl to roux - en - y gastric bypass . additional ewl versus sleeve gastrectomy was attributed to the added malabsorptive effects of the duodenojejunal bypass . patients undergoing this procedure have demonstrated restoration of insulin sensitivity , with increased insulin output , and doubling of -cell glucose sensitivity . the mechanism is postulated to be intestinal over - stimulation , with increased glp 1 and incretin secretion . excess weight loss , resolution of diabetes , hypertension , sleep apnoea and cardiac remodelling with reduction in cardiac risk profile , provide compelling arguments for expansion of metabolic surgery . the biomedical research potential from distinct anatomical changes in the gut , occurring in a controlled manner during surgery , the collaboration between surgical and laboratory teams sheds new light on pathogenesis of metabolic syndrome and diabetes , through the effectiveness of gastrointestinal surgery , and heralds in a new era spurred by the necessity to curb the epidemic . | abstractthe rapid reversal of diabetes , hypertension , hyperlipidaemia and obesity by surgical means has challenged accepted doctrines regarding the management of metabolic syndrome . sleeve gastrectomy , which developed initially as a preparatory procedure for biliopancreatic diversion with duodenal switch , has seen an exponential rise in popularity as an effective lone laparoscopic bariatric procedure .
superior excess weight loss , a low complication rate , and excellent food tolerance , combined with a short hospital stay , have made this the procedure of choice for patients and surgeons across the globe .
high volume centres nurture the ongoing development of experienced and specialized teams , pathways and regimens .
optimum surgical outcomes allow minimization of metabolic syndrome , reducing cardiovascular and cerebrovascular risk . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mouse embryos form five pairs of mammary rudiments ( mrs ) . their formation is preceded by the formation of three wnt10b - expressing mammary streaks in the axilla , inguen , and in between forelimb and hindlimb these streaks fuse into one continuous mammary line ( ml ) on each flank by e11.5 , on which mrs develop in asynchronous fashion and not in numerical sequence , with mr1 in the axilla ; mr2 , mr3 and mr4 on the flank ; and mr5 in the inguen . the hedgehog ( hh ) pathway was among the first signaling cascades tested for a role in murine mammogenesis , but is not required for it [ 2 , 3 ] . nonetheless , extratoes ( xt ) mice , which harbor a spontaneous , functional null - mutation for the transcription factor gli3 , exhibit multiple defects in prenatal mammary development [ 47 ] . given the role of gli3 in hh signaling , we provide a brief overview of hh signaling and gli transcription factors , followed by their functions in mammogenesis in mouse embryos . mammals possess three orthologues of the drosophila segment polarity gene hedgehog ; sonic hedgehog ( shh ) , indian hedgehog ( ihh ) , and desert hedgehog ( dhh ) [ 8 , 9 ] . while embryonic expression and function of dhh is restricted to spermatogenesis and schwann cells , shh and ihh are widely expressed and encode secreted morphogens with well - known roles for shh in neural tube , limb and somite development and for ihh in chondrogenesis [ 10 , 11 ] . in canonical hh signaling , hh molecules bind their twelve - transmembrane receptor patched1 ( ptch1 ) or ptch2 . ptch then derepresses the seven - transmembrane protein smoothened ( smo ) , which becomes activated . through intracellular signaling complexes -whose components have not been studied in embryonic mammary development and are thus not described here- smo activation converges on the gli family of krppel - type zinc - finger transcription factors , comprising gli1 , gli2 and gli3 . gli1 is expressed when hh signaling is active , and encodes the transcriptional activator gli1 . gli2 and gli3 can be expressed in the absence of hh signaling , in which case their protein products are cleaved to render transcriptional repressors ( gli2 , gli3 ) . gli2 requires less active hh signaling than gli3 to remain uncleaved and function as a transcriptional activator ( gli2 , gli3 ) . among gli transcriptional targets are gli1 and ptch1 , which provide regulatory feedback loops for hh signaling [ 12 , 13 ] . they need further exploration , but certainly point to three additional , non - canonical signaling scenarios : 1 ) signaling involving hh pathway components independently of gli - mediated transcription , such as shh - mediated erk activation in mammary epithelial cells without smo - activation ; 2 ) direct interaction of hh signalling components with other molecular pathways ; potentially relevant for mammogenesis is the role of wnt signaling in expression and function of gli proteins , and 3 ) non - contiguous or atypical interaction of core hh pathway components with each other . studies of the role of hh signaling components in mammogenesis began in the late 1960 s , when d.r . johnson identified and characterized a mouse strain which he named extra - toes ( xt ) , after the prominent polydactyly in all four paws of heterozygotes . in e13 embryos homozygous for this spontaneous , semi - dominant mutation , he also found a reduced number of mrs between the forelimb and hindlimb . because his wild type control had a supernumerary mr near mr3 the number of nipples visible in xt / xt mice at this stage is reduced from four to two pairs , the most anterior and posterior ones persisting . note that johnson was mistaken in three aspects : 1 ) what he referred to as nipples were in fact mammary buds , which precede nipple formation ; 2 ) had he taken a proper control , he would have concluded that only one mr ( mr3 ) was missing on the flank ; 3 ) had he known that wild - types also form mrs behind the forelimb ( mr1 ) and hindlimb ( mr5 ) , he would have noticed an absence of mr5 in xt / xt embryos [ 57 , 18 ] . arose a spontaneous mouse mutant , named xt because it phenocopies johnson s xt mutant . xt mice carry a 51.5 kb deletion downstream of nucleotide 1670 of gli3 , including the dna - binding zinc fingers and thus abolishing both gli3 and gli3 functions [ 1921 ] , without loss of other known functional sequences . these renamed gli3 mice represent a good model for the human greig cephalopolysyndactyly syndrome ( gcps ) , which can be a sporadic or inherited trait , caused by heterozygous loss - of - function mutations of the gli3 gene . the syndrome is characterized by polysyndactyly of hands and feet , hypertelorism , and skull abnormalities including craniosynostosis at variable penetrance [ 19 , 22][omim 165240 , 175700 ] , the latter seen in mice only when homozygous mutant . while no mammary phenotypes have been reported for gcps patients and gli3 mouse mutants , gli3 embryos fail to induce mr3 and mr5 [ 57 , 18 ] . moreover , . 1 t with 1l ) , resembling mrs of wild - type male embryos , and also exhibits impaired branching morphogenesis ; while mr1 is hardly affected . the xt mutation thus exemplifies that all mammary glands are different and can develop inter - independently . the question then arises via which molecular mechanisms and tissue - interactions gli3 regulates formation and development of mr2-5.fig . 1expression patterns of gli1 , gli2 and gli3 , and models of tissue- and molecular interactions involving gli3 in mammary development . a q cross - sections of wild - type embryos and ( r w ) gli3 embryos at e11.5-e13.5 hybridized with s - labeled rna - probes for gli1 , gli2 and gli3 . insets in t and u present wild - type mr2 from l respectively m at the same magnification . x cartoon of a lateral view of a mouse embryo . between e10.5 and e11.5 gli3 is expressed in the limb buds and all somites ( outlined in gray and numbered ) . gray shades represent overlapping in expression with fgf10 , the intensity positively correlating with level of fgf10 expression . note the proximity of the overlapping somitic expression to mr3 and mr2 , and overlapping limb mesenchymal expression to mr1 , mr2 , mr4 and mr5 . mr1 and mr5 are hidden behind the limbs . z model for gli3-mediated repression of gli1 in the me ( bud shape ) and contiguous mm ( darker shade of gray surrounding mammary bud ) , based on expression data in panels a w and in [ 5 , 6 ] . in the absence of gli3 , gli1 is misexpressed in the mm of mr1 , mr2 and mr4 , indicating gli3 normally represses gli1 expression . whether this occurs tissue - autonomously ( intact block arrow ) or via tissue interactions ( broken block - arrow ) remains unclear . abbreviations : li : liver , r : rib primordium , st : stomach , wt : wild - type expression patterns of gli1 , gli2 and gli3 , and models of tissue- and molecular interactions involving gli3 in mammary development . a q cross - sections of wild - type embryos and ( r w ) gli3 embryos at e11.5-e13.5 hybridized with s - labeled rna - probes for gli1 , gli2 and gli3 . insets in t and u present wild - type mr2 from l respectively m at the same magnification . x cartoon of a lateral view of a mouse embryo . between e10.5 and e11.5 gli3 is expressed in the limb buds and all somites ( outlined in gray and numbered ) . gray shades represent overlapping in expression with fgf10 , the intensity positively correlating with level of fgf10 expression . note the proximity of the overlapping somitic expression to mr3 and mr2 , and overlapping limb mesenchymal expression to mr1 , mr2 , mr4 and mr5 . mr1 and mr5 are hidden behind the limbs . z model for gli3-mediated repression of gli1 in the me ( bud shape ) and contiguous mm ( darker shade of gray surrounding mammary bud ) , based on expression data in panels a w and in [ 5 , 6 ] . in the absence of gli3 , gli1 is misexpressed in the mm of mr1 , mr2 and mr4 , indicating gli3 normally represses gli1 expression . whether this occurs tissue - autonomously ( intact block arrow ) or via abbreviations : li : liver , r : rib primordium , st : stomach , wt : wild - type prior to and at the time of ml and mr formation , gli3 is not expressed in the surface ectoderm , from which the mrs derive , but is expressed in the limb mesenchyme , and in the somites in the region between fore- and hindlimbs ( fig . 1c ) . given the earlier implications of somitic involvement in the establishment of the mammary streak along the flank and in mr induction [ 1 , 7 ] , the somitic gli3 expression was of interest . indeed , the ventral elongation of the somites including expression of gli3 in all thoracic and lumbar somites , and fibroblast growth factor ( fgf)10 in thoracic somites # 12 to # 18 , determines the position of the ml on the dorso - ventral body axis . the absence of mr3 in gli3 embryos is due to reduction of somitic fgf10 expression , in particular the relatively high fgf10 expression in somite # 15 underlying mr3 . as mr2 is located above somite # 12 , reduced somitic fgf10 expression may be involved in impaired development of mr2 as well . it is most likely that somitic gli3 indirectly activates somitic fgf10 independent of shh signaling ( and references therein ) . somitic fgf10 may reach and activate the ectodermal fgfr2b via diffusion and/or transportation by dermal precursor cells that delaminate from the somites . this cascade leads to ectodermal cell elongation , wnt10b marker expression , and canonical wnt signaling as required for ml and mr formation , but only at the level of mr3 , and possibly mr2 . these insights finally gave some molecular explanation for the capacity of the dermal mesenchyme to induce mr formation as recognized four decades earlier [ 2527 ] . however , at the level of mr4 and mr5 , fgf10 is not expressed in the somites . given that null mutants for either gli3 or fgf10 fail to induce mr5 and both genes are expressed in the adjacent limb mesenchyme ( fig . 1x ) , it is tempting to speculate that an epistatic interaction between these molecules may also exist in the limb mesenchyme and be required for induction of mr5 . the compromised induction of mr2 and mr4 in the absence of gli3 can perhaps be attributed to gli3-independent residual expression of fgf10 and other genes in the thoracic somites and limb mesenchyme . the cellular functions of gli3 during early mammary growth and morphogenesis are fourfold , and the same in all mrs : downregulation of 1 ) cell proliferation and 2 ) cell apoptosis in epithelial cells of the ml and mrs ; 3 ) mediation of ectodermal cell recruitment into mrs , which contributes to mr growth until at least e14.5 ; 4 ) hypertrophy of the basal / peripheral cells of the me , which provides a large proportion of the growth between e12.5 and e13.5 . while similar regulatory functions for gli3 have been identified in other cell types ( references in ) , it remains to be investigated how gli3 mediates so many distinct effects in the same cell population ; and whether these epithelial effects rely on gli3 expression prior to mammary induction , on cell - autonomous gli3 function in the me , or via tissue - interactions with and gli3 expression in the mm ( fig . at e11.5 , the somites also express gli2 , but not gli1 ( fig . expression of gli genes in the surface ectoderm or mammary tissues is arguable at e12.5 , except for notable gli3 expression in mr5 ( fig . 1d k ) as confirmed by rna - profiling . by e13.5 , gli3 and gli2 are convincingly expressed in overlap in the ectoderm , mammary epithelium ( me ) and mammary mesenchyme ( mm ) ( fig . 1m , n , p , q ) , the latter confirmed for gli3 by rna - profiling and immunohistochemistry . thus , the initial growth defects of gli3 mr2 and mr4 at e11.5 could subsequently be compounded by the lack of gli3 in any of the tissue compartments . although gli2 and gli3 overlap in expression , homozygous gli2-null mutants have no mammary induction defect [ 6 , 28 ] . neither have gli1-null , gli2 or gli2 mutants which express gli1 from the endogenous gli2 promoter however , removing one gli3 allele in gli2 embryos abolishes induction of mr3 and mr5 as in gli3 embryos . moreover , gli1 is misexpressed in the mm of mr2 in e13.5 gli3 embryos ( fig . 1 t ) . the high gli1 expression in mr1 and mr4 at e13.5 ( fig . 1r , v ) may also reflect misexpression in the mm , similar to such misexpression reported at e14.5 . together , these data indicate that gli3 acts as gli3 during mr formation ( fig . 1y , z ) , and is the only gli family member with functional relevance for embryonic mammary development , by repressing gli1 transcription , and antagonizing gli2 function . moreover , these data indicate that canonical hh signaling needs to be in an off - state to allow mammogenesis , at least at the positions of mr3 and mr5 . the above - described repressor function of gli3 and absence of shh , ihh , gli1 and ptc1 expression in the surface ectoderm or dermal mesenchyme at the time of ml and mr induction ( our unpublished data and fig . 1a ) , explain why shh and ihh mutant mice have no mammary induction defect [ 2 , 3 ] . all together , these data indicate hh signaling is not required for induction of any of the five mrs . while normally , shh , ihh and ptc1 are expressed in the me from e12.5 onward and in postnatal stages , the normal outgrowth of transplanted e12.5 shh and ihh me in cleared wild - type mammary fat pads or under the kidney capsule , indicates that epithelial hh signaling or mesenchymal shh is not either required during later embryonic and postnatal stages . interestingly , activating components of the hh signaling cascade become expressed in the surface ectoderm and me only after the formation of mr , but prior to hair follicle formation . we therefore propose that the off - state of hh signaling is a discriminatory factor for the choice of a skin appendage between mammary and either hair or non - mammary fate , and that therefore mrs must develop prior to hair follicle formation , i.e. prior to activation of hh signaling in the trunk ectoderm [ 29 , 30 ] . such a decisive role for hh signaling appendage fate requires further investigation , but seems to be confirmed by the glandular appearance of hair follicles when hh signaling in the skin is ablated in k14cre;smo embryos . gli3 function is critical for embryonic development of mr2 - 5 ; in particular gli - mediated repression of canonical hh signaling is critical for induction of mr3 and mr5 . its variable requirement for the five mrs in mouse gives perhaps some insight in mechanisms underlying the variation in number of mammary glands among mammalian species . for example , mr3 requires somitic gli3 as the earliest known effector in a cascade involving fgf10/fgfr2b and subsequent wnt signaling ( fig . 1y ) , but other tissue - interactions and perhaps molecular mechanisms act downstream of gli3 in early development of other mrs , and remain to be elucidated . examples of additional interesting avenues for investigation pertain to possible interactions with other important mesenchymal factors in mr3 formation ( e.g. nrg3 , tbx3 , or raldh2 that mediates retinoic acid signaling ) [ 3234 ] ( fig . 1y ) ; whether the sustained protrusion of mr2 in gli3 embryos bears any mechanistic similarity to the protrusion of mrs in wild - type males ; and whether gli3 is involved in non - canonical hh signaling in mammogenesis . given the many molecular similarities between embryonic mammary development and mammary / breast tumors [ 35 , 36 ] , it is of interest whether gli3 plays a role in breast cancer . it is noteworthy that gli(1 ) was discovered as an oncogene , and like gli2 and shh , is upregulated in various cancers . hh signaling is considered a therapeutic target for breast cancer , as gli(1 ) upregulation predicts a poor prognosis for estrogen receptor negative or triple negative breast cancers [ 3739 ] . yet , gli3 is seldom reported in association with cancer . in absolute number and relative gli1 , only few somatic mutations in gli3 have been found in breast cancer samples [ cosmic database , sanger institute ] . it would be of interest to determine whether these gli3 mutations relate to gli1 upregulation , and whether they have any diagnostic or prognostic value . | the first mouse mutation associated with a heritable defect in embryonic mammary gland development was extratoes .
it represents a functional null - mutation of the gene encoding gli3 , which is best known as a transcription factor mediating canonical hedgehog ( hh ) signaling . here
we review the roles of hh and gli proteins in murine embryonic mammary development .
we propose that an off - state for hh signaling , mediated by gli3-repressor , is determinant for induction of a mammary instead of hair follicle fate in the trunk surface ectoderm . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the woolly apple aphid , eriosoma lanigerum , is a pest in many apple - growing countries . in new zealand , it is considered a serious pest , causing reduced tree growth and contamination of fruit . insects infest both shoots and roots of trees , while 1st instar nymphs can enter through the calyx and establish colonies inside the fruit ( essig , 1942 ) . aphid colonies start to appear in spring on the branches of apple trees and spread through the entire summer , inducing galls in the tissue on which they feed . e. lanigerum is a north american insect where their primary host is the american elm tree ( ulmus americana l ) . over - wintering eggs are laid on elm by apterous oviparous females that are produced by alate sexuparae in the fall that consist of reproducing males and oviparous females ( fig . fundatrices , which are a specialized apterous viviparous morph that can develop only on the primary host , hatch from the eggs , settle on the base of the bud , and produce the spring migrant alate aphids parthenogenetically . spring migrants settle on apple trees , which are the secondary hosts , and spend the whole summer producing apterous virginoparae females ( wingless females that reproduce parthenogenitically ) . in the fall the alate sexuparae develop from the colony and settle on the elm to produce apterous males and females ( baker , 1915 ) . there are no records of sexual reproduction or natural dispersal by winged forms of e. lanigerum in countries where the elm is not present ( schoene et al . , 1935 ; however , in some countries where elm does not occur , winged forms produce males and females that lay eggs on apple ( theobald , 1921 ; gautam et al . , 1983 ) . in the eastern united states , woolly apple aphid alates were important in spreading the species over long distances . in some other areas in the world , their importance is limited since any sexual forms deposited by alates rarely mated ( hoyt et al . , 1960 ) . dumbleton ( 1934 ) found no evidence of e. lanigerum migration to elm in new zealand , therefore continuous existence of the aphid on apple depended solely on the wingless females . it is believed to be anholocyclic ( developing without eggs ) on apple spending the winter either aerially or on roots . crawlers ( 1st instar virginoparae ) are regarded as migrants , and close tree spacing or wind favours their dispersal . laboratory studies in new zealand and australia revealed that the main progeny of alate e. lanigerum were apterous sexual morphs with degenerate mouthparts ( asante et al . different records of varying progenies have been reported by many researchers in several countries ( table 1 ) . in this paper observations are described of sexuparae and sexual morphs of e. lanigerum in the laboratory as well as on apple trees grown outside the laboratory in auckland , new zealand . this research was carried out in late summer - autumn ( february - april ) in two consecutive years ( 2003 and 2004 ) in mount albert , auckland . ten potted apple trees ( variety royal gala ) infested with e. lanigerum and grown outside were used to collect the aphids . e. lanigerum colonies on another 10 apple trees of the same variety were maintained in a glasshouse at 25 3 c. all laboratory tests were carried out in controlled environmental conditions at 24 1 c , 65 10% relative humidity , and 16:8 hours light : dark cycle . one hundred alate aphids collected from colonies on apple trees outside using a fine brush , were placed individually in covered petri dishes ( 1.2 cm high and 5.5 cm diameter ) . every 24 hours , offspring were checked and the total number of males and oviparous females reproduced recorded . morphological differences between male , oviparous female , and 1st instar virginoparae were studied under the microscope ( 10 x ) . body measurements on each of 30 body length was measured from the front of the head to the base of the cauda , and the body width was measured across the abdomen . development of the males and oviparous females was studied in the laboratory using clean apple leaves . mature leaves collected from uninfected apple trees were washed with water to remove possible predators . the leaf was placed with the abaxial surface upwards in a petri dish ( 1.2 cm high and 8.5 cm diameter ) that was glued to a rectangular perspex board ( 10 x 20 cm ) . a small hole ( 0.5 cm diameter ) was drilled in the side of the petri dish through which the stem of the leaf protruded into a plastic vial ( 5 cm long , 1.2 cm diameter ) filled with water , which was also glued to the same board of perspex . five males and five oviparous females were placed on the abaxial side of the leaf in the petri dish . each aphid was observed daily until dead and exuviae ( indicating ecdysis ) around each sexupara were counted . when eggs were present next to dead oviparous females , the bodies were removed and eggs were left on the leaves for further observations . apple trees both outside and in the glasshouse were also checked for presence of sexual morphs and eggs . when the e. lanigerum colonies on the trees became overpopulated and more alates were visible , 10 leaves were randomly picked from each tree and checked under the microscope for oviparous females , males and eggs . the number of sexual morphs and eggs found were compared between the trees grown under different environmental conditions . the eggs were separated carefully from the leaves and kept individually on a layer of moist tissues in small plastic petri dishes ( 3.5 x 1 cm ) . they were kept under three different environmental conditions for further observations to simulate seasonal variation : a ) 24 1 c and l : d 16:8 ( summer ) ; b ) 18 1 c and l : d 12:12 ( spring ) ; c ) 12 1 c and l : d 10:14 ( winter ) . one hundred alate aphids collected from colonies on apple trees outside using a fine brush , were placed individually in covered petri dishes ( 1.2 cm high and 5.5 cm diameter ) . every 24 hours , offspring were checked and the total number of males and oviparous females reproduced recorded . morphological differences between male , oviparous female , and 1st instar virginoparae were studied under the microscope ( 10 x ) . body measurements on each of 30 newly emerged oviparous females , males , and 1st instar virginoparae were made . body length was measured from the front of the head to the base of the cauda , and the body width was measured across the abdomen . development of the males and oviparous females was studied in the laboratory using clean apple leaves . mature leaves collected from uninfected apple trees were washed with water to remove possible predators . the leaf was placed with the abaxial surface upwards in a petri dish ( 1.2 cm high and 8.5 cm diameter ) that was glued to a rectangular perspex board ( 10 x 20 cm ) . a small hole ( 0.5 cm diameter ) was drilled in the side of the petri dish through which the stem of the leaf protruded into a plastic vial ( 5 cm long , 1.2 cm diameter ) filled with water , which was also glued to the same board of perspex . five males and five oviparous females were placed on the abaxial side of the leaf in the petri dish . each aphid was observed daily until dead and exuviae ( indicating ecdysis ) around each sexupara were counted . when eggs were present next to dead oviparous females , the bodies were removed and eggs were left on the leaves for further observations . apple trees both outside and in the glasshouse were also checked for presence of sexual morphs and eggs . when the e. lanigerum colonies on the trees became overpopulated and more alates were visible , 10 leaves were randomly picked from each tree and checked under the microscope for oviparous females , males and eggs . the number of sexual morphs and eggs found were compared between the trees grown under different environmental conditions . the eggs were separated carefully from the leaves and kept individually on a layer of moist tissues in small plastic petri dishes ( 3.5 x 1 cm ) . they were kept under three different environmental conditions for further observations to simulate seasonal variation : a ) 24 1 c and l : d 16:8 ( summer ) ; b ) 18 1 c and l : d 12:12 ( spring ) ; c ) 12 1 c and l : d 10:14 ( winter ) . seven out of 100 alates produced 1 or 2 viviparous nymphs as well as males and females , which agrees with the findings of asante and danthanarayana ( 1990 ) who reported that some alate individuals in new zealand could give birth to a mixture of sexual morphs and nymphs with fully developed mouthparts . asante ( asante , 1994 ) further described that alates produced a mixure of virginoparae and sexual morphs only in summer ( table 1 ) . dumbleton and jeffreys ( 1938 ) tested autumn alates in glass tubes and found that their progeny were exclusively sexual morphs , but they also reported that summer alates reproduce both virginoparae and sexual progenies . in new zealand , reproduction of e. lanigerum in the field was believed to be totally parthenogenetic by apterous viviparous females . in this study , virginoparae , sexuparae ( alates reproducing males and oviparous females ) and sexual morphs ( males and oviparous females ) were observed on apple , both in laboratory and natural populations in the absence of elm trees . varied observations have been reported of the reproduction of alate e. lanigerum from different parts of the world ( table 1 ) . our findings of sexual reproduction on apple differ with those by schoene and underhill ( 1935 ) ; pringle and heunis ( 2001 ) ; and lal and singh ( 1947 ) , who stated that sexual reproduction by the winged forms of e. lanigerum could not take place if elm was absent as occurs in many parts of the world . for example , in south africa , although winged forms are produced , they remain on apple trees and reproduce parthenogenetically ( pringle et al . , 2001 ) . in turkestan , where elm does not occur , the winged forms produce males and females that lay eggs , which hatch into parthenogenetic females . furthermore it was recorded that e. lanigerum reproduced for 10 years on apple without sexual revival from elm ( theobald , 1921 ) . no eggs were observed by schoene and underhill ( 1935 ) in aerial colonies on apple during their study of 14 seasons in the united states , but they assumed that sexual forms might be born on apple and on rare occasions an over - wintering egg might occur . they also reported that natural spread of e. lanigerum by flight would not take place if elm trees were absent . although the dispersal behavior of alates was not covered in this study , from our observations we assume they move out from the colonies and settle on the same or a different apple tree . as far as we know , the elm , u. americana , is not present in auckland , however it is possible that the lifecycle could adapt to the secondary host . as some alates are produced young virginoparae in addition to sexual morphs , both asexual and sexual reproduction may happen on apple . eggs were kept in three different laboratory conditions to investigate the relationship between temperature and development of the eggs . dumbleton and jeffrerys ( 1938 ) and asante ( 1994 ) also found that eggs did not hatch in the laboratory , but they did not test the viability of eggs in the field . although we were unable to prove the eggs hatch on apple , we suggest the eggs that females lay on apple could develop into young virginoparae , with well - formed mouthparts for feeding . the fecundity and longevity of alate sexuparae are much lower than those of apterous virginoparae ( gautam et al . , 1983 ; sandanayaka et al , 2003 ) . the smaller number of offspring produced by alates appears to have no significant effect on increasing the population and infestation . however , alates may enable dispersal over greater distances and provide increased genetic diversity through sexual reproduction . an alate reproduced an average total of 7.46 0.15 ( range 410 ) sexual morphs , including 3.52 0.13 ( 16 ) females and 3.94 0.11 ( 27 ) males , during their lifetime of 2.06 0.05 ( 13 ) days in the petri dish . most of the alates started reproduction on the first day and reproduced the highest number of nymphs on the second day . there was no difference between female and male numbers reproduced ( p<0.05 ) ( fig . 2 ) . asante and danthanarayana ( 1990 ) found that an alate produced on average 6.88 0.34 ( 211 ) mainly sexual morphs , in a ratio of 1 : 1.69 males to females , during their lifetime of 36 days . gautam and verma ( 1983 ) observed that an alate lived for 47 days and produced an average number of 5.3 ( 48 ) of sexual morphs . dumbleton and jeffreys ( 1938 ) found that the maximum number of sexual morphs produced by an alate was 7 . schoene and underhill ( 1935 ) observed twice as many females as males produced by alates . table 1 shows the previous records of e. lanigerum sexual reproduction in many parts of the world . our findings disagree with those of lal & singh ( 1947 ) , mols ( 1996 ) , and pringle and heunis ( 2001 ) , who reported that alate e. lanigerum produced only virginoparae . the oviparous female is bigger ( 0.85 0.01 mm in length and 0.45 0.01 mm in width ) than the male ( 0.55 0.01 mm in length and 0.27 mm in width ) . the male is similar to the size of first instar virginoparae ( 0.64 0.01 mm in length and 0.25 0.01 mm in width ) ( fig . 3 , table 2 ) . asante and danthanarayana ( 1990 ) reported that the length and the width of an average oviparous female were 0.93 0.01 mm and 0.50 0.01 mm respectively . they also found that males were smaller ( 0.70 0.01 mm in length and 0.30 0.01 mm in width ) than oviparous females . oviparous females live for 8.95 0.17 days ( n = 20 ) and males live for 7.1 0.12 days ( n = 20 ) . our observations show that both males and oviparous females undergo four molts , completing five instars without feeding with no change in body size . they have degenerated mouthparts , which are not suitable for feeding and become sexually mature after the last molt . oviparous females usually stay in one place until oviposition whereas males become mobile after the third or fourth instar . oviposition occurs only after successful mating , after which the oviparous female lays a single egg , which almost equals the size of her abdomen ( fig . these findings agree with those of gautam and verma ( 1982 ) and asante ( 1994 ) . 4 ) and 0.64 0.01 mm in length and 0.29 0.01 mm in width ( n = 20 ) and becomes darker with age . these measurements are similar to those reported by others : baker ( 1915 ) 0.64 mm x 0.288 mm ; monzen ( 1925 ) 0.55 mm x 0.35 mm ; asante ( 1994 ) 0.58 0.01 mm x 0.33 0.01 mm wide . eggs are mostly laid on the abaxial surface of apple leaves and occasionally are found covered with wool secreted by the oviparous female . more sexual morphs and eggs were found on leaves collected from apple trees grown in the glasshouse ( 7.6 0.93 sexual morphs and 3.5 0.60 eggs per tree ) than from the trees grown outside ( 1.0 0.39 sexual morphs and 1.3 0.34 eggs per tree ) . alates on the trees outside the glasshouse obviously have more opportunity to disperse and find another apple tree than those on the trees in the glasshouse . since some alates produced young virginoparae before producing sexual morphs , both asexual and sexual reproduction may happen on the new host . although sexual morphs may not be able to feed on the new host , oviparous females lay eggs , which develop into young viginoparae . it may be that alates from aphid colonies can spread long distances between apple trees , however , nothing has been published on the migratory behavior of alates . from our findings we suggest that they could have a considerable impact on spreading infestation among apple trees . further research is required on the dispersal behavior of alate aphids and any other alternative host plants under different environmental conditions in new zealand . life cycle of the woolly apple aphid mean reproduction of alate woolly apple aphids in a petri dish during day 13 of their lifetime . first instar apterous virginoparae ( left ) , oviparous female carrying a single egg ( middle ) and male ( right ) . woolly apple aphid oviparous female ; laying an egg on the abaxial surface of an apple leaf . different characteristics of oviparous female , male , and the first instar virginoparae of eriosoma lanigerum . | reproduction of the woolly apple aphid , eriosoma lanigerum ( hausmann ) , can take place parthenogenetically or sexually when both host plants , apple ( malus domestica borkh . ) and elm ( ulmus americana l. ) are available .
since elm is not commonly grown in new zealand , e. lanigerum , a major pest of apple , is thought to reproduce only parthenogenetically here . during our studies between 1999 and 2003 ,
different morphs of e. lanigerum have been observed on apple trees , which were studied in more detail in 2003 and 2004 . in the laboratory , alates reproduced mainly sexual morphs with degenerated mouthparts .
oviparous females lived for 8.95 0.17 days ( n = 20 ) and males lived for 7.1 0.12 days ( n = 20 ) .
both went through 4 moults , without feeding or changing body size .
oviparous female laid a single egg and died soon after oviposition .
in addition to sexual morphs , shiny brown , oblong eggs were seen on apple leaves grown outside as well as in the glasshouse . as the numbers of eggs and sexual morphs on trees grown outside were less than on those grown in the glasshouse
, we suggest that alates disperse into the natural environment searching for an apple or elm tree to continue the sexual reproduction while spreading the population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
neuropsychiatric effects of cannabinoids , including endocannabinoids and cannabis ingredients , have been primarily studied in relation to cb1 cannabinoid receptors ( cb1rs ) because cb1r has been considered the major , if not the only , cannabinoid receptor in the nervous system . although early studies showed that cb2 cannabinoid receptors ( cb2rs ) are expressed only in the immune system but not in the brain [ 13 ] , recent evidence has indicated that cb2rs are also present in the brain ( for review , see ) . in situ hybridization studies show that cb2r mrnas are expressed in neurons in the cerebellum , globus pallidus , cerebral cortex , hippocampus [ 6 , 7 ] , ventral tegmental area , nucleus accumbens , and dorsal striatum in rodents and macaque . these data have been supported by negative control experiments with cb2r knockout ( ko ) mice or sense probes [ 5 , 7 , 8 ] . the detection of cb2r proteins using anti - cb2r antibodies has been controversial [ 1013 ] perhaps because of the low expression levels of cb2rs and/or poor specificity of the currently available antibodies . the expression of cb2rs in microglia can be induced under pathological conditions for neuroprotective immune responses ( for review , see ) . cb1rs are unequivocally involved in many neurocognitive effects induced by cannabinoids ( for review , see ) , but it is unclear whether cb2rs also participate in neurological effects . -tetrahydrocannabinol ( thc ) , the primary psychoactive component of marijuana , binds to cb1r and cb2r with the same affinity . anandamide and 2-arachidonoylglycerol , two main endocannabinoids , can also activate both cb1r and cb2r with a 3- to 4-fold higher affinity for cb1r than for cb2r although anandamide and -thc are low - efficacy agonists of cb2rs [ 1618 ] . therefore , it is conceivable that both receptors in the brain might be activated when levels of endocannabinoids are elevated or after long - term intake of marijuana . activation of cb2rs reduces pain ( for review , see ) , impulsive behaviors , and locomotor activity [ 2123 ] of rodents and also vomiting of ferrets . chronic activation or blockade of cb2rs in rodents increases or decreases , respectively , anxiety . activation of cb2rs decreases the excitability of peripheral sensory neurons , cortical pyramidal neurons , and dopaminergic neurons in the ventral tegmental area . cb2rs modulate excitatory synapses in the hippocampus [ 27 , 28 ] as well as inhibitory synaptic transmission [ 25 , 29 , 30 ] . in humans , the polymorphism of cnr2 , which encodes cb2r , is related to schizophrenia [ 31 , 32 ] , depression , and bipolar disorder . the deletion of cb2rs in mice also induces schizophrenia - like symptoms , such as impairment in sensory - motor gating and an increase in depressive behavior . in addition , cb2r ko mice display a deficit in long - term memory assessed in a step - down passive avoidance test [ 27 , 34 ] , which probes the functions of the hippocampus , entorhinal cortex , parietal cortex , and/or amygdala ( for review , see ) . however , it has not been determined whether cb2r ko mice also display other phenotypes resembling schizophrenia - related behaviors . patients with schizophrenia have working memory deficits ( for review , see ) and impaired functions of the hippocampus ( for reviews , see [ 37 , 38 ] ) and amygdala ( for reviews , see [ 39 , 40 ] ) . these features are often recapitulated in animal models of schizophrenia ( for reviews , see [ 41 , 42 ] ) . because cb2r is implicated in schizophrenia in humans and schizophrenia - associated behaviors in mice , we hypothesized that cb2r ko mice might have deficits in working memory and long - term memory dependent on the hippocampus and/or amygdala . here , we tested spatial working memory and long - term fear memory of cb2r ko mice . our data indicated that contextual fear memory , which is dependent on the hippocampus , was impaired in cb2r ko mice whereas hippocampus - independent , cued fear memory was not affected . in addition , spatial working memory was enhanced in cb2r ko mice . however , acute blockade of cb2rs by am630 did not alter memory , motor activity , or anxiety . these results suggest that the roles of cb2rs in memory are diverse depending on memory types and/or brain areas . cb2r ko mice ( the jackson laboratory , bar harbor , me ; stock number 005786 ) were originally created by deltagen ( san mateo , ca ) on the background of c57bl/6j mice . we crossed homozygous ko mice ( cb2r ) with c57bl/6j mice ( the jackson laboratory ) to obtain heterozygous cb2r mice . these wild type ( wt ) and ko mice of either sex were used for experiments at age 2.54 months . male c57bl/6j mice at age 2.53 months were also used for am630 administration ( figures 5 and 6 ) . animals were group - housed ( 3 - 4 mice per cage ) in a temperature- and light - controlled room ( 23c and the light / dark cycle of 6 am/6 pm ) with free access to food and water . before experiments , the experimenter handled mice daily for 5 days , 5 min a day . on the day of experiment , all experiments were conducted in accordance with the animal use protocol that was approved by the institutional animal care and use committee of georgia regents university . we genotyped mice using redextract - n - amp tissue pcr kit ( sigma - aldrich , st . louis , mo ) and the following primers : ggggatcgatccgtcctgtaagtct , gactagagctttgtaggtaggcggg , and ggagttcaaccccatgaaggagtac . male c57bl/6j mice ( 2.53 months old ) were injected with am630 ( tocris , minneapolis , mn ) , a specific cb2r antagonist , at 3 mg / kg ( i.p . age- and sex - matched control mice were administered with vehicle ( 0.9% nacl solution with 5% dmso and 5% tween 80 ) . an am630 stock solution was made in dmso and diluted immediately before injection in a nacl - tween 80 solution . in the fear conditioning experiments , mice were treated with am630 or vehicle 3 min after the conditioning session . in the experiments of y - maze , open field arena , and elevated zero maze , another group of animals ( i.e. , drug - naive ) were administered with am630 or vehicle 1 h before the behavioral tests . the fear conditioning chamber ( 18 18 28.5 cm ; coulbourn instruments , whitehall , pa ) was made of metal on two sides and transparent plastic on the other sides with an opening at the upper part of the walls . the floor of the chamber consisted of a stainless steel grid , to which an electric shock was applied . the conditioning chamber was housed in a soundproof isolation cubicle ( coulbourn instruments ) and illuminated with 7-lux white light from a lamp attached to a wall of the chamber . auditory tones for fear conditioning were generated by a sound generator ( sony audio control center str - dh130 ) and delivered to a speaker attached to the conditioning chamber . for fear conditioning , a mouse was placed in the chamber for 90 s and then presented with a tone ( 80 db ) for 30 s. during the last 2 s of the tone , an electric shock ( 0.5 ma , 2 s ) was delivered to the grid floor . the behavior of mice was monitored and recorded by a camera mounted on the ceiling of the chamber and analyzed by the freezeframe 4 software ( actimetrics , wilmette , il ) . when mice showed no noticeable movement for 1 s , it was counted as freezing behavior . the 2 min session of a 90 s rest and a 30 s tone was repeated 3 times continuously for a given mouse . immediately after the conditioning the conditioning chamber was wiped with 70% ethanol after testing each animal . for contextual fear memory tests , mice were placed , 24 h after the conditioning , in the same conditioning chamber for 5 min and the freezing behavior was monitored . cued fear memory was tested 1 - 2 h after the contextual memory test with visual and odorous modifications of the conditioning chamber . acetic acid ( 5% ) in a petri dish was placed in the isolation cubicle , but outside the chamber , for a new odor . visual context was altered by lining the walls and floor of the chamber with paper and/or placing an opaque plastic bucket ( 16.5 cm diameter and 12.5 cm height ) in the chamber . for additional visual modifications , a mouse was put in the chamber for 2 min and then presented with a tone ( 80 db ) for 3 min . animals were returned to home cages 1 min after the termination of the tone . during the cued fear memory test , two wt mice escaped from the chamber through the upper opening and thus were removed from the analysis . a continuous spontaneous alternation test was performed in a y - maze ( san diego instruments , san diego , ca ) . the y - maze consisted of three arms at 120 and was made of beige plastic . each arm was 7.5 cm wide and 38 cm long , and its three sides ( except for the side adjoining the other arms ) were surrounded by 12.5-cm high walls . the floor of the y - maze was covered with a sawdust bedding material . between each trial , a mouse was placed in the y - maze and allowed to explore for 3 min under the illumination of 100 lux . mouse behavior was monitored , recorded , and analyzed by a webcam ( c920 , logitech , newark , ca ) and the any - maze software ( stoelting , wood dale , il ) . a mouse was considered to have entered an arm if the whole body ( except for the tail ) entered the arm and to have exited if the whole body ( except for the tail ) exited the arm . if an animal consecutively entered three different arms , it was counted as an alternating triad . because the maximum number of triads is the total number of arm entries minus 2 , the score of alternation was calculated as exploratory motor activity and anxiety were tested in an open field arena ( 40 40 cm with 30-cm high walls ) , which was made of wood coated with black plastic . a mouse was placed in the open field arena and allowed to explore for 5 min under 100-lux illumination . mouse behavior was monitored , analyzed , and recorded by a webcam ( logitech c920 ) and the any - maze software ( stoelting ) . the area of 20 20 cm in the middle of the arena was set as a center area in the analysis software . the tendency of a mouse to avoid this center area was used as an indication of anxiety level . anxiety levels of mice were also tested in an elevated zero maze ( san diego instruments ) . the width of the track was 5 cm and the inner diameter was 48 cm . two opposite quadrants of the circular track ( referred to as closed quadrants ) were surrounded by two 15-cm high walls along the edge of the track . the edges of the other two quadrants of the track ( referred to as open quadrants ) were lined with 1-cm high rails . a mouse was placed on the zero maze and allowed to explore for 5 min under 200-lux illumination . mouse behavior was monitored , recorded , and analyzed by a webcam ( logitech ) and the any - maze software ( stoelting ) . a mouse was considered to have entered or exited a closed quadrant if the whole body ( except for the tail ) entered or exited , respectively , the quadrant . comparisons between two groups were made with student 's t - tests with a two - tailed confidence level of p < 0.05 . for fear conditioning , cb2r wt and ko mice were presented with a 30 s tone and a 2 s electric foot shock , 3 times every 2 min ( figure 1(a ) ) . for the first 2 min , wt and ko mice spent 1.6 0.5% ( n = 18 ) and 1.7 0.8% ( n = 11 ) , respectively , of the time being frozen ( p = 0.86 , t - test ; figure 1(a ) ) , suggesting that the two groups of mice had similar baseline freezing behavior . during the second 2 min period , the freezing time increased to about 10% for both wt and ko mice , and there was again no difference between the two strains ( p = 0.95 , t - test ; figure 1(a ) ) . for the last 2 min of the conditioning session , the freezing time of ko mice ( 26 4% ) was not significantly different from that of wt mice ( 30 4% ) ( p = 0.52 , t - test ; figure 1(a ) ) . this result implies that wt and ko mice had similar baseline responses to electric foot shocks . on the next day , the same animals were tested for long - term , contextual fear memory by being placed in the same conditioning chamber for 5 min without a tone or a foot shock . during the 5 min exposure to the same context , wt mice showed freezing behavior for 45 4% of the time , whereas ko mice froze for a significantly shorter period of time , 30 3% ( p = 0.0078 , t - test ; figure 1(b ) ) . this result suggests that the contextual fear memory might be impaired in cb2r ko mice . however , an alternative interpretation could be that the ko mice quickly noticed after being placed in the chamber that a foot shock was not delivered and thus disconnected the context from fear . to test for this possibility , we analyzed the freezing behavior separately during the early ( 02 min ) and late ( 4 - 5 min ) periods of the 5 min exposure . for the first 2 min , the freezing time of the ko mice ( 26 3% ) was still significantly shorter than that of the wt mice ( 44 4% ) ( p = 0.0027 , t - test ; figure 1(b ) ) . similarly , the ko mice displayed significantly shorter freezing time ( 30 5% ) during the last 1 min period than the wt mice did ( 48 5% ) ( p = 0.020 , t - test ; figure 1(b ) ) . this result implies that the mice did not adapt to a shock - free environment but showed consistent freezing behavior throughout the 5 min exposure period . together , our data support the idea that the long - term contextual fear memory , which is dependent on the hippocampus , was impaired in cb2r ko mice . mice were placed in the conditioning chamber with modified visual and odorous cues for 2 min without a shock or a tone and then for 3 min with a tone . for the first 2 min , wt and ko mice showed no difference in baseline freezing behavior in the new context : 10 2% and 7.6 2% freezing time for wt ( n = 16 ) and ko ( n = 11 ) , respectively ( p = 0.52 , t - test ; figure 1(c ) ) . when presented with a tone for 3 min , the mice displayed more freezing , but the freezing time of ko mice ( 39 7% ) was again not significantly different from that of wt mice ( 42 4% ) ( p = 0.74 , t - test ; figure 1(c ) ) . these results suggest that the impairment of long - term fear memory in cb2r ko mice was specific for hippocampus - dependent processes . we performed a spontaneous alternation test in a y - maze to assess spatial working memory ( figure 2(a ) ) . alternation of arm entries is driven by an instinct of a mouse to visit a novel place and requires the mouse to remember which arms it entered in its immediately previous exploration ( for review , see ) . during the 3 min test session in a y - maze , cb2r ko mice had a significantly higher probability of alternating three consecutive entries ( 68 2% ; n = 12 ) than wt mice did ( 61 2% ; n = 19 ) ( p = 0.012 , t - test ; figure 2(b ) ) . this result suggests that the spatial working memory of cb2r ko mice was enhanced compared with that of wt mice . alternatively , it is also possible that cb2r ko mice had higher exploratory motivation and thus stayed in each arm for a shorter period of time , resulting in a less temporal burden for memory storage . to test for this possibility , we analyzed the total number of arm entries for 3 min , but both wt and ko mice showed similar number of entries ( p = 0.19 , t - test ; figure 2(c ) ) . fear memory tests and a y - maze test involve motor activity and/or anxiety of mice . although the analyses of these tests ( figures 1 and 2 ) implied that the mobility and basal freezing behavior of cb2r ko mice were similar to those of wt mice , we further examined these properties of mice in an independent assay . an open field arena was used to assess both motor activity and anxiety while mice explored the arena for 5 min ( figure 3(a ) ) . as an assay of anxiety in an open field arena , the exploration time and travel distance in the center area of the arena were analyzed . cb2r ko mice spent 23 3 s ( n = 11 ) in the center area and it was not significantly different from the time spent by wt mice ( 27 3 s ; n = 18 ) ( p = 0.40 , t - test ; figure 3(b ) ) . the distance traveled in the center area by ko mice ( 2.3 0.3 m ) was also similar to that by wt mice ( 2.5 0.3 m ) ( p = 0.58 , t - test ; figure 3(c ) ) . these results suggest that there was no difference in anxiety levels between the two strains of mice . the total distance traveled by the ko mice for 5 min ( 21.8 1.9 m ) was not different from that by the wt mice ( 21.8 1.1 m ) ( p = 0.997 , t - test ; figure 3(c ) ) . the mean speed of travel was 7.3 0.4 cm / s for wt mice and 7.3 0.7 cm / s for ko mice ( p = 0.98 , t - test ; figure 3(e ) ) . the anxiety of cb2r ko and wt mice was additionally assessed in an elevated zero maze , which consisted of two quadrants with walls and two other quadrants without walls ( figure 4(a ) ) . the more anxious a mouse is , the more time it will spend in walled , or closed , quadrants . during a 5 min test session , cb2r wt ( n = 18 ) and ko ( n = 11 ) mice spent the same amount of time ( 69 2% of the total time ) in the closed quadrants ( p = 0.89 , t - test ; figure 4(b ) ) . the distance traveled in the closed quadrants was 67 1% and 69 2% of the total travel distance for wt and ko mice , respectively ( p = 0.54 , t - test ; figure 4(c ) ) . the two mouse groups also displayed similar levels of overall motor activity in an elevated maze because the total travel distance was 15.7 0.8 m for wt and 14.5 0.8 m for ko mice ( p = 0.33 , t - test ; figure 4(d ) ) . this result supports the idea that the anxiety levels of cb2r ko mice were similar to those of wt mice . next , we tested whether acute blockade of cb2rs also induced similar effects to those of chronic ko of cb2rs . c57bl/6j mice were fear - conditioned as described in figure 1(a ) and then randomly divided into two groups with 11 mice per group . these two groups were not different from each other in freezing behavior during the 6 min conditioning session ( p > 0.1 in each 2 min period ; figures 5(a ) and 5(b ) ) . mice in the test group were injected with am630 ( 3 mg / kg ; i.p . ) , a cb2r antagonist , 3 min after the conditioning and control mice were administered with vehicle . in the contextual memory test on the next day , am630-treated mice froze 56 5% of the 5 min test period and this value was not significantly different from that of vehicle - treated mice ( 64 5% ; p = 0.30 , t - test ; figure 5(c ) ) . when we analyzed the freezing behavior for the early 2 min ( p = 0.84 , t - test ; figure 5(c ) ) and the last 1 min ( p = 0.094 , t - test ; figure 5(c ) ) , the two groups still did not differ from each other . in the cued memory test , the freezing time of am630-treated mice ( 37 7% ) was not significantly different from that of control mice ( 28 2% ; p = 0.23 , t - test ; figure 5(d ) ) . their basal freezing before the tone was also similar to each other ( p = 0.94 , t - test ; figure 5(d ) ) . these data indicate that acute blockade of cb2rs altered neither contextual nor cued fear memory . we examined working memory , exploratory behavior , and anxiety using another group of drug - naive mice . c57bl/6j mice were injected with am630 ( 3 mg / kg ; i.p . ; n = 12 ) or vehicle ( n = 12 ) and used 1 h later for behavioral tests ( figure 6(a ) ) . in the working memory test in a y - maze , am630-treated mice showed a 61 5% rate of spontaneous alternation and it was similar to that of vehicle - injected mice ( 64 3% ; p = 0.60 , t - test ; figure 6(b ) ) , suggesting that spatial working memory was not affected by acute administration of am630 . the number of arm entries was also similar in the two groups ( p = 0.50 , t - test ; figure 6(b ) ) . in the assay of open field arena , four parameters were analyzed the time spent in the center area , distance traveled in the center area , total travel distance , and travel speed but none of them was altered by am630 ( p > 0.8 , t - tests ; figure 6(c ) ) . the behavior of am630-treated mice on an elevated zero maze was not significantly different from that of control animals when the time and distance in closed quadrants and the total travel distance were analyzed ( p > 0.5 , t - test ; figure 6(d ) ) . the data from open field arena and zero maze experiments imply that the acute treatment with am630 had little effect on locomotor activity and anxiety . the present study shows that cb2r ko mice have , compared with wt mice , enhanced spatial working memory , impaired contextual fear memory , and normal cued fear memory ( table 1 ) . these changes in memory are not caused by confounding effects of alterations in motor activity or anxiety because cb2r ko and wt mice displayed similar behavioral phenotypes in an open field arena and an elevated zero maze . given that the hippocampus is involved in contextual , not cued , fear memory [ 5053 ] , our results imply that the effects of cb2r deletion on memory are variable depending on memory types and/or brain areas . our data also indicate that acute blockade of cb2rs by am630 has no effect on memory , motor activity , or anxiety of mice , implying that the downregulation of cb2rs might need to be prolonged to induce such effects . cb2rs have been implicated in the regulation of synaptic and neuronal functions . in the hippocampus , excitatory synaptic transmission is increased by chronic activation of cb2rs and dendritic spine density is reduced by deletion of cb2rs . acute stimulation of cb2rs decreases the amplitude of spontaneous inhibitory synaptic transmission in the entorhinal cortex and inhibits potassium - evoked gaba release from synaptosomes , but not in the hippocampus . chronic activation of cb2rs increases gabaa receptor expression , although it does not change inhibitory synaptic transmission in the hippocampus . cb2r agonists increase chloride conductance and reduce membrane excitability of cortical , not hippocampal , neurons . these studies suggest that the cellular effects of cb2r activation appear to be diverse depending on brain areas . taken together with our current results , the spatial specificity of cb2r functions might be an important factor in determining the role of cb2rs in modulating synaptic transmission and memory . for a complete understanding of the cellular mechanisms of cb2r effects , it will be necessary to determine the roles of cb2rs in regulating diverse properties of synaptic transmission , for example , presynaptic release properties , postsynaptic responsiveness , short - term plasticity , and long - term plasticity . our observation of impaired long - term memory is in accord with the previous report of deficits in step - down passive avoidance memory in cb2r ko mice [ 27 , 34 ] . the passive avoidance memory depends on functions of the hippocampus , entorhinal cortex , parietal cortex , and/or amygdala . on the other hand , the fear conditioning tests probe hippocampus - dependent and hippocampus - independent memory separately [ 5053 ] . our data revealed that a deficit in long - term fear memory is specific for hippocampus - dependent , contextual memory . in the open field test and elevated zero maze test , cb2r ko mice were not different from wt mice in terms of exploratory activity and anxiety ( figures 3 and 4 ) . however , it was previously reported that cb2r ko mice traveled a significantly shorter distance in an open field arena and spent less time in the open arms of an elevated plus maze compared with wt mice . it is unclear what caused the difference between our results and the previous report , but one of the reasons could be the difference in mouse background . we obtained c57bl/6j - based ko mice and bred them with c57bl/6j mice , whereas , in the other study , c57bl/6j - based ko mice were crossed with cd1 mice . given that some effects of cannabinoid receptor ko are variable depending on the strain background [ 43 , 55 , 56 ] , the mouse background might have contributed to the discrepancy between the two studies . one of the advantages of using our mouse strain is that potential confounding effects resulting from changes in motor activity and/or anxiety can be ruled out . in the cb2r ko mice that we used , amino acids 26137 of cb2r ( total 347 amino acids ) were deleted . however , a different region was removed in the cb2r ko mice used in the other study . if the sequence upstream of the deleted region is translated , a peptide with potential biological activity could be generated . in addition , it is possible that the sequence downstream of the deleted region could be translated if the neocassette ( hence the stop codon in the cassette ) is spliced out . because different regions are missing in the two strains of cb2r ko mice , such partial translation , if any , would produce peptides that might possess distinct function in each mouse strain , resulting in differences in phenotypes . we used both male and female mice but the previous study included only males . however , the sex difference might not account for the difference in the results because our conclusion remained consistent even when we analyzed only male mice in our data set . with only males , the freezing time of ko mice ( n = 8) in the contextual memory test was shorter than that of wt mice ( n = 13 ; p = 0.038 , t - test ) , and there was no difference in the cued memory test between wt ( n = 12 ) and ko ( n = 8) mice ( p = 0.91 , t - test ) . the probability of alternation in the y - maze test with male ko mice ( n = 8) was higher than that with male wt mice ( n = 13 ; p = 0.024 , t - test ) . there was no difference between the two male groups in any analysis of the open field test and zero maze test ( p > 0.2 , t - tests ) . as introduced earlier , the abnormality of cnr2 in humans is related to schizophrenia [ 31 , 32 ] and cb2r ko mice display schizophrenia - like phenotypes , for example , impairment in sensory - motor gating and an increase in depressive behavior . individuals with schizophrenia have deficits in working memory ( for review , see ) , hippocampal functions ( for reviews , see [ 37 , 38 ] ) , amygdala functions ( for reviews , see [ 39 , 40 ] ) , and anxiety ( for review , see ) . however , our study indicates that cb2r ko mice display improved working memory , normal cued fear memory ( which requires amygdala function ) , and normal anxiety levels . although cb2r ko mice clearly recapitulate some of the schizophrenia - related phenotypes , our data imply that the degree of the recapitulation needs to be scrutinized . acute administration of the cb2r antagonist am630 in vivo had little effects on memory , locomotion , and anxiety in our experiments . at the cellular level , we have observed that treatment of hippocampal slice cultures with sr144528 , a cb2r antagonist , even for 710 d did not affect excitatory synaptic transmission . therefore , it appears that the downregulation of cb2rs needs to last long to produce any effect on synaptic functions and memory . acute intraperitoneal administration of am630 at 3 mg / kg , which we also used , into mice has been reported to impair long - term memory in a passive avoidance test and increase anxiety in a light - dark box test . in contrast , the same drug at the same dose in our experiments did not produce any significant effect on long - term fear memory or anxiety . the reason for this discrepancy is unclear but the differences in mouse strain and/or the types of behavioral assays might have contributed to the unmatched results . although both cb2r wt mice and c57bl/6j mice are considered control groups , the former ( figure 1(a ) ) displayed less freezing response to a foot shock than the latter ( figure 5(b ) ) . c57bl/6j is a congenic background of cb2r wt mice , but their genetic compositions might not be identical to each other , possibly resulting in differences in phenotypes . furthermore , context- or cue - induced freezing behavior of cb2r wt mice ( figures 1(b ) and 1(c ) ) is not the same as that of vehicle - injected c57bl/6j mice ( figures 5(c ) and 5(d ) ) . in addition to the genetic mismatch , the stress caused by vehicle injection into c57bl/6j mice and/or vehicle itself might be another factor contributing to the phenotypic differences between the two control groups . to avoid these confounding effects , comparisons were made only between cb2r wt and ko mice or between c57bl/6j groups . one of the possible mechanisms for the delayed effects of cb2r downregulation could be its effects on neurogenesis . activation of cb2rs promotes the proliferation of neural progenitor cells in vivo in the hippocampus [ 60 , 61 ] and subventricular zone , as well as neural stem cells in culture . interestingly , blockade of hippocampal neurogenesis in adult mice impairs contextual fear memory but not cued fear memory or spatial memory . it would be an important task to determine whether the effect of cb2r ko on contextual memory is mediated by the disruption of hippocampal neurogenesis . cb2r ko mice have impairment in eye - specific segregation of retinal projections to the dorsal lateral geniculate nucleus and an increase in retinal sensitivity . therefore , if the vision of cb2r ko mice is abnormal , it might influence the contextual learning because this form of learning requires recognition of visual context . if vision is one of the factors contributing to the deficit in contextual memory in cb2r ko mice , it would still remain puzzling how abnormal vision , if any , does not interfere with , but rather enhanced , spatial working memory , of which the acquisition and recall also require visual cues . although cb2rs are expressed in the brain , the expression level of cb2rs in the peripheral immune system is much higher than that in the central nervous system ( for reviews , see [ 4 , 67 ] ) . therefore , the deletion of cb2rs in the immune system , not only in the brain , should be taken into account when data from cb2r ko mice are interpreted . the immune system can enhance the ability of learning and memory under quiescent conditions ( i.e. , without inflammation or injury ) via interactions among t cells , microglia , and neurons , whereas a surge of cytokines under inflammatory conditions can impair the processes of learning and memory ( for review , see ) . in relation to immune functions , cb2r ko mice are more vulnerable to experimental autoimmune encephalomyelitis , allergic dermatitis , and bacterial infection ( for review , see ) . it needs to be determined in the future whether the compromised immune functions in cb2r ko mice affect the processes involved in learning and memory . cb1r ko mice display impaired extinction , but normal acquisition , of both spatial reference memory [ 44 , 45 ] and cued fear memory . contextual fear memory of cb1r ko mice was reported to be impaired or enhanced , whereas passive avoidance memory was unaffected . combined with our data ( table 1 ) , these results indicate that the normal acquisition of cued fear memory is common for both cb1r ko and cb2r ko mice , but the changes in working memory are opposite in cb1r ko and cb2r ko mice . acute administration of a cb1r agonist into rodents impairs spatial reference memory [ 7072 ] , working memory [ 71 , 73 ] , and contextual fear memory . in contrast , acute treatment of mice with a cb2r agonist enhances passive avoidance memory whereas a cb2r antagonist impairs it but not fear memory ( figure 5 ) . taken together , these studies reveal that cb1rs and cb2rs have both similar and distinct roles in modulating memory . given that -thc , the major psychoactive component of cannabis , and endocannabinoids ( e.g. , anandamide and 2-arachidonoylglycerol ) can activate both cb1rs and cb2rs [ 1618 ] , it will be an important task to determine how various effects of -thc on cognitive functions are mediated by each type of cannabinoid receptors . once the neurocognitive effects of each receptor are fully characterized , cb1r or cb2r can be selectively targeted for pharmacological therapeutics to induce only desired effects while avoiding unwanted ones . | neurocognitive effects of cannabinoids have been extensively studied with a focus on cb1 cannabinoid receptors because cb1 receptors have been considered the major cannabinoid receptor in the nervous system .
however , recent discoveries of cb2 cannabinoid receptors in the brain demand accurate determination of whether and how cb2 receptors are involved in the cognitive effects of cannabinoids .
cb2 cannabinoid receptors are primarily involved in immune functions , but also implicated in psychiatric disorders such as schizophrenia and depression . here , we examined the effects of cb2 receptor knockout in mice on memory to determine the roles of cb2 receptors in modulating cognitive function .
behavioral assays revealed that hippocampus - dependent , long - term contextual fear memory was impaired whereas hippocampus - independent , cued fear memory was normal in cb2 receptor knockout mice .
these mice also displayed enhanced spatial working memory when tested in a y - maze .
motor activity and anxiety of cb2 receptor knockout mice were intact when assessed in an open field arena and an elevated zero maze .
in contrast to the knockout of cb2 receptors , acute blockade of cb2 receptors by am603 in c57bl/6j mice had no effect on memory , motor activity , or anxiety .
our results suggest that cb2 cannabinoid receptors play diverse roles in regulating memory depending on memory types and/or brain areas . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the importance of finding prognostic and predictive markers is an ongoing challenge in oncology . the main attention regarding nsclc directs towards the epidermal growth factor receptor- ( egfr ) targeted pathway , where the most studied genetic alterations include egfr mutations , egfr copy number , and kras mutations . kras mutations have been shown to be associated with worse survival in resected patients [ 1 , 2 ] and have also been shown to be a negative prognostic factor regarding adjuvant chemotherapy , whereas the significance in the stage iii ( locally advanced ) or stage iv ( metastatic ) setting still is unclear . in this study , we analysed tumour tissue samples regarding kras mutations , egfr mutations , and egfr positivity by fish the study population is represented by patients from two prospective trials who have received combined radiochemotherapy with curative intent : the raket study , a randomized three - armed phase ii study where patients were treated with two cycles of induction chemotherapy ( carboplatin / paclitaxel ) followed by either hyperfractionated accelerated radiotherapy concurrent with a third cycle chemotherapy , conventional radiotherapy concurrent with daily paclitaxel or conventional radiotherapy concurrent with weekly paclitaxel . secondly the recently finished satellite trial , a one - armed phase ii study , where the treatment consisted of two cycles of induction chemotherapy ( cisplatin / docetaxel ) followed by radiotherapy concurrent with the egfr - directed antibody cetuximab . the aim was to explore the prognostic impact of kras mutations in the stage iii setting where the patients have been treated with high - dose radiotherapy with concurrent chemotherapy / biotherapy and to survey the prevalence of kras and egfr alterations in a scandinavian population . the inclusion criteria were identical and consisted of histologically or cytologically proven nonresectable nsclc stage iiia / b ( the 6th version of the tnm system ) , age > 18 , fev1 > 1.0 main exclusion criteria were malignant pleural effusion , other malignancy treated within the last five years . neither study excluded patients with weight loss . the raket study is a randomized national multicentre three - armed phase ii study where patients were treated with two cycles of induction chemotherapy ( carboplatin auc 6/paclitaxel 200 mg / m ) followed by either ( a ) hyperfractionated accelerated radiotherapy 1.7 gy bid to 64.6 gy concurrent with a third - cycle chemotherapy , ( b ) radiotherapy with 2 gy daily to 60 gy concurrent with daily paclitaxel 12 mg / m or ( c ) radiotherapy with 2 gy daily to 60 gy concurrent with weekly paclitaxel 60 mg / m . the satellite trial is a one - armed multicentre phase ii study where patients were treated with two cycles of induction chemotherapy ( cisplatin 75 mg / m / docetaxel 75 mg / m ) followed by radiotherapy , 2 gy daily , to 68 gy concurrent with weekly cetuximab ( initial dose of 400 mg / m followed by 250 mg / m ) . all patients gave their written informed consent and the studies were approved by the regional ethics board . formalin - fixed paraffin - embedded tissues were collected from the diagnostic / pretherapeutic samples , and the analyses were performed at one site . the specimens were pathologically revised by a reference pathologist , and the section with highest percentage of tumour cells were estimated and marked , thereafter microdissected in preparation for the molecular analyses . the analysis of the kras- and egfr mutations were performed by using therascreen kras mutation kit and therascreen egfr29 mutation kit ( dxs diagnostics ) , detecting mutations in exon 2 and exon 18 , 19 , 21 , respectively . egfr copy number was analysed by using vysis lsi egfr spectrumorange / cep7 spectrumgreen probe ( vysis inc . the statistics for the main studies have been previously described [ 5 , 6 ] . the os survival analyses are done according to the kaplan meier method and possible univariate differences between groups are estimated with log - rank test . univariate and multivariate cox regression were done for several prognostic factors ( i.e. , kras mutation , performance status , gender , stage , and weight loss ) . in the multivariate cox analyses the most significantly covariate was kept in the model and the other variables were entered into the model one by one and were maintained if they statistically improved the model on the 5% level . the studies are as mentioned published previously but in short patients in the satellite trial had a median survival of 17 months with a toxicity profile inferior to what usually is seen in concurrent chemoradiation . the raket trial had a median survival of 17.8 months , with all arms showing acceptable side effects , however there was no difference between the arms regarding local control or survival [ 5 , 6 ] . all specimens from the patients in the satellite trial were collected that previously had a biopsy performed , which were 34 out of 71 that is , 48% , the remaining patients were diagnosed on cytology . a group of the same size was chosen from the raket study using all tissue samples from the institution that randomized most of the patients . we hereby obtained 35 samples and as the number equals the sample number in the satellite study , we then made a comparison between baseline characteristics in the whole study population and the subset with tissue specimen available ( table 1 ) . the groups with tissue samples available show close to the same basal criteria as the whole population , with the exception of a slightly higher proportion of adenocarcinoma in the raket study group . the mean percentage of tumour cells in the samples , as assessed by the reference pathologist was 79% ( range 10100% ) . the prevalence of kras mutations was 28.8% ( 19 out of 66 ) , where the majority was found in adenocarcinomas and a small proportion in squamous cell carcinoma ( scc , 10.5% ) . the group with mutated kras had a significantly inferior survival , which maintained its significance when introducing other possible prognostic factors into the cox regression model . they had previously shown to be of importance in the main study analyses , or are known to influence survival ( i.e. , performance status , gender , stage , and weight loss ) . the group difference is shown in figure 1 with a hazard ratio of 2.32 ( p = 0.006 , 95% ci 1.274.26 ) . the complete univariate and multivariate analyses are shown in tables 4 and 5 . the prevalence of egfr mutations were 7.5% ( 5 out of 67 ) , one exon 19 deletion , one l858r ( exon 21 ) mutation both in adenocarcinomas and three g719x mutations ( exon 18 ) which were found in squamous cell carcinomas ( scc ) and nsclc nos . the prevalence of fish positivity regarding egfr was 19.7% ( 12 out of 61 ) , where the prevalence in the satellite and raket trial differed substantially 32.3% and 6.7% respectively . the histologies involved were in equal amounts scc and adenocarcinoma with a lesser proportion nsclc nos . four of the patients that were fish positive had overlapping mutations , two with mutated kras , and two with mutated egfr . the knowledge about kras mutations and egfr alterations , and their role in nsclc , has expanded considerably in the last decade . kras mutations are more common in adenocarcinomas and smokers and are reported in 1530% without any pronounced ethnical differences [ 710 ] . kras mutations have been shown to be associated with worse survival or higher frequency of relapses in resected patients [ 1 , 2 ] . in a meta - analysis regarding all nsclc stages , kras was a negative prognostic factor in terms of survival in univariate analysis but it was not analysed in the multivariate setting . there is also data that kras is a negative prognostic factor for treatment with adjuvant chemotherapy [ 3 , 8 ] , whereas data regarding chemotherapy in the metastatic setting still is unclear . we have only found one study on the matter in stage iii disease in which the patients received neoadjuvant radiochemotherapy followed by surgery where they found that kras was a negative prognostic factor regarding pfs in univariate analysis but a multivariate analysis was not performed . in our study kras mutations were found in 28.8% , predominantly in adenocarcinomas , and this is in accordance with published data . when analysing kras mutation as a prognostic marker we found mutated kras to be a significant negative prognostic marker for survival which kept its significance in multivariate analysis when introducing other known possible prognostic factors , that is , performance status , gender , stage and weight loss , into the model . as far as we know this is the first time this is shown in a multivariate analysis in stage iii disease treated with radiochemotherapy with a curative intent . the treatment with cetuximab in the satellite trial might have interfered , as mutated kras is a biomarker of resistance to cetuximab in colorectal cancer , however in neither the flex- nor bms099 trial where cetuximab was given combined with chemotherapy in stage iv disease , a correlation between kras and response to cetuximab in nsclc was observed . we have also presented the frequencies of egfr mutations and egfr fish positivity in this cohort , solely to give an idea of the prevalence in this scandinavian population . the frequency of egfr mutations differ for example , depending on histology , smoking status , and ethnicity . the highest figures are seen in asian female never smokers with adenocarcinomas ( > 50% ) , whereas caucasians have an overall mutational frequency of 710% which will rise to about 1316% when considering adenocarcinomas [ 10 , 1416 ] . egfr fish positivity does not appear to have the same connection to histology or ethnicity but the prevalence varies substantially between 25 to > 50% [ 7 , 9 , 14 , 15 , 1720 ] . in this study , the egfr mutation prevalence of 7% in a histologically unselected northern european caucasian population is in accordance with previously published data , but two out of five patients had tumors originating from scc . the pattern seen in the present study , with several exon 18 mutations in scc differing from the most frequently reported pattern with the most common mutations being exon 19 deletions and exon 21 mutations , predominantly in adenocarcinomas . regarding fish positivity the prevalence seems to be somewhat low ( 19.7% ) , with equal cases of adenocarcinomas and scc . there is a substantial difference in the prevalence of fish positive patients between the raket study and satellite study where the prevalence is 6.7% and 32.3% respectively . we have no explanation for this difference , the samples were reanalysed with the same result . in summary , we have shown that mutated kras is an independent negative prognostic factor for survival in nsclc stage iii disease treated with combined chemoradiotherapy or bioradiotherapy , and the prevalence of kras mutations and egfr mutations are as expected in this northern european population . | background .
the main attention regarding prognostic and predictive markers in nsclc directs towards the egfr - targeted pathway , where the most studied genetic alterations include egfr mutations , egfr copy number , and kras mutations .
we wanted to explore the prognostic impact of mutated kras in the stage iii setting treated with high - dose radiochemotherapy .
methods .
samples were obtained from patients participating in two prospective studies of locally advanced nsclc receiving combined radiochemotherapy : the raket study , a randomized phase ii study where patients were treated with induction chemotherapy ( carboplatin / paclitaxel ) followed by concurrent radiochemotherapy , and the satellite trial , a phase ii study with induction chemotherapy ( cisplatin / docetaxel ) followed by radiotherapy concurrent cetuximab .
the samples were analysed regarding kras mutations , egfr mutations , and egfr fish positivity .
results .
patients with mutated kras had a significantly inferior survival , which maintained its significance in a multivariate analysis when other possible prognostic factors were taken into account .
the prevalence of kras mutations , egfr mutations , and egfr fish positivity were 28.8% , 7.5% , and 19.7% , respectively .
conclusion .
mutated kras is an independent negative prognostic factor for survival in nsclc stage iii disease treated with combined radiochemotherapy .
the prevalence of kras mutations and egfr mutations are as expected in this scandinavian population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
protozoan parasites of the genus leishmania cause a spectrum of clinical disease , including cutaneous , mucocutaneous , and visceral leishmaniasis ( vl ) . approximately 12 million people are infected with this parasite worldwide with 1.52 million new cases occurring each year . leishmania parasites are dimorphic organisms which exist as promastigotes in extracellular stage and in the sandfly midgut , and as amastigote that lives intracellularly in the phagolysosomes of macrophages in the mammalian host cells [ 2 , 3 ] . unfortunately , currently available treatment regimens are nonselective drugs with significant toxicity and limited efficacy [ 4 , 5 ] . on the other hand , efforts aimed at the development of vaccines have only achieved low levels of protection in trials in human subjects [ 6 , 7 ] . thus , there is an urgent need to identify novel molecular targets that can be exploited for drug development , vaccine design , or both . trypanosomatid protozoa such as leishmania are purine auxotrophs and are totally dependent upon their hosts to provide purine nucleotides for their survival , growth , and multiplication [ 8 , 9 ] . it has shown that leishmania promastigotes possess a unique class i nuclease , [ 10 , 11 ] that involves the salvage of preformed purines through the hydrolysis of either 3-nucleotides or nucleic acids [ 1216 ] . an intracellular amastigote - specific protein , p-4 , with class i nuclease activity has also been identified in l. pifanoi by kar et al . and by our group in l. major . however , there was no data about the presence and characteristics of this nuclease in l. infantum , the causative agent of infantile human leishmaniasis . the aim of this study was to clone and characterize the p4 nuclease from leishmania infantum . promastigotes were cultured at 26c in rpmi 1640 medium with glutamine ( gibco brl ) supplemented with 10% heat - inactivated fetal calf serum ( sigma - aldrich ) . organisms were harvested in logarithmic phase and washed with phosphate buffer saline ( pbs , ph 7.2 ) . parasites were disrupted in lysis buffer ( 50 mm nacl , 50 mm edta , 1% sds , 50 mm tris - hcl , ph 8.0 ) and incubated overnight with proteinase k ( 100 mg / ml , sigma - aldrich ) at 37c . a pair of primers was designed based on p4 gene sequence previously reported for cutaneous leishmaniasis ( cl ) strains : forward , 5-catatgtggggctgcgtgggtcacat-3 and reverse , 5- tactcgagcacctcgcttcggacg-3 . each pcr reaction contained 200 ng dna , 10 p mol each of forward and reverse primers , 1.5 mm mgcl2 , 200 m dntps , 1 pcr buffer , 2 unit of pfu dna polymerase ( fermentas ) and up to 25 l d h2o . pcr amplification was carried out in 94c for 4 min , followed by 30 cycles of denaturation at 94c for 1 min , annealing at 60c for 60 sec , and extension at 72c for 60 sec with a final extension cycle at 72c for 20 min . the dna bands were visualized under an ultraviolet light ( uv transilluminator ) and documented . the pcr product was purified by pcr product purification kit ( roche ) and ligated into the pgem - t easy vector ( promega ) . the ligation reaction was transformed into dh5 ( promega ) competent cells and plated on luria - bertani ( lb ) agar , containing ampicillin ( 50 mg / ml ) , 5-bromo-4 chloro-3-indolyl--d - galactoside ( x - gal : 20 mm ) , and isopropyl thio--d - galactoside ( iptg : 200 mg / ml ) . the white colonies containing recombinant plasmid were selected for plasmid extraction and pcr screening . then cloning was verified by restriction digestion and sequencing . the pgem vector containing li - p4 gene was digested with nde i and xho i and the insert was purified , subcloned into the nde i - xho i digested pet28a ( novagen ) expression vector and transformed into the e. coli bl21 ( novagen ) . the bacteria containing pet28a - li - p4 was cultured in lb broth medium and grown until od = 0.5 . expression of recombinant p4 was induced by addition of 25 l of 1 mm iptg then incubated for further 4 h at 37c and analyzed by sds - page . for purification of recombinant li - p4 , e. coli bl21 containing expression vector was cultured in 1 liter lb broth medium , and following induction with iptg , the pellet was collected by centrifugation . the bacterial sediment was disrupted in 5 ml lysis buffer ( ph = 8 , 50 mm nah2po4 , 300 mm nacl ) by sonication , centrifuged for separation of soluble and insoluble fraction and analyzed by sds - page . since the recombinant protein was expressed as 6 his - tag fusion , the ni - nta column ( qiagen ) was used for purification . briefly , li - p4 inclusion body was dissolved in lysis buffer containing 8 m urea and passed through ni - nta column that previously equilibrated with related buffer . the column was washed and recombinant protein was released and collected using 250 mm imidazol . an adult rabbit ( new zealand white ) was immunized subcutaneously with 200 mg of purified rl - ip4 emulsified in an equal volume of complete freund 's adjuvant ( cfa ) ( sigma - aldrich ) , followed by a subcutaneous boosting 2 weeks later with 100 g of recombinant p4 protein in incomplete freund 's adjuvant ( ifa ) ( sigma - aldrich ) . two weeks later , the rabbit was boosted intravenously with 50 g of rlip4 , and blood was collected 1 week later . for determination of p4 nuclease , lysates of promastigotes and amastigotes of l. infantum were incubated with rabbit antiserum raised against rli - p4 followed by incubation in 1/5000 dilution of hrp conjugated goat antirabbit igg ( sigma - aldrich ) . after washing to remove unbound antibodies , membranes were incubated in 1/5000 dilution of hrp conjugated goat antirabbit igg ( sigma ) and processed for ecl . the protocol for detection of leishmania elongation factor-1a ( as an internal control ) in lysates of promastigotes and amastigotes using mouse after culture , the leishmania infantum was subjected to dna extraction and li - p4 gene amplification . pcr amplification of p4 nuclease gene from l. infantum results in a pcr product of 951 bp that was in expected size ( figure 1 ) . the pcr product was cloned in the pgem - t easy vector using t - a cloning method and confirmed by restriction digestion ( figure 2 ) . li - p4 was amplified from l. infantum amastigote using forward and reverse primers based on the sequence previously reported for cutaneous leishmaniasis ( cl ) strains . the nucleotide sequence was submitted to the genebank / ncbi data base under accession number aby27514.1 . result of sequencing revealed that the gene consists of an orf of 951 base pairs with a predicted molecular mass of 33 kda . structural analysis using signal p software showed a signal sequence consisting of the first 30 amino acids and two putative n - linked glycosylation sites ( at amino acid residues 108 and 251 ) . a search of the swisspro database with the predicted amino acid sequence revealed a significant similarity to a number of proteins belonging to the class i nuclease family as shown by the alignment using the clustalw program ( figure 3 ) . the protein with highest similarity to p4 nuclease was p1/s1 secretory nuclease of l. donovani ( genbank accession no . xp_001684745.1 ) , single - strand - specific nuclease from l. pifanoi ( accession no . aao65599.1 ) ; identities and positivities between li - p4 nuclease and each of these proteins are shown in table 1 . analysis of the sequences for conserved domains using the ncbi protein blast tool showed that in spite of some heterogeneity in primary structure , all of these proteins contained a conserved nuclease domain specific to class i nuclease family . for expression of recombinant li - p4 , the pcr product was subcloned in the ndei - xhoi site of pet28a ( novagen ) in frame with c - terminal 6his - tag and transformed into the e. coli bl21 ( figure 5 ) . the molecular mass was found to be 33 kda , which was slightly higher than the native mature protein due to the addition of a hexa - his - tag sequence . purification of recombinant protein was performed by affinity chromatography on ni - nta resin , and fractions were analyzed by sds - page ( figure 6 ) . to examine further developmental regulation of expression of p4 nuclease in l. infantum , polyclonal rabbit antisera raised against recombinant li - p4 were used to probe western blots containing lysates of promastigotes and amastigotes of l. infantum . as shown in figure 7(a ) , a strongly reactive band of the expected mass ( 33 kda ) was observed in lysates of amastigotes ( lane 3 ) but appeared fairly in lysates of procyclic or metacyclic promastigotes ( lane 1 and 2 , resp . ) . to ensure that equivalent amounts of promastigote and amastigote proteins were loaded and transferred for detection , a similar blot was incubated with monoclonal antibody against ef-1 ( upstate biotechnology , usa ) , a protein that is expressed in all life cycle stages ( figure 7(b ) ) . as it is shown in figure 7(b ) , the abundance of ef-1 in promastigote samples ( lane 1 and 2 ) was similar to that one in amastigote lysates ( lane 3 ) . p-4 is a single - stranded specific class i nuclease that was identified initially in l. amazonensis and then characterized in l. pifanoi by kar et al . . recently , we isolated a class i nuclease gene from amastigotes of l. major . in the present study we characterized this nuclease in l. infantum . similarity analysis revealed that the sequence of corresponding protein from l. infantum has high sequence homology to the p4 nuclease of l. donovani , l. major , l. pifanoi , and 3-nucleotidase / nuclease enzymes previously described in different trypanosomatids . the alignment results indicated the presence of 5 main conserved domains between these nucleases from different species . the class i nuclease from promastigote stage of some leishmania species have been extensively studied [ 8 , 13 , 19 , 25 , 26 ] . it has shown that expression of this nuclease upregulated significantly in response to purine starvation [ 13 , 17 ] which is consistent with the opinion that class i nuclease enzyme plays a vital role in providing purines for growth and development of leishmania parasites . since there is no a homologue enzyme with similar properties in mammalian tissues , this enzyme can serve as a chemotherapeutic target for selective targeting of leishmania during infection . considering that leishmania is present as amastigotes in mammalian tissues and this stage is responsible for disease manifestations , the higher expression of the class i nuclease in amastigote stage further supports the use of this enzyme as a target . in conclusion , the results of the present study revealed that li - p4 nuclease belongs to the class i nuclease group of enzymes that are highly expressed in amastigote stage of l. infantum and could be exploited as target for chemotherapy . | parasite of the genus leishmania is reliant on the salvage pathway for recycling of ribonucleotides .
a class i nuclease enzyme also known as p4 nuclease is involved in salvage of purines in cutaneous leishmania species but the relevant enzymes have not been characterized in leishmania infantum ( l. infantum ) .
the aim of this study was to clone and characterize the gene encoding class i nuclease in l. infantum .
dna extracted from l. infantum was used for amplification of p4 nuclease gene ( li - p4 ) by pcr .
the product was cloned , sequenced , and expressed in e. coli for further characterization .
analysis of the sequence of li - p4 revealed that the gene consists of an orf of 951 bp .
sequence similarity analysis indicated that li - p4 has a high homology to relevant enzymes of other kintoplastids with the highest homology ( 88% ) to p1/s1 class i nuclease from l. donovani .
western blotting of antirecombinant li - p4 with promastigote and amastigote stages of l. infantum showed that this nuclease is present in both stages of parasite with higher expression in amastigote stage .
the highly conserved nature of this essential enzyme in leishmania parasites suggests it as a promising drug target for leishmaniasis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the demographic change leads to a larger proportion of older people in many countries . in europe , for example , the median age increased from 36 years in 1992 to 42 years in 2016 . the literature reflects many oral problems of older people in need of care,1,2 while oral health of nursing home residents is considered even more compromised.35 a variety of factors seem to produce an increased likelihood of deterioration of oral health conditions . on the one hand , both polypharmacia and multimorbidity which are highly prevalent in nursing home residents can contribute to oral problems ; on the other hand , the vast majority of older people in need of residential care show cognitive and motor disabilities that hinder adequate oral hygiene and access to dental health care provision . at this stage , carers have a key position in maintaining older peoples oral health.68 nonetheless , carers have to deal with many other tasks such as washing , dressing , toileting and coordinating physicians visits with the result that oral care often has no priority . these problems , however , are emphasized by the fact that nurses miss knowledge on the specific oral hygiene requirements of older people.6,7 a further limitation of adequate oral hygiene provision is care - resistant behavior , which can be frequently observed in people suffering from dementia.9 previous studies indicated poor oral hygiene in subjects with dementia in comparison to those without cognitive impairments , namely , more caries increments and worse periodontal conditions,1013 and the prevalence of cognitive and motor impairments in nursing homes is likewise high ( ~50% of institutionalized elderly ) . however , maintaining a lifelong good oral health is important for both oral function ( nutrition ) and its impact on general health such as cardiovascular diseases , stroke , diabetes mellitus and pneumonia.1416 some authors made an attempt to improve oral conditions of nursing home residents , mainly with the focus on relatively autonomous older people . it has been demonstrated that residents education in teeth brushing techniques has a positive effect on oral hygiene . further , studies have investigated the effects of carers education and found improved oral hygiene , less gingivitis , a reduced prevalence of denture stomatitis and improved denture hygiene.1719 additionally , some studies stressed the positive effects of professional teeth cleaning leading to a reduction in oral pathogens such as candida and prevalence of febrile diseases and pneumonia ; the same was true for reduction in denture plaque.20 however , the literature lacks reports on the effectiveness of carers education in more compromised nursing home residents in need of intensive care and/or suffering from dementia . sparse available literature indicates only marginal improvements in oral hygiene as well as denture hygiene after implemented interventions.21,22 however , it remains unclear if carers teaching on gerodontologic issues is capable of improving oral health of demented and care - dependent older people over a clinically relevant period . this study , therefore , aimed to evaluate the effectiveness of carers education and implementation of ultrasound baths for denture cleaning on the oral health and denture hygiene of cognitively and motorically impaired older people after six months following the interventions , and to compare the outcome to a control group without interventions . this controlled trial was part of an interdisciplinary research project that was initiated and supported by the federal ministry of social affairs , baden - wrttemberg , germany . the study deals with questions concerning medical services for residents of nursing homes , their quality of life and the improvement in both . the investigation procedures were approved by the local ethics committee of the university of heidelberg ( approval no s-002/2012 ) . fourteen nursing homes in southwest germany were selected to be representative by the federal ministry of social affairs of the state baden - wrttemberg . no participant - related allocation to intervention or control group was performed by the research team because of possible side effects of the interventions in a nursing home on participants in the control group . the federal ministry of social affairs assigned the nursing homes instead at random to intervention and control homes ( eight intervention homes / six control homes ) . the inclusion criteria for participation of the residents were that they had natural remaining teeth and/or dentures and did not plan moving home during the study period . it was further demanded that participants or their legal guardians in case they were not sui legis ( incapable of giving informed consent by law ) signed an informed consent document . no further inclusion criteria were used in order to examine a preferably wide spectrum of seniors . two - hundred and seventy - seven residents agreed to participate and were included in the study . cross - sectional characteristics are published elsewhere.13 a detailed study flowchart according to consort criteria can be seen in figure 1 . prior to the interventions for the carers , each participant underwent a comprehensive dental examination and an assessment of cognitive state ( baseline visit ) . the dental examinations were repeated after six months following the intervention ( follow - up visit ) . the dental examinations were carried out by two dentists , experienced in epidemiologic surveys . in terms of validity , they were calibrated at the department of prosthodontics , university of heidelberg , and tested for their interrater agreement by double investigations of 15 participants of the sample . the examiners were blinded against the group membership ( intervention / control group ) , and both performed dental examinations of participants in all 14 nursing homes according to their time schedule . the second examiner did not join the research team until the baseline examinations and investigated , therefore , fewer participants in this wave . the cognitive state was evaluated and documented by four psychologists trained in geriatric assessments by investigating patients attending the memory clinic of the university of heidelberg ( head : prof dr johannes schrder , md , phd ) . additionally , demographic data such as age , sex , diseases and permanent medications were collected from the care documentation and the medical records . to evaluate oral hygiene , the plaque control record ( pcr)23 and the gingival bleeding index ( gbi)24 were used . both indices allot a calculation of the quotient of test - positive tooth surfaces and all surfaces ( mesial , buccal , distal , palatal / lingual ) , resulting in a percentage value ( 0%100% ) . for pcr , all tooth surfaces were tinted with a plaque indicator solution ( mira-2-ton ; hager & werken , duisburg , germany ) . participants were then asked to rinse their mouth with water , followed by enumeration of positive tooth sites . for the determination of gbi , a periodontal probe was used ( cpc11.5 ; hu friedy , tutlingen , germany ) . the probe was gently inserted and slid through the mesial , buccal , distal and palatal / lingual gingival sulcus of each tooth . after approximately ten seconds , bleeding sites were counted and divided by the total number of available tooth surfaces . the community periodontal index of treatment needs ( cpitn ) was administered with the same probe.25 again , the probe was inserted in the gingival sulcus of each tooth with a controlled force of 20p . using the cpitn , five codes are possible for each of the up to six sextants ; these codes give information on periodontal health condition ; code 0 mirrors healthy conditions , codes 1 and 2 gingivitis , and codes 3 and 4 moderate and severe periodontitis , respectively . denture hygiene was administered using the denture hygiene index ( dhi).26 for the evaluation of dhi , dentures were tinted with a plaque indicator ( plaque test ; ivoclar vivadent , schaan , liechtenstein ) , rinsed with water and evaluated for plaque - positive sites by illumination of a polymerization lamp ( bluephase ; ivoclar vivadent ) . plaque - positive areas were separately counted for each denture and divided by ten ( total possible sites ) to give a score , which could range from 0% to 100% . these exercises covered the dimensions orientation , short - term memory , arithmetic tasks , language use and comprehension and basic motor skills . using mmse , the score of completed exercises was 1 point and of failed exercises was 0 point . scores > 20 points are indicative of more or less normal cognitive functioning , while lower scores hint dementia.27 for analytic purposes , the mmse cut - off value of 20 was used for allocation of dementia and non - dementia groups.27 to assess the level of care needed , the barthel index ( bi ) was administered by qualified caregivers in the corresponding nursing homes . this assessment method was recommended in a previous study.28 bi allows evaluation of the functional capacity of older people and is therefore broadly established in epidemiologic studies on older communities . in the evaluation of functional capacity ( activities of daily living ) , a score of 0 is indicative of total dependence , whereas a score of 100 reflects total independence.29 several interventions were offered to the intervention homes targeting residents and staff as well as the structure and the processes of nursing homes . the dental interventions featured both a two - day comprehensive education program for the carers and the implementation of ultrasound baths for denture cleaning . for the educational part of the interventions , as many carers as possible were targeted to participate in the lectures . therefore , the lectures were offered twice for each nursing home . finally , one carer from each ward of a nursing home participated at minimum in the education program . education on age - related changes and pathologies of the oral cavity and a standardized estimation tool of oral conditions were provided . carers were taught feasible teeth brushing techniques , handling of interdental space brushes and mouth rinses . furthermore , a care movie , produced and offered by the dental association of baden - wrttemberg , germany , was shown to the attendees . to improve the estimations of the caregivers concerning oral health conditions , a validated assessment tool was introduced to the attendees ; revised oral assessment guide.30 in addition , all carers were trained in the handling of different kinds of removable dentures using demonstration models . in order to make an attempt in improving denture hygiene for all intervention homes , two ultrasound baths were each supplied ( sonorex super rk 31h ; bandelin gmbh , berlin , germany ) ; the caregivers were trained in the autonomous use of the baths during the study period . in terms of safety , it was recommended that the carers only use soapy water for the ultrasonic cleaning of the dentures . to fulfill hygienic requirements , resin molds were supplied to each denture wearer to guarantee a safe cleaning process in the bath . first , the caregivers estimated the oral health by the use of the revised oral assessment guide ( roag ) ; second , they took out dentures ( if applicable ) and cleaned dentures and natural residual teeth by themselves under the supervision of a study dentist . finally , the contents of the lectures were handed out to all attendees of the homes on cd - rom and also in a print version . in addition , 25 professional carers in leading positions of all participating intervention homes were trained as multipliers in order to provide a communication training with the special module the special elements of this module were communication strategies for interaction between physicians and medical specialists engaged in nursing home care and professional caregivers . the training included exercises for structured information flow even with dentists.31 all data analyses were carried out with the aid of statistical package of the social sciences 19.0 ( ibm corporation , armonk , ny , usa ) . the dental target variables pcr , gbi , cpitn and dhi were compared between intervention and control groups , between participants with and without dementia and between baseline and follow - up investigations by the use of independent t - tests . in addition to bivariate analysis , multivariate regression models for the changes in the dental target variables between baseline and follow - up ( dependent variables ) were compiled and confounded with age , sex , dementia / non - dementia and the level of dependency ( independent variables ) . this controlled trial was part of an interdisciplinary research project that was initiated and supported by the federal ministry of social affairs , baden - wrttemberg , germany . the study deals with questions concerning medical services for residents of nursing homes , their quality of life and the improvement in both . the investigation procedures were approved by the local ethics committee of the university of heidelberg ( approval no s-002/2012 ) . fourteen nursing homes in southwest germany were selected to be representative by the federal ministry of social affairs of the state baden - wrttemberg . no participant - related allocation to intervention or control group was performed by the research team because of possible side effects of the interventions in a nursing home on participants in the control group . the federal ministry of social affairs assigned the nursing homes instead at random to intervention and control homes ( eight intervention homes / six control homes ) . the inclusion criteria for participation of the residents were that they had natural remaining teeth and/or dentures and did not plan moving home during the study period . it was further demanded that participants or their legal guardians in case they were not sui legis ( incapable of giving informed consent by law ) signed an informed consent document . no further inclusion criteria were used in order to examine a preferably wide spectrum of seniors . two - hundred and seventy - seven residents agreed to participate and were included in the study . a detailed study flowchart according to consort criteria can be seen in figure 1 . prior to the interventions for the carers , each participant underwent a comprehensive dental examination and an assessment of cognitive state ( baseline visit ) . the dental examinations were repeated after six months following the intervention ( follow - up visit ) . the dental examinations were carried out by two dentists , experienced in epidemiologic surveys . in terms of validity , they were calibrated at the department of prosthodontics , university of heidelberg , and tested for their interrater agreement by double investigations of 15 participants of the sample . the examiners were blinded against the group membership ( intervention / control group ) , and both performed dental examinations of participants in all 14 nursing homes according to their time schedule . the second examiner did not join the research team until the baseline examinations and investigated , therefore , fewer participants in this wave . the cognitive state was evaluated and documented by four psychologists trained in geriatric assessments by investigating patients attending the memory clinic of the university of heidelberg ( head : prof dr johannes schrder , md , phd ) . additionally , demographic data such as age , sex , diseases and permanent medications were collected from the care documentation and the medical records . to evaluate oral hygiene , the plaque control record ( pcr)23 and the gingival bleeding index ( gbi)24 were used . both indices allot a calculation of the quotient of test - positive tooth surfaces and all surfaces ( mesial , buccal , distal , palatal / lingual ) , resulting in a percentage value ( 0%100% ) . for pcr , all tooth surfaces were tinted with a plaque indicator solution ( mira-2-ton ; hager & werken , duisburg , germany ) . participants were then asked to rinse their mouth with water , followed by enumeration of positive tooth sites . for the determination of gbi , a periodontal probe was used ( cpc11.5 ; hu friedy , tutlingen , germany ) . the probe was gently inserted and slid through the mesial , buccal , distal and palatal / lingual gingival sulcus of each tooth . after approximately ten seconds , bleeding sites were counted and divided by the total number of available tooth surfaces . the community periodontal index of treatment needs ( cpitn ) was administered with the same probe.25 again , the probe was inserted in the gingival sulcus of each tooth with a controlled force of 20p . using the cpitn , five codes are possible for each of the up to six sextants ; these codes give information on periodontal health condition ; code 0 mirrors healthy conditions , codes 1 and 2 gingivitis , and codes 3 and 4 moderate and severe periodontitis , respectively . denture hygiene was administered using the denture hygiene index ( dhi).26 for the evaluation of dhi , dentures were tinted with a plaque indicator ( plaque test ; ivoclar vivadent , schaan , liechtenstein ) , rinsed with water and evaluated for plaque - positive sites by illumination of a polymerization lamp ( bluephase ; ivoclar vivadent ) . plaque - positive areas were separately counted for each denture and divided by ten ( total possible sites ) to give a score , which could range from 0% to 100% . these exercises covered the dimensions orientation , short - term memory , arithmetic tasks , language use and comprehension and basic motor skills . using mmse , the score of completed exercises was 1 point and of failed exercises was 0 point . scores > 20 points are indicative of more or less normal cognitive functioning , while lower scores hint dementia.27 for analytic purposes , the mmse cut - off value of 20 was used for allocation of dementia and non - dementia groups.27 to assess the level of care needed , the barthel index ( bi ) was administered by qualified caregivers in the corresponding nursing homes . this assessment method was recommended in a previous study.28 bi allows evaluation of the functional capacity of older people and is therefore broadly established in epidemiologic studies on older communities . in the evaluation of functional capacity ( activities of daily living ) , a score of 0 is indicative of total dependence , whereas a score of 100 reflects total independence.29 several interventions were offered to the intervention homes targeting residents and staff as well as the structure and the processes of nursing homes . the dental interventions featured both a two - day comprehensive education program for the carers and the implementation of ultrasound baths for denture cleaning . for the educational part of the interventions , as many carers as possible were targeted to participate in the lectures . therefore , the lectures were offered twice for each nursing home . finally , one carer from each ward of a nursing home participated at minimum in the education program . education on age - related changes and pathologies of the oral cavity and a standardized estimation tool of oral conditions were provided . carers were taught feasible teeth brushing techniques , handling of interdental space brushes and mouth rinses . furthermore , a care movie , produced and offered by the dental association of baden - wrttemberg , germany , was shown to the attendees . to improve the estimations of the caregivers concerning oral health conditions , a validated assessment tool was introduced to the attendees ; revised oral assessment guide.30 in addition , all carers were trained in the handling of different kinds of removable dentures using demonstration models . in order to make an attempt in improving denture hygiene for all intervention homes , two ultrasound baths were each supplied ( sonorex super rk 31h ; bandelin gmbh , berlin , germany ) ; the caregivers were trained in the autonomous use of the baths during the study period . in terms of safety , it was recommended that the carers only use soapy water for the ultrasonic cleaning of the dentures . to fulfill hygienic requirements , resin molds were supplied to each denture wearer to guarantee a safe cleaning process in the bath . first , the caregivers estimated the oral health by the use of the revised oral assessment guide ( roag ) ; second , they took out dentures ( if applicable ) and cleaned dentures and natural residual teeth by themselves under the supervision of a study dentist . finally , the contents of the lectures were handed out to all attendees of the homes on cd - rom and also in a print version . in addition , 25 professional carers in leading positions of all participating intervention homes were trained as multipliers in order to provide a communication training with the special module the special elements of this module were communication strategies for interaction between physicians and medical specialists engaged in nursing home care and professional caregivers . all data analyses were carried out with the aid of statistical package of the social sciences 19.0 ( ibm corporation , armonk , ny , usa ) . the dental target variables pcr , gbi , cpitn and dhi were compared between intervention and control groups , between participants with and without dementia and between baseline and follow - up investigations by the use of independent t - tests . in addition to bivariate analysis , multivariate regression models for the changes in the dental target variables between baseline and follow - up ( dependent variables ) were compiled and confounded with age , sex , dementia / non - dementia and the level of dependency ( independent variables ) . of the 277 residents initially enrolled in the study , 54 participants declined to undergo the mmse and eight participants had neither their own teeth nor dentures ( necessary for the target variables ) . therefore , 219 complete datasets were available for baseline analysis . during the six - month study period , a further 32 participants were lost to follow - up ( response : 85.4% ) . thus , complete data of 187 participants were available for longitudinal analyses ( figure 1 ) . at baseline , the mean ( sd ) age of participants was 83.1 years ( 9.0 ) . of the control group , 48 and 27 participants lived in urban and rural nursing homes , respectively ( intervention group : 94 urban participants/50 rural participants , p=0.483 ) . the study population suffered in mean ( sd ) from 3.4 ( 2.2 ) chronic medical conditions and permanently took 6.5 ( 3.4 ) drugs . the mean ( sd ) bi among the participants was 49.5 ( 29.6 ) ; the mean ( sd ) mmse score was 15.8 ( 9.1 ) . approximately 70% of the participants wore any kind of removable dentures for rehabilitation of at least one jaw . the mean ( sd ) value for the number of remaining teeth among the sample was 7 ( 8.4 ) . at baseline examination in the intervention and control groups , the mean ( sd ) pcr was found to be 85.7 ( 18.0 ) and 85.0 ( 21.9 ) , the mean ( sd ) gbi 49.3 ( 26.6 ) and 55.8 ( 30.4 ) , the mean ( sd ) dhi 84.5 ( 15.4 ) and 82.5 ( 15.5 ) and the mean ( sd ) cpitn 3.0 ( 0.7 ) and 2.9 ( 0.7 ) , respectively . cross - sectional participants characteristics including the abovementioned dental target variables were comparable in the intervention and control groups ( p>0.05 ) with the exception of medication ( p<0.05 ) . with regard to people with and without dementia , the mean cpitn scores and more detailed baseline characteristics are presented elsewhere.13 at follow - up examination after six months in the intervention group , a mean ( sd ) pcr value of 70.1 ( 26.1 ) , a mean ( sd ) gbi value of 40.2 ( 29.3 ) , a mean ( sd ) dhi value of 57.8 ( 27.9 ) and a mean ( sd ) cpitn value of 2.9 ( 0.6 ) were observed , indicating significant improvements in pcr and dhi ( p<0.001 ) . significant improvements were found in people with and without dementia compared to the control group ( p<0.05 ) . in the control group , the multivariate regression analysis of effects on changes in pcr ( table 2 ) , gbi ( table 3 ) , dhi ( table 4 ) and cpitn ( table 5 ) revealed that worse baseline conditions were an indicator for more substantial improvements in the oral health indices in each model ( p<0.001 ) . furthermore , being in the intervention group was associated with significant improvements in pcr ( p=0.002 ) and dhi ( p<0.001 ) . the site of the nursing home independently affected the improvements in pcr with less improvement in participants living in urban homes ( p=0.001 ) . dhi significantly improved in more care - dependent subjects compared to those who needed less help by the caregivers ( p<0.001 ) . consistently , age , sex , number of chronic diseases , permanent medications and prevalence of dementia had no independent effect on the improvement in dental indices ( p>0.05 ) , albeit a clear trend to slightly lower improvements in pcr was observed in participants with dementia ( p=0.053 ) . the results of this study indicated worse oral health conditions compared to previous cross - sectional studies in non - demented , less care - dependent older people.1,35 this recent study , however , also proved the effectiveness of dental education for carers and implementation of ultrasound devices in order to improve oral health and denture hygiene of care - dependent and/or older people with dementia in nursing homes . during the six - month study period , oral hygiene as measured by pcr and denture hygiene ( dhi ) significantly improved in the intervention group , whereas no effects could be observed in the control group . these results are comparable to those found in a previous intervention study , albeit the participants in our recent study were more cognitively impaired.22 in this context , the improvements in denture hygiene have to be evaluated as especially relevant . this study has demonstrated that the introduction of ultrasound baths is a very successful measure for sustainable improvement in denture hygiene . it should also be stressed that primarily high - maintenance older people ( low bi ) profited from the denture cleanings . this is important for two reasons : on the one hand , previous research revealed strong correlations between denture plaque and the incidence of pneumonia ; on the other hand , care - dependent multi - morbid older people are specifically prone to diseases such as bacteremia because of their reduced immune status.15,16,20 as this investigation highlights , this problem can be overcome with a simple measure . moreover , a substantial reduction in dental plaque accumulation has been observed during the study period ; dental plaque is also capable of provoking pneumonia and a reduction is able to reduce this risk and vice versa . this specific study outcome has to be evaluated at that positive because professional teeth cleaning which might have had a considerable effect on the potential to improve was not part of the interventions . therefore , in some cases , it was securely not possible for the trained and motivated carers to remove calculus , which might have limited larger improvements . however , the aim of this recent study was to test concepts to improve oral health , which are easily applicable in the daily care routine . in analysis of gbi and cpitn , no significant improvements could be measured over the study period , albeit a substantial trend to improvement was observed . one should keep in mind that gbi can be affected by anticoagulative medications , which were present in ~40% of the participants.13 furthermore , 89% of the participants had periodontitis in at least one sextant ( see cpitn ) . therefore , this outcome is as expected.32 in general , it should be considered that the results of this study would have substantially been affected by the transfer of caregivers improved knowledge in the care routine . moreover , lack of time was probably still a limitation for adequate oral hygiene procedures.7 this effect seemed to be more evident in larger urban long - term care homes ( less improvement in pcr compared to rural homes ; p<0.001 ) . a further limitation of the study outcome might have been care - resistant , affective and uncooperative behavior highly prevalent in seniors suffering from dementia.9 our sample included ~60% participants with more or less severe dementia . it should also be borne in mind that cognitive and motor function can decrease over time , which can be associated with worsening of oral conditions.19 the most positive aspect of this study was that it was able to reduce plaque accumulation and denture plaque likewise in participants with and without dementia . to this end and albeit all constraints associated with nursing aspects , one might highlight that the investigated interventions are efficient over a clinically relevant period of time . in general , it should be considered that intra - individual baseline conditions ( size of the dental indices ) were significantly related to changes in oral health as well as denture hygiene with higher improvements in subjects with worse baseline conditions . the results of this study could be biased due to the exclusion of 54 participants refusing to undergo mmse tests . however one should also consider that neither the carers knowledge nor their attitudes concerning oral health were considered . this , however , is a limitation of this study as it might have an impact on the efficacy of the interventions . the results of this study could be biased due to the exclusion of 54 participants refusing to undergo mmse tests . however , this variable was needed for clarification of the research questions . one should also consider that neither the carers knowledge nor their attitudes concerning oral health were considered . this , however , is a limitation of this study as it might have an impact on the efficacy of the interventions . within the limitations of this study , carers education improves oral health of care - dependent nursing home residents with and without dementia over a clinically relevant period of time . the implementation of ultrasound baths for denture cleaning is a simple but effective measure to improve denture hygiene in both institutionalized older people and seniors with dementia and in severe need of care . improved communication between carers and residents as well as relatives and health care professionals may be helpful and improves residents ( dental ) care quality . however , longer study periods are needed to clarify if these positive effects are stable in the long term or whether renewal of the interventions is necessary . | aimthe aim of this study was to evaluate the effectiveness of carers education on improvements in oral health and denture hygiene of care - dependent and cognitively impaired older people in nursing homes compared to those without intervention.methodsa total of 219 seniors living in 14 nursing homes in southwest germany ( intervention : n=144 ; control : n=75 ) were enrolled in this study . for each participant ,
plaque control record ( pcr ) , gingival bleeding index ( gbi ) , denture hygiene index ( dhi ) and community periodontal index of treatment needs ( cpitn ) were assessed at baseline and six months following the interventions .
in addition , demographic parameters such as age , sex , chronic diseases , permanent medications , level of dependency and cognitive state were recorded . in the intervention homes , education for caregivers
was provided and ultrasound baths for denture cleaning were implemented .
changes in the dental target variables pcr , gbi , cpitn and dhi during the six - month study period were compared between subjects in the intervention and the control groups as well as between subjects with and without dementia .
additionally , multivariate models were compiled for each dental index to evaluate possible confounders.resultsin the intervention group , pcr and dhi significantly improved during the study period ( p<0.001 ) .
oral health and denture hygiene improved likewise in subjects with and without dementia . in the control group ,
no significant improvements were observed ( p>0.05).conclusioncarers education improves oral health of people in nursing homes over a clinically relevant period of time .
implementation of ultrasound baths is a simple and effective measure to improve denture hygiene of both institutionalized elderly people and seniors with dementia and in severe need of care . from a clinical standpoint , it is noteworthy that the respective interventions can be easily implemented in everyday care routine . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there are more than 100,000 colours of synthetic dyes produced commercially , and over 7 10 tons of dyes are produced annually worldwide . dyes are used throughout the world in textile , paper , cosmetic , pharmaceutical , and food industries and also used as additives in petroleum products . synthetic dyes are extensively used particularly in the textile and dyeing industries . in the process of dyeing , about 1520% of the dyes used for dyeing do not bind to the fibres and are lost in the effluent . it has been estimated that about 280,000 tons of textile dyes are discharged in such industrial effluents every year worldwide . the discharge of textile dyes into rivers or lakes is the most visible sign of water pollution because several dyes are visible even at a low concentration of less than 1 ppm . in addition to changing the colour of water , the presence of dye in the receiving water bodies also impedes sunlight penetration that in turn decreases photosynthetic activity , dissolved oxygen concentration , and water quality and causes acute toxic effects on aquatic flora and fauna . many synthetic dyes are also toxic and carcinogenic to aquatic and human lives because they are made from compounds such as benzidine and other aromatic compounds . reductive cleavage of azo dyes , which comprises about 70% of all dyes used , also resulted in the production of amines that are mutagenic to human and are also retained in the anaerobic compartment of the lower intestine by intestinal microflora after ingestion of azo dyes [ 79 ] . therefore , industrial effluents containing dyes must be treated prior to their discharge into the environment . among industrial effluents , wastewater from textile and dyestuff industries is one of the most difficult to be treated since the dyes used are usually synthetic and contain complex aromatic molecular structures making them more stable and difficult to degrade . conventional wastewater treatment plants using activated sludge treatment are unable to treat dye - containing wastewater . it has been estimated that up to 90% of reactive textile dyes still persist even after the treatment . several physical and chemical methods including membrane filtration , adsorption , ion exchange , ozonation , flocculation - coagulation , and oxidation have been used to treat dye containing wastewater . however , due to high cost involved , disposal problems , and less adaptable to a wide range of dye wastewaters , most of these methods have not been widely applied [ 6 , 12 ] . bioremediation of dye containing effluents using effective dye degrading microorganisms is still seen as an attractive alternative solution due to its low - cost , environmentally friendly , and publicly acceptable treatment technology . white rot fungi have been shown to be able to degrade a wide range of organic pollutants including synthetic dyes [ 1316 ] . in recent years , many studies have focussed on the use of white rot fungi to decolourise synthetic dyes due to its ability to produce nonspecific , ligninolytic enzymes [ 1618 ] . dye decolourisation , in particular by the white rot fungus phanerochaete chrysosporium , has been intensively studied , and the degradation pathway for sulfonated azo dye by this isolate has also been elucidated [ 6 , 9 ] . however , there is no report on the use of endophytic fungi for the decolourisation of dye . most studies on endophytic fungi have focussed on studying its relationship with its host and its diversity and also to isolate bioactive compounds of medical value from these fungi [ 1921 ] . in this view , the present investigation is an attempt to find out and examine the possible application of very little studied endophytic fungi isolated from melastoma malabathricum to decolourise several synthetic dyes belonging to two major dye groups widely applied in the dyeing industries . here we report the screening and isolation of dye decolourising endophytes on agar medium and dye decolourisation analysis to select the best isolate that decolourises synthetic dyes . the endophytic fungi used in this study were isolated from the stem of a healthy flowering plant , m. malabathricum . plant samples were collected from the surrounding areas of universiti malaysia sarawak ( unimas ) and kota samarahan campus and processed immediately after collection . the plant samples were washed under running tap water to remove debris and air - dried before being cut into 5 cm in diameters . in order to eliminate epiphytic microorganisms , the samples were surface - sterilized [ 21 , 22 ] by immersion in 5% ( v / v ) clorox for 5 minutes , followed by 70% ( v / v ) ethanol , and rinsed twice with sterilized distilled water . the surface sterilized samples were blot - dried using sterile filter paper and then aseptically cut into 2 cm in diameters . the pieces of stems were then transferred aseptically onto potato dextrose agar ( pda ) ( merck , germany ) plates ( 3 pieces per petri plate ) and incubated at room temperature for a period of 2 weeks . the plates were observed daily , and hyphal tips of developing fungal colonies were subcultured individually . the isolated endophytes were grown onto glucose minimal ( gm ) agar plates and initially screened for their ability to decolourise anthraquinone dye ( remazol brilliant blue r , rbbr ) and three azo dyes ( orange g , congo red , and methyl red ) . the gm agar medium contained ( g / l ) : k2hpo4 , 1 ; znso47h2o , 0.01 ; cuso45h2o , 0.05 ; mgso47h2o , 0.5 ; feso47h2o , 0.01 ; kcl , 0.5 ; glucose , 10 ; nano3 , 3 ; and agar , 20 . the ph of the agar medium was adjusted to 5.5 before being autoclaved at 121c for 15 minutes . dyes were added into the agar from a stock solution to a final concentration of 200 mg l. the agar plates were inoculated with a 5 mm agar plug from a 7-day old fungal culture and incubated in the dark at room temperature . plates were regularly monitored and observed for visual disappearance of colour for a period of 16 days . the best dye decolourising isolate was selected for further dye decolourisation in liquid gm medium . dyes were added to the 20 ml gm liquid medium in 100 ml erlenmeyer flask to a final concentration of 200 mg l. each flask was inoculated with 2 pieces of 5 mm agar plugs from a 7-day old fungal culture and incubated in the dark at room temperature under static condition . each culture condition was prepared in triplicate , incubated for a period of 16 days , and sampled at 4-day interval . during the sampling , each culture was harvested and centrifuged at 6000 rpm for 10 minutes to separate the fungal mycelium from the culture medium . fungal biomass was determined by drying the fungal mycelium to a constant weight at 70c . dye decolourisation by the isolated fungus was measured by monitoring the absorbance of each dye in the culture medium at its respective maximum absorption wavelength ( 595 nm for rbbr , 475 nm for orange g , 497 nm for congo red , and 520 nm for methyl red ) using a uv - vis spectrophotometer ( libra s12 , biochrom ) . percentage of decolourisation was calculated according to the following formula :
( 1)percentage of decolourisation ( % ) = acasac100 ,
where ac is the absorbance at the maximum absorption wavelength of dye in the control flask at time , t , and as is the absorbance at the maximum absorption wavelength of dye in the sample flask at time , t . the selected fungal isolate was identified by morphological characteristic as well as comparison of internal transcribed spacer ( its ) sequences . the morphological appearances of the selected fungal isolate were characterized based on mycelium colours , growth patterns , and structure of fruiting bodies . genomic dna of the selected fungus was extracted according to the method of cubero et al . . extracted fungal dna was then pcr - amplified using universal primer pair of its1 and its4 under the following condition : initial denaturation at 95c for 5 minutes , 30 cycles of denaturation at 95c for 1 minute , annealing at 55c for 1 min , extension at 72c for 1 min , and a final extension at 72c for 7 minutes . a neighbour - joining tree was constructed , and the distances between sequences were calculated . bootstrap analysis was performed with 1000 replications to assess the confidence limits of the branches . a total number of twenty endophytic fungi were successfully isolated from the stem of m. malabathricum . these fungi were named according to the source from which they were isolated and followed by a number ( ms120 with m = melastoma and s = senduduk ) . dye decolourisation activity of the isolated endophytic fungi was screened using an agar plate method with decolourisation observed by the production of clear halo . all of the tested fungi were able to grow on the dye containing minimal agar medium , and 14 of the fungal isolates were able to decolourise at least one of the dyes ( table 1 ) . among the 20 tested fungi , 13 isolates were able to decolourise rbbr , 2 isolates decolourised orange g , 13 isolates decolourised congo red , and 9 isolates decolourised methyl red . only one endophyte , isolate ms8 , was able to decolourise all four different dyes tested ( figure 1 ) . dye decolourisation by isolate ms8 was also the most rapid among all of the 20 fungal isolates tested . both rbbr and orange g dye in the agar medium started to decolourise within 2 to 3 days after fungal inoculation and were completely decolourised within a period of 8 days with no visible traces of dye adsorption on the fungal mycelium . congo red and methyl red were also partially decolourised by isolate ms8 with the production of halo , and no observable dye was absorbed by the fungal mycelium . isolates ms4 and ms17 were also able to completely decolourise rbbr by day 14 and orange g by day 12 , respectively , with no dye adsorption to the fungal mycelium . isolate ms8 was selected for further dye decolourisation in glucose minimal liquid medium based on the ability to decolourise all the dyes on the agar plate . the results obtained showed that isolate ms8 was able to decolourise all of the four different dyes tested to a different extent ( figure 2 ) . among the four different dyes tested , rbbr was decolorized the fastest and to the greatest extent by isolate ms8 , up to 97.4% decolourisation in 4 days . the three azo dyes were also decolourised by isolate ms8 with methyl red being the highest , reaching 56% decolourisation after 16 days followed by congo red ( 48.1% ) and orange g ( 32.6% ) . among the two different dye groups tested , the anthraquinonic dye rbbr was decolourised to a greater extent as compared to the three azo group dyes . decolourisation of the monoazo dye methyl red was also greater as compared to the decolourisation of both diazo dyes congo red and orange g. this shows that dyes belonging to chemically different groups are not decolourised to the same extent and the structural differences in the dye molecule strongly affect the decolourisation process . similar results have also been reported on a white rot fungi irpex lacteus which showed a lower efficiency in removal of monoazo and diazo dyes in liquid medium as compared to anthraquinone , phthalocyanine , and triphenylmethane dyes . decolourisation of a monoazo dye , xylidine ponceau , by a basidiomycetous fungal isolate rck-3 was also reported to be more efficient than the diazo dye , congo red . as decolourisation of a dye requires the destruction of the chromophore , the complexity and amount of chromophore a dye carries in its chemical structure therefore determine the resistance of the dye towards decolourisation . decolourisation of the monoazo dye methyl red was also greater as compared to the decolourisation of the diazo dye congo red and monoazo dye orange g even though all three are of the same azo type dye . decolourisation of orange g by isolate ms8 in liquid medium however was surprisingly lower than the extent of orange g decolourisation achieved by the isolate on agar plate . a possible reason for this would be that the presence of dye in liquid medium was much more toxic towards the isolate as compared to the toxicity of dye on agar medium . further quantification of the biomass produced by isolate ms8 with the presence of the tested dye in liquid medium shows that the biomass produced was greatly reduced as compared to the control biomass of the isolate produced in the absence of the dye ( table 2 ) . the presence of azo type dye in liquid medium has previously been reported to reduce gas solubility , and therefore high azo dye concentration can decrease fungal growth . a white rot fungus ischnoderma resinosum , capable of degrading a wide spectrum of chemically and structurally different synthetic dyes , has also been reported to be more sensitive to dyes in liquid culture than in agar plate . the biomass produced by i. resinosum in media containing malachite green and crystal violet also reached only about 10% when compared to the control biomass produced in the media without dyes . besides that , the production of some other dye oxidizing activities by the isolate might also be better on agar as compared to liquid medium . isolate ms8 was selected for further identification based on its morphological characteristic and also by comparison of the its sequences . isolate ms8 is a fast growing fungus with mycelium that covers the whole 90 mm petri dish in 7 days ( figure 3(a ) ) . the fungal isolates , when observed microscopically , showed the presence of clamp connection ( figure 3(b ) ) , the characteristic feature of basidiomycetous fungi . the isolate however did not produce any spore like structures , which normally provided the basis for fungal identification . isolation of a mycelial sterilia , fungi that do not sporulate in culture , such as isolate ms8 however is not uncommon during the isolation of endophytic fungi . for a given host , mycelial sterilia can take up to an average of 20% of the population of fungal endophytes . pcr amplification of the its region of isolate ms8 using a universal primer pair , its1 , and its4 , resulted in a pcr product with an approximate size of 620 bp in molecular weight . comparison of the its sequence with the established fungal its sequences in the genbank through a standard nucleotide - nucleotide blast homology search shows that isolate ms8 shared 99% sequence similarity with a basidiomycetes , marasmius cladophyllus . the sequence had been successfully deposited in genbank database ( accession number : kf241549 ) . a phylogenetic tree was constructed to determine the phylogenetic relationship of isolate ms8 with other marasmius species using m. epiphyllus as the outgroup ( figure 4 ) . the short branches and clustering of isolate ms8 together with m. cladophyllus show that isolate ms8 was closely related to m. cladophyllus . isolate ms8 was also distantly related with m. rotula . on a whole , endophytic fungus ms8 identified to be m. cladophyllus was able to decolourise the 4 different dyes tested especially anthraquinonic dye which was known to resist degradation due to their fused aromatic structures . the dye decolourization ability of this isolate was also comparable to that of white rot fungi such as i. lacteus and thelephora sp [ 27 , 34 ] . novel peroxidases capable of degrading beta - carotene were recently found to be produced by marasmius scorodonius . these novel peroxidases may be assigned to the group of dyp - type peroxidases ( dye decolourising peroxidases ) that is able to degrade synthetic anthraquinone dyes . these novel peroxidases may also be produced by isolate ms8 which was shown to effectively decolourise the anthraquinonic dye , rbbr . further enzymatic studies therefore are necessary in order to elucidate the possible enzymatic activities involved in dye decolourisation by our m. cladophyllus isolate ms8 . endophytic fungi isolated from the medicinal plant m. malabathricum in particular isolate ms8 was able to decolourise both the anthraquinone and azo type of synthetic dye to a different extent . this therefore suggests , that besides white rot fungi , endophytic fungi were also capable of decolourising the synesthetic dyes and of interesting potential to be used in the decolourisation of dyestuff effluents . | a total of twenty endophytic fungi successfully isolated from melastoma malabathricum ( senduduk ) were examined for their ability to decolourise azo dyes : congo red , orange g , and methyl red and an anthraquinone dye , remazol brilliant blue r. initial screening on the glucose minimal media agar plates amended with 200 mg l1 of each respective dye showed that only isolate ms8 was able to decolourise all of the four dyes .
the isolate decolourised completely both the rbbr and orange g in the agar medium within 8 days .
further quantitative analysis of the dye decolourisation by isolate ms8 in aqueous minimal medium showed that isolate ms8 was able to decolourise all the tested dyes at varying levels .
dye decolourisation by the isolate ms8 was determined to be 97% for rbbr , 33% for orange g , 48% for congo red , and 56% for methyl red , respectively , within a period of 16 days
. molecular identification of the fungal isolate ms8 using primer its1 and its4 showed that isolate ms8 shared 99% sequence similarity with marasmius cladophyllus , a basidiomycete . the ability to decolourise different types of dyes by isolate
ms8 thus suggested a possible application of this fungus in the decolourisation of dyestuff effluents . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
by the year 2020 , major depressive disorder ( mdd ) will become the second leading cause of global disease burden.1 it is characterized by a persistent depressed mood , alterations in motivation , and pervasive feelings of guilt and worthlessness , and will affect approximately 15% of the general population.2 although the etiology and pathogenesis of depression is still unclear , the rapid development of neuroimaging technologies have provided improved methods and made it possible to explore brain structure and functional abnormalities in mdd patients.3 past anatomical studies designed to explore whole - brain differences had reported that mdd patients showed smaller gray - matter volume ( gmv ) in some brain regions , such as the frontal cortex,4 temporal gyrus,5 putamen,6 and caudate.7 meanwhile , gmv was found to be increased in the amygdala,8,9 hippocampus,10 and other regions11 in patients with depression . some research has found that gmv deficits in the frontal gyrus , temporal lobe , and insula were negatively correlated with depressive symptoms or illness duration in mdd patients.12,13 the prefrontal cortex volume has been shown to be negatively correlated with risky choices in patients with mdd.14 in addition , decreased gmv of the cingulate cortex has been associated with decreased cognitive performance in patients with depression.15 these findings imply that gmv abnormalities in patients with depression may be correlated with clinical symptoms . in this study , we used magnetic resonance imaging ( mri ) with voxel - based morphometry ( vbm ) , applying the diffeomorphic anatomical registration through exponentiated lie algebra ( dartel ) procedure to investigate the change in gmv in patients with mdd and the relationship between clinical variables . resting - state functional mri ( rsfmri ) scans performed on patients who were in a relaxed state of mind with eyes closed has aroused increasing interest since the study of biswal et al.16 regional homogeneity ( reho ) , a frequently used method , is conducted to analyze the similarities of intraregional time series across the whole brain . moreover , reho reflects the temporal synchrony of spontaneous blood oxygen level - dependent signal rather than its density . therefore , abnormal reho may be relevant to changes in temporal aspects of neural activity in regional areas , and can be used to detect abnormal activity in whole - brain regions of psychiatric disorders in the resting state . as a matter of fact , reho has been widely used to explore the pathophysiology of neuropsychiatric disorders , such as parkinson s disease,17 schizophrenia,18 attention deficit / hyperactivity disorder,19 autism,20 anxiety,21 and mdd.22 as reported in previous studies , mdd had been associated with abnormal neural activity in some brain regions implicated in emotional regulation , such as the dorsal prefrontal cortex , the amygdala , and other regions.8,23 a meta - analysis of neuroimaging studies focused on reho of patients with depression found that the medial prefrontal cortex was increased in depression.24 in addition , reho alterations in depression patients have been identified in many other brain regions , including the anterior cingulate cortex25 or precuneus , and have been shown to correlate with symptom severity or disease duration.26 a previous study showed that besides patients with mdd , those at high risk for mdd also exhibited significantly decreased reho in the right insula and in the left cerebellum.22 furthermore , wang et al found that patients with mdd displayed a reho decrease in the right precuneus after treatment with escitalopram.27 these findings showed that functional alterations in brain regions can be identified using reho in patients with mdd . moreover , reho changes in the precuneus have been found in response to pharmacological treatment in mdd . in this study , we detected regional neural activity in medication - free patients with mdd in the resting state by using the reho method . multimodal neuroimaging techniques , such as structural mri and rsfmri , were used to explore the pathophysiology of depression . nevertheless , it is unclear whether these anatomical alterations and functional deficits contribute independently to depression . previous studies have shown that anatomical and functional brain abnormalities are dissociated in schizophrenia and might contribute independently to the pathophysiology of schizophrenia,2831 while one study reported decreased association between functional activity and regional gmv in schizophrenia.32 recently , a study reported that the dissociation of anatomical and functional abnormalities was also observed in patients with mdd.33 to our knowledge , this is the first study that investigated anatomical and functional alterations simultaneously in the same depression patients . the authors investigated abnormalities of gmv and amplitude of low - frequency fluctuation ( lff ) in patients with mdd , and found that brain structural and functional deficits contribute independently to depression . the aim of the current study was to explore the association between brain functional and anatomical deficits in unmedicated patients with mdd . based on the aforementioned studies,2831,33 we hypothesized that functional and anatomical abnormalities in brain regions would be observed in different brain areas in medication - free patients with mdd . to test this hypothesis , we investigated abnormalities of gmv and reho in unmedicated patients with depression , the interrelationship between these alterations , and their relationship with clinical variables . depressive patients included in our study generally visited their psychiatrist because of depressive relapse after quitting medication . at that time , their physician either asked him / her to contact us or asked his / her permission to be referred to us . fifty unmedicated patients with mdd were recruited from the psychiatry department of west china hospital of sichuan university . major depression was diagnosed by two qualified psychiatrists ( xm and ml ) using the structured clinical interview according to the diagnostic and statistical manual of mental disorders ( dsm)-iv criteria.34 all patients were assessed and scanned as soon as possible ( usually within 3 days ) to prevent treatment delay . patients who had taken psychotropic medications in the previous 3 months before scanning were excluded . in addition , exclusion criteria included age younger than 18 years or older than 60 years , history of loss of consciousness , mental retardation , cardiovascular disease , schizophrenia , bipolar disorder , anxiety disorder , neurological illness , and alcohol or drug abuse . fifty demographically similar ( age- , sex- , and education - matched ) healthy controls were recruited by poster advertisements from the local area . healthy controls were interviewed using the structured clinical interview for dsm - iv , non - patient edition,35 to assure that none of them had a current or past history of depression or other major physical or neurological illness , or substance abuse . this study was approved by the ethics committee of sichuan university , and was conducted according to the helsinki declaration . all patients were scored by two qualified psychiatrists ( xhm and mll ) according to the 17-item hamilton depression rating scale ( ham - d ) and 14-item hamilton anxiety scale ( ham - a ) to assess the severity of symptoms . all scanning was performed on a 3.0 t mr scanner ( achieva ; philips , amsterdam , the netherlands ) using an eight - channel phased - array head coil . foam padding and earplugs were used to minimize head movement and scanner noise . during scanning , participants were often reminded to remain motionless with eyes closed , without falling asleep , and without thinking of anything special ( confirmed by subjects immediately after the experiment ) . high - resolution t1 images were acquired by 3-d magnetization - prepared rapid gradient - echo sequence as follows : repetition time 8.37 ms , echo time 3.88 ms , flip angle 7 , in - plane matrix resolution 256256 , field of view 2424 cm , and number of slices 188 . a total of 240 volumes of echo - planar images were obtained axially with a gradient - echo echo - planar imaging sequence with the following parameters : repetition time 2,000 ms , echo time 3.711 ms , flip angle 7 , in - plane matrix resolution 256256 , field of view 256256 mm , and number of slices 38 . none of the participants had more than 2 mm maximum displacement in x , y , or z and 2 of angular motion during the whole mri scan . for each participant , the fmri scanning lasted for 8 minutes and 6 seconds , and 240 volumes were obtained . all structural data were processed using the dartel36 toolbox with the statistical parametric mapping software package ( spm8 ; http://www.fil.ion.ucl.ac.uk/spm ) . vbm preprocessing involved five steps , and followed the standard approach of ashburner.36 the modulated gray - matter images were smoothed with an isotropic gaussian kernel of 6 mm full width at half maximum to be used in statistical analysis . reho analysis was performed with the data processing assistant for resting - state fmri37 in matlab ( mathworks , natick , ma , usa ) . individual reho maps were generated by calculating kendall s coefficient of concordance ( kcc ) of the time series of a given voxel with those of its nearest neighbors ( 26 voxels ) in a voxel - wise analysis.38 zang et al described the formula for calculating the kcc value in their study.39 after calculating the reho map voxel by voxel , the resulting fmri data were then spatially smoothed with a gaussian kernel of 666 mm full width at half maximum . while functional connectivity approaches measure the temporal correlation of low - frequency fluctuations ( lffs ) between remote brain regions , reho measures the local synchronization of spontaneous fmri,40 which is based on the assumption that lffs within a functional cluster will synchronize with neighboring voxels.24 based on spss version 17.0 , the test for categorical data and student s t - test for continuous variables were used to evaluate differences in demographic characteristics between patients and controls . two sample t - tests contained in spm8 were used to test the differences in gmv and reho values between patients and controls . confounding factors were regressed out , including age , sex , education years , and total volume of gray matter and white matter of each subject . anatomical analyses yielded statistical parametric maps based on a voxel - level height threshold of p<0.001 ( uncorrected for multiple comparisons ) . the statistical results of reho were corrected using the alphasim program , which is based on monte carlo simulations ( http://afni.nimh.nih.gov/pub/dist/doc/manual/alphasim.pdf ) . to determine the overlap between gmv and reho results , brain regions with abnormal gmv or reho were overlaid on the same template . furthermore , brain regions with abnormal gmv and reho were identified as regions of interest . mean values of gmv and reho were extracted for further pearson s correlation analysis between these abnormal values and the ham - d or ham - a scores in the patient group . depressive patients included in our study generally visited their psychiatrist because of depressive relapse after quitting medication . at that time , their physician either asked him / her to contact us or asked his / her permission to be referred to us . fifty unmedicated patients with mdd were recruited from the psychiatry department of west china hospital of sichuan university . major depression was diagnosed by two qualified psychiatrists ( xm and ml ) using the structured clinical interview according to the diagnostic and statistical manual of mental disorders ( dsm)-iv criteria.34 all patients were assessed and scanned as soon as possible ( usually within 3 days ) to prevent treatment delay . patients who had taken psychotropic medications in the previous 3 months before scanning were excluded . in addition , exclusion criteria included age younger than 18 years or older than 60 years , history of loss of consciousness , mental retardation , cardiovascular disease , schizophrenia , bipolar disorder , anxiety disorder , neurological illness , and alcohol or drug abuse . fifty demographically similar ( age- , sex- , and education - matched ) healthy controls were recruited by poster advertisements from the local area . healthy controls were interviewed using the structured clinical interview for dsm - iv , non - patient edition,35 to assure that none of them had a current or past history of depression or other major physical or neurological illness , or substance abuse . this study was approved by the ethics committee of sichuan university , and was conducted according to the helsinki declaration . all patients were scored by two qualified psychiatrists ( xhm and mll ) according to the 17-item hamilton depression rating scale ( ham - d ) and 14-item hamilton anxiety scale ( ham - a ) to assess the severity of symptoms . all scanning was performed on a 3.0 t mr scanner ( achieva ; philips , amsterdam , the netherlands ) using an eight - channel phased - array head coil . foam padding and earplugs were used to minimize head movement and scanner noise . during scanning , participants were often reminded to remain motionless with eyes closed , without falling asleep , and without thinking of anything special ( confirmed by subjects immediately after the experiment ) . high - resolution t1 images were acquired by 3-d magnetization - prepared rapid gradient - echo sequence as follows : repetition time 8.37 ms , echo time 3.88 ms , flip angle 7 , in - plane matrix resolution 256256 , field of view 2424 cm , and number of slices 188 . a total of 240 volumes of echo - planar images were obtained axially with a gradient - echo echo - planar imaging sequence with the following parameters : repetition time 2,000 ms , echo time 3.711 ms , flip angle 7 , in - plane matrix resolution 256256 , field of view 256256 mm , and number of slices 38 . none of the participants had more than 2 mm maximum displacement in x , y , or z and 2 of angular motion during the whole mri scan . for each participant , the fmri scanning lasted for 8 minutes and 6 seconds , and 240 volumes were obtained . all structural data were processed using the dartel36 toolbox with the statistical parametric mapping software package ( spm8 ; http://www.fil.ion.ucl.ac.uk/spm ) . vbm preprocessing involved five steps , and followed the standard approach of ashburner.36 the modulated gray - matter images were smoothed with an isotropic gaussian kernel of 6 mm full width at half maximum to be used in statistical analysis . reho analysis was performed with the data processing assistant for resting - state fmri37 in matlab ( mathworks , natick , ma , usa ) . individual reho maps were generated by calculating kendall s coefficient of concordance ( kcc ) of the time series of a given voxel with those of its nearest neighbors ( 26 voxels ) in a voxel - wise analysis.38 zang et al described the formula for calculating the kcc value in their study.39 after calculating the reho map voxel by voxel , the resulting fmri data were then spatially smoothed with a gaussian kernel of 666 mm full width at half maximum . while functional connectivity approaches measure the temporal correlation of low - frequency fluctuations ( lffs ) between remote brain regions , reho measures the local synchronization of spontaneous fmri,40 which is based on the assumption that lffs within a functional cluster will synchronize with neighboring voxels.24 based on spss version 17.0 , the test for categorical data and student s t - test for continuous variables were used to evaluate differences in demographic characteristics between patients and controls . two sample t - tests contained in spm8 were used to test the differences in gmv and reho values between patients and controls . confounding factors were regressed out , including age , sex , education years , and total volume of gray matter and white matter of each subject . anatomical analyses yielded statistical parametric maps based on a voxel - level height threshold of p<0.001 ( uncorrected for multiple comparisons ) . the statistical results of reho were corrected using the alphasim program , which is based on monte carlo simulations ( http://afni.nimh.nih.gov/pub/dist/doc/manual/alphasim.pdf ) . the statistical threshold for this analysis was set at p<0.001 . to determine the overlap between gmv and reho results , furthermore , brain regions with abnormal gmv and reho were identified as regions of interest . mean values of gmv and reho were extracted for further pearson s correlation analysis between these abnormal values and the ham - d or ham - a scores in the patient group . age ( years ; mdd 31.129.495 , healthy controls 31.309.307 ) , sex ratio ( male : female 19:31 in both groups ) , and years of education ( mdd 13.423.387 , healthy controls 13.523.418 ) were not significantly different between mdd patients and healthy controls ( p>0.05 ) ( table 1 ) . mean ham - d and ham - a scores were 23.104.196 and 16.125.612 , respectively . relative to healthy controls , patients with mdd showed significantly increased gmv in the left posterior cingulate gyrus ( pcg ; montreal neurological institute [ mni ] : x=3 , y=48 , z=8 , voxels = 208 ; p<0.001 , uncorrected ) and significantly decreased gmv in the left lingual gyrus ( lg ; mni : x=25 , y=64 , z=4 , voxels = 251 ; p<0.001 , uncorrected ) ( figure 1 ) . with regard to the reho comparison , patients showed significantly increased reho values in the left precuneus ( mni : x=12 , y=63 , z=60 , voxels = 44 ; p<0.001 , uncorrected ) and decreased reho values in the left putamen ( mni : x=27 , y=6 , z=3 , voxels = 28 ; p<0.001 , uncorrected ) ( figure 2 , table 2 ) . we overlaid the regions with abnormal gmv or reho values on the same template , but found no overlap of brain regions . linear correlation suggested no significant correlation between mean gmv values within regions with anatomical abnormalities and reho values in regions with functional abnormality in the patient group . the structural and functional brain alterations in mdd did not significantly correlate with symptom severity in the patient group ( table 3 ) . age ( years ; mdd 31.129.495 , healthy controls 31.309.307 ) , sex ratio ( male : female 19:31 in both groups ) , and years of education ( mdd 13.423.387 , healthy controls 13.523.418 ) were not significantly different between mdd patients and healthy controls ( p>0.05 ) ( table 1 ) . mean ham - d and ham - a scores were 23.104.196 and 16.125.612 , respectively . relative to healthy controls , patients with mdd showed significantly increased gmv in the left posterior cingulate gyrus ( pcg ; montreal neurological institute [ mni ] : x=3 , y=48 , z=8 , voxels = 208 ; p<0.001 , uncorrected ) and significantly decreased gmv in the left lingual gyrus ( lg ; mni : x=25 , y=64 , z=4 , voxels = 251 ; p<0.001 , uncorrected ) ( figure 1 ) . with regard to the reho comparison , patients showed significantly increased reho values in the left precuneus ( mni : x=12 , y=63 , z=60 , voxels = 44 ; p<0.001 , uncorrected ) and decreased reho values in the left putamen ( mni : x=27 , y=6 , z=3 , voxels = 28 ; p<0.001 , uncorrected ) ( figure 2 , table 2 ) . we overlaid the regions with abnormal gmv or reho values on the same template , but found no overlap of brain regions . linear correlation suggested no significant correlation between mean gmv values within regions with anatomical abnormalities and reho values in regions with functional abnormality in the patient group . the structural and functional brain alterations in mdd did not significantly correlate with symptom severity in the patient group ( table 3 ) . compared to healthy controls , patients with mdd showed significantly increased gmv in the left pcg and decreased gmv in the left lg . functional analysis showed that patients had increased reho values in the left precuneus and decreased reho values in the left putamen . moreover , no significant correlation between mean gmv values or reho values of the regions and clinical variables was found in the depressed group . in our study , vbm - dartel identified increased gmv in the left pcg and decreased gmv in the left lg . previous studies may have found gray - matter reduction in the cg , identifying these abnormalities in elderly depressed patients,41 depressed adolescents,42 and patients with psychotic depression,43 while these structural brain abnormalities were particularly found in patients with a longer course of illness . in addition , depression in late life is frequently associated with medical comorbidity.44 other studies may have been limited by relatively small sample size,45 effect of medication , or the current mood state.46 meanwhile , other investigators also found that selected samples of mdd patients free of medical comorbidity showed a decrease in cg volume when compared with controls.47 however , a meta - analysis showed increased gray matter in the cingulate cortex in medication - washout patients.48 the gmv of cingulate regions in these studies varied . the main factors of such inconsistent results may include mixed samples of patients with mdd . a previous study reported that the pcg was innervated by the serotonergic system,49 which is associated with vulnerability or pathophysiology of depression.50 some studies suggested it may play an important role in the integration of emotional behaviors51 and in the interactions between emotion and cognition.52 vogt et al reported that the pcg may partially underlie self - referential emotional processing,53,54 and it has been further identified to be preferentially involved in affective evaluation of incoming stimuli , crucial to the initiation of aggression.55 besides , the lg was reported to be involved in the visual recognition network and play a key role in global aspects of figure recognition56 and object naming.57 in addition , it was believed to be involved in the perception of emotions when facial stimuli were presented . much evidence has shown that anatomical changes in the pcg and lg may be associated with dysfunction of emotional processing53,58,59 and play a role in emotional processing related to episodic memory.60 alterations in reho reflect functional brain spontaneous neuronal activity , and previous findings of reho have indicated that alterations in regional spontaneous activity existed in depression subjects , especially in mdd.61 on one hand , increased reho values in the precuneus has been reported in early onset treatment - nave depressions.62 the authors suggested that the average reho values in this region could serve as biomarkers to distinguish patients with early onset depression from individuals with late - onset depression . in the current study , reho values of depression patients were found to be increased in the posterior components of the default mode network ( precuneus ) , which was implicated in broad - based continuous sampling of external and internal environments and appeared to serve an important adaptive function . in addition , the alteration in brain regional activity in this region may be implicated in working memory dysfunction63 and may be associated with the cognitive processing of depression.64,65 on the other hand , decreased brain activity in the putamen is consistent with a previous study.66 a study further reported that decreased reho value in the putamen plays a key role in planning and execution of a self - generated novel action.67 all these findings suggest that abnormalities in the precuneus and putamen may be associated with execution function and play a crucial role in the pathogenesis of depression . as mentioned earlier , brain structural and functional changes may play a different role in depression . our current study found that anatomical and resting - state functional deficits existed in different brain regions as a dissociation pattern of brain structural and functional deficits in mdd , especially in gmv and reho analysis . some researchers have found a dissociation pattern of morphometric and functional abnormalities in psychiatric disorders , such as schizophrenia30,68 and depression.33 to the best of our knowledge , this is the first study to use vbm - dartel and reho methods to reveal both anatomical and functional alterations simultaneously in the same unmedicated patients with mdd . as a previous study speculated , the dissociation pattern may have resulted from different analysis methods.33 structure mri is used to identify anatomical deficits in gray matter , while fmri is used to investigate resting - state functional alterations in gray matter . on the other hand , anatomical and functional abnormalities might play different roles in the disease and contribute independently to the neurobiology of mdd . anatomical alterations evolve in a relatively static or slow process,68 which may represent more stable and long - standing changes.69,70 nevertheless , functional deficits may represent physiological changes related to the acute - illness stage,71 and may be normalized after treatment or clinical remission.72,73 furthermore , some studies have reported that anatomical alterations in brain regions may correlate with rumination74 or suicide attempts in depression patients,75 while functional alteration of the brain was found to be possibly related to refractoriness to treatment . the latter change might be an imaging marker for predicting future depression recurrence.76 from the current study , we tentatively speculate that structural and functional deficits are distributed in different brain regions in the same sample of mdd patients , thus providing evidence for the dissociation of the gmv and reho changes in depression . the strength of our study was the inclusion of medication - free patients , excluding the possibility of medication . first , the small sample size may have reduced the general definitiveness of our results , and well - designed studies with a larger sample size are needed . fourth , although a dissociation pattern of brain regions with gmv and reho alterations was observed in unmedicated patients with mdd , the potential roles of functional and structural changes and the interaction between them need further exploration . finally , a follow - up study is needed to clarify the relationship between depression and those significant brain alterations . our study suggests a dissociation pattern of brain regions with anatomical and functional alterations in unmedicated patients with mdd , especially with regard to gmv and reho . this finding implies that functional and anatomical abnormalities of brain regions might contribute independently to the pathophysiology of mdd . | backgroundusing magnetic resonance imaging ( mri ) and resting - state functional magnetic resonance imaging ( rsfmri ) to explore the mechanism of brain structure and function in unmedicated patients with major depressive disorder ( mdd).patients and methodsfifty patients with mdd and 50 matched healthy control participants free of psychotropic medication underwent high - resolution structural and rsfmri scanning .
optimized diffeomorphic anatomical registration through exponentiated lie algebra and the data processing assistant for rsfmri were used to find potential differences in gray - matter volume ( gmv ) and regional homogeneity ( reho ) between the two groups .
a pearson correlation model was used to analyze associations of morphometric and functional changes with clinical symptoms.resultscompared to healthy controls , patients with mdd showed significant gmv increase in the left posterior cingulate gyrus and gmv decrease in the left lingual gyrus ( p<0.001 , uncorrected ) . in reho analysis , values were significantly increased in the left precuneus and decreased in the left putamen ( p<0.001 , uncorrected ) in patients with mdd compared to healthy controls .
there was no overlap between anatomical and functional changes .
linear correlation suggested no significant correlation between mean gmv values within regions with anatomical abnormality and reho values in regions with functional abnormality in the patient group .
these changes were not significantly correlated with symptom severity.conclusionour study suggests a dissociation pattern of brain regions with anatomical and functional alterations in unmedicated patients with mdd , especially with regard to gmv and reho . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 54-year - old man was admitted to the hematology department , robert - bosch - hospital , stuttgart , germany , in early 2010 , with fever ( 39.5c ) , chills , and minor dyspnea that had lasted for 3 days . four years earlier , he had received a stem cell transplant for acute myeloid leukemia , which was in first complete remission after myeloablative conditioning with total body irradiation , 12 gy , and cyclophophamide , 120 mg / kg bodyweight . the post - transplant course was complicated by grade 3 graft - versus - host - disease of the skin and gut , multiple infectious episodes , chronic renal failure ( creatinine level 3 mg / dl , glomerular filtration rate 25 ml / min , urea level 80 mg / dl ) , repeatedly occurring cytomegalovirus replications , and later on extensive chronic graft - versus - host - disease , necessitating continuous immunosuppressive therapy ( tacrolimus , steroids ) , and anti - infective prophylaxis ( dose - adjusted levofloxacin , 125 mg / d , posaconazole , 3 200 mg / d ) , respectively . after admission , chest radiograph revealed no abnormal findings . blood cultures were drawn , and the patient was given empiric antimicrobial drug therapy with intravenous ( iv ) imipenem / cilastatin ( 500 mg/8 h ) and full - dose levofloxacin ( iv 2 250 mg / d ) the same day . the computerized tomography scan revealed a large infiltrate in the right upper lobe . in the initially drawn blood cultures , gram - negative rods were cultivated after 165 h. f. tularensis was suspected on the basis of biochemical identification , and the isolate was sent to the reference laboratory for tularemia for confirmation ( bundeswehr institute of microbiology , munich , germany ) . subsequently ( day 8 after admission ) , the antimicrobial drug therapy was extended to doxycycline ( iv 2 100 mg / d ) . examination of smears originating from the positive blood cultures revealed bacteria that presented as pleomorphic , faintly staining , gram - negative coccobacilli . an aerobic , slow - growing bacterium was recovered from chocolate agar after a 2-day incubation at 37c in an atmosphere of 5% co2 . presumptive identification of the isolate with the gram - negative card on the vitek 2xl instrument ( biomrieux , nrtingen , germany ) indicated f. tularensis . the isolate was sent to the national reference laboratory for tularemia for confirmation and further characterization . the presumptive phenotypic identification of the f. tularensis strain was confirmed by real - time pcr that targeted francisella - specific 16s rdna sequences ( francisella lightmix kit ; tip molbiol , berlin , germany ) , a type b specific real - time pcr that targeted the 23s rdna gene , as well as 23s rdna sequencing . molecular analysis of the 23s rdna sequence and phenotypic determination of macrolides susceptibility ( etest ; biomrieux ) revealed that the isolate represented a strain of f. tularensis holarctica biovar i. antimicrobial drug susceptibility testing was performed according to the current recommendations of the clinical and laboratory standards institute ( 7 ) by using the commercially available , ce - certified micronaut - s - microtiter broth dilution testing system ( merlin , bornheim , germany ) and gave results characteristic for all f. tularensis strains ( table ) . although the strain was susceptible for levofloxacin , according to clinical and laboratory standards institute standards , the mic of 0.25 mg / l was at least twice as high when compared with 69 other f. tularensis subsp . holarctica strains ( 0.031 , n = 11 ; 0.062 , n = 54 ; 0.125 , n = 4 ) ( 7 ) . multilocus variable number of tandem repeats analysis ( 8) demonstrated that the strain clustered with 10 additional german f. tularensis strains from which 3 were isolated from hares found in an area < 20 km from the patient s home . * clsi , clinical and laboratory standards institute ; s , susceptible ; r , resistant . because infection with f. tularensis or other francisella species is relatively infrequent in nature , informative examples of infection in immunocompromised persons are rare . provide a comprehensive review of f. tularensis infections in this patient collective , most of which occur in patients who have had a solid organ transplant or who have aids ( 9 ) . only 2 cases of tularemia caused by f. tularensis in stem cell or bone marrow transplant patients have been reported to date ; 1 patient died because of severe neutropenia ( 10 ) . in the patient described here , tularemia was acquired while he was undergoing prophylaxis with levofloxacin , a potential active agent against f. tularensis . this failure of anti - infective prophylaxis was most probably related to the reduced levofloxacin concentration caused by renal - based dose adaption rather than because the strain had developed fluoroquinolone resistance . although the strain isolated from the blood stream of the patient was susceptible to levofloxacin by an approved microdilution broth assay , heterogeneous resistance against fluoroquinolones could not be completely ruled out for methodologic reasons . it has been well documented that f. tularensis can easily be rendered ciprofloxacin - resistant because of single nucleotide polymorphisms of the quinolone - resistant determining region of gyrase a , but such strains have so far never been isolated from patients with clinical cases ( 11 ) . although doxycycline is not considered the drug of choice for severe tularemia , treatment with iv doxycycline for 16 days was successful for this patient . thus , doxycycline might be a useful alternative for treating cases in which aminoglycosides or fluoroquinolones can not be applied or may have failed . careful and comprehensive survey and questioning of the patient did not definitely reveal the route of infection . the only potential risk factor mentioned was mowing the lawn of his garden close to a forest about 9 days before onset of symptoms . although it remains unproven , this hypothesis is consistent with the molecular epidemiologic results , demonstrating that identical or nearly identical genotypes were found near the patient s home . | we describe a case of human tularemia caused by francisella tularensis subsp .
holarctica in a stem cell transplant recipient with chronic graft - versus - host disease who was receiving levofloxacin prophylaxis .
the infection was characterized by pneumonia with septic complications .
the patient was successfully treated with doxycycline . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
gonadotropins , commonly used in modern assisted reproduction , differ according to their source and amount of luteinizing hormone ( lh ) activity.1 highly - purified human menopausal gonadotropin ( hp - hmg ) uses human chorionic gonadotropin to provide the lh activity . recombinant human follicle - stimulating hormone ( r - hfsh ) numerous clinical trials and systematic reviews have shown comparative live - birth rates for hp - hmg and r - hfsh in women undergoing standard in vitro fertilization ( ivf ) and intracytoplasmic sperm injection ( icsi ) , also reporting higher numbers of oocytes retrieved with r - hfsh.24 even so , cumulative live - birth rates per started fresh cycle are rarely reported , due to short patient follow - up periods and high attrition rates after the completion of the fresh ivf / icsi cycle . this is troubling , because live - birth rates per started fresh cycle are strongly associated with the number of embryos available for transfer , and hence the number of oocytes retrieved,5 implying that outcome of stimulation in a fresh cycle could affect cumulative success rates of the treatment . additionally , it has been demonstrated that success rates may differ according to the fertilization method ( ivf versus icsi)3,6 and type of gonadotropin - releasing hormone analog ( gnrh ) used.7 evidence on the effectiveness of treatments consisting of both fresh and frozen embryo transfer ( fet ) cycles is scarce and incomplete . it has been established that frozen cycles are associated with lower success rates,8,9 although this difference may be attributed to confounding factors : frozen cycles are typically not the first cycles women undertake , and effectiveness declines with successive failed attempts . a recent review found no significant differences between r - hfsh and urinary gonadotropins in frozen cycles,10 although it included only two trials comparing r - hfsh and hp - hmg : one reporting live - birth rates after fresh transfer11 and one reporting cumulative live - birth rates.12 even so , the routine use of fet in general has been demonstrated to increase overall live - birth rates . in the uk , fet was found to increase the cumulative live - birth rate by nearly 16%.13 in addition , the trend towards single - embryo transfers ( sets ) rather than double - embryo transfers ( dets ) has a bearing on the cumulative success rates . even though set has been demonstrated to be less effective than det on a per - cycle basis , there seems to be no significant difference between one cycle with det and two cycles with set.14 also , based on individual patient data from eight trials ( n = 1,367 ) , the live - birth rate in additional frozen sets contributed to a cumulative live - birth rate not significantly lower than the rate after one fresh det ( 38% vs 42% ) , with a minimal risk of multiple gestations and a higher chance of delivering a term singleton live birth compared with det.15,16 simulation studies also suggest that if all good - quality embryos are replaced over multiple fets , repeated set has the potential to produce more live births than repeated det.17 in ivf - treatment programs with embryo cryopreservation , up to 42% of all implantations were able to be derived by fet,18 and fet procedures contribute an additional 25%50% chance of pregnancy for those couples who have embryos cryopreserved.19,20 with advances in embryo cryopreservation , live - birth rates associated with fets have nearly doubled over the past decade,21 thus making combinations of fresh and frozen cycles even more dependent on the availability of supernumerary embryos . from an economic standpoint , as the use of fet can markedly contribute to the overall success of ivf / icsi cycles,22 it can decrease the overall cost of treatment per live birth . in light of the evidence on the importance of the number of oocytes retrieved , the method of oocyte fertilization , and gnrh analog used , economic comparisons of different gonadotropin preparations should incorporate not only evidence on standard ivf and icsi separately but also according to the stimulation protocol ( gnrh long agonist vs gnrh antagonist ) . moreover , they should model the effect of fet and dropout rates on the cumulative live - birth rate rather than limiting the analyses to fresh cycles only . in order to assess the efficacy of hp - hmg and r - hfsh , we designed a rapid literature review of evidence on women undergoing ivf / icsi.23,24 numerous reviews have been conducted to provide evidence for this comparison , including a recent cochrane systematic review comparing urinary and recombinant gonadotrophins.25 the cochrane review was not deemed to be specifically suitable for the purpose of this study s analyses , as it combined studies using hmg or hp - hmg , did not report separately on gnrh agonist / antagonist protocols in ivf and icsi , and used a composite - outcome measure of ongoing pregnancy or live births . even so , we did use it to identify previously known trials and reran the search to include evidence from randomized trials not available at the time of the cochrane review . in brief , trials with patient populations consisting of women undergoing ivf or icsi and randomized to hp - hmg or r - hfsh were eligible for inclusion . we conducted updated electronic searches for trials in medline , embase , and central using the following keywords , and a modified version of the cochrane highly sensitive search strategy : fsh , follicle - stimulating hormone , recombinant , hmg , and human menopausal gonadotropin / gonadotropin . trials including women undergoing transfer from donor oocytes or embryos were excluded . all dosages and durations of gonadotropins were included , in order to truly represent the variability of clinical protocols . we extracted and meta - analyzed data on live births according to the protocol used ( gnrh long agonist / ivf , gnrh long agonist / icsi , gnrh antagonist / ivf , and gnrh antagonist / icsi ) . we meta - analyzed the number of oocytes retrieved separately for gnrh - agonist and gnrh - antagonist protocols . for the meta - analyses , odds ratios less than one and mean difference less than zero favored hp - hmg and vice versa . the intention of this study was to combine fresh and frozen cycles based on the availability of frozen embryos , hence comparative data on numbers of embryos available for freezing were also sought . however , even though studies reported numbers of embryos transferred , available information on additional embryos was inadequate . therefore , in order to model treatment pathways , the number of oocytes retrieved was used as a proxy for the number of embryos available for transfer . to account for embryo - quality criteria required for transfer or cryopreservation , a literature review was conducted to identify source data on the number of good - quality embryos as a percentage of the number of oocytes retrieved . only one such study involving hp - hmg and r - hfsh was identified.26 each patient was simulated individually through up to three cycles , accounting for the availability of good - quality embryos for transfer . the number and quality of available embryos determined whether frozen transfer would take place and whether there would be supernumerary embryos available for cryopreservation . we assumed that if good - quality frozen embryos were available after thawing , frozen transfer would be performed ; if not , then a new fresh cycle would begin . the percentage of patients with embryos surviving freezing / thawing was calculated as 90% , from the most recent swedish registry data.27 the number of embryos transferred ( set vs det ) was also sampled based on the swedish registry data . in addition , we assumed that following a live birth , women would not undergo additional treatments . to model success rates in women starting ivf / icsi treatment and control for possible selection bias , we sought to identify clinical evidence from studies on women who had not been treated previously , and separately for the first , second , and third cycles . among the reports included in the review , only one relatively small study ( n = 127 ) provided live - birth data on patients who had not undergone ivf / icsi prior to randomization,28 in women undergoing an ivf gnrh - agonist cycle . therefore , we used data from a prospective cohort study conducted in norway ( n = 1,136)29 as the source for the base - case economic evaluation . as neither the data from the norwegian cohort study nor meta - analyses of any of the four stimulation protocols reported significant differences for live - birth rates , equal effectiveness was assumed and cost - minimization analysis was conducted . to allow swedish - specific calculation of cost per live birth and utilize crucial data on success rates after set and det , the evaluation was based on the most recent success - rate data from the 2010 swedish ivf registry ( table 1).27 to account for the entire population of patients , we chose the registry success rates . since the registry combines outcomes from all cycles in a sequence , we also analyzed an additional scenario with success rates adjusted for decreasing effectiveness in subsequent cycles . in this scenario , success rates in individual cycles 2 and 3 , relative to cycle 1 , were modeled as 88% ( 23%/26% ) and 72% ( 19%/26% ) , respectively.30 we attributed mean success rates to cycle 2 and multiplied those for cycle 1 by 1.13 ( 26%/23% ) and for cycle 3 by 0.82 ( 19%/20% ) , to reflect relative effectiveness with cycle 1 the most and cycle 3 the least effective . in the base - case scenario , the mean number of oocytes retrieved was obtained from the norwegian cohort study comparing hp - hmg versus r - hfsh,29 where the advantage of r - hfsh was found to be smaller than in the meta - analysis . for this reason , and also to model only patients with no prior treatments , the cohort study data rather than the meta - analysis results were used for the number of oocytes retrieved . individual variation in the number of oocytes retrieved was modeled as a poisson distribution based on the reported mean numbers of oocytes and validated by expert opinion based on distributions of oocyte numbers from a clinical trial2 and human fertilisation and embryology authority ( hfea ) data from the uk.31 the number of embryos available for transfer or freezing was obtained indirectly based on the percentage of oocytes retrieved . this link between oocytes retrieved and embryos was reported by ziebe et al,11 accounting for embryo - quality criteria : minimum quality and top quality . the authors defined the minimum embryo quality as four or more blastomeres on day 3 , while top - quality embryos had seven or more blastomeres , both with 20% fragmentation . based on local expert opinion , in swedish practice six cells are required to meet minimum quality standards , while good - quality embryos are required to have eight cells , also with the same fragmentation criterion . it has also been reported that only embryos with at least seven blastomeres on day 3 and 20% fragmentation were used for cryopreservation,32 meeting the top quality criteria from ziebe et al . as according to expert opinion , in 90% of set procedures only good- or top - quality embryos are used , the figures corresponding to top - quality embryos from ziebe et al were used for set : 11.3% and 9.0% for hp - hmg and r - hfsh , respectively . in det , however , good- and top - quality embryos are used in only 10% of cycles , hence the numbers of embryos of minimum quality from ziebe et al were used : 36.4% and 33.9% , respectively . it was assumed that if a patient is treated with ivf in the first cycle , ivf would also be offered in subsequent cycles , with no option for switching . also , if a patient was treated with set in cycle 1 , set would also be modeled in cycles 2 and 3 . dropout rates after the first and second cycles were taken from an analysis of 4,102 cycles from the german ivf registry,33 as swedish dropout data were not available . drug market prices were provided by merck serono sweden.34 cost of gonal - f ( merck serono , darmstadt , germany ) formulation accounting for at least 90% of the market share ( 900 iu ) was used along with the corresponding formulation of menopur ( 1,200 iu ; ferring pharmaceuticals , copenhagen , denmark ) ( table 2 ) . as this was a cost - minimization analysis , only costs of gonadotropins were considered , assuming the cost of other resources to be identical or captured by treatment tariffs that do not differentiate between stimulation protocols . as no first - cycle - specific data were available from the literature review , gonadotropin use for both ivf and icsi was obtained from the observational study by bjercke et al.29 a recent meta - analysis35 reported the same difference for drug use as found in the registry study for ivf ( 235 iu vs 238 iu , respectively , p = 0.03 ) , but the former did not report data for ivf and icsi separately , hence the observational data were used instead . treatment length in days was also obtained from this study29 : 11.4 days for hp - hmg and 10.8 days ( p = 0.008 ) for r - hfsh in ivf ; 12.3 and 10.9 days for icsi ( p = 0.0001 ) , respectively . no convenience / utility advantage or reduction in drug wastage with the gonal - f pen device compared to syringe injections was considered in the analysis . costs of procedures were derived as the difference between total costs of treatment and costs of drugs . costs of treatment were based on tariffs from two public and two private infertility treatment centers ( table 3 ) . costs were calculated both for public and private centers , and averages from four fertility centers were used . costs of procedures were used to calculate the cost differential associated with longer duration of treatment for hp - hmg . it was assumed that longer treatment increases the average costs of treatment minus costs of gonadotropins proportionately , rather than costs of any specific procedures ; disaggregated cost - of - treatment data were not available . only direct medical costs encompassed by the tariff price were considered . even though difference in treatment length was accounted for in the calculation , it was conservatively assumed that difference in nonmedical , indirect costs and societal costs would be negligible . incremental cumulative values were calculated per patient starting treatment and per live birth for combinations of one , two , and three fresh and frozen cycles . as ivf and icsi cycles are approximately 30 days in duration and up to three fresh treatment cycles can be completed within the course of a single year,13 no discounting was applied in the analyses . in the model , the cohort of 10,000 patients was deemed sufficient for results to remain robust after the model was tested for convergence . variation in individual simulations of public and private centers was comparable to variation between public and private centers . for this reason , even though only results from public centers are reported in detail , the findings are applicable to both settings . the results were reported as live - birth rates , costs per patient starting treatment program , and cost per live birth . due to the relative simplicity of the modeling approach , dictated by the paucity of direct evidence , we addressed uncertainty in a series of scenario analyses , univariate sensitivity analyses , and probabilistic sensitivity analyses ( psas ) . to address combined uncertainty associated with input variables , we varied all uncertain values by 20% . the following variables were included in the psas : number of oocytes retrieved , number of minimum-/good - quality embryos , percentage of embryos surviving cryopreservation , success rates , dropout rates , drug dosage , and treatment length . uniform distributions were used for sampling to account for maximum uncertainty , and all variables were treated as independent , assuming no correlation . psa was run separately for treatments with fresh and frozen cycles , depending on availability of frozen embryos and for treatment with fresh cycles only . meta - analyses of data derived from the included randomized trials demonstrated no significant difference between r - hfsh and hp - hmg regarding live - birth rate for the different stimulation protocols and choice of fertilization with standard ivf or icsi : gnrh - agonist ivf ( odds ratio [ or ] 0.74 , 95% confidence interval [ ci ] 0.541.01 ) , gnrh - agonist icsi ( or 0.85 , 95% ci 0.391.87 ) , and gnrh - antagonist icsi ( or 0.91 , 95% ci 0.661.25 ) ( figure 1 ) . similarly , when the data were combined , the difference was not significant ( or 0.82 , 95% ci 0.661.01 ) . the number of oocytes retrieved was significantly greater in patients receiving r - hfsh compared to hp - hmg , both for gnrh - agonist ( mean difference [ md ] 1.89 , 95% ci 0.763.02 ) and gnrh - antagonist ( md 2.16 , 95% ci 0.74 to 3.59 ) protocols , and for combined data ( md 1.96 , 95% ci 1.022.90 ) ( figure 2 ) . for the cohort of 1,000 patients undergoing up to three fresh or frozen cycles depending on frozen availability , the simulations produced no difference in live - birth rates : 44.62% ( 95% ci 43.64%45.60% ) vs 44.64% ( 43.66%45.62% ) for hp - hmg and r - hfsh , respectively . no differences were found between the comparators in individual treatment cycles when fresh and frozen transfers were combined . when fresh and frozen transfers in cycles 2 and 3 were analyzed separately , r - hfsh was associated with more frozen transfers and hp - hmg with more fresh transfers ; the difference was significant in cycle 2 for both fresh and frozen and in cycle 3 for frozen transfers only ( figure 3 ) . in simulation with only fresh transfers available , no difference in effectiveness of treatments consisting of up to three cycles was found : 43.28% ( 95% ci 42.32%44.26% ) for hp - hmg and 42.58% ( 95% ci 41.61%43.56% ) for r - hfsh . economic simulations showed that using r - hfsh is cost - saving compared to hp - hmg in a combination of fresh and frozen ivf and icsi cycles in sweden , with 43,030 kr for hp - hmg and 40,263 kr for r - hfsh , saving 2,767 kr ( 95% ci 1,5804,057 ) per patient starting treatment . cost savings from using r - hfsh instead of hp - hmg were 6.43% , expressed as percentage of the total cost of treatment with hp - hmg . the difference in treatment cost resulted primarily from the higher cost of treatment with hp - hmg in cycle 2 ( 1,628 kr ) , owing to a greater number of higher - cost fresh transfers with hp - hmg ; r - hfsh was associated with a greater number of less costly frozen transfers ( figure 5 ) . costs of hp - hmg and r - hfsh were 7,917 kr and 8,468 kr , respectively , while the respective costs of procedures were 35,112 kr and 31,795 kr . when only fresh cycles were considered , the total treatment costs were 49,561 kr for hp - hmg and 47,809 kr for r - hfsh , saving 1,752 kr ( 95% ci 483,658 ) per patient starting treatment . the savings from using r - hfsh instead of hp - hmg were 3.54% , expressed as percentage of the total cost of treatment with hp - hmg . the difference in treatment cost was attributed primarily to the slightly higher cost of treatment with hp - hmg in cycle 1 ( 1,140 kr ) and 2 ( 588 kr ) , owing to the higher procedure cost associated with greater treatment length with hp - hmg . costs of hp - hmg and r - hfsh were 10,273 kr and 11,746 kr , respectively , while the respective costs of procedures were 39,288 kr and 36,063 kr . on a per - live - birth basis , r - hfsh was less costly , at 90,195 kr ( 10,282 or $ 13,394 ) compared to 96,436 kr ( 10,994 or $ 14,321 ) with hp - hmg per treatment consisting of up to three fresh or frozen cycles ( figure 6 ) . in simulations restricted to fresh cycles only , the costs per delivery were 114,512 kr ( 13,054 or $ 17,005 ) with hp - hmg and 112,280 kr ( 12,800 or $ 16,674 ) with r - hfsh . table 5 shows the modeled scenarios with alternative input assumptions . in treatments combining fresh and frozen cycles , cost savings from using r - hfsh instead of hp - hmg varied across scenarios from 5.53% to 8.12% , expressed as the percentage of the total cost of treatment with hp - hmg . expressed in currency , the savings per patient starting treatment varied from 2,653 kr to 3,345 kr . in the univariate sensitivity analyses , the results were found to depend on price and dosage of gonadotropin , treatment length , success rates , and number of oocytes retrieved . when unit price of r - hfsh was varied , cost savings from using r - hfsh versus hp - hmg obtained up until the price of r - hfsh increased by 30% based on cost per patient starting treatment and 31.5% based on cost per live birth . for gonadotropin dosage , the break - even point ( no savings ) was reached when dosage of hp - hmg was decreased by 38% to 62% of baseline value . when treatment length was varied , the savings were achieved even with no difference between hp - hmg and r - hfsh up until treatment with r - hfsh was set to be 20% longer than the baseline difference of 0.6 days for ivf and 1.4 days for icsi . variation in success rates did not affect cost per patient starting treatment , but for difference in average cost per live delivery , hp - hmg became more cost - effective when its effectiveness was increased by 11% relative to baseline . cost savings from using r - hfsh decreased with decreasing difference in the number of oocytes retrieved , but the break - even point was only reached with more oocytes retrieved with hp - hmg ( 50% and 70% relative to the baseline difference ) . the probabilistic sensitivity analyses demonstrated that within the varied input range , r - hfsh remains cost - saving in 100% of the simulated cohort per patient starting treatment ( figure 7 ) and 85% per live delivery ( figure 8) . meta - analyses of data derived from the included randomized trials demonstrated no significant difference between r - hfsh and hp - hmg regarding live - birth rate for the different stimulation protocols and choice of fertilization with standard ivf or icsi : gnrh - agonist ivf ( odds ratio [ or ] 0.74 , 95% confidence interval [ ci ] 0.541.01 ) , gnrh - agonist icsi ( or 0.85 , 95% ci 0.391.87 ) , and gnrh - antagonist icsi ( or 0.91 , 95% ci 0.661.25 ) ( figure 1 ) . similarly , when the data were combined , the difference was not significant ( or 0.82 , 95% ci 0.661.01 ) . the number of oocytes retrieved was significantly greater in patients receiving r - hfsh compared to hp - hmg , both for gnrh - agonist ( mean difference [ md ] 1.89 , 95% ci 0.763.02 ) and gnrh - antagonist ( md 2.16 , 95% ci 0.74 to 3.59 ) protocols , and for combined data ( md 1.96 , 95% ci 1.022.90 ) ( figure 2 ) . for the cohort of 1,000 patients undergoing up to three fresh or frozen cycles depending on frozen availability , the simulations produced no difference in live - birth rates : 44.62% ( 95% ci 43.64%45.60% ) vs 44.64% ( 43.66%45.62% ) for hp - hmg and r - hfsh , respectively . no differences were found between the comparators in individual treatment cycles when fresh and frozen transfers were combined . when fresh and frozen transfers in cycles 2 and 3 were analyzed separately , r - hfsh was associated with more frozen transfers and hp - hmg with more fresh transfers ; the difference was significant in cycle 2 for both fresh and frozen and in cycle 3 for frozen transfers only ( figure 3 ) . in simulation with only fresh transfers available , no difference in effectiveness of treatments consisting of up to three cycles was found : 43.28% ( 95% ci 42.32%44.26% ) for hp - hmg and 42.58% ( 95% ci 41.61%43.56% ) for r - hfsh . economic simulations showed that using r - hfsh is cost - saving compared to hp - hmg in a combination of fresh and frozen ivf and icsi cycles in sweden , with 43,030 kr for hp - hmg and 40,263 kr for r - hfsh , saving 2,767 kr ( 95% ci 1,5804,057 ) per patient starting treatment . cost savings from using r - hfsh instead of hp - hmg were 6.43% , expressed as percentage of the total cost of treatment with hp - hmg . the difference in treatment cost resulted primarily from the higher cost of treatment with hp - hmg in cycle 2 ( 1,628 kr ) , owing to a greater number of higher - cost fresh transfers with hp - hmg ; r - hfsh was associated with a greater number of less costly frozen transfers ( figure 5 ) . costs of hp - hmg and r - hfsh were 7,917 kr and 8,468 kr , respectively , while the respective costs of procedures were 35,112 kr and 31,795 kr . when only fresh cycles were considered , the total treatment costs were 49,561 kr for hp - hmg and 47,809 kr for r - hfsh , saving 1,752 kr ( 95% ci 483,658 ) per patient starting treatment . the savings from using r - hfsh instead of hp - hmg were 3.54% , expressed as percentage of the total cost of treatment with hp - hmg . the difference in treatment cost was attributed primarily to the slightly higher cost of treatment with hp - hmg in cycle 1 ( 1,140 kr ) and 2 ( 588 kr ) , owing to the higher procedure cost associated with greater treatment length with hp - hmg . costs of hp - hmg and r - hfsh were 10,273 kr and 11,746 kr , respectively , while the respective costs of procedures were 39,288 kr and 36,063 kr . on a per - live - birth basis , r - hfsh was less costly , at 90,195 kr ( 10,282 or $ 13,394 ) compared to 96,436 kr ( 10,994 or $ 14,321 ) with hp - hmg per treatment consisting of up to three fresh or frozen cycles ( figure 6 ) . in simulations restricted to fresh cycles only , the costs per delivery were 114,512 kr ( 13,054 or $ 17,005 ) with hp - hmg and 112,280 kr ( 12,800 or $ 16,674 ) with r - hfsh . table 5 shows the modeled scenarios with alternative input assumptions . in treatments combining fresh and frozen cycles , cost savings from using r - hfsh instead of hp - hmg varied across scenarios from 5.53% to 8.12% , expressed as the percentage of the total cost of treatment with hp - hmg . expressed in currency , the savings per patient starting treatment varied from 2,653 kr to 3,345 kr . in the univariate sensitivity analyses , the results were found to depend on price and dosage of gonadotropin , treatment length , success rates , and number of oocytes retrieved . when unit price of r - hfsh was varied , cost savings from using r - hfsh versus hp - hmg obtained up until the price of r - hfsh increased by 30% based on cost per patient starting treatment and 31.5% based on cost per live birth . for gonadotropin dosage , the break - even point ( no savings ) was reached when dosage of hp - hmg was decreased by 38% to 62% of baseline value . when treatment length was varied , the savings were achieved even with no difference between hp - hmg and r - hfsh up until treatment with r - hfsh was set to be 20% longer than the baseline difference of 0.6 days for ivf and 1.4 days for icsi . variation in success rates did not affect cost per patient starting treatment , but for difference in average cost per live delivery , hp - hmg became more cost - effective when its effectiveness was increased by 11% relative to baseline . cost savings from using r - hfsh decreased with decreasing difference in the number of oocytes retrieved , but the break - even point was only reached with more oocytes retrieved with hp - hmg ( 50% and 70% relative to the baseline difference ) . the probabilistic sensitivity analyses demonstrated that within the varied input range , r - hfsh remains cost - saving in 100% of the simulated cohort per patient starting treatment ( figure 7 ) and 85% per live delivery ( figure 8) . the results of the review and simulation modeling demonstrated the comparative efficacy of r - hfsh and hp - hmg in terms of live - birth rates . the economic model in the swedish setting additionally demonstrated cost saving per live birth as a result of the increased number of oocytes retrieved with r - hfsh allowing for more cryopreserved embryos and more frozen cycles . since differences in the costs associated with each stimulation therapy exist , a cost analysis performed according to regional prices is important for clinicians , patients , and policy - makers . several previous meta - analyses have compared the efficacy of r - hfsh to that of hmg and hp - hmg.3,7,25,3537 a recent review found no evidence of a difference between hp - hmg versus r - hfsh in ongoing pregnancy rate per started cycle ( 26.7% vs 24.3% ) , embryo transfer ( 33.0% vs 29.4% ) , or live - birth rates per embryo transfer ( 35.1% vs 30.8%).7 most reviews include only trials using gnrh agonists long downregulation and include both standard ivf and icsi patients in the analyses . in addition , they include trials that used hmg or hp - hmg , assuming a similar class effect of individual human gonadotropins . subgroup analyses done to include only women downregulated with a gnrh - agonist long protocol or whose embryos were fertilized using standard ivf have shown a higher probability of success with hmg and hp - hmg.3,37 since across europe the proportion of icsi constitutes 66.5% of fresh assisted reproductive technology cycles , this does not completely represent reality.38,39 additionally , most trials comparing gonadotropins do not report on cumulative live - birth rates per treatment program , embryo quality , or dropout rates in subsequent frozen cycles . this gap in the literature is therefore filled with data from observational studies and ivf registries . furthermore , it should be noted that some reviews limited inclusion of trials based on stimulation characteristics , eg , excluding fixed - dose studies35 or including only published trials.25 in previous economic studies involving sequences of fresh and frozen cycles , probability of oocyte retrieval was typically either not considered or based on incomplete evidence . in a study comparing recombinant and urinary fsh , the number of supernumerary embryos available for cryopreservation was not accounted for.40 the number of frozen embryos available and successfully transferred was modeled using australian and new zealand data in an economic study of impact of maternal age.41 the results depended on availability of embryos for frozen transfer , which were different for different age - groups , leading to a threefold difference in the probability of frozen cycles ranging from 0.27 to 0.77 , depending on maternal age . this study , however , did not aim to compare different stimulation options . in a german model , even though the probability for cryopreservation survival was used , no data on the actual number of oocytes or embryos available for freezing were reported.42 the same effectiveness - data source and simplified architecture of the decision model were adopted in a recent economic evaluation in greece.43 in one study comparing two gonadotropins , probabilities of subsequent frozen cycle , based on expert opinion , were different for the two comparators , but availability of embryos for cryopreservation was not considered.44 the availability of cryopreserved embryos as directly related to the number of oocytes retrieved was modeled previously in the uk.45 in that study , at least three supernumerary oocytes had to be available for a cryopreserved embryo to be offered . this parameter was varied in the sensitivity analysis from 3 to 7 , assuring robustness of the model , but evidence on the number of oocytes in hp - hmg and r - hfsh was obtained from two clinical trials : european and israeli study group ( eisg ) study46 and the menotrophin versus recombinant fsh in vitro fertilization trial ( merit),2 while in this model registry data validated by a meta - analysis were used instead , accounting for different embryo - quality criteria for set and det and efficiency of cryopreservation . the number of oocytes retrieved , success rates , drug dosage , and treatment length were different in the two studies ; importantly , the current analyses were based on a model built on mean values rather than individual data . furthermore , in the uk study , the number of embryos transferred was not modeled to be associated with success rates , whereas in the present study , success rates for set and det were obtained from the swedish registry . the percentage of set modeled on swedish practice was considerably higher than in the two randomized controlled trials . most notably , however , the uk study showed higher cumulative live - birth rates of hp - hmg ( 53.7% , 95% ci 49.3%58.1% ) vs r - hfsh ( 44.6% , 95% ci 40.2%49.0% ) , the advantage resulting from trial data , and model assumptions of success in frozen cycles depending on success in fresh cycles with a decrement applied . since the combined eisg and merit data produced statistically significantly greater success rates in fresh cycles , the advantage of hp - hmg also carried to frozen cycles . that approach , justified as pregnancy in fresh ivf / icsi cycle from which the frozen embryos originated had been shown to be a predictive factor for pregnancy in frozen thawed cycles,47,48 was not used in this cost - minimization analysis ; instead it was based on equal success rates for the two compared options . finally , the uk study did not compare numbers of fresh and frozen cycles per treatment in the two treatment arms , making it impossible to draw conclusions about contribution of the number of oocytes and embryos to the total cost of treatment . another economic evaluation , conducted in the swedish setting , did not address the choice of gonadotropins , focusing on set vs det , but it can be used to compare and cross - validate cost data used in our model.49 this study was based on detailed costing with diagnosis - related groups tariff for individual procedures , unlike in our model , where tariffs covering the entire treatment cycle had been obtained from the centers as 26,873 kr for ivf , 31,023 kr for icsi , and 9,107 kr for fet , and comparable to tariffs used in our study . in our study , however , costs of ovarian hyperstimulation syndrome , miscarriage , maternity , and pediatric care were not considered , following the evidence of no difference in these outcomes between the two compared options . this led to underestimation of total cost per live birth , while the cost differential between treatments was not affected . the cost calculated per live - born child was 197,647 kr in the det group and 218,042 kr in the set group , excluding costs for loss of productivity but including maternal and neonatal costs for up to 6 months postdelivery . in contrast , in our study , cost per live birth was 96,436 kr for hp - hmg and 90,195 kr for r - hfsh . results of an economic evaluation typically depend on drug dosage , which we obtained from the norwegian registry study.29 the discrepancy in dosage between experimental and pragmatic studies could be attributed to the fact that in some trials the starting and daily dosage of r - hfsh was higher than the one commonly used in routine practice,2,46 even though lower dosage of r - hfsh has been found to produce success rates as high as those with the higher dose . in one study , starting doses for r - hfsh varied between 150 and 300 iu.3 in other reviews , gonadotropin dosage was highly heterogeneous and often not meta - analyzed , due to the marked heterogeneity between the data from individual trials . this interindividual variation combined with differences in treatment practice suggests that good - quality large single studies , whether randomized controlled trials or prospective cohorts , can provide more reliable evidence on drug dosage . in a recent observational study restricted to consecutive icsi patients with first cycle only , the mean dosage of r - hfsh was significantly lower than that of hp - hmg ( 1,639.2 vs 2,356.4 iu , p < 0.001).50 this is in line with the norwegian study used in our analysis , also at the same time producing more oocytes and more mature oocytes . gonadotropin - dosage data are available from large registries and have been used in other economic analyses,51 with results favoring r - hfsh ( 2,073 vs 2,540 iu ) , but we used the more recent scandinavian study including only patients who had not been treated previously . had we used the drug dosage from those other registries , our results would be even more in favor of r - hfsh . even so , a recent meta - analysis of 16 randomized studies reported greater mean gonadotropin dose for hp - hmg than r - hfsh ( 235.46 iu , 95% ci 16.62454.30 ; p = 0.03).35 it should be noted that the use of a pen device is likely to have contributed to the efficiency of gonadotropin administration . in a study comparing r - hfsh administered via pen and via syringe , the difference in total drug dosage was 1,909.38 vs 2,100.65 iu ( p < 0.001)52 ; also , duration of stimulation was greater in the syringe group : 9.70 vs 10.47 days ( p < 0.05 ) . interestingly , in this study , the number of embryos available for freezing was also greater in the pen group : 4.56 vs 1.30 ( p < 0.05 ) . registry data is likely to produce effectiveness results different from use of controlled trials . in trew et al,51 r - hfsh was associated with better outcomes than hp - hmg in respect of number of oocytes retrieved ( 11 vs 10 ) , number of mature oocytes retrieved ( 9 vs 8) , number of oocytes / embryos frozen per cycle ( 2.1 vs 1.7 ) , and number of embryos thawed and used in fet ( 0.74 vs 0.67 ) ; p - values for all differences were less than 0.01 . in addition , in a german registry study , live - birth rate following frozen transfers was higher with r - hfsh compared to hmg ( 9% vs 7%).42 efficacy trials are experimental in design , and are used to detect significant differences between competing interventions in a specific control scenario.53 effectiveness studies on the other hand tend to be more pragmatic in nature , allowing natural variability of patient populations , intervention administration , and follow - up durations to factor into the analyses . these studies often show lower success rates , but are closer to real - life conditions . interestingly , there was a discrepancy between the swedish registry data used in our analysis and findings from clinical trials of greater live - birth rates in set than in det.54 this could have resulted from preferential use of det in patients with greater risk factors , such as age , as percentage of set decreased from 98.5% for age < 25 years to 40.3% for age 42 for ivf , and from 85.5% to 31.3% for icsi . another possible explanation is the use of more restrictive embryo - quality criteria in set compared to det . while this discrepancy would be a limitation if the model were used to compare set vs det protocols , it would not affect the conclusions drawn on the use of gonadotropins . one of the highly debated issues is whether embryo cryopreservation offers the same success rates as fresh cycles . it should be noted that the method of cryopreservation has been demonstrated to affect the success rates by both influencing the number of available embryos after thawing and by affecting embryo quality.55 vitrification is becoming accepted as the most preferred method of oocyte and embryo cryopreservation . at present , postthaw survival rates vary between 30% and 78% between centers , depending on prethaw criteria and the stage at which embryos are frozen,56 with vitrification cryosurvival reaching 96.02% and 75.3% embryos having 100% blastomere survival.57 the combination of elective set with an optimized cryopreservation program has been predicted to become the standard of care for routine ivf / icsi treatment.56 meanwhile , in sweden , slow freezing is still the standard practice for embryo cryopreservation . the cost saving in countries using vitrification may be greater than in countries still primarily using slow - freezing techniques . even if embryos are available following thawing , clinicians have questioned the success of these embryos compared with ones produced from a fresh cycle . it has been suggested that controlled ovarian hyperstimulation adversely affects implantation following ivf - et.26 a recent systematic review58 provided limited proof that cryoembryo transfers may in fact be more successful than transfers from fresh cycles . the argument is that when transferring cryothawed embryos , the uterine endometrial lining has returned to normal and is more favorable for implantation . this same theory explains why blastocyst transfers have been demonstrated to have a higher success rate than cleavage - stage transfers.59 indeed , it has been proposed that success rates would increase if all , not only supernumerary , embryos were cryopreserved.57 in this study , which included only patients of age < 38 years , a 27.8% ongoing pregnancy rate was achieved in fresh et contrasted with 39% in frozen et , with a comparable number of embryos transferred . furthermore , the success rates in the first , second , and third or more frozen thawed cycles , when all earlier frozen thawed cycles from the same egg retrieval had failed , were compared , and there was no significant difference in pregnancy or live - birth rate.60 if such a scenario were adopted , success rates following fet would be modeled as higher than in standard fresh cycles , thus further increasing the advantage of r - hfsh in our model . this is further complicated by the assumption in our model of the same success rates for all frozen cycles ; it must however be noted that natural fets are associated with lower success rates compared to estrogen - plus - progesterone cycles.61 the use of cumulative rates per treatment instead of rates following fresh cycles is becoming an important benchmark in reproductive trials and meta - analyses . it has become recognized that by only investigating differences in fresh cycles , the true comparative effectiveness of interventions is often distorted . commonly used interventions including set,14 blastocyst transfers,59 and in this case r - hfsh have different effectiveness portfolios depending on whether evidence is only taken from fresh cycles or from the cumulative success across all fresh and frozen cycles generated from a single stimulation . in most cases , the availability of additional embryos for cryopreservation reduces any comparative advantage of success from fresh cycles only . in the current study , we used the cumulative live - birth rates in the economic model , as this related to true effectiveness of the interventions . one of the key assumptions in our model was the association between the number of oocytes retrieved and the number of embryos available for transfer or cryopreservation . the average number of embryos available for freezing had been found to be strongly dependent on the number of oocytes retrieved , with the cumulative pregnancy rate after stimulated and frozen cycles following a single - stimulation cycle being significantly higher in those with a higher number of oocytes obtained . despite the small reduction in fertilization rate , the retrieval of many preovulatory oocytes produced ongoing pregnancy rates per stimulation ( fresh- plus frozen - cycle embryo transfers ) of 28.3% when six to ten preovulatory oocytes were retrieved and 41.5% when more than ten were retrieved.19 the number of embryos actually frozen can depend on the number of embryos available for freezing , in that some centers require a minimum number of embryos , ie , a single supernumerary embryo may not qualify for cryopreservation . when two embryos are transferred ( det ) and the total number of top - quality embryos is 3.5,62 the remaining single embryo may be lost . this would further disadvantage treatment , producing even marginally fewer good - quality embryos with stringent quality criteria applied . in sunkara et al s study,31 based on the uk hfea data , there was a strong association between the number of oocytes and the live - birth rate that rose with increasing number of eggs up to 15 , plateaued between 15 and 20 eggs , and declined beyond 20 eggs . while this finding and the nomogram constructed by the authors can have practical use at an individual level , it is unlikely that it could be used to predict live - birth rates for different gonadotropins in fresh cycles . a mean difference of one supernumerary oocyte can be of paramount importance in making a subsequent cryocycle possible , with all the economic implications , but a mean difference of one embryo in a fresh cycle between nine and ten embryos can only lead to predicted advantage in live - birth rate of 1% , most likely with no statistical significance , as corroborated by the results of our analysis . embryo quality and selection of embryos for transfer based on quality criteria have been engraved in the minds of embryologists and clinicians since the start of assisted reproduction . it is natural to assume that higher - quality embryos , including on a genetic level,63 have a higher probability of implanting and developing into a normal fetus , eventually leading to a live birth . the specific criteria , however , are difficult to establish , as evidence is limited due to multiple - embryo transfers either confounding the analysis or lacking in the case of set , when additional embryos are not used.64 more rigorous approaches revealed that neither number of cells nor blastomere fragmentation were good predictors of implantation outcome.65 recently , new evidence has disproved these assumptions , and on the contrary has shown that selection based on quality criteria may in fact be decreasing success rates,48,66 highlighting the clinical importance of the number of embryos available for transfer , with its economic implications . furthermore , not only the embryo - quality criteria but also the timing of cryopreservation affects pregnancy and delivery rates.67 with extended postthaw culture time and combined with the greater number of available embryos , success rates would be predictably greater.68 economic evaluations in reproductive medicine are common , especially for treatment interventions , but are often either underreported or lack high - quality methods.69 omission of incremental cost analyses , sensitivity analyses to confirm robustness of the models used , and discounting are the common methodological weaknesses as gauged by international standards . these criteria70 were conformed to during the course of this study with the exception of discounting , noted not to have been undertaken due to the short time horizon . economic studies conducted by a health economist or in a health economics department are often more methodologically sound and relate to the complexities of studies of this nature.69 at the same time , less than half of economic evaluations use live birth as the primary outcome measure , with a fifth using a clinical pregnancy as the desired outcome . we agree with the conclusions of moolenaar and colleagues that long - term effectiveness outcomes are of more importance than surrogate outcomes , and further believe that cumulative live birth is the most appropriate outcome measure in studies of reproductive medicine.69 even though in medical decision - making clinical and cost considerations are important , patient preferences should also be taken into account . a recent study revealed that in terms of stimulation , patients preferred low dose variability , fsh derived from dna technology over highly purified extract from urine from postmenopausal women , and injection pens over conventional syringe and short administration times.71 it can be speculated that patients would also prefer frozen cycles compared to fresh ones , although an unexpectedly large group of swedish patients choose not to use their cryopreserved embryos . in a recent study , 30.6% in the set group and 34.7% in the det group had all their embryos destroyed , and some couples chose to continue with stimulated fresh cycles instead of frozen thawed cycles.72 greater emphasis on more rational choices of treatment options would increase success rates while also reducing the number of multiple pregnancies , lowering treatment cost , and helping patients to meet their preferences . | gonadotropin - releasing hormone - analog type , fertilization method , and number of embryos available for cryopreservation should be incorporated into economic evaluations of highly purified human menopausal gonadotropin ( hp - hmg ) and recombinant human follicle - stimulating hormone ( r - hfsh ) , as they may affect treatment costs .
we searched for randomized trials and meta - analyses comparing hp - hmg and r - hfsh .
meta - analysis showed no significant difference in live births ( odds ratio 0.82 , 95% confidence interval [ ci ] 0.661.01 ) , but a greater number of oocytes with r - hfsh ( mean difference [ md ] 1.96 , 95% ci 1.022.90 ) .
using a cost - minimization model for sweden , accounting for embryo availability , survival following thawing , and patient dropout , we simulated patients individually for up to three cycles .
r - hfsh was found to be cost - saving , at 2,767 kr ( 95% ci 1,5804,057 ) per patient ( 315 or $ 411 ) ; baseline savings were 6.43% of the total hp - hmg cost . in fresh cycles only ,
the savings for r - hfsh were 1,752 kr ( 95% ci 483,658 ) per patient ( 200 or $ 260 ) .
in univariate sensitivity analyses , savings were obtained until the price of r - hfsh increased by 30% or the dosage of hp - hmg decreased by 38%62% of baseline value . in probabilistic sensitivity analysis , r - hfsh was cost - saving in 100% of the simulated cohort per patient and in 85% per live birth ; the respective percentages for fresh cycles only were 97.3% and 73.1% . in conclusion ,
a greater number of oocytes with r - hfsh allows for more frozen embryo transfers , thereby reducing overall treatment cost . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
apnea index, ie , the number of apneas per sleep - hour , frequently gives a better indication of the seriousness of the disorder.1 the term apnea index was probably coined in this quote , a parenthetical remark embedded in the second page of a book that was published in 1978.1 apart from one misgiving,2 the apnea index was endorsed by research groups in the early 1980s,38 but was later replaced by the apnea - hypopnea index ( ahi ) , the average number of apneas and hypopneas per hour of sleep.911 since 1983 , the ahi has also been popularized under another self - explanatory name , the respiratory disturbance index.11 both indices proved helpful in clinical practice , helping to diagnose sleep apnea and make treatment decisions . clinical measures , however , are not necessarily the preferred measures in biomedical science , where modeled variables should accord with sound research methodology . in retrospect , sleep researchers have adopted the ahi and its predecessor too quickly , skipping a formal appraisal of the two variables . only recently do we encounter dissenting writers who question the wisdom of using the ahi in research and suggest numerous alternative measures.1216 this commentary offers a methodical analysis of the scientific merit of the ahi , and questions the indiscriminate use of this variable in research . paraphrasing a familiar idiom on apples and oranges , the merit of counting often depends on the answer to the following question : are we counting apples alone and oranges alone , or are we counting a mix ? whichever definition of a respiratory event is used , it is inconceivable that all apneas and all hypopneas are the same kind of exposure , as far as effects are concerned . for instance , the clinical consequences of not breathing for 60 seconds can not be identical to the consequences of shallow breathing for 30 seconds , and the consequences of accompanying hypoxemia surely depend on its magnitude and duration , not on an arbitrary cutoff point . not surprisingly , the hypopnea definition affects the count of hypopneas,17 yet no agreed - upon definition will solve the underlying problem : all kinds of apples and all kinds of oranges are counted identically in one overly simplified variable . of course , no alternative variable is free of weaknesses either , but deficient measures can still be ranked as better and worse . setting that issue aside , how well do we count apneas and hypopneas ? judging from the literature , the answer seems variable , although several difficulties should be mentioned . the ahi depends on physiological and technical variables including sleep position , sleep stage , ( rapid eye movement [ rem ] versus non - rem ) , scoring rules , and device - related parameters , such as sensitivity , calibration , and the type and quality of the signals.9,12,1822 interestingly , in the era of digital technology , much of the scoring is still done manually , leaving the door open for human error . yet all of these counting - related issues are the prelude for deeper methodological pitfalls of the ahi . the first insight may be gained by a closer look at the name of the variable . rate is a well - defined term in mathematics , denoting the ratio of the change in one quantity to the change in another . in epidemiology and medicine , the denominator of the rate is usually the passing of time , which can be counted in years ( cancer rates ) , days ( case fatality rates ) , hours ( albumin excretion rate ) , minutes ( heart rate ) , or even seconds ( forced expiratory volume in one second ) . some rates quantify the change in discrete variables ( eg , number of heart beats ) , whereas others quantify the change in continuous variables ( eg , volume of exhaled air ) . although there are several kinds of rates , ie , population rate , individual rate , instantaneous rate , hazard rate , and average rate , all of them include some quantity of interest in the numerator and time in the denominator . the acronym ahi contains the word index , but this measure is not some human - made index like the standard and poor s 500 ; it is actually a rate . more precisely , the ahi may be written as the average of the hourly rates of a respiratory event , as shown next . suppose a person sleeps k hours where k is an integer , and n denotes the number of respiratory events during that time . let ni denote the number of events in the i - th hour of sleep ( i=1,2 , k ) , such that n = ni . but the number of events in the i - th hour ( ni ) is related to the rate of events in the i - th hour ( denoted ri ) as follows : ni events/1 hour = ri events / hour . so ni = ri , and , therefore , ahi = n / k = ( ni)/k = ( ri)/k , which is the average of k hourly rates . there is nothing sacred about dividing time into hours . if sleep duration is divided into q intervals of 10 minutes , rather than k intervals of one hour , another ahi ( per 10 minutes ) may be written as the average of q event rates in 10-minute intervals , ( ri)/q . we can not , however , shrink the time intervals infinitely and consider an average of time point ( ie , instantaneous ) rates . the instantaneous rate is a derivative of some quantity ( y ) as a function of time ( t ) , but y = f(t ) is not differentiable when y is the count of events by time t ( because it is not a continuous function ) the former describe properties of objects at discrete time points ( eg , body mass , height , and waist circumference ) , whereas the latter are made up by mathematics ( eg , body mass index and waist - to - hip ratio ) . natural variables make up the causal structure of the natural world ; derived variables do not . natural variables are causes and effects of other natural variables ; derived variables are not.23 rates are not natural variables , and the average rate of a respiratory event is no exception . the ahi is not caused by anything and does not affect anything ; there is no causal parameter behind the association of the ahi with any variable . to think that the ahi itself ( the product of mathematics ) affects the level of sleepiness is analogous to thinking that body mass index , also a product of mathematics , affects the level of blood glucose . both are examples of thought bias,2325 which is ubiquitous in science . and as harsh and scary as the last claim might sound , it is solidly true and yet to be challenged . first , many rates , such as the mortality rate or the rate of lung cancer , do not claim to be more than what they are , ie , the frequency of some event . second , some rates may also be used to impute the unknown values of natural variables of interest . for instance , airflow ( liters per second ) serves to measure the speed at which air moves , and the forced expiratory volume in one second provides information about airway obstruction , which is actually the airway diameter . likewise , the heart rate tells us not only about the frequency of a heartbeat , but also about the condition , or location , of the governing pacemaker . derived variables , including rates , may sometimes serve as substitutes for natural variables,25 provided we explicitly state what they are supposed to measure . scientific inference thrives on explicit , precise assumptions , which may be false , but should not include the apologetic phrase do not really know . scientists are allowed , perhaps even encouraged , to remain uncertain about whether a is a cause of b , but they may not declare uncertainty about what a and b stand for.26 a measurement in science must be coupled with an explicit theory of what is assumed to be measured , because a measured variable is merely a substitution for some variable of interest.23,25 yet all too often a measurement takes on a life of its own , absurdly becoming the focus of the inquiry . in retrospect , that was the case with the ahi . for the most part , researchers did not bother to state what exactly is being measured by that index . what does the average rate of a respiratory event substitute for ? if probed about the causal variable of interest , many researchers would probably answer severity of sleep - disordered breathing or some related idea , such as the level of physiological stress or the tendency of the upper airway to collapse they are abstract nouns . if anything , the ahi must substitute for some physical property : upper airway pressure , upper airway diameter ( in the obstructive type ) , excitation of respiratory muscles ( in the central type ) , and the volume of inhaled air to name a few examples . that a single derived variable can substitute for more than one natural variable does not dismiss the duty of researchers to state which natural variable they claim to be measuring . consider a linear regression model that an analyst might fit :
log(ahi+0.1)=0+1neck+v+ewhere neck is neck circumference , v denotes a vector of all so - called covariates , and denotes a vector of their coefficients . without an explicit theory of what is being measured by the ahi and neck , a reader may claim that both variables substitute for upper airway pressure at a given moment . if so , 1 in this model is an absurdity , ie , an attempt to estimate the effect of a variable on itself . on the other hand , if the researchers state that neck circumference substitutes for the volume of fat around the upper airway and the ahi substitutes for subsequent upper airway diameter , they may claim that 1 estimates the effect of the former on the latter . as that example shows , a regression model can correspond to two theories , one logical and another absurd , but a model may not correspond to we are not sure what we have measured . to model a variable without an explicit theory of what is assumed to be measured is a mathematical exercise , not science,26,27 because no one can corroborate or negate an unspecified causal theory . if we are interested in the causes of sleep apnea , the ahi may be the dependent variable , substituting for a specified physical property as illustrated in the last example . on the other hand , the ahi is rarely , if ever , the preferred choice whenever we study the possible consequences of sleep apnea , such as sleepiness , stroke , blood pressure , and death . several lines of reasoning argue against modeling the ahi as an independent variable . first and foremost , the hallmark of sleep apnea , whether obstructive , central , or mixed , is reduced volume of inhaled air ( which might lead to hypoxemia , sympathetic surges , and microarousals ) . that type of exposure calls for modeling assumptions , and it is unclear why the average frequency of a respiratory event is a better model than the number ( and type ) of respiratory events , the total duration of respiratory events,13 or other proposed measures.1416 by analogy , which variable better captures exposure to cigarette smoke while awake : the rate of cigarette smoking or the total number of cigarettes smoked ? why do researchers prefer to model , for instance , pack - years of smoking rather than a smoking disturbance index , ie , the average number of cigarettes smoked per hour of wakefulness ? any logic behind a preference for the respiratory disturbance index in sleep research should have carried to the smoking disturbance index in smoking research . second , modeling the ahi leads to excessive information bias that can be avoided by using alternative variables . consider two people who share the same value of the ahi , say 10 , one of whom usually sleeps 7 hours each night them , for example , according to the volume of inhaled air during sleep . if researchers think that the interval between successive events might play the role of an effect modifier,28 they may fit an appropriate model ; for example , include a product term that contains event - free sleep duration . as already discussed , distinguishing between apneas and hypopneas and taking event duration into account should be considered as well . third , sleep duration is not only the denominator for the rate of a respiratory event , but is also a variable that substitutes for whatever sleep is supposed to achieve . since sleep and sleep apnea share some effects of interest ( eg , daytime sleepiness ) , the logic of putting sleep duration in the denominator of the ahi is far from clear . one theoretical exception aside,29 confounding bias is not removed by dividing the exposure variable ( the number of respiratory events ) by the confounder ( sleep duration ) . as we just saw , the denominator of the ahi plays a dual role . on the one hand , it is the usual time interval for rate computation , but on the other hand it is a variable that captures sleep duration per se . given the latter role , we may view the ahi not only as a rate that substitutes for some physical property , but also as a ratio of two variables , ie , the number of respiratory events ( n ) divided by sleep duration ( s ) . informally , n may be some measure of sleep apnea during the night and s may be some measure of battery charge upon awakening . is there any justification for modeling the ratio of two variables as an independent variable ? systolic blood pressure=0+1n / s+v+elog ( death rate)=0+1n / s+v to answer this question , we should first ask ourselves what we have in mind when we model n / s in these equations . if we claim that n / s substitutes for a natural variable , and name it , we are partially safe . the ratio may be considered an imputation of the unknown values of that variable , analogous to any measurement.23 of course , the substitution may still be criticized for having information bias , as argued in the previous section . in all other circumstances , modeling a ratio such as n / s is unjustified because the model entails excessive bias or misspecification of causal relations . if only n ( or whatever n is measuring ) affects the outcome of interest , division by s adds information bias by creating a variable ( n / s ) , the distribution of which differs from that of n. if only s ( or whatever s is measuring ) affects the outcome , the error might be compounded by unexplained modeling of 1/s , rather than s , on top of detrimental multiplication by n. and if both n and s affect the outcome , neither the effect of n nor the effect of s is estimated by the coefficient of their ratio ( misspecification ) . at best , we may view the ratio n / s as an interaction term . for instance :
log ( death rate)=0+1n(1/s)+v but that does not solve the problem either . interaction models , serving to estimate effect modification between two causes of some outcome,28 can be interpreted properly only when the components of the product term are included as well.30 if researchers hold a theory of effect modification between sleep apnea and sleep duration , they should fit the following model :
log ( death rate)=0+1n+2s+3ns+v lastly , even under the paradigm of predicting the outcome , ignoring cause - and - effect relationships , modeling the ratio alone might be worse than modeling one of its components , or worse than modeling the ratio together with its components.30 although there is some justification for modeling the ahi as the dependent variable , modeling of the ahi as an independent variable is rarely justified . the number and type of respiratory events overnight , their total duration,13 and other recently proposed variables1416 are better models of exposure to sleep apnea . apnea index,1 the same first author preferred to report the total number , or duration , of nocturnal apneas,31,32 rather than their number per sleep - hour . what caused him to change his mind is unclear , but the effect of his casual remark lasted for many years . should previous studies that used the ahi as an exposure variable be declared useless ? not at all . in retrospect , we may ( awkwardly ) view the ahi as a measure of the total number of respiratory events , just as we may ( awkwardly ) view the body mass index as a measure of body fat . in both cases , we can save the model by admitting to have mistakenly added some information bias by dividing the numerator ( the preferred measure ) by another variable . moreover , we may argue that the bias is negligible or small , because sleep duration , s , does not vary greatly among many people , and n / s is highly correlated with n. notwithstanding their saving of past work , post hoc arguments do not justify perpetuating a recognized methodological mistake , regardless of its practical significance . many of the arguments presented here extend to other ratio variables that are commonly used in sleep research : the arousal index , percentage of time in desaturation , and percentage of time in each sleep stage . in fact , the modeling of ratios has been harshly criticized in other branches of science as well.29,30,3337 however , the lessons offered are far more general . first , a variable that is useful in clinical practice is not necessarily the preferred variable in biomedical science . second , we should never accept a new variable into science on the basis of feelings or authority . third , if the analyzed variable is a derived variable , researchers should explicitly state which natural variable they claim to be measuring . and if they are unwilling to commit to a clear theory,38 they are not in the business of science.26 | despite the widespread use of the apnea - hypopnea index in research , its scientific and statistical properties have not been examined thoroughly .
the index may be viewed either as a rate ( number of events per hour of sleep ) or as a ratio of two variables ( number of events / number of hours of sleep ) . when considered as a rate
, the apnea - hypopnea index may be modeled as the dependent variable , provided that researchers explicitly state which physical property they assume to be measuring . on the other hand ,
the index is rarely , if ever , the preferred model of exposure to sleep - disordered breathing ( an independent variable ) , regardless of whether it is considered a rate or a ratio variable . continued indiscriminate use of the apnea - hypopnea index in sleep research should be discouraged . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
bony defects in the cranial skeleton can occur as a result of congenital defects , acquired injuries or ablative tumour resection . in the present day scenario , increased survival because of body armour and advanced emergency and trauma medicine has resulted in patients once not considered amenable for survival being aggressively treated . reconstruction of the calvarium is required for both cosmetic and functional reasons , i.e. , mechanical protection of the brain and prevention of low pressure syndrome . since successful spontaneous calvarial reconstruction only occurs in infants younger than two years of age , a variety of materials have been proposed to restore such defects including autogenous bone grafts , allogenic banked bone , alloplastic materials ( such as calcium ceramics , polymers , etc . ) and tissue - engineered bone scaffolds seeded with osteoprogenitor cells and growth factors . the multitude of methods reflects that each technique has its own shortcomings as well as the need for new and improved treatment options . we chose the high - density porous polyethylene ( hdpe ) implant since[511 ] the porous nature of the implant allows soft tissue ingrowth , there is less incidence of infection , it can be used in proximity to paranasal sinuses and it is also feasible where previous alloplastic cranioplasties have failed due to infection . furthermore , using the hdpe cranial hemisphere implant with its pre - formed convexity makes the reconstruction simpler and faster to perform than using sheets and is particularly useful for moderate to large skull defects . we used the hdpe implant in seven patients over a three - year period , from october 2007 to december 2010 , for reconstruction of moderate to large cranial defects ( > 8 cm ) . cranial defects were classified as small , medium and large in respect of their largest diameter , which is the most important parameter particularly for stability [ table 1 ] . size of calvarial defect all of our patients were males aged 19 to 55 years . all defects were located in the fronto - temporo - parietal region of the skull . the average interval following the initial surgery was 5 months ( range , 39 months ) . the recommended interval following the last neurosurgery is 3 to 6 months in order to allow intracranial pressure to return to normal , the tissue bed to mature and decrease chances of infection . computed tomography ( ct ) scan with 3d reconstruction was the imaging modality of choice for accurate evaluation of the bony defect . a detailed written informed consent was obtained from all patients after explaining the various options for cranioplasty and the nature , merits and possible adverse effects of the implant . all the procedures were performed under general anaesthesia and preceded by the infiltration of a solution containing adrenaline ( 1 in 5 lacs dilution ) and hyaluronidase ( 1500 iu ) in 500 cc ringer 's lactate . the infiltration serves the dual purpose of achieving haemostasis and creating a plane of dissection between the dura and overlying tightly adherent skin , scar tissue and in one case skin graft . in order to avoid placing the implant directly under the surgical incision , the most common approach used was the bicoronal approach in four patients ( 57% ) and a new incision in one patient ( 14% ) , although we did place it through the pre - existing incision in two patients ( 29% ) . in all cases , we used the hdpe cranial hemispheres that were further shaped as per the defect requirements with mayo scissors or scalpel to a size slightly larger than the defect , so that it does not dip into the defect and produce a visible step in the contour . implant edges were feathered with a scalpel blade to obtain a smooth contour to the surrounding bone or a high - speed drill may be used to create a shelf at the edge of the craniotomy defect . additional moulding of the convexity can be achieved by placing the implant in a hot sterile bath for several minutes . fixation was performed with titanium miniplates and screws or polydiaxone sutures [ figure 1a ] . in very large defects , dural hitch sutures are taken between the dura and pericranium / galea which will hold the dura tightly against the bone / implant to prevent accumulation of fluid / haematoma in the extradural space . for the surgical closure , well - vascularised tissue was used for obliteration of dead space and for implant coverage . a galeopericranial flap [ figure 1b ] was used in five patients ( 71% ) , one patient had previous free latissimus dorsi ( ld ) flap which was re - draped over the implant and one patient had tissue - expanded scalp flaps rotated and transposed over the implant . fixation of medpor implant to edges of the skull defect with pds sutures bipedicled galeopericranial flap raised and transposed over the implant all patients received pre - operative antibiotic prophylaxis . the patients were followed up to observe for any complications or complaints related to the implant . the average follow - up period was 18 months ( longest3 years and shortest6 months ) . in order to avoid placing the implant directly under the surgical incision , the most common approach used was the bicoronal approach in four patients ( 57% ) and a new incision in one patient ( 14% ) , although we did place it through the pre - existing incision in two patients ( 29% ) . in all cases , we used the hdpe cranial hemispheres that were further shaped as per the defect requirements with mayo scissors or scalpel to a size slightly larger than the defect , so that it does not dip into the defect and produce a visible step in the contour . implant edges were feathered with a scalpel blade to obtain a smooth contour to the surrounding bone or a high - speed drill may be used to create a shelf at the edge of the craniotomy defect . additional moulding of the convexity can be achieved by placing the implant in a hot sterile bath for several minutes . fixation was performed with titanium miniplates and screws or polydiaxone sutures [ figure 1a ] . in very large defects , dural hitch sutures are taken between the dura and pericranium / galea which will hold the dura tightly against the bone / implant to prevent accumulation of fluid / haematoma in the extradural space . for the surgical closure , well - vascularised tissue was used for obliteration of dead space and for implant coverage . a galeopericranial flap [ figure 1b ] was used in five patients ( 71% ) , one patient had previous free latissimus dorsi ( ld ) flap which was re - draped over the implant and one patient had tissue - expanded scalp flaps rotated and transposed over the implant . fixation of medpor implant to edges of the skull defect with pds sutures bipedicled galeopericranial flap raised and transposed over the implant all patients received pre - operative antibiotic prophylaxis . the patients were followed up to observe for any complications or complaints related to the implant . the average follow - up period was 18 months ( longest3 years and shortest6 months ) . the hdpe cranial hemisphere was used in seven patients , following neurosurgeries that required cranioplasty . in our study , the implant was most commonly used after a partial / hemi - craniectomy for post - traumatic decompression as a delayed secondary reconstruction . location of cranial bone defects the defect sizes were 10 cm on average in the greatest dimension , range 7 to 19 cm . requirements of each defect were evaluated in terms of bone and soft tissue cover [ table 3 ] . bone / soft tissue requirement of the defect we had good aesthetic results [ figures 2a and b ] with no patient dissatisfaction or complications such as infection , implant exposure , etc . pre - operative view of patient with frontal craniectomy defect following transpalatal bullet injury good long - term post - operative result of the same patient at 1 year this patient had a post - decompressive craniectomy defect in the frontal region [ figure 3a ] , had undergone three previous cranioplasties , once with his own banked bone flap and twice with alloplastic materials ( polymethylmethacrylate [ pmma ] and silicone ) , all of which had got infected and needed removal . he presented to us with a persistent discharging sinus and tethered forehead skin [ figure 3b ] . on exploration , a piece of polypropylene ( prolene ) mesh , which is often the backing for silicone implants , was found in the sinus tract [ figure 3c ] and removed and the defect filled with a local galeopericranial flap . in view of the post - surgical scarring , we felt that the soft tissue quality was too poor for stable implant coverage . hence , we opted for a free ld musculocutaneous flap to restore the skin deficit and provide bulk to fill in the dead space and simulate bony contour [ figures 4a and b ] . the problem that followed was repeated sagging of the flap due to its inherent bulk and lack of periosteal attachments despite two revision procedures . therefore , a final decision was taken to place an hdpe implant under cover of the free flap [ figure 5a and b ] . late post - operative results after final stage of reconstruction are seen in figure 6 . ( a ) three - dimensional ct scan showing large frontal bone defect in a case of complicated cranioplasty , ( b ) pre - operative view of the patient showing puckered forehead skin with sinus , ( c ) intra - operative photo showing remnant of prolene mesh post - operative result following free ld flap with sagging of forehead over the right eyebrow post - operative ct scan showing excess bulk of the ld flap intra - operative view of medpor cranial hemisphere in situ ld muscle re - draped over the implant for soft - tissue coverage early post - operative result at one year showing stable contour ( frontal view ) the patient had a post - traumatic composite skull defect with skin graft placed directly over the dura . she initially presented with a cerebrospinal fluid leak and unstable scar which were managed conservatively [ figures 7a and b ] . six months after the wounds had settled , we planned a secondary reconstruction of her composite defect with tissue expansion to provide skin cover and hdpe to replace bone . two tissue expanders were placed as shown in figures 8a and b. serial tissue expansion was carried out over a period of eight weeks [ figures 9a and b ] . at the time of final surgery , hydrodissection was essential prior to reflecting the skin graft without breaching the underlying adherent dura . a posteriorly based scalp flap was transposed and a laterally based flap was advanced to cover the hdpe implant placed in the calvarial defect [ figures 10a and b ] . post - operative results show excellent cosmetic restoration of the hair - bearing scalp [ figures 11a and b ] . ct scan of patient with left temporal region composite defect pre - operative view of patient showing skin graft with unstable scar on left temple crescentric tissue expander placed in left parietal region through radial incision near midline rectangular tissue expander placed in left mastoid region serial tissue expansion over 8 weeks ( frontal view ) lateral view of tissue expanders in situ showing external ports medpor implant contoured to defect size scalp flaps transposed / advanced over the implant post - operative frontal view at 6 months post - operative frontal view at 6 months this patient had a post - decompressive craniectomy defect in the frontal region [ figure 3a ] , had undergone three previous cranioplasties , once with his own banked bone flap and twice with alloplastic materials ( polymethylmethacrylate [ pmma ] and silicone ) , all of which had got infected and needed removal . he presented to us with a persistent discharging sinus and tethered forehead skin [ figure 3b ] . on exploration , a piece of polypropylene ( prolene ) mesh , which is often the backing for silicone implants , was found in the sinus tract [ figure 3c ] and removed and the defect filled with a local galeopericranial flap . in view of the post - surgical scarring , we felt that the soft tissue quality was too poor for stable implant coverage . hence , we opted for a free ld musculocutaneous flap to restore the skin deficit and provide bulk to fill in the dead space and simulate bony contour [ figures 4a and b ] . the problem that followed was repeated sagging of the flap due to its inherent bulk and lack of periosteal attachments despite two revision procedures . therefore , a final decision was taken to place an hdpe implant under cover of the free flap [ figure 5a and b ] . late post - operative results after final stage of reconstruction are seen in figure 6 . ( a ) three - dimensional ct scan showing large frontal bone defect in a case of complicated cranioplasty , ( b ) pre - operative view of the patient showing puckered forehead skin with sinus , ( c ) intra - operative photo showing remnant of prolene mesh post - operative result following free ld flap with sagging of forehead over the right eyebrow post - operative ct scan showing excess bulk of the ld flap intra - operative view of medpor cranial hemisphere in situ ld muscle re - draped over the implant for soft - tissue coverage early post - operative result at one year showing stable contour ( frontal view ) the patient had a post - traumatic composite skull defect with skin graft placed directly over the dura . she initially presented with a cerebrospinal fluid leak and unstable scar which were managed conservatively [ figures 7a and b ] . six months after the wounds had settled , we planned a secondary reconstruction of her composite defect with tissue expansion to provide skin cover and hdpe to replace bone . two tissue expanders were placed as shown in figures 8a and b. serial tissue expansion was carried out over a period of eight weeks [ figures 9a and b ] . at the time of final surgery , hydrodissection was essential prior to reflecting the skin graft without breaching the underlying adherent dura . a posteriorly based scalp flap was transposed and a laterally based flap was advanced to cover the hdpe implant placed in the calvarial defect [ figures 10a and b ] . post - operative results show excellent cosmetic restoration of the hair - bearing scalp [ figures 11a and b ] . ct scan of patient with left temporal region composite defect pre - operative view of patient showing skin graft with unstable scar on left temple crescentric tissue expander placed in left parietal region through radial incision near midline rectangular tissue expander placed in left mastoid region serial tissue expansion over 8 weeks ( frontal view ) lateral view of tissue expanders in situ showing external ports medpor implant contoured to defect size scalp flaps transposed / advanced over the implant post - operative frontal view at 6 months post - operative frontal view at 6 months trauma is the predominant aetiology for skull defects as seen in our study and corroborated by various authors . whatever the cause , these defects lead to functional ( neurologic ) debility , social embarrassment due to disfigurement and an economic burden . the need for their reconstruction has lead to the development of many reconstructive techniques using autografts , allografts and various alloplastic materials . the donor sites for autogenous materials include split rib grafts , iliac crest bone graft from the inner table and split calvarial bone graft from the inner or outer table . though autogenous bone grafts are the gold standard for craniomaxillofacial reconstruction , they have several disadvantages including donor site morbidity , graft resorption , additional operative time and insufficient donor resources , especially in very large defects . allogenic bone carries the risk of disease transmission , immunological reactions and possibly graft - versus - host disease . the options for alloplastic materials include the following :
polymers - pmma , silicone , hdpe ( medpor ) , polyether - ether ketonecalcium ceramics - calcium hydroxyapatite ( ha ) , calcium phosphatestitanium mesh
polymers - pmma , silicone , hdpe ( medpor ) , polyether - ether ketone calcium ceramics - calcium hydroxyapatite ( ha ) , calcium phosphates the properties of an ideal bone substitute include biocompatibility , ease of moulding to the defect with fast setting time , durability , radiolucency to allow radiographic assessment , non - conductivity , easily available , sterilisable , inexpensive , osteoconductive and osteoinductive . however , alloplastic materials such as those mentioned above are not the most appropriate options for the paediatric or adolescent patient . as the cranial vault of these patients undergoes further ossification and remodelling , autogenous or allogenic bone grafts are a better option because of their capacity for osseointegration and grow with the child 's skull . one of the most widely used alloplastic materials is pmma , also known as bone cement . however , pmma has many disadvantages including the exothermic reaction produced during the curing process and significant rate of infection when used adjacent to the paranasal sinuses . other types of bone cement are calcium phosphate and ha which have advantages such as biocompatibility and osteoconductivity . however , because of the unacceptably high complication rate with the use of calcium - based bone cements in large skull defects , many authors believe that their use is contraindicated . however , it is radio - opaque and produces image artefacts on post - operative ct and mri scans , making it less preferred to radiolucent alloplasts . hdpe is composed of hdpe microspheres that are sintered to create a framework of interconnecting pores approximately 100 to 250 m in diameter . it is available in a variety of shapes and sizes . for calvarial reconstruction , cranial hemispheres they have a 4 - 6 mm thickness and are available in left and right versions . they are particularly useful in the frontal and parietotemporal regions where excessive bending of the hdpe sheets is needed to match the skull curvature and give a good cosmetic result . in large skull defects ( > 8 cm ) , too much bending of the implant also decreases the strength of the construct . customised implants are created from high - resolution , three - dimensionally reconstructed ct scans . cranial hemispheres provide a cheaper , off - the - shelf alternative to these customised implants . the hdpe implant material is easy to use , can be carved with sharp instruments , sheets can be easily cut with scissors , sutures can be passed through it and it is easily stabilised with miniplates and screws . it remains stable after many years of use in human beings with studies having a follow - up period of more than 30 years . these characteristics make the surgical procedure simpler than with other cranioplasty materials . the simplicity of implantation shortens the operative time , as verified by hong et al . in a study comparing porous polyethylene implant with pmma . the absolute operation times were shorter using the hdpe implant and the differences were statistically significant ( p=0.030 ) . the radiolucent property of hdpe is an advantage while doing post - operative neuroimaging with ct or mri scans [ figure 12 ] . post - operative ct scans illustrating the radiolucent property of medpor implant the large and stable pores of hdpe promote a rapid bony and fibrous ingrowth into the implant which in turn minimises capsule formation , anchors the implant and maintains the local host immune response . used scanning electron microscopy to conclusively demonstrate the ingrowth of fibrovascular host tissue into the medpor implant after 3 months . several studies have found that there was bleeding from the cut surface of the implant during revision surgery . did serial follow - up ct images of patients which showed an increase in the hounsfield ( hf ) units of the implant , particularly at the marginal areas which was considered to be indirect evidence for the ingrowth of vascularity , soft tissue and bone from the bony edge of the defect . thus , the vascular ingrowth protects the implant from infection and the several millimetres of bone ingrowth into the implant serves as a stable interface with a high tensile strength that anchors the implant . this property also makes hdpe safe in reconstruction adjacent to the paranasal sinuses which is advantageous while reconstructing the frontal bone . well - vascularised tissue should be used for obliteration of dead space and implant coverage to minimise chances of exposure post - operatively in case of wound dehiscence . a galeopericranial flap serves this purpose and was used in 5 out of 7 patients in our series ( 71% ) . the implant may be placed deep to temporalis muscle , tissue - expanded local flaps or free flaps , as the situation demands . reduced blood supply of the scalp skin following repeated surgeries necessitated a prior free flap in one patient which was re - draped over the implant at the time of hdpe insertion . one patient had a composite defect involving skin and bone for which tissue expansion was carried out . this has the added advantage of increasing scalp vascularity , providing a thick capsule for implant cover and restoration of hair - bearing skin . it is particularly useful after wound infection , because of scalp atrophy , poor nutritional condition and tense sutures . as far as possible , the surgical incision should be remote from the underlying implant . thus , in the event of wound gape , the chances of implant exposure are reduced . to this end , we have used the bicoronal approach in the majority of patients ( four out of seven ) . hdpe is safe to use even when previous alloplast cranioplasties have failed , as seen in our first case report . had a similar experience with a patient with two cranioplasties and two revision operations owing to infection . overall , our patients were satisfied with the aesthetic results of the alloplast augmentation , as evaluated during post - operative follow - ups , over an 18-month period on average ( range , 3 years to 6 months ) . we have achieved excellent cosmetic results and no implant - related complications such as infection , extrusion , migration or exposure of the implant . ( 140 cases of open facial fractures ) , yaremchuk ( 370 facial implants over 11 years , liu et al . ( 611 cases of small to medium cranioplasties with hdpe ) , couldwell et al . ( 10 patients of cranioplasty ) who have reported good results with no implant - related complications . the only potential drawback with hdpe is that the ingrowth of soft tissue into the inner surface of the implant may render removal difficult in cases that demand re - operation , though there are no reports of any experience with this issue . a possible solution is to coat the inner surface of the implant to selectively prevent dural adherence . lastly , the future of cranioplasty lies in tissue engineering using bone morphogenic proteins , osteoprogenitor cells and tissue scaffolds to stimulate new bone formation . this holds the promise of overcoming the disadvantages of both autogenous and alloplastic materials for cranial bone reconstruction . the properties of the hdpe implant make it an easy , safe and effective alternative to the existing methods of cranial contour correction . this method provides similar cosmetic results to standard alloplast cranioplasty with no donor site morbidity , excellent and stable contour enhancement , decreased risk of infection due to soft tissue ingrowth and minimal long - term complication rate . the hdpe cranial hemispheres further save time and cost , give better strength and a superior aesthetic result while performing large and/or complex cranial vault reconstructions . | aims : cranial vault reconstruction can be performed with a variety of autologous or alloplastic materials .
we describe our experience using high - density porous polyethylene ( hdpe ) cranial hemisphere for cosmetic and functional restoration of skull defects .
the porous nature of the implant allows soft tissue ingrowth , which decreases the incidence of infection .
hence , it can be used in proximity to paranasal sinuses and where previous alloplastic cranioplasties have failed due to implant infection.materials and methods : we used the hdpe implant in seven patients over a three - year period for reconstruction of moderate to large cranial defects .
two patients had composite defects , which required additional soft tissue in the form of free flap and tissue expansion.results:in our series , decompressive craniectomy following trauma was the commonest aetiology and all defects were located in the fronto - parieto - temporal region .
the defect size was 10 cm on average in the largest diameter .
all patients had good post - operative cranial contour and we encountered no infections , implant exposure or implant migration.conclusions:our results indicate that the biocompatibility and flexibility of the hdpe cranial hemisphere implant make it an excellent alternative to existing methods of calvarial reconstruction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
delay in initiating appropriate antibiotic therapy can increase the mortality associated with vap , and thus therapy should not be postponed for the purpose of performing diagnostic studies . this initial empirical therapy can be modified based on the knowledge of local microbiological data , patient characteristics , and sensitivity pattern of expected pathogens at the institution . one of the consequences of increasing antimicrobial resistance is an increased probability of inappropriate initial empiric antimicrobial treatment of infections . the aim of this study was to find the incidence of vap and mortality associated with vap at our institution . we also aimed to find the proportion of various bacterial pathogens isolated from tracheal aspirate of patients with vap , their antibiotic sensitivity pattern and patient outcome in terms of duration of mechanical ventilation and hospital stay . such an approach of guided empirical antibiotic therapy has shown to decrease morbidity and mortality , duration of treatment and hospital stay , and has also helped in cost reduction and prevention of development of multi - drug resistant strains . apache ii score of all critically ill patients admitted to medical intensive care unit likely to be taken on ventilator was evaluated . if the patients were taken on ventilatory support for two or more days and were not suffering from pneumonia prior to taking on ventilator , they were included in the study . a total of 107 patients met the required criteria over 1 year duration of study period and were included in the study . the baseline evaluation of all cases included the patient - related factors such as age , concomitant diseases , immune suppression , indication for mechanical ventilation , and the severity of illness based on apache ii score during first 24 hours of admission . the diagnosis of vap was established using clinical pulmonary infection score ( cpis ) , which was evaluated on a daily basis until the patient was on ventilator support . early - onset vap was defined as vap occurring within the first 4 days of hospitalisation and late - onset vap was defined as vap occurring after 4 days of hospitalisation . endotracheal aspirate was preferred over protected specimen brush ( psb ) sampling and broncho - alveolar lavage ( bal ) , as these techniques are more invasive and studies have shown no mortality benefit of using these over endotracheal aspirate.[1012 ] endotracheal aspirate was obtained under aseptic precautions using a 22-inch ramson 's 12f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25 cm . gentle aspiration was then performed without instilling saline , and the catheter was withdrawn from the endotracheal tube . after this , 2 ml of 0.9% saline was injected in the endotracheal tube with a sterile syringe to flush the exudates into a sterile container for collection . samples were inoculated onto 5% blood agar , macconkey agar , which were reconstituted according to the manufacturer 's specifications , and sterilised at 121c for 15 minutes . the plates were read the following day , but extended to 48 hours if there was no bacterial growth within 24 hours . antimicrobial susceptibility test was performed using mueller - hinton agar plates by kirby - bauer disc diffusion method , according to the clinical laboratory standards institute ( clsi ) guidelines . the patients diagnosed with vap were started on initial empirical antibiotic therapy , which was guided by the fact whether a multi - drug resistant pathogen was expected . later on , based on culture sensitivity reports the treatment was modified . other measures assessed included the incidence of vap , frequency of different pathogens isolated , their antibiotic sensitivity pattern , duration of mechanical ventilation and duration of hospital stay . the results were also analysed to find out any association between patient characteristics , severity of underlying illness as assessed by apache ii score , factors related to course of care like re - intubation with the incidence and rate of mortality in vap . the study cohort was classified into four groups : vap , non - vap , survivors , and non - survivors . the data obtained were subjected to univariate analysis using the chi - square test . the level of significance was set at p < 0.05 . endotracheal aspirate was obtained under aseptic precautions using a 22-inch ramson 's 12f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25 cm . gentle aspiration was then performed without instilling saline , and the catheter was withdrawn from the endotracheal tube . after this , 2 ml of 0.9% saline was injected in the endotracheal tube with a sterile syringe to flush the exudates into a sterile container for collection . samples were inoculated onto 5% blood agar , macconkey agar , which were reconstituted according to the manufacturer 's specifications , and sterilised at 121c for 15 minutes . the plates were read the following day , but extended to 48 hours if there was no bacterial growth within 24 hours . antimicrobial susceptibility test was performed using mueller - hinton agar plates by kirby - bauer disc diffusion method , according to the clinical laboratory standards institute ( clsi ) guidelines . the patients diagnosed with vap were started on initial empirical antibiotic therapy , which was guided by the fact whether a multi - drug resistant pathogen was expected . later on , based on culture sensitivity reports the treatment was modified . other measures assessed included the incidence of vap , frequency of different pathogens isolated , their antibiotic sensitivity pattern , duration of mechanical ventilation and duration of hospital stay . the results were also analysed to find out any association between patient characteristics , severity of underlying illness as assessed by apache ii score , factors related to course of care like re - intubation with the incidence and rate of mortality in vap . the study cohort was classified into four groups : vap , non - vap , survivors , and non - survivors . endotracheal aspirate was obtained under aseptic precautions using a 22-inch ramson 's 12f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25 cm . gentle aspiration was then performed without instilling saline , and the catheter was withdrawn from the endotracheal tube . after this , 2 ml of 0.9% saline was injected in the endotracheal tube with a sterile syringe to flush the exudates into a sterile container for collection . samples were inoculated onto 5% blood agar , macconkey agar , which were reconstituted according to the manufacturer 's specifications , and sterilised at 121c for 15 minutes . the plates were read the following day , but extended to 48 hours if there was no bacterial growth within 24 hours . antimicrobial susceptibility test was performed using mueller - hinton agar plates by kirby - bauer disc diffusion method , according to the clinical laboratory standards institute ( clsi ) guidelines . the patients diagnosed with vap were started on initial empirical antibiotic therapy , which was guided by the fact whether a multi - drug resistant pathogen was expected . other measures assessed included the incidence of vap , frequency of different pathogens isolated , their antibiotic sensitivity pattern , duration of mechanical ventilation and duration of hospital stay . the results were also analysed to find out any association between patient characteristics , severity of underlying illness as assessed by apache ii score , factors related to course of care like re - intubation with the incidence and rate of mortality in vap . the study cohort was classified into four groups : vap , non - vap , survivors , and non - survivors . the data obtained were subjected to univariate analysis using the chi - square test . the level of significance was set at p < 0.05 . out of 107 patients included in study cohort , 68 ( 63.54% ) were males and 39 ( 36.44% ) were females . the incidence of vap in our study was 28.04% , with 30 of 107 patients developing vap . of these 30 patients , 4 ( 13.3% ) developed early - onset vap and 26 ( 86.7% ) developed late - onset vap . a majority of vap cases were observed in patients aged up to 30 years ( 53.4% ) . however , age - wise , no significant statistical association with vap could be seen ( p = 0.427 ) . there were 27 ( 35.1% ) females in the non - vap group , while in vap group , this proportion was slightly higher ( n = 13 ; 43.3% ) . however , the proportion of males was higher in the non - vap group ( 64.9% ) as compared to vap group ( 56.7% ) . on statistical evaluation , this difference between two genders was not found to be statistically significant ( p = 0.427 ) [ table 1 ] . age and sex distribution of non - vap and vap group of patients the clinical spectrum of cases indicates that the maximum number of cases enrolled in the study were of neuroparalytic snake bite ( 24 cases ) followed by central nervous system infections ( 18 cases ) , suspected poisoning ( 13 cases ) , sepsis ( 12 cases ) , and cerebrovascular disease ( 10 cases ) . no significant association between vap and diagnosis was seen ( p = 0.071 ) [ table 2 ] . comparison of clinical conditions in vap group , non - vap group , survivors , and non - survivors re - intubation was done in 8 patients , of which 7 ( 87.5% ) developed vap , clearly indicating that re - intubation is an important predisposing factor in the development of vap ( p < 0.001 ) . early tracheostomy was done in 11 patients who required prolonged ventilatory support , of which 4 ( 36.36% ) developed vap and 7 ( 63.36% ) did not . the mean apache ii score ( during first 24 hours of admission ) of the patients who developed vap was 22.47 8.382 , while that of the patients who did not develop vap was 14.74 7.491 . the difference between the two groups was statistically significant ( p < 0.001 ) [ table 3 ] . the mean of acute physiology score ( aps ) component of apache ii score in vap group was 14.6 5.73 and in non - vap group , it was 7.7 4.768 . the mean of glasgow coma score ( gcs ) in vap group was 6.13 2.649 , while in non - vap group , it was 4.84 2.829 ; the difference was found to be statistically significant ( p = 0.033 ) . however , no significant difference was found in the age score and chronic health condition score in the two groups . comparison of individual scores and total apache ii score of 30 patients diagnosed as vap based on a cpis score of more than six , 26 ( 86.67% ) patients had monomicrobial infection and 4 ( 13.33% ) had polymicrobial infection . the most common organism isolated was pseudomonas aeruginosa followed by methicillin - resistant staphylococcus aureus ( mrsa ) , klebsiella pneumoniae , and acinetobacter baumannii [ table 4 ] . most strains of p. aeruginosa were resistant to the commonly used beta - lactam antibiotics known to be effective against p. aeruginosa , with 5 ( 55.56% ) isolates being resistant to ceftazidime , cefepime , cefoperazone+sulbactam . all 9 ( 100% ) isolates were sensitive to polymyxin b and colistin , while 7 ( 87.88% ) isolates were sensitive to carbapenems . all 8 ( 100% ) isolates of s. aureus were resistant to oxacillin , indicating the high prevalence of mrsa as a cause of vap in our setting . six isolates of k. pneumoniae ( 85.71% ) out of 7 were resistant to ceftriaxone , cefotaxime and ceftazidime , suggesting a high prevalence of extended - spectrum beta - lactamase ( esbl ) producing organism as a cause for vap in our setting . five isolates ( 71.43% ) were sensitive to gatifloxacin and meropenem , while 6 isolates ( 85.71% ) were sensitive to imipenem . however , all 6 isolates ( 100% ) were sensitive to polymyxin b and colistin [ table 5 ] . causative organisms in vap- correlation of frequency , type of vap , and associated mortality antibiotic sensitivity pattern of the common isolates the primary outcome measure assessed in the present study was mortality . the overall mortality in our study was 32.71% , with the death of 35 patients during the course of their illness . mortality in vap group was 46.67% , with the death of 14 patients out of 30 who developed vap during the course of their illness . mortality in non - vap group was significantly low at 27.28% , with the death of 21 patients out of 77 during the course of their illness . mortality in late - onset vap was significantly high at 50% , with the death of 13 patients out of 26 during the course of their illness . however , mortality was relatively low at 25% in early - onset vap , with the death of 1 patient out of 4 during the course of their illness , but the difference between two groups was not significant statistically ( p = 0.351 ) . the overall risk of mortality was stratified by the apache ii score during the first 24 hours of admission . the mean apache ii score among survivors was 13.64 6.79 and among non - survivors was 23.63 7.62 . mortality rate was high in patients with cerebrovascular disease ( 60% ) , sepsis and septic shock ( 58.33% ) , and in cases of suspected poisonings ( 53.85% ) . the next most lethal organism was k. pneumoniae , with a mortality rate of 71.42% [ table 4 ] . the mean duration of ventilation in the vap group was 12.03 6.531 days and in non - vap group , 5.13 3.945 days . the mean duration of hospital stay in vap group was 16.13 10.02 days and in the non - vap group , 8.81 6.262 days . both these parameters were observed to be significantly lower in non - vap group as compared to vap group ( p < 0.001 ) . this correlates with other similar studies in which the incidence of vap was 15.5 - 47% , depending on the diagnostic criteria used.[1316 ] there was no statistically significant association between the age of the patient and development of vap ( p = 0.427 ) , indicating that the age of the patient has no predisposition and no protective value for the development of vap . also , no statistically significant difference was found between the two genders with respect to the development of vap , indicating that both males and females are equally predisposed to develop vap . distribution of various diseases in vap and non - vap groups shows that the incidence of vap was high in infectious conditions like septic shock ( 58.33% ) , meningoencephalitis ( 33.33% ) , complicated malaria ( 50% ) and also in conditions requiring prolonged mechanical ventilation like guillain - barre syndrome ( gbs ) ( 50% ) . the incidence was significantly low in conditions requiring mechanical ventilation for short duration like neuroparalytic snake bite ( 4.17% ) and in conditions with no underlying lung disease or infection like cerebrovascular disease ( 20% ) , cardiogenic shock ( 11.11% ) . however , no significant association between vap and diagnosis was seen ( p = 0.071 ) . this indicates that the primary disease of the patient is not correlated with the probability of developing vap . a significantly higher value was observed in vap group ( p < 0.001 ) . in a similar study done by panwar and colleagues , it was concluded that patients who developed vap had a significantly higher apache iii score within the first 24 hours of admission . also , statistically significant difference was seen between vap and non - vap group with respect to the mean of acute physiology score ( aps ) component ( p < 0.001 ) and glasgow coma score ( gcs ) ( p = 0.033 ) of apache ii score . however , no significant difference was found in the age score and chronic health condition score in the two groups . the risk of vap was greatly increased in patients who underwent re - intubation ( p < 0.001 ) . a similar high incidence of vap was found to be associated with re - intubation in other studies . this might be because this invasive procedure of intubation was repeated and also duration of ventilation was increased . another hypothesis for this is that the patient who required re - intubation would have been vulnerable to aspiration in the interval between extubation and re - intubation . this underlies the importance of proper weaning protocols in the prevention of vap and the associated mortality . although the incidence of vap was found to be lower in patients who underwent early tracheostomy , but this was not found to be statistically significant ( p = 0.516 ) . thus , from the analysis of various factors used to stratify risk for development of vap , we conclude that a high total apache ii score along with a high aps and gcs during the first 24 hours and re - intubation during the course of patient care significantly predispose them to development of vap . other factors like age and sex of the patient and underlying chronic health condition do not predispose them to the development of vap . the next most common organism isolated was mrsa , with a total of eight isolates , of which seven were isolated from patients with late onset vap . other common organisms isolated were k. pneumoniae ( 7 isolates ) and a. baumannii ( 6 isolates ) . in four cases of polymicrobial infection , two cases had mrsa and k. pneumoniae in combination , and in one case , k. pneumoniae in combination with p. aeruginosa , and in the remaining one case , enterococcus in combination with p. aeruginosa was seen . the organisms implicated in vap were similar in other such studies[1316 ] [ table 6 ] . comparison of incidence , mortality rate , and pathogens causing vap in various studies analysis of antibiotic sensitivity pattern of these organisms suggests that a large number of these are highly resistant to the commonly used drugs . most strains of p. aeruginosa were resistant to the commonly used beta - lactam antibiotics known to be effective against p. aeruginosa , with 5 ( 55.56% ) isolates being resistant to ceftazidime , cefepime , cefoperazone+sulbactam . all isolated strains of s. aureus were mrsa and 85.71% isolates of k. pneumoniae were esbl producing . carbapenem resistance was noted still higher with a. baumannii , with 50% isolates resistant to carbapenems . the overall picture suggests that number of drug - resistant strains of various organisms is rising and is an important cause of vap in our setting . mortality in vap group was 46.67% , while in non - vap group , it was 27.28% and the difference was statistically significant ( p < 0.001 ) . although vap was not independently associated with mortality , mortality rate was higher in patients with vap . the rate of mortality was less in early - onset vap group as compared to late - onset vap , but the difference was found to be statistically insignificant ( p = 0.351 ) . a similar high mortality rate associated with vap was observed in other similar studies[1316 ] [ table 6 ] . the mean apache ii score was significantly higher ( p < 0.001 ) in non - survivors than survivors . it was further concluded that derangements in acute physiology and severity of underlying disease of the patient at the time of admission are more responsible for mortality than the underlying chronic health condition . a similar association of mortality with a high mean apache iii score was observed in a study by panwar and colleagues . mortality was also influenced by the type of organism isolated being highest for infections caused by a. baumannii ( 83.33% ) and k. pneumoniae ( 71.42% ) . we conclude that most cases of vap in our setting are those of late - onset vap and a majority of these are caused by highly resistant strains . local epidemiological data like this should be collected at all centres , as such information can help in guiding the initial empirical antibiotic therapy , which would be more rationale and help in decreasing mortality and morbidity . also , apache ii score is a good parameter to prognosticate the risk of mortality as well as the risk of developing vap . | background : the initial empirical therapy of ventilator associated pneumonia ( vap ) modified based on the knowledge of local microbiological data is associated with decreased morbidity and mortality .
the objective was to find the incidence and risk factors associated with vap , the implicated pathogens and their susceptibility pattern as well as to assess the final clinical outcome in vap.materials and methods : this was a prospective cohort study of 107 patients taken on ventilatory support for two or more days and those not suffering from pneumonia prior were to be taken on ventilator .
the study was done over a period of one year .
vap was diagnosed using clinical pulmonary infection score of > 6 .
the mortality , incidence of vap , frequency of different pathogens isolated , their antibiotic sensitivity pattern , duration of mechanical ventilation and duration of hospital stay were assessed.statistical analysis : univariate analysis , 2 test and paired t-test.results:the incidence of vap was 28.04% .
mortality in vap group was 46.67% , while in the non - vap group was 27.28% .
high apache ii score was associated with a high mortality rate as well as increased incidence of vap .
the most common organisms isolated from endotracheal aspirate of patients who developed vap were pseudomonas aeruginosa , methicillin - resistant staphylococcus aureus ( mrsa ) , klebsiella pneumoniae and acinetobacter baumannii .
most strains of pseudomonas ( 55.56% ) were resistant to commonly used beta - lactam antibiotics known to be effective against pseudomonas .
all strains of staphylococcus aureus were mrsa and most isolates of k. pneumoniae ( 85.71% ) were extended - spectrum beta - lactamase producing .
about 50% isolates of acinetobacter were resistant to carbapenems .
mortality was highest for infections caused by a. baumannii ( 83.33% ) and k. pneumoniae ( 71.42%).conclusions : apache ii score can be used to stratify the risk of development of vap and overall risk of mortality .
drug - resistant strains of various organisms are an important cause of vap in our setting . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the thyroid hormones ( ths ) l - thyroxine and l - triiodothyronine are iodothyronines exerting their major physiological effects by regulation of gene expression in target cells , which they must first enter by crossing the plasma membrane [ 13 ] . iodothyronines are now known to translocate cell membranes by a variety of mechanisms , which include the sharing of transport systems for large neutral amino acids ( lnaas ; principally aromatic and branched - chain amino acids ) and organic anions ( see , e.g. , [ 46 ] for review ) . th retain a tyrosine - derived amino acid moiety within the iodothyronine molecular structure , allowing them to be accepted as substrates by lnaa transporters such as system l ( notably the system l1 slc7a5/slc3a2 heterodimer isoform lat1 ) [ 7 , 8 ] and system t ( mct10 ; slc16a10 ) . white adipose tissue is an important target tissue for th action , where effects include stimulation of adipogenesis itself , modulation of fatty acid synthesis via regulation of expression of lipogenic enzymes [ 1012 ] and modulation of leptin secretion [ 13 , 14 ] . th enter rat adipocytes largely by a system l1-type amino acid transporter and lat1 mrna are expressed in rat adipocytes . system l1 is also likely to be of major importance for amino acid metabolism in adipose tissue , which is a site of significant bcaa degradation and utilization for fatty acid and sterol synthesis [ 17 , 18 ] . the system l1 substrate leucine in particular appears to be involved in modulation of the mtor signalling pathway in adipocytes . the activity and expression of system l1 in adipocytes , and its regulation by th , may therefore be of quantitative importance for whole body iodothyronine and amino acid turnover . in the present study using differentiated 3t3-l1 mouse adipocytes [ 20 , 21 ] , l-[2,3,4,5,6-h]phenylalanine was obtained from amersham ( ge healthcare , slough , u.k . ) and l-[i]-triiodothyronine from perkinelmer ( bucks , uk ) . cell culture media were obtained from gibcobrl life technologies ( paisley , uk ) unless stated otherwise ; other chemicals were obtained from either sigma chemicals ( poole , dorset , uk ) or bdh merck ltd ( poole , dorset , uk ) . 3t3-l1 mouse fibroblasts ( atcc cl-173 ) were cultured at 37c , 95% air : 5% co2 in dulbecco 's modified eagles medium ( dmem ; high - glucose ) with 10% donor bovine serum ( dbs ) and 1% antibiotic / antimycotic ( a / a ) solution . before reaching confluence , cells were resuspended by trypsinisation and reseeded into 6- or 12-well experimental plates . to differentiate into adipocytes , the 3t3-l1 fibroblasts were grown to confluence ( preadipocytes ) and then the medium was changed to dmem with 10% foetal bovine serum ( fbs ) and 1% a / a solution over the duration of the differentiation process . for the first two days of differentiation , 1 gml insulin , 5 m isobutylmethylxanthine , and 100 pm dexamethasone were also added to the media and for the subsequent two days 1 gml insulin alone was added . the adherent cells were allowed to fully differentiate over a further six days , then used for experiments on days 11 or 12 . immediately prior to an experiment , media was aspirated from the wells and the cells were washed twice in pbs . transport buffer ( 121 mm nacl , 4.9 mm kcl , 2.5 mm mgso4 , 20 mm tris - hcl , 1 mm cacl2 , ph 7.4 ) containing either l-[i]-t3 at 30 kbqml or l-[h]phenylalanine at 18.5 kbqml and any other necessary compounds ( e.g. , inhibitors ) were then added to the cells . once the cells had been incubated in the transport buffer for the designated time period , the buffer was aspirated and the cells were washed quickly three times in cold pbs to halt the uptake process . the cells were then lysed in 1.25 ml 50 mm naoh overnight at room temperature prior to assay of radioactivity by liquid scintillation counting and determination of protein concentration using bradford reagent ( biorad uk ) . preliminary experiments ( data not shown ) demonstrated that the uptake of 5 m [ h]phenylalanine was linear for at least 5 minutes and therefore , in all subsequent experiments reported here , phenylalanine uptake was measured over a 3-minute period . the specific activity ( dpmpmol ) of radiotracers was calculated from the radioactivity ( dpm ) of 10 l transport buffer measured using liquid scintillation counting ; tracer uptake is expressed as pmolmg protein10 min . for trans stimulation studies , 3t3-l1 adipocytes were preincubated in transport buffer containing 2 mm leucine for 15 min prior to the initial pbs washes . 3t3-l1 cells were preloaded with [ h]phenylalanine for a period of 15 minutes according to the uptake protocol described above . the radioactive buffer was then aspirated off and the cells were rapidly washed three times with pbs . the cells were then re - incubated in ( nonradioactive ) transport buffer , half of which was removed at timed intervals and immediately replenished with fresh buffer . at the end of each experiment , the remaining buffer was aspirated and the cells lysed overnight in 1.25 ml 50 mm naoh . the incubation buffer aliquots and cell lysates were assayed for radioactivity and the lysate also for protein concentration as described above . rna was extracted from cells using trizol reagent ( invitrogen , poole , uk ) according to the manufacturer 's instructions , resuspended in rnase - free h2o and quantified by uv spectrometry . 1 g rna was denatured in the presence of 0.5 g oligodt ( oligo synthesis service , university of dundee ) at 70c for 5 min then reverse - transcribed using moloney murine leukemia virus reverse transcriptase ( m - mlv rt ) at 100 u/g rna in 25 l reaction buffer including 500 m dntps ( fermentas ) at 42c for 1 hour . the resulting first - strand cdna was stored at 20c prior to use in pcr using gene - specific primers to test for specific mrna expression . the primer sets used in the pcr program were lat1 forward 5-tctccttgcccattgtcacc-3 reverse 5-atgactcccaggtggtagttcc-3 lat2 forward 5-aagggaacccgacagcgaaacaac-3 reverse 5-gggggaagcaggtagggaagagtg-3.
for each pcr , 2 l of first strand dna , 1 m each primer and standard 2x gotaq green pcr master mix ( promega ) were used in a 20 l total volume . the pcr programme used was 95c , 3 min ; [ 94c , 30 s ; 55c , 30 s ; 72c , 1 min ] 40 cycles ; 72c , 2 min using a thermo scientific hybaid px2 thermal cycler . statistical significance for uptake measurements was assessed by one - way anova followed by a dunnet post hoc test . for efflux measurements , graphpad software ( san diego , ca , usa ) was used to determine whether the gradients of the lines of best fit ( rate constants ) were significantly different from control . the uptake of 50 nm l-[i]-t3 into 3t3-l1 adipocytes included a substantial saturable component , being reduced by around 40% on addition of 10 um unlabelled t3 ( figure 1 ) . the magnitude of this saturable component ( approximately 11.2 pmolmg protein10 min ) was similar in both adipocytes and pre - adipocytes , although total uptake was about 50% higher in pre - adipocytes . an excess of the lnaa leucine ( 10 mm ) , inhibited over 80% of saturable t3 uptake ( figure 1 ) . pre - incubation of 3t3-l1 adipocytes in transport buffer containing 2 mm leucine for 15 minutes ( followed by a rapid wash in pbs ) resulted in a minor trans stimulatory increase in saturable 50 nm l-[i]-t3 uptake ( by 20 8.5% , n = 3 ) , although this increase did not reach statistical significance . the uptake of 5 m phenylalanine into 3t3-l1 cells ( 0.465 0.065 nmolmg proteinmin , n = 12 ) was saturable , being reduced more than 95% by addition of excess ( 10 mm ) unlabelled phenylalanine , leucine or bch ( 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid ; a synthetic system l - type amino acid transport inhibitor ) ( figure 2 ) . 5 m phenylalanine uptake was also substantially inhibited by t3 and rt3 ( 82% and 57% inhibition , resp . ) at 10 m , although inhibition by t4 ( 17% ) and triiodothyroacetic acid ( triac ; a t3 analogue lacking the -amino grouping ) did not achieve statistical significance at this concentration ( figure 2 ) . saturable phenylalanine uptake into 3t3-l1 cells had a km of 31 m and a vmax of 2.6 0.5 nmolmg proteinmin ( mean sem , n = 6 ; see figure 3 ) . the inhibitory effect of t3 on phenylalanine uptake also appeared to be competitive , with a ki of the order of 1 - 2 m ( see figure 4 ) semilogarithmic plots of the cumulative loss of preloaded [ h]phenylalanine tracer from 3t3-l1 cells showed that the initial efflux was described by a single rate constant ( see figure 5(a ) ) , indicating that phenylalanine was released largely from a single , freely exchangeable intracellular pool . efflux of pre - loaded l-[h]phenylalanine from 3t3-l1 adipocytes was trans stimulated in a concentration - dependent manner by external leucine ( figure 5(a ) ) . leucine and tryptophan ( both system l substrates ) were able to generate over 20 times stimulation of basal phenylalanine efflux ( figure 5(b ) ) . t3 is known to be a substrate for system l1 amino acid transport , so we investigated the ability of t3 to trans stimulate phenylalanine efflux . t3 was unable to significantly trans stimulate l-[h]phenylalanine efflux at 10 m ( a concentration approaching the limit of t3 solubility in culture medium ) , although it did inhibit the trans stimulatory effect of 10 m leucine ( see figure 6(a ) ) . rt3 also inhibited the trans stimulatory effect of 10 m leucine , although t4 did not to any significant degree ( figure 6(a ) ) . the t3 analogue triac ( which does not interact with system l1 ) had no effect on either basal or leucine - stimulated phenylalanine efflux . the effect of t3 upon leucine trans stimulated phenylalanine efflux was found to be concentration dependent ( see figure 6(b ) ) with 3.2 m t3 able to inhibit 50% of 10 m leucine trans stimulated phenylalanine efflux , demonstrating the relatively high affinity of t3 for this interaction . we detected mrna for lat1 , but not lat2 ( the alternative catalytic subunit producing system l1-type amino acid transport ) in 3t3-l1 cells using rt - pcr ( see figure 7 ) . 3t3-l1 cells in culture are used extensively as an in vitro model system for studying white adipose tissue and the present results demonstrate that saturable uptake of the thyroid hormone l - t3 in both pre - adipocytes and terminally differentiated 3t3-l1 adipocytes occurs largely by a mechanism inhibited by the lnaa leucine , a substrate of the multifunctional system l1 transport system shared by lnaa and iodothyronines ( see for review ) . saturable uptake processes appear to be the predominant routes of cellular th entry for genomic signaling via thyroid receptors in animal cells . there appears to be little change in functional expression of saturable t3 transport during adipocyte differentiation ( at least for 3t3-l1 cells ) , which is perhaps unsurprising given that t3 is important for the differentiation process itself as well as the control of mature adipocyte functions . the nonsaturable uptake of t3 into adipocytes includes surface binding ( presumably to secreted lipids and lipoproteins ) and partitioning into the lipid bilayer as well as passive diffusion into the cytosol . transport of phenylalanine ( a representative lnaa substrate for systems l1 , l2 and t ) in 3t3-l1 adipocytes conforms almost exclusively with classical system l1-type function as mediated by lat1 , in that ( i ) phenylalanine influx has a km in the low micromolar range ( 31 m ) , ( ii ) it is inhibited by bch and ( iii ) phenylalanine efflux is markedly trans stimulated in a concentration - dependent manner by both leucine and tryptophan ( consistent with the obligatory exchange mechanism of system l1 ) . these features are clearly distinct from those of other likely contributors to phenylalanine transport , specifically because ( i ) system l2 ( lat3/lat4 ) does not recognize tryptophan as a substrate [ 25 , 26 ] , ( ii ) system t ( mct10 , originally named tat1 ) does not recognize leucine as a substrate [ 27 , 28 ] , and ( iii ) lat3 , lat4 , and mct10 all utilise facilitative diffusion rather than an exchange mechanism [ 2527 ] . phenylalanine uptake by 3t3-l1 cells was competitively inhibited by t3 ( ki of 1 - 2 m ) and rt3 in a manner consistent with expected substrate interactions for the lat1 system l1 transporter [ 2932 ] . this strong competitive interaction between iodothyronines and lnaa for transport by system l1 in 3t3-l1 mouse adipocytes is consistent with our previous studies using isolated white adipocytes from rats , although the relatively - weak inhibitory effects of t4 in the present study may reflect minor species - specific differences in the relative affinity of different th for lat1 . the vmax for phenylalanine transport in 3t3-l1 cells ( 2.6 nmolmg proteinmin ) is broadly equivalent to 50 pmol10 cellsmin , a value of the same order of magnitude as that measured for system l1 transport in rat adipocytes . collectively , our results indicate that the na - independent system l1 transporter contributes substantially to iodothyronine and lnaa transport in 3t3-l1 adipocytes and thus for delivery of th from the plasma to the cytosol , where ultimately they reach the cell nucleus . system l1 has been shown to be an important effector of t3 transport in tissues including placenta and brain as well as adipose ( for review ) . the lat1 and lat2 genes encode for alternative catalytic protein subunits of system l1 and these function as heterodimers with 4f2hc / cd98 ( see for review ) . lat1 and lat2 both mediate uptake of iodothyronines as well as lnaa [ 30 , 31 ] but while both are expressed in rat adipocytes , it appears that only lat1 is expressed at the mrna level in 3t3-l1 cells . the km values obtained for iodothyronine transport by system l1 are substantially lower than those measured for lnaa transport , which help t3 especially to compete effectively with amino acids for transport under physiological conditions ( see for review ) . high - affinity receptors for both t4 and t3 have been identified associated with the plasma membrane of adipocytes and these may also facilitate preferential iodothyronine uptake . to our knowledge , t3 is the most potent natural inhibitor of system l1 in the mammalian body ( and easily surpasses the widely - used synthetic inhibitor bch in terms of ki , if not specificity ) , although brasilicardin compounds isolated from bacteria have recently been shown to inhibit with nanomolar potency . given the therapeutic potential of system l1 inhibitors as immunosuppressants and anticancer drugs [ 34 , 35 ] , it is tempting to suggest that the iodothyronine skeleton might be used as a template for improved design of highly specific , non - th active , system l1 inhibitors . reverse t3 but not triac ( a t3 analog lacking an amino acid moiety which acts as a potent thyroid receptor agonist ) interacts with system l1 in adipocytes , demonstrating structural specificity of system l1 which is clearly distinct from that of nuclear thyroid hormone receptors . triac selectively stimulates the metabolic rate of adipose tissue in vivo , a feature considered as a potential tool to increase whole body energy metabolism . it appears from our results that triac enters adipocytes by a different mechanism to t3 , which may help explain why triac administered to rats accumulates in white adipose tissue even when coadministered with high t3 doses . the bulky t3 molecule has a much reduced vmax for transport by system l1 compared to lnaa , such that its specific interactions with system l1 transport may competitively inhibit not only influx but efflux of substrate lnaa by retarding conformational changes of the transport cycle ( note the inhibitory action of t3 on leucine - induced trans stimulation of phenylalanine efflux in 3t3-l1 cells ) . nevertheless , the obligatory exchange mechanism of the system l1 transporter should allow limited lnaa iodothyronine or t4-t3/rt3 exchanges across the adipocyte plasma membrane and we indeed observed a minor trans stimulation of saturable l - t3 uptake in 3t3-l1 adipocytes preincubated with leucine . it is noteworthy in this respect that adipose tissue in vivo releases small quantities of lnaa . white adipose tissue depots have the capacity to deiodinate iodothyronines ( especially rt3 ) [ 37 , 38 ] , thus it is conceivable that regulation of iodothyronine turnover in fat cells through this pathway would contribute significantly to modulation of whole body t4-rt3 metabolism , perhaps particularly in obese individuals . in this respect , downregulation of iodothyronine uptake by system l1 in adipocytes in the hypothyroid state , as reported previously in adipocytes from hypothyroid rats , would tend to reduce the sensitivity of adipose tissue to hormonal activation but might help conserve hormone and iodine availability to other tissues by reducing their degradation in adipose tissue . physiological variations in plasma lnaa concentrations , as occurs during natural feeding cycles , may impact th transport and action in adipose ( and other tissues where system l1 is the predominant th transporter ) . | thyroid hormones enter isolated white adipocytes largely by a system l1-type amino acid transporter en route to exerting genomic actions .
differentiated 3t3-l1 mouse adipocytes in culture express mrna for lat1 ( the catalytic subunit of high - affinity system l1 ) .
l-[125i]-t3 uptake into 3t3-l1 adipocytes included a substantial saturable component inhibited by leucine .
l-[3h]phenylalanine uptake into 3t3-l1 cells was saturable ( km of 31 m ) , competitively inhibited by t3 ( ki of 1.2 m ) and blocked by leucine , bch , and rt3 as expected for substrate interactions of system l1 .
efflux of preloaded l-[3h]phenylalanine from 3t3-l1 adipocytes was trans stimulated by external leucine , demonstrating the obligatory exchange mechanism of system l1 transport .
t3 ( 10 m ) did not significantly trans stimulate l-[3h]phenylalanine efflux , but did competitively inhibit the trans stimulatory effect of 10 m leucine .
the results highlight strong competitive interactions between iodothyronines ( t3 , rt3 ) and amino acids for transport by system l1 in adipocytes , which may impact cellular iodothyronine exchanges during altered states of protein nutrition . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the leading causes of death in the united states include heart disease , cancer , and stroke ; the incidence of these conditions can be reduced by modifying and/or eliminating associated risk factors . the majority ( 66.3% ) of u.s . adults 20 years and older are overweight or obese and 32.2% are obese . a shift towards more sedentary lifestyles and occupations and increased reliance on and use of labor - saving devices obesity is a major issue for corporate society because of the economic impact , negative effects on work performance , and other potentially serious risks and complications associated with obesity . therefore , it may be important for worksites to be more conducive to employee health and is an excellent place to promote health and wellness . according to the wellness councils of america , more than 81% of businesses with more than 50 employees have some type of health promotion program in place . employee wellness centers have been shown to provide numerous benefits for employees including : weight reduction , increased physical fitness and stamina , and decreased stress . recent research has also discovered that employers benefit from such programs by experiencing reduced healthcare costs , increased productivity , reduced incidence of sickness and absenteeism , improved recruitment , decreased turnover rates , and enhanced employee morale . a review of over 70 published research articles on worksite wellness programs found that , on average , employers experience a $ 3.50-$1.00 savings - to - cost ratio ( reduced absenteeism and health care costs compared to program costs ) because of wellness programs . on average , research has shown that there is a 28% reduction in sick leave and absenteeism , a 26% reduction in health care costs , and a 30% reduction in worker 's compensation claims . comprehensive worksite wellness programs provide ongoing and integrated programs of health promotion and disease management , with individualized risk reduction for employees as a crucial element . this integrated approach has been found to be much more effective in preventing disease and promoting overall health than addressing each issue separately . worksites are an ideal setting for health behavior change because they offer access to employees through controlled environmental and communication support systems and a large number of people can be repeatedly reached over an extended period of time . by utilizing the built - in social support found in the workplace , recognizing that there are varying levels of influence ( intrapersonal , interpersonal , institutional , community ) , and addressing employee preferences and perceived barriers , the likelihood of achieving and maintaining better health and well - being will be significantly increased . other factors found to be crucial for successful worksite wellness programs include : long - term commitment , top - level management support , employee involvement , leadership , specified objectives , detailed planning , focus on employee needs , resourceful , and a smooth integration into workplace environment . even if all these factors are present , the true effectiveness of a worksite wellness program is dependent on the characteristics of the target population and the proportion of the population that participates in the intervention [ 20 - 22 ] . if employees are not interested , unmotivated , or information is not personally relevant , the most well - planned program can fail . mclellan et al . had an overall participation rate of 23% , ranging widely ( 10 - 86% ) among different workgroups . experienced similar rates with an overall median participation rate of 33% , ranging from 10 - 64% . research shows that women are generally more likely to participate in worksite wellness programs than men and , overall , married employees have much higher participation rates than their single co - workers . other determinants of higher participation rates include : white - collar or secured contract employees , full - time employees , older age , and small company employees ; shift workers , lower income , and less education displayed much lower participation rates . although previous research has indicated what characteristics of employees are most associated with participation in worksite wellness programs , it is still unclear from a qualitative perspective why employees may decide not to participate . minimal research exists on wellness programs in the university setting , in particular among foodservice employees . the purpose of this research was to determine why employees decided not to participate in an employee wellness program , wellness wednesdays : " eat & meet " about healthy living , conducted for aramark employees at east carolina university in greenville , north carolina . wellness wednesdays : " eat & meet " about healthy living was conducted at east carolina university , a public , coeducational university located in greenville , north carolina . total enrollment for the fall 2009 semester was 27,654 students , including both on - campus and distance education students , with an additional 1,782 full - time and part - time faculty members . currently , the university 's campus wellness center provides informational tables and events and offers group presentations on health - related topics such as smoking cessation , nutrition , stress management , alcohol use , and physical activity . to date wellness wednesdays : " eat & meet " about healthy living was created by the aramark nutrition director in order to provide employees with the opportunity to participate in a worksite wellness program , emphasizing various nutrition- and health - related topics . this program has not been implemented for employees at other aramark locations and is unique to east carolina university . the program was created in order to address employee health characteristics such as high cholesterol , abnormal glucose levels , hypertension , and overweight / obesity . these health needs were discovered at the 2008 aramark employee wellness screening and served as the basis for the class and the selected topics . topics covered in the program were those that would benefit employees that are overweight or obese , seeking to lose / maintain weight , have hypertension , high cholesterol , and/or diabetes , or are interested in improving their overall health . the number and length of weekly classes were determined based on optimal employee and management schedules . this was critical in planning because organizers had to ensure that employees would be able to take a break from their responsibilities to attend the weekly classes while still keeping food production on schedule . collaboration with other organization directors and managers was necessary to make the final decision regarding program duration and length / location of classes . marketing strategies utilized to promote the wellness program and recruit participants included : discussion of program in foodservice facilities ' pre - service meetings ( all employees in that shift present ) and in employee round table meetings , inclusion of an article in the employee newsletter , and distribution of posters / flyers located in all foodservice locations and on employee bulletin boards . wellness wednesdays : " eat & meet " about healthy living was implemented on september 30 , 2009 with its first class and an introduction to how the program operates , the timing and location of classes , topics to be discussed each week , and incentives offered . east carolina university aramark employees are predominantly service workers ( 83.7% ) , with 7.3% administrative support workers , 6.4% officers and manager , and 1.9% other job positions . 75.9% are african american , 21.8% are caucasian , 1.5% are hispanic , and 0.8% are asian / indian . based on data from the 2008 aramark employee wellness screening , common health characteristics of employees employees were tested for cholesterol , blood pressure , and glucose readings and body measurements were also taken . of these employees , 27% of participants had moderate ( 201 - 239 mg / dl ) to high ( > 240 mg / dl ) total cholesterol ; 21% had high fasting ( > 100 mg / dl ) or non - fasting ( > 140 mg / dl ) glucose levels ; and 68% had moderate ( 120/80 to 140/90 mmhg ) to high ( > 140/90 mmhg ) blood pressure readings . additionally , 27% of employees were classified as overweight ( bmi : 25.0 - 29.9 kg / m ) and 51% as obese ( bmi : > 30 kg / m ) . overall , a large amount of aramark employees are overweight or obese and have a moderate to high risk for hypertension , with some having a moderate to high risk for high cholesterol and diabetes . all aramark employees ( n = 481 ) over the age of 18 were eligible to participate . all interested employees ( n = 50 ) obtained clearance / approval from their manager to ensure that schedules permitted participation . over a 10-week period , 30 minute classes were taught once a week by a registered dietitian . topics ( shown in table 1 ) included various nutrition- and health - related issues that were intended to increase employees ' knowledge and skills on nutrition and healthy eating . the location of the classes alternated between the two dining halls on campus each week to ensure that employees from both ends of campus had the opportunity to attend . incentives to participate in this program were that employees would receive a $ 5.00 credit or " wellness bucks " for each class attended . at the end of the 10-week period , the total number of classes attended were tallied by reviewing weekly sign - in sheets and given to the payroll / accounting department so payments could be included in employee paychecks . for example , if an employee attended all 10 classes , he / she would receive an extra $ 50.00 credit in their paycheck . a five question knowledge - check quiz was administered to participants at the end of each class to determine the effectiveness of the information and materials presented and the participants ' level of knowledge on the topics . this method of program evaluation was chosen due to the inconsistency of participant attendance . a pre- and post - program evaluation tool therefore , only post - class knowledge quizzes were administered for evaluation to gauge level of participant knowledge and retention of the new material . short , 3 - 5 minute interviews ( n = 19 ) were randomly obtained from aramark employees ( both those who attended , n = 11 , and those who did not attend the program , n = 7 ) and the program organizer ( n = 1 ) with questions aimed at information about attendance , participation , incentives , location , and suggestions . a funnel approach was used in interviews with the broadest questions asked first ( to avoid sensitizing interviewees and leading responses ) to more specific prompts for further information . selection was completely random and there was no inclusion criteria set in order to obtain unbiased , non - influenced responses . by choosing to use a random sampling strategy and conducting short , informal interviews in the work area , feedback from a wide range of employees was able to be obtained ( both participants and non - participants ) since employees did not have to stop working or feel pressured to answer in a particular way . a total of 50 ( 10.4% ) east carolina university aramark employees , managers , and leadership team members attended wellness wednesdays : " eat & meet " about healthy living at least once during the 10-week program . out of the 10 available classes , 50% attended 1 class ; 22% attended 2 classes ; 14% attended 3 classes ; 4% attended 4 classes ; and 1% attended 5 classes . it was found that employees from some locations on campus had stronger participation than others . employees at retail dining facilities located in the middle of campus had the least participation , while the two dining halls ( one on each end of campus ) and retail facilities on the west end of campus had the highest employee participation rate . class size varied from week to week and ranged from 4 to 20 people . on average the weekly five question knowledge quizzes administered at the end of each class , it was found that most people scored well on the knowledge assessments . qualitative interviews of random aramark employees after the completion of the program revealed several themes and barriers for not participating . the top three reported barriers to participation ( in order from most often to least often reported ) were insufficient incentives , inconvenient locations , and time limitations . employees expressed that offering more money as an incentive would make it more likely for them to attend and the extra money was " always good . " some employees would only attend classes held at their location and did not attempt to go to the classes held at the opposite end of campus . timing and scheduling of the weekly classes were reported to be difficult because they were conducted during the work day and it was often hard to find a time that employees would be able to attend without disrupting their shift schedules and responsibilities . time was an especially important barrier with retail location facilities which did not have time in between meals to leave and classes were held during one of their busiest times . scheduling the classes on one morning during the week limited the number of employees that could attend . employees who were off on wednesdays or who worked the night shifts had to make an extra effort to come in during their time off to attend the classes . some employees reported that they were not interested in the topics discussed and , therefore , did not attend . topics that were cited as being of interest that were not included in the program or were not covered in - depth included : hypertension , stress management , heart health , shopping on a budget , exercise , and proper child nutrition . marketing referred to initiatives for the promotion and publication of the program such as flyers , information from location managers during pre - service meetings with employees , and other media outlets . employees felt that they were not adequately informed and made aware of the program and the timing and scheduling of the occurrence of the classes . health beliefs were expressed as comments such as not attending because of perceived sufficient health knowledge and having a healthy family . from an organizers perspective , successfully planning and implementing this program was not without its own set of barriers , many of which were similar to those expressed by employees . scheduling and timing of the weekly classes were reported to be difficult because they were conducted during the work day and it was often hard to find a time that employees would be able to attend without disrupting the shift schedules . attendance was further hindered when sites were short - handed due to callouts ( employee calls to inform managers that he / she will not be at work due to sickness , transportation issues , etc ) , production schedule being behind target , or by continuous service operations ( such as retail outlets versus dining halls that had set meal periods and open / close schedules ) . to better accommodate the busy schedules of foodservice employees , organizers tried to keep the classes short , 15 to 30 minutes . however , it was reported to be difficult to adequately address all of the information within the short class periods . the location of the weekly classes was another important and sometimes difficult factor for organizers to address . on this college campus , employees were spread out over 14 dining locations . with people in so many different locations , it was nearly impossible to find a location that was convenient for all to attend without having to walk or drive . if employees chose to drive , parking spaces are limited and , therefore , created another problem to factor in with transportation . this issue was addressed by alternating the end of campus that classes were held at , but this still did not capture all dining locations , leaving some employees with a travel time to factor in . finally , program evaluation on knowledge for wellness wednesdays was extremely difficult due to low participation rates and regular attendees . an overall knowledge pre / post - evaluation would not have provided accurate information about the effectiveness of the program because all employees did not attend all 10 classes . with such irregular attendance , it was hard to evaluate how effective the program was in relation to lifestyle factors , weight , and health status as well as preventing maximum knowledge gain due to the inability to build on information from one week to the next . a complete list of barriers cited by the program organizer is shown in table 4 . according to previous research , the average participation rate among employees for worksite wellness programs is less than 50% . mclellan et al . had an overall participation rate of 23% ; robroek et al . evaluation of wellness wednesdays : " eat & meet " about healthy eating supported these findings with an overall participation rate of 10.4% . barriers such as insufficient incentives , inconvenient locations , time limitations , not interested in topics presented , schedule , marketing , health beliefs , and not interested in the program were found and negatively impacted participation rates in this employee wellness program . these barriers also supported previous findings , especially employee disinterest and information presented not being personally relevant . however , the top three barriers reported ( incentives , location , and time ) had not been previously reported as barriers to worksite wellness program participation . these barriers may be unique to college campus employees and partially related to the physical spread of the work environment . in order to increase participation rates , creative approaches to meeting employees ' needs are required . previous research shows that by addressing employee preferences and perceived barriers , the likelihood of achieving and maintaining better health and well - being will be significantly increased . this information can be obtained prior to the start of the program by distributing a needs and interest survey to all employees and would ensure that the topics presented were relevant and appropriate for the intended audience . evaluation of wellness wednesdays : " eat & meet " about healthy living provides useful information for future program development of employee wellness programs , especially in work environments that are diverse and physically spread out such as college campuses . results show that employee wellness programs can be implemented on college campuses and are effective in increasing knowledge and skills of employees on nutrition- and health - related topics . however , program planning that addresses identified barriers including insufficient incentives , inconvenient locations , and time limitations may facilitate higher participation in future worksite wellness opportunities . | the purpose of this research was to determine barriers that prevent participation in an employee wellness program , wellness wednesdays : " eat & meet " about healthy living , conducted at east carolina university ( ecu ) in greenville , north carolina .
all ecu aramark employees ( n = 481 ) over the age of 18 were eligible to participate in the wellness program .
weekly 30 minute classes , taught by a registered dietitian , on various nutrition- and health - related topics were conducted for 10-weeks .
five question knowledge quizzes were administered to participants at the end of each class to determine the comprehension of material presented .
qualitative interviews ( n = 19 ) were conducted with employees ( participants and non - participants ) and the program organizer after the completion of the 10-week program to identify barriers to program participation .
a total of 50 ( 10.4% of the total number of potential participants ) ecu aramark employees , managers , and leadership team directors attended wellness wednesdays at least once during the 10-week program .
employees , on average , scored 71 - 100% on the weekly knowledge quizzes administered at the end of each class .
the most common barriers to participation reported included ( most often to least often reported ) : insufficient incentives , inconvenient locations , time limitations , not interested in topics presented , undefined reasons , schedule , marketing , health beliefs , and not interested in the program .
results showed that employee wellness programs can be effective in increasing knowledge of employees on nutrition- and health - related topics .
however , program planning that addresses identified barriers including insufficient incentives , inconvenient locations , and time limitations may facilitate higher participation in future worksite wellness opportunities . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
rigid gas - permeable ( rgp ) contact lenses are made of durable plastic material that can transmit oxygen due to its silicone content . rgp lenses were designed in the late 1970s for patients who could not obtain successful optical correction with soft contact lenses . they are most often used in eyes with keratoconus , high astigmatism , and presbyopia , and after refractive surgery . rgp lenses often perform better than soft lenses due to their durability , which enables them to retain shape . they are highly resistant to deposits , because their low water content impedes adhesion of tear film proteins and lipids to the surface of the lens . due to their high endurance the back surface of an rgp lens maintains its shape ; in contrast , soft lenses conform easily to the anterior cornea . as a result , the complete optical system for the rgp lens consists of a rigid lens , a tear layer , and finally , the eye . fitting rigid lenses involves assembling this 3-piece structure to maintain functionality , despite repeated displacements caused by blinking or eye movements . the final choice of lens must safely fit the patient , cause minimal discomfort , and provide maximal vision correction . several parameters must be taken into consideration when fitting rgp lenses , including the radius of the back surface , the diameter , the back vertex power , the thickness , and the edge profile . factors that may impact rgp lens fitting include corneal anatomy , lid geometry and mechanics , and pathological condition , like pterygium or impaired tear secretion . the conventional method of fitting rgp lenses is to use a set of trial lenses . this set consists of rgp lenses with the same diameter and back vertex power , but with a range of base curve radii ( bcr ) that differ by 0.1 mm increments . the criterion standard for evaluating the lens - to - cornea fit has been to examine the fluorescein pattern . however , due to the subjectivity in evaluating the fluorescein pattern and many factors that may alter the image ( such as tear secretion insufficiency , allergies , corneal deposits , location and mobility of the lens , local epithelial reaction ) , there is a need for a new , precise , objective method . anterior segment spectral optical coherent tomography ( as soct ) is a method that has gained increasing clinical importance in anterior segment imaging . as soct is a non - contact , non - invasive method capable of capturing cross - sectional images of contact lenses , tear film , and the cornea [ 68 ] . as soct also allows video - rate and 3-dimensional cross - sectional imaging of the eye as it is being fitted with a contact lens . although several studies previously described the as soct technique for assessing contact lens fitting , there is little scientific information on its practical value in this field . therefore , this study aimed to verify the applicability of currently commercially available as soct technology for evaluating rgp lens alignments and to compare the results with the traditionally used method of examining the fluorescein pattern . twenty - six eyes of 14 patients ( 10 female , 4 male ) , with a mean age of 39.612.3 years ( range : 2360 ) , were enrolled in the study . exclusion criteria were any diagnosed corneal pathology ( keratoconus , keratopathy , dystrophy , ectasia ) or a corneal astigmatism greater than 0.5 diopters . rgp lenses were fitted by 1 operator with a trial fitting set ( bias , hecht , germany ) . the initial bcr of rgp lenses was selected to be 0.1 mm smaller than that indicated by keratometry readings ( ark-530a , nidek , japan ) . after topical anesthesia with proparacaine hydrochloride ( alcaine 0.5% , alcon laboratories , inc . ) , fluorescein was introduced into the eyes by applying bioglo strips impregnated with 1 mg of fluorescein sodium u.s.p . ( hub pharmaceuticals , llc , california , usa ) . the fluorescein pattern and as soct ( rtvue 100 fd , optovue , california , usa ) were compared for evaluating the alignment and fit of a set of lenses with decreasing bcrs ( in 0.1-mm increments ) , for up to 3 consecutive changes . the fluorescein pattern was photographed 5 times for each lens with a slit - lamp - mounted canon eos 300d digital camera , starting 23 seconds after blinking . five as soct hi - res cornea cross line scan tomograms of 5-micron axial resolution were also acquired for each lens . the time of oct measurement was also 23 sec after blinking , at the moment when the lens was in the center of the cornea ( 1 mm ) , monitored on the live eye preview image . on each tomogram , the gap between the posterior surface of the lens and the anterior surface of the central cornea ( apical clearance ) was measured manually , 3 times . informed consent was obtained from the subjects after explaining the nature and possible consequences of the study . the research was approved by the ethics committee of the institution where all authors were affiliated . the range of apical clearances detected by as soct was 362 m . the mean coefficient of repeatability , defined as the standard deviation divided by the mean result , was 18.2% . the average bcr for an aligned fit , defined according to the fluorescein pattern , was 7.80.26 mm . bcr reductions of 0.1 , 0.2 , and 0.3 mm increased the apical clearance detected in the fluorescein pattern ( by approximately established percentage diameter value ) ( figure 1 ) . the corresponding mean as soct measurements were 12.38 ( sd=9.91 ) , 28.79 ( sd=15.39 ) , and 33.25 ( sd=10.60 ) microns , respectively ( figure 2 ) . the first 2 reductions in bcr ( 0.1 and 0.2 mm ) caused significant increases in apical clearance ( p<0.05 for both ) , but the second and third bcr reductions ( 0.2 and 0.3 mm ) cause similar apical clearances ( p>0.05 ) . figure 3 shows examples of fluorescein pattern images and soct imaging measurements for the same eye . in 5 cases ( 5.10% of measurements ) , the apical clearance was visible with the fluorescein pattern , but was not detectable with as soct . table 1 shows the sensitivity of fluorescein pattern and soct methods for apical clearance detection . the fluorescein pattern remains the criterion standard for rgp contact lens fitting . in clinical practice , other aspects are also taken into consideration , including the patient s subjective comfort , lens centration , lens movement , and surface wettability . hence , there is a need for a new , objective , practical tool for contact lens fitting assessments . although oct is the device of choice for retinal imaging , it is also widely used to evaluate the anterior segment , because it enables both structural imaging and morphometric measurements of ocular tissues . it has been proven for efficacy in imaging the tear meniscus and conjunctival folds , in performing pachymetry , and in producing corneal curvature maps . the notion that soct might be useful for contact lens imaging was previously presented , with emphasis on its potentially crucial role in clinical practice . to the best of our knowledge , no reports have described rgp lens fitting assessments with oct . however , there are a few reports on soft contact lens fitting evaluations . according to cui et al , soft contact lens fitting should be based on an objective evaluation , like that provided with oct measurements . combining ultrahigh - resolution and ultralong - scan depths , oct has enabled the dynamic tracking of lens micro - movements , and thus , it represented a new practical method for assessing the fit of soft contact lens . in one of our previous investigations , we studied 3 devices for pachymetry the rtvue 100 fd ( for as soct ) , the pentacam , and ultrasound and we also compared them for efficacy in measuring central corneal thickness . the as soct device showed the highest reproducibility of results , which was consistent with findings from other authors [ 1517 ] . therefore , we assumed that this method would serve as a good alternative in anterior segment imaging , including for assessments of rgp lens fits . in a study by prakash et al . , corneal epithelial thickness at the vertex was assessed with a fourier domain as oct , and it showed high reproducibility . gonzlez - mijome et al . examined in vivo physiological reactions with high - resolution soct in subjects who wore soft contact lens . they demonstrated that high resolution soct was an advantageous tool for detecting slight hypoxia - induced changes . in the present study , with every bcr change , 15 measurements were taken with the as soct ( 5 scans , with 3 manual measurements each ) . in the statistical analysis , we used an average of the positive values obtained ; however , in several cases , only some measurements showed apical clearance . thus , this method was less sensitive than fluorescein pattern examinations for assessing rgp lens fits . our manual as soct measurements showed moderate repeatability ( 18.2% ) ; these measurements were strongly dependent on the choices of measurement location and time after blinking . we took great care to perform the measurements consistently at the same position ( in the center of the cornea ) and at the same time ( shortly after blinking ) . nevertheless , the high standard deviation in our results indicated that the measurements lacked precision . another important finding was the overlap in results ( figure 2 ) . in practice , the findings reflect a trend towards increasing apical clearance ; however , it did not enable an estimation of the exact lens bcr , based on the absolute measurement values . a standard trial set of rgp lenses for fitting consists of lenses with bcrs that steepen in increments of 0.1 mm . in the present study , a 0.1 mm change from the initial bcr produced a change in apical clearance that was detectable with as soct ; however , the sensitivity was only 76.92% , compared to 92.31% for the fluorescein pattern method . this implies that as soct could successfully detect the apical clearance only for lenses with bcrs that differed from the initial trial lens by 0.2 mm or more . we assume that as soct did not perform well in rgp fit assessments , because it is a dynamic process ; both lens position and the placement of the as soct measurement may change during scanning , and this could affect quantitative results . in the fluorescein pattern method , the influence of the lens movements on fit evaluation might be diminished by experience of the examiner or by taking a photograph in a specific moment and location of the lens . thus , the fluorescein method enabled a more accurate qualitative analysis than the as soct method . however , the fluorescein pattern method has the disadvantages inherent in a manual , subjective technique . a potential solution , to be verified in the future , may be to mount the soct device on the slit - lamp to be able to acquire a fluorescein pattern image and a soct tomogram at the same moment in time and in a precisely defined plane . this type of device could improve the rgp fit assessment technique , because it would be based on the fluorescein pattern , but also would provide objective , quantitative data . the lens - to - cornea fit was measurable with the as oct method for lens sets with bcrs that steepened in increments greater than 0.1 mm . the currently available as soct systems may provide a new method for assessing the lens - to - cornea fit . however , in this study , it had lower sensitivity in apical clearance detection than the fluorescein pattern method . this observation , combined with its relatively low measurement precision , may limit the clinical value of current as soct systems . | backgroundthis study aimed to evaluate anterior segment spectral optical coherence tomography ( as soct ) for assessing the lens - to - cornea fit of rigid gas - permeable ( rgp ) lenses .
the results were verified with the fluorescein pattern method , considered the criterion standard for rgp lens alignment evaluations.material/methodstwenty-six eyes of 14 patients were enrolled in the study . initial base curve radius ( bcr ) of each rgp lens was determined on the basis of keratometry readings . the fluorescein pattern and as soct tomograms were evaluated , starting with an alignment fit , and subsequently , with bcr reductions in increments of 0.1 mm , up to 3 consecutive changes .
as soct examination was performed with the use of rtvue ( optovue , california , usa).resultsthe average bcr for alignment fits , defined according to the fluorescein pattern , was 7.8 mm ( sd=0.26 ) .
repeatability of the measurements was 18.2% .
bcr reductions of 0.1 , 0.2 , and 0.3 mm resulted in average apical clearances detected with as soct of 12.38 ( sd=9.91 , p<0.05 ) , 28.79 ( sd=15.39 , p<0.05 ) , and 33.25 ( sd=10.60 , p>0.05 ) , respectively.conclusionsbcr steepening of 0.1 mm or more led to measurable changes in lens - to - cornea fits .
although as soct represents a new method of assessing lens - to - cornea fit , apical clearance detection with current commercial technology showed lower sensitivity than the fluorescein pattern assessment . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a young male domestic shorthair cat weighing 1.6 kg was admitted to a veterinary teaching hospital for elective orchiectomy . a lumbosacral epidural injection of preservative - free morphine ( 0.1 mg / kg ) and lidocaine ( 0.25 ml / kg ) was performed under general anesthesia . one hour after extubation , the cat became agitated . acepromazine ( 0.02 mg / kg i m ) was administered but clinical signs did not cease . naloxone ( 2 g / kg iv ) was administered and clinical signs resolved within 20 mins . a young male domestic shorthair cat weighing 1.6 kg was admitted to the veterinary teaching hospital of the sao paulo state university ( unesp - botucatu ) for an elective orchiectomy as part of a teaching laboratory for third - year veterinary students . the cat was judged to be healthy on the basis of physical examination and medical history ( american society of anesthesiologists grade i ) . after premedication with an intramuscular injection of acepromazine ( acepran 0.2% , 0.05 mg / kg ; vetnil ) , ketamine ( dopalen , 5 mg / kg ; ceva ) , morphine ( dimorf 1% , 0.2 mg / kg ; cristlia ) and xylazine ( xilazin , 0.5 mg / kg ; syntec ) , a 24 g intravenous catheter was aseptically placed in the cephalic vein . anesthesia was induced with iv propofol ( propovan , 2 mg / kg ; cristlia ) . endotracheal intubation was performed with a 3.5 mm cuffed endotracheal tube connected to a non - rebreathing system and anesthesia was maintained with isoflurane ( isoforine ; cristlia ) in 100% oxygen . an isotonic crystalloid solution ( lactated ringer s solution ; fresenius - kabi ) was administered at a rate of 10 ml / kg / h iv throughout surgery . monitoring included thoracic auscultation for heart and respiratory rate , mucous membranes evaluation , rectal temperature and systolic arterial blood pressure using a doppler ultrasonic device ( 811-b ; parks medical electronics ) . under aseptic conditions and for teaching purposes , a veterinarian with experience in anesthesia ( lkk ) performed a lumbosacral epidural injection of preservative - free morphine ( dimorf 1% , 0.1 ml / kg ; cristlia ) over 1 min , and using the stylet of a 24 g catheter . orchiectomy was performed uneventfully by an experienced surgeon , and meloxicam ( melocox , 0.1 mg / kg ; eurofarma ) was given intramuscularly at extubation . during anesthetic recovery , approximately 1 h after extubation , the cat became agitated and restless . severe licking and biting of the hindlimbs , tail and lumbar area were observed ( see video 1 in supplementary material ) . acepromazine ( 0.02 mg / kg ) was given intramuscularly ( approximately 30 mins ) without any significant changes in behavior . approximately 20 mins later , the cat was calm and not showing signs of discomfort or pruritus ( see video 2 in supplementary material ) . morphine , administered epidurally , is a popular opioid used for the treatment of pain in dogs and cats . in cats , epidural administration of morphine has long - lasting antinociceptive effects . the mechanism is still unclear , but some hypotheses include the involvement of serotoninergic receptors , the activation of areas in the dorsal horn of the spinal cord and the presence of an . a lack of resistance during the epidural technique was noted , which normally suggests appropriate needle placement . in addition , cerebrospinal fluid was not observed in the needle hub , but it can be difficult to see because of the small size of the epidural space in this species . experimental studies have shown that injection of high doses of morphine ( 0.21.0 mg / kg ) into the cisterna cerebellomedullaris induces itch behavior in cats . in people , the onset of pruritus occurs between 0.5 and 3 h after epidural morphine . in this case , clinical signs occurred 1 h after extubation ( approximately 1.5 h after epidural injection ) . at that time , lidocaine - induced motor blockade had probably ended as the cat could ambulate normally . the reversal of analgesia is a common fear among researchers , but human studies show that opioid antagonism is effective in the treatment of pruritus caused by epidural and intrathecal morphine . opioid antagonists are administered by constant rate infusion or boluses using patient - controlled devices in humans to treat opioid - induced adverse effects . pruritus appears to be closely associated with stimulation of mu receptors as partial and full opioid antagonists are effective in the prophylaxis and treatment of opioid - associated pruritus . low - dose naloxone was associated with a decrease in pruritus and nausea without changes in pain scores in humans . , pruritus might be under - reported and interpreted as agitation in the anesthetic recovery , pain or dysphoria . the intense grooming behavior in cases reported earlier were successfully treated with low doses of propofol and ondansetron , a serotoninergic receptor antagonist . this is the first case report using naloxone , an opioid antagonist for the treatment of morphine - induced pruritus . brain barrier to exert its effects in the central nervous system and reversing opioids that are administered by the epidural route . a low dose of acepromazine was administered in an attempt to produce sedation and anxiolysis without reversing the analgesic effects of morphine . acepromazine has sedative and anti - histaminic properties that could have contributed to the treatment of pruritus ; however , this effect was not observed in this case . finally , a low dose of naloxone ( 2 g / kg ) was administered intravenously over 1 min and it seemed to reverse the clinical effects . the duration of action of naloxone is unknown in cats ; however , reoccurrence of pruritus was not observed until at least 3 h later when the patient was discharged . the anesthetic and analgesic protocols used in this case are not commonly employed at our veterinary teaching hospital . veterinarians should be aware of this possible complication after intrathecal or epidural administration of opioids , and naloxone can be considered as a treatment option . | case summarya young male domestic shorthair cat weighing 1.6 kg was admitted to a veterinary teaching hospital for elective orchiectomy . a lumbosacral epidural injection of preservative - free morphine ( 0.1 mg / kg ) and lidocaine ( 0.25 ml / kg ) was performed under general anesthesia .
one hour after extubation , the cat became agitated .
severe licking and biting of the hindlimbs , tail and lumbar area were observed .
pruritus was suspected and likely to be caused by epidural morphine .
acepromazine ( 0.02 mg / kg i m ) was administered but clinical signs did not cease .
naloxone ( 2 g / kg iv ) was administered and clinical signs resolved within 20 mins.relevance and novel informationdifferent therapeutic approaches are available for the treatment of morphine - induced pruritus .
this case describes an additional treatment option using opioid antagonism with naloxone . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
broadly , there are five areas which are available for a bams graduate to build a career successfully viz . clinical practice , academic ( teaching ) , management & administration , drug manufacturing and research . research is a process of searching the knowledge by systematic investigation and to establish novel facts by scientific methods . medical research has lot of importance as it is much needed for the addition of knowledge and thereby to improve health care . it can be achieved by various methods of research ranging from drug trials to community surveys and from trends in the past years to unusual cases in the hospital . even though variety of approaches are available , the scenario of medical research in india is not encouraging . there are reports available mentioning facts & figures about the modern medical undergraduate students level research and also discussing the potential reasons behind this apathy , . considering the global scenario , the medical council of india is focusing more on the improvement of medical research and emphasizing the same even at undergraduate level . in case of ayurveda , although the research culture is slowly gaining pace , the undergraduate students are not educated or motivated in this direction . the present study reports the attitude of interns in an ayurveda teaching hospital about research as a career . we carried out a cross sectional study among the interns of the kleu 's bmk ayurved mahavidyalaya , belgaum , wherein the interns ( n = 40 ) were asked to prioritize their career options from research , teaching and clinical practice . lastly , the interested candidates were asked to enroll their names for the ongoing research projects in the college . this whole exercise was done at the end of a lecture , which was arranged as a part of routine activities for the interns as an institutional norm . out of 40 interns , 36 preferred clinical practice as first career priority , whereas 4 selected teaching as option . research was chosen as second priority by 18 and third priority by 22 interns . when asked about the rationale behind this priority , they unanimously opined that ayurveda is a clinical science and they have opted for a medical degree , hence clinical practice obviously becomes their first preference . they also feel that treating the patients and thereby helping mankind is a noble job and they would be happier to take up this job . further , they have experienced that the physician who treats the patients receives high regards in the society and that is why their preference is towards clinical practice . interestingly , although they could justify their first preference towards clinical practice reasonably well ; they could not provide any justification for their preference towards research . rather , they expressed their inability to comment anything about research . regarding enrollment to the research projects the present study was carried out to know the attitudes of the interns towards research as career option in an ayurvedic teaching hospital . this may be because they are not exposed to the research methodology and importance of research during their undergraduate studies . further , the current curriculum does neither include terms like evidence base , data generation nor the introduction to findings of major nationwide research projects such as csir - nmitli , a science initiative in ayurveda . the central council for indian medicine ( ccim ) has introduced research as a subject in final year ayurvedic ( bams ) students , which is welcoming step . although this will impart theoretical knowledge , it would prove more impactful if coupled with practical training . the students during their undergraduate studies rarely get an opportunity to visit a research institute or get hands - on - training in certain techniques . the same thing is reflected in the career options prioritized by the interns participated in our study . we therefore suggest that an elective module exclusively in research can be introduced during the internship tenure , wherein the interested students can be posted at a research institute for a period of two months or so . for the students of modern medicine ( mbbs ) , various schemes and programmes are available such as icmr short term studentship ( sts ) , kvpy ( kishore vaigyanik protsahan yojana ) , conferences for medical students and so on . mbbs students are eligible to get srf through which they can work on a research project for three years and can extend the work by registering to phd . it is offered by indian council of medical research ( icmr ) , council of scientific and industrial research ( csir ) and university grants commission ( ugc ) . we further feel that if the students are exposed to the research methodology in their undergraduate days , they will be in a better position to conduct full - fledged research studies during their postgraduate tenure . this will certainly help to improve the standards of md / ms dissertations and phd theses . vaidya - scientist fellowship programme to train the candidates in the shastras , science and medicine along with exposure to appropriate research methodology is an ambitious programme , which not only needs to be continued but also to be strengthened by increasing intake capacity . our study thus highlights the ignorance ( and therefore apathy ) of interns towards research as career option . however , it must be noted here that the study has not been conducted in structured way . this makes the results less generalizable and it would be desirable to carry out such study in different colleges across the country involving a larger sample size . to sum up , the career preferences given by interns in our study indicates conventional approach towards medical education . there is need to change their attitudes through appropriate training and by introducing different programmes to foster the research culture . | although today 's ayurvedic graduates have many career options to select from , they are not given any exposure to these options during their study .
this results in apathy towards selection of any career apart from clinical practice .
the present study carried out amongst interns of one ayurvedic college highlights this fact and underlines the importance of introducing
research as a subject in the curriculum . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lower extremity ( le ) malalignment influences the load distribution on the joints ,
mechanical efficiency of the muscles , and proprioceptive orientation and feedback from the
hip and knee , resulting in altered neuromuscular function and control of the lower
extremities1 , 2 . among these le alignment variables , femoral anteversion has been
identified as a risk factor for hip and knee joint injury3 , 4 . increased femoral
anteversion can increase hip adduction and knee abduction because the patella shifts to the
medial side of the femoral condyle groove , thereby increasing the q - angle and ultimately
resulting in knee valgus deformity5 . as
females have a wider pelvis , larger q - angle , and larger femoral anteversion values than
males , more females experience frontal plane stress while engaging in functional tasks4 . thus , an accurate assessment of femoral
anteversion is important for diagnosing and preventing hip and knee injuries6 . femoral anteversion is the degree of forward projection of the femoral neck from the
frontal plane of the shaft7 . radiographic evidence
and complex trigonometric formulae have been employed to determine the femoral anteversion
angle and the femoral neck shaft angle8 . however , the limitations of radiographs do not allow for the axes to be placed
accurately9 . ultrasound ( us ) , which is
both inexpensive and noninvasive , can be used to measure femoral anteversion , but it is not
easy for a novice examiner to find the true axis of the femur10 . computed tomography ( ct ) is one of the most reliable methods of
measurements for determining the rotational alignment of the lower extremities11 . the inter - examiner reliability of femoral
anteversion measurements with ct is higher than with magnetic resonance imaging ( mri ) , and
there is a significant correlation between the results of ct and the internal rotation of
the hip joint . although imaging can be useful , a physical examination is needed in daily
clinical practice to determine femoral anteversion . craig s test is the most commonly used
physical method for measuring femoral anteversion . craig s test results correlate with
commonly used radiographic techniques ( r = 0.93)12 . however , the examiner may find it difficult to locate and
palpate the greater trochanter and the goniometer axis because one hand has to maintain the
internal rotation of the hip while the other hand measures the angle between a virtual
vertical line , which is based on different standards among examiners and the bisection line
of the tibia using the goniometer . examiners may find it difficult to control the goniometer
axis while maintaining the maximal lateral position of the greater trochanter . thus , there is a continuing need for a method to measure femoral anteversion that is easy
to use , accurate , and reproducible . the purpose of this study was to examine the inter- and
intra - examiner reliability of a goniometer , an inclinometer , and a goniometer with a laser ,
all of which are tools used to measure femoral anteversion in craig s test . thirty - seven healthy volunteers ( 20 males , age 28.71.1 years , height 1.710.4 m , and mass
72.87.7 kg ; 17 females , age 26.31.6 years , height 1.640.2 m , and mass 67.35.9 kg )
participated . the inclusion criteria were no prior medical history of surgery and no acute
le orthopedic injury or lumbar spine injury for at least the previous 6 months . before
taking part , the participants were placed in a prone position , with 90 flexion
of the knee joint . using one hand , the examiner palpated the greater trochanter until it was
positioned laterally and maximally during passive internal rotation of the hip joint . the
examiner then used a handheld goniometer with his other hand to measure the angle between
the tibial lines , a line bisecting the medial and lateral malleoli , and an imaginary
vertical line extending from the table13 , 14 . the second method also started with craig s test but used an acumar digital inclinometer
( lafayette instrument co. , lafayette , in , usa ) instead of a handheld goniometer . the
inclinometer was attached along the line between the fibular head and the lateral malleolus . calibration was performed with the vertical line extending from the table during each
craig s test , and the angle displacement between the vertical line and the end position was
recorded . in the third method , femoral anteversion was measured using a handheld goniometer with a
leveling laser beam ( ld - sl01 , land group , zhejiang , pr china ) . the leveling laser beam ,
located on a tripod , was used to project both vertical and horizontal beams . the
intersection point of the vertical and horizontal lines was focused on the center of the
subject s patella . during craig s test , the position of the goniometer axis for the virtual
vertical line was located using the vertical laser beam . two novice examiners ( fourth - year undergraduates in the department of physical therapy )
used the three methods in all the tests . the examiners results from the first session were compared with
the corresponding results from the second session to calculate the intra - examiner
reliability of each method . to avoid any learning effect , each examiner had a 1-day interval
between the first and second sessions . on the same day , the other examiner evaluated the
same subject in an identical fashion to calculate the inter - examiner reliability . all the
data were recorded by a third examiner to avoid comparison of the data during the three
methods for each of the two examiners . the examiners collected the data during the tests to
ensure that the participants remained as stable as possible for all three methods . to ensure
that the examiners remained blinded to each other s assessments , the two examiners entered
the examination room independently . each of the examiners performed three trials ( one
session for each trial ) , and each measurement was taken on the right femur . the data were analyzed using pasw statistics for windows ( version 18.0 ; spss inc . , intraclass correlation coefficients ( icc ) ( 3,1 ) and 95% confidence intervals ( ci )
were used to analyze the intra - examiner and inter - examiner reliability . the icc reference
values of the present study for the reliability of the measurements were poor ( less than
0.25 ) , low ( 0.260.49 ) , moderate ( 0.500.69 ) , high ( 0.700.89 ) , and very high ( above
0.90)15 . the
goniometer , combined with the laser , showed the highest reliability ( icc 0.680.93 ) among
the methods assessed ( table 1table 1.icc3,1 and 95% ci for day - to - day intra - examiner reliabilitysessionexaminer 1examiner 2mean ( sd)icc ( 95%ci)mean ( sd)icc ( 95%ci)goniometer110.5 1.4 * 0.82 ( 0.61 to 0.92)7.9 1.20.74 ( 0.43 to 0.88)210.4 1.28.1 1.6goniometer with a laser beam110.3 1.00.86 ( 0.68 to 0.93)10.0 1.20.78 ( 0.51 to 0.9)210.0 1.29.7 1.3inclinometer19.6 1.30.73 ( 0.39 to 0.88)8.7 1.90.72 ( 0.37 to 0.87)210.0 0.98.3 1.6*degree ) . however , the craig s test with the goniometer and laser showed moderate reliability ( icc
0.130.83 ) ( table 2table 2.icc3,1 and 95% ci for inter - examiner reliability of day 1icc ( 95%ci)goniometer0.25 ( 0.68 to 0.67)goniometer with a laser beam0.62 ( 0.13 to 0.83)inclinometer0.27 ( 0.64 to 0.68 ) ) . the aim of this study was to determine the intra- and inter - examiner reliabilities of
femoral anteversion measurements obtained using craig s test with a goniometer , an
inclinometer , and a goniometer with a laser beam . the results showed that craig s test using
a goniometer with a laser beam had moderate inter - examiner reliability and that the
reliability was higher than that of the other methods . the angle between a line extending from the longitudinal axis of the tibia ,
assumed to be vertical , to the dorsal condyle of the femur and a vertical line to the ground
is considered to represent femoral anteversion . it is considered easier to find the femoral torsion . rather
than finding the longitudinal axis of the tibia , the femoral torsion axis is found using a
line connecting the dorsal surfaces of the medial and lateral condyle of the femur . although
the fti is more reliable than ryder s method16 , we focused on the reliability of the vertical line extending to
the ground . although both ryder s method and the fti utilize the longitudinal axis of the
femur , the imaginary vertical line could vary with the standing posture and head posture of
the rater . the results of our study showed that craig s test using a goniometer with a laser
beam was more reliable than the traditional craig s test . ruwe et al . reported that craig s test of the femoral anteversion
angle correlated with intraoperative measures ( r = 0.930 ) and with
radiographic techniques ( r = 0.941 ) . however , other studies found that the
results of physical examinations of femoral anteversion were not consistent with those
obtained with imaging techniques10 , 16 . souza and powers17 reported that physical examinations had such a wide
confidence interval that their clinical utility may even be called into question . one
problem when using a goniometer is the position of the axis . although goniometers are
commonly used to measure the range of motion , it is difficult to simultaneously handle the
instrument and identify reference anatomical points additionally , anatomical errors and
undesirable movements may compromise the results18 ,
19 . another possible reason why
goniometers are less reliable is that the experience and ability of the examiner may , at
least partially , affect the reproducibility of the measurement20 . our results showed that the inclinometer method with
craig s test had lower reliability because of the difficulty in locating the attachment
position for the inclinometer . we used a goniometer with a laser beam to increase the
reproducibility in assessing the vertical axis , resulting in better inter - examiner
reliability than the traditional craig s test . using a goniometer with a laser beam , the
novice examiner can measure femoral anteversion with a more accurate reference axis . however , the examiner can not ensure the femoral anteversion angle using a goniometer with a
laser beam because physical examination methods do not correlate well with imaging
techniques ( ct , mri , us)10 , 16 . clinicians are aware that goniometer measurements are not
interchangeable with true femoral torsion obtained by imaging techniques . although we controlled the standard measurement axis with the laser beam , we did not
control subject posture during the measurement . pelvic location was not in the same prone
position on the two measurement days . because the acetabulum location is changed by the
pelvic tilt position21 additionally , no lower
extremity muscle length test was performed ; thus , the iliopsoas muscles and rectus femoris
can affect the pelvic and femur locations in a prone position . the future studies should
consider participants positions during measurement and examine relationship between muscle
length in lower extremity and femoral anteversion . in this study , we found that craig s test using a goniometer with the laser beam method
showed high intra - examiner reliability and moderate inter - examiner reliability . clinically ,
these findings may supplement existing measurement skills and reduce the difficulty in
locating the goniometer axis during craig s test . | [ purpose ] the purpose of this study was to determine the inter- and intra - examiner
reliability of measurement methods for femoral anterversion during craig s test .
[ subjects
and methods ] the study included 37 healthy participants ( 20 males and 17 females ) .
two
novice examiners ( department of physical therapy students at silla university ) used three
different methods to measure the femoral anterversion during craig s test : a goniometer , a
goniometer with a laser beam , and an inclinometer .
[ results ] the intra - examiner
reliability was high for both examiners with all three measurement methods , with scores of
0.82 , 0.86 , and 0.73 for examiner 1 and 0.74 , 0.78 , and 0.72 for examiner 2 for the
goniometer , goniometer with the laser beam , and inclinometer , respectively .
the
inter - examiner reliability during craig s test was below moderate for both the goniometer
( 0.25 ) and inclinometer ( 0.27 ) and moderate for the goniometer with the laser beam ( 0.62 ) .
[ conclusion ] this study found that craig s test using a goniometer with a laser beam had
high intra - examiner reliability and moderate inter - examiner reliability .
clinically , these
findings may supplement existing measurement skills and reduce the difficulty of locating
the goniometer axis during craig s test . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
even in the earliest explorations of eukaryotic ultrastructure it was clear that the nucleus , the defining organelle of eukaryotes , can and does differ widely in size and morphology between different species . these nuclei do , however , seem to share a number of certain features in the electron microscope : every nucleus is bounded by a double - membraned nuclear envelope ( ne ) , perforated by nuclear pore complexes ( npcs ) and often underlayered on the nuclear periphery by a dense lamina . electron dense bodies such as the nucleolus are commonly found in the nuclear interior ; and even the earliest light microscopic studies recognized that chromatin , the nucleus packaged dna , seemed to come in less and more densely packaged forms , termed euchromatin and heterochromatin respectively . though all these features are clearly present in the model metazoan organisms , such as vertebrate , fly , and nematode cells , stark differences emerge when we look at another favorite group of organisms , the fungi . the model yeast saccharomyces lacks both a lamina and obvious heterochromatin , and the npcs seem far smaller than those in metazoa . thus , metazoan organisms generally disassemble their ne and npcs completely at the onset of mitosis to allow the spindle to assemble and segregate the chromosomes . a new ne and the npcs reassemble around the daughter chromosomes at the end of mitosis . by contrast , both the ne and npcs remain intact throughout the entire cell cycle of yeast , with the spindle forming inside the unbroken nucleus ( see refs . 8 and 9 for reviews ) . yeast and metazoa are actually rather close cousins from the perspective of the entire eukaryotic evolutionary tree , both sharing the opisthokont branch or supergroup ( fig . 1 ) . however , many unicellular parasitic protozoa are highly divergent eukaryotes , and many sources have suggested that their nuclear organization is markedly different , albeit lacking much in the way of a molecular characterization . thus , our normal opisthokont - centric view , focusing on those cells and organisms most closely related to our selves , i.e. , animals and fungi , may be inadequate in attempting to understand these economically important and human - impacting disease organisms . further , as many protists are major components of the biosphere , their overall impact on the environment is immense . here we use one such divergent organism , trypanosoma brucei , as a perspective on this issue . remarkably , recent advances have revealed that many of the underlying structures and systems in nuclei seem far more conserved than appearances suggested from the rather divergent transcriptional mechanisms in trypanosomes , but that there are crucial differences . these advances allow us not only to view the whole tree of eukaryotic evolution anew , but shed new light on how our own cells are organized and function , with therapeutic implications not only for these divergent parasites but also for ourselves . ( a ) cartoon of structures at , and associated with , the nuclear envelope . shown are the nuclear pore complex / karyopherins ( red ) , sun / kash ( linc complex ) proteins ( blue ) and known components of a nuclear lamina ( lamins , green ; nup-1 , yellow ) . ( b ) the evolutionry distributions of the nuclear pore complex / karyopherins , sun / kash proteins and known nuclear lamina proteins are shown colorized and overlaid upon a schematic phylogeny of the eukaryotes , emphasizing the five contemporary - recognized supergroups . feca , first eukaryotic common ancestor ; leca , last eukaryotic common ancestor ; kap , karyopherin ; sar + ccth , stramenopiles alveolates , and rhizaria + cryptomonads , centrohelids , telonemids and haptophytes . trypanosomes are members of the euglenozoa , a group of organisms that belongs to the excavata supergroup ( fig . 1 ) . they most likely branched very early during eukaryotic evolution , which in part may explain some of their more unusual biology . species include the photosynthetic euglenids , which populate most fresh water environments , free living phagotrophs , such as bodo saltans , and plant and animal parasites , the phytomonads and trypanosomatids , respectively . trypanosoma brucei has emerged as the model organism for this group , on account of both its importance as the causative agent of human african trypanosomiasis , and from technical advances that include robust rnai systems , excellent cytology and , most recently , forward genetics based on whole genome rnai screening . accordingly , our understanding of transcription and chromatin organization is comparatively advanced for t. brucei , although major gaps remain in our knowledge . as far as we know , all trypanosomatids exploit primarily polycistronic transcription , where large ( tens ) numbers of open reading frames are transcribed in tandem . there is little evidence for functional association between orfs in individual polycistronic transcription units ( ptus ) , although evidence suggests that the position within the ptus is associated with mrna copy number . the nascent rnas that are produced from the ptus are processed by a combination of trans - splicing and polyadenylation to yield mature mrnas that , bar an unusual 5 cap structure , are organizationally indistinguishable from higher eukaryotes . however , this mode of transcription does mean that much of the genome is constitutively transcribed , and mrna abundance is primarily controlled at the post - transcriptional level , in sharp contrast to metazoan and yeast model systems , where the transcription of each gene is usually highly regulated by a dedicated promoter . notable exceptions to this mechanism are the loci encoding the superabundant surface antigens , the variant surface glycoprotein ( vsg ) and procyclin ; these molecules are expressed at very high levels , and rather remarkably , their transcription is driven by rna polymerase i , rather than the more usual rna pol ii which is responsible for transcribing the majority of ptus . both vsg and procyclin are developmentally regulated , with the former expressed exclusively in mammalian infective forms and the latter in insect vector stages . while procyclin orfs are embedded within the body of the chromosomes and consist of small loci of a handful of orfs , vsg transcription is substantially more complex . vsg is the molecular basis for antigenic variation , the primary immune evasion mechanism in these organisms . the sequential expression of distinct vsgs , in a semistochastic manner , serves to allow escape from immune destruction at the population level , and which appears to rely on monoallelic expression , i.e. , a single vsg expressed in any one cell at any one time . key to this is the restriction of transcriptionally active vsg orfs to subtelomeric expression sites ( es ) , where the vsg is the most telomere - proximal orf in a pol i - driven ptu . selection of a single vsg is achieved by repression of most vsg ess within heterochromatin , and the translocation of the active expression site into a specialized region of the nucleus called the expression site body ( esb ) . it is likely that the positioning of vsg ess at the nuclear periphery , by virtue of their subtelomeric location , places the inactive ess within the heterochromatin . both telomere suppression and vsg - specific repression mechanisms appear to operate ( see below ) . further , the procyclin locus , which is also transcribed by pol i , is also subjected to control via positioning within the nucleus ; when active , i.e. , in the insect , the locus resides peripherally to the nucleolus . while definitive data are lacking , all evidence points to a peripheral nuclear position for the locus in the mammalian infective stages , where it is ( relatively ) inactive . while polycistronic transcription is certainly not unique to trypanosomes , the high proportion of the genome transcribed by this mechanism is highly unusual . however , taken with the presence of pol i - mediated transcription of protein - coding genes , exploitation of 4d positioning of loci encoding super - abundant surface antigens whose expression is modulated in a life cycle dependent manner and the divergent evolutionary position of trypanosomes suggests the presence of unusual mechanisms at the nuclear periphery . although it had been suggested from in silico analysis that the nuclear transport system of trypanosomes had little in common with that of opisthokonts , a combination of proteomics , structural studies , and comparative genomics has revealed that the npc and associated karyopherin transport factors are an ancient feature , and that the overall configuration of this organelle and the transport mechanism and diversity of pathways were established in the last eukaryotic common ancestor ( termed leca ) . by contrast the lamina and associated macromolecules appear to be more divergent . the basic npc architecture , in terms of division into a structural scaffold , consisting predominantly of protocoatomer - related proteins , together with a gating system comprising about ten disordered fg repeat - containing nucleoporins , is conserved across the eukaryotes . further , the karyopherin family is likewise ancient and , perhaps more remarkably , based on an ability to reconstruct the majority of karyopherin clades as being widely represented across the eukaryotes , the level of diversity and specificity in nucleocytoplasmic transport is both well conserved across the eukaryotic lineage and a feature of the leca . what these studies imply is that the plural mechanisms of nucleocytoplasmic transport , which are intimately wrapped up with mrna processing and translocation into the cytoplasm and hence gene expression , are extremely ancient . minor differences in the compositions between mammalian , yeast , plant and protozoan npcs may signal some diversification / adaptation of mechanism that reflects the differing transcriptional systems in place in these various lineages , but at a level that is quite detailed and one that is not immediately obvious or accessible from a study of the proteins comprising the npc and in silico approaches alone . in part , this is due to our rather limited grasp of the precise functions of many individual nucleoporins themselves , and it may well be that some functionality is redundant , such that the presence of a specific subunit from one organism has little or no clear impact on functionality ; this is certainly an area where more investigation is warranted . we have evidence for a nucleoporin , tbnup92 , that appears functionally similar to the mitotic spindle - associated tpr nuclear basket proteins , despite an absence of obvious sequence - based homology and also an fg - repeat nucleoporin , tbnup53b , potentially involved in transcriptional control and hence analogous to the nup98 proto - oncogene from drosophila , albeit again with no obvious primary structural similarity ( holden , j , mpr and mcf , unpublished data , and refs . it is unclear if these functional similarities in the absence of evidence for sequence relatedness are a result of convergent evolution or a failure in search algorithms to detect such similarity . in sharp contrast to the npc / karyopherin system , there is good evidence for significant divergence in the nuclear lamina . while a nuclear lamina has been clearly detectable by ultrastructural analysis in various eukaryotes , and might be expected , in the sense of a basic requirement for structural support of the nucleus ( though yeast does manage without apparent support ) , a knowledge of the molecular basis was restricted to metazoa , where the lamin proteins have been well characterized . despite extensive searches of the genomes of yeasts and many other organisms , no evidence for lamin orthologs had been forthcoming , leading to the suggestion that lamins represent a metazoan innovation . first , through a serendipitous route , a clear lamin ortholog was identified for dictyostelium discoideum , which even includes a c - terminal prenylation signal , heptad repeat signatures and a potential cdk-1 phosphorylation site consensus ; orthologs are also present in additional amoebozoa genomes . with lamins restricted to metazoa , lineage - specific innovation is the obvious explanation , but the new data suggest that in fact lamins arose several hundred million years earlier , at least as early as the origin of the unikont lineage , which includes the opisthokonta and amoebozoa . clearly then , the absence from fungi can now be interpreted as a secondary loss , and has profound implications for our views on gene expression mechanisms and lifestyles of rather early eukaryotes close to the radiation of the modern supergroups . this study also provides a salient lesson as well identification of divergent proteins and detecting an ortholog is often challenging ; the tools available have especial difficulty with coiled coil proteins . this topic is discussed further in a recent extra view article in these pages to which the interested reader is referred . in the remaining supergroups , the bikonts , there is so far only one example of a lamina - associated protein for which convincing functional evidence is available . this is the trypanosome nup-1 protein , which actually has structural similarities with and fulfills many of the reported functions of lamins . nup-1 forms a fenestrated , apparently fibrillar , network on the inner face of the nucleus , and is implicated in functions including maintaining the structural integrity of the nucleus , positioning of npcs and telomeres , and mediating telomeric silencing . interactome analysis also indicates a physical association between the npc and nup-1 ( obado s , mcf , mpr and chait bt , unpublished ) . in trypanosomes , the role in telomere positioning is particularly critical as monoallelic vsg expression is dependent on heterochomatinization of subtelomeric vsg expression sites , and indeed there is good evidence that this process is disrupted by knockdown of nup-1 . while the parallels between nup-1 and unikont lamins are striking , there are some critical differences . first , there is no obvious sequence relatedness and the amino acid repeats in t. brucei are 144 residues , significantly larger than the heptad repeats of the lamins . second , nup-1 is a huge protein of 407 kda , compared with ~60 kda for lamins , which means that nup-1 can reach across a substantial proportion of the trypanosome nuclear volume , and hence may indicate a rather distinct structural organization to the lamins ( fig . 2 ) . however , this may in part be specific to trypanosomes as the orthologs in leishmania are considerably smaller , albeit still predicted to contain over 2,000 residues . hence , while there is no evidence for any relationship or common ancestry between nup-1 and the lamins , we remain agnostic on this issue . blue ovals indicate the relative sizes of a fibroblast and trypanosome nucleus , at 10 m and 1.5 m in diameter . the molecular weight of the unikont lamins is approximately 60 kda while nup-1 is 450 kda ; these are indicated as white bars close to the indicator lines for each nucleus . the inference is that the structural arrangement of the lamina in these systems is potentially very different . also , as mitosis is closed in trypanosomes , the nup-1 network does not break down as does the mammalian lamin network , but rather it is maintained throughout mitosis , where it may participate in chromosomal segregation ( holden j and mcf , unpublished data ) . the absence of a massive re - assortment of the nuclear envelope during mitosis is quite significant in terms of maintaining epigenetic marks and the mechanisms by which specific dna sequences are incorporated into heterochromatin , as in metazoa several lamin - dependent mechanisms that deliver loci to heterochromatin occur as a component of mitosis and reassembly of the nuclear envelope at late anaphase , which clearly can not be the case for trypanosomes . hence it is unclear just how many of the proteins that control entry , exit and maintenance of heterochromatin are shared across the eukaryotes . however , it seems to us a key point that peripheral organization of developmentally - regulated chromatin ( kept inactivated as heterochromatin until needed ) at a nuclear lamina composed of coiled - coil proteins is a shared feature of representative unikont and bikont organisms . linc complexes are comprised of trimers of sun and kash domain proteins ; these trimers then interact within the lumenal space of the nuclear envelope . these trans - membrane domain proteins are responsible for providing a physical tether for the lamina to the nuclear envelope , as well as a connection between the nuclear lamina and the cytoskeleton . significantly , sun and/or kash domain proteins with the same architecture as those present at the nuclear envelope of metazoa are found in all eukaryotic lineages ( including excavata lineages such as the diplomonads and heterolobosids ) , with the exception of the trypanosomatids ( fig . by contrast , sun - like proteins , have different architecture to classical sun proteins ( fig . 3 ) and their function is likely distinct from the classical sun proteins of the linc complex , and are found in trypanosomatids as well as elsewhere . this is perhaps consistent with the restriction of the nup-1/nup-2 lamina to trypanosoma and perhaps argues against convergent evolution from a common lamin / sun / kash system . if this is the result of loss from a leca possessing a lamin - based system , or reflects differential evolution of the lamina in the trypanosomatid and unikont lineages remains to be determined . it is also possible that , as trypanosomes likely branched early from the eukaryotic lineage , that evolution of the lamin / sun / kash system postdates their speciation event . however , the discovery of the d. discoideum lamin is a further salient lesson in relying too heavily on in silico data alone , if any more are really needed at this juncture , and resolution of this issue will require deeper experimental probing . in summary , the nuclear periphery of the trypanosomes appears to be a mixture of highly conserved elements , together with other elements that may be lineage specific , or are at the very least , extremely divergent ( fig . 1 ) . the values supporting the separation into two main subfamilies are : approximate likelihood ratio test calculated with phyml 3.0/non - parametric bootstrap calculated in raxml 7.2.6/posterior probabilities from phylobayes 3.3b . the right panel depicts the domain structures of sun - domain containing proteins of the representative species used in the phylogenetic analyses . given the evidence that nup-1 is involved in the positioning of telomeres , npcs and also the repression of both the vsg and procyclin loci , it is important to consider how the t. brucei lamina impacts singular , mono - telomeric vsg expression and organizes chromatin in a broader context . it seems unlikely that a lamina itself would directly control allelic exclusion , but tethering could certainly be important for maintaining the silencing of all but one of the telomeric vsg genes . for example , a single telomeric vsg may " untether " as part of the process that allows transcriptional activation . a swap in tethering could then allow transcription to switch from one telomeric vsg to another , a process known as in situ switching . it is worth considering what is known about the sub - nuclear context of the active and silent telomeric vsgs in this regard . silent vsgs are thought to be associated with the nuclear periphery while the active vsg is found in the esb . however , no esb - specific factor has been described , and cells depleted for the telomeric - repeat dna binding protein , rap1 , that is required for full telomeric vsg silencing , form multiple esbs . this then provides support for the idea that rna pol i recruitment and esb formation are consequences of activation . thus , current observations are consistent with a tethering - untethering model as outlined above , but it remains to be seen whether activation and untethering , if it happens , occur in a specific order or if they occur concomitantly . significantly here , no increase in the number of esbs was observed following nup-1 knockdown , suggesting a distinct mechanism to rap1 . there is increasing evidence that basal telomeric silencing in t. brucei and vsg gene silencing are mechanistically distinct . the first evidence in support of this distinction came from studies on telomeres themselves , which could be removed , disrupting basal telomeric silencing , but without disrupting vsg silencing . a second piece of evidence derives from studies on the histone deacetylase , silent information regulator 2 related protein 1 ( sir2rp1 ) , which is required to maintain basal telomeric silencing in many organisms but had no major impact on vsg silencing . interestingly , studies on nup-1 suggest that it is only vsg silencing that is dependent on the intact nuclear lamina . it remains possible that basal telomeric silencing is dependent upon another component of the nuclear lamina but characterization of these other components will be required to determine whether this is indeed the case . the lamina component , nup-1 , is now known to play a role in vsg silencing , and other observations are consistent with the idea that the t. brucei nuclear lamina is important for organizing and reducing the mobility of many subtelomeric vsg genes within the confines of the nuclear space . it will be important to identify lamina - associating sequences and lamina - associated domains in t. brucei and structural or regulatory rnas should probably also be considered in possible models of vsg expression control . ultimately , any model that seeks to explain mono - telomeric and switchable vsg transcription , a system that requires communication among telomeric genes , will likely require the identification of new key regulators and will also need to deal with issues relating to cause and effect . whatever comes next , we suspect that further characterization of the t. brucei lamina will make an important contribution to improving our understanding of this complex process . the structure and segregation of the t. brucei nuclear genome , suggests the possibility of differential interactions with the nuclear lamina , with implications for recombination and gene expression . the 32 mbp haploid nuclear genome of t. brucei is distributed across more than 120 linear chromosomes , divided into three classes : 11 pairs of megabase chromosomes ( mbc ) of at least a megabase in size , one to five intermediate sized chromosomes ( ic ) , and more than 100 minichromosomes ( mc ) of 50 to 150 kbp . the mbcs contain all of the housekeeping genes , as well as about 15 telomere - proximal vsg ess . the mcs are highly repetitive in nature and constructed around a palindromic arrangement of a characteristic 177 bp direct repeat ; many also contain vsg genes , providing a library of distinct variants . the intermediate chromosomes also carry vsg genes , though in contrast to the mcs , these are present in ess . in addition to the linear chromosomes , the t. brucei nucleus contains an unknown number of circular extra - chromosomal dnas termed nlaiii repeat ( nr)-elements of up to 400 kbp in size . the nr - elements contribute approximately 6% of the total dna content of the nucleus , but have no known function . in common with the mcs , these different classes of nuclear dna exhibit significant variation in segregation during mitosis and their subsequent organization in the interphase nucleus . the mbcs are segregated by a spindle - kinetochore interaction via microtubules peripheral to the main central spindle , so enabling the telomeric regions of the mbcs to maintain their association with the nuclear lamina during mitosis and remain within the established heterochromatin throughout the cell cycle , although to date components of the trypanosome kinetochore remain uncharacterized . this arrangement may serve to prevent interaction with the active vsg es , which localizes to the extranucleolar expression site body , the site of rna polymerase i driven expression of the active vsg , and which replicates later during the cell cycle . by contrast the mcs and nr - elements segregate along the central spindle and rapidly migrate to the poles of the daughter nuclei , after which the mcs maintain an asymmetric distribution during interphase , and the nr - elements disperse throughout the interphase nucleus . compared with the mbcs , the interaction of the mcs with the nuclear lamina therefore appears episodic , with the association breaking down during mitosis as they migrate along the central spindle , and then becoming re - established upon completion of mitosis , as indicated by a persistent asymmetric distribution during interphase . the vsg genes on the mcs are not in ess meaning that they can not be expressed from these loci , so any potential loss of their heterochromatin state during mitosis will presumably not lead to expression , negating a need for this level of repression . instead , periodic dissociation from the nuclear lamina may allow for recombination between mcs , potentially serving to generate further vsg variants . establishment of putative mc - lamina interactions may also allow recombination with silent vsg ess also present in the peripheral heterochromatin , but likely also prevents disruption of the active vsg during interphase on account of the differential positioning and kinetics of replication of the esb . in contrast to the mbcs and mcs , there is no evidence that the nr - elements interact with the nuclear lamina . indeed , their circular structure and consequent lack of telomeres may preclude any such interaction , resulting in their dispersal during interphase . our understanding of the evolution of the ne has advanced considerably in the past five years , with 2012 being a particularly good year for moving forward in our understanding of the evolutionary biology of the lamina . the old paradigm of lamins as metazoa specific is now clearly obsolete , and there is robust evidence for a lamina in at least one branch of the excavata . many gaps remain , and we currently lack definitive information on the compositions of the lamina of plants , chromalveolates , stramenopiles and several excavata lineages , despite the clear evidence for heterochromatin in these taxa . in the case of plasmodium , a member of the chromalveolates , a role for telomeric positioning in antigenic variation and with gross similarities to african trypanosomes is well known , but the absence of a molecular definition of a lamina is a significant gap in comprehending the virulence mechanisms of a major pathogen . much novel biology and many surprises likely await the investigations of the lamina in these organisms . the rather unusual minichromosomes , which contribute to antigenic variation , are an important aspect of the biology of trypanosomes , and may have had a strong influence of the evolution of the nuclear lamina in these taxa , potentially to avoid promiscuous recombination , reactivation and other defects that could disrupt antigenic variation . however , genome structure alone can not explain the high divergence between lamin - based and nup-1-based lamina as , for example , minichromosomes are absent from t. cruzi , a related trypanosomatid that has a clear nup-1 ortholog . in terms of defining the functions of the trypanosomatid nup-1 lamina , a pre - requisite for deeper comprehension of how related the mechanisms of organization of chromatin truly are in trypanosomes and unikonts , it will be essential to probe the interactions of these proteins in greater detail . this will necessitate interrogation of how trypanosome lamina components operate in the context of specific dna sequences , determination of the nature and distribution of lamina - targeting sequences ( if such exist ) , how the nup-1 lamina organizes chromatin - modifying activities , and how this system integrates with the nuclear envelope and spindle . answering these questions is most likely a long journey , but the identification of nup-1 as a lamina component has finally provided a doorway through which we can begin that journey . lastly , we can ask : why do eukaryotes seem to share , as a most fundamental mechanism of genetic control , developmental regulation by packaging of huge blocks of chromatin at the nuclear periphery , a periphery organized in many cases by an extensive coiled - coil protein network ? such developmental heterochromatin in higher eukaryotes is used to store the genetic information needed to build tissues . cohorts of tissue - specific genes are packaged away in lineages where expression is not needed , or perhaps more critically , would be detrimental if allowed to occur ; the dynamic range of heterochromatin suppression is very much greater than simple promoter - based inactivation . hemoglobin genes are thus normally inactive in the nuclear peripheral heterochromatin of all but hemopoetic cells while cell adhesion molecules that specify cell type and position are similarly inactivated during metazoan embryogenesis . but leca was undoubtedly unicellular , and therefore these sophisticated multicellular organism - related processes can not explain the need for such tight regulation . likewise , the parasitic lifestyle of trypanosomes necessitates massive remodeling to accommodate drastically different insect and vertebrate host environments , but again leca predates multicellularity , and hence such parasitic lifestyles . however , the inference that leca possessed such a developmental regulation mechanism indicates that it could undergo significant changes in its lifestyle . the primordial environment leca faced was potentially much more unstable and chaotic than most organisms face nowadays , as it is our extensive biosphere that contributes to stabilizing earth s modern climates . it is also possible that the specific location that leca found itself in had specific challenges that necessitated periodic modulations of gene expression patterns , for example salinity or seasonal changes . we speculate that perhaps leca evolved to change its form and function to adapt to these shifting environments . an ability to store great amounts of genetic information to be used upon need could have been the path to the eukaryotic colonization of diverse land and sea environments , and the basis for the multicellularity required for the complex lifeforms that enabled such colonization . | temporal and spatial organization of the nucleus is critical for the control of transcription , mrna processing and the assembly of ribosomes .
this includes the occupancy of specific territories by mammalian chromosomes , the presence of subnuclear compartments such as the nucleolus and cajal bodies and the division of chromatin between active and inactive states .
these latter are commonly associated with the location of dna within euchromatin and heterochromatin respectively ; critically these distinctions arise through modifications to chromatin - associated proteins , including histones , as well as the preferential localization of heterochromatin at the nuclear periphery .
most research on nuclear organization has focused on metazoa and fungi ; however , recent technical advances have made more divergent eukaryotes accessible to study , with some surprising results .
for example , the organization of heterochromatin is mediated in metazoan nuclei in large part by lamins , the prototypical intermediate filament proteins . despite the presence of heterochromatin , detected both biochemically and by em in most eukaryotic organisms , until this year lamins were thought to be restricted to metazoan taxa , and the proteins comprising the lamina in other lineages were unknown .
recent work indicates the presence of lamin orthologs in amoeba , while trypanosomatids possess a large coiled - coil protein , nup-1 , that performs functions analogous to lamins .
these data indicate that the presence of a nuclear lamina is substantially more widespread than previously thought , with major implications for the evolution of eukaryotic gene expression mechanisms .
we discuss these and other recent findings on the organization of nuclei in diverse organisms , and the implications of these findings for the evolutionary origin of eukaryotes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
despite the favorable impact of the recent economic recession on the registered nurse ( rn ) shortage in hospitals , long - term solutions must be pursued in order to offset the estimated deficit of 260,000 rns by 2025 . countering the shortage is essential ; it has been well documented that adequate rn staffing has a positive impact on the safety and quality of care and on patient outcomes [ 2 , 3 ] . both recruitment and retention strategies efforts at recruiting new nursing students have been so fruitful that about 54,000 qualified applicants from entry - level baccalaureate nursing programs were turned down in 2010 . conversely , retaining newly licensed rns ( nlrns ) in their jobs has not been as successful : us organizations fail to retain 26% of nlrns for more than two years after the start of their first jobs , although almost 92% take another job in nursing . this large discrepancy between organizational and professional turnover rates suggests that nlrns are disenchanted with their employers but not with nursing . while the evidence on what professional and organizational characteristics are related to nlrns ' intentions of leaving their jobs is growing [ 68 ] , we could not find any multistate studies in which nlrns describe what they like best about being a nurse . because improving nlrns ' retention rates decreases organizational costs and ensures a stable future rn workforce , we hypothesize that creating opportunities for nlrns to carry out what they best like about being a nurse might help to narrow the gap between professional and organizational turnover rates . those pursuing a nursing career believe that their work will provide them opportunities to help or care for others [ 1114 ] , as well as interesting , varied , and flexible employment prospects [ 13 , 15 , 16 ] , good and stable income [ 1416 ] , and some degree of professional autonomy [ 15 , 16 ] . brennan [ 17 , page 561 ] reported on the professional traits senior nursing students described as typical of nursing : emotional proficiency ( e.g. , being compassionate ) , devotion / service ( e.g. , being committed or an advocate ) , dependability ( e.g. , being accountable or a decision maker ) , and cognitive proficiency further , nursing education programs set expectations for future nurses to provide care that is patient centered , evidence based , high quality , and safe , delivered as part of an interdisciplinary team , and aided by information technologies [ 18 , 19 ] . however , evidence suggests that many settings are not supportive of nlrns providing the kind of care they expect to provide . for example , nlrns have reported that excessive workloads can preclude the provision of patient - centered care [ 2023 ] . they often describe work environments as unsafe and their involvement in quality and safety initiatives as minimal . many nlrns perceive colleagues to be antagonistic [ 20 , 23 , 2527 ] and nurse managers as unsupportive [ 23 , 28 ] . a study of a nationally representative sample of us rns found that limited variety , autonomy , social support , collaboration with physicians , and opportunities for promotion and employment affected nlrns ' intentions of leaving their jobs . studies have described students ' expectations of nursing practice prior to entering nursing school or starting a nursing job [ 1117 ] , the expectations nursing schools impose on them [ 18 , 19 ] , and their own discontent with practice environments [ 6 , 2028 ] . lacking from the literature are nlrns ' insights into what the best part of nursing is that , if achieved , might help organizations to retain these nurses . in this descriptive study , we analyzed the responses to an open - ended question what is the best part of being a nurse ? that we had inserted at the end of a quantitative survey designed to collect data on nlrns ' personal characteristics ( such as education and marital status ) , work - environment and job characteristics ( such as autonomy and job satisfaction ) , and employment opportunities . information about the quantitative survey is provided elsewhere . the institutional review boards at new york university and the university at buffalo granted us permission to conduct the study . the random sample was nlrns who answered the above question and were licensed by exam between august 1 , 2007 , and july 31 , 2008 , in metropolitan statistical areas and rural areas in 15 states ( al , ky , md , mi , nc , nj , nv , ny , ok , or , pa , sc , tn , tx , and wv ) . the sample was designed to represent nlrns residing in 25 metropolitan statistical areas ( msas ) and 2 rural counties in the 15 states . first , the distribution of nlrns by each site needed in order to achieve the minimum desired sample size was determined . this list was then organized by each of the 27 sites and sorted according to a random number . for example , in the msa site greenville - spartanburg - anderson , 503 names and addresses of nlnrs were sent from the state . these were then sorted numerically ( smallest to largest ) , and the first 190 names were selected . we recruited subjects from these 15 states because their nursing boards could identify rns licensed by exam for the first time , and they provided data efficiently . content analysis was used to identify the themes regarding what nlrns reported as the best part of being a nurse . in content analysis , representations not of physical events but of texts , images , and expressions that are created to be seen , read , interpreted , and acted upon for their meaning thematic units were chosen for this study because of their descriptive richness [ 29 , p. 108 ] . initially , an assistant entered into an excel spreadsheet all of the nlrns ' written comments . the second author read all of the comments , so that a sense of the whole could be determined and coded the comments by selecting passages that related to the research question . the coded comments totaled nearly 41,000 words ; individual comments ranged from two words ( job security ) to 324 words ( average , 34 words ) . the comments related to the research question were enumerated with the second author noting unique comments as well as recurrent passages . the participants ' comments comprised of phrases and sentences were clustered or grouped to identify data that shared some characteristics and were then categorized . for example , phrases that came directly from participants such as decreased pain and decreased nausea , were characterized as decreasing patients ' symptomatology . the participants ' comments such as the best part of being a nurse is being able to help people in time of need and saving lives every day and the feeling i get knowing i helped save a life or made a difference in a person 's life is very gratifying for me were characterized as saving a patient 's life . for example , comments characterized as decreasing patients ' symptomatology and saving a patient 's life , were then categorized as impacting patient outcomes . categories were clustered , and dendrograms ( tree - like diagrams ) were created to illustrate how participants ' direct comments were collapsed into categories based on shared characteristics , and how the themes were derived from a cluster of categories . , the second author created an audit trail to record reflections , evidence of consistency in coding , and interpretations of data . all of the authors reviewed the audit trail and had discussions about the selection of key characteristics , relationships , and the development of themes until an agreement was reached on the final coding scheme . in addition , numerous participant quotes were included in the results to enhance the credibility of the findings . using the american association of public opinion research response - rate definition ( # 3 ) , the response rate for the quantitative survey was 57% , which resulted in a sample of 1,765 . of the 1,765 who responded to the quantitative survey , 1,195 answered the open - ended response question ; of those , 43 comments were unrelated to the research question and included address or name changes . these comments were removed , resulting in an analytic sample of 1,152 . as table 1 shows , the nlrns who provided comments had a mean age of 32.9 ( sd = 9.1 ) years , with a range of 21 to 63 years . they were primarily white ( 75.6% ) , female ( 91.7% ) , employed full time ( 92.3% ) , and married ( 53.7% ) . almost 85% were employed in inpatient hospital settings ; 86.9% of the hospitals were not magnet recognition program institutions . a majority of the respondents ( 59% ) had an associate 's degree at the time of entry into practice ; the rest had a baccalaureate ( 37% ) , a diploma ( 3.4% ) , or a master 's or doctoral degree ( 0.5% ) . respondents reported a mean of 8.9 ( sd = 4.2 ) months worked since licensure , with a range of 0 to 20 months . although we sampled nurses from 15 us states in which they were first licensed , by the time of data collection , some subjects had already worked in another state . these additional 13 states were az , ca , co , de , fl , in , ky , mn , mo , oh , va , wa , and wi . five themes emerged from the data describing the nlrns ' perceptions of what they considered to be the best parts of being a nurse : providing holistic patient care , having an autonomous and collaborative practice , using diverse knowledge and skills to impact patient outcomes , receiving recognition , and having a job that is secure and stimulating . overwhelmingly , nlrns commented on the centrality of the nurse - patient dyad . within this relationship , they said , nurses exercise caring , compassion , kindness , helpfulness , and advocacy for patients and families aspects of their work that they described as paramount to their personal and professional contentment . one wrote that being a care provider ( both physical and mental aspect of care / need ) and patient advocate and getting the patient trust of you is the most rewarding / important . the following comments suggest that these traditional nursing traits continue to give nlrns a sense that they are enriched , it may edge on the side of holistic nursing but i try my best every time i 'm at work to reflect a sense of caring , happiness , humor , confidence , and strength to my patients . feeling fulfilled in the process of helping others and believing i am attaining my purpose for this time in my life . the best part of being a nurse is being able to help people in one of their times of great need . i am honored to be an advocate for my patients , to see that they are cared for in a way that restores them to health and is satisfactory to both the patient and their family members . many of the comments also suggest a spiritual component . said one respondent [ nursing offers a ] heightened awareness of the importance of spirituality & the reward from recognizing & embracing it . i desire to give the best and most professional nursing care that i can give . many comments suggest that through providing holistic care , nurses grow personally . in taking on the responsibility of ensuring that patients ' needs are met providing quality patient care , as a nurse in a magnet hospital , it provides me with autonomy in my scope of practice . yet they said that autonomy does not imply aloneness , but rather multidisciplinary collaboration with colleagues who value nurses ' knowledge and contributions . respondents noted that a collaborative environment makes [ the ] job doable and more enjoyable ; patients ultimately benefit . the value of teamwork when faced with challenging working conditions is illustrated by the comment of an emergency room nurse . at my job , the best part of being a nurse is the spirit of teamwork and collaboration between er physicians and nurses and nurses with one another . we are constantly treating way too many patients at once , with limited supplies , inadequate space and stressful conditions . i rarely feel as if i do n't have someone ( coworkers ) there to back me up . also , because of doctors ' trust in my assessment and treatment recommendation , i feel a valued part of the team . the nlrns ' comments suggest that they gain satisfaction from using their knowledge and skills to improve patient outcomes . their knowledge encompasses the science of nursing , the nursing process , communication skills , a variety of technical & critical thinking skills , organizational skills , and know[ing ] how , as illustrated by the following comments . the best part of being a nurse is having the opportunity to make a difference in the lives of others . that difference can range from making eye contact and causing a patient to smile to using simple intuition that something is not right and acting on it to save a life . knowing it 's my fault a patient is pain free ; helping patients smile in spite of the pain ; watching patients ' progress ; the one - on - one contact with patients ; helping patients of other languages / cultures to feel comfortable in a foreign setting ; reading survey results that i did something right and made a difference for someone enough that they would remember days / weeks later . the ability to educate and direct people toward healthcare and healthcare - related decisions . having the knowledge to correctly answer questions about health - related matters or have the knowledge where to find answers i do not presently know . in addition , respondents said that they believed that nlrns are providing quality care , using evidence - based practices , and serving as resources for both patients and colleagues . patient education , problem solving , critical thinking , making timely decisions that help patients , and catch[ing ] mistakes . honor , privilege , and joy in witnessing the results of their care for patients , families , and the public . decreased pain , decreased nausea , finding cancer early , decreasing health care costs for the school district , contributing to improvement of community and public health , improved patients understanding of their plan , ease [ of ] suffering , empowered patients , and the saving of lives . the following quotes feature participants ' recognition of the crucial role they play in the outcomes of delivering health care . i feel a great sense of satisfaction and purpose from educating my patients on home care and providing support and a listening ear . when a patient can verbalize or demonstrate a skill with understanding and confidence , i feel i have made a difference in that patient's / family member 's quality of life and outcome or prognosis . this can be as drastic as actually reviving a patient from a code , or as simple as being there when they needed to talk or make a life altering decision . the nlrns ' comments revealed the satisfaction they derive from their work and from the respect and gratitude they receive concerning their impact on patients , families , and communities . they wrote that the best part of being a nurse is seeing satisfaction and gratitude on my patients ' faces , the respect and admiration when people find out i am a nurse , professional respect , gratitude of patients and families , and public trust . one memorable experience i recently had was a 24-week neonate admitted , and every care was given while the parents watched , sadly he did not survive the night but after handing mom her wrapped up child to hold , she stood up and gave me a big hug and said thank you for your hard work , watching your hard effort all night made this devastating experience a lot easier to deal with . i started to tear and it was certainly a moment that strengthened me as a clinician / care giver and as a person . the satisfaction of seeing my patient gets better and knowing that your work was worth it and appreciated . it is amazing to watch the progression of critically ill patients ; it honestly makes the long and stressful days worth every minute and every ache and pain ! the nlrns said that they appreciate the ability to find a position considered recession proof and flexible in terms of practice setting and schedule . competitive salaries , and professional advancement , as illustrated by the following comments . there are so many different areas provided for a registered nurse to pursue . also with i left that field because i wanted to be able to positively affect others ' lives , to work in a somewhat recession proof field , and be able to find a job no matter where i opted to settle . many of the comments addressed the excitement of the job , the changing patient populations , the continued learning , the fast paced and unpredictable nature of their work , and the challenges that they also said that nursing is intellectually challenging and that because medicine is constantly changing the learning never stops , as the following quotes demonstrate . i enjoy the challenge this is a job that requires me to use my education and critical thinking skills constantly . i also like that i pretty much see or learn something new every day . i love connecting with and supporting patients and families in crisis , amidst their vulnerability & tears . i love connecting with and supporting patients and families in crisis , amidst their vulnerability & tears . it is a joy to serve .
having a profession that gives you a learning experience every time you are on the floor , you use your brain and common sense , you can make a difference to someone , there is a lot of room for growth and movement .
having a profession that gives you a learning experience every time you are on the floor , you use your brain and common sense , you can make a difference to someone , there is a lot of room for growth and movement . the purpose of the study was to discover nlrns ' current views regarding the best part of being a nurse . theme one : providing holistic patient careit revealed that nurses value holistic and varied expressions of caring ( physical , mental , psychosocial , spiritual ) , as well as the ability to advocate on patients ' behalf . similarly , brennan [ 17 , page 561 ] described caring and advocacy as traditional nursing attributes associated with emotional proficiency and devotion / service . further , ethos is defined as the disposition , character , or fundamental values peculiar to a specific person , people , culture , or movement . the nursing ethos encompasses caring , compassion , helpfulness , dignity , and empathy for the sick or well . in several studies , these traditional nursing characteristics were described as the ones that attract many students to nursing [ 1114 ] . our findings in theme one suggest that nlrns embody these traditional traits in the early stages of their practice . it revealed that nurses value holistic and varied expressions of caring ( physical , mental , psychosocial , spiritual ) , as well as the ability to advocate on patients ' behalf . similarly , brennan [ 17 , page 561 ] described caring and advocacy as traditional nursing attributes associated with emotional proficiency and devotion / service . further , ethos is defined as the disposition , character , or fundamental values peculiar to a specific person , people , culture , or movement . the nursing ethos encompasses caring , compassion , helpfulness , dignity , and empathy for the sick or well . in several studies , these traditional nursing characteristics were described as the ones that attract many students to nursing [ 1114 ] . our findings in theme one suggest that nlrns embody these traditional traits in the early stages of their practice . theme two : having an autonomous and collaborative practiceit demonstrated nlrns ' appreciation of both autonomous and collaborative practice . the need for autonomy and teamwork aligns with brennan 's contemporary attributes of independence ( such as being autonomous ) and liability ( such as being accountable or a decision maker ) . others have reported that new nurses value autonomy and collegial relationships with physicians [ 6 , 7 , 15 , 16 , 23 ] . further , such attributes continue to be incorporated into nursing education , as part of the quality and safety education for nurses ( qsens ) framework and are influential in shaping nursing identity . the need for autonomy and teamwork aligns with brennan 's contemporary attributes of independence ( such as being autonomous ) and liability ( such as being accountable or a decision maker ) . others have reported that new nurses value autonomy and collegial relationships with physicians [ 6 , 7 , 15 , 16 , 23 ] . further , such attributes continue to be incorporated into nursing education , as part of the quality and safety education for nurses ( qsens ) framework and are influential in shaping nursing identity . theme three : using diverse knowledge and skills to impact patient outcomesit showed that in their work nlrns seek to apply a variety of skills , abilities , and types of knowledge , including , for example , communication , decision making , catching mistakes , critical thinking , problem solving , patient education , and intuition . the nlrns reported the importance of being a source of evidence - based information for patients and colleagues making health care decisions . providing care based on evidence the diverse - role expectations that pertain to knowing and doing detailed in our study are also reported by takase et al . [ 7 , 8 ] , who found that nursing - role expectations included the use of knowledge , decision making , and patient education . we believe that a novel finding from our study pertains to the nlrns ' reported fulfillment from seeing how their nursing knowledge and skills contribute to improving outcomes for individuals and communities ( for instance , decreasing health care costs for a school district ) . unlike the attributes that the nlrns describe as the best part of being a nurse in the other themes in our study which are already captured by available rn work environment instruments ( e.g. , ) , the attribute from this theme is not . the nlrns ' focus on patient outcomes could be explained partly by recent efforts in nursing education to impart knowledge on the links between nurses ' work and patient outcomes , as well as increased participation of nurses in data - reporting initiatives that link nursing care and outcomes , such as the national database of nursing quality indicators . future research should explore the relationship between staff retention and organizational capacity to engage staff rns in continuous dialogue about the impact of nursing care on patient outcomes . it showed that in their work nlrns seek to apply a variety of skills , abilities , and types of knowledge , including , for example , communication , decision making , catching mistakes , critical thinking , problem solving , patient education , and intuition . the nlrns reported the importance of being a source of evidence - based information for patients and colleagues making health care decisions . providing care based on evidence fits the description by brennan [ 17 , p. 561 ] of role expectations such as cognitive proficiency . the diverse - role expectations that pertain to knowing and doing detailed in our study are also reported by takase et al . [ 7 , 8 ] , who found that nursing - role expectations included the use of knowledge , decision making , and patient education . we believe that a novel finding from our study pertains to the nlrns ' reported fulfillment from seeing how their nursing knowledge and skills contribute to improving outcomes for individuals and communities ( for instance , decreasing health care costs for a school district ) . unlike the attributes that the nlrns describe as the best part of being a nurse in the other themes in our study which are already captured by available rn work environment instruments ( e.g. , ) , the attribute from this theme is not . the nlrns ' focus on patient outcomes could be explained partly by recent efforts in nursing education to impart knowledge on the links between nurses ' work and patient outcomes , as well as increased participation of nurses in data - reporting initiatives that link nursing care and outcomes , such as the national database of nursing quality indicators . future research should explore the relationship between staff retention and organizational capacity to engage staff rns in continuous dialogue about the impact of nursing care on patient outcomes . theme four : receiving recognition and theme five , having a job that is secure and stimulatingit shows that new nurses find caring for patients is fulfilling , but they also need external rewards such as financial security , intellectual stimulation , and opportunity for professional advancement . our findings echo those of other researchers who report that new entrants into nursing appreciate having job stability [ 1416 ] , and work that is flexible and stimulating [ 13 , 15 , 16 ] . it shows that new nurses find caring for patients is fulfilling , but they also need external rewards such as financial security , intellectual stimulation , and opportunity for professional advancement . our findings echo those of other researchers who report that new entrants into nursing appreciate having job stability [ 1416 ] , and work that is flexible and stimulating [ 13 , 15 , 16 ] . we acknowledge that some turnover of nlnrs is unavoidable , but organizations can provide much of what the nlrns said they liked about nursing , for example , investing in workflow redesign to allow nlrns more time spent in direct patient care , a professional trait described in theme one that respondents said they value . also , implementing some of the four high - performance workforce practices recommended by the agency for healthcare research and quality could help meet certain needs that nlrns identified in this study . for example , the use of teams in decentralized decision making could help address nlrns ' need for autonomy and collaboration identified in theme two . mchugh et al . also recommended tracking and rewarding performance related to patient outcomes , a strategy that might facilitate nrlns ' desire to see how their work affects patient care , as identified in theme three . recommended the use of extensive training and skill development , as well as opportunities for career development . suggestions include providing continuing education activities for employees and bringing in outside speakers if there is no resident expert , which aligns with the nlrns ' desire for professional growth , as identified in theme five . organizations interested in retaining nlrns could also consider implementing transforming care at the bedside ( tcab ) , a model for engaging frontline staff in quality improvement initiatives . bolton and aronow reported that tcab initiatives in their facility resulted in a reduction in nurse - turnover rates from 7% to 3% over a four - year period , which was estimated to have saved the institution $ 5.6 million . nurse education teams , employee recognition programs , letters of excellence awarded to top performers by the chief nursing officer , and interdisciplinary service agreements [ 34 , page 77 - 78]all in harmony with desires the nlrns identified in our study . while the results contribute to the understanding of what nlrns value in their work , the results should be generalized to the wider population of nlrns with caution . this analysis is based on the comments of the nlrns licensed in 15 us states who took the time to provide a written , qualitative response to a survey question . however , we think that we have used sound methods to ensure rigor in our data analysis . according to sandelowski [ 35 , page 33 ] , auditability can be used as a criterion of rigor or merit relating to the consistency of qualitative findings . a study and its findings are auditable when another researcher can clearly follow the decision trail used by the investigator in the study . we believe that we have met this criterion for ensuring the rigor . in our case , the first , third , and the fourth authors all reviewed the second author 's audit trail , and all of the authors had discussions about the selection of key attributes , relationships , and the development of themes until an agreement was reached on the final coding scheme . our findings , based on responses from nlrns who have been in practice on average for less than nine month across 15 states , align closely with reported expectations of professional nursing practice for students planning to enter nursing education and anticipations for practice that education settings impart on their graduates . despite the extraordinary advances in technology in recent years , the primacy of the nurse they recognize the impact of nurses in the lives of individual patients and in communities , and they are fulfilled by it . additionally , they expect both financial and professional benefits for the provision of their services . the nlrns ' comments suggest that interprofessional collaboration is likely to not only result in improved patient outcomes but also in better nurse retention . further , nlrns recognize the need for continued development of clinical competencies and of formal education , and they expect their employers ' support of this need . schools can not adequately prepare students for practice in all places ; each practice site demands that nurses learn a significant amount of local , specific knowledge [ 36 , page 31 ] . benner et al . suggest that this additional preparation for nursing practice could be accomplished as part of one - year residency programs in specialty work settings , coupled with improvements in undergraduate nursing education . the effectiveness of these interventions for improving nlrns ' retention should be studied in the future . organizations might be able to improve the retention of nlrns within the first two years of starting their jobs by securing opportunities for new nurses to realize what our respondents described as the best parts of being a nurse : providing holistic care , being accountable and collaborative with other providers , seeing how their care is affecting patient outcomes , being recognized and rewarded for their work , and stimulated in their clinical environment . creating opportunities for nlrns to do what is most enjoyable in everyday practice may close the gap between the disproportionately large organizational versus professional turnover of nlrns . future research should examine the impact of organizational strategies on retention rates of nlrns in a variety of settings . | about 25% of newly licensed registered nurses ( nlrns ) leave their first job within two years , but only 2% leave the nursing profession in this same timeframe . therefore , the researchers sought to discover what new nurses like best about being a nurse , in hopes of gaining information that might help facilities to reduce turnover rates .
data were collected between january and march 2009 from 1,152 nlrns licensed in 15 us states .
krippendorff 's method was used to analyze survey responses .
five themes emerged : providing holistic patient care , having an autonomous and collaborative practice , using diverse knowledge and skills to impact patient outcomes , receiving recognition , and having a job that is secure and stimulating .
strategies are discussed that organizations might employ in helping nlrns to realize what they best like about their work , which might lead to improved retention rates . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hasslacher and colleagues have provided a new piece of data regarding pleiotropic effects of levosimendan . in their elegantly designed study , the authors showed in both in vitro and in vivo experiments that levosimendan ' cools down ' oxidative burst in polymorphonuclear neutrophils , and hence prevents or decreases the deleterious effects of reactive oxygen species . levosimendan is known not only to be an inodilator but also to exert cellular protective effects by antioxidant , anti - inflammatory , anti - apoptotic properties [ 2 - 4 ] . herein , the authors seem to puzzle out one piece of the whole pathophysiologic mechanism driving septic - shock - induced myocardial dysfunction . interesting enough , in patients with septic shock , oxidative burst activity was cooled down in unstimulated as well as in stimulated polymorphonuclear neutrophils , whereas in patients with acute heart failure only stimulated oxidative burst was cooled down by levosimendan . we think that the clinical meaning of such a differential effect deserves to be investigated in future studies . it is possible to turn such net improvements into clinically meaningful benefit providing that the time , route and mode of administration are well controlled . decreased respiratory burst activity of polymorphonuclear neutrophils in the study could possibly be driven by the membrane hyperpolarizing effect of levosimendan or phosphodiesterase iii inhibitory effects , which is mainly observed at high doses . actually , whatever the mechanism , such an effect should be kept in mind to tailor the therapy of patients suffering from potentially hazardous complications of excess reactive oxygen species including septic shock . of note , upon preload optimization by fluid administration and/or vasopressor treatment in the study , levosimendan treatment seemed to be well accepted by the patients . however , the reason for the lack of a relationship between a decrease in oxidative burst and survival might be linked to the time of initiation of drug administration . inotropic therapy is usually considered a last option in many patients , and oxidative burst could possibly have already done its irreversible injury in such patients . we think the present study provides a unique opportunity to move faster in decision - making and therapy . | levosimendan , in addition to its inotropic properties , could have anti - inflammatory and anti - oxidative properties , and can potentially decrease the deleterious effects of reactive oxygen species on the tissues . in their study , hasslacher and colleagues provided not only in vitro but also in vivo evidence that levosimendan could preserve organ function in acute heart failure and septic - shock - induced myocardial depression via cooling down the oxidative burst of circulating cells . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
one hundred and twelve eyes of 112 patients with cataract and oht ( 60 males , 52 females ) who were operated between january 2010 and november 2011 were evaluated retrospectively . their mean age was 61.32 11.12 ( standard deviation [ sd ] ) ( 4588 ) years . full ophthalmological examinations including uncorrected visual acuity , best corrected visual acuity ( bcva ) , iop measurements , acd , ica , and cct measurements , slit - lamp biomicroscopy , and fundus examination , were performed preoperatively and postoperatively . iop measurements were made with goldmann applanation tonometer ( haag - streit , switzerland ) , acd with iol master optical biometer ( zeiss , germany ) , ica with goldmann 3-mirror lens ( haag - streit , switzerland ) and cct was measured with ultrasonic pachymeter ( meda , usa ) . the iop levels of the patients were higher than normal , but they had no visual field defects and neither used any antiglaucomatous medications , that 's why classified as oht . the cases with primary open angle glaucoma , acute or chronic primary angle closure glaucoma ( acg ) , pseudoexfoliation ( pex ) syndrome , pigmentary dispersion syndrome , history of ocular surgery , and intraoperative and/or postoperative complications were excluded . preoperative mean bcva of the patients was 0.54 0.23 ( sd ) ( 0.31.00 ) , postoperatively it was 0.03 0.04 ( sd ) ( 0.000.10 ) according to the logarithm of the minimum angle of resolution scores . preoperative mean iop value was 24.67 2.14 ( sd ) ( 2129 ) mmhg , the decrease in iop values of the 1 week , 1 month , 3 month , 6 month , and 1 year was statistically significant but that of the 2 year was not significant . preoperative mean acd value was 2.98 0.33 ( sd ) ( 2.43.6 ) mm . the increase in acd values of the 1 week , 1 month , 3 month , 6 month , and 1 year was statistically significant , but that of the 2 year was not significant . preoperative mean ica value was grade 2.85 0.75 ( 24 ) according to shaffer classification . the increase in ica values of the 1 week , 1 month , 3 month , 6 month , and 1 year was statistically significant , but that of the 2 year was not significant . preoperative mean cct value was 550.89 20.07 ( sd ) ( 520595 ) mm . the increase in cct values of 1 week and 1 month was statistically significant , but those of 3 month , 6 month , 1 year and 2 year were not significant . postoperatively , visual field tests were performed every 6 months from a 1 postoperative month on . preoperative and postoperative bcva , iop , acd , ica , and cct values are summarized . in fig . pre- and post - operative bcva , iop , acd , ica and cct values postoperative intraocular pressure changes postoperative anterior chamber depth changes postoperative ridocorneal angle changes postoperative central corneal thickness changes it is known that the cataract extraction causes iop reduction , but the mechanism is not known completely . after cataract surgery , iop reduction is more prominent in patients with acute or chronic acg . the more shallow anterior chamber is preoperative , the more deepening will occur postoperatively , and ica widens more and as a result of these , mean iop reduction occurs more . showed that in patients with primary acg , cataract surgery resulted in the dissolution of lens volume and pupillary block and also attenuation of the anterior positioning of the ciliary process , which contributed to the postoperative widening of the angle . huang et al . reported that postoperative reduction in iop was proportional to the increase in angle after cataract surgery and postoperative iop reduction was greater in eyes with a narrower angle . besides , after cataract surgery , iop reduction is prominent in eyes with pseudoexfoliative glaucoma . this is due to increase blood - aqueous barrier permeability which is impaired in pexsyndrome and intraoperative aspiration of the pseudoexfoliative material on anterior lens capsule and trabecular meshwork leading to increased outflow . the most important parameter affecting postoperative iop is the preoperative iop level , meaning the higher preoperative iop is , the more postoperative reduction is , the lower preoperative iop is , the less postoperative reduction is . reported that cataract surgery decreased iop in patients with oht over a long period of time , at least 36 months . chang et al . reported that , in ocular hypertensive and glaucoma patients , uncomplicated phacoemulsification had no significant iop - lowering effect compared with the phakic fellow eye for up to 3 years postoperatively and also there was no difference between the mean number of postoperative iop - lowering medications used in the surgical and fellow eyes . in our study , we observed that , in patients with cataract and oht , after phacoemulsification , reduction in iop and increase in both acd and ica were statistically significant at postoperative 1 week , 1 month , 3 month , 6 month , and 1 year , but these changes were not significant at the end of 2 year . phacoemulsification surgery decreases iop and increases acd and ica in the short - term , but in the long - term , it does not cause any significant changes . | we evaluated the effect of phacoemulsification surgery on intraocular pressure ( iop ) , anterior chamber depth ( acd ) , iridocorneal angle ( ica ) , and central corneal thickness ( cct ) of the patients with cataract and ocular hypertension .
the decrease in iop values of the 1st week , 1st month , 3rd month , 6th month , and 1st year was statistically significant , but that of the 2nd year was not significant .
the increase in acd and ica values of the 1st week , 1st month , 3rd month , 6th month , and 1st year was statistically significant , but that of the 2nd year was not significant .
the increase in cct values of 1st week and 1st month was statistically significant , but those of 3rd month , 6th month , 1st year , and 2nd year were not significant .
in conclusion , phacoemulsification surgery decreases iop and increases acd and ica in the short - term .
however , in the long - term it does not cause any significant changes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
clozapine has demonstrated superior efficacy in the management of treatment - resistant schizophrenia and bipolar disorder . regular monitoring of blood counts ensures the safety of clozapine use ; however , certain situations may pose a dilemma . no controlled studies are feasible in this context for obvious reasons and it is not a common encounter in psychiatric settings , with just a few cases reported worldwide . we report a case of a clozapine - stabilized , treatment - resistant bipolar disorder patient with ovarian carcinoma requiring chemotherapy . the clinical challenges are discussed in light of a brief review of the available reports . educated till 9 standard , is a known case of obsessive - compulsive disorder since 8 years of age , and bipolar affective disorder since 22 years of age . she has been on regular treatment , with highly inadequate control of illness , multiple hospitalizations , and modified electroconvulsive therapies ( mects ) since adolescence . following a failure to respond to several psychotropic medications / combinations thereof , the patient was finally initiated on clozapine ( 200300 mg / day ) in addition to lithium ( 900 mg / day ; adequate serum levels ) in the year 2002 , with a remarkable decrease in the frequency and duration of episodes . improvement continued with a further addition of lamotrigine since 2007 ( to control intermittent mild depressive episodes ) . on these medications , in addition , the patient had hypertension , hypothyroidism ( possibly , lithium - induced ) , and obesity ( body mass index : 33.8 ) . the patient was diagnosed to have ovarian carcinoma ( papillary adenocarcinoma stage iiic ) . in the same month , she underwent operative surgery ( total abdominal hysterectomy with bilateral salpingo - oophorectomy and debulking ) , with a plan to initiate chemotherapy with carboplatin . a review of psychiatric management was warranted since carboplatin is known to be associated with a significant drop in blood counts in the course of treatment . due to high likelihood of developing cytopenia with chemotherapy and difficulty in identifying the culprit drug , after several discussions , it was planned that clozapine may be tapered off gradually ( at least during chemotherapy ) . chemotherapy cycles were started at a dose of 200 mg in 5% dextrose on a weekly basis ( one full cycle of chemotherapy involved three sessions of weekly carboplatin followed by 3 weeks gap , i.e. , 6 weeks in total ) . before each chemotherapy , complete blood counts and renal function test were checked . around 2 weeks after the cessation of clozapine , the patient started to have manic symptoms with irritable mood , increase in goal - directed activity , demandingness , reduced sleep , and occasional aggression . lithium levels were within therapeutic range ( 0.871.1 meq / l ) and thyroid function tests were within normal limits . haloperidol was added and increased to 20 mg / day with only a mild improvement in her symptoms . the patient was discharged after three full cycles of chemotherapy , with a plan to continue the rest three cycles from her hometown . the manic symptoms increased in ensuing weeks , posing difficulty in managing her at home . the patient received the 4 chemotherapy in her hometown , which was associated with a drop in blood counts within 3 weeks ( hemoglobin : 7 g / dl , total lymphocyte count : 1800 cells/l , neutrophils : 600 cells/l , platelet : 38,000/l , and dipping further to 18,000/l ) , after which they again presented . after consulting a hematologist and a medical oncologist , it was considered to be postchemotherapy drop , with advice to manage it conservatively ( and a plan to initiate granulocyte colony - stimulating factor [ g - csf ] in case of further decline / complications ) . as the patient had not shown response to haloperidol for optimum dose and duration , the reintroduction of clozapine was considered in addition to on - going lithium and lamotrigine . at this point , both clozapine versus mect were considered as possible options , however it was decided first to go in favor of clozapine in view of excellent response to clozapine in the past few years stabilizing the course of illness and a definite requirement of long - term prophylaxis in her case . risk benefits of clozapine were reassessed and the decision was finalized only after discussion with the patient 's family members . clozapine was initiated and built up more gradually , 12.525 mg for every 34 days . when the weekly chemotherapy dose was due , the dose of clozapine was kept static for additional 23 days . a final dose of 275 mg / day was reached with regular monitoring of blood counts . the patient was subsequently discharged in early 2015 with no further drop in blood counts at any other point . for the past 1 year , the patient continues to be in active follow - up with no recurrence of carcinoma and largely stabilized on previous medications ( viz . this report contributes to a very limited literature on the concurrent use of clozapine with chemotherapy , which is expected to cause a significant drop in blood counts in the usual course . the initial options involve discontinuing clozapine or replacing it with another antipsychotic drug / s , or concurrent administration of clozapine and chemotherapy with careful monitoring . on one hand , the circuitous path of withdrawing a medication on which a treatment - resistant patient is stabilized may compromise psychiatric stability , yet there is a valid argument that such inconvenience would pale in the face of serious hematological risks . such difficult decisions could also be better informed if the evidence support becomes more robust and elaborates on the various clinical considerations . a pubmed - based literature search ( 19952015 ) , followed by cross - references search , using relevant keywords found only 16 case reports worldwide ( one from india ) reporting clozapine use during chemotherapy . initially , it was decided to discontinue clozapine , but it had to be reintroduced after a failed trial with another antipsychotic drug / s . leukopenia / neutropenia was observed in a large majority ( all except three ) of these reports , it was attributed to consequent drop of chemotherapy . a precaution which has been taken in several reports is the modified white blood cell monitoring protocol , i.e. , for every 2 days as opposed to weekly in the presence of leukopenia . it is important to discuss with oncologists whether the clinical presentation is consistent with chemotherapy - induced leukopenia . in some case reports clozapine use during chemotherapy : a review of indexed literature ( 1995 - 2015 ) some studies have suggested the concurrent use of g - csf along with clozapine , when the counts are low . although the g - csf guidelines restrict its use as a primary prophylaxis ( to patients with 20% risk for febrile neutropenia based on patient- , disease- and treatment - related factors ) , it has been given along with chemotherapy and clozapine in few case reports . lithium may also promote leukocytosis and it is suggested to be potentially beneficial in patients with leukopenia . in this patient , lithium was continued for her psychiatric condition , but may have contributed beneficially to blood counts . clinicians from western countries have to apply for a waiver from manufacturer to use clozapine in such exceptional circumstances . even then , clozapine has to be stopped in the event of severe reduction in blood counts . till date nonetheless , clinicians need to clearly document the reasons favoring the continuation of clozapine and consent of family members . the pathophysiological mechanisms may involve genetic susceptibility or immune - mediated toxicity . a possible activation of common apoptotic pathways by clozapine , similar to anticancer drugs , has also been hypothesized , but no concrete evidence points to such a synergistic effect . clozapine - induced leukopenia usually occurs within the 1 year of initiation , and it is nondose dependent and idiosyncratic , which contrasts with its predictable occurrence at the nadir of chemotherapy . there is a need for further research on the underlying mechanisms causing agraulocytosis . to resolve the dilemma , we considered three points of utmost importance in guiding the decision / s , namely , ( 1 ) a careful risk - benefits assessment , depending on the patient 's oncological status and psychiatric condition , ( 2 ) detailed discussion with patient / family members and their consent , and ( 3 ) availability of strong consultation - liaison services , with support from medical oncology , hematology , and emergency medicine . at times , there is a need to make calculated decisions and take acceptable risks , along with watchful monitoring and high level of preparedness . this case highlights one such instance and adds to very limited reports worldwide with the concurrent use of clozapine and chemotherapy . | regular monitoring of blood counts ensures the safety of clozapine use ; however , certain clinical situations may pose a dilemma for management such as use of clozapine in the presence of myelosuppressive chemotherapy .
further , there is very limited literature to guide such decisions .
we report a case of a clozapine - stabilized , treatment - resistant bipolar disorder patient with ovarian carcinoma requiring chemotherapy .
the clinical challenges are discussed in light of a brief review of the available reports . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
antibacterial agents are among the most used medications in children especially in the community setting . they are usually obtained by advisement of physicians and health care workers . in some countries , they can be provided directly from pharmacies and drugstores without the need for a prescription . the majority of consumed antibiotics are used for the treatment of viral upper acute respiratory tract illness ( arti ) that do not benefit from their use . inappropriate overuse of antibiotics arises from incorrect differentiation of bacterial from nonbacterial illnesses or misinterpretation of their effects by patients , physicians , and health care workers . this excessive utilization is a major health problem worldwide , and it has been well documented in the region . it increases potential adverse reactions and cost of the diseases both for the patients and the community , moreover , it 's most important disadvantageous the generation and spread of resistant bacteria . infections induced by these resistant microorganisms can increase the mortality , morbidity , and a hospital stay of patients . experience reveals that the problem of the resistant bacteria could not be solved by the creation of more effective antibiotics . this is true especially in outpatient settings because more than 90% of antibiotics are used in such settings . a thorough evaluation of utilization rate of antibiotics in common illnesses is the first step in planning programs to improve consumption of antibacterials in the population . there is no published study of the rate of antibiotic use in arti in iran . therefore , in this study we used the data from a nationwide household survey to investigate the antibiotic consumption rate in iranian children aged under 5 years with arti . data were collected from a national health survey conducted in 2010 by the ministry of health and medical education ( mohme ) and national institute of health research , iran 's multiple indicator demographic and health survey . detailed methodology is explained , and herein we describe it in brief . in summary , the survey was a cross - sectional multistage stratified cluster - random study , which was performed through face to face household interviews in 31 provinces of iran . the samples were selected proportional to inhabitants of each province and each district within the province . in order to draw meaningful inferences about each province , the minimum sample size for each province in addition , the samples were weighted to reflect the population size of rural and urban areas in each district . the clusters in each district were selected randomly from the list of the last national population and housing census of iran . finally , 3096 clusters ( 2187 urban and 909 rural ) were included . furthermore , 181 supervisors were involved to ensure the consistency and quality of the collected data . the ethics committee of the tehran university of medical sciences , the information office of the mohme , the review board of the statistics center of iran and the policy council and the board of deputies of the mohme approved the study . pamphlets about the importance of the survey , its confidentiality , and freeness of the eligible family to participate or refuse the study were presented to selected households at least 1-day before the interview . at the beginning of the interview , verbal assent and written consent the protection of privacy of interviewee information was assured by categorization and storing of all completed questionnaires in a separate room and saving the data in the web - based information system anonymously . these data were accessible only to specified members of the research team . after checking the age of the children from their birth certificate or its copy , the parents were asked to respond to following questions :
if their under 5 years child had any cough during last 2 weeks prior to interview ? ( rate of arti).if yes , if the child taken to physician , pharmacy , or health system personnel ? ( rate of referral to heath care system).if yes , the child taken to a private or governmental clinic ? ( rate of referral to private / governmental / both / other health care systems).then parents were asked to bring the prescription paper and consumed drugs , trained interviewers checked the presence of prescribed oral and injected antibiotics ( antibiotic consumption rate , injection antibiotic consumption rate ) . if their under 5 years child had any cough during last 2 weeks prior to interview ? ( rate of arti ) . if yes , if the child taken to physician , pharmacy , or health system personnel ? ( rate of referral to heath care system ) . if yes , the child taken to a private or governmental clinic ? ( rate of referral to private / governmental / both / other health care systems ) . then parents were asked to bring the prescription paper and consumed drugs , trained interviewers checked the presence of prescribed oral and injected antibiotics ( antibiotic consumption rate , injection antibiotic consumption rate ) . finally , the data were entered into the predesigned forms . specialized software was based on the cspro data - entry software ( provided by the unicef ) was modified to the questionnaires of the study and was used . the data was uploaded daily through a protected web - based system from all provincial teams in a central computer . the chi - square test was used to identify the association of gender and place of residence with antibiotic consumption and also a place of residence with the referral health care system in studied children . in summary , the survey was a cross - sectional multistage stratified cluster - random study , which was performed through face to face household interviews in 31 provinces of iran . the samples were selected proportional to inhabitants of each province and each district within the province . in order to draw meaningful inferences about each province , the minimum sample size for each province in addition , the samples were weighted to reflect the population size of rural and urban areas in each district . the clusters in each district were selected randomly from the list of the last national population and housing census of iran . finally , 3096 clusters ( 2187 urban and 909 rural ) were included . , 181 supervisors were involved to ensure the consistency and quality of the collected data . the ethics committee of the tehran university of medical sciences , the information office of the mohme , the review board of the statistics center of iran and the policy council and the board of deputies of the mohme approved the study . pamphlets about the importance of the survey , its confidentiality , and freeness of the eligible family to participate or refuse the study were presented to selected households at least 1-day before the interview . at the beginning of the interview , verbal assent and written consent the protection of privacy of interviewee information was assured by categorization and storing of all completed questionnaires in a separate room and saving the data in the web - based information system anonymously . after checking the age of the children from their birth certificate or its copy , the parents were asked to respond to following questions :
if their under 5 years child had any cough during last 2 weeks prior to interview ? ( rate of arti).if yes , if the child taken to physician , pharmacy , or health system personnel ? ( rate of referral to heath care system).if yes , the child taken to a private or governmental clinic ? ( rate of referral to private / governmental / both / other health care systems).then parents were asked to bring the prescription paper and consumed drugs , trained interviewers checked the presence of prescribed oral and injected antibiotics ( antibiotic consumption rate , injection antibiotic consumption rate ) . if their under 5 years child had any cough during last 2 weeks prior to interview ? ( rate of arti ) . if yes , if the child taken to physician , pharmacy , or health system personnel ? ( rate of referral to heath care system ) . if yes , the child taken to a private or governmental clinic ? ( rate of referral to private / governmental / both / other health care systems ) . then parents were asked to bring the prescription paper and consumed drugs , trained interviewers checked the presence of prescribed oral and injected antibiotics ( antibiotic consumption rate , injection antibiotic consumption rate ) specialized software was based on the cspro data - entry software ( provided by the unicef ) was modified to the questionnaires of the study and was used . the data was uploaded daily through a protected web - based system from all provincial teams in a central computer . chicago , il , usa ) . the chi - square test was used to identify the association of gender and place of residence with antibiotic consumption and also a place of residence with the referral health care system in studied children . a total of 29,609 families from 31,350 predesigned families participated in the study ( 94.5% participation rate ) . from 9,345 children under 5 years in participant families , 9,298 ( 99.5% ) enrolled in the survey . overall , 1506 cases ( 16.2% ) had arti in the 2 weeks prior to interview , in whom 1143 ( 75.9% ) were referred to physician , pharmacy or other health care centers . referral to private clinics were higher in urban than in rural areas ( 43.4 vs. 30.4% ; p < 0.001 ) [ table 1 ] . the rate of antibiotic consumption was > 75% in loristan , bushehr , kurdistan , and semnan states . injection antibacterials were advised to more than 20% of infected children in ghom , loristan , and fars provinces [ table 2 ] . total number of participant children in accordance to place of residence and referral health care system number of under 5 children with acute respiratory tract infection and the rate of referral to health care system , total and injection antibiotic consumption in provinces of iran in 2010 the frequency of receiving antibiotics was higher in urban than in rural inhabitants ( 66.0% vs. 57.7% ; p < 0.05 ) [ table 3 ] . in contrast , there was no significant difference in antibiotic usage between two genders [ table 3 ] . in addition , the rate of prescribed injection antibiotic was similar in both genders as well as in rural and urban areas [ table 4 ] . antibiotic consumption rate in children < 5 years with recent cough in iran in accordance to gender and residence group injection antibiotic consumption rate in children < 5 years with recent cough in iran in accordance to gender and residence group this nationwide study showed that 62.6% of the children with acute cough during the previous 2 weeks had used antibiotics . this is a very high percentage , compared to similar studies conducted in other countries as united states in 2011 , norway in 2003 , and united kingdom in 2004 , which were reported to be 21% , 27% and 31% , respectively . however , the high percentage of antibiotic usage in the current survey is consistent with some studies in other countries as malaysia in 2011 and united kingdom in 1990 , and also in the eastern mediterranean region . it has been estimated that 90% of children seeking care for respiratory infections has an illness consistent with viral etiology and do not benefit from antibiotic therapy . underlying reasons for overuse of antibiotics despite scientific disagreement is multifaceted and vary from one country to another . in many situations , the misconception of patients and physicians concerning the effectiveness of antibiotics is the main barrier in the logic use of antibacterial agents . a common scenario is a patient who thinks antibiotics are needed for all infections and so insist on antibiotics , and a physician who do not have enough time to explain why antibiotics are not necessary and therefore simply prescribe them to save time . another setting is a patient who requests antibiotics for a viral infection and a physician who gain income from the patients and so advises them to obtain patient expectations . physicians , who have not enough information or experience in the differentiation of bacterial from nonbacterial illnesses frequently advise antibiotics . furthermore , physicians who are overly cautious excessively prescribe antibiotics in viral infections to protect their patients from complications of the diseases . in some countries including iran , self - medication of antibiotics due to over the counter sale of them is an important additional problem . in these countries most drugs , particularly antibiotics , can be obtained from pharmacies without the need for a prescription . in these communities , some people who can not afford doctor consultations it is necessary to declare potential barriers inappropriate use of antibiotics in each community and to plan strategies for reducing the overall and broad spectrum usage of antibiotics . effective measures in other communities were combinations of interventions including dissemination of clinical practice guidelines , training courses for physicians , follow - up meetings , and feedback to physicians , group education for physicians assistants and for pharmacists , posters for waiting rooms , brochures and hand out to the patients , and restriction of over - the - counter sale of antibiotics . although certain interventions in iran have been targeted at reducing inappropriate prescribing of antibiotics and injection medicines , more focused interventions aiming at reducing inappropriate use of medicines for children are required . in this study , 13.1% of children who had arti received an injection form of the antibacterial agent . to our knowledge , there is no previous report about injection antibiotic usage in arti of children in iran and also in other countries . most children with an acute cough have a viral infection and do not benefit from antibiotics . a minority of them have acute bacterial sinusitis , concurrent acute otitis media , or bacterial pneumonia in which very uncommonly an injection antibiotic is necessary . therefore , consumed injection antibiotics for respiratory infections in the current study are overtly high . injection antimicrobials have the potential to produce severe adverse reactions as anaphylaxis and local injury or infection . the rationale for this type of inappropriate advice of antibiotics probably is similar to causes of the excessive use of antibiotics , that is , unscientific insist of the patients , entail of the patient 's expectations by physicians to save time and income , and unscientific believe of the physicians on rapid and complete effect of injection antibiotics in common respiratory infections . our study shows the rate of oral or injectable antibiotic usage in loristan , bushehr , tehran , fars , and alborz states is considerably higher than mean national consumption rate . in contrast , antibiotic consumption in ilam , west azerbaijan , kerman , and sistan and baluchistan provinces was less than other states [ table 2 ] . although the small sample size in some areas precludes definite estimation of antibiotic usage in these states , the difference in cultures and beliefs about the effect of antibiotics might explain this variation . our findings show that the possibility of getting antibiotic was higher in children living in urban areas compared to rural districts . in urban regions , 66.0% of children who sought care for cough ultimately received an antibiotic while this rate was 57.7% in rural parts . this can be explained by the fact that in urban areas many families prefer to seek medical advice in private offices than governmental clinics . obtaining patient 's medical expectations is more convenient in private offices compared to governmental health centers . in our study , 43.4% of the urban and 30.4% of the rural inhabitants received medical advice in private centers [ table 1 ] . the data do not provide information about the actual diagnosis of children who received antibiotics . moreover , there is no information about the source of the advice of antibiotics , that is , physicians or health care workers prescription , or self - medications . the other limitation is that no information exists about the presence of fever or coryza , and also the appropriateness of the type , dose , and courses of advised antibiotics . the strength of this study is its nationwide coverage with a multi - stage stratified cluster - random selection of the participants , which guarantees the representativeness of the results for the whole community . the other strength is the accurate measurement of antibiotic consumption rate by face - to - face interviews at the home where the drugs were being used . the third strength is a measurement of outpatient injection antibiotic usage in children with acute respiratory problems in addition to total antibiotic utilization . to the best of our knowledge the data do not provide information about the actual diagnosis of children who received antibiotics . moreover , there is no information about the source of the advice of antibiotics , that is , physicians or health care workers prescription , or self - medications . the other limitation is that no information exists about the presence of fever or coryza , and also the appropriateness of the type , dose , and courses of advised antibiotics . the strength of this study is its nationwide coverage with a multi - stage stratified cluster - random selection of the participants , which guarantees the representativeness of the results for the whole community . the other strength is the accurate measurement of antibiotic consumption rate by face - to - face interviews at the home where the drugs were being used . the third strength is a measurement of outpatient injection antibiotic usage in children with acute respiratory problems in addition to total antibiotic utilization . to the best of our knowledge the prevalence of total and injection antibiotics usage in iranian children aged < 5 years with arti is alarmingly high . all authors contributed in the study concept , conducting the analyses , drafting and revising the paper . all authors confirmed the final draft for submission and accept the responsibility for the paper content . | background : to investigate the prevalence of antibiotic usage in children aged < 5 years with acute respiratory tract illness ( arti ) in iran.materials and methods : data were collected from a national health survey conducted in 2010 ( iran 's multiple indicator demographic and health survey ) .
participants of this cross - sectional study were selected by multistage stratified cluster - random sampling from 31 provinces of iran .
parents of children with < 5 years of age responded to questions about the occurrence of any cough during the previous 2 weeks , referral to private / governmental / other health care systems , and utilization of any oral / injection form of antibiotics .
data were analyzed using spss software18 .
the chi - square test was used to determine antibiotic consumption in various gender and residency groups and also a place of residence with the referral health care system.results:of the 9345 children under 5 years who participated in the study , 1506 cases ( 16.2% ) had arti during 2 weeks prior to the interview , in whom 1143 ( 75.9% ) were referred to urban or rural health care centers ( 43.4 vs. 30.4% ; p < 0.001 ) .
antibiotics were utilized by 715 ( 62.6% ) of affected children .
injection formulations were used for 150 ( 13.1% ) patients .
the frequency of receiving antibiotics was higher in urban than in rural inhabitants ( 66.0% vs. 57.7% p < 0.05).conclusion : the prevalence of total and injection antibiotics usage in children < 5 years with arti is alarmingly high in iran .
therefore , interventions to reduce antibiotic use are urgently needed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
interatrial septal aneurysm ( iasa ) along with atrial septal defect and patent foramen ovale are congenital anomalies which are encountered often in the adult patient . with improvement in two dimensional echocardiography and the increasing usage of transesophageal echocardiography , a 41-year old male patient was referred to our institution by his primary care physician for transthoracic echocardiography to evaluate his hypertensive heart disease . the transthoracic echocardiography ( tte ) showed a large mass measuring 1.4 1.4 cm in the left atrium that could represent a thrombus or myxoma [ figure 1 ] . computed tomographic ( ct ) scan of the chest and heart with intravenous contrast did not show any cardiac tumor . tee was then done and it showed a giant iasa bulging into the left atrium and mimicking a left atrial mass [ figure 2 ] . the patient had not had stroke or other cardio embolic phenomenon ; therefore no further interventions were undertaken other than starting aspirin . transthoracic echocardiography showed a large mass ( white arrow ) measuring 1.4 1.4 cm in the left atrium that could represent a thrombus or myxoma transesophageal echo showing interatrial septal aneurysm ( white arrow ) iasa is a congenital malformation of the atrial septum that may occur as an isolated abnormality or in association with various cardiac defects , such as patent foramen ovale ( pfo ) , atrial septal defect ( asd ) , and mitral valve prolapse or connective tissue diseases . its prevalence varies depending on the diagnostic method used but with the widespread use of echocardiography , iasa has become an increasingly recognized entity . , concluded that iasa is detected in 8% of the patients who undergo tee ; it is associated with pfo in 25% of cases and with asd in 22.5% of cases . the diagnosis of iasa is very important to prevent various complications and in differentiating it from an intracardiac mass - like myxoma which will have implications on choice of therapy . nongated chest ct may be unable to distinguish asa from intracardiac mass like in our case and in such cases , tee should provide clarification . however , when echocardiographic evaluation is suboptimal , ecg - gated cardiac mri and ecg - gated cardiac 64-multidetector ct scan are useful alternative modalities of diagnosis . tee has to be regarded the imaging modality of choice for initial evaluation of this lesion as various studies have shown that a significant number of patients with iasa detected on tee were not diagnosed on tte . also as in our case tee can help distinguishing iasa from an atrial mass , which may not be feasible on tte images . although iasa are usually found incidentally as in our case , they can have clinical consequences , such as cardiac thrombo - embolic events , right to left shunt across a pfo or asd , or can mimic a left or right atrial tumor . an annual stroke rate of 3.8% among patients with iasa and pfo compared with 1.05% among those without these anomalies was found in a systematic review of patients with cryptogenic stroke . this study implied a possible increased risk of recurrent stroke in patients with asa and pfo . observations have also been made regarding prevalence of atrial arrhythmias in patients with iasa but no definite associations have been established in this regard . , noted atrial arrhythmias in 25% of patients with iasa . in another multicenter study of 195 patients atrial tachycardia was found in 24% of patients with iasa and 14% of patients had atrial fibrillation . management options for atrial septal aneurysm vary according to the clinical scenario with interventions ranging from just observation in asymptomatic individuals to ablation by surgical or catheter interventions in patients at high risk of stroke . | interatrial septal aneurysm ( iasa ) consists of redundant atrial septal tissue , which bulges into either the left or the right atrium .
the clinical implications of this entity are not entirely clear ; however , if it is associated with other cardiac abnormalities such as patent foramen ovale and atrial septal defects .
it may assume significance by increasing the risk of cardioembolic events such as stroke .
we present a case of an individual with giant iasa detected by transesophageal echocardiography , which was mimicking a left atrial mass on transthoracic echocardiography .
this case emphasizes the superiority of transesophageal imaging over transthoracic echocardiography for this clinical entity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
core stabilization exercises may prevent or improve
symptoms of low back pain because it provides the basis for force production by the
limbs2 . broad benefits of core
stabilization have been reported , including improvement of athletic performance and
prevention of injuries3 . the core muscles include the abdominal muscles in the front , paraspinal and gluteal muscles
in the back , the diaphragm as the roof , and the pelvic floor and hip girdle musculature at
the bottom . this core is composed of 29 muscle pairs that help to stabilize the spine ,
pelvis , and kinetic chain during functional movements . without these muscles , traditional core
exercises , core stability exercises , ball and device exercises , free - weight exercises , and
noncore free - weight training have been studied as methods for core stability1 . methods of increasing core stability also
involve the use of an unstable support surface ( uss ) , such as a ball or balance
platform4 , 5 . the use of uss that increases trunk muscle activity may also be
effective during core stability training6,7,8,9 . in addition , movements of the limbs and
body weight during core stabilization exercises can be used to provide resistance to trunk
muscles10 , 11 . moreover , shoulder resistance exercises increase the endurance and
strength of core stability muscles12 . several studies have been performed using uss during core stability training13,14,15,16 ,
but no study has addressed the effects of a uss on core muscle activities during a shoulder
exercise . therefore , the purpose of this study was to determine the effects of uss on trunk
and lower extremity muscle activities during pulley - based shoulder exercises . subjects were volunteers recruited
from a university in seoul and were accepted for this study if they were in good health , had
no current musculoskeletal , neuromuscular , or cardiovascular problems , and had a normal
range of shoulder joint motion . subjects were excluded if they had trauma or pain in the
trunk or a shoulder joint or a history of surgery . in addition , those who had experienced
core stabilization training or therapy within the last 3 months were excluded . subjects
signed an informed consent form prior to participation , and the study protocol was approved
by the institutional review board of the university of sahmyook . forty - eight hours before starting the study , all subjects abstained from excessive
exercise . a 5-min warm - up stretching exercise was conducted prior to the performing of the
exercises . prior to electrode placement , sites were prepared by abrading the skin with fine
sandpaper and cleaning it with 70% isopropyl alcohol . muscle
activations of the trunk were measured during pulley - based shoulder exercise ( pbse ) using
14-kg resistance on the uss . pbse comprised shoulder abduction , adduction , flexion ,
extension , internal rotation , and external rotation . the orders of the six pbse exercises
were randomized , and each exercise was repeated five times . a metronome , set at 80 counts
per minute , was used during the exercises to control speed . all exercises were conducted with the feet apart ( within shoulder
width ) and parallel to the shoulders . abduction and flexion exercises were conducted from 0
to 90 of the shoulder range of motion with the elbow joint in extension . adduction exercise
involved 90 to 0 of the shoulder range of motion with the elbow joint in extension . extension exercise involved 180 to 90 of the shoulder range of motion with the elbow joint
in extension . external rotation exercise involved internal rotation 45 to external rotation
45 with the elbow joint in 90 of flexion . internal rotation exercise was conducted from
external rotation 45 to internal rotation 45 with the elbow joint in 90 of flexion17 . a pulley machine ( pulley ex , sanimed ,
ibbenbren , germany ) was used for all shoulder exercises . the flat floor of the laboratory
was used as the stable support surface , and a pedalo - vestimed # 50
( diameter 50 cm , height 19 cm ) was used for the uss during shoulder exercises . the top and
bottom of the pedalo device were connected by four fixed springs , and the top of the pedalo
device was able to move up and down in all directions . to measure trunk muscle activities , emg data were collected from the rectus abdominis ( ra ) ,
external oblique ( eo ) , and erector spinae ( es ) ; to measure lower extremity muscle
activities , emg data were collected from the rectus femoris ( rf ) , tibialis anterior ( ta ) ,
and gastrocnemius ( ga ) . for the ra , electrodes were placed 2 cm lateral , 1 cm superior , and
1 cm inferior to the umbilicus . for the eo , the electrode was placed midway between the
anterior superior iliac spine and the most inferior aspect of the rib cage . for the es , the
electrodes were placed 2 cm lateral to the 3rd lumbar vertebra and parallel to the
lateral - most high iliac crest . for the rf , the electrode was placed midway between the knee
and iliac crest on the front of the thigh . for the ta , the electrode was placed on the
lateral side of the tibia three - fourths of the distance from the knee to the ankle . for the the locations of
all electrodes were determined using the method described by cram and kasman18 , and all electrodes were placed on the
dominant sides . a datalog p3x8 data acquisition unit ( biometrics ltd , gwent , uk ) surface emg signals were extracted with the biometrics analysis
software ( v7.50 ) in ascii and were processed using a root mean square ( rms ) algorithm in
myoresearch xp master edition 1.06 ( noraxon u.s.a . the sampling
rate was set at 1,000 hz per channel , emg signals were band - pass filtered from 20 to 450 hz ,
and a 60-hz notch filter was used to reduce noise . descriptive statistics were used to analyze general subject characteristics , and a one - way
repeated - measures analysis of variance was used for each muscle . twenty healthy adult male subjects ( height , 176 5 cm ; weight , 70 9 kg ; age , 22
3 years ; values are presented as means sd ) participated in this study ( table 1table 1.subject characteristicscharacteristicsage ( years)22.4 2.7height ( cm)176.4 5.1weight ( kg)69.8 8.6dominant siterightvalues are expressed as mean sd ) . values are expressed as mean sd the ra and es showed significantly less activation on the uss ( p < 0.05 ) during shoulder
external rotation , but they showed no significant difference on the uss during shoulder
abduction , adduction , extension , flexion , and internal rotation . the eo and rf showed no
significant difference on the uss during any shoulder exercises ( table 2table 2.mean ( sd ) of the emg activity of trunk muscles on ussshoulder exercisestable support surfaceunstable support surfacerectus abdominis1 . however , the ta showed significantly greater activation ( p < 0.05 ) on the
uss during shoulder abduction , adduction , external rotation , and internal rotation . on the
other hand , the ta showed no significant difference during shoulder extension and flexion on
the uss , whereas the ga showed significantly greater activation ( p < 0.05 ) on the uss
during shoulder abduction , extension , and internal rotation . however , during shoulder
adduction , flexion , and external rotation , the ga showed no significant difference on either
a stable surface or the uss ( table 3table 3.mean ( sd ) of the emg activity of lower extremity muscles on ussshoulder exercisestable support surfaceunstable support surfacerectus femoris1 . . internal rotation23.4 10.930.5 8.2**statistical significance ( p > 0.05 ) ) . * statistical significance ( p < 0.05 ) * statistical significance ( p > 0.05 ) this study indicates that the use of uss during pbse did not increase trunk muscle
activity . on the contrary , this is probably because of the compensation strategy of the ankle rather than
because of that the trunk muscles . this ankle compensation is a postural control strategy
that first appears when there is a slight instability in the support surface . balance in the
upright posture can be restored through muscle contraction near the ankle joint , and a close
relationship exists between this ankle strategy and the activities of the ta and ga . in the
case of postural sway under unstable conditions , balance is recovered by an ankle strategy ,
a hip strategy , or both simultaneously19 .
in the case of rapid shaking of the support surface , balance recovery is achieved via an
integrated ankle / hip joint strategy , and in the case of swaying of the support surface in an
upright posture , balance can be maintained by ankle movement without hip joint
extension20 . in addition , to maintain
postural control , normal adults mainly use an ankle strategy , whereas elderly individuals
and children mainly use a hip strategy21 .
in this study , we compared muscle activities in young male subjects on stable and unstable
support surfaces . based on the results , it would appear that compensation for the uss
involved an ankle strategy rather than trunk muscle activity . shoulder abduction and
adduction exercises involve movements in the frontal plane17 , and postural sway from the uss occurs in the medial / lateral
direction . the results showed significantly increased ta and ga activities ( p < 0.05 )
during shoulder abduction when uss was used but only showed significantly increased ta
activity during shoulder adduction . although ga activity did not significantly increase
during shoulder adduction , muscle activity increased slightly . in this study , the use of uss
significantly increased ga muscle activity during shoulder extension ( p < 0.05 ) . the
extension and flexion exercises involve movements in the sagittal plane19 ; thus , postural sway occurs as the center of gravity moves
forward and backward on the support base . the maintenance of balance against such
forward / backward sway is dependent on the alternating activities of the ta and ga . ga
activity begins before the body collapses in the forward direction , whereas ta activity
appears before collapse in the backward direction23 . in the present study , shoulder flexion resulted in no significant
differences in lower extremity or trunk muscle activity on the unstable surface . however ,
the most activity was seen in the ta compared with the other muscles . in the normal upright
posture , the center of gravity is on the front side22 , and ankle dorsiflexor activity is low ; on the other hand , ankle
plantar flexor activity is high21 , 23 , 24 . the ankle plantar flexor plays an important role in torque
adjustment at the ankle joint and in the maintenance of upright posture25 . therefore , back sway occurs during shoulder flexion due
to use of uss , but because of the influence of the center of gravity at the ankle joint , it
appears to have no significant impact on ta activity due to the ankle dorsiflexors . shoulder
external and internal rotation exercises change the center of gravity with a complex form in
the forward / backward direction as well as in the medial / lateral direction . during shoulder
external rotation on uss , the body sways in the lateral backward direction , and an ankle
strategy can be used to maintain balance . in this study , the ta activity increased
significantly on the uss ( p < 0.05 ) , showing that the ta compensated for lateral backward
sway via eccentric contraction . shoulder internal rotation causes the body to sway in a
forward medial direction , and the ankle strategy is used to maintain balance in a manner
similar to that during shoulder external rotation ( p < 0.05 ) . in this study , pbse may have been able to increase core stability , but using a uss to
enhance core stability may not be effective . further confirmation of these results is necessary in larger , more diverse populations ,
including females and older individuals , and there is a need to measure the deep muscles
such as the transverse abdominis and internal oblique . | [ purpose ] the aim of the present study was to identify the effects of an unstable support
surface ( uss ) on the activities of trunk and lower extremity muscles during pulley - based
shoulder exercise ( pbse ) . [ subjects ] twenty healthy college students were included in this
study .
[ methods ] surface emg was carried out in twenty healthy adult men .
the activities
of trunk and lower extremity muscles performed during pbse using a resistance of 14 kg on
a stable or unstable support surface were compared .
the pbse included shoulder abduction ,
adduction , flexion , extension , internal rotation , and external rotation .
[ results ] on the
unstable surface , the rectus abdominis and erector spinae showed significantly less
activation during shoulder external rotation , but the extent of activation was not
significantly different during other shoulder exercises .
the external oblique and rectus
femoris showed no significant difference during any shoulder exercises .
the tibialis
anterior showed significantly greater activation during all shoulder exercises , except
flexion and extension .
the gastrocnemius showed significantly greater activation during
shoulder abduction , extension , and internal rotation .
however , during shoulder adduction ,
flexion , and external rotation , the gastrocnemius showed no significant difference .
[ conclusion ] the use of uss to increase core stability during pbse is probably not
effective owing to compensatory strategies of the ankle . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in total 1,147 blood samples were collected from rodents : 1,060 were live - trapped , wild animals from < 20 sites ( table 1 ) , and 87 blood samples were collected from a captive colony of wild house mice ( 9 ) and tested serologically . all animal research was conducted under license , according to uk regulations . species key : mmu , mus musculus ( house mouse ) ; rn , rattus norvegicus ( brown or norway rat ) ; as , apodemus sylvaticus ( wood mouse ) ; mg , myodes glareolus ( bank vole ) ; ma , microtus agrestis ( field vole ) ; mmi , micromys minutis ( harvest mouse ) ; cl , cynomys ludovicianus ( black - tailed prairie dog ) ; sv , sciurus vulgaris ( red squirrel ) ; sc , sciurus carolensis ( gray squirrel ) ; na , not available . species containing positive animals are in boldface italics , with number positive and number tested in parentheses . serum samples were separated by centrifugation ( 10,000 rpm , 10 min ) and tested for lcmv antibody by using the manufacturer s protocol for commercial indirect fluorescent antibody assay slides ( charles river laboratories , wilmington , ma , usa ) . a 1:40 dilution of anti - rat or anti - mouse immunoglobulin g fluorescein isothiocyanate ( sigma - aldrich , gillingham , uk ) or a combination of both were used as secondary antibody . ninety - three serum samples ( from the original serum samples tested for antibody ) that were either antibody positive or from sites with high seroprevalence were tested for arenavirus rna by pcr . another 379 blood samples from the captive colony of house mice , which had not been previously tested for antibody , were also tested . the pcr targeted a fragment of the glycoprotein precursor gene ( gpc ) ( 10 ) . a selection of samples found negative by the gpc pcr were subsequently retested by pcr targeted at a fragment of the nucleoprotein ( n ) gene ( 8) , by using primers to sequences common to the old world arenaviruses . total rna was extracted by using qiaamp viral rna mini - kit ( qiagen , crawley , uk ) , converted to cdna , and amplified by using a single - step kit ( superscript iii one - step rt - pcr with platinum taq polymerase system ; invitrogen , paisley , uk ) in conjunction with oligonucleotides arena1 and lcmv322 ( 10 ) or 1010c and either ow1696r or nw1696r ( 8) . products were separated and visualized by agarose gel electrophoresis , and amplicons were purified with the qiaquick pcr purification kit ( qiagen ) . bidirectional sequencing was performed off - site ( mwg biotech ag , ebersberg , germany ) . the software package mega version 4.0 ( 11 ) was used to construct an alignment of a 283-nt fragment of the gpc gene nucleotide sequences and predicted amino acid sequences , and for phylogenetic analysis with the neighbor - joining method ( p distance model ) , with bootstrap support based on 1,000 pseudoreplicates . pairwise genetic distances were calculated by using the p distance model ; percentage sequence identities were calculated by subtracting the genetic distances from 1.0 and multiplying by 100 . overall , 66 of 1,147 serum samples and 7 of 9 rodent species had antibodies to arenaviruses . sciurus vulgaris had the highest prevalence , 26% , although only 15 squirrels were tested . antibodies were also detected in apodemus sylvaticus , microtus agrestis , micromys minutis , captive - housed cynomys ludovicianus , and rattus norvegicus . seroprevalence varied between species ( 1.4%26% ) and between sites ( 0%50% ) ( table 1 ) . gpc pcr amplicons were obtained from 127 of 472 tested samples , and sequences were determined for 97 samples ( table 1 ) . twenty samples negative in the gpc pcr , but seropositive or from high prevalence sites , were tested by n gene pcr , and 2 were weakly positive : 1 s. vulgaris and 1 a. sylvaticus . nucleotide and amino acid gpc sequence identities for all the samples in this study ranged from 93.6%100% ( table 2 ) , and 94.5%100% , respectively ( data not shown ) . when compared with other arenaviruses , the nucleotide sequences exhibited 78.7%85.8% identity with lcmv reference sequences and only 58.1%59.9% identity with lassa virus ( appendix figure ) . although antibodies to arenaviruses have been reported in a range of european rodent species , our study provided evidence of arenaviruses infecting red squirrels ( s. vulgaris ) and european harvest mice ( m. minutis ) . antibodies to arenaviruses have been reported in introduced s. carolensis in great britain ( 12 ) but were not detected in this study . we also reported antibodies to arenaviruses in black - tailed prairie dogs ( cynomys ludovicianus ) : those tested in this study were part of a colony in a zoo , however , and had contact with wild mice , some of which were seropositive . as found in previous studies , mus musculus was more likely to be infected with lcmv than other rodent species . the nucleotide sequences of most pcr amplicons clearly identified lcmv as the most frequent cause of the antibody detected . however , the detection of arenaviral rna in 2 animals by the n gene pcr , but not by the lcmv - specific gpc pcr , may suggest the presence of another species of arenavirus . further studies are needed to determine if other arenaviruses species are present in european rodent populations ( 8) . genetic heterogeneity was present within and between sites ( figure ) , as seen in previous studies of arenaviruses ( 13,14 ) . sequences from animals in the captive colony and a nearby farm ( mf ) clustered and were different from those from a more distant farm ( bhf ) . furthermore , all of the british sequences clearly clustered separately from the reference strain sequences ( from the united states , france , germany , or slovakia ) . these findings suggest spatial heterogeneity in sequence may be reflected in host range and pathogenicity . unrooted neighbor - joining tree using the p - distance model ( 1,000 replicates ) for a section of the glycoprotein precursor gene gene , showing bootstrap values of > 60 for all sequences identified in this study ( 283 bp ) and indicating site of origin . mf * is from apodemus sylvaticus , and all other sequences are from mus musculus . this study has increased the list of european ( and north american ) rodents that may be infected with lcmv and that might therefore pose a risk to humans . the genetic variation observed and potential variations in pathogenicity may indicate that some wildlife populations pose more of a public health risk than others . further studies are needed to assess which mutations cause increased pathogenicity and to establish whether or not lcmv represents the only arenavirus present in european rodent populations . unrooted neighbor - joining radial tree that used the p - distance model ( 1,000 replicates ) for a section of the glycoprotein precursor gene gene , rooted to lassa virus strain lp . a total of 24 representative sequenced amplicons from wild rodents ( 283 bp ) are shown , with comparisons to previously published lymphocytic choriomeningitis virus ( lcmv ) sequences and lassa virus strain lp ( genbank ) . | during a study to extend our knowledge of the host range and genetic diversity of arenaviruses in great britain , 66 of 1,147 rodent blood samples tested for antibody , and 127 of 482 tested by pcr , were found positive .
all sequences most closely resembled those of previously identified lymphocytic choriomeningitis virus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
protection of the gonads against diagnostic x - rays gained ground in the 1950s [ 14 ] . among the reasons were the increased radiation awareness caused by the genetic effects observed in irradiated fruit flies and the higher cancer incidence in the atomic bomb survivors . both effects are supposed to be induced without a threshold dose [ 5 , 6 ] . gonad shielding in radiology has become common practice and is recommended by national and international bodies [ 7 , 8 ] . the gonads will lie in the primary x - ray field or within close proximity ( 5 cm ) ; ( b ) the clinical objectives of the examination will not be compromised ; ( c ) the patient has a reasonable reproductive potential . gonad shielding may be quite effective as it can lower the dose to the testes by about 95% and the dose to the ovaries by about 50% . the lower level of protection in females is mainly due to the large spread in the position of the ovaries , including areas far from the midline lying anterior to pelvic anatomy that has to be visible in the image [ 7 , 9 ] . in the early years the attainable dose reduction was also high in an absolute sense , because the doses needed for imaging were high . in his 1953 review on the potential hazards of the use of x - rays in paediatrics , miller reported a patient entrance dose of about 12 mgy for a radiograph , and an entrance dose rate of 100200 mgy / min during fluoroscopy . fluoroscopy at that time was performed with the classical fluorescent screen , and it was often used instead of radiography , easily resulting in entrance doses of a few hundred mgy . other investigators [ 1012 ] reported similar dose values , but efforts to reduce patient dose were underway . unfortunately , the use of gonad protection is not only advantageous , as becomes clear from many evaluations that show that gonad shielding is poor in daily practice [ 1421 ] . it appears to be very difficult to place the x - ray shield correctly , i.e. fully covering the target area but none of the bony pelvic structures . as a consequence , many images are suboptimal or worse , leading to loss of diagnostic information that impairs the radiologist s work . moreover , the dose reduction can be limited as well , or there may even be a dose increase . since the introduction of gonad shielding there have been major advances in x - ray imaging technology and radiation biology . the improved technology and optimisation of imaging protocols have resulted in much lower doses [ 2231 ] , while the risk for heritable disease has been found to be lower than previously assumed . the question then arises whether today s reduction in radiation risk by applying gonad shielding is still worthwhile in view of its negative consequences . this balance has not been drawn up so far and as the outcome might have a large impact on daily practice , we decided to re - evaluate the benefit of gonad shielding in terms of attainable radiation risk reduction and associated loss of diagnostic information . the three pillars of the radiation protection model of the international commission on radiological protection ( icrp ) are justification , optimisation and dose limits . to comply with the second obligation , optimisation we performed such an evaluation of pelvic radiography in children , using data already available in our picture archiving and communication system ( pacs ) ( kodak carestream health , rochester , ny ) . organ and effective doses , and the effect of gonad shielding on these doses , were calculated using pcxmc , a monte carlo program for estimating patient doses in medical x - ray examinations ( stuk radiation and nuclear safety authority , helsinki , finland ) . , dr . goos - suprema , heidelberg , germany ) gave a trivial reduction of the already very small radiation risk . at the same time , we often observed a serious loss of diagnostic information caused by improper gonad shielding . on the basis of these findings the radiological staff unanimously decided to discontinue gonad shielding in paediatric pelvic imaging using x - rays . realising that our results might be of wider interest and appropriate for publication , we extended our initial investigation with more data , obtained both before and after discontinuation of gonad shielding . this extended study is the subject of this article ; with respect to its execution the medical ethics committee of the maastricht university medical center formally acknowledged that no medical ethical approval was required . in the first retrospective study we investigated gonad shielding and patient dose in children aged 015 years . the children had a standard anterior - posterior ( ap ) pelvic radiograph in 2007 or 2008 , mostly in relation to congenital hip dysplasia . the projection covered the region from the iliac crests to 2 cm below the trochanter minor on the femur . following the majority of other investigators [ 2226 , 33 , 34 ] , we distinguished age groups of 01 years , 15 years , 510 years and 1015 years . additional radiographs were evaluated in the second retrospective study in 2010 after we had stopped the application of gonad shields . the pelvic radiographs had been acquired in three rooms , each equipped with an x - ray system using a digital flat panel detector ( axiom aristos fx plus ; siemens , erlangen , germany ) . these systems have pre - programmed protocols , which set the high voltage ( kvp ) , additional filter , focus to image - detector distance , and either a fixed tube current - exposure time product ( mas value ) or the automatic exposure control ( aec ) . the protocol indicates whether the bucky anti - scatter grid has to be present or absent , but grid insertion or removal has to be done manually . for the younger patients , age - dependent protocols with fixed technique parameters are used . for the 1015 age group different protocols are applied because the children of this age vary strongly in size . for the smaller patients no grid and no aec i.e. irrelevant edges of the images are removed digitally . subsequently the images are sent to our pacs in digital imaging and communications in medicine ( dicom ) format . the dicom header contains retrievable information on the exposure [ e.g. kvp , filter , mas value , use of the grid and the air kerma - area product ( kap ) ] . information on the use of the aec is not stored , neither is the size of the unshuttered field of view . because the quality of gonad shielding potentially has a large impact on the diagnostic information in the image and the dose reduction as well , the shielding was visually evaluated ( by m.j.f . ) . for boys , the gonad shield had to fully cover the testes , while all bony pelvic parts remained uncovered . for girls , the central section of the pelvis had to be covered , again without shielding parts of the pelvic bones , with the exception of the sacrum to just below the sacro - iliac joints . the radiograph made during the patient s very first visit to the department was obtained without shielding . judging from the presence of poor images , retakes had been limited to the absolute minimum . in the evaluation , we therefore identified also all images in which important diagnostic landmarks were not visible due to shielding . specifically we considered assessability of shenton s line , perkin s lines and the acetabular angle ( see fawcett et al . 3 ) ; these studies were labelled as retake required , although no retake was obtained in reality . we also estimated the fraction of the testes that was actually shielded ( percent coverage ) by visual inspection of the radiographs . the corresponding testes dose reduction was calculated with pcxmc as the dose to the testes due to an exposure with the size of the gonad shield , with the field overlaying percent coverage of the testes in the cranial - caudal direction . for girls , we assumed that protection is not very sensitive to positioning of the shield ( in a statistical sense at least ) , because of the large spread in the position of the ovaries . in the first dosimetric study ( data from 2007 and 2008 ) gonad shielding was standard , in the second study ( data from 2010 ) shielding was absent . together with the discontinuation of the gonad shielding , we continued to optimise our protocols . in the first place , more guidance for the imaging of larger children ( 1015 years ) was introduced because of large differences in exposure within this group . secondly , following the european guidelines , we added an additional copper filter of 0.1 mm for the two intermediate age groups . for the youngest patients ( 01 years ) the decrease in image quality was considered too large by the paediatric radiologist ; for the 1015 age group , the filter was already used . the basic filtration of the x - ray beam ( i.e. in the absence of 0.1 mm cu ) was determined from the measured half - value layer in aluminium . since most authors had reported the entrance dose as a dose - in - air including backscatter [ 22 , 23 , 2531 ] , we followed this convention . we estimated backscatter factors for the conversion of incident air kerma to entrance dose for each age group and radiation quality using data from the nrpb report r279 . these factors were 1.26 , 1.35 , 1.39 , 1.45 and 1.48 for the age groups 01 years , 15 years , 510 years , 1015 years small childen and 1015 years large children , respectively . the incident air kerma was derived by pcxmc from the kap and the estimated unshuttered image size . note that the dose in tissue , used in two publications [ 24 , 33 ] , is about 5% higher than the entrance dose as used by most other investigators and us . input information for pcxmc comprises imaging technique settings ( kvp , filtration ) , kap , image field size and projection . note that these exposure parameters are generally independent of the use of gonad shielding , unless the shield was in front of an active aec chamber . the effect of shielding is taken into account by subtracting a fraction of the gonad dose calculated for the no - shield exposure ; under optimal circumstances this subtracted fraction amounts to 95% in male patients and 50% in female patients . the dose estimation in a specific age group of children will be illustrated using the 510 age group as an example . rather than treating these children as a single group in the dose calculation , we considered 5- to 7.5-year - olds and 7.5- to 10-year - olds separately to reduce the potential effects of spread in patient size . by interpolation between data for child phantoms of different age present in pcxmc , we determined the weight and length of children of 6.25 and 8.75 years . using the exposure parameters and interpolated patient size and weight for each subgroup , organ doses and effective dose were calculated with pcxmc for the 6.25- and 8.75-year - olds . the average dose for the 510 age group was then calculated by averaging the results for these two subgroups . doses for other age groups were estimated in a similar fashion ( always using two subgroups ) . the problem of the collimator settings not being stored in the dicom header ( necessary as input on field size ) was addressed by determining the average difference in width and height of the original ( unshuttered ) and shuttered images for a limited set of images for which both types of data were retained . considerable variations in measured differences existed , but on average 1 cm had to be added in all four directions to compensate for the shuttering . although this correction for shuttering is necessarily approximate , its application was preferred over leaving it out as this systematically would overestimate the entrance dose . to derive the effective dose from organ doses , the tissue - weighting factors published in icrp 103 were chosen in pcxmc . as gonad shielding is applied to limit hereditary effects , the detriment adjusted risk for heritable disease was estimated ( the detriment adjusted risk takes the various potential , negative consequences of the exposure into account , weighting for the seriousness of the corresponding harms ; for the official definition see icrp 103 ) . because we saw no solution to the problem of translating the loss of diagnostic information into a numerical risk that might be compared with the risk of radiation , we limited the quantitative risk analysis to radiation effects only . shortcomings of gonad shielding , which manifest themselves inevitably in daily practice , and which have an impact on the patient dose , are : ( 1 ) in males , an incomplete coverage of the testes , ( 2 ) the need for retakes because vital landmarks are obscured and ( 3 ) an increase in dose when an active aec - chamber is ( partly ) shielded by the lead supposed to shield the gonads . only point 1 was taken into account , the other two were not , because of missing information . the detriment adjusted hereditary risk of a pelvic radiograph can be calculated using the nominal coefficient of 5.4 10 sv for persons of reproductive age . for the computation of the total detriment adjusted risk , the risk coefficient for cancer ( 5.5 10 sv for the whole population ) with an age - dependent correction for the higher cancer risk for children is needed as well . these calculations further require the effective dose , the testes dose and the dose to the ovaries . the reduction of hereditary risk achieved by gonad shielding was also expressed as a percentage of the total risk of a radiograph obtained without shielding . the three pillars of the radiation protection model of the international commission on radiological protection ( icrp ) are justification , optimisation and dose limits . to comply with the second obligation , optimisation we performed such an evaluation of pelvic radiography in children , using data already available in our picture archiving and communication system ( pacs ) ( kodak carestream health , rochester , ny ) . organ and effective doses , and the effect of gonad shielding on these doses , were calculated using pcxmc , a monte carlo program for estimating patient doses in medical x - ray examinations ( stuk radiation and nuclear safety authority , helsinki , finland ) . , dr . goos - suprema , heidelberg , germany ) gave a trivial reduction of the already very small radiation risk . at the same time , we often observed a serious loss of diagnostic information caused by improper gonad shielding . on the basis of these findings the radiological staff unanimously decided to discontinue gonad shielding in paediatric pelvic imaging using x - rays . realising that our results might be of wider interest and appropriate for publication , we extended our initial investigation with more data , obtained both before and after discontinuation of gonad shielding . this extended study is the subject of this article ; with respect to its execution the medical ethics committee of the maastricht university medical center formally acknowledged that no medical ethical approval was required . in the first retrospective study we investigated gonad shielding and patient dose in children aged 015 years . the children had a standard anterior - posterior ( ap ) pelvic radiograph in 2007 or 2008 , mostly in relation to congenital hip dysplasia . the projection covered the region from the iliac crests to 2 cm below the trochanter minor on the femur . following the majority of other investigators [ 2226 , 33 , 34 ] , we distinguished age groups of 01 years , 15 years , 510 years and 1015 years . additional radiographs were evaluated in the second retrospective study in 2010 after we had stopped the application of gonad shields . the pelvic radiographs had been acquired in three rooms , each equipped with an x - ray system using a digital flat panel detector ( axiom aristos fx plus ; siemens , erlangen , germany ) . these systems have pre - programmed protocols , which set the high voltage ( kvp ) , additional filter , focus to image - detector distance , and either a fixed tube current - exposure time product ( mas value ) or the automatic exposure control ( aec ) . the protocol indicates whether the bucky anti - scatter grid has to be present or absent , but grid insertion or removal has to be done manually . for the younger patients , age - dependent protocols with fixed technique parameters are used . for the 1015 age group different protocols are applied because the children of this age vary strongly in size . for the smaller patients no grid and no aec subsequently the images are sent to our pacs in digital imaging and communications in medicine ( dicom ) format . the dicom header contains retrievable information on the exposure [ e.g. kvp , filter , mas value , use of the grid and the air kerma - area product ( kap ) ] . information on the use of the aec is not stored , neither is the size of the unshuttered field of view . because the quality of gonad shielding potentially has a large impact on the diagnostic information in the image and the dose reduction as well , the shielding was visually evaluated ( by m.j.f . ) . for boys , the gonad shield had to fully cover the testes , while all bony pelvic parts remained uncovered . for girls , the central section of the pelvis had to be covered , again without shielding parts of the pelvic bones , with the exception of the sacrum to just below the sacro - iliac joints . the radiograph made during the patient s very first visit to the department was obtained without shielding . judging from the presence of poor images , retakes had been limited to the absolute minimum . in the evaluation , we therefore identified also all images in which important diagnostic landmarks were not visible due to shielding . specifically we considered assessability of shenton s line , perkin s lines and the acetabular angle ( see fawcett et al . 3 ) ; these studies were labelled as retake required , although no retake was obtained in reality . we also estimated the fraction of the testes that was actually shielded ( percent coverage ) by visual inspection of the radiographs . the corresponding testes dose reduction was calculated with pcxmc as the dose to the testes due to an exposure with the size of the gonad shield , with the field overlaying percent coverage of the testes in the cranial - caudal direction . for girls , we assumed that protection is not very sensitive to positioning of the shield ( in a statistical sense at least ) , because of the large spread in the position of the ovaries . in the first dosimetric study ( data from 2007 and 2008 ) gonad shielding was standard , in the second study ( data from 2010 ) shielding was absent . together with the discontinuation of the gonad shielding , we continued to optimise our protocols . in the first place , more guidance for the imaging of larger children ( 1015 years ) was introduced because of large differences in exposure within this group . secondly , following the european guidelines , we added an additional copper filter of 0.1 mm for the two intermediate age groups . for the youngest patients ( 01 years ) the decrease in image quality was considered too large by the paediatric radiologist ; for the 1015 age group , the filter was already used . the basic filtration of the x - ray beam ( i.e. in the absence of 0.1 mm cu ) was determined from the measured half - value layer in aluminium . since most authors had reported the entrance dose as a dose - in - air including backscatter [ 22 , 23 , 2531 ] , we followed this convention . we estimated backscatter factors for the conversion of incident air kerma to entrance dose for each age group and radiation quality using data from the nrpb report r279 . these factors were 1.26 , 1.35 , 1.39 , 1.45 and 1.48 for the age groups 01 years , 15 years , 510 years , 1015 years small childen and 1015 years large children , respectively . the incident air kerma was derived by pcxmc from the kap and the estimated unshuttered image size . note that the dose in tissue , used in two publications [ 24 , 33 ] , is about 5% higher than the entrance dose as used by most other investigators and us . input information for pcxmc comprises imaging technique settings ( kvp , filtration ) , kap , image field size and projection . note that these exposure parameters are generally independent of the use of gonad shielding , unless the shield was in front of an active aec chamber . the effect of shielding is taken into account by subtracting a fraction of the gonad dose calculated for the no - shield exposure ; under optimal circumstances this subtracted fraction amounts to 95% in male patients and 50% in female patients . the dose estimation in a specific age group of children will be illustrated using the 510 age group as an example . rather than treating these children as a single group in the dose calculation , we considered 5- to 7.5-year - olds and 7.5- to 10-year - olds separately to reduce the potential effects of spread in patient size . by interpolation between data for child phantoms of different age present in pcxmc , we determined the weight and length of children of 6.25 and 8.75 years . using the exposure parameters and interpolated patient size and weight for each subgroup , organ doses and effective dose were calculated with pcxmc for the 6.25- and 8.75-year - olds . the average dose for the 510 age group was then calculated by averaging the results for these two subgroups . doses for other age groups were estimated in a similar fashion ( always using two subgroups ) . the problem of the collimator settings not being stored in the dicom header ( necessary as input on field size ) was addressed by determining the average difference in width and height of the original ( unshuttered ) and shuttered images for a limited set of images for which both types of data were retained . considerable variations in measured differences existed , but on average 1 cm had to be added in all four directions to compensate for the shuttering . although this correction for shuttering is necessarily approximate , its application was preferred over leaving it out as this systematically would overestimate the entrance dose . to derive the effective dose from organ doses , the tissue - weighting factors published in icrp 103 were chosen in pcxmc . as gonad shielding is applied to limit hereditary effects , the detriment adjusted risk for heritable disease was estimated ( the detriment adjusted risk takes the various potential , negative consequences of the exposure into account , weighting for the seriousness of the corresponding harms ; for the official definition see icrp 103 ) . because we saw no solution to the problem of translating the loss of diagnostic information into a numerical risk that might be compared with the risk of radiation , we limited the quantitative risk analysis to radiation effects only . shortcomings of gonad shielding , which manifest themselves inevitably in daily practice , and which have an impact on the patient dose , are : ( 1 ) in males , an incomplete coverage of the testes , ( 2 ) the need for retakes because vital landmarks are obscured and ( 3 ) an increase in dose when an active aec - chamber is ( partly ) shielded by the lead supposed to shield the gonads . only point 1 was taken into account , the other two were not , because of missing information . the detriment adjusted hereditary risk of a pelvic radiograph can be calculated using the nominal coefficient of 5.4 10 sv for persons of reproductive age . for the computation of the total detriment adjusted risk , the risk coefficient for cancer ( 5.5 10 sv for the whole population ) with an age - dependent correction for the higher cancer risk for children is needed as well . these calculations further require the effective dose , the testes dose and the dose to the ovaries . the reduction of hereditary risk achieved by gonad shielding was also expressed as a percentage of the total risk of a radiograph obtained without shielding . in total , 500 ap pelvic radiographs with gonad protection were identified in the period 20072008 . by keeping very strictly to the criteria for good diagnostic information , our scores for gonad protection left much to be desired ( table 1 ) . for girls , in 91% the shielding was not applied strictly according to the rules ; for boys , in 66% . in one case a poorly positioned shield covered an osteomyelitic lesion in a boy ( fig . 1 ) . rates of retakes that would be required if all essential landmarks had to be visible are also shown in table 1.table 1summary of gonad shielding during paediatric ap pelvic radiography in the period 2007 - 2008agemale ( n = 193)female ( n = 307 ) ( years )
n
shielding incorrect ( % ) retakes required ( % )
n
shielding incorrect ( % ) retakes required ( % ) 0 - 1146479297581 - 54052011387285 - 10877115090010 - 155269052880number of radiographsshielding strictly according to standard rules ( see text)because an important anatomical landmark was obscured , but retake was not actually takenfig . an osteomyelytic lesion is clearly displayed ( arrow ) ( right ) . due to gonad shielding this was missed in the previous examination summary of gonad shielding during paediatric ap pelvic radiography in the period 2007 - 2008 number of radiographs shielding strictly according to standard rules ( see text ) because an important anatomical landmark was obscured , but retake was not actually taken conventional pelvic radiograph with testes shielding ( left ) . an osteomyelytic lesion is clearly displayed ( arrow ) ( right ) . due to gonad shielding this was missed in the previous examination over the whole range of 0 - 100% coverage of the testes , the average dose reduction decreased with increasing age ( and kvp ) from approximately 0.98 to 0.90 times the coverage . so for practical purposes , the fractional testes dose reduction is equal to the fractional coverage . the actual reduction in testes dose , taking this partial shielding into account , is for boys of 01 years 51% , 15 years 54% , 510 years 76% and 1015 years 77% . for girls , the imaging technique settings used are shown in table 2 ; part of these data were necessary in the dose calculations . table 3 presents the kap , the incident air kerma , the effective dose ( for a hermaphrodite ) , the gonad doses and the contribution of the gonads to the effective dose . due to the absence of the cu filter for the group of children of 01 years note the relative spread in all doses in table 3 will be a little higher than specified for the kap due to the additional uncertainty in the x - ray beam area . the dose data from the 20072008 study were only slightly higher and are not shown.table 2imaging technique settings in ap pelvic radiographyage
n
filterhigh voltagemas valueaecgrid(years)(mm cu)(kv)(mas)(yes / no)(yes / no)0 - 136 - 504.2nn1 - 5630.1555.2nn5 - 10430.155/606.5nn10 - 15270.17012y / ny / n10 - 15260.18113yythe average focus - image receptor distance was 117 24 cminherent filtration was 3.3 mm al - equivalenttube current exposure time productsmaller children , typically no grid and no aeclarger children , typically with grid and/or aectable 3mean dose data ap pelvic radiography in absence of gonad shielding ( n = 195)agekapincident air kermaeffective dose icrp 103organ dose testiclesorgan dose ovariescontribution of gonads to effective dose(years)(mgycm)(gy)(sv)(gy)(gy)(sv)0 - 118.8 7.88713972051 - 516.6 6.3468561435 - 1049 28841511124510 - 15168 12522340319981710 - 15369 1564849872524939air kerma - area productsmaller children , typically no grid and no aeclarger children , typically with grid and/or aec imaging technique settings in ap pelvic radiography the average focus - image receptor distance was 117 24 cm inherent filtration was 3.3 mm al - equivalent tube current exposure time product smaller children , typically no grid and no aec larger children , typically with grid and/or aec mean dose data ap pelvic radiography in absence of gonad shielding ( n = 195 ) air kerma - area product smaller children , typically no grid and no aec larger children , typically with grid and/or aec table 4 gives for the different age groups an overview of the total and hereditary detriment - adjusted risks caused by pelvic radiographs . note the very low absolute magnitude of risks for boys and girls alike . for boys , there was an average reduction of the risk of heritable disease as percentage of the total risk of 24 6% when shielding was used ; for girls , 6 3% . assuming uncompromised protection of the gonads ( according to icrp 34 , 95% gonad dose reduction in boys , 50% in girls ) , without any dose increase by collateral effects , this reduction would be 33 5% in boys and 6 3% in girls . taking the retakes into account that would be required according to the rules for properly shielded images , the total risk reduction for boys would hardly change ( 23 8% ) with respect to not using a gonad shield , but for girls there would be an increase in total risk of 10 27%.table 4detriment adjusted risks caused by ap pelvic radiography with and without gonad shieldingagetotal risk without shieldinghereditary risk without shieldinghereditary risk with shieldingboysgirlsboysgirlsboysgirls(years)per 10per 10per 10per 10per 10per 100 - 11.61.30.50.10.20.11 - 51.00.80.30.10.10.05 - 102.01.60.60.10.10.110 - 154.22.71.70.50.40.310 - 1510.26.83.91.30.90.7smaller children , typically no grid and no aeclarger children , typically with grid and aec detriment adjusted risks caused by ap pelvic radiography with and without gonad shielding smaller children , typically no grid and no in total , 500 ap pelvic radiographs with gonad protection were identified in the period 20072008 . by keeping very strictly to the criteria for good diagnostic information , our scores for gonad protection left much to be desired ( table 1 ) . for girls , in 91% the shielding was not applied strictly according to the rules ; for boys , in 66% . in one case a poorly positioned shield covered an osteomyelitic lesion in a boy ( fig . 1 ) . rates of retakes that would be required if all essential landmarks had to be visible are also shown in table 1.table 1summary of gonad shielding during paediatric ap pelvic radiography in the period 2007 - 2008agemale ( n = 193)female ( n = 307 ) ( years )
n
shielding incorrect ( % ) retakes required ( % )
n
shielding incorrect ( % ) retakes required ( % ) 0 - 1146479297581 - 54052011387285 - 10877115090010 - 155269052880number of radiographsshielding strictly according to standard rules ( see text)because an important anatomical landmark was obscured , but retake was not actually takenfig . an osteomyelytic lesion is clearly displayed ( arrow ) ( right ) . due to gonad shielding this was missed in the previous examination summary of gonad shielding during paediatric ap pelvic radiography in the period 2007 - 2008 number of radiographs shielding strictly according to standard rules ( see text ) because an important anatomical landmark was obscured , but retake was not actually taken conventional pelvic radiograph with testes shielding ( left ) . an osteomyelytic lesion is clearly displayed ( arrow ) ( right ) . due to gonad shielding this was missed in the previous examination over the whole range of 0 - 100% coverage of the testes , the average dose reduction decreased with increasing age ( and kvp ) from approximately 0.98 to 0.90 times the coverage . so for practical purposes , the fractional testes dose reduction is equal to the fractional coverage . the actual reduction in testes dose , taking this partial shielding into account , is for boys of 01 years 51% , 15 years 54% , 510 years 76% and 1015 years 77% . for girls , the imaging technique settings used are shown in table 2 ; part of these data were necessary in the dose calculations . table 3 presents the kap , the incident air kerma , the effective dose ( for a hermaphrodite ) , the gonad doses and the contribution of the gonads to the effective dose . due to the absence of the cu filter for the group of children of 01 years their dose is higher than that for the 15 age group . note the relative spread in all doses in table 3 will be a little higher than specified for the kap due to the additional uncertainty in the x - ray beam area . the dose data from the 20072008 study were only slightly higher and are not shown.table 2imaging technique settings in ap pelvic radiographyage
n
filterhigh voltagemas valueaecgrid(years)(mm cu)(kv)(mas)(yes / no)(yes / no)0 - 136 - 504.2nn1 - 5630.1555.2nn5 - 10430.155/606.5nn10 - 15270.17012y / ny / n10 - 15260.18113yythe average focus - image receptor distance was 117 24 cminherent filtration was 3.3 mm al - equivalenttube current exposure time productsmaller children , typically no grid and no aeclarger children , typically with grid and/or aectable 3mean dose data ap pelvic radiography in absence of gonad shielding ( n = 195)agekapincident air kermaeffective dose icrp 103organ dose testiclesorgan dose ovariescontribution of gonads to effective dose(years)(mgycm)(gy)(sv)(gy)(gy)(sv)0 - 118.8 7.88713972051 - 516.6 6.3468561435 - 1049 28841511124510 - 15168 12522340319981710 - 15369 1564849872524939air kerma - area productsmaller children , typically no grid and no aeclarger children , typically with grid and/or aec imaging technique settings in ap pelvic radiography the average focus - image receptor distance was 117 24 cm inherent filtration was 3.3 mm al - equivalent tube current exposure time product smaller children , typically no grid and no aec larger children , typically with grid and/or aec mean dose data ap pelvic radiography in absence of gonad shielding ( n = 195 ) air kerma - area product smaller children , typically no grid and no aec larger children , typically with grid and/or aec table 4 gives for the different age groups an overview of the total and hereditary detriment - adjusted risks caused by pelvic radiographs . note the very low absolute magnitude of risks for boys and girls alike . for boys , there was an average reduction of the risk of heritable disease as percentage of the total risk of 24 6% when shielding was used ; for girls , 6 3% . assuming uncompromised protection of the gonads ( according to icrp 34 , 95% gonad dose reduction in boys , 50% in girls ) , without any dose increase by collateral effects , this reduction would be 33 5% in boys and 6 3% in girls . taking the retakes into account that would be required according to the rules for properly shielded images , the total risk reduction for boys would hardly change ( 23 8% ) with respect to not using a gonad shield , but for girls there would be an increase in total risk of 10 27%.table 4detriment adjusted risks caused by ap pelvic radiography with and without gonad shieldingagetotal risk without shieldinghereditary risk without shieldinghereditary risk with shieldingboysgirlsboysgirlsboysgirls(years)per 10per 10per 10per 10per 10per 100 - 11.61.30.50.10.20.11 - 51.00.80.30.10.10.05 - 102.01.60.60.10.10.110 - 154.22.71.70.50.40.310 - 1510.26.83.91.30.90.7smaller children , typically no grid and no aeclarger children , typically with grid and aec detriment adjusted risks caused by ap pelvic radiography with and without gonad shielding smaller children , typically no grid and no aec larger children , typically with grid and aec the absolute magnitude of the reduction in hereditary risk , even assuming complete uncompromised shielding of the gonads , was very small . first of all , technical developments and protocol optimisation have lowered the dose needed for a pelvic radiograph from about 10 mgy in the 1950s to a few tenths of a milligray today . secondly , the risk coefficient for heritable disease is considerably lower than previously assessed . for about 50 years , radiographers worldwide have been applying gonad shielding in radiography of the pelvis and abdomen . all available studies , including our own , show that gonad shielding is poor in clinical practice ( table 5 ) . impaired diagnostic information and limited gonad dose reduction are potential consequences . in unfortunate cases there can even be an increase in exposure due to the need for retakes or due to shielding an active aec chamber , effects that could not be quantitatively included in this study due to the lack of adequate information . the risk reductions we calculated are thus likely to be too optimistic.table 5gonad shield positioning in pelvic radiography according to various studiesref.number of radiographs with shieldingpercentage with incorrectly placed shieldsboysgirlstotalboysgirlsaverage(%)(%)(%)kenny and hill 102107209446052wainwright 7640116385945mccarty et al . barter6115501161264836mcmanus and davis 6187411359597166this study193307500669181taking the number of each sex into account gonad shield positioning in pelvic radiography according to various studies taking the number of each sex into account the patient doses incurred in our department are relatively low , but not exceptionally , as can be seen in table 6 , which presents data published in the past 20 years [ 2230 , 33 , 34 ] . we identified more than 40 articles with pertinent data , but only studies giving doses for children of several ages were included . note that the dose to a superficially located organ like the testis will be similar to the entrance dose.table 6mean entrance doses in air , including backscatter , in pelvic radiography according to studies in the past two decadesageruiz et al . suliman and elshiekh this study19911994199619961998199820032006200720082008(years)(gy ) ( gy ) ( gy)(gy)(gy)(gy ) ( gy ) ( gy ) ( gy ) ( gy)(gy)(gy ) ( gy ) ( gy)(gy)(gy)0 - 110709101406014012069901475132434491402261101 - 5129511304103508036020023495123797 - 358420309625 - 10235030106805506005603004582983471286354669 - 38811610 - 1531704180123010701200118043098355850818166529132540321324/713entrance dose in tissue , which is typically 5% higher than entrance doses in air which includes backscatterage groups ( years ) 00.5 , 0.5 - 2 , 37 , 812age groups ( years ) < 0.5 , 2.5 - 7.5 , 12.5 - 17.5values at 1 , 5 , 10 and 15 years ; averaged over 3 hospitals with similar data . children of 15 years weighted only 27 kgbackscatter factors from applied to incident air kerma ( from table 3)centre i two rooms averagedcentre ii2.5 mm al5.5 mm al filtrationscreen - film , average of two roomscomputed radiography , average of two roomshospital ahospital bsmaller children , typically no grid and no aeclarger children , typically with grid and/or aec mean entrance doses in air , including backscatter , in pelvic radiography according to studies in the past two decades entrance dose in tissue , which is typically 5% higher than entrance doses in air which includes backscatter age groups ( years ) 00.5 , 0.5 - 2 , 37 , 812 age groups ( years ) < 0.5 , 2.5 - 7.5 , 12.5 - 17.5 values at 1 , 5 , 10 and 15 years ; averaged over 3 hospitals with similar data . children of 15 years weighted only 27 kg backscatter factors from applied to incident air kerma ( from table 3 ) centre i two rooms averaged screen - film , average of two rooms computed radiography , average of two rooms smaller children , typically no grid and no aec larger children , typically with grid and/or aec table 6 also shows considerable spread in doses . thirteen out of 15 reported entrance doses for 0 to 1-year - old children are lower than the diagnostic reference level ( drl ) of 640 gy given in the european guidelines for 4-month old infants , while 12 out of 15 values for 1 to 5-year - old children are below the drl of 924 gy for 5-year - olds . smans et al . reported data from a european survey that do not fit in table 6 due to a different age grouping . their doses include a low median value of 48 gy for children younger than 1 year and quite a high mean value of 3,460 2,730 gy for 8 to 12-year - olds . the large spread and the many high values reported in the literature indicate that a lot is still to be gained by optimisation . this issue is currently being addressed in many countries by setting drls for frequently performed procedures , as recommended by the icrp [ 32 , 38 ] . discontinuation of gonad protection should not be considered before optimisation has been performed and dose levels in the low range of table 6 have been realised . patient dose reductions since the fifties were realised by using harder radiation , a larger focus - patient distance , the introduction of faster screens and films , and the discontinuation of fluoroscopy in favour of radiography . in fluoroscopy the introduction of the image intensifier was a major step . recently the more sensitive digital detectors and the concomitant development of image processing software helped reduce patient dose . despite its limitations , the high numbers of retakes required , but not actually taken , are symptomatic . often the radiologist is forced to fill in the gaps with information from previous images . this is not without risk , as illustrated by the incident with the shielded osteomyelytic lesion ( fig . 1 ) . this incident shows that even the peripheral zones of pelvic bones should not be covered . the kap meters are calibrated on a regular basis and their accuracy is typically within 5 - 10% . pcxmc has only a limited number of mathematical phantoms , and the size of the individual patient may not correspond to that of the phantom closest in age . as a consequence , in some cases pcxmc s dose estimates will be too high , and in others too low , but the average dose estimate for patients within an age group will be fairly realistic . the correction for shuttering to obtain the true x - ray field size introduces an additional uncertainty in the dose estimates . to give an idea of its magnitude , assume that the uncertainty equals the fully applied correction of 1 cm in all directions . this would result in an uncertainty of the estimated area of 13% for the smallest and 6% of the largest fields . note that for a given kap the effect of a change in the beam area on the effective dose is likely to be small , but on the dose to the gonads ( or any other single organ ) it will have its full impact . taking all considerations together , the accuracy of the average calculated dose should be better than about 20% . for individual patients the error may be larger , as indicated by the spread in kap values in table 3 . an important practical aspect for the emphasis over the years on applying gonad shields has nurtured the conviction that major risks have to be countered . workers and parents are so used to shielding that not using it is considered a major neglect . and it can not be denied that there is an average risk reduction for boys of about 24% and of 6% for girls , so why stop protection ? the answer is given by the icrp , which advises that risks in the range 10 - 10 be considered as of no concern . only for the group of large boys of age 1015 years is the potential reduction in hereditary ( or total ) risk 3.0 10 . radiographers should learn that the risks associated with the potential loss of diagnostic information outweigh the very small benefit of gonad shielding . parents could be helped by showing them the risks of exposures that are commonly accepted as harmless . a few have been collected in table 7 and they illustrate how small the effective dose ( which also accounts for the gonad dose ) of pelvic radiography in children is . the ncrp considers 10 sv as a negligible annual effective dose . as a final example of the risk of a normal life activity , a drive by car over 100 km , e.g. for a retake of the image in fig . 1 , has in the eu on average a risk of 1 10 for a fatal accident , the risk for an injury is much higher.table 7the effect of a few trivial activities in all - day life on effective doseactionsavingexpenselowering radon ( rn ) concentration at home with 1 bq / m ( e.g. by increasing ventilation ; worldwide average conc . 40 bq / m)80 sv / yearholidays on a cruise ship instead of on land 2 sv / daylarge distance flying 5 sv / hvisit of cave with relatively low radon concentration of 1 kbq / m 4 sv / hperson living in cornwall ( 6.5 msv / year due to radon only ) goingto london ( 1 msv / year ) 15 sv / dayliving in the netherlands ( 2 msv / year)5 sv / dayapproximate data , exact values depend on several details the effect of a few trivial activities in all - day life on effective dose approximate data , exact values depend on several details there are good arguments to stop gonad protection in pelvic radiography of children , provided modern equipment and properly optimised imaging protocols are used . the risk reduction for girls and young boys is marginal , for older boys there is room for discussion . our staff decided upon images of constant good quality , for all children , rather than the minor benefit of gonad protection . available resources for education and optimisation are better directed at applications with a potentially higher risk reduction . | objectiveto re - evaluate gonad shielding in paediatric pelvic radiography in terms of attainable radiation risk reduction and associated loss of diagnostic information.methodsa study on patient dose and the quality of gonad shielding was performed retrospectively using 500 pelvic radiographs of children from 0 to 15 years old . in a subsequent study , 195 radiographs without gonad shielding were included .
patient doses and detriment adjusted risks for heritable disease and cancer were calculated with and without gonad shielding.resultsfor girls , gonad shields were placed incorrectly in 91% of the radiographs ; for boys , in 66% . without gonad shielding , the hereditary detriment adjusted risk for girls ranged between 0.1 106 and 1.3 106 and for boys between 0.3 106 and 3.9
106 , dependent on age .
with shielding , the reduction in hereditary risk for girls was on average 6 3% of the total risk of the radiograph , for boys 24 6% . without gonad shielding , the effective dose ranged from 0.008 to 0.098 msv.conclusionswith modern optimised x - ray systems , the reduction of the detriment adjusted risk by gonad shielding is negligibly small .
given the potential consequences of loss of diagnostic information , of retakes , and of shielding of automatic exposure - control chambers , gonad shielding might better be discontinued . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
breast cancer is a major public health issue and the most commonly diagnosed cancer for women worldwide [ 13 ] . despite the lower incidence rate compared to those living in western countries , breast cancer incidence in chinese women has increased dramatically in the past 20 years , with a total increase of 50100% . during the 1970s , the average age - standardized incidence rate of breast cancer for chinese women living in shanghai was about 18.3 per 100,000 women and by 1989 , the age - standardized incidence rate for breast cancer has increased to about 25.1 per 100,000 women [ 5 , 6 ] . the mortality of female breast cancer has constantly increased in china since 1973 , and the mortality in urban areas were higher than that of rural areas . a recent study conducted by ziegler and colleagues ( 2008 ) projects that based on a representative sample of chinese women from both urban and rural areas , the age - standardized breast cancer incidence rate in china will be 87.8 per 100,000 women by the year 2021 . this projection is corroborated by another study , which used data from the chinese national family planning and reproductive health survey ( nfprhs ) . the study estimates that the age - standardized breast cancer incidence rate in china will be 85.3 per 100,000 women in year 2021 ; the increase in incidence and prevalence of breast cancer is not limited to major cities in china . it is pervasive throughout all of china and has been projected to continue to increase in the future . not only is the overall incidence rate for breast cancer rising in china , but also , another intriguing fact is that women in china are diagnosed with breast cancer at an earlier age than caucasians . in hong kong , the incidence of breast cancer occurs at the highest rate at the age of 40 years while for caucasians the incidence of breast cancer occurs at the highest rate between the ages of 45 years and 55 years . furthermore , the earlier diagnosis of breast cancer for chinese women is coupled with growing evidence that breast cancer in younger women is biologically more aggressive than in their older counterparts [ 1113 ] . limited evidence indicates that there is a lower survival rate if breast cancer is detected at an earlier age [ 14 , 15 ] . there is also evidence that suggests that age is a significant factor for relapse of breast cancer and overall mortality , whereas a young age at diagnosis is an adverse prognostic factor [ 15 , 16 ] . therefore , not only are chinese women on average diagnosed earlier in their lives , but also the breast cancer is often more detrimental . although it is unclear whether the disparity in incidence of breast cancer between the chinese and western populations is due to genetic susceptibility , evidence indicates that a westernized lifestyle , which is usually defined by menarche , decreased parity , delayed childbearing , a diet rich in saturated fat , and a sedentary lifestyle , is associated with the increased incidence of breast cancer [ 17 , 18 ] . early detection of breast cancer through regular screening modalities and enhanced treatment has been found to decrease mortality rates by 2530% [ 19 , 20 ] . during the past 40 years , randomized clinical trials have demonstrated substantially reduced mortality rates from breast cancer among women who participate in screening mammography [ 20 , 21 ] . nevertheless , routine mammography screening programs commonly available in the u.s . and other western societies have not been utilized in china . most chinese women are screened voluntarily or seek medical advice when an abnormality is present . with the recent health care reform in china , about 60% of individuals in 2008 were covered by the three major health insurance programs , new rural cooperative medical scheme ( ncms ) , urban employees basic medical insurance ( ur - bmi ) , and urban residents basic medical insurance for the unemployed ( ur - bmi ) . in urban areas where the medical condition and insurance are well established , a program issued in 2009 aims to provide free breast cancer screening for all the women in 200 counties . despite the continuous effort and increasing interests among chinese public health officials and various nonprofit organizations such as cancer foundation of china and chinese anti - cancer association , there are currently no standard breast cancer screening guidelines , and nationwide breast cancer screening has not been implemented routinely in china . while breast cancer screening is widely accepted globally to achieve early detection of cancer and reduce mortality by downstaging the disease , there is a paucity of studies reporting the attitudes and practices of breast cancer screening among chinese women . the purpose of this descriptive study was to explore the relationships of sociodemographic characteristics , knowledge , and beliefs about breast cancer ( bc ) and their practices to the self - reported practice of bc screening ( bcs ) among women in china . the specific aims were to ( a ) describe the sociodemographic characteristics , knowledge , beliefs , and mammography screening practices of women in china ages 40 and older and ( b ) identify correlates of bcs practices . in this cross - sectional study , the data was collected from the wuhan , the capital city of hubei province , an important central city as the political , economic , scientific and technological , cultural , and financial center in inland china . this study protocol was reviewed and approved by the institutional review board for conducting this research . the study participants were recruited at the gatherings of community centers , parks , and temples . the study aim was explained to eligible women , who were assured that their participation would be voluntary and confidential . after consents were obtained , the participants completed the survey , which took approximately 2030 minutes . the study measurement survey included two parts : ( a ) chinese mammogram screening beliefs questionnaire ( cmsbq ) and three subscales were used in current study : ( 1 ) perceived self - efficacy ( 2 items ; sample item : i am confident in my ability to obtain breast cancer screening regularly ) , ( 2 ) perceived benefits subscale ( 7 items ; sample item : having breast cancer screening will help to find breast lumps early ) , and ( 3 ) perceived barriers subscale ( 21 items ; sample item : i feel uncomfortable taking off clothes in front of health professionals during the screening ) . possible responses to the items ranged from 1 ( strongly agree ) to 4 ( strongly disagree ) . the findings of benefits and barriers subscales among asian women demonstrated excellent supportive psychometric properties with promising cronbach 's alphas above 0.70 , and the results from the confirmatory factor analysis supported construct validity with good model fit indices [ 23 , 24 ] . the survey instrument also included demographic information ( e.g. , age , marital status , education , income level , and health insurance coverage ) . ( b ) the open - ended questions asked participants to identify the three most frequent barriers that they encountered and that prevented them from getting breast cancer screening , and the facilitators that would make them more likely to get screened . the participants were instructed to leave the space blank if they did not believe they had a significant barrier to using mammography . descriptive statistics , including percentages , means , and standard deviation ( sds ) , were calculated . next , multivariate logistic regression analysis was performed to examine the associations of demographics , knowledge , beliefs , and behavioral factors with the probability of having received mammograms / ultrasounds after accounting for all other factors in the model . these associations were expressed in the form of adjusted odds ratios with 95% confidence intervals ( ci ) . qualitative analytic techniques were employed for the analysis of the open - ended questions . the primary researcher and two research associates reviewed and coded participants ' responses separately to uncover emerging themes and categories of the responses . the coding of the responses was then discussed and verified by two senior investigators with expertise in cancer control and qualitative research . once consensus on coding was reached by the research team , the set of themes / categories were finalized . to complete each content area , quotes from the responses have been highlighted to illustrate the category . discrepancies between the two researchers were resolved through iterative discussions until consensus was reached . both the content and frequency of the responses were then analyzed . the mean age of 400 participants was 51.8 years ( ranging from 40 to 81 year , sd = 7.7 ) . ninety - six percent of the respondents were currently married . while the education levels were widely distributed , 44% of the women reported their highest education was high school , 14% with college or higher education , and 4% with no formal education . of those who reported their monthly income , 44% reported median income levels ( equals to u.s . $ 410$725 ) while almost 1/5 of the participants reported having incomes of less than $ 410 ( u.s . the occupations of these women were more evenly distributed with 23% working blue - collar jobs and 29% working white - collar jobs . more than half of the chinese women ( 53% ) respondents did not have insurance . as shown in table 2 , despite the fact that 80% of the participants have heard of breast self - exams , only 20% of the women knew the appropriate time intervals to conduct monthly breast self - exams . although 41% of the participants have heard of mammograms , 75% of the women never had a mammogram during the past five years ; only 13% reported ever having a mammogram done in the same time interval ( table 2 ) . chinese women are known to have smaller and denser breasts than western women , and therefore it is a common practice to have an ultrasound done in this country . about 23% of the participants reported having ultrasounds within the span of the past five years . about 33% of women reported that they had had their breasts checked by the doctor and/or other health professionals ( i.e. , clinical breast exam ) in the past two years . in terms of planning to be screened in the future for a mammogram or an ultrasound , less than 1/5 of the participants reported such an intention . the mean / standard deviation for the self - efficacy , benefits and barriers subscales can be found in table 2 . the study tool asked the respondents to name up to three of the most important reasons that prevented women from having regular breast cancer screening . in this sample , 346 women ( 86.5% ) gave 807 responses related to their perceptions on barriers toward bc screening . ten themes emerged from the participants ' responses to the question of barriers to breast cancer screening ( table 3 ) . if a woman had multiple responses that corresponded to the same theme , they were counted only once . as shown in table 3 , the most frequently reported barrier related to the theme of low priority ( 63% ) , participants mentioned no time , too much trouble getting a screening , took too much time , lazy , and another quote was do n't care about it . more than half of participants ( 58% ) of the valid responses indicated barriers that could be classified as do n't need it because i feel ok , and the responses included no symptoms , do n't feel abnormal , do n't need it as there is no breast pain , and do n't feel lumps and abnormality . i think i have low probability of getting breast cancer and i 'm lucky and could n't get it , provided vivid responses to show what respondents have in mind about the cues / triggers for obtaining breast cancer screening . the third most frequently reported barrier related to lack of awareness ( n = 145 , 42% ) , and examples of responses included awareness is not emphasized / enough , do n't have related knowledge ( on breast cancer or screening ) , do n't know how to do screening , and so forth . among these responses , 22 ( 6% ) i 'm too old to get screened . about 33% of responses were related to the cost of having a mammogram ; several women indicated that after retirement , they do not have insurance arrangements getting mammograms . logistics , including do not know where to go for a screening , difficulty when doing the exams in a big hospital , and traffic / transportation . radiation exposure was the least frequently identified barrier ( 1% ) in the study sample . logistic regression analyses were conducted modeling the odds of ever having screening done within the previous five years . the r of cox and snell and nagelkerke showed that 14%21% of variance of bcs practice was explained by the selected variables , and the model had an overall correct prediction of 71% . among variables included in the model , demographic variables ( age , education , and insurance ) did not have significant prediction with screening behavior while increased self - efficacy ; having performed monthly self - exams and having had clinical breast exams in the past two years were significant predictors of having had a mammogram or an ultrasound in the previous five years . among these variables , for those who reported having recent clinical breast exams done in the past two years , those who performed monthly breast self - exams and those who reported higher self - efficacy were more likely to get the mammogram or ultrasound done in the past five years ( odds ratios = 4.5 , 3.0 , and 1.9 resp . , see table 4 ) . interestingly , the interaction between recent cbe performance and monthly breast exams had an odds ratio less than one , meaning those women who have performed both exams more frequently report they were less likely to get mammograms or ultrasounds . in terms of factors associated to the participants ' intention to obtain mammograms in the future , the results from pearson 's correlation showed that only one variable , knowledge , is associated with women 's intention for getting screening in the next year ( r = 0.15 , p < 0.01 ) , that is , women with higher knowledge scores were more likely to indicate that they plan to get screening in the future . while breast cancer incidence has been historically less prevalent in asian countries compared to the west , recent statistic data reveal breast cancer incidence rates have had a 2030% increase in china in the past decade according to china 's urban cancer registries . to our knowledge , this is the first study that investigated practices and knowledge toward breast cancer screening among chinese women outside of beijing and shanghai . the current study surveyed women participants from wuhan , a metropolitan area located in the heart of china , which has developed very quickly and whose economy has kept a continual and steady growth . china became a majority urban country in 2012 and wuhan is among china 's fastest - growing city in population and home to significant economic activity . similar to shanghai , wuhan has a large increase in population with more than nine million citizens . the results provided evidence that few chinese women in the study sample participated in any bcs modalities ( mammography , ultrasound , cbe , and/or breast self - exams ) ; specifically , only 30% of women reported they had cbe done in the past two years and 70% of women never had a mammogram . the rates reported in the current study were even lower than the rates of ( 4364% ) in previous studies conducted in other regions of china ( i.e. , beijing , shanghai , guangzhou , and xi'an ) [ 26 , 27 ] and in other studies on asian american women ( including chinese american ) [ 23 , 28 ] ; the low rates of breast cancer screening reported in the current study can be associated with lack of awareness of breast cancer , possessing high misconceptions toward early detection , lack of access to screening programs , and social and economic barriers . nevertheless , the mediating effects of psychosocial and cultural variables on the impact of breast cancer intervention in low - to - middle income countries ( lmc ) are still understudied . the personal presentations of illness influence women 's responses to prevention and screening campaigns as well as the likelihood of initiating and complying with recommended guidelines in breast care and screening . public education that includes messages conveying the idea that breast cancer is curable in the majority of women when it is detected early and followed with timely and proper treatment is a key first step for successful breast health programs . in terms of knowledge and attitudes related to breast cancer screening , chinese women participants in the current study had much lower knowledge levels about breast cancer and risk factors , perceived less susceptibility , and reported greater barriers to screening and lower self - efficacy compared to study findings on immigrant chinese women in the u.s . the study utilized both qualitative and quantitative methodology that provided less research - derived and broader understanding regarding barriers to breast cancer screening . with open - ended questions , women were able to provide in their own words why they did not perform bc screening . interestingly , the most prevalent theme is low priority , followed by the theme of feeling ok . more than half of the women felt that breast cancer screening was not necessary because they did not experience any symptoms or abnormality . the findings were consistent with other studies carried out in korea [ 31 , 32 ] , singapore [ 33 , 34 ] , and malaysia , which showed that the women did not perceive the importance of early detection of breast cancer . similarly to the findings reported from i m 's study ( 2004 ) for korean women , study participants in china did not perceive the need for breast cancer screening if they did not have any symptoms or family history , because they thought their risk of developing breast cancer was low . the data lent support for the recent release of the consensus statement from the breast health global initiative that indicated a lack of public awareness in the importance of early detection of breast cancer in lmcs . identifying barriers to early detection is a critical component of breast cancer control programs and developing effective strategies to overcome barriers should involve both community and public health leaders . practical evidence - based strategies are needed for effective communication with the public in promoting early detection of breast cancer . in the current study , the results revealed several areas of misconceptions or incorrect information perceived by study participants . for example , participants underestimate the importance of regular screening when they provide responses such as they were too old ; therefore , screening was not necessary , or they had done self - exams so they do not need additional mammograms . campaigns can be most effective if they are carefully targeted to meet the unique needs of the targeted audience in lmcs [ 3638 ] . messages can be designed to appeal to these identified misconceptions with culturally acceptable languages and channels , for example , via health promoters or lay health advisors who have developed trusted relationships with targeted at - risk women in the community in low - resource countries . in addition , self - efficacy emerged as a significant predictor suggesting that the intervention content was successful in addressing this key concept by offering effective strategies to overcome their personal barriers and increase confidence in obtaining regular screening . the study found positive associations between ever having had a mammogram , having cbe within the past two years , and performing monthly breast - exams , that is , adoption of one screening practice was positively correlated with other breast screening modalities in the current study . this finding was consistent with a previous study conducted in the u.s . among immigrant asian women . while cbe may be the more commonly accessible screening in china , the encounter can act as an ideal educational moment for care providers to educate women about the importance of mammography and improve adherence with both screening modalities . it is also equally important that during these educational encounters the need to emphasize the importance and relevance of screening , particularly among previously never - screened women , and to encourage women who had previously performed cbe and breast self - exams ( bses ) that mammogram screening can not be replaced by the compliance of regular cbes and monthly bses . financial cost emerged as one of the top five barriers for chinese women in this study to access mammography screening . this finding is consistent with other studies done in hong kong and immigrant chinese women in the u.s . women 's lack of resources , combined with cultural and attitudinal barriers , along with limited access to affordable mammography services directly affect the likelihood of bcs since women with low incomes may have many other competing priorities related to survival that make breast cancer screening a low priority . the responses of study participants suggest that they might be amenable to engage in more bcs if they were more aware of what was available to them and if they still have access to preventive services such as mammograms after they retire . in 2008 , the chinese ministry of health started a program on early detection and treatment of cancer sponsored by central financial assistance that provide cbe , mammography , and ultrasound for women in 30 provinces in china . efforts to develop programs and/or policies to improve breast cancer screening will be more successful if the implementation includes strategies to increase cancer knowledge , awareness , and information and complementary efforts to help women address emotional , socioeconomic , and other barriers to clinical breast exam and mammography use . first , due to the nature of self - report data , there may have been over- or under - reporting of screening practices . future studies with a combination of self - report and verification from objective chart reviews are warranted to ensure the accuracy in reporting socially desired behaviors , such as cancer screening . second , because the use of convenience sample and small sample size , this approach can lead to sampling error ; therefore , the results can not be generalized to other regions / provinces in china , a country with more than 1.3 billion citizens with diverse socioeconomic and cultural backgrounds . nevertheless , based on the demographics in the current study sample , the study recruited relatively diverse groups of women with a wide range of income and educational levels . changes in breast cancer incidence and distribution of breast cancer patterns in chinese women present opportunities for developing and implementing effective public health programs to promote bcs for women in china . it is essential that public health campaigns focus on the importance of early detection and prevention that target both general public and health care professionals working directly with their clients . the findings of this descriptive correlational study provide a foundation to better understand beliefs and attitudes of chinese women toward bcs . the concept of screening while asymptomatic is lacking and a low priority toward bcs was observed in the current study . as a result , this study highlights a critical need among general public , health professionals , and the health care system to work collaboratively toward narrowing the gap in bcs and to improve the quality of breast cancer care in this population . | background . breast cancer is a major public health issue and the most commonly diagnosed cancer for women worldwide . despite lower incidence rates than those living in western countries , breast cancer incidence among chinese women has increased dramatically in the past 20 years .
nevertheless , there is a paucity of studies reporting the attitudes toward and practices of breast cancer screening among chinese women
. methods .
this cross - sectional study examined the practices , knowledge , and attitudes toward breast cancer screening ( bcs ) on a convenience sample of 400 chinese women . results . among study participants ,
75% of the women never had a mammogram and the top three barriers reported were low priority , feeling ok , and lack of awareness / knowledge toward breast cancer screening .
the results from the logistic regression model showed increased self - efficacy ; having performed monthly self - exams , and having had clinical breast exams in the past two years were significant correlates while demographic variables were not correlated with screening behaviors .
conclusion .
the findings provide a foundation to better understand beliefs and practices of chinese women toward bcs and highlight the critical need for general public , health professionals , and the health care system to work collaboratively toward improving the quality of breast cancer care in this population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
spontaneous preterm birth has multifactorial etiologies , including premature activation of the fetal endocrine system , pathological distention , and inflammation / infection . inflammation and oxidative stress are coexisting situations , and there are potential mechanisms for the role of oxidative stress in the pathogenesis of preterm birth . preterm birth may result in many complications , such as necrotizing enterocolitis , respiratory distress syndrome , and retinopathy of prematurity . therefore , it is crucial to diagnose the inflammatory response or oxidative stress early in order to identify the strategies for treatment , thereby improving the prognosis . however , there is at present no adequate diagnostic tool to use in recognizing the disease early . vitamin d is a prohormone that is either taken by food or produced by photochemical reactions in the skin . therefore , vitamin d level is related to sunlight exposure and diet , and use of vitamin d in pregnancy cause little or no change in its serum levels in pregnancy . vitamin d is associated with immune system function and inflammation , which may be a link between vitamin d and preterm birth . decreased maternal serum levels of vitamin d have been reported to be involved in many complications , such as preterm birth , preeclampsia , small for gestational age , and gestational diabetes mellitus . in case of systemic inflammation , neutrophil count increases and lymphocytes decrease in the circulation , resulting in high neutrophil - to - lymphocyte ratio , which is a simple marker of inflammation . many studies have searched for the markers of intrauterine inflammation such as neutrophil to lymphocyte ratio , c - reactive protein , and 25-hydroxyvitamin d to find simple and less invasive methods to predict spontaneous preterm birth . pregnancy is a physiological condition that has a high susceptibility to oxidative stress , in which there is an imbalance between production of reactive oxygen species and ability of the anti - oxidative system to detoxify them . the high oxidative stress status in pregnancy may result in many complications , such as preterm birth , intrauterine fetal growth retardation , and preeclampsia . oxidative stress - related genes were reported to be involved in the physiopathology of preterm birth . paraoxonase 1 is part of an enzyme with antioxidant properties that is related to high - density lipoprotein ( hdl ) particles . the major antioxidant role of hdl is through the metabolism of oxidative low - density lipoprotein by paraoxonase 1 ; thus , it can decrease the level of oxidative stress . the relationship between the r alloenzyme of the paraoxonase 1 q192r polymorphism and preterm birth was recently reported . paraoxonase 1 was also shown to have an anti - inflammatory role by decreasing chemotaxis and adhesion of monocytes to endothelial cells and inhibiting differentiation of monocytes to macrophages . the aim of this study was to evaluate the association between preterm birth and the maternal serum level of 25-hydroxyvitamin d and neutrophil - to - lymphocyte ratio as inflammatory markers and paraoxonase 1 as an oxidative marker . this prospective study was performed in the obstetrics service of our hospital over a period of 6 months . all patients provided written informed consent after approval of the study by the human research ethics committee of cumhuriyet university . the patients with preterm labor and term labor who met the research criteria and consented to participate in this study were enrolled consecutively . all pregnancies resulted in birth inclusion criteria were : maternal age 1845 years , pregnancy gestational age 2237 for the preterm birth group and gestational age 3742 for the term birth group , and singleton pregnancy without use of any drugs . exclusion criteria for preterm and term birth groups were : maternal age less than 18 years or more than 45 years ; multiple pregnancy ; any evidence of chronic medical or infectious diseases ; pregnancies with membrane rupture , presence of clinical or laboratory signs of chorioamnionitis , or placental disease ; history of uterine or fetal anomaly ; and pregnant women administered steroids , with fever of unknown origin , or fetal tachycardia . preterm and term labor were diagnosed by the spontaneous presence of persistent uterine contractions ( 4 every 20 min or 8 every 60 min ) with documented cervical change or cervical effacement 80% or cervical dilation > 2 cm . centers for disease control and prevention ( cdc ) as preterm < 37 weeks , late preterm 3436 weeks , and early preterm < 34 weeks . gestational age data was based on the first day of last menstrual period of a pregnant woman with ultrasound confirmation at her first obstetrical visit . the demographic and obstetrical information was obtained by interview with patients and by searching medical records . the major clinical parameters of the study population were : age , body mass index ( bmi ) , socioeconomic status , gravidity , parity , miscarriage , gestational age , neonatal weight , and neonatal apgar 1 and 5 scores . the blood sera were separated by centrifugation and stored at 80c until the time of study . serum 25-hydroxyvitamin d levels were detected by competitive immunoassay using roche diagnostic commercial kits and a multichannel automatic analyzer ( roche cobas 6000-e 601 , rotkreuz , switzerland ) . serum paraoxonase 1 levels were determined by kinetic method ( relassay diagnostics , gyeonggi - do , korea ) as defined in the manufacturer s instructions . blood samples were gathered in a hematological sample tube , and the neutrophil , lymphocyte , and monocyte counts were determined with the same hematology analyzer ( mindray bc-6800 , shenzhen , china ) that was used for the calculation of the neutrophil - to - lymphocyte ratio . data are presented as mean sd , median ( min max ) , or percentage , as appropriate . the kolmogorov - smirnov test was used to assess the normality of the distribution of the data . for the analysis of parametric data , data that were not normally distributed were analyzed with the mann - whitney u test for comparisons between groups . the association of serum 25-hydroxyvitamin d and paraoxonase 1 levels and neutrophil - to - lymphocyte ratio value in preterm and term groups was evaluated by using the pearson correlation test . the blood sera were separated by centrifugation and stored at 80c until the time of study . serum 25-hydroxyvitamin d levels were detected by competitive immunoassay using roche diagnostic commercial kits and a multichannel automatic analyzer ( roche cobas 6000-e 601 , rotkreuz , switzerland ) . serum paraoxonase 1 levels were determined by kinetic method ( relassay diagnostics , gyeonggi - do , korea ) as defined in the manufacturer s instructions . blood samples were gathered in a hematological sample tube , and the neutrophil , lymphocyte , and monocyte counts were determined with the same hematology analyzer ( mindray bc-6800 , shenzhen , china ) that was used for the calculation of the neutrophil - to - lymphocyte ratio . data are presented as mean sd , median ( min max ) , or percentage , as appropriate . the kolmogorov - smirnov test was used to assess the normality of the distribution of the data . for the analysis of parametric data , data that were not normally distributed were analyzed with the mann - whitney u test for comparisons between groups . the association of serum 25-hydroxyvitamin d and paraoxonase 1 levels and neutrophil - to - lymphocyte ratio value in preterm and term groups was evaluated by using the pearson correlation test . this study was conducted with 35 ( 44.3% ) women with preterm birth and 44 ( 55.7% ) women with term birth . the preterm group had significantly lower maternal age , gravidity , parity , gestational age , serum level of high - density lipoprotein , number of monocytes , neonatal weight , neonatal apgar 1 , and neonatal apgar 5 than those of the term group ( p<0.05 ) . the bmi , socioeconomic status , and median number of miscarriages of the preterm and term groups were found to be comparable ( p>0.05 ) . the maternal serum level of low - density lipoprotein of the preterm group was significantly higher than that of the term group ( p<0.05 ) . table 2 shows the correlation coefficients of serum 25-hydroxyvitamin d and paraoxonase 1 levels and neutrophil - to - lymphocyte ratio value in the preterm and term groups . in the preterm group , regarding these parameters , there was a significant but weak positive correlation between the serum levels of 25-hydroxyvitamin d and paraoxonase 1 ( r=0.35 ; p=0.021 ) . in the term group , regarding these parameters , there was no significant correlation among these parameters ( p>0.05 ) . figure 1 presents 25-hydroxyvitamin d and paraoxonase levels and neutrophil - to - lymphocyte ratio of preterm and term groups . the 25-hydroxyvitamin d and paraoxonase 1 levels of the preterm group were significantly lower than those of the term group ( p<0.05 ) . the neutrophil - to - lymphocyte ratio of the preterm group was significantly higher than that of the term group ( p<0.05 ) . in this study we researched the relationship between preterm birth and the serum levels of 25-hydroxyvitamin d and paraoxonase 1 and neutrophil - to - lymphocyte ratio . as markers of inflammation and oxidative stress , the maternal serum levels of 25-hydroxyvitamin d and paraoxonase 1 were decreased and neutrophil - to - lymphocyte ratio was significantly increased in the preterm birth group . when we evaluated the correlation of these markers , a mild positive correlation was found between serum 25-hydroxyvitamin d and paraoxonase 1 levels in the preterm group . 25-hydroxyvitamin d is the primary storage form of vitamin d , so it may be detected in serum to determine vitamin d status . many studies have shown the association between vitamin d status and adverse pregnancy outcomes , including spontaneous preterm birth [ 11 , 20 ] . vitamin d is known to prevent bacterial infections by stimulating cathelicidin in the cells in the placenta at both maternal and fetal sites . it was reported that in pregnancies with deficiency of vitamin d , there is increased production of tumor necrosis factor--like inflammatory cytokines . furthermore , vitamin d decreases inflammation in decidua by inhibiting the nuclear factor kappa b pathway . women with deficient vitamin d levels might be at high risk for preterm birth because vitamin d deficiency can increase the inflammatory response to clinical and subclinical infections . it has been reported that maternal vitamin d status in the gestational weeks close to delivery , but not in the early periods of pregnancy , is related to preterm birth . the enzyme activating vitamin d and the vitamin d receptor are expressed in the human placenta and decidua . the maternal vitamin d receptor genotype was found to be related to deficient immune reaction at the placenta - decidua site that results in preterm birth . in our study , we also found the decreased serum 25-hydroxyvitamin d levels in the preterm birth group . this may be the reason for spontaneous preterm birth without any clinical chorioamnionitis or any other detected infection . the systemic response to intrauterine infection is arranged by the innate immune system , started by the recruitment of leukocyte types like neutrophils and lymphocytes . an increase in white blood cell or neutrophil count is a sign of subclinical inflammation . since inflammation and infection are important mechanisms in the etiology of preterm birth , there is a much more need to use a noninvasive method rather than invasive methods such as amniocentesis . in spontaneous preterm delivery , neutrophil counts increase and lymphocyte counts decrease , resulting in an increase in neutrophil - to - lymphocyte ratio . women experiencing high neutrophil - to - lymphocyte ratio when they are experiencing symptoms and signs of preterm labor might have a high probability of preterm birth . the cytokines released from the inflammatory region in the choriodecidua during the early phase of inflammation can result in a change in the number of leukocyte subsets . therefore , an inflammatory condition in the placenta can be detected by measuring neutrophil - to - lymphocyte ratio , which is an inexpensive and noninvasive method . the findings about neutrophil - to - lymphocyte ratio in our study was also compatible with the literature . paraoxonase is a hydrolytic enzyme associated with high - density lipoprotein protecting low - density lipoprotein from oxidative modification . decreased lipid peroxidation and oxidative stress can protect against oxidative damage of dna defect in signaling pathways . the activity of paraoxonase was reported to be decreased in animal models of inflammatory diseases . because of anti - inflammatory and antioxidant features of paraoxonase 1 , decrease in its serum activity may worsen the inflammatory and oxidative stress condition . in many studies , paraoxonase activity was found to be decreased in cases with preterm birth [ 13 , 27 ] . serum paraoxonase 1 levels were found to be decreased in the preterm group in our study that is compatible with the literature . decreased vitamin d activity was found to be associated with low levels of paraoxonase 1 activity , so the low serum vitamin d levels may result in a defective inflammatory and oxidative response . the acute - phase response due to low serum level of vitamin d results in decreased paraoxonase 1 activity and this condition causes the conversion of high - density lipoprotein from anti - inflammatory to proinflammatory molecules . the low paraoxonase activity increases oxidative damage of dna of lymphocytes , which explains the lower lymphocyte count increasing the neutrophil - to - lymphocyte ratio in preterm birth . these mechanisms may explain the decreased maternal serum 25-hydroxyvitamin d and paraoxonase 1 levels and increased neutrophil - to - lymphocyte ratio in spontaneous preterm birth . we excluded many obstetric and medical situations with potential to influence the studied parameters , which reduced the sample size . furthermore serum 25-hydroxyvitamin d and paraoxonase 1 levels and neutrophil - to - lymphocyte ratio could be evaluated only at a single state . we could not enroll a control group with the same gestational age as the preterm group , because our center is a tertiary one and only preterm pregnancies that will give birth are accepted in our service . the maternal serum 25-hydroxyvitamin d and paraoxonase 1 levels and neutrophil - to - lymphocyte ratio of preterm birth group are found to be significantly different when compared to term birth group in our study . further studies are needed to determine if these parameters can be used to predict if a preterm labor will result in preterm birth . | backgroundthe aim of this study was to evaluate the association of maternal serum 25-hydroxyvitamin d , paraoxonase 1 , and neutrophil - to - lymphocyte ratio in women having early spontaneous preterm birth without clinical chorioamnionitis.material/methodsthis study was prospectively administered in women referred to our obstetrics service with preterm labor that resulted in preterm birth ( n=35 ) and term labor that ended in term birth ( n=44 ) .
the maternal serum levels of 25-hydroxyvitamin d and paraoxonase 1 were measured and neutrophil - to - lymphocyte ratio was calculated.resultsthe 25-hydroxyvitamin d and paraoxonase 1 levels of the preterm group were significantly lower than those of the term group ( p<0.05 ) .
the neutrophil - to - lymphocyte ratio value of the preterm group was significantly higher than that of the term group ( p<0.05 ) .
there was a significant but small positive correlation between the serum levels of 25-hydroxyvitamin d and paraoxonase 1 in the preterm group ( r=0.35 ; p=0.021).conclusionsdecreased maternal serum 25-hydroxyvitamin d and paraoxonase 1 levels and increased neutrophil - to - lymphocyte ratio may have a role in the etiology of spontaneous preterm birth . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
inflammatory bowel diseases(ibd ) including ulcerative colitis(uc ) and crohn s disease(cd ) are chronic inflammatory disorders of the gastrointestinal tract identified by episodes of relapse and remission . ibd had uncertain etiology ; it imagined to be caused by interplaying among different environmental , genetic and immunologic factors . previous study revealed that different factors such as infectious diseases and nutrition during infancy , tonsillectomy , appendectomy , lifestyle factors and diet , domestic hygiene , refrigeration of food , time scales of socioeconomic evolution , drugs ( nonsteroidal anti - inflammatory drugs [ nsaids ] and oral contraceptive pills [ ocps ] ) , smoking , intestinal pathogens , and measles vaccination play a role in ibd . based on geographical , racial , genetic , sexual , and habitual differences , epidemiological studies are needful . numerous studies which have been directed on the epidemiology of ibd ; show considerable differences on geographical incidence . in recent decades , the incidence of ibd has been relatively stable , in areas such as u.s . and it is estimated that up to 1.4 million people in the united states and 250,000 people in the united kingdom suffer from ibd . however , incidence of ibd increased in previously low incidence areas such as asia . ng et al . expressed that the crude annual overall incidence values per 100,000 individuals were 1.37 for ibd in asia ( 0.76 for uc , 0.54 for cd , and 0.07 for ibd - undetermined ) . this increase most likely relates to improved physician awareness and diagnostic modalities , environmental and lifestyle factors according to socioeconomic change and rapid industrialization in asian countries . although the prevalence and incidence of ibd have not been properly studied in iran , our country is mentioned as a country with an increasing rate of ibd . iran is a wide country with different ethnicities , so more studies with focus on epidemiologic and clinical features of ibd can elucidate its pattern in iran . this study aimed to survey the epidemiologic features of ibd in guilan province , north of iran . in this retrospective cross sectional study , we assessed the documents of 868 patients with ibd that referred to private and governmental clinics and hospitals of guilan province , north of iran , during 2002 - 2012 . the diagnosis of ibd was confirmed based on clinical manifestation , radiologic , colonoscopic and pathologic findings and opinion of a gastroenterologist . variables such as demographic data ( age , gender , place of living ) , risk factors ( smoking , family history , age at initiation of disease , duration of disease and age at initiation of complication ) , and diagnosis ( site of involvement , pathologic and radiologic findings ) , extraintestinal manifestations and type of treatment ( corticosteroids , immunosuppressive drugs , salicylates , antibiotics and anti tnf drugs ) were evaluated . extraintestinal manifestations consist of musculoskeletal , ocular , renal , dermatological , hepatic and pulmonary systems involvements . according to esmat et al.,our diagnosis of uc was also based on the evidence of diffuse mucosal disease of colon with different proximal extentions from the rectum , superficial inflammation , crypt abscess , cryptitis and rectal involvement without any evidence of small bowel involvement other than backwash ileitis , in the same way cd was defined as skip lesions at endoscopy , cobblestone appearance , mucosal ulceration on colonoscopy , aphtus lesion found during upper endoscopy , deep inflammation or chronic terminal ileal inflammation with or without radiologic evidence of skip lesions , structuring disease , fistulizing disease existence of perianal disease(skin tags , abscess , fistula ) , or small intestinal involvement and noncaseating granulomas . indeterminate colitis ( ic ) was defined as an active and patchy architectural distortion , in the absence of small bowel involvement after radiologic evaluation , ileal intubations , an inconclusive endoscopic appearance , and histologic features that were not specifically diagnostic for cd or uc . all the information was collected for each case and then statistical analysis of quantitative and qualitative data was conducted using spss software ( version 18 , usa ) by chi square test . this study was approved by ethics committee of gastrointestinal and liver diseases research center ( gldrc ) . table 1 shows the demographic and clinical profile of the total number of patients with ibd , 756 people ( 87.1% ) had uc and 112 of them ( 12.9% ) had cd . the mean age of patients with uc and cd was 46.7315.79 and 40.1514.27 years respectively . the most common age of disease in uc was 40 - 59 years and in cd was 20 - 39 years . study 12.6 % of patients with uc and 12.5 % in cd had a family history of ibd . frequency of positive family history and cigarette smoking was not different between two disease groups ( p=0.9 and p=0.7 ) . the mean age at initiation of disease in patients with uc and cd was 40 and 34.5 years respectively . the most common age of disease initiation in uc was 40 - 49 years and in cd 20 - 29 years that was significantly different ( p<0.001 ) . the mean duration of disease was 4 and 5 years in uc and cd respectively . the mean age at initiation of complication was 40 years in uc and 32 years in cd . complications significantly initiated earlier in patients with cd ( p<0.001 ) . in most of patients , complication was initiated at 30 - 39 years in uc ( 28% ) and 20 - 29 years in cd ( 23.6% ) . in present study , 25.4 percent of patients with ibd suffered from extraintestinal manifestations of ibd ( 191 patients in uc and 30 patients in cd ) ( table 1 ) .
the frequency of arthritis , as the most prevalent extraintestinal manifestation was 36 percent . most of patients were treated with combination of two drugs ( 60% in uc and 72.3% in cd ) . then salicylates were the most common drugs in both groups ( 38.4% in uc and 25.9% in cd ) . in the recent decades , the incidence of uc in western countries gradually increased and a few years later , a similar increase was occurred in cd . studies in developing countries indicated that although , in comparison with europe and north america , ibd still has a low incidence and prevalence in asian countries , it is increasing rapidly . previous studies in iran revealed an increasing rate of uc and cd . in this study we assessed the epidemiological features of 868 patients with ibd in a clinic and hospital based study in guilan province during 10 past years . our study showed that cd was presented significantly more common in younger patients than uc . the mean age of patients with uc and cd was 46.73 and 40.15 years respectively in our study . another study in iran showed about 37 and 32 years for uc and cd respectively . the ratio of male to female in this study is different with other studies ( 0.92:1 in uc and 0.75:1 in cd ) . in a report by shirazi et al , it was 1.08:1 in uc and 1.83:1 in cd.16 just the same as taghavi et al . reported male / female ratio was 0.9:1 and 0.98:1 for uc and cd patients , respectively . in iran , the male / female ratio was reported to be 0.8:1 and0.7:1 for uc , also fallahi et al . and derakhshan et al . stated 1.4:1 and 1.2:1 for cd patients , in series . a review study in asia by prideaux showed an equal gender distribution for uc and demonstrating male predominance for cd .
in asia , positive family history was reported in 0.0 - 3.4% of patients with ibd that is lower than the 10 - 25% in western countries . in similar studies conducted by thia aghazadeh et al . and shirazi et al . reported lower positive family history in their population . in our study , the rate of positive family history were higher than previous studies . our study showed that 12.6 % of patients with uc and 12.5 % in cd had a family history of ibd . therefore , when a patient has lower gi symptom and family history of ibd , this disease should be considered for screening . studies in the west have shown that smoking is a risk factor for the development of cd but is protective for the development of uc . revealed that frequency of smoking was 5.2% in uc and 7.4% in cd . in our study , 3.3% and 4.5% smoked cigarette in patients with uc and cd respectively that is lower than previous studies .
in previous studies , the prevalence of extraintestinal manifestations of ibd was 25.4% .
in a report by jiang and colleagues , 90.5% of patients were prescribed 5-asa , whereas approxi - mately 33.0% took steroids and 27.5% were prescribed immunosuppressors . reported the majority of patients with cd ( 41.2% ) and uc ( 76% ) were treated with only 5-amino salicylic acid ( 5-asa ) . our study showed that most of patients were treated with combination of two drugs : salicylates and azathioprine ( 60% in uc and 72.3% in cd ) . then salicylates were the most common drugs in both groups ( 38.4% in uc and 25.9% in cd ) . this difference can be related to severity of disease in patients that we did not consider it in our study . this study showed that the incidence of ibd gradually increased during the past 4 years . taghavi et al . also showed an obvious increase in the new cases of ibd in the past three decades . this development can be associated with augmentation of the diagnostic services and /or increase in public information , although ; it is still not obvious whether this increase in iran is attributable to the environmental features emanating from industrialization or other unfamiliar factors .
as a limitation , so it is suggested to do population based prospective studies with considering all related factors and details of disease in future . this study showed that cd were presented significantly more common in younger patients than uc and totally the disease was slightly more common in female . it is suggested to plan more educational program to improve the time of diagnosis . this study was supported by the gastrointestinal and liver diseases research center ( gldrc ) of guilan university of medical sciences ( gums).this survey was approved by ethical committee of gldrc . we would like to thank all members of gastrointestinal and liver diseases research center ( gldrc ) that assisted us in this study . sources of funding : this study was initiated and conducted by gastrointestinal and liver diseases research center ( gldrc ) of guilan university of medical sciences ( gums ) . | backgroundthe geographical incidence of ibd varies considerably .
this study aimed to survey the epidemiologic features of ibd in guilan province , north of iran , during ten years duration .
methods
in this retrospective cross - sectional study , we assessed the documents of 868 patients with ibd referred to private and governmental clinics of guilan province between 2002 and 2012 .
variables such as demographic data , risk factors , diagnosis , extraintestinal manifestations and type of treatment were collected .
results
among 868 patients with ibd , 756 patients ( 87.1% ) diagnosed as uc and 112 patients ( 12.9% ) as cd . the mean age of patients with uc and cd was 46.7315.79 and 40.1514.27 years respectively .
male / female ratio in uc and cd was 0.92:1 and 0.75:1 respectively .
the most common age of disease initiation in uc was 40 - 59 years and in cd 20 - 39 years ( p<0.001 ) .
extraintestinal manifestations were seen in 25.4 percent of patients with ibd .
most of patients were treated with combination of two drugs : salicylates and azathioprine ( p<0.04 ) .
the incidence of ibd gradually increased during the past 4 years in guilan province .
conclusion
this study showed that cd were presented significantly more common in younger patients than uc and totally the disease was slightly more common in female . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
launching a journal is a bit like raising a child . even more than a child , a journal is unformed when you begin , and grows and develops a personality based on the decisions you make for it and the effort you put into it which for a journal translates into the look and feel of the journal , the type and quality of the articles it publishes , and its editorial and publishing policies . when dmm launched in 2008 , i wrote an editorial entitled provoking progress ( siegel , 2008 ) . in this piece , i voiced my excitement and hope for the research that dmm would publish and for the community of basic researchers and clinical scientists who would meet between its covers to accelerate our progress towards understanding , diagnosing and treating human disease . together , the editorial team , advisory group and i defined the scope of the journal : first , research articles using ( any ) model organism to study ( any ) human disease ; we later expanded this to include in vitro disease models . translational impact it is nt enough to give lip service to disease ; the research has to move us forward towards understanding disease mechanisms or developing new diagnoses or therapies . finally , we strove to create a fair and transparent editorial practice , in which we set high standards without asking authors to do needless or endless work . more than just the occasional review and editorial , this area features a number of different kinds of articles aimed at spurring new research and inspiring the next generation of scientists . these include clinical puzzles , in which clinicians identify a disease that would benefit from basic science research ; a model for life interviews with scientists and clinicians who sustain stellar careers and lead exemplary lives ; at a glance poster articles that double as handy lab references ; and special articles , which cover a wide range of issues , such as the recommended procedures for describing and performing metabolic assays of glucose homeostasis in mice ( ayala et al . , 2010 ) , the evolution of human obesity ( wells , 2012 ) , or suggestions for optimizing the value of preclinical models ( katz et al . , 2012 ) . over the past few years , dmm has also nurtured young scientists through journal club articles and research presentation grants . importantly , the journal is open access , so everyone who wishes can read and use the articles immediately upon publication . for those of you in the know about the kinds of creative commons licenses offered , i will note that we recently decided to move from the cc - nc - sa license , which prevents commercial re - use and requires any further distributions of the article to use the same creative commons license , to the less restrictive cc - by license , which requires attribution only . as always , the journal is committed to publishing policies that best serve our community . when i look back on those decisions for dmm , i am pleased : the quality of the articles is high and the look of the journal matches it ; and there are interesting ways for basic researchers and clinical researchers to interact with and inform each other . of course , these successes are not mine alone : we had enormous support in our efforts from the company of biologists itself , from the journal advisory group , from the editorial team , and from the many researchers who submitted to , reviewed for and published in dmm . about a year and a half ago , i agreed to become the director of scientific education and public communications at the broad institute of mit and harvard , and realized i would have limited time to devote to dmm , too little to give it what it needs to continue to grow . i encouraged the company of biologists to identify academic editors instead of another professional editor to succeed me , as i felt that the journal had now reached an age where its lead editors should be researchers actively engaged in the work covered by the journal . with the help of an old friend and colleague , judith glaven , and the dmm advisory group , we gathered feedback on the journal and suggestions for possible lead editors , ultimately arriving at ross cagan as the new editor - in - chief , and monica justice and george tidmarsh as senior editors . the process was thoughtful , but not quick ; and so to help me with the transition , the advisory group stepped in as editors for new submissions starting in december of last year . but i no longer have a sense of the daily flow of the journal , since i can only see those papers i have been handling which i have to admit feels a little strange , and which brings me to my last point . if launching a journal is like raising a child , then passing that journal along to new editors is like being at your child s wedding . i watch with pride at what the journal has become , with enormous respect for the new editors , and with hope for how the journal will develop under new leadership . ross , monica and george are just the right team to guide the next phase of the journal s growth . they describe their vision for the journal a vision that i fully support in their introductory editorial ( cagan et al . , 2013 ) . like a mother , , my attachment to the journal feels permanent . and like a mother , i know that the time is right , and that the new editors will spur the journal in all sorts of exciting ways . | summaryjournals do more than publish collections of research articles and reviews ; they also create community , influence standards for community behavior and provoke progress in a particular field . in this editorial ,
founding editor - in - chief vivian siegel compares launching a journal to raising a child , and reflects on the choices and successes of her tenure at dmm as she passes the leadership of the journal to new editors . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lethal complications may become inevitable making vigilant scrutiny and monitoring of such patients a necessity . although conventional measures to estimate infections such as white blood count ( wbc ) count and erythrocyte sedimentation rate esr values are valuable in determining state of patient at testing time , the predictability of these is worth limited . the desirability of serum - derived surrogate predictor behavior and outcome can not be under estimated , arousing interest in identifying substances which could function as prospective monitor of disease progression . c - reactive protein ( crp ) was discovered in 1930 in pneumococcal pneumonia patients . crp is present only in small amounts in normal healthy individuals and is involved in process of innate immune system with functions of compliment activation , antigen clearance , and mediation of phagocytosis by activation of neutrophills . in severe infections or inflammatory reactions , striking rise in serum concentration of crp is seen up to 1000 fold within few hours of clinical symptoms . crp concentration raises with infection making it a positive acute phase reactant with a very short half - life of 57 h. thus , advantage of having short half lives makes serum crp levels as sensitive indicators of infection . so in the present study , we assessed the efficacy of serum crp levels as monitoring tools in 20 patients with fascial space infections of odontogenic origin , for determining severity of infections , length of hospital stay , and efficacy of treatment regime . this randomized prospective study was conducted on patients visiting department of oral and maxillofacial surgery , with diagnosis of fascial space infections of odontogenic origin . inclusion criteria was patients with in age group of 17 to 57 , any carious or periodontally involved tooth correlated as foci of infection on clinical examination , and radiographic evidence of periapical changes . exclusion criteria was that the patients who were medically compromised , pregnant , chronic alcoholics , on steroid therapy , and on contraceptives . routine laboratory investigations were done along with airway assessment . at the onset of treatment , discharge samples from infectious site were collected and sent for culture sensitivity and blood sample for assessing values of crp . blood samples of all the patients were taken as , t1 before starting any treatment , t2 4 day of treatment , and t3 8 day of treatment . empirical antibiotic regime was started to control infection and appropriate analgesics were given for pain relief . incisions were placed keeping facial esthetics , vital structures , and dependent part of swelling into consideration . if infection subsided , no further surgical intervention was done and empirical antibiotic therapy continued . but if infection increase or failed to subside , further surgical intervention was done and antibiotic regime changed according to culture and sensitivity reports . assessment of patients was done based on various clinical parameters on every 4 day and correlated with laboratory values of serum crp . signs used were change in size of swelling ( using thread and scale ) , mouth opening ( measuring central incisor distance ) , active discharge ( 1 if present and 0 if absent ) , and number of spaces involved ( using clinical observation and ct scan ) . symptoms recorded were pain ( visual analogue scale ) , dysphagia ( 1 if present and 0 if absent ) , and hoarseness of voice ( 1 if present 0 if absent ) . treatment regime was considered effective if laboratory values of both inflammatory markers and clinical parameters showed improved condition of patients . this was a randomized prospective study conducted on 20 patients with diagnosis of fascial space infections of odontogenic origin . the patients were within age group of 17 to 57 years with 90% males and 10% females . the mean age of males was 40.78 8.41 and that of females was 40 15.56 years . mandible was involved in 16 patients ( 80% ) and 4 patients ( 20% ) had infection of maxillary origin . the severity of infection and effectiveness of treatment regime were determined using correlation between clinical parameters and laboratory values of serum crp [ table 1 ] using regression test . crp levels of patients on day 0 , 4 , and 8 the relation of crp with the clinical signs and symptoms was also evaluated using the same method . on first day , the regression equation explained the direct and linear relation between crp and size of swelling with crp being significant predictor of size of swelling ( p < 0.01 ) . regression also proved crp being a significant predictor of mouth opening ( p < 0.01 ) . the regression equation implied that for every one unit increase in crp , there was an increase of 0.04 units in number of spaces and 56.2% of the variation in number of fascial spaces was explained by crp values . similarly regression equation for pain showed direct relationship with crp . with every one unit increase in crp , there was an increase of 0.01 units in pain and 12.03% of the variation in pain could be explained by crp values . the analyzed data also showed that 20 patients ( 100% ) included in study had discharge present on day 1 . dysphagia was seen in 13 patients ( 65% ) and 8 patients ( 40% ) had hoarseness of voice . day 4 : the values obtained on day 4 were again evaluated using the same method . the regression equation explained the direct and linear relation between crp and size of swelling , crp being significant predictor of size of swelling ( p < 0.01 ) having r values of 35.94% . the data for mouth opening explained an inverse relation between crp and mouth opening . equation proved that crp was a significant predictor of mouth opening ( p < 0.01 ) having r values of 47.71% . contrary to mouth opening the number of fascial spaces involved was directly proportional to crp values . the regression equation for number of spaces implied that for every one unit increase in crp , there was an increase of 0.04 units in number of spaces and 53.28% of the variation in number of spaces was explained by crp values . similarly , regression equation for pain showed direct relationship with crp . with every one unit increase in crp , there was an increase of 0.03 units in pain and 4.73% of the variation in pain could be explained by crp values . the data also showed that 75% of patients included in study had discharge present on day 4 . dysphagia was seen in 30% of patients and 15% of patient had hoarseness of voice . day 8 : the regression equation explained direct and linear relation between crp and size of swelling , but crp was not a significant predictor of size of swelling ( p > 0.05 ) having r values of 17.9% . the data for mouth opening explained an inverse relation between crp and like swelling size crp was also not a significant predictor of mouth opening ( p > 0.05 ) having r values of 19.2% . the regression equation implied that for every one unit increase in crp , there was an increase of 0.10 units in number of spaces and 49.82% of the variation in number of spaces was explained by crp values . similarly , regression equation for pain showed direct relationship with crp . with every one unit increase in crp , there was an increase of 0.05 units in pain and 8.1% of the variation in pain could be explained by crp values . the data showed that none of patients included in study had discharge present on day 8 . dysphagia was seen in four patients ( 20% ) and one patient ( 5% ) had hoarseness of voice . the above statistical analysis finds strong correlation between laboratory values of marker with clinical parameters used to measure severity of infection . the analysis also proved that values of marker significantly changed and moved toward normal as the condition of patient improved with effective treatment . on the other hand , there was minimal change in the values of markers for a patient whose condition did not improve and patient died ( fifth patient ) on 6 day . thus , study proved that crp is significant predictors of severity of infection and effectiveness of treatment regime . we noticed that crp was also a significant predictor for hospital stay ( p < 0.001 ) . the regression equation shows that there was a linear relationship between crp and hospital stay , i.e. , higher the crp level , higher was the hospital stay . r = 0.4011 implies that 40.11% of variation in hospital stay was explained by crp [ figure 1 ] . we noticed that crp was also a significant predictor for hospital stay ( p < 0.001 ) . the regression equation shows that there was a linear relationship between crp and hospital stay , i.e. , higher the crp level , higher was the hospital stay . r = 0.4011 implies that 40.11% of variation in hospital stay was explained by crp [ figure 1 ] . the acute phase response is a complex set of systemic and metabolic reactions elicited by infections or other causes of injury . besides other physiological , metabolic , and biochemical changes , the acute phase response is characterized by alterations in the hepatic synthesis and serum levels of some proteins . thus , while the levels of positive acute phase proteins like crp , complement 3 , serum amyloid a , alpha-1 , and glycoprotein , etc . , increase due to stimulation of hepatic synthesis , depression of hepatic production of visceral transport proteins ( negative acute phase proteins ) like albumin , transferring , thyroxin binding prealbumin ( tbpa ) , and retinol binding proteins ( rbp ) , etc . several reports have indicated that visceral transport proteins , mainly those with a low turnover rate , like tbpa , rbp are useful to evaluate protein and protein energy under nutrition as well as to monitor nutritional recovery during nutrient repletion . however , the presence of infection results in depression of their hepatic production as well as increased passage to the extra vascular space , consequently diminishing their serum levels making them markers for acute phase conditions . similarly crp , which is present in only small amounts in healthy individuals , is involved in several processes of the unspecific immunologic defense . in severe infections or inflammatory reactions , a striking rise in the serum concentration is often seen . this suggests the possibility that rise of crp is sufficiently rapid and specific to serve as a definitive aid in the early diagnosis of septicemia . thus , based on these properties of the markers attempt has been made to use them in patients with fascial space infections . in the present study , we found that crp had a high degree of correlation with severity of infection having p value < 0.01 from day 0 and day 4 . , where they found statistically significant correlation between prealbumin and crp at 2 day ( r = 0.45 , p < 0.01 ) and 5 day ( r = 0.53 , p < 0.01 ) in infection patients . crp levels were found to be significantly high ( p < 0.01 ) in most of patients of space infections of odontogenic origin . similar results were obtained by ren et al . and ylijoki et al . where crp levels declined significantly when effective treatment was given to the patient . in this study , crp was also a significant predictor for hospital stay ( p < 0.001 ) . the regression equation shows that there was a linear relationship between crp and hospital stay , i.e. , higher the crp level , more was the hospital stay . they also found crp to be a significant predictor for hospital stay ( p < 0.001 ) . the findings of this prospective analysis indicate that crp is effective markers for determining severity of infection , efficacy of treatment regime , and length of hospital stay for patients with fascial space infections of odontogenic origin . the duration of antibiotic usage , need for intensive care , and use of additional nutritional supplements become more rationale if these measurements are incorporated in clinical decisions . thus , we conclude that crp should be incorporated as monitoring tools for managing patients with fascial space infections of odontogenic origin . | objectives : study included 20 patients with diagnosis of fascial space infections of odontogenic origin to assess efficacy of serum crp levels as monitoring tools for determining severity of infections , hospital stay and efficacy of treatment.materials and methods : blood samples taken on day 0 , 4 and 8 for measuring serum levels of marker .
simultaneously clinical parameters like swelling size , pain etc .
were also recorded on day 0 , 4 and 8 and appropriate treatment given to each patient .
correlation between markers and parameters was found using regression and paired t-test.results:statistical analysis found strong correlation between lab .
values of markes and parameters used to measure severity of infection .
also crp is significant marker for hospital stay ( p<.01).interpretation and conclusion : prospective analysis indicates crp can be effective marker for determining severity of infection , treatment efficacy and hospital stay .
duration of antibiotic usage , intensive unit care , use of nutritional supplements becomes more rationale .
markers also make treatment cost effective and help protecting patients from side effects of excess drug usage . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 71-year - old woman presented with a complaint of sudden decrease in vision in the right eye , 7 days after tkra . the patient 's history was unremarkable except a severe pain of more than the visual analog scale of 8 points for about 2 days , because the analgesic dose given was not adequate for the pain after the surgical operation . on examination the best corrected visual acuity ( bcva ) was 20/100 in the right eye and 20/20 in the left eye . retinal examination showed a well differentiated serous detachment that was about 3.5 disc diameter in size and located on the macular area in the right eye . no disc edema , retinal cotton wool spots , hemorrhages , or vascular abnormalities were noted in both eyes ( fig . 1 ) . a fluorescein angiography ( fa ) of right eye performed at the first visit revealed choroidal hypoperfusion and a serous detachment without any leakage points in the early phase of the angiogram ( fig . 2a ) . in the mid and late phases , the area of non - perfusion showed pooling of the dye in the subretinal space without a leakage point ( fig . indocyanine green ( icg ) angiography was also performed on the same day and showed delayed perfusion of the choriocapillaris without a leakage point in the early phase followed by slow filling of neurosensory detachment without a focal source of leakage in the late phase ( fig . after 2 months , the symptoms and clinical findings began to improve gradually and at the follow - up examination 6 months after the first clinic visit , there was a complete resolution of the serous detachment of macula . the bcva had improved to 20/20 in the right eye and the fluorescein angiogram showed minor disturbances in the rpe only ( fig . serous detachment of the neurosensory retina can occur due to any process that disrupts the outer blood - ocular barrier controlled by the rpe.3 diagnosis of a serous detachment is made clinically , although optical coherence tomography has recently been used for the detection of clinically occult serous elevations of the retina . the underlying mechanisms of subretinal exudation are thought to include choroidal vascular perfusion and permeability changes , which result in increased choroidal interstitial fluid with further extension into the subretinal space.3 in our case , this 71-year - old woman presented with a unilateral choroidal ischemia with serous macular detachment detected by fa and icg angiography . the most common cause of this finding is the neovascular form of age related macular degeneration.3,4 however , the patient did not have subretinal hemorrhages , exudates or fibrosis at any time.5 other signs of choroidal neovascualr membrane including a gray - green membrane and pigment epithelial detachment were also absent . subretinal leakage , due to altered choroidal vascular perfusion and permeability , occurs in systemic inflammatory and infectious diseases with fluid extension into the subretinal space.3 systemic malignant hypertension , toxemia of pregnancy , and hypercoagulable states may result in choriocapillaris occlusion and choroidal ischemia with subsequent breakdown of the outer blood ocular barrier and serous detachment.3,6 however , the patient had no significant ophthalmic history and her medical history and review of systems were unremarkable . other causes of serous macular detachment include acute and chronic central serous chorioretinopathy ( csc ) . however , fa failed to show focal rpe leaks , rpe stippling , or gravitational fluid tracts consistent with csc.7,8 the icg angiography showed a slow pooling of icg in the subneurosensory space but failed to demonstrate focal leaks or frank choroidal leakage as seen in csc . idiopathic csc in a resolving phase with early resolution of fluorescein leakage and persistence of subretinal fluid , might present with serous macular detachment . however , the acute onset of visual loss in a close temporal relationship to severe postoperative pain that interfered with sleep for 2 days after surgery ( visual analog scale : 8 points ) and the constant pain ( visual analog scale : 2~4 points ) despite narcotic analgesics suggest a different etiology . a search of the medline database ( search words used : choroidal ischemia , pain , serous retinal detachment ) showed no studies on choroidal hypoperfusion and serous detachment related to severe pain . generally , pain reacts to nociceptive stimulation , and primarily secretes histamine or substance p , and serotonin ; secondary stimulation of the sympathetic nervous system follows.9 it is possible that the sympathetic innervation produced vasoconstriction and alteration of blood flow in the choroidal vascular beds leading to choroidal hypoperfusion . compromised function of the retinal pigment epithelium and/or choroid would lead to accumulation of subretinal fluid as is observed in our patient with a serous detachment . a recent survey investigation of the severity of pain , following ambulatory surgery in 5,703 patients , indicated that 30%(1,712 ) of the patients experienced moderate - to - severe pain postoperatively . however , because individual tolerance to pain varies , patients who have pain do not always present with ocular symptoms.10 therefore , we propose that severe postoperative pain influences sympathetic activity that can result in ischemic injury with focal choroidal vascular compromise and secondary dysfunction of the overlying rep cells ; this may occur in some patients and lead to leakage across the rpe and accumulation of subretinal fluid . further investigation of the potential impact of pain on the delicate balance of fluid homeostasis , at the outer blood - ocular barrier , may be warranted . | to report the association of a unilateral serous macular detachment with severe postoperative pain . a 71-year - old woman presented with a sudden decrease in vision in the right eye , seven days after a total knee replacement arthroplasty .
the patient 's history was unremarkable except for a severe pain greater than the visual analog scale of 8 points for about 2 days after surgery .
retinal examination showed a well differentiated serous detachment that was about 3.5 disc diameter in size and located in the macular area .
fluorecein angiography and indocyanine green angiography showed delayed perfusion of the choriocapillaris without leakage points in the early phase and persistent hypofluorescence with pooling of dye in the subretinal space in the late phase .
there was a spontaneous resolution of the serous detachment and the choroidal changes with residual pigment epithelial changes .
severe postoperative pain may influence the sympathetic activity and introduce an ischemic injury with a focal , choroidal vascular compromise and secondary dysfunction of overlying rpe cells in select patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 17-year - old boy presented with severe headache of 2 weeks duration and sudden decrease in vision in both eyes for 10 days , right eye followed by left within 5 days . on examination , right eye had no perception of light and left eye had of counting fingers close to face vision . pupil was fixed dilated and nonreacting to light in right eye and left eye pupil was normal in size , but had ill - sustained reaction to light . fundus examination revealed subtle temporal pallor of optic disc in both eyes [ fig . 1 ] . he had undergone computed tomography of the brain and orbit which revealed a lesion in the spheno - ethmoid sinus which was slightly hyperdense . bone windows showed erosion of the roof of ethmoidal sinus [ fig . 2 ] . mri of the brain revealed a lesion in the spheno - ethmoid sinuses and located between the two internal carotid arteries which was hyperintense on t1w images and iso- to hyperintense on t2w images [ fig . picture of the optic nerve head right ( a ) and left ( b ) preoperative ct scan of the brain and paranasal sinuses coronal section ( a ) with bone cuts ( b ) shows lesion in the spheno - ethmoid sinus which is slightly hyperdense and erosion of bone in the roof of the ethmoidal sinus preoperative mri of the brain t1w ( a and b ) : axial sections showing hyperintense lesion in the spheno - ethmoid sinuses and located between the two internal carotid arteries . t2w ( c and d ) : axial and coronal sections showing iso- to hyperintense lesion patient was immediately referred to neurosurgeon for surgical intervention , but there was a delay of 2 days by the patient . when he presented to the neurosurgeon , he had developed right oculomotor nerve paresis in addition to the sixth nerve paresis . right trans - ethmo - sphenoidal approach and total evacuation of the mucocele under general anesthesia . one week after surgery , the right eye condition was same , but left eye showed vision improvement to counting fingers at 4 m ; pupil was sluggishly reacting to light . one month after surgery the right eye showed only abducent nerve paresis , while oculomotor nerve paresis was completely resolved ; pupil showed relative afferent pupillary defect . left eye showed improvement in vision of 6/6 , n6 , and pupillary reaction was normal . on 2 months follow - up , both eyes had full range of ocular movements [ fig . 4 ] . postoperative clinical picture of the patient showing full range of ocular movements postoperative ct scan of the brain and paranasal sinuses axial section ( a ) with bone window ( b ) showing complete excision of the lesion mucoceles are cyst - like lesions lined with respiratory epithelium that most commonly produce bone destruction within the paranasal sinuses . approximately two - thirds of all mucoceles involve the frontal sinuses , and the majority of the remainder involve the ethmoidal sinus . sphenoidal mucoceles occur rarely and have an incidence of 1% of all paranasal sinus mucoceles . anterior clinoid mucoceles causing optic neuropathy and cranial nerve palsies are reported in the literature , but sphenoid mucoceles causing both optic neuropathy and ophthalmoplegia are very rare and we could not find any similar report in the literature . the most common is headache ( frontal or retroorbital ; 70% of patient ) and second is visual disturbance ( 65% of patients ) . other visual symptoms include diplopia , ocular muscle paresis , exophthalmus , and complete visual loss . the slow and silent expansion of a mucocele may be unsuspected until bone is eroded and it impinges on adjacent structures . proposed theories for development of mucocele include chronic infection , allergic sinonasal disease , trauma , previous surgery , and in some cases the cause remains uncertain . lund and milroy proposed that the obstruction to sinus outflow in combination with superimposed infection caused the release of cytokines from lymphocytes and monocytes . the cytokine release would stimulate fibroblasts to secrete prostoglandins and collagenases , which in turn could stimulate bone resorption leading to expansion of the mucocele . a large mucocele produces a classic radiographic appearance of an enlarged distorted sinus with a bony defect representing a breakthrough into the adjacent structures . the ct features include a homogeneous iso- to hyperdense expansile mass , which completely fills the sinus cavity and surrounding structures . on contrast administration , there is no increase in the density of mucocele due to its avascular mucoid content . differential diagnosis includes hypophyseal , tumors , craniopharyngioma , meningioma , chordoma , dysgerminoma , cholesteatoma , and tumors arising from nasopharynx , sinuses , and base of the skull . surgical treatment options consists of trans - nasal endoscopic , trans - ethmoidal , trans - antral , trans - palatal , and trans - septal . the degree of improvement in visual acuity after an operation depends on visual acuity before the operation , the mode of development of the mucocele , and the time from onset of the disease until surgery . have described that if surgery is delayed for more than 610 days after the start of visual loss and if there is optic atrophy , the visual prognosis seems to be poor . the above presented case had symptoms in the right eye for 15 days and in the left eye for 10 days . although there was no optic atrophy in the right eye , the vision did not improve . poor recovery of the right eye could be due to comparative delay in presentation and intervention . mucoceles , though rare , have to be considered in the differential of visual deterioration . early surgery of these benign lesions will lead to complete recovery even in patients with poor vision . | sphenoid sinus mucocele comprises only 2% of all paranasal sinus mucoceles . in literature
, there is a case report on sphenoidal mucocele causing bilateral optic neuropathy , with unilateral partial recovery and cranial nerve palsy , but we did not come across any literature with bilateral optic neuropathy and ophthalmoplegia together caused by spheno - ethmoidal mucocele .
we present such a rare case of spheno - ethmoidal mucocele causing bilateral optic neuropathy and unilateral sixth nerve palsy who had postsurgery , unilateral good vision recovery , and complete resolution of sixth nerve palsy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cells of the immune system continually monitor a host for invading pathogens and participate in clearing those pathogens so the body remains free of infection . this active response is an immunogenic response . under non - infectious conditions , cells of the immune system are also continually exposed to proteins of the host and any immune responses which develop are suppressed so the host maintains a state of self - tolerance . the cells that direct the outcome of pathogen exposure are the antigen - presenting cells ( apc ) , and these include dendritic cells ( dc ) , macrophages and some b lymphocytes . the potential for control of the uptake and presentation of environmental antigens by apc is important for immunotherapy aimed at both the tolerogenic and immunogenic capacity of apc . achieving therapeutic control over dc could have impact on immunization for pathogens and cancers on the one hand , and immunosuppression for autoimmune diseases and organ transplant rejection on the other . to date , the difficulty has been to determine the conditions under which dc behave in an immunogenic versusa regulatory or suppressive manner . spleen has been the organ of focus in many dc studies due to its unique role as a site of dc development [ 13 ] . it is also a site for dc exposure to blood - borne pathogens and apoptotic or dying cells . the main function of dc is to endocytose and process antigen from pathogens or apoptotic cells , and to present antigen as peptide in the context of major histocompatibility complex ( mhc ) class i and ii molecules for t - cell recognition and activation . the outcome of t - cell activation can be either immunity or tolerance depending on the signals that accompany t - cell receptor ( tcr ) recognition of antigen . cell surface markers like cd11c , cd11b , cd8a , cd4 , mhc - ii and cd45ra are most widely used for phenotypic characterization of dc subsets . different subsets of dc are present across lymphoid organs like spleen , bone marrow ( bm ) , lymph nodes and thymus , with different subsets distinguishable by function and marker expression . the murine thymus , for example , contains mainly cd8a conventional ( c)dc that also express cd11c and mhc - ii , which develop within this organ , while cd8ot cdc resident in murine thymus are thought to be immigrants . spleen is distinct in that it contains multiple dc subsets including plasmacytoid ( p ) dc , and the cd8ot and cd8a subsets of cdc . the cd8ot cdc in murine spleen are cd11ccd11bmhc - iib220 cells , and can be further distinguished on the basis of cd4 expression . the cd8 cdc are also distinguishable as cd11bcd4 cells , while pdc can be characterized by marker expression as cd11ccd11bcd8tmhc - ipb220 cells , with cd8 and mhc - ii expression dependent on the state of maturation . pdc are also marked by secretion of interferon- ( ifn- ) , which is effective in mediating viral clearance [ 9 , 10 ] . both cdc subsets are derived from precursors originating in bm , which migrate to spleen where they develop into immature , steady - state dc . as well as differing in marker expression , cdc differ in their location within organs , with cd8 cdc localizing to the t - cell areas of spleen and cd8 cdc to the marginal zone . distinct monocyte - derived dc with the functional and pheno - typic characteristics of cdc are also recruited into sites of inflammation . langerhans cells ( lc ) also appear to be inflammatory dc and represent a distinct monocyte - derived cell type expressing langerin ( cd207 ) that resides in the epidermis and the intestinal epithelium . lc migrate to lymph nodes in response to contact with antigen in the presence of inflammation or danger signals . inflammatory dc derive from circulating monocytes , which differentiate under the influence of inflammatory factors like granulo - cyte - macrophage colony stimulating factor ( gm - csf ) , tumour necrosis factor ( tnf)-a and il-4 [ 1214 ] . they are distinct from the dc subsets described in spleen in the resting state , although they have phenotypic and functional similarity to cd8ot cdc . the developmental relationship between cdc and inflammatory dc is not yet clear , although recent evidence for a common dendritic progenitor in bm for cdc and pdc [ 2 , 15 ] , now implicates inflammatory dc as a different lineage with a distinct myeloid progenitor and developmental pathway more closely aligned with mono - cyte development . recent studies have shown that by 6 weeks of age , mouse spleen contains 2.4% dc which express mhc - ii on their cell surface and are immunocompetent . a primary function of dc is uptake of antigen from a site of infection with subsequent migration to lymph nodes and presentation of antigen to cd4 t cells in the context of mhc - ii molecules . if dc also become activated via pathogen - associated danger signals , which signal through toll - like receptors ( tlr ) on the dc , then there is up - regulation of t - cell co - stimulatory molecules like cd86 and cd40 , leading to t - cell activation and an immunogenic response . however , capacity to present antigen to t cells and to initiate an immune response differs with their cd8a phenotype . cd8ot cdc endocytose foreign antigen , and induce a cd4 t - cell response both in the presence and absence of bacterial lipopolysaccharide ( lps ) as a some cdc subsets can endocytose exogenous antigen and present it to cd8 t cells in the context of mhc - i molecules in a process termed cross - presentation , whereby foreign antigen is endocytosed and degraded within endosomes to be presented as peptide in the context of mhc - i molecules . this pathway is important for clearance of pathogens like viruses or parasites that do not infect apc , and for removal of apoptotic normal and cancerous cells . in terms of cdc in spleen , cd8a cdc are able to cross - present antigen most efficiently [ 17 , 18 ] . functional studies on dc are difficult due to the problem of isolating small subsets of cells and of maintaining their functional potential . removal of cells from the host , injection into recipient animals , or staining cells with antibody for facs analysis , can lead to activation . it is difficult to obtain an ex vivo population in the resting or steady - state for use in comparative studies . a wealth of evidence now indicates that dc maturation or activation status rather than dc lineage per se determines the immuno - genicity of dc . dc tolerogenicity is not therefore a characteristic of a specific subset , or lineage of dc , but a feature of the environmental niche surrounding the developing cell . indeed , an important characteristic of dc is their functional plasticity and their ability to adopt different apc characteristics depending on the cytokine milieu or inflammation site in which they are located . several environmental factors are well known to support the development of tolerogenic / suppressive dc including the immunosuppressive cytokines il-10 and transforming growth factor- ( tgf- ) , as well as other factors like hepatocyte growth factor , granulocyte colony stimulating factor ( g - csf ) , prostaglandin e2 and histamine [ 21 , 22 ] . dc that are tolerogenic or suppressive contribute to peripheral tolerance mechanisms essential in supporting the state of central or thymic tolerance established at birth . peripheral tolerance is maintained by multiple mechanisms including anergy or deletion of self - reactive t cells , and the induction of regulatory t cells ( tregs ) , which suppress the function of self - reactive t cells . it is well established that immature cdc resident in spleen are tolerogenic in the steady - state , taking up antigen from the environment as soluble molecules or apoptotic cells , and presenting these to t cells in the absence of a co - stimulatory signal , often with low mhc - ii expression , so inducing to a tolerogenic outcome [ 2326 ] . in contrast , these same cells also become highly immunogenic when exposed to inflammatory or danger signals , inducing strong immunogenic responses in nave t cells . activating proin - flammatory cytokines can include tnf- , ifn- and cd40-ligand ( cd40-l ) , while danger signals can include lps , cpg motifs and double stranded ( ds ) rna . for example , cd8 cdc have been shown to be highly immunogenic and able to induce cd8 cytotoxic t cells in response to viral infection [ 18 , 27 ] . dc of the same type can also function in cross - presentation of apoptotic cells to cd8 t cells , mediating deletion of reactive t cells , although the mechanism of deletion is unclear . much of the work on immature , tolerogenic dc has involved in vitro cultured cells , and the identity of the in vivo cell equivalent is unclear . many studies have involved dc produced by culture of bm cells with gm - csf and il-4 , which yields a subset of dc very similar to cd8ot cdc . several papers now report the ability of these cells to induce both regulatory and anergic t cells [ 30 , 31 ] . indeed , in the collagen - induced arthritis model in mice , orally induced tolerance due to collagen administration has been associated with pdc and their production of induction of 2,3 indoleamine dioxygenase ( ido ) with subsequent formation of tregs . tregs then have an inhibitory effect on t - cell proliferation and their production of inflammatory cytokines . soluble factors produced by tolerogenic dc could represent valuable immunotherapeutic agents for control of t - cell proliferation and activation in autoimmune diseases . immature pdc induce anergy in cd4 t cells , and mature pdc can induce regulatory t - cell function in cd8 t cells . while the induction of cd4 t - cell anergy by immature pdc is thought to occur through dc - t - cell contact in the absence of costimulatory molecules , the induction of regulatory function in cd8 t cells by mature pdc may be mediated by the activation of the pdc by cd40l . while a number of different examples exist in the literature , this group of cells is not well defined [ 20 , 3234 ] . several reports have described the induction of dcregs with suppressive or regulatory function for cd4 t cells after in vitro co - culture of haematopoietic progenitors , precursors or even dc above splenic stroma [ 3335 ] . indeed , evidence that splenic stromal cells support dc haematopoiesis is consistent with a central role for microenvironments in spleen in dc development [ 1 , 36 , 37 ] . subsets of murine monocytes and dc with regulatory function some authors describe dcregs that can induce the development of treg cells [ 20 , 35 ] . immature dc expressing cd45rb , isolated directly from bm or induced by culture of bm progenitors with stroma comprising a combination of fibroblastic and endothelial cells . others have described dcregs , which do not induce treg formation , but are immunosuppressive due to their production of inhibitory factors . tang et al . reported dcregs as cd11ccd11bmhc - ii dc developing when bm - derived haematopoietic stem cells ( hsc ) were cultured over a spleen endothelial stroma . these cells were derived in vitro from mature cd11cmhc - ii dc induced after culture of bm cells with gm - csf and il-4 . when cultured above a splenic stroma , they proliferated and differentiated further dependent on stroma - produced soluble tgf- and contact with fibronectin . these two dc subsets are quite distinct in terms of lineage origin , although both are regulatory in that they directly inhibit cd4 t - cell proliferation through release of nitric oxide , which interferes in the il-2 signalling pathways important in t - cell proliferation [ 33 , 34 ] . dcregs described by tang et al . also activate cd4 t cells in terms of cytokine production , but are unable to induce their proliferation . wong and rodriguez showed expansion of a cd11clocd8mhc - iiocd45rb subset of dcreg in response to infection with plasmodium yoelii , p. berghei and lps treatment . the expansion of dcreg lasted until 10 days after infection and corresponded with a drop in numbers of cdc . the dcreg population was shown to stimulate tregs , which secrete il-10 and suppress cd4 t - cell function and appear to resemble the dcreg described previously by svensson et al .. indeed , descriptions and mode of action of dcreg differ , and the challenge for immu - nologists now is to reconcile cells identified by in vitro studies , with in vivo subsets , and to determine the in vivo conditions that favour one cell type over another . recently , myeloid suppressor cells ( msc ) were described that have a cd11bcd11cgr-1 phenotype , and so bear some phenotypic relationship with monocytes and myeloid dc . this cell type has been described in several mouse models and in association with a variety of disease states . the exact phenotype and mechanism of action of msc appears to vary with cell location and the disease state of the host , so it is possible that different subsets of this cell type exist , although they generally reflect inflammatory monocytes . , describe a cd11bgr-1 cell type , which is expanded in tumour - bearing mice . these cells up - regulate arginase ( arg1 ) and nitric oxide synthase ( nos2 ) activity in response to ifn- and il-13 , leading to an environment containing reactive nitric oxide species and depleted levels of l - argi - nine . this results in t - cell apoptosis , impaired proliferation and failure of t cells to express functional antigen - specific tcr . other groups report cells that act through either arg1 or nos2 [ 40 , 41 ] . msc reported in mice that have undergone traumatic stress like surgery , are cd11bgr-1 myeloid cells with up - regulated arg1 activity , and are found in spleen in close proximity to t - cell zones . , , develop from bm cells cultured with gm - csf and resemble cd11bly-6cly-6 g monocytes . these become suppressive in the presence of ifn- and appear to require cell - cell contact and nos2 activity to achieve this effect . a subset of cd11bly-6cly-6 g msc that resemble monocytes have also been described by zhu et al .. these were observed in the neural tissue of experimental autoimmune encephalitis ( eae)-immu - nized mice . they can up - regulate both arg1 and nos2 in response to a variety of cytokines , including ifn- and il-4 , so suppressing t cells in a mechanism initiated by cell - cell contact . recently weber et al . described type ii monocytes and their suppressive effect upon adoptive transfer into mice with induced experimental autoimmune encephalomye - litis ( eae ) . ameliorated disease and reduced t - cell infiltration into the central nervous system , due to production of tregs and t helper type 2 cells through increased il-10 and tgf- expression , which led to an anti - inflammatory response . differences between the myeloid cell types described by these groups could be explained by the different disease states of the mice from which they were isolated . msc differ by comparison with described dcregs in that they are associated with disease states and often appear to contribute to pathology as opposed to playing a role in immunosuppression . dendritic cells are emerging as a highly versatile cell type that displays plasticity in response to environmental factors . several theories have been proposed regarding the subsets of cells involved in these two processes . most of the well - described steady - state dc have tolerogenic capacity as immature cells , but can become immunogenic upon maturation / activation in the presence of a danger signal . tolerance mediated by these cells most likely involves ubiquitous self - antigens , like those released by apoptotic cells . other subsets of cells , including dcregs and msc , function to turn down an immune response under inflammatory conditions . cells like these would be important in ensuring that tolerance is maintained even when pathogens are present . increasing evidence now suggests that dc can emerge from a number of precursors and can acquire a range of immunosup - pressive or regulatory functions under different environmental triggers . msc may also have a developmental origin common with some dc and particularly diffdc , but appear to be distinct from other dcregs . our conclusion is that dcregs represent a broad class of cells , which participate in a number of ways to turn down an immune response . their role in homeostasis and switching off immune responses therefore reflects yet another immune capacity for dc , which now extends to immunostimula - tion , induction of tolerance , maintenance of peripheral tolerance and immunosuppression . | dendritic cells ( dc ) are central to the immune system because of their role in antigen presentation leading to either tolerance or immunity among cells of the adaptive immune response .
it is becoming increasingly evident that dc show extensive plasticity in terms of their origin and function , giving rise to a number of subsets represented differentially in all lymphoid organs .
this article considers the tolerogenic capacity of murine dc and draws a distinction between dc that induce tolerance in the immature state and immunity in an inflammatory context , and those that act as regulatory cells inducing immunosuppression in the presence of inflammation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dental implants are at present often the preferred treatment option in instances of missing teeth as a means to protect surrounding tissues and provide proper retention . providing oral rehabilitation with retention through implant support offers clinicians an indispensable strategy clinically in several cases . technology in this field has reached a point that has seen numerous modifications introduced to enhance implant retention and provide a suitable prosthetic loading in the shortest possible time by accelerating the rate of healing . in studies aimed at improving the osseointegration of implants , rough surfaces were found to be better than smooth surfaces with regards to enhancing the implant 's mechanical attachment to the bone . this has led to a number of different physical , chemical , and biochemical methods being developed for increasing surface roughness and improving osseointegration . among the available chemical methods , acidification has become widely accepted and is based on etching the implant surface with strong acids . this has been reported to produce micro - holes 1.52 m in size on the implant surface , which assist osseointegration by increasing the available surface for the attachment of bone tissue . physical methods include sandblasting , which involves applying abrasive ceramic particles such as alumina , titanium dioxide , and calcium phosphate ( capo4 ) via compressed air and a suitable carrier fluid . hydroxyapatite , as well as beta tricalcium phosphate and its derivatives , can also be used as an etching material to create a retentive area on the surface and offer the advantage of being biocompatible , osteoconductive , and resorbable . in the case of titanium implants , it is typically a combination of these techniques that is most frequently used to improve its surface structure . crowning techniques incorporating physical and chemical methods , such as acidification - sandblasting , and biochemical methods involving hydroxyapatite have therefore proven to be the most successful . regardless of the treatment used , it is important to ensure homogeneity over the whole surface in order to prevent varying levels of deformation in the bone - implant contact surface during implementation . success in the postoperative period is therefore highly dependent on surface properties such as the bone type , the sharpness and design of the bur used , and the groove characteristics of the implant . with this in mind , this study explores the effects of stress induced by the forces associated with d1 type implantation and observes the changes that occur in the surface of the bone and an acid - etched , sandblasted implant during its removal . a total of six self - tapping implants were sourced from three different manufacturers , namely : implant a ( bt lock dental implants , montecchio maggiore , italy ) , implant b ( implant direct , ca , usa ) and implant c ( implance , trabzon , turkey ) . the surfaces of these implants were roughened by acidification - sandblasting using large grit particles combined with hydroxyapatite ( implant a and b ) or capo4 ( implant c ) . each implant was affixed to a d1-quality bovine tibia in accordance with the manufacturer 's instructions by first using a sterile - saline - cooled pilot drill , then twist drills matched to the diameter of the implant , to produce six implant sockets . while three of these sockets were used for implantation , with one implant from each manufacturer , the other three sockets served as controls . implantation torque in all instances was within a range of 30 to 35 ncm , and the implants were removed after primary stabilization was achieved . external parts of the bone blocks in which the sockets were located were cut by a drill at the sagittal plane under sterile saline irrigation . once this cut reached the central region of the block ( i.e. , the socket area ) , the block surfaces were separated from each other by manually applying a mild force , with a gauge being used to prevent surface deformation . in all , 12 samples were prepared : screwed implants ( n = 3 ) , nonscrewed implants ( n = 3 ) , sockets that underwent screwing and implant removal ( n = 3 ) , and sockets that were prepared only with twist drills ( n = 3 ) . after drying , these were all anodized with gold in preparation for examination of their surface by scanning electron microscopy at various magnifications to assess whether any deformation or alteration of the surface was induced . the most striking outcomes of the clinical assessment of implant and bone surfaces during scanning electron microscopy examination were obtained at 20 and 500 magnification [ figures 16 ] , which revealed that the screw configuration in the bone and all three implant types are damaged by implant removal . at 20 and 500 magnification , comparison of the surfaces of the implants that were removed with those that were not used shows compression - type deformation in implant a [ figure 2d ] , patchy micro - holes on the surface of implant b [ figure 4d ] , and the removal of bony tissue along with the screw configuration in implant c [ figure 6c ] . we can see these type of deformations on the bone surfaces which contacted with the implants a and c surfaces [ figures 2b and 6a ] . at 20 magnification , it was determined that vertical sulci present in the surface design of all the implants used caused an accumulation of bone particles [ figures 2c , 4c , and 6c ] ; nevertheless , no compression was observed . in the case of implant a , it was found that the surface of the unused control was not homogenous [ figure 1c ] and its removal produced microfractures in the bone surface [ figure 2a ] . when the screwed and removed implant surfaces structure examined under 500 magnification , on a implant 's surface sharp scratches , on b implant 's surface rounded mesh type and on c implant 's surface round particulate type deformation were investigated [ figures 2d , 4d , and 6d ] . bone surface before a implant screwing under 20 ( a ) and 500 ( b ) magnifications ; surface of unscrewed a implant under 20 ( c ) and 500 ( d ) magnifications bone surface after removal of a implant under 20 ( a ) and 500 ( b ) magnifications ; surface of a implant after screwing and removal under 20 ( c ) and 500 ( d ) magnifications bone surface before b implant screwing under 20 ( a ) and 500 ( b ) magnifications ; surface of unscrewed b implant under 20 ( c ) and 500 ( d ) magnifications bone surface after removal of b implant under 20 ( a ) and 500 ( b ) magnifications ; surface of b implant after screwing and removal under 20 ( c ) and 500 ( d ) magnifications bone surface before c implant screwing under 20 ( a ) and 500 ( b ) magnifications ; surface of unscrewed c implant under 20 ( c ) and 500 ( d ) magnifications bone surface after removal of c implant under 20 ( a ) and 500 ( b ) magnifications ; surface of c implant after screwing and removal under 20 ( c ) and 500 ( d ) magnifications although implant loss can be caused by a smooth implant surface or short implant stature , the anatomic location can also play an important role . thus , although it is important to determine surgical margins by preoperative assessment , relocation may be possible by adjusting the angle and distance immediately after implant removal if anatomical threats or inconvenient neighborhoods are detected intraoperatively . in the event that such intraoperative relocation is possible , ensuring minimal impairment of the implant surface and deformation of the bone become of great importance . the number of studies relating to the evaluation of implant surface characteristics and their modification is steadily increasing , though acidified and sandblasted surfaces still tend to be the most commonly used in clinical practice . past studies have suggested that acid - etched and sandblasted surfaces are comparable to hydroxyapatite - coated surfaces in terms of bone contact but offer the important advantage of eliminating melting , peeling , and solvent - style deformation . despite these advantages , micro - holes were found to form on the surface of implant b [ figures 3 and 4 ] , which suggests that acid - etched and sandblasted surfaces can not , in fact , provide bone contact at every point . histological examination has revealed that a higher bone - implant contact is obtained in the case of surfaces crowned with hydroxyapatite than with those subjected to acidification and sandblasting . nevertheless , surface deformation is encountered more frequently with crowned implants than with acidified and sandblasted surfaces . from the results of the present study , it is clear that some change has occurred in all of the implant groups and the bone surface after implantation and removal . a coarse grit size was used in this study for sandblasting as this is known to increase bone contact ; and yet , no difference was observed between the implants in terms of bone contact , even though capo4 sandblasting was used on implant c. it is therefore believed that the use of capo4 sandblasting may produce a harder surface morphology than hydroxyapatite sandblasting . given the limitations of this study , it can not be known for certain at what stage in the implantation and removal procedure the micro - fractures in implant a were produced ; however , it is considered that they most likely occurred during the screwing process . of the implant types tested , only implant a was to found to have an inhomogeneous surface . this is significant , as ensuring homogeneity in the surface of implants during manufacturing is important to preventing additional stress being induced in the bone during implantation . it is also worth considering that a d1-type bone was studied , with self - tapping implants clearly causing more trauma to this bone type and predisposing it to the formation of fractures . while the stress distribution in the trabecular bone occurs in a broader area during the screwing process , the stress in the cortical bone is limited to the close surrounding of the implant . however , the occurrence of microfractures did not necessarily imply compression of the bone , with bone particles being observed to collect in the grooves of the implant . as this study was focused solely on the deformation of acid - etched , sandblasted surfaces , there is still a need for follow - up work to investigate the implant surface after it is screwed into bone blocks . this could be achieved by cutting the bone at the sagittal plane , and should bring about a different point of view to that in the current literature . nevertheless , it is apparent from this study that the use of self - tapping implants in the d1-type bone can mechanically alter the implant surface , and so a tap drill may be necessary for some circumstances to protect the surface characteristics of the implant . however , it should be noted that self - tapping implants can show different results depending on the bone type . finally , if removal is required after implantation , then using an implant with a larger unit diameter in the second implantation would assist in primary stabilization . | objective : the aim of this study was to determine whether there are any changes in the surface of bone or implant structures following the removal of a screwed dental implant.materials and methods : for this , six individual samples of acid - etched and sandblasted implants from three different manufacturers implant systems were used .
they were screwed in a d1 bovine bone , and they were removed after primary stabilization . the bone and implant surfaces
are evaluated with scanning electron microscope.results:through examination of the surfaces of the bone prior to implantation and of the used and unused implant surfaces , it was found that inhomogeneity in the implant surface can cause microcracking in the bone.conclusions:this is attributed to the stress induced during the implantation of self - tapping implants and suggests that a tap drill may be required in some instances to protect the implant surface . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dermatofibrosarcoma protuberans ( dfsp ) is a rare skin sarcoma known for its indolent and low metastatic potential . recently , dfsp has been shown to be characterized by a reciprocal translocation , t(17;22)(q22;q13 ) , and a supernumerary ring chromosome derived from the translocation r(17;22 ) . the col1a1 gene is located at 17q2122 and encodes the a1 ( l ) chain of type i collagen . the pdgfb gene is located at 22q13 and encodes the b chain of the platelet - derived growth factor ( pdgf ) ligand . the fusion causes a deregulation of the pdgfb gene by deleting its exon 1 and placing it under the direct control of the col1a1 gene . this rearrangement leads to an unregulated production of the growth factor , which seems to play an important role in the development of dfsp . epidemiological studies revealed that more than 95% of dfsp present anomalies on the 17q22 and 22q13 chromosomal regions , leading to the fusion of the col1a1 and pdgfb genes [ 4 , 5 ] . in approximately 5% of cases , no col1a1-pdgfb fusion was found , suggesting that other genes might be involved in the dfsp pathogenesis . cushing 's syndrome is characterized by a chronic and excessive exposure to endogenous glucocorticoids ( gcs ) . chronic gc excess has detrimental effects on the skin , leading to atrophy and impaired wound healing . several in vitro studies have shown that gcs induce alterations in extracellular matrix homeostasis , such as collagen synthesis and the expression of matrix metalloproteinases , leading to a reduction in the collagen mass [ 8 , 9 , 10 ] . in other words , increased doses of gcs induce a catabolic phenotype in skin fibroblasts in vivo and in vitro . in this paper , we describe a patient with a rapid onset of dfsp associated with bilateral adrenalectomy for cushing 's syndrome . to our knowledge , there is no english report of dfsp associated with bilateral adrenalectomy for cushing 's syndrome . a 50-year - old japanese woman visited our outpatient clinic with a 20-year history of an asymptomatic , about 3 mm in diameter , subcutaneous nodule on her breast . one year before , this nodule rapidly enlarged after she underwent bilateral adrenalectomy for cushing 's syndrome . on her initial visit , physical examination revealed a brown - colored , elastic hard , well - demarcated nodule on the left side of her breast ( fig . an excisional biopsy showed densely packed , monomorphic , plump , spindle cells arranged in a storiform pattern in the central area of the tumor nodule and spindle cells infiltrating into the subcutis of the peripheral lesion ( fig . the tumor cells were positive for cd34 and negative for factor xiiia ( fig . 2c , d ) , sma , and s100 ( data not shown ) . based on the above - mentioned findings , we diagnosed this patient as having dfsp . interestingly , the serum levels of cortisol before and after bilateral adrenalectomy were 17.1 and 0.8 mg / dl , respectively . we excised the tumor with a 3-cm surgical margin of mammary gland tissue . a half year after surgical treatment this case is unique in suggesting an association between dfsp and cushing 's syndrome , and , to the best of our knowledge , this is the first case report of dfsp coexisting with cushing 's syndrome . gcs bind to receptors in the cytoplasm to form complexes that translocate into the nucleus to regulate downstream targets by binding to glucocorticoid response elements . previously , mahonen et al . reported that dexamethasone treatment decreased the transcription of the col1a1 gene . schoepe et al . reported that , in a skin model , the inhibition of col1a1 mrna expression correlated with the dose and type of gcs ( e.g. hydrocortisone , prednicarbate , mometasone-17-furoate , and clobetasol-17-propionate ) . thus , the increase of cortisol in cushing 's syndrome may suppress the transcription of the col1a1/pdgfb fusion gene in dfsp . in our case , the tumor mass dramatically enlarged 1 month after bilateral adrenalectomy for cushing 's syndrome , which was coincident with the sudden reduction of serum cortisol ( from 17.1 to 0.8 mg / dl ) . assessed the treatment of 25 cases of nonresectable dfsp patients with imatinib mesylate . in their report , although imatinib mesylate targets pdgf- and can be effective for dfsp , a clinical response was achieved in only 36% of cases . our present report sheds light on the suppressive effect of gcs on the development of dfsp , which could lead to therapeutic use of gcs , although in vitro studies regarding the effect of gcs on the growth of cultured dfsp are a prerequisite . | we describe a 50-year - old japanese patient with dermatofibrosarcoma protuberans ( dfsp ) rapidly growing after bilateral adrenalectomy for cushing 's syndrome that reduced the serum level of cortisol from 17.1 to 0.8 mg / dl .
it is known that glucocorticoids decrease the transcriptions of the col1a1 gene and the pdgfb gene , which is under the direct control of the col1a1 gene in most dfsp .
therefore , the hypersecretion of glucocorticoids in cushing 's syndrome might suppress the development of dfsp .
to the best of our knowledge , this is the first case of rapid growth of dfsp that may be associated with bilateral adrenalectomy for cushing 's syndrome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
progression of periodontal disease leads to periodontal bone loss with resorption of the alveolar crest and tooth mobility and it is considered one of the most prevalent oral diseases in adult population . the clinical and radiographic examinations play an important role in the diagnosis and management of the disease . the advances of digital imaging technology in dentistry have been an alternative to film - based radiography and have given new alternatives to detect periodontal bone loss4,9,10 . this technology has allowed image manipulation , such as conversion of the film - based radiographs into digitized images that can be exhibited on a monitor . the digitized images can enhance radiographic interpretation , with use of resources such as brightness and contrast control , colorization , and inversion effects that may be applied to the radiographic image9 and can be useful in evaluating bone loss and treatment efficacy9,10 . outcome measures for digitized images include direct measurement of bone height along the root surface using software . studies concerning the accuracy in the detection of bone loss with film - based and digitized images showed no differences among these two radiographic systems3,7,11 . on the other hand , when the interproximal bone loss was evaluated using the film - based and digitized methods , and the results compared with measurements during surgical procedures , the radiographic methods underestimated periodontal bone loss . among the radiographic methods , the digitized one underestimated the interproximal bone loss less than the film - based one2 . there is one published paper3 that used inverted radiographic image to compare linear radiographic measurements and measurements during surgical procedure for the interproximal bone loss and the results showed no statistically significant differences among digitized , inverted or conventional methods regarding surgical measurements . it is reasonable to assume that the early detection of periodontal bone loss should be evaluated by inverted digitized imaging using image tool software because there is a lack of studies addressing this issue . the aim of this study was to compare bone loss measurements between inverted and unprocessed digitized radiographic imaging . a total of thirty - five film - based periapical radiographs of patients suffering from moderate to advanced untreated periodontal bone loss of lower premolar and molars were selected from the department files with forty bone loss areas . the radiographs were selected on the basis of no probabilistic sampling with the selection criteria of high - quality radiographs , which present maximum sharpness , ideal contrast , and density with no metallic restorations and or proximal overlapping . the film - based radiographs were digitized with a flatbed scanner ( snapscan tpo , agfa , taiwan , china ) with a transparency and a radiograph adapter ( snapscan 1236 s , agfa , taiwan , china ) used for transilluminating the radiograph image . the digitized images were manipulated with image tool software ( image tool , san antonio , tx , usa ) using image inversion , that is , transformation of radiopaque structures into radiolucent structures and vice - versa . the images were displayed on a 15-inch and 24-bit s - vga video monitor ( sync master 500b , samsung , serebran , malaysia ) under reduced room lighting . one calibrated examiner performed all radiographic measurements , three times , from the cementoenamel junction to the most apical extension of the bone loss , in both types of image ( inverted and unprocessed ) . the reference points were marked in the images and the program calculated the distances in pixels , giving the mean and standard deviation . the results in pixels were converted into mm based on a known dimension in mm using a calibrated spatial tool ( figure 1 ) . the comparison of bone loss measurements between inverted and unprocessed digitized radiographic imaging was evaluated . intraclass correlation coefficient ( )6 was applied to verify if both types of images were reliable . the comparison of bone loss measurements between inverted and unprocessed digitized radiographic imaging was evaluated . intraclass correlation coefficient ( )6 was applied to verify if both types of images were reliable . coefficients of variation of bone loss measurements in inverted and unprocessed digitized radiographic imaging , means and standard deviations are presented in table 1 . the bone loss measurements in both types of imaging were very similar ( 6.4485 and 6.3790 ) . the intraclass correlation coefficient was highly significant ( = 0.99 ) and positive between bone loss measurements in inverted ( i ) and unprocessed ( u ) imaging ( figure 2 ) . thus , both types of imaging presented an almost perfect agreement with the same reliability in the bone loss measurements . the experimental question to be addressed in this study was whether the inverted digitized radiographic imaging provides higher efficacy than unprocessed digitized imaging . the results showed that regardless of digitized inverted imaging , there is no difference between bone loss measurements , in both types of imaging , from inverted and unprocessed digitized radiographic , which indicates that both methods presented the same reliability . although digital imaging technology in dentistry has given new options to detect periodontal bone loss4,9,10 and digitized images should enhance radiographic interpretation , the results of the present study showed no differences between manipulated imaging , such as an inversion , when comparison was made with unprocessed digitized imaging . this result might be explained by the nature of radiographic interpretation tasks , such as the linear measurement and by the examiner 's calibration , which was trained to read inverted radiographs . there are some computer programs that can be applied for digitized radiographs , allowing the manipulation of the radiographic imaging , as well as having a tool that gives linear measurements , which are commonly used for assessing periodontal bone loss2,3,9'11 . in the present study , the software of choice was image tool , which has been developed by the team from university of santo antonio ( texas , usa ) specifically for dental applications and can be easily downloaded from the internet . as far as it could be ascertained , there is no published paper using this program for detection of bone loss . studies using film - based radiographs for assessment of periodontal bone loss are common . in a number of studies comparing direct digital systems and film - based imaging , manipulated or not , related to periodontal bone loss , it has been shown that there is no difference among them1,5,8 . although we have evaluated digitized images , the results of the present study are consistent with those published elsewhere . digitized radiographic imaging for assessing periodontal bone loss has been used in previous studies3,7,12 , but no study employed image tool software and only one used digitized inverted imaging3 . however , eickholz et al.2 ( 1998 ) using a computer - assisted analysis system to assess periodontal bone loss in digitized radiographs compared to film - based radiograph , found that film - based imaging provided better quality than digitized radiograph when bone loss was evaluated . the outcomes of the present study showed that the periodontal bone loss can be measured with the same reliability using inverted digitized radiographic imaging or unprocessed digitized radiographic imaging . inverted and unprocessed digitized radiographic imaging was reliable and there was no difference in the diagnostic accuracy between these types of image in periodontal bone loss measurements . | the advances in digital imaging technology in dentistry have provided an alternative to film - based radiography and have given new options to detect periodontal bone loss .
the purpose of this study was to compare inverted and unprocessed digitized radiographic imaging in periodontal bone loss measurements .
thirty - five film - based periapical radiographs of patients suffering from moderate to advanced untreated periodontal bone loss associated to lower premolar and molars was selected from the department files , with 40 bone loss areas .
the film - based radiographs were digitized with a flatbed scanner with a transparency and radiograph adapter used for transilluminating the radiograph imaging .
digitization was performed at 600 dpi and in gray scale .
the images were digitized using image tool software by applying image inversion , that is , transformation of radiopaque structures into radiolucent structures and vice - versa .
the digital data were saved as jpeg files .
the images were displayed on a 15-inch and 24-bit video monitor under reduced room lighting .
one calibrated examiner performed all radiographic measurements , three times , from the cementoenamel junction to the most apical extension of the bone loss , in both types of image ( inverted and unprocessed ) .
brightness and contrast were adjusted according to the examiner 's individual demand .
intraclass correlation coefficient was used to compare the measurements from both types of images .
the means of radiographic measurements , in mm , for inverted and unprocessed digitized imaging were 6.4485 and 6.3790 , respectively .
the intraclass correlation coefficient was significant ( 0.99 ) the inverted and unprocessed digitized radiographic images were reliable and there was no difference in the diagnostic accuracy between these images regarding periodontal bone loss measurements . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
skeletal muscle tissues are responsible for the provision of postural control , the coordination of excitation - contraction - relaxation cycles for voluntary movements , the integration of key metabolic and biochemical pathways , and the regulation of heat homeostasis . under normal physiological conditions , hence , supramolecular protein complexes with specialized functions , structures , and connections represent a major biochemical feature of muscle fibres . an excellent example of a large protein assembly present in skeletal muscle is the dystrophin - glycoprotein complex of the sarcolemma [ 15 ] . the crucial importance of the dystrophin - associated protein complex is exemplified by the pathophysiological fact that primary genetic abnormalities in the dystrophin gene result in progressive muscle wasting diseases , such as duchenne or becker muscular dystrophy [ 68 ] . in normal muscle , the dystrophin - glycoprotein complex provides a trans - sarcolemmal linkage between the actin membrane cytoskeleton and the extracellular matrix component laminin . the subsarcolemmal dystrophin matrix and the molecular connection between the basal lamina structure and the muscle interior is believed to prevent damage to the muscle surface from potential membrane - distorting forces during contraction - relaxation cycles . in x - linked muscular dystrophy , dystrophin deficiency results in a drastic reduction of sarcolemmal glycoproteins that triggers a loss of plasmalemmal integrity . muscle fibres are more susceptible to contraction - induced injury and their lateral transmission of force is impaired . cycles of sarcolemmal microrupturing and natural membrane repair mechanisms appear to cause the introduction of ca - leak channels that in turn elevate cytosolic ca - levels and disturb ca - fluxes through the sarcoplasmic reticulum in dystrophic fibres [ 1416 ] . interestingly , a recent study on the therapeutic effect of upregulating the intramuscular heat shock protein hsp72 to ameliorate the dystrophic phenotype revealed that the serca - type ca - atpase is dysfunctional in severely dystrophic muscle . these findings strongly indicate that impaired ca - homeostasis plays a key role in x - linked muscular dystrophy . however , it is not well understood how many molecular and cellular factors are involved in the overall process leading to the highly complex pathology of dystrophinopathy . thus , in order to determine the hierarchy of secondary pathobiochemical effects that render a dystrophic muscle more susceptible to necrosis , it is crucial to elucidate global alterations due to the disintegration of the dystrophin - glycoprotein complex . mass - spectrometry - based proteomics suggests itself as a suitable analytical tool for such large - scale and high - throughput approaches to study the effects of dystrophin deficiency . in contrast to hypothesis - based and targeted bioresearch , proteomics can be considered an unbiased and technology - driven approach for the comprehensive cataloging of entire protein complements [ 1921 ] . skeletal muscle proteomics in particular is concerned with the global identification and detailed cataloguing of the protein constituents of voluntary contractile fibres in health and disease [ 2224 ] . in the long term , comparative proteomics promises to be instrumental for the establishment of comprehensive biomarker signatures of myogenesis , muscle repair mechanisms , physiological adaptations and pathological changes , as well as the natural aging process . most gel electrophoresis - based proteomic studies use high - resolution two - dimensional gel electrophoresis in combination with advanced mass spectrometric analysis for the unequivocal identification of muscle proteins of interest [ 2729 ] . in the case of x - linked muscular dystrophy , a variety of mass spectrometric investigations have attempted to determine proteome - wide changes in dystrophin - deficient muscle tissue in order to establish a dystrophy - specific biomarker signature [ 30 , 31 ] . large - scale proteomic profiling studies have included investigations of serum [ 32 , 33 ] , cardiac muscle [ 34 , 35 ] , and various skeletal muscle tissues [ 16 , 3643 ] from the mdx mouse model of duchenne muscular dystrophy , as well as a proteomic analysis of dystrophic grmd dog skeletal muscle . although the findings from individual studies do not agree on the exact number and extent of protein alterations within the dystrophic muscle proteome , all investigations concur that dystrophin - deficient fibres exhibit a generally perturbed protein expression pattern . previous gel electrophoresis - based proteomic profiling studies of dystrophic samples have focused on the cytosolic fraction from 1 , 3 , and 6 months old hind limb muscle covering a pi range of 47 and using coomassie and silver - staining methods [ 36 , 37 ] , crude extracts from gastrocnemius muscle from 9 weeks old hind limb tissue covering a pi range of 310 and using stains - all labeling , preparations from 6 weeks old gastrocnemius muscle covering a pi range of 310 and using fluorescence 2d - dige labeling , crude extracts from 9 weeks old diaphragm tissue covering a pi range of 310 and using hot coomassie staining , crude extracts from 9 weeks old diaphragm muscle covering a pi range of 310 and using fluorescence 2d - dige labeling , crude extracts from 10 weeks old antisense oligomer - treated diaphragm tissue covering a pi range of 310 and using 2d - dige labeling , crude extracts from 9 weeks old extraocular muscle covering a pi range of 310 and using fluorescence 2d - dige labeling , and crude extracts from aged diaphragm muscle covering a pi range of 310 and using fluorescence rubps labeling . in analogy to the above - outlined proteomic studies , this report has focused on aged tibialis anterior muscle from dystrophic mdx mice . the tibialis anterior is one of the most active lower leg muscles , which exhibits a relatively high degree of resistance to fatigue during periods of intense running , making it an interesting contractile system to study with respect to secondary effects of dystrophinopathy . in addition , previous experimental gene therapy studies have focused on mdx tibialis anterior muscle . labeling of proteins with fluorescent dyes has been extensively applied in proteomic investigations and we have used here fluorescent rubps staining for a comparative proteomic survey of dystrophic leg muscle from 8 weeks , 12 months , and 22 months old mdx mice . the densitometric analysis of two - dimensional gels , covering a pi range of 310 , in combination with mass spectrometry identified significant age - related changes in carbonic anhydrase , aldolase , electron transferring flavoprotein , pyruvate kinase , myosin , tropomyosin , and the small heat shock protein hsp27 in dystrophic mdx tibialis anterior muscle . materials and electrophoresis - grade chemicals for the proteomic analysis of muscle proteins were purchased from amersham biosciences / ge healthcare , little chalfont , buckinghamshire , uk . for protein digestion , sequencing grade - modified trypsin was obtained from promega ( madison , wi , usa ) . chemiluminescence substrate and primary antibodies were obtained from vision biosystems novocastra , newcastle upon tyne , uk ( mab ncl - b - dg to the dystrophin - associated glycoprotein -dystroglycan ) and abcam , cambridge , uk ( ab54913 to the ca3 isoform of carbonic anhydrase ; and ab12351 to the small heat shock protein hsp27 ) . all other chemicals used were of analytical grade and purchased from sigma chemical company , dorset , uk . the mdx mouse is an established model system of x - linked muscular dystrophy and widely used in basic research and for the evaluation of novel therapeutic options to treat diseases of progressive skeletal muscle wasting . the mdx mouse is a naturally occurring mutant that is missing the dp427 protein isoform of the membrane cytoskeletal protein dystrophin due to a point mutation in the dmd gene . in analogy to the etiology of patients suffering from duchenne muscular dystrophy , deficiency in full - length dystrophin results in a drastic reduction of all dystrophin - associated glycoproteins in mdx skeletal muscle , making it a suitable animal model for studying secondary pathobiochemical changes due to dystrophin deficiency . dystrophic tibialis anterior muscle from 8 weeks , 12 months , and 22 months old mdx mice and normal tissues from age - matched c57 mice were obtained from the bioresource unit of the university of bonn . mice were kept under standard conditions and all procedures were performed in accordance with german guidelines on the use of animals for scientific experiments . animals were sacrificed by cervical dislocation and muscle tissues quickly removed and quick - frozen in liquid nitrogen . for the mass spectrometry - based proteomic survey of aged mdx skeletal muscle tissue , tibialis anterior specimens were shipped to ireland on dry ice and stored at 80c prior to usage . in order to obtain muscle protein extracts , 4 dystrophic muscle specimens from each age group were pulverized by grinding tissue pieces in liquid nitrogen using a mortar and pestle . ground muscle powder was solubilized in lysis buffer with the ratio of 100 mg wet weight to 1 ml lysis buffer ( 7 m urea , 2 m thiourea , 4% chaps , 2% ipg buffer ph 310 , 2% ( w / v ) dtt ) . to prevent excess protein degradation , following gentle rocking for 30 minutes , suspensions were centrifuged at 4c for 20 min at 20,000 g and the protein concentration determined . for the separation of muscle proteins , standard two - dimensional gel electrophoresis was carried out by previously optimized methodology using first dimension isoelectric focusing with ph 310 strips , and second dimension slab gel electrophoresis with 500 g protein per gel . twelve slab gels were run in parallel at 0.5 w / gel for 60 min and then 15 w / gel until the blue dye front had disappeared from the bottom of the gel . postelectrophoretic staining for the total protein profile was performed with the fluorescent dye ruthenium ii tris bathophenanthroline disulfonate ( rubps ) . as described previously by rabilloud and colleagues , a stock solution of rubps dye was prepared . following washing twice for 5 min , gels were stained for 6 hours in 20% ( v / v ) ethanol containing 200 nm of ruthenium chelate . gels were re - equilibrated twice for 10 min in distilled water prior to imaging . fluorescently labelled proteins from aged mdx tibialis anterior muscle were visualised using a typhoon trio variable mode imager . gel analysis was performed with progenesis 2d analysis software and protein spots with significantly altered expression levels were identified by mass spectrometry . protein identification was performed with 2d protein spots from coomassie - stained pick gels , following counter - staining of rubps - labelled analytical gels . excised protein spots were treated by standardized in - gel tryptic digestion for the generation of representative peptide mixtures . excision , washing , destaining , and treatment with sequencing - grade trypsin were performed by a previously optimized method . further recovery was achieved by adding 30% acetonitrile/0.2% trifluoroacetic acid to the gel plugs for 10 min at 37c with gentle agitation . samples were dried through vacuum centrifugation and concentrated peptide fractions were then suspended in mass spectrometry - grade distilled water and 0.1% formic acid , spun down through spin filters and added to lc - ms vials for identification by ion trap lc - ms analysis . the mass spectrometric analysis of peptides was carried out with a model 6340 ion trap lc / ms apparatus from agilent technologies ( santa clara , ca , usa ) . separation of peptides was performed with a nanoflow aglient 1200 series system equipped with a zorbax 300sb c18 analytical reversed phase column using hplc - chip technology . mobile phases used were a : 0.1% formic acid , b : 50% acetonitrile and 0.1% formic acid . samples were loaded into the enrichment part of the chip at a capillary flow rate set to 4 l / min with a mix of solvent a and solvent b at a ratio of 19 : 1 . tryptic digests were eluted with a linear gradient of 5% to 70% solvent b over 6 min , 70% to 100% solvent b over 1 min , 100% to 5% over 1 min . a 5 min post - time of solvent a was used to remove any potential carry over . the capillary voltage was set to 2000 v. the flow and temperature of the drying gas were 4l / min and 300c , respectively . database searches were carried out with mascot ms / ms ion search ( matrix science , london , uk ; ncbi database , release 20100212 ) . all searches used mus musculus as taxonomic category and the following parameters : ( 1 ) two missed cleavages by trypsin , ( 2 ) mass tolerance of precursor ions 2.5 da and product ions 0.7 da , ( 3 ) carboxymethylated cysteins fixed modification , ( 4 ) oxidation of methionine as variable modifiaction , ( 5 ) percentage coverage was set at over 10% , and ( 6 ) at least 2 matched distinct peptides . all pi - values and molecular masses of identified proteins were compared to the relative position of their corresponding 2d spots on analytical slab gels . one - dimensional immunoblotting was employed to verify key findings from the proteomic profiling of aged mdx tibialis anterior muscle . gel electrophoretic separation and transfer was carried out with a mini - protean ii electrophoresis and transfer system from biorad laboratories ( hemel - hempstead , herts , uk ) . muscle proteins were transferred to nitrocellulose for 70 minutes at 100 v and at 4c . blocking of membranes was achieved with a milk protein solution ( 5% ( w / v ) fat - free milk powder in 0.9% ( w / v ) nacl , 50 mm sodium phosphate , ph 7.4 ) for 1 hour . nitrocellulose sheets were washed and then incubated for 1 hour with secondary peroxidase - conjugated antibodies , diluted in blocking solution . immunodecorated bands were visualized using chemiluminescence substrate ( roche diagnostics , mannheim , germany ) . prior to the proteomic analysis of differently aged dystrophic tibialis anterior muscle preparations , the protein complement from extracts of normal muscle samples was gel electrophoretically separated and key proteins identified by mass spectrometry . this procedure established a select number of reliable landmark protein spots of a typical proteomic muscle map for control purposes . figure 1 shows a representative fluorescent rubps - labelled gel with the electrophoretically separated protein spot pattern of normal mouse tibialis anterior muscle . major 2d protein spots were treated by in - gel digestion and the most abundant constituent of this area of the gel identified by mass spectrometry . table 1 lists the names of identified muscle marker proteins , their international accession number , pi - values , their relative molecular masses , number of matched peptide sequences , percentage sequence coverage , and mascot scores . identified proteins ranged in molecular mass from 17.1 kda ( spot 22 , myoglobin ) to 70.7 kda ( spot 2 , unknown protein ) , and covered a pi - range from pi 4.6 ( spot 20 , myosin light chain mlc3 ) to pi 8.7 ( spot 15 , fast troponin subunit tni ) . spots 1 to 22 represent major muscle - associated protein species with apparent molecular mass to isoelectric point ratios of 57 kda / pi 5.2 , 71 kda / pi 5.8 , 59 kda / pi 6.7 , 47 kda / pi 6.7 , 43 kda / pi 6.6 , 40 kda / pi 5.8 , 33 kda / pi 4.7 , 33 kda / pi 4.7 , 37 kda / pi 6.2 , 40 kda / pi 8.3 , 36 kda / pi 8.4 , 30 kda / pi 6.9 , 23 kda / pi 5.6 , 23 kda / pi 5.6 , 22 kda / pi 8.7 , 23 kda / pi 5.7 , 21 kda / pi 5.0 , 19 kda / pi 4.8 , 19 kda / pi 4.8 , 19 kda / pi 4.6 , 12 kda / pi 5.0 , and 17 kda / pi 7.1 , respectively ( figure 1 ) . electrospray ionization mass spectrometry identified these marker proteins as isoforms of mitochondrial atp synthase , pyruvate kinase , enolase , creatine kinase , actin , tropomyosin , malate dehydrogenase , aldolase , glyceraldehyde-3-phosphate dehydrogenase , carbonic anhydrase , triosephosphate isomerase , troponin , adenylate kinase , parvalbumin , myoglobin , and various myosin light chains ( table 1 ) . following the optimization and initial mass spectrometric identification of muscle marker proteins in normal mouse tibialis anterior muscle , fluorescence high - resolution two - dimensional gel electrophoresis was employed to detect potential differences in aging - related protein expression patterns in mdx tibialis anterior muscle . figure 2 summarizes analytical gels with 4 biological repeats of 8 weeks , 12 months , and 22 months old total mdx muscle extracts . panels ta mdx 1 to 4 , ta mdx 5 to 8 and ta mdx 9 to 12 represent 8 weeks , 12 months , and 22 months old muscle preparations , respectively . since the overall 2d spot patterns of normal versus dystrophic tibialis anterior muscle were relatively comparable , a detailed denitometric analysis was carried out in order to evaluate potential differences in individual protein species . densitometric scanning was performed with a typhoon trio variable imager and progenesis 2d analysis software was used to establish differential expression patterns during muscle aging . the detailed proteomic survey of dystrophic tibialis anterior revealed distinct age - related changes in 8 muscle protein species between 8 weeks and 22 months old total mdx muscle preparations . a representative fluorescent 2d master gel of mdx tibialis anterior muscle is shown in figure 3 . as compared to a recent study on senescent mdx diaphragm muscle , which showed drastic age - dependent changes in 11 proteins in this severely necrotic tissue , the more mildly affected mdx tibialis anterior muscle showed less pronounced proteome - wide changes during the aging process . this finding agrees with the differing pathology of mdx leg muscle versus mdx diaphragm muscle . skeletal muscle proteins that exhibited significant alterations in expression levels are marked by circles and are numbered 1 to 8 in the 2d gel representing the urea - soluble proteome from mdx tibialis anterior muscle . besides listing the names of identified proteins , their accession number , pi - values , their relative molecular masses , the number of matched peptide sequences , percentage sequence coverage , and ms / ms scores , this table also shows the fold change of individual proteins affected in dystrophin - deficient mdx tibialis anterior muscle during aging . proteins species with a changed concentration in mdx tibialis anterior muscle ranged in molecular mass from 23 kda ( heat shock protein hsp27 ) to 224 kda ( myosin 3 ) and covered a pi - range from pi 4.7 ( tropomyosin ) to pi 8.5 ( electron transferring flavoprotein ) . an increased abundance was shown for the ca3 isoform of carbonic anhydrase ( spots 1 and 4 ) , the glycolytic enzyme aldolase ( spot 2 ) , and electron transferring flavoprotein ( spot 3 ) . the key cytosolic enzyme pyruvate kinase ( spot 5 ) , myosin 3 ( spot 6 ) , tropomyosin ( spot 7 ) , and the molecular chaperone hsp27 ( spot 8) were found to be decreased in mdx tissue . following the mass spectrometric establishment of age - related changes in the urea - soluble mdx tibialis anterior muscle proteome , immunoblotting was used to investigate the concentration of the two most extensively changed new markers ca3 and hsp27 in normal versus dystrophic preparations . antibodies to the dystrophin - associated glycoprotein -dystroglycan ( -dg ) , which forms the main trans - sarcolemmal linker between the extracellular matrix and the cortical actin cytoskeleton in the fibre periphery , were employed to verify the dystrophic status of mdx tissue samples during aging . figure 4(a ) illustrates the drastic reduction of -dg in both 8 weeks and 22 months old mdx tibialis anterior muscle , which is characteristic of dystrophinopathy . equal loading of lanes was ensured by silver staining of gel electrophoretically separated protein preparations ( not shown ) . immunoblotting of young versus old muscle samples with antibodies to the ca3 isoform of carbonic anhydrase ( figure 4(b ) ) and the molecular chaperone hsp27 ( figure 4(c ) ) showed an increased abundance of the metabolic enzyme and a decreased concentration of the small heat shock protein in dystrophin - deficient muscle . thus , both the fibre type - specific protein ca3 and the stress protein hsp27 represent suitable candidate biomarkers of the dystrophic phenotype . duchenne muscular dystrophy is one of the most crippling neuromuscular disorders of childhood , therefore warranting detailed large - scale studies into the establishment of comprehensive biomarker signatures of dystrophinopathy [ 30 , 31 ] . in dystrophinopathy , the almost complete absence of the dp427 isoform of the membrane cytoskeletal protein dystrophin causes a drastic reduction of a large number of surface glycoproteins that in turn triggers a loss of sarcolemmal integrity . the mdx mouse is a widely used model system for the evaluation of novel treatment options to counter - act the symptoms of x - linked muscular dystrophy and basic biomedical research promises to provide the basis of evidence for the development of novel treatment regimes , such as stem cell therapy , myoblast transfer , or exon skipping therapy . previous proteomic studies have established a considerable number of novel biomarkers of secondary changes in dystrophin - deficient organisms . besides the cataloging of generally perturbed protein expression patterns , individual proteomic surveys of mdx muscles of differing subtype and age have demonstrated a drastically altered abundance of adenylate kinase isoform ak1 , the luminal ca - binding protein calsequestrin of the terminal cisternae [ 16 , 41 ] , the cytosolic ca - buffering element regucalcin , mitochondrial isocitrate dehydrogenase , and the muscle - specific molecular chaperone cvhsp [ 40 , 41 ] . a recent aging study of the severely dystrophic mdx diaphragm has demonstrated a drastic increase in the extracellular matrix proteins collagen and dermatopontin , the molecular chaperone b - crystallin , and the intermediate filament protein vimentin , suggesting increased accumulation of connective tissue , an enhanced cellular stress response and compensatory stabilization of the weakened membrane cytoskeleton in severely dystrophic muscle tissue . in the present report , proteomic profiling showed that during the natural aging of the moderately dystrophic tibialis anterior muscle a number of key skeletal muscle proteins change in abundance . we have studied aged mdx muscle , because dystrophic mouse muscle tissue progressively deteriorates with age and thus more closely resembles the neuromuscular pathology seen in duchenne patients . the age - related pathogenesis of mdx muscle is characterized by a drastic loss of myofibres and concomitant replacement by connective tissue [ 6264 ] , progressive motor weakness , the presence of branched fibres that trigger mechanical weakening of the muscle periphery , a reduced life span and increased susceptibility to spontaneous rhabdomyosarcoma , a decline in regenerative potential and alterations in the crucial mtor signaling pathway , and impaired functional and structural recovery after injury . hence , senescent mdx muscle represents a suitable dystrophic phenotype for determining potential global changes in the protein complement during aging . this report has summarized the findings of a comparative proteomic analysis of mildly affected mdx tibialis anterior muscle from 8 weeks versus 22 months old mice . the identification of aldolase , pyruvate kinase , carbonic anhydrase , tropomyosin , myosin , electron transferring flavoprotein and small heat shock protein hsp27 as new indicators of progressive muscular dystrophy might be useful for the establishment of a more comprehensive biomarker signature of dystrophinopathy . the protein with the highest age - related increase was identified as carbonic anhydrase isoform ca3 . in general , carbonic anhydrases catalyze the reversible hydration of co2 and are widely distributed throughout the body . skeletal muscles express several isoforms of this crucial metabolic enzyme in a fibre - type - specific manner . the predominant ca3 isoform is mostly present in the cytosolic fraction of type i and iia fibers . interestingly , metabolic adaptations , altered neuromuscular activity patterns , stretch - induced hypertrophy , and disuse atrophy greatly influence the expression of muscle carbonic anhydrases [ 7173 ] . the higher concentration of the ca3 isoform of carbonic anhydrase in aged mdx muscle , as shown here by mass spectrometry - based proteomics , could be an indication of an increased demand for efficient co2 removal during mdx fibre aging . on the other hand , since the ca3 isoform is predominantly located in slower - twitching fibre populations , its altered density could also be due to age - related fibre - type shifting in the mdx tibialis anterior muscle . this would agree with the findings of a recent proteomic survey of middle aged versus aged vastus lateralis muscle , which revealed increased levels of ca3 in senescent human skeletal muscle . the greatest reduction in a muscle - associated protein during aging of the mdx tibialis anterior was shown to be the small heat shock protein hsp27 . this indicates a potentially blunted cellular stress response in dystrophic tibialis anterior fibres and demonstrates that marked differences exist with respect to expression levels of small heat shock proteins in moderately affected hind limb muscles versus severely dystrophic diaphragm muscle in the mdx model of dystrophinopathy [ 40 , 41 ] . while changes in elements of the contractile apparatus suggest downstream effects of dystrophin deficiency on myosin and tropomyosin organization , altered expression levels in electron transferring flavoprotein and glycolytic enzymes indicate perturbed mdx muscle metabolism . the beta - polypeptide chain of the electron transferring flavoprotein is involved in mitochondrial fatty acid and amino acid catabolism and the enzymes aldolase and pyruvate kinase catalyze the reversible break - down of fructose-1,6-biphosphate into dihydroxyacetone phosphate and glyceraldehyde-3-phosphate and the critical oxidoreduction - phosphorylation step that converts adp and phosphoenolpyruvate to atp and pyruvate , respectively . alterations in glycolytic enzymes and mitochondrial proteins in mdx tibialis anterior muscle indicate altered flux rates through key metabolic pathway . with respect to the glycolytic pathway , the activity of four muscle proteins is central to its regulation on the enzymatic level , i.e. the metabolic flux through hexokinase , phosphofructokinase , glycogen phosphorylase , and pyruvate kinase , whereby metabolic silencing of muscle glycolysis is probably mediated by the inactivation of pyruvate kinase . this central role of pyruvate kinase in muscle metabolism makes its changed abundance in the mdx tibialis anterior muscle a crucial finding . pyruvate kinase was previously shown to be a suitable biomarker of the general aging process in skeletal muscle tissues [ 77 , 78 ] . interestingly , the change of metabolic enzymes in aged mdx tibialis anterior muscle , such as pyruvate kinase and aldolase , agrees with the proteomic analysis of golden retriever muscular dystrophy . in the grmd dog model of dystrophinopathy , targets of the transcriptional control factor of energy metabolism pgc-1 , that is , various glycolytic and oxidative enzymes , were found to be reduced . in conclusion , the comparative proteomic survey of dystrophic tibialis anterior muscle from 8 weeks versus 22 months old mdx mice has revealed altered expression levels in a number of critical proteins during skeletal muscle aging . however , the degree of concentration changes was less pronounced in the moderately dystrophic tibialis anterior muscle as compared to the recently analyzed aged mdx diaphragm . these differing proteomic findings agree with the pathophysiological concept that the aged mdx diaphragm muscle is more severely affected as compared to moderately necrotic mdx hind limb muscle . in the long - term , the proteomic identification of new biomarkers of dystrophinopathy might be useful for the establishment of a comprehensive and muscle subtype - specific signature of duchenne muscular dystrophy . this would be useful for improving diagnostic procedures , monitor disease progression , identify novel therapeutic targets and aid in the evaluation of novel treatments , such as exon - skipping therapy or stem cell therapy . | x - linked muscular dystrophy is a highly progressive disease of childhood and characterized by primary genetic abnormalities in the dystrophin gene .
senescent mdx specimens were used for a large - scale survey of potential age - related alterations in the dystrophic phenotype , because the established mdx animal model of dystrophinopathy exhibits progressive deterioration of muscle tissue with age .
since the mdx tibialis anterior muscle is a frequently used model system in muscular dystrophy research , we employed this particular muscle to determine global changes in the dystrophic skeletal muscle proteome .
the comparison of mdx mice aged 8 weeks versus 22 months by mass - spectrometry - based proteomics revealed altered expression levels in 8 distinct protein species .
increased levels were shown for carbonic anhydrase , aldolase , and electron transferring flavoprotein , while the expressions of pyruvate kinase , myosin , tropomyosin , and the small heat shock protein hsp27 were found to be reduced in aged muscle .
immunoblotting confirmed age - dependent changes in the density of key muscle proteins in mdx muscle .
thus , segmental necrosis in mdx tibialis anterior muscle appears to trigger age - related protein perturbations due to dystrophin deficiency .
the identification of novel indicators of progressive muscular dystrophy might be useful for the establishment of a muscle subtype - specific biomarker signature of dystrophinopathy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
darier disease is a rare autosomal dominant inherited genodermatosis with onset around puberty , characterized by yellow to brown , oily keratotic papules and plaques primarily affecting the seborrheic areas of the face and chest . the disorder may show different clinical manifestations , such as palmoplantar pits and nail abnormalities . in this report we describe a flare - up of darier disease during treatment with interferon--2a ( ifn-2a ) . after excision and sentinel node biopsy of an amelanotic malignant melanoma located on the left lower leg , with a breslow tumor thickness of 3.5 mm , our 48-year - old female patient was treated with subcutaneous injections of 3 million international units of ifn-2a thrice weekly . the therapy was initially well tolerated . the patient had been diagnosed in puberty with darier disease , affecting her face and sternum . since then she had had almost yearly disease flare - ups , especially at the beginning of the summer period . one month after the initiation of ifn-2a treatment the patient presented with an exacerbation of darier disease , with multiple , disseminated , erythematous and brownish , partly follicular , hyperkeratotic papules on the trunk and extremities accompanied by severe itching ( fig . 1 ) . some of the skin lesions , especially on the lower extremities , showed a glossy and lichenoid form ( fig . we discontinued ifn-2a treatment and the patient was admitted to our inpatient department for further diagnostic investigation and therapy . the epidermis showed irregular hyperplasia and partly significant suprabasal acantholysis with dyskeratotic keratinocytes ( fig . close to these areas a dense subepidermal , band - like , lymphocytic infiltration under a narrow epidermis was observed ( fig . a biopsy from another skin lesion demonstrated compact orthohyperkeratosis , acanthotic epidermis with scattered suprabasal areas with acantholysis and dyskeratosis . oral antihistaminics and external application of steroids , urea and polidocanol improved both the skin lesions and itching . as we had ruled out drug eruption , we continued the treatment with ifn-2a at the same dose , and the patient was further monitored in the context of postsurgical tumor follow - up . despite the initial improvement of the lesions , they did not heal and persisted during the therapy with ifn-2a . darier disease , also known as dyskeratosis follicularis or darier - white disease , is a rare autosomal dominant inherited skin disorder which usually becomes apparent in the second decade of life . mutations in the atp2a2 gene , encoding serca2 , a calcium pump of the sarco-/endoplasmic reticulum , are responsible for the disorder . . however , the mechanism by which decreased activity of the serca2 calcium pump leads to these changes is still under investigation . mechanical trauma , heat , humidity , ultraviolet b radiation and oral corticosteroids are known trigger factors of the disease . moreover , lithium is a recognized exacerbating factor of darier disease . suggested that lithium exacerbates the symptoms of darier disease through reducing the epidermal levels of serca2 to a critical point , promoting the acantholytic and other histologic disturbances of the disorder . diltiazem has also been reported to worsen the disease , acting possibly on the same axis with the gene defect of the disorder . our patient had flare - ups of the disease in the face and chest almost every year at the beginning of the summer period , but this flare - up came extremely early , with a remarkable , unexpected manifestation on the extremities , partly with lesions that resembled lichen nitidus . lichen nitidus is a rare skin eruption characterized by multiple , small , discrete , glistening , flesh - colored papules that may occur anywhere in the skin . due to this fulminant course of the eruption , we suspected ifn as a possible trigger . to our knowledge dry skin , itching , mild hair loss and induction or exacerbation of psoriasis vulgaris are known cutaneous side effects of ifn. there are reports of flare - up of psoriasis vulgaris after starting ifn therapy for several diseases . the pathogenetic interpretation of these findings is difficult due to the lack of a convincing etiologic concept . in order to understand the mechanism of such an association it induces immune activation through enhancement of interleukin-22 ( il-22)-producing t cells and provides the interface between immune activation and epidermal remodeling by increasing keratinocyte responsiveness to il-1 . . demonstrated that ifn strengthens the responsiveness of epidermal keratinocytes to il-22 , an important mediator in the pathogenesis of psoriasis , via increased il-22 receptor expression . it is also known that ifn activates the jak - stat pathway , whose cytokine components play a crucial role in common skin disorders , including psoriasis vulgaris and atopic dermatitis [ 9 , 10 ] . however , whether ifn really worsens the course of darier disease remains unclear . | darier disease / dyskeratosis follicularis is a genodermatosis characterized by brown , oily keratotic papules and plaques in the seborrheic areas of the face and chest .
responsible for the disease are mutations in the atp2a2 gene , encoding serca2 , a calcium pump of the sarco-/endoplasmic reticulum .
mechanical trauma , heat , humidity , ultraviolet b radiation , oral corticosteroids and lithium are known trigger factors of the disorder .
we report on a 48-year - old german woman with a flare - up of darier disease under interferon--2a ( ifn-2a ) therapy with clinical signs of lichen nitidus . due to the fulminant course of the eruption , we suspected ifn as a possible trigger .
to our knowledge there are no reports regarding exacerbation of darier disease during ifn therapy .
possible pathogenetic mechanisms are being discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in a recent issue of critical care , elliott and colleagues reported important results from the very first evaluation of a post - icu home - based rehabilitation program . this very rigorous study of an explicit intervention that included a self - instruction exercise manual , trainer visits , and telephone follow - up had minimal loss to follow - up and excellent internal validity . the authors demonstrated successful random assignment of their study sample at 1 week post - hospital discharge and successful application of their 8-week home - based rehabilitation program . both control and intervention groups had important reductions in functional status prior to the institution of the rehabilitation program , and both groups had meaningful improvements in functional and quality - of - life measures at the end of the study . however , there was no statistically significant improvement in functional outcome associated with the study intervention at 26 weeks of follow - up . over the past decade , a rich literature cataloguing the diversity of physical and neuropsychological disabilities sustained by patients and families after critical illness has emerged [ 2 - 8 ] . the findings of icu - acquired weakness and cognitive and mood disorders are prevalent and robust across different study samples . there has been enormous enthusiasm about the potential to intervene in and ameliorate aspects of this documented spectrum of disability both during and after the icu stay . interventions to date have included icu rehabilitation programs , early mobility interventions such as daily awakening and recognition and treatment for delirium [ 11 - 14 ] , an icu diary intervention , a nurse - led follow - up program , and a self - directed manual for rehabilitation . only the icu diary intervention and self - directed rehabilitation manual intervention have demonstrated a longer - term benefit . there has been no evaluation of the impact of a home - based post - icu rehabilitation program to date . current impediments to the progress of designing rehabilitation programs after icu discharge include uncertainties about which patients require specific intervention or have rehabilitation potential ; the timing , intensity , duration , and nature of the application of an intervention ; and which specific outcome measures should be used to capture benefit . the study by elliott and colleagues was a very well - designed and well - executed intervention . so why was there no incremental benefit observed from this home - based rehabilitation program ? perhaps some insight resides in a better understanding of who was recruited to this post - icu intervention , their risk for disability , and the outcome metrics used in this trial . as a start , the nature of the study sample may help shed some light on these results . study inclusion and exclusion criteria may have played an important part here since only patients discharged home with or without a carer were included in this intervention . it is possible that this selected for those who had less perceived limitation at the time of hospital discharge or more functional reserve and those who may have had less need for formal rehabilitation or programmed assistance . perhaps there is a band of patients within the group typically referred for inpatient rehabilitation who would significantly benefit from outpatient , home - based intervention such as the exercise program in this study . currently , however , we need to better understand the clinical criteria and decision making surrounding stratification for inpatient versus outpatient rehabilitation , work on making those criteria explicit , understand different tiers of function , and evaluate these in the context of early rehabilitation programs . through the selection for a more debilitated sample or at least a broader spectrum of disability in post - icu patients , it is possible that benefit may be realized with home - based programs and inpatient care resources in addition , the patients in this study were mechanically ventilated for a relatively brief period of time and may not have had well - established and clinically important icu - acquired weakness . also , data on premorbid functional status , burden of comorbid illness , and the presence / nature of early mobility or icu - based rehabilitation programs or other relevant icu - based practice patterns , including exposure to corticosteroids and paralytics , in this study sample would have been very helpful to further inform risk , risk modifiers , and rehabilitation potential . we are still in the process of refining what the appropriate outcome measures should be for rehabilitation studies , their responsiveness over time , and ability to capture specific morbidities . although 6-minute walk distance and physical component summary ( pcs ) of the 36-item short - form health survey ( sf-36 ) were clearly compromised in this study and improved over time , these may not have been sensitive or specific metrics to capture the subtlety of improvement in muscle weakness in this more resilient patient sample . the predominant questions for the pcs subscore relate to the extent to which health limits physical activity or work , the perceived intensity of pain , and a personal evaluation of health . it is possible that the patients did not perceive these things to be that different between groups . however , there are many other morbidities of critical illness that are well documented in other studies - not measured as part of this protocol - that may have been responsive to this intervention . it is possible that early vigorous exercise may have altered the prevalence of mood or cognitive disorders , the nature of health - care utilization , and its cost over the study period or beyond and possibly even had an indirect benefit to the caregiver . it is also plausible that the patients and caregivers may have been able to articulate specific improvements from the intervention within the context of a qualitative interview . elliott and colleagues should be commended on this outstanding effort , and perhaps their protocol did make an important difference in the lives of these patients and their carers . before we discard this work as another negative study , we need to reevaluate how we select our study samples in terms of who may benefit most from this intervention and perhaps embrace the notion of measuring multiple outcomes across physical , neuropsychological , and caregiver domains to understand more fully the complex impact of a single rehabilitation intervention . | post - icu morbidity is an important issue for patients , families , and the health - care system .
elliott and colleagues outlined the results from their novel report of the very first home - based physiotherapy program to be tested in survivors of critical illness .
the authors described an explicit intervention , which included a self - instruction exercise manual , trainer visits , and telephone follow - up , with excellent internal validity and yet no difference in outcome measures at 26-week follow - up .
these results are discussed in the context of risk stratification / individual tailoring of post - icu programs to patient and family needs and suggest that the collection of multiple simultaneous outcome measures across functional , neuropsychological , caregiver , and health - care utilization domains may offer additional insight into the benefits of post - rehabilitation programs . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.