text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
neuroendocrine tumours are rare and have been reported to arise in a number of structures within the head and neck . to date only four cases of small cell / high - grade neuroendocrine tumour of the tongue have been reported [ 14 ] . a 55-year - old caucasian lady initially presented to her general practitioner with a 2-month history of a non - tender , firm lump and odynophagia in the right side of her neck . fine needle aspiration biopsy showed a small cell carcinoma . on further examination she had a 1.5 cm diameter mass on the right lateral posterior tongue and palpable lymph nodes in the right level 2 area . her only comorbidity is type 2 diabetes . on imaging with computed tomography ( ct ) of the neck and chest , an asymmetrically enhancing soft tissue mass was seen in the right glossotonsillar sulcus , with associated ipsilateral right - sided level 2a lymphadenopathy ( fig . 1 ) . positron emission tomography ( pet ) demonstrated hypermetabolism in the right glossotonsillar sulcus , which was consistent with the primary site and evidence of distant metastases ( fig . 2 ) . the patient was reviewed in the head and neck clinic and was staged on imaging as t1 n2b m0 . figure 1:ct showing a primary tumour in the right glossotonsillar sulcus ( black arrow ) and lymphadenopathy ( white arrow ) . ct showing a primary tumour in the right glossotonsillar sulcus ( black arrow ) and lymphadenopathy ( white arrow ) . the patient subsequently underwent a partial right hemiglossectomy and right - sided modified radical neck dissection ( fig . macroscopically , the primary site showed an ulcerating tumour 18 by 14 mm at its posterior end . microscopically , the tumour extended 7 mm into the underlying skeletal muscle and showed malignant cells with frequent mitoses and apoptotic necrosis . there was no evidence of lympovascular invasion , but multiple foci of perineural invasion was present ( fig . furthermore , there was an involvement of four out of six ipsilateral lymph nodes at level 2a/3 . on immunoperoxidase staining the tumour was strongly positive for cd 56 and positive for chromogranin , synaptophysin , pan cytokeratin , cam 5.2 and ttf-1 ( fig . these features were consistent with a high - grade neuroendocrine carcinoma .
figure 3:macroscopic specimen of the primary tumour on the posterior aspect of the right side of the tongue . figure 4:(top left ) section through superior aspect , illustrating surface ulceration and normal adjacent squamous cells . ( bottom left ) high - power view of carcinoma , illustrating hyperchromatic nuclei with variable cytoplasm and apoptosis . figure 5:(top left ) histopathology demonstrating positive cd 56 , ( top right ) chromogranin , ( bottom left ) cam 5.2 and ( bottom right ) synaptophysin . macroscopic specimen of the primary tumour on the posterior aspect of the right side of the tongue . ( top left ) section through superior aspect , illustrating surface ulceration and normal adjacent squamous cells . ( bottom left ) high - power view of carcinoma , illustrating hyperchromatic nuclei with variable cytoplasm and apoptosis . ( top left ) histopathology demonstrating positive cd 56 , ( top right ) chromogranin , ( bottom left ) cam 5.2 and ( bottom right ) synaptophysin . the larynx is the most common site for primary neuroendocrine tumour in the head and neck region ; however , it represents < 0.5% of all primary laryngeal malignancies . there is very limited literature on neuroendocrine tumours of the oral cavity and , thus , some ambiguity arises with respect to classification . to date , there have been only four cases in the literature of a primary small cell neuroendocrine tumour of the tongue . hence , the following discussion is based on neuroendocrine neoplasms of the larynx [ 14 ] . the world health organization classification divides neuroendocrine carcinoma of the larynx into five categories , namely : typical carcinoma , atypical carcinoma , small cell carcinoma , combined cell carcinoma and paraganglioma . our patient had a high - grade neuroendocrine carcinoma on histology , which is synonymous with poorly differentiated , small cell or grade iii neuroendocrine tumour . on light microscopy , poorly differentiated neuroendocrine tumours are characterized by a high mitotic count ( > 1020 mitoses per 10 high - power field in extrapulmonary sites ) and extensive necrotic material . the role of staging in small cell neuroendocrine tumours is less clear and has not been shown to correlate well with overall survival . our patient had metastases to ipsilateral lymph nodes at the time of diagnosis , but no evidence of metastatic disease elsewhere . other single - centre institutions have reported cervical adenopathy in 80% of patients at the time of diagnosis . the treatment modalities for high - grade neuroendocrine tumours of the head and neck consist of a combination of surgery , radiotherapy and chemotherapy . in our case , yoshida et al . treated their patient with radiotherapy only , due to the patient 's poor general condition , whereas khurana et al . and all three patients demonstrated an excellent initial response with complete resolution of the tumour . in both patients receiving combined chemotherapy , however , there were severe complications including mucositis , necessitating a peg tube , and neutropenia . there was documented tumour recurrence in only one patient treated with combination therapy , who remained stable with further chemotherapy . review articles of neuroendocrine tumours of the larynx have shown that surgical excision alone does not significantly improve local control and should be avoided even for early lesions . radiotherapy alone has displayed some success in tumour control at the primary site , but did not improve survival . chemotherapy , however , when used in combination with radiotherapy has been shown to significantly improve survival and platinum - based chemotherapy is proving to be the most efficacious . overall , the prognosis of small cell neuroendocrine tumour of the head and neck remains very poor , with progression to metastatic disease in the majority of cases . the reported median survival times for tumours of the larynx range from 9.8 to 14 months . an early study by baugh et al . reported comparative medial survival rates of up to 19 months in those who received chemotherapy , compared with 11 months in those who did not receive any chemotherapy . it is generally recognized that poor response to chemotherapy is an important poor prognostic factor . in a small case series of 12 patients by hautom et al . , there was a suggestion that the site of the primary tumour may also be of prognostic value . small cell neuroendocrine tumours of the salivary glands ( parotid / tonsil ) had better overall median survival ( 30 months ) versus those arising from other head and neck sites ( 15.2 months ) . in conclusion , neuroendocrine carcinomas of the head and neck are a rare entity and this makes it difficult to conduct high - quality studies to define the optimal treatment of such cancers . therefore , until favourable prognostic indicators can be established , neuroendocrine carcinomas of the head and neck will continue to have a poor prognosis . | neuroendocrine tumours are rare and have been reported to arise in a number of structures within the head and neck .
we present the case of a 55-year - old lady who presented a t1-n2-m0 neuroendocrine tumour of the tongue and right level 2a lymphadenopathy .
the patient underwent a partial right - sided glossectomy and a modified radical neck dissection . given the rarity of small cell neuroendocrine tumours of the tongue , there is some ambiguity with respect to classification .
treatment for neuroendocrine tumours is most effective with a multimodality approach and a poor response to chemotherapy is an important prognostic indicator .
radiotherapy , combined with chemotherapy , has shown the most promise with complete resolution of the primary tumour and metastatic disease . due to the rarity of neuroendocrine tumours and the lack of favourable prognostic indicators
, defining optimal treatment remains difficult . as a result
, they continue to have a poor overall prognosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the muscular damage is described as a condition which results in exhaustion , fatigue , loss
of power and pain after heavy exercises1 . this is
termed as micro trauma , micro injury or muscular damage in the literature2 . different type of exercises cause pain in
different degree and they have different effects on the muscular damage3 . strenuous and unaccustomed exercise can induce skeletal
muscle damage and this is particularly true of exercise including eccentric contraction4 . although muscular damage is closely related
to the intensity of the exercise , unfamiliar exercises can cause muscular damage
frequently5,6,7 . increased activity of ck and ldh may occur in serum in healthy subjects after exercising
and serves as a marker of injury to skeletal muscle , where the degree of biochemical
abnormality reflects the extent of tissue injury . due to the nature of the orienteering
competitions which take place on both flat and rough surfaces ( downwards and uphill ) the
muscles downwards the muscles are mainly subjected to eccentric contraction which cause more
muscular damage compared with the runs on flat surfaces where the muscles are subjected to
both eccentric and concentric contractions8 . athletes loose water and electrolyte by sweat and consume a lot of energy during training
and competition periods . the loss of even 2% of liquid as a result of training or a mild
dehydration may cause a significant decrease in their performance . as the body is
dehydrated , the blood volume and the amount of sweat formation decrease and body temperature
increases . in order to compensate this excessive temperature , the body needs to work much
harder to support the blood circulation and produce more sweat . the loss of essential
electrolytes of sodium and potassium salts causes complications such as muscle cramps ,
fatigue and exhaustion and headaches . by the help of appropriate drink , the sports drinks were developed
to replace the liquid , electrolyte and energy lost during the training period . the isotonic
drink quickly replaces the liquid lost by sweat and provides carbohydrate needed9 . based on all this information , the aim of
the study is to determine the effects of the intake of the isotonic sports drink on the
level of the skeletal muscle damage of orienteering athletes . the study was practiced on 21 male elite orienteering athletes who had at least two years
of sporting life . the participants are divided into two groups as the experimental ( n=11 )
and placebo group ( n=10 ) ( table 1table 1.the physical properties of placebo and experimental groupsgroupsage ( years)body height ( cm)body weight ( kg)bmi ( kg / m)body fat percentage ( % ) placebo15.7 2.2161.8 8.050.0 6.719.0 1.516.6 7.1experimental15.4 2.2160.1 9.648.4 7.118.8 1.615.5 7.7 ) . four different 15 cc venous blood samples were taken from the athletes
pre - competition ( pre - c ) , post - competition ( post - c ) , 2 hours post - competition ( 2 hr post - c )
and 24 hours post - competition ( 24 hr post - c ) . the blood samples were first centrifuged at a
rate of 5,000 revolution / minute and the upper phases were transferred to eppendorf tubes and
kept at 80 c until the use . the serum levels of troponin , myoglobin were determined by
immunoassay method using original beckman coulter kits in an au2700 auto analyzer , ck and
ldh enzyme levels were assayed by calorimetric method using beckman coulter kits in an
au2700 auto analyzer . after taking their first blood samples during the resting period the first group was given the isotonic
drink ( in 500 ml water 137 kcal , 32 gr carbohydrate ( isomoltulose ) , 120 mg calcium , 248 mg
chloride , 230 mg sodium ) . the second group chosen as the placebo group was given 500 ml pure
water in dark colored bottles . since the participants were in the same camp they were
subjected to the same diet . the competition was carried out an advanced 712 km long blue
tract with a target number of 20 and an estimated completion time of 6080 minutes10 , 11 . the participants were given detailed information about the
objectives of the study in accordance to the helsinki medical declaration and they gave
their full content . this study was carried out according to the approval of non enterprising
ethical committee ( decision number of 2015/3 ) . because the volume of the samples was less than n=30 the non - parametric test was employed . the measurement carried out unrelated to the non - parametric test for comparisons between the
groups were made by using mann whitney u - test ( mann whitney u - test for independent samples ) . the comparisons between the groups were made by using wilcoxon signed rank test for paired
samples . all of variable levels were similar for both groups ( p>0.05 ) expect that it was founded
significantly different for 2 hr post - c myoglobin values ( p<0.05 ) ( table 2table 2.comparison of the serum troponin ( ng / ml ) , myoglobin ( ng / ml ) , ck ( u / l ) and ldh
( u / l ) concentrations levels at time durationsvariablegroupsprepost2 hr24 hrcompetitioncompetitionpost - competitionpost - competitiontroponin ( ng / ml)placebo0.005 0.0010.008 0.003 * 0.040 0.055 * 0.007 0.006experimental0.005 0.0020.007 0.002 * 0.038 0.034 * 0.010 0.008*myoglobin ( ng / ml)placebo30.2 13.486.9 44.9 * 73.7 20.8 * 21.99 2.3experimental 24.9 5.561.0 34.6 * 50.2 29.7 * 51.58 19.3ck ( u / l)placebo259.1 83.6348.9 155.9 * 368.3 132.5 * 285.0 89.5experimental213.1 104.5267.9 127.4 * 273.1 136.5 * 233.3 101.1ldh ( u / l)placebo222.5 27.5233.5 19.1217.2 33.3215.5 pre - c serum troponin level significantly different from post - c and 2 hr post - c values for
the placebo group ( p<0.05 ) . 2 hr troponin level significantly different from post - c and
24 hr post - c values ( p<0.05 ) . post - c and 2 hr post - c myoglobin values were higher than
pre - c serum level for the placebo group ( p<0.05 ) . 24 hr myoglobin level was found
significantly lower than post - c and 2 hr post - c values ( p<0.05 ) . pre - c serum ck level
significantly different from post - c and 2 hr post - c values for the placebo group
( p<0.05 ) . 24 hr ck level was found significantly lower than post - c and 2 hr post - c
values . there were no differences between in other values ( p>0.05 ) ( table 2 ) . pre - c serum troponin level was significantly lower than post - c , 2 hr post - c and 24 hr
post - c values for the experimental group ( p<0.05 ) . 2 hr troponin level was significantly
different from post - c and 24 hr post - c values ( p<0.05 ) . pre - c serum myoglobin level was
significantly lower than post - c and 2 hr post - c myoglobin values for the experimental group
( p<0.05 ) . pre - c serum ck level was significantly lower than post - c and 2 hr post - c ck
values for the experimental group ( p<0.05 ) . there were no differences between other
values ( p>0.05 ) ( table 2 ) . schwane et al . investigated the relation between the muscle damage and plasma activities of
ck and ldh of seven athletes the
athletes were asked to run first on a flat surface then on a surface with % 10 inclination .
following downhill running ( 57% of vo2max ) , significant delayed - onset soreness was
experienced in gluteal , quadriceps , anterior leg , and posterior leg muscles , and plasma cpk
( but not ldh ) activity was significantly increased ( 351% at 24 h ) . in contrast , following a
78% of vo2max running , no statistically significant soreness occurred in any muscle group ,
and plasma cpk and ldh activities were not elevated12 . another important factor regarding athletes the increased need of liquid and decrease in sodium intake and the
marginal insufficiency of the calcium , potassium and magnesium may result in a decline in
the performance . it is stated that the intake of drinks before , during and after the
competition within appropriate protocols would obviate the decrease in the performance of
athletes13 , 14 . the main functions of water in relation to physical activity are
to carry oxygen to tissues , hormones and nutrients as well as carbon dioxide and other
metabolic wastes ; to help regulate the level of blood ph , and to help dissipate heat14 . the water needs depend on the intensity
of the activity and thermal stress and 0.71 l / h of isotonic drink during activity should be
taken15 . the drink should contain
0.50.7 g na / l for sports of 23 hours , while na 0.71.2 g / l for ultra - endurance16 . sports drinks should hydrate and prevent
dehydration during sports activity , provide mineral salts ( mainly na and cl and p ) ; provide
carbohydrates ( hc ) increase the absorption of water by the combination of mineral salts and
sugars ( fast and slow absorption in a ratio of 3/1)14 . tested the hypothesis that calcium from the sarcoplasmic reticulum
contributes to exercise - induced muscle damage . dantrolene sodium ( dantrium ) is a muscle
relaxant that affects the flux of calcium over the sarcoplasmic membrane . rats were treated
with dantrolene sodium for a week before a 2 h run on a treadmill . the total creatine kinase
activity and isoenzyme composition in plasma were measured before and after the exercise . the treated rats showed a marked decrease ( 34% ) in exercise - induced enzyme efflux , caused by
a decrease in the muscle specific isoenzyme . while a 13-fold increase found in control rats ,
only a 6.5-fold increase in treated animals was observed . it is concluded that dantrolene
sodium protects the muscle against exercise - induced damage17 . brink et al . , studied the effect of the sports drink on the sustainability of the
performance in a tennis match on 8 tennis players . their hypothesis was that drinking sports
beverages before , during and after each tennis match would limit the decrease in physical
performance compared to conditions where the only fluid intake was water . the physical test
results for the lower limbs showed no significant differences between the groups . conversely , on the upper limbs the emg data showed greater fatigue of the triceps brachii in
the placebo condition compared to resting , while the ingestion of sports drinks attenuated
this fatigue18 . in another study , six
male volunteers exercised to exhaustion on a cycle ergometer at a workload which required
approximately 70% of vo2max . after one preliminary trial , subjects performed this exercise
test on six occasions a week . immediately before the exercise , and at 10-min intervals
throughout , subjects ingested 100 ml of one of the following : control ( no drink ) , water ,
glucose syrup , fructose syrup , glucose - fructose syrup or a dilute glucose - electrolyte
solution . each of the syrup solutions contained approximately 36 g cho per 100 ml ; the
isotonic glucose - electrolyte solution contained 4 g glucose per 100 ml . expired air samples
for determination of vo2 , respiratory exchange ratio and the rate of cho oxidation were
collected at 15-min intervals . subjects drinking the isotonic glucose - electrolyte solution exercised longer ( 90.8
( 12.4 ) min , mean ( sem ) than on the control test ( 70.2 ( 8.3 ) min ; p less than 0.05)19 . also in another study , lukaski hc emphasizes the importance of magnesium for the work
performance . acute , intense activity results in short - term increases in both urine and sweat
losses of minerals that apparently diminish during recovery in the days after exercise . states that in the athletes
given the carbon hydride and protein drink has 22% of their muscle glycogen refreshed after
40 minutes following a strenuous exercise and the replacement of the muscle glycogen after
two hours takes place 4 times faster than the athletes who take carbohydrate support
only21 . saunders et al . , reported that
the athletes given a supplement cho - p ( carbohydrate and protein ) mixture throughout the an
exhaustive cycling exercise had 83% lower ck enzyme levels at the15th hour after the
exercise compared with those who took carbon hydride only22 . some results obtained in literature also support the hypothesis of this research . for
example ; isomaltulose , for its slow rate of hydrolysis and low glycogenic index23 , and for the characteristics of fructose ,
its component , with increased fluid and solute absorption in the small intestine and
increased exogenous oxidation24 , could
improve the duration of exercise . sports drinks should : hydrate and prevent dehydration
during sports activity , provide mineral salts ( mainly na and cl and p ) ; provide
carbohydrates ( hc ) increase the absorption of water by the combination of mineral salts and
sugars ( fast and slow absorption in a ratio of 3/1 ) . for hydration to be adequate , drinks
during the competition must be isotonic ( 200320 mosm / kg water ) . during physical activity ,
in sports with a duration of less than 1 hour it is clear that the isotonic drink acutely taken before the competition has protective
effect and decreases the muscle damage incurred during competitions . although the muscle
damage of experimental group was lesser than the placebo group during the competition and
recovery period , it was not found to be significant . it is possible that the isotonic drinks
could be useful for athletes since they prevent the muscle from being damaged and increase
the stability of muscle cells by establishing the liquid and electrolyte balance of the
body . further research is needed to clarify the effect of the isotonic drinks on the cell
membrane . sports drinks should moisturize by providing minerals and carbohydrates and
increase the absorption of water with an ideal combination of salts and sugars . therefore ,
it is important to provide correct hydration - protocols before , during and after physical
activity , as well as know possible limitations of the sport . | [ purpose ] the purpose of this study was to investigate the effects of the intake of an
isotonic sports drink ( 500 ml water , 32 gr carbonhydrate , 120 mg calcium , 248 mg chloride ,
230 mg sodium ) the level of the skeletal muscle damage of orienteering athletes .
[ subjects
and methods ] the study was carried out on 21 male elite orienteering athletes .
the
athletes were divided into two groups by randomized double - blind selection .
the
experimental group ( n=11 ) was given the isotonic sports drink , while the placebo group
( n=10 ) was given 500 ml pure water .
blood samples were taken pre - competition ,
post - competition , 2 hours post - competition and 24 hours post - competition .
[ results ] the
pre - c troponin , myoglobin and creatinine kinase serum levels of the placebo group were
significantly lower than the post - competition and 2 hours post - competition values .
the 24
hours post - competition levels of the same analyses were also significantly lower than the
post - c and 2 hours post - competition .
the pre - competition troponin , myoglobin and
creatinine kinase levels of the experimental group were found to be significantly lower
than the post - competition , 2 hours post - competition 24 hours post - competition values . in
conclusion
, the present results suggest that the intake of supportive sports drinks before
exercising significantly prevents the observed muscle damage .
the study showed that serum
myoglobin levels between the experimental and the placebo group is significantly different
during the 2 hours post - competition period .
[ conclusion ] the level of serum creatinine
kinase and myoglobin accurately shows the extent of the muscle damage . however , further
studies on the effect of isotonic sports drink in different training programs on the cell
membrane and the muscle damage are needed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the intensity of pain can be reported by patients on a scale from 0 to 10 . the numeric rating scale ( nrs ) is a well - studied method of measuring both acute and chronic pain , has been validated by several investigators , and is widely used to measure pain in clinical practice and in clinical studies.13 the nrs has some practical limitations in a clinical setting . there is no clear evidence about its optimal cut points , and it requires the patient s ability to understand the abstract concept of the nrs.4 therefore , it can hardly be used in end - of - life care situations , when many patients are not fully conscious and pain is a very common symptom . in this setting , decisions about the intensity of analgesic therapy and judgments regarding its efficacy are usually based on interpretation of possibly pain - related symptoms by clinical impression . therefore , it would be desirable to have a tool to measure pain intensity and analgesia - induced reduction in pain intensity without active contribution by the patient . the expert working group on pain of the european association of palliative care discourages inclusion of these patients in interventional pain studies but recommends the development of alternative ways to diagnose pain.5 the aim of our study was to investigate the autonomic nervous system ( ans ) as a predictor of response to analgesic treatment by measuring heart rate variability ( hrv ) . jeanne et al used hrv measurement to diagnose pain during general anesthesia in patients undergoing surgery . they found that the high - frequency ( hf ) power of hrv reflecting parasympathetic ( vagal ) activity decreased in a sensitive , reproducible way in patients under general anesthesia when light sedation was used . therefore , the authors speculated that hrv might be useful for monitoring the adequacy of analgesia during anesthesia.6 this has led to the development of an analgesia / nociception index , which might help to anticipate analgesic response.7 similar results associating hrv with pain have been obtained in patients with irritable bowel syndrome,8 in patients with pain who are undergoing physiotherapy9 and in postoperative pain,10 occupational pain,11 and experimentally induced pain in healthy volunteers.12 in the latter two studies , nociception was concomitant with an increase in low frequency ( lf ) , reflecting both sympathetic and parasympathetic ( vagal ) and an increase in log lf / hf , indicating overall balance between sympathetic and parasympathetic ( vagal ) activities . these data suggest a possible role for these parameters in monitoring and measuring pain reduction during opioid treatment of patients with advanced cancer . the study admitted ten consecutive patients ( aged > 18 years ) with terminal cancer who were admitted to the palliative - care unit for treatment of uncontrolled pain , were capable of giving informed consent , had a baseline opioid therapy for cancer - related pain , had previous episodes of cancer breakthrough pain ( cbtp ) , and were judged by the recruiting physician to be able to complete the study diary . the study used a portable 5-point electrocardiogram with a sampling rate of 4,000 hz to measure hrv over 1 day ( 2024 hours ) . the study excluded patients with atrial fibrillation , those taking beta blockers , those with a pacemaker , and those with heart or lung transplants , because physiologic hrv is no longer present in these conditions . the power analysis was not conducted , as the aim was to obtain preliminary data that could be used for planning definite studies . the study was approved by the ethics committee of the medical university of vienna , vienna , austria . the study analyzed the first episode of cbtp after the start of monitoring of hrv in each patient . therapy for cbtp consisted of the following opioids : buccal fentanyl , short - acting oral hydromorphone , or short - acting morphine . the decision to use any of them was made by the prescribing physician together with the patient . in the cases of hydromorphone and morphine , the dose of breakthrough pain medication was one - sixth of the total daily dose . the study monitored for changes in lf and log lf / hf in patients with opioid treatment for cbtp , which is an abrupt , short - lived , and intense pain that breaks through the sustained - released analgesia provided to control persistent pain13 and responds to treatment with opioids within minutes.14,15 pain was assessed using an nrs with a range from 0 to 10 on which 0 was defined as no pain and 10 was defined as worst pain imaginable . assessments of pain by nrs were performed immediately before opioid administration for cbtp and 30 minutes afterward . in each patient , a 24-hour peak - to - peak hrv measurement with a sampling rate of 4,000 hz ( medilog ar12plus ; schiller handelsgesellschaft gmbh , linz , austria ) was performed . hf , lf , total power ( tp ) , pnn50 , log lf / hf , and heart rate were compared . to provide validity and reliability , the guidelines of the task force of the european society of cardiology and the north american society of pacing and electrophysiology were applied.16 hf is a band of power spectrum ranging from 0.15 to 0.4 hz that reflects parasympathetic ( vagal ) activity . tp is the subsumption of measurements between 0.003 and 0.4 hz and serves as a benchmark of total variability . pnn50 measures the percentage of successive inter - beat ( rr ) intervals that differ from one another by > 50 milliseconds . log lf / hf is the ratio between the power of lf and hf bands . data for hf , lf , log lf / hf , tp , heart rate , and pnn50 were obtained for the following time intervals . t 2 : 30 minutes before the start of opioid medication;t 1 : 15 minutes before the start of opioid medication;t + 1 : 1025 minutes after the start of opioid medication;t + 2 : 1045 minutes after the start of opioid medication;t + 3 : 1075 minutes after the start of opioid medication ; andt + 4 : 10135 minutes after the start of opioid medication . t 2 : 30 minutes before the start of opioid medication ; t 1 : 15 minutes before the start of opioid medication ; t + 1 : 1025 minutes after the start of opioid medication ; t + 2 : 1045 minutes after the start of opioid medication ; t + 3 : 1075 minutes after the start of opioid medication ; and t + 4 : 10135 minutes after the start of opioid medication . for metric data , the mean value , standard deviation ( sd ) , minimum ( min ) value , maximum ( max ) value , and difference between max and min ( range ) were reported , based on skewed distribution . the level of significance was set at p = 0.05 , and p - values were corrected for multiple tests after bonferroni holm test . to estimate effect sizes , pearson s correlation coefficient ( r ) was reported , based on the following ratings : 0.1 = small , 0.3 = moderate , and 0.5 = large effect size . statistical analysis was performed using the ibm statistical package for the social sciences ( spss ) version 17.0 . the study admitted ten consecutive patients ( aged > 18 years ) with terminal cancer who were admitted to the palliative - care unit for treatment of uncontrolled pain , were capable of giving informed consent , had a baseline opioid therapy for cancer - related pain , had previous episodes of cancer breakthrough pain ( cbtp ) , and were judged by the recruiting physician to be able to complete the study diary . the study used a portable 5-point electrocardiogram with a sampling rate of 4,000 hz to measure hrv over 1 day ( 2024 hours ) . the study excluded patients with atrial fibrillation , those taking beta blockers , those with a pacemaker , and those with heart or lung transplants , because physiologic hrv is no longer present in these conditions . the power analysis was not conducted , as the aim was to obtain preliminary data that could be used for planning definite studies . the study was approved by the ethics committee of the medical university of vienna , vienna , austria . the study analyzed the first episode of cbtp after the start of monitoring of hrv in each patient . therapy for cbtp consisted of the following opioids : buccal fentanyl , short - acting oral hydromorphone , or short - acting morphine . the decision to use any of them was made by the prescribing physician together with the patient . in the cases of hydromorphone and morphine , the dose of breakthrough pain medication was one - sixth of the total daily dose . the study monitored for changes in lf and log lf / hf in patients with opioid treatment for cbtp , which is an abrupt , short - lived , and intense pain that breaks through the sustained - released analgesia provided to control persistent pain13 and responds to treatment with opioids within minutes.14,15 pain was assessed using an nrs with a range from 0 to 10 on which 0 was defined as no pain and 10 was defined as worst pain imaginable . assessments of pain by nrs were performed immediately before opioid administration for cbtp and 30 minutes afterward . in each patient , a 24-hour peak - to - peak hrv measurement with a sampling rate of 4,000 hz ( medilog ar12plus ; schiller handelsgesellschaft gmbh , linz , austria ) was performed . hf , lf , total power ( tp ) , pnn50 , log lf / hf , and heart rate were compared . to provide validity and reliability , the guidelines of the task force of the european society of cardiology and the north american society of pacing and electrophysiology were applied.16 hf is a band of power spectrum ranging from 0.15 to 0.4 hz that reflects parasympathetic ( vagal ) activity . tp is the subsumption of measurements between 0.003 and 0.4 hz and serves as a benchmark of total variability . pnn50 measures the percentage of successive inter - beat ( rr ) intervals that differ from one another by > 50 milliseconds . higher parasympathetic ( vagal ) activity results in higher pnn50 values . log lf / hf is the ratio between the power of lf and hf bands . data for hf , lf , log lf / hf , tp , heart rate , and pnn50 were obtained for the following time intervals . t 2 : 30 minutes before the start of opioid medication;t 1 : 15 minutes before the start of opioid medication;t + 1 : 1025 minutes after the start of opioid medication;t + 2 : 1045 minutes after the start of opioid medication;t + 3 : 1075 minutes after the start of opioid medication ; andt + 4 : 10135 minutes after the start of opioid medication . t 2 : 30 minutes before the start of opioid medication ; t 1 : 15 minutes before the start of opioid medication ; t + 1 : 1025 minutes after the start of opioid medication ; t + 2 : 1045 minutes after the start of opioid medication ; t + 3 : 1075 minutes after the start of opioid medication ; and t + 4 : 10135 minutes after the start of opioid medication . for metric data , the mean value , standard deviation ( sd ) , minimum ( min ) value , maximum ( max ) value , and difference between max and min ( range ) were reported , based on skewed distribution . the level of significance was set at p = 0.05 , and p - values were corrected for multiple tests after bonferroni holm test . to estimate effect sizes , pearson s correlation coefficient ( r ) was reported , based on the following ratings : 0.1 = small , 0.3 = moderate , and 0.5 = large effect size . statistical analysis was performed using the ibm statistical package for the social sciences ( spss ) version 17.0 . seven patients ( three males and four females ; mean age : 62 5.2 years ) developed cbtp and were available for hrv analysis . opioids were administered in the following doses : hydromorphone 1.3 , 2.6 , and 5.2 mg and morphine 20 mg . three patients were administered rapid - acting opioids ( transbuccal fentanyl in two and transnasal fentanyl in one ) . transbuccal fentanyl was administered in a dose of 200 g and transnasal fentanyl in a dose of 100 g . pain measured by nrs was 7.4 1.3 ( mean sd ; range 6.09.0 ) before opioid administration and 5.0 1.5 ( mean sd ; range 3.07.0 ) 30 minutes thereafter ( p < 0.05 ) . there was a mean reduction in pain of 2.6 points on the patient - reported nrs . four patients had a reduction of 2 points , two patients had a reduction of 3 points , and one patient had a reduction of 4 points . the mean log lf / hf showed a nonsignificant reduction after treatment ( recording time intervals t + 2 , t + 3 , and t + 4 ; table 1 ) . other hrv - derived parameters , including hf , lf , tp , pnn50 , and heart rate , remained unchanged ( data not shown ) . a highly significant ( p < 0.05 ) positive correlation with a correlation coefficient ( r ) of > 0.700 was found between changes in nrs from t + 1 to t + 2 and changes in log lf / hf . other tested hrv - derived parameters , including hf , lf , tp , pnn50 , and heart rate , showed no significant correlation with the patient - reported changes in nrs . log lf / hf decreased in all patients who had a reduction in pain of > 2 points on the nrs ( figure 1 ) but remained unchanged in patients who had reductions of up to 2 points ( figure 2 and table 2 ) . pain measured by nrs was 7.4 1.3 ( mean sd ; range 6.09.0 ) before opioid administration and 5.0 1.5 ( mean sd ; range 3.07.0 ) 30 minutes thereafter ( p < 0.05 ) . there was a mean reduction in pain of 2.6 points on the patient - reported nrs . four patients had a reduction of 2 points , two patients had a reduction of 3 points , and one patient had a reduction of 4 points . the mean log lf / hf showed a nonsignificant reduction after treatment ( recording time intervals t + 2 , t + 3 , and t + 4 ; table 1 ) . other hrv - derived parameters , including hf , lf , tp , pnn50 , and heart rate , remained unchanged ( data not shown ) . a highly significant ( p < 0.05 ) positive correlation with a correlation coefficient ( r ) of > 0.700 was found between changes in nrs from t + 1 to t + 2 and changes in log lf / hf . other tested hrv - derived parameters , including hf , lf , tp , pnn50 , and heart rate , showed no significant correlation with the patient - reported changes in nrs . log lf / hf decreased in all patients who had a reduction in pain of > 2 points on the nrs ( figure 1 ) but remained unchanged in patients who had reductions of up to 2 points ( figure 2 and table 2 ) . the aim of the present study was to investigate the ans as a predictor of response to analgesic treatment by measuring hrv . the results suggested that pain - associated changes in the ans can be detected in palliative - care patients suffering from advanced cancer despite the fact that dysfunctions in this system in these patients have been reported , while current evidence indicates longer survival in cancer patients who have higher vagal nerve activity.1719 the results of the present study showed a decline in log lf / hf , reflecting the overall balance between sympathetic and parasympathetic activities after cbtp treatment in the group of palliative - care patients . these data are in line with the results of previous studies , which showed decreased log lf / hf after easing experimentally induced or postoperative pain.10,12 log lf / hf is the ratio between the power of lf and hf bands . it can be used to quantify the overall balance between the sympathetic and parasympathetic systems . higher log lf / hf values reflect stress - induced domination of the sympathetic system , and lower levels reflect domination of the parasympathetic system during relaxation . in the present study , reduced log lf / hf after cbtp treatment with opioids suggests relaxation of patients due to relief from pain - induced stress . this hypothesis is supported by the fact that opioid treatment of cbtp resulted in a median reduction in pain of 2.6 points on the patient - reported nrs . a similar amount of pain reduction following treatment was observed in several intervention studies on cbtp.14,15 1 ) it did not define a standardized protocol , and physicians were able to choose short- or rapid - acting opioids based on clinical impression . we believe that this limitation is acceptable because our intention was to objectify treatment response to various formulations of opioids . 3 ) this was a hypothesis - generating study , and a larger , confirmatory study is needed . the strengths of the present study are that it tested our research hypothesis in a small sample size to limit resource expenditure and that measuring hrv is a feasible , noninvasive tool . the findings suggest a causal relationship between patient - reported pain and log lf / hf after cbtp treatment . therefore , if our results can be substantiated in a larger trial , log lf / hf might be an ideal hrv - derived parameter to monitor opioid - induced pain relief , even in unconscious patients . in a previous pilot study with healthy volunteers , otherwise , in the 62 patients undergoing general anesthesia , nervous system - stimulating effects differed while the influence of various sedatives on hrv was being studied.20,21 therefore , this topic warrants further investigation . it is interesting to note that patients with a reduction of > 2 points on the nrs had a clear decline in their log lf / hf , while the log lf / hf remained more or less unchanged in patients who had a decline in nrs of only 2 points . this might reflect a cut point of ans before it reacts to pain relief , but this needs to be investigated in further studies . concerning dyspnea , a 1-point reduction in nrs has been deemed a minimally clinically important difference and has been used to define a response to palliative treatment in randomized controlled trials.2224 this pilot study indicated that measuring hrv might provide data about analgesic response , even in unconscious patients . it is a noninvasive tool that can be ethically applied in patients suffering from advanced illnesses . data from this preliminary study showed that the ans of patients with advanced cancer reacted to opioid - induced relief of cbtp in a way that might allow pain detection without active contribution from patients . | backgrounddecisions on the intensity of analgesic therapy and judgments regarding its efficacy are difficult at the end of life , when many patients are not fully conscious and pain is a very common symptom . in healthy individuals and in postoperative settings , nociception and subsequent pain relief have been shown to induce changes in the autonomic nervous system ( ans ) , which can be detected by measuring heart rate variability ( hrv).objectivesthe changes in the ans were studied by measuring hrv during opioid therapy for cancer breakthrough pain ( cbtp ) in palliative - care patients with cancer and compared these changes with patient - reported pain levels on a numeric rating scale ( nrs).patients and methodsthe study included ten patients with advanced cancer and baseline opioid therapy . in each patient , a 24-hour peak - to - peak hrv measurement with a sampling rate of 4,000 hz was performed .
high frequency ( hf ) , low frequency ( lf ) , total power , pnn50 ( indicating parasympathetic activity ) , and log lf / hf were obtained in two intervals prior to therapy and in four intervals thereafter .
intensity of cbtp was recorded using a patient - reported nrs prior to therapy and 30 minutes afterward.resultscbtp occurred in seven patients ( three males and four females ; mean age : 62 5.2 years ) and was treated with opioids .
a highly significant positive correlation was found between opioid - induced reduction in patient - reported pain intensity based on nrs and changes in log lf / hf ( r > 0.700 ; p < 0.05 ) .
log lf / hf decreased in patients who had a reduction in pain of > 2 points on the nrs but remained unchanged in the other patients.conclusionour data suggest that log lf / hf may be a useful surrogate marker for alleviation of cbtp in patients with advanced cancer and might allow detection of pain without active contribution from patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
microarray and next - generation sequencing ( rna - seq ) technologies enable researchers to study any genomewide transcriptome at coordinated and varying stages . since biological processes are time varying , they may be best described by time series gene expression rather than by a static gene expression analysis . acknowledging the nature of genes that are involved in dynamic biological processes ( e.g. , developmental processes , mechanisms of cell cycle regulation , etc . ) has potential to provide insight into the complex associations between genes that are involved . in fact , the functionality of genes can be inferred if their expression patterns , or profiles , are similar to genes of known function . there are published clustering methods that include into the analysis the duration of the experimental stages , or the staged dependence structure of gene expression . the results from these approaches are certainly more informative and realistic than groupings that are gained from static clustering methods ( i.e. , clustering at a single - staged experimental point ) , but their results are limited in interpretation . the seminal work from luan and li is a good example of a clustering application that takes the time dependent nature of genes into account . more realistic , though , is the fact that some biological processes typically start and end at identifiable stages , or time points , and that the genes in a process may be dynamically regulated at different stages of the biological process . in other words , genes can be coregulated over a finite series of points ( i.e. , only a portion of points represent the total when the transcriptome is being sampled ) . a variety of subspace clustering methodologies have attempted to address the time - dependent nature of transcriptome experiments through biclustering , or plaid models . although these bicluster ( i.e. , clusters obtained by any subspace clustering method are referred to as biclusters from this point forward ) approaches are popular , they have limitations . for example , madeira and oliveira discretized real - valued gene expression data as upregulated , downregulated , and unchanged according to the slope of expression change from one time point to the next . they then rely on string processing techniques to develop an algorithm that identifies contiguous column coherent biclusters . alternatively , zhang et al . alter original expression data by deleting and inserting border time points , and then use an algorithm based on a mean squared residue score to cluster the modified expression data . we are motivated by the fact that the genes involved in the biclusters that are obtained by [ 8 , 9 ] have the same starting and ending time point(s ) . even though it is well known that time lags exist for many genes that are involved in the same biological process and that genes with the same function may give rise to unique expression patterns / profiles , to our knowledge this information has not been incorporated into any statistical approach for clustering . ji and tan focus on extracting time - lagged gene clusters known as q - clusters , where q is the time length of a bicluster ( i.e. , the number of consecutive time points in the bicluster ) , that can have different time lengths , but genes in the same cluster must have the same durations over time , even though time lags exist among the genes . proposed to use a wavelet - based cluster method to detect time shift / delay situation . to our knowledge , none of the current or existing subspace clustering methodologies is able to provide biclusters that are varying in their duration of time length . we know that standard exploratory clustering methods are useful for grouping items that behave in a similar fashion . however , when these standard approaches are applied to experiments that evaluate the transcriptome over coordinated experimental stages , they fail to acknowledge the dynamic nature of such processes . as such , this work focuses on the dynamic and nonconsistent nature of gene activity ( figure 1 ) . although presented here in the context of coordinated transcriptome data , this novel dynamic clustering approach is applicable to a vast range of sequential data scenarios where the order of the series is of interest . specifically , there may be discontinuities ( e.g. , a gene may enter or exit a biological process at any time point ) , or more generally , a time - varying spectral frequency in nonstationary or piecewise stationary time series ( i.e. , signal ) that can be studied using techniques and theories from signal decomposition . time series and signal are used exchangeable from this point forward . once decomposed , the components can be quantified based on their constrained coherency ( coco , details in the section 2.2 ) and gathered via an agglomerative hierarchical clustering that involves determining the number of clusters and separating signal from noise . for a nonstationary time series , time - frequency analysis is usually employed to map one - dimensional time series onto a two - dimensional time - frequency domain so that both the frequency and time information can be considered [ 12 , 13 ] . addison justifies the continuous wavelet transformation ( cwt ) based time - frequency analysis and states that it has many benefits over other time - frequency representations of multiple - component signals ( i.e. , signals that contain multiple frequencies ) or signals with discontinuities in frequency . we assume that even though a gene may be expressed multiple times in a time series , it may also be involved in multiple biological processes , and therefore multiple spectral components need to be considered . toward this end , we employ cwt to decompose gene expression signals , s(t ) :
( 1)w(b , a)=1as(t)(tba)dt ,
where (t ) is the mother wavelet , a is the scale parameter , b is the shift parameter , and the morlet wavelet is employed . the significant frequency values and their associated starting and ending time points for an expression signal , s(t ) = ( s1 , s2 , , sn ) , are determined as follows.perform a continuous wavelet transformation ( cwt ) on the time series s(t ) . generate a white noise time series w(t ) = ( w1 , w2 , , wn ) , where wi 's are distributed as n(0, ) , where is the variance of the time series s(t).perform a cwt on the white noise time series from step 2 and obtain the time - frequency representation . repeat steps 2 - 3 m times ( usually , m 1000 ) . for each frequency f at each time point t , the 95th percentile of m modulus serves as the threshold . perform a continuous wavelet transformation ( cwt ) on the time series s(t ) . generate a white noise time series w(t ) = ( w1 , w2 , , wn ) , where wi 's are distributed as n(0, ) , where is the variance of the time series s(t ) . perform a cwt on the white noise time series from step 2 and obtain the time - frequency representation . repeat steps 2 - 3 m times ( usually , m 1000 ) . for each frequency f at each time point t , the 95th percentile of m modulus serves as the threshold . let w0(t , f ) represent the threshold surface calculated from white noise information , and let w(t , f ) represent the cwt outcome of the original gene expression signal s(t ) . determining the significant components whose cwt values are above the threshold surface is equivalent to identifying the components from w :
( 2)w(t , f)=max { 0,w(t , f)w0(t , f ) } ,
where t represents time and f denotes frequency . it is worth noting that the meaningful component on the sliced cwt has some width in the frequency domain , and that a signal may contain several significant components . a crazy climber ridge extraction algorithm is employed to extract significant frequencies and their related starting and ending time points . the actual clustering ( of genes ) requires a similarity metric that measures the pairwise relationship between genes via their decomposed components . since frequency is of interest , a coherency is used . for two signals x and y , coherency is
( 3)cxy(f)=pxy2(f)pxx(f)pyy(f ) ,
where pxx(f ) and pyy(f ) are the respective power spectral densities of the two signals and pxy(f ) is their cross - spectral density . typically when calculating the coherency function between two signals , the lengths of the signals are the same . however , since the component signals may differ in length , the median length for all frequencies is used to represent a uniform time length . further , since coherency is a function of frequency , its range is from zero to half of the sampling frequency of a discrete signal ( i.e. , a continuous signal measured at discrete time points ; ) . in general , the sampling frequency , or sampling rate , is the number of time points per second as measured in hertz . given two signals with frequencies fx and fy , we use the average of the coherency function in the interval [ fx , fy ] to represent the coherency similarity and refer to it as coherency for simplicity . although it is expected that coherency will decrease as the difference between two frequencies ( from two signals ) increases , there are situations ( figure 2 ) when a nonmonotonic coherency pattern identifiable from a coherency plot exists . to ensure monotonicity , we provide a modified coherency that acknowledges that the valleys of the coherency curves are nonincreasing along the frequency differences when we construct a representative curve that is monotonic in frequency difference . although many other similarity measures can be employed ( e.g. , brownian distance measurement ) , our modification ( coco ) is data - driven and provides a constrained coherency that serves as a similarity measurement for clustering ( figure 2 ) . although the ward linkage finds compact and homogenous clusters by minimizing the variance of objects , there are two issues that we need to address : determining the number of clusters and differentiating meaningful clusters from noise clusters ( i.e. , clusters containing only noise ) . a variety of approaches have been suggested for determining the number of clusters [ 2224 ] . one well - known approach involves finding the elbow ( or , change point ) of an error curve . although others have attempted to compare the error curve of the original data to the error curve of the data generated from a null reference distribution ( i.e. , uniform distribution ) by employing the gap statistic , this approach is not applicable to overlapping clusters , nor is it appropriate for noisy data [ 24 , 25 ] . we approach the issue of determining the number of clusters by globally evaluating the merge distance plot , which is represented by the height of joint nodes in a cluster tree . a null reference distribution is able to provide a merge - distance threshold that can be compared to the original merge distance . specifically , a minimal convex set , or a convex hull , is formed based on a set of convex combinations of all points of interest . the merge distance is obtained by performing clustering on data generated from a uniform distribution from the convex hull . used a convex hull to generate randomly distributed gene expression values so that distinctions between clusters arise with statistical confidence . here , a convex hull is employed to assess the statistical significance of the merge distance of hierarchical clusters . by evaluating the merge distance globally , the number of clusters can be determined . for a set x containing n objects , { x1 , , xn } , the convex hull of x is
( 4)h(x)={i=1nixi xix,i0,i=1ni=1 } ,
where xi can be one or more dimensions . for time series gene expression data , n is the total number of decomposed components and the xi 's are the component frequencies . the following steps are used to determine the number of clusters.perform hierarchical clustering with ward linkage and coco similarity on the original data ( xi ) containing n points and obtain the merge distance set m0 = ( d2 , , dn).randomly choose n objects from the uniform distribution [ min(xi ) , max(xi ) ] . perform hierarchical clustering on the random data set from step ( 2 ) , and obtain a new merge distance set.repeat steps ( 2)-(3 ) m times ( usually m 1000 ) . for each possible number of clusters ( k , k = 2 , , n ) the 95th percentile of m merge distances , dk , serves as a threshold and the 95% threshold curve is constructed as m = ( d2 , , dn ) . compare m0 with m ; the largest k which satisfies dk > dk is the optimal number of clusters k0 . since some gene expression data can be quite noisy , an additional step in cluster validation necessitates differentiating the noise cluster from meaningful ( i.e. , significant ) clusters . perform hierarchical clustering with ward linkage and coco similarity on the original data ( xi ) containing n points and obtain the merge distance set m0 = ( d2 , , dn ) . randomly choose n objects from the uniform distribution [ min(xi ) , max(xi ) ] . perform hierarchical clustering on the random data set from step ( 2 ) , and obtain a new merge distance set . repeat steps ( 2)-(3 ) m times ( usually m 1000 ) . for each possible number of clusters ( k , k = 2 , , n ) the 95th percentile of m merge distances , dk , serves as a threshold and the 95% threshold curve is constructed as m = ( d2 , , dn ) . compare m0 with m ; the largest k which satisfies dk > dk is the optimal number of clusters k0 . the objects in a noise cluster are scattered , while the objects in a statistically significant cluster , which are similar to the tight clusters in , are dense . here , the silhouette metric , a measure of tightness and separation of clusters , is used to assess the level of statistical significance of clusters . for each object i , its silhouette width is defined as
( 5)s(i)=b(i)a(i)max { a(i),b(i ) } ,
where a(i ) is the average dissimilarity of object i to other objects in the same cluster and b(i ) is the average dissimilarity of object i to objects in its nearest neighbor cluster . the average silhouette width of objects in a cluster represents the quality of the cluster in terms of compactness and separation . the average silhouette of a noise cluster ( if it exists ) should be low , while for statistically significant clusters it should be high . when evaluating the silhouettes for k0 clusters , a uniform reference distribution is employed to generate independently located objects upon which the hierarchical clustering operates . the silhouettes are obtained for the reference data for the same cluster number k0 as follows .for k0 clusters from the original data , compute their silhouettes . randomly choose n objects from the uniform distribution on the convex hull of the frequencies of the original data.perform hierarchical clustering on data from step ( 2 ) , choose k0 clusters and obtain their silhouettes.repeat steps ( 2)-(3 ) m times ( usually m 1000 ) and obtain m sets of k0 silhouettes . for each of k0 silhouettes of the original data , calculate its p value from mk0 values . the significance level is . a cluster is significant if its p value < ; otherwise , it is noise . for k0 clusters from the original data , compute their silhouettes . randomly choose n objects from the uniform distribution on the convex hull of the frequencies of the original data . perform hierarchical clustering on data from step ( 2 ) , choose k0 clusters and obtain their silhouettes . repeat steps ( 2)-(3 ) m times ( usually m 1000 ) and obtain m sets of k0 silhouettes . for each of k0 silhouettes of the original data , calculate its p value from mk0 values . the significance level is . a cluster is significant if its p value < ; otherwise , it is noise . up to this point , we have described a two - step cluster validation that provides the number of clusters and differentiates significant clusters from a noise cluster . since a gene 's expression over time can be described in terms of frequencies and then decomposed into components that each may have unique start and stop points , the time - dependent structure of the data is retained , and the concept of a dynamic cluster evolves naturally . in anticipation of assessing the performance of the proposed dynamic clustering algorithm via simulation , we realize two further issues . first , to our knowledge , there are no clustering approaches , which provide gene sets at different ( time ) points . second , because we work from simulated data , we need a metric to compare the clusters that result from dynamic clustering with the cluster - scenario from which they were simulated . to address these issues , the proposed cluster validation algorithm objectively evaluates the quality of clustering results using information from the data ( i.e. , silhouette width ) . when prior information ( e.g. , pathway , etc . ) is available , obviously it contributes even more information upon which to base cluster validation . fortunately , this is exactly the situation for time series gene expression with time - varying frequencies ; information on both true cluster membership and true time duration for genes in clusters is available . since traditional criteria [ 32 , 33 ] only involve the true cluster membership , we provide a new criterion that takes into account both time information and cluster characteristics . assume an estimated cluster e obtained via a clustering method represents the true class c such that some genes in e differ from genes in class c in terms of the gene identification number or the gene time information . for each gene in either true class c , or estimated cluster e , consider the true time interval and estimated time interval . the discovery index for gene g in class j or cluster j is defined as
( 6)dgj = pgjqgjpgjqgj ,
where pgj denotes the true time interval and qgj denotes the estimated time interval . by this definition , specifically , when gene g appears in the class but is not detected in the corresponding cluster we have dgj = 0 since qgj = 0 ; similarly , when it is detected in the cluster but is not in the corresponding class we get dgj = 0 due to pgj = 0 . for a class it is possible to define its cluster by using all pairwise comparisons and a specified ( small ) cut - off . we can find the closest cluster ( i.e. , estimate ) for each class . specifically , if the distance between a class and its closest cluster ( i.e. , the difference between two frequency values ) is less than the predefined cutoff , then the cluster will be called its estimate . at times not all of the classes will be detected , or some cluster may be superfluous since it may not have a matching class . in these situations , the discovery indices for the genes in either that class or that cluster are all zero . finally , the overall discovery index for the genes across the corresponding clusters and classes is
( 7)d=j=1jg=1gdgjj=1joj ,
where g the number of genes , j is the maximum of the number of clusters and the number of classes , oj is the number of genes in the jth cluster or class , and dgj is the discovery index for gene g in the jth cluster or class . clearly , g=1dgj oj , so 0 d 1 . because the proposed approach includes two subprocedures , namely , time - frequency decomposition and clustering , and because the result of the first subprocedure impacts the results of the second subprocedure , a power study will be conducted on these two subprocedures separately . the power of the signal decomposition is investigated relative to the noise level , frequency level , difference between frequencies of components in a gene signal , and time lengths of components . interestingly , gene expression contains various features , for example , some genes may have one component with a certain frequency ; some genes may have two components with other frequencies ; others may have more than two components with different frequencies . we acknowledge that investigating the performance of the signal decomposition , and the proposed clustering method , for these types of data is challenging simply because it is difficult to summarize the distribution of the frequencies for multiple components from multiple genes . furthermore , the time durations of the components affect statistical power . signal decomposition is influenced by many parameters / factors , including frequency , frequency difference ( for multiple component signals ) , time length of signal , ratio of the amplitude of the components , and noise level . because of the limitation of displaying multiple factor effects simultaneously , a power study of signal decomposition on two - component signals is performed for investigating the effect of frequency , frequency difference , amplitude ratio , and noise . , the two - component signals are simulated from
( 8)s(t)=cos ( 2ft+1)+acos ( 2(f+f)t+2)+ noiseleveln(0,1 ) ,
where t is time from 0 to 10 seconds , f represents spectral frequency that varies from 0.1 hz to 1.0 hz , f denotes the frequency difference between two components ( from 0.1 hz to 1.0 hz ) , a represents the amplitude ratio between two components ( 0.5 , 0.2 , 1.0 , 2.0 , 5.0 ; the amplitude of the first component is 1 , as a baseline ) , and 1 and 2 are the phase shifts that are randomly chosen from [ 0 , 2 ] . the noise level varies from 0 to 1.0 , in increments of 0.10 . in spectral analysis , particularly in fast fourier transformations , the length of a signal is usually a power of two . we consider 64 time points that equally partition the sample space . the power of decomposing each gene expression time series is defined as
( 9)k=1cwki=1qui+j=1mvjk=1cwk ,
where i=1ui is the total time duration of the q true components ( q = 2 for the two - component signal decomposition ) , j=1vj is the total time duration of the m estimated components , and k=1wk is the total time duration of the coverlap components between the true and estimated components . for each parameter combination , the overall power of the signal decomposition is the average power for decomposing 1000 signals . figure 3 illustrates the power study of decomposing two - component signals with amplitude ratio 1.0 without noise . a larger difference between two frequencies results in greater power , and a lower frequency is more likely to be detected than a higher frequency . similar conclusions are obtained for decomposing signals with different amplitude ratios and different noise levels ( plots not shown ) . components with longer time duration are more likely to be detected than those having short time duration ( plots not shown ) . the performance of the dynamic clustering approach coupled with the proposed validation method is investigated using the discovery index , which reflects the effect of both the signal decomposition and the clustering . it is a considerable challenge to display the discovery index for a set of data across all possible combinations of parameters . fortunately , it is possible to assess the effect due to noise in the discovery index while holding the other parameter settings fixed . further , the effect of time , when other parameter settings are fixed , is also assessed . relying on the previous simulation , we use 140 simulated genes to illustrate the dynamic nature of the simulated time series . time series expression data for 140 genes in three groups are simulated as follows :
( 10)group 1=cos ( 20.1t+1)+cos ( 20.8t+2)+noiseleveln(0,1),group 2=cos ( 20.4t+3)+cos ( 20.8t+4)+ noiseleveln(0,1),group 3=cos ( 20.1t+5)+cos ( 20.4t+6)+ noiseleveln(0,1 ) .
the time t and the phase shifts j ( j = 1 , , 6 ) are simulated as in the previous power study . there are 20 , 40 , and 80 genes in groups 1 , 2 , and 3 , respectively . each gene expression profile contains two components whose frequencies are 0.1 hz , 0.4 hz , and 0.8 hz . each pair of genes from different groups shares one common component . the discovery index is calculated for each scenario , and the average discovery index - calculated for each of the 1000 simulated data sets ( table 1 ) . figure 4 illustrates single gene expression profiles with two components , 0.1 and 0.4 hz , at three different noise levels ( 0.5 , 1 , and 1.5 ) . interestingly , the discovery index is very high even though the data are moderately noisy ( i.e. , noise level 1.0 and the energy ratio from signal and noise is 1 : 1 ) . dynamic clustering using the proposed similarity metric and validation methods is able to capture meaningful information from relatively noisy data . the components in the previous simulation are simulated ( 3 ) under varying times ( 0 to 10 ) , across the entire time interval . since some genes may belong to a cluster in only a portion of a time interval ( simply because of noise ) , dynamic clusters are demonstrated using simulated data where time intervals for some components are only a portion of entire time interval . one hundred and forty genes are simulated as follows :
( 11)group 1=cos ( 20.1t+1)+n(0,0.5 ) , 0t<5=cos ( 20.1t+2)+cos ( 20.8t+3)+n(0,0.5 ) , 5t10,group 2=cos ( 20.4t+4)+cos ( 20.8t+5)+n(0,0.5 ) , 0t<5=cos ( 20.4t+6)+n(0,0.5 ) , 5t10,group 3=cos ( 20.1t+7)+n(0,0.5 ) , 0t<5=cos ( 20.1t+8)+cos ( 20.4t+9)+n(0,0.5 ) , 5t10 .
the true clusters ( i.e. , the clusters from which the 140 genes are simulated ) are illustrated in figure 5 where different colors represent different clusters . in each panel , the segmentation represents the starting and ending time points of the corresponding genes involved in that cluster . the cluster characteristics are represented by the component frequencies , 0.1 , 0.4 , and 0.8 hz , and are listed on the top of each panel . the dynamic property of the clusters is displayed in figure 6 and is visibly comparable to figure 5 ( simulation setting ) . in the ( red ) cluster with frequency 0.1 hz , all genes from group 1 and group 3 are involved during the whole time interval . for the ( green ) cluster with frequency 0.4 hz , all genes from group 2 appear in the entire interval . in this cluster , some genes from group 3 remain in the second half of the time interval and some genes are in the entire time interval . for the third ( blue ) cluster with frequency of 0.83 hz , most genes in group 1 are active in the second half interval and most genes in group 2 are active in the first half interval . figure 6 reveals that components with a lower frequency , and of long duration , are unlikely to be affected by noise during the decomposition . interestingly , the edge effect of time series is involved in the results ( figure 6 ) . specifically , the starting or ending time points for the genes in the third ( blue ) cluster may not be accurately estimated , yet they can be estimated precisely for the genes of a long duration ( e.g. , the genes in the first ( red ) cluster and genes from the second group in the second ( green ) cluster ) . although we relied on the 140 genes from our earlier simulation to demonstrate the performance of the proposed method , it is worth noting that performance improves as the number of genes increases . specifically , increasing gene number allows our algorithm to more accurately identify the noise cluster , thus separating the gene cluster(s ) of interest more precisely . while our simulation studies demonstrate that our approach is able to both capture meaningful signals from very noisy data and group them very well , we can not compare our method with existing methods simply because no information about time is contained in the clusters obtained by other methods . many microarray experiments have been conducted for the purpose of understanding complex dynamic biological processes and gene function of cell cycle ( e.g. , yeast , human fibroblasts , human cancer cell lines , and plasmodium falciparum ) [ 3740 ] . applicable here is the fact that it is essential cell - cycle genes exhibit periodic expression over time . dynamic clustering is applied to cell - cycle plasmodium falciparum ( known to cause malaria in humans ) expression data from . between the mosquito vector and human host , its genome is sequenced and has over 5,000 cell - cycle genes ; 530 of them are annotated into 14 functional groups . a more complete understanding of the life cycle and gene regulation will provide the foundation for drug and vaccine development , for example , shortening its life cycle may control transmission . most of studies on the p. falciparum data focus on either detecting periodic genes [ 41 , 42 ] or static clustering [ 43 , 44 ] . dynamic clustering is applied to the 530 gene representations measured at 46 time points spanning 48 hours during the intraerythrocytic developmental cycle ( idc ) with 1 hour time resolution for the hb3 strain . the missing data ( for time point 23 and 29 ) are imputed by the k - nearest neighbor algorithm with k = 12 . using the continuous wavelet transformation and ridge extraction , 530 time series gene expression profiles are decomposed into a set of 1,019 component signals whose the number of genes in each ( and between ) significant cluster is summarized in figure 8 . in the signal decomposition , the phase or phase shift can be obtained for each component . figure 9 summarizes genes that are ordered by the phase ( shift ) of the corresponding component . red represents high values and green denotes low values . the cluster characteristic is represented by period ( reciprocal of frequency ) . 444 genes are in the cluster with period of 31.9 hours and 528 genes are in the cluster with period of 63.8 hours . the periods of 31.9 hours and 63.8 hours are equivalent to1.5 cycles and 0.75 cycles , respectively . specifically , that the majority of the periodic gene profiles exhibit an overall expression period of 0.75~1.5 cycles in 48 hour interval . since the components contain time information ( i.e. , starting and ending time points ) , the number of genes in a cluster may vary across time . the dynamic property of clusters from the p. falciparum data can be summarized in terms of number of genes at each time point ( figure 10 ) . a nonparametric bootstrap is employed to calculate the 95% confidence interval for the statistic . hence the 95% confidence band for the curve of the number of genes is constructed by calculating the confidence intervals across all time points . as illustrated in figure 10 , the number of genes in cluster 2 varies with time while the number of genes in cluster 1 ( i.e. , the ones with longer period ) remains constant . this confirms the findings from the simulation study that genes with lower spectral frequency are more likely to be detected than those with higher frequency . apparently , multiple periods in p. falciparum data have not been studied ( i.e. , no published results ) ; therefore , the expression pattern in figure 10 may warrant further investigation . we employed the web - accessible programs david ( database for annotation , visualization and integrated discovery [ 47 , 48 ] ) and plasmodb ( plasmodium genomics resource ) for the gene ontology ( go ) analysis . in david , the go - bp fat term is used to report enrichment results , as it attempts to filter the broadest terms so that they do not overshadow the more specific terms . is the only go term that is detected as enriched ( with fdr = 8.9e 19 ) for the genes appearing in cluster 1 . the genes involved in both clusters with significant go terms are listed in table 2 . for example , we find that the processes amino acid activation and trna metabolic process this gene is involved in the glycolysis . as a point of future research , we noticed that the phase information is often used to cluster cell cycle gene expression profiles [ 35 , 44 , 51 ] . as such , a nature evolution of our approach is to employ phase information in clustering ( see section 5 ) . when the application is gene expression , methods from signal processing have proven successful in decomposing the nature of complicated time series that contain multiple component signals . a two - step cluster validation is proposed to statistically determine the optimal number of clusters and to select the statistically significant clusters . to our knowledge , there are no clustering approaches that provide unique gene sets at different time points ( i.e. , genes in the same cluster may have different starting and ending points , and even have different time durations in the cluster ) . a simulation study demonstrates the benefits of our approach by showing that it is able to capture meaningful signals and separate them , even for very noisy data . finally , we understand and acknowledge that it would be useful and encouraging to compare our method with other existing methods . unfortunately , this is not possible simply because no information about time is contained in the clusters that are obtained by other methods . time information is the critical component for both determining the clusters obtained by our method and calculating the dynamic index formula which measures the clustering performance . the proposed method focuses on clustering periodic time series by considering the spectral frequencies that are decomposed and extracted from periodic data . beyond the spectral frequency , in fact , clustering only the spectral frequency of time series may not be sufficient to understand very complicated biological processes . in other words , even though two genes involved in the same biological process have the same spectral frequencies , they may play different roles in the process . the phase relationship between genes may help understand such regulation and is a point of future research . it is worth noting that we can not change the order of studies , ( i.e. , perform a phase study first followed by a frequency study ) since genes with different spectral frequency must belong to different biological processes , and genes with different phases may or may not belong to the same process . therefore , within each cluster of spectral frequency , genes can be subclustered according to their component phases so that the gene relationship may be revealed in greater detail . genes involved in multiple biological processes ( simultaneously ) may play a major role in one process while playing a minor role in another process . since the energy of a time series is proportional to its amplitude squared , the importance of a gene in a process can be measured using the squared amplitude of its corresponding component . based on this , and due to the fact that genes may participate in different processes at different time , the dynamic importance of genes in biological processes can be established . as a point of future research , if three features of periodic time series , namely , spectral frequency , phase shift , and amplitude , are all included , as well as the time information of components , the complex dynamic biological processes may be better understood . because the proposed dynamic clustering process is time dependent , an appreciation for the number of time points that are recommended for the method is a necessary discussion . since the main feature of a periodic time series is spectral frequency , frequency detection is highly reliant on the sampling rate . therefore , the minimal or recommended number of time points is related to the nature of biological processes / clusters in which the genes are involved . according to the sampling theorem , a signal can be exactly recovered if the sampling rate is greater than twice the signal frequency . thus , if a signal has 5 cycles in one hour duration , the sampling rate must be more than 20 points in one hour . in other words , if the sampling rate is small , then a signal with high frequency can not be detected . finally , since spectral frequencies are extracted from periodic time series , the time points occur at equally spaced intervals . for periodic time series with unevenly spaced points , thus , our proposed approach is applicable , but some information may be lost due to data imputation . further , since the proposed two - stage approach ( i.e. , data preparation and dynamic clustering ) is designed for periodic data , for data that are not periodic , the signal decomposition approach is not applicable in the data preparation step . however , if some other characteristic can be defined and extracted from the nonperiodic time series , the second step of the proposed approach remains applicable . dynamic clustering is a two - step cluster validation that is able to differentiate meaningful clusters from noisy clusters . the results from our approach provide insight into the dynamic association among time - limited coexpressed genes that might otherwise go undetected by current clustering approaches . clustering and gene network inference are both known to help in predicting the biological functions of genes or unraveling the mechanisms involved in biological processes . specifically , in the gene networks , the challenge is to deal with a large number of genes , but when clustering , the clusters are assumed independent . in actuality , gene network procedures and gene clustering procedures cover each other 's shortcomings . as such , the proposed dynamic clustering has great potential for inferring gene networks , in particular , for exploring networks at the level of gene clusters . although the proposed method is motivated by and explained in the context of time series microarray data , it is a general method that is applicable to any periodic phenomena , including but not limited to seasonal data in marketing research , meteorology , and astronomy . | it is well accepted that genes are simultaneously involved in multiple biological processes and that genes are coordinated over the duration of such events .
unfortunately , clustering methodologies that group genes for the purpose of novel gene discovery fail to acknowledge the dynamic nature of biological processes and provide static clusters , even when the expression of genes is assessed across time or developmental stages . by taking advantage of techniques and theories from time frequency analysis ,
periodic gene expression profiles are dynamically clustered based on the assumption that different spectral frequencies characterize different biological processes .
a two - step cluster validation approach is proposed to statistically estimate both the optimal number of clusters and to distinguish significant clusters from noise .
the resulting clusters reveal coordinated coexpressed genes .
this novel dynamic clustering approach has broad applicability to a vast range of sequential data scenarios where the order of the series is of interest . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
people living in the present century are under the threat of death as never before due to tuberculosis ( tb ) infection associated with human immunodeficiency virus ( hiv ) infection . tb is a treatable disease but remains one of the leading causes of death , particularly among people living in resource - limited countries [ 1 , 2 ] . statistics show that at least one - third of the 34 million people living with hiv worldwide are infected with latent tb , and people coinfected with tb and hiv are 2134 times more likely to develop active tb disease than people without hiv [ 24 ] . also , the rate of mortality is much greater for patients coinfected with tb and hiv . in 2011 , over 700 000 people suffered from hiv associated with tb , of whom about 200 000 died , and the burden was greatest in sub - saharan africa [ 2 , 5 ] . as it has been proven that antiretroviral therapy ( art ) reduces both case - fatality rates and the incidence of recurrent tb , the world health organization ( who ) recommends that art be given to all hiv patients with extrapulmonary tb ( stage 4 ) and to all those with pulmonary tb ( stage 3 ) , unless the cd4 count is above 350 cells / mm . however , the combination of antiretrovirals ( arvs ) with anti - tb drugs may precipitate intolerable adverse reactions , even death , due to the additive drug toxicities and interactions [ 79 ] . therefore , initiation of art in individuals undergoing treatment for tb , or vice versa , merits special consideration . since 2005 , rwanda has experienced a generalized hiv epidemic at a rate of 3% in the adult population . the incidence of tb disease in rwanda is around 361 per 100 000 population , of which 41% are coinfected with hiv [ 11 , 12 ] . there are 161 tb clinics in rwanda and all are using who 's directly observed treatment short - course ( dots ) strategy for the management of tb disease . new cases of pulmonary tb are treated with a standardized regimen of a fixed - dose combination of rifampicin , isoniazid , pyrazinamide , and ethambutol ( rhze ) taken daily for 2 months ( intensive phase ) and then a fixed - dose combination tablet of rh administered 3 days a week for 4 months ( continuation phase ) . as recommended by who , patients with tb / hiv are eligible for art if they have a cd4 + cell count < 350 cells / mm . in different health centres or hospitals providing anti - tb medications , a rise in complications or death rates has been observed among tb / hiv patients who were on cotherapy with anti - tb / arv . these deaths or severe complications were sometimes seen within a few weeks following the initiation of art . currently , only a few pharmacovigilance studies have been conducted to assess the exact impact of combining arv with anti - tb drugs on efficacy and toxicity . this study aimed at evaluating the types of combined regimens that are used , their associated effectiveness , and the occurrence of any serious side effects in both single hiv and hiv / tb coinfected patients , already on art , when referred to a referral hospital for complications . this study is a retrospective descriptive notes - based review of a series of adults with hiv or combined hiv / tb infection hospitalized in the internal medicine service at kigali university teaching hospital ( chuk ) in rwanda . the chuk with its 500-bed capacity is the largest of the four public teaching hospitals in rwanda where some clinical trials are being conducted . in the present study , we were interested in analyzing some routine data from hiv / aids inpatients , where arv and anti - tb drugs were administered , to evaluate the effectiveness and safety of the first - line regimens applied . adult patients over 20 years of age and of both sexes , diagnosed with hiv - alone or hiv / tb coinfection and admitted between january 2012 and april 2013 , were eligible . they were admitted for other hiv - related or non - hiv - related infections , wasting syndrome or suspected tb . the hospital receives patients referred by other health centres upon treatment failure or development of complications . patients had tb proven by microscopy and smear culture and hiv proven by elisa method and western blot or pcr . according to the protocol of the hospital , patients are defined as tb - positive if at least one microbiological specimen is positive for acid - fast bacilli . the data indicated that around 86.4% and 13.6% were pulmonary and extrapulmonary tb , respectively , and the most had cryptococcus meningitis and candidiasis infection . full blood count , liver enzymes , and serum creatinine were determined at baseline and at follow - up times . when the patients ' condition deteriorated , the cause was investigated through additional diagnostic tests such as urine , stool , cerebrospinal fluid , pleural fluid and ascite analysis , blood culture , chest radiography , or abdominal ultrasound when deemed necessary by the treating physicians . an example of the methods used to diagnose , monitor , and manage patients during clinical trials at this hospital can be found elsewhere . generally , initiation of tb treatment at chuk requires assessment by at least two senior physicians from the department , experienced in tb care . during the period of hospitalization , all treatments were directly observed and administered by nurses in charge of care . according to the national protocol , patients with a new diagnosis of tb receive 6 months of antituberculous treatment consisting of 2 months of rifampicin , isoniazid , pyrazinamide , and ethambutol followed by 4 months of r and h ( 2rhze/4rh ) . in the retreatment regimen 2srhze/1rhze/5rhe , first - line art consists of two nucleoside reverse transcriptase inhibitors ( nrtis ) and a non - nucleoside reverse transcriptase inhibitor ( nnrti ; nevirapine or efavirenz ) . national guidelines recommend initiation of art for all extrapulmonary tb regardless of cd4 cell count and pulmonary tb with cd4 count < 200 cells / mm within 2 to 8 weeks after starting antituberculous treatment . in the case of pulmonary tb with cd4 counts between 200 and 350 cells / mm , initiation of art preferably , all tb patients are either switched to or started on an efavirenz - based regimen because of potential drug interactions of rifampicin with nevirapine . for this study , a data collection form was used to extract data from patient profiles , treatments received , and therapeutic outcomes . since the study was not a clinical trial , we were only interested in extracting limited useful data for measuring treatment outcomes and side effects encountered ( e.g. , age , sex , type of medication , infection status , length of hospitalization , and length of art ) . indicators for antiretroviral effectiveness and safety included changes in cd4 cells / mm , body weight , physical improvement , death rate , and aes . type and frequency of side effects patients ' files that contained many confusing data were excluded . around 180 hiv patients were retrieved and 120 dossiers comprising 60 single hiv - alone and 60 hiv / tb coinfected cases were considered for analysis . clinical outcome was defined as improved , unimproved , or dead as indicated in the patients ' notes by the treating physician . changes in weight and cd4 cell counts compared baseline values at admission and the last control values . according to the protocol in the service , an ae was defined as clinical deterioration or a new symptom occurring after the onset of treatment . the causes of aes are commonly suspected as adverse drug reactions ( adr ) , concurrent infection ( or neoplasm ) , treatment failure , paradoxical reactions , or paradoxical tb - associated immune reconstitution inflammatory syndrome ( tb - iris ) . drug - induced liver toxicity was defined as symptomatic elevation of serum transaminases ( more than three times the upper limit of normal ) and/or jaundice during therapy , after exclusion of other apparent causes . renal toxicity was defined in the same way on the basis of kidney function tests . data acquisition and analysis were carried out using spss v16 and microsoft excel 2007 software . descriptive statistics were used to describe patient demographics and clinical characteristics in terms of percentages or median values . for example , for age , we grouped patients as young ( < 40 years ) or old ( > 40 years ) . statistical cross - tabulation was used for data comparison using the chi - squared test for proportions or fisher 's exact test for dichotomous variables . it was not meaningful to use kaplan - meier estimates to evaluate the cumulative death probability as we have only been able to control baseline values and end outcomes . table 1 shows the overall comparative profile of patient demographics in the two groups . the majority of patients were females ( 62.5% versus 37.5% ) . the majority of patients were less than 40 years of age 96/120 ( 80% ) . the baseline median values and range for age , weight , and cd4 cell count were 30 and 30 ( 2058 ) years , 54 and 52 ( 3565 ) kg , and 78 and 100 ( 8280 ) cells / mm , respectively , for the two groups . indicators of efficacy retained in our study were body weight gain , cd4 cell count changes , physical improvement , and death . as shown in figure 1(a ) , the majority of patients in both groups lost weight . the majority of the hiv - alone group had increased cd4 cell counts while the same percentage of the hiv / tb group had significantly decreased cd4 cell counts ( figure 1(b ) ) . seventeen out of 120 patients ( 14.2% ) died during the period of the study ( figure 1(c ) ) . figure 2 shows the cumulative percentage of physical improvement and deaths as observed up to 90 days in the hospital . each patient was evaluated at the second week after admission and then one , two , and three months later during the days spent as inpatient . patients who could not be discharged after three months were finally declared unimproved ( 13.3% in hiv - alone and 41.6% in tb - coinfected ) while continuing treatment in the hospital .
table 2 five nucleoside reverse transcriptase inhibitors ( nrtis ) , lamivudine ( 3tc ) , tenofovir ( tdf ) , abacavir ( abc ) , zidovudine ( azt ) , and stavudine ( d4 t ) , and two nonnucleoside reverse transcriptase inhibitors ( nnrtis ) , efavirenz ( efv ) and nevirapine ( nvp ) , were used . three combinations were used in single - hiv patients and five in hiv / tb patients . the most frequently used regimen was 3tc+df+efv in 53.3% of hiv patients and 60% of hiv / tb patients , followed by the combination 3tc+tdf+nvp in 41.7% of hiv patients and 20% of hiv / tb patients . other combinations used abc , azt , and d4 t . the percentages of patients judged to be improved were 80% with 3tc+tdf+nvp and 75% with 3tc+tdf+efv . the addition of first - line anti - tb ( rhze ) to these two regimens reduced the effectiveness ( 80% versus 33.3% for nvp and 75% versus 41.7% for efv ) while doubling the death toll ( 0% versus 16.7% for nvp and 15.6% versus 27.8% for efv ) . the majority of single - hiv infected patients had increased cd4 cell counts under the two backbone regimens an 88% increase ( 22/25 ) with the 3tc+tdf+nvp regimen and a 93.8% increase ( 30/32 ) with the 3tc+tdf+efv regimen . in the hiv / tb coinfected patients , however , the majority of patients had a decreased cd4 count a 100% decrease ( 12/12 ) with the 3tc+tdf+nvp regimen and an 88.9% decrease ( 32/36 ) with the 3tc+tdf+efv regimen . the number of deaths was the highest in patients under the 3tc+tdf+efv regimen : 5/32(15.6% ) in the single - hiv infected group and 10/36(27.8% ) in the tb / hiv coinfected group . regimens without tdf resulted in no mortalities , but fewer patients or none at all were judged to be improved as seen with the azt combined regimen . table 3 shows the association between some variables and patient outcomes in the two groups . we found that gender had a significant influence in hiv / tb infected patients47.1% of females improved against 26.9% of males ; 8.8% of females died compared to 34.6% of males . the most cases of death were recorded in younger patients ( < 40 years ) regardless of the drug regimen . in 96 patients under 40 years old , there were 16 deaths while in 24 patients above 40 years of age , 2 cases of death were recorded . table 4 depicts the types and frequencies of ades experienced by patients during the treatment . the most frequent complaints found were vomiting ( 56.7% ) , asthenia ( 45% ) , headache ( 38.3% ) , ulceration ( 36.7% ) , diarrhea ( 31.7% ) , and dyspnea ( 25% ) . severe ades were hepatitis , kidney dysfunction , thrombocytopenia , and stevens - johnson syndrome . frequencies are slightly higher in the hiv / tb group than in the hiv - alone group . in table 4 , we have added potential offensive drugs commonly reported in the literature as inducing such side effects . for example , vomiting occurred in 56.7% of all patients and may be precipitated by all arvs or anti - tb drugs as the body 's reaction to the pathophysiological condition . tb and hiv affect all ages and both genders . in our study , we found that females outnumbered males in both single - hiv ( 68.3% versus 31.7% ) and hiv / tb coinfected ( 56.7% versus 43.3% ) groups and , there is evidence that women of 2024 years old are at much higher risk of hiv infection than their male peers . according to the rwanda demographic and health survey 2010 , it has been reported that young women are more likely than men to contract hiv and most of these women are between 24 and 44 years old . in sub - saharan africa , women constitute 60% of people living with hiv [ 14 , 15 ] . in developing countries in general , women are at an extreme disadvantage in terms of prevention and treatment of hiv , and one of the factors that put women most at risk is sexual violence [ 1618 ] . studies conducted in african countries have found that the first sexual experience of a girl is often forced , and during unprotected vaginal intercourse , women are more likely than men to contract hiv because hiv - infected semen has a higher viral concentration than vaginal secretions [ 19 , 20 ] . also , the gender hierarchies found within many societies contribute to the correlation of women and hiv . the number of patients aged above 50 years was very small in the hiv / tb group compared to the single - hiv group ( 26.7% versus 3.3% ) . this is an indication of the impact of coinfection on the survival rate in old persons , indicating that people coinfected with hiv / tb in africa have little chance of living over 50 years of age if infected early . the tritherapy adopted at chuk combines two nrtis plus one nnrti . in the single - hiv group , the nrtis used were tdf , 3tc , and d4 t . in the hiv / tb group , azt and abc were added to the three used in the single - hiv group . this protocol follows who guidelines which recommend two nrtis plus one nnrti in first - line hiv regimens and rhze as the backbone anti - tb . worldwide , once - daily regimens comprising a nonthymidine nrti backbone ( tdf+ftc or tdf+3tc ) and one nnrti ( efv ) are maintained as the preferred choices in adults , adolescents , and children older than 3 years [ 22 , 23 ] . our study showed that protease inhibitors such as lopinavir ( lpv ) and ritonavir ( rtv ) are not used at chuk . in developed western countries , new treatments have been introduced : atazanavir ( atv ) , darunavir ( drv ) , cobicistat ( cobi ) , elvitegravir ( evg ) , fosamprenavir ( fpv ) , emtricitabine ( ftc ) , raltegravir ( ral ) , and rilpivirine ( rpv ) . the department of health and human services ( dhhs ) recommended regimens are efv+tdf / ftc , atv / rtv+tdf / ftc , and drv / rtv+tdf / ftc . the international antiviral society - usa ( ias - usa ) recommended regimens are efv / tdf / ftc or efv+abc/3tc , atv / rtv+(tdf / ftc or abc/3tc ) , and drv / rtv+tdf / ftc . these regimens are not available in rwanda since the treatment here is low - cost or free . indicators of efficacy in our study were cd4 cell count elevation , body weight gain , physical improvement , and death rate . the majority of single - hiv patients had increased cd4 cell counts ( a median of 20% over 2 months ) while the same percentage of the hiv / tb group had significantly decreased cd4 cell counts ( p < 0.05 ) if we compare the baseline values at entry and exit time . in the literature , it has been proved that modern arvs can suppress viral load in people infected with hiv by up to 10 thousand times and can lead to significant increases in cd4 cell counts and this can be sustained for at least 7 years and probably indefinitely [ 2527 ] . the slightly increased rate in hiv / tb coinfected patients is consistent with the severity of complications in this group . the comparison of weight gain in the two groups showed that the majority of patients lost weight instead of gaining it . however , treatment of hiv infection with arvs may affect the interpretation of weight loss . weight loss and wasting syndrome are some of the most common symptoms of hiv infection , particularly in people with certain opportunistic infections [ 28 , 29 ] . hiv - infected patients treated with art agents may lose subcutaneous fat ( lipoatrophy ) in the absence of fat - free mass ( ffm ) depletion and that can confound the clinical interpretation of weight loss . weight gain is certainly an indicator of body recovery , but it could also be related to either disease worsening or drug side effects . the patients in our study were referred to chuk after the development of complications and most of them had opportunistic infections treated with amphotericin , fluconazole , and co - trimoxazole . despite the small size of the study sample examined and notwithstanding the impact of the advanced status of infection , some intriguing questions arise , such as why a higher number of deaths have been observed in patients under the tdf+3tc+efv / rhze regimen and why none out of six patients under 3tc+azt+efv+rhze was declared improved ? as indicated in section 2 , all tb patients are preferably either switched to or started on an efavirenz - based regimen because of potential drug interactions of rifampicin with nevirapine . this may mean that the worst cases would be managed with efv combined regimen , which could explain at least in part the higher death toll . many studies described the possible causes of death in post - haart as aids related infections , non - aids malignancies , non - aids infections , liver disease , cardiovascular disease , respiratory distress , renal failure , and also drug - related side effects , but deep speculation is beyond the scope of the present study . since all patients were supervised during treatment , we may exclude the impact of drug nonadherence . in general , the prognosis is worse for hiv / tb patients compared to those with hiv - alone . the possible explanations may be the complications of tb disease as such , the additive side effects of combined drugs , the lack of adjustment of therapeutic dosing , for example , when efavirenz is given with rifampicin , and the poor predicted response to art . many studies have documented the impact of concurrent treatment with anti - tb drugs and arvs [ 79 , 43 ] . in our study , the great improvement of 80.0% found among hiv - alone patients compared to only 33.3% in hiv / tb patients is an indicator of complications brought about by coinfection . the death rate was higher in hiv / tb patients ( 12/60 ; 20% ) than in the hiv group ( 5/60 ; 8.3% ) or around two times higher . data reported worldwide indicate that the risk of death is 1.8 times greater during cotherapy than during single anti - tb treatment [ 3342 ] . the pattern of timing in mortality for the hiv - alone and hiv / tb groups indicated that deaths in the former group occurred soon after admission less than 1 month ( presumably through the infection precipitating admission ) , while those in the hiv / tb group occurred after 1 month ( by slow underlying hiv and tb disease progression ) . other studies showed that extensively drug - resistant tuberculosis was a cause of death in patients coinfected with tuberculosis and hiv in south africa [ 3 , 43 ] . in some cases , people have hiv that is resistant to all three of the main antiretroviral drug classes nrtis , nnrtis , and pis . there is thus room for speculating that such multiresistant cases may represent one cause of nonimprovement and death observed in our patients , without ruling out the possibility of potential drug toxicities . our patients experienced almost all the side effects frequently described with arvs and anti - tb drugs which are vomiting , headache , ulceration , asthenia , diarrhea , dyspnea , convulsions , anemia , nightmares , skin rashes , neuropathy , renal failure , hepatitis , thrombocytopenia , stevens - johnson syndrome , and lipodystrophy . the rate of occurrence is likely higher in the hiv / tb group than in the hiv group . a previous study in rwanda showed that the rate of developing a serious adr was 35% in tb / hiv coinfected versus 7% in single - tb infected individuals , and this is in agreement with our findings . this confirms what has been found by others that the combination of arvs and anti - tb drugs increases or duplicates the risk of experiencing common side effects of both those treatments [ 4446 ] . the potential offensive drugs most reported in the literature and listed in table 4 indicate what is likely to cause the side effects experienced . we should accept this unless there are some unequivocal data that describe severe adverse drug reactions to specific treatments , such as tdf and renal dysfunction . this drug has been tested in a great variety of locations and not been found to be associated with severe side effects in the majority of patients . nevertheless , tdf is an acyclic nucleotide analogue reverse - transcriptase inhibitor structurally similar to the nephrotoxic drugs adefovir and cidofovir . despite initial cell culture and clinical trial results supporting the renal safety of tdf , its clinical use is associated with a low , albeit significant , risk of kidney injury . tenofovir nephrotoxicity is characterized by proximal tubular cell dysfunction that may be associated with acute kidney injury or chronic kidney disease . withdrawal of the drug leads to an improvement in analytical parameters that may only be partial . the treatment regimens applied comprising first - line antiretrovirals and anti - tb , alongside aggressive antifungal therapy , are efficient in controlling the progression of the infection . however , attention should be paid when combining nonnucleoside antiretrovirals ( efv and nvr ) with anti - tb drugs to minimize the risk of death by drug intoxication . this retrospective cohort study formulates hypotheses and questions to be tested in future studies and trials . | background .
overlapping toxicity between drugs used for hiv and tb could complicate the management of hiv / tb coinfected patients , particularly those carrying multiple opportunistic infections .
this study aimed to evaluate the clinical outcomes and adverse drug events in hiv patients managed with first - line antiretroviral and first - line anti - tb drugs . methods .
this is a retrospective study utilizing medical dossiers from single - hiv infected and hiv / tb coinfected patients already initiated on art .
predictors of outcomes included changes in cd4 cells / mm3 , body weight , physical improvement , death rate , and adverse drug reactions .
results . records from 60 hiv patients and 60 hiv / tb patients aged between 20 and 58 years showed that all clinical indicators of effectiveness were better in single - hiv infected than in hiv / tb coinfected patients : higher cd4 cell counts , better physical improvement , and low prevalence of adverse drug events .
the most frequently prescribed regimen was tdf/3tc / efv+rhze .
the mortality rate was 20% in hiv / tb patients compared to 8.3% in the single - hiv group .
conclusion .
treatment regimens applied are efficient in controlling the progression of the infection .
however , attention should be paid to adjust dosing when combining nonnucleoside antiretrovirals ( efv and nvr ) with anti - tb drugs to minimize the risk of death by drug intoxication . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
carotid atherosclerotic plaque tissue donated by patients
undergoing endarterectomy for high - grade carotid stenosis was processed ,
homogenized , and preserved as described elsewhere 5 , 16 , 17 . plaque
homogenates from 5 patients were pooled , and aliquots were used to stimulate
platelet aggregation under static conditions or were coated onto glass
coverslips for flow studies 16 , 18 , 19 . in addition to plaque , which
contains mainly type i and iii collagens 4 , 6 , blood was exposed to horm collagen
fibers also consisting of type i and iii collagens ( 16 ) . nanoscopic imaging of gpvi - fc binding and platelet adhesion to
collagen under flow was performed by structured illumination microscopy ( sim )
( 20 ) and
stimulated emission depletion ( sted ) microscopy . the means of 2 parallel experimental conditions were
compared by using the student t test or , if normality
was not assured , by using the mann - whitney u test as
indicated in the figure legends . more than 2 concurrent experimental
conditions using the same samples were tested by using repeated measures
analysis of variance . if normality was not assured by repeated measures ,
analysis of variance on ranks was used followed by pair - wise comparisons
with p values based on a tukey adjustment for multiple testing . gpvi - fc , even at very high concentrations , apparently can not
saturate all binding sites on plaque collagen and incompletely inhibits platelet
aggregation ( 16 ) . to gain further insights into the underlying mechanism , we studied the kinetics
and spacial distribution at low shear flow ( 600/s ) of how fluorescent gpvi - fc
added to blood accretes on collagen fibers and how this affects platelet
adhesion , which precedes platelet aggregation . we noted that gpvi - fc binding to
collagen was very fast ( video 1 ) , and dense gpvi - fc dots could repel
arrested platelets from stably adhering to collagen ( figure 1a ) . however , the platelets settled preferentially on segments of collagen fibers
carrying little gpvi - fc ( figures 1a
and 1b ) , and they were even able to displace neighboring
collagen - bound gpvi - fc to firmly attach to these collagen segments . use of sim
confirmed that platelets stably adhered to the segments of collagen fibers ,
which carried little gpvi - fc ( figure 1c , video 2 ) . we therefore aimed to modify gpvi - fc in such a way that it would
assure a more continuous binding to collagen and resist displacement by
platelets . fc - mediated cross - linking of the fc tails
would more closely align gpvi - fc molecules to their corresponding binding motifs
on collagen . human - fc immunoglobulin g ( igg ) and fab2
antibodies at equimolar concentrations with gpvi - fc to allow the formation of
cross - linked ( xl ) complexes ( gpvi - fc*igg - xl and gpvi - fc*fab2-xl ) . pre - incubation
of blood with gpvi - fc*igg - xl or gpvi - fc*fab2-xl inhibited static platelet
aggregation stimulated by plaque or collagen more effectively than gpvi - fc alone
( figure 2a ) . for
plaque - stimulated samples , inhibition by gpvi - fc*igg - xl was 72 12% compared
with 35 13% by gpvi - fc , and inhibition by gpvi - fc*fab2-xl was 84 10%
compared with 40 13% by gpvi - fc . for collagen - stimulated samples , inhibition
by gpvi - fc*igg - xl was 60 17% compared with 20 17% by gpvi - fc , and inhibition
by gpvi - fc*fab2-xl was 67 21% compared with 18 9% by gpvi - fc . bare fc
protein cross - linked with anti human - fc igg or anti concentration response curves of gpvi - fc*fab2-xl showed superior inhibition by
gpvi - fc*fab2-xl at all concentrations starting with 33 nm for plaque- and
collagen - stimulated samples ( figure 2b ) . these concentrations are well below the maximal
plasma gpvi - fc concentrations ( 50 g / ml = 333 nm ) that were reached after
intravenous application in a previous phase i clinical study ( 13 ) . we then explored the effects of gpvi - fc antibody cross - linking
on plaque - induced platelet aggregation under flow . coronary thrombosis mostly
arises from rupture of thin - capped ( < 65 m ) fibroatheroma , exposing the
plaque lipid core containing collagenous structures to circulating blood
6 , 21 , 22 . this action creates a new thrombogenic and rough
luminal surface that will influence platelet adhesion and aggregation dynamics
probably similar to our plaque model . in our model , plaque fragments of
different sizes and consisting of lipids and collagenous structures are exposed
to arterially flowing blood 4 , 16 . the subtle ( < 8 m ) roughness of the plaque
surface in our model created local differences in dynamics and extent of
plaque - induced platelet aggregate formation at flow . for comparison , flow
experiments using collagen - coated surfaces were also performed . as depicted in the micrographs and diagrams in figures 3a and
3b , gpvi - fc*igg - xl inhibited
plaque - stimulated aggregate formation at any time after the start of flow much
more efficiently than gpvi - fc . with gpvi - fc*fab2-xl , the inhibition was even
more pronounced , and gpvi - fc*fab2-xl virtually abolished platelet accretion on
plaque material . interestingly , inhibition of plaque - induced platelet aggregate
formation by gpvi - fc*igg - xl and gpvi - fc*fab2-xl at the end of flow was more
pronounced than after collagen stimulation . we then compared the binding kinetics of labeled gpvi - fc and
cross - linked gpvi - fc to collagen to explore whether a faster binding of
cross - linked gpvi - fc might explain its better inhibitory effect . perfusion of
collagen - coated coverslips with blood containing phycoerythrin ( pe)-labeled
cross - linked gpvi - fc ( gpvi - fc*fab2-xl ) or pe - labeled gpvi - fc ( gpvi - fc*fab2 )
revealed that gpvi - fc*fab2-xl bound only slightly faster than gpvi - fc*fab2
( figure 3c ,
videos 3 and 4 ) . similar observations were made with
gpvi - fc*igg and gpvi - fc*igg - xl ( data not shown ) . as demonstrated by the
fluorescence intensity surface plots , the final gpvi - fc*fab2-xl binding to
collagen was much higher than that of gpvi - fc*fab2 . the very rapid binding of
cross - linked gpvi - fc to collagen delayed and reduced the formation of
collagen - induced platelet aggregate formation at 2 and 5 min after start of flow
( figures 3b and
3c ) . as in the static assays , bare fc protein cross - linked with
anti human - fc igg or anti human - fc fab2 did not inhibit plaque- and
collagen - stimulated platelet aggregation under flow ( supplemental figure 1 ) . we
found that the ratio of gpvi - fc to antibody was crucial for platelet inhibition .
a 1:1 ratio of gpvi - fc : anti human - fc fab2 ( presumably generating longer linear
complexes ) was more effective in inhibiting plaque - induced platelet aggregation
in flowing blood than a ratio of 1:0.5 ( supplemental figure 2 ) . gpvi - fc*fab2-xl
seemed to inhibit plaque - stimulated platelet aggregation under flow even better
than anti - gpvi antibodies ( supplemental figure 3 ) . the protein complexes formed by the interaction of gpvi - fc with
anti human - fc igg or anti human - fc fab2 antibodies were characterized by
analytical ultracentrifugation ( supplemental figure 4 ) . this method provides hydrodynamic
and thermodynamic information concerning the size , shape , and interactions of
macromolecules . for not cross - linked and cross - linked complexes of gpvi - fc with
anti human - fc igg , we found 3 peaks with similar svedberg values but a different
distribution of the protein s abundance . when anti human - fc fab2 was used , a
shift to higher svedberg values was found , indicating the formation of protein
complexes of higher molecular weight and possibly different configurations of
fab2 cross - linked complexes . tentative structures of gpvi - fc*igg - xl and
gpvi - fc*fab2-xl complexes based on the approximate molecular weight of the main
peaks ( approximately 400 to 800 kda ) are depicted in supplemental figure 4b . they
show the predominant formation of oligomeric ( [ gpvi - fc]2 and
[ gpvi - fc]3 ) complexes . the accretion of fluorescent - labeled gpvi - fc and cross - linked
gpvi - fc from flowing blood onto collagen fibers and the relation to platelet
adhesion was studied by using nanoscopy . conditions and gpvi - fc / antibody ratios
were similar to that shown in supplemental figure 4 , in which the samples had been
characterized by analytical ultracentrifugation . imaging using structured
illumination microscopy ( sim ) of samples fixed after blood perfusion showed that
not cross - linked gpvi - fc*igg and gpvi - fc*fab2 was bound to collagen in a dotty
and inhomogeneous manner , leaving segments on collagen free which , in fact ,
platelets used for surface membrane anchoring ( figure 4 ) . in
contrast , gpvi - fc*igg - xl and gpvi - fc*fab2-xl binding to collagen was abundant ,
continuous , and rapid enough to virtually prevent platelet attachment . the
qualitative observations were confirmed by quantitative measurements .
the superior potency of gpvi - fc*igg - xl and gpvi - fc*fab2-xl to prevent platelet
adhesion to collagen fibers compared with gpvi - fc was clearly visible by sim
( figure 5 ) . stable platelet
adhesion measured in the same samples was drastically reduced by cross - linking
of gpvi - fc ( 76% ) with anti human - fc fab2 . optical nanoscopy using sim and sted microscopy ( for even higher
resolution ) of collagen fibers incubated with fluorescent - labeled gpvi - fc and
gpvi - fc cross - linked with anti human - fc igg or anti human - fc fab2 revealed a
continuous and homogeneous binding compared with the dotted pattern of not
cross - linked gpvi - fc ( figures 5a and
5b ) . in the sted micrographs , in which collagen was
simultaneously stained with alexafluor594-conjugated anti - collagen type i and
iii antibodies , binding of cross - linked gpvi - fc to collagen showed complete
co - localization with the anti - collagen antibodies . to confirm our hypothesis that it is in fact cross - linking that potentiates the inhibitory effect of gpvi - fc , inhibition of platelet aggregation
on plaque and collagen fibers by gpvi - fc*fab2-xl were compared with that by
gpvi - fc*fab . fab antibodies bear only 1 antigen - binding site and are unable to
cross - link antigens . plaque- or collagen - coated surfaces were pre - incubated with
either gpvi - fc*fab or gpvi - fc*fab2-xl . as expected , virtually no effect of
gpvi - fc*fab was observed in contrast to a complete inhibition of plaque- and
collagen - induced platelet aggregation by gpvi - fc*fab2-xl , indicating that indeed
cross - linking causes the potent inhibition by gpvi - fc*fab2-xl ( figure 6a ) . analysis by using sim imaging demonstrated the absence of
platelet adhesion to collagen fibers in the gpvi - fc*fab2-xl samples and a
reticulated , dense binding pattern of gpvi - fc*fab2-xl binding in contrast to the
staggered pattern of gpvi - fc*fab binding ; this approach left fiber segments free
for platelet membrane contacts . the qualitative observations were confirmed by
quantitative measurements ( figure 6b ) . to test whether cross - linked gpvi - fc would increase bleeding
time , measurements were conducted by using the platelet function analyzer
pfa-200 ( siemens healthcare , germany ) . this device simulates primary hemostasis
in vitro and is used for routine screening of patients with potential
hemorrhagic risk 23 , 24 . gpvi - fc*fab2-xl did not significantly increase the
closure times measured with the pfa-200 collagen / adenosine diphosphate or
collagen / epinephrine cartridges compared with buffer or gpvi - fc ( figure 7 ) . as expected , aspirin produced a prolonged closure time with
the collagen / epinephrine cartridge . we found that cross - linking of gpvi - fc with fc - directed
antibodies drastically increased its potency to inhibit atherosclerotic plaque-
and collagen - induced platelet aggregation under static and flow conditions . the
increase in efficacy was obviously due to cross - linking per se and not to
saturation of other fc - binding sites with anti human - fc antibodies . first ,
analytical ultracentrifugation confirmed the formation of cross - linked gpvi - fc
complexes after incubating gpvi - fc with equimolar amounts of anti human - fc igg
or fab2 antibodies . second , functional platelet experiments under flow and
nanoscopic imaging studies comparing the effect of gpvi - fc incubated with
anti human - fc fab2 or fab antibodies ( which can not cross - link ) unequivocally
showed that cross - linking of the fc domains of gpvi - fc is the underlying
mechanism . in blood , the addition of gpvi - fc cross - linked
with anti human - fc fab2 led to an even stronger inhibition of plaque- and
collagen - induced platelet aggregation than the addition of gpvi - fc cross - linked
with anti human - fc igg , particularly under flow conditions ( figure 3 ) . a possible
explanation for the stronger inhibition with fab2-containing complexes could be
that gpvi - fc*fab2-xl complexes can not again be stripped from plaque collagen by
blood cells carrying the fc receptor what might happen to gpvi - fc*igg - xl
complexes . particularly after rapid binding of cross - linked gpvi - fc*igg - xl to
plaque collagen in the flow studies , the goat fc tails might be well accessible
for the fc receptors of nearby flowing blood cells . this might explain the
different kinetics and degree of inhibition by anti - fc fab2- and igg
cross - linking of gpvi - fc in the flow studies ( figure 3b ) . advanced microscopic imaging studies provided insights into the
mechanism of improved platelet inhibition by gpvi - fc cross - linking . notably ,
collagen fibers bound labeled gpvi - fc from flowing blood very rapidly and
stably ; there was only a small difference in the binding kinetics between
cross - linked and not cross - linked gpvi - fc but a higher plateau level of
cross - linked gpvi - fc binding . nanoscopy using sim and sted microscopy showed
that gpvi - fc cross - linked with anti human - fc igg or anti human - fc fab2 bound to
collagen in a more continuous and homogeneous manner compared with the dotted
binding pattern of not cross - linked gpvi - fc . cross - linked gpvi - fc covered
collagen similar to a sheath , thereby impeding platelets to contact binding
motifs on collagen . cross - linking obviously generates multiple linear oligomeric
gpvi - fc complexes providing high - density alignment of gpvi domains with their
corresponding collagen - binding motifs ( figure 8) . the increase in efficacy by gpvi - fc cross - linking could lead to
several advantages for future antiplatelet treatments of cardiovascular
patients . first , cross - linked gpvi - fc offers effective platelet inhibition on
sites of plaque rupture independent of the actual flow rate . second , the
inhibitory effect of cross - linked gpvi - fc on plaque - induced platelet aggregation
is at least as potent as that of anti - gpvi antibodies , but it is focused on the
injured lesion and not burdened with systemic antiplatelet effects ( unlike that
of anti - gpvi antibodies ) . although the tail bleeding time of gpvi - deficient mice is only moderately
increased ( 14 ) , a
variable bleeding diathesis is observed in patients with rare genetic or
acquired gpvi defects ( 25 ) . finally , due to the high efficacy , cross - linked gpvi - fc can be
used in much lower doses than gpvi - fc . moreover , under arterial flow inhibition
by cross - linked gpvi - fc , complexes appeared to be even more pronounced if
stimulated by human plaque material than by collagen fibers alone ( figure 3 ) . this further focuses
its action to the injured plaque and may translate to a reduced risk of systemic
bleeding . indeed , by measuring closure time with the pfa-200 device , we found no
evidence that cross - linked gpvi - fc increases bleeding time in vitro . when atherothrombosis causes acute myocardial infarction or
ischemic stroke , a highly efficient antiplatelet therapy is needed . we
demonstrated that the new principle of generating multimeric gpvi complexes
( e.g. , by antibody cross - linking of gpvi - fc ) exploits the full local potential
of gpvi antagonism in human plaque cross - linked gpvi - fc complexes
in the bloodstream very rapidly accrete onto denuded plaque collagen fibers and
cover them continuously and stably . this approach efficiently prevents platelet
arrest and aggregate formation . the rapid deployment to the triggering plaque
lesion , its high local potency , and the lack of systemic platelet impairment combine to make an attractive pharmacodynamic profile that should inspire the
development of new poly - gpvi domain based drugs targeting plaque
collagen platelet interaction . antibody cross - linked gpvi - fc complexes with
persistent coating of collagen exposed at the lesion but limited stability in
the circulation due to dissociation of the antibody from gpvi - fc may be
preferable ; an example is for percutaneous coronary interventions in which
a short - term , but highly effective , lesion - focused antithrombotic action is
desired at the moment of dilation of a stenosing plaque . in fact , human
monoclonal antibodies against fc selected from a human combinatorial antibody
library are already available and could , in principal , be further developed for
gpvi - fc complexing in clinical studies . other strategies might be preferred ,
including transforming gpvi domains by chemical linking into a multivalent
format with long - term stability in the circulation and avoiding potential
immunogenic problems of gpvi - fc antibody complexes . these approaches might be
used if a prolonged protection from thrombogenic de novo plaque collagen
exposure is desired , such as in patients with recurrent embolism from plaque
erosion ( 26 ) . cross - linking gpvi - fc into oligomeric complexes aligned gpvi
domains densely with their corresponding binding motifs on collagen and
strikingly enhanced gpvi - fc suppression of platelet adhesion and plaque- and
collagen - induced aggregation under static and flow conditions without increasing
bleeding time in vitro . transformation of gpvi into multivalent gpvi complexes
may provide a new strategy for a highly effective and safe gpvi targeting
treatment against acute atherothrombosis.perspectivescompetency in medical
knowledge : gpvi mediates platelet activation
by injured plaques exposing collagen . this scenario can be
blocked by gpvi antibodies possibly burdened with systemic
platelet dysfunction or , less potently , by a gpvi - fc fusion
protein that conceals gpvi - binding motifs on collagen of
lesioned plaques from platelets but leaves systemic platelet
function intact . we demonstrate here that cross - linking the
fc tails of gpvi - fc to form oligomeric gpvi - fc complexes
results in a rapid continuous coverage of collagen fibers
and complete prevention of platelet aggregation on human
plaque in static and flow models without increasing bleeding
time . gpvi
axis of platelet activation can be provided at the culprit
lesion by linking gpvi - fc to oligomeric complexes while
systemic platelet function is preserved.translational outlook :
cross - linked gpvi - fc , which rapidly binds to the site of
plaque injury , might prevent atherothrombosis with no
increased risk of systemic bleeding . this approach may hold
special promise in intervention - associated plaque trauma , in
which suppression of initiating platelet activation is
desired to attenuate ensuing steps to
restenosis . competency in medical
knowledge : gpvi mediates platelet activation
by injured plaques exposing collagen . this scenario can be
blocked by gpvi antibodies possibly burdened with systemic
platelet dysfunction or , less potently , by a gpvi - fc fusion
protein that conceals gpvi - binding motifs on collagen of
lesioned plaques from platelets but leaves systemic platelet
function intact . we demonstrate here that cross - linking the
fc tails of gpvi - fc to form oligomeric gpvi - fc complexes
results in a rapid continuous coverage of collagen fibers
and complete prevention of platelet aggregation on human
plaque in static and flow models without increasing bleeding
time . gpvi
axis of platelet activation can be provided at the culprit
lesion by linking gpvi - fc to oligomeric complexes while
systemic platelet function is preserved . translational outlook :
cross - linked gpvi - fc , which rapidly binds to the site of
plaque injury , might prevent atherothrombosis with no
increased risk of systemic bleeding . this approach may hold
special promise in intervention - associated plaque trauma , in
which suppression of initiating platelet activation is
desired to attenuate ensuing steps to
restenosis . | summaryto enhance the antithrombotic properties of
recombinant glycoprotein vi fragment crystallizable ( gpvi - fc ) , the authors
incubated gpvi - fc with anti - human fc antibodies to cross - link the fc tails of
gpvi - fc .
cross - linking potentiated the inhibition of human plaque- and
collagen - induced platelet aggregation by gpvi - fc under static and flow
conditions without increasing bleeding time in vitro .
cross - linking with
anti - human - fc fab2 was even superior to anti - human - fc immunoglobulin g ( igg ) .
advanced optical imaging revealed a continuous sheath - like coverage of collagen
fibers by cross - linked gpvi - fc complexes .
cross - linking of gpvi into oligomeric
complexes provides a new , highly effective , and probably safe antithrombotic
treatment as it suppresses platelet gpvi - plaque interaction selectively at the
site of acute atherothrombosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there are two main mechanisms ensuring the efficient transfer of amyloidogenic proteins
from the cytosolic or extracellular milieu to neuronal plasma membranes . the first one is
the reduction of dimensionality ( from 3d to 2d ) that occurs when a soluble protein
dissolved in the bulk solvent binds to a membrane surface ( ref . the underlying idea is that the membrane 2d space can
concentrate proteins far more efficiently than the 3d space of the bulk solvent . as a
consequence , the average distance between two proteins is shorter in 2d than in 3d , and
this effect is more pronounced for higher protein concentrations ( ref . this phenomenon is particularly important for amyloidogenic
proteins that tend to self - aggregate after a conformational transition ( fig . 2 ) . thus , the simple fact of the concentration of
monomers in a restricted membrane area is , by itself , a crucial step in the complex
process of amyloid oligomerisation / aggregation . figure 2neuronal membranes as concentration platforms and chaperones for
amyloidogenic monomers : key role of sphingolipid ( a ) amyloidogenic monomers have a low affinity for the
liquid - disordered ( ld ) phase of plasma membranes enriched in phosphatidylcholine . ( b ) by contrast , the monomers have a high affinity for
sphingolipid cholesterol domains in the liquid - ordered ( lo ) phase . in this
case , monomers are not only concentrated on the membrane surface , but also undergo a
major conformational change induced by the sphingolipids . this property is referred
to as the chaperone effect of sphingolipids on amyloidogenic proteins . neuronal membranes as concentration platforms and chaperones for
amyloidogenic monomers : key role of sphingolipid cholesterol
domains . ( a ) amyloidogenic monomers have a low affinity for the
liquid - disordered ( ld ) phase of plasma membranes enriched in phosphatidylcholine . ( b ) by contrast , the monomers have a high affinity for
sphingolipid cholesterol domains in the liquid - ordered ( lo ) phase . in this
case , monomers are not only concentrated on the membrane surface , but also undergo a
major conformational change induced by the sphingolipids . this property is referred
to as the chaperone effect of sphingolipids on amyloidogenic proteins . the second mechanism explaining the affinity of amyloidogenic proteins for neuronal
membranes is lipid specificity . converging data obtained from various laboratories with a
broad range of experimental approaches have shown that amyloidogenic proteins interact
with the lipids found in the lo phase that is , sphingolipids and cholesterol
( fig . alzheimer a peptides
recognise several glycosphingolipids , including neutral species such as asialo - gm1 or
galactosylceramide ( galcer ) as well as gangliosides such as gm1 ( refs 26 , 27 ,
28 , 29 ) ; -synuclein binds to gangliosides gm1 and gm3 ( refs 30 , 31 ) ; prp
interacts with sphingomyelin , galcer , gm1 and gm3 ( refs 27 , 32 , 33 ) and is associated with sphingolipid signalling platforms ( ref . overall , this high affinity for
sphingolipids determines the concentration of amyloid proteins in lipid raft areas of the
extracellular leaflet of the plasma membrane . several amyloidogenic proteins can also bind
to negatively charged glycerophospholipids ( refs 35 , 36 ) , which are enriched in the
cytoplasmic leaflet of the plasma membrane ( ref . this type of interaction has been extensively studied for
-synuclein , which recognises anionic phosphatidylserine and phosphatidylglycerol
( refs 36 , 37 , 38 , 39 ) . in this review , we restrict our analysis to the role of cholesterol and
sphingolipids in the interaction of amyloidogenic proteins and membranes . as we will see ,
these lipids play a more active role in the conformation , oligomerisation and aggregation
of amyloidogenic proteins than just acting as a concentration platform . that the same amyloidogenic protein could interact with several distinct sphingolipids
( refs 26 , 27 , 31 ) could be viewed as paradoxical
and difficult to reconcile with a real specificity of interaction . a biochemical analysis
of sphingolipid structures is necessary to get a clearer view on this issue . sphingolipids
are formed by the condensation of a fatty acid chain with a sphingoid base ( which is
generally sphingosine although five different sphingoid bases have been detected in
mammalian cells ) . the biochemical diversity of sphingolipids is first generated by the
numerous fatty acids ( more than 20 , varying in chain length , degree of saturation and
degree of hydroxylation ) that can be attached to the sphingoid base to form a ceramide
( ref . sphingolipids are then classified into
sphingomyelin and glycosphingolipids , according to the biochemical nature of the polar
part attached to ceramide : phosphorylcholine for sphingomyelin , and a glycan moiety for
glycosphingolipids . several hundred different carbohydrate structures have been described
in glycosphingolipids , with various combinations of neutral sugars , sulfated sugars and
sialic acids ( ref . this is
the case for the glycosphingolipids galcer , globotriaosylceramide ( gb3 ) and
gm3 , which have a distinct sugar moiety but a common galactosyl residue with the same
orientation ( fig . c ) . as a logical
consequence of this common structural feature , a protein that recognises one of these
glycosphingolipids ( e.g. galcer ) , through binding to this galactose residue , might also
interact with the other two ( in this case , gb3 and gm3 ) . this means that the
biochemical code governing glycosphingolipid protein interactions is degenerate . an example of this striking property is the v3 loop domain of the human immunodeficiency
virus 1 ( hiv-1 ) surface - envelope glycoprotein gp120 , which was shown to recognise first
galcer ( refs 41 , 42 , 43 ) , and then , several
years later , both gb3 and gm3 ( refs 44 , 45 ) . however , there is a unique
molecular mechanism that accounts for the interaction of each of these glycosphingolipids
with gp120 ( ref . figure 3glycosphingolipids and amyloidogenic proteins : a common mechanism of
interaction ? despite their high level of biochemical diversity , some
glycosphingolipids share a common galactosyl ring with an orientation compatible
with the establishment of stacking ch- interactions between the sugar and
an aromatic residue . such galactosyl rings are indicated in shaded circles in the
sugar moiety of ganglioside gm3 ( a ) , globotriaosylceramide gb3 ( b ) and
galactosylceramide galcer ( c ) . in these cases , the apolar side of the galactosyl
ring fits particularly well with the aromatic - ring side chain of an aromatic residue
( phe , in this case ) exposed at the surface of an amyloid protein ( d ) . the electronic
cloud of the system stacks onto the ch groups of the galactosyl ring . this interaction is favoured by the common geometric structure of both rings , which
allows a coordinated binding process between ch groups and electrons . cholesterol , which has a strong affinity for sphingolipids , can further improve the
accessibility of the galactosyl group through fine tuning of glycosphingolipid
conformation ( e ) . this effect involves the establishment of an h - bond network
between the oh group of cholesterol , the nh group of the sphingolipid and the oxygen
atom of the glycosidic bond linking the ceramide and the sugar part of the
sphingolipid . galcer - nfa , galcer with a nonhydroxylated fatty acid in the ceramide
moiety . glycosphingolipids and amyloidogenic proteins : a common mechanism of
interaction ? despite their high level of biochemical diversity , some
glycosphingolipids share a common galactosyl ring with an orientation compatible
with the establishment of stacking ch- interactions between the sugar and
an aromatic residue . such galactosyl rings are indicated in shaded circles in the
sugar moiety of ganglioside gm3 ( a ) , globotriaosylceramide gb3 ( b ) and
galactosylceramide galcer ( c ) . in these cases , the apolar side of the galactosyl
ring fits particularly well with the aromatic - ring side chain of an aromatic residue
( phe , in this case ) exposed at the surface of an amyloid protein ( d ) . the electronic
cloud of the system stacks onto the ch groups of the galactosyl ring . this interaction is favoured by the common geometric structure of both rings , which
allows a coordinated binding process between ch groups and electrons . cholesterol , which has a strong affinity for sphingolipids , can further improve the
accessibility of the galactosyl group through fine tuning of glycosphingolipid
conformation ( e ) . this effect involves the establishment of an h - bond network
between the oh group of cholesterol , the nh group of the sphingolipid and the oxygen
atom of the glycosidic bond linking the ceramide and the sugar part of the
sphingolipid . galcer - nfa , galcer with a nonhydroxylated fatty acid in the ceramide
moiety . let us first consider the way in which proteins bind to galcer , which is both the major
lipid of myelin sheaths ( ref . 47 ) and the
simplest possible brain - expressed glycosphingolipid , consisting of a ceramide linked to a
single galactosyl group ( i.e. a ceramide monohexoside ) . most of the galcer molecule is
dipped into the membrane , so that the galactosyl moiety is the principal region of the
glycolipid available for protein binding . in this respect , there is a functional
similarity between proteins that recognise galcer and galactose - specific lectins . however ,
the local concentration of galactosyl groups in a nanodomain of galcer is extremely high
compared with the maximal concentration of free galactose in biological fluids ( another
illustration of the reduction - in - dimensionality concept discussed above ) . moreover , the
conformation of the galactose head group in the glycolipid is restricted by the ceramide
backbone , which allows only limited motion of the sugar ( ref . by contrast , galactose in water solution is free to adopt a wide
range of conformations . finally , the most polar part of ceramide , which includes both
amide and hydroxyl ( oh ) groups , as well as the -glycosidic bond linking ceramide
to galactose , can also participate in the binding reaction and further stabilise the
galcer protein complex . taken together , these biochemical properties of the
galactosyl head group of galcer protein interactions are
distinct from galactose lectin interactions ( ref . 49 ) . at the molecular level , numerous proteins that bind to galcer have a solvent - exposed
aromatic residue that provides a complementary surface for a stacking interaction with the
galactose ring ( fig . 3d ) . as a result of the
distribution of the oh groups linked to the pyranosyl ring of galactose , this sugar has
two chemically distinct faces : one apolar with hydrocarbyl ( ch ) groups and the other polar
with oh groups . therefore , the apolar face of galactose is particularly suited for a
stacking interaction with an aromatic structure ( ref . 50 ) . this type of interaction between ch groups and a -electron cloud
system has been described and referred to as ch interaction by nishio
and co - workers ( ref . the
ch stacking mechanism is involved in the interaction between
glycosphingolipids and several amyloidogenic proteins , including prp ( ref . , the apolar side of the central galactosyl group has a similar
orientation to that in galcer ( fig . 3a c ) ; thus , galcer - binding proteins are predicted to also bind to
gb3 and gm3 through ch stacking . note that the
conformation of the sugar moiety of glycosphingolipids is restricted by a network of
h - bonds ( ref . 52 ) that involves either an oh
group in the acyl chain of the ceramide ( intramolecular network ) or the oh group of
cholesterol ( intermolecular network , fig . 3e ) , as
further discussed below ( see the section the outside and inside effects of
cholesterol ) . the notion that unrelated proteins , displaying a solvent - accessible aromatic residue in a
hairpin domain , might bind these glycosphingolipids through a similar stacking mechanism
has motivated the search for v3-like domains in various proteins , including amyloidogenic
proteins ( ref . this is the concept of the
glycosphingolipid - binding domain or , more generally , of the sphingolipid - binding domain
( ref . such domains are characterised by the
presence , in a flexible region of the surface of a protein , of an aromatic residue with
its side chain oriented towards the solvent , as illustrated in figure 4a with the superimposition of the glycosphingolipid - binding
domains of a and -synuclein ( ref . the recognition of the glycosphingolipid by this region of the protein is
thought to proceed through an induced - fit mechanism involving the conformational mobility
of the aromatic side chain and a concomitant adjustment of the orientation of the
galactosyl head group ( fig . ( a )
amyloidogenic proteins share a common sphingolipid - binding domain , which can be
shown by superimposing the structure of micelle - bound alzheimer a peptide
[ pdb i d : 1ba4 , in red ] ( ref . 150 ) onto the
structure of micelle - bound -synuclein [ pdb i d : 1xq8 , in blue ] ( ref . 142 ) . the motif corresponds to a
helix turn helix structure displaying an aromatic residue ( tyr10
for a ; tyr39 for -synuclein ) oriented towards the solvent and
located at a similar position in the loop . the location of glu residues associated
with glu to lys mutations in genetic forms of alzheimer and parkinson diseases is
indicated ( glu22 for a and glu46 for -synuclein , respectively ) . the amino acid sequence of both proteins ( upper panel ) show very little homology ,
apart from the above - mentioned tyr residues ( asterisk ) and a common val residue
( val52 for -synuclein and val24 for a ) . ( b ) due to the high
conformational plasticity of amyloidogenic proteins , the sphingolipid - binding domain
can adopt several distinct conformations , as shown for the core amyloid - forming
motif of amylin [ nfgailss octapeptide , pdb i d : 1kuw ] ( ref . the -carbon chain of the peptide is coloured in
blue , and the phe residue in red . twenty conformers obtained by nuclear magnetic
resonance ( nmr ) analysis are superposed . once bound to the glycosphingolipid ( gsl ,
coloured in green ) 53 obtained with lactosylceramide
( laccer ) . a common sphingolipid - binding domain in amyloidogenic proteins . ( a )
amyloidogenic proteins share a common sphingolipid - binding domain , which can be
shown by superimposing the structure of micelle - bound alzheimer a peptide
[ pdb i d : 1ba4 , in red ] ( ref . 150 ) onto the
structure of micelle - bound -synuclein [ pdb i d : 1xq8 , in blue ] ( ref . the motif corresponds to a
helix turn helix structure displaying an aromatic residue ( tyr10
for a ; tyr39 for -synuclein ) oriented towards the solvent and
located at a similar position in the loop . the location of glu residues associated
with glu to lys mutations in genetic forms of alzheimer and parkinson diseases is
indicated ( glu22 for a and glu46 for -synuclein , respectively ) . the amino acid sequence of both proteins ( upper panel ) show very little homology ,
apart from the above - mentioned tyr residues ( asterisk ) and a common val residue
( val52 for -synuclein and val24 for a ) . ( b ) due to the high
conformational plasticity of amyloidogenic proteins , the sphingolipid - binding domain
can adopt several distinct conformations , as shown for the core amyloid - forming
motif of amylin [ nfgailss octapeptide , pdb i d : 1kuw ] ( ref . 68 ) . the -carbon chain of the peptide is coloured in
blue , and the phe residue in red . twenty conformers obtained by nuclear magnetic
resonance ( nmr ) analysis are superposed . once bound to the glycosphingolipid ( gsl ,
coloured in green ) 53 obtained with lactosylceramide
( laccer ) . in summary , a glycosphingolipid - binding domain is a flexible domain containing
turn - inducing ( gly , pro ) , basic ( arg , lys , his ) and aromatic residues ( phe , tyr , trp )
( refs 27 , 54 , 55 , 56 , 57 ) . the critical involvement of
aromatic residues in the interaction between proteins and glycosphingolipids has been
convincingly demonstrated by using synthetic peptides in which these residues were
replaced by ala or leu ( refs 53 , 54 , 55 ) :
correspondingly , the interaction with the glycosphingolipid has been dramatically
decreased or even totally lost . reciprocally , conservative aromatic substitutions ( e.g.
phe to trp ) did not affect binding to glycosphingolipids ( ref . glycosphingolipid interactions driven by
ch stacking of a sugar and aromatic residue ( refs 52 , 58 ) . one important consequence of protein sphingolipid interactions is that the
conformation of the protein can be significantly affected on binding to sphingolipids
( fig . this chaperone effect of
sphingolipids is a direct consequence of the unique modalities of
protein sphingolipid interactions ( ref . as soon as binding begins , the structure of the sphingolipid changes and the
protein gradually adapts its shape to this moving target . a stable anchoring of the
protein to the sphingolipids can be obtained by optimising protein the
flexibility of the sphingolipid - binding domain is particularly well suited to trigger
structural rearrangements in the protein ( ref . . this unexpected consequence of protein sphingolipid interactions
has been extensively studied with hiv-1 . briefly , on binding to raft glycosphingolipids
through its v3 domain , hiv-1 gp120 undergoes a series of conformational changes that are
required for virus fusion ( refs 19 , 45 ) . because the sphingolipid - binding domain is
evolutionarily conserved ( it has been found in virus , bacteria , insect and mammalian
proteins ) , it is likely that sphingolipids can modulate the conformation and regulate the
function of a wide range of proteins ( refs 52 ,
53 , 54 , 55 , 56 , 57 ) . how could this concept of a sphingolipid - mediated chaperone effect apply to
membrane - bound amyloids ? seminal work by matsuzaki , yanagasiwa and co - workers has shown
that lipid rafts act as surface catalysts able to accelerate the aggregation of
a ( refs 29 , 59 , 60 , 61 , 62 ,
63 ) . most interestingly , gm1-bound a
has been identified as a pre - amyloid form acting as an endogenous seed for the formation
of neurotoxic amyloid fibrils in alzheimer disease ( refs 29 , 61 , 62 , 63 ) . these data have not
only strengthened the role of lipid rafts as preferential binding sites for unstructured
amyloidogenic proteins on neuronal membranes but have also suggested that these membrane
domains behave as conformational catalysts for amyloid formation . in other words , lipid
rafts can control the conformation of membrane - bound amyloid through a chaperone effect
( refs 49 , 59 , 64 ) . yet , conflicting data have
suggested that binding of a to gm1 induces a conformational transition from
random coil to a protective -helical structure ( ref . 30 ) , or to a fibrillation - prone -structure
( refs 61 , 66 ) . the structure of amyloidogenic proteins bound to gm1 depends on several
physicochemical parameters , including ph , membrane fluidity , gm1-carrier lipid ratios ,
protein concentration and the absence or presence of cholesterol , which could explain the
discrepancies reported in the literature . in any case , the available data suggest that
lipid rafts could ( 1 ) modulate the conformational changes of unstructured monomers from
the unfolded state to more - ordered or structures , and ( 2 ) control
the balance between and structures , which in turn determine the
oligomerisation / aggregation status of amyloidogenic proteins . 59 ) have shown that the
oligomerisation and aggregation of a peptides occur in ganglioside - enriched
domains of the plasma membrane . a possible sequence of events could be as follows : ( 1 )
soluble a monomers bind to the sugar head group of gangliosides in
cholesterol sphingolipid - enriched domains such as lipid rafts ; ( 2 ) on binding to
gangliosides , a is constrained to adopt an -helical structure ; ( 3 ) as
the protein density on the membrane increases , a undergoes a conformational
transition from an -helix - rich structure to a -strand - rich one ; and
( 4 ) the ganglioside - bound a complex with acquired secondary structures serves as
a seed for amyloid fibril formation . indeed , a fibrils with high toxicity have
been successfully generated in an acellular system using gm1-containing raft - like
liposomes ( ref . 67 ) . altogether , these data
strongly support the concept that the ganglioside cluster can act as a chaperone able to
lower the activation energy for the conformational changes of a ( ref . this scenario is also consistent with the
involvement of the glycosphingolipid - binding domain in membrane unstructured amyloidogenic proteins can adopt a wide range of conformations in water and
in biological membranes ( fig . the
conformational flexibility of the amyloid core peptide of amylin ( nfgailss ) has been
studied by nuclear magnetic resonance ( nmr ) ( ref . , this peptide can adopt three
distinct classes of conformations owing to the wide flexibility of the peptide chain
( fig . 4b ) . correspondingly , the unique phe
residue of the motif has three main possible orientations ( ref . 53 ) . on binding to a glycosphingolipid bearing an appropriately
oriented galactosyl group ( lactosylceramide in fig .
4b ) , the phe residue stacks onto the sugar so that only one of the numerous peptide
conformations is selected and locked . this illustrates the potency of ch stacking interactions to
stabilise a thermodynamically unstable conformation at a minimal energetic cost , just like
a wedge can efficiently block a car on a sloping street ( ref . this simple but efficient mechanism could allow raft
glycosphingolipids to act as molecular chaperones inducing -helix - rich
structures in amyloidogenic proteins ( fig . the stabilisation of an -helix structure is beneficial , because
this can prevent protein misfolding and aggregation ( ref . 49 ) . however , the -helix conformation could also facilitate
membrane insertion and channel / pore formation , leading to dramatic perturbations of
membrane permeability , as shown for -synuclein ( ref . in addition , the chaperone effect of glycosphingolipids is not
irreversible . changing the physicochemical properties of the raft protein
complex , for example through oxidative damage to the proteins or lipids ( refs 70 , 71 ) ,
could theoretically induce the dissociation of the amyloid peptides from
glycosphingolipids such as galcer . then , the sudden exposure of aromatic side chains would
allow a tight packing ( through interactions ) between
adjacent helices . this would lead to the formation of a dimer , a key step in the
generation of amyloid fibrils ( refs 72 , 73 ) , which is thought to proceed through an ordered
polymerisation of structures ( ref . when bound to glycosphingolipids ( gsls ) through the
sphingolipid - binding domain , the aromatic residues of two vicinal amyloidogenic
proteins can not interact with each other and the protein is forced to adopt an
-helix conformation . the molecular mechanism of this interaction is the
ch stacking between the galactosyl ring of galcer and the
aromatic residue of the protein . the -helix structure of amyloidogenic
proteins is not only present in membrane - bound monomers ( as illustrated in fig . 2 , right panel ) , but also in oligomeric
-synuclein channels ( fig . the
-amyloid aggregation process is triggered when the
glycosphingolipid protein complex is destabilised , resulting in the
release of the protein from its glycosphingolipid chaperone ( a ) . in this new
glycosphingolipid - free environment , the aromatic residues of two vicinal
amyloidogenic proteins can interact together ( b ) , inducing a drastic conformational
change from an initial -helix to a -strand structure . amyloid
aggregation then results from the -driven assembly of
aromatic side chains ( for a review , see ref . 79 ) , forming amyloid dimers that in turn associate to form amyloid fibrils
( as illustrated in fig . when bound to glycosphingolipids ( gsls ) through the
sphingolipid - binding domain , the aromatic residues of two vicinal amyloidogenic
proteins can not interact with each other and the protein is forced to adopt an
-helix conformation . the molecular mechanism of this interaction is the
ch stacking between the galactosyl ring of galcer and the
aromatic residue of the protein . the -helix structure of amyloidogenic
proteins is not only present in membrane - bound monomers ( as illustrated in fig . 2 , right panel ) , but also in oligomeric
-synuclein channels ( fig . the
-amyloid aggregation process is triggered when the
glycosphingolipid protein complex is destabilised , resulting in the
release of the protein from its glycosphingolipid chaperone ( a ) . in this new
glycosphingolipid - free environment , the aromatic residues of two vicinal
amyloidogenic proteins can interact together ( b ) , inducing a drastic conformational
change from an initial -helix to a -strand structure . amyloid
aggregation then results from the -driven assembly of
aromatic side chains ( for a review , see ref . 79 ) , forming amyloid dimers that in turn associate to form amyloid fibrils
( as illustrated in fig . , we would like to underscore ( 1 ) the key role of aromatic residues
in the self - assembly of amyloid fibrils and ( 2 ) the chaperone effect of raft
glycosphingolipids that could induce otherwise thermodynamically unstable -helix
structures of amyloid fibril - forming proteins . indeed , most amyloidogenic proteins
( including a and prp ) have an amino acid sequence that is expected to form
but not structures ( ref . -helix/-strand discordant. lipid rafts can
prevent those proteins from adopting the conformation they prefer , stabilising their
structure in a forced conformation . this stabilisation
can occur in the early biosynthetic pathway as demonstrated for prp ( ref . inhibition of sphingolipid biosynthesis
logically increases prp misfolding into disease - associated structures ( ref . this mechanism seems to also apply for
several neurotransmitter receptors ( e.g. the nicotinic acetylcholine receptor ) whose
transport and assembly in the plasma membrane require the assistance of sphingolipids
( ref . mutations in amyloidogenic proteins
that are associated with inherited forms of neurodegenerative diseases have been shown to
directly affect sphingolipid binding . this is the case for the
creutzfeldt jakob - linked e200k mutation of prp , which affects
prp sphingomyelin interactions ( ref . , by providing a complementary surface for amyloidogenic proteins , cellular
glycosphingolipids might constitutively stabilise their conformation and
inhibit their aggregation , as recently demonstrated for amylin ( ref . protein
interactions ( refs 18 , 50 ) would then trigger amyloid growth
and deposition ( refs 49 , 79 ) . to what extent glycosphingolipids could also stimulate
-strand - mediated amyloid aggregation ( ref . the mutual
effect of gm1 and a on their respective conformations is likely to displace the
equilibrium of the reaction towards the formation of amyloid aggregates , as observed in
vitro ( ref . finally , it should be noted that noncovalent interactions distinct from
ch stacking might also contribute to sphingolipid 81 ) , h - bonds and electrostatic bridges ( especially for sulfated
glycosphingolipids , gangliosides and sphingomyelin ) ( ref . 82 ) . indeed , in addition to aromatic side chains ( tyr10 ) , several
aliphatic ( ref . 81 ) and basic residues such as
his13 have been implicated in gm1a interactions ( ref . anionic phospholipids such as
phosphatidylserine , which bind to -synuclein through electrostatic interactions
( ref . 84 ) , could , in the cytoplasmic
leaflet of the plasma membrane , have a role equivalent to the one played by gangliosides
in the external leaflet . high cholesterol has been identified as a major risk factor for both alzheimer ( ref . 85 ) and parkinson ( ref . 86 ) diseases , and dysregulation of cholesterol homeostasis is a
hallmark of neurodegenerative diseases ( ref . unfortunately , the effects of cholesterol on amyloid fibrillogenesis and toxicity are not
well understood and the results reported so far are controversial ( ref . 89 ) and stimulates its insertion into phospholipid
monolayers ( ref . 90 ) . 92 ) or
decreases ( refs 93 , 94 ) a polymerisation is still uncertain . moreover , the
generation of a peptides through app proteolysis occurs within lipid rafts and
is sensitive to inhibitors of cholesterol biosynthesis ( ref . 95 ) , so that the involvement of cholesterol homeostasis in alzheimer
disease can not be simply ascribed to the regulation of a fibrillogenesis . in the case of parkinson disease , data obtained with both cultured neuronal cells and
transgenic mice have shown that the cholesterol - depleting agent
methyl--cyclodextrin decreased the level of -synuclein in membrane
fractions ( ref . 96 ) . moreover , metabolic
inhibition of cholesterol biosynthesis with statins reduced the levels of
-synuclein accumulation in neuronal membranes , whereas cholesterol
supplementation of cultured neurons increased -synuclein aggregation ( ref . consistent with these studies , it was recently
reported that lovastatin treatment of -synuclein transgenic mice was associated
with a marked reduction of -synuclein aggregation and abrogation of neuronal
pathology ( ref . this suggests that treatment
with cholesterol - lowering agents might be beneficial for patients with parkinson disease . it has been suggested that oxidised cholesterol metabolites could accelerate
-synuclein aggregation ( ref . 71 ) , which
provides a mechanistic link between oxidative stress and parkinson disease . yet the
molecular mechanisms by which cholesterol and/or its metabolites could affect the
oligomerisation / aggregation status of amyloidogenic proteins have not been fully
deciphered . first , cholesterol has a major impact on the conformation of sphingolipids . the apolar
part of sphingolipids ( i.e. the most important part of the ceramide ) interacts with the
smooth face of cholesterol , whereas the oh group of cholesterol is accessible to the polar
part of the sphingolipid ( ref . this oh group is involved in an h - bond network that restricts the
conformation of the sugar moiety in a parallel orientation with respect to the membrane . this effect is particularly important when the ceramide contains a nonhydroxylated fatty
acid ( nfa , fig . because this conformation of
the sphingolipid is particularly suited for a sphingolipid - binding domain , cholesterol
usually accelerates protein binding to sphingolipid ( ref . by contrast , when the sphingolipid contains a
hydroxylated fatty acid ( hfa ) , the oh group of cholesterol is excluded from the h - bond
network and it can not exert its conformational effect on the sphingolipid . in this case ,
cholesterol does not improve but rather perturbs the organisation of sphingolipids and can
even inhibit glycosphingolipid binding to amyloidogenic proteins ( ref . thus , according to the distribution of hfas
versus nfas in sphingolipids , an increase of membrane cholesterol can lead to opposite
effects on sphingolipid - mediated amyloidogenic protein binding and aggregation . in any
case , these effects are due to a fine tuning of sphingolipid conformation induced by
cholesterol , and do not involve any kind of physical interaction between amyloidogenic
proteins and cholesterol . by contrast , the second mechanism involves a direct interaction between the amyloidogenic
protein and cholesterol . therefore , this effect requires the insertion of a part of the
amyloid protein in the membrane ; otherwise the protein would not be in physical contact
with cholesterol . 100 )
have shown that a peptide aggregation on the bilayer surface requires a
sphingomyelin - rich environment but can occur in the absence of cholesterol . this is in
line with our hypothesis that sphingolipids are fully responsible for the initial binding
of amyloidogenic proteins to lipid rafts , and that cholesterol is not directly involved at
this stage . however , at the second step the presence of cholesterol may greatly facilitate
peptide insertion into the bilayer . the preferential interaction of amyloidogenic proteins
with lipid raft domains ensures that cholesterol is indeed present underneath the
sphingolipids that have attracted the unstructured monomer ( fig . once inserted in the membrane , the amyloidogenic protein
will immediately find cholesterol and interact with its free side that is , the
face that is not in contact with sphingolipids ( for a detailed explanation of cholesterol
topology , see ref . figure 6lipid - dependent formation of an -synuclein oligomeric
channel . unfolded -synuclein monomers ( a ) are attracted by the
polar heads of glycosphingolipids and concentrated on the surface of
sphingolipid cholesterol membrane domains ( b ) . sphingolipids , complexed
with cholesterol , induce a conformational change ( unstructured to -helix
transition ) of -synuclein . the newly formed -helices can insert
into the plasma membrane ( c ) where they can further oligomerise under the control of
cholesterol molecules ( blue arrows ) ( d ) and eventually form an oligomeric ion
channel . such channels are thought to disturb membrane permeability to calcium ions
( red arrows ) , resulting in neuronal dysfunction and toxicity . the minus signs ( in
red ) refer to the negative charges of -synuclein . unfolded -synuclein monomers ( a ) are attracted by the
polar heads of glycosphingolipids and concentrated on the surface of
sphingolipid cholesterol membrane domains ( b ) . sphingolipids , complexed
with cholesterol , induce a conformational change ( unstructured to -helix
transition ) of -synuclein . the newly formed -helices can insert
into the plasma membrane ( c ) where they can further oligomerise under the control of
cholesterol molecules ( blue arrows ) ( d ) and eventually form an oligomeric ion
channel . such channels are thought to disturb membrane permeability to calcium ions
( red arrows ) , resulting in neuronal dysfunction and toxicity . the minus signs ( in
red ) refer to the negative charges of -synuclein . by stimulating the oligomerisation of membrane - inserted amyloidogenic proteins , cholesterol could facilitate the formation of a pore - like assembly displaying ion channel
properties ( fig . 10 ) have hypothesised that amyloid pore / channels
provide the most direct pathway for inducing neurodegenerative effects , through loss of
ionic homeostasis increasing cell calcium to toxic levels . the structure of amyloid pores ,
which have been observed by atomic force microscopy ( refs 9 , 10 ) , remains to be experimentally
elucidated at the atomic level . computational models have suggested that most amyloid
pores are probably formed by a complex assembly of -rich protofibrils or
oligomers ( ref . 130 ) , as shown in figure 1 . however , in the case of
-synuclein , tsigelny et al . 101 )
have elegantly modelled a realistic oligomeric channel formed by the assembly of
-helical monomers . the possible events leading to the formation of an
-synuclein oligomeric channel under the dual control of sphingolipids and
cholesterol are summarised in figure 6 . there is a
striking similarity between -synuclein ( refs 69 , 31 ) and colicin e1 , a bacterial
toxin that also inserts into anionic areas of the plasma membrane , forming channel - like
structures consisting of an -helix bundle ( ref . moreover , it has been hypothesised that amyloid pores might be
similar to -barrel pore - forming bacterial toxins ( ref . 103 ) . since cholesterol controls the oligomerisation and insertion
of these bacterial toxins ( ref . 104 ) in the
target membrane , it is likely that it is also required for the assembly of amyloid pores . how could cholesterol control the oligomerisation process of membrane - inserted
amyloidogenic proteins and facilitate the formation of amyloid pores ? the recent
high - resolution crystal structure of an engineered human adrenergic 2 receptor ,
suggesting a molecular mechanism by which cholesterol mediates receptor dimerisation ( ref . on the basis of these structural data , one could hypothesise that
cholesterol binds to membrane - embedded fragments of amyloidogenic proteins , facilitates
their recruitment and coordinates their oligomerisation . overall , this would mean that
amyloid pore formation and ion channel function are under the control of both
sphingolipids and cholesterol , in agreement with recent data obtained in model membranes
with -synuclein ( ref . finally , it has been reported that
spherical amyloid oligomers or protofibrils can also increase membrane conductance without
forming ion channels or pores ( ref . it is
not known if cholesterol and/or sphingolipids are involved in this nonspecific
permeabilising activity . the involvement of gangliosides in several neurodegenerative diseases is not totally
surprising if one considers that these sphingolipids are critical for neuronal integrity and
plasticity ( ref . since the probability of acquiring these
diseases gradually increases with age , it is important to evaluate how ganglioside
expression varies during the lifetime of individuals , and whether these diseases can alter
this process ( ref . the
differentiation of pc12 cells into neuron - like cells caused a marked increase in both
gangliosides and cholesterol , and thereby greatly potentiated the accumulation and
cytotoxicity of a ( ref . gm1 seems
to control the oligomerisation and aggregation process of a and
-synuclein ( refs 29 , 30 , 31 ) . gm3
has been shown to control -synuclein channel formation and to correct the
channelopathy induced in planar lipid membranes by the parkinson - disease - linked e46k mutant
of the protein ( ref . gm3
is a minor ganglioside , which , in marked contrast with the major ganglioside species gm1 and
gd1a , shows a regular increase with age ( ref . the expression of gm3 is highly regulated during brain development ( ref . 113 ) , and this ganglioside has been implicated in the
regulation of neuronal cell death ( ref . 114 ) .
moreover , the homozygous loss - of - function mutation of gm3 synthase , which totally suppresses
the expression of gm3 and all gm3-derived gangliosides , has been linked to an infantile
symptomatic epilepsy syndrome ( ref . these data indicate that ganglioside gm3 probably plays a more important role in
brain physiology and pathology than its low expression levels in adult brain could have
suggested in the past . several studies support the view that deregulation of lipid metabolism is an important
feature of neurodegenerative diseases . the three main lipid categories
glycerophospholipids , sphingolipids and cholesterol are affected ( refs 116 , 117 ,
118 , 119 , 120 , 121 ) . a large body of data has established a link between cholesterol
homeostasis , apolipoprotein e polymorphism and app processing ( ref . correspondingly , cholesterol - lowering strategies with statins
have acquired potential therapeutic importance in treating alzheimer disease ( ref . statins have also proved to be efficient in
decreasing -synuclein aggregation and neuronal toxicity in animal models of
parkinson disease ( ref . specific changes in
ganglioside content have been detected in the brains of patients with alzheimer disease
( refs 116 , 125 ) : a decrease or even loss of the major gangliosides gm1 , gd1a , gd1b and gt1b ,
and an increase in gm2 , gm3 and gd3 . similar alterations of ganglioside expression were
observed in the brains of transgenic mouse models of alzheimer disease ( ref . moreover , the balance between nfa and hfa ceramides is altered in animal models ( ref . interestingly , the authors of the latter study
showed that there is a gender - dependent accumulation of ceramides in the cerebral cortex :
female mice exhibited a strong increase in hfa species , and males in nfa species . this
observation could be linked to the increased risk of women versus men for developing
alzheimer disease ( ref . 129 ) . because cholesterol
can exert distinct effects on amembrane interactions according to the
nfa : hfa content of brain sphingolipids ( ref . 52 ) ,
it will be interesting to determine how cholesterol impacts on
aglycosphingolipid interaction in men and women suffering from
alzheimer disease . how amyloidogenic proteins kill neurons is still a mystery . in particular , as recently
discussed by butterfield and lashuel ( ref . 130 ) ,
there remains a knowledge gap regarding the molecular - level details by which
amyloid - forming proteins act on the membrane and induce membrane
permeabilization. deciphering the complex interplay between amyloidogenic
proteins and membrane lipids , especially sphingolipids and cholesterol , will certainly help
to achieve a clearer view on this enigma . several milestones have already been reached ,
which have inspired an important part of today 's research efforts worldwide . despite their
lack of amino acid sequence homology , amyloidogenic proteins share a number of intriguing
properties : ( 1 ) an important conformational plasticity , allowing the same protein to remain
unordered or to form highly ordered and structures ( refs 4 , 5 ) ; ( 2 )
self - oligomerising capacities that revealed unexpected common antigenic properties ( ref . 7 ) ; ( 3 ) the ability to form pore - like structures
with ion channel properties ( refs 9 , 10 ) ; ( 4 ) self - aggregating activity leading to
fibrillation and plaque deposition ( ref . 131 ) ; and
( 5 ) common structural motifs allowing specific interactions with sphingolipids ( ref . 49 ) and cholesterol ( yet uncharacterised ) in lipid raft
domains of the plasma membrane . it is intriguing that hiv-1 , which interacts with
glycosphingolipids through the v3 domain of its surface glycoprotein gp120 , can induce major
neurological disabilities , identified as hiv-1-associated dementia ( ref . 110 ) . in this respect , it is also worth noting that
the protein cln3 , involved in batten disease ( the juvenile form of neuronal ceroid
lipofuscinosis ) , also binds to galcer through a v3-like sphingolipid - binding domain ( ref . this neural disease is caused by a
mutation in this domain , namely e295k ( ref . 133 ) ,
which is analogous to mutations e22k in a , e46k in -synuclein and e200k
in prp , all associated with inherited forms of neurodegenerative disease and located in the
sphingolipid - binding domains of these proteins . at least for two of these proteins ( prp and
-synuclein ) , the substitution of an anionic glutamic acid side chain by a cationic
lysine resulted in altered binding to membrane sphingolipids ( refs 27 , 31 ) . this further
emphasises the key role of the sphingolipid - binding domain in neuronal diseases . future studies will be necessary to better evaluate the neurotoxicity of the various forms
of amyloidogenic proteins , including monomers , oligomers and aggregates , and to understand
how these different species cooperate to accelerate ( or slow down ) the onset of
neurodegenerative symptoms . this will help to decide on a rational basis which therapeutic
strategy should be used at the different stages of the diseases . this will be possible with
the finding of nontoxic drugs specifically affecting amyloid channels ( ref . 135 ) . combining molecular ( refs 31 , 52 ) , biophysical ( refs
14 , 31 ,
69 , 136 , 137 ) , cellular ( refs 93 , 114 ,
138 ) and animal ( refs 126 , 128 , 139 ) studies will allow a better characterisation of
the sphingolipids that regulate amyloid oligomerisation / aggregation . biophysical properties
of the membrane such as membrane curvature should be taken into consideration ( ref . 130 ) . indeed , depending on the surface curvature of
the model membrane , interestingly , gm1 and gm3 are
concentrated in membrane areas that markedly differ in membrane curvature ( ref . 143 ) , so that on binding to distinct gangliosides , the
same amyloid protein could adopt distinct conformations . this could be the case for
-synuclein , which recognises both gm1 ( ref . antiganglioside
antibodies could interfere with normal ganglioside function and could thus play a role in
disease pathogenesis , as anti - gm1 antibodies probably do in some parkinson patients ( refs
110 , 144 ) . careful determinations of the titres of these antibodies in various biological
fluids , including cerebrospinal fluid , will be particularly informative . beneficial effects
of ganglioside supplementation have been reported in animal models of parkinson disease
( ref . enzymes involved in glycosphingolipid metabolism might represent targets that inhibit both
the production and amyloid aggregation of alzheimer a peptides ( ref . correspondingly , lipid raft disruption has been
shown to protect neurons against amyloid oligomer toxicity in vitro ( ref . we need to better understand how cholesterol
interacts with amyloidogenic proteins , regulates their supramolecular structures and is
involved in the pathophysiology of neurodegenerative diseases ( refs 86 , 87 ) . we should also
determine how mutations of amyloidogenic proteins affect their interaction with neural
membranes ( refs 27 , 69 , 148 ) . a decisive
breakthrough will be to understand why neurodegenerative diseases involve specific brain
areas , and how local lipid composition may account for such geographic restrictions ( refs
127 , 135 ) . finally , we have to identify the environmental molecules ( such as food
contaminants , pesticides and mycotoxins ) that could modulate amyloid formation through
direct binding to amyloid proteins and could represent important risk factors for
neurodegenerative diseases ( ref . | alzheimer , parkinson and other neurodegenerative diseases involve a series of brain
proteins , referred to as amyloidogenic proteins , with exceptional
conformational plasticity and a high propensity for self - aggregation .
although the
mechanisms by which amyloidogenic proteins kill neural cells are not fully understood , a
common feature is the concentration of unstructured amyloidogenic monomers on
bidimensional membrane lattices .
membrane - bound monomers undergo a series of
lipid - dependent conformational changes , leading to the formation of oligomers of varying
toxicity rich in -sheet structures ( annular pores , amyloid fibrils ) or in
-helix structures ( transmembrane channels ) .
condensed membrane nano- or
microdomains formed by sphingolipids and cholesterol are privileged sites for the binding
and oligomerisation of amyloidogenic proteins . by controlling the balance between
unstructured monomers and or conformers ( the chaperone effect )
,
sphingolipids can either inhibit or stimulate the oligomerisation of amyloidogenic
proteins .
cholesterol has a dual role : regulation of protein
sphingolipid
interactions through a fine tuning of sphingolipid conformation ( indirect effect ) , and
facilitation of pore ( or channel ) formation through direct binding to amyloidogenic
proteins . deciphering this complex network of molecular interactions in the context of
age- and disease - related evolution of brain lipid expression will help understanding of
how amyloidogenic proteins induce neural toxicity and will stimulate the development of
innovative therapies for neurodegenerative diseases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during early development , pgcs originate in a particular region of the embryo that is often located a relatively great distance from where individual germ cells
will eventually reside . unlike other species , in avian and some reptile embryos , pgcs use blood circulation for transport to the gonadal anlage . this unique
biological property and accessibility of avian pgcs provides an opportunity to collect and transplant pgcs . it was
first reported in 1993 that transfer of chicken pgcs from early embryonic blood to the bloodstream of recipient embryos can result in transmission of the donor
genotype to offspring of recipient chickens . since then , several research groups have attempted to produce germline
chimeras using intravascular transplantation of pgcs , particularly in the chicken [ 8 , 9 , 11 , 13,14,15,16,17,18,19,20,21,22 ] . because blood circulation of avian pgcs is transient , appropriate timing of their collection and transplantation remain to be verified . although
several qualitative descriptions of the migration of avian pgcs through blood circulation have been reported , there has been very little quantitative observation . recent findings of
germline - specific molecular markers such as the chicken homologue genes vasa , dead end and dazl enable reliable
analysis of chicken pgcs .
therefore , the distribution and number of immunohistochemically stained chicken pgcs using anti - vasa antibody were observed to clarify when and where chicken pgcs
move from the extraembryonic region to the vasculature , and from the vasculature to the gonadal anlage . the entrance
of pgcs from the anterior part of the extra - embryonic region into the vascular network starts at stage 10 ( arabic numerals refer to the staging system of
hamburger and hamilton , 1951 ) and is completed at stage 13 . the migration of pgcs to the gonadal anlage begins at
stage 15 and is completed at stage 17 . however , access to developing vasculature is technically difficult until a chicken embryo reaches stage 13 . in addition ,
the frequency of germline transmission decreases when pgcs are transferred to the chicken embryos at stage 17 or later [ 21 ,
30 ] . both male and female pgcs collected from 5- to 7-day - old chicken embryos ( stages 2731 ) also have the ability to
differentiate into functional gametes following transplantation [ 31 , 32 ] . male germ
cells obtained from adult chicken testes , possibly spermatogenic stem cells , retain germline competency after transplantation to recipient embryos , but their competency seems lower than pgcs . in contrast to males , the germline competency of female germ cells is readily
lost from 15.5 days post - incubation owing to the start of meiosis . taking these into consideration , the appropriate
times for chicken pgc collection and transplantation are stages 1314 as well as 2731 , and stages 1316 , respectively . because the pgcs are a very small cell population during early development and comprise less than 0.02% of blood cells and approximately 2% of gonadal cells
[ 35 , 36 ] , transfer of intact blood or gonadal cells to recipient embryos results
in very low efficiency of producing germline chimeric chickens . recent investigations of several cell surface antigens
of chicken pgcs such as stage - specific embryonic antigen-1 ( ssea-1 ) and embryonic mouse antigen-1 ( ema-1 ) enabled
enrichment of chicken pgcs by magnetic activated cell sorting ( macs ) or florescence - activated cell sorting ( facs ) [ 36 ,
39 ] . the qcr1 antibody , which reacts with an epitope in pgcs of japanese
quail ( coturnix japonica ) and common pheasant ( phasianus colchicus ) , but does not react with chicken pgcs , is available for pgc
purification in these species [ 41 , 42 ] . the antigen - antibody reaction - based system
allows isolation of pgcs from both blood and gonads . in the future , further investigations of cell surface markers of pgcs in several avian species other than the
chicken , japanese quail , and common pheasant are anticipated . since avian embryonic blood cells are roughly composed of a small number of pgcs and a huge number
of erythrocytes , two approaches can be used to purify pgcs : one is separation of pgcs from erythrocytes by density gradient methods using ficoll or nycodenz
[ 6 , 35 ] , and the other is erythrocyte lysis using an ammonium chloride - potassium
buffer . among these , the nycodenz gradient centrifugation method achieves both high recovery and purity rates of pgcs
in the chicken and japanese quail . in addition to these species , availability of this method for duck ( anas
platyrhynchos ) , green pheasant ( phasianus versicolor ) and common pheasant has been confirmed ( nakamura et al . ,
unpublished data ) . a unique pgc enrichment method from gonadal tissues was developed in the chicken using the biological property that pgcs are discharged when
embryonic gonads are incubated in dulbecco s phosphate - buffered saline without ca and mg d - pbs( ) . this is the simplest method currently available to harvest chicken pgcs and is potentially applicable in various avian species . in the future ,
further improvement of unstable pgc recovery rate mammalian pgcs can only be propagated as lineage - restricted germ cells for short periods in vitro . in 2006 , etches and colleagues demonstrated that chicken pgcs
can be propagated for the long - term in vitro while maintaining lineage specificity and germline transmission competency . chicken pgcs isolated from embryonic blood can be expanded in a complex medium containing chicken serum , fetal bovine serum ( fbs ) ,
fibroblast growth factor 2 ( fgf2 ) , and buffalo rat liver ( brl ) cell - conditioned medium on a feeder of either brl cells or sandoz inbred mouse - derived
thioguanine - resistant and ouabain - resistant ( sto ) fibroblasts . several research groups revealed that fgf signaling is
required for chicken pgc proliferation in vitro [ 18 , 48 , 49 ] . a recent study has suggested that the membrane - bound form of chicken stem cell factor 2 ( scf2 ) , but not the secreted form
of chicken scf1 , enhanced the propagation of chicken pgcs in cooperation with fgf2 . however , this ill - defined culture
system can not support efficient propagation of female chicken pgcs . more recently , mcgrew and colleagues defined serum - free , feeder - free , and physio - chemically
permissive culture conditions for chicken pgcs , ascertaining that fgf2 , insulin , and activin are sufficient for the propagation of chicken pgcs . furthermore , a lower osmolality condition ( 250 mosm / kg ) , one of the characteristics of the defined culture system , also
enabled efficient derivation and propagation of both male and female chicken pgcs . establishment of long - term culture systems of chicken pgcs provides the
opportunity to significantly amplify donor pgcs before cryopreservation as well as to manipulate the genome with
subsequent cloning in a manner
similar to mouse embryonic stem ( es ) cells in the chicken . further investigations of culture conditions of non - chicken avian pgcs may help to conserve the genetic
resources of wild birds ex situ . to data , ultra - low temperature preservation of chicken pgcs has been performed using a slow - freezing method . the most widely used freezing protocol is
cryopreservation of chicken pgcs in serum containing media supplemented with 10% dimethylsulfoxide ( dmso ) as a cryoprotectant at a cooling rate of 1c / min until
reaching 80c . this freezing protocol yields a recovery rate of approximately 50% , and over 85% viability of post - thawing chicken pgcs [ 13 , 55 , 56 ] . several comparative studies have examined the types
of cryoprotectant including their concentrations and the cooling rates to investigate a more efficient protocol [ 22 , 55 , 57 , 58 ] . to summarize previous studies ,
chicken pgcs in a medium containing more than 10% serum and either 510% dmso or 10% ethylene glycol as cryoprotectants at a cooling rate of 2c / min result in
higher recovery and viability of post - thawed chicken pgcs than classic freezing protocols . commercially available serum and dmso - based cryomedium also results in
higher recovery and viability of chicken pgcs after thawing than a common freezing protocol . due to its easier
availability and higher performance , commercial cryomedium particularly cellbanker 1 ( nippon zenyaku kogyo , koriyama , japan ) has been used to cryopreserve pgcs
from chicken and quail [ 30 , 59,60,61 ] . in contrast to the slow - freezing method , a vitrification method can theoretically store cells both intracellularly and
extracellularly by ice - free solidification . although a previous study reported lower recovery and viable rates of vitrified pgcs than in frozen - thawed pgcs , the vitrification method could improve the recovery and viability of chicken pgcs after exploration of various vitrifying
protocols . several infertile animal models such as germ cell - deficient mutant mice and
triploid fishes have been used widely in germ cell transplantation studies to produce only donor - derived sperm or eggs [ 62 ,
63 ] . to date , genetic mutants either lacking germ cells or with deficient gametogenesis have not been reported in birds . zzz chicken embryos could potentially be used as
recipients for pgc transplantation , but rarely occur . thus , partial , if not complete , removal of endogenous pgcs prior to transplantation of donor pgcs is an
effective approach to increase the efficiency of donor - derived gametes in recipient chickens . surgical removal of tissues containing pgcs such as blastodermal
cells or blood from recipient chicken embryos resulted in increased germline chimerism [ 65 , 66 ] . irradiation of chicken embryos with x - rays or gamma - rays resulted in decreased number of endogenous pgcs and thus increased the proportion of
donor - derived gametes [ 67 , 68 ] . however these methods failed to produce stable
high - grade germline of chimeric chickens , suggesting recovery of the remaining endogenous pgcs after treatment . busulfan ( 1,4-butanediol dimethanesulfonate ) , a
dna alkylating agent , is the most commonly used drug for removal of endogenous germ cells in mammals . in particular in adult male mice , a single intraperitoneal
injection of over 40 mg / kg busulfan enables constant preparation of recipients lacking endogenous germ cells for germ cell transplantation [ 62 , 69 , 70 ] . although busulfan also has sterilization effects on
chicken and japanese quail germ cells during development , the degree of germ cell depletion is variable owing to less efficient drug delivery [ 71 , 72 ] . as shown in fig . 2 . production of sterilized recipient embryos by removal of endogenous primordial germ cells ( pgcs ) using a unique drug delivery method and its application
for pgc transplantation . ( a ) a sustainable emulsion containing busulfan contacts with the chicken embryos rapidly after injection into the yolk . ( b ) this
drug delivery method allowed elimination of pgcs at a constant level . ( c ) donor pgcs could repopulate with gonads of sterilized recipient embryos after
transplantation . ( d ) use of sterile recipients enabled efficient production of chickens that produce only donor - derived offspring . scale bars , 1 cm ( a ) and
100 m ( b and c ) . 2008 ) developed a unique drug delivery method by utilizing a biological property of the chicken embryo - it lies on the
top of the yolk even if the egg is rotated . the principle of this method is as follows : a sustainable emulsion
containing busulfan rapidly rises when it is injected into the yolk then contacts with the chicken embryos owing to a lower density than the yolk contents . a subsequent study revealed that application of busulfan at an early time point could reduce
the sterilizing effects of the residual drug on donor pgcs . finally , an experiment was attempted to transplant donor
chicken pgcs to sterilized recipient embryos following administration of busulfan . of 11 resulting recipients , seven produced only donor - derived gametes ( 99.5% on
average of total recipients ) . as described above , the production efficiency of donor - derived gametes was markedly
increased using sterile recipients . in the future , production of chicken lines where the germ cells are completely depleted is required for more efficient
production of recipient chickens that produce only donor - derived offspring . for example , in combination with transgenesis of cultured pgcs in
vitro , generation of cre / loxp system - mediated germ cell - specific knock - out or ablation avian models via germline chimeras would be the best
approach . production of sterilized recipient embryos by removal of endogenous primordial germ cells ( pgcs ) using a unique drug delivery method and its application
for pgc transplantation . ( a ) a sustainable emulsion containing busulfan contacts with the chicken embryos rapidly after injection into the yolk . ( b ) this
drug delivery method allowed elimination of pgcs at a constant level . ( c ) donor pgcs could repopulate with gonads of sterilized recipient embryos after
transplantation . ( d ) use of sterile recipients enabled efficient production of chickens that produce only donor - derived offspring . scale bars , 1 cm ( a ) and
100 m ( b and c ) . in this review , recent technical advances regarding avian pgc manipulation for use in poultry pgc - bank programs have been introduced . as shown in fig . , the procedures of ex situ conservation of poultry genetic resources consist of five steps ; 1 ) collection of embryonic tissues containing
pgcs from target lines or breeds , 2 ) purification or culture of pgcs , 3 ) pgc storage in liquid nitrogen , 4 ) pgc transplantation to sterilized recipient embryos ,
and 5 ) recovery of populations by mating of male and female recipients . to date , successful long - term culture of pgcs from various chicken breeds including
indigenous breeds has been reported [ 9 , 18 , 22 , 49 ] . therefore , at least in the chicken , the major advantage of pgcs for use as a source of gene banking is
that pgcs obtained from a single donor embryo would be amplified significantly in vitro prior to cryopreservation . in addition , transplantation
of post - thaw pgcs to sterile recipients of a commercial layer line would be rapidly and significantly multiplied , recovering the population size from only a small
flock of recipients . the most important aspect of gene banking is the collection of germplasm without losing the present wealth of genetic diversity . to recover a population whilst
maintaining sustainable genetic diversity from the germplasm repository , it will be necessary to conserve the germplasm from at least 13 individuals of each sex
( ideally 25 individuals of each sex ) . thus , the collection of pgcs from fertilized embryos obtained from various
combinations of males and females in each population would be ideal for poultry gene banking . from an industrial point of view , cryopreservation of pgcs could be
used as back - up for commercially or industrially important poultry lines or breeds that have been selected for a long time in case of they are lost as a
consequence of pathogen outbreaks , genetic problems , breeding cessation , or natural disasters . additionally , pgc cryobanking enables a dramatic reduction of costs
associated with maintenance of live birds . collection of pgcs from developing gonads has the advantage of recovering a large
number of pgcs and ensuring a prolonged period for collection . however all embryos which have the potential to hatch out under ordinary circumstances must be
sacrificed for gonadal pgc collection . therefore , the practical use of gonadal pgcs would be restricted if the availability of fertilized embryos is not limited ,
such as the case with industrially as well as commercially valuable poultry breeds or lines . however , the availability of fertilized embryos in most noncommercial
breeds such as indigenous , rare and/or endangered breeds is restricted by several factors such as small population sizes , low egg production , and seasonal
breeding . a unique biological property of avian pgcs that temporally circulate thorough the vascular system would provide the opportunity to combine the
reproduction of living birds with collection of pgcs . indeed , of the 88 fertilized embryos of gifujidori used for pgc collection , 12 survived to sexual maturity
with normal reproductive capacity . subsequently , six gifujidori offspring were successfully regenerated ( 6% of total offspring ) by mating male and female
recipient chickens that had received frozen - thawed gifujidori pgcs . in this method , it was also demonstrated that this procedure is available for combined preservation of living birds with pgcs in japanese
quail , green pheasant , and common pheasant ( nakamura et al . , unpublished data ) . in fish , male germ cells ( type a spermatogonia ) and female germ cells ( oogonia ) that are transplanted to the opposite sex of recipients can differentiate into
functional eggs and sperm [ 63 , 76 ] . although chicken pgcs can differentiate into
functional gametes in the gonads of opposite sex recipients , the efficiency is very low . histological analysis
suggested that female pgcs in male chicken gonads are capable of passing through the first and second meiotic divisions , but rarely complete spermatid elongation
. for gene banking purposes , male and female pgcs should be collected separately and cryopreserved , as efficient
germline transmission of pgcs requires that the sex of the donor be matched to the sex of the recipient . if avian pgcs can differentiate into functional gametes in the gonads of xenogeneic recipients , pgc transplantation could be a powerful tool for ex
situ conservation of wild birds including endangered species . in avian species , xenogeneic germline transmission between phylogenetically different
genera ( common pheasant to chicken ) , family ( chicken to guinea fowl ( numida meleagris ) ) or order ( duck to chicken , and houbara bustard
( chlamydotis undulata ) to chicken ) was reported only in males , but not in females [ 42 , 79,80,81,82 ] . in future , detailed histological analysis is needed to evaluate the ability of xenogeneic gametogenesis by transfer of donor pgcs carrying a
reporter gene to sterilized interspecific recipient embryos . 2013 ) reported that cryopreservation of pgcs and subsequent production of functional gametes following
transplantation is also feasible in japanese quail in which the semen has not been cryopreserved . more recently , a
practical trial reported that successful transport of a chicken breed by shipment of cryopreserved pgcs using a dry shipper . in such a situation , it should be possible to run poultry pgc - bank programs that conduct a collection , cryopreservation , depositing , and
distribution service . based on the recent technical advances in poultry pgc manipulation described here , collection , freezing and storage of pgcs from both
industrial and indigenous poultry breeds has begun as part of the national institute of agrobiological sciences ( nias ) genebank projects ( nias , tsukuba , japan ) .
at present , the nias genebank contains 15 chicken breeds , including eight indigenous breeds that are designated as natural treasures of japan ( gifujiori ,
hinaidori , jitokko , koeyoshi , kurokashiwa , satsumadori , toumaru and yakido ) , and three japanese quail lines ( nakamura et al . , unpublished data ) .
to date , successful transplantation of freeze - thawed immature ovarian tissues to a juvenile recipient has been performed in the japanese quail . because of its high production efficiency of donor - derived eggs in recipients , immature poultry ovarian tissues cryopreservation of pgcs together with frozen stocks of semen and immature ovaries will ensure preservation of
poultry genetic resources economically and semi - permanently . the falcon ( falco peregrinus japonensis ) is classified as vulnerable ( i.e. , species facing a high risk of
extinction in the wild ) by the japanese ministry of environment red list . i
do not know whether this idea can be realized , but i intend to establish germ cell manipulation technologies that are universally available across species , to
allow conservation of genetic resources of various animal species . | the majority of poultry genetic resources are maintained in situ in living populations
. however , in situ conservation of
poultry genetic resources always carries the risk of loss owing to pathogen outbreaks , genetic problems , breeding cessation , or natural disasters .
cryobanking
of germplasm in birds has been limited to the use of semen , preventing conservation of the w chromosome and mitochondrial dna .
a further challenge is posed by
the structure of avian eggs , which restricts the cryopreservation of ova and fertilized embryos , a technique widely used for mammalian species . by using a
unique biological property and accessibility of avian primordial germ cells ( pgcs ) , precursor cells for gametes , which temporally circulate in the vasculature
during early development , an avian pgc transplantation technique has been established . to date , several techniques for pgc manipulation including purification ,
cryopreservation , depletion , and long - term culture have been developed in chickens .
pgc transplantation combined with recent advanced pgc manipulation
techniques have enabled ex situ conservation of poultry genetic resources in their complete form . here , the updated technologies for avian pgc
manipulation are introduced , and then the concept of a poultry pgc - bank is proposed by considering the biological properties of avian pgcs . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
colorectal cancer ( crc ) is the second leading cause of cancer - related deaths in the united states men and women combined ; statistical estimates for 2015 indicate ~132,700 new crc cases and 49,700 associated deaths . though several initiatives involving colon screening and therapeutic interventions have impacted the overall crc management in the developed countries of the world , clearly more efforts are still needed to overcome crc risk , to arrest the disease progression , and to reduce the mortality numbers associated with this malignancy . one such effort that has gained an appreciable momentum over the last three decades , involves the intake of non - toxic natural dietary / non - dietary agents which can be used globally , for the prevention of crc . in most cases , these agents , derived from fruits and vegetables as well as herbs and other supplements , have been shown to reduce the incidence of pre - neoplastic adenomatous polyps and/or their progression to more advanced forms of crc ( fig . , an attempt has been made to tabulate and summarize the beneficial effects of one such natural chemopreventive agent i.e. , silibinin , against crc . silibinin is a flavonolignan which is isolated from the seeds of milk thistle , silybum marianum ( fig . 2 ) ; it has a long history of human use for liver ailments , widely available as a nutraceutical supplement and now clinically used to manage hepatotoxicity in various countries including the united states . importantly , silibinin is considered as a very promising cancer chemopreventive agent based on completed studies showing its strong efficacy against various epithelial cancers ( fig . as elaborated in detail in this review , silibinin has shown significant in vitro and in vivo anti - crc efficacy in various pre - clinical models of crc . inferences from completed in depth studies investigating the cellular and biological mechanisms associated with anti - crc effects of silibinin are summarized in tables 14 , which detail the effect of silibinin on various molecules regulating cell cycle , cell survival , autophagy , apoptosis , angiogenesis , and inflammation in its efficacy against colon tumorigenesis . natural dietary agents , such as silibinin , can reduce the incidence of pre - neoplastic lesions by targeting cancer stem cells and proliferating bulk tumor cells to prevent the disease progression to more advanced forms of the malignancy . silibinin inhibits tumorigenesis , inflammatory responses , and angiogenesis involved in crc growth and progression . b : chemical structure of silibinin - the principal bioactive constituent of milk thistle extract isolated from the dried seeds of milk thistle . silibinin inhibits various signaling and regulatory pathways in its chemopreventive and therapeutic efficacy against various epithelial cancers . under in vitro cell culture conditions , silibinin has been shown to inhibit the growth and proliferation of a wide range of crc cells ( table 1 ) . mechanistic studies have attributed these inhibitory effects to cell cycle arrest as well as both caspase - dependent and -independent apoptotic pathways ( table 1 ) . an increase in cyclin - dependent kinase ( cdk ) inhibitors kip1/p27 and cip1/p21 , together with a decrease in the kinase activity of cdk2 and cdk4 in g0/g1 arrested crc cells ; while an increase in the kinase activity of cdc2/p34 molecule along with a decrease in protein expression of cell cycle regulators cdc25c , cdc2/p34 and cyclin b1 by silibinin in g2 m arrested crc cells have been reported ( table 1 ) . furthermore , a decrease in the hyperphosphorylation of retinoblastoma ( rb ) by silibinin has also been reported as one of the mechanisms involved in the early cell cycle arrest induced by silibinin in crc cells ; though total rb levels are unaffected , a decrease in the protein expression levels of cyclin -d1 , -d3 , -a and -b1 and cdk-1 , -2 , -4 , and -6 by silibinin has been reported . the in vitro effects of silibinin alone or in combination with other molecules are summarized in table 1 . growth inhibition : dose ( 50 - 100 g / ml ) and time ( 24 - 72h ) dependent . g2/m cell cycle arrest ( higher dose : 100 g / ml ) . no apoptosis at lower doses . apoptotic death ( ~ 15% ) after 48 hours with 100 g / ml dose . annexin v staining for apoptosis , caspase activity assay , and cytochrome c localization analysis . mrna and protein levels of kip / p27 and cip/ p21 protein levels of cdc25c , cdc2/p34 , and cyclin b1 kinase activity of cdc2/p34 caspase independent apoptosis . inhibitory effects of silibinin ( 100 mol / l dose ) on -catenin mediated signaling . 2010 inhibitory effects of silibinin ( 1 - 100 mol / l dose ) on cdk4 signaling pathway . mtt cell viability assays . protein levels of cdk-4 , and cyclin d1 hyper phosphorylation of retinoblastoma dose and time dependent growth inhibition . apoptosis of ht29 cells via egr - l - mediated nsaid - activated gene-1 ( nag-1 ) up - regulation ( silibinin : 50 - 100 mol / l dose ) . ectopic expression of egr-1 significantly upregulates nag-1 promoter activity and nag-1 protein expression in a dose - dependent manner . ic50 in fet and geo lines is 75 g / ml and 40 g / ml for hct116 cells at 72 hours . growth inhibitory effects more due to inhibition of cell cycle regulatory molecules than due to apoptosis . protein levels of kip / p27 and cip / p21 protein levels of cyclin bl / dl and cdk-2 no effect on cox-2 levels . dose ( 50 - 200 mol / l ) and time ( 24 - 72 hours ) dependent growth inhibition . g1 cell cycle arrest ( lower / higher doses ) as well as g2 m arrest with 200 mol / l . protein levels of cleaved caspase -3 and -9 , and cleaved parp protein levels of kip / p27 and cip / p21 protein levels of cyclin- d1/-d3/-a/-b1 and cdk-1/-2/-4/-6 hyper phosphorylation of retinoblastoma
anti - angiogenic effect . inhibits the chemotaxis migration of endothelial cells ea.hy.926 towards crc cells ( ic50 : 0.66 mol / l dose ) . inhibits ea.hy.926 capillary formation ( ic50 : 2.6 mol / l dose ) . vascular density index in the choriallontoic membrane assay by 20 mol / l dose . transwell migration and matrigel based capillary tube formation assay . mrna levels of vegfr - l(flt - l ) vegf secretion by lovo cells ( ic50 : 131.7 mol / l dose ) . 2003/2005 invasiveness of crc cells il-6 induced proliferation and invasion of lovo cells [ h ] thymidine incorporation assay . mmp-2 promoter activity via attenuation of ap-1 binding activity . cell growth inhibition by 50 - 200 mol / l dose after 24 - 72 hours . nuclear and cytoplasmic -catenin levels expression of -catenin regulator cdk-8 -catenin - dependent tcf-4 transcriptional activity expression of -catenin transcriptional targets : c - myc and cyclin d1 anti - inflammatory effect ( 50 - 100 nuclear levels of p65 and p50 ib protein levels phospho- ib levels nfb transcriptional activity 300 mol mrna and protein levels of death receptors dr4/-5 both intrinsic and extrinsic apoptotic pathways involved . / l dose synergizes with hd ac inhibitors : ( saha and trichostatin a ) to cause cellular death . pi3k - akt - mtor pathway and erk1/2 pathway no inhibitory effect on normal human colon ncm 460 cells . events associated with autophagy long term exposure causes autophagic cell death ( 100 mol / l dose ) while higher doses ( 200 mol / l dose ) cause apoptosis . metabolomics study utilizing 13c , 1h , 3ip based nmr spectroscopy . early on reactive oxygen species generation . pi3k - akt - mtor pathway and erk1/2 pathway interference in mitochondrial metabolism , phopspholipid and protein synthesis , and glucose uptake . abbreviations : crc , colorectal cancer ; facs ; fluorescence- activated cell sorting ; mtt , 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2h - tetrazolium bromide ; rt - pcr , reverse transcription polymerase chain reaction ; tcf-4 , t - cell factor-4 ; trail , tnf - related apoptosis - inducing ligand ; hdac , histone deacetylase ; dnmt , dna methyltransferase ; saha , suberoylanilide hydroxamic acid ; igf-1 , insulin - like growth factor-1 ; egf , epidermal growth factor ; emsa , electrophoretic mobility shift assay ; nmr , nuclear magnetic resonance . other in depth studies have shown that at physiologically relevant dose ( 100 mol / l ) , silibinin causes oxidative stress in crc cells , which triggers an apoptotic response , and is followed by a chain of events involving strong inhibition of the pi3k - akt - mtor pathway , activation of the erk1/2 pathway , rough endoplasmic reticulum stress ( er ) , and suppression of protein translation , which results in autophagy - mediated programmed cell death type ii . high - resolution nuclear magnetic resonance spectroscopy ( h , c , p - nmr ) studies have further confirmed that silibinin interferes with essential mitochondrial metabolic pathways , and the events associated with both phospholipid as well as protein synthesis . furthermore , silibinin has also been found to interfere with the glucose uptake in these cells ; overall , these events result in energy restriction in crc cells and their severe and irreparable injury by silibinin . studies have also shown that significant apoptotic death of crc cells occurs when high silibinin doses are used , which suggests that silibinin harbors the potential to induce both apoptotic and autophagy associated programmed cell death in crc cells . with regards to silibinin efficacy against crc stem cells ( csc ) , silibinin has also been shown to interfere with the kinetics of csc pool generation , which in turn , decreases the self - renewal and rectifies the aberrant differentiation of the csc . these results are detailed in table 2 ; the potential of silibinin to target csc is being extensively investigated by our group ( table 2 ) . our in vitro studies showed that silibinin strongly decreases the percentage of colonosphere formation ( a stem cell characteristic ) of crc cells and that this effect on csc is mediated via blocking of interleukin ( il)-4/6 signaling in crc cell lines . silibinin also caused a strong decrease in il-4/6 induced activation of stat-3 and nf - kb transcriptional activity , which was associated with decreased mrna / protein levels of various csc regulatory molecules , and csc - associated markers and transcription factors ( table 2 ) . we also found that silibinin significantly reduces the booster signals of macrophages towards csc , resulting in decreased colonosphere numbers under both normoxic and hypoxic conditions ( agarwal & colleagues 2015 , unpublished data , table 2 ) . these results are highly significant , given the fact that silibinin has shown efficacy against both csc and bulk cancer cells , and that csc are now primarily recognized as the essential factors contributing to initiation / progression as well as the relapse of crc . csc from primary crc isolated from human tumor with duke c3 crc stage , and ht-29 cells . more differentiated clones pp2a - akt - mtor pathway
25 - 100 mol / l dose used . csc : cd44 epcam cells number and size of coionospheres il4 and il6 mediated effects on csc il4 and il6 induced effects on nfb and stat-3 mrna and protein levels of lgr5 , ascl2 , cd44 , cd133 , oct 4 , nanog . msi-1 , bmi-1 , and hes-1 symmetric self - renewal of csc more differentiated clones booster signals of macrophages ( u937 and thp-1 ) towards colon csc resulting in decreased coionosphere numbers under both normoxic and hypoxic conditions . csc : cd44 epcam cells macrophage mediated effects on csc silibinin modifies the cytokine profile of macrophage conditioned media . agarwal & colleagues 2015 : tumorigenic potential of csc ( cd44epcam crc cells ) csc self - renewal in serial transplantation studies inhibitory effects on both csc and bulk daughter cells . s.c cell injections of sorted csc ( cd44epcam ) ht-29 cells mixed with matrigel ( 1:1 ) in flank of nod / scid male mice . after 24 hours of cell injections ; oral gavage with silibinin ( 200 mg / kg ) in cmc vehicle every day for ~40 days . diffusion weighted mri , dce - mri , and fdg - pet ; facs , confocal microscopy , and paired cell analysis . tumor cellularity , vascularity , glycolytic activity tumor growth in serial transplantation studies symmetric self - renewal of csc asymmetric self - renewal of csc shifts the cell division to symmetric proliferation resulting in generation of two daughter cells transforms / differentiates cd44 population into a cd44- phenotype . agarwal & colleagues 2015a : abbreviations : crc , colorectal cancer ; csc , colorectal cancer stem cells ; facs ; fluorescence- activated cell sorting ; rt - pcr , reverse transcription polymerase chain reaction ; rtpcr , real -time rt - pcr ; emsa , electrophoretic mobility shift assay ; mri , magnetic resonance imaging ; dce - mri , dynamic contrast enhanced - mri ; 18fdg - pet , 18fluorine-2-deoxy - glucose ( fdg ) positron emission tomography . notably , several in vitro mechanistic studies have used high doses of silibinin ( 300 mol / l ) ; the clinical relevance of such high doses warrants caution ; this is founded on the results of several preclinical as well as clinical trial studies that underline limiting the silibinin concentration to ~100 mol / l dose in in vitro studies based on silibinin concentrations achievable in mouse plasma and colon tissues of crc patients . specifically , the results of the clinical trial data showed that silibinin feeding in the form of 720 mg / day ( formulated with phosphatidylcholine ) as silipide capsules for 7 days to crc patients leads to high bioavailability of silibinin in colonic tissue ( 121 nmol / g of silibinin traced in colonic tissue which is equivalent to 121 mol / l silibinin concentration ) . using azoxymethane ( aom ) and 1,2-dimethylhydrazine ( dmh ) as potential carcinogens to induce sporadic crc in rodent models , various research groups have demonstrated the potential of silibinin to decrease the number of carcinogen - induced aberrant crypt foci ( acf ) , crypt multiplicity as well as colonic tumors in these colon tumorigenesis animal models ( table 3 ) . to determine the stage specific efficacy of silibinin feeding , different silibinin feeding protocols based on whether silibinin feeding started before the carcinogen exposure ( pre - initiation phase ) , during the carcinogen exposure ( initiation phase ) , after the carcinogen exposure ( post - initiation phase ) , or through the entire period of the study ( pre-/-post initiation phase ) were carried out ; though all silibinin feeding protocols showed efficacy against crc growth and progression , the percentage of crc inhibition was stronger in the animals on the pre-/-post - initiation protocol . silibinin has also shown significant efficacy against spontaneous intestinal tumorigenesis in apc mice model ( table 3 ) . both short and long term intervention studies with silibinin have confirmed that total intestinal polyps are significantly reduced in number and size by silibinin feeding . while a decrease in proliferation index and an increase in apoptotic index were observed in the polyps of silibinin treated mice , furthermore , our lab has also used a colitis - related aom / dss - induced colon tumorigenesis model to assess the role of inflammatory conditions on colon csc generation and expansion , and their modulation by silibinin . our results have indicated the protective effect of oral silibinin feeding in this model as evidenced by the absence of large macroadenomas ( > 2 - 3 mm ) in the colon . this effect was accompanied by minimal colonic inflammation ( decrease in recruitment of inflammatory cells ) ; tissue analysis indicated a decrease in the expression of pro - inflammatory cytokines , and associated transcription factors : stat-3 and nf - kb levels in the colonic tissues ( table 3 ) . a decrease in transformed stem cell population ( for csc pool expansion ) was also identified ( dual staining for bmi-1 and cd44 ) in the colonic tissues . silibinin feeding has also shown significant preventive and/or therapeutic efficacy against human crc xenograft tumors in athymic nude mice ( table 4 ) . these studies indicate that not only has silibinin an inhibitory effect on tumor growth , but this inhibitory effect is sustained even after silibinin withdrawal ; furthermore , silibinin has also shown significant efficacy against established xenograft tumors . dose dependent decrease in azoxymethane ( aom)-induced pre - neoplastic aberrant crypt ( acf ) formation and crypt multiplicity . inhibition more pronounced when silibinin given prior to initiation and continued till study end ( pre-/-post initiation protocol ) . silibinin feeding protocols : pre - initiation ; post - initiation ; and pre-/-post initiation . pcna positive cells apoptotic cells ; cleaved parp cyclin dl , cox-2 , and inos velmurugan et al . inhibition more pronounced when silibinin given prior to initiation and continued till study end ( pre-/-post initiation protocol ) . oral gavage with silibinin ( 250 - 750 mg / kg ) in cmc vehicle for 5 days a week . pcna positive cells apoptotic cells , cleaved ( caspase-3 and parp ) and p21 cyclin dl , cox-2 , vegf , and inos nuclear and cytoplasmic -catenin key molecules of igf-1 axis : phospho ( igf-1 r , akt and gsk-3 ) ravichandran et al . oral gavage with silibinin ( 300 mg / kg ) in cmc vehicle every day . silibinin feeding protocol : start one week after last aom ( post - initiation ) . protein levels of bcl-2 and bax levels mrna levels of inflammatory markers : mmp-7 , ell- , and tnf protein levels of mmp-7 inhibits 1 , 2-dimethylhydrazine ( dmh)-induced colonic pre - neoplastic changes . acf formation , dysplastic acf , and tumor incidence restores the levels of gsh - dependent enzymes . lipid peroxidation in colonic tissues and enzymic anti - oxidants male albino wistar rats . oral gavage with silibinin ( 50 mg / kg ) in cmc vehicle every day . silibinin feeding protocols : initiation ; post - initiation ; pre-/-post initiation ( entire period ) . fecal biotransforming microbial enzymes colonic and fecal -glucuronidase mucosal and fecal activities of -glucosidase and -galactosidase nitroreductase and sulphatase -catenin , pcna , agyrophillic nucleolar organizing regions , and cyclin dl prevents suppression of cdx2 mrna and protein levels . 2009/2010a/2010b/2012/2014 intestinal adenoma numbers unformulated silibinin more effective than silibinin - phospholipid complex preparation ( * silipide ) . oral gavage with silibinin ( 250 - 750 mg / kg ) in cmc vehicle for 5 days a week . pcna positive cells -catenin , cyclin dl , c - myc , phospho ( akt and gsk-3 ) , cox-2 , and inos , levels nitrotyrosine and nitrite levels rajamanickam et al . 2009 decrease in total number of intestinal polyps in proximal ( 27% ) , middle ( 34% ) , and distal regions ( 49% ) . decrease in polyp numbers in size range > 2 - 3 mm ( 92% ) . anti - proliferative , pro - apoptotic , anti inflammatory , and anti - angiogenic effects ( normal crypt - villus region unaffected ) . oral gavage with silibinin ( 750 mg / kg ) in cmc vehicle for 5 days a week . pcna positive cells apoptotic cells , cleaved ( caspase-3 and parp ) immunoreactivity of hif - l , vegf , enos , and nestin inhibitory effects on -catenin mediated signaling . nuclear -catenin , cyclin dl , cox-2 , and pge2 levels modulates cytokine profile in intestinal polyps . mice sacrificed after 3 months of silibinin feeding ki67 positive cells incidence of high grade dysplasia and intramuscular carcinoma mice with prolapsed rectum inflammatory cells / markers and associated transcription factors male balb / c mice . 2% dss in drinking water for 7 days . oral gavage siliphos ( * silibinin - phyto - some preparation-600mg / kg in cmc vehicle every day : pre-/-post initiation ) . mast cells , macrophages , nfb , stat-3 , cox-2 , il-6 , and il-4 colon csc markers / regulatory factors / transcription factors cd44 cells and bmi-1+/cd44 + dual stained cells nuclear ( sox2 , nanog , and oct 3/4 ) agarwal & colleagues 2015b : abbreviations : aom , azoxymethane ; acf , aberrant crypt foci ; dmh , 1 , 2- dimethylhydrazine ; cmc , carboxymethyl cellulose ; dss , dextran sodium sulphate ; csc , colorectal cancer stem cells * siliphos or silibinin - phytosome ( from indena , italy ) that contains silibinin and phosphatidylcholine in 1:2 ratio . * silipide ( from indena , italy ) that contains silibinin and phosphatidylcholine in 1:1 ratio . tumor volume ( 48% ) and tumor weight ( 42% ) decreased by silibinin . * silibinin - phytosome showed more significant inhibitory effect due to better bioavailability . s.c cell injections of 4 10 ht-29 cells mixed with matrigel ( 1:1 ) in right flank of athymic balb / c nu / nu male mice . after 5 days of implantation oral gavage with silibinin or * silibinin - phytosome ( sp ) combination in cmc vehicle , 5 days a week for 32 days . daily dose : silibinin ( 200 mg / kg ) ; silibinin - phytosome ( 300 - 600 mg / kg)-which is equivalent to 100 - 200 mg / kg silibinin . pcna positive cells cyclin dl and phospho ( erk1/2 and akt ) cox-2 , hif - l , inos , and nos3 inhibits tumor growth and cell proliferation . tumor volume ( 34% - 46% ) and tumor weight ( 38% - 49% ) decreased by 100 and 200 mg / kg silibinin , respectively . s.c cell injections of 5 10 lovo cells mixed with matrigel ( 1:1 ) in right flank of athymic balb / c nu / nu male mice . after 24 h of cell injections ; oral gavage with silibinin in cmc vehicle , 5 days a week for 6 weeks . pcna positive cells kip / p27 protein levels no effect on protein levels of cdk 's , cyclins , and cip / p21 . phosphorylation of rb at ser 795 , ser 807/811 sites and total rb levels inhibits tumor growth and cell proliferation but induces apoptosis . tumor volume ( 26% - 46% ) and tumor weight ( 29% - 52% ) decreased by 100 and 200 mg / kg silibinin , respectively . s.c cell injections of 5 10 sw480 cells mixed with matrigel ( 1:1 ) in right flank of athymic balb / c nu / nu male mice . after 24 h of cell injections ; oral gavage with silibinin in cmc vehicle , 5 days a week for 6 weeks . expression of -catenin signaling associated molecules : c - myc , cyclin dl , and cdk8 protocol i : even after silibinin withdrawal , a decrease in tumor volume sustains . s.c cell injections of 5 10 sw480 cells mixed with matrigel ( 1:1 ) in right flank of athymic balb / c nu / nu male mice . protocol i : silibinin fed to growing tumors , after 24 h cell injections for 28 days ; after 28 days silibinin stopped but tumor study continued for more 21 days . protocol ii : 25 days past cell injections , silibinin fed to mice with established tumors , and tumor study continued for 16 more days in presence of silibinin . pcna positive cells expression of p - catenin and phospho- gsk-3 , cyclin dl , c - myc , and survivin vegf , inos , and cd31 velmurugan et al . crc cells from primary tumors in spheroid culture ( or ht-29 cells ) with and without silibinin treatment ( 5 g / ml ) for 15 days . 10 to 2 10 spheroid culture enriched cells were silibinin treated prior to injections . s.c cell injections of 5 10 cells done and tumor growth monitored for 6 weeks to 6 months . in vitro effect on cancer stem cells in spheroid culture inhibits tumorigenicity and tumor growth under in vivo conditions . archived tumor tissues from lovo and sw480 xenografts used total p65 immunoreactivity score nfb transcriptional activity levels of nfb regulated molecules : cyclin dl , bcl-2 , vegf , mmp-9 , and inos induction of starvation induced autophagy . immunoreactivity score of sqstm1 sqstm1 protein expression in tumor lysates . [ sqstm1 is selective substrate of autophagy and its protein levels are decreased during starvation induced autophagy ] . abbreviations : crc , colorectal cancer ; cmc , carboxymethyl cellulose ; rb , retinoblastoma . * silibinin - phytosome ( from indena , italy ) that contains silibinin and phosphatidylcholine in 1:2 ratio . the summarized studies in four tables provide adequate evidence highlighting the potential of silibinin intake to significantly impact crc growth and progression . these results also indicate silibinin potential to interfere with csc pool expansion via targeting both csc , bulk daughter cells and their inflammatory niche , as well as associated signals involved with the survival and multiplication of colon csc pool ( fig . 4 ) ; the various mechanisms involved in these inhibitory effects are : a ) silibinin causes cell cycle arrest resulting in decreased proliferation , and induces multiple programmed cell death mechanisms ; b ) silibinin interferes with cellular metabolism to induce energy restriction like conditions ; and c ) silibinin inhibits various signaling and regulatory pathways involved in tumorigenesis , inflammatory responses , and angiogenesis . the inflammatory milieu of the colorectal cancer stem cells ( csc ) niche is an important growth regulator for both csc and progenitor cell population . silibinin has the potential to target colon csc self - renewal and aberrant differentiation , and associated inflammatory niche during crc inhibition . given that silibinin has the potential to target the csc or the tumor initiating cells , it can be beneficial for use in the early stages of crc development , as well as in later stages in cancer treatment to eradicate the csc pool and bulk tumor cells to prevent cancer relapse ( fig . given the fact that silibinin consumption is exceptionally safe and that it has high bioavailability in colonic tissue of crc patients , the efficacy evaluation of silibinin in clinical trials is advocated , both as a crc preventive agent and as an adjunct therapy for its clinical use in crc cases which are incurable by current therapeutic modalities . novel preventive and therapeutic strategies are needed to reduce csc number , target their self - renewal capacity or rectify their aberrant differentiation , or interfere with the pro - tumorigenic signals arising in the colon niche | abstractglobally , the risk of colorectal cancer ( crc ) as well as the incidence of mortality associated with crc is increasing .
thus , it is imperative that we look at alternative approaches involving intake of non - toxic natural dietary / non - dietary agents , for the prevention of crc . the ultimate goal of this approach is to reduce the incidence of pre - neoplastic adenomatous polyps and prevent their progression to more advanced forms of crc , and use these natural agents as a safe intervention strategy during the clinical course of this deadly malignancy . over the years
, pre - clinical studies have shown that silibinin ( a flavonolignan isolated from the seeds of milk thistle , silybum marianum ) has strong preventive and therapeutic efficacy against various epithelial cancers , including crc .
the focus of the present review is to provide a comprehensive tabular summary , categorically for an easy accessibility and referencing , pertaining to the efficacy and associated mechanisms of silibinin against crc growth and progression . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
on average , 414% of patients discharged from intensive care units ( icus ) will be readmitted [ 111 ] . it is known that readmission to the ( icu ) is often associated with increased inhospital mortality , poor long - term prognosis , increased morbidity , and prolonged length of hospitalization , resulting in increased costs [ 13,8 ] . the increasing cost of icu care and limited resources lead us to evaluate predictors of icu readmission . in the present study we sought to determine predictors of icu readmission in patients undergoing coronary artery bypass grafting ( cabg ) in our institution . the ability to predict who is at risk for icu readmission may set the stage for pre - emptive strategies . we conducted a retrospective study of 169 patients who underwent isolated coronary artery bypass grafting ( cabg ) at our tertiary center between january 2009 and december 2010 . the case group contained 54 patients who were readmitted to the icu during the same hospitalization , and the control group comprised 115 randomly selected patients . saphenous veins , the radial artery , and the internal mammary artery were used as conduits for myocardial revascularization . myocardial protection during the aortic cross - clamping period was achieved with cold crystalloid cardioplegia . statistical analysis was performed using the spss 19.0 ( statistical package for social science for windows 19 ) statistical software package . when the distribution of variables was normal , student s t test was used for comparison of quantitative sizes of 2 independent samples , and the non - parametric mann - whitney u test was used to compare non - normally distributed variables . qualitative data was compared between the 2 groups using the chi - square ( ) test . pearson s or spearman s correlation coefficient was used taking into account the distribution of variables . the probability of an event given certain risk factor was calculated using logistic regression analysis , including odds ratio ( or ) and its confidence interval ( 95% ci ) . statistical analysis was performed using the spss 19.0 ( statistical package for social science for windows 19 ) statistical software package . when the distribution of variables was normal , student s t test was used for comparison of quantitative sizes of 2 independent samples , and the non - parametric mann - whitney u test was used to compare non - normally distributed variables . qualitative data was compared between the 2 groups using the chi - square ( ) test . pearson s or spearman s correlation coefficient was used taking into account the distribution of variables . the probability of an event given certain risk factor was calculated using logistic regression analysis , including odds ratio ( or ) and its confidence interval ( 95% ci ) . out of 1045 adult patients who underwent cabg during the study period and who were discharged alive after the first icu stay , 54 ( 5% ) patients required readmission to the icu during the same hospitalization . the mean interval from icu discharge to repeated icu admission was 4 days ( range 147 days ) . the mean length of hospital stay was 21 days for patients not readmitted , and 37 days for those who were readmitted ( p<0.001 ) to the icu . the hospital mortality of patients readmitted to the icu was significantly higher than patients who did not require readmission ( 17% vs. 3.8% , p=0.025 ) . there was no statistically significant difference between the mean length of the primary stay in the icu of patients requiring readmission and non - readmitted patients ( 2.11.9 vs. 1.91.9 days , respectively ) . preoperative patient characteristics and perioperative variables were evaluated as predictors of icu readmissions ( table 2 ) . analysis showed that older age of patients ( p=0.03 ) , body mass index ( bmi ) > 30 kg / m ( p=0.04 ) , non - elective surgery ( p=0.004 ) , duration of operation > 4 h ( p=0.04 ) , bypass surgery time ( p=0.02 ) , and aortic cross - clamp time ( p=0.05 ) were independent risk factors of readmission . postoperative cns disorders ( p=0.005 ) and prolonged mechanical ventilation ( p=0.002 ) appear to be the only independent postoperative predictors of readmission . the logistic regression analysis revealed that independent predictors for readmission to the icu after cabg were : age > 70 years ( odds ratio 2.86 ; ci 1.465.59 ) , bmi > 30 kg / m ( odds ratio 2.55 ; ci 1.314.97 ) , euroscore ii > 3.9% ( odds ratio 3.56 ; ci 1.597.98 ) , non - elective surgery ( odds ratio 2.85 ; ci 1.375.95 ) , duration of operation > 4 h ( odds ratio 3.44 ; ci 1.547.69 ) , bypass time > 103 min ( odds ratio 2.5 ; ci 1.374.57 ) , aortic cross - clamp time > 46 min . ( odds ratio 1.02 ; ci 1.01.04 ) , mechanical ventilation > 530 min ( odds ratio 3.98 ; ci 1.828.7 ) , postoperative central nervous system ( cns ) disorders ( odds ratio 3.95 ; ci multivariate logistic regression analysis identified independent risk factors of readmission to icu : age and prolonged mechanical ventilation ( > 825 min ) after operation , bypass time > 103 min , and mechanical ventilation > 530 min ( tables 4 and 5 ) . this icu readmission rate appears similar to that of other reported studies , which have ranged from 4% to 14% [ 111 ] . our results support this conclusion by demonstrating that the inhospital mortality and hospital stay were significantly higher for patients readmitted to the icu . readmission rates have been associated with premature discharges in several studies [ 9,1214 ] , but in our study the mean length of the primary stay in the icu of patients requiring readmission and patients who had no readmission to the icu were not statistically significantly different 5.7 ( 9.5 ) and 4.4 ( 7.1 ) days , respectively . furthermore , discharge after less than a 24-hour initial stay in the icu was not a risk factor of readmission ( p=0.08 ) . the independent predictors of readmission in our study were older age , higher bmi ( > 30 kg / m ) , non - elective surgery , longer operation time ( > 4 h ) and aortic cross clamp time , postoperative cns dysfunction , and prolonged lung ventilation . older age is a risk factor associated not only with readmission to the icu ; it also correlates with increased mortality and morbidity following cardiac surgery . as the population gets older , the average age of patients undergoing surgery also increases . this is associated with the influence of age - related changes affecting different organ systems , and comorbidities that are more prevalent among elderly patients . given this , it is appropriate to analyze the perioperative course features in elderly patients and to improve their care . emergency non - elective surgery is another risk factor , mentioned in other studies , with cardiac surgery being no exception . emergency surgery and older age predispose patients to both icu readmission and higher overall morbidity and mortality . operation time , cardiopulmonary bypass time , and aortic cross - clamping period correlate with each other and are risk factors for re - admission to the icu . al - sarraf et al have shown that prolonged duration of aortic cross - clamping has a negative effect on outcome , increasing post - operative morbidity and mortality in both low- and high - risk patients . other authors have observed that a longer aortic cross - clamp time worsens outcomes in patients with preserved ejection fraction ( 40% or higher ) . kg / m ) are both risk factors associated with adverse outcomes after cardiac surgery . in our study , only 2 ( 2.1% ) patients had bmi < 21 kg / m . a bmi above 30 kg / m was observed in 66 ( 39% ) patients , and statistical analysis showed that bmi greater than 30 kg / m is a risk factor for icu readmission . the occurrence of cns disorders after surgery was the only independent post - operative risk factor of readmission . the incidence of cns dysfunction is higher after cardiac than non - cardiac surgery , and the risk increases with age . four neurologic and cognitive complications are observed after cardiopulmonary bypass ( cpb ) : stroke ( with an incidence of 1.5% to 5.2% ) , postoperative delirium ( 10% to 30% ) , short - term ( 33% to 83% ) , and long - term cognitive changes ( 20% to 60% ) . preventive interventions and early recognition of those patients could potentially decrease cns disorders and their negative consequences . the main cause of icu readmission was cardiac arrhythmias ( for the most part atrial fibrillation ) ( 50% ) . atrial fibrillation ( af ) and atrial flutter occur frequently after most types of cardiac surgery . af has been reported in 15% to 40% of patients in the early postoperative period following cabg , in 37% to 50% after valve surgery , and in as many as 60% undergoing valve replacement plus cabg . a multicenter study on af after cardiac surgery has shown that post - operative af is associated with prolonged hospital stay , higher incidence of infections , renal failure , and neurological complications . other risk factors include advanced age , and postoperative withdrawal of a beta - blocker or an angio - tensin - converting enzyme ( ace ) inhibitor . reduced risk was associated with postoperative administration of beta - blockers , ace inhibitors , potassium supplementation , and nonsteroidal anti - inflammatory drugs . identification of older patients , those who have higher bmi , who underwent non - elective surgery , who experienced surgery lasting more than 4 hours , and who have postoperative cns disorders , may help to identify patients at risk of icu readmission . careful optimization of these high - risk patients and caution before discharging them from the icu may help reduce the rate of icu readmission , mortality , length of stay , and cost . | backgroundthe aim of this study was to identify predictors of repeated admission to the intensive care unit ( icu ) of patients who underwent cardiac surgery procedures.material/methodsthis retrospective study analyzed 169 patients who underwent isolated coronary artery bypass grafting ( cabg ) between january 2009 and december 2010 .
the case group contained 54 patients who were readmitted to the icu during the same hospitalization and the control group comprised 115 randomly selected patients.resultslogistic regression analysis revealed that independent predictors for readmission to the icu after cabg were : older age of patients ( odds ratio [ or ] 1.04 ; ci 1.0041.08 ) ; body mass index ( bmi ) > 30 kg / m2 ( or 2.55 ; ci 1.314.97 ) ; euroscore ii > 3.9% ( or 3.56 ; ci 1.597.98 ) ; non - elective surgery ( or 2.85 ; ci 1.375.95 ) ; duration of operation > 4 h ( or 3.44 ; ci 1.547.69 ) ; bypass time > 103 min ( or 2.5 ; ci 1.374.57 ) ; mechanical ventilation > 530 min ( or 3.98 ; ci 1.828.7 ) ; and postoperative central nervous system ( cns ) disorders ( or 3.95 ; ci 1.4410.85 ) .
the hospital mortality of patients who were readmitted to the icu was significantly higher compared to the patients who did not require readmission ( 17% vs. 3.8% , p=0.025).conclusionsidentification of patients at risk of icu readmission should focus on older patients , those who have higher bmi , who underwent non - elective surgery , whose operation time was more than 4 hours , and who have postoperative cns disorders .
careful optimization of these high - risk patients and caution before discharging them from the icu may help reduce the rate of icu readmission , mortality , length of stay , and cost . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
many older people are at risk of cognitive impairment , one of the most disturbing aspects of aging . when these changes in cognitive function are first clinically recognizable , they are often referred to as mild cognitive impairment ( mci ) . mci is considered to be the transitional phase between normal aging and dementia and is recognized as the prodromal stage of alzheimer 's disease ( ad ) . thus , mci is a putative target for the prevention of neurodegenerative disease . the identification of individuals with mci who will progress to ad is a critical issue . longitudinal studies have reported that brain volume decreases by 0.2 - 0.5% each year . among older people experiencing cognitive decline such as mci , the rate of brain volume loss ( notably gray matter volume loss ) is higher than that among healthy older people . numerous studies have demonstrated that mci - related regional gray matter volume loss is most significant in the medial temporal and frontal cortex , including the prefrontal cortex . assessment of gray matter volume may allow early detection of mci and subsequent neurodegenerative disease . scanning mris are not suitable as primary clinical screening to assess gray matter volume since they require money and time , and the assessment of cognitive functioning using neuropsychological tests is more useful in clinical settings . it is well known that the prefrontal cortex plays a crucial role in cognitive functioning and executive functioning in particular . further , there is substantial evidence that different areas of the prefrontal cortex exert different roles in executive control . however , the association between gray matter volume and cognitive dysfunction in patients with mci remains unclear . an understanding of the association between gray matter volume and executive functioning could provide strategies to reduce dementia risk in high - risk populations . the present study examined associations between cognitive performance , specifically executive functioning , and gray matter volume in older people with mci . the sample for this cross - sectional study consisted of 83 community - dwelling older people with mci ( mean age 75.4 years ; 49.4% females ) who consented and completed the baseline assessment of a randomized controlled trial ( rct ; trial registration umin - ctr umin000003662 ) evaluating the effects of multicomponent exercise on cognitive functioning . the ethics committee of the national center for geriatrics and gerontology approved the study protocol . participants enrolled in the rct were aged 65 years and over , community dwelling , and not suffering from dementia . participants who had either a clinical dementia rating of 0 ; a clinical dementia rating of 1 - 3 along with a history of neurological , psychiatric , or cardiac disorders , or other severe health issues ; used donepezil ; showed impairment in basic activities of daily living ; or participated in other research projects were excluded from the rct study . a total of 100 subjects participated in the rct and completed baseline neuropsychological assessments . in the present cross - sectional imaging analysis , mris were performed with a 1.5-tesla system ( magnetom avanto , siemens , germany ) . three - dimensional volumetric acquisition with a t1-weighted gradient echo sequence was then used to produce a gapless series of thin sagittal sections using a magnetization preparation , rapid - acquisition gradient - echo sequence ( repetition time , 1,700 ms ; echo time , 4.0 ms ; flip angle , 15 ; acquisition matrix , 256 256 , and 1.3-mm slice thickness ) . brain tissue volume , normalized for subject head size , was estimated with sienax , which is part of fsl ( fmrib software library , version 5.0 ) . sienax first extracted brain and skull images from the single whole - head input data . the brain image was then affine - registered to mni152 space ( using the skull image to determine the registration scaling ) ; this was done primarily in order to obtain the volumetric scaling factor to be used in normalizing head size . next , tissue type segmentation with partial volume estimation was completed in order to calculate the total volume of brain tissue ( including separate estimates for the volume of gray matter , white matter , peripheral gray matter , and ventricular cerebrospinal fluid ) . we interviewed all participants about their age , gender , body mass index ( bmi ) , and education . in addition , the timed up and go ( tug ) test was used as a mobility assessment . the tug test involves the participant rising from a standard armchair , walking a distance of 3 m at a normal and safe pace , turning around , walking back to the chair , and sitting down again . tug is measured in seconds using a stopwatch . the time taken to complete the tug test was measured twice , and the best - timed trial was used for each participant 's score . global cognition was assessed using the mini - mental state examination ( mmse ) administered by licensed and well - trained clinical speech therapists . the mmse consisted of 11 tasks including the assessment of memory , comprehension , orientation to time and place , praxis , and attention . we assessed three key executive functions , including ( 1 ) set shifting ; ( 2 ) working memory , and ( 3 ) selective attention and conflict resolution . the trail making test ( tmt , parts a and b ) was used to assess set shifting . in tmt part a , participants are asked to draw lines to connect 25 circles numbered from 1 to 25 as quickly as possible . in tmt part b , participants are asked to connect circles containing numbers ( from 1 to 13 ) or letters ( from a to l ) in an alternating numeric , alphabetical order ( 1-a-2-b-3-c- -13-l ) . errors must be corrected immediately and the sequence reestablished . in the japanese version of tmt part b , the amount of time ( in seconds ) it took to complete each task was recorded . we administered forward and backward digit span tests from the wechsler adult intelligence scale - iv in order to assess working memory . both conditions required participants to repeat sequences of verbally presented digits of increasing length ( in either forward or backward order ) . the examiner pronounces a list of digits at a rate of approximately one digit per second , and subjects are required to immediately repeat the list in the same order . if subjects are successful on the second list , a list one digit longer is given , as before . however , if subjects also fail on the second list , the test is ended . the length of the digit sequences gradually increases , starting with a sequence of three numbers ( e.g. , 5 , 8 , 2 ) to a sequence of maximum 9 items ( e.g. , 7 , 1 , 3 , 9 , 4 , 2 , 5 , 6 , 8) . the same procedure is used for the digit span backward task , except that in this case , subjects have to reproduce the sequence of digits in the reverse order and the longest list consists of 8 items . the difference between the forward and backward scores was used as an index of the central executive component of working memory ( ds ) . we used the color- and picture - word stroop test to assess selective attention and conflict resolution . first , participants were instructed to read words printed in black ink out loud ( e.g. , blue ) . finally , they were shown a page with color words printed in incongruently colored ink ( e.g. , the word participants were asked to name the color in which the words were printed ( while ignoring the word itself ) . we recorded the time participants took to complete each condition . the ability to selectively attend and control response output pearson 's correlation coefficients were used to quantify the bivariate associations between gray matter volume and age , bmi , education level , mobility , global cognition , and executive functions . multiple linear regression models were constructed to determine the independent association between executive functioning and gray matter volume . covariates included in the first model were age , gender , bmi , education , and global cognition ( mmse ) . the executive functioning variable(s ) that were significantly related to gray matter volume in the results of pearson 's correlation coefficients were then entered into the second model . the statistical analyses were completed using spss for windows version 17.0 ( spss , chicago , ill . the sample for this cross - sectional study consisted of 83 community - dwelling older people with mci ( mean age 75.4 years ; 49.4% females ) who consented and completed the baseline assessment of a randomized controlled trial ( rct ; trial registration umin - ctr umin000003662 ) evaluating the effects of multicomponent exercise on cognitive functioning . the ethics committee of the national center for geriatrics and gerontology approved the study protocol . participants enrolled in the rct were aged 65 years and over , community dwelling , and not suffering from dementia . participants who had either a clinical dementia rating of 0 ; a clinical dementia rating of 1 - 3 along with a history of neurological , psychiatric , or cardiac disorders , or other severe health issues ; used donepezil ; showed impairment in basic activities of daily living ; or participated in other research projects were excluded from the rct study . a total of 100 subjects participated in the rct and completed baseline neuropsychological assessments . in the present cross - sectional imaging analysis , mris were performed with a 1.5-tesla system ( magnetom avanto , siemens , germany ) . three - dimensional volumetric acquisition with a t1-weighted gradient echo sequence was then used to produce a gapless series of thin sagittal sections using a magnetization preparation , rapid - acquisition gradient - echo sequence ( repetition time , 1,700 ms ; echo time , 4.0 ms ; flip angle , 15 ; acquisition matrix , 256 256 , and 1.3-mm slice thickness ) . brain tissue volume , normalized for subject head size , was estimated with sienax , which is part of fsl ( fmrib software library , version 5.0 ) . sienax first extracted brain and skull images from the single whole - head input data . the brain image was then affine - registered to mni152 space ( using the skull image to determine the registration scaling ) ; this was done primarily in order to obtain the volumetric scaling factor to be used in normalizing head size . next , tissue type segmentation with partial volume estimation was completed in order to calculate the total volume of brain tissue ( including separate estimates for the volume of gray matter , white matter , peripheral gray matter , and ventricular cerebrospinal fluid ) . we interviewed all participants about their age , gender , body mass index ( bmi ) , and education . in addition , the timed up and go ( tug ) test was used as a mobility assessment . the tug test involves the participant rising from a standard armchair , walking a distance of 3 m at a normal and safe pace , turning around , walking back to the chair , and sitting down again . tug is measured in seconds using a stopwatch . the time taken to complete the tug test was measured twice , and the best - timed trial was used for each participant 's score . global cognition was assessed using the mini - mental state examination ( mmse ) administered by licensed and well - trained clinical speech therapists . the mmse consisted of 11 tasks including the assessment of memory , comprehension , orientation to time and place , praxis , and attention . we assessed three key executive functions , including ( 1 ) set shifting ; ( 2 ) working memory , and ( 3 ) selective attention and conflict resolution . these measures are distinct , but moderately correlate with one another . the trail making test ( tmt , parts a and b ) was used to assess set shifting . in tmt part a , participants are asked to draw lines to connect 25 circles numbered from 1 to 25 as quickly as possible . in tmt part b , participants are asked to connect circles containing numbers ( from 1 to 13 ) or letters ( from a to l ) in an alternating numeric , alphabetical order ( 1-a-2-b-3-c- -13-l ) . errors must be corrected immediately and the sequence reestablished . in the japanese version of tmt part b , the amount of time ( in seconds ) it took to complete each task was recorded . we administered forward and backward digit span tests from the wechsler adult intelligence scale - iv in order to assess working memory . both conditions required participants to repeat sequences of verbally presented digits of increasing length ( in either forward or backward order ) . the examiner pronounces a list of digits at a rate of approximately one digit per second , and subjects are required to immediately repeat the list in the same order . if they succeed , a list one digit longer is presented . if they fail , a second list of the same length is presented . if subjects are successful on the second list , a list one digit longer is given , as before . however , if subjects also fail on the second list , the test is ended . the length of the digit sequences gradually increases , starting with a sequence of three numbers ( e.g. , 5 , 8 , 2 ) to a sequence of maximum 9 items ( e.g. , 7 , 1 , 3 , 9 , 4 , 2 , 5 , 6 , 8) . the same procedure is used for the digit span backward task , except that in this case , subjects have to reproduce the sequence of digits in the reverse order and the longest list consists of 8 items . the difference between the forward and backward scores was used as an index of the central executive component of working memory ( ds ) . we used the color- and picture - word stroop test to assess selective attention and conflict resolution . first , participants were instructed to read words printed in black ink out loud ( e.g. , blue ) . finally , they were shown a page with color words printed in incongruently colored ink ( e.g. , the word participants were asked to name the color in which the words were printed ( while ignoring the word itself ) . we recorded the time participants took to complete each condition . the ability to selectively attend and control response output we interviewed all participants about their age , gender , body mass index ( bmi ) , and education . in addition , the timed up and go ( tug ) test was used as a mobility assessment . the tug test involves the participant rising from a standard armchair , walking a distance of 3 m at a normal and safe pace , turning around , walking back to the chair , and sitting down again . tug is measured in seconds using a stopwatch . the time taken to complete the tug test was measured twice , and the best - timed trial was used for each participant 's score . global cognition was assessed using the mini - mental state examination ( mmse ) administered by licensed and well - trained clinical speech therapists . the mmse consisted of 11 tasks including the assessment of memory , comprehension , orientation to time and place , praxis , and attention . we assessed three key executive functions , including ( 1 ) set shifting ; ( 2 ) working memory , and ( 3 ) selective attention and conflict resolution . the trail making test ( tmt , parts a and b ) was used to assess set shifting . in tmt part a , participants are asked to draw lines to connect 25 circles numbered from 1 to 25 as quickly as possible . in tmt part b , participants are asked to connect circles containing numbers ( from 1 to 13 ) or letters ( from a to l ) in an alternating numeric , alphabetical order ( 1-a-2-b-3-c- -13-l ) . errors must be corrected immediately and the sequence reestablished . in the japanese version of tmt part b , the amount of time ( in seconds ) it took to complete each task was recorded . we administered forward and backward digit span tests from the wechsler adult intelligence scale - iv in order to assess working memory . both conditions required participants to repeat sequences of verbally presented digits of increasing length ( in either forward or backward order ) . the examiner pronounces a list of digits at a rate of approximately one digit per second , and subjects are required to immediately repeat the list in the same order . if they succeed , a list one digit longer is presented . if they fail , a second list of the same length is presented . if subjects are successful on the second list , a list one digit longer is given , as before . however , if subjects also fail on the second list , the test is ended . the length of the digit sequences gradually increases , starting with a sequence of three numbers ( e.g. , 5 , 8 , 2 ) to a sequence of maximum 9 items ( e.g. , 7 , 1 , 3 , 9 , 4 , 2 , 5 , 6 , 8) . the same procedure is used for the digit span backward task , except that in this case , subjects have to reproduce the sequence of digits in the reverse order and the longest list consists of 8 items . the difference between the forward and backward scores was used as an index of the central executive component of working memory ( ds ) . we used the color- and picture - word stroop test to assess selective attention and conflict resolution . first , participants were instructed to read words printed in black ink out loud ( e.g. , blue ) . finally , they were shown a page with color words printed in incongruently colored ink ( e.g. , the word participants were asked to name the color in which the words were printed ( while ignoring the word itself ) . we recorded the time participants took to complete each condition . the ability to selectively attend and control response output pearson 's correlation coefficients were used to quantify the bivariate associations between gray matter volume and age , bmi , education level , mobility , global cognition , and executive functions . multiple linear regression models were constructed to determine the independent association between executive functioning and gray matter volume . covariates included in the first model were age , gender , bmi , education , and global cognition ( mmse ) . the executive functioning variable(s ) that were significantly related to gray matter volume in the results of pearson 's correlation coefficients were then entered into the second model . the statistical analyses were completed using spss for windows version 17.0 ( spss , chicago , ill . the results of the correlation coefficient matrix for gray matter volume are given in figure 1 . gray matter volume showed a significantly negative correlation with age ( r = 0.348 , p = 0.001 ) . we found a modest but statistically significant negative correlation with set - shifting performance ( r = 0.414 , p < 0.001 ) . worse performance ( larger tmt ) predicted less gray matter volume . in the multiple linear regression analyses ( table 2 ) , after accounting for covariates including age , gender , bmi , education , and mmse , set - shifting performance ( tmt ) was independently associated with gray matter volume ( standardized = 0.376 , p = 0.001 ) . gray matter volume correlated significantly with set - shifting ability ( less gray matter was associated with worse performance ) . however , we did not find significant correlations with working memory or selective attention and conflict resolution in older people with mci . set shifting requires high - level cognitive ability that includes shifting attention or response patterns based on different rules . performance on set - shifting tests ( such as the tmt ) has been shown to be impaired in patients with frontal lobe lesions , frontal lobe epilepsy , frontal - striatal dysfunction due to basal ganglia lesions , parkinson 's disease , and huntington 's disease . reported that older people with mci and greater annualized atrophy ( e.g. , > 3% per year ) were at much higher risk of ad . thus , brain volume , including gray matter volume , may be a viable sign identifying the risk of progression to ad in older people with mci . in primary health care settings , we recommend set - shifting assessment to reflect gray matter volume ; this assessment may be useful in predicting the risk of dementia in aging populations . higher levels of cognitive functioning such as set shifting could be mediated by a predominantly frontal neural network . set shifting not only relies on brain regions important for cognitive control , but also on brain regions that mediate other fundamental skills critical to good performance , such as visual scanning or motor speed . in the present study , we used tmt to assess the set - shifting ability among older people with mci . previously , tmt has been useful to assess not only set shifting , but also to discriminate individuals destined to convert from mci to ad . . indicated that the ad conversion prediction accuracy of tmt part b reached 64.6% in a longitudinal study . in addition , carlson et al . reported that the decline in executive functioning ( tmt scores ) preceded memory declines associated with progression to ad . according to these previous studies and our findings , tmt to assess set - shifting ability may help in the early detection of those patients with progression to ad . we were therefore unable to investigate causal relationships between gray matter volume and executive functioning . second , we analyzed the gross volume of gray matter rather than a region of interest . cognitive functions ( including executive functioning ) are typically defined by functional localization ; thus , it will be important to further clarify the association between specific cognitive functions and regions of interest in the brain . therefore , additional studies including participants with varying cognitive health will be needed to clarify the relationship between gray matter volume and executive functioning and to characterize dementia - related pathology . finally , we did not investigate the association between gray matter volume and executive functioning according to mci subtypes . the degree of decline in cognitive function varies in nature by mci subtypes ( amnestic vs. non - amnestic , and multiple domain vs. single domain ) . thus , the association between gray matter volume and executive functioning should be investigated in consideration of mci subtypes . our findings suggest that set - shifting performance is positively associated with gray matter volume in older people with mci . set - shifting ability could be more strongly associated with age - related structural brain changes compared to other aspects of executive processes , such as working memory and selective attention and conflict resolution . therefore , we recommend set - shifting assessment to reflect gray matter volume in primary health care settings . there are no financial or personal relationships with other people or organizations that may lead to a conflict of interest . | background / aimsan understanding of the association between gray matter volume and executive functioning could provide strategies to reduce dementia risk in older people with mild cognitive impairment ( mci).methodsin a cross - sectional analysis , we assessed executive functioning in 83 older people with mci using three standard neuropsychological tests : set shifting ( difference between trail making test parts b and a ) , working memory ( difference between digit span forward and backward from the wechsler adult intelligence scale - iv ) , and selective attention / response inhibition ( difference between the second and third conditions of the color- and picture - word stroop test ) .
gray matter volume was computed from brain mris and sienax from fsl software.resultsgray matter volume was significantly associated with set - shifting performance after accounting for age , gender , body mass index , education , and global cognition ( standardized = 0.376 , p = 0.001 ) , but not with working memory or selective attention / response inhibition.conclusionthe executive function of set - shifting ability was correlated with gray matter volume in older people with mci . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
brain - machine interfaces ( bmis ) impose arbitrary associations between neural activity patterns and prosthetic actions . a neuroprosthetic skill is considered successfully acquired when this association is learned and the prosthesis can be controlled in a goal - directed manner . the underlying principle is that neural activity , reinforced via operant conditioning , can be volitionally generated . operant conditioning of cortical neurons has been successfully achieved in monkeys ( engelhard et al . , 2013 , fetz , 1969 , fetz and baker , 1973 , hwang et al . , 2013 , moritz et al . , 2008 , 2014 ) , rodents ( arduin et al . , 2013 , clancy et al . , 2014 , gage et al . , 2005 , 2012 ) , and humans ( cerf et al . , 2010 ) by translating their activity into auditory or visual feedback signals and reinforcing desired patterns with reward . because this paradigm specifies which neurons control an action , it circumvents the neural complexity associated with natural behavior . its use goes , therefore , beyond bmi applications ; it can serve as a research tool that facilitates dissecting the involved plasticity mechanisms ( sadtler et al . , 2014 ) . a closed - loop implementation in which the feedback takes the form of direct cortical activation ( i.e. , an artificial sensory channel ) would offer the advantage of having full control of the neurons directly involved in the association to be learned . implementing such an artificial position sense ( lebedev et al . , 2011 ) in a bmi setting could not only offer more flexible and faster feedback mappings , but , more importantly , substitute the position sense of a neuroprosthetic device when natural sensation is lost . , 2013 ) ; bias ( salzman et al . , 1990 ) , mimic ( oconnor et al . 2013 ) , or even augment ( thomson et al . , 2013 ) natural perception ; and cue goal - directed movements ( fitzsimmons et al . it can also be optimally integrated with natural sensory cues during real reaching movements ( dadarlat et al . , 2015 ) . however , in conjunction with volitional neural control , cortical stimulation has only been able to provide cues for choosing ( odoherty et al . , 2009 ) or for discriminating ( odoherty et al . , 2011 ) between virtual targets , while natural sensory feedback was used to guide learning and the actual execution . the feasibility of artificial sensations to not only cue , but to actually instruct in real time the generation of conditioned neural patterns , remains currently unexplored . this would mean that the brain can create an association between an action and its real - time sensory consequence when both are restricted to activities of different sets of cortical neurons . stable activity patterns of local populations of motor cortex neurons have been found to emerge during motor learning ( peters et al . , 2014 ) , and highly interconnected cortical ensembles ( harris and mrsic - flogel , 2013 ) might be responsible for the emergence of such population dynamics where individual neurons matter little . operant conditioning of a single motor cortex neuron might thus be expected to entrain its ensemble during learning and just be a participant of a changing population code . recent findings , however , suggest that learning might be confined to the conditioned neurons rather than involving a cortical ensemble ( arduin et al . , 2013 , clancy et al . , 2014 ) conclusive evidence of such learning specificity requires conditioning single neurons and simultaneous unambiguous tracking of a large number of neighboring non - conditioned neurons . in the present study , we therefore address the following questions : can mice learn to use a fabricated feedback channel to control single - neuron activity ? how do responses of the conditioned and neighboring cortical neurons change with learning ? for this purpose , we developed an all - optical bmi , a system for simultaneous wide - field two - photon population imaging of neurons expressing genetically encoded calcium ( ca ) indicators in primary motor cortex ( m1 ) and simultaneous activation of neurons expressing optogenetic actuators in primary somatosensory cortex ( s1 ) . operant conditioning of a single m1 neuron was performed by reading out its activity in real time , transforming it into a rate code of optogenetic stimulation pulses in s1 and reinforcing above - threshold activations with reward . we tested the necessity of the optogenetic feedback signal for identifying the reinforced activations and for learning to produce them more often over time . we then analyzed learning - related changes observed in conditioned neurons in comparison to those in neighboring , longitudinally tracked , non - conditioned neurons . our results unveil basic properties of l2/3 processing , which may also characterize cortical activity during , but not be delineable with , natural behaviors . to test if artificial sensory feedback can guide operant conditioning of cortical neurons , we first developed a novel two - photon imaging system designed for simultaneous optogenetic stimulation of cortical areas in head - fixed mice ( figures 1a1d ; see star methods ) . mice expressed the genetically encoded ca indicator gcamp6f in forelimb m1 and the optogenetic actuator channelrhodposin-2 ( chr2 ) in the corresponding somatosensory representation ( figure 1a ) . we used a cre - dependent reporter mouse line ( ai32 ) to ensure a stable level of chr2 expression over time . to monitor the effect of the optogenetic stimulation , we measured the local field potential in the contralateral s1 with electrocorticograms ( ecogs ; figure 1b ) . experimental animals were either classified as chr2 mice ( n = 8) or control mice ( n = 11 ) depending on whether ecog responses were detectable upon optogenetic stimulation ( figures 1c , s1a , and s1b , available online ) . the absence of optogenetically driven responses in control mice was due to insufficient or lack of expression of chr2 ( see star methods ) . two - photon images of large populations of individual l2/3 neurons ( 461 164 , mean sd ) were acquired at 30hz and simultaneously streamed to a dedicated computer for real - time processing ( figure 1d ) . to condition the activity of a single neuron , we extracted its fluorescence changes from the image and used it as a proxy for its neuronal activity . the fluorescence transients were transformed directly into a rate code dictating the frequency of the optogenetic stimulation pulses targeting s1 . a water reward was delivered whenever the conditioned neuron s activity and , by extension , the rate of optogenetic stimulation crossed a chosen threshold , thereby reinforcing high activation levels ( figure 1e ) . we trained the chr2 and control mice in the operant conditioning task for at least 15 consecutive daily sessions , for 3040 min per session ( figure s2a ; see star methods for details ) . potential visual cues from the optogenetic stimulation were effectively masked with blue light flashes ( figure s1c ) . learning was defined as significant increases in threshold crossing rate ( tcr ) of the conditioned neuron s ( cn ) ca response between session start and end ( two - tailed paired t test , p < 0.05 ) . according to this definition , chr2 mice learned on average within single sessions ( figure 2a ) , with six out of eight individuals showing significantly increased tcrs . a significant increase in tcr compared to session start was already observed in the second time bin ( p < 10 ) , suggesting that operant control of the cn ensued after 4.9 1.64 min ( mean sd ) of conditioning . control mice , which underwent identical experimental procedures and were rewarded at similar rates as chr2 mice ( figure s2b ) , did not learn on average , with only one out of eleven showing an increase in the tcr ( figure 2b ) . baseline tcr at the start of a session did not differ between mice that learned and the ones that did not learn ( non - paired t test , p = 0.15 ; figure s2c ) . 0.05 ) became more frequent across successive days of training in chr2 mice only ( figure 2c ) . after more than 10 consecutive days of conditioning , the probability of observing learning in a given chr2 animal reached 40% . during these learning sessions , the number of threshold crossings increased by 0.66 0.08 ( mean sem ) every minute . movement artifacts in the two - photon images and activation of the cn by the optogenetic stimulation via direct inputs from s1 were negligible and did not contribute to threshold crossings ( figures s2d learning was also not accompanied by more frequent contralateral forepaw movements ( figure s2h ) . in previous studies , operant conditioning of cortical neurons in the absence of sensory feedback ( reward only ) was found to be either not possible ( koralek et al . , 2012 ) or only successful in experienced animals previously trained with visual feedback ( fetz , 1969 ) or extensively exposed to reward - based learning ( hira et al . , 2014 ) . our results indicate that in naive animals , providing feedback by chr2-based cortical stimulation can expedite operant conditioning of cortical neurons when compared to reward reinforcement only . therefore , the brain is able to form associations between the activity of a single neuron and proportional feedback stimulation in s1 within single behavioral sessions . given that learning occurs surprisingly fast , have the mice truly formed an association between activity increases of the cn and the reward outcome ? is optogenetic feedback a necessary cue for maintaining this association after the initial learning has occurred ? contrary to normal task conditions where rewards were automatically delivered , these questions were addressed with a condition , during which mice had to initiate licks upon threshold crossings to receive the reward . this condition therefore tested if the mice can behaviorally detect instances of threshold crossings ( i.e. , the actions that lead to reward ) and was introduced for brief intervals of time at the end of the last five experimental sessions ( figure s2a ) . to learn and maintain an association between above - threshold activation and the reward outcome , mice could also rely on internal predictions related to the generation of the neuron s activity ( i.e. , analogous to efference copies ) . to assess the relative contribution of the involved cues , we uncoupled the optogenetic feedback from the cn s activity in feedback removal and playback conditions . in the normal feedback condition , detection probability , defined as the proportion of threshold crossings successfully detected by subsequent licking , was close to unity ( figures 2d and 2e ) . when feedback was transiently removed , detection probability significantly dropped ( p < 10 , kruskal - wallis test ) and became no different than would be expected by chance ( figure s4 ; see star methods for details ) . these results reveal that the association has indeed been learned , that the optogenetic stimulus remains necessary , and that potential internal cues alone are not sufficient for detecting correct performance . to assess if optogenetic stimulation alone was sufficient for identifying the rewarded actions , we also introduced a playback condition , during which the stimulation pattern was transiently decoupled from the cn s real - time activity and controlled by a recording from a previous day ( figures 2d and 2e ) . during playback , because rewarded actions were not generated anymore by the animal , their identification could only be based on the s1 stimulation pattern . detection probability during playback was not different compared to normal feedback periods ( p = 0.33 ) , demonstrating the importance optogenetic stimulation acquired during learning ( figures 2d and 2e ) . to exclude reliance on any other sensory cues , such as visual percepts evoked by the blue light pulses , we also delivered playback stimuli to a control area not expressing chr2 ( figure 1a ) . under these conditions , detection ability was significantly compromised ( p < 10 ) and indistinguishable from either the stimulus removal condition ( p = 0.84 ) or chance occurrence ( figure s4 ) . these results indicate that the artificial sensory signal is not only needed for learning to rapidly occur , but also to behaviorally identify correct performance during the task and remain the sole necessary cue for this purpose thereafter . ca events might occur more frequently over time and thus the rate of those that cross threshold also increases . alternatively , the ca events might become larger and thereby cross threshold more often . to examine this , we looked at activity changes of the cns in all sessions with significant learning ( n = 33 ) . within - session increases in tcr were guided by increases in the rate of ca events ( i.e. , occurrence of spike bursts ) , as well as increases in their individual amplitudes ( i.e. , number of spikes in a burst ) ( figures 3a and 3b ) . while both changes in ca event rate and amplitude contributed to tcr increases , event amplitude changes accounted significantly more on average for the variability in tcr during a session ( general linear model ; figure 3b , inset ) . furthermore , if either increase of the amplitude or rate of the conditioned events still persists , it would indicate that this activity change might be the result of learning - related plasticity . we found that upon feedback removal event rate significantly dropped , leading to a decreased number of threshold crossings , yet the event amplitude remained elevated ( figure 3b ) . the persistence of the elevated amplitude might therefore be an indication of lasting plasticity changes in the system . the immediate decrease in the rate of events , on the other hand , indicates that feedback remains necessary for maintaining the learned behavior and that the observed increases in cn s activity are not signs of irreversible ca accumulation or related to the acquisition of a habit . we next asked if these learning - related changes are specific to the cn or if they can also be found in simultaneously imaged neighboring neurons . we found that 6.4% ( quartiles , 2.3% and 10.6% ) of neighboring neurons had significant within - session linear increases in either event rate or amplitude and were therefore labeled as increasing neurons ( ins ) these increases , however , did not match the characteristics of the learning - related activity changes of the cns ( figures 3c and s5 ) . whereas the rate changes of ins were similar to those of cns ( two - sided paired t test , p = 0.51 , t(26 ) = 0.661 ) , the mean changes in event amplitude , which are mostly responsible for learning , were statistically different ( p < 0.001 , t(26 ) = 4.257 ) . furthermore , the onset of ca events in ins lagged both rewarded ca events of the cn and reward onsets ( figure 3d ) . thus , activity increases observed in non - conditioned neurons probably reflect the behavioral consequences ( e.g. , reward anticipation , collection , or consumption ) rather than causes of above - threshold activations of the cn . it follows that learning - related changes are restricted to the cn and do not involve the collective activation of a local population of m1 neurons . because the feedback signal represents a pseudo - random stimulation pattern for all neurons other than the cn , the observed neuronal specificity suggests that it is the activity - locked feedback signal , and not just the s1 optogenetic stimulation per se , that is important for learning . the neuronal specificity further suggests that the conditioned activity was not primarily related to other variables such as forelimb movements that would most likely result in driving all forelimb - related neurons in concert . in spite of an absence of learning - related activity increases in neighboring neurons , it is still possible that the cn is driven by activity in the local network . indeed , we found that a small fraction of neighboring neurons ( 2.5% ; quartiles , 0% and 8.2% ) exhibited ca events that preceded those of the cn more often than would be expected by chance ( p < 0.01 , hypergeometric probability ) ( figure 3e ) and could therefore potentially constitute pre - synaptic inputs . these events occurred sparsely ( 30% 10% , mean sd of threshold crossings ) , and in only 16% of these leading neurons , an ideal observer could discriminate whether a conditioned ca event would cross threshold or not ( p < 0.05 , permutation test , receiver operating characteristic [ roc ] analysis ; see star methods for details ) . leading neurons , but not the ins , were situated in closer spatial proximity to the cn than a size - matched random neuronal sample ( figures 3e and 3f ) . small spatially organized functional clusters of neurons might therefore exist in l2/3 of m1 , as previously suggested ( hira et al . these putative local pre - synaptic drivers might actually be more numerous , yet be individually weak and therefore below the detection threshold of ca imaging used in this study . therefore , even if the animals learned to control a single neuron instead of an m1 subpopulation , the nearby neurons might still play an active role in providing part of the drive to the cn . long - term tracking of individual l2/3 neurons has revealed that their population representation might be stable , but their individual responsiveness and/or functional tunings are flexible day to day in motor ( huber et al . , 2012 , peters et al . , 2014 ) , as well as sensory ( unpublished data ) cortices . similarly , consistent cross - day learning of multi - unit neuroprosthetic control has been found to require either daily retraining or iteratively adapting the decoder to the day - to - day variability of neuronal activity ( orsborn et al . , 2014 , taylor et al . , 2002 ) . redundant representations of a motor or sensory function across many neurons might allow such flexibility and reflect a necessary adaptability of neural responses . however , operant conditioning of a single m1 neuron attributes a functional role to that neuron only . it might therefore be expected that its responses would become more stable and stereotyped over time . we analyzed the stability of the cns across multiple days of learning . despite their exclusive status , cns were readily found inactive at the start of a new session and often remained silent for several consecutive days ( figures 4a and s6 ) . this prevented further conditioning with the same neuron and forced us to choose a new one . the decision to switch conditioning to a new neuron was based on a baseline recording prior to session start ( see star methods for details ) , whereas the data in figure 4a depict the neuron s average activity during the entire session . the distribution of day - to - day changes in the overall ca event rate of the cns was not different from that of the non - conditioned neurons ( figure 4b ; two - sample kolmogorov - smirnov goodness - of - fit test , p = 0.15 ) . conditioned l2/3 neurons seem therefore not to be immune to flexibility , even when they acquire an exclusive functional role , which further highlights the robustness of this seemingly intrinsic property of l2/3 representations . taking together the remarkable speed and specificity with which the conditioned neuron adapts to the imposed constraints , our results suggest the existence of functionally and spatially specific plasticity mechanisms able to tune the activity of an l2/3 neuron on very short timescales . to determine if more complex mappings can also be rapidly learned with artificial feedback , we trained mice to modulate the activity of three neurons simultaneously . chr2 mice previously trained on the single - neuron task were taught to co - activate two arbitrarily chosen m1 neurons , while silencing a third neuron to gain reward . the amplitude of the fluorescence signal of each neuron was transformed with a logistic function . the outputs of neurons 1 and 2 were summed and that of neuron 3 subtracted to obtain an ensemble signal ( figure 5a ) . the ensemble signal dictated the frequency of optogenetic stimulation pulses according to the same transfer function as in figure 1d , and above - threshold crossings triggered reward . the threshold level was chosen so that only simultaneous activations of neurons 1 and 2 , and near - baseline activity of neuron 3 , led to reward . any activation , no matter how strong , of either neuron 1 or 2 alone was not sufficient for threshold crossing , and any above - baseline activity of neuron 3 prevented it ( figure 5b ) . we found that chr2 mice can also learn this more complex mapping , as indicated by within - session linear increases in tcrs ( figure 5c ) . as imposed by the mapping rule , neurons 1 and 2 were co - activated at threshold crossings of the ensemble activity ( figure s7b ) . the probability of these co - activations might fortuitously increase during a session as the rate of ca events increases in the two neurons , or even in only one of them . both neurons indeed increased their overall activity throughout a session ( figure s7a ) . but to test whether mice also generated more co - activation per se , we analyzed if the number of co - activations per produced ca event changes during learning . we found that this ratio significantly increased between session start and end for both neuron 1 ( p = 0.003 , kruskal - wallis test ) and neuron 2 ( p = 0.03 ) , demonstrating that more frequent co - activation did not occur fortuitously . a comparison of each neuron s activity aligned on any ca event of the other , between the start and end of a session , confirms that they became more co - active during learning ( figure s7b ) . to illustrate a practical neuroprosthetic application of this mapping , we also translated the imposed rules into mechanical constraints governing the multi - joint displacement of a robotic arm ( figure 5a ; movie s1 ) . the activity of each neuron was transformed into a joint angle , rendering the ensemble activity proportional to the distance ( in joint angle coordinates ) from the arm s endpoint to a target area . the optogenetic stimulation thus provided feedback of the arm s position relative to the target . the increased number of threshold crossings was therefore akin to more frequent target hits ( figure 5c ) . although unbeknownst to the mouse , increases in the rate of successful displacements toward the target illustrate how multiple l2/3 neurons can be conditioned to execute goal - directed movements of a prosthetic device under the guidance of artificial sensory feedback . this study reveals that artificial sensory feedback about the current activity state of one or multiple volitionally modulated neurons can guide rapid learning during operant conditioning . we effectively fabricated an optical version of an artificial cortical communication channel ( jackson et al . , 2006 ) , which was used by mice to rapidly ( i.e. , in less than an hour ) learn to produce reinforced neural activity patterns in a goal - directed manner , similarly to using natural sensorimotor associations . schematic depictions of such a channel are readily included in idealized views of neuroprosthetic control where artificial sensory information from the prosthetic device is fed back directly to the brain ( bensmaia and miller , 2014 , kwok , 2013 ) . our experiments provide a seminal proof of concept of such a system using an adaptation - based approach ( bensmaia and miller , 2014 ) and illustrate that it could in principle be used to modulate multiple neurons in concert for executing goal - directed multi - joint prosthetic movements . a more biomimetic implementation ( bensmaia and miller , 2014 ) it would necessitate that multiple instances of the artificial channel be learned in parallel , each activating and providing proprioceptive feedback of a single joint . graded stimulation of the cortex has previously only been used to guide natural forelimb reaches ( dadarlat et al . , 2015 ) , albeit under the assistance of proprioception and a lengthy ( i.e. , several months ) learning procedure involving pairings with visual cues . in contrast , we demonstrate that both sensory and motor peripheries can be bypassed and that unassisted , arbitrary associations can be fashioned between activities of two different sets of cortical neurons ( not necessarily invoking direct anatomical pathways ) . a key component in our experiments was the wide - field imaging of a large number of cortical neurons and their longitudinal tracking during conditioning . it enabled us to peek into cortical mechanisms underlying volitional neural control and how the brain drives its own activity . conceptually , the reinforced activity of the conditioned neuron ( i.e. , the controlled variable ) is driven by a this might seem surprising given that cortical networks are locally highly interconnected ( harris and mrsic - flogel , 2013 ) . it is , however , consistent with the general sparseness of l2/3 neuronal firing ( petersen and crochet , 2013 ) where population activity is thus not expected to reflect a common motor function and might be less correlated compared to the output neurons of the deeper layers of cortex . previous studies actually report a similar confinement of learning - related activity to conditioned cortical neurons ( arduin et al . , 2013 , clancy et al . , 2014 ) . the original single - neuron conditioning experiments of fetz and baker ( fetz and baker , 1973 ) targeted deeper cortical layers ( probably layer 5 ) using microelectrodes to simultaneously record the conditioned and an adjacent neighboring neuron . their findings revealed that in about half of the recorded pairs , the responses were correlated during threshold crossings . we can therefore hypothesize that spatial specificity is more prominent in l2/3 and might be related to the necessary flexibility of this cortical layer for the purposes of learning new skills and adaptive mechanisms in general ( huber et al . it follows that the volitional controller driving l2/3 neurons most likely involves other , more distributed or distant cortical activations or subcortical pathways ( koralek et al . , 2012 ) . our results also demonstrate that when reward is contingent on the volitional activation of a single neuron , neural mechanisms can home in on that cell and ignore its immediate cortical neighbors . in a way , this mirrors a concept put forward by in vivo single - cell stimulation experiments ( brecht et al . , 2004 , houweling and brecht , 2008 ) . the latter suggests the existence of circuits downstream of the stimulated cortical neuron capable of reading out single - cell activity . our finding , on the other hand , suggests that activity in circuits upstream of the conditioned neuron can be routed to a single cortical cell . both emphasize the behavioral relevance of single - neuron activity , which might be more significant than previously thought . the closest direct precedent to our study is the work of clancy and colleagues ( clancy et al . , 2014 ) . they also used wide - field imaging to condition cortical neurons and were thus also able to unambiguously track activity of a local subpopulation of individual neurons during learning . instead of conditioning a single neuron , they conditioned ensembles of up to eleven neurons . the auditory feedback and reward delivery were dependent on the summed activity of the ensemble . additionally , they calibrated the feedback transform coefficients and reward thresholds daily based on baseline activity levels , whereas we kept them the same throughout the experiment for each conditioned neuron . their approach was hence more immune to day - to - day fluctuations in the activity of single neurons and probably explains why apart from observing within - session learning as we did , their mice also learned across days . similar coordination between non - conditioned neurons , those outside the ensembles , was not present and did not increase over time . such specificity of learning - related changes to conditioned neurons is confirmed in the present study , but our findings go further by demonstrating that this remains true even when conditioning is restricted to just a single neuron . clancy and colleagues also identified that some non - conditioned cells were activated around threshold crossings , which was more evident for those nearby than those distant from the conditioned ensemble . although a direct comparison is not possible because they do not report precise temporal relationships , these nearby cells might be similar to our spatially clustered leading neurons , which represent a putative pre - synaptic drive of operant activity in the local network . the finding that increased amplitudes of the ca events ( reflecting stronger bursts ) guided learning and persisted despite a performance drop after feedback removal led us to speculate that learning might in part be the result of neuronal plasticity , such as synaptic potentiation or more synchronous inputs to the conditioned neuron . future experiments could thus be aimed at identifying potentiated synapses and subsequently tracing the source of the related pre - synaptic input ( wickersham et al . , 2007 ) . since the volitional controller , again conceptually , uses the feedback signal to modify the controlled variable ( fetz , 2007 ) , the fact that we could artificially constrict the feedback to a set of cortical neurons might further facilitate its identification . a potential site of plasticity could be the cn s synapses receiving direct input from s1 . in the mouse vibrissal system , s1 projections directly target l2/3 neurons in m1 ( mao et al . , 2011 ) , and analogous the sequential activation of the cn and s1 afferents might have , by design , led to a hebbian - like spike timing - dependent plasticity ( markram et al . , 1997 ) and have been a contributing factor to producing more post - synaptic spikes over time . if that were the case , it is expected that s1 stimulation would evoke higher ca levels in the cn after , as compared to before , learning . however , we were not able to detect any significant fluorescence transients in the cn upon optogenetic activation of s1 , neither before nor after learning ( figure s3c ) . learning - related activity increases in the cn therefore do not seem to be mediated by direct s1-to - m1 projections , reinforcing the idea that more intricate pathways are involved . actually , because s1 stimulation does not lead , but follows , the cn s activation by a few milliseconds , it is more likely that the synapses in question were depressed and not potentiated ( jacob et al . , 2007 ) . indeed , stimulation of a cortical site proportional to real - time activity recorded at another site induces neural plasticity that is consistent with synaptic potentiation of pathways from the recording to the stimulation site , and not vice versa ( jackson et al . , 2006 ) . further work is therefore required to unequivocally identify the recruited pathways and the source of the input driving the conditioned neurons in m1 . in practical terms , this means that attaching an artificial position sense to neuroprosthetic actuators is feasible and can in principle be rapidly learned ( figure 5a ; movie s1 ) . these findings in rodents might also be applicable to humans and pave the way toward developing artificial feedback systems for patients , which could be implemented even with currently available electrode - based approaches . besides neuroprosthetic applications , our study also provides a novel behavioral tool for in vivo circuit dissection : an in cerebro learning paradigm that bypasses sensory and motor peripheries by imposing the learned action and its feedback directly in the cortex . this approach can potentially substitute for natural behavior and thereby facilitate dissecting neural circuits underlying sensorimotor learning . for instance , trans - synaptic tracing ( beier et al . , 2011 , wickersham et al . , 2007 ) can identify the presynaptic drivers of the conditioned neuron and the postsynaptic targets of the stimulated neurons , thus revealing how the feedback signal is routed to instruct volitional control and what ultimately drives the output . in addition , structural imaging and functional manipulations of the spines of conditioned neurons or the boutons of stimulated cells can provide insights into the synaptic plasticity mechanisms at play . finally , the accuracy of circuit dissection can be improved by producing a more specific feedback signal aimed at individual neurons with two - photon targeted activation and simultaneous imaging ( packer et al . , 2015 , reagent or resourcesourceidentifierantibodiesanti - chr2mfd diagnosticsclone 15e2biotinylated goat anti - mouse iggvector labscat # ba-9200 ; rrid : ab_2336171bacterial and virus strainsaav2.1-syn-gcamp6f.wpre.sv40university of pennsylvaniacat # cs0201aav2.1-hsyn-cre.wpre.hghuniversity of pennsylvaniacat # cs0342chemicals , peptides , and recombinant proteinssigma fast dab tabletsigma - aldrichcat # d4293 - 50setexperimental models : organisms / strainsmouse : ai32 : rosa - cag - lsl - chr2(h134r)-eyfp - wprejackson laboratoryrrid : imsr_jax:012569mouse : wild type : c57bl/6ncrlcharles rivercat # 027 further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact , daniel huber ( [email protected] ) . we used 8 to 12 weeks old ai32 transgenic homozygote male mice carrying a floxed chr2(h134r)-eyfp fusion gene inserted in the gt(rosa)26sor locus in a c57/bl6 background mouse strain ( madisen et al . , 2012 ) the animals were housed in an animal facility , maintained on a 12:12 light / dark cycle and were placed under a water restriction regime ( 1 ml / day ) ( median weight : 22.5 g , range : 19.2 g to 24.1 g ) . the animals did not undergo any previous surgery , drug administration or experiments and were housed in groups of maximum 5 animals per cage . all procedures were approved by the institutional animal care and use committee of the university of geneva and geneva veterinary offices . all surgeries were conducted under isoflurane anesthesia ( 1.5%2% ) and additional analgesic ( 0.1 mg / kg buprenorphine intramuscular ( i.m . ) ) , local anesthetic ( 50 - 100 l 1% lidocaine subcutaneous ( s.c . ) under the scalp ) and anti - inflammatory drugs ( 2.5 mg / kg dexamethasone i.m . and 5 mg / kg carprofen s.c . ) were administered as necessary . a custom made titanium head bar was implanted in the skull to allow for subsequent head fixation . a craniotomy was performed over the left frontal cortex and two viral injections ( 30 - 50 nl each ) were delivered ( 10 - 20 nl / min ) into the forepaw representation in s1 ( 0.75 mm anterior , 2.25 mm or 1.75 mm lateral to bregma ) and two in the forepaw m1 ( 1.75 mm anterior and either 2 mm or 1.5 lateral ) . in 8 mice , ( aav2.1-syn - cre , 1:100 for 2 mice and 1:1000 for 6 mice , 0.2% fastgreen in sterile saline , virus stock titer 1.46 10 genome copy per ml ( gc / ml ) ) . in m1 , ( aav2.1-syn - gcamp6f , 1:10 , 2.96 10 gc / ml ) was injected . the coordinates for the somatosensory representation of the forepaw were based on a series of intrinsic signal imaging sessions ( 7 additional ai32 mice ) . after virus injection , cortex was rinsed for 1 - 2 min with dexamethasone ( 0.03% ) . two hand - cut glass coverslips ( 150 m thick ) that matched the shape of the craniotomy were glued together with optical adhesive ( norland 61 ) . the cranial window was placed on top of the cortex , glued to the bone with cyanoacrylic glue and secured with dental cement . the correspondence between the s1 injection sites and the sensory forepaw representation was confirmed post - operatively with intrinsic signal imaging in each mouse . the m1 injection coordinates were calculated relative to the s1 coordinates and based on a database of cortico - cortical projections in somatic sensorimotor areas ( zingg et al . , 2014 ) . in addition , all mice were implanted with cortical surface electrodes ( teflon coated gold wires , au-3 t , science products , germany ) in the contralateral somatosensory ( 0.75 mm anterior , 2 mm lateral to bregma ) and visual cortices ( 3 mm posterior , 1 mm lateral to bregma ) . after a four day recovery period , mice were placed under a water restriction regime ( 1 ml / day ) . neural responses could be evoked by optogenetic stimulation of s1 in all 8 mice ( figures s1a and s1b ) . histological verification of chr2 expression revealed dense labeling of cell bodies and neuropil in l2/3 and l5 at the s1 site , whereas no neurons were retrogradely labeled in m1 ; only axonal projections of chr2 neurons from s1 could be observed ( figure s8a ) . 11 additional male mice that underwent identical surgery and injection procedures were used as controls as they did not exhibit ecog responses to the optogenetic stimulus ( figures s1a and s1b ) and showed no or only sparse expression of chr2:4animals were wild - type siblings not carrying the floxed chr2-eyfp gene.2ai32 mice were heterozygote siblings4ai32 homozygote mice received a highly diluted cre - virus injection in s1 ( 1:10000).2ai32 homozygote mice received a diluted cre - virus injection in s1 ( 1:1000 ) , but showed only very sparse expression of chr2 ( figure s8b ) . we explain the low chr2 expression levels and lack of evoked responses in these mice by the failed virus delivery during surgery . ai32 mice were heterozygote siblings ai32 homozygote mice received a highly diluted cre - virus injection in s1 ( 1:10000 ) . ai32 homozygote mice received a diluted cre - virus injection in s1 ( 1:1000 ) , but showed only very sparse expression of chr2 ( figure s8b ) . we explain the low chr2 expression levels and lack of evoked responses in these mice by the failed virus delivery during surgery . at the end of the experiments , mice were deeply anesthetized with pentobarbital , transcardially perfused with cold saline and paraformaldehyde 4% ( pfa ) and the brains were removed and stored overnight in pfa 4% . then , the brains were transferred to a sucrose solution ( 20% in pbs 0.1 m ) for at least 24 hr and sliced in 50 m coronal sections with a freezing microtome . tissue was stored in a solution of sodium azide ( 0.01% in pbs 0.1 m ) until histological processing . slices were incubated with a mouse primary monoclonal antibody anti - chr2 ( clone 15e2 , mfd diagnostics ) and with a biotinylated secondary antibody anti - mouse ( vector labs ) . the tissue was finally processed with diaminobenzidine ( sigma - aldrich ) for the colorimetric reaction . slices were mounted and imaged with a wide field scanner microscope ( olympus vs120 ) at 10x . mice were head - fixed and placed on a heated platform under light isoflurane anesthesia ( 0.75% ) . ten 1 s vibrotactile stimuli consisting of a 100 hz sinusoidal vibration were delivered to their forepaw with a 10 s inter stimulus interval . the cranial window was illuminated by a collimated red light led ( 630 nm ) and imaged at 10 fps with a 256 by 332 pixels resolution . the average difference image between the stimulation period and a 1.5 s baseline period was processed by a 50 by 50 pixels spatial averaging filter and subsequently smoothed by a 5 by 5 pixels gaussian low pass filter with 0.5 pixels standard deviation . imaging was performed with a custom built two - photon microscope ( mimms ; https://openwiki.janelia.org/wiki/display/public/home ) controlled by scanimage 4.2 ( scanimage.org ) using a 16x 0.8 na objective ( nikon ) and with excitation wavelength at 940 nm ( ultra ii , tunable ti : sapphire laser , coherent ) . 512 by 512 pixel images covering 626 by 665 m of cortex were acquired at 29.57 hz using bidirectional scanning with a resonant scanner system ( thorlabs ) . the power was modulated with pockels cell ( 350 - 80-la-02 , conoptics ) and calibrated with a photodiode ( thorlabs ) . optogenetic stimuli were generated with a 473 nm laser ( dhom - w473 - 200mw , ultralasers ) which was custom modified to be gated electronically using ttl pulses . the power was calibrated before each session to be 20mw at the stimulation site on the brain surface . the imaging and optogenetic beams were combined using a longpass dichroic mirror ( 700dcxxr , chroma ) between the scan lenses and the tube lens . the primary mirror for imaging was a custom polychroic ( chroma , zt470/561/nir - trans ) transmitting the infrared and blue light , while reflecting the green . before detection , the remaining ir light was filtered with a colored glass band pass filter ( bg39 , chroma ) , whereas the remaining blue light was removed with a short pass filter ( cg475 , chroma ) . images were continuously acquired using gated photo multiplier tubes ( gpmt ) ( h11706p-40 sel , hamamatsu ) and written in 16 bit format to disk in separate files ( 1110 frames / file ) . the start / end of file trigger was issued by a separate pc and later used for temporal alignment of ca traces with behavioral variables . the objective was aligned perpendicular to the imaging window for each mouse using a custom built laser - based alignment device . at the start of each session , the imaging field was manually located using reference images of previous recording days and slow drifts manually corrected for throughout the session . to correct for lateral movements , a custom matlab registration algorithm was used to align each image to a template taken as the average image of a 30 s resting baseline period recorded at the start of each session . the cross - correlation was computed between each image and the template by multiplying the two - dimensional discrete fourier transform of one with the complex conjugate of the fourier transform of the other and taking the inverse fourier transform of the product . the row and column location of the peak cross - correlation value was taken as the vertical and horizontal shift , respectively . 10% of each image was cropped at the boundaries for the purposes of this computation . semi - automatic custom matlab routines were used to draw regions of interests ( rois ) for individual neurons using the session average image . the ca - dependent fluorescence time series were extracted by averaging pixels within each roi . the time - varying baseline f0 of a fluorescence trace was computed as the average value in a 20 s moving time window by excluding values that surpass 20% of this average . at each time point , the updated baseline value f0 was subtracted from the raw fluorescence value f to yield f and compute the relative change to baseline as f / f0 . images of scanned brain tissue acquired with scanimage were streamed on the local network using the user datagram protocol ( udp ) . each end - of - frame signal triggered a custom coded matlab routine that sent , in succession , 32 equal - sized lines of the 512 by 512 pixel image ( i.e. , 16 packets / image ) over the network . the packets were read on the appropriate udp port on a separate pc , the images reassembled and the relative change with respect to baseline of the conditioned neuron(s ) computed by extracting the average pixel intensity in a defined region of interest comprising a single cell . the extracted activity was downsampled to 0.2 s by averaging blocks of 6 consecutively received images and changes relative to a preceding 20 s moving baseline window were computed ( f / f0 ) . f / f0 values exceeding 20% were excluded when updating the baseline value . a second custom written matlab instance running on the same pc transformed , at every time sample t , f / f0 into a frequency value f(t ) according to f(t)=aen(t)a where n(t ) is the f / f0 value at time t. the obtained frequency value was then binned into one of 17 bins ranging from 1 hz to 15.12 hz in quarter - octave increments and produced a rate signal for the optogenetic pulses . the pulse rate was updated whenever the binned f(t ) differed from the binned f(t-1 ) . linear changes in neural activity therefore resulted in exponential changes in the feedback signal ( figure 1d , inset ) . a third custom written matlab instance used the rate code to generate an analog output signal on a data acquisition board ( national instruments , austin , tx ) that produced the optogenetic feedback to the mouse . the same instance also triggered a 0.35 s auditory beep and a reward pulse that opened a valve to deliver a drop of water to the mouse whenever the signal crossed a threshold level . the water drop was sucked away with a peristatic pump ( minipulse 2 , gilson , middleton , wi ) right upon delivery , thereby requiring immediate consumption and instigating anticipatory licking . rewards were always delivered automatically upon threshold crossings except in the lick - triggered reward condition of the last 5 sessions ( see behavioral training section below ) . the threshold level was initially chosen for each neuron on a trial - and - error basis to yield a minimum of approximately two rewards per minute , based on a baseline recording period , and was kept fixed thereafter . that was binned in the maximum 15.12 hz bin and was set by adjusting the coefficient a. only threshold crossings triggered a reward and the 15 hz stimulation was turned off if a sustained activity above threshold continued in excess of 1 s. the optogenetic feedback was reinstated once such sustained activity came back below threshold . this was done to pair the maximum stimulation frequency ( 15 hz ) with activity threshold crossings only , as this is what we sought to reinforce . by turning the stimulus off we avoided optogenetically reinforcing high levels of activity sustained above threshold that did not lead to reward . the total median time delay between frame completion and feedback generation was uniformly distributed between 19.2 ms and 219.2 ms ( see table).median ( 5% and 95% quantiles ) time delays incurred by the different processing stagesframe transmission11.2 ( 9.2 , 13.0 ) mssignal extraction7.1 ( 6.8 , 10.1 ) msrate code computation0.84 ( 0.8 , 5.4 ) msfeedback generation0.052 ( 0.05 , 3.2 ) ms median ( 5% and 95% quantiles ) time delays incurred by the different processing stages the choice of the conditioned neurons was biased toward neurons in the middle of the imaged field of view . other selection criteria were a clear identifiable morphology and a minimal ca event rate of 2 events / minute ( assessed during initial baseline measurements lasting 2 to 3 min ) . once a neuron was chosen , it was used for conditioning on all subsequent sessions as long as it remained active ( produced more than 2 ca events / minute ) . if the criterion was not met , conditioning was switched to a new neuron meeting the criterion before the start of the session . the functional role ( relationship to movements ) of the chosen neurons was not assessed and therefore remained unknown . because image movement correction was not performed for the real - time data , we quantified the artifactual transitions in the conditioned f / f0 traces that were induced by lateral motions ( figures s2d the optogenetic feedback was guided by mirrors through the imaging objective and visually aligned on the chr2 expression site in forepaw s1 using a ccd camera and a reference image of the blood vessel map . the squared pulses were used to electrically switch the laser on and off creating as such a fast and silent shutter for the blue light stimulus . the same pulse signal elongated by 1 ms turned off the gpmt used for imaging during photostimulation periods . this resulted in at most one band of 92 lines of the 512 by 512 pixel images to be blacked out over a two frame period for the maximal 15 hz stimulation level . eventual blanking of the cn was detected online and the frame in question was ignored in subsequent processing stages . as a visual mask , a collimated blue light led ( 473 nm , roithner ) was turned on and the gpmt turned off during flyback periods of scanning ( 1.5 ms pulses at the 29.57 hz acquisition rate ) , thus not affecting the acquired images while providing a perceptually stable visual stimulus . this pulsated blue light illuminated the otherwise dark setup from session start to session end . the feedback signal was delivered continuously without any trial structure but was paused for 1 s at 37.5 s intervals to allow for logging acquired data to separate files . this end / start of file trigger was also used to periodically update the saved image files on the scanimage pc and later used for aligning extracted ca traces with behavioral variables . mice sat head - fixed in a tube ( 25 mm inner diameter ) . the forepaw contralateral to the imaged and stimulated cortical sites was resting on a hold bar to maintain balance while the ipsilateral forepaw was restrained inside the tube . the water reward was delivered through a spout placed at licking distance below the snout . the tube and the mouse were connected to a 5 v node and , when touched , the conductive hold bar and reward spout shunted the 5 v to a circuit that pulled a respective analog input signal to the data acquisition board to high . licks and forepaw rests were in this manner continuously acquired at a sampling rate of 1 khz . releases of the hold bar were used to assess if mice consistently used contralateral forepaw movements to solve the task ( figure s2h ) . we used 4 control mice to test the efficacy of a blue visual mask in suppressing visually evoked ecog responses by the optogenetic stimulus . with the mask turned off , visually evoked potentials were observed in response to the onset and offset of the blue laser pulse train , but were completely suppressed when the mask was turned on ( figures s1c and s1d ) . mice were trained in the operant conditioning task for 15 to 17 consecutive daily sessions . the experimental timeline of each session was divided into condition blocks ( figure s2a ) . each conditioning session began with a three minute period of playback where a neural activity recorded on a previous day controlled the optogenetic feedback and reward delivery , in otherwise identical experimental settings . the f / f0 trace of the conditioned neuron saved in a previous session was used for this purpose . instead of the f / f0 values extracted from the streamed images at each time sample in real - time , the optogenetic feedback and threshold crossings were determined by the f / f0 values of that saved trace . control was then switched to the conditioned neuron and after an average of 25 min of real - time conditioning , the optogenetic feedback was removed for 3 min and reinstated thereafter . lick - triggered rewards were introduced during the first 3 min of playback and 3 min before , during and after optogenetic feedback removal . instead of being automatically delivered , mice had to initiate licking in a 500 ms time window following threshold crossings to obtain the reward . because rewards were otherwise always automatically delivered , these brief introductions of the lick - triggered reward condition were not significant enough to incentivize mice to engage in continuous licking as is sometimes observed in such lick - triggered reward paradigms . additionally , each session ended with 6 min of playback under the lick - triggered reward condition . in the first 3 min , optogenetic stimulation was applied to a control non - chr2 site and moved back to the s1 chr2 site in the last 3 min of playback . the positions corresponding to the chr2 and control sites were located on the blood vessel map using a ccd camera and their image coordinates recorded . the optogenetic beam was then positioned with a pair of galvanometric mirrors on those same image coordinates ( using a reflective surface ) and the corresponding voltages applied to the two mirrors were recorded for each site . the beam was then moved between chr2 and control sites , during the experiment , by applying the appropriate voltage levels at relevant times . all transitions between different experimental conditions were not cued by experiment interruptions or additional sensory stimuli . in the three neuron conditioning experiments , each neuron s activity n was transformed by a logistic function according tof(n)=12[1+tanh(a(nc ) ) ] . the ensemble activity f(n1)+f(n2)f(n3 ) controlled the rate of optogenetic feedback pulses and reward delivery . a and c were set to 2.2 and 0.6 , respectively and the reward threshold to 1.75 . this mapping constrained neurons n1 and n2 to co - activate and n3 to remain silent to bring the ensemble activity above threshold and trigger a reward . more specifically , f / f0 values of n3 above 0.36 prevented threshold crossings irrespective of n1 and n2 activity . concomitant f / f0 values of n1 and n2 above 1.15 resulted in threshold crossings provided the activity of n3 remained at zero . no statistical methods were used to predetermine sample size and all trained animals were included in the analysis . two - tailed student s t test ( for samples with equal variances ) or welch s t test ( for samples with unequal variances ) equal variances were determined with the two - sample f - test and the normality assumption was tested with the kolmogorov - smirnov test . the efficacy of chr2 activation ( figures s1a and s1b ) was assessed by measuring differentially between the two contralateral cortical electrode responses evoked by a 0.5 s train of 5 ms optical pulses delivered at 15 hz . peak responses in a 20 ms time window following the onset of each 5 ms light pulse were compared across all stimulation trials ( n = 30 ) to peak responses to the same number of simulated light pulses in the 0.5 s baseline period preceding the stimulus train onset . animals with significant differences ( paired t test , p < 0.05 ) between true and simulated mean peak values were classified as chr2 mice and as control mice otherwise . no method of randomization was used and the investigator was not blind with respect to the classification of 5 control animals , but was blind for the other 6 and for all chr2 animals . learning curves were calculated for the conditioning period between the end of the initial playback and either the onset of feedback removal or onset of the lick - triggered reward condition that precedes feedback removal . threshold crossing rate ( tcr ) was calculated for each of 8 equally sized time bins in this window . learning sessions were defined as those with significant linear increases of tcr across the 8 bins ( linear regression , p < 0.05 ) . mice with significantly bigger tcr in the last compared to the first bin across all sessions were labeled as learners and as non - learners otherwise . tcr normalization was performed by offsetting individual session learning curves to the same tcr value in the first bin , taken as the mean of all first bin tcr values , and dividing the rate of each bin by it . chance levels of detection probability of threshold crossings assessed in the lick - triggered reward condition ( figure s4 ) were simulated separately for each mouse and each experimental condition as follows : 1 . we identified the experimental epoch corresponding to each individual data point included in the mean value calculations of figure 2e . we isolated licks that occur only during baseline stimulation ( i.e. , 1 hz ) and attributed them to spontaneous licking . we then simulated spontaneous licking for the whole epoch by randomly reproducing the isolated lick sequences , thus preserving their temporal statistics ( i.e. , the inter - lick - interval and lick duration ) . chance detection probability was then calculated using these simulated licks and the same neural activity as for the actual data . as such , this procedure yielded for each individual data point a corresponding chance level and allowed paired statistical comparisons . ca events were detected by taking the first derivative of the smoothed f / f0 trace ( savitzky - golay filter , second order polynomial , 15 data points ) and an event onset was defined when the z - scored trace crossed a value of 2 and event end when it decreased again below 0 . event amplitude was defined as the difference of the f / f0 values between event end and event onset time points . event rate and average event amplitude were calculated for the same 8 time bins as the learning curves . a general linear model with the threshold crossing rate ( tcr ) z score as the dependent and the z scores of the event rate ( er ) and event amplitude ( ea ) as the independent variables was fit to each of the 33 learning sessions as follows : tcr = berer+beaea . the relative contribution of er and ea changes to tcr increases was evaluated by comparing the distributions of the fitted ber and bea values expressed in terms of number of standard deviations across all learning sessions . event rate and event amplitude change factors correspond to the ratios between the last and first time bins of the two measures , respectively . temporal ca event probability ( figure s3a ) was computed by transforming each f / f0 trace into an event trace which was set to 1 between each event onset and end , and to 0 otherwise . the reward - triggered average of all event traces of a given neuron yielded the event probability . increasing neurons were defined , in a given learning session , as those having significant linear increases ( p < 0.05 , linear regression ) of either their eas or ers between the start and end of learning , evaluated with the 8 time - binned values . leading neurons were identified , in a given learning session , by computing the hypergeometric cumulative distribution function value for each non - cn according top=1i=0x(ki)(mkni)/(mn),where x is the number of instances in which the non - cn produced a ca event in a 1 s interval preceding the onset of the cn s threshold crossing ca event . k is the product of the number of time samples in the 1 s interval and the number of threshold crossings in a given session ( number of samples drawn ) , m is the product of the number of time samples in a 4 s interval preceding the cn s event onset and the number of threshold crossings ( size of the population ) and n is the number of instances in which non - cn events occurred in the 4 s interval ( number of items with the desired characteristic in the population ) . non - cns with p < 0.01 were defined as leading neurons ( i.e. , those that produce ca events that precede the cn s threshold crossing ca event more often than what would be expected by chance ) . a receiver operating characteristic ( roc ) analysis was carried out on the leading neurons to assess whether their activity can predict threshold crossings of the cn s ca trace . for each learning session , the cn s ca events were classified into rewarded ( those that crossed threshold , event type x ) and unrewarded ( those that did not cross threshold , event type y ) , and each leading neuron s f / f0 trace in a 1 s interval preceding the onset of these events was taken into account . a discrimination score ( dvx ) was computed for each leading neuron for the i event type x as the dot - product of the neuron s f / f0 trace ( xi ) and the mean trace across all type x events ( excluding the i event , x ) minus the dot - product of xi and the mean trace across all type y events ( y ) . the discrimination score dvy was analogously obtained for the i event type y and , thus , according todvx = xi(xjiy)dvy = yi(xyji ) . an roc curve was constructed by plotting , for each criterion value c varied across the range of dvx and dvy values , p(dvx > c ) ( i.e. , the fraction of dvx values exceeding the criterion ) against p(dvy > c ) ( i.e. , the fraction of dvy values exceeding the criterion ) . the area under the roc curve ( auc ) was computed using trapezoidal numerical integration ( trapz ( ) function in matlab ) and corresponds to the fraction of events correctly discriminated by an ideal observer using the obtained discrimination scores . a permutation test , consisting of shuffling the x and y event labels and calculating auc values with 1999 shuffled subsets , yielded a p value for each leading neuron , taken as the fraction of shuffled auc values that were more extreme than the auc corresponding to the non - shuffled data . leading neurons with p < 0.05 were deemed to correctly predict , above chance level , weather a cn s ca event would cross threshold . bootstrap hypothesis testing of a test statistic being different from zero was performed by taking at random , with replacement , n values from the total set of n measurements of a variable , 1999 times . the two - tailed bootstrap p value was then computed from the 1999 sample measurements of a test statistic x as follows : p=2min(1bj=1bi(xj0),1bj=1bi(xj>0)),where b = 1999 , xj is the j bootstrap sample of x and i ( ) is the indicator function , which is equal to 1 when its argument is true and 0 otherwise . | summaryneuronal motor commands , whether generating real or neuroprosthetic movements , are shaped by ongoing sensory feedback from the displacement being produced .
here we asked if cortical stimulation could provide artificial feedback during operant conditioning of cortical neurons .
simultaneous two - photon imaging and real - time optogenetic stimulation were used to train mice to activate a single neuron in motor cortex ( m1 ) , while continuous feedback of its activity level was provided by proportionally stimulating somatosensory cortex .
this artificial signal was necessary to rapidly learn to increase the conditioned activity , detect correct performance , and maintain the learned behavior .
population imaging in m1 revealed that learning - related activity changes are observed in the conditioned cell only , which highlights the functional potential of individual neurons in the neocortex .
our findings demonstrate the capacity of animals to use an artificially induced cortical channel in a behaviorally relevant way and reveal the remarkable speed and specificity at which this can occur . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
is associated with increased surgical risk and a worse long - term outcome in patients undergoing aortic valve replacement.1 there seems to be little doubt that preprocedural mitral regurgitation adversely impacts prognosis in transcatheter aortic valve implantation ( tavi ) patients as well.2 however , in some patients , the severity of mitral regurgitation is reduced following tavi.3 data concerning the potential clinical benefit of such an improvement with long - term follow - up are more limited.2 recently , khawaja et al4 demonstrated that mitral regurgitation worsening is associated with a poorer survival rate . persistent or even worsening significant mitral regurgitation may be especially important in patients who develop a significant paravalvular leak following tavi , leading to additional volume overload and making these patients vulnerable to haemodynamic decompensation . however , the impact of this adverse interaction between mitral and aortic regurgitation on survival rates following tavi has not yet been separately studied . the polish transcatheter aortic valve implantation registry ( pol - tavi ) 2013 included 105 patients qualified for tavi with significant mitral regurgitation . this provided an opportunity to supplement existing data concerning the impact of preprocedural and postprocedural mitral regurgitation on mortality following tavi and its interaction with aortic regurgitation . pol - tavi is an obligatory prospective registry of all patients undergoing tavi in polish hospital centres.5 the registry database contains detailed demographic and clinical characteristics , results of imaging studies including echocardiography and ct , laboratory assessment , procedural results and the results of a short - term and midterm follow - up ( 1 month , 6 months and 1 year ) . the current analysis included patients who underwent tavi in the year 2013 , regardless of the access site and valve type . transthoracic echocardiographic studies were performed prior to the procedure , immediately postprocedure and at a 1-month follow - up . mitral regurgitation assessment involved assessment of multiple indices including valve morphology , colour doppler and continuous - wave doppler of the regurgitant jet , vena contracta width , regurgitant volume and effective orifice area ( when available ) , according to current guidelines.6
7 mitral regurgitation was considered significant if graded as moderate ( grade 3 ) or severe ( grade 4 ) . changes in mitral regurgitation severity were assessed between the baseline study , postprocedure and at a 1-month follow - up . they were classified as improvement / no change and worsening of mitral regurgitation by at least one grade . paravalvular aortic regurgitation was graded according to the valve academic research consortium ( varc)-2 criteria.8 the follow - up period was defined from the date of the procedure to either death or the last available follow - up visit . mortality data were obtained from the clinical follow - up data or from the national statistics office ( pesel system , pl ) , when necessary . statistical analysis was performed by spss v 17.0 ( ibm , new york , usa ) . survival curves were created using the kaplan meier method for the following subgroups with : ( i ) insignificant versus significant mitral regurgitation at baseline , ( ii ) immediately postprocedure and ( iii ) at a 1-month follow - up , as well as for subgroups of patients with ( iv ) no change versus improvement versus worsening of mitral regurgitation at a 1-month follow - up , compared with the baseline study . to assess the interaction between the presence of aortic and mitral regurgitation , we compared the survival of patients ( i ) without significant mitral and aortic regurgitation versus ( ii ) those with either significant aortic or significant mitral regurgitation alone versus ( iii ) those with both significant mitral and aortic regurgitation postprocedure . univariate cox proportionate hazards modelling was performed for each covariate using an unadjusted model . subsequently multivariate models using a forward elimination method and entry criteria of p0.05 were constructed . the study complied with the declaration of helsinki , and the institutional ethics committee of the institute of cardiology approved the research protocol . transthoracic echocardiographic studies were performed prior to the procedure , immediately postprocedure and at a 1-month follow - up . mitral regurgitation assessment involved assessment of multiple indices including valve morphology , colour doppler and continuous - wave doppler of the regurgitant jet , vena contracta width , regurgitant volume and effective orifice area ( when available ) , according to current guidelines.6
7 mitral regurgitation was considered significant if graded as moderate ( grade 3 ) or severe ( grade 4 ) . changes in mitral regurgitation severity were assessed between the baseline study , postprocedure and at a 1-month follow - up . they were classified as improvement / no change and worsening of mitral regurgitation by at least one grade . paravalvular aortic regurgitation was graded according to the valve academic research consortium ( varc)-2 criteria.8 the follow - up period was defined from the date of the procedure to either death or the last available follow - up visit . mortality data were obtained from the clinical follow - up data or from the national statistics office ( pesel system , pl ) , when necessary . statistical analysis was performed by spss v 17.0 ( ibm , new york , usa ) . survival curves were created using the kaplan meier method for the following subgroups with : ( i ) insignificant versus significant mitral regurgitation at baseline , ( ii ) immediately postprocedure and ( iii ) at a 1-month follow - up , as well as for subgroups of patients with ( iv ) no change versus improvement versus worsening of mitral regurgitation at a 1-month follow - up , compared with the baseline study . to assess the interaction between the presence of aortic and mitral regurgitation , we compared the survival of patients ( i ) without significant mitral and aortic regurgitation versus ( ii ) those with either significant aortic or significant mitral regurgitation alone versus ( iii ) those with both significant mitral and aortic regurgitation postprocedure . subsequently multivariate models using a forward elimination method and entry criteria of p0.05 were constructed . the study complied with the declaration of helsinki , and the institutional ethics committee of the institute of cardiology approved the research protocol . in the year 2013 , 381 patients were enrolled in the pol - tavi registry following the tavi procedure , including 166 males ( 43.6% ) and 215 females ( 56.4% ) aged 78.87.4 years ( range 3585 years ) . a medtronic corevalve prosthesis was implanted in 209 patients ( 54.9% ) , edwards - sapien xt in 133 ( 34.9% ) patients , edwards - sapien in 2 patients ( 4.5% ) and other valve types in 22 patients ( 5.8% ) . inhospital and overall mortality were 6.6% and 10.2% ( 25 and 39 patients , respectively ) . the demographic and clinical data are presented in table 1 and baseline echocardiographic characteristics in table 2 . baseline demographic and clinical characteristics cabg , coronary artery bypass grafting ; pci , percutaneous coronary intervention . baseline echocardiographic characteristics significant ( grade 3 or 4 ) mitral regurgitation was present in 27.6% at baseline examination , in 16% of patients prior to discharge , in 8.7% of patients at a 1-month follow - up and in 2.9% of patients at a 6-month follow - up ( p0.0001 for all vs baseline ) . changes in the mitral regurgitation grades during follow - up are presented in figure 1 . mitral regurgitation ( mr ) grades preprocedure , postprocedure and at a 1-month follow - up . patients with a medtronic corevalve prosthesis had a greater degree of mitral regurgitation prior to discharge than patients with the edwards - sapien or edwards - sapien xt valves ( 2.00.8 vs 1.80.7 , p0.005 ) . meier analysis revealed that patients with significant versus insignificant preprocedural mitral regurgitation did not differ with respect to mortality ( log rank mantel there were significant differences in mortality however when preprocedural mitral regurgitation deteriorated versus remained unchanged or improved at the 1-month follow - up ( log rank mantel significant differences in mortality were apparent in patients with significant versus insignificant mitral regurgitation postprocedure and at the 1-month follow - up ( log rank mantel meier curves demonstrating the association between mitral regurgitation ( mr ) and mortality in the overall group . ( a ) no significant difference in total mortality between patients with significant versus insignificant preprocedural mitral regurgitation ( log rank mantel cox p=0.10 ) ; ( b ) significant difference in mortality in patients in whom preprocedural mitral regurgitation deteriorated versus remained unchanged or improved at a 1-month follow - up ; ( c ) significant differences in mortality in patients with significant versus insignificant mitral regurgitation postprocedure and ( d ) at a 1-month follow - up . thirty - one patients ( 8.1% ) had significant aortic regurgitation postprocedure including 12 patients with both significant mitral and aortic regurgitation ( 3.1% ) . patients with significant versus insignificant aortic regurgitation , immediately postprocedure , differed significantly with respect to mortality ( log rank mantel this difference was no longer apparent when a subgroup of patients without significant mitral regurgitation postprocedure was selected ( log rank mantel similarly in a subgroup of patients without significant aortic regurgitation postprocedure , there were no significant differences in mortality between individuals with versus without significant mitral regurgitation postprocedure ( log rank mantel significant mitral and aortic regurgitation postprocedure had a significant impact on mortality only when associated with each other ( log rank mantel meier curves demonstrating the relationship between mitral regurgitation ( mr ) and aortic regurgitation ( ar ) postprocedure . ( a ) significant difference in mortality between patients with significant versus insignificant ar immediately postprocedure ; ( b ) no difference in mortality between patients with significant versus insignificant ar postprocedure in a subgroup of patients without significant mr postprocedure ; ( c ) no difference in mortality between patients with significant versus insignificant mr postprocedure in a subgroup of patients without significant ar postprocedure ; ( d ) significant difference in mortality in patients with associated mitral and ar postprocedure . univariate cox regression analysis revealed that preprocedure mitral regurgitation had no significant association with mortality ( or 1.71 , 95% ci 0 . factors significantly , and at borderline significance , associated with mortality in the overall population at univariate cox proportionate hazards modelling are presented in table 3 . univariate cox proportionate hazards modelling at multivariate cox regression modelling in the overall group concomitant significant mitral and aortic regurgitation postprocedure and euroscore ii were independently associated with mortality ( or 3.21 , 95% ci 1.54 to 5.71 , p=0.002 and or 1.07 , 95% ci 1.02 to 1.11 , p=0.003 ) . kaplan meier analysis revealed that patients with significant versus insignificant preprocedural mitral regurgitation did not differ with respect to mortality ( log rank mantel there were significant differences in mortality however when preprocedural mitral regurgitation deteriorated versus remained unchanged or improved at the 1-month follow - up ( log rank mantel significant differences in mortality were apparent in patients with significant versus insignificant mitral regurgitation postprocedure and at the 1-month follow - up ( log rank mantel meier curves demonstrating the association between mitral regurgitation ( mr ) and mortality in the overall group . ( a ) no significant difference in total mortality between patients with significant versus insignificant preprocedural mitral regurgitation ( log rank mantel cox p=0.10 ) ; ( b ) significant difference in mortality in patients in whom preprocedural mitral regurgitation deteriorated versus remained unchanged or improved at a 1-month follow - up ; ( c ) significant differences in mortality in patients with significant versus insignificant mitral regurgitation postprocedure and ( d ) at a 1-month follow - up . thirty - one patients ( 8.1% ) had significant aortic regurgitation postprocedure including 12 patients with both significant mitral and aortic regurgitation ( 3.1% ) . patients with significant versus insignificant aortic regurgitation , immediately postprocedure , differed significantly with respect to mortality ( log rank mantel this difference was no longer apparent when a subgroup of patients without significant mitral regurgitation postprocedure was selected ( log rank mantel similarly in a subgroup of patients without significant aortic regurgitation postprocedure , there were no significant differences in mortality between individuals with versus without significant mitral regurgitation postprocedure ( log rank mantel significant mitral and aortic regurgitation postprocedure had a significant impact on mortality only when associated with each other ( log rank mantel meier curves demonstrating the relationship between mitral regurgitation ( mr ) and aortic regurgitation ( ar ) postprocedure . ( a ) significant difference in mortality between patients with significant versus insignificant ar immediately postprocedure ; ( b ) no difference in mortality between patients with significant versus insignificant ar postprocedure in a subgroup of patients without significant mr postprocedure ; ( c ) no difference in mortality between patients with significant versus insignificant mr postprocedure in a subgroup of patients without significant ar postprocedure ; ( d ) significant difference in mortality in patients with associated mitral and ar postprocedure . univariate cox regression analysis revealed that preprocedure mitral regurgitation had no significant association with mortality ( or 1.71 , 95% ci 0 . factors significantly , and at borderline significance , associated with mortality in the overall population at univariate cox proportionate hazards modelling are presented in table 3 . univariate cox proportionate hazards modelling at multivariate cox regression modelling in the overall group concomitant significant mitral and aortic regurgitation postprocedure and euroscore ii were independently associated with mortality ( or 3.21 , 95% ci 1.54 to 5.71 , p=0.002 and or 1.07 , 95% ci 1.02 to 1.11 , p=0.003 ) . the current study demonstrated that there was a significant interaction between the presence of a paravalvular leak following tavi and persistent mitral regurgitation . of practical importance , while there was a significant difference in mortality between patients with significant versus insignificant aortic regurgitation immediately postprocedure , this difference was no longer apparent in a subgroup of patients without significant mitral regurgitation postprocedure . conversely , significant mitral regurgitation , as expected , had an impact on mortality , but this difference was not apparent in a subgroup of patients without significant aortic regurgitation . concomitant significant mitral and aortic regurgitation postprocedure led to a sevenfold increase in mortality , independently of other risk factors . it has been identified as an independent risk factor of short - term and long - term mortality.9 while some authors suggest that the risk attributed to a paravalvular aortic regurgitation may be in part related to confounding factors , volume overload caused by a regurgitant jet should not be ignored . the interaction with mitral valve function was demonstrated by hayashida et al10significant paravalvular leaks were associated with the lack of regression or even further aggravation of mitral regurgitation . in such circumstances , the harm resulting from combined volume overload may clearly prevail over the benefits of pressure overload correction with tavi . since significant mitral regurgitation is associated with increased perioperative risk and worse long - term survival , some authors recommend double - valve replacement / repair.11 the benefit of mitral valve repair with aortic valve surgery was demonstrated , for example , by coutinho et al12 who reported that patients who underwent combined mitral and aortic valve surgery experienced more pronounced reverse left ventricular remodelling and greater clinical benefit ( new york heart association functional ( nyha ) functional classes iii to iv ) . the lack of improvement in mitral regurgitation severity in patients who underwent isolated aortic valve surgery was associated with nearly fivefold increase in late mortality . we observed greater mortality only in patients in whom mitral regurgitation deteriorated . in the propensity - matched analysis of patients with significant mitral regurgitation performed by mccarthy et al13 , patients undergoing double - valve surgery and tavi had comparable perioperative outcomes . however , as expected , mitral regurgitation was more significantly reduced in surgical than tavi patients and midterm survival was better in surgical patients . given these considerations in the cornerstone placement of aortic transcatheter valve ( partner ) trial , which laid the ground for the percutaneous tavi , concomitant significant mitral regurgitation constituted one of the exclusion criteria.14 nevertheless , a subgroup of patients with significant mitral regurgitation was also included in the partner trial and its presence was associated with a doubling of 30-day mortality.15 presently , an increasing number of high - risk patients with aortic stenosis and concomitant mitral regurgitation undergo tavi beyond classical indications.16 the decisions to intervene in one or both valves in high - risk patients with aortic stenosis and concomitant mitral regurgitation involve a quadruple choice between single - valve , double - valve surgery , isolated tavi and tavi with sequential / simultaneous percutaneous mitral valve intervention in selected patients.17 the decisions are usually based on the assessment , mitral valve morphology and function as well as the probability of mitral regurgitation improvement after isolated aortic valve intervention.18 however , the prediction of mitral regurgitation improvement following tavi is somewhat elusive . the results of clinical observations are conflicting and a reproducible set of factors that can be reliably used to predict improvement of mitral regurgitation following isolated aortic valve intervention has yet to be equivocally defined.11
19 therefore , in patients with mitral regurgitation , special precautions should be taken to avoid paravalvular aortic regurgitation and resulting combined volume overload following the procedure . of notice , paravalvular leaks were more prevalent following the use of self - expandable valves as compared with balloon - expandable valves.20 moreover , the use of the self - expandable valves was associated with a less prominent mitral regurgitation improvement compared with the balloon - expandable valves.21 we also observed a greater degree of mitral and aortic regurgitation postprocedure following self - expandable valve implantation . it is therefore interesting to note that mitral valve regurgitation was an independent risk factor for late death in the registry studies where most patients were treated with the corevalve system . this association was much weaker or not apparent in the registry studies where the corevalve system was used in a minority of patients.2 these observations may be explained by the more frequent adverse interactions between mitral and aortic regurgitation in patients who received balloon - expandable valves . this study has several limitations . while the diagnosis of mitral and aortic regurgitation criteria was unified throughout the centres , according to the current guidelines , there was no core echocardiographic laboratory and quantitative assessment was not universally unified . the registry did not provide data on the aetiology of concomitant mitral regurgitation , therefore we were not able to substratify patients according to the mechanism of a regurgitant jet . the subgroup of patients with concomitant mitral and aortic regurgitation was limited in number and an analysis needs to be replicated in the meta - analysis of available data . the current study demonstrated that there was a significant interaction between the occurrence of paravalvular leak following tavi and persistent mitral regurgitation . of practical importance while there was a significant difference in mortality between patients with significant versus insignificant aortic regurgitation immediately postprocedure , this difference was no longer apparent in a subgroup of patients without significant mitral regurgitation postprocedure . conversely , significant mitral regurgitation , as expected , exerted an impact on mortality but this difference was not apparent in a subgroup of patients without significant aortic regurgitation . concomitant significant mitral and aortic regurgitation postprocedure led to a significant increase in mortality , independent of other risk factors . it remains to be established whether in patients for whom a percutaneous approach is chosen , preprocedural mitral regurgitation should influence the prosthesis choice . undoubtedly , it warrants consideration of managing physicians since clearly , patients with significant paravalvular leak following tavi in whom significant mitral regurgitation persists or worsens are at greater risk of haemodynamic complications and have a worse midterm prognosis . in such patients , a second step intervention either a paravalvular leak closure or percutaneous edge - to - edge mitral valve repair ( or both)should be considered by a multidisciplinary heart team . key messageswhat is already known on this subject?in some patients , significant preprocedural mitral regurgitation ( mr ) improves while in the others , it worsens following transcatheter aortic valve implantation ( tavi ) . persistent significant mr may be especially important in patients who develop a significant paravalvular leak.what might this study add?it demonstrated that there was a significant interaction between the presence of a paravalvular leak and persistent mr postprocedure that led to an increased mortality independent of other risk factors . of importance however , significant mr had no impact on mortality in a subgroup of patients without significant aortic regurgitation and significant paravalvular leak had no impact on mortality in a subgroup of patients without significant mr.how might this impact on clinical practice?the results of the study may influence management approach to paravalvular leaks following tavi , depending on the presence or absence of significant mr postprocedure . in some patients , significant preprocedural mitral regurgitation ( mr ) improves while in the others , it worsens following transcatheter aortic valve implantation ( tavi ) . persistent significant mr may be especially important in patients who develop a significant paravalvular leak . it demonstrated that there was a significant interaction between the presence of a paravalvular leak and persistent mr postprocedure that led to an increased mortality independent of other risk factors . of importance however , significant mr had no impact on mortality in a subgroup of patients without significant aortic regurgitation and significant paravalvular leak had no impact on mortality in a subgroup of patients without significant mr . the results of the study may influence management approach to paravalvular leaks following tavi , depending on the presence or absence of significant mr postprocedure . this study has several limitations . while the diagnosis of mitral and aortic regurgitation criteria was unified throughout the centres , according to the current guidelines , there was no core echocardiographic laboratory and quantitative assessment was not universally unified . the registry did not provide data on the aetiology of concomitant mitral regurgitation , therefore we were not able to substratify patients according to the mechanism of a regurgitant jet . the subgroup of patients with concomitant mitral and aortic regurgitation was limited in number and an analysis needs to be replicated in the meta - analysis of available data . the current study demonstrated that there was a significant interaction between the occurrence of paravalvular leak following tavi and persistent mitral regurgitation . of practical importance while there was a significant difference in mortality between patients with significant versus insignificant aortic regurgitation immediately postprocedure , this difference was no longer apparent in a subgroup of patients without significant mitral regurgitation postprocedure . conversely , significant mitral regurgitation , as expected , exerted an impact on mortality but this difference was not apparent in a subgroup of patients without significant aortic regurgitation . concomitant significant mitral and aortic regurgitation postprocedure led to a significant increase in mortality , independent of other risk factors . it remains to be established whether in patients for whom a percutaneous approach is chosen , preprocedural mitral regurgitation should influence the prosthesis choice . undoubtedly , it warrants consideration of managing physicians since clearly , patients with significant paravalvular leak following tavi in whom significant mitral regurgitation persists or worsens are at greater risk of haemodynamic complications and have a worse midterm prognosis . in such patients , a second step intervention either a paravalvular leak closure or percutaneous edge - to - edge mitral valve repair ( or both)should be considered by a multidisciplinary heart team . key messageswhat is already known on this subject?in some patients , significant preprocedural mitral regurgitation ( mr ) improves while in the others , it worsens following transcatheter aortic valve implantation ( tavi ) . persistent significant mr may be especially important in patients who develop a significant paravalvular leak.what might this study add?it demonstrated that there was a significant interaction between the presence of a paravalvular leak and persistent mr postprocedure that led to an increased mortality independent of other risk factors . of importance however , significant mr had no impact on mortality in a subgroup of patients without significant aortic regurgitation and significant paravalvular leak had no impact on mortality in a subgroup of patients without significant mr.how might this impact on clinical practice?the results of the study may influence management approach to paravalvular leaks following tavi , depending on the presence or absence of significant mr postprocedure . in some patients , significant preprocedural mitral regurgitation ( mr ) improves while in the others , it worsens following transcatheter aortic valve implantation ( tavi ) . persistent significant mr may be especially important in patients who develop a significant paravalvular leak . it demonstrated that there was a significant interaction between the presence of a paravalvular leak and persistent mr postprocedure that led to an increased mortality independent of other risk factors . of importance however , significant mr had no impact on mortality in a subgroup of patients without significant aortic regurgitation and significant paravalvular leak had no impact on mortality in a subgroup of patients without significant mr . the results of the study may influence management approach to paravalvular leaks following tavi , depending on the presence or absence of significant mr postprocedure . in some patients , significant preprocedural mitral regurgitation ( mr ) improves while in the others , it worsens following transcatheter aortic valve implantation ( tavi ) . persistent significant it demonstrated that there was a significant interaction between the presence of a paravalvular leak and persistent mr postprocedure that led to an increased mortality independent of other risk factors . of importance however , significant mr had no impact on mortality in a subgroup of patients without significant aortic regurgitation and significant paravalvular leak had no impact on mortality in a subgroup of patients without significant mr . the results of the study may influence management approach to paravalvular leaks following tavi , depending on the presence or absence of significant mr postprocedure . | objectiveto analyse the impact of postprocedural mitral regurgitation ( mr ) , in an interaction with aortic regurgitation ( ar ) , on mortality following transcatheter aortic valve implantation ( tavi).methodsto assess the interaction between mr and ar , we compared the survival rate of patients ( i ) without both significant mr and ar versus ( ii ) those with either significant mr or significant ar versus ( iii ) with significant mr and ar , all postprocedure .
381 participants of the polish transcatheter aortic valve implantation registry ( 166 males ( 43.6% ) and 215 females ( 56.4% ) , age 78.87.4 years ) were analysed .
follow - up was 94.196.5 days.resultsinhospital and midterm mortality were 6.6% and 10.2% , respectively .
significant mr and ar were present in 16% and 8.1% patients , including 3.1% patients with both significant mr and ar .
patients with significant versus insignificant ar differed with respect to mortality ( log rank p=0.009 ) .
this difference was not apparent in a subgroup of patients without significant mr ( log rank p=0.80 ) . in a subgroup of patients without significant ar , there were no significant differences in mortality between individuals with versus without significant mr ( log rank p=0.44 ) .
significant mr and ar had a significant impact on mortality only when associated with each other ( log rank p<0.0001 ) . at multivariate cox regression
modelling concomitant significant mr and ar were independently associated with mortality ( or 3.2 , 95% ci 1.54 to 5.71 , p=0.002).conclusionssignificant mr or ar postprocedure , when isolated , had no impact on survival . combined mr and ar had a significant impact on a patient 's prognosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the concentration of serum uric acid ( sua ) is one of the potential markers of cardiovascular and cerebrovascular diseases , which , arguably , are included in most difficult contemporary diseases . this is reflected not only in increase of number of cases , but also in percentage of lethality of patients with cardiovascular diseases . that is why clinical research is very important , dealing with causes of genesis of cardiovascular disease , as well as evaluation of results of such studies , especially having in mind the fact that there are certain discrepancies among them . connection between hyperuricemia and hypertension in humans has been established in series of studies ( 1 , 2 ) . the results of recent pilot study entitled allopurinol ( xanthine oxidase inhibitor lowering concentration of uric acid in serum and urine ) leads to the lowering of urates and blood pressure level ( 3 ) also speak of link between urates and blood pressure . it is known also that hyperuricemia occurs as independent risk factor of stroke , and patients with elevated urates have worse outcome of cerebrovascular incident . elevated urates levels represent a risk factor for peripheral arterial disease ( atherosclerosis of carotid artery ) , in certain heart failures etc . even though the results of research up to date pertaining to the effect of serum uric acid concentrations on cardiovascular diseases and lethality ( aim ) are partially contrastive , the prevailing opinion is that the connection exists . it is established in the series of known studies amongst which are : nhanes i national health and nutrition examination survey i ( 5926 subjects ) where it was established that the elevated sua is the independent cause of occurrence of cardiovascular lethality in general population ( 4 ) . it was also established that the elevated sua is the leading risk of cardiovascular diseases in persons between 45 and 55 years of age in both sexes ; in framingam study ( 6763 subjects ) the link between sua and cardiovascular diseases in general population ( 5 ) was established , but not as an independent from the other risk markers like hypertension , for example ; similar results were acquired in some newer studies , such is rotterdam study which included 4385 subjects , where the independent connection between sua and the incidence of coronary heart disease and cerebrovascular insult ( 6 ) was established ; research of this topic was realized under chicago health association on a sample of 7804 persons of both sexes , where the link between level of sua and cardiovascular morbidity was established ( 7 ) ; an independent connection between sua and lethality in population was established as well in monica study ( sample of 1044 males in age group of 45 64 years ) ( 8) . hyperuricemia occurs at concentration of uric acid of 416 mmol / l . at concentration below the said value , uric acid is released from monosodium urate , and above this concentration the formation of precipitate crystals was observed . th ere are authors that consider the normal values of uric acid to be its values of 458 ( 9 ) it is also known that the increase of uric acid production can be the effect of increased nucleoprotein degradation , excessive intake of purines with food or excessive synthesis of uric acid as a consequence of rare enzyme mutation defect ( 10 ) . since the concentration of serum uric acid is a risk factor of genesis of certain diseases , including those most difficult , with which we deal here , it is of utmost medical importance to putt it under effective control . in this pharmacological - clinical study the primary objective pertained to the analysis of uric acid values and lipid status in patients on therapy with allopurinol , starting from its primary values , i.e. before the start of therapy , as control values ( each patient is his / her own control ) . the therapeutic effects of allopurinol ( daily dose of 100 mg ) on values of triglycerides , cholesterol and ldl and hdl fractions were monitored during three months and six months of treatment of hyperuricemic patients with the additional diagnosis of metabolic syndrome and pronounced cardiovascular diseases and diagnosed hypertension . the eventual change of atherogenic index was also monitored . our research encompassed 40 clinically treated patients of both sexes and belonging to diff erent age groups , divided according to the diagnose of disease in several subgroups . all patients were diagnosed with hyperuricemia , hospitalized in mkc sarajevo and ju opta bolnica ( general hospital ) abdulah naka in sarajevo ( 2010 2013 . ) . inclusion criteria for patient acceptance in this analysis were as follows : hyperuricemia verified by medical doctor based on laboratory diagnostics ; availability of treatment data including eventual complications ; availability of indicators of sex and age determination and anamnestic data . during the study the following methods were used : explicative , assay analysis , statistical and comparative methods . all clinical measurements were carried out by using standard ifcc methods on suitable biochemical analyzers . out of total of 40 subjects on allopurinol therapy , 60% were males , and 40% were females . four patients were below 40 years of age , one 41 - 50 , four 51 - 60 , eight 61 - 70 and 23 patients were above 70 years of age . chi - squared test showed no statistically significant difference in sex structure of the subjects included in this study , =1.6 ; df=1 ; p=0.205 . by analysis of average values of uric acid before and after three months and six months of treatment , it was established that the average value of uric acid in subjects before the treatment was 523.45 mmol / l , after three months of allopurinol use 433.25 mmol / l , and after six months of treatment it was 435.77 there was no statistically significant difference in average values of uric acid after three and six months of treatment ( p = 0.936 ) , implying that the desired effects of therapy were achieved . as can be seen from table 1 and figure 1 , the average values of uric acid in tested patients decreased significantly after three and six months of allopurinol therapy , while the values of triglycerides , cholesterol and ldl fractions statistically significantly increased ( p > 0.05 ) . the values of hdl fractions increased after three months of therapy , while later their value stayed constant . graphical depiction of the afore - mentioned indicators : in subjects with metabolic syndrome ( pronounced heart diseases ) the atherogenic index increased statistically significantly after three and six months of therapy and was at lower limit of reference values , which can be seen in table 2 , as well as figure 2 : it is evident from the presented indicators that during the allopurinol therapy of the subjects with metabolic syndrome ( pronounced heart problems ) there was statistically significant decrease of average values of uric acid , but the values of triglycerides , cholesterol and ldl - fractions increased statistically significantly ( p > 0.05 ) , while the value of hdl fraction increased aft er three months of treatment , but aft erwards , during the next three months , remained constant . atherogenic index in subjects with metabolic syndrome ( pronounced heart diseases ) statistically significantly increased after three and six months of therapy , even though it remained at the upper limit of reference values . due to these findings , it is advisable , along the control of uric acid values , to monitor the values of the available fractions of lipid profile , as well as the value of atherogenic index , due to the fact that these are patients with pronounced risk factors for development of kv incidents , thus keeping them inside tolerable limits . by evaluation of efficacy of allopurinol on the values of lipid profile fractions in hyperuricemic patients treated on three and six months regime , it was established that the average value of uric acid statistically significantly differed from the reference values before the start of the allopurinol treatment of patients ( p = 0,04 ) . after three months and six months of therapy the value of uric acid decreased and was at the upper tolerable limit of reference values . since no statistically significant differences in average values of uric acid were established after the third to sixth months of treatment , it could be concluded that the desirable effects regarding the decrease in sua were achieved . with allopurinol therapy of the subjects with metabolic syndrome and pronounced heart diseases , the average value of uric acid statistically significantly decreased , but the values of triglycerides , cholesterol and ldl fraction statistically significantly increased ( p > 0.05 ) . the value of hdl fraction increased after three months of therapy , and afterwards during the next three months of therapy remained constant . atherogenic index statistically significantly increased after three and six months of therapy , even though it remained at the upper limit of reference values . | subject : the concentration of serum uric acid ( sua ) is one of the potential markers of cardiovascular and cerebrovascular diseases , as well as some other severe diseases . in this pharmacological clinical study we evaluated allopurinol effect on certain values of lipid profile fractions in hyperuricemic patients diagnosed with metabolic syndrome that had pronounced cardiovascular problems , also with diagnosed hypertension.methods:research sample comprised 40 clinically treated hyperuricemic patients of both sexes , different ages , classified into several subgroups according to the disease diagnoses .
the methods used in the study included : assay analysis , statistical and comparative methods .
all clinical measurements were performed with standard ifcc methods on suitable biochemical analyzers.results:study established that after the first three months of allopurinol use , there was statistically significant difference in the average value of uric acid compared to the patients initial state . during the next three months of therapy no further statistically significant difference in average values of uric acid ( p = 0,936 ) was detected , meaning that the desirable effects of drug use were achieved .
simultaneously , the values of triglycerides , cholesterol and ldl fractions in test subjects increased significantly ( p > 0,05 ) .
the values of hdl fractions increased after three month therapy with allopurinol , but later their value remained constant .
atherogenic index increased significantly after three and six months of therapy , therewith retaining at upper limit of reference value.conclusion:the study results confirmed the primary hypothesis , which was that the allopurinol use affects the values of lipid profile fractions in hyperuricemic patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
derives from the greek word
gelos ( laughter ) and was introduced in 1957 by daly
and mulder . it is used to name seizures characterized by sudden laughter
attacks , out of social context , without any particular emotion like joy or
happiness . in 1971 ,
gascon and lombroso suggested as diagnostic criteria the presence of stereotyped
laughter episodes in the absence of external triggers that can be associated
with other epileptic manifestations , ictal or interictal discharges on the
electroencephalogram ( eeg ) , and absence of other conditions that could explain
the pathologic laughter . the vast majority of gelastic epilepsy series reported
include only children , and they have found an association with hypothalamic
hamartomas , a lesion that therefore must be always ruled out in these patients . however , other lesions and localizations have also been reported , mainly in
other adult patients , , . here , we describe three patients with gelastic
seizures ( gs ) with no evidence of hypothalamic hamartomas . a 35-year - old man with a history of neurocysticercosis was
treated with antiparasitic drugs as a teenager . since the age of 29 years , he had almost daily spells characterized by sudden
unmotivated laughter attacks which were described by his relatives since the
patient was not aware . in addition , he had occasional seizures which started
with forced head version towards the right , followed by right upper and
lower limb jerks , and finally secondary generalization . magnetic
resonance imaging ( mri ) showed upper right and inferior left mesial frontal
lobe nodular lesions , consistent with calcified neurocysticercosis
( fig . five gs were
recorded on scalp video - eeg monitoring , all of them showing ictal patterns
arising from the left anterior temporal lobe ( fig . positron emission tomography
( pet ) was performed , showing left mesial frontal and anterior temporal
hypometabolism ( fig . invasive
recordings were performed with left frontal deep electrodes and foramen
ovale electrodes , and ictal and interictal activities arising from the left
mesial frontal region was demonstrated ( fig . resection of the left frontal
pole , which included the lesion , was performed ( fig . the patient has been seizure - free since the surgery ( 5 years of follow - up ) and under no medication for 3 years ( ilae class i ) . a 45-year - old man with epilepsy since the age of 14 years had seizures characterized by sudden laughter attacks ,
associated with feelings of joy and happiness , which lasted about 30 s , occasionally associated with disconnection followed by one
to two minutes of postictal confusion . he had up to 5 episodes per day in
spite of multiple antiepileptic treatments ( carbamazepine , phenobarbital ,
levetiracetam , and topiramate ) . 2a ) ; surface eeg
recordings showed left frontotemporal interictal epileptiform discharges
( fig . 2b ) ; two
gelastic seizures with left frontotemporal ictal onset were recorded . neuropsychological evaluation showed bilateral
mesial and anterior temporal alterations with predominance of the left
hemisphere . the patient
remained seizure - free for a year , and seizures relapsed afterwards , with a
50% reduction compared to presurgical average ( ilae class iv ) . old , he experienced brief laughter attacks , apparently unmotivated ,
that was perceived as strange behavior by his family . gelastic epilepsy was
diagnosed , and the patient was placed on carbamazepine ; the treatment was
stopped after a seizure - free period of 6 years . five years
after the medication withdrawal , he began again with episodes of unmotivated
laughter , with no emotional correlate , associated with disconnection . carbamazepine was restarted with
complete control of the spells except during a few poor adherence
periods . a 35-year - old man with a history of neurocysticercosis was
treated with antiparasitic drugs as a teenager . since the age of 29 years , he had almost daily spells characterized by sudden
unmotivated laughter attacks which were described by his relatives since the
patient was not aware . in addition , he had occasional seizures which started
with forced head version towards the right , followed by right upper and
lower limb jerks , and finally secondary generalization . magnetic
resonance imaging ( mri ) showed upper right and inferior left mesial frontal
lobe nodular lesions , consistent with calcified neurocysticercosis
( fig . five gs were
recorded on scalp video - eeg monitoring , all of them showing ictal patterns
arising from the left anterior temporal lobe ( fig . positron emission tomography
( pet ) was performed , showing left mesial frontal and anterior temporal
hypometabolism ( fig . invasive
recordings were performed with left frontal deep electrodes and foramen
ovale electrodes , and ictal and interictal activities arising from the left
mesial frontal region was demonstrated ( fig . resection of the left frontal
pole , which included the lesion , was performed ( fig . the patient has been seizure - free since the surgery ( 5 years of follow - up ) and under no medication for 3 years ( ilae class i ) . a 45-year - old man with epilepsy since the age of 14 years had seizures characterized by sudden laughter attacks ,
associated with feelings of joy and happiness , which lasted about 30 s , occasionally associated with disconnection followed by one
to two minutes of postictal confusion . he had up to 5 episodes per day in
spite of multiple antiepileptic treatments ( carbamazepine , phenobarbital ,
levetiracetam , and topiramate ) . 2a ) ; surface eeg
recordings showed left frontotemporal interictal epileptiform discharges
( fig . 2b ) ; two
gelastic seizures with left frontotemporal ictal onset were recorded . neuropsychological evaluation showed bilateral
mesial and anterior temporal alterations with predominance of the left
hemisphere . the patient
remained seizure - free for a year , and seizures relapsed afterwards , with a
50% reduction compared to presurgical average ( ilae class iv ) . a 42-year - old man had no relevant medical history . at 15
years old , he experienced brief laughter attacks , apparently unmotivated ,
that was perceived as strange behavior by his family . gelastic epilepsy was
diagnosed , and the patient was placed on carbamazepine ; the treatment was
stopped after a seizure - free period of 6 years . five years
after the medication withdrawal , he began again with episodes of unmotivated
laughter , with no emotional correlate , associated with disconnection . carbamazepine was restarted with
complete control of the spells except during a few poor adherence
periods . gelastic seizures are seen in less than 1% of all epilepsies
, and they are
mainly associated with hypothalamic hamartomas in children . usually , these
seizures begin during infancy , even in the neonatal period , with a progressive
course which may include other focal or generalized seizures . invasive eeg recordings and electrical stimulation have
shown that gelastic seizures originated from the hypothalamic hamartomas ,
although they can arise from other lesions , like tumors , malformations of
cortical development , tuberous sclerosis , and postinfectious foci . to the best of our knowledge , this is the first report of neurocysticercosis related to gs . in patients who have gelastic seizures without an impairment of
consciousness , laughter is described as unmotivated or emotion - free , which could
be interpreted as a dissociation between the motor and emotional components of
laughter , although the physiological basis of joy and laughter are not fully
understood . one of
them had a lesion in the left superior mesial frontal region and experienced gs
not accompanied by joy . ictal subdural recordings showed that the seizures began
in the left anterior cingulate gyrus . the other two patients had complex partial
seizures originating from the temporal lobe ; in these cases , electrical
stimulation of the fusiform and parahippocampal gyri produced bursts of laughter
accompanied by a feeling of mirth . the authors concluded that the anterior
cingulate region is involved in the motor aspects of laughter , while the basal
temporal cortex is involved in the processing of joy . these findings are also
consistent with a case described by coria et al . in a patient who had a right lateral
basal temporal lesion and experienced joy associated with gelastic
seizures intracranial
recordings and cortical electrical stimulation have shown involvement of the
mesial and lateral superior frontal , cingulate and orbitofrontal gyri
. interestingly ,
in a case studied by chassagnon et al . with stereo - eeg , a nonlesional patient became
seizure - free after radiofrequency stimulation , resulting in two distinct lesions
in the left superior frontal and cingulate gyri . in our first patient , gs were associated with motor signs but
not with emotion , therefore suggesting a frontal lobe origin . although the
surface eeg showed left anterior temporal ictal onset , both the mri and pet
showed left mesial frontal and anterior temporal changes . invasive eeg
recordings localized the left mesial frontal lobe as the ictal onset area , which
was assumed to be the probable epileptogenic area , which was confirmed by the
good surgical outcome . in the second case , the structural and functional neuroimaging
and the surface eeg were consistent with a temporal origin of the seizures . this
patient had , during the seizure , a sense of joy , similar to the cases reported
by iwasa et al .
which originated from the right or left mesial our
patient initially reached seizure - freedom for a year , although a long - term
reduction of 50% compared to presurgical status was finally reached . this was
probably due to an incomplete resection of a cortical dysplasia associated with
the hippocampal sclerosis . unlike the previous cases , our last patient had unremarkable
imaging or eeg findings and responded well to antiepileptic drugs . although
there were no ictal recordings that could confirm the topographical origin of
the seizures , a hypothalamic onset is unlikely . since the patient has had
complete seizure control with antiepileptic drugs , further studies were not
indicated although gelastic epilepsy has been associated with hypothalamic
hamartomas in children , other localizations , including frontal and temporal lobe
foci , are more frequent among adult patients , . gelastic epilepsy is usually
refractory , and surgery may be a useful tool , as reported in two of our
cases . | gelastic epilepsy or laughing seizures have been
historically related to children with hypothalamic hamartomas .
we report three
adult patients who had gelastic epilepsy , defined as the presence of seizures
with a prominent laugh component , including brain imaging , surface / invasive
electroencephalography , positron emission tomography , and medical / surgical
outcomes .
none of the patients had hamartoma or other hypothalamic lesion .
two
patients were classified as having refractory epilepsy ( one had biopsy - proven
neurocysticercosis and the other one hippocampal sclerosis and temporal cortical
dysplasia ) .
the third patient had no lesion on mri and had complete control with
carbamazepine .
both lesional patients underwent resective surgery , one with
complete seizure control and the other one with poor outcome .
although
hypothalamic hamartomas should always be ruled out in patients with gelastic
epilepsy , laughing seizures can also arise from frontal and temporal lobe foci ,
which can be surgically removed .
in addition , we present the first case of
gelastic epilepsy due to neurocysticercosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
percutaneous lumbar sympathectomy ( pcls ) is a popular treatment for beurger 's disease affecting the toes . although pcls with or without radiological guidance is a minimally invasive technique to chemically block the lumbar sympathetic ganglia with phenol injection but inadvertent damage to adjacent structures is a matter of concern . we herein report a patient who developed acute renal failure due to bilateral ureteric necrosis and stricture following pcls for beurger 's disease . a 70-year - old nondiabetic , nonhypertensive gentleman , smoker for 12 years presented to the emergency department with renal failure . history revealed interventional treatment for beurger 's disease in the form of toe amputation and bilateral injections for percutaneous chemical lumbar sympathectomy 6 months back . at admission he had loss of appetite , intractable vomiting , and fever for 15 days , and progressive oligoanuria for the last 6 days . his serum creatinine was 6.5 mg / dl , hemoglobin 6.2 gm% , tlc 24000/cmm and blood gases revealed severe metabolic acidaemia with a base deficit of 10 . an abdominal sonography revealed bilateral gross hydronephrosis with dilated upper ureter on both sides along with a collection in the region of the right psoas muscle , possibly due to urinoma . a noncontrast computed tomography scan revealed gross hydronephrosis on both the sides with atrophic and thin renal parenchyma on the right side along with the urinoma over the right psoas [ figure 1 ] . he was dialyzed ; metabolic abnormalities were corrected and then bilateral percutaneous nephrostomies and a percutaneous drain in the right psoas collection were placed . after achieving an initial postobstructive dieresis the daily output from right nephrostomy stabilized at 400 ml and from left nephrostomy achieved an output of 1500 ml per day with hardly any output from the urethra . the general condition of the patient improved following conservative treatment and his creatinine dropped to 1.8 mg% , after control of sepsis . ( a ) a noncontrast ct scan showing bilateral hydronephrosis ( right > left ) and a urinoma over the psoas muscle on the right side due to rupture of the calyx / fornices as a result of ureteric obstruction , with dilated upper ureter on left side . ( b ) axial view of the same in the operating room , bilateral retrograde ureteropyelogram and simultaneous bilateral nephrostogram under fluoroscopy was performed to delineate the length of ureteric obstruction . it revealed upper - right ureteric stricture of length about 68 cm and upper - left ureteric stricture of about 23 cm [ figure 2 ] . the glomerular filtration rate ( gfr ) of the right kidney was 6 ml / min and 34 ml / min of the left side . ( b ) nephrostogram with simultaneous rgp on the left side shows urinoma and approximately 34 cm loss of the upper - left ureter around the pelvi ureteric junction he was explored on the better functioning side first and approximately 45 cm of the upper - left ureter was found necrotic and fibrosed , as against 23 cm defect depicted by the dye study . it was obliterated and had dense adhesions in the periureteric area presumably secondary to absolute alcohol injection . after renal descensus and ureteric mobilization an end to end uretero - ureterostomy was done over a 6 f ureteric stent . on the other side approximately 1012 cm of upper ureter was found to be necrotic and obliterative and almost the entire upper ureter was strictured . the histopathology of the segment of ureter was sent and revealed only inflammatory cells with few areas of fibrous tissues . no malignancy was noted . in view of poorly functioning right kidney with a gfr of 6 ml / min , and advanced age of the patient , extensive reconstruction of the ureter was not considered and right nephrectomy was done . in the post - op period , patient developed adhesive intestinal obstruction , which was managed by exploratory laparotomy and adhesiolysis . following this , he maintains a serum creatinine level between 1.41.8 mg% after 1 year of follow up and is asymptomatic . most iatrogenic ureteric injuries , complete or partial ureteric transaction , and less commonly ureteric necrosis , can complicate several surgical and percutaneous procedures . if detected intraoperatively on the table , they can be repaired immediately as the tissues are healthy and supple . however , when these injuries are missed during surgery and noticed only days or weeks later , the patient develops symptoms from ureteric obstruction , colic , urinoma , or abscess formation , flank pain , fever , urosepsis , acute renal failure if bilateral . as an initial treatment external drainage of the renal pelvis by nephrostomy and the urinoma or abscess the further management of these patients depends on the location and the extent of the ureteric loss . antegrade or retrograde placement of an indwelling ureteric stent is usually attempted in short ureteric narrowing , if the defect is nonobliterative , but with long segmental obliteration , complex open surgical repair has to be done . if the patient is regarded as unsuitable for such an operation , and the contralateral kidney functions normally , sometimes even nephrectomy is preferred . options include uretero - ureterostomy , uretero - pyelostomy , uretero - calycostomy , and ileal transposition depending upon length of stricture . boari flap and psoas hitch are usually not the options as the injury following pcls usually involves upper ureter around first to third lumbar vertebra . since the patient landed up into nephrectomy of one side and is an old patient , any procedure that has more morbidity is not advisable . these complications are due to imprecise deposition and unpredictable spread of injected chemicals too far beyond the needle tip . arteritis of ureteral vessels causing ischemia of ureter is not known in the literature and the possibility is thoughtful but not fitting to our case as we have a cause for the ureteric necrosis in our patient . acute renal failure secondary to bilateral ureteric injury following pcls is not reported in literature till now . high index of suspicion should be made for bilateral ureteric injury in a patient who presents with acute renal failure and has a history of percutaneous intervention for chemical sympathectomy for peripheral vascular disease . unilateral injury may go undetected as the ipsilateral kidney may undergo atrophic changes secondary to chronic obstruction . stricture due to ureteral ischemia following chemolysis due to phenol injection in reteroperitoneum is a slow , steady , and time taking phenomenon , as it occurs due to development of fibrosis around ureter . | we report a case of acute renal failure as a result of obstructive uropathy as a consequence of instillation of phenol used for chemical sympathectomy in beurger 's disease of the lower limbs .
extensive bilateral ureteral necrosis occurred as a result of phenol instillation that .
such practices are still common among the general surgeons and such a complication has not been described before . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
for many years , certain researchers and practitioners have claimed that there was a need for a change of approach to occupational safety and health ( osh ) because implementations based on the traditional approach did not result in a satisfactory improvement in the level of safety . moreover , the traditional approach to osh is not fully compatible with the growing complexity of contemporary organizations and increasing variability of performed processes inside these organizations and in the environment outside them , given that the traditional approach considers variability of performance to be a possible threat . resilience , believed to be an important property of complex and continuously changing systems and/or an ability to cope with diversity , is claimed to be a good answer to the needs of contemporary organizations . although the concept of resilience has gained in popularity over the course of this millennium , it has a somewhat long history . according to alexander , the word passed into english via middle french , with the meaning to retract or to cancel. the term resilience was then used with the meaning of rebounding , while from the 19th century the term was also used to signify the ability to recover from adversity . according to mcaslan , resilience was introduced into scientific terminology in that century , when it was first used to describe a property of timber . however , it is generally believed that the current popularity of resilience results from its adoption in modern science through ecology as a result of the works of c. s. holling , who defined resilience as the capacity to continue to exist in a domain in the face of change . resilience determines the persistence of relationships within a system and is a measure of the ability of these systems to absorb changes of state variables , driving variables , and parameters , and still persist.[3,p.14 ] since then , the concept of resilience in ecology has been vigorously discussed . currently , the term resilience is present in many fields , from mechanics to a broad range of psychological [ 49 ] and social sciences.[912 ] some research on resilience even focuses on areas such as urban resilience , the education system and organized crime . the concept of resilience has been adopted in the policies of numerous governments , including those of the usa and canada ; it has also been adopted by the united nations , as the development of resilience in national and global resilience has been set as a priority for global safety policy.[1618 ] the european commission has defined its approach to resilience on the global level , e.g. , in the communication from the commission to the european parliament and the council . the eu approach to resilience : learning from food security crises. the concept of resilience has also been studied on the organizational level . the concept of the resilience of organizations was originally used to describe the need to respond to changes in the business environment . thus , the concept of resilience was originally used to show the need for properties such as flexibility , adaptability and agility to change following environment changes . since that time , focus has shifted to disruptive events and catastrophes because effective management during a crisis or disaster may be key to success or collapse ( many examples of companies facing unexpected incidents or disasters are given by sheffi ) . organizations need to be prepared for effective crisis management . according to seville et al . perfect storm that may cause adversity for any organization , and resilience is what allows an organization to survive or even to prosper , to turn challenges into opportunities. while most organizations have plans and schemes that address risk , crises , adversity and even disasters , they are typically managed in isolation from one another , resulting in gaps or wasted resources through overlaps , while organizational resilience aims to bring these tasks and activities together as a single process , one that resides at the very center of an organization 's management ethos and way of operating . rapid developments in the concept of resilience and its growing popularity have resulted in the introduction of national standards for resilient organizations in some countries . other countries are also introducing or preparing national standards on resilience . in 2011 , the first international organization for standardization ( iso ) standards on resilience were issued ( standard no . the concept of resilience is adopted to research osh from different fields and thus with different approaches , e.g. , via socio - technical studies ( e.g. , ) , the psychological and behavioral aspects of organizational resilience and the link with research on individual or family resilience and its influence on work , which is why the different definitions of and attitudes to resilience applied to the different scientific fields cited in this article should help to understand the nature of resilience in osh . the wide range of fields in which the concept of resilience has been independently applied , together with the large number of approaches , makes defining resilience difficult and problematic . the multitude of uses and interpretations may lead to confusion . when we keep in mind that resilience is defined , depending on the object of research , as a property of material , ecological and social ( and other ) systems , individuals ( in different roles ) , families , teams , communities , organizations , nations and states , this difficulty is obvious . however , a variety of definitions can exist as long as they are acknowledged and there are people who can translate between them.[30,p.2 ] resilience was first defined in the field of the mechanics of materials as the ability of a material to absorb energy when it is elastically deformed and to release that energy upon unloading . non - material , sciences , the original meaning simply became a type of metaphor . as already noted , resilience was introduced to ecology by holling , who formulated the ecological definition of resilience . following intense discussion , over the years many definitions of ecological resilience were introduced together with many approaches and interpretations . some of them were combined by mcaslan [ 2,p.4 ] :
holling , 1973 : the resilience of an ecosystem is the measure of the ability of an ecosystem to absorb changes and still exist.pimm , 1984 : resilience is the speed with which a system returns to its original shape.holling et al . , 1995 : resilience is the buffer capacity or ability to absorb perturbation or the magnitude of the disturbance that can be absorbed before a system changes its structure by changing the variables and processes that control behavior.alwang et al . , 2001 : resilience is the ability to resist downward pressure and to recover from shock . from the ecological literature , it is the property that allows a system to absorb , use and even benefit from change . where resilience is high , it requires a major disturbance to overcome the limits to qualitative change in a system and allow it to be transformed rapidly into another condition.walker et al . , 2002 : resilience is the potential of a system to remain in a particular configuration and to maintain its feedback and functions , and it involves the ability of the system to reorganize itself following the disturbance - driven change.cardona , 2003 : resilience is the capacity of the damaged ecosystem or community to absorb negative impacts and recover from them.stockholm resilience centre , 2009 : resilience refers to the capacity of a social - ecological system both to withstand perturbations from , for instance , climate or economic shocks and to rebuild and renew itself afterwards . the loss of resilience can cause the loss of valuable ecosystem services and may even lead to rapid transitions or shifts into qualitatively different situations and configurations , evident in , for instance , people , ecosystems , knowledge systems , or whole cultures.
holling , 1973 : the resilience of an ecosystem is the measure of the ability of an ecosystem to absorb changes and still exist . pimm , 1984 : resilience is the speed with which a system returns to its original shape . 1995 : resilience is the buffer capacity or ability to absorb perturbation or the magnitude of the disturbance that can be absorbed before a system changes its structure by changing the variables and processes that control behavior . alwang et al . , 2001 : resilience is the ability to resist downward pressure and to recover from shock . from the ecological literature , it is the property that allows a system to absorb , use and even benefit from change . where resilience is high , it requires a major disturbance to overcome the limits to qualitative change in a system and allow it to be transformed rapidly into another condition . walker et al . , 2002 : resilience is the potential of a system to remain in a particular configuration and to maintain its feedback and functions , and it involves the ability of the system to reorganize itself following the disturbance - driven change . cardona , 2003 : resilience is the capacity of the damaged ecosystem or community to absorb negative impacts and recover from them . stockholm resilience centre , 2009 : resilience refers to the capacity of a social - ecological system both to withstand perturbations from , for instance , climate or economic shocks and to rebuild and renew itself afterwards . the loss of resilience can cause the loss of valuable ecosystem services and may even lead to rapid transitions or shifts into qualitatively different situations and configurations , evident in , for instance , people , ecosystems , knowledge systems , or whole cultures. resilience has this been treated as a measure of capacity or as a type of capacity itself , speed , ability or potential . as in the case of ecological research , individual resilience has been defined , e.g. , as follows :
both the capacity to be bent without breaking and the capacity , once bent , to spring back [ 31,p.248];the skills , abilities , knowledge , and insight that accumulate over time as people struggle to surmount adversity and meet challenges [ 32,p.298];the capacity to maintain competent functioning in the face of major life stressors [ 33,p.158];the successful adaptation to life tasks in the face of social disadvantage or highly adverse conditions [ 34,p.163];the ability of adults in otherwise normal circumstances who are exposed to an isolated and potentially highly disruptive event , such as the death of a close relation or a violent , life - threatening situation , to maintain relatively stable , healthy levels of psychosocial and physical functioning as well as the capacity for generative ( i.e. , capable of reproduction ) experiences and positive emotions [ 5,p.20 ] ; anda dynamic process that involves a personal negotiation through life that fluctuates across time , life stage and context.[35,p.6 ]
both the capacity to be bent without breaking and the capacity , once bent , to spring back [ 31,p.248 ] ; the skills , abilities , knowledge , and insight that accumulate over time as people struggle to surmount adversity and meet challenges [ 32,p.298 ] ; the capacity to maintain competent functioning in the face of major life stressors [ 33,p.158 ] ; the successful adaptation to life tasks in the face of social disadvantage or highly adverse conditions [ 34,p.163 ] ; the ability of adults in otherwise normal circumstances who are exposed to an isolated and potentially highly disruptive event , such as the death of a close relation or a violent , life - threatening situation , to maintain relatively stable , healthy levels of psychosocial and physical functioning as well as the capacity for generative ( i.e. , capable of reproduction ) experiences and positive emotions [ 5,p.20 ] ; and a dynamic process that involves a personal negotiation through life that fluctuates across time , life stage and context.[35,p.6 ] except for the main idea of facing challenges , it is somewhat difficult to guess that all of those definitions concern the same subject . thus , there is also little consensus on individual resilience in practice , especially in clinical practice . barnard identifies the following nine individual phenomena that the literature has repeatedly shown to correlate with resiliency : ( a ) being perceived as more cuddly and affectionate in infancy and beyond ; ( b ) having no sibling born within 2024 months of one 's own birth ; ( c ) a higher level of intelligence ; ( d ) the capacity and skills for developing intimate relationships ; ( e ) achievement orientation in and outside school ; ( f ) the capacity to construct productive meanings for events in individuals worlds that enhance their understanding of these events ; ( g ) being able to selectively disengage from the home , engage with those outside and then to re - engage ; ( h ) being internally oriented and having an internal locus of control ; and ( i ) the absence of serious illness during adolescence.[36,p.139140 ] recent years have raised an interest in coping with disasters and other disruptive large - scale events , and psychological research is therefore also more focused on this type of resilience . however , numerous studies on disasters and the people facing them show that there are different types of reactions to such events , and some researchers claim that resilience is one such possible reaction . for example , carver suggests that resilience is one of four possible reactions to adversity , together with thriving , survival and succumbing . mcaslan defines two issues that are generally agreed upon :
the issue of adaptability , where individuals who are able and willing to adapt are more likely to reduce their risk of being exposed to similar disruptive events , or at least to reduce the impact of such exposure ; resilient individuals are likely to be able and willing to adapt ; andthe issue of transient dysfunction , where the absence of dysfunction or distress in an individual suggests resistance rather than resilience however , dysfunction or distress is temporary , followed by a return to normal functioning.[2 , p. 5 ]
the issue of adaptability , where individuals who are able and willing to adapt are more likely to reduce their risk of being exposed to similar disruptive events , or at least to reduce the impact of such exposure ; resilient individuals are likely to be able and willing to adapt ; and the issue of transient dysfunction , where the absence of dysfunction or distress in an individual suggests resistance rather than resilience however , dysfunction or distress is temporary , followed by a return to normal functioning.[2 , p. 5 ] there are many definitions of resilience in the field of organizational and national and global resilience studies . unlike the definitions in the cases of ecology and psychology , they seem to be more consistent and similar . however , they are formulated as very broad and theoretical constructs that leave open a great possibility of interpretation in relation to practical use . the level of difficulty is high because what resilience means may vary depending on the approach , current needs , threats and the organization itself . however , defining national and organizational resilience is facilitated , at least on a theoretical level , by the fact that , together with scientific definitions , there are also definitions that have been created for the purpose of legal solutions and cooperation on the national and international levels and for the needs of national standards . the united nations defines resilience as follows :
the ability of a system , community or society exposed to hazards to resist , absorb , accommodate to and recover from the effects of a hazard in a timely and efficient manner , including through the preservation and restoration of its essential basic structures and functions . the resilience of a community in respect to potential hazard events is determined by the degree to which the community has the necessary resources and is capable of organizing itself both prior to and during times of need.[17,p.24 ]
the ability of a system , community or society exposed to hazards to resist , absorb , accommodate to and recover from the effects of a hazard in a timely and efficient manner , including through the preservation and restoration of its essential basic structures and functions . the resilience of a community in respect to potential hazard events is determined by the degree to which the community has the necessary resources and is capable of organizing itself both prior to and during times of need.[17,p.24 ] the european commission states :
resilience is the ability of an individual , a household , a community , a country or a region to withstand , to adapt , and to quickly recover from stresses and shocks . the concept of resilience has two dimensions : the inherent strength of an entity an individual , a household , a community or a larger structure to better resist stress and shock and the capacity of this entity to bounce back rapidly from the impact . increasing resilience ( and reducing vulnerability ) can therefore be achieved either by enhancing the entity 's strength , or by reducing the intensity of the impact , or both.[19,p.5 ]
resilience is the ability of an individual , a household , a community , a country or a region to withstand , to adapt , and to quickly recover from stresses and shocks . the concept of resilience has two dimensions : the inherent strength of an entity an individual , a household , a community or a larger structure to better resist stress and shock and the capacity of this entity to bounce back rapidly from the impact . increasing resilience ( and reducing vulnerability ) can therefore be achieved either by enhancing the entity 's strength , or by reducing the intensity of the impact , or both.[19,p.5 ] the us department of homeland security defines resilience as the ability to resist , absorb , recover from or successfully adapt to adversity or a change in conditions and also provides the following extended definition :
( 1 ) ability of systems , infrastructures , government , business and citizenry to resist , absorb , recover from , or adapt to an adverse occurrence that may cause harm , destruction , or loss of national significance , ( 2 ) capacity of an organization to recognize threats and hazards and make adjustments that will improve future protection efforts and risk reduction measures.[40,p.2324 ]
( 1 ) ability of systems , infrastructures , government , business and citizenry to resist , absorb , recover from , or adapt to an adverse occurrence that may cause harm , destruction , or loss of national significance , ( 2 ) capacity of an organization to recognize threats and hazards and make adjustments that will improve future protection efforts and risk reduction measures.[40,p.2324 ] in the case of companies and organizations , the definitions of resilience were formulated in national standards . according to standard no . asis spc.1 - 2009,[26,p.48 ] resilience is the adaptive capacity of an organisation in a complex and changing environment. two additional notes are given , stating that ( a ) resilience is the ability of an organisation to resist being affected by an event or the ability to return to an acceptable level of performance in an acceptable period of time after being affected by an event and ( b ) resilience is the capability of a system to maintain its functions and structure in the face of internal and external change and to degrade gracefully when it must. based on standard no . because there are so many approaches that scientists and practitioners take to define resilience , longstaff et al . have attempted to systemize them using the multidisciplinary resilience framework , based on the level of complexity and normativity . those authors define four types of approaches to resilience :
type i : resilience as the capacity to rebound and recover , where resilience is seen as a pure measure of elasticity against perturbations and the rapidity of recovery;type ii : resilience as the capacity to maintain a desirable state , regarding resilience as something positive and bouncing back to an approved equilibrium proves the existence of reliance;type iii : resilience as the capacity of the system to withstand stress , describing resilience as the relationship between the current system state and a potential system shift that will flip the system into a different state;type iv : resilience as the capability to adapt and thrive , underlining the existence of multiple possible states but also calling for successful adaption before or after a disturbance occurs. this approach assumes the possibility that the post - disturbance state may even be better.[30,p.67 ]
type i : resilience as the capacity to rebound and recover , where resilience is seen as a pure measure of elasticity against perturbations and the rapidity of recovery ; type ii : resilience as the capacity to maintain a desirable state , regarding resilience as something positive and bouncing back to an approved equilibrium proves the existence of reliance ; type iii : resilience as the capacity of the system to withstand stress , describing resilience as the relationship between the current system state and a potential system shift that will flip the system into a different state ; type iv : resilience as the capability to adapt and thrive , underlining the existence of multiple possible states but also calling for successful adaption before or after a disturbance occurs. this approach assumes the possibility that the post - disturbance state may even be better.[30,p.67 ] the application of the concept to the field of osh seems to be a natural result of both research on resilience in various fields , including organizational studies , disaster studies and psychology , and the fact that research on resilience involves interest in problems such as safety , danger , stress , adversity , recovery , disturbance and disaster . the concept of resilience corresponds well to ideas such as the need for proactivity , anticipation and the need to reformulate the traditional approach to safety because it allows , at some point , a limited increment of safety . some approaches to resilience concerning safety and health focus on the psychological and behavioral aspects of resilience and the organization and on the influence of the individual on performance in terms of resilience and on individual resilience itself . for example , kamphuis and delahaij present a psychological resilience model of the netherlands armed forces . a specific approach to the evaluation of resilience has been implemented in quebec , canada , as a result of work of the resilience subcommittee of the organization of civil protection in quebec ( oscq ) . it is based on a four - step methodology that includes ( a ) the portrait of a system , ( b ) the study of outputs and inputs , ( c ) the management of failures and ( d ) the evaluation of resilience . propose the use of a simulation and visualization method with the use of cameras that monitor and then measure a worker 's behavior , meaning that behavioral sampling together with the dynamic safety culture model constructed for the system would be the basis for resilience assessment . research conducted by affinity health at work , which considered organizations from a psychological perspective and regarded resilience as being dependent on the social or environmental context , defined the following categories as crucial for resilience : ( a ) job design ( resilience can be developed by focusing on a person 's role and how non - monetary rewards may contribute to reducing stress and motivate a person ) ; ( b ) leadership ( focusing on the role of leadership in resilience and how it may promote resilience ) ; ( c ) organizational structure and culture ( resilience interventions using processes and organizational culture to best equip organizations to face challenges ) ; and ( d ) systemic / external environment ( interventions that use risk management and assess risk by examining external factors and threats ) . together with such tools as traditional osh tools ( e.g. , risk assessment , education , crisis management , risk assessment ) , the author suggests work on individual and team resilience and a stronger focus on leaders and their role in resilient organizations . the work of vanbreda is an example of yet another approach . as a social worker , he investigates resilience at work as being strictly linked with the personal situations of workers , and his fields of interest are mainly families and the community . he uses the concept of the work life interface to refer to the often conflictual relationship between the occupational or work role / system and the personal life or family roles / systems of people . this approach also assumes that , despite the common assumption , family and work are not two separate worlds . thus , resilience at work is strongly influenced by the quality of the individual 's personal / family life . vanbreda also emphasizes the role of culture , gender , religion , community and other factors for resilience . the best known and developed approach to resilience in relation to osh is most probably resilience engineering , which mainly originated from research on the functioning of complex socio - technical systems . it is a consequence of this definition that it is equally important to study things that go right as things that go wrong . for resilience engineering , the understanding of the normal functioning of a socio - technical system is the necessary and sufficient basis for understanding how it fails . and it is both easier and more effective to increase safety by improving the number of things that go right , than by reducing the number of things that go wrong.[43,p.xxix ]
the ability to succeed under varying conditions . it is a consequence of this definition that it is equally important to study things that go right as things that go wrong . for resilience engineering , the understanding of the normal functioning of a socio - technical system is the necessary and sufficient basis for understanding how it fails . and it is both easier and more effective to increase safety by improving the number of things that go right , than by reducing the number of things that go wrong.[43,p.xxix ] this approach considers variability and changes inside and outside an organization as normal and necessary and as a source of positive and negative outcomes , not as a threat . according to hollnagel , resilience engineering regards the things that go wrong as the flip side of the things that go right because they are both the results of the same underlying processes : in consequence of that , things that go right and things that go wrong should be explained in basically the same way.[43,p.xxxiii ] hollnagel and woods define resilience engineering as a paradigm for safety management that focuses on how to help people cope with complexity under pressure to achieve success.[44,p.6 ] the authors claim that it strongly contrasts with what is typical today a paradigm of tabulating error as if it were a thing , followed by interventions to reduce this count. grtan describes resilience engineering as asking the question why does it work rather than why does it fail. hollnagel uses the concept of safety ii as opposed to safety i , understood as avoiding what goes wrong . the concept of safety ii defines safety management as a tool to ensure that as much as possible goes right , which means that safety is managed by achievements and , consequently , is measured by counting the number of cases where things go right , not merely by the number of failures . of course , this approach does not mean that traditional measures are unnecessary , but they are simply considered to be part of safety management . for the purpose of resilience engineering theory , hollnagel defined resilience as the ability of a system or an organization to react and recover from disturbances at an early stage , with minimal effects on dynamic stability.[47,p.16 ] this definition was enhanced by woods , who formulated four properties of resilient systems : buffering capacity , flexibility , margin ( between operation and the performance boundary ) and tolerance ( the system 's behavior near the boundary ) . hale and heijer described resilience as an ability to steer the activities of the organisation so that it may sail close to the area when accidents happen , but always stays out of that dangerous area.[49,p.36 ] leveson et al . defined resilience as follows : resilience is the ability of systems to prevent or adapt to changing conditions in order to maintain ( control over ) system property.[50,p.95 ] westrum provides a typology of resilience situations for the purpose of resilience engineering . considering the nature of the threats to the integrity to the system , he defines three possibilities : a regular threat , an irregular threat and an unexampled event . resilience situations are always divided depending on where the event falls on the organization 's time horizon . from this perspective , westrum defines three possibilities : foreseeing and avoiding , coping with ongoing trouble and repairing after catastrophe . wears and morrison propose three levels of resilience : a negative feedback loop ( the system responds to reduce deviation ) , a response to disturbance that is either unexampled or not managed at level 1 ( and involves trade - offs and sacrifice decisions ) and learning from relevant feedback obtained during the response . hollnagel notes that :
the definition of resilience can be made more concrete by pointing to four abilities that are necessary for a system to be resilient . these are the ability to respond to events , to monitor ongoing developments , to anticipate future threats and opportunities , and to learn from past failures and successes alike.[48,p.xxix ]
the definition of resilience can be made more concrete by pointing to four abilities that are necessary for a system to be resilient . these are the ability to respond to events , to monitor ongoing developments , to anticipate future threats and opportunities , and to learn from past failures and successes alike.[48,p.xxix ] the so - called four cornerstones are one of the fundamental concepts of resilience engineering . these cornerstones are as follows :
knowing what to do ( responding to actual / regular disruptions and disturbances);knowing what to look for ( monitoring the critical);knowing what to expect ( anticipating the potential ) ; andknowing what has happened ( learning from experience ) .
knowing what to do ( responding to actual / regular disruptions and disturbances ) ; knowing what to look for ( monitoring the critical ) ; knowing what to expect ( anticipating the potential ) ; and knowing what has happened ( learning from experience ) . resilience management is thus defined as managing the four core processes that are critical to the resilience of an organization :
responding , which requires preparedness based on right anticipation . paries notes that resilience requires a combination of readiness and creativity , anticipation and serendipity . the crucial idea is that nothing can be anticipated in every detail ; thus , what the organization needs is being prepared to be unprepared. to visualize this concept , paries uses the example of landing on the hudson river and the entire decision - making during this operation.monitoring : wreathall emphasizes the role of proactivity and the anticipation of major changes in safety and other critical performance domains . he claims that , for resilient organizations , data on performance are needed not just from outputs of the processes but from intermediate activities along the way.anticipation : woods provides six patterns that describe the anticipating abilities of resilient systems : ( a ) resilient systems are able to recognize that adaptive capacity is falling or inadequate to the contingencies and squeezes or bottlenecks ahead ; ( b ) resilient systems are able to recognize the threat of exhausting buffers and reserves ; ( c ) resilient systems are able to recognize when to shift priorities across goal trade - offs ; ( d ) resilient system are able to make perspective shifts and contrast diverse perspectives that go beyond their nominal system position ; ( e ) resilient systems are able to navigate interdependencies across roles , activities and levels ; and ( f ) resilient systems are able to recognize the necessary ways to adapt.learning , based on the paradigm that the organization must learn from what is both right and wrong .
responding , which requires preparedness based on right anticipation . paries notes that resilience requires a combination of readiness and creativity , anticipation and serendipity . the crucial idea is that nothing can be anticipated in every detail ; thus , what the organization needs is being prepared to be unprepared. to visualize this concept , paries uses the example of landing on the hudson river and the entire decision - making during this operation . monitoring : wreathall emphasizes the role of proactivity and the anticipation of major changes in safety and other critical performance domains . he claims that , for resilient organizations , data on performance are needed not just from outputs of the processes but from intermediate activities along the way. anticipation : woods provides six patterns that describe the anticipating abilities of resilient systems : ( a ) resilient systems are able to recognize that adaptive capacity is falling or inadequate to the contingencies and squeezes or bottlenecks ahead ; ( b ) resilient systems are able to recognize the threat of exhausting buffers and reserves ; ( c ) resilient systems are able to recognize when to shift priorities across goal trade - offs ; ( d ) resilient system are able to make perspective shifts and contrast diverse perspectives that go beyond their nominal system position ; ( e ) resilient systems are able to navigate interdependencies across roles , activities and levels ; and ( f ) resilient systems are able to recognize the necessary ways to adapt . learning , based on the paradigm that the organization must learn from what is both right and wrong . rigaud and martin systemize trade - offs and also define the fields affected by specific trade - offs :
acute chronic trade - offs , which affect an agent 's perceptions of the normal and abnormal functioning of the system , the criticality of situations , the response plan and adaptation to unanticipated situations , the nature of indicators , measurement frequency , the criticality of variability in indicators , the potential consequences of change and innovation for risk and the ability to respond , the ability to identify new threats and opportunities , the choice of relevant situations for learning , the ability to identify a diversity of lessons from situations and the ability to learn lessons.efficiency thoroughness trade - offs , which affect the availability of time , knowledge , information and resources : to detect an abnormal situation , to recognize the situation , to consider the criticality of the situation and decide to respond and to respond , to collect data , evaluate and analyze indicators , for change and innovation identification , for change management and risk and opportunities analysis and to study situations and learn from the results of investigations.specialist generalist trade - offs , which affect the communication capacity between units and the variability in a unit 's perspective on the criticality of situations.distributed concentrated trade - offs , which affect the communication capacity between units.optimality fragility trade - offs , which affect the safety culture and safety barriers . acute chronic trade - offs , which affect an agent 's perceptions of the normal and abnormal functioning of the system , the criticality of situations , the response plan and adaptation to unanticipated situations , the nature of indicators , measurement frequency , the criticality of variability in indicators , the potential consequences of change and innovation for risk and the ability to respond , the ability to identify new threats and opportunities , the choice of relevant situations for learning , the ability to identify a diversity of lessons from situations and the ability to learn lessons . thoroughness trade - offs , which affect the availability of time , knowledge , information and resources : to detect an abnormal situation , to recognize the situation , to consider the criticality of the situation and decide to respond and to respond , to collect data , evaluate and analyze indicators , for change and innovation identification , for change management and risk and opportunities analysis and to study situations and learn from the results of investigations . specialist generalist trade - offs , which affect the communication capacity between units and the variability in a unit 's perspective on the criticality of situations . distributed concentrated trade - offs , which affect the communication capacity between units . optimality fragility trade - offs , which affect the safety culture and safety barriers . in general , because resilience itself is believed to be difficult ( or impossible ) to measure directly , resilience engineering proposes various tools based on the measurement of the four main abilities ( cornerstones ) . this tool is a questionnaire consisting of four sets of questions ( one set dedicated to each cornerstone ) . hollnagel emphasizes that all four cornerstones are necessary to ensure the appropriate resilience level ; thus , a low level of performance in one cornerstone can not be compensated by a high level in another cornerstone . present the stress strain model of resilience , proposed originally by woods and wreathall , as a tool for using the rag in the concept and visualization that the stress this model is almost directly based on the stress and strain relationships described by the mechanics of materials . for example , based on the four main abilities ( cornerstones ) , rigaud and martin define 11 abilities as key indicators of resilience and simultaneously integrate trade - offs into the analysis . furthermore , there are other proposals and models for the assessment of resilience and also for other purpose , including , e.g. , assessing osh systems from the resilience engineering perspective . the resilience engineering approach is very socio - technical and clearly concentrates on processes and resources . however , the human role is clearly seen in such fields where resilience is directly connected with one individual 's decision , as in the case of pilots and air traffic controllers ( e.g. , ) . the advantages of resilience engineering are a large number of case studies and the strict connection with practice . moreover , definitions and tools are formulated so generally that it can be easily adopted by many fields of activity . the increasing popularity of resilience , together with the number of fields to which it is applied , has resulted , quite naturally , in rising criticism of resilience theory itself and/or its application to specific scientific fields . it is an obvious target because , even within certain scientific fields ( e.g. , ecology and psychology ) , there is no compromise on what exactly resilience is , especially in terms of a multidisciplinary definition . kaplan , cited by mcaslan , criticizes the entire concept :
the deceptively simple construct of resilience is in fact rife with hidden complexities , contradictions and ambiguities . arguably , any consensus that exists regarding the nature of resilience rests upon the idea of the achievement of positively ( or the avoidance of negatively ) valued outcomes in circumstances where adverse outcomes would normally be expected . a close examination of this idea , however , reveals a number of unresolved questions that at best render the concept less than useful , and at worst impede progress in understanding human adaptation.[65,p.9 ]
the deceptively simple construct of resilience is in fact rife with hidden complexities , contradictions and ambiguities . arguably , any consensus that exists regarding the nature of resilience rests upon the idea of the achievement of positively ( or the avoidance of negatively ) valued outcomes in circumstances where adverse outcomes would normally be expected . a close examination of this idea , however , reveals a number of unresolved questions that at best render the concept less than useful , and at worst impede progress in understanding human adaptation.[65,p.9 ] alexander suggests that some discomfort may result from the very wide scope of the definition , especially if the term is pushed to represent more than it may deliver . note the lack of clarity and consistency of definitions and also conclude that there is clearly a need for resilience researchers to enhance the scientific rigor of their work . there are many voices representing various scientific fields claiming that different types of systems with different origin ( e.g. , ecosystems and social systems ) are operating in ways which are so different that a theory concerning one type can not be directly applied to another ; while davidson argues that resilience theory offers some promise , but it is completely inapplicable to the social sciences . resilience theory has been even attacked for being a concept that promotes and excuses the status quo of contemporary neoliberal capitalism . list many gaps in and limitations to resilience theory and research , including inconsistencies in approaches and the lack of an agreed - upon conceptual framework , including the lack of an exact definition . they also note the lack of attention to social / cultural contexts and the little attention to organizational culture , and underline the fact that most research is usa - centric , meaning that socio - cultural differences should be taken into account . it is also emphasized that there is no distinction in studies between small , medium and large organisations , nor is there clarity about whether they were in the private , public or third sector.[29,p.7 ] some remarks on culture differences were expressed also by bracco et al . because they present problems and obstacles resulting from differences in political , cultural and normative systems . more generally , some researchers noted the importance of a multidimensional and longitudinal approach to resilience ( e.g. , ) . he defined problems such as the reliance on post hoc analysis of past events , the loose theoretical concept , the wrong diagnosis or predictions and relying on generalized metaphors as explanatory principles . mcdonald also asked whether the popularity of resilience engineering has resulted from the real power of the theory or from the weakness of other models . an evaluation matrix was presented , in which resilience theory was assessed as very weak in terms of theoretical power and as completely unprepared in terms of technology readiness . it must be added that , since that time , the theory of resilience engineering has been much developed . both resilience engineering and the concept of resilience itself are defined widely enough to easily link them with other approaches to osh management . for example , gallis and zwetsloot describe the concepts of resilience engineering and the high - reliability organization as closely related approaches providing a new vision on risk management , and they list the commitment to resilience as one characteristic of high - reliability organizations , citing weick and suttcliffe , who define the commitment to resilience as one of five practices for developing the mindfulness of an organization . despite these doubts and the lack of clarity , resilience remains attractive in fields that cope with complexity , unpredictability and changes which lead to threats and sometimes even to danger . the weak points of resilience theory in the field of osh are the same as in other fields : the unclear definition and the question of how resilience shall be measured . however , most studies on resilience engineering concentrate on the practical problems of organizations . certain weak points of resilience theory in the field of osh result from the fact that its development began only a few years ago and it needs some time to mature . to summarize , it is noteworthy that there are many voices on the concept of resilience as a revolution in safety management , including the announcement of a new era in safety . however , a detailed analysis leads to the conclusion that the change is not as large as it seems . state that resilience engineering differs more in the perspective it provides on safety than in the methods and practical approaches that are used to address real - life problems.[75,p.9 ] | the concept of resilience has become very popular , especially in the 21st century .
this concept is applicable to many fields , from mechanics to a broad range of social sciences .
resilience has even become part of the national and global policies of the usa , the united nations and the european commission .
the concept of resilience has also been implemented in the area of safety and health based on the criticism of the traditional approach to occupational safety and health , which does not result in a satisfactory level of occupational safety .
the concept of resilience was adopted to research occupational safety and health in different fields and thus with different approaches , such as via socio - technical studies , the psychological and behavioral aspects of organizational resilience and the link with research on individual or family resilience and its influence on work . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
adhesive capsulitis of the hip ( ach ) has also been referred to as " frozen hip"1 ) or " capsular constriction"2 ) . it was first described by caroit et al.3 ) and since then there have only been few publications on the condition4,5,6 ) . however , subsequent experience has led authors to speculate that this condition does exist more commonly than was suggested earlier6 ) . there have been descriptions of case reports of the same but there is a lack of description of a case series . the medical literature has described two kinds of ach ; primary idiopathic adhesive capsulitis of hip ( iach ) and secondary ach2,6 ) . they have defined iach as adhesive capsulitis that is present without known etiology or concomitant pathology . this presentation is similar to that for adhesive capsulitis of the shoulder ( acs)3 ) . ach is due to retraction of the fibrous joint capsule of the hip and unless iach is diagnosed through surgery or biopsy , clinicians must rely on the patient 's history and clinical findings and normal radiography to diagnose iach5 ) . there is a lack of description of an objective evaluation modality that demonstrates direct evidence of this . thus the purpose of this study was to delineate the characteristic of findings observed on magnetic resonance arthrography ( mra ) by identifying the capsular thickness involved and their significance on clinical presentation of restricted range of motion in cases with iach and to report on the authors experience with the diagnosis of iach . from september 2006 to august 2012 , mra images of all the patients with hip pain or restricted range of movements , with normal plain hip radiographs were retrospectively assessed . at the time of this reporting , we excluded all subjects who have soft tissue abnormal ( labral tear or ligament tear 16 hips ) . out of them , 10 hips ( 8 patients ) were selected in the study group ( table 1 ) , who were diagnosed as cases of iach by the evaluation of a single radiologist on mra findings . diagnostic criteria of iach which we assuming are as 1 ) reduction of intra - articular capacity of joint , 2 ) limitation of range of motion , with or without pain . twenty patients were included in the control group with normal mra findings and with only hip pain without limitation of range of motion . the exclusion criteria were abnormal laboratory result ( blood cell count , inflammation markers , blood phosphate / calcium balance ) , in the presence of any sign of osteonecrosis or progressing coxarthrosis by radiological examination , inflammatory arthritis ( rheumatoid arthritis , systemic lupus erythematosus etc . ) excluded secondary ach . the study group included 10 hips ( 8 patients ) with 3 males and 7 females . the average age of the patients with iach was 44.4 ( 28 - 64 ) years . the control group included 20 hips ( 20 patients ) with 7 males and 13 females . the average age of the patients was 47.1 ( 21 - 72 ) years ( table 2 ) . the restriction of motion , which was initially recorded by a single senior surgeon was noted and compared for the study group and control group ( table 3 ) . a single radiologist recorded the mra finding of iach . the mra images of the patients in the study group were assessed ; t1 weighted image was chosen where the femur head was the widest and coronal cut was taken at the center of the femur head ( fig . the capsular thickness was measured in the anterior and posterior and inferior recess as shown in fig . similarly , t1 weighted images showing femur head as widest was cut in the axial plane at the center of the femoral head ( fig . the capsular thickness was measured in the superior and inferior recess as shown in fig . 3b . and three surgeons independently measured capsule thickness to evaluate the interobserver variability ( intraclass correlation coefficient , 0.853 ) . all patients with iach received conservative therapy , but patient who unrelieved the symptoms by conservative treatment , in whom arthroscopic release was performed . conservative treatment included lifestyle modifications to avoid pain - provoking activities , supervised physical therapy , and oral anti - inflammatory medications . an independent student t - test and wilcoxon rank - sum test were using spss statisics software ( for windows release ver . 17.0 ; spss inc . , chicago , il , usa ) , and significance was accepted at the 95% level . the range of motion possible was recorded in flexion , abduction , adduction , external rotation and internal rotation . in the control group , the mean flexion was 136.75.9 ; mean abduction was 424.9 ; mean adduction was 31.52.8 ; mean external rotation was 413.4 , mean internal rotation was 363.4. for patients in the iach group the mean flexion was 122.55.5 ; mean abduction was 282.8 ; mean adduction was 26.52.4 ; mean external rotation was 30.53.8 , mean internal rotation was 25.52.4. there was a statistically significant reduction in the mean range of motion of hip joints in all planes , in patients of the iach group when compared with the control group . however , even though there was global restriction of motion in the hip joint , the patient complained of maximum restriction in range of rotation ( table 3 ) . the capsular thickness was measured on the mra in millimeters as described earlier , in the anterior , posterior , superior and inferior recess . the mean capsular thickness in the control group was 2.610.8 mm anteriorly , 1.940.5 mm posteriorly , 1.880.5 mm superiorly and 1.840.5 mm inferiorly . similarly , the mean capsular thickness in the iach group was 3.140.7 mm anteriorly , 2.610.5 mm posteriorly , 2.780.5 mm superiorly and 2.130.4 mm inferiorly . the capsular thickness showed statistically significant difference between the control and iach groups in the posterior and superior recess ( table 4 ) . caroit et al.3 ) introduced the concept of ach . since then only a dozen or so articles have been published referring to this diagnosis1,2,3,5,6,7,8,9,10,11,12 ) . adhesive capsulitis of a joint has been defined as a condition that begins with synovial inflammation and ends in capsular fibrosis13,14,15,16 ) . the fibrosis of joint capsule in iach is caused by the same cytokines as that for acs ; however , their levels vary . hsu et al.17 ) has reported the association between acs and iach , but this has not been previously discussed in the literature in details . presently , there is no study that has examined or that can pinpoint the changes that occur , in otherwise unexplained iach . the exact reported incidence of ach is unknown but it is probably higher than is generally thought . it is said to selectively affect women between the ages of 35 and 501,3,6,18 ) . in our study seven out of ten patients , of the iach group were middle - aged women ranging in age from 31 to 61 years . six out of the ten patients had other co - morbid medical conditions typically associated with adhesive capsulitis like diabetes mellitus , hypertension and hyperlipidemia . patients suffering from diabetes mellitus have shown to have tendency to develop iach , associations have been established in similar involvement for the shoulder2,19 ) . however this cohort is too small to draw any reliable conclusions on this aspect . for the diagnosis of iach clinicians have mostly relied on their clinical findings , unless it is diagnosed through surgery or biopsy6 ) . literature shows that in the diagnosis of iach , hip radiographs often reveal only osteopenia . radiographic abnormalities have generally been reported only when there is underlying disease that leads to adhesive capsulitis2,7 ) . in this study the radiographs of the hip were normal in all the 10 hips and this is consistent with the literature . magnetic resonance imaging ( mri ) and computed tomography criteria for acs have been well known3,11,18,20 ) . similarly , authors6 ) also suggest role of mri of the hip in order to detect potential bone or cartilage pathologies . although some authors2,7 ) have described observations of tightness during arthrography as sign of reduced articular capacity and adhesive capsulitis , others have only argued of its relevance for iach . studies have also pointed out the need for a contra - lateral injection to compare and validate results6 ) . and mri can show evidence of capsular fibrosis where there is thickness of the anterior joint capsule11 ) . so best to our knowledge the characteristic of mra for iach has not been described in literature yet . in ach , there is limitation of motion in all three planes ( flexion - extension , internal - external rotation and abduction - adduction)3,6 ) . some authors suggest that iach is under - diagnosed as it leads to less functional limitation as compared to the other joints , loss of range of motion is much better tolerated in the hip than other joints , such as the shoulder and knee3,12 ) . similar results were observed in our study that the range of motion of the hip joint in the patients with iach was statistically significantly restricted in flexion , abduction , adduction and rotations . future studies are needed with larger sample size and longer follow - up . and we could not compare to contralateral normal hips of the iach patients due to 2 patients have both hip problem . if we compare contralateral normal hip of the iach patients , we would have been excluded to differences in individual difference in thickness of the capsule . and we did not distinguish between each stage of iach like an acs22 ) , because there was no proven or disproved by definitive diagnostic test like histopathology or arthroscopic finding . so in order to make an accurate diagnosis of iach need to histopathology or arthroscopic finding . the characteristic of mra is to identify the presence and location of capsular thickening superiorly and posteriorly , which correlates clinically as restricted motions . and | purposethe clinical suspicion of idiopathic adhesive capsulitis of the hip ( iach ) involves restricted range of motion and normal hip radiographs .
the purpose of this study was to delineate the characteristic findings observed on magnetic resonance arthrography ( mra ) by identifying the anatomical structures involved and their significance on clinical presentation of restricted range of motion.materials and methodswe retrospectively evaluated mra 's of 46 hips ( 44 patients ) who suffered hip pain from september 2006 to august 2012 in our hospital . of those , 10 cases ( 8 patients ) with clinical suspicion of iach were compared to 20 normal hip cases ( control group ) . to identify anatomical evidence of adhesive capsulitis in the mra 's of the iach group , capsular thickness
was measured superiorly , inferiorly , anteriorly and posteriorly , and compared to that of the randomly selected control group.resultscomparison of the mra findings of the control group to that of the iach group showed that there was a statistically significant increase in the mean thickness of the joint capsule superiorly and posteriorly ( p<0.01 ) , while comparison of examination findings revealed a statistically significant decrease in the mean range of motion ( flexion 122.55.5/abduction 28.02.8/adduction 26.52.4/external rotation 30.53.8/internal rotation 25.52.4 ) in the iach group.conclusiona change in the capsular thickness on mra is a common finding in iach patients with the increase more evident in the posterior and superior capsules than the anterior and inferior capsules . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
( figure 1 ) , has allowed for a less interrupted , more precise , better visualized , and faster sinus surgery.5 despite its advantages , the powered instrument could be harmful due to its ability to rapidly grasp and draw tissue into the blade before cutting , without the surgeon s awareness , which could lead to injury to vital cranial and orbital structures.69 in a nationwide study on 62,823 ess cases in the us , the overall major complication rate was 1% , of which orbital injury comprised 0.07%.10 the purpose of this report is to emphasize the ophthalmic hazards associated with powered instrumentation in ess . we describe two cases in which orbital injuries were sustained during powered ess , resulting in the rare complication of combined vision loss and ocular motility dysfunction . we conducted a search for cases of this complication that were reported from 1985 to 2012 , through the pubmed website , using the keywords endoscopic sinus surgery , a 52-year - old man underwent powered ess for bilateral ethmoid sinus disease and polyposis . no anatomical anomalies of the medial orbital wall were noted on preoperative computed tomography ( ct ) imaging . during surgery , the area of bleeding was controlled with bipolar cautery and eventually packed with gel foam . at the conclusion of the case , the left ethmoid sinus was re - examined and found to be dry with no evidence of active bleeding . in the immediate postoperative period , the patient s left eye was described by his wife as swollen shut . the patient was discharged without any intervention . the next morning , the eyelid swelling had improved ; however , he reported loss of vision in his left eye and the eye was deviated out . a computerized tomography scan of the orbits revealed a bony dehiscence of the medial wall of the orbit and soft tissue changes of the intraorbital injury ( figure 2 ) . despite 3 days of intravenous methylprednisolone three weeks after the surgery , the patient sought a second opinion at our institution . visual acuity was 20/20 in the right eye and no light perception ( nlp ) in the left eye . the left eye was unable to adduct and there was a large angle left exotropia in primary gaze ( figure 3a ) . forced duction and forced generation testing in the office were negative in the left eye . , there was a macular cherry red spot with arterial narrowing ( figure 3b ) . intraoperatively , there was bleeding from the area of the inferomedial right lamina papyracea , and when the surgeon inspected it , he described the inferomedial wall as being dehiscent or inadvertently fractured ( he was not clear on the precise interpretation of the finding ) . the medial and inferior recti muscles were not identified , but adjacent periorbital fat was contacted by the microdebrider . as the patient was being extubated , there was moderate nasal bleeding from the right nares with the development of right orbital edema , ecchymosis , and proptosis . an intraoperative ophthalmology consultation was obtained ; intraocular pressures were 17 mmhg in the right eye and 21 mmhg in the left eye , and fundus examination was unremarkable . there was limited movement of the right eye in all directions , with diffuse periorbital ecchymosis and swelling . a magnetic resonance imaging ( mri ) scan of the orbits revealed a hematoma in the inferonasal quadrant of the right orbit ( figure 4a ) . one month after surgery , the patient was referred to a local neuro - ophthalmologist . visual acuity was light perception only in the right eye , with limited movement of the right eye in all gazes , with the addition of 3 mm of right - eye enophthalmos . a follow - up mri showed fibrosis in the inferonasal aspect of the orbit ( figure 4b ) . visual acuity was light perception in the right eye and 20/20 in the left eye . there was 2 mm of right enophthalmos , deepening of superior eyelid sulcus and 2 mm of lagophthalmos . dilated fundus examination of the right eye revealed a pale optic nerve with cupping , but was otherwise unremarkable ( figure 5b ) . two decades ago , grabbing forceps were used by sinus surgeons to strip away mucosa and extirpate soft tissue , followed by the development of suction forceps.11 in 1994 , a revolutionary powered cutting instrument , termed the hummer or it is constructed of a hollow shaft connected to an aspiration - irrigating device with a rotating or oscillating blade at its distal end . aspiration of soft tissue and thin bone into the blade allows for precise excision and removal . the rate of aspiration and speed of the blade is controlled by the surgeon.12 despite its advantages , as a powered instrument with strong suction and cutting ability , the microdebrider can rapidly grasp and draw tissue into the blade before cutting , without the surgeon s awareness , or pull periorbita and fat into the sinus with removal of orbital tissue without entering the orbit,13 which can lead to injury to vital orbital structures.69 in a study of 62,823 ess cases , the overall major complication rate was 1% , of which orbital injury comprised 0.07%.10 vision loss and ophthalmoplegia are two infrequent and devastating complications of ess . they are rarely seen in combination . in this report , we describe two cases from our clinic and nine more case reports from the literature that had both complications concurrently ( table 1 ) . each case has distinct clinical and radiographic findings and a distinct mechanism of injury , highlighting the variety of mechanisms that may be involved in the ophthalmic complications associated with powered ess . the negative forced duction test indicating a non - restrictive process and the negative forced generation test indicating loss of muscle activity indicate a diagnosis of loss of function of the medial rectus muscle . the medial rectus muscle was the most common extraocular muscle injured in the previously published cases ( eight of nine);8,1620 direct injury or laceration of the medial rectus muscle was present in eight out of the eleven cases . two cases of ophthalmoplegia were caused by entrapment of the muscle within a defect of the medial orbital wall.16 due to its proximity to the lamina papyracea , the medial rectus muscle is known to be the muscle most susceptible to injury during ess.12 when it is completely transected during powered ess , surgical correction may not be possible because of the loss of too much muscle mass.21 thus , strabismus surgery was not indicated in case 1 . in our second patient , there may have been a pre - existing anatomical defect in the medial orbital wall ( dehiscent lamina papyracea ) . in light of the positive forced duction test , we believe the complete ophthalmoplegia was due to inadvertent surgical disruption of the orbital connective tissue framework through the medial orbital wall , resulting in a hematoma that was replaced by fibrosis;7 an mri 1 month after surgery showed that the normal high orbital fat signal was replaced with a low abnormal signal consistent with fibrosis ( figure 4b ) . strabismus surgery was not indicated in this case either , as it would have been very difficult to realign the eyes given the underlying mechanism of injury . also , neither patient was complaining of double vision because of the loss of vision in the same eye . ocular motility complications of ess may result from direct damage to the muscle from contusion , destruction , or transection;7,8,1720,22 entrapment of the muscle within a bony orbital wall defect;16,23 oculomotor nerve injury;24 or disruption of the orbital connective tissue system.7 all eleven cases in table 1 had concomitant vision loss with different degrees of severity . three cases had retinal vascular occlusion,17,19 and the most serious of all cases had bilateral vision loss and ophthalmoplegia.17 vision loss is a less common complication than ophthalmoplegia . in our first patient , the visual loss was probably due to ophthalmic artery occlusion or a combined central retinal artery occlusion and optic nerve injury , as nlp vision rarely , if ever , results from central retinal artery occlusion alone . this case joins the few published reports of retinal vascular occlusion as a cause of vision loss following ess.17,19,25,26 in our second patient , fundoscopic examination showed a pale optic nerve , a non - specific finding that does not help define the underlying mechanism of injury . we believe the vision loss was a result of either the orbital hematoma causing a compressive optic neuropathy or the use of cautery resulting in direct injury to the optic nerve . orbital hemorrhage is known to be the most reported ophthalmic complication associated with ess12 and can , as in our patient , result in indirect ( compressive ) optic nerve injury.8,16,18 a meta - analysis of 2583 patients undergoing ess found a 0.12% incidence of orbital complications , the vast majority being orbital hemorrhage,27 caused by unintentional entry into the orbit through the lamina papyracea.28 the other possible mechanism of optic nerve injury in our patient is direct trauma from the use of cautery . there are few reports of irreversible unilateral and bilateral visual loss caused by direct injury to the optic nerve from the electrocoagulator and microdebrider.17,19,20,29,30 there is no proven treatment for direct traumatic optic neuropathy . several procedures and measures have been recommended by ent surgeons in order to avoid orbital hematoma / blindness when performing powered ess.13 high risk patients should be recognized through review of ct scans for preoperative orbital dehiscence , expansion by disease , and thinning . the location of the medial rectus against the lamina papyracea should be noted , as well as whether the anterior ethmoid artery is below the skull base in the ethmoid sinus and subject to trauma and retraction into the orbit , and whether the maxillary sinus is hypoplastic.13 in surgery , the key to preventing orbital injury is identifying the lamina papyracea . the most helpful way to identify any opening in the lamina papyracea is to use simultaneous endoscopic exam and eye palpation , the so - called bulb press test , which was first identified in a 1989 report by stankiewicz et al.13,14 during surgery , any patient who has orbital fat exposure should be observed for orbital hematoma . time is critical when dealing with increased intraorbital pressure more so with an acute arterial or fast hematoma . reversal of critical pressure is the key to success.14,15 orbital massage should be instituted and pressure measured with an ophthalmometer , if available . if the eye is persistently hard and tense or pressure continues to be elevated a lateral canthotomy with cantholysis should be performed only if the surgeon knows how to perform the procedure . unfortunately cantholysis and canthotomy are not taught in most training programs because they are looked upon as ophthalmology procedures . perhaps , in high risk patients , the surgeon performing the operation should be experienced with this procedure.13 unfortunately , there is very little room for treatment in cases of direct optic nerve injury13 and treatment is difficult when significant muscle mass loss has occurred as a result of transection.21 a comprehensive review of the preventive measures and treatment that can be applied by the sinus surgeon during or after powered ess is beyond the scope of this paper . sinus surgery can cause major complications in the orbit , which is a different anatomical system . surprisingly , in the last 18 years , only nine cases of combined vision loss and ophthalmoplegia have been reported . two of these cases were examined at the duke eye center during the last year . we therefore conclude that the scarcity of published cases may be due to underreporting or underdiagnosis , perhaps due to insufficient awareness and collaboration between sinus surgeons and ophthalmologists . we believe it is important that both should be familiar with the mechanisms leading to these concurrent complications of ess and should enhance collaboration for facilitating better recognition , treatment , and reporting of these cases . | objectiveto describe two rare cases of concurrent vision loss and external ophthalmoplegia following powered endoscopic sinus surgery ( ess).designobservational case report.resultsthe records of two patients who underwent powered ess and developed multiple concurrent ophthalmic complications were retrospectively reviewed for clinical history , neuro - ophthalmologic examination , and imaging findings .
patient 1 developed a retinal vascular occlusion and complete loss of adduction .
patient 2 developed an orbital hemorrhage , optic neuropathy , and a restrictive global ophthalmoplegia .
similar published case reports were also reviewed.conclusiondespite advances in powered ess technique and instrumentation , serious ophthalmic complications can still occur .
inadvertent entry into the medial orbital wall can result in a combination of blindness and ocular motility dysfunction .
the variety of mechanisms responsible for these complications underscores the importance of thorough pre- and postoperative clinical examination and review of imaging studies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
therapeutic molecules that specifically target cancer cells are the key to the development of patient - tailored cancer treatment . the selective targeting of cancer cells would enable treatments that inhibit tumor growth and invasion while sparing the tumor surrounding normal cells , thus reducing the adverse side effects frequently caused by conventional chemotherapies ( toniatti et al , 2014 ) . because of the versatility of the rnai process , rna - based gene therapy is emerging as a potential effective and safe approach to target various human diseases , including cancers ( uchino et al , 2013 ) . rnai molecules include both extrinsic short interfering rnas ( sirnas ) and intrinsic antisense rnas ( as - rna ) , and micrornas ( mirnas ) , and modulate post - transcriptional and sequence - specific gene silencing . si / mirnas are processed by the ribonuclease dicer to produce short double - stranded rnas ( dsrnas ) of 20 - 24 base pairs that in the cytoplasm are recognized by the rna - induced silencing complex ( risc ) . the risc drives the strand that directs silencing ( guide strand ) to the target mrna , while the other strand ( passenger strand ) is degraded . depending on the degree of complementarity , the hybridization of guide strand to the mrna prevents translation or induces degradation ( rand et al , 2005 ) . sirnas that show a perfect complementarity to their target mrna , induce gene silencing through a sequence - specific cleavage of the target rna , whereas micrornas , that show a partial complementarity , can mediate translational repression or transcript degradation ( figure 1 ) . scheme of mi / sirna processing pathway . using rnai to inhibit the action of genes relevant for cancer cell survival and progression presents several advantages over other inhibitors as small molecules , peptides and antibodies , since the elevated target specificity is coupled to low toxicity . chemical modifications can be easily introduced in sequence to increase resistance to nucleases , stability or binding properties ( shukla et al , 2010 ) . in addition , solid - phase synthesis of short nucleic acids has made the large - scale production cost - effective . to - date numerous pre - clinical studies have provided encouraging results for use of this class of molecules as cancer therapeutics . while the rnai technology offer potential to inhibit expression of specific and multiple target genes , raising the hope of patient tailored therapies ; however , several challenges hinder their successful translation into the clinic . a major obstacle is represented by the necessity to develop safe and effective means for their delivery , enabling the selective accumulation of rnai at target sites , their intracellular uptake , correct processing and functional silencing of target genes . in this aptamers are short , structured , single - stranded rna or dna ligands that bind to target molecules with high specificity and affinity ( kd in the low nanomolar - picomolar range ) . in the last decade , aptamers that target the extracellular domain of transmembrane receptors overexpressed in tumors have been generated , thus becoming , along with monoclonal antibodies , ideal tools for the specific recognition of cancer cell surface ( cerchia and de franciscis , 2010 ) . thanks to their unique characteristics , cancer targeting aptamers are revealing a promising mean to selectively drive nanoparticle - based cargoes to affected cancer tissues . further , because of the chemical versatility of nucleic acids , aptamers have been as well directly conjugated to different secondary reagents such as chemotherapeutics , imaging probes and sirnas / mirnas to be selectively driven toward the target cells . in this review , we will discuss the various approaches adopted to use aptamers for the selective delivery of si / mirnas to cancer cells with a special focus on the design of aptamer - rnai conjugates . aptamers are generated from high complexity pools through a combinatorial process named systematic evolution of ligands by exponential enrichment ( selex ) to tightly bind to their proper targets ( tuek and gold , 1990 ) . various aptamers have been raised that bind to and inhibit the function of proteins involved in cancer . as such , the aptamer technology is now emerging for its potential as an effective diagnostic and therapeutic tool , and many aptamers are currently in clinical and preclinical trials ( esposito et al , 2011 ) . aptamers were first identified as cancer therapeutics because of their ability to inhibit their targets and for their appropriate pharmacokinetic and pharmacodynamic properties . more recently , thanks to their excellent targeting properties , they have been developed as delivery tools for secondary therapeutic agents and nanoparticles . to - date , they have been successfully conjugated to different active molecules , including nanoparticles ( farokhzad et al , 2006 ; wang et al , 2013 ) , anti - cancer therapeutics ( bagalkot et al , 2006 ) , toxins ( chu et al , 2006a ) , enzymes ( chen et al , 2008 ) , radionuclides ( hicke et al , 2006 ) , sirnas ( zhou and rossi , 2010 ) and mirnas ( wu et al , 2011 ; dai et al , 2012 ; liu et al , 2012 ; esposito et al , 2014 ) . in these conjugates , the aptamer moiety is used to selectively drive the secondary reagent to affected tissues or cells that overexpress the aptamer target , eluding the accumulation of drugs in non - target cells . consequently , the efficacy of the therapy is increased and the possibility of unwanted side effects is reduced ( figure 2 ) . the use of aptamers as delivery tools is particularly relevant in the case of conjugates with si / mirna therapeutics ( wu et al , 2014 ) . aptamers can be used to selectively deliver secondary reagents to target cells that express aptamer target on cell surface ( left ) . only this subset of cells will be exposed to the secondary reagent , whereas cells that do not express aptamer target will not be affected ( right ) . aptamers show important advantages over viral and lipid nanoparticle - based approaches proposed for irna delivery . even if adenovirus- and adeno - associated viruses have shown high efficacy , they give problems of insertional mutagenesis and immunogenicity ( kay , 2011 ) . on the other hand , nanoparticle - based systems have achieved a limited effectiveness in vivo , resulting in a preferentially accumulation in the liver , a dose - dependent toxicity and hepatotoxicity ( zhou et al , 2013a ) . thus the use of aptamers offers the possibility to overcome these problems enabling the specific accumulation of sirnas in target tumor cells in a safe and effective manner . to - date , the use of synthetic sirnas has been largely adopted to suppress the expression of pathologically important genes in cancer and several preclinical studies have shown the effective inhibition of tumor cell growth , angiogenesis , metastasis and chemo - resistance ( bora et al , 2012 ; rao et al , 2013 ) . given the unprecedented potential impact in using si / mirnas for personalized cancer therapy , a great effort has been invested to develop approaches enabling their safe and specific delivery . in this respect , using aptamers as delivery moieties revealed as a safe and effective approach for the specific recognition of solid tumors in preclinical studies . aptamers against the extracellular domain of the prostate - specific membrane antigens ( psma ) , a9 and a10 aptamers ( lupold et al , 2002 ) , have been extensively characterized for sirna delivery by developing different approaches based either on non - covalent or covalent conjugation . one of the first studies reported the development of a non - covalent approach that employed the use of a streptavidin connector ( figure 3a ) ( chu et al , 2006b ) . the a9 aptamer and the sirna targeting laminin a / c and gapdh genes were modified with biotin and then assembled via a streptavidin bridge . the treatment of psma - positive lncap cells with the conjugates resulted in a gene expression inhibition comparable to those observed with conventional lipid reagents . ( a - d ) schematic representation of the different approaches developed for the direct conjugation of anti - psma aptamer and sirna ( see text for a detailed description ) . the functional antisense strand of the sirna is in red . the anti - nucleolin aptamer that is a g - rich quadruplex - forming oligonucleotide is extended with a poly ( dt ) spacers , while the sense strand of a sirna is modified with a sulfo - smpb linker . the molecule is obtained by the annealing of multimeric antisense strand with aptamer - incorporating sense strands . in the same year , mcnamara et al ( 2006 ) described an elegant covalent approach in which the aptamer is extended at the 3end with a tail complementary to the antisense strand of the sirna ( nonfunctional or sense strand ) and then annealed with the sirna antisense strand ( functional strand , figure 3b ) , generating a completely rna - based molecule . this approach was used to conjugate the anti - psma a10 aptamer with sirnas targeting survival genes , the polo - like kinase 1 ( plk1 ) or bcl-2 . the resulting chimeras specifically silenced target genes and induced cell death in psma - positive cancer cells . in a later study , ( dassie et al , 2009 ) the a10-plk1-sirna chimera was further optimized for in vivo application by truncating the aptamer portion , swapping the sense and antisense strands of the sirna portion and adding a two - nucleotide 3 -overhang and a peg tail ( figure 3c ) . by suppressing the expression of the plk-1 gene , the resulting conjugate effectively inhibited the growth of psma - positive tumors after systemic administration . the a10 aptamer has been further covalently conjugated to different sirnas , including those targeting the eukaryotic elongation factor-2 ( wullner u et al , 2008 ) or two key components of the nonsense - mediated mrna decay ( pastor et al , 2010 ) . in addition , a truncated version of a10 aptamer ( a10 - 3 ) was linked to a short hairpin rnas ( shrnas ) against the dna - activated protein kinase by generating a single molecules completely modified with 2 fluoro - pyrimidine ( 2-f - py ) ( ni x et al , 2011 ) . in this chimera , the 3-terminus of the aptamer was extended with the sirna sense strand , followed by a 10-mer loop sequence and by the sirna antisense strand ( figure 3d ) . several other aptamers against cell surface proteins overexpressed on cancer cells have been used for sirna delivery . for example , the aptamer against nucleolin as1411 ( bates et al , 2009 ) was recently conjugated to sirnas specific for snail family zinc finger 2 ( slug ) and neuropilin 1 ( nrp1 ) proteins ( lai et al , 2014 ) . in the chimeric molecules ( aptncl - slugsir and aptncl - nrp1sir ) , the aptamer portion was extended with a poly(dt ) spacer and conjugated through the sulfhydryl group ( s ) bridge to the sirna sense strand modified with a sulfo - smpb linker ( figure 3e ) . aptncl - slugsir and aptncl - nrp1sir specifically knocked down the expressions of slug and nrp1 in nucleolin - positive cancer cells and , when used in combination , significantly reduced cancer cell migration and invasion in vitro and inhibited tumor growth , invasiveness and angiogenesis in vivo . in addition , as1411 aptamer was used as targeting agent on pegylated cationic liposome containing braf specific sirna . the complex showed an efficient tumor - targeting capability and inhibited tumor growth in xenograft of a375 melanoma cells ( li et al , 2014 ) . another interesting cancer - related surface target is the epidermal growth factor receptor ( egfr ) and its activated deletion variant ( egfrviii ) , the most common egfr mutation found in many malignancies including glioma . by using the streptavidin - biotin approach a dna aptamer against egfrviii ( tan et al , 2013 ) was used to deliver c - met sirna into glioma u87 mg cells overepressing egfrviii ( zhang et al , 2014 ) . the efficient delivery of c met sirna resulted in increasing apoptosis and inhibiting proliferation of target cells . in addition , aptamers specific for her-2 positive breast cancer cells were covalently conjugated to bcl-2 sirna , generating a chimera able to sensitize cells to chemotherapy ( thiel et al , 2012 ) . by using a dna aptamer against mucin 1 ( muc1 ) , that is overexpressed in different tumors ( kufe , 2009 ) , it has been recently proposed a promising approach in which chemically conjugated multimeric antisense strands were annealed with aptamer - guide strands ( figure 3f ) . compared to conventional chimeras , this multimeric construct enhanced sirna intracellular delivery ( yoo et al , 2014 ) . aptamer - targeted delivery has been also applied in cancer immunotherapy . in order to enhance antitumor immunity , berezhnoy et al ( 2014 ) conjugated an aptamer that binds the 4 - 1bb , a costimulatory molecule of cd8 + t cells , with a sirna targeting raptor , a component of the mammalian target of rapamycin complex 1 ( mtorc1 ) . they found that the systemic administration of the chimera downregulated mtorc1 activity in cd8 + t cells , leading to a potent memory response that potentiated antitumor immunity . in the same year , herrmann et al ( 2014 ) covalently liked an aptamer against the cytotoxic t lymphocyte associated antigen 4 ( ctla4 ) , that is upregulated in tumor associated cd8 + t cells , to sirna targeting stat-3 , that induce peripheral tolerance in tumor associated immune cells inhibiting cd8 + t cell activity . specific t cells and reduced tumor growth and metastasis in different mouse tumor models . thus the studies concerning the use of aptamers for the delivery of sirnas are growing rapidly and strongly support the importance of these two class of molecules for cancer treatment . endogenous mirnas regulate important biological process including cancer initiation , progression and metastasis , showing a great potential as cancer therapeutics . deregulation of mirna expression has been involved in different malignancies and it is ascertained that mirnas may act as oncogenes ( oncomirs ) or tumor suppressors , depending on the cellular function inhibited ( kasinski and slack , 2011 ; di leva et al , 2013 ) . mirnas have the potential to target simultaneously multiple genes that cooperate in the same pathway , thus resulting in an efficient cell reprogramming . as such , it makes unquestionable the development of a safe mean for the specific delivery of oncosuppressor mirnas enabling the reduction of off - target effects while increasing the therapeutic effectiveness . therefore , given the progresses in the design of aptamer - based strategies for sirna delivery , it has been recently explored the use of aptamers as delivery moieties for micrornas . in a first study , a second generation aptamer against psma ( a10 - 3.2 ) was conjugated to a polyamidoamine ( pamam)-based microrna ( mir-15a and mir-16 - 1 ) using peg as a spacer . the construct demonstrated to be able to selectively deliver the mirna moiety into lncap ( psma positive ) prostate cancer cells , inducing cell death in vitro ( wu et al , 2011 ) . the same aptamer was recently used as recognition ligand in an atelocollagen ( ate)-based microrna ( mirna ; mir-15a and mir-16 - 1 ) vector to target prostate cancer bone metastasis ( hao et al , 2014 ) . liu et al ( 2012 ) then described a direct combination between aptamers and mirnas . the molecule , in which the anti - muc1 aptamer was conjugated to let-7i mirna , sensitized ovcar-3 ovarian cancer cells to paclitaxel . the same aptamer was also combined to mir-29b that , by inhibiting dna methyltransferases expression , is able to induce pten gene . thus , the resulting chimera ( figure 4a ) induced apoptosis in ovcar-3 cells ( dai et al , 2012 ) . more recently , we developed a novel multifunctional aptamer - mirna conjugate ( named gl21.t - let ) ( esposito et al , 2014 ) by combining a previously characterized anti - axl receptor inhibitory aptamer named gl21.t ( cerchia et al , 2012 ) with the tumor suppressor let-7 g mirna ( boyerinas et al , 2010 ) . for the conjugation strategy , the aptamer was extended with the passanger strand of the mirna and then annealed with the guide strand ( figure 4b ) . notably , instead of using a perfect complementary 22-mer mirna duplex , we introduced an internal partial complementarity and a longer sequence ( 26 - 27 bases ) with the aim to have a better dicer substrate ( amarzguioui and rossi , 2008 ) . we demonstrated that gl21.t - let was selectively delivered to axl - expressing cancer cells , processed by the irna machinery , leading to silence let-7 g targets in vitro and in vivo . importantly , the conjugate combined the mirna activity with the aptamer function ( axl signaling inhibition ) , resulting in an effective inhibition of cell migration and survival in vitro and of tumor growth in vivo . moreover , we also reported another conjugation strategies via a 17-mer stick complementary sequence ( figure 4c ) that is based on rules already described for aptamer - sirna chimeras for hiv treatment ( zhou et al , 2013b ) . the abnormal high expression of oncomir in cancer cells greatly contributes to the malignant phenotype . for an effective therapy , it is thus required to design single strand antisense oligonucleotides ( named anti - mirs ) able to antagonize the oncomir action . ( a - c ) schematic representation of the different approaches developed for the direct conjugation of aptamers to mirnas ( see text for details ) . the functional guide strand of the mirna is in red . to - date only a few studies are present in literature that describe the development of theragnostic nanoparticles ( mfas ) containing as1411 aptamer as targeting molecule and mir-221 molecular beacon ( mir-221 mb ) complementary to the oncogenic mirna-221 ( kim et al , 2012 ) . once delivered to nucleolin positive cells , the mir-221 mb released from the mfas was able to image mirna-221 in the cytoplasm and simultaneouslyinhibiting the mirna function . the selective delivery of anti - mirs to target cancer cells is still in its infancy ; nevertheless , the development of aptamer - mediated approaches represent a concrete possibility to achieve this goal . to - date , the use of synthetic sirnas has been largely adopted to suppress the expression of pathologically important genes in cancer and several preclinical studies have shown the effective inhibition of tumor cell growth , angiogenesis , metastasis and chemo - resistance ( bora et al , 2012 ; rao et al , 2013 ) . given the unprecedented potential impact in using si / mirnas for personalized cancer therapy , a great effort has been invested to develop approaches enabling their safe and specific delivery . in this respect , using aptamers as delivery moieties revealed as a safe and effective approach for the specific recognition of solid tumors in preclinical studies . aptamers against the extracellular domain of the prostate - specific membrane antigens ( psma ) , a9 and a10 aptamers ( lupold et al , 2002 ) , have been extensively characterized for sirna delivery by developing different approaches based either on non - covalent or covalent conjugation . one of the first studies reported the development of a non - covalent approach that employed the use of a streptavidin connector ( figure 3a ) ( chu et al , 2006b ) . the a9 aptamer and the sirna targeting laminin a / c and gapdh genes were modified with biotin and then assembled via a streptavidin bridge . the treatment of psma - positive lncap cells with the conjugates resulted in a gene expression inhibition comparable to those observed with conventional lipid reagents . ( a - d ) schematic representation of the different approaches developed for the direct conjugation of anti - psma aptamer and sirna ( see text for a detailed description ) . the anti - nucleolin aptamer that is a g - rich quadruplex - forming oligonucleotide is extended with a poly ( dt ) spacers , while the sense strand of a sirna is modified with a sulfo - smpb linker . the molecule is obtained by the annealing of multimeric antisense strand with aptamer - incorporating sense strands . in the same year , mcnamara et al ( 2006 ) described an elegant covalent approach in which the aptamer is extended at the 3end with a tail complementary to the antisense strand of the sirna ( nonfunctional or sense strand ) and then annealed with the sirna antisense strand ( functional strand , figure 3b ) , generating a completely rna - based molecule . this approach was used to conjugate the anti - psma a10 aptamer with sirnas targeting survival genes , the polo - like kinase 1 ( plk1 ) or bcl-2 . the resulting chimeras specifically silenced target genes and induced cell death in psma - positive cancer cells . in a later study , ( dassie et al , 2009 ) the a10-plk1-sirna chimera was further optimized for in vivo application by truncating the aptamer portion , swapping the sense and antisense strands of the sirna portion and adding a two - nucleotide 3 -overhang and a peg tail ( figure 3c ) . by suppressing the expression of the plk-1 gene , the resulting conjugate effectively inhibited the growth of psma - positive tumors after systemic administration . the a10 aptamer has been further covalently conjugated to different sirnas , including those targeting the eukaryotic elongation factor-2 ( wullner u et al , 2008 ) or two key components of the nonsense - mediated mrna decay ( pastor et al , 2010 ) . in addition , a truncated version of a10 aptamer ( a10 - 3 ) was linked to a short hairpin rnas ( shrnas ) against the dna - activated protein kinase by generating a single molecules completely modified with 2 fluoro - pyrimidine ( 2-f - py ) ( ni x et al , 2011 ) . in this chimera , the 3-terminus of the aptamer was extended with the sirna sense strand , followed by a 10-mer loop sequence and by the sirna antisense strand ( figure 3d ) . several other aptamers against cell surface proteins overexpressed on cancer cells have been used for sirna delivery . for example , the aptamer against nucleolin as1411 ( bates et al , 2009 ) was recently conjugated to sirnas specific for snail family zinc finger 2 ( slug ) and neuropilin 1 ( nrp1 ) proteins ( lai et al , 2014 ) . in the chimeric molecules ( aptncl - slugsir and aptncl - nrp1sir ) , the aptamer portion was extended with a poly(dt ) spacer and conjugated through the sulfhydryl group ( s ) bridge to the sirna sense strand modified with a sulfo - smpb linker ( figure 3e ) . aptncl - slugsir and aptncl - nrp1sir specifically knocked down the expressions of slug and nrp1 in nucleolin - positive cancer cells and , when used in combination , significantly reduced cancer cell migration and invasion in vitro and inhibited tumor growth , invasiveness and angiogenesis in vivo . in addition , as1411 aptamer was used as targeting agent on pegylated cationic liposome containing braf specific sirna . the complex showed an efficient tumor - targeting capability and inhibited tumor growth in xenograft of a375 melanoma cells ( li et al , 2014 ) . another interesting cancer - related surface target is the epidermal growth factor receptor ( egfr ) and its activated deletion variant ( egfrviii ) , the most common egfr mutation found in many malignancies including glioma . by using the streptavidin - biotin approach a dna aptamer against egfrviii ( tan et al , 2013 ) was used to deliver c - met sirna into glioma u87 mg cells overepressing egfrviii ( zhang et al , 2014 ) . the efficient delivery of c met sirna resulted in increasing apoptosis and inhibiting proliferation of target cells . in addition , aptamers specific for her-2 positive breast cancer cells were covalently conjugated to bcl-2 sirna , generating a chimera able to sensitize cells to chemotherapy ( thiel et al , 2012 ) . by using a dna aptamer against mucin 1 ( muc1 ) , that is overexpressed in different tumors ( kufe , 2009 ) , it has been recently proposed a promising approach in which chemically conjugated multimeric antisense strands were annealed with aptamer - guide strands ( figure 3f ) . compared to conventional chimeras , this multimeric construct enhanced sirna intracellular delivery ( yoo et al , 2014 ) . aptamer - targeted delivery has been also applied in cancer immunotherapy . in order to enhance antitumor immunity , berezhnoy et al ( 2014 ) conjugated an aptamer that binds the 4 - 1bb , a costimulatory molecule of cd8 + t cells , with a sirna targeting raptor , a component of the mammalian target of rapamycin complex 1 ( mtorc1 ) . they found that the systemic administration of the chimera downregulated mtorc1 activity in cd8 + t cells , leading to a potent memory response that potentiated antitumor immunity . in the same year , herrmann et al ( 2014 ) covalently liked an aptamer against the cytotoxic t lymphocyte associated antigen 4 ( ctla4 ) , that is upregulated in tumor associated cd8 + t cells , to sirna targeting stat-3 , that induce peripheral tolerance in tumor associated immune cells inhibiting cd8 + t cell activity . specific t cells and reduced tumor growth and metastasis in different mouse tumor models . thus the studies concerning the use of aptamers for the delivery of sirnas are growing rapidly and strongly support the importance of these two class of molecules for cancer treatment . endogenous mirnas regulate important biological process including cancer initiation , progression and metastasis , showing a great potential as cancer therapeutics . deregulation of mirna expression has been involved in different malignancies and it is ascertained that mirnas may act as oncogenes ( oncomirs ) or tumor suppressors , depending on the cellular function inhibited ( kasinski and slack , 2011 ; di leva et al , 2013 ) . mirnas have the potential to target simultaneously multiple genes that cooperate in the same pathway , thus resulting in an efficient cell reprogramming . as such , it makes unquestionable the development of a safe mean for the specific delivery of oncosuppressor therefore , given the progresses in the design of aptamer - based strategies for sirna delivery , it has been recently explored the use of aptamers as delivery moieties for micrornas . in a first study , a second generation aptamer against psma ( a10 - 3.2 ) was conjugated to a polyamidoamine ( pamam)-based microrna ( mir-15a and mir-16 - 1 ) using peg as a spacer . the construct demonstrated to be able to selectively deliver the mirna moiety into lncap ( psma positive ) prostate cancer cells , inducing cell death in vitro ( wu et al , 2011 ) . the same aptamer was recently used as recognition ligand in an atelocollagen ( ate)-based microrna ( mirna ; mir-15a and mir-16 - 1 ) vector to target prostate cancer bone metastasis ( hao et al , 2014 ) . liu et al ( 2012 ) then described a direct combination between aptamers and mirnas . the molecule , in which the anti - muc1 aptamer was conjugated to let-7i mirna , sensitized ovcar-3 ovarian cancer cells to paclitaxel . the same aptamer was also combined to mir-29b that , by inhibiting dna methyltransferases expression , is able to induce pten gene . thus , the resulting chimera ( figure 4a ) induced apoptosis in ovcar-3 cells ( dai et al , 2012 ) . more recently , we developed a novel multifunctional aptamer - mirna conjugate ( named gl21.t - let ) ( esposito et al , 2014 ) by combining a previously characterized anti - axl receptor inhibitory aptamer named gl21.t ( cerchia et al , 2012 ) with the tumor suppressor let-7 g mirna ( boyerinas et al , 2010 ) . for the conjugation strategy , the aptamer was extended with the passanger strand of the mirna and then annealed with the guide strand ( figure 4b ) . notably , instead of using a perfect complementary 22-mer mirna duplex , we introduced an internal partial complementarity and a longer sequence ( 26 - 27 bases ) with the aim to have a better dicer substrate ( amarzguioui and rossi , 2008 ) . we demonstrated that gl21.t - let was selectively delivered to axl - expressing cancer cells , processed by the irna machinery , leading to silence let-7 g targets in vitro and in vivo . importantly , the conjugate combined the mirna activity with the aptamer function ( axl signaling inhibition ) , resulting in an effective inhibition of cell migration and survival in vitro and of tumor growth in vivo . moreover , we also reported another conjugation strategies via a 17-mer stick complementary sequence ( figure 4c ) that is based on rules already described for aptamer - sirna chimeras for hiv treatment ( zhou et al , 2013b ) . the abnormal high expression of oncomir in cancer cells greatly contributes to the malignant phenotype . for an effective therapy , it is thus required to design single strand antisense oligonucleotides ( named anti - mirs ) able to antagonize the oncomir action . ( a - c ) schematic representation of the different approaches developed for the direct conjugation of aptamers to mirnas ( see text for details ) . the functional guide strand of the mirna is in red . to - date only a few studies are present in literature that describe the development of theragnostic nanoparticles ( mfas ) containing as1411 aptamer as targeting molecule and mir-221 molecular beacon ( mir-221 mb ) complementary to the oncogenic mirna-221 ( kim et al , 2012 ) . once delivered to nucleolin positive cells , the mir-221 mb released from the mfas was able to image mirna-221 in the cytoplasm and simultaneouslyinhibiting the mirna function . the selective delivery of anti - mirs to target cancer cells is still in its infancy ; nevertheless , the development of aptamer - mediated approaches represent a concrete possibility to achieve this goal . gene therapies based on the use of irna to modulate gene expression are revealing as highly promising approaches for the treatment of canvers . aptamers are emerging as safe and effective molecules enabling the specific recognition of target cells in vivo , the intracellular uptake and the functional processing of the rnai , ultimately leading to proper target gene silencing . to - date , diverse approaches have been adopted to conjugate aptamers with sirnas and , more recently , aptamer - microrna chimeras have been described . therefore , even if the aptamer - based anti - mirs delivery has been still poorly addressed , it represents an important challenge with broad applicability to treat many human diseases , including cancer , metabolic , cardiologic and infectious diseases . | rna interference ( rnai ) is an important biological process that ultimately leads to suppression of gene expression .
activators of rnai are typically small interfering rnas ( sirna ) and micrornas ( mirna ) that offer considerable therapeutic potnetial . however , a major obstacle to take these these molecules to the clinic is the absence of safe and reliable means for their specific delivery to target cells . in this regard , a highly promising class of molecules
is represented by nucleic acid aptamers .
these are short , structured , single - stranded rnas or dnas oligonucleotides that , by binding with high specificity to target molecules , provide high affinity ligands and potential antagonists of disease - associated proteins .
further , because of the high binding specificity , aptamers represent a powerful tool for the selective delivery of therapeutic cargos , including mi / sirnas , chemotherapeutics , toxins and nanoparticles to cancer cells or tissues , thus potentially increasing the efficacy of a given therapy as well as reducing toxicity . in this review
, we will focus on recent advances in the field of aptamer - mediated mi / sirna delivery , discussing their potential and challenges in cancer therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
biodiesel , also known as fatty acid methyl esters ( fame ) , has attracted great attention in recent years because of the depletion of fossil fuels , increased crude oil price , and its environmental benefits . it is mainly synthesized by transesterifying triglycerides from soybean , rapeseed , and palm oils with methanol . the advantages of biodiesel over diesel fuel are its renewability , biodegradability , lower emission of toxic compounds , and higher combustion efficiency . however , the industrial scale production of biodiesel is limited due to the undesirable byproducts , the recovery of glycerol , the removal of inorganic salts and water , the treatment of wastewater , and the requirement of high energy . many research works related to enzymatic catalysts have been carried out to overcome these drawbacks [ 57 ] . they can catalyze transesterification of triglycerides as well as esterification of free fatty acids to produce biodiesel . compared to chemical catalysis , the lipase - catalyzed synthesis of biodiesel is more compatible with variations in the quality of raw materials . the main obstacle for commercialization of the lipase - catalyzed process is the cost of the enzyme [ 7 , 8 ] . 0.62 usd per kg . to compensate for the high cost of the enzyme , an effective way is to extend the operational life of the lipase , which would significantly increase productivity of a given amount of enzyme and lower the biodiesel production price . this can be achieved by using immobilized enzymes . in the batch system , novozym 435 , an immobilized candida antarctica lipase b on acrylic resin , could be repeatedly used 550 cycles under their optimal reaction conditions [ 1012 ] . li et al . reported that the enzyme activity of novozym 435 showed no obvious loss after being used for 200 cycles . furthermore , royon et al . used 13.5% cotton oil and 54% methanol with novozym 435 in tret - butanol solvent system to produce biodiesel at 50c reaction temperature and 24 hours reaction time with 97% yield . chang et al . reported that canola oil and methanol ( molar ratio 1 : 3.5 ) was employed to biosynthesize biodiesel with 42% novozym 435 at reaction temperature of 38c and reaction time of 12.4 hours in hexane system . therefore , we chose novozym 435 as the biocatalyst in a pack - bed reactor system in this study . for industrial scale production , the use of immobilized enzyme with packed - bed reactor is more cost effective than the batch operation . the immobilized lipase is packed into a column and the reaction mixture is continuously pumped through the column . , the advantages of using a packed - bed reactor also include continuous removal of glycerol and excess alcohol , effective reuse of enzymes , and the protection of enzyme particles from mechanical shear stress [ 1416 ] . however , long - term operation of a packed - bed reactor is still a challenge . in a solvent - free system , the packed - bed reactor can be operated for 37 days without decreasing ester yield [ 17 , 18 ] . the stepwise addition of methanol prevented the deactivation of the lipase , which allowed a constant enzyme activity during 100 days of operation . furthermore , chen and wu regenerated lipase by periodically washing with tert - butanol , and the lipase maintained its activity for 70 days . the stability of immobilized lipase also can be improved using tert - butanol as the solvent in the continuous packed - bed reactor . the enzyme activity was maintained through 5 and 20 days by halim et al . and royon et al . , respectively . in this study , we developed a continuous packed - bed reactor , which was packed with novozym 435 lipase , to produce biodiesel from soybean oil with methanol . tert - butanol was used as the solvent , because it is an ideal medium that enhances miscibility of methanol with vegetable oils as well as being regenerating agent of lipase [ 10 , 13 , 15 , 20 ] . statistical experiment design and rsm analysis were employed to investigate the affinities between the reaction variables ( reaction temperature , flow rate , and substrate molar ratio ) and response ( molar conversion percentage ) , and to obtain the optimal conditions for continuous packed - bed reactor operation . this paper provides a feasible model for long - term operation of packed - bed reactor and sheds light on industrial scale production of biodiesel with enzymatic catalysts . immobilized lipase ( triacylglycerol hydrolase , ec 3.1.1.3 ; novozym 435 ) from candida antarctica , supported on acrylic resin beads , was purchased from novo nordisk bioindustrials , inc . ( bagsvaerd , denmark ) . according to the commercial production manual , its catalytic activity was 10,000 plu / g ( propyl laurate units per gram ) , and it contained 1%-2% ( w / w ) moisture . soybean oil was purchased from taisun enterprise co. , ltd . ( chang - hua , taiwan ) . methanol and tert - butanol were purchased from katayama chemical co. , ltd . tributyrin was purchased from sigma chemical co. ( st . louis , mo , usa ) . molecular sieves ( 4 ) were purchased from davison chemical ( baltimore , md , usa ) , and n - hexane was obtained from merck chemical co. ( darmstadt , germany ) . a 3-level-3-factor box - behnken design with three replicates at the center was employed in this study , requiring 15 experiments [ 22 , 23 ] . the variables and their levels selected for the study of biodiesel synthesis were reaction temperature ( 40c60c ) , flow rate ( 0.10.5 ml / min ) , and substrate molar ratio ( 1 : 31 : 5 ) . all experiments in this paper were performed in a 32.5% tert - butanol system with a packed - bed reactor . table 1 presents the independent factor ( xi ) levels and the experimental design in terms of coded and uncoded values . to avoid bias , all materials were dehydrated by molecular sieves ( 4 ) for 24 hours . soybean oil ( 0.05 mole ) , tert - butanol ( 32.5% , based on the weight of soybean oil ) , and different molar ratios of methanol were well mixed in a feeding flask . the transesterification reaction was carried out in a packed - bed reactor consisting of a stainless steel tube 25 cm in length and with a 0.46 cm inner diameter . the mixture was pumped through the continuous reactor ( a packed - bed column with 1.7 g novozym 435 lipase ) at the designed conditions . the biodiesel formation was determined by injecting a 1 l aliquot in splitless mode into a gas chromatograph ( hewlett packard 7890 , avondale , pa , usa ) equipped with a flame - ionization detector ( fid ) and an mxt-65tg - fused silica capillary column ( 30 m 0.25 mm i.d . ; film thickness 1 m ; restek , bellefonte , pa , usa ) . the percentage of molar conversion was defined as ( mmol of biodiesel/3 mmol of initial soybean oil ) 100% and was estimated using peak area integrated by on - line software hewlett packard 6890 series ii chem station ( hewlett packard 6890 , avondale , pa , usa ) . the experimental data ( table 1 ) were analyzed by the response surface regression ( rsreg ) procedure of sas software to fit the following second - order polynomial equation
( 1)y=k0+i=13kixi+i=13kiixi2+i=12j = i+13kijxixj ,
where y is the response ( percent molar conversion ) , k0 , ki , kii , and kij are constant coefficients , and xi is the uncoded independent variable . the ridge max option was used to compute the estimated ridge of maximum response for increasing radii from the center of the original design . reaction temperature and molar substrates ratio are crucial parameters affecting the yield of enzymatic synthesis of biodiesel . many researches [ 10 , 24 , 25 ] showed that lipase such as novozym 435 deactivated at a methanol - to - oil ratio more than 3 . the deactivation was resulted from the contact between lipase and insoluble methanol in the reaction mixture . however , the molar conversion increased with the increase of methanol to soybean oil ratio and did not decrease even at the ratio above 4 : 1 ( data not shown ) . the addition of tert - butanol to the mixture enhanced miscibility of methanol with vegetable oils and therefore protected lipase from deactivation [ 10 , 26 ] . another important parameter affecting the conversion efficiency in a packed - bed reactor is substrate flow rate . figure 1 showed the conversion decreased with increasing flow rate . the highest conversion ( 81% ) the increase in substrate flow rate caused reduction in the residence time of substrate in the packed - bed reactor , which resulted in poor contact between lipases and substrates . the choice of temperature , flow rate , and substrate molar ratio range ( table 1 ) needs to be examined precisely in box - behnken design . the optimal conditions of synthesis can be found inside the experimental region through the analyses of statistics and contour plots . the major objective of this study is the development and evaluation of a statistical approach to better understand the affinity between the variables of a continuous lipase - catalyzed transesterification reaction in continuously packed - bed reactor . on the basis of this concept , the large - scale and continuous process can be optimized to obtain greater efficiency and to decrease human resource requirements . compared with one - factor - at - a - time design , the rsm employed in this study was more efficient in reducing the number of experimental runs and time required to determine the optimal parameters for optimal biodiesel production . the rsreg procedure was employed to fit the second - order polynomial ( 1 ) to the experimental data ( table 2 ) with a coefficient of determination , r = 0.985 . among the various treatments , the highest molar conversion ( 81.23 1.49% ) was treatment no . 2 ( 0.1 ml / min , 60c , and substrate molar ratio 1 : 4 ) , and the lowest molar conversion ( 27.53 1.76% ) was treatment no . 3 ( 0.5 ml / min , 40c , substrate molar ratio 1 : 4 ) . 12 showed that the optimal flow rate was 0.1 ml / min , resulting in approximately 80% molar conversion . from the sas output of rsreg , the second - order polynomial ( 2 ) obtained was given below :
( 2)y= 7.188 + 1.613x1 163.456x2 + 13.633x3 0.023x12 + 1.236x1x2 + 0.292x22 + 0.222x1x3 + 1.125x2x3 2.708x32 . the results indicated that the second - order polynomial model was an adequate representation of the actual relationship between the response percentage and the significant variables with very small p - value ( .0006 ) . furthermore , the overall effect of the three synthesis variables on the molar conversion of biodiesel was further analyzed by a joint test ( table 3 ) . these results revealed that the flow rate and temperature were important parameters , which have a statistically significant overall effect ( p < .01 ) on the response molar conversion of biodiesel . the relationships between reaction factors and response could be better understood by examining the planned series of contour plots generated from the predicted model . figures 2(a)2(c ) represented the same range of temperature ( 40c60c ) and substrate molar ratio ( 1 : 31 : 5 ) . overall , the three contour plots presented a similar behavior in that predicted molar conversion increased . at a flow rate of 0.1 ml / min , the maximum molar conversion obtained was up to 80% ( figure 2(a ) ) whereas the yield was significantly reduced at 0.5 ml / min ( figure 2(c ) ) . thus , the most suitable flow rate would be around 0.1 ml / min . the optimal point of synthesis was determined by ridge max analysis , which approximates the estimated ridge of maximum response for increasing radii from the center of original design . table 4 indicated that molar conversion increased with a reduced flow rate , which is in agreement with our previous study . the ridge max analysis indicates that maximum molar conversion was 83.31 2.07% at 0.1 ml / min , 52.1c , with a 1 : 4 substrate molar ratios . the biocatalysis of such esters by lipase - catalysis reactions under milder conditions has become a current industrial interest . many reactions were conducted by immobilized lipase in a continuous packed - bed bioreactor for minimizing labors and overhead costs in the industry . an optimized enzymatic catalysis of biodiesel production with higher yield at reduced cost in the optimal condition would be more appealing to the consumers and benefit to the manufacturers . the validity of the predicted model was examined by conducting experiments at the suggested optimum synthesis conditions . the value predicted by ridge max analysis was 83.31 2.07% , and the actual value was 82.81 0.98% . the operational stability of the continuous packed - bed reactor was shown in figure 3 . the ridge max analysis suggested the optimal reaction conditions were flow rate of 0.1 ml / min , temperature of 52.1c , and a methanol - to - oil ratio of 1 : 4 . a high molar conversion ( 80% ) was obtained and the immobilized lipase was operated over 30 days without losing catalytic activity . watanabe et al . achieved a high conversion ( 90% ) over 100 days in the stepwise methanolysis with three columns of continuous packed - bed reactor system ; however , they required a large amount of immobilized lipase ( 10 g ) . chen and wu studied the methanolysis reaction with a continuous stirred tank reactor and obtained a 70% conversion over 70 days . the drawback is the requirement for periodical regeneration of the lipase by tert - butanol washing . reported a conversion of 79%-80% over 5 days by methanolysis of waste palm oils in a tert - butanol mediated packed - bed system . these results , applied to large - scale biodiesel production , will increase costs associated with reactor design and poor operational stability . the packed - bed reactor proposed in this paper not only extended the usability of the lipase but also improved the conversion efficiency in the continuous one - step operation system . we developed an optimal packed - bed reactor for continuous production of biodiesel from soybean oil in a tert - butanol solvent system . rsm and 3-factor-3-level box - behnken design were employed for optimization of transesterification of soybean oil . the ridge max analysis indicates that maximum molar conversion was 83.31% at 0.1 ml / min , 52.1c , with a 1 : 4 substrate molar ratio . the continuous packed - bed reactor can operate more than 30 days without an appreciable loss in substrate conversion . this system demonstrates the potential for industrial scale production of biodiesel by using a packed - bed reactor with a tert - butanol solvent system . | an optimal continuous production of biodiesel by methanolysis of soybean oil in a packed - bed reactor was developed using immobilized lipase ( novozym 435 ) as a catalyst in a tert - butanol solvent system .
response surface methodology ( rsm ) and box - behnken design were employed to evaluate the effects of reaction temperature , flow rate , and substrate molar ratio on the molar conversion of biodiesel .
the results showed that flow rate and temperature have significant effects on the percentage of molar conversion .
on the basis of ridge max analysis , the optimum conditions were as follows : flow rate 0.1 ml / min , temperature 52.1c , and substrate molar ratio 1 : 4 . the predicted and experimental values of molar conversion were 83.31 2.07% and 82.81 .98% , respectively .
furthermore , the continuous process over 30 days showed no appreciable decrease in the molar conversion .
the paper demonstrates the applicability of using immobilized lipase and a packed - bed reactor for continuous biodiesel synthesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the vascular endothelium provides a cellular interface between the circulating blood and the vascular smooth muscle of the blood vessel walls . it also has an important role in maintaining the balance of the endovascular environment . many factors , such as peroxide , ox - low density lipoprotein ( ldl ) , angiotensin i , and tumor - necrosis - factor-(tnf- ) can induce the production of reactive oxygen species ( ros ) by nadph oxidase in endothelium and vascular smooth muscle , which results in oxidative stress to the endothelial cells ( ecs ) and , thus , the induction of cell apoptosis . ec dysfunction is a trigger factor for the development of atherosclerosis and other cardiovascular diseases . many studies have shown that ec apoptosis is one of several atherogenic factors [ 4 , 5 ] . additional studies have also shown that hemolymph from the silkworm ( bombyx mori ) can inhibit insect and mammalian cell apoptosis that is induced by viruses and several chemical inducers , such as staurosporine , camptothecin , and actinomycin d [ 68 ] . as one such antiapoptotic component in silkworm hemolymph , the 30 k protein has been studied widely [ 6 , 7 ] . a recent study showed that another protein in silkworm hemolymph , storage protein 2 ( sp2 ) , can also inhibit staurosporine - induced hela cell apoptosis and ros generation . owing to the influence of juvenile hormone and ecdysone , sp2 is synthesized by the fat body of feeding larvae and released into the hemolymph . at the end of the feeding period sp2 is presumed to be used as a store of the amino acids required for the development of adult tissues . in the current study , we cloned and expressed the gene encoding silkworm sp2 ( sp2 ) both in a prokaryotic expression system and a silkworm baculovirus system . the expressed protein in escherichia coli was used to generate polyclonal antibodies . the distribution of sp2 in different developmental stages and different tissues was detected by western blot . in addition , the expressed protein in the silkworm baculovirus system was used to study the anti - apoptotic effects of sp2 on human umbilical vein ecs ( huvecs ) induced by peroxidation . this work will lay a foundation for the development and utilization of protein drugs from economically important insects for treatment of vascular diseases . escherichia coli strains tg1 and bl21 ( de3 ) were grown at 37c in lb medium . the silkworm - derived cell line bmn was maintained at 27c in tc-100 medium ( gibco , usa ) supplemented with 10% fetal bovine serum ( fbs ) . b. mori nuclear polyhedrosis virus ( bacmid , conserved by our lab ) was propagated in bmn cells . huvecs were purchased from the american type culture collection ( manassas , va , usa ) and cultured in dulbecco 's modified eagle medium ( gibco , usa ) supplemented with 10% fbs ( gibco , usa ) in a humidified incubator at 37c in an atmosphere of 5% co2 . fifth - instar silkworm larvae ( jingsong haoyue , showa ) were reared on fresh mulberry leaves at 25c . male new zealand rabbits were purchased from the animal research center of hangzhou normal university . a dna gel purification kit and cy3-labeled goat anti - rabbit igg hrp - labeled goat anti - rabbit igg was purchased from dingguo biotechnology ( beijing , china ) . cellfectin ii reagent and a ni - nta purification system were sourced from invitrogen ( carlsbad , usa ) ; a cell death detection elisa kit was sourced from roche diagnostics ( castle hill , australia ) ; the annexin v - fitc / pi apoptosis detection kit was purchased from invitrogen ( carlsbad , usa ) ; staurosporine was sourced from the beyotime company ( shanghai , china ) . similarity analyses for the nucleotide and protein sequences were carried out using genbank blastn and blastp algorithms . the hydrophobicity analysis and the isoelectric point prediction were conducted on the expasy website ( http://www.expasy.org/ ) . simulation for the protein tertiary structure was generated by using the swiss - model program ( http://swissmodel.expasy.org/ ) . the open reading frame ( orf ) of sp2 was amplified by pcr using the cdna library of silkworm pupa constructed by our laboratory as a template . the forward and reverse primers were as follows : p1 , 5-cgcggatccatgaagtctgtcttaatt-3 ; and p2 , 5-ccgctcgagttaattttttggaacaac-3 , which contained bamhi and xhoi restriction sites , respectively . escherichia coli bl21 ( de3 ) was transformed with the recombinant plasmid and cultured in lb media , that included 50 g / ml kanamycin , at 37c until od600 reached approximately 0.5 . recombinant protein expression was induced with 1 mmol / l iptg for 4 h. the his - tagged fusion protein was extracted from the bacteria and purified by ni - affinity chromatography . the protein content was analyzed following the method of bradford and then used to immunize the male new zealand rabbits to prepare the polyclonal antibodies . an elisa was utilized to determine the polyclonal antibody titer , and the specificity of the polyclonal antibody was detected by western blot analysis . western blot analysis was used to evaluate the distribution of sp2 in different tissues of the fifth - instar larvae and other developmental stages of the silkworm . tissues from fifth - instar larvae ( head , epidermis , hemolymph , fat body , silk gland , trachea , the malpighian tubule , and midgut ) were isolated and pulverized into powder in liquid nitrogen . the powdered tissues were then resuspended in a lysis buffer ( 50 mm tris - cl , ph 8.0 ; 0.15 m nacl ; 5 mm edta ; 0.5% np-40 ; 1 mm dithiothreitol ; 5 mg / ml sodium deoxycholate ; 100 mg / l pmsf ; 5 g / ml aprotinin , sigma ) , and the mixture was incubated on ice for 30 min . the supernatants containing total proteins were equalized by assaying the protein content ( following the method of bradford ) . samples were verified by running on a 12% sds - page and electrophoretically transferred onto polyvinylidene difluoride ( pvdf ) membranes . the membranes were blocked with 3% skim milk in phosphate - buffered saline ( pbs ) at 4c overnight , and rabbit anti - sp2 antibody was added and the solution incubated at room temperature for 2 h. after washing with pbst ( pbs + 0.05% tween-20 ) , the bound antibodies were detected by anti - rabbit igg followed by a dab detection system . bmn cells were cultured overnight on a glass coverslip that could be used specifically for confocal microscopy . after removing the culture medium , the cells were washed three times for 5 min in pbs and fixed in 4% polyformaldehyde in pbs ( ph 7.4 ) at room temperature for 15 min , followed by permeabilization with 0.2% triton x-100/pbs for 10 min . the fixed cells were preblocked in 3% bsa in pbs at 4c for 4 h , followed by incubation with the anti - sp2 polyclonal antibody ( diluted 1 : 1000 in blocking buffer ) at room temperature for 2 h ; cells were incubated simultaneously with control serum , which was obtained from the rabbits before immunization with the antigen . after three 10 min pbst washes , cells were incubated with cy3-labeled goat anti - rabbit igg ( diluted 1 : 1000 , promega ) at 37c for 2 h and washed twice in pbst . the cells were then incubated with 46-diamidino-2-phenylindole ( 1 g / ml in pbs ) at 37c for 30 min . after the cells were washed once with pbst , they were photographed on a nikon eclipse te 2000-e confocal microscope ( nikon , japan ) . the sp2 gene was inserted into the mcs of the transfer plasmid pfastbac - htb between bamh i and xho i sites and transformed into dh10bac cells . the sp2 gene was then transferred into a wild type bacmid ( wtbacmid ) dna by homologous recombination to construct the recombinant baculovirus bacmid - sp2 . after white - blue plaque selection , the positive colonies were selected and analyzed by pcr with m13 universal primers , sp2 forward and reverse primers . the recombinant bacmid was transfected into bmn cells for amplification . the third - generation virus ( moi = 10 pfu / cell ) was further used to infect bmn cells ( 1 10 cells / flask ) for subsequent protein expression . after cultivation for 48 h , the cells were harvested by phosphate buffer solution ( pbs , ph 7.4 ) washes , pulsed sonication and centrifugation at 12,000 rpm for 10 min . the supernatant was subjected to ni - affinity chromatography according to the manufacturer 's instructions ( invitrogen ) . after purification by affinity chromatography , the sp2 protein was concentrated , and imidazole was removed by dialysis against 25 mm hepes [ 4-(2-hydroxyethyl ) piperazine-1-ethanesulfonic acid ) , sigma ] ; ph 7.5 , 100 mm nacl . huvecs were isolated by 0.25% trypsinization and cultured in dulbecco 's modified eagle medium ( gibco ) supplemented with 10% fbs and maintained in a humidified atmosphere with 5% co2 at 37c air until 7080% confluence was reached . cells ( from the experimental group ) were pretreated for 24 h with culture medium containing purified sp2 protein ( at a final concentration of 0.5 , 1 , and 2 g / ml ) . after washing twice with hank 's balanced salt solution ( gibco ) , the experimental and negative groups were both exposed to 2 ml sts ( 1 m ) for 2 h to induce apoptosis , whereas the normal group was treated with 2 ml hank 's balanced salt solution . the experimental group was then washed twice with hank 's balanced salt solution and cultured in culture medium in the presence of purified sp2 protein ( at a final concentration of 0.5 , 1 , and 2 g / ml ) . huvec viability and apoptosis were evaluated after 12 h. cell viability was estimated using mtt ( 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide ; sigma ) assay . cells were seeded into 96-well plates at densities of 1 10cells / well and incubated overnight . following the treatments as indicated above , 10 l mtt ( 5 mg / ml ) was added to each well and incubated for 4 h. the insoluble formazan crystals were dissolved in 200 l / well dimethylsulfoxide , and absorbance was measured at 490 nm to calculate the relative cell viability ratio dna fragmentation was evaluated by histone - associated dna fragments using a photometric enzyme immunoassay ( cell death detection elisa , roche ) , according to the manufacturer 's instructions . cells at a density of 1 10 cells / ml were harvested and washed twice with ice - cold pbs . for the quantitative assessment of apoptosis , staining with annexin v - fitc and pi labeling was undertaken before flow cytometric analysis , according to the manufacturer 's recommendations ( annexin v - fitc / pi apoptosis detection kit , invitrogen ) . facs analysis was accomplished using a facscalibur ( becton dickinson , san jose , ca , usa ) . the data were expressed as mean sem and analyzed by the student 's t - test and the newman - keuls test . differences with a value of p < 0.05 were considered statistically significant . sequence analysis revealed that the orf of sp2 ( accession number dq443358 ) was 2112 bp in length and encoded a protein of 703 amino acids , with a predicted molecular mass of 83.45 kd and a theoretical isoelectric point of 5.7 . through blastp comparison , three conservative structural domains of the hemocyanin superfamily were discovered : hemocyanin_n domain , hemocyanin_m domain , and hemocyanin_c domain . hemocyanin can be any of a group of copper - containing respiratory proteins that serve an oxygen - carrying function in the blood of some arthropods and most mollusks . the tertiary structure of silkworm sp2 was predicted using swiss - model ( figure 1 ) . the orf for sp2 was subcloned into the prokaryotic expression vector pet-28a ( + ) . the his - tagged fusion protein was expressed in e. coli bl21 ( de3 ) ( figure 2(a ) ) and purified by ni - affinity chromatography . the purified his - sp2 fusion protein was successfully detected by sds - page ( figure 2(b ) ) . the predicted molecular weight of the fusion protein , including a 3.56-kd his - tag , was 87 kd , which is concordant with the calculated value . the concentration of purified sp2 protein was determined by use of the bradford assay to be 1.5 mg / ml . with the affinity - purified proteins , the titer of the polyclonal antibody , as determined by elisa , was 1 : 6400 . western blot analysis indicated that the antibody reacted specifically with purified his - sp2 fusion protein ( figure 2(c ) ) . to determine the distribution of sp2 in different tissues of the fifth - instar larva and other development stages of the silkworm the results showed that the level of sp2 was very high in the pupal and larval stages but extremely low in the egg and adult stages ( figure 3(a ) ) . in the fifth instar larvae , the sp2 level was highest in the hemolymph and fat body and lowest in the trachea and midgut ( figure 3(b ) ) . the treated cells were examined under a nikon eclipse te2000-e confocal microscope , and images were analyzed using ez - c1 software . dapi - stained nuclei fluoresce red when stimulated with 353 nm light , and cy3-labeled goat anti - rabbit igg fluoresces red when stimulated with 550 nm light . our results indicated that sp2 is mainly located in the cell membrane and only partly in the cytoplasm ( figure 4 ) . to study the function of sp2 protein , recombinant bacmid - sp2 was used to infect bmn cells for expression of the his - tagged protein , and wtbacmid was used as a control ( figure 5(a ) ) . owing to the low expression level of natural sp2 protein in bmn cells , the results of western blot did not show the specific band in the bmn cells lysates infected by wtbacmid ( figure 5(b ) ) . the concentration of purified sp2 protein was determined by use of the bradford assay to be 0.108 mg / ml . the results of sds - page and western blot analysis indicated that the purified fusion protein sp2 had a molecular mass of approximately 87 kd ( figures 5(c ) and 5(d ) ) . sts triggers within the cell both morphological changes and internucleosomal dna fragmentation , which represents apoptosis . apoptotic cells accompanying dna fragmentation were analyzed at 24 h after sts treatment using elisa . a low concentration ( 0.1 m ) of sts did not affect apoptosis , whereas a high concentration ( 2 m ) induced necrosis , and 1 m triggered dna fragmentation efficiently compared with the positive control ( camptothecin ) provided by the kit . based on these data , the following experiments were examined using 1 m sts . cell viability was ameliorated by addition of the purified recombinant sp2 protein in a dose - dependent manner ( figure 6 ) , indicating that sp2 can enhance apoptotic huvec viability . to investigate the inhibitory effect of sp2 protein on sts - induced huvec apoptosis , an elisa was used to detect the dna fragmentation . as shown in figure 7 , huvec apoptosis as measured by dna fragmentation was significantly attenuated by recombinant sp2 protein in a dose - related manner . to quantify the apoptotic huvecs , an annexin v - fitc apoptotic cells were identified by fluorescein ( fitc ) conjugated to the human anticoagulant - annexin v , which was able to bind to phosphatidyl serine ( ps ) in the outer leaflet of the membrane of apoptotic cells . to distinguish cells that had lost membrane integrity , propidium iodide ( pi ) as shown in figure 8 , the apoptosis rate of untreated huvecs ( normal control ) was 1.9% , whereas the percentage of apoptotic huvecs ( negative control ) that had been treated with 1m sts was 52.9% . compared with the negative control , the apoptosis rate of sts + sp2 ( 1 g / ml)-treated huvecs decreased to 42.1% . these results indicate that sp2 has anti - apoptotic effects on huvec apoptosis induced by sts . as the major regulator of vascular homeostasis , the endothelium exerts several vasoprotective effects , such as vasodilation , suppression of smooth muscle cell growth , and inhibition of inflammatory responses . a large body of evidence has suggested that endothelial dysfunction is caused by superoxide and other ros [ 16 , 17 ] . supplementation with antioxidant vitamins c and e can restore endothelial function and , therefore , retard the progression of atherosclerosis . other factors , such as vascular endothelial growth factor ( vegf ) , low concentration of nitric oxide ( no ) in serum , calcium antagonists , prostacyclin , and estrogen , can also inhibit ec apoptosis . many clinical trials have been done to investigate ways of treating diseases associated with apoptosis with anti - apoptotic genes and proteins [ 20 , 21 ] . silkworm hemolymph and its 30 k protein have been reported to exhibit anti - apoptotic activity in various mammalian and insect cell systems and could have therapeutic potential in diseases related to apoptosis . in the current study , another potential anti - apoptotic protein in silkworm hemolymph ( sp2 ) was studied . as a member of the hemocyanin superfamily hemocyanins are large copper - containing proteins that transport oxygen in the hemolymph of many arthropod and mollusk species . most hexamerins are considered to be storage proteins , providing energy , serving as carrier protein or possibly involved in the humoral immune response . owing to the important role of hexamerins during arthropod development , we speculated that silkworm sp2 protein might also have an important role during cell apoptosis . to explore its functions , the sp2 protein was expressed and purified both in a prokaryotic expression system and silkworm baculovirus system . the purified sp2 prokaryotic expression product was used to generate monoclonal antibodies to study the distribution and location of sp2 in silkworm , whereas the purified expression product was used to study its antiapoptotic function . our analysis of the level of sp2 in different tissues of the fifth - instar larva and other developmental stages of the silkworm showed that sp2 levels were highest in the hemolymph and fat body and lowest in the egg and adult stages . these results suggest that sp2 gene activity is affected by juvenile and molting hormones . from the analysis of the subcellular localization of sp2 , we found that , in the bmn cell line , sp2 was localized to both the cell membrane and cytoplasm but was found primarily in the cell membrane . because sp2 is a secreted protein and has a signal peptide predicted by bioinformation ( data not shown ) , our results suggest that it is translocated across the cell membrane guided by the signal peptide . to study the anti - apoptotic activity of sp2 on vascular ec apoptosis , we constructed an sts - induced huvec apoptosis model . the sts treatment was able to induce generation of ros , which results in oxidative stress to the cells . sts at a concentration of 1 m exerted prominent apoptotic effects in cultured huvec . an mtt assay , dna fragmentation detection , and flow cytometric analysis showed that the purified recombinant sp2 protein could significantly enhance the viability of huvec and inhibit huvec apoptosis induced by sts . these findings provide new insights into the prevention of endothelial dysfunction and could ultimately provide therapies for atherosclerosis . | storage protein 2 ( sp2 ) not only is an important source of energy for the growth and development of silkworm but also has inhibitory effects on cell apoptosis .
endothelial cell ( ec ) apoptosis is an important contributing factor in the development of atherosclerosis ; therefore , study of the antiapoptotic activity of sp2 on ecs provides information related to the treatment of atherosclerosis and other cardiovascular diseases . in this study ,
the sp2 gene was cloned and expressed in escherichia coli to produce a 6xhis - tagged fusion protein , which was then used to generate a polyclonal antibody .
western blot results revealed that sp2 levels were higher in the pupal stage and hemolymph of fifth - instar larvae but low in the egg and adult stages .
subcellular localization results showed that sp2 is located mainly on the cell membrane .
in addition , a bac - to - bac system was used to construct a recombinant baculovirus for sp2 expression .
the purified sp2 was then added to a culture medium for human umbilical vein ecs ( huvecs ) , which were exposed to staurosporine .
a cell viability assay demonstrated that sp2 could significantly enhance the viability of huvec .
furthermore , both elisa and flow cytometry results indicated that sp2 has anti - apoptotic effects on staurosporine - induced huvec apoptosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the commonest neoplasms of the heart are metastatic ( autopsy frequency 1.5 - 21% ) . three - quarters of these are benign and three - quarters of these are myxomas.(1 ) myxomas most commonly occur in the left atrium ( 90% ) and are generally attached to the atrial septum in or adjacent to the fossa ovalis . they can also be found in the right atrium , or right or left ventricles . they tend to present in the age group 30 - 60 years , and more commonly in females . syndrome myxoma , a genetic disorder should be suspected in individuals who are under 40 years of age with multiple myxomas.(1 ) carney s complex , a neuroendocrine - cardiac syndrome is a common cause of familial recurrent cardiac myxomas . other characteristics include pigmented skin lesions , schwannomas and multiple recurrent mucocutaneous myxomas , and endocrinal neoplasms / overactivity.(2 ) myxomas may be asymptomatic ( these being picked up incidentally on routine echocardiography or other imaging ) . obstruction of a heart chamber by a large myxoma may lead to transient loss of cardiac output with syncope and pulmonary hypertension , resulting in pulmonary oedema and breathlessness . fragments of the tumour may also embolise causing systemic constitutional symptoms such as fever and arthralgia.(1,3 ) structurally most myxomas have a stalk , and are gelatinous with a broad base . the surface may be either friable or villous.(4 ) histologically , they are made up of polygonal multipotential mesenchymal cells which are found in the subendocardium . these cells are thought to be neuroendocrine in origin , and have the ability to differentiate into fibroblasts , smooth muscle cells , endothelial cells and neuroendocrine cells.(2 ) diagnosis of cardiac myxomas is usually made using transthoracic echocardiography ( tte ) , which has a 95.2% detection rate . we present a 42 year old female who was referred to the cardiology service by her gp . she reported a 5 week history of new york heart association ( nyha ) functional classification class ii iii dyspnoea , a generalised lack of energy and a flu - like illness , with cough , for which her gp prescribed antibiotics . 3 weeks prior to presentation , she experienced a tia - like episode , with right - sided facial and upper limb weakness , and dysarthria . this episode lasted about 30 minutes . on examination , a soft ( 2/6 ) systolic murmur was heard over the right sternal edge . a further mass or extension of this was also seen in the right ventricular outflow tract . mri and ct thorax ( figures 1 & 2 ) demonstrated a 4.1 cm x 9 cm x 4.1 cm lobulated mass within the right ventricle , obstructing the right ventricular outflow tract . ct thorax demonstrating a mass within the right ventricle mri thorax demonstrating the same mass as in figure 1 patient was referred for urgent surgery . at surgery under cardiopulmonary bypass , the right ventricle was explored through incisions in the right atrium , and in the infundibulum . an 8 cm x 7 cm mass was found to be attached to the inflow of the right ventricle ( the anterior tricuspid leaflet ) and the apex . a further incision in the apex of the right ventricle was required to resect the tumour with all its attachments . the anterior leaflet of the tricuspid valve was excised and the valve reconstituted as a bicuspid valve . cardiac myxomas are a rare cause of various signs and symptoms and should be considered in the differential diagnosis . some are picked up incidentally . whatever the presentation , the management of a myxoma remains prompt surgical resection to prevent embolisation or occlusion of an intracardiac valve . | myxomas are the commonest primary cardiac tumours
. they may be asymptomatic , and picked up incidentally , or be the cause of congestive heart failure , arrhythmias and/or murmurs .
echocardiography is necessary for diagnosis .
surgical resection is recommended to prevent further complications .
a rare symptomatic ventricular myxoma is presented in this case report . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
telemedicine can be defined as the use of telecommunication technologies to provide medical information and service . historically , it started more than 4 decades ago to allow communication and discussion between physicians of small hospitals and those of large tertiary care hospitals for non - acute cases where advanced treatment must be planned and agreed on . therefore , telemedicine started in an asynchronous module where data can be stored and forwarded and then reviewed offline . however , acute care has developed significantly in the last few decades as well as telecommunication technologies , which made synchronous telemedicine possible and in a different format from telephone - based to audio - video teleconference , and this may go further with the attachment of peripheral devices for robotic surgery or procedures under tele - guidance . we can define telestroke as the emergency use of telecommunication technologies to provide appropriate acute stroke therapy at a distance . a telestroke program using telephone consultation is cheap and takes less time to initiate and to complete , however , it is associated with significant limitations and the risk of making a wrong diagnosis or at least inaccurate acute stroke related deficit evaluation , and then the wrong thrombolysis decision . most of the current telestroke programs use synchronous two - way audio - video teleconferences , and this is our area of interest in this article . the patient is clinically evaluated using the national institute of health stroke scale ( nihss ) and the brain image is reviewed by a stroke neurologist from a distance , and then a thrombolysis decision is taken . in one randomized controlled study , the audio - video teleconference was compared to the telephone - based telestroke and was found to be more sensitive , more specific , and more likely to lead to the right thrombolysis decision.3,4 after confirming the diagnosis of acute stroke , there are 2 important measures to increase the recanalization rate with significant clinical benefit : thrombolysis rate ( percentage of acute stroke patients who received iv t - pa within the therapeutic window ) and iv t - pa needle time ( time from stroke onset to iv t - pa bolus ) . currently , 2 options exist for acute stroke patients care in medically under served areas : either urgent patient transfer to a tertiary care hospital where acute stroke treatment can be administered , or managing the patient at the local hospital . patient transfer can be via ambulance or air evacuation , which is associated with high transportation costs , smaller increase in thrombolysis rate , and smaller chance for significant recovery if they were treated , because most likely the iv t - pa needle time will be within the last third of the therapeutic time - window , which is associated with higher number needed to treat.5 the second option necessitates telestroke technology so stroke experts share with local physicians the duty of applying evidence - based acute stroke therapy . we need to look here for 2 measures , the validity of patient assessment using the nihss through teleconference , and the effectiveness , including success , and complication rate , of telestroke based intravenous thrombolysis . few studies have looked into the accuracy of patient assessment using the nihss . in one study,6 the nihss scores of 20 patients were compared to their nihss scores carried out remotely through a broadband - connected workstation . both assessments were carried out by qualified neurologists . paired t tests and pearson correlation coefficients were very strong ( r=0.9552 , p=0.0001 ) indicating that high scores in bedside correlate with high scores remotely . for the second measure , we will review published data from major telestroke programs in europe and north america . the reach telestroke network started in 2003 in georgia , usa.7 by 2005 , the network had 7 hospitals in rural areas connected to the medical college of georgia via one - way video and two - way audio teleconference system . between march 2003 and may 2005 , 194 acute stroke consultations were made within the 3-hour therapeutic window and 30 patients with a median nihss of 12.5 were treated with iv t - pa . rapid improvement defined as a drop of 4 or more nihss points within 24 hours occurred in 18 out of 30 treated patients , and no symptomatic intracerebral hemorrhage occurred . the study interestingly showed a significant reduction in onset to treatment after one year of operation from 143 to 111 minutes . the most common reasons for not treating were rapid improvement , nihss was below 4 , beyond therapeutic window , or presence of seizure or hemorrhage prior to treatment . some other data recently published represents the experience of the university of pittsburg medical center telestroke network with its 12 spoke facilities through audio - video conferencing equipment.8 between july 2008 and december 2009 , 351 telestroke consultations were performed . eighty - three stroke patients received iv t - pa at the spoke hospitals , and 59 patients at the hub center . the 2 groups were similar in their baseline characteristics including median nihss scores and mean onset to treatment time . the mean arrival to treatment time was longer in the telestroke patients ( 67.8 versus 98.9 minutes ) . the study showed no statistical significant difference between the 2 groups in favorable outcomes , symptomatic intracerebral hemorrhage , and mortality rates . the northern alberta telestroke service started in 2003.9 by 2007 , 7 spoke centers were connected to the university of alberta hospital ( 4 via audio - video teleconference , and 3 via telephone only ) . in their first 2 years of experience , the telestroke was activated 210 times and only 44 patients were candidates for thrombolysis using iv ten ( 23% ) of them were assessed by the er physician at the spoke centers without video assessment by a stroke neurologist . sixteen ( 40% ) patients had a modified rankin scale less than 2 by 90 days from iv t - pa , and 9 deaths occurred within 90 days from iv thrombolysis . only 2 ( 4.5% ) of the treated patients had t - pa complications with intracerebral hemorrhage , and the rest died due to other mechanisms . the telemedical project for integrative stroke care ( tempis ) was established in 2003 serving a large area in south east bavaria , germany.10 it comprised 12 spoke hospitals connected to 2 academic centers in munich via video teleconference and ct / mri image transfer . currently , tempis is considered to be the largest telemedical stroke service in the world . tempis was associated with significant improvement of acute in - hospital stroke treatment in terms of quality indicators such as rapid brain imaging , thrombolysis rate , assessment of swallowing disorders , and early rehabilitation therapy.11 when patients served with tempis were compared to similar acute stroke patients within the same region , but not served with telemedicine , tempis showed significant reduction in death and dependency outcome at 3 , 12 , and 30 months,10,12 without a significant difference in mortality rate alone . the thrombolysis rate in most of the published data of different telestroke networks ranges from 18 - 51%.7 - 10 reasons for no iv t - pa include stroke onset beyond 270 minutes , presence of contraindication that was not recognized by the er physician at the spoke hospital , or patient having a stroke mimic like seizure with todd s paralysis , cns neoplasm with sudden deterioration , cns infection , and others . considering the threat of these acute stroke mimics , on - call stroke neurologists are still of great benefit to the patients and the spoke hospitals . the small waste of telestroke resources on acute stroke mimics is well compensated by the gain of managing these urgent neurological conditions despite the fact that some patients were required to be transferred to the university hospital anyway . with time and experience there are 3 nonexclusive methods of clinical operation of telestroke : drip and keep , which means after telestroke consultation and approval for iv t - pa , the iv t - pa is infused at the spoke center followed by admission there for observation and stroke work up . this requires a local stroke unit with at least minimal acceptable quality of care with multidisciplinary teams to have an integrative telestroke network . a follow up assessment by a stroke neurologist can also be carried out by telestroke , or through outpatient visit to the hub center a few weeks later . for further complications during the acute phase of treatment , urgent telestroke consultation can be initiated again by the treating physician at the hub hospital . the second method is the ship method , which is recommended for patients with an acute stroke with contraindication for iv t - pa , but that can still have intraarterial t - pa , or an endovascular procedure , and mechanical removal / disruption of the clot ( for example : patients on anti - coagulation with inr > 1.6 ) . here , the patient gets transferred directly to the hub center for urgent treatment and intervention . the third way is drip and ship and indicated for those acute stroke patients who are candidates for iv t - pa . however , the consulting spoke hospital can not provide appropriate post - tpa care or stroke workup . the patient can have the iv t - pa infused locally , and then shipped to the hub center . developing telestroke networks may better encourage more spoke centers to participate if they choose drip and ship since it put less load on the spoke centers , and with time and experience , spoke centers can start admitting patients after thrombolysis . it is also important to mention that the type of clinical practice can be influenced by financial incentives and reimbursements for physicians and hospitals , and by clear job descriptions and duties at each end of the telestroke network , in case of complications or medico - legal claims . the quantity and type of manpower required for a telestroke network varies , and depends on the proposed size of the network , type of clinical operation , and complexity of care . based on experience , each hub center needs 4 or more stroke neurologists , one of them assigned as the medical director of the network , one telestroke manager , one data manager , 2 telestroke nurses , and 2 information technologists , plus the clinical and administrative back up support from the tertiary hospital . for each spoke center , you need to involve at least the emergency physicians , emergency nurses directed by the head of er there , plus a program manager . for drip and keep practice , the multidisciplinary teams including the internists should be added . effective and interactive relationships between different network sites , frequent sites visits between hub and spoke personnel , continuing medical educational activities , and sharing data , and successful stories are mandatory for sustainability and further development . the recommended quality and performance measures for acute stroke units should be used to assess quality and performance of the telestroke networks plus other measures that are specific to telestroke , such as those concerned with communication ( table 1 ) . the director of the telestroke network must obtain the data regularly from each spoke , and hub center , and discuss them at least once annually with all network staff in a transparent fashion with the intention to improve quality and reduce failures . professionals of each telestroke network should also compare their network performance with other networks nationally and internationally . today , most tertiary care hospitals are either practicing some form of telemedicine or considering it soon . the practice can be limited to certain health care networks of similar financial and legal jurisdiction , or may go beyond different states borders . therefore , the first legal issue is getting the license from an appropriate body based on the defined map of telemedicine practice , and making sure the practice does not exceed that map . the second challenge is staff accreditation as different hospitals may have different regulations and requirements . for example in saudi arabia , although the saudi commission for health specialties has a set of regulations concerning staff accreditation to designated positions , tertiary care hospitals like king khalid university hospital have added further requirements . therefore , mutual agreement on staff accreditation between the spoke and hub centers is needed with defined rules and areas of practice , and then hospitals do not need to change their accreditation requirements in order to practice telemedicine . the third challenge is agreement on sharing electronic medical records and patient s data without breaking rules of confidentiality and privacy . this agreement can be initiated by the hospitals boards , but needs to be approved by the appropriate licensing / legal body . as the telestroke network expands and more cases are treated , the hub stroke neurologists may become overwhelmed between their regular hospital duties and telestroke cases , but they will still be legally responsible for delivering the telestroke service on time ; otherwise , they may be blamed for negligence . the director of the telestroke network needs to adequately estimate the required number of stroke neurologists based on the size of the population served , and ensure a fair and stable reimbursement system ; otherwise , staff - recruitment failure may occur . a medical error or failure to serve the acute stroke patient on time can be related to the staff at the spoke center , staff at the hub center , technology related , patient related , or mixed . therefore , a 24/7 documentation and auditing system is needed . the job description of every staff member within the network must be clearly written and defined . regular telestroke morbidity and mortality educational activities must run and be shared between all network sites to enhance the learning curve at different levels as well as discussing successful stories . for example in the usa alone , the direct and indirect costs associated with stroke for 2008 are approximately us$65.5 billion.13 fagan and colleagues14 showed that acute stroke treatment with iv t - pa is associated with an incremental cost savings of us$8,000 per qaly gained , and telestroke was proved to increase thrombolysis rates mainly in patients living in suburban and rural areas.15 there are 2 cost categories associated with telestroke : equipment costs and telestroke running costs , including physician s compensations and salaries for network employees . the annual telestroke hub equipment cost is approximately us$16,204/site , and the annual telestroke spoke equipment costs are approximately us$5,309/site,16 which are cheap when we consider today s medical costs . when looking into the cost - effectiveness of telestroke , we consider the telestroke running costs from one side , which are more or less predictable per network s size , versus the thrombolysis - related savings , such as less or no disability , shorter length of stay at hospital , and savings from less patients transportation . the cost - effectiveness ratio can be non - constant and affected by the network s performance and number of cases treated . too reduce its costs further , it can be part of a synchronous telemedicine network so some resources are shared with other acute medical consultation services . in conclusion , telestroke is the only solution in many countries to serve suburban areas and to increase the thrombolysis rate . new regulations are needed to ensure its legality and stability , and initiatives should come from stroke neurologists , er physicians , and medical directors of small hospitals . | despite developments in acute stroke therapies , stroke continues to be a leading cause of death and disability worldwide .
one major limitation from intravenous thrombolysis with tissue plasminogen activator ( t - pa ) is patient s arrival to the emergency room at a tertiary care hospital after the therapeutic time - window , which is generally 270 minutes .
the problem is worse for people living in suburban areas where stroke expertise can be missing .
therefore , telestroke networks were developed at several sites where a stroke neurologist at a tertiary hospital participates through synchronous audio - video teleconference in confirming diagnosis of stroke , assessing risks and benefits of giving iv t - pa , and making the decision with the patient and emergency physician at the local hospital . in this article , we will review the experience of major telestroke networks in north america and europe , and the evidence of its safety and cost - effectiveness .
telestroke complexity , with regard to practice , manpower , quality assurance , and legal issues will be discussed briefly . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the data used in the present study is from ct scans obtained from subjects in an on - going severe asthma research program ( sarp ) . the subjects included in our study with severe persistent asthma were required to have a history of physician - diagnosed asthma , and to have received asthma therapy for at least 12 months . the diagnosis of asthma was based on demonstration of reversible airway obstruction ( i.e. , 12% increase in fev1 ) , and was confirmed by airway hyperreactivity to methacholine ( i.e. , methacholine pc20 8 mg / ml ) ( 12 ) . subjects were classified as having severe persistent asthma using the criteria of the national asthma education and prevention program ( naepp ) and the ats ( american thoracic society ) workshop on refractory asthma ( 13 ) . the diagnosis of chronic bronchitis was based on the ats definition ( 12 ) and included having a cough and sputum on most days of the month for at least three months of the year during the previous two years , as well as a current or previous smoking history with a minimum of 20 pack years . patients were excluded from analysis if their ct scans did not meet protocol specifications . institutional review board approval and patient informed consent were obtained for the sarp study . at the time of this study , ct scans from 23 subjects enrolled for the sarp were available . one experienced chest radiologist ( j.m.g . , 13 years of experience with chest ct ) reviewed ct scans and identified the presence of lung nodules with the assistance of lungcare ( siemens , forchheim , germany ) . of the 23 subjects , 10 ( 4 men and 6 women ; age range , 26 - 55 years ; mean age , 42 years ) who had nodules on both inspiratory and expiratory ct scans were included in this study . this group included seven subjects with severe persistent asthma and three subjects with chronic bronchitis . all patients underwent full inspiratory and expiratory ct of the thorax in the supine position . images were obtained during suspended full inspiration , and suspended relaxed ( not forced ) expiration . the scans were performed using a 16-detector - row ct scanner ( somatom sensation 16 ; siemens , germany ) , with 160.75-mm collimation , 120 kvp , 50 effective mas , 500-msec gantry rotation time , 18 mm table feed per rotation , 1-mm slice thickness , and 0.7 mm reconstruction increment . ct images were reconstructed with a field of view large enough to cover the complete lung cross - section ( 262 - 424 mm ) . this corresponds to an in - plane pixel size of approximately 0.51 - 0.83 mm . all ct studies were transferred from the ct scanner to a siemens workstation , and were analyzed using lungcare including " nodule enhanced viewing " and volume software . the volume of the nodule was computed by clicking on the nodule within the voi . the apparent diameter of each nodule was calculated from the computed nodule volume on the basis of the volume - diameter relationship of spheres . nodules were categorized as isolated , juxtavascular , or juxtapleural nodules . for the computation of the lung volume and whole lung attenuation the volume program uses a threshold - based 3d region growing technique to separate the lung regions from other tissues and structures , and selects all voxels between -500 and -980 hu ( 14 ) . the threshold range was chosen to exclude nonaerated lung tissue such as vessels , major airway or hyperinflated lung tissue . thus , the segmented lung region corresponds to the sum of the voxels whose attenuation values fall within these threshold values . the volume and mean attenuation of the lung were calculated from the total count and the mean attenuation of the voxel sums . these values were defined as lung volume and whole lung attenuation . to compute the nodule attenuation and regional attenuation of the lung for each nodule , a region of interest ( roi ) that covered about one - half of the diameter of the nodule was placed over the nodule . a larger roi of 2.0 - 2.5 cm was then placed adjacent to the nodule to measure the regional lung attenuation of the lung . these measurements were performed by one radiologist ( j.m.g . ) . the volume and mean attenuation of the nodule , and regional lung attenuation were measured twice after an interval of several days . differences between nodule volume on inspiration and expiration were compared with a paired t - test . the percent difference was defined as a percentage of the absolute difference between inspiration and expiration measurements divided by the mean of the two values . the percent difference in nodule volume , nodule attenuation , lung volume , whole lung attenuation , and regional lung attenuation were computed . the association between lung nodule volume and nodule attenuation , lung volume , whole lung attenuation , or regional lung attenuation was calculated using the pearson correlation coefficient . the data used in the present study is from ct scans obtained from subjects in an on - going severe asthma research program ( sarp ) . the subjects included in our study with severe persistent asthma were required to have a history of physician - diagnosed asthma , and to have received asthma therapy for at least 12 months . the diagnosis of asthma was based on demonstration of reversible airway obstruction ( i.e. , 12% increase in fev1 ) , and was confirmed by airway hyperreactivity to methacholine ( i.e. , methacholine pc20 8 mg / ml ) ( 12 ) . subjects were classified as having severe persistent asthma using the criteria of the national asthma education and prevention program ( naepp ) and the ats ( american thoracic society ) workshop on refractory asthma ( 13 ) . the diagnosis of chronic bronchitis was based on the ats definition ( 12 ) and included having a cough and sputum on most days of the month for at least three months of the year during the previous two years , as well as a current or previous smoking history with a minimum of 20 pack years . patients were excluded from analysis if their ct scans did not meet protocol specifications . institutional review board approval and patient informed consent were obtained for the sarp study . at the time of this study , ct scans from 23 subjects enrolled for the sarp were available . one experienced chest radiologist ( j.m.g . , 13 years of experience with chest ct ) reviewed ct scans and identified the presence of lung nodules with the assistance of lungcare ( siemens , forchheim , germany ) . of the 23 subjects , 10 ( 4 men and 6 women ; age range , 26 - 55 years ; mean age , 42 years ) who had nodules on both inspiratory and expiratory ct scans were included in this study . this group included seven subjects with severe persistent asthma and three subjects with chronic bronchitis . all patients underwent full inspiratory and expiratory ct of the thorax in the supine position . images were obtained during suspended full inspiration , and suspended relaxed ( not forced ) expiration . the scans were performed using a 16-detector - row ct scanner ( somatom sensation 16 ; siemens , germany ) , with 160.75-mm collimation , 120 kvp , 50 effective mas , 500-msec gantry rotation time , 18 mm table feed per rotation , 1-mm slice thickness , and 0.7 mm reconstruction increment . ct images were reconstructed with a field of view large enough to cover the complete lung cross - section ( 262 - 424 mm ) . this corresponds to an in - plane pixel size of approximately 0.51 - 0.83 mm . all ct studies were transferred from the ct scanner to a siemens workstation , and were analyzed using lungcare including " nodule enhanced viewing " and volume software . the volume of the nodule was computed by clicking on the nodule within the voi . the apparent diameter of each nodule was calculated from the computed nodule volume on the basis of the volume - diameter relationship of spheres . nodules were categorized as isolated , juxtavascular , or juxtapleural nodules . for the computation of the lung volume and whole lung attenuation the volume program uses a threshold - based 3d region growing technique to separate the lung regions from other tissues and structures , and selects all voxels between -500 and -980 hu ( 14 ) . the threshold range was chosen to exclude nonaerated lung tissue such as vessels , major airway or hyperinflated lung tissue . thus , the segmented lung region corresponds to the sum of the voxels whose attenuation values fall within these threshold values . the volume and mean attenuation of the lung were calculated from the total count and the mean attenuation of the voxel sums . these values were defined as lung volume and whole lung attenuation . to compute the nodule attenuation and regional attenuation of the lung , we selected a transverse section with the largest nodule cross section area . for each nodule , a region of interest ( roi ) that covered about one - half of the diameter of the nodule was placed over the nodule . a larger roi of 2.0 - 2.5 cm was then placed adjacent to the nodule to measure the regional lung attenuation of the lung . the volume and mean attenuation of the nodule , and regional lung attenuation were measured twice after an interval of several days . differences between nodule volume on inspiration and expiration were compared with a paired t - test . the percent difference was defined as a percentage of the absolute difference between inspiration and expiration measurements divided by the mean of the two values . the percent difference in nodule volume , nodule attenuation , lung volume , whole lung attenuation , and regional lung attenuation were computed . the association between lung nodule volume and nodule attenuation , lung volume , whole lung attenuation , or regional lung attenuation was calculated using the pearson correlation coefficient . nodule volumes ranged from 4.0 to 297.5 mm ( mean , 28.2 mm ) on inspiration ct and from 4.8 to 307.4 mm ( mean , 31.5 mm ) on expiration ct . these measures correspond to nodule diameters ranging from 2.0 mm to 8.3 mm ( mean , 3.8 mm ) on inspiration ct , and from 2.1 to 8.4 mm ( mean , 3.9 mm ) on expiration ct . there were 10 nodules 3 mm , 21 nodules 3 - 5 mm , and two nodules > 5 mm . the mean values for lung nodule volume , nodule attenuation , lung volume , whole lung attenuation , and regional lung attenuation are summarized in table 1 . the difference between inspiration and expiration nodule volume was significant ( p = 0.001 for all nodules ; p = 0.005 for nodules the mean percent difference in lung nodule volume was 23.1% ( range , 0.5 - 76.9% ) for all nodules and for nodules 3 mm ( table 2 , fig . 1 ) . the volume of the nodules studied was found to measure larger on the expiration ct than on the inspiration ct ( 28 out of 33 nodules ; 19 out of 23 nodules 3 mm ) . a statistically significant correlation between the percent difference of lung nodule volume and lung volume ( r = 0.45 , p = 0.03 ) or regional lung attenuation ( r = 0.51 , p = 0.01 ) was found for nodules 3 mm . a correlation between the percent difference of lung nodule volume and nodule attenuation or whole lung attenuation for nodules 3 mm was not statistically significant ( p > 0.05 ) . a correlation between lung nodule volume and nodule attenuation , lung volume , whole lung attenuation , or regional lung attenuation for all nodules was not statistically significant ( p > 0.05 ) . there were statistically significant correlations between : lung volume and whole lung attenuation ( r = 0.99 , p < 0.0001 ) , between lung volume and regional lung attenuation ( r = 0.85 , p < 0.0001 ) , and between whole lung attenuation and regional lung attenuation ( r = 0.86 , p < 0.0001 ) . radiologists have the common challenge of accurate characterization of lung nodules as malignant or benign ; this differentiation of nodules is critical for appropriate medical management . recently , computer - aided diagnosis ( cad ) programs have assisted in nodule detection ( 15 - 19 ) , and have been used to assess change in size of nodules on serial ct scans ( 6 , 7 , 10 , 11 , 20 ) . the use of such programs could substantively enhance the accuracy and efficiency of detecting changes in nodules over time . of primary concern is whether a nodule , that appears to have grown on the basis of sequential volume measurements , actually has grown , and whether the difference in measurements is significant or due to error . by using estimates of the variation in percentage volume change , in stable nodules as a function of initial diameter , kostis et al . ( 20 ) suggested that one could formulate an optimal follow - up time at which growth in a nodule can be reliably detected . parameters for acquiring or reconstructing images , as well as measurement methods , can affect measurement error in nodule volumetry ( 7 - 9 ) . even when a nodule is intrinsically unchanged between two scans , it may be measured differently due to altered technique such as scanning position . for instance , wormanns et al . ( 11 ) reported that the volume measurement error in 151 nodules ranged from -41 to 29% ( mean , 0.710.6% ) when two consecutive ct scans were performed within 10 minutes after new positioning . ninety - five percent of all measurements had a volume measurement error between -22.5 and 24.1% . these values were comparable to our results , allowing for the difference in definition of the percent difference between the two studies . in our study , no variation was identified due to acquisition or reconstruction parameters or scanning position . our results demonstrated that the nodule volume measurements were significantly affected by variation in respiratory phase . similar findings , of variability of lung nodule volume measurements with respiration , have been previously reported ( 21 , 22 ) . novak et al . ( 21 ) reported that change in nodule volume measurements , between different respiratory phases , was significantly larger than for nodules scanned twice at full inspiration . in another study , nodule size was measured bi - dimensionally , and a significant difference in the size of the lung nodules during inspiration and expiration was identified ( 22 ) . in our study one possibility is that the difference observed reflects a real change of nodule volume during the respiratory cycle ; another possibility is that this difference is caused by a change in segmentation between the nodule and the background . because many of the nodules in our study were apparently calcified nodules , the chance to identify real change in nodule volume was low . some collapsed or partially collapsed alveoli around the nodules on expiration , however , our study demonstrated that volumetric measurements of pulmonary nodules were significantly correlated with changes in lung volume . nodule volume measurement programs employ threshold techniques used to separate background voxels ( 11 ) . it is well known that lung attenuation is affected by the respiratory phase ( 23 , 24 ) . a change of background attenuation may affect the segmentation process of the lung nodule , this was observed in our study . although we measured both the regional lung attenuation and the whole lung attenuation , only the regional lung attenuation had a significant effect on the lung nodule volume measurement . by contrast , a significant correlation between lung nodule volume and nodule attenuation , lung volume , whole lung attenuation , or regional lung attenuation was not observed for all nodules studied . because measurement variation in smaller nodules is larger , and there are many nodules < 3 mm in all nodule groups , the effect of background attenuation may be lost as a result of the larger variation in the nodule volume measurement itself . first , the number of cases in our study was small , and the sizes of all studied nodules were relatively small second , the differences observed in lung volumes on inspiration and expiration scans are likely far larger than those typically expected on routine inspiratory follow - up clinical ct scans . the results of our study reflect upper range variations in nodule volume due to respiratory differences , and were not related to positional variation on follow up studies . in conclusion , this variability in respiration - related measurements should be considered when a change in a pulmonary nodule consistent with growth is identified . | objectiveto evaluate how changes in lung volume affect volumetric measurements of lung nodules using a multi - detector row ct.materials and methodsten subjects with asthma or chronic bronchitis who had one or more lung nodules were included .
for each subject , two sets of ct images were obtained at inspiration and at expiration .
a total of 33 nodules ( 23 nodules 3 mm ) were identified and their volume measured using a semiautomatic volume measurement program .
differences between nodule volume on inspiration and expiration were compared using the paired t - test .
percent differences , between on inspiration and expiration , in nodule attenuation , total lung volume , whole lung attenuation , and regional lung attenuation , were computed and compared with percent difference in nodule volume determined by linear correlation analysis.resultsthe difference in nodule volume observed between inspiration and expiration was significant ( p < 0.01 ) ; the mean percent difference in lung nodule volume was 23.1% for all nodules and for nodules 3 mm .
the volume of nodules was measured to be larger on expiration ct than on inspiration ct ( 28 out of 33 nodules ; 19 out of 23 nodules 3 mm ) .
a statistically significant correlation was found between the percent difference of lung nodule volume and lung volume or regional lung attenuation ( p < 0.05 ) for nodules 3 mm.conclusionvolumetric measurements of pulmonary nodules were significantly affected by changes in lung volume .
the variability in this respiration - related measurement should be considered to determine whether growth has occurred in a lung nodule . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cervical cancer is the second most common cancer in women world - wide with an annual 493,243 cases and 273,505 deaths . the incidence of cervical cancer is higher in developing countries and less in developed countries with an effective cervical screening program . about 80% of the cases occur in developing countries . in some of the places , latin america , the caribbean , sub - saharan africa and south and south - east asia have the highest incidence rate . the main cause of cervical cancer is infection by human papillomavirus ( hpv ) . during their life - time many women become infected with hpv , but interestingly only a small fraction of them develop cervical cancer and the rest regress to a normal healthy state . this suggests the role of additional risk factors playing an important role in the outcome of the infection . these risk factors include host and viral genetic factors along with environmental and life style factors . host genetic risk factors to hpv infection and cervical cancer : the genetic link to cervical cancer development is strongly supported by epidemiological studies . a hereditary component of cervical tumors was detected in comparisons of twins and in a mother - daughter family study . the possibility of host genetic predisposition is strengthened by the observation that biological first degree relatives of the women who have developed a cervical tumor experience a two - fold risk of developing cervical tumor compared to non - biological relatives of women with cervical tumor . major host genes that have been considered to play either a susceptible or protective role in the development of cervical intraepithelial neoplasia ( cin ) or cervical cancer from hpv infection have been discussed . the following medical subject headings ( mesh ) and text words were used to search the medline database , polymorphism(s). separate searches were carried out for each individual candidate host gene using the search terms , cervical , * the name of the gene* , hpv , * the name of the gene*. studies on human subjects and published in any languages were considered . the studies that compared allele or genotype frequencies of candidate host genes in cervical cancer patients or patients in any grade of cin with non - cancerous healthy individuals or among the different groups of cases were eligible for this review . human leukocyte antigen genes ( hla ) : hla comprises a family of genes within the major histocompatibility complex ( mhc ) localized on chromosome 6 ( 6p ) . hla genes are divided into 2 major classes ; class i genes ( most notably hla a , b and c genes ) and class ii genes ( most notably dr , dq and dp genes ) . hla class i molecules ( hla class i gene product ) are expressed in all nucleated cells and present foreign antigens to cd8 + cytotoxic t lymphocytes ( ctls ) ( acquired immune response ) . cd8 + t cells have the ability to kill the foreign antigen presented to them by the hla class i molecules . hla class ii molecules ( hla class ii gene products ) are typically expressed in cells of the immune system , such as dendritic cells , macrophages , b - lymphocytes and are known to be important in presenting antigenic peptides to cd4 + helper t - lymphocytes . class i and class ii hla genes are highly polymorphic , a necessity for evolutionary survival as it provides resistance to potential pathogens by binding and presenting a wide variety of antigenic peptides . presence of hla molecules that bind hpv antigens with high affinity might confer a protective effect on the progression of cervical cancer ; on the other hand presence of hla molecules that do not recognize and bind a wide variety of hpv antigens might be associated with the susceptibility of the disease . hla a , b and c genes have been investigated by several groups in different population in relation to cervical cancer . hla a2 , a*01 , a*24 , a*1104 , b7 , b15 , b63 and cw*0202 loci have been reported to be associated with increased risk of developing cervical cancer.[919 ] on the other hand , a protective effect has been found for hla a*0207/0215n or a*2402 . hla
dq and dr genes have been extensively studied by many groups in different population across the globe . dqa1 * 01 , * 03 , dqb1 * 02 , * 03 , * 04 , * 06 and dqw1 , dqw3 alleles have been associated with increased risk of developing the disease.[1011142047 ] a protective association has also been found with dqa1 * 0501 and dqb1 * 0201 , * 0103 , * 0301/*0501 , * 04 , * 05 , * 050201 , * 06 alleles.[27333444454851 ] drb1 * 4 , * 5 , * 11 , * 13 , * 15 , * 16 were found to be susceptibleloci.[121415303136384042435157 ] and dr * 1 , * 2 , * 4 , * 6 , * 12 , * 13 , * 14 , * 15 were found to be protective loci.[10121543485158 ] only a few studies investigated the do and dp genes and reported a positive association with severity of the disease with both the dob1 * 03 and dpb1 genes . the interactions of dq - dr haplotypes and their effect on cervical cancer showed interesting results . an increased association with the disease was found for drb1-dqb1 ( 04 - 03 , 15 - 06 , 16 - 05 , 08 - 04 ) and dqa1-dqb1 ( 01 - 06 , 05 - 03).[303240546165 ] a protective effect was also found for dqa1-dqb1 ( 02 - 02 ) , drb1-drb1 ( 1301 - 02 ) and drb1-dqb1 ( 15 - 06 ) . tp53 : tp53 gene localized on chromosome 17q 13.1 encodes protein 53 ( p53 ) and is a tumor suppressor gene that regulates the cell cycle . in case of dna damage , tp53 is up regulated and causes g1 arrest of the cell allowing the genetic damage to be repaired . tp53 gene is commonly known to have a polymorphism in codon 72 with two alleles encoding either arginine ( arg / arg ) or praline ( pro / pro ) . they reported a seven times higher risk of developing hpv - associated cervical carcinogenesis in individuals with arg homozygosity than with heterozygous genotype . several groups investigated the tp53 codon 72 polymorphism in cervical cancer susceptibility in different ethnic groups with contradictory results . many studies on various ethnic groups found tp53 codon 72 arg as a risk allele for hpv infection and progression to cervical cancer comparing case - control individuals.[6684 ] tp53 codon 72 arg was found to be associated with adenocarcinoma but not with squamous cell carcinoma ( scc ) and conferring susceptible effect to gstt1 null individuals . a large number of case - control studies in different ethnic groups failed to show an association of arg allele with hpv infection and progression to cervical cancer.[7885117 ] tp53 codon 72 arg allele was also found to have decreased association to cervical abnormalities and hpv infection . on the other hand , the tp53 pro / pro genotype was reported to have a higher risk in developing cervical cancer . tumor necrosis factor ( tnf ) genes : tnf genes are situated centromeric to the hla - b genes and telomeric to the c2 genes . tnf genes produce two immunologically important proteins , tnf- and tnf-. these proteins play a crucial role in the inflammatory response and immune activities toward tumor cells . tnf acts through the tnf receptors ( tnf - r1 and r2 ) and is a part of the complex pathway of triggering apoptosis . the binding of tnf to tnf - r1 initiates the pathway that leads to caspase activation via the adapter proteins ( tradd , fadd ) committing the cell to apoptosis . this binding is also involved in activation of transcription factors involved in cell survival and inflammatory responses . cancer patients have been found with increased levels of tnf- . several polymorphic sites have been reported in tnf locus including five microsatellites of tnfa - e . tnfa is closely linked to tnf- gene and contains 14 different alleles ( a1-a14 ) with an ac / gt dinucelotide repeat . several groups investigated the role of various polymorphic sites of tnf gene in association to cervical cancer in different ethnic populations . a positive association was found with cervical cancer and the presence of tnfa-8 , tnf- -572 , -857 , -863 and also with tnf
g-308a.[123125 ] g-308a did not show any association in south african population . mhc class i polypeptide - related sequence a ( mica ) : the mica gene is located on chromosome 6 , centromeric to hla - b and telomeric to tnf and encodes the highly polymorphic mhc ( hla ) class i chain - related gene a. the mica is expressed by keratinocytes and epithelial cells on the cell surface and interacts with t cells and has an important role in immune response and direct induction of mucosal immunity . the protein functions as a stress - induced antigen broadly recognized by intestinal epithelial gamma delta t cells . exon 5 of mica gene contains a microsatellite locus with 5 alleles , in strong linkage disequilibrium with hla - b alleles . different polymorphic sites of mica were investigated in swedish and asian population but none were found to have an association with cervical cancer . waf1/p21 : the waf1/p21 gene is located on chromosome 6p21.2 and is a tp53 mediator . any changes in this gene may affect the regulation of cell growth and result in excessive proliferation of cancer cells . a serine to arginine change has been well documented followed by a c to a transversion at the third base of codon 31 . ser / ser genotype was found to be the susceptible genotype for adenocarcinoma in high risk hpv but not for scc . il-10 is a th2 type cytokine produces a suppressive effect on cell mediated immunity ( cmi).[135137 ] increased expression of il-10 is reported in scc and increased serum levels of il-10 in cervical cancer . one of the polymorphisms that is associated with low , medium or high production of il-10 situates in the promoter region of the gene at position-1082 . several studies investigated this polymorphism with conflicting results . -1082 a / g was found to be the risk genotype for cervical cancer . however , -1082 g allele was shown to have an inverse association with hpv persistency . a few studies failed to find any association of this polymorphism with cervical cancer.[143146 ] methylenetetrahydrofolate reductase ( mthfr ) : mthfr gene is situated on chromosome 1p36.3 . mthfr enzyme regulates the metabolism of folate and methionine , which are critical for dna methylation and synthesis . c to t transition at nucleotide position 677 of the mthfr gene results in alanine to valine . compared to homozygous wild type ( ala / ala ) both heterozygous ( ala / val ) and homozygous ( val / val ) variants reduce mthfr enzyme activity in individuals with a low folate status . hence this polymorphism might cause an abnormal dna methylation and dna synthesis which can lead to an increased risk of developing cancer . different groups investigated the effect of this polymorphism in different case - control populations with conflicting results . some found the polymorphism as a risk factor to develop cervical cancer[151154 ] while others did not.[155157 ] a reduced risk of developing cin ii / iii for the mutant - type carriers compared to the wild type carriers of this polymorphism was also reported . interferon - gamma ( ifn- ) :
ifn- gene is mapped on chromosome 6 . ifn- is crucial in defending against viruses and in the induction of immune mediated inflammatory responses . t to a change at the + 874 position from translation start site in the first intron of ifn- gene was reported to have a high ifn- production . a low ( a / a ) , medium ( a / t ) and high ( t / t ) ifn- production is associated with + 874 single nucleotide polymorphism ( snp ) . one of the earliest responses of human body to injury or infection is the release of chemokines that triggers penetration of local inflammatory and immune cells . it has been postulated that hpv disrupts the interaction between epithelial cells and the immune system by deregulating the expression of chemokines which have been associated with bacterial or viral infections , autoimmune diseases , heart diseases and many others . mcp-1 is responsible for recruiting macrophages to tumors in bladder , cervix , ovary , lung and breast . though macrophages display tumor cytotoxicity , tumor - associated macrophages ( tams ) mainly have protumor functions and help in tumor angiogenesis . more expression of mcp-1 recruits more macrophages and speeds up the process of tumor progression . when the epithelial cells are infected by hpv , it reduces the mcp-1 expression from low - grade squamous intraepithelial lesions ( lsil ) to high - grade squamous intraepithelial lesions ( hsil ) and the levels of mcp-1 expression increases again from hsil to invasive cervical cancer ( icc ) . macrophages , which are recruited by mcp-1 chemokine , express ccr2 on their cell surface . ccr2 has two isoforms ccr2a and ccr2b originated from the ccr2 gene by alternative splicing . a single nucleotide polymorphism ( snp ) of g to a at position 190 of ccr2 gene changes amino acid valine ( gtc ) to isoleucine ( atc ) at codon 64 ( ccr2-v64i ) . this conservative amino acid change takes place in the first transmembrane domain of ccr2a and ccr2b . this change makes ccr2a more stable and increases its half - life but does not any way affect the stability of ccr2b isoform . the increased stability of ccr2a might accumulate a large amount of this isoform on the macrophage cell surface which also interferes with the ccr2b function . this misleads the cells and the macrophage recruitment drops during the development of the tumor which hampers the tumor angiogenesis and eventually gives a protective effect to the tumor progression . this polymorphism ( ccr2-v64i ) has been extensively studied and several reports show a protective role of the polymorphism with aids,[165168 ] multiple sclerosis and breast cancer . this polymorphism was studied in portuguese , swedish and south african black and mixed - ancestry population . comparing squamous intraepithelial lesions ( sil ) with the a allele was also found to be a risk allele for developing hsil and cervical cancer compared to healthy controls . contrasting to that , a decreased risk of developing cervical cancer was reported in the presence of the a allele . some groups failed to find an association of this polymorphism with cervical cancer , pre - cancerous lesions or hpv infection . fas and fas ligand ( fasl ) :
fas gene is situated on chromosome 10q24.1 . tumorigenesis is achieved not only by increased cell proliferation but also by a decreased apoptotic rate . together with fas ligand ( fasl ) , it triggers programmed cell death . the signal produced by the dna binding of transcription factors sp1 ( stimulatory protein 1 ) and stat1 ( signal transducer and activator of transcription 1 ) fas -1377 bp and -670 bp are situated within sp1 and stat1 binding sites respectively . it has been shown that a change of a at -1377 of fas promoter considerably reduces sp1 binding compared to -1377 g resulting in a decrease of fas gene expression . gamma interferon activation signal ( gas ) is a binding element responsible for dna binding of stat1 . -670bp is located within gas binding site . a change of g at -670 of fas promoter region partially or completely abolishes the gas element , hence significantly reduces the fas gene expression which results in decreased activation induced cell death ( aicd ) and uncontrolled growth of the virus . it has also been shown that a higher basal expression of fasl is associated with the c allele at position 844 of fasl gene than with the t allele . reduced expression of fasl inhibits the apoptotic activity of the fas - fasl pathway . studies on these polymorphisms with cervical cancer ranging from asian , european to black and mixed - ancestry african have shown conflicting results . an association of fas-670a allele and a / a genotype with higher risk of developing cervical cancer was reported . other studies on case - controls and affected sib - pairs ( asp ) did not find any association of this polymorphism with cancer of the cervix.[183185 ] fas-1377 polymorphism was not found to be associated with disease severity . allele and c / c genotype was found to be susceptible to cervical cancer ; however , other groups refuted this result . casp8 : casp8 gene is localized on chromosome 2q33 - 34 and codes for caspase 8 . two commonly known polymorphisms in the casp8 gene have been well studied , namely casp8 d302h and casp8 -652 6n ins / del . among these , only casp8 -652 6n ins / del ( rs3834129 ) polymorphism is associated with susceptibility to cervical cancer . a functional polymorphism of a six nucleotide deletion of agtaag at the position 652 of the promoter region of the casp8 gene ( casp8 -652 6n ins / del ) has been identified . this six nucleotide deletion destroys a binding element for transcriptional activator stimulatory protein-1 ( sp1 ) which reduces capase-8 expression leading to decreased aicd in ctls . the influence of casp8 -652 6n ins / del polymorphism on cervical cancer was investigated and a reduced risk of cervical cancer was reported with casp8 -652 6n del / del . genes encoding detoxifying enzymes ( cyp1a1 , cyp2d6 , gstm1 , gstt1 ) : environmental risk factors have been speculated to play an important role in hpv infection and persistence by many researchers . smoking is a well - known environmental risk factor in progression to cervical cancer , suggesting a possible link with allelic changes at the genes encoding for detoxifying enzymes . cyp1a1 and cyp2d6 are phase 1 cytochrome p450 enzyme that catalyze the modification of various enzymes including carcinogenic enzymes and help the phase 2 enzymes , glutathione s - transferases ( gst family ) , to convert to extractable compounds . cyp1a1 : several polymorphisms have been described for cyp1a1 , a t to c change ( m2 ) in the 3non - coding region of the gene leading to an mspi restriction site has been well studied . an increased risk of developing cervical cancer with c allele , c / c and t / c genotype of m2 polymorphism compared to wild type t / t genotype was observed . other studies reported m1 polymorphism ( g ) and cyp1a1 * 3 as the risk alleles for cervical cancer . cyp2d6 : cyp2d6 is classified in wild type homozygous extensive metabolizers ( em ) carrying a mutation of g to a at intron 3/exon 4 , heterozygous extensive metabolizers ( hem ) carrying a base pair deletion in exon 5 and poor metabolizers ( pm ) with a total gene deletion . it was shown that em is a susceptible allele and genotype for high grade cin in women who smoke , but the same is not true for progression to scc . gstm1 : gstm1genotype is a combination of gstm1 * 0 , gstm1*a and gstm1*b alleles . gstm1 * 0 is also called gstm1 null , which is a deletion of the gene and no expression of protein for homozygotes . studies with this polymorphism showed a positive association with susceptibility to cervical cancer and high risk hpv infection and gstm1 null genotype , whereas other groups failed to find any association.[70199201 ] gstt1 : gstt1 gene plays a role in phase two detoxification of carcinogens present in tobacco smoke and also in pesticides like halo - methanes and methyl bromide . some studies with this polymorphism on cervical cancer patients found an association of this genotype with increasing risk of developing cervical cancer or hsil;[70202204 ] on the other hand , some studies reported no association with cancer of the cervix . this review compiles the major host genetic risk factors that have been found associated and not - associated with hpv infection and progression to cancer of the cervix . zoodsma et al , published a meta - analysis of hla genes and other non - hla candidate genes . a review article by hildesheim
et al , on hla genes considered 28 publications . all these reviews considered publications up till 2002 . the present review is wider in every sense as it considers a greater number of publications . this is also an updated review of host genetic susceptibility to cervical cancer compared to the above - mentioned reviews . this review also includes more genes ( such as fas , fasl , ccr2-v64i and ifn- ) than reviewed by zoodsma et al . in conclusion , this review shows a broad picture of host genetic determinants to hpv infection , different stages of neoplasia and progression to cervical cancer . it is not possible to pin - point one or two genes causing severity or conferring a protective effect to a complex disorder like cervical cancer , rather depends on different genes involved in different pathways in addition to the main causative agent . it is also evident that a complex disease like cervical cancer depends on different parameters and a critical interaction between different genes and also between gene and environment play a crucial role in that . | cervical cancer is the second most common cancer in women worldwide .
this is caused by oncogenic types of human papillomavirus ( hpv ) infection .
although large numbers of young sexually active women get hpv - infected , only a small fraction develop cervical cancer .
this points to different co - factors for regression of hpv infection or progression to cervical cancer .
host genetic factors play an important role in the outcome of such complex or multifactor diseases such as cervical cancer and are also known to regulate the rate of disease progression .
the aim of this review is to compile the advances in the field of host genetics of cervical cancer .
medline database was searched using the terms ,
hpv ,
cervical ,
cin ,
polymorphism(s) , cervical+ * the name of the gene * and hpv+ * the name of the gene*. this review focuses on the major host genes reported to affect the progression to cervical cancer in hpv infected individuals . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
type 1 diabetic participants ( n = 66 ; mean sd age 42 10 years ) were evaluated in the human performance laboratory , university of delaware , newark , delaware . this study had the approval of the institutional review board of the university of delaware . individuals with possible secondary causes of osteoporosis ( e.g. , hyperparathyroidism ) were excluded , although seven did have borderline decreased vitamin d levels but normal parathyroid hormone levels . analysis of the data omitting these subjects produced similar results ; thus , they were included in the study cohort . nutrient content was determined with the food processor nutrition analysis and fitness software package ( version 8.0 ; esha research , salem , or ) . urine n - telopeptides were determined via a vitros eci competitive assay on a morning spot sample . linear regression was used to assess potential independent associations for markers of bone turnover ( i.e. , dependent variable ) . participants consumed , on average , slightly more zn than the daily recommended dietary allowance ( rda ) ( 11 mg / day for men and 8 mg / day for women ) . it should be noted , however , that approximately one - third of the individuals demonstrated values less than the rda . osteocalcin levels were lower for individuals with zn intake levels below the rda ( 15.9 5 [ n = 21 ] vs. 19.6 6 ng / ml [ n = 45 ] ; p < 0.05 ) . zn intake correlated with osteocalcin in the group overall ( r = 0.48 ; p < 0.001 ) . when examined by sex , both zn intake and osteocalcin levels were highly correlated for men ( r = 0.57 ; p < 0.001 ) , but the correlation did not reach statistical significance for women ( r = 0.34 ; p = 0.09 ) . no significant correlations were observed for n - telopeptides and zn . a direct - entry linear regression model , with osteocalcin as the dependent variable , insulin use per kilogram , total calorie intake , and zn entered as potential independent variables , the overall model was significant ( r = 0.32 ; p < 0.01 ) . zn intake ( p < 0.001 ) , however , was the only independent correlate of osteocalcin , whereas sex was borderline statistically significant ( p = 0.061 ) . a potential interaction between sex and zn intake was investigated and found not to be significant . in sex - specific models , controlling for the other variables , zn intake ( p < 0.01 ) was independently associated with osteocalcin for men ( r = 0.34 and p < 0.05 for the model ) but not for women . we also examined the r for the model when mg , phosphorus ( p ) , or ca was entered as a potential independent variable replacing zn . no other micronutrient produced as strong an r for the regression model as that for zn , and only p was independently associated with osteocalcin ( p < 0.05 ) . no independent association with zn was found when n - telopeptides were used as the dependent variable . although it has been shown that zn stimulates osteoblasts and the zinc effects on nutrient / nutrient interactions and trends in health and ageing ( zenith ) study ( 5 ) showed some , albeit inconsistent , evidence of a relationship between zn nutritive status and bone turnover , to our knowledge this is the first study in type 1 diabetes that shows an independent association for zn intake and osteocalcin . our results , however , suggest that this relationship may be stronger for men than for women . the anabolic effect of igf - i in osteoblasts is enhanced by zn ( 6 ) . zn deficiency , however , impairs dna synthesis and protein metabolism , negatively impacting bone formation ( 1 ) . in type 1 ( 4 ) showed a significant decrease in both bone mineral content and zn , suggesting that zn deficiency may be a contributory factor to bone loss . some have suggested that zn deficiency leads to an increase in free radical production ( 7 ) . oxidative stress has been shown to be an independent risk factor for osteoporosis ( 8) . why zn intake appears to be more strongly associated with osteocalcin for men than for women herzberg et al . ( 9 ) showed that urinary discharge of zn is increased in postmenopausal women with osteoporosis . thus , perhaps the role of zn in bone metabolism plays a larger role for women once they have reached menopause . it should be noted that there was no significant association of age with markers of bone turnover for either sex . only one morning urine sample was collected for n - telopeptides , which may explain the lack of association because of a large intra - individual variability for n - telopeptides . this study provides evidence of a relationship between zn and a marker of bone turnover in type 1 diabetes . as for its limitations , the cross - sectional nature of in addition , for 9 of 25 subjects who were taking a multivitamin , the exact zn content of their supplement could not be determined . a common multivitamin with an average zn , ca , mg , and p content was assigned to these subjects . this assignment could have attenuated the associations , potentially obscuring that between n - telopeptides and zn intake . although the importance of higher levels of osteocalcin with regard to bone health is not clear , dietary factors are modifiable . given that an inadequate intake of zn has been reported as a risk factor for fractures in men ( 10 ) , zn may be important in reducing this risk in people with type 1 diabetes . | objective to examine the relationship between zn nutritive status and biochemical markers of bone turnover in type 1 diabetes.research design and methods serum osteocalcin , urine n - telopeptides , and dietary intake data , obtained by 3-day food records , were assessed for 66 individuals with type 1 diabetes.resultszn intake correlated with osteocalcin in the group overall ( r = 0.48 ; p < 0.001 ) but not with n - telopeptides .
examined by sex , both zn and osteocalcin correlated for men ( r = 0.57 ; p < 0.001 ) , but the correlation did not reach statistical significance for women ( r = 0.34 ; p = 0.09 ) . a direct - entry linear regression model with osteocalcin as the dependent variable was performed .
duration , sex , a1c , insulin use per kilogram , total calorie intake , and zn intake were entered as potential independent variables .
the model was statistically significant ( r2 = 0.32 ; p < 0.01 ) .
zn intake ( p < 0.001 ) , however , was the only independent correlate of osteocalcin.conclusionsthis study provides evidence of a positive relationship between zn intake and osteocalcin in type 1 diabetes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
herbal medicines are the most preferred ways of cam . in usa , 38% of the population use herbal medicines . although herbal products are believed to be harmless among consumers , they might have side effects , and they have potential to cause drug interactions . although turkey has a long tradition of using herbal medicine , the data about the frequency of utilization of herbal medicine in chronic diseases are scarce [ 4,7 - 12 ] . therefore , in this study , we aimed to determine the frequency of the use of herbal medicine among patients who had been diagnosed with diabetes mellitus ( dm ) , hypertension ( ht ) , and hyperlipidemia ( hl ) in family medicine department . a cross - sectional descriptive study was conducted among adult patients ( n = 232 ) who had been followed with dm , ht , hl from april 2014 to december 2014 in hasky outpatient clinics of family medicine department of dkap yldrm beyazt training and research hospital in ankara . a face - to - face questionnaire was administered to the participants by the first author . the questionnaire included information about socio - demographic features , chronic diseases , conventional medications , and herbal medicine use . compliance to conventional medicine use was defined as compliance and non - compliance whether the patients regularly had received their prescribed drugs according to the clinicians instructions . in addition , data about the name of the herbal medicine , the reasons for herbal use , belief about effectivity , knowledge about potential adverse effects , and by whom ( e.g. , families or friends , media or health care providers ) its use was recommended were collected . the study was approved by local ethical committee of dkap yldrm beyazt training and research hospital . the data obtained from the study were analyzed using statistical package for social sciences version 15 for windows . descriptive statistics is presented as mean standard deviation , range , and frequency ( % values ) . chi - square test or fisher s exact test was used for categorical variables and student s t - test for normally distributed data with equal variances . a p < 0.05 considered as statistically significant . the data obtained from the study were analyzed using statistical package for social sciences version 15 for windows . descriptive statistics is presented as mean standard deviation , range , and frequency ( % values ) . chi - square test or fisher s exact test was used for categorical variables and student s t - test for normally distributed data with equal variances . it was found that 96.2% of women were housewives and 63.6% of men were retired . there were 35 patients ( 16.1% ) who had dm , 59 patients ( 27.2% ) who had ht , 7 patients ( 3.2% ) who had hl , and there were 116 patients ( 53.5% ) who had more than one disease . among those patients , 212 of them ( 97.7% ) used conventional medicine and the socio - demographic and clinical features of the study population are presented in table 1 . the socio - demographic and clinical features of the study population the number of herbal medicine users was 63 . herbal medicine use was found to be significantly higher among female gender ( p = 0.04 ) . conventional medication use was found to be lower among herbal medicine consumers ( 97.3% vs. 99.4% ) . herbal medicines were commonly recommended to the users by their families or friends ( 61.9% ) , by media ( 27% ) , and by health care providers ( 11.1% ) , respectively . herbal medicines were merely recommended by professional health care providers ( 7.9% by physicians , 3.2% by pharmacists ) . among those herbal medicine users , 68.3% thought that herbal medicines had a good effect , 11.1% had a minor effect , and 20.6% had no effect on their medical conditions . a total of 54 herbal medicine users ( 85.7% ) thought that herbal medicines had no adverse effects , 7 ( 11.1% ) thought they might have adverse effects , 2 ( 3.2% ) had no idea . the most common reasons of herbal medicine use were to increase the effectiveness of the conventional medications ( 39.7% ) , to believe that they were harmless ( 33.3% ) , to find them more effective ( 25.6% ) , and cheaper ( 1.6% ) than the conventional drugs . most frequently used herbs were lemon ( 39.6% ) and garlic ( 11.1% ) for ht , cinnamon ( 12.7% ) for dm , and walnut ( 6.3% ) for hl . patients mostly use roots , leaves , fruits or seeds of plants which can be found easily . dm , ht , and hl are the most prevalent chronic diseases in the world . according to turdep-2 and tekharf studies , the prevalence of dm is 16.6% , the prevalence of ht is 31.6% , and the prevalence of hl is 37.3% in turkey . recent studies support the popularity and increasing use of cam by individuals in western countries as well as in turkey . we found approximately one - third of our patients had used herbal medicine for the treatment of chronic diseases . the differences in the reported rates of herbal medicine use might depend on socio - demographic features of study population even in the same country . reported 53% herbal medicine use for ht in a study population similar to our study population ( most of the individuals were female , mean age was 57.6 years , and education level was low ) . soner et al . found 48.8% herbal use in a population mostly consisted of female inpatients with the median age 37.0 years and with higher education levels . however , gck et al . reported lower rates ( 16% ) herbs use in cardiovascular disease among male predominant patients with the mean age of 49 13 years . the proposed reasons of the prevalent use of herbal medicines were insufficient controlling in the market , ease of reaching to the products , and over advertising of those products by media . our findings were also compatible with those previous reports . hence , most of the women were housewives ( 96.2% ) in our study population . the television programs , especially for women may be the possible explanation for this cause . in contrast to the studies , we did not find a relationship between herbal medicine use and education level . previous studies found that people who had high education level were more likely to use herbal medicines . although the effectiveness of the herbal medicines in the treatment of chronic diseases has not been clearly documented , we found that non - compliance with conventional medication was found to be higher in herbal medicine users . furthermore , we found that most of the patients believed that herbal medicine was effective ( 68.3% good effect , 11.1% minor effect ) and had no adverse effects ( 85.7% ) . although there were 7 patients ( 11.1% ) who thought herbal medicines might have adverse effects , we did not ask their experiences about adverse effects . unfortunately , we did not collect data about the impact of those medications on our patients medical conditions ( e.g. , blood pressure , hemoglobin a1c levels or lipid profiles ) . soner et al . found that 53.2% of the study population believed that herbal medicines were not harmful , had less side effects or completely safe ; they also found that 11.3% of the herbal medicine users had adverse effects such as palpitation , abdominal pain or hot flushing . in addition , we found that herbal medicines were merely recommended by professional health care providers ( 7.9% by physicians , 3.2% by pharmacists ) . family and friends or media were the main sources of information as seen in previous studies . this is another important point , which could lead to negative outcomes in the treatment . the potential side - effect and outcome influence may be brought about by combinated use of herbal medicine and conventional drugs , and these circumstances are always difficult to predict because elucidating the exact mechanism of each extract of an herb that affects drug s pharmacokinetic is still incomplete . hence , adverse drug reactions , toxicities , and treatment failure are more likely to occur when drugs are consumed with herbs . to date , an increasing number of studies in evaluating herbal medicine - drug interaction have been reported , and many herbal drugs and products interactions and side effects are well - known . for example , concomitant use of danshen ( salvia miltiorrhiza ) and warfarin may exaggerate the anticoagulant effect of warfarin and possibly cause bleeding . korean / asian ginseng ( panax ginseng ) and american ginseng ( panax quinquefolius ) have antidiabetic effects [ 22 - 24 ] using ginseng concurrently with oral hypoglycemic agents or insulin injections may increase the risk of hypoglycemia . therefore , herbs should be used with the control of a professional health - care provider . we do not know the attitudes of the health care professionals for herbal medicines in turkey which should be further evaluated . although 20.6% of the herbal medicine users thought that herbal medicine was ineffective for their treatment , and 11.1% of them believed that herbal medicines might have had adverse effects , interestingly they continued to use herbal medicines . patients mostly use roots , leaves , fruits or seeds of plants which can be found easily , according to our study . found that 74.7% of patients used cam ( mostly herbal medicines ) for ht and lemon was the most preferred one . the results are consistent with our study . although lemon was the most preferred one for ht , its effectiveness for decreasing blood pressure was not shown before certainly . according to our knowledge , this is the first study in turkey about herbal medicine use among three , most prevalent chronic diseases . first of all , this is a local study and the number of participants is limited . second , the source of information was subjective and according to the declaration of patients . in this study , herbal medicine use was found to be higher among patients with chronic diseases and most of the patients used herbal medicine without professional recommendations . there were also patients who prefer to use herbal medicines instead of their prescribed drugs . therefore , physicians should be aware of herbal medicine usage of their patients and inform them about the effectivity and side effects of herbal medicines . | aim : complementary and alternative medicine ( cam ) is commonly used all over the world , and herbal medicines are the most preferred ways of cam .
the aim of this study was to determine the frequency of herbal medicine use among patients with chronic diseases.methodology:a cross - sectional descriptive study was conducted from april 2014 to december 2014 among patients who had been diagnosed with diabetes mellitus ( dm ) , hypertension ( ht ) , and hyperlipidemia ( hl ) in family medicine department of dkap yldrm beyazt training and research hospital , in ankara .
a questionnaire about herbal drug use was applied by face to face interview to the participants.results:a total of 217 patients were included in this study .
the mean age of the participants was 56.6 9.7 years ( 55 male and 162 female ) .
the rate of herbal medicine use was 29% .
herbal medicine use among female gender was significantly higher ( p = 0.040 ) .
conventional medication use was found to be lower among herbal medicine consumers .
there was no relationship between herbal medicine use and type of chronic disease , living area , and occupation or education level .
most frequently used herbs were lemon ( 39.6% ) and garlic ( 11.1% ) for ht , cinnamon ( 12.7% ) for dm , and walnut ( 6.3% ) for hl.conclusions:in this study , herbal medicine use was found to be higher among patients who had been diagnosed with chronic diseases .
therefore , physicians should be aware of herbal medicine usage of their patients and inform them about the effectivity and side effects of herbal medicines . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a two - month - old male infant presented with tachypnea , diaphoresis , and poor feeding . he was born at full term with no perinatal medical problems at a primary care hospital . his primary care physician noted a cardiac murmur , but recommended reevaluation at the age of two months because his physical examination did not reveal any other abnormalities . the patient did well for the first month , but experienced progressive worsening of the aforementioned symptoms . he was tachypneic ( 60 respirations / min ) and tachycardic ( 155 beats / min ) . a systolic murmur was heard at the cardiac apex and the femoral pulses were weak . the upper extremity blood pressure was approximately 20 mmhg higher than the lower extremity blood pressure . no evidence of infection or inflammation was found based on blood chemistry panels , a complete blood count , and serologic markers . creatine kinase and creatine kinase - mb levels were within normal limits . however , troponin - t was elevated ( 0.075 ng / ml ; reference range , 0.00.014 ng / ml ) . the serum n - terminal of the pro - hormone was 9,601 pg / ml ( reference range , 0154 pg / ml ) . echocardiography revealed coarctation of the aorta ( diameter , 3 mm ; peak pressure gradient , 30 mmhg ; mean pressure gradient , 14 mmhg ) , a patent ductus arteriosus ( pda ) 1.5 mm in size , a patent foramen ovale ( pfo ) , and grade iii / iv mitral regurgitation . the left ventricle was globally hypokinetic ( ejection fraction , 13% ; shortening fraction , 8%10% ) and markedly dilated . the left ventricular end - diastolic and end - systolic dimensions were 36 mm ( 138% of normal range ) and 31 mm ( 188% of normal range ) , respectively ( fig . 1 ) . intravenous infusion of prostaglandin e1 was initiated , but the patient s peripheral perfusion and left ventricular function did not improve . therefore , an urgent operation was scheduled . a median sternotomy approach was chosen for possible intra - operative or postoperative mechanical circulatory support . cardiopulmonary bypass ( cpb ) the aortic arch was repaired using resection of the aortic coarctation and an extended end - to - side anastomosis technique under regional antegrade cerebral and myocardial perfusion . post - repair echocardiography demonstrated severe left ventricular dysfunction with a left ventricular ejection fraction of 15% . epicardial echocardiography was carried out with extreme caution , but during echocardiographic evaluation , the patient s vital signs slowly deteriorated . cpb was resumed and was changed over to left ventricular assist device ( lvad ) support . the lvad system was constructed with an 18-french left atrial drainage cannula placed through the right superior pulmonary vein , a 10-french ascending aortic cannula , and a centrifugal pump . on postoperative day 5 , the left ventricular ejection fraction had recovered to 40% with minimal lvad support ( 200 ml / min ) and the lvad was decannulated . the sternum was closed on postoperative day 6 and the patient was weaned from ventilator on postoperative day 9 . a follow - up echo - cardiogram revealed recovered left ventricular function ( ejection fraction , 50% ) with regression of mitral regurgitation ( grade i / iv ) ( fig . patients with coarctation of the aorta usually present in infancy with symptoms of congestive heart failure or with hypertension later in childhood . neonates and infants are symptomatic when blood flow to the lower body is restricted due to pda closure or increased afterload on the left ventricle , resulting in acute congestive heart failure . a clinical review of patients who underwent neonatal repair of coarctation revealed that neonates with an intact ventricular septum had more significant global left ventricular dysfunction than those with ventricular septal defects , suggesting that the pressure load on the left ventricle can be the cause of left ventricular dysfunction . when the heart is exposed to pressure load as adverse remodeling develops under a long - standing pressure load , eccentric hypertrophy with heart failure occurs . some reports have suggested that coarctation in adult patients can be an occult cause of dilated cardiomyopathy . however , aortic coarctation complicated by severely depressed left ventricular function in very early infancy , as occurred in our patient , has rarely been reported . our patient s left ventricular dysfunction and mitral regurgitation recovered after relief of the pressure load caused by coarctation of the aorta . left ventricular dysfunction can be completely restored , even in adult patients diagnosed with dilated cardiomyopathy . for patients with severe left ventricular dysfunction , coarctation of the aorta should be considered as a possible cause that is reversible . repair of aortic coarctation through left thoracotomy is the standard procedure for neonates and infants who have no aortic arch hypoplasia or intracardiac anomalies . however , when the patient s left ventricular function is severely depressed , the patient can not tolerate the sudden increased after - load on the left ventricle during the cross - clamping of the aortic arch . if the patient deteriorates hemodynamically during the clamp - and - sew procedure , it is extremely difficult to perform cannulation for mechanical circulatory support , especially in neonates and small infants . in order to avoid this risky situation , we used a central approach and repaired the aortic coarctation under cpb and regional cerebral perfusion . for patients with cardiogenic shock or hemodynamic instability due to severely depressed left ventricular function , the safety of the central approach outweighs the risks related to cpb and regional cerebral perfusion . if necessary , cpb can be easily converted to a lvad . in order to minimize operation - related myocardial damage coronary perfusion and non - working beating of the heart were maintained during the aortic arch repair . the pfo might be beneficial to vent the left side of the heart for patients with extracorporeal membrane oxygenation ( ecmo ) support . however , for patients with lvad support , if left atrial blood is drained vigorously by a lvad , right atrial blood can be shunted through the pfo , resulting in systemic hypoxemia . perioperative ecmo support with repair of the aortic coarctation under ecmo could have been another option for our patient . currently , ventricular assist devices are preferred for patients with preserved pulmonary function because they are associated with less inflammation , less need for anticoagulation , and better clinical outcomes . in conclusion , coarctation of the aorta can be complicated by severe left ventricular dysfunction , even in early infants . myocardial dysfunction can be reversed with surgical repair of the aortic coarctation , and a central approach with a back - up lvad is a safe and effective treatment strategy for these patients . | a two - month - old infant presented with coarctation of the aorta , severe left ventricular dysfunction , and moderate to severe mitral regurgitation . through median sternotomy , the aortic arch was repaired under cardiopulmonary bypass and regional cerebral perfusion .
the patient was postoperatively supported with a left ventricular assist device for five days . left ventricular function gradually improved , eventually recovering with the concomitant regression of mitral regurgitation .
prompt surgical repair of coarctation of the aorta is indicated for patients with severe left ventricular dysfunction .
a central approach for surgical repair with a back - up left ventricular assist device is a safe and effective treatment strategy for these patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
proximal femoral osteotomy ( pfo ) is the most common major reconstructive surgery in the region of the hip in children and adolescents . the indications are wide and include developmental dysplasia of the hip ( ddh ) , containment in perthes disease , realignment of the proximal femur following slipped capital femoral epiphysis and stabilisation of the hip in a wide range of neuromuscular diseases , the most common of which is cerebral palsy ( cp ) [ 25 ] . implants for proximal femoral osteotomy may be required for internal fixation from approximately the age of 12 months to skeletal maturity and across a range of body weights , typically ranging from 10 kg to more than 120 kg . historically , two - part devices were first used in proximal femoral osteotomy in children , derived from devices used for the fixation of proximal femoral fractures in adults . with time , fixed - angle blade plates became the most widely used implant because of their sound biomechanical basis supported by several large retrospective studies showing excellent results [ 7 , 8 ] . recent developments in fracture fixation , incorporating locking screws to improve the biomechanical construct , have been introduced to implants for internal fixation in proximal femoral osteotomy [ 911 ] . a second significant innovation was the development of a one - piece cannulated blade plate , which can be inserted over a guide wire . the seating chisel is passed over the guide wire to cut the track for the blade plate , which is also inserted over the guide wire . this differs from classical pfo with ao blade plate fixation , in which a guide wire is inserted in the proximal femur and the insertion of the seating chisel and implant is referenced from the position and direction of this wire , but not passed directly over the guide wire [ 7 , 8 ] . the cannulated blade plate concept was described by grant and colleagues in 1990 but has only become widely available commercially in recent years [ 12 , 13 ] . in 2013 , poul and colleagues reported more precise correction of proximal femoral deformities in a study in which the cannulated paediatric osteotomy system ( capos ) was compared to the conventional angled blade plate ( synthes ) . approximately 160 proximal femoral osteotomies per annum are performed at our tertiary - level paediatric hospital . the safety and efficacy of this procedure is therefore very important in our overall service . it is also important for us to be able to teach this surgery to our surgical registrars and fellows . we hypothesised that this new system would offer significant advantages over existing systems , including more stable fixation and an easier and safer learning curve for trainees . we decided to introduce the implant in a controlled fashion and prospectively audit our first 25 patients . our study goals were limited to short - term , technical outcomes of the pfo . given the diverse diagnoses , clinical and functional outcomes would require long - term follow - up of larger , homogeneous subgroups . an excel ( microsoft ) spreadsheet was devised to include demographic details , diagnosis , surgical indications , surgical planning , operation report , the implant used , pre- and post - operative radiographic data and surgical adverse events . the study was conducted under the audit provisions of the hospital s research and ethics committee . this was a prospective cohort study , with consecutive enrolment of all children and adolescents who had a pfo with the pediloc locking cannulated blade plate system ( orthopediatrics ) , between april 1 , 2013 and july 31 , 2014 ( table 1 ) . patient data was entered on an excel spreadsheet from the patient s electronic scanned medical record ( esmr ) , and operation reports and radiological data from the patient archiving and communication system ( pacs ) . pre - operative radiographs were reviewed on synapse ( fujifilm , pacs ) and a number of radiographic parameters measured , relevant to the underlying diagnosis . these included migration percentage ( mp ) , neck shaft angle ( nsa ) and trochanteric height . neck shaft angle was measured from an ap radiograph with the hips internally rotated by an amount equal to the estimated femoral neck anteversion ( fna ) , usually about 40 . fna was measured by the trochanteric prominence test ( tpat ) and confirmed by computed tomography in selected patients . ambulant children with cp had three - dimensional gait analysis to plan single event , multilevel surgery ( semls ) [ 16 , 17].table 1diagnosis , surgical indication , operative procedure and outcome of 25 patients with proximal femoral osteotomy and cannulated locking blade plate fixationiddiagnosisgmfcs levelindicationoperationoutcome1cpvsubluxationbilateral vdros2cpvsubluxationbilateral vdros3cpvsubluxationbilateral vdros4cpvsubluxationbilateral vdros5nmivwindswept hipsbilateral vdros6cpiisemlsbilateral fdoinfection7cpvsubluxationbilateral vdros8cpvsubluxationbilateral vdros9cpvsubluxationbilateral vdros10cpiisemlsbilateral fdos11lcptdcoxa vararight valgus pfos12cpvdislocationbilateral vdros13cpivsubluxationbilateral vdros14cpvsubluxationbilateral vdros15metabolicvfractureleft hip fracture orifs16nmvsubluxationbilateral vdros17cpiiisemlsbilateral fdos18cpivsubluxationbilateral vdros19cpivsubluxationbilateral vdros20cpiisemlsbilateral fdos21ddhtdsubluxationleft vdros22lcptdcontainmentright vdreos23ddhtddislocationor / left vdrounknown24metabolicivsubluxationbilateral vdros25cpiisemlsbilateral fdos
cp cerebral palsy , nm neuromuscular , lcp legg calv perthes disease , ddh developmental dysplasia of the hip , gmfcs gross motor function classification system , td typically developing , vdro varus derotation osteotomy , fdo femoral derotation osteotomy , pfo proximal femoral osteotomy , or open reduction , orif open reduction internal fixation , vdreo varus derotation extension osteotomy , s satisfactory : defined as no change in the position of the implant between the time of surgery and latest follow - up , union within 6 weeks in children and 12 weeks in adolescents , and all technical goals of surgery achieved diagnosis , surgical indication , operative procedure and outcome of 25 patients with proximal femoral osteotomy and cannulated locking blade plate fixation
cp cerebral palsy , nm neuromuscular , lcp legg calv perthes disease , ddh developmental dysplasia of the hip , gmfcs gross motor function classification system , td typically developing , vdro varus derotation osteotomy , fdo femoral derotation osteotomy , pfo proximal femoral osteotomy , or open reduction , orif open reduction internal fixation , vdreo varus derotation extension osteotomy , s satisfactory : defined as no change in the position of the implant between the time of surgery and latest follow - up , union within 6 weeks in children and 12 weeks in adolescents , and all technical goals of surgery achieved sequential radiographs were obtained before discharge from hospital and at 3 , 6 and 12 weeks after surgery . for the purposes of this study , bony union was defined as the presence of bridging callus across > 75 % of the osteotomy surface as well as external , medial bridging callus . the time to union was noted and the position of the implants studied on pacs at each interval , specifically looking for signs of union and any change in position of the implant or osteotomy . technical outcomes of the surgery including femoral head cover ( mp ) and change in neck shaft angle were also observed . changes in mp and nsa in the non - ambulant cp [ gross motor function classification system ( gmfcs ) iv and v ] subgroup were compared using paired t tests with p < 0.05 . pfos were performed under general anaesthesia , peri - operative intravenous antibiotics and insertion of an epidural catheter and bladder catheter when considered appropriate [ 16 , 18 ] . the lower limbs were prepared and draped free and a preliminary fluoroscopic examination was performed to confirm adequate range of motion , that any subluxation of the femoral head was reducible and that the goals of surgery were technically feasible . the need for additional soft tissue releases and bony procedures was also assessed , including adductor and psoas releases , open reduction of the hip and pelvic osteotomy [ 1619 ] . biplanar fluoroscopy was used throughout the procedure with the c - arm in a fixed position over the operated hip . the lateral radiographs were obtained by moving the operated limb into a flexed , abducted position . the proximal femur was exposed subperiosteally with careful retraction of the vastus lateralis to preserve its nerve and blood supply . a suitable entry for the insertion of the guide wire was marked using a combination of analysis of the surgical goals , the likely implant to be used and the patient s specific anatomy . for the most common procedure ( varus derotation osteotomy in cp ) the goal was a nsa of 100 and complete containment of the femoral head . the guide wire was inserted into the centre of the femoral neck on both ap and lateral radiographic projections and a 100 plate of the appropriate width and length was selected . selection of the blade width was aided by passing a seating chisel over the guide wire and , in the flexed - abducted view , checking fluoroscopically that the chisel ( and plate ) would be able to cross the isthmus of the neck without risk of penetration or fracture . the appropriate seating chisel was used to cut a track for the selected blade plate ; the seating chisel and blade plate were matched . attention was given to cutting the track collinear with the guide wire to avoid inadvertent advancement or removal of the guide wire . the appropriate osteotomy was then marked and performed using an oscillating saw with the appropriate spacing device to make sure that the cut was at an appropriate distance from the seating chisel . depending on the correction desired , the second cut was made on the distal fragment to improve the reduction of the osteotomy and coaptation of the fragments [ 18 , 19 ] . if there was a significant medial offset , then a third cut was made on the lateral surface of the proximal fragment to recess the plate against the femur . this had the added advantages of increasing proximal stability and preventing implant prominence and soft tissue irritation . a reduction clamp was then used to finalise the position of the implant with respect to both parts of the proximal femur . preliminary fixation was performed using a non - locking screw to achieve compression at the osteotomy site . fixation was then completed using the requisite number of locking and non - locking screws ( fig . 1 ) . the hip was put through a range of motion to ensure that fixation was stable . the fluoroscopic images were also scrutinised to determine whether the goals of surgery had been achieved : e.g. , femoral head cover . the stability of fixation was assessed and this determined the need for hip spica casting , restricted weight - bearing or immediate mobilisation ( fig . 2 ) . the guide wire was removed and , following irrigation , the incision was closed in layers . routine post - operative care was provided with formal imaging of the osteotomy prior to discharge from hospital . immediate range of motion , physiotherapy and full weight - bearing as tolerated was encouraged in all patients apart from one 3-year - old girl with ddh who had a revision open reduction and capsulorraphy.fig . 1cannulated locking blade plate fixation in a sawbone model of vdro of the proximal femur . two locking towers are in position , in the first screwhole ( which is inserted into the proximal metaphysis ) and the third screwhole ( which is inserted into the diaphysis ) . the remaining screwholes , the second and fourth , are for non - locking screws and offer the opportunity for compression prior to the insertion of the locking screwsfig . the guide wire has been inserted close to the centre of the proximal femoral metaphysis and advanced across the proximal femoral growth plate and into the triradiate cartilage to stabilise the open reduction . c the 90 toddler plate has been bent to change the nsa to 100. the osteotomy and shortening have been performed and the blade plate has been inserted and fixation screws placed . d the guide wire has been partially removed to check the stability of the open reduction and the stability of the vdro . following this , the guide wire was removed and a hip spica cast applied , the only hip spica in the series cannulated locking blade plate fixation in a sawbone model of vdro of the proximal femur . two locking towers are in position , in the first screwhole ( which is inserted into the proximal metaphysis ) and the third screwhole ( which is inserted into the diaphysis ) . the remaining screwholes , the second and fourth , are for non - locking screws and offer the opportunity for compression prior to the insertion of the locking screws four fluoroscopic images showing the sequence of fixation using the cannulated locking blade plate . a revision anterolateral open reduction has been performed for left ddh . the guide wire has been inserted close to the centre of the proximal femoral metaphysis and advanced across the proximal femoral growth plate and into the triradiate cartilage to stabilise the open reduction . c the 90 toddler plate has been bent to change the nsa to 100. the osteotomy and shortening have been performed and the blade plate has been inserted and fixation screws placed . d the guide wire has been partially removed to check the stability of the open reduction and the stability of the vdro . following this , the guide wire was removed and a hip spica cast applied , the only hip spica in the series all patients were followed closely after surgery to monitor healing , function and surgical adverse events ( saes ) . descriptive statistics were obtained from excel , including means and standard deviations ( sds ) . statistical analyses were performed using stata statistical software , release 13 ( statacorp , college station , texas , usa ) . pfos were performed under general anaesthesia , peri - operative intravenous antibiotics and insertion of an epidural catheter and bladder catheter when considered appropriate [ 16 , 18 ] . the lower limbs were prepared and draped free and a preliminary fluoroscopic examination was performed to confirm adequate range of motion , that any subluxation of the femoral head was reducible and that the goals of surgery were technically feasible . the need for additional soft tissue releases and bony procedures was also assessed , including adductor and psoas releases , open reduction of the hip and pelvic osteotomy [ 1619 ] . biplanar fluoroscopy was used throughout the procedure with the c - arm in a fixed position over the operated hip . the lateral radiographs were obtained by moving the operated limb into a flexed , abducted position . the proximal femur was exposed subperiosteally with careful retraction of the vastus lateralis to preserve its nerve and blood supply . a suitable entry for the insertion of the guide wire was marked using a combination of analysis of the surgical goals , the likely implant to be used and the patient s specific anatomy . for the most common procedure ( varus derotation osteotomy in cp ) the goal was a nsa of 100 and complete containment of the femoral head . the guide wire was inserted into the centre of the femoral neck on both ap and lateral radiographic projections and a 100 plate of the appropriate width and length was selected . selection of the blade width was aided by passing a seating chisel over the guide wire and , in the flexed - abducted view , checking fluoroscopically that the chisel ( and plate ) would be able to cross the isthmus of the neck without risk of penetration or fracture . the appropriate seating chisel was used to cut a track for the selected blade plate ; the seating chisel and blade plate were matched . attention was given to cutting the track collinear with the guide wire to avoid inadvertent advancement or removal of the guide wire . the appropriate osteotomy was then marked and performed using an oscillating saw with the appropriate spacing device to make sure that the cut was at an appropriate distance from the seating chisel . depending on the correction desired , the second cut was made on the distal fragment to improve the reduction of the osteotomy and coaptation of the fragments [ 18 , 19 ] . if there was a significant medial offset , then a third cut was made on the lateral surface of the proximal fragment to recess the plate against the femur . this had the added advantages of increasing proximal stability and preventing implant prominence and soft tissue irritation . a reduction clamp was then used to finalise the position of the implant with respect to both parts of the proximal femur . preliminary fixation was performed using a non - locking screw to achieve compression at the osteotomy site . fixation was then completed using the requisite number of locking and non - locking screws ( fig . 1 ) . the hip was put through a range of motion to ensure that fixation was stable . the fluoroscopic images were also scrutinised to determine whether the goals of surgery had been achieved : e.g. , femoral head cover . the stability of fixation was assessed and this determined the need for hip spica casting , restricted weight - bearing or immediate mobilisation ( fig . 2 ) . the guide wire was removed and , following irrigation , the incision was closed in layers . routine post - operative care was provided with formal imaging of the osteotomy prior to discharge from hospital . immediate range of motion , physiotherapy and full weight - bearing as tolerated was encouraged in all patients apart from one 3-year - old girl with ddh who had a revision open reduction and capsulorraphy.fig . 1cannulated locking blade plate fixation in a sawbone model of vdro of the proximal femur . two locking towers are in position , in the first screwhole ( which is inserted into the proximal metaphysis ) and the third screwhole ( which is inserted into the diaphysis ) . the remaining screwholes , the second and fourth , are for non - locking screws and offer the opportunity for compression prior to the insertion of the locking screwsfig . the guide wire has been inserted close to the centre of the proximal femoral metaphysis and advanced across the proximal femoral growth plate and into the triradiate cartilage to stabilise the open reduction . c the 90 toddler plate has been bent to change the nsa to 100. the osteotomy and shortening have been performed and the blade plate has been inserted and fixation screws placed . d the guide wire has been partially removed to check the stability of the open reduction and the stability of the vdro . following this , the guide wire was removed and a hip spica cast applied , the only hip spica in the series cannulated locking blade plate fixation in a sawbone model of vdro of the proximal femur . two locking towers are in position , in the first screwhole ( which is inserted into the proximal metaphysis ) and the third screwhole ( which is inserted into the diaphysis ) . the remaining screwholes , the second and fourth , are for non - locking screws and offer the opportunity for compression prior to the insertion of the locking screws four fluoroscopic images showing the sequence of fixation using the cannulated locking blade plate . a revision anterolateral open reduction has been performed for left ddh . the guide wire has been inserted close to the centre of the proximal femoral metaphysis and advanced across the proximal femoral growth plate and into the triradiate cartilage to stabilise the open reduction . c the 90 toddler plate has been bent to change the nsa to 100. the osteotomy and shortening have been performed and the blade plate has been inserted and fixation screws placed . d the guide wire has been partially removed to check the stability of the open reduction and the stability of the vdro . following this , the guide wire was removed and a hip spica cast applied , the only hip spica in the series all patients were followed closely after surgery to monitor healing , function and surgical adverse events ( saes ) . descriptive statistics were obtained from excel , including means and standard deviations ( sds ) . statistical analyses were performed using stata statistical software , release 13 ( statacorp , college station , texas , usa ) . between april 1 , 2013 and july 31 , 2014 , 45 proximal femoral osteotomies were performed in 25 children and adolescents . the majority of pfos were performed by registrars and fellows , under the supervision of the senior authors . there were 13 boys and 12 girls with a mean age of 7 years and 9 months ( range of 317 years ) and a mean weight of 22.7 kg ( range 1166 kg ) . mean follow - up was 9 months ( sd range 420 months ) . all children were followed to bony union apart from one girl with ddh who moved to another state , within 4 weeks of surgery , whilst in hip spica cast . seventeen children had cerebral palsy , two had other neuromuscular diseases , two had ddh , two had metabolic disease and two had perthes disease . five ambulant children with cp had bilateral external rotation pfos to improve gait , 15 children with cp / other neuromuscular and metabolic disorders had bilateral varus derotation osteotomies ( vdros ) for hip subluxation , two girls with ddh had unilateral vdros , one boy with perthes disease had unilateral vdro for containment and another boy with perthes disease had valgus osteotomy for coxa vara . one child with a metabolic disorder had fixation of an insufficiency fracture . in the cp / neuromuscular group who had bilateral vdros for hip subluxation ( fig . 3 ) , the mean mp pre - operatively was 48 % ( sd 24 % ) and post - operatively was 11 % ( sd 13 % ) the mean nsa was 155 ( sd 9.6 ) and the mean post - operative nsa was 112 ( sd 9 ) . these changes were significant at p < 0.001 . the ambulant cp group had satisfactory correction of internal rotation gait clinically , which was confirmed on gait analysis in the first two patients who have had follow - up gait analysis ( figs . 4 , 5).fig . 3right hip dislocation in a 5-year - old boy with severe cerebral palsy and poor nutritional status , weighing 12 kg . bilateral vdros with the infant plate showing containment of both hips , sound bony union with no loss of position and no requirement for a hip spica castfig . a left hip abduction contracture and right hip adduction contracture were released and combined with bilateral vdros using 40 mm , 90 child plates . this is the simplest type of osteotomy because the guide wire , chisel and blade plate are placed centrally in the proximal metaphysisfig . 5bilateral fdos with the 100 cannulated locking blade plate , in a 10-year old boy with cerebral palsy , gmfcs level ii , undergoing semls . the goal was a 40 external rotation correction on both sides with no change in nsa . note the position of the tip of the blade in the strong bone of the calcar and inferior femoral neck . the patient mobilised full weight - bearing within a week of surgery and had excellent correction of internal rotation gait right hip dislocation in a 5-year - old boy with severe cerebral palsy and poor nutritional status , weighing 12 kg . bilateral vdros with the infant plate showing containment of both hips , sound bony union with no loss of position and no requirement for a hip spica cast windswept hips in a 7-year - old boy with a neuromuscular disease . a left hip abduction contracture and right hip adduction contracture were released and combined with bilateral vdros using 40 mm , 90 child plates . this is the simplest type of osteotomy because the guide wire , chisel and blade plate are placed centrally in the proximal metaphysis bilateral fdos with the 100 cannulated locking blade plate , in a 10-year old boy with cerebral palsy , gmfcs level ii , undergoing semls . the goal was a 40 external rotation correction on both sides with no change in nsa . note the position of the tip of the blade in the strong bone of the calcar and inferior femoral neck . the patient mobilised full weight - bearing within a week of surgery and had excellent correction of internal rotation gait in the two girls with ddh , one achieved correction of long leg dysplasia by a pfo which included 30 derotation , 10 varus and 1 cm of shortening . in the other girl , vdro was used to stabilise a revision open reduction with varus of 20 , derotation of 40 and shortening of 1 cm ( fig . 2 ) . the boy with perthes disease had satisfactory containment following varus of 15 , extension of 15 and external rotation of 20. the second boy with perthes disease had satisfactory correction of iatrogenic coxa vara by valgus pfo of 30. his mean pre - operative nsa of 94 was corrected to 134 post - operatively . 6iatrogenic coxa vara in a 10-year - old boy previously treated by vdro for perthes disease . the preoperative nsa was 94. a valgus proximal femoral osteotomy was formed with a 90 plate and the nsa was restored to 132 , with correction of limb length discrepancy and the abductor insufficiency . a pelvic osteotomy will be required in due course iatrogenic coxa vara in a 10-year - old boy previously treated by vdro for perthes disease . the preoperative nsa was 94. a valgus proximal femoral osteotomy was formed with a 90 plate and the nsa was restored to 132 , with correction of limb length discrepancy and the abductor insufficiency . a pelvic osteotomy will be required in due course there were no delayed unions , mal - unions or loss of position . one boy with neuromuscular disease and impaired immunity had a low - grade staphylococcus epidermidis infection . the infection was asymptomatic and was only recognised at the time of routine plate removal by the culture of a small amount of fluid which was present around the blade of the implant . this was a grade iii complication , according to the modified clavien dindo system . proximal femoral osteotomy is an important reconstructive option in the management of a wide range of hip pathology in children and adolescents [ 18 ] . the implants for this procedure have paralleled advances in implant technology for fixation of proximal femoral fractures and osteotomies in adults [ 611 ] . more recently , developments in cannulated device technology along with locking plate technology have been combined into a new system , which appears to have the versatility to cover the full range of reconstructive requirements from birth to skeletal maturity in children s orthopaedics . the principles and surgical approach are built solidly on the foundations of previous technology and require only minor modifications . we conducted an audit of our first 25 patients to determine the complication rate during the learning curve as well as the ability of established and trainee surgeons to learn how to use the new system . technically , the system performed faultlessly with no loss or change of position between the insertion of implants and bony union at 612 weeks after surgery . the stability of fixation was felt to be adequate , even in younger children with cp who had hypertonia , nutritional impairment and osteopenia . apart from one girl with an open reduction of ddh , hip spicas were not used . no restrictions were placed on mobility or weight - bearing , which was a major advantage for early rehabilitation after semls . despite this immediate mobilisation policy , there were no changes in implant position , and the technical goals of all procedures were achieved . this zero revision rate compares favourably with both older and newer systems such as the richards intermediate hip screw , the ao blade plate and the pediatric lcp plate [ 7 , 8 , 10 , 11 ] . in addition , older systems were more likely to be followed by hip spica casting , which has high costs in terms of time and materials , is inconvenient for families and is associated with significant morbidity [ 8 , 10 , 17 , 18 , 21 , 22 ] . the lcp system also employs a locking screw technology but there are significant restrictions on the choice of nsa , given that most commercial systems have only two side - plate angles for varus correction [ 11 , 12 ] . in addition , delayed union seems to be a problem with the lcp system , where the fixation system seems to be too rigid for some paediatric indications [ 10 , 11 ] . the limitations of our study include the wide range of ages and indications , the concentration on purely technical and not functional outcomes and the small number of patients and osteotomies . in addition , a detailed study of attitudes and comfort levels from trainees at different levels will be conducted again in comparison with existing non - cannulated , non - locking technology . | backgroundproximal femoral osteotomy is the most common major reconstructive surgery in the region of the hip joint in children and adolescents .
given that it may be required across a wide range of ages and indications , appropriate instrumentation is necessary to ensure a technically satisfactory result .
recent developments in fixation include cannulation of the blade plate and locking screw technology.methodswe conducted a prospective audit of our first 25 patients who had a unilateral or bilateral proximal femoral osteotomy using a recently available system which combines cannulation and locking plate technology .
the principal outcome measures were the radiographic position of the osteotomy at the time of union and surgical adverse events.resultsforty-five proximal femoral osteotomies were performed in 25 patients , mean age 8 years ( range 317 years ) , for a variety of indications , the most common of which was hip subluxation in children with cerebral palsy .
all osteotomies were soundly united by 6 weeks in children and by 3 months in adolescents , in the position achieved intra - operatively .
there were no revision procedures and the technical goals of surgery were achieved in all patients .
there was one adverse event , a low - grade peri - prosthetic infection , diagnosed at the time of implant removal.conclusionsin this prospective audit of our first 25 patients , the new system performed well across a wide range of ages , body weights and surgical indications .
further comparative studies will be required to determine whether it offers additional advantages over more traditional systems . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
icodextrin is an alternative to the hyperosmolar glucose containing solutions in peritoneal dialysis ( pd ) . icodextrin is an iso - osmolar dialysis solution that consists of a mixture of high molecular weight water - soluble polymers of glucose , isolated by the fractionation of hydrolyzed cornstarch , which induces sustained transcapillary ultrafiltration through colloid osmosis during dwells of > 12 h. peritoneal ultrafiltration with icodextrin is ideal than the 1.36% and 2.27% glucose solutions , and in general , comparable with the 3.86% glucose solution . this review focuses on the clinical effects of icodextrin on the sodium and fluid balance in pd . furthermore , the discrepant effects of icodextrin on blood pressure control and residual renal function ( rrf ) are also discussed . the effects of icodextrin on the peritoneal membrane , biocompatibility and its side effects are also discussed . among the several studies on icodextrin , two randomized controlled trials have been studied on the effects of icodextrin on fluid status [ 37 ] . the two randomized controlled trials showed a reduction in extracellular water ( ecw ) or total body water ( tbw ) with the use of icodextrin . in the study by konings et al . , the left ventricular mass decreased in the group randomized to icodextrin . woodrow et al . inferred that the ecw and tbw decline with the use of icodextrin in automated peritoneal dialysis ( apd ) patients . in the cross - sectional study by boudville et al . , the apd patients on icodextrin had a significantly lower ratio between the ecw and intracellular water , compared with patients treated with conventional glucose solutions . ultimately , there appears to be an overall agreement between the studies concerned with the effects of icodextrin on volume status . the use of icodextrin may also reduce the dropout from pd treatment in a recent retrospective study from japan , the treatment dropout rate and even mortality were significantly reduced in patients treated with icodextrin . despite the fact that continuous fluid removal can be achieved with pd , chronic fluid overload is a common problem , particularly in anuric pd patients , leading to the high prevalence of hypertension and left ventricular hypertrophy in them . one of the contributing factors to chronic fluid overload in pd patients is the decline in the peritoneal ultrafiltration capacity , caused by diabetiform alterations of the peritoneal capillaries , due to the long - term effects of high glucose concentrations in the peritoneal cavity . this leads to an increased uptake of the glucose from the pd solution into the peritoneal capillaries , and a subsequent loss of the osmotic gradient and ultrafiltration capacity . to increase the peritoneal ultrafiltration , higher glucose concentrations are prescribed , resulting in greater exposure of the peritoneal membrane to glucose and increasing peritoneal damage . predominantly , in patients with high transport ultrafiltration failure of the peritoneal membrane , the use of conventional glucose solutions may result in insufficient peritoneal fluid removal , owing to the rapid uptake of glucose through the peritoneal membrane . in addition to the loss of peritoneal ultrafiltration capacity , a progressive decline in rrf and a subsequent loss of urine production have an adverse impact on the balance between the fluid intake and removal in pd patients . in the study by gunal et al . , a significant decrease in the blood pressure and cardiothoracic index was observed when the peritoneal ultrafiltration was increased with the use of hypertonic glucose solutions . however , in our research , the rrf and urine volume declined to a highly significant degree . , despite an increase in the peritoneal ultrafiltration , no adverse effects were observed on the rrf . . showed that the rrf was better preserved with the use of icodextrin than with the standard glucose solutions . as discussed earlier , it has been suggested that a relative preservation of the intravascular volume , due to the oncotic effect of the icodextrin metabolites , might be an important factor concerned with the preservation of renal function , despite the reduction in ecw . also , the results from the nepp study did not suggest any adverse effects of the use of icodextrin on rrf . in contrast , the findings of konings et al . revealed a much higher baseline rrf and a greater decline in the rrf with the use of icodextrin , when compared with the results of davies et al . and plum et al . probably , the patients in konings study may have been less overfilled at the baseline , although a direct comparison between the fluid status in the various studies can not be made . however , it is quite likely that the arterial underfilling played a role in the decline of rrf in konings study . four patients were found to be severely underfilled ( according to the normalized ecw values ) . when the underfilled patients after icodextrin treatment were excluded from the analysis , the decline in rrf did not differ much between the patients treated with icodextrin and the control subjects ( 1.0 1.6 versus 0.6 0.8 ml / min ; p = 0.6 ) , whereas the fall in rrf in the underfilled patients was higher than the other subjects ( 3.2 2.4 ml / min versus 1.0 1.6 patients with a more advanced decline in rrf , as documented in the studies by davies and plum , may have been more overfilled at the start of the study , and therefore , it is less likely that the use of icodextrin would have resulted in underfilling . the net sodium balance in pd depends on the sodium intake , urinary sodium excretion and peritoneal sodium removal . peritoneal sodium removal appears to be increased with the use of icodextrin , which may be due to both the enhanced ultrafiltration and the reduction in sodium sieving , due to the induction of ultrafiltration by colloid osmosis during the use of icodextrin , with a lesser role for aquaporin - mediated water transport . with a strict sodium restriction and an increased use of 3.86% glucose solutions , gunal et al . observed a reduction in blood pressure in the overfilled continuous ambulatory peritoneal dialysis ( capd ) patients . in contrast , despite an improvement in the fluid status , the use of icodextrin did not result in the decrease in blood pressure in the studies by davies et al . and konings et al . , and even appeared to result in a small increase in blood pressure in the study by plum et al . . in contrast , according to the study by woodrow et al . , the systolic blood pressure declined in the apd patients , who switched over to icodextrin for the long dwell . first , the improvement in fluid status ( mean decline in ecw , which was 1.7 l and 1.0 l , according to konings et al . and davies et al . , respectively ) might have been too small to bring about a significant improvement in the blood pressure control . indeed , the decline in the body weight , with the approach of gunal et al . , using hypertonic glucose solutions , was much larger ( 4 kg ) . second , owing to the oncotic effect of icodextrin metabolites that enter the systemic circulation , the blood volume might have remained relatively stable in icodextrin - treated patients , despite a decrease in ecw . third , in some of the studies , the observational period might be too short to monitor the changes in the blood pressure owing to the lag phenomenon , although this holds true for the long - term studies , such as those by konings et al . and davies et al . as sodium balance is dependent on the relation between the intake and output , especially in anuric pd patients , a reduction in sodium intake , along with the use of icodextrin is vital to maintain the sodium balance with less increase in the extracellular volume and blood pressure , compared with the conventional glucose - containing solutions . the maintenance of sodium balance is also important for volume - dependent effects . in this aspect , a reduction in the tissue renin angiotensin aldosterone system activity , due to sodium restriction , could have additional beneficial effects on the blood pressure control and cardiovascular structure . also , the recent concept of non - osmotic storage of sodium in the body , especially in the skin , may be significant , although its relevance is still unknown . because of the oncotic effect of icodextrin metabolites that enter the systemic circulation , resulting in thirst , increased fluid intake and subsequently to pseudohyponatraemia , the blood volume might have remained relatively stable in icodextrin - treated patients , in spite of the decrease in ecw . some icodextrin metabolites might enter the systemic circulation , after being degraded to oligosaccharides ( maltose , maltotriose and maltotetraose ) and eventually to glucose . , that the atrial natriuretic peptide , a surrogate marker of the intravascular fluid status , did not decline in the icodextrin - treated patients , whereas it decreased in patients treated with standard glucose solutions . in another study in contrast , the fact that the left ventricular mass decreased in the study by konings et al . suggests that the intravascular volume also declines . thus , the effects of icodextrin on surrogate markers of intravascular fluid volume remain to be elucidated . available indirect evidence would suggest that with a small decline in ecw , the intravascular fluid volume remains stable or even increases with the use of icodextrin , potentially due to the oncotic effects of the icodextrin metabolites , whereas with larger declines in ecw , the intravascular volume also decreases . future studies , assessing changes in the plasma volume after icodextrin prescription , are required to confirm this hypothesis . icodextrin has a ph of 5.8 , uses lactate as a buffer and contains relatively low levels of glucose degradation products ( gdp ) , such as glyoxal ( go ) , methylglyoxal ( mgo ) and 3-deoxyglucosone ( 3-dg ) , compared with the 1.36% glucose solutions . the gdps are reactive carbonyl compounds , which may , among others , induce the production of advanced glycation end products ( age ) . although their relevance with pd is not completely elucidated , age compounds may have adverse effects on the peritoneal membrane and cardiovascular status . owing to the reduction in gdps , the icodextrin may seek to reduce age formation , becoming more biocompatible than the conventional glucose - containing dialysis solutions . indeed , ueda et al . showed a significantly lower generation of n - carboxymethyllysine ( cml ) , as compared with the standard 1.36% glucose solutions . a significant reduction in the carbonyl stress and lower cml generation was observed during a single dwell of icodextrin , when compared with the standard 1.36% glucose solutions . posthuma et al . also observed lower formation of age products after in vitro incubation of albumin with icodextrin , when compared with the conventional glucose solutions . on the other hand , konings et al . found an increase in plasma and dialysate levels of cml after treatment with icodextrin , whereas gottloib et al . observed an increase in thiobarbituric acid reactive substances ( suggesting an increase in lipid peroxidation ) in the peritoneal effluent , and dysplastic changes of mesothelial cells in rats , after exposure to icodextrin . when compared with the bicarbonate / lactate buffered solutions , in vivo studies after long - term exposure to standard lactate - buffered solutions showed greater loss in ultrafiltration capacity , increased vascular endothelial growth factor ( vegf ) expression and vascular density , higher age concentrations , upregulation of tumour growth factor ( tgf- ) expression and development of fibrosis . after exposure to icodextrin , in vitro studies showed an improved phagocytic and respiratory burst activity in polymorphonuclear cells and monocytes , when compared with glucose - based solutions . improved proliferation of mesothelial cells was observed after incubation with icodextrin , when compared with glucose - based solutions . in contrast , exposure of mesothelial cells to undiluted icodextrin showed a reduction in cell viability and proliferation , and damage of dna , similar to glucose - based solutions . cancer antigen 125 ( ca125 ) is produced in the peritoneal cavity by the mesothelial cells and can be detected in dialysis effluents . in the nepp study , levels of ca125 in a standard pd regimen ( spd ; 4 dwells glucose lactate based ) were compared with a low glucose - gdp regimen ( nepp ; 1 dwell amino acids , 1 dwell icodextrin and 2 dwells bicarbonate / lactate - buffered glucose - based solution ) . the ca125 levels declined more after initiating capd with the spd regimen and remained lower than that resulting from the treatment with nepp , suggesting that non - glucose solutions may have less detrimental effects on mesothelial cell mass and probably on the peritoneal membrane . on the other hand , the nepp regimen was associated with an increase in il-6 , il-8 and vegf . besides , according to a recent study by katsutani et al . , a reduction in plasminogen activator inhibitor-1 and tissue - type plasminogen activator may be implicated to the fibrogenesis in human peritoneal mesothelial cells . also , in the eapos study , longitudinal changes in the peritoneal membrane function ( increase in solute transport and reduction in ultrafiltration capacity ) were more pronounced in anuric patients , treated with conventional glucose solutions , than the icodextrin - treated patients . this suggests a beneficial effect of the use of icodextrin in the preservation of the peritoneal membrane . still , we believe that until now , the clinical effects of icodextrin on the preservation of peritoneal membrane integrity are still not completely elucidated and should be the focus for future studies . despite the beneficial effects of icodextrin in increased peritoneal sodium removal , improved fluid status , lipid profiles and possible diabetic control , there are also a few important clinical side effects , which deserve mention . however , reports of severe cutaneous hypersensitivity reactions to icodextrin remain rare and may have different presentations . three patients developed a vesicular rash on their palms after starting treatment with icodextrin , but they were able to continue their treatment . , a woman with a generalized exfoliative dermatitis , secondary to an allergic reaction to icodextrin , was reported , and she had to discontinue taking icodextrin . at the moment , the overall incidences of allergic reactions are unknown . primarily in the years 2001 and 2002 , this complication has been attributed to peptidoglycan contamination of the dialysate by the gram - positive bacteria , alicyclobacillus acidocaldarius . since the implementation of corrective actions , the incidence of aseptic peritonitis due to icodextrin has declined . the concentration of icodextrin metabolites reaches steady - state levels within 2 weeks and remains stable throughout the duration of the polymer use . in the long - term study , exposure to these levels of maltose and oligosaccharides over 3 years represent the longest exposure of these substances in the uraemic patients , without any clinical or metabolic adverse effects , providing an important evidence of safety . icodextrin and its metabolites may , to a small degree , be transported from the peritoneum to the systemic circulation by lymphatic transport . after 6 weeks of treatment with icodextrin , the total serum icodextrin and metabolite concentration was found to be 5.2 mg / ml . this was observed to have implications on the blood glucose measurement methods , based on glucose dehydrogenase pyrroloquinolinequinone - based methods ( gdh - pqq ) , which could lead to an overestimation of blood glucose and undetected hypoglycaemia . recently , in a norwegian study , the serum glucose was measured simultaneously in the venous blood , using the laboratory reference method ( hexokinase ) , and compared with eight glucometers . two assays , the ascensia contour ( bayer healthcare diagnostic division , new york , usa ) and the accu - chek ( roche diagnostics , indianapolis , usa ) , showed > 60% higher glucose values than the reference method . both glucometers were based on the gdh - pqq method and thus should not be used in diabetic pd patients treated with icodextrin . in patients using icodextrin , the serum amylase activity is significantly lower than in those treated only with glucose - based solutions , which may have implications on the diagnosis of pancreatitis . in patients treated with icodextrin and suspected of pancreatitis improvement in fluid status due to its sustained transcapillary ultrafiltration during the long dwell period may lead to more peritoneal sodium removal and maintenance of sodium balance . icodextrin induces less production of age , which has the potential positive long - term effects on cardiovascular status and peritoneal membrane function . despite many similarities in the results of various clinical studies on icodextrin , the few discrepancies , mainly concerning the effects of icodextrin on blood pressure control and rrf , should be the focus of further studies . furthermore , studies concerning the long - term effects of icodextrin on peritoneal membrane function are anticipated with great interest . | objective .
this study reviews the relevant publications on the clinical effects of icodextrin in peritoneal dialysis ( pd).design .
the study provides a systematic review of the literature ( medline search with icodextrin as the keyword).results .
icodextrin induces sustained transcapillary ultrafiltration during long dwell periods .
it also stimulates increased removal of sodium by the peritoneal membrane , reduction of extracellular water ( ecw ) and total body water ( tbw ) .
effects of icodextrin on blood pressure control and residual renal function are discrepant .
icodextrin induces a reduction in the formation of advanced glycation end - products , while the longitudinal changes in the peritoneal membrane transport are less prominent.conclusions .
use of icodextrin in pd improves the sodium and fluid balance .
icodextrin is potentially more biocompatible , when compared with the conventional glucose solutions .
the side effects are rare . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
obstetric anal sphincter injuries ( oasis ) after vaginal delivery can affect a woman 's physical and mental health , as well as future pregnancies . up to 57% of women with oasis may have fecal and flatal incontinence persisting at long - term follow - up , and further worsens after subsequent delivery in around 20% of cases . the risk of a severe perineal tear is increased five - fold in her subsequent delivery . the reported incidence of oasis varied among various countries from < 1% to 11% , and increased over time in wales , england , and denmark to around 6% . the latest report from united states in 2015 suggestive of 4.4% ( 309 , 109/7 , 096 , 056 ) had an oasis after vaginal delivery . among the various risk factors of oasis , use of forceps delivery is the most significant one , with an odds ratio ( or ) of 5.6 even if routinely combined with mediolateral episiotomy , and it has been found to associate with a higher risk then ventouse . another interest literature report from united kingdom in 2015 suggested kielland 's forceps has a similar rate of 3- and 4-degree perineal tear compared with low forceps delivery . in this report , there are 279/1492 women ( 19% ) having oasis after forceps delivery . while ventouse delivery without episiotomy was a significant risk factor with an or of 3 that with routine episiotomy was not . although the use of median episiotomy increased the risk of oasis , the results of the various studies on the effect of mediolateral episiotomy causing oasis were conflicting . reported higher risk of oasis in primiparous than multiparous women with an or of 3.84 . there was lack of published data in chinese population ; the reported figure was increased from 0.03% to 0.08% in period of the year 2004 to the year 2009 in hong kong territory - wide audit conducted by hong kong college of obstetricians and gynecologists . however , the reported figure is very low when compared with other worldwide literature . besides , there was no report on studying the risk of oasis specifically for nonrotational outlet forceps . whether the latter is associated with a less severe perineal trauma than mid - level , and rotational forceps is not known . our hospital is one of the tertiary referral and major obstetrics departments in hong kong with around 55006000 annual delivery , mostly belonged to chinese ethnicity . the aim of the present study is to determine the incidence and risk factors of oasis in chinese women . it may help to determine the possible avoidable risk factors , and hence reduce the incidence of oasis in future . all women delivered vaginally in a hong kong tertiary referral obstetrics and gynaecology centre by spontaneous vaginal delivery / ventouse delivery / forceps delivery whom has been suffered from oasis between january 1 , 2011 and june 30 , 2014 were reviewed . additionally , women whom had antenatal care in our center but delivered in another obstetric unit because of whatever reasons were excluded from this study . in our center , all pregnant women were encouraged to attempt vaginal delivery except there is recognized indication for elective cesarean section such as breech presentation , multiple previous cesarean section , placenta previa . before vaginal delivery , women are allowed to express their choice of not having routine episiotomy at onset of labor except clinical necessity such as instrumental delivery . their choice would be followed by labor room midwives or obstetricians as far as clinically safe for patient . in our unit , all midwives are registered under the midwives council of hong kong and able to perform delivery independently . for qualification of doctors , all the doctors can perform vaginal delivery or instrumental delivery independently after certified training certified by the hong kong college of obstetricians and gynecologists . if the patient has no contrary intention to routine episiotomy , a mediolateral episiotomy would be made upon delivery . instrumental delivery including ventouse or forceps delivery would be performed for clinical indication such as prolonged second stage of labor , fetal bradycardia , and persistent occipito - posterior position . forceps delivery will be used for obstetric emergency condition such as fetal distress and cord prolapse , or when ventouse delivery is contraindicated such as suspected fetal hemorrhagic disorder or prematurity . for other nonspecific indications of instrumental delivery , choice of forceps or ventouse delivery would depend on the preference of the medical staff . when forceps delivery is chosen , only outlet nonrotational forceps delivery with fetal head in direct occipito - anterior position was performed as in traditional belief of chinese women having relatively small body built and hence their pelvis may not be large enough for rotational forceps . in case of fetal head in occipito - posterior or occipito - transverse position , we usually use rotational ventouse delivery . during instrumental delivery , a routine mediolateral episiotomy would be performed by medical staff that is usually defined as postdelivery angles of < 30 and > 60. after delivery , all women would be examined by midwife or medical staff for any perineal injury including oasis . if oasis injury is suspected by midwife , all these women would be further examined by medical staff to confirm the diagnosis and prepare for repair in operation theatre under anesthesia . we adopted the classification of oasis into 3- and 4-degree perineal tears as described by sultan , and endorsed by the international consultation on incontinence and the royal college of obstetricians and gynaecologists . a 3-degree perineal tear is defined as a partial or complete disruption of the anal sphincter muscles , which may involve either or both the external anal sphincter ( eas ) and internal anal sphincter ( ias ) muscles . for 3a degree tear , it was defined as < 50% eas involvement and 3b degree tear represents > 50% eas involvement . a 4-degree tear is defined as a disruption of the anal sphincter muscles with a breach of the rectal mucosa . overall , we have retrospectively reviewed the obstetric delivery record of 15,446 women from 2011 to june 2014 , and there were 49 women having oasis after the various mode of vaginal delivery . control subjects were drawn from all vaginal deliveries of > 24 weeks gestation in the same department randomly . collected demographic information includes age , parity , maternal height and body weight hence body mass index ( bmi ) , maturity at delivery , duration of 2 stage of labor , newborn birth weight , apgar score at 1 min and 5 min , and total blood loss . besides , further information was retrieved on current delivery record which including mode of delivery , any episiotomy made at delivery , details on degree of perineal tear . other variables including prolong second stage of labor , forceps delivery , nulliparity , induction of labor and baby birth weight > 4 kg were reviewed as risk factors for suffering from oasis after vaginal deliveries . at around 6 months postdelivery , women were assessed again for any residual complication including fecal and flatal incontinence , perineal pain , and coital problem at out - patient setting . distribution of maternal and obstetrical predictor variables was compared with the use of mann whitney u - test ( continuous predictors ) and fisher exact test ( categorical predictors ) . a p < 0.05 was considered as statistically significant . univariate and multivariate logistic regression analysis was performed to evaluate the influence of potential risk factors on oasis . ors and 95% confidence intervals ( cis ) were estimated to describe the prognostic strengths of variables potentially influencing the occurrence of oasis considered in the logistic regression model . statistical analyses were performed using statistical package for the social sciences ( windows version 15.0 ; spss inc . , this study has been approved by kowloon central cluster / kowloon east cluster research ethics committee of hospital authority of hong kong ( reference number : kc / ke-14 - 0133/er-1 ) . there were a total of 49 women suffering from oasis after vaginal delivery from the year 2011 to june 2014 . the overall incidence is 0.32% . of these 49 cases , 3 ( 6.1% ) , 27 ( 55.1% ) , 9 ( 18.4% ) and 10 ( 20.4% ) had 3a , 3b , 3c , and 4-degree oasis , respectively . all women were delivered at term ( > 37 weeks of gestation ) . comparing the maternal characteristics between the oasis and control group , there were no significant difference among mean age ( 31 vs. 31 , p = 0.39 ) , parity ( 0 vs. 0 , p = 0.06 ) , maturity at delivery ( 39 weeks vs. 39 weeks , p = 0.23 ) , maternal bmi ( kg / m ) ( 20.74 vs. 20.90 , p = 0.44 ) , duration of 2 stage of labor ( minutes ) ( 19 vs. 15 , p = 0.61 ) except there is significantly more blood loss in the oasis group compared with the control group ( 300 ml vs. 200 ml , p < 0.01 ) . comparing the baby characteristics and outcome , there were no statistical significant difference on baby birth weight ( 3.2 kg vs. 3.2 kg , p = 0.11 ) , apgar score at 1 min ( 8 vs. 8 , p = 0.28 ) and 5 min ( 9 vs. 9 , p = 0.35 ) . there was overall increasing trend of oasis after vaginal deliveries from the year 2011 to june 2014 ( 0.300.38% ) . there was statistical significant increase in the incidence of oasis in nulliparous women having vaginal delivery without episiotomy ( p < 0.01 ) but not in multiparous women ( p = 0.11 ) [ table 1 ] . in addition , there was no statistical difference in the incidence of oasis in nulliparous ( p = 0.81 ) and multiparous ( p = 0.58 ) women having vaginal delivery with episiotomy . on the other hand , the background rate of 1- and 2-degree perineal tear was similar from the year 2011 to june 2014 ( 25.629.4% ) . from the year 2011 to june 2014 , there was no significant difference in the incidence of oasis in both nulliparous and multiparous women having forceps delivery and ventouse delivery . for the overall incidence of oasis in forceps delivery , it was ranged from 2.4% to 4.44% ( p = 0.38 ) without statistical significant difference . for ventouse delivery , the overall incidence was ranged from 0% to 0.74% ( p = 0.56 ) and again shows no statistical significant difference . incidence of oasis in various mode of vaginal delivery oasis : obstetric anal sphincter injuries . when comparing the incidences of oasis among different modes of deliveries [ table 2 ] , the incidence in women having vaginal delivery without episiotomy is similar to the group with episiotomy ( 0.25% vs. 0.28% , p = 0.72 ) . on the other hand , there was significantly higher incidence of oasis in instrumental delivery group ( including both forceps and ventouse delivery ) compared with normal vaginal delivery group ( 0.84% vs. 0.26% , p < 0.01 ) . in addition , when comparing the incidence of oasis in forceps group against ventouse group , there was statistically significant higher incidence in the oasis group ( 2.86% vs. 0.39% , p < 0.01 ) . comparison on incidence of oasis among different mode of vaginal deliveries from 2011 to june 2014 oasis : obstetric anal sphincter injuries an univariate analysis of these 49 cases and 438 randomly selected control subjects showed that forceps delivery ( or = 8.73 , p < 0.01 ) , prolonged second stage of labor ( or = 1.43 , p < 0.01 ) increased the risk of oasis . however , ventouse ( p = 0.73 ) , nulliparity ( p = 0.24 ) , induction of labor ( p = 0.77 ) or birth weight > 4 kg ( p = 0.43 ) did not increase the risk [ table 2 ] . in multivariate regression models , only forceps delivery ( or = 6.28 ( 95% ci = 2.3217.04 ) , p < 0.01 ) proved to be independent risk factor . among the 49 women having oasis after delivery , there was no reported case of fecal incontinence or flatal incontinence at 6 months after delivery despite there were two women ( 4.08% ) complaining subjective sensation of fecal and flatal urgency but not affecting their usual daily activities . there was one woman ( 2.04% ) complained of mild wound pain and discomfort without coital difficulty , but on physical examination , there was no local lesion or wound complication identified . the overall incidence of oasis after vaginal deliveries among chinese women in hong kong ( 0.42% ) in 2013 was lower than the reported incidence ( 0.611% ) of oasis in caucasians . however , this rate is higher than that reported incidence mentioned previously in our hong kong territory - wide audits results ( 0.030.08% ) . the reported rate of levator ani injury diagnosed by ultrasound scan in primiparous women was as high as 15.4% , 33.3% , and 71.4% following spontaneous vaginal delivery , ventouse extraction , and forceps delivery , respectively . in fact , detection of oasis after vaginal delivery demands certain level of clinical skills , and it may be easily missed if the perineum is not examined carefully after delivery . consistent with previous studies , our study also showed outlet forceps delivery was associated with increased risk of oasis . when comparing forceps delivery against ventouse delivery , the incidence of oasis was significantly higher ( 2.86% vs. 0.39% , p , there was no report to specifically evaluate the oasis rate after outlet forceps alone . in fact , there may be perception that outlet forceps may cause less perineal trauma than mid - level forceps delivery . when operator performs outlet forceps delivery , the cephalic curve of the forceps distended the perineum widely when lifting fetal head during crowning . an interesting report from memon and handa showed that there is four times higher chance to have levator ani avulsion when comparing forceps against ventouse delivery . it could be proposed from this evidence that the forceps overall diameter in both anterior - posterior and lateral are much bigger than fetal head alone contributing to this phenomenon of pelvic floor injury . for the same analogy , this provides one of the possible explanations for the significant increase in risk for oasis in women having outlet forceps delivery . the second possible explanation is the potential relative shorter perineum in asian then caucasians thus the overall oasis rate in forceps delivery is higher than worldwide literature . the maternal bmi median from our case samples were ranged from 20.4 to 21.5 , which are within the normal range , and this range is much lower when compared with another report in caucasian countries . these overall smaller body built in chinese population we have showed that on logistic regression , ventouse delivery with routine episiotomy was not a risk factor for oasis . this could be explained anatomically as vacuum cup placement occupies much less vaginal space than the rigid cephalic curve of forceps . consistent with previous studies on other countries , we found there was an increasing trend of oasis over time . first , there was increasing trend of spontaneous vaginal delivery without episiotomy in our unit for multiparous but not for nulliparous women . however , consistent with other studies , not making routine episiotomy has not been found to be an independent risk factor in univariate or multivariate analysis [ table 3 ] . second , although increasing number of forceps , a risk factor of oasis , the number of the later after forceps was not increased over time . third , like the explanation in another study , we postulated that there was an improvement in competence of diagnosing oasis after the introduction of obstetric anal sphincter repair workshop with lectures and hands on sessions in our department in 2012 . since the year 2012 , most of the obstetrics and gynecology trainee and labor ward midwives in this department have attended the workshop . according to the literature report from andrews et al . , their sonographic evidence persistent anal sphincter defect reduced from 92% to 10% postoperatively after the introduction of oasis workshop . ( united states ) showed the trainees had significant improvement of scores on oasis repair after the usage of objective structured assessment of technical skills ( osata ) assessment . fourth , we did not study the techniques of protecting the perineum that can reduce the occurrence of oasis . univariate and multivariate logistic regression analysis of individual risk factor for oasis among women with various modes of vaginal delivery * ci : confidence interval ; or : odds ratio ; oasis : obstetric anal sphincter injuries . the results of this study have an implication on the choice of instrumental deliveries . although it has been shown that forceps delivery had higher successful rate of instrumental delivery than ventouse delivery , this benefit have to balance against the increase risk of maternal oasis and subsequent morbidities . in fact , a report from bulgaria did show that the usage rate of forceps delivery was dropped from > 2% to < 1% in a decade . this indicates that obstetricians nowadays prefer ventouse rather than forceps in nonspecific indications of instrumental delivery . although forceps delivery still has irreplaceable role in cases such as cord prolapse , suspected fetal hemorrhagic disorders or prematurity , its role in another situation is questionable when taken into the account of maternal oasis and its consequence . besides , with increasing incidence of oasis , emphasis on techniques to protect perineum irrespective of whether episiotomy is made or not may be an important factor to reduce the risk of oasis . interventions including the classical method of protecting perineum , good communication between the operator and the delivering woman , a delivering position that allows visualization of the perineum , and restrictive of midline resulted in a decrease in oasis from 45% to 12% over a period of 6 years . another interesting issue identified in the study is the significant increase in the incidence of oasis in women having vaginal delivery without episiotomy ( p < 0.01 ) . in fact , the incidence in this group has been increased from the year 2011 ( 0.20% ) to the year 2014 ( 2.30% ) . consistent with previous literature reports , it suggested that asian ethnicity and vaginal or instrumental delivery without episiotomy is associated with high - risk of oasis . although there was no statistically significant difference in incidence of oasis in women having delivery with or without episiotomy ( p = 0.72 ) , the increasing trend of oasis in nulliparous group did alert us on the possibility of high - risk association in this women group . further evaluation of this aspect of a well - designed prospective cohort study is recommended . one of the limitations of this study is the retrospective cohort design in a single department with a small sample size . this can be improved by usage of endoanal ultrasound to enhance the detection rate of oasis , or trained medical / nursing staff on clinical diagnosis . thirdly , we did not study the effects of epidural analgesia , techniques of protecting the perineum , and the direction of episiotomy . the incidence of oasis in hong kong chinese women was increased after 2012 particularly in nulliparous women having vaginal delivery without episiotomy , but still lower than the reported figures in the literature . | background : obstetric anal sphincter injuries ( oasis ) can cause an adverse impact on women 's physical and mental health .
there was lack of published data in chinese population particularly on studying the risk of oasis for nonrotational outlet forceps .
this study was to determine the incidence and risk factors of oasis.methods:this is a retrospective cohort study carried out in a tertiary referral hospital in hong kong .
the control group was selected randomly .
univariate and multivariate logistic regression analysis was performed to evaluate the influence of potential risk factors on oasis .
this study reviewed the obstetric records of oasis women and random control from january 2011 to june 2014 .
univariate and multivariate logistic regression analysis was performed to evaluate the influence of potential risk factors on oasis.results:of 15,446 women delivered , 49 had oasis .
the percentage of oasis increased from 0.3% ( 2011 ) to 0.38% ( 2014 ) .
there was an increasing trend of oasis in attempted spontaneous vaginal delivery without episiotomy ( p < 0.01 ) , but it did not increase the oasis risk ( p = 0.46 ) .
univariate analysis of 49 cases and 438 control subjects showed that forceps delivery ( odds ratio [ or ] = 8.73 , p < 0.01 ) , prolong second stage of labor ( or = 1.43 , p < 0.01 ) increased the risk for oasis . in multivariate regression models ,
only forceps delivery ( or = 6.28 , p < 0.01 ) proved to be independent risk factor.conclusions:the incidence of oasis in chinese women was increased after 2012 , but still lower than the reported figures in the literature .
outlet forceps delivery could be a possible associated risk factor . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a considerable number of natural and public disasters such as mass shootings , earthquakes , floods and hurricanes , and catastrophic accidents in the air and on the ground have occurred in recent years . notwithstanding the deep tragedy of these events , they offer opportunities for important research in the biosciences to better understand , prevent , and respond to such disasters in the future in a manner that minimizes human suffering . however , research in this area is rife with inevitable ethical , legal , and policy challenges and implications . fritz defines a disaster as an event concentrated in time and space , in which a society or one of its subdivisions undergoes physical harm and social disruption , such that all or some essential functions of the society or subdivision are impaired. as such , disasters provide real - world laboratories for the effects of harmful , irreversible loss , and damage requiring long - term recovery from their social , political , and economic repercussions . agents of destruction vary , but in most traditional definitions of disaster research they fall into the category of natural forces . a basic framework categorizes disaster effects into three impact conditions : hazard exposure , physical vulnerability , and social vulnerability . research involving any of these conditions has , as at least one of its endpoints , the goal of reducing future risk . disaster research began in the 1950s primarily in the usa , and has become increasingly international over time . lindell 's studies of the aftermath of 2005 hurricane katrina , for example , revealed invaluable knowledge about the impact of failed management and care of affected persons forced to disperse from the epicenter of an event , and remedies for future disaster planning . prior to katrina , disaster research on the 1979 three mile island incident and 1996 catastrophe in chernobyl led to policy decisions about nuclear power accidents . other research on disasters have also revealed important insights into coping strategies among emergency workers , impact of disasters on collective memory , the importance of culture and humor in recovery , and the cultural impact of terrorist attacks and religion in responsiveness . the fundamental difference in doing disaster research compared to other forms of human subjects research is the context in which it is carried out . indeed , studies have illustrated the ethical complexities of conducting disaster research for both participants as well as researchers . separating disaster research from other forms of research and regulatory responses is the critical nature of timing of research , access to people , documents or other materials , and ultimately generalizability to other settings . timing is especially key where arriving late to the disaster scene may yield poor or incorrect research results or be a missed opportunity to take advantage of unfolding events data that quarantelli describes as ephemeral or bourque et al . as perishable . the pressure of time for rapid interventions required of research teams may also preclude the usual formal institutional ethics board review . while some scholars have questioned whether reduced research ethics scrutiny may justifiably apply in disaster research settings , minimal risk standards which still require oversight by an external research ethics body are expected . for example , wendler considers whether the standard of minimal risk can be applied in these rapid response situations , and proposes a charitable participation standard where individuals should be enrolled in research only when the risks do not exceed the risks of charitable activities deemed acceptable for these individuals. similarly , jesus et al . address the minimal risk question by advancing the need for flexible study designs that can be used across a wide variety of disasters but reviewed prior to implementation . disaster researchers , sometimes described as action researchers , come to a crisis setting seeking access to a purposive sample of respondents or informants . they bring courage to a scene , but often do so alongside other researchers who bring their own disciplinary methodologies , perspectives , and biases . whether researchers are operating in collision or convergence with others , their presence can challenge the fundamental principle of non - maleficence by intruding on participants lives at a critical time . , for example , reviewed research carried out on survivors of the bangladesh tsunami in 2004 , and found that numerous studies were conducted without proper approval or standards . they attributed the sources of this lapse to the leniency of local standards , the vulnerability of victims , and the collapse of infrastructure that occurred after this mass natural disaster . even in the face of a stable infrastructure for research while anonymity may be preserved in data aggregated from large pools of respondents , the identity of sole or small numbers of informants , such as first responders or community leaders , may be difficult to conceal without jeopardizing the integrity of the data or attribution to such experts . the price of knowledge accumulation in any of these scenarios is borne disproportionately by subjects . in 2004 , the new york academy of medicine and the us national institute of mental health identified four critical areas of importance to research protocols in disaster settings : ( 1 ) decision - making capacity of potential participants , ( 2 ) vulnerability , ( 3 ) risks and benefits of participation , and ( 4 ) informed consent . their conclusions highlight that existing guidelines and norms pertaining to research on human participants may not be sufficient to address all situations that arise during disasters , and that real vigilance is necessary [ ] to ensure that general ethical principles are adhered to and participants are protected. extreme life circumstances simultaneously and abundantly challenge decisions about life and death , valuing and foregoing , speed and patience , trust and distrust . given the press and urgency of these situations , the ability of researchers to obtain informed consent by fully delivering information about the purpose of a study , risks , benefits , and alternatives may be compromised . as such , we offer a new model of consent , in complement to existing methodologies , for the disaster research setting . the basic tenet of the consent in escrow model is that data collection takes place under the time course of conventional procedures ( table 1 ) , but consent for data use is held in escrow until the acute post - disaster window has closed . this two - tiered model places opt - in at the core of the research ethics process unlike , for example , the single - tier approach articulated by the american psychological association and us federal code 45cfr46.116 that assert and protect participants right to withdraw at any time , but according to which , consent allows for immediate data utilization . by holding data that are not time sensitive in escrow for later use , the model provides a layer of protection for individuals without compromising initial stage of data collection . the model also supports the ethical concept that consent should not be a single point in time event , but rather be viewed as an ongoing process throughout the course of a research study . summary of traditional models of informed consent and limitations for the disaster context . in canada , the usa , and in other developed states , policies for protecting human subjects acknowledge that there are times when modification to standard research ethics board processes is justified , provided that exceptions and the means to implement them are not unduly broad , overreaching , or unjustifiably invasive. this guidance applies specifically to and enables research in the disaster setting . these policies also widely acknowledge that research participants in the midst of a disaster or an emergency are vulnerable , and that pre - existing vulnerabilities are potentially exacerbated under these extreme circumstances . gender , race , and class are all factors correlated with vulnerability during disaster events , including those such as hurricane katrina . while traditional notions of informed consent make allowances for the exposure of research participants or groups through mechanisms such as assent for children or community consent in the case of indigenous peoples , a model that enables individuals to opt out of participating in a study to which they contributed data under acute circumstances has not been broached . in this way , consent in escrow builds on the two - stage model for retrospective clinical research proposed by norris et al . , that provides the opportunity for subsequent research and is sensitive to participant recovery with a lengthened timeline , but that is not a prerequisite to release of data for analysis and utilization . using the consent in escrow approach , initial informed consent from participants for the collection of data is obtained in the acute setting , but the data are held unexamined in escrow by a data steward until contributors can be recontacted and the second tier of informed consent is obtained for data release ( figure 1 ) . respect for the autonomy of research participants is promoted through the opportunities afforded by the passage of time and the post - acute setting , and upheld by enabling them to re - evaluate their contribution . multiple attempts for recontact are built into the protocol ex ante following other established ethics procedures where future attempts at recontact must be justified . limits to repeated attempts must be factored into any protocol to preserve the benefit - risk balance with respect to autonomy and the right to refuse recontact . as with the model proposed by norris et al . , researchers using the consent in escrow model may invite participants to provide information for kin through whom recontact is pursued secondary to primary contact at the future timepoint . the significance and effectiveness of the kinship resource depends on the proximity of the kin to the affected person , the closeness of the tie , and the extent to which the kin is also affected . nonetheless , it is common for study teams to collect information about relatives and friends of participants during the informed consent process for clinical trials when longer term follow - up is desired . temporal dimensions of traditional models for informed consent and new model for consent in escrow . the timing of the second stage of consent for release of data held in escrow will vary by context , but we anchor it in the period of time when the lives of research participants can reasonably be expected or observed to have stabilized such as when social , economic , and political routines have been restored . new data may be collected under conventional procedures to compare or augment data collected at the acute timepoint , but originally collected data may not be modified post hoc . should a recontacted participant desire the latter , the conditions for release of data under the consent in escrow model are not satisfied and the data are destroyed . the requirement to obtain community consent such as research with indigenous populations should not be circumvented in the first tier , and must be explicitly respected in the second . under conditions when assenting youth attain age of majority during the data holding period , consent in the second tier is not required from the originally consenting surrogate . under conditions in which competence of the participant is compromised over time after first - tier consent , proxy consent must be invoked at the second tier . in the case of participant 's death , an advanced directive for research or the instructions of the executor of the estate to which data may become property prevail . alternatively , the data are destroyed . a limited version of this model is currently being applied successfully in a pediatric emergency research setting in british columbia , canada . here , verbal consent for research is acquired at the time of tissue biopsy by a treating physician , and then confirmed at a later time when the research study can be explained in greater detail and at time of reduced stress by an arm 's length researcher to avoid potential coercion . situating consent in escrow in broader world events , the model would apply , for example , to a comparative study of emotional differences and long - term psychological changes between the families of those who vanished in flight mh370 , which disappeared presumably off the western coast of australia , and flight mh17 , which was shot down over ukraine . while the location of the former flight and , most significantly , the victims bodies remain a mystery , families associated with the latter tragedy have the opportunity for closure and healing . in what disaster or emergency research settings situations will consent in escrow not be suitable ? for one , it can not be applied to research with an immediate health intervention or short - term goal . , it can not be applied to studies of war refugees , for example , where recontact would be too burdensome or simply a ludicrous requirement during times of political instability . pre - reviewed , minimal risk research , as conceptualized and described above by wendler and jesus et al . the collection of hair samples , for example , would qualify for such an exemption . indeed , as with all research conducted in disaster and emergency settings , the consent in escrow model should be evaluated for its appropriateness to the specific research situation and for the associated risks and benefits it offers . other complexities in applying the model will derive from heterogeneity in methods to determine return - to - life stability by research teams , and the inherent variability in progress along this continuum among people and populations . recontact information may be unavailable at time of disaster or later invalidated due to a change in anticipated participant location . participants may also feel burdened by the two - stage model and not wish to be reminded of the traumatic event in question . use of the model may compound or extend fear of retaliation experienced by disaster researchers who are confronted with pressures to reveal informants identities , such as those reported after the 1989 exxon valdez oil spill . two - tiered consent imposes pressures on funding streams , on researchers who rely on sufficient data to be released from escrow to power their analyses , and is complicated by changes in research leadership and personnel that inevitably occur over time . decisional capacity and the ability to provide truly informed consent rely on durable and ongoing competence of research participants , and must neither be impulsive or be made under duress . these conditions are difficult to achieve in disaster and emergency situations , and increasingly so in this era of instant messaging and social media , in which the right to privacy has been all but lost . still , human societies are remarkably resilient in the face of large - scale crises , and disaster victims do not become irrational , self - destructive , necessarily hopeless , or dependent . disaster victims may well be able to provide consent for immediate or long - term data use , but our model alleviates the extra burden of decision - making and choice in situ , and privileges time for participant reflection . the model still needs to be tested , but we submit that when applied judiciously , consent in escrow will mitigate an extra strain that research brings to an already challenged setting , offer a welcome extra layer of protection to participants , and foster the completion of the research cycle for the advancement of the health and well - being of survivors . | disasters such as flash flooding , mass shootings , and train and airplane accidents involving large numbers of victims produce significant opportunity for research in the biosciences .
this opportunity exists in the extreme tails of life events , however , during which decisions about life and death , valuing and foregoing , speed and patience , trust and distrust , are tested simultaneously and abundantly . the press and urgency of these scenarios
may also challenge the ability of researchers to comprehensively deliver information about the purposes of a study , risks , benefits , and alternatives . under these circumstances
, we argue that acquiring consent for the immediate use of data that are not time sensitive represents a gap in the protection of human study participants . in response , we offer a two - tiered model of consent that allows for data collected in real - time to be held in escrow until the acute post - disaster window has closed .
such a model not only respects the fundamental tenet of consent in research , but also enables such research to take place in an ethically defensible manner . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this prospective study was approved by the institutional human experimentation committee and investigational review board of kangbuk samsung hospital , and all investigations were performed in accordance with the tenets of the declaration of helsinki . we recruited patients who visited our clinic for ocular examination between may 2007 and december 2007 . all healthy participants underwent a comprehensive ophthalmic examination including best - corrected visual acuity , manifest refraction , slit - lamp biomicroscopy , iop measurement using goldmann applanation tonometry , zeiss four - mirror gonioscopy , dilated fundus examination using indirect microscopy , stereoscopic optic disc photography , and standard automated perimetry with a 30 - 2 swedish interactive threshold algorithm of the humphrey visual field analyzer ( carl zeiss meditec , dublin , ca , usa ) . subjects were included only if they had an iop of 21 mmhg or less , no history of iop greater than 21 mmhg , open angles , optic discs with a healthy appearance , and normal standard automatic perimetry results . subjects were excluded if they had glaucomatous optic discs , defined by the presence of neuroretinal rim thinning , excavation , or localized or diffuse retinal nerve fiber layer defects indicative of glaucoma . we also excluded subjects if they had abnormal glaucoma hemifield test results , cataract of grade ii or greater by the lens opacities classification system iii , previous ocular surgery , a history of systemic or topical medication that might affect iop , corneal pathologic features that might limit the accuracy of tonometry readings , or if they did not wish to participate in repeated goldmann applanation tonometry . finally , 23 eyes in 23 subjects were included in this study . if both eyes in the same patient were eligible , we randomly selected one . general daily activities , diet , physical activity , body position such as supine , prone , or lateral decubitus , and systemic medications that would not influence iop were not restricted . diurnal iop was assessed in the sitting position with a goldmann applanation tonometer , and the subjects remained in a sitting position for 10 minutes before iop measurement . we scheduled iop measurements every 2 hours between 9 am and 11 pm , and two diurnal iop assessments were performed 8 weeks apart . right eyes were measured before left eyes by a well - trained ophthalmologist ( kus ) using the same slit - lamp , and the mean of three measurements at each time point was recorded . to minimize bias , prior iop measurements were not available during the measurement process . to determine the repeatability of diurnal iop according to time - course profile , we calculated intra - class correlation coefficients ( iccs ) at each time point to compare visits 1 and 2 , which occurred 8 weeks apart . in addition , to verify the repeatability of diurnal iop according to trend - course profile , we calculated iccs for mean iop , maximum iop , minimum iop , fluctuation - iop ( maximum iop to minimum iop ) , and fluctuation - standard deviation ( standard deviation of mean iop ) for visits 1 and 2 . poor , fair to good , and excellent agreement were noted when iccs were less than 0.4 , between 0.4 and 0.75 , and higher than 0.75 , respectively . armonk , ny , usa ) . the alpha level ( type i error ) was set at 0.05 . to determine the repeatability of diurnal iop according to time - course profile , we calculated intra - class correlation coefficients ( iccs ) at each time point to compare visits 1 and 2 , which occurred 8 weeks apart . in addition , to verify the repeatability of diurnal iop according to trend - course profile , we calculated iccs for mean iop , maximum iop , minimum iop , fluctuation - iop ( maximum iop to minimum iop ) , and fluctuation - standard deviation ( standard deviation of mean iop ) for visits 1 and 2 . poor , fair to good , and excellent agreement were noted when iccs were less than 0.4 , between 0.4 and 0.75 , and higher than 0.75 , respectively . , armonk , ny , usa ) . the alpha level ( type i error ) was set at 0.05 . among 23 asian subjects , 12 ( 52.2% ) were female , and the average age was 65.4 13.9 years ( range , 21 to 84 ) . the mean iop and the mean difference between the two visits at each time point are presented in table 1 . the mean difference was less than 1 mmhg , and this difference was not significant ( p > 0.05 , mann - whitney u - test ) at any time - point . the repeatability of iop measurements was excellent at all time - points , with iccs ranging from 0.812 to 0.946 ( p < 0.001 ) . the 9 am iop showed the best reliability between visits ( iccs , 0.946 ) . mean iop showed the best repeatability ( iccs , 0.929 ) , followed by minimum iop ( iccs , 0.912 ) and then peak iop ( iccs , 0.899 ) . iop fluctuation , expressed as the difference between peak iop and minimum iop or as the standard deviation of all diurnal iop values , showed poor reliability ( table 2 ) . the mean iop and the mean difference between the two visits at each time point are presented in table 1 . the mean difference was less than 1 mmhg , and this difference was not significant ( p > 0.05 , mann - whitney u - test ) at any time - point . the repeatability of iop measurements was excellent at all time - points , with iccs ranging from 0.812 to 0.946 ( p < 0.001 ) . the 9 am iop showed the best reliability between visits ( iccs , 0.946 ) . mean iop showed the best repeatability ( iccs , 0.929 ) , followed by minimum iop ( iccs , 0.912 ) and then peak iop ( iccs , 0.899 ) . iop fluctuation , expressed as the difference between peak iop and minimum iop or as the standard deviation of all diurnal iop values , showed poor reliability ( table 2 ) . if diurnal iop measurements are highly repeatable from day to day , it would provide a basis for comparing iops during both pretreatment and posttreatment periods at standardized times of the day and would be useful for assessing the iop - lowering effect of glaucoma drugs . in the current study , our results showed excellent long - term repeatability of diurnal iop measurements in healthy asian subjects . there was also excellent agreement of diurnal iop with regard to mean iop , peak iop , and minimum iop . however , iop f luctuation , expressed as the difference between peak iop and minimum iop or as the standard deviation of all diurnal iop values , showed poor reliability . this report encourages clinicians to evaluate iop and assess the effectiveness of iop - lowering therapy with confidence . first , we evaluated the second iop measurement 8 weeks following the first measurement in order to validate the long - term repeatability of diurnal iop measurements . second , we analyzed the diurnal iop of a healthy asian population , which has a higher prevalence of normal - tension glaucoma than other racial groups . few studies have shown the repeatability of diurnal iop in normal subjects , and their results were variable . daubs evaluated the diurnal iop of seven male international airline pilots every hour over a range of 5 to 23 days using a durham - langham pneumatic type tonometer , and de venecia and davis evaluated the diurnal iop of 230 eyes in 115 males using schitz tonometry five times per day for 3 days . these studies indirectly demonstrated repeatability of the diurnal curve pattern without direct comparison of iop at each time point . although curve patterns were occasionally repeated for several consecutive days in some subjects , this was not always the case . . reported fair to good agreement ( iccs ranging from 0.35 to 0.71 ) of diurnal iop in 40 healthy subjects measured in the seated position , evaluated during a 1-week interval using goldmann tonometry . on the other hand , mottet et al . reported excellent agreement ( iccs , 0.81 ) of a midline estimating statistic of rhythm and also noted variable agreement at each time point ( iccs ranging from 0.27 to 0.90 ) using a modular one pneumatonometer in six normal caucasian subjects in the supine position every week over 6 weeks the current study demonstrated excellent repeatability ( iccs ranging from 0.812 to 0.946 ) of diurnal iop , evaluated during an 8-week interval using goldmann applanation tonometry in 23 normal asian subjects in the sitting position . the differences in study findings could be due to differing study designs , differences between the racial groups studied , and different measurement methods , including iop evaluation time , repeat interval , evaluation instrument , and subject position . similar conditions are observed in the agreement of diurnal iop in ocular hypertension or primary open angle glaucoma subjects . some studies have shown poor to good agreement , while other studies showed excellent agreement . they demonstrated the excellent reliability of the maximum / minimum values of iop and blood pressure phasing over a 24-hour rhythm , once a week for 5 consecutive weeks , while patients were in both sitting and supine positions . similarly , we determined excellent repeatability for point iop , peak iop , and minimum iop and poor repeatability for iop fluctuations even though our study measured iop using only goldmann applanation tonometry in a sitting position between 9 am and 11 pm over an 8-week interval . although iop fluctuation may not be a sufficient way to characterize circadian iop rhythm , iop measurements at standardized times of day may be useful for assessing the effectiveness of glaucoma therapy . phenomenon , wherein iop was lower at the second visit compared to the first visit due to subject relaxation and experience with ocular examinations . realini et al . reported that the mean difference between visits was consistently 1 mmhg at all time points . however , we did not find a similar tendency in iop difference ( lower at visit 2 than visit 1 ) between visits , and the mean difference in iop between the two visits was only 0.25 mmhg in this study . these discrepant results may be due to the difference in time between measurements ; the previous studies evaluated the second diurnal iop 1 day or 1 week after the first . therefore , subjects could easily adapt to the previously unfamiliar environment and could remember the process of the study at the second visit . on the other hand , our study evaluated the second measurement 8 weeks after the first , which may have limited the bias of subject adaptation to the uncomfortable goldmann applanation tonometry , as participants were more likely to have similar feelings about iop measurements 8 weeks later . in addition , iop measurements were performed by only one ophthalmologist using the same goldmann applanation tonometry instrument with the same slit - lamp microscope . thus , the long - term repeatability of diurnal iop was excellent , with iccs greater than 0.8 . first , we studied a relatively small number of participants and did not evaluate the iop over a 24-hour period . however , in an outpatient setting , patients typically visit the clinic during wakeful periods when the seated position is normal . therefore , the long - term repeatability of diurnal iop during this time is likely valuable data for glaucoma management . second , physical activity and body position variations such as the supine , prone , or lateral decubitus positions , which may have influenced the iop variation , were not restricted between diurnal iop measurements even though the iop was measured after a sitting position was maintained for 10 minutes . also , diet , including intake of water or caffeinated beverages , before the visit and/or between diurnal iop measurements was not restricted . third , iop in glaucoma patients is known to fluctuate more than that in normal controls . therefore , there may be more variability in diurnal iop measurements in glaucoma patients compared to normal controls . additionally , the mean iops in koreans in the namil study or other korean epidemiologic studies were lower than the iops of people of european or american descent . therefore , it is possible that iop variability in koreans is lower than that of other races and ethnicities . in particular , the mean iop in our study was around 12.2 mmhg , lower than that in the namil study . therefore , we can not eliminate the influence of selection bias , and care must be exerted in the generalization of these results to glaucoma patients . in conclusion , this study demonstrated excellent repeatability of diurnal iop measurements 8 weeks apart in healthy asian subjects . there was also excellent reliability in mean iop , peak iop , and minimum iop , though iop fluctuation showed poor reliability . we suggest that a single iop measurement to assess the effectiveness of iop - lowering therapy may not be worse than multiple measurements of iop both at baseline and posttreatment follow - up . | purposeto determine the long - term repeatability of diurnal intraocular pressure ( iop ) patterns in healthy asian subjects without glaucoma.methodstwenty-three eyes in 23 healthy asian subjects without glaucoma underwent diurnal iop measurements using goldmann applanation tonometry every 2 hours from 9 am to 11 pm during two visits that were 8 weeks apart . to validate repeatability between visits , we calculated intra - class correlation coefficients ( iccs ) mean iop , peak iop , minimum iop , and iop fluctuation at each time point and expressed the results as the difference between peak iop and minimum iop or as the standard deviation of all diurnal iop values in the diurnal iop curve.resultsiop repeatability was excellent at all time points , with iccs ranging from 0.812 to 0.946 ( p < 0.001 ) .
the 9 am iop showed the best repeatability between visits ( iccs , 0.946 ) .
repeatability of mean iop , peak iop , and minimum iop was also excellent ( iccs ranging from 0.899 to 0.929 ) . however , iop fluctuations showed poor repeatability , with an icc lower than 0.15.conclusionslong-term repeatability of diurnal iop patterns in healthy asian subjects was excellent .
these findings suggest that iop measurements at standardized times of the day will be useful for assessing the effectiveness of glaucoma therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
female wistar rats , approximately 6 months old and weighing 250 g , were used in this study . animals were housed under a 12-hour light and 12-hour dark cycle with standard food and water provided ad libitum . intraocular pressure ( iop ) in both eyes was measured just before treatment and regularly after treatment . details of iop measurements and iop time courses of each animal are given in the supplementary materials . after treated eyes were exposed to elevated iop for approximately 2 weeks , treated eyes of each animal were removed and prepared for optical imaging and immunohistochemical study . to serve as controls , some of the contralateral untreated eyes an eye cup of 5-mm diameter was excised and placed in a dish of warm ( 3335 c ) oxygenated physiologic solution . after removal of the vitreous , the retina was dissected free of the rpe and choroid and then draped across a slit in a membrane with the photoreceptor side against the membrane . a second , thinner membrane with a matching slit was put on the rnfl surface to gently flatten the retina . the preparation was carried out with intense white illumination , which thoroughly bleached the visual pigment in the photoreceptors and ensured that the reflectance in this layer remained constant . the mounted retina was then placed in a chamber perfused with a warm physiologic solution to maintain the tissue in a living state . all experiments adhered to the arvo statement for the use of animals in ophthalmic and vision research . the protocol for the use of animals was approved by the animal care and use committee of the university of miami . the device and measurement of retinal reflectance have been described in detail previously and are briefly described in the supplementary materials and supplementary figure s1 . the output of the microreflectometer is a relative reflectance calculated by calibration with a diffuse white reflector , expressed in units of percent incident light reflected . retinal nerve fiber layer reflectance was measured for bundle areas located at distances from the onh center of 300 , 400 , 500 , 600 , and 700 m . reflectance measured on bundle areas includes light reflected from the rnfl and its underlying tissue . because the weak scattering of the rnfl causes little attenuation to an incident beam , we assumed that the reflectance from deep layers was approximately the same as that from nearby gap areas between bundles . 1 ) , and the average reflectance of gap areas ( rgap ) was then subtracted from the total reflectance ( rtotal ) measured on the bundle areas to get an estimate of the bundle reflectance alone , that is , r = rtotal
rgap . hereafter , the relative reflectance r denotes the reflectance of the rnfl alone and is simply called reflectance . reflectance image of normal bundles at 440 nm . nerve fiber bundles appear as bright stripes and are separated by gaps , seen as darker spaces between bundles . black arc with a radius of 400 m indicates a fan - shape sector centered at the onh center . thick boxes : bundle areas crossed by the arc ; thin boxes : gap areas ; arrows : blood vessels . , the incident and scattering angles were calculated from the relative positions of the bundle , light source , and camera . as in previous work , the incident angle of a bundle was defined as the angle between the incident ray and a plane perpendicular to the bundle ; the scattering angle was defined as the angle between incident and scattering planes , where the incident plane contained the incident ray and the bundle and the scattering plane contained the reflected ray and the bundle . the three - dimensional ( 3d ) orientation of a bundle was calculated from its projected angles in images that were taken at two additional camera positions . after reflectance measurements , the same retinas were transferred to an imaging micropolarimeter and rnfl retardance ( ) was measured in transmission . the device and measurement procedures have been described in detail previously and are given in the supplementary materials . birefringent nerve fiber bundles were observable with the micropolarimeter under conditions in which the polarization state exiting the tissue was nearly extinguished by the polarization detector ( c'a , see supplementary fig . because the polarization detector provided only a limited number of states , some bundles could not be seen by the micropolarimater . retardance was measured along a bundle at distances from the onh center of 300 , 400 , 500 , 600 , and 700 m to form a retardance profile . the measurement accuracy of was 0.05 nm . because rnfl birefringence shows little variation with wavelength , in this study was measured at 500 nm only . to calculate birefringence ( n ) , the thickness ( t ) of bundle areas was measured from confocal images of the rnfl ( details are in the next section ) . n was then calculated as the ratio of and t. n is a dimensionless quantity expressed in units of nm/m . in both reflectance and retardance measurements , a series of images were taken . to compensate for possible tissue shift during measurements , each set of images after optical measurements , which were completed in approximately 40 minutes for both reflectance and retardance measurements , the mounted retina was fixed in 4% paraformaldehyde for 30 minutes at room temperature and rinsed thoroughly in pbs . the tissue then was removed from the membranes for further immunohistochemical staining and confocal imaging . the detailed staining procedures have been published previously and are given in the supplementary materials . the fluorescently stained retina was imaged by a confocal laser scanning microscope ( leica tcs sp5 ; leica microsystems , wetzlar , hesse , germany ) . a 40 oil objective provided en face images of a retina with a field of view of 389 389 m and a resolution limited to the sampling density of 0.76 m per pixel . to cover all bundles emerging from the onh , at least a 3 3 tiled array of images was taken that covered a retinal area of 1.2 1.2 mm with the onh at the center ( fig . for each array position , en face images were collected at evenly spaced positions in depth ( 1 m apart in tissue ) starting from the rnfl surface through the retina to a depth at least including the ganglion cell layer . the retina was then reconstructed in 3d and cross - sectional ( cs ) images were synthesized from the reconstruction with customized software ( figs . ( a ) retinal image in reflectance . ( b ) merged en face image of the same retina with f - actin , mt , and nf stain . staining variation across the image was due to tissue curvature resulting in bundles imaged at different depths . ( c e ) cross - sectional images of f - actin , mt , and nf stain along the yellow line in ( b ) . bv , blood vessel . to identify the location of an individual nerve fiber bundle measured optically , the en face confocal image of a retina was registered onto the optical images of the same retina by matching the blood vessel patterns ( figs . cross - sectional images along lines crossing the bundle areas were obtained from a reconstructed 3d confocal image . the rnfl was identified as an intensely stained structure in the top layer of the retina ( figs . a merged cs image of stained f - actin , mts , and neurofilaments ( nfs ) was used . the thickness of an individual bundle was measured as the average thickness within a window centered on the bundle and half as wide ( dashed lines in figs . 2c e ) . in this study , the axial resolution of the confocal microscope calculated for the longest excitation wavelength was 0.7 m and the step size of the depth scan was 1 m . measurement uncertainty of the rnfl thickness did not exceed 2 m , which was used as the measurement accuracy for rnfl thickness . three kinds of data were available from each retina analyzed : ( 1 ) reflectance spectra at several positions along all bundles that matched the criteria set for scattering and incident angles ( criteria established using data acquired in normal bundles ; see results ) , ( 2 ) retardance profiles for all bundles that were visible in polarization images , and ( 3 ) a severity grade for f - actin distortion in fan - shaped areas around the onh , with each area having relatively similar appearance of f - actin in confocal images . to reduce bias , registration of the reflectance and retardance images identified those bundles that had measurements of both optical properties . finally , registration of the optical and confocal images provided a severity grade for the sector in which bundles had optical measurements . the sector width was determined by the extent of bundles that had both reflectance and retardance measurements . most of the sectors had angular widths of approximately 30 and sectors in the same retina were well separated ( see fig . 9 for details ) . retinal nerve fiber layer reflectance spectra measured at on - peak and off - peak reflectance . images taken at 500 nm with the scattering angle at 178. ( a ) bundle areas ( b1 and b2 ) imaged at maximum ( on - peak ) reflectance with incident angles ( ia in inset ) of 17 and 18 for b1 and b2 , respectively . the dashed line is perpendicular to the bundle , which is tilted 4. the thin lines illustrate the reflection geometry of light scattering by a cylinder at direct backscattering . the thick lines with arrows indicate the incident beam provided by the light source and the reflected beam detected by the camera ; that is , the image in ( a ) was taken with the configuration of the bundle ( b1 ) orientation , and the positions of the light source and camera that meets the geometry of light scattering by cylinder . ( b ) bundle areas imaged at off - peak reflectance with the camera position unchanged and the incident angle ( ib ) changed to 26 and 27 for b1 and b2 , respectively . inset : similar to the inset in ( a ) , the thin lines illustrate the incident beam and predicted reflected beam . because in this setting the camera position did not change , the camera detected a reflected beam ( the lower thick line with arrow ) that was off the predicted beam ; that is , the bundle was measured at off - peak reflectance . ( c ) reflectance spectra measured at on - peak and off - peak reflectance for the bundle areas of b1 and b2 . at off - peak reflectance , the mean reflectance of the spectra decreased by 50% for b1 and 52% for b1 and b2 . ( d ) the normalized spectra were nearly identical for the on - peak and off - peak measurements . bundle b3 was measured with similar incident angles , but the scattering angle changed from 172 to 160. bundle b4 was measured with similar scattering angles , but the incident angle changed from 21 to 10. ( b ) normalized spectra showing that the spectral shape is similar with changes of either the incident angle or scattering angle . the arcs indicate distances from the onh center of r = 300 to 700 m . ( b ) reflectance spectra along one bundle with areas indicated in ( a ) as white dots and thick box . bundle areas indicated in ( a ) as white circles and a dot and marked as a d at r = 600 m . the normalized spectra in ( c ) and ( e ) showing similar spectral shape along a bundle and within a sector . incident angles : 16 to 20 , scattering angles : 174 to 177. reflectance spectra of normal nerve fiber bundles . each spectrum was the average of three to six bundles measured at r = 500 m and normalized to the mean reflectance at 560 to 600 nm . incident and scattering angles ranging from 7 to 25 and 162 to 180 , respectively . ( a , b ) bundle thickness and retardance decrease with the increase of distance from the onh along the bundle in figure 5 . ( d ) profiles of the mean n 2 sd of 32 sectors from eight normal retinas . the error bar at the right side of ( d ) shows the maximum variation ( 2 sd ) in n across radii for individual sectors . confocal laser scanning microscopy images of nonuniform cytoskeletal damage in a hypertensive retina stained with f - actin . ( a ) en face image of a 3 3 tiled array centered on the onh . ( b ) cross - sectional images with f - actin stain along the lines defined in ( a ) . yellow arrows : bundles analyzed for reflectance and birefringence ; white arrows : blood vessels . the appearance of nerve fiber bundles varies across retinal sectors from normal - looking in ( a1 ) , to subtle distortion near the onh in ( a2 ) , moderate distortion in ( a3 ) , and severe distortion and obvious thinning in ( a4 ) . note that tissue curvature meant that bundles across the retina were not all imaged at the same depth in ( a ) and that distortion was evaluated from multiple en face images at different depths of the rnfl . the gray shades indicate the structural severity grade assigned to each sector ( a1a4 ) . for each sector , bundle areas were defined at different distances from the onh center ( r = 300700 m ) . at each r , all bundles with approximately uniform background in optical images and containing no blood vessels were analyzed ( fig . 1 ) . the averages of the reflectance spectrum , birefringence , and thickness of these bundle areas were then used to represent the properties of the rnfl at the location . note that within a sector , different numbers of bundles were averaged at different radii due to the change of arc size . for each sector , at least two bundles at r = 300 m and four to eight bundles at each r 400 m were analyzed and then averaged ( the number of bundles averaged for each r in each sector is given in supplementary table s1 ) . unless otherwise stated , the average reflectance spectrum , birefringence profile , and thickness were used in comparisons among sectors . data analysis and confocal image reconstruction were implemented with customized software programmed in matlab ( matlab version 2012b , the mathworks , inc . , female wistar rats , approximately 6 months old and weighing 250 g , were used in this study . animals were housed under a 12-hour light and 12-hour dark cycle with standard food and water provided ad libitum . intraocular pressure ( iop ) in both eyes was measured just before treatment and regularly after treatment . details of iop measurements and iop time courses of each animal are given in the supplementary materials . after treated eyes were exposed to elevated iop for approximately 2 weeks , treated eyes of each animal were removed and prepared for optical imaging and immunohistochemical study . to serve as controls , some of the contralateral untreated eyes an eye cup of 5-mm diameter was excised and placed in a dish of warm ( 3335 c ) oxygenated physiologic solution . after removal of the vitreous , the retina was dissected free of the rpe and choroid and then draped across a slit in a membrane with the photoreceptor side against the membrane . a second , thinner membrane with a matching slit was put on the rnfl surface to gently flatten the retina . the preparation was carried out with intense white illumination , which thoroughly bleached the visual pigment in the photoreceptors and ensured that the reflectance in this layer remained constant . the mounted retina was then placed in a chamber perfused with a warm physiologic solution to maintain the tissue in a living state . all experiments adhered to the arvo statement for the use of animals in ophthalmic and vision research . the protocol for the use of animals was approved by the animal care and use committee of the university of miami . the device and measurement of retinal reflectance have been described in detail previously and are briefly described in the supplementary materials and supplementary figure s1 . the output of the microreflectometer is a relative reflectance calculated by calibration with a diffuse white reflector , expressed in units of percent incident light reflected . retinal nerve fiber layer reflectance was measured for bundle areas located at distances from the onh center of 300 , 400 , 500 , 600 , and 700 m . reflectance measured on bundle areas includes light reflected from the rnfl and its underlying tissue . because the weak scattering of the rnfl causes little attenuation to an incident beam , we assumed that the reflectance from deep layers was approximately the same as that from nearby gap areas between bundles . 1 ) , and the average reflectance of gap areas ( rgap ) was then subtracted from the total reflectance ( rtotal ) measured on the bundle areas to get an estimate of the bundle reflectance alone , that is , r = rtotal
rgap . hereafter , the relative reflectance r denotes the reflectance of the rnfl alone and is simply called reflectance . reflectance image of normal bundles at 440 nm . nerve fiber bundles appear as bright stripes and are separated by gaps , seen as darker spaces between bundles . black arc with a radius of 400 m indicates a fan - shape sector centered at the onh center . thick boxes : bundle areas crossed by the arc ; thin boxes : gap areas ; arrows : blood vessels . , the incident and scattering angles were calculated from the relative positions of the bundle , light source , and camera . as in previous work , the incident angle of a bundle was defined as the angle between the incident ray and a plane perpendicular to the bundle ; the scattering angle was defined as the angle between incident and scattering planes , where the incident plane contained the incident ray and the bundle and the scattering plane contained the reflected ray and the bundle . the three - dimensional ( 3d ) orientation of a bundle was calculated from its projected angles in images that were taken at two additional camera positions . after reflectance measurements , the same retinas were transferred to an imaging micropolarimeter and rnfl retardance ( ) was measured in transmission . the device and measurement procedures have been described in detail previously and are given in the supplementary materials . birefringent nerve fiber bundles were observable with the micropolarimeter under conditions in which the polarization state exiting the tissue was nearly extinguished by the polarization detector ( c'a , see supplementary fig . because the polarization detector provided only a limited number of states , some bundles could not be seen by the micropolarimater . retardance was measured along a bundle at distances from the onh center of 300 , 400 , 500 , 600 , and 700 m to form a retardance profile . the measurement accuracy of was 0.05 nm . because rnfl birefringence shows little variation with wavelength , in this study was measured at 500 nm only . to calculate birefringence ( n ) , the thickness ( t ) of bundle areas was measured from confocal images of the rnfl ( details are in the next section ) . n was then calculated as the ratio of and t. n is a dimensionless quantity expressed in units of nm/m . in both reflectance and retardance measurements , a series of images were taken . to compensate for possible tissue shift during measurements , each set of images after optical measurements , which were completed in approximately 40 minutes for both reflectance and retardance measurements , the mounted retina was fixed in 4% paraformaldehyde for 30 minutes at room temperature and rinsed thoroughly in pbs . the tissue then was removed from the membranes for further immunohistochemical staining and confocal imaging . the detailed staining procedures have been published previously and are given in the supplementary materials . the fluorescently stained retina was imaged by a confocal laser scanning microscope ( leica tcs sp5 ; leica microsystems , wetzlar , hesse , germany ) . a 40 oil objective provided en face images of a retina with a field of view of 389 389 m and a resolution limited to the sampling density of 0.76 m per pixel . to cover all bundles emerging from the onh , at least a 3 3 tiled array of images was taken that covered a retinal area of 1.2 1.2 mm with the onh at the center ( fig . for each array position , en face images were collected at evenly spaced positions in depth ( 1 m apart in tissue ) starting from the rnfl surface through the retina to a depth at least including the ganglion cell layer . the retina was then reconstructed in 3d and cross - sectional ( cs ) images were synthesized from the reconstruction with customized software ( figs . 2c e ) . ( a ) retinal image in reflectance . ( b ) merged en face image of the same retina with f - actin , mt , and nf stain . staining variation across the image was due to tissue curvature resulting in bundles imaged at different depths . ( c e ) cross - sectional images of f - actin , mt , and nf stain along the yellow line in ( b ) . bv , blood vessel . to identify the location of an individual nerve fiber bundle measured optically , the en face confocal image of a retina was registered onto the optical images of the same retina by matching the blood vessel patterns ( figs . cross - sectional images along lines crossing the bundle areas were obtained from a reconstructed 3d confocal image . the rnfl was identified as an intensely stained structure in the top layer of the retina ( figs . a merged cs image of stained f - actin , mts , and neurofilaments ( nfs ) was used . the thickness of an individual bundle was measured as the average thickness within a window centered on the bundle and half as wide ( dashed lines in figs . 2c e ) . in this study , the axial resolution of the confocal microscope calculated for the longest excitation wavelength was 0.7 m and the step size of the depth scan was 1 m . measurement uncertainty of the rnfl thickness did not exceed 2 m , which was used as the measurement accuracy for rnfl thickness . three kinds of data were available from each retina analyzed : ( 1 ) reflectance spectra at several positions along all bundles that matched the criteria set for scattering and incident angles ( criteria established using data acquired in normal bundles ; see results ) , ( 2 ) retardance profiles for all bundles that were visible in polarization images , and ( 3 ) a severity grade for f - actin distortion in fan - shaped areas around the onh , with each area having relatively similar appearance of f - actin in confocal images . to reduce bias , registration of the reflectance and retardance images identified those bundles that had measurements of both optical properties . finally , registration of the optical and confocal images provided a severity grade for the sector in which bundles had optical measurements . the sector width was determined by the extent of bundles that had both reflectance and retardance measurements . most of the sectors had angular widths of approximately 30 and sectors in the same retina were well separated ( see fig . retinal nerve fiber layer reflectance spectra measured at on - peak and off - peak reflectance . images taken at 500 nm with the scattering angle at 178. ( a ) bundle areas ( b1 and b2 ) imaged at maximum ( on - peak ) reflectance with incident angles ( ia in inset ) of 17 and 18 for b1 and b2 , respectively . the dashed line is perpendicular to the bundle , which is tilted 4. the thin lines illustrate the reflection geometry of light scattering by a cylinder at direct backscattering . the thick lines with arrows indicate the incident beam provided by the light source and the reflected beam detected by the camera ; that is , the image in ( a ) was taken with the configuration of the bundle ( b1 ) orientation , and the positions of the light source and camera that meets the geometry of light scattering by cylinder . ( b ) bundle areas imaged at off - peak reflectance with the camera position unchanged and the incident angle ( ib ) changed to 26 and 27 for b1 and b2 , respectively . inset : similar to the inset in ( a ) , the thin lines illustrate the incident beam and predicted reflected beam . because in this setting the camera position did not change , the camera detected a reflected beam ( the lower thick line with arrow ) that was off the predicted beam ; that is , the bundle was measured at off - peak reflectance . ( c ) reflectance spectra measured at on - peak and off - peak reflectance for the bundle areas of b1 and b2 . at off - peak reflectance , the mean reflectance of the spectra decreased by 50% for b1 and 52% for b1 and b2 . ( d ) the normalized spectra were nearly identical for the on - peak and off - peak measurements . bundle b3 was measured with similar incident angles , but the scattering angle changed from 172 to 160. bundle b4 was measured with similar scattering angles , but the incident angle changed from 21 to 10. ( b ) normalized spectra showing that the spectral shape is similar with changes of either the incident angle or scattering angle . the arcs indicate distances from the onh center of r = 300 to 700 m . ( b ) reflectance spectra along one bundle with areas indicated in ( a ) as white dots and thick box . bundle areas indicated in ( a ) as white circles and a dot and marked as a d at r = 600 m . the normalized spectra in ( c ) and ( e ) showing similar spectral shape along a bundle and within a sector . incident angles : 16 to 20 , scattering angles : 174 to 177. reflectance spectra of normal nerve fiber bundles . each spectrum was the average of three to six bundles measured at r = 500 m and normalized to the mean reflectance at 560 to 600 nm . incident and scattering angles ranging from 7 to 25 and 162 to 180 , respectively . ( a , b ) bundle thickness and retardance decrease with the increase of distance from the onh along the bundle in figure 5 . ( d ) profiles of the mean n 2 sd of 32 sectors from eight normal retinas . the error bar at the right side of ( d ) shows the maximum variation ( 2 sd ) in n across radii for individual sectors . confocal laser scanning microscopy images of nonuniform cytoskeletal damage in a hypertensive retina stained with f - actin . ( a ) en face image of a 3 3 tiled array centered on the onh . ( b ) cross - sectional images with f - actin stain along the lines defined in ( a ) . yellow arrows : bundles analyzed for reflectance and birefringence ; white arrows : blood vessels . the appearance of nerve fiber bundles varies across retinal sectors from normal - looking in ( a1 ) , to subtle distortion near the onh in ( a2 ) , moderate distortion in ( a3 ) , and severe distortion and obvious thinning in ( a4 ) . note that tissue curvature meant that bundles across the retina were not all imaged at the same depth in ( a ) and that distortion was evaluated from multiple en face images at different depths of the rnfl . the gray shades indicate the structural severity grade assigned to each sector ( a1a4 ) . for each sector , bundle areas were defined at different distances from the onh center ( r = 300700 m ) . at each r , all bundles with approximately uniform background in optical images and containing no blood vessels were analyzed ( fig . 1 ) . the averages of the reflectance spectrum , birefringence , and thickness of these bundle areas were then used to represent the properties of the rnfl at the location . note that within a sector , different numbers of bundles were averaged at different radii due to the change of arc size . for each sector , at least two bundles at r = 300 m and four to eight bundles at each r 400 m were analyzed and then averaged ( the number of bundles averaged for each r in each sector is given in supplementary table s1 ) . unless otherwise stated , the average reflectance spectrum , birefringence profile , and thickness were used in comparisons among sectors . data analysis and confocal image reconstruction were implemented with customized software programmed in matlab ( matlab version 2012b , the mathworks , inc . , fifteen rats were used in the study , with 11 rats treated to develop ocular hypertension and 4 rats without any treatments . eight retinas were used as control with four retinas from each of the four normal rats and four retinas from contralateral eyes of treated rats . because no differences were found for the optical properties and cytostructure of the retinas from the normal rats and the contralateral untreated eyes , these eight retinas served as normal controls . due to the property of directional reflectance of the rnfl , figure 3a shows a bundle area ( b1 ) that was measured at maximum ( on - peak ) reflectance with the light source and camera positions set to satisfy the geometry for light scattering by cylinders ( details in the legend for fig . figure 3b shows an example of the same bundle measured at off - peak reflectance . with a 4 change of the incident angle and without change of the camera position , the same bundle area appeared dimmer ( fig . the measured r decreased to approximately 50% of its on - peak reflectance ( fig . 3c ) . to compare the similarity of the measured rnfl reflectance spectra , each reflectance spectrum was normalized to the average reflectance at 560 to 600 nm . the shapes of the rnfl reflectance spectra in figure 3c were nearly identical ( fig . because the shape of the rnfl reflectance spectrum can vary with the incident and scattering angles , we examined this variation over a limited range , as illustrated in figure 4 . figure 4a shows the spectra of two bundles from different retinas that were measured at different incident and scattering angles . the two spectra for bundle b3 were obtained with similar incident angles ( 19 and 21 , respectively ) . changing the scattering angle from 172 to 160 caused r to decline slightly at all wavelengths , with the decrease ranging from 3.1% to 6.7% . the two spectra for bundle b4 were obtained with similar scattering angles ( 178 and 177 , respectively ) . changing the incident angle from 21 to 10 caused r to increase , with a greater increase at short wavelengths ( e.g. , 10.4% at 400 nm ) , again the overall spectral shapes were similar . the normalized spectra in figure 4b show that a 12 change of incident angle or a 11 change of scattering angle result in very little change in their overall shape . we conclude that the shape of the rnfl reflectance spectrum is not very sensitive to the measurement geometry as long as the ranges of incident and scattering angles are restricted . in this study , the incident and scattering angles ranged from 7 to 25 and 163 to 179 , respectively . thirty - two sectors in eight control retinas ( four sectors in each retina ) were analyzed . consistent with our previous report , bundles in all 32 sectors showed intense and uniform stain of f - actin , mts , and nfs . figure 5a shows the bundle and gap areas used to measure the reflectance at a radius ( r ) of 500 m . the centers of the measurement areas for other radii along the same bundle are indicated by dots . r decreased with distance from the onh center due to thinning of the bundle peripherally . 5c ) show that the shape of the reflectance spectrum was similar along the bundle . 5e ) indicate that the shape of the reflectance spectrum was also similar among bundles at the same r. the spectra in figure 4 from two bundles in two different retinas suggest that the shape of the reflectance spectrum is similar among normal bundles . figure 6 shows normalized reflectance spectra of 32 normal sectors measured at r = 500 m . the similarity of these spectra suggests that the shape of the rnfl reflectance spectrum is a robust feature that can be used to study changes of rnfl reflectance in diseased retinas . figures 7a and 7b show an example of the thickness and retardance profiles along the bundle displayed in figure 5 . the corresponding n , however , varied little between r = 300 m and 700 m ( fig . figure 7d summarizes n profiles of 32 sectors , with each n profile the average of bundles within the same sector . for each sector , n did not change very much with radius , with a maximum sd of 0.02 nm/m . the average values along bundles , however , were significantly different among sectors ( p < 0.0001 ) , with n ranging from 0.24 to 0.39 nm/m . unpublished data show no consistent pattern of n profiles around the onh in normal retinas ; sector location , therefore , was not considered when comparing n of treated bundles with normal values . the baseline iop of treated eyes before treatment ( 10.2 0.6 mm hg ) was not statistically different from the control retinas ( 10.2 0.5 mm hg ; p = 0.6 , t - test ) . the mean iop in 2 weeks ranged from 16.7 to 23.8 mm hg , with the mean peak iop of 41.0 8.5 mm hg ( individual iop time courses are in supplementary fig . the rat model of glaucoma used in this study induced characteristic changes of axonal cytoskeletal components , which we have reported previously . these changes , confirmed in this study , include the findings that various degrees of cytoskeletal distortion occur within a single treated retina , that the distortion starts early near the onh , and that distortion of f - actin occurs before change of mts and nfs . the goal of this study was to demonstrate how the optical properties of the rnfl , specifically the rnfl reflectance spectra and n profiles , change in bundles with different degrees of ultrastructural damage . because f - actin distortion precedes change of mts and nfs , the appearance of f - actin stain a grading system was developed to describe f - actin distortion and identify retinal sectors with different degrees of damage . this distortion and the grading system are illustrated in figure 8 , which shows an example of changes of f - actin around the onh and along bundles . bundles in retinal sectors a1 and a2 are normal - looking in the en face image . their corresponding cs images at r = 500 m show uniformly stained f - actin within bundles ( fig . the cs image of a1 near the onh ( r = 300 m ) is also nearly normal - looking ; however , the cs image of a2 at r = 300 m is less uniform compared with that at r = 500 m . nonuniform stain suggests distortion of cytoskeletal structure . for bundles in sector a3 , distortion of f - actin in the en face image and nonuniform stain in the cs image sector a4 shows an example of a retinal sector in which severe damage of axonal cytoskeleton and obvious thinning of rnfl occur . although figure 8a shows only a single en face image , multiple en face images at different depths in the rnfl were examined before assigning a grade to a retinal sector . from here on , we denote the f - actin appearance of a sector with one of the grades a1 through a4 based on its similarity to a sector in figure 8 . for each retina , a grade was assigned to each clock - hour sector around the onh . for the 11 treated retinas , the distribution of grades a1 though a4 did not show location dependence ( p = 0.998 , tested by friedman 's nonparametric 2-way repeated measures test ) . the retinal sectors available for this study were limited by the requirements that the sectors must have all of the measurements of reflectance , birefringence , and cytostructure , and rnfl reflectance was measured near direct backscattering ( scattering angle ranged from 162180 ) . twenty - five sectors in 11 treated retinas were studied . for each studied sector , average thickness measured at r = 300 m was compared with a normal value ( mean sd of 20.2 8.4 m ) derived from 146 normal bundles with randomly distributed bundle orientation ( 92 normal bundles in this study and an additional 54 normal bundles measured in other studies ) . all four sectors graded a1 and five sectors graded a2 had thickness not significantly different from normal ( p > 0.37 ) . six of 10 sectors graded a3 also had normal thickness , whereas the other 4 sectors were thinner than normal ( p < 0.043 , 1-way anova followed by post hoc least significant difference test ) . all six sectors graded a4 were significantly thinner than the normal ( p < 0.001 ) , with average t ranging from 5.49.6 m . a summary of rnfl thickness and birefringence measured in all studied sectors is given in table s1 in the supplementary materials . below we present the reflectance spectrum and birefringence of treated nf bundles in three groups . the first group , mild cytoskeletal distortion , includes bundles that fall in sectors graded a1 with nearly normal - looking bundles , and those graded a2 that show no apparent cytoskeletal change away from the onh but do show change near the onh . the second group , moderate cytoskeletal distortion , corresponds to sectors graded a3 , and the third group , severe cytoskeletal distortion , corresponds to sectors graded a4 . bundles in sectors graded a1 and a2 showed two patterns of behavior , which are illustrated in figure 10 for two bundles in figure 8 . figures 10a and 10c , respectively , show the normalized reflectance spectra of the indicated bundles in sectors a1 and a2 of figure 8 . for display clarity , the figures show only the spectra measured at r = 300 , 500 , and 700 m . the normalized reflectance spectra were similar to the normal at wavelengths greater than 460 nm but showed a decrease at short wavelengths ( 440 nm ) as the bundle neared the onh . reflectance spectra and birefringence ( n ) profiles of bundles with no obvious cytoskeletal change in the peripheral retina . ( a ) and ( b ) for the indicated single bundle in ( a1 ) of figure 8 ; ( c ) and ( d ) for the indicated single bundle in ( a2 ) of figure 8 . the normalized reflectance spectra ( a , c ) were similar to the normal at wavelengths 460 nm ; however , the reflectance at short wavelengths decreased as bundle areas neared the onh . the n profiles were either similar to the normal ( b ) or showed decreased n at r = 300 m ( d ) ; gray bar : normal range of n . ( e , f ) show the normalized reflectance spectra of all sectors graded as a1 and a2 . spectra measured at r = 700 m , which were similar to the normal , do not show . figure 10b shows the n profile of the bundle in sector a1 . for this bundle , the n was approximately constant along the bundle and within the normal range . in contrast , figure 10d shows that the n profile of the bundle in the a2 sector decreased significantly at r = 300 m compared with its values at r = 400 to 700 m , although the mean n of the profile was within the normal range . for nine retinal sectors graded a1 or a2 from five retinas , the reflectance spectra of all analyzed sectors showed change at short wavelengths as bundle areas neared the onh . in contrast , five of these sectors ( four a1 and one a2 in fig . 11a ) had the n profiles similar to figure 10b , whereas the other four sectors ( all a2 in fig . 11b ) showed n that decreased at r = 300 m compared with its value measured at r 400 m , similar to figure 10d . birefringence ( n ) profiles for retinal sectors with no obvious cytoskeletal change in the peripheral retinal region ( grades a1 and a2 ) . n along bundles were either approximately constant and within the normal range ( a ) or showed a decrease of n near the onh ( b ) . gray bar : normal range of n . compared with bundles with mild cytoskeletal distortions , the normalized reflectance at short wavelengths for bundles with moderate cytoskeletal distortion ( grade a3 ) demonstrated a greater decrease at r = 300 m and the decrease also occurred at other distances . figure 12a shows the reflectance spectra of the indicated single bundle in retinal sector graded a3 of figure 8 . the normalized reflectance at short wavelengths decreased more than in sectors a1 and a2 as the bundle areas neared the onh . the corresponding n profile ( fig . reflectance spectra and birefringence ( n ) profile of a single bundle with moderate cytoskeletal distortion in figure 8 ( sector a3 ) . ( a ) the normalized reflectance spectra at short wavelengths decreased as the bundle area neared the onh . figure 13 shows another example of a grade a3 retinal sector in a different retina . stain of f - actin and mts in cs images were less uniform compared with the normal and showed more prominent structural distortion than sector a3 of figure 8 . 13e ) shows that the decrease of the reflectance at short wavelengths occurred at all r. the spectra also show that the normalized reflectance at long wavelengths became higher than the normal ( p = 0.025 ) , especially at r = 300 m ( p < 0.001 ) . reflectance spectra and birefringence ( n ) profile of another bundle in a different retina with moderate cytoskeletal distortion ( grade a3 ) . ( a d ) cross - sectional images showing distortion of f - actin and mts with bundles . ( e ) reflectance spectra of the indicated bundle in ( a ) and ( b ) ( yellow arrow ) . ( f ) n at all r was below the normal ( gray bar ) . for 10 retinal sectors graded a3 in nine retinas , all showed change of the reflectance spectra near the onh , both at short wavelengths and at long wavelengths ( fig . reflectance spectra and birefringence ( n ) profiles of bundles with moderate cytoskeletal distortion ( grade a3 ) . ( a ) compared with the normal , the normalized reflectance spectra at r = 300 m showed a decrease at short wavelengths and an increase at long wavelengths . ( b ) n at all r was below the normal range ( gray bar ) . for bundles in retinal sectors with severe cytoskeletal change in en face images and thinning in cs images ( grade a4 ) , figure 15a shows the reflectance spectra of the indicated single bundle in sector a4 of figure 8 . the bundle thickness at r = 300 m was 9.5 m , significantly lower than the normal . the n of bundles with severe damage , however , also could have a n profile falling below the normal range . figures 15c and 15d show the reflectance spectra and n profiles of six severely damaged retinal sectors , each from a different retina ( sectors a4 in fig . the average thickness at r = 300 m was less than 9.6 m for all sectors . although for thin bundles with high n the inaccuracy of n could be substantial ( supplementary table s1 ) , no amount of the error can remove the fact that bundles with significant birefringence were observed for the retinal sectors of grade a4 . reflectance spectra and birefringence ( n ) profiles of sectors with severe distortion of cytoskeleton and thinning of rnfl ( grade a4 ) . ( a , b ) reflectance spectra and n along the indicated single bundle in sector ( a4 ) of figure 8 . ( c , d ) reflectance spectra and n profiles of six sectors , each from a different retina . due to the property of directional reflectance of the rnfl , bundle reflectance ( r ) depends on the measurement geometry . figure 3a shows a bundle area ( b1 ) that was measured at maximum ( on - peak ) reflectance with the light source and camera positions set to satisfy the geometry for light scattering by cylinders ( details in the legend for fig . figure 3b shows an example of the same bundle measured at off - peak reflectance . with a 4 change of the incident angle and without change of the camera position , the same bundle area appeared dimmer ( fig . the measured r decreased to approximately 50% of its on - peak reflectance ( fig . 3c ) . to compare the similarity of the measured rnfl reflectance spectra , each reflectance spectrum was normalized to the average reflectance at 560 to 600 nm . the shapes of the rnfl reflectance spectra in figure 3c were nearly identical ( fig . because the shape of the rnfl reflectance spectrum can vary with the incident and scattering angles , we examined this variation over a limited range , as illustrated in figure 4 . figure 4a shows the spectra of two bundles from different retinas that were measured at different incident and scattering angles . the two spectra for bundle b3 were obtained with similar incident angles ( 19 and 21 , respectively ) . changing the scattering angle from 172 to 160 caused r to decline slightly at all wavelengths , with the decrease ranging from 3.1% to 6.7% . the two spectra for bundle b4 were obtained with similar scattering angles ( 178 and 177 , respectively ) . changing the incident angle from 21 to 10 caused r to increase , with a greater increase at short wavelengths ( e.g. , 10.4% at 400 nm ) , again the overall spectral shapes were similar . the normalized spectra in figure 4b show that a 12 change of incident angle or a 11 change of scattering angle result in very little change in their overall shape . we conclude that the shape of the rnfl reflectance spectrum is not very sensitive to the measurement geometry as long as the ranges of incident and scattering angles are restricted . in this study , the incident and scattering angles ranged from 7 to 25 and 163 to 179 , respectively . thirty - two sectors in eight control retinas ( four sectors in each retina ) were analyzed . consistent with our previous report , bundles in all 32 sectors showed intense and uniform stain of f - actin , mts , and nfs . figure 5a shows the bundle and gap areas used to measure the reflectance at a radius ( r ) of 500 m . the centers of the measurement areas for other radii along the same bundle are indicated by dots . r decreased with distance from the onh center due to thinning of the bundle peripherally . 5c ) show that the shape of the reflectance spectrum was similar along the bundle . 5e ) indicate that the shape of the reflectance spectrum was also similar among bundles at the same r. the spectra in figure 4 from two bundles in two different retinas suggest that the shape of the reflectance spectrum is similar among normal bundles . figure 6 shows normalized reflectance spectra of 32 normal sectors measured at r = 500 m . the similarity of these spectra suggests that the shape of the rnfl reflectance spectrum is a robust feature that can be used to study changes of rnfl reflectance in diseased retinas . figures 7a and 7b show an example of the thickness and retardance profiles along the bundle displayed in figure 5 . the corresponding n , however , varied little between r = 300 m and 700 m ( fig . figure 7d summarizes n profiles of 32 sectors , with each n profile the average of bundles within the same sector . for each sector , n did not change very much with radius , with a maximum sd of 0.02 nm/m . the average values along bundles , however , were significantly different among sectors ( p < 0.0001 ) , with n ranging from 0.24 to 0.39 nm/m . unpublished data show no consistent pattern of n profiles around the onh in normal retinas ; sector location , therefore , was not considered when comparing n of treated bundles with normal values . the baseline iop of treated eyes before treatment ( 10.2 0.6 mm hg ) was not statistically different from the control retinas ( 10.2 0.5 mm hg ; p = 0.6 , t - test ) . the mean iop in 2 weeks ranged from 16.7 to 23.8 mm hg , with the mean peak iop of 41.0 8.5 mm hg ( individual iop time courses are in supplementary fig . the rat model of glaucoma used in this study induced characteristic changes of axonal cytoskeletal components , which we have reported previously . these changes , confirmed in this study , include the findings that various degrees of cytoskeletal distortion occur within a single treated retina , that the distortion starts early near the onh , and that distortion of f - actin occurs before change of mts and nfs . the goal of this study was to demonstrate how the optical properties of the rnfl , specifically the rnfl reflectance spectra and n profiles , change in bundles with different degrees of ultrastructural damage . because f - actin distortion precedes change of mts and nfs , the appearance of f - actin stain was used to grade the degree of damage . a grading system was developed to describe f - actin distortion and identify retinal sectors with different degrees of damage . this distortion and the grading system are illustrated in figure 8 , which shows an example of changes of f - actin around the onh and along bundles . bundles in retinal sectors a1 and a2 are normal - looking in the en face image . their corresponding cs images at r = 500 m show uniformly stained f - actin within bundles ( fig . 2b ) . the cs image of a1 near the onh ( r = 300 m ) is also nearly normal - looking ; however , the cs image of a2 at r = 300 m is less uniform compared with that at r = 500 m . nonuniform stain suggests distortion of cytoskeletal structure . for bundles in sector a3 , distortion of f - actin in the en face image and nonuniform stain in the cs image sector a4 shows an example of a retinal sector in which severe damage of axonal cytoskeleton and obvious thinning of rnfl occur . although figure 8a shows only a single en face image , multiple en face images at different depths in the rnfl were examined before assigning a grade to a retinal sector . from here on , we denote the f - actin appearance of a sector with one of the grades a1 through a4 based on its similarity to a sector in figure 8 . for each retina , a grade was assigned to each clock - hour sector around the onh . for the 11 treated retinas , the distribution of grades a1 though a4 did not show location dependence ( p = 0.998 , tested by friedman 's nonparametric 2-way repeated measures test ) . the retinal sectors available for this study were limited by the requirements that the sectors must have all of the measurements of reflectance , birefringence , and cytostructure , and rnfl reflectance was measured near direct backscattering ( scattering angle ranged from 162180 ) . twenty - five sectors in 11 treated retinas were studied . for each studied sector , average thickness measured at r = 300 m was compared with a normal value ( mean sd of 20.2 8.4 m ) derived from 146 normal bundles with randomly distributed bundle orientation ( 92 normal bundles in this study and an additional 54 normal bundles measured in other studies ) . all four sectors graded a1 and five sectors graded a2 had thickness not significantly different from normal ( p > 0.37 ) . six of 10 sectors graded a3 also had normal thickness , whereas the other 4 sectors were thinner than normal ( p < 0.043 , 1-way anova followed by post hoc least significant difference test ) . all six sectors graded a4 were significantly thinner than the normal ( p < 0.001 ) , with average t ranging from 5.49.6 m . a summary of rnfl thickness and birefringence measured in all studied sectors is given in table s1 in the supplementary materials . below we present the reflectance spectrum and birefringence of treated nf bundles in three groups . the first group , mild cytoskeletal distortion , includes bundles that fall in sectors graded a1 with nearly normal - looking bundles , and those graded a2 that show no apparent cytoskeletal change away from the onh but do show change near the onh . the second group , moderate cytoskeletal distortion , corresponds to sectors graded a3 , and the third group , severe cytoskeletal distortion , corresponds to sectors graded a4 . bundles in sectors graded a1 and a2 showed two patterns of behavior , which are illustrated in figure 10 for two bundles in figure 8 . figures 10a and 10c , respectively , show the normalized reflectance spectra of the indicated bundles in sectors a1 and a2 of figure 8 . for display clarity , the figures show only the spectra measured at r = 300 , 500 , and 700 m . the normalized reflectance spectra were similar to the normal at wavelengths greater than 460 nm but showed a decrease at short wavelengths ( 440 nm ) as the bundle neared the onh . reflectance spectra and birefringence ( n ) profiles of bundles with no obvious cytoskeletal change in the peripheral retina . ( a ) and ( b ) for the indicated single bundle in ( a1 ) of figure 8 ; ( c ) and ( d ) for the indicated single bundle in ( a2 ) of figure 8 . the normalized reflectance spectra ( a , c ) were similar to the normal at wavelengths 460 nm ; however , the reflectance at short wavelengths decreased as bundle areas neared the onh . the n profiles were either similar to the normal ( b ) or showed decreased n at r = 300 m ( d ) ; gray bar : normal range of n . ( e , f ) show the normalized reflectance spectra of all sectors graded as a1 and a2 . spectra measured at r = 700 m , which were similar to the normal , do not show . figure 10b shows the n profile of the bundle in sector a1 . for this bundle , the n was approximately constant along the bundle and within the normal range . in contrast , figure 10d shows that the n profile of the bundle in the a2 sector decreased significantly at r = 300 m compared with its values at r = 400 to 700 m , although the mean n of the profile was within the normal range . for nine retinal sectors graded a1 or a2 from five retinas , the reflectance spectra of all analyzed sectors showed change at short wavelengths as bundle areas neared the onh . in contrast , five of these sectors ( four a1 and one a2 in fig . 11a ) had the n profiles similar to figure 10b , whereas the other four sectors ( all a2 in fig . 11b ) showed n that decreased at r = 300 m compared with its value measured at r 400 m , similar to figure 10d . birefringence ( n ) profiles for retinal sectors with no obvious cytoskeletal change in the peripheral retinal region ( grades a1 and a2 ) . n along bundles were either approximately constant and within the normal range ( a ) or showed a decrease of n near the onh ( b ) . compared with bundles with mild cytoskeletal distortions , the normalized reflectance at short wavelengths for bundles with moderate cytoskeletal distortion ( grade a3 ) demonstrated a greater decrease at r = 300 m and the decrease also occurred at other distances . figure 12a shows the reflectance spectra of the indicated single bundle in retinal sector graded a3 of figure 8 . the normalized reflectance at short wavelengths decreased more than in sectors a1 and a2 as the bundle areas neared the onh . the corresponding n profile ( fig . reflectance spectra and birefringence ( n ) profile of a single bundle with moderate cytoskeletal distortion in figure 8 ( sector a3 ) . ( a ) the normalized reflectance spectra at short wavelengths decreased as the bundle area neared the onh . figure 13 shows another example of a grade a3 retinal sector in a different retina . stain of f - actin and mts in cs images were less uniform compared with the normal and showed more prominent structural distortion than sector a3 of figure 8 . 13e ) shows that the decrease of the reflectance at short wavelengths occurred at all r. the spectra also show that the normalized reflectance at long wavelengths became higher than the normal ( p = 0.025 ) , especially at r = 300 m ( p < 0.001 ) . reflectance spectra and birefringence ( n ) profile of another bundle in a different retina with moderate cytoskeletal distortion ( grade a3 ) . ( a d ) cross - sectional images showing distortion of f - actin and mts with bundles . ( e ) reflectance spectra of the indicated bundle in ( a ) and ( b ) ( yellow arrow ) . ( f ) n at all r was below the normal ( gray bar ) . for 10 retinal sectors graded a3 in nine retinas , all showed change of the reflectance spectra near the onh , both at short wavelengths and at long wavelengths ( fig . reflectance spectra and birefringence ( n ) profiles of bundles with moderate cytoskeletal distortion ( grade a3 ) . ( a ) compared with the normal , the normalized reflectance spectra at r = 300 m showed a decrease at short wavelengths and an increase at long wavelengths . ( b ) n at all r was below the normal range ( gray bar ) . for bundles in retinal sectors with severe cytoskeletal change in en face images and thinning in cs images ( grade a4 ) , the reflectance spectra were nearly flat across wavelengths . figure 15a shows the reflectance spectra of the indicated single bundle in sector a4 of figure 8 . the bundle thickness at r = 300 m was 9.5 m , significantly lower than the normal . the n of bundles with severe damage , however , also could have a n profile falling below the normal range . figures 15c and 15d show the reflectance spectra and n profiles of six severely damaged retinal sectors , each from a different retina ( sectors a4 in fig . the average thickness at r = 300 m was less than 9.6 m for all sectors . although for thin bundles with high n the inaccuracy of n could be substantial ( supplementary table s1 ) , no amount of the error can remove the fact that bundles with significant birefringence were observed for the retinal sectors of grade a4 . reflectance spectra and birefringence ( n ) profiles of sectors with severe distortion of cytoskeleton and thinning of rnfl ( grade a4 ) . ( a , b ) reflectance spectra and n along the indicated single bundle in sector ( a4 ) of figure 8 . ( c , d ) reflectance spectra and n profiles of six sectors , each from a different retina . this study used a rat model of glaucoma and isolated retinas to provide insight into how the rnfl reflectance spectrum and birefringence change in retinal nerve fiber bundles with different degrees of cytostructural damage . use of isolated retinas eliminated the confounding effects of other ocular tissues , including the cornea and lens , on measurements of the rnfl optical properties . in normal rat retinas , we found that the shape of the rnfl reflectance spectrum , as expressed by the normalized reflectance spectrum ( rn ) , did not change along bundles , and rnfl birefringence ( n ) was approximately constant along bundles . these results suggest that the structures that contribute to rnfl reflectance and birefringence do not change very much along bundles in normal tissue . the underlying anatomic bases for rnfl reflectance and birefringence are not identical , however , as studies show that in rodent retinas , mts are the dominant structures for rnfl birefringence , whereas mts contribute less than 50% to rnfl reflectance . it is known that glaucoma damages the ultrastructure of ganglion cell axons and different structures ( e.g. , mts , nfs , f - actin ) respond differently to the damage . hence , under the circumstance of glaucomatous damage to the rnfl , the optical properties of rnfl reflectance and birefringence are expected to change , but these changes may not be similar . the damage to the axonal cytoskeleton induced by the rat model of glaucoma used in this study varies from undetectable to severe and , in addition , different degrees of structural damage can occur within a single retina , as reported previously . this feature of the model allowed us to compare the change of rnfl optical properties with the degree of damage severity , as assessed by the severity of f - actin distortion . to prevent bias , we graded the severity of f - actin distortion within retinal areas without knowledge of their optical properties , and have included data from all nerve fiber bundles for which optical measurements were possible . it must be noted that , although the association between f - actin distortion and damage severity is plausible , the use of f - actin distortion as a measure of overall structural damage has not been independently validated , a limitation of the study . if one accepts our grading system as a measure of damage , the principal finding of the study is that , with the exception of birefringence in some severely damaged sectors ( discussed later ) , as damage severity increases , both rn and n depart further and further from normal . thus , optical properties can serve as an accessible surrogate for cytoskeletal damage . in addition , detectable change in both optical properties occurs before change in rnfl thickness and , in some cases , even before apparent cytoskeletal change . the pattern of change of optical properties with severity observed in this study suggests that axonal damage starts at the onh and then propagates peripherally along bundles , following the pattern for cytoskeletal damage found previously and confirmed here ( fig . the earliest change seen , a short - wavelength decrease in rn that is apparent even in sectors with normal - looking f - actin ( grade a1 ) , is larger in spectra acquired closer to the onh ( figs . , rn begins to flatten , with a greater decrease at short wavelengths and an increase at long wavelengths . although change also occurs more peripherally , it is still larger near the onh ( figs . finally , with severe damage and thinning ( grade a4 ) , rn becomes flat at all distances from the onh ( fig . similar to changes in rn , change in n also begins near the onh , as seen for four of five grade a2 n profiles ( fig . unlike rn , however , n profiles in all grade a1 and one grade a2 sector appeared normal , suggesting that n is a less sensitive indicator of damage than short - wavelength change of rn . with moderate cytoskeletal damage ( grade a3 ) the n profiles all fell below the normal range ( fig . sectors with severe damage showed either decreased n profiles or , unexpectedly , n profiles within the normal range . one explanation for normal n profiles in sectors with overall severe cytoskeletal damage and rnfl thinning could be that the few surviving axons possess a cytoskeleton with an orderly array of nearly normal mts . the flat spectra for the same sectors support the idea that the structures contributing to rnfl reflectance and birefringence are not the same and are consistent with studies that show mts contribute differently to the two properties . indeed , the differing behavior of rn and n for all grades of damage severity lends support to this idea . change of rnfl reflectance was not uniform across wavelengths ; instead rn at short wavelengths responded earlier to structural damage . this may support the previously suggested two - mechanism model for the reflectance spectrum and also may provide a means to detect early damage in a clinical setting . for example , rnfl spectra may be amenable to measurement by hyperspectral imaging , or a ratio of short - to - long wavelength reflectance may capture the early change . in developing a spectral method , however , care will be required to account for short - wavelength absorption in the ocular media . an advantage of using spectral shape is that it is not sensitive to the measurement geometry as long as the ranges of incident and scattering angles are restricted ( figs . this contrasts with the use of intrinsic reflectance , the internal rnfl reflectance seen on oct , which several studies showed might provide sensitive detection of rnfl damage . the measured value of rnfl reflectance is strongly affected by directional reflectance , as shown in figure 3a and our earlier studies . clinical imaging systems do not simultaneously view all bundles at on - peak reflectance due to the change of bundle orientation around the onh , introducing substantial variation into measurements of intrinsic reflectance . although not as sensitive to early damage as rn , measurements of the n profile may provide an alternative method to detect early structural change in the rnfl . whether they suffer early decline near the onh in glaucoma remains to be determined , but further work is clearly desirable . because birefringence and reflectance appear to depend differently on axonal cytostructure , the two approaches may even be complementary . the rat model of glaucoma used in this study caused an acutely high iop after laser treatment that then slowly decreased over time ( supplementary fig . s3 ) . despite iop as high as 56 mm hg ( the highest iop observed in rat 6 ) , the value was below the mean blood pressure of the normal rat ( reported as approximately 70 mm hg measured under anesthesia ) , so a short exposure to the acutely high iop is not expected to cause ischemic damage to the retina . we believe that the cytostructural distortion observed in this study was caused by the moderate levels of iop elevation over 2 weeks ; that is , axonal damage due to prolonged iop elevation . also , further , the tendency for changes to occur nearer the onh in the less severely damaged sectors suggests that the onh is the locus of the iop insult . these characteristics of the rat model share similarity with human glaucoma and , hence , the findings obtained in this study may provide guidance for future studies of the relationship between changes of rnfl optical properties and ultrastructure in human glaucoma . | purposeglaucoma damages the retinal nerve fiber layer ( rnfl ) .
this study used precise multimodal image registration to investigate the changes of the rnfl reflectance spectrum and birefringence in nerve fiber bundles with different degrees of axonal damage.methodsthe reflectance spectrum of individual nerve fiber bundles in normal rats and rats with experimental glaucoma was measured from 400 to 830 nm and their birefringence was measured at 500 nm .
optical measurements of the same bundles were made at different distances from the optic nerve head ( onh ) .
after the optical measurements , the axonal cytoskeleton of the rnfl was evaluated by confocal microscopy to assess the severity of cytoskeletal change.resultsfor normal bundles , the shape of the rnfl reflectance spectrum and the value of rnfl birefringence did not change along bundles . in treated retinas ,
damage to the cytoskeleton varied within and across retinas .
the damage in retinal sectors was subjectively graded from normal - looking to severe .
change of spectral shape occurred near the onh in all sectors studied .
this change became more prominent and occurred farther from the onh with increased damage severity .
in contrast , rnfl birefringence did not show change in normal - looking sectors , but decreased in sectors with mild and moderate damage .
the birefringence of severely damaged sectors was either within or below the normal range.conclusionsvarying degrees of cytoskeletal damage affect the rnfl reflectance spectrum and birefringence differently , supporting differences in the ultrastructural basis for the two optical properties .
both properties , however , may provide a means to detect disease and to estimate ultrastructural damage of the rnfl in glaucoma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the index hpai - h5n1 was confirmed in nigeria at a commercial poultry farm in kaduna state , and , by the end of the initial outbreak , over 46,000 poultry [ 1 , 2 ] had been destroyed . this outbreak brought the asian strain of highly pathogenic avian influenza ( hpai ) h5n1 into africa for the first time in the beginning of january , 2006 [ 37 ] in nigeria . since its emergence in africa in 2006 , avian influenza viruses of the h5n1 subtype have spread rapidly to poultry farms in several african countries . it has caused deaths of millions of birds in africa , as is the case in other affected parts of the world . highly pathogenic avian influenza ( hpai ) is caused by aivs that are extremely virulent , causing up to 100% mortality in domestic chickens . the h5n1 highly pathogenic avian influenza ( hpai ) virus has been a great concern not only for the poultry industry but also for human health since 1997 . following the index hpai - h5n1 in nigeria , several efforts have been directed to increased surveillance and diagnosis of the disease . this has led to increased diagnostic capacity , reporting , and research into the diverse genotype of h5n1 isolates from nigeria . the commercial poultry production system in nigeria as categorized by the fao , which stems from the two major systems : rural poultry production and commercial poultry production , was affected by the hpai outbreaks . also , several attempts were made to determine the losses in terms of the number of poultry , monetary , and social values as a result of the disease burden in nigeria . these attempts have been at some point in the course of the disease or aimed at a particular region of the country due to some identified constraints . also no overall , detailed clinical and pathological record has been given on a case by case basis for all the outbreaks as seen from different states and regions of the countries which could highlight factors involved in the spread of the disease . 2006 , in their letter to the veterinary record , mentioned a few lesions seen in the index case . 2006 described the clinicopathological and husbandry features associated with the maiden diagnosis of ai in nigeria . other reports were limited to cases seen in 2006 [ 14 , 15 ] only . 2007 had earlier reported lesions which depict circulatory disturbances , respiratory , intestinal , and reproductive system pathology in selected cases . this study aimed at achieving the determination of the losses on a state by state basis and the total losses recorded during the entire course of the disease in nigeria and also aimed at highlighting the morbidity , mortality , and pathology in the commercial poultry production systems as practiced in nigeria . all the data including state , location , farm flock size , and morbidity and mortality records used in this study were supplied directly by clients who reported and submitted carcasses of layers , pullet , cockerels , and broilers for postmortem examination and avian influenza diagnosis at the national veterinary research institute ( nvri ) , central diagnostic laboratory , vom . a total of three hundred and sixteen ( 316 ) carcasses from one hundred and fifty - three ( 153 ) farms from eighteen ( 18 ) states and the federal capital territory , abuja , were examined . these carcasses were submitted directly by clients for postmortem examination and avian influenza diagnosis and were selected based on laboratory confirmation of hpai h5n1 virus infection at the nvri laboratory . carcasses of the commercial birds that died after natural infection with hpai were submitted for pathological examination . following postmortem examination of the carcasses , sections of liver , heart , spleen , kidney , lung , trachea , proventriculus , gizzard , duodenum , ileum , cecum , and brain were removed and fixed in 10% buffered formalin . all tissue samples were then embedded in paraffin , sectioned at 5 m , mounted on clean glass slides , and stained with hematoxylin and eosin ( h&e ) stains for histopathologic examination using low and high powered field of carl zeiss or nikon binocular microscope .
virus isolation . for virus isolation , samples of liver , heart , spleen , kidney , lung , trachea , duodenum , and caecum were removed and submitted for virological investigation , where the homogenates of the trachea , lung , liver , spleen , and kidney were inoculated via the allantoic cavity into 911-day - old embryonating chicken eggs obtained from specific antibody negative chickens . during the period under review ( 20062008 ) , a total of eighteen ( 18 ) states ( adamawa , bauchi , bornu , jigawa , kaduna , kano , katsina , sokoto , plateau , nasarawa , kwara , lagos , ogun , oyo , rivers , edo , anambra , and enugu ) and the federal capital territory , abuja , had confirmed hpai h5n1 outbreaks in commercial layer , pullet , cockerel , and broiler ( table 1 ) . a total of one hundred and fourteen thousand , nine hundred and twenty - nine ( 114,929 ) commercial chickens died from a total flock size of nine hundred and sixty - five thousand , five hundred and eighty - three ( 965,583 ) before the rest of the flocks were stamped out . the north - western region recorded the highest number of mortalities in commercially raised chickens as a result of natural infection with hpai in nigeria . the figure ( 69,741 ) represents 60.68% of the total number ( 114,929 ) of commercially raised chickens that died as a result of hpai ( table 1 ) . while the total number of chicken losses as a result of hpai death and stamping out in this region ( 438,386 ) was second to the south - western region where commercial bird losses totaled 445,320 and the number that died as a result of hpai when the reporting was done was 26,878 , being 23.38% of the total number of commercial chickens that died as a result of hpai . mortality rates were the highest in broilers flocks ( 73.92% ) and the least in layers flocks ( 11.11% ) . a breakdown of the figures , which showed layer flocks , has been the most affected commercial chicken type with a total bird loss of 939,620 , representing 97.31% of the commercially raised chickens . of the 939,620 layer population affected in 127 farms , 104,351 layers , representing 90.79% of 114,929 , died as a result of direct hpai infection in layer flocks . eight hundred and fifty thousand , six hundred and fifty - four ( 850,654 ) birds , which represent the difference between the flock size and the number of the dead , were stamped out . broilers were the second most affected commercial chicken type of which 6,433 , representing 0.66% of the total flock size ( 965,583 ) of commercially raised chickens , were affected by hpai . of the 6,433 broilers affected , 4,755 broilers , representing 4.14% of the total number of commercially raised chickens ( 114,929 ) , died as a result of direct hpai infection , while the remaining broilers were stamped out . pullets were the next affected commercial chicken type of which 16,421 ( 11.70% ) were affected and 4408 ( 3.84% ) were reported to be dead . cockerel was the least affected commercial chicken type of which 3109 ( 0.32% ) were affected and 1,415 ( 1.23% ) were reported to be dead . main clinical and pathologic findings were observed in the nervous , circulatory , respiratory , integumentary , musculoskeletal , gastrointestinal , and reproductive systems and occasionally lesions are multisystemic . signs observed and reported are sudden death , high mortality , weakness , and recumbency . others ranged from nasal discharges , dyspnea , coughing , sneezing , diarrhea , shank hyperemia and haemorrhage , inability to stand , ataxia , and torticollis . in layers , egg structural abnormalities such as shell - less egg , white - colored eggs , and soft eggs were reported . lesions observed in the circulatory system included congestion ( figures 1 and 2 ) and cyanosis of comb and wattle , comb and wattle edema , and facial and subcutaneous edema . within the respiratory system , there were airsacculitis and pneumonia . there was petechiation to ecchymoses of the proventricular ( figure 3 ) and intestinal mucosa with resultant enteritis in the gastrointestinal system . integumentary system lesions are mainly cyanosis , edema , and ecchymotic hemorrhages while there were inflammatory , degenerative , and necrotic lesions in the musculoskeletal system . in adult birds , mainly layers reproductive lesions were observed and they were mainly ovarian follicular ecchymotic hemorrhages ( figure 4 ) .
layers . most of the commercially raised layers ( 67% ) exhibited lesions of the circulatory system , mainly cyanosis of comb and wattle with occasional facial edema . only 20% showed nervous signs and brain lesions of neuronal and purkinje cell necrosis of cerebrum and cerebellum , respectively . respiratory lesion of airsacculitis and pneumonia ( figure 4 ) with vascular congestion ( figure 5 ) was evident in 43.5% with more than half having pneumonia . of the 70 clinical reports of diarrhea , only 42 had enteritis and 18 were hemorrhagic . enteric petechiation and ecchymoses were observed in 45 of the carcasses while pancreatic necrosis was occasionally encountered ( figures 6 and 7 ) . splenic necrosis and loss of lymphoid cells were also seen in the carcasses ( figure 8) . a few carcasses ( 6.4% ) showed integumentary system lesions ; these are mainly cyanosis , edema , and ecchymotic hemorrhages . reproductive lesions were only observed in these layers , and these were observed in 15.3% only . these were mainly ovarian follicular ecchymotic hemorrhages and structure abnormality . shank hyperemia ( figure 9 ) and haemorrhage were also frequently seen .
pullet . of the twenty - five ( 25 ) pullet carcasses examined , 60% had report of the circulatory system signs , mainly cyanosis of comb and wattle with occasional facial edema . only 4% showed nervous lesion in the brain such as neuronal and purkinje cell necrosis of cerebrum and cerebellum , respectively . respiratory lesions of nasal exudation , airsacculitis , and pneumonia were evident in 32% . enteric lesion was observed in 3 ( 12% ) of the 25 carcasses examined . twenty - eight ( 28 ) percent had muscular and shank hemorrhages with necrosis , and/or myositis . twenty - four ( 24 ) percent of the pullets which died suddenly were from flocks with high mortality and also had multisystemic lesions . no lesion was observed in the integumentary and reproductive systems , respectively , in all carcasses examined .
broiler . of the twenty - nine ( 29 ) broiler carcasses examined , 82.7% had lesions of the circulatory system , mainly cyanosis of comb and wattle with occasional facial edema . only 4 ( 13.7% ) showed brain lesions of neuronal and purkinje cell necrosis of cerebrum and cerebellum , respectively . ten ( 34.4% ) of the broilers which died suddenly were from flocks with high mortality and had multisystemic lesions . no lesion was observed in the integumentary and reproductive systems , respectively , in all carcasses examined . cockerel . of the fourteen ( 14 ) cockerel carcasses examined , 64% had lesions of the circulatory system , mainly cyanosis of comb and wattle with occasional facial edema . only 5 ( 35.7% ) showed nervous lesions of neuronal and purkinje cell necrosis of cerebrum and cerebellum , respectively . five ( 35.7% ) of the pullets which died suddenly were from flocks with high mortality and had multisystemic lesions . the north - western region recorded the highest number of mortalities in commercially raised chickens as a result of natural infection with hpai in nigeria . this represents 60.68% ( 69,741 ) of the total number of chickens which died as a direct result of hpai infection . the total number of chickens which died as a direct result of hpai infection and those that were stamped - out in this region was 438,386 , only second to the total number of chickens which died as a direct result of hpai infection and those that were stamped out in the south - western region which stood at 445,320 . indeed , south - western nigeria , particularly the states surrounding the city of lagos , holds much of nigeria 's poultry industry . it is estimated that over 65% of nigeria 's commercial poultry are located in the five southern states of lagos , ogun , oyo , osun , and ondo . a very high number of poultry deaths and losses were also reported in a north - western regional avian influenza investigation in the north - western region , apart from the fact that it was in this region where the first outbreak of hpai in nigeria was reported [ 4 , 18 ] in a farm that had predominantly commercial birds [ 2 , 14 ] . although the total poultry losses were higher in the southwest region , the total number of chickens which died as a direct result of hpai infection was 26,878 being 23.38% of the national total number of commercially raised chickens that died as a direct result of hpai infection , as compared with 60.68% ( 69,741 ) in the northwest . this difference may be as a result of the fact that the farms in the southwest are more organized and densely stocked as compared with those in the northwest which are not well organized and not as densely stocked . the finding of high mortality in the north - western states is consistent with earlier reports [ 2 , 13 ] . in the north - western regional analysis which excluded bird losses in sokoto state , four hundred and eighty thousand , three hundred and seventy - eight ( 480,378 ) birds were reported as being lost as a result of hpai incursions and stamping out . the deviation of this finding from ours may be as a result of nonseparation between the various sectors of poultry production systems , as it includes backyard flocks and noncommercial and commercial flocks . the north - central states had a mortality of 6418 ( 5.58% ) being the total number of commercial chickens that died as a result of hpai when the reporting was done , while the total number of chicken losses as a result of natural death and stamping out policy in this region was 31,189 . the south - south region lost more birds to direct hpai infection ( 5309 ) as compared to the north - eastern region ( 4880 ) but more birds ( 29586 ) were destroyed in the northeast than in the south - south where 7,700 birds were destroyed . the southeast lost the least number of birds to hpai ( 1703 ) but had a high number of birds ' losses to hpai and stamping out ( 13402 ) . under the commercial poultry production sector practiced in nigeria , the commercial layer - type chicken was the most hit by the highly pathogenic avian influenza outbreaks experienced by the nigerian poultry industry . with a total flock size of 939,620 lost in 127 farms having confirmed outbreaks , this is attributed to the large number of laying birds in individual flocks as compared to other chicken types under these sectors . this significantly affected the economy not only because a whooping sum of n631 million ( us$5.43 million ) was paid as compensations to farmers but also because laying hens contribute huge resources to the national poultry flock and this emphasizes the importance of commercial layer flocks for nigeria 's economy . it was also observed that the average mortality rate was the least in commercial layers ( 11.11% ) and the highest in broilers ( 73.92 ) . this may be as a result of the cage housing of commercial layers which restrict movement and contact between hpai infected ones and noninfected ones compared with broilers raised in deep litter and which also share water and feed sources . average mortality rate was higher in cockerels ( males = 45.51% ) than in pullets ( females = 26.84% ) . the necropsy finding observed in the 316 carcasses examined of which 248 were commercial layer , 25 were pullet , 14 were cockerel , and 29 were broilers cut across more than one system and occurred more frequently and severely and in most of the carcasses examined irrespective of chicken type . in commercial layers , the systems affected included mainly circulatory , respiratory , and intestinal systems as observed by earlier investigators from the index case of hpai [ 2 , 4 ] in nigeria . only 20% of the 248 layer carcasses had neurologic signs and lesions contrary to what was observed in the index case where only young stocks had nervous system signs . also , other investigators reported presence of nervous signs and lesion with no particular reference to age and with reference to adult birds . eighty - two percent ( 82.7% ) of the broilers showed signs and lesions of circulatory disturbances followed by 67% in layers . this work was able to document the total hpai bird losses in commercially raised chickens in nigeria on a state by state cases and region by region cases , previously unreported . it also showed that mortality was the highest in broiler and males ( cockerels ) had more death than females ( pullets ) . this study was able to document the losses in hpai infected commercial chickens in nigeria and the overall pathological findings of hpai infection in chickens in nigeria previously unreported . | commercial layer - type , pullet , cockerel , and broiler chicken flocks infected with highly pathogenic avian influenza ( hpai ) h5n1 in nigeria between 2006 and 2008 were investigated for morbidity , mortality , and pathology .
of the one hundred and fifty - three ( 153 ) farms confirmed with hpai infection , one hundred and twenty - seven ( 127 ) were layer - type farms , nine ( 9 ) were pullet and broiler farms each , and eight ( 8) were cockerel rearing farms .
this study revealed the morbidity and mortality of a total of 939,620 commercial layer chickens , 16,421 pullets , 3,109 cockerels , and 6,433 broilers .
mortality rates were 11.11% in commercial layers , 26.84% in pullets , 45.51% in cockerels , and 73.92% in broilers in a total of eighteen ( 18 ) states and the federal capital territory , abuja .
a total of 316 carcasses were examined of which 248 were commercial layer , 25 were pullet , 14 were cockerel , and 29 were broiler .
main clinical and pathologic findings were observed in the nervous , circulatory , respiratory , integumentary , musculoskeletal , hemopoietic , gastrointestinal , and reproductive systems and , occasionally , lesions were generally nonspecific and multisystemic .
lesions occurred more frequently , severely , and in most of the carcasses examined , irrespective of chicken type . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in addition , they are very conservative and do not function as templates for protein synthesis . according to the location of the lnrna gene on the genome , lncrnas can be divided into 5 categories : ( 1 ) sense lncrna , ( 2 ) antisense lncrna , ( 3 ) bidirectional lncrna , ( 4 ) intronic lncrna , and ( 5 ) intergenic lncrna.10,1416 in various aspects of research on lnrnas , the functions and mechanisms of lncrnas are the most difficult and least understood . now , new research indicates that lncrnas have been implicated in various aspects of gene regulation , including imprinting , epigenetic regulation , trafficking of nucleus and cytoplasm , transcription , mrna splicing , and so on.1012 lncrnas have also been related to many diverse biological processes , such as cell cycle , cell proliferation , cell apoptosis , and cell differentiation.1719 on the basis of the pattern of their functions , lncrnas have been divided into 4 subtypes , namely , signals ( x - inactive specific transcript [ xist]20 and panda21 ) , decoys ( gas521 ) , guides ( hox transcript antisense intergenic rna [ hotair]22 and lincrna - p2123 ) , and scaffolds ( anril24 ) . previous studies have found that the abnormal expression or dysfunction of lnrna is closely related to the initiation and progression of human diseases , including cancer . lncrnas are closely involved in tumor development , for example , in gastric cancer , the maternally expressed gene 3 ( meg3 ) expression is clearly reduced , and meg3 overexpression can inhibit cell proliferation and induce the cell apoptosis of gastric cancer.20 therefore , in some types of cancer , specifically expressed lncrnas may be used as tumor biomarkers , and they can be served as therapeutic targets as well to conquer cancer . to summarize , lncrnas can play a role through a variety of mechanisms in cancer to influence its development . despite the increasing knowledge about the functions of lncrna in cancer , the modes of action of most lncrnas in most cancers remain unclear . widely understanding the mechanism of action , regulatory pathways , hierarchical structure , and operation of the network of lncrnas , we will greatly improve our recognitions of their function in cancer accordingly and find new way of treatment through regulating their function in oc . in 2003 , rangel et al21 found a new transcript , human oc - specific transcript 2 ( host2 ) , specific expression in human oc tissue . the host2 gene is located on chromosome 10 with a length of 2.9 kb , and it does not have an open reading frame , does not encode proteins , and belongs to lncrna.21 lncrna host2 have a highly specific expression in eoc , but the expression is very low or none in a variety of other common malignancies . after inhibiting the expression of host2 , the migration , invasion , and proliferation of ovcar-3 cells were significantly reduced.21 recently , the mechanisms of lncrna host2 regulating the biological behavior in eoc cells by binding to microrna let-7b was reported.22 the study first indicated that the lncrna host2 , which is highly expressed in eoc , functions as a molecular sponge which allows direct binding to let-7b and then inhibits the function of let-7b in the eoc . moreover , they found that given the overexpression of host2 in eoc , host2/let-7b may contribute to the regulation of growth and development in eoc . thus , we can easily infer that the expression of let-7targeting genes hmga2 , c - myc , dicer , and imp3 increases , thus promoting the initiation and development of eoc . in addition , they observed that suppression of the activity of let-7b can increase both the mrna and protein levels of hmga2 , c - myc , dicer , and imp3 . the schematic diagram of host2 promoting the endogenous expression of metastasis - promoting related genes , which were targeted by let-7b , is shown in ( fig . the results showed that the functions of let-7b can inhibit the expression of the oncogenes that negatively regulate cell growth and proliferation . in addition , the regulation between host2 and let-7b can provide innovative strategies for better diagnosis and treatment of this deadly malignant tumor . a schematic diagram of host2 enhances the endogenous expression of metastasis - promoting genes that are targeted by let-7b . a , down - regulation of host2 may increase let-7b activity , which would inhibit expression of its target genes ( hmga2 , c - myc , dicer , and imp3 ) . b , high regulation of host2 binds to more let-7b and increases expression of its target genes ( hmga2 , c - myc , dicer , and imp3 ) . hox transcription antisense rna ( hotair ) is the first trans - acting lncrna to be found , which is located in human chromosome 12q13.13 with a length of 6232 bp.23,24 the human hox gene family is divided into 4 subfamilies : hoxa , hoxb , hoxc , and hoxd , whereas lncrna hotair is identified from a custom tilling array of the hoxc locus.25,26 hotair is located in the antisense strand of the hoxc gene cluster , but it could regulate the hoxd gene cluster.26 the most familiar regulatory mechanism of hotair is that the 5 or 3 ends of hotair can be respectively combined with prc2 ( composed of ezh2 , suz12 , and eed)25 and histone demethylase complex ( lsd1 , co rest , and rest),27 and it mediates these 2 complexes binding to specific genomic loci , then respectively makes histone h3 trimethylated at lysine 27(h3k27me3 ) and histone h3 dimethyl lys4(h3k4me2 ) , and then causes the chromosome in a closed state and silences the expression of the target gene25 ( fig . 2 ) . thus , hotair can regulate the expression of hoxd epigenetically , which was sited at human chromosome 2q.26 a schematic diagram of the mechanisms of hotair . hotair when combined with prc2 ( composed of ezh2 , suz12 , and eed ) can trimethylate histone h3 at lysine 27 ( h3k27me3 ) and inhibit hoxd gene expression . the expression of hotair is very high in the eoc tissue compared with normal ovarian tissues . in addition , high expression of hotair is closely associated with the occurrence and development , invasion , metastasis , and prognosis in eoc.28 these researches emphasized the great clinical significance of hotair in patients with eoc , and hotair expression may act as a biomarker in predicting the progression of eoc . they also pointed out that the knockdown hotair can inhibit cellular epithelial - mesenchymal transition ( emt ) and reduce potential of tumorigenesis and migration ability via regulating the emt - related gene . that is , hotair can be used as a potential therapeutic target to treat patients with eoc . recently , studies have reported that hotair can play a role by regulating the cell cycle and apoptosis pathway in serous oc ( soc).28 the study showed that silencing of hotair can delay the progression of cell cycle and promote the apoptosis of the a2780 and ovca429 soc cells , evidencing that hotair may participate in the regulation of cell cycle and apoptosis to promote cell proliferation in soc . in addition to these studies , they also disclosed that the mechanism of hotair in soc is partly through regulating the expression of cell cycle and apoptosis - related genes , such as cyclin e , bcl-2 and caspase-9 , caspase-3 , and brca1 . these research can be extended to our existing cognition about the downstream genes of hotair , including the cell cycle related and apoptosis - related proteins . in addition , these results in the present studies give us a stronger appreciation of the significance of the abnormal expression of lncrnas in the soc , and offer us a theoretical basis for the targeted therapy of soc by lncrna - based targeted strategies . the h19 gene is located at human chromosome 11p with a full length of 2.3 kb , which is the first lncrna to be found related with cancer.29 numerous studies have shown that h19 is differentially expressed in many cancers , and for its function in cancer , it plays a dual role : promote the tumor or suppress the cancer.30 several groups reported that h19/igf2 gene imprinting is associated with differences in methylation , chromatin conformation , and transcription cycle of the allelic of h19.31,32 mizrahi et al33 reported that the expression of h19 was detected in 90% of ascites cells of patients with oc by means of situ hybridization . by decreasing the expression of h19 in a subcutaneous nude mice model for oc , it could be observed that 40% of the tumor growth was inhibited.33 this indicates that overexpression h19 promotes the growth and the knockdown of the expression of h19 can inhibit the growth of oc . recently , medrzycki et als31 research reported that histone h1.3 can inhibit the expression of h19 and suppress the growth of oc cells . h1.3 , a variant of h1 , is highly expressed in the ovcar-3 cell line , which is an eoc cell line . in addition , excessive expression of h1.3 can reduce the growth rate and colony formation of ovcar-3 cells , indicating that h1.3 may play a suppressive role in cancer cells . moreover , in multiple different oc cell lines , overexpression of h1.3 can inhibit the expression of h19 , whereas down - regulation of h1.3 can increase the expression of h19 , suggesting histone h1.3 as a specific inhibitor of h19 . histone h1.3 can regulate h19 expression mainly because overexpression of histone h1.3 can make the occupancy of h1.3 better at the imprinting control region ( icr ) , which encompasses the h19 regulator region , and also accompanied by the increase of dna methylation and the decrease in the insulator protein ccctc binding factor occupancy at the icr ( fig . most of all , the synergies of increased expression of h1.3 and reduced expression of h19 can better inhibit the growth of ovarian epithelial cancer . a schematic diagram of epigenetic mechanisms of h19 repression mediated by h1.3 histone h1.3 overexpression leads to increased occupancy of h1.3 at the h19 regulator region encompassing the icr , concomitant with increased dna methylation and reduced occupancy of the insulator protein ctcf at the icr , which can inhibit the expression of h19 . x - inactive specific transcript ( xist ) is a lnrna that is located at the x chromosome inactivation ( xi ) center , which is important in the initial phase of x chromosome inactivation.34 the precise molecular mechanism of xist in the initial phase of x chromosome inactivation remains elusive , but there are plenty of evidence suggesting that xist plays a stronger effect in the process of cell differentiation and proliferation and the maintenance of genomic stability.35 as xist is located at the x chromosome , it is involved in gynecological diseases . studies have shown that the expression of xist is detected in almost all female cells , except in gynecological malignancies such as cervical cancer , breast cancer , and oc.32 benoit et al36 showed that xist was not detected in more than half of the oc cells with barr body staining compared with normal ovarian cells . in addition , other studies indicated that reduction of the expression of xist can decrease the sensitivity of oc cells to paclitaxel , suggesting that xist can serve as a biomarker of the prognosis of oc . this mechanisms could be interpreted by the xist toxic effects of paclitaxel and might also be considered relevant in the reactivation of x-specific resistance gene and increased expression of these genes on the x chromosome.37 another explanation is that loss of xist is caused by genetic instability , thereby promoting resistance to chemotherapy in oc.37 lncrna uca1 is cloned from blz-211 , which is a human bladder carcinoma cell line , and the full length of uca1 cdna is 1442 bp.38 early studies have shown that uca1 is associated with the development of embryonic and bladder cancer , and it is also observed as highly expressed in oc and other tumors.39 in addition , uca1 plays a key role in promoting invasion and metastasis of tumor cells by up - regulating the expression of matrix metallopeptidase 2 ( mmp2 ) and mmp9 in oc.38 recently , yang et al40 indicated that uca1 could bind to mir-485 - 5p directly in eoc as an endogenous sponge . low expression of uca1 could down - regulate the expression of mmp14 , and mmp14 is one of the target genes of mir-485 - 5p . in addition , uca1 could improve eoc metastasis , and it is also associated with poor prognosis . therefore , uca1 can be a new prognostic biomarker and may serve as a potential target for the treatment of eoc . lsinct5 is an lncrna with a length of 2.6 kb and is located in the cell nucleus.40 studies have shown that the expression of lsinct5 is very high in both oc cell lines and tissues.41,42 it also shows that knockdown of lsinct5 can reduce cell proliferation and induce changes in the expression of some genes , such as neat-1 and pspc1.41 although the function mechanism of lsinct5 in oc is still unclear , it plays a significant role in the initiation and development of oc.43 so , lsinct5 may be used as an appropriate target for the treatment of oc . lncrna meg3 is located at the human chromosome 14q32.3 , which is also called maternally expressed gene 3.44 studies have found that meg3 is expressed in many normal tissues , including ovarian tissue45 ; however , the level of meg3 is very low or rarely detected in some tumor tissues and tumor cell lines , including breast cancer , cervix cancer , hepatocellular cancer , colon cancer , and so on.4648 studies have demonstrated that meg3 showed low or no expression in eoc tissues and oc cells compared with normal ovarian tissues,49 and overexpression of meg3 could inhibit proliferation and promote apoptosis in the oc cells ; therefore , meg3 may be a tumor suppressor gene in oc.50 the low expression of meg3 in oc is caused by multiple mechanisms , and the increased hypermethylation of the meg3 promoter can reduce the expression of meg3 rna in eoc.49 in addition , the study also noted that meg3 can control the proliferation of oc cells via targeting p53 and/or rb1.50 so , through further research , meg3 may be used as a potential therapeutic target and may provide new treatment strategies for eoc . bc200 is a lncrna with a length of 200 nucleotides and expressed specifically in the human nervous system.10,51 the expression of bc200 was significantly decreased in oc tissue compared with that in normal ovarian epithelium.52 this suggests that the low expression of bc200 may be associated with the development of oc . the low expression of bc200 may be used as a potential diagnostic marker for patients with oc . in addition , down - regulation of bc200 can lead to the proliferation of oc cells and inhibit the sensitivity of oc cells to carboplatin.52 however , the current research also shows that bc200 has no obvious effect on the invasion and migration of oc cells . in a summary , the dysregulation of bc200 was detected in oc , and this evidence provide some clinical implications of bc200 for the diagnosis and targeted therapy of oc . pvt1 is an lncrna with a length of 1.9 kb , originally identified as a transcriptional unit from a human homologous sequence to pvt1.53 the amplification and overexpression of pvt1 can increase cell proliferation and inhibit cell apoptosis , suggesting that it is an antiapoptotic gene.54 recently , it was reported that pvt1 is associated with cisplatin resistance in oc.55 it also indicated that overexpression of pvt1 can inhibit the expression of transforming growth factor-1 , p - smad and caspase-3 in oc , which were associated with cell apoptosis.55 in short , pvt1 expression is closely related with carboplatin resistance in oc by regulating cell apoptotic pathways . in 2003 , rangel et al21 found a new transcript , human oc - specific transcript 2 ( host2 ) , specific expression in human oc tissue . the host2 gene is located on chromosome 10 with a length of 2.9 kb , and it does not have an open reading frame , does not encode proteins , and belongs to lncrna.21 lncrna host2 have a highly specific expression in eoc , but the expression is very low or none in a variety of other common malignancies . after inhibiting the expression of host2 , the migration , invasion , and proliferation of ovcar-3 cells were significantly reduced.21 recently , the mechanisms of lncrna host2 regulating the biological behavior in eoc cells by binding to microrna let-7b was reported.22 the study first indicated that the lncrna host2 , which is highly expressed in eoc , functions as a molecular sponge which allows direct binding to let-7b and then inhibits the function of let-7b in the eoc . moreover , they found that given the overexpression of host2 in eoc , host2/let-7b may contribute to the regulation of growth and development in eoc . thus , we can easily infer that the expression of let-7targeting genes hmga2 , c - myc , dicer , and imp3 increases , thus promoting the initiation and development of eoc . in addition , they observed that suppression of the activity of let-7b can increase both the mrna and protein levels of hmga2 , c - myc , dicer , and imp3 . the schematic diagram of host2 promoting the endogenous expression of metastasis - promoting related genes , which were targeted by let-7b , is shown in ( fig . the results showed that the functions of let-7b can inhibit the expression of the oncogenes that negatively regulate cell growth and proliferation . in addition , the regulation between host2 and let-7b can provide innovative strategies for better diagnosis and treatment of this deadly malignant tumor . a schematic diagram of host2 enhances the endogenous expression of metastasis - promoting genes that are targeted by let-7b . a , down - regulation of host2 may increase let-7b activity , which would inhibit expression of its target genes ( hmga2 , c - myc , dicer , and imp3 ) . b , high regulation of host2 binds to more let-7b and increases expression of its target genes ( hmga2 , c - myc , dicer , and imp3 ) . hox transcription antisense rna ( hotair ) is the first trans - acting lncrna to be found , which is located in human chromosome 12q13.13 with a length of 6232 bp.23,24 the human hox gene family is divided into 4 subfamilies : hoxa , hoxb , hoxc , and hoxd , whereas lncrna hotair is identified from a custom tilling array of the hoxc locus.25,26 hotair is located in the antisense strand of the hoxc gene cluster , but it could regulate the hoxd gene cluster.26 the most familiar regulatory mechanism of hotair is that the 5 or 3 ends of hotair can be respectively combined with prc2 ( composed of ezh2 , suz12 , and eed)25 and histone demethylase complex ( lsd1 , co rest , and rest),27 and it mediates these 2 complexes binding to specific genomic loci , then respectively makes histone h3 trimethylated at lysine 27(h3k27me3 ) and histone h3 dimethyl lys4(h3k4me2 ) , and then causes the chromosome in a closed state and silences the expression of the target gene25 ( fig . 2 ) . thus , hotair can regulate the expression of hoxd epigenetically , which was sited at human chromosome 2q.26 a schematic diagram of the mechanisms of hotair . hotair when combined with prc2 ( composed of ezh2 , suz12 , and eed ) can trimethylate histone h3 at lysine 27 ( h3k27me3 ) and inhibit hoxd gene expression . the expression of hotair is very high in the eoc tissue compared with normal ovarian tissues . in addition , high expression of hotair is closely associated with the occurrence and development , invasion , metastasis , and prognosis in eoc.28 these researches emphasized the great clinical significance of hotair in patients with eoc , and hotair expression may act as a biomarker in predicting the progression of eoc . they also pointed out that the knockdown hotair can inhibit cellular epithelial - mesenchymal transition ( emt ) and reduce potential of tumorigenesis and migration ability via regulating the emt - related gene . that is , hotair can be used as a potential therapeutic target to treat patients with eoc . recently , studies have reported that hotair can play a role by regulating the cell cycle and apoptosis pathway in serous oc ( soc).28 the study showed that silencing of hotair can delay the progression of cell cycle and promote the apoptosis of the a2780 and ovca429 soc cells , evidencing that hotair may participate in the regulation of cell cycle and apoptosis to promote cell proliferation in soc . in addition to these studies , they also disclosed that the mechanism of hotair in soc is partly through regulating the expression of cell cycle and apoptosis - related genes , such as cyclin e , bcl-2 and caspase-9 , caspase-3 , and brca1 . these research can be extended to our existing cognition about the downstream genes of hotair , including the cell cycle related and apoptosis - related proteins . in addition , these results in the present studies give us a stronger appreciation of the significance of the abnormal expression of lncrnas in the soc , and offer us a theoretical basis for the targeted therapy of soc by lncrna - based targeted strategies . the h19 gene is located at human chromosome 11p with a full length of 2.3 kb , which is the first lncrna to be found related with cancer.29 numerous studies have shown that h19 is differentially expressed in many cancers , and for its function in cancer , it plays a dual role : promote the tumor or suppress the cancer.30 several groups reported that h19/igf2 gene imprinting is associated with differences in methylation , chromatin conformation , and transcription cycle of the allelic of h19.31,32 mizrahi et al33 reported that the expression of h19 was detected in 90% of ascites cells of patients with oc by means of situ hybridization . by decreasing the expression of h19 in a subcutaneous nude mice model for oc , it could be observed that 40% of the tumor growth was inhibited.33 this indicates that overexpression h19 promotes the growth and the knockdown of the expression of h19 can inhibit the growth of oc . recently , medrzycki et als31 research reported that histone h1.3 can inhibit the expression of h19 and suppress the growth of oc cells . h1.3 , a variant of h1 , is highly expressed in the ovcar-3 cell line , which is an eoc cell line . in addition , excessive expression of h1.3 can reduce the growth rate and colony formation of ovcar-3 cells , indicating that h1.3 may play a suppressive role in cancer cells . moreover , in multiple different oc cell lines , overexpression of h1.3 can inhibit the expression of h19 , whereas down - regulation of h1.3 can increase the expression of h19 , suggesting histone h1.3 as a specific inhibitor of h19 . histone h1.3 can regulate h19 expression mainly because overexpression of histone h1.3 can make the occupancy of h1.3 better at the imprinting control region ( icr ) , which encompasses the h19 regulator region , and also accompanied by the increase of dna methylation and the decrease in the insulator protein ccctc binding factor occupancy at the icr ( fig . most of all , the synergies of increased expression of h1.3 and reduced expression of h19 can better inhibit the growth of ovarian epithelial cancer . a schematic diagram of epigenetic mechanisms of h19 repression mediated by h1.3 histone h1.3 overexpression leads to increased occupancy of h1.3 at the h19 regulator region encompassing the icr , concomitant with increased dna methylation and reduced occupancy of the insulator protein ctcf at the icr , which can inhibit the expression of h19 . x - inactive specific transcript ( xist ) is a lnrna that is located at the x chromosome inactivation ( xi ) center , which is important in the initial phase of x chromosome inactivation.34 the precise molecular mechanism of xist in the initial phase of x chromosome inactivation remains elusive , but there are plenty of evidence suggesting that xist plays a stronger effect in the process of cell differentiation and proliferation and the maintenance of genomic stability.35 as xist is located at the x chromosome , it is involved in gynecological diseases . studies have shown that the expression of xist is detected in almost all female cells , except in gynecological malignancies such as cervical cancer , breast cancer , and oc.32 benoit et al36 showed that xist was not detected in more than half of the oc cells with barr body staining compared with normal ovarian cells . in addition , other studies indicated that reduction of the expression of xist can decrease the sensitivity of oc cells to paclitaxel , suggesting that xist can serve as a biomarker of the prognosis of oc . this mechanisms could be interpreted by the xist toxic effects of paclitaxel and might also be considered relevant in the reactivation of x-specific resistance gene and increased expression of these genes on the x chromosome.37 another explanation is that loss of xist is caused by genetic instability , thereby promoting resistance to chemotherapy in oc.37 lncrna uca1 is cloned from blz-211 , which is a human bladder carcinoma cell line , and the full length of uca1 cdna is 1442 bp.38 early studies have shown that uca1 is associated with the development of embryonic and bladder cancer , and it is also observed as highly expressed in oc and other tumors.39 in addition , uca1 plays a key role in promoting invasion and metastasis of tumor cells by up - regulating the expression of matrix metallopeptidase 2 ( mmp2 ) and mmp9 in oc.38 recently , yang et al40 indicated that uca1 could bind to mir-485 - 5p directly in eoc as an endogenous sponge . low expression of uca1 could down - regulate the expression of mmp14 , and mmp14 is one of the target genes of mir-485 - 5p . in addition , uca1 could improve eoc metastasis , and it is also associated with poor prognosis . therefore , uca1 can be a new prognostic biomarker and may serve as a potential target for the treatment of eoc . lsinct5 is an lncrna with a length of 2.6 kb and is located in the cell nucleus.40 studies have shown that the expression of lsinct5 is very high in both oc cell lines and tissues.41,42 it also shows that knockdown of lsinct5 can reduce cell proliferation and induce changes in the expression of some genes , such as neat-1 and pspc1.41 although the function mechanism of lsinct5 in oc is still unclear , it plays a significant role in the initiation and development of oc.43 so , lsinct5 may be used as an appropriate target for the treatment of oc . lncrna meg3 is located at the human chromosome 14q32.3 , which is also called maternally expressed gene 3.44 studies have found that meg3 is expressed in many normal tissues , including ovarian tissue45 ; however , the level of meg3 is very low or rarely detected in some tumor tissues and tumor cell lines , including breast cancer , cervix cancer , hepatocellular cancer , colon cancer , and so on.4648 studies have demonstrated that meg3 showed low or no expression in eoc tissues and oc cells compared with normal ovarian tissues,49 and overexpression of meg3 could inhibit proliferation and promote apoptosis in the oc cells ; therefore , meg3 may be a tumor suppressor gene in oc.50 the low expression of meg3 in oc is caused by multiple mechanisms , and the increased hypermethylation of the meg3 promoter can reduce the expression of meg3 rna in eoc.49 in addition , the study also noted that meg3 can control the proliferation of oc cells via targeting p53 and/or rb1.50 so , through further research , meg3 may be used as a potential therapeutic target and may provide new treatment strategies for eoc . bc200 is a lncrna with a length of 200 nucleotides and expressed specifically in the human nervous system.10,51 the expression of bc200 was significantly decreased in oc tissue compared with that in normal ovarian epithelium.52 this suggests that the low expression of bc200 may be associated with the development of oc . the low expression of bc200 may be used as a potential diagnostic marker for patients with oc . in addition , down - regulation of bc200 can lead to the proliferation of oc cells and inhibit the sensitivity of oc cells to carboplatin.52 however , the current research also shows that bc200 has no obvious effect on the invasion and migration of oc cells . in a summary , the dysregulation of bc200 was detected in oc , and this evidence provide some clinical implications of bc200 for the diagnosis and targeted therapy of oc . pvt1 is an lncrna with a length of 1.9 kb , originally identified as a transcriptional unit from a human homologous sequence to pvt1.53 the amplification and overexpression of pvt1 can increase cell proliferation and inhibit cell apoptosis , suggesting that it is an antiapoptotic gene.54 recently , it was reported that pvt1 is associated with cisplatin resistance in oc.55 it also indicated that overexpression of pvt1 can inhibit the expression of transforming growth factor-1 , p - smad and caspase-3 in oc , which were associated with cell apoptosis.55 in short , pvt1 expression is closely related with carboplatin resistance in oc by regulating cell apoptotic pathways . to summarize , lncrnas play a major role in the control of oc cell growth , division , metastasis , invasion , proliferation , and drug resistance22,28,31,33,37,38,43,50,52,55 ( fig . the abnormal expression of some lncrnas can contribute to the development and progression of oc . in addition , aberrant expression of some lncrnas in oc can provide new information for disease detection , diagnosis , and treatment to patients with eoc . lncrna is associated with the sensitivity of chemotherapy drug in oc , so the detection of lncrna level within tumor cells can predict patients sensitivity to chemotherapy . in aspects of molecular therapy , lncrna as an emerging target can provide new information for targeting therapy of oc . in addition , lnrna as a tumor marker has a higher sensitivity and specificity for the diagnosis and prognosis of oc.56 however , compared with microrna , the research of lncrna is still in the fledgling stage . only a small amount of lncrnas are identified and found to be associated with oc , and the molecular mechanisms of their role in the development and progression of oc are still not yet well defined . accordingly , further work on lncrnas are required to understand the molecular mechanism and to serve for the clinical prognosis and therapy of diseases . dysregulation and functional roles of lncrnas in oc . a , host2 could increase cell metastasis , invasion , and proliferation via binding to let-7b and inhibiting the function of let-7b , and then increase expression of its target genes ( hmga2 , c - myc , dicer , and imp3 ) . b , hotair represented a prognostic marker and increased cell metastasis and invasion by regulating emt - related genes ; hotair promoted soc cell proliferation and decreased cell apoptosis by regulating certain cell cycle and apoptotic - related genes ( cyclin e , bcl-2 , caspase-9 , caspase-3 , and brca1 ) . f , pvt1 inhibited cell apoptosis and increased cell proliferation and carboplatin resistance in oc by knockdown the expression of tgf-1 , p - smad4 , and caspase-3 . g , bc200 inhibited oc cell proliferation and increased the sensitivity of oc cells to carboplatin . h , xist could inhibit oc cell resistance to paclitaxel via reactivating the x - specific resistance gene . i , uca1 promoted invasion and metastasis by up - regulating mmp2 and mmp9 expression in oc cells ; uca1 represented a prognostic marker and enhanced eoc metastasis through the uca1-mir-485 - 5p - mmp14 axis . | abstractovarian cancer is the leading cause of death among women with gynecologic malignancies .
the development and progression of ovarian cancer are complex and a multiple - step process .
new biomarker molecules for diagnostic and prognostic are essential for novel therapeutic targets and to extend the survival time of patients with ovarian cancer .
long noncoding rnas ( lncrnas ) are non protein - coding transcripts longer than 200 nucleotides that have recently been found as key regulators of various biological processes and to be involved in the development and progression of many diseases including cancers . in this review
, we summarized the expression pattern of several dysregulated lncrnas ( hotair , h19 , xist , and host2 ) and the functional molecular mechanism of these lncrnas on the initiation and progression of ovarian cancer .
the lncrnas as biomarkers may be used for current and future clinical diagnosis , therapeutics , and prognosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
small cell carcinoma of the prostate ( scpca ) , also termed neuroendocrine scpca , was first described by wenk et al . in 1977 . its incidence has been estimated at slightly less than 2% of de novo prostate cancer . small cell carcinomas usually present together with adenocarcinomas . in some cases , neuroendocrine differentiation occurs sequentially , with an initial pattern of conventional adenocarcinoma , which thereafter presents with focal neuroendocrine differentiation while in recurrence after androgen deprivation therapy . in approximately 35% of scpca cases , the clinical phenotype of scpca may be distinguishable from that of typical adenocarcinoma by the common initial presentation of rapidly symptomatic , locally advanced or metastatic disease , occurring frequently with visceral and lytic bone metastases , marked prostatic enlargement and disproportionately low or absent prostate - specific antigen ( psa ) levels as well as resistance to androgen ablation . these tumors are highly aggressive , with a median survival of 910 months and a 5-year survival of less than 1% . the most typical age at diagnosis is 6170 years , although an age range from 24 to 90 years has been reported . prostatic malignant neuroendocrine cells tend to produce ectopic peptides , with adrenocorticotropic hormone ( acth ) and calcitonin being detected most frequently in serum . approximately 10% of small cell carcinoma cases present with paraneoplastic syndromes [ 2 , 6 ] . the most common immunohistochemical markers used to diagnose scpca are neuron - specific enolase ( nse ) , chromogranin a ( chra ) , synaptophysin ( syn ) , cd56 and thyroid transcription factor-1 ( ttf-1 ) . serum acth , calcitonin , and parathyroid hormone levels may be elevated regardless of the presence of paraneoplastic syndromes . tumor markers such as carcinoembryonic antigen ( cea ) and cancer antigen 19 - 9 ( ca 19 - 9 ) are also often elevated [ 3 , 6 ] . psa is a more complicated marker of the disease . generally , in the case of adenocarcinoma , the disease burden is strongly correlated with the psa level . however , in patients with mixed tumors or pure scpca , the neuroendocrine component does not secrete psa and , therefore , does not contribute to an elevated psa level , as psa reflects the bulk and activity of the nonmalignant elements in the prostate . given the distinct pathologic and clinical features of the disease and using small cell carcinoma of the lung as a therapeutic model , the treatment for mixed or pure scpca consists mainly of a combined multidrug chemotherapy and radiation therapy to improve local control , with radical prostatectomy as an adjunctive therapy in selected cases [ 5 , 7 ] . chemotherapy regimens have been employed with a reported response rate of 60% without any durable complete remission . we present a case of pure scpca treated with a combined chemo - radiotherapeutic approach . written informed consent was obtained from the patient for the publication of this case report and any accompanying images . moreover , we review the available literature to gain additional insight into the diagnosis , treatment , and prognosis of this disease . in may 2007 , a 77-year - old man was referred to our hospital with symptoms of urinary retention and dysuria . his past medical history included cardiac insufficiency . on digital rectal examination , the serum psa level was within the normal range ( 1.4 ng / ml ; range : 04 ) . he underwent an operation for phimosis , and a catheter was inserted into the urinary bladder . two weeks after the surgery , the patient was admitted to the urology clinic with macroscopic hematuria and catheter occlusion . computer tomography ( ct ) of the pelvis showed an enlarged prostate with protrusion into the bladder , while a chest ct showed diffuse lung emphysematous microbullae . the ca 19 - 9 level was elevated ( 96 ng / ml ; range : 137 ) , while the cea level was within normal limits . microscopically , both lobes were diffusely infiltrated by small round neoplastic cells with scanty cytoplasm and a high nuclear to cytoplasmic ratio . immunohistochemically , the neoplastic cells exhibited positivity for pancytokeratin , syn , ttf-1 and cd56 ( fig . the histopathological pattern as well as the presence of positive staining for neuroendocrine markers and the absence of pulmonary lesions suggestive of primary pulmonary pathology were the basis for the diagnosis of pure primary scpca . the tumor was staged as t2cn0m0 ( 2002 american joint committee on cancer ( ajcc ) staging criteria ) . the patient was admitted to the radiation therapy department of the university hospital of ioannina in july 2007 . the prostate and the regional lymph nodes were included in the irradiation fields . a linear accelerator ( 6 mv ) was used . the daily dose was 1.8 gy and the total dose was 63 gy . in total , 35 fractions were given . after 45 gy to the whole pelvis , a boost dose ( 18 gy ) to the primary site was applied using the shrinkage technique . six chemotherapy cycles ( carboplatin , 450 mg / auc 5 ) were also administered every 21 days concomitantly and consequently to radiotherapy . the patient tolerated this treatment well , without any interruption due to acute side effects . serum psa was within normal limits ( 0.2 ng / ml ) , while ca 19 - 9 remained elevated ( 69 ng / ml ; range : 137 ) . the ct scan revealed an enlarged left hilum with lobular atelectasis as well as multiple nodular bilateral lung metastatic lesions . he was hospitalized because of dyspnea and died few weeks later , as his condition continued to deteriorate . scpca is rare , accounting for 0.52% of all prostatic malignancies [ 2 , 3 ] . adenocarcinomatous elements are present concomitantly in at least half of cases , but prognosis does not appear to be affected by the presence of a non - small cell component as , after recognition of the small cell phenotype , in these cases , survival is less than 1.5 years . additionally , the small cell component may be multifocal and variably distributed through the prostate [ 3 , 7 , 9 ] . most patients with scpca are symptomatic at diagnosis in comparison with patients with prostate adenocarcinoma alone . signs and symptoms , in order of frequency , include obstructive , neurologic , and constitutional symptoms , followed by symptoms from paraneoplastic syndromes , bone pain , hydronephrosis , abdominal pain , hematochezia , and hematuria . these tumors have a propensity to metastasize distally to visceral organs , including the liver , bone , lungs , central nervous system , and pericardium , and regionally to the pelvic lymph nodes . the initial hypothesis was that scpca is derived from the neural crest line / amine precursor uptake and decarboxylase cell system , now called neuroendocrine system , a cell lineage that is different from prostatic epithelium . based on the observation that scpca sometimes coexists with adenocarcinoma , it was postulated that scpca is the product of a final dedifferentiation of the typical adenocarcinoma according to the model of divergent differentiation . coexpression of psa in neuroendocrine cells was viewed as supporting evidence for the prostatic epithelial origin of these cells . nevertheless , the cells seem to represent postmitotic cells , a fact that makes it unlikely that these cells suddenly start to proliferate and become a highly aggressive small cell carcinoma . finally , a recent theory proposes a direct origin from a multipotential prostatic epithelial stem cell for scpca , based on the lack of immunohistologic characteristics typical of the usual prostatic epithelial cell ( psa expression and androgen receptor positivity ) and the extremely high mib-1 labeling index clearly exceeding that of even dedifferentiated adenocarcinomas . the prostatic neuroendocrine cells have regulatory functions and are capable of producing and releasing a wide variety of secretory products like serotonin and various peptides , including the chromogranins , peptides of the calcitonin families , acth , the parathormone - related protein , thyroid - stimulating hormone - like peptides , human choriogonadotropin - like peptides , somatostatin , glucagons , cea , and the bombesin - like peptides [ 3 , 6 ] . nse , chra , ttf-1 and syn are considered representative neuroendocrine tissue markers that are used in the pathologic diagnosis of scpca in addition to a lack of androgen receptor positivity and a lack of psa . it has also been reported that neuroendocrine scpca cells showing an aggressive phenotype exhibit intense staining of vascular endothelial growth factor ( vegf ) . the measurement of serum neuroendocrine markers should be useful for diagnosing and monitoring the patients clinical course , as this constitutes a representative indicator and an objective measure of the neuroendocrine differentiation , reflecting not only the primary tumor cell population but also its associated metastases . nse and chra have been demonstrated as the main serum neuroendocrine markers for the clinical evaluation of scpca . additionally , it has been reported that patients who present with a low serum albumin level and a high serum ldh level at the time of initial diagnosis appear to have inferior survival . because of the rarity of pure scpca , most of our knowledge concerning its diagnosis , treatment and prognosis has been gained from a few single - institution reviews and case reports . therefore , it is impossible to draw definitive conclusions regarding the most effective treatment of this disease . the published studies assessed cases of pure scpca together with cases where scpca coexists with adenocarcinoma . the existing and mostly single - institution experience with scpca and an analysis of the pure scpca cases are summarized in table 1 . the role of hormonal therapy in small cell carcinoma remains controversial . in the setting of mixed histologies , hormonal therapy ( by orchiectomy , gonadotropin - releasing agonists , or antagonists with the early addition of antiandrogens ) should be used according to stage and treatment regimens . for localized disease the timing ( neoadjuvant or adjuvant ) and duration of hormone ablation in those patients are uncertain . , long - term hormonal therapy should be combined with chemotherapy [ 2 , 7 ] . in cases of pure scpca , hormonal therapy is not recommended , as the prostatic neuroendocrine cells are deprived of androgen receptors . whether the androgen ablation therapy should be continued or not in patients with adenocarcinoma whose tumors undergo neuroendocrine transdifferentiation is a crucial matter . considering that prolonged hormonal ablation therapy may enhance the selection and progression of neuroendocrine differentiated , androgen - independent tumor cells through processes of transdifferentiation or clonal selection , in combination with the antiandrogen withdrawal effect , it is recommended that the antiandrogens are discontinued before initiation of chemotherapy . according to small cell lung carcinoma treatment experience , cisplatin and etoposide are the most commonly recommended agents . a recent phase ii trial advocated that the addition of doxorubicin to this regimen caused higher toxicity related to the patients survival outcome . cyclophosphamide , vincristine , taxanes and ifosfamide have also been added to cisplatin in various combinations [ 2 , 13 ] . regarding irradiation , no exact guidelines for total dose and irradiation volume have been given . because of the disease propensity for local and pelvic lymph node relapse , the treatment volume should include the pelvic lymph nodes with a dose between 45 and 55 gy ( daily dose 1.8 gy ) , followed by a boost to the prostate volume reaching in some studies a total dose of 72 gy . although in scpca locoregional treatment is secondary to systemic therapy , in cases of localized or early scpca , several studies suggest that surgical resection with or without external beam radiotherapy should be evaluated further as a treatment strategy for selected patients with nonmetastatic scpca , as it may provide better local control and a potential survival benefit when combined with systemic therapy compared with systemic therapy alone [ 5 , 14 ] . in some cases , the diagnosis of scpca will be incidental to a coexisting adenocarcinoma upon pathological examination of a prostatectomy specimen . adjuvant chemotherapy at least 4 cycles of cisplatin and etoposide should be added to these patients , while adjuvant radiotherapy is implemented at the discretion of the treating physician , based on adverse pathologic features such as involved surgical margins and/or extracapsular extension ( pt3a ) . radiation therapy could also have a role in the treatment of patients with scpca and metastases . its role is palliative , as it may control local symptoms such as complications of brain and bone metastases . transurethral resection of the prostate may be considered for cases with obstructive voiding symptoms that do not respond to chemotherapy and pharmacologic interventions . recently , the neuroendocrine cells became a therapeutic target , which opens additional options for patients with scpca . agents , like somatostatin analogues , neuropeptide - like serotonin and bombesin antagonists , or inflammatory cytokines , like interleukin-6 , are under investigation in clinical and laboratory settings . however , trials using somatostatin analogues not only for scpca but also for hormone refractory prostate cancer with or without metastases have attained some success without major adverse effects . the expression of the angiogenic factors vegf and tgf - a in neuroendocrine scpca cells may also be used in the diagnosis , follow - up and targeting of specific molecular sites . additionally , in hormone refractory prostate cell lines , it has been found that vegf - c promotes survival of cancer cells under oxidative stress by the activation of mammalian target of rapamycin and akt a mechanism that could also potentially serve as a novel therapeutic target . scpca presents an aggressive tumor histology that is associated with a high disease - specific mortality . for patients with localized disease , a benefit of the application of local treatment modalities like radiation therapy , in combination with chemotherapy with or without hormonal therapy , seems to be acceptable . further research may lead to advances in the understanding of the neuroendocrine differentiation in prostate cancer , potential integration of treatment modalities and exploration of novel therapeutic targets that would be translated in improved clinical outcome . | primary small cell carcinoma of the prostate ( scpca ) is a rare pathologic entity with unique clinical features and a poor prognosis .
we present a case of a patient diagnosed with pure scpca treated with a combined chemo - radiotherapeutic approach .
pathological findings showed that the neoplastic cells exhibited positivity for pancytokeratin , synaptophysin , thyroid transcription factor-1 and cd56 .
immunostaining for prostate - specific antigen was negative , while serum prostate - specific antigen was within normal limits .
we review the available literature to gain additional information about diagnosis , treatment and prognosis of pure scpca . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tourniquets are widely used during limb operations to minimize surgical bleeding and to maintain a relatively bloodless field . exsanguination of the limb and inflation of the tourniquet produce an initial increase in arterial pressure . this increase has been attributed to several factors , including an expansion of central venous blood in association with a theoretical increase in peripheral vascular resistance and delayed hypertension , accompanied by ischemia and pain due to tourniquet compression 1 - 3 . these hemodynamic changes are minimal in healthy young patients but may not be tolerated by older patients with poor cardiac reserve 4 . previous studies have only focused on the management of delayed tourniquet - induced hypertension in young patients 4 - 7 . remifentanil is a selective -opioid receptor agonist with a rapid onset , short duration , and short blood / effect - site equilibration half - time . some studies have indicated that remifentanil may be associated with significant hemodynamic changes characterized by decreases in arterial pressure , heart rate , cardiac output , and systemic vascular resistance 8,9 . therefore , remifentanil have potential for prevention of both initial and delayed tourniquet - induced hypertension . we investigated the effect of continuous intravenous remifentanil administration on systemic arterial pressure , heart rate , and cardiac output in elderly patients under sevoflurane / n2o general anesthesia who were undergoing knee surgery accompanied by use of a tourniquet . the study protocol was approved by our institutional review board and ethical committee . written informed consent was obtained from each patient . included in the study were 30 female patients ranging in age from 51 to 84 years with an asa physical status of class i - ii . study participants were scheduled for total knee replacement surgery with a tourniquet under sevoflurane / n2o general anesthesia . fifteen patients each were assigned randomly to the control group and the remifentanil group using computer - generated sequence numbers . routine monitors were used including non - invasive arterial pressure , ekg , pulse oximetry , end - tidal co2 , and anesthetic concentrations . laryngoscopy was performed following loss of all four twitches from the train - of - four test performed by ulnar nerve stimulation . all patients received mechanical ventilation with a mixture of nitrous oxide ( 50% ) in oxygen ( fresh gas flow rate = 3 l / min , inspiratory : expiratory ratio = 1:2 ) . the inspired ventilation was adjusted to obtain an end - tidal co2 partial pressure between 30 and 35 mmhg starting five min after anesthesia induction . a 20-gauge catheter was placed in the radial artery for continuous blood pressure monitoring . in the remifentanil group , the infusion of remifentanil was started with a target organ concentration of 2.0 ng / ml via a target - controlled infusion system ( orchestra module dps , fresenius - vial , brezins , france ) . in the control group , the syringes used with both groups were labeled with remifentanil in order to blind the data collector . heart rate ( hr ) , systolic arterial pressure ( sap ) , diastolic arterial pressure ( dap ) , end - tidal carbon dioxide concentration ( etco2 ) , and end - tidal sevoflurane concentration ( etsevo ) were measured and recorded every ten minutes during the study period . cardiac index ( ci ) and total systemic vascular resistance index ( tsvri ) were monitored with transesophageal doppler ultrasound monitor ( edum ; hemosonic 100 ; arrow , reading , pa , usa ) . a standard bis monitor strip ( bis sensor , aspect medical systems , newton , ma , usa ) was placed on the forehead before induction of anesthesia . the bispectral index was displayed continuously throughout the procedure using a model a 2000 spectral eeg monitor ( aspect medical systems , natick , ma , usa ) and maintained between 40 and 60 . vital signs taken before the inflation of the tourniquet were used as the baseline values . the concentration of sevoflurane was adjusted when necessary within the full range to maintain systolic arterial pressure and heart rate within 20% of baseline and to keep bis values between 40 and 60 . in all patients , a pneumatic tourniquet was applied to the thigh with a layer of soft - roll under the wrap . ephedrine ( 3 mg increments ) was available for hypotension ( sap < 80 mmhg for > 60 s ) , atropine ( 300 g increments ) was available for bradycardia ( hr < 40 bpm ) , and esmolol ( 30 mg increments ) was available for hypertension ( sap > 200 mmhg for > 60 s ) or tachycardia ( hr > 130 bpm for > 60 s ) . patient data were excluded from further analysis if these drugs were given during the procedure . a pilot study with eight patients showed a mean maximum sap ( sd ) of 123 ( 8.7 ) and 147 ( 8.9 ) in the remifentanil group and the control group , respectively . therefore , a sample size of five per group was calculated as being needed to show a difference of maximum sap through 25 and 30 mmhg ( sd 9 mmhg ) between groups with an risk of 0.01 and a risk of 0.1 7 . however , we recruited 15 patients for each group . student 's t test or fisher 's exact test was used to analyze demographic data . hr , sap , dap , ci , tsvri , etco2 , etsevo , and bis were analyzed by repeated measurement . age , weight , height , and preexisting medical conditions did not significantly differ between the groups ( table 1 ) . there were significant differences in mean hr , sap , dap , and etsevo during the procedure between the groups ( p = 0.047 , p < 0.001 , p = 0.017 , and p < 0.001 , respectively ) . there were no differences in mean ci , tsvri , etco2 , or bis over time between the groups . hr , sap , dap , and ci demonstrated a statistically significant time trend effect ( p < 0.001 ) with a statistically significant time - group interaction between the two groups ( p = 0.02 , 0.007 , 0.001 , 0.01 ) ( fig . 1 ) . there were no circumstances that led to the withdrawal of a patient from the study . the present study demonstrates that an intravenous infusion of remifentanil significantly reduces hemodynamic increase during tourniquet inflation in elderly patients under sevoflurane / n2o general anesthesia . hr , sap , dap , and ci remained stable before , during , and after tourniquet inflation in the patients in the remifentanil group . . however , tourniquet - induced hypertension can be a serious side effect in patients with cardiovascular problems , neurological diseases , or glaucoma 2,5 . we recruited elderly female patients for this study irrespective of the presence of hypertension or diabetes . therefore , the outcome of this investigation could be clinically useful for the treatment of vulnerable patients compared with other studies using healthy subjects 5 - 7 . hypotension after the induction of anesthesia is a well - recognized phenomenon during surgical preparations , such as draping , without any surgical stimuli and may be aggravated by deep anesthesia 10 - 12 . anesthesiologists tend to lower the anesthetic depth during this period in order to avoid worsening the hypotension . the immediate increase in arterial pressure after inflation of a tourniquet may be due to light anesthesia , painful stimuli as a result of tourniquet inflation , an increase in systemic vascular resistance , or an expansion of central venous blood caused by exsanguination of the limb . on the other hand , the delayed hypertension observed with the use of a tourniquet is known to be related to nmda receptor activation by peripheral noxious stimuli from the extremities and occurs 40 - 60 min after inflation 5,6 . we monitored the ci and tsvri of patients using esophageal doppler ultrasonography throughout the study period . esophageal doppler ultrasonography offers continuous , noninvasive and reproducible cardiac output monitoring with less short - term variability than thermodilution 13,14 . in the control group of our study , ci increased by 19% ten minutes after tourniquet inflation and returned to near - baseline values after deflation . 3 demonstrated that ci did not change immediately after inflation but afterwards increased by 18% , with a further increase to a value 40% higher than baseline after deflation . they also demonstrated that systemic vascular resistance increased by 20% immediately after inflation with an 18% decrease after deflation . these differences from our findings can be explained by the fact that in the girardis study , ci was calculated by the pulse contour method . 15 reported a slight increase in ci with stable map and tsvri values after tourniquet deflation in 34 patients undergoing knee arthroplasty during general anesthesia . the correspondence of these results to those obtained in our investigation can be explained by the similar nature of both studies . both studies investigated elderly patients with cardiovascular disease undergoing total knee arthroplasty . unlike our study , in the parmet study , isoflurane concentration did not change from the time of tourniquet deflation until the conclusion of the study . these results can vary depending on the method of monitoring , the anesthetic drugs used , the type of operation , and the status of the patients enrolled in the study . remifentanil stimulates nmda receptors of different subunit combinations ( nr1a/2a , nr1a/2b ) via an allosteric mechanism leading to acute tolerance 16 . sevoflurane , co - administered with remifentanil , inhibits nmda receptors in a dose - dependent manner , thereby neutralizing the remifentanil stimulation of these receptors 17 - 19 . as a result , the use of remifentanil with sevoflurane will not aggravate slow - onset nmda - mediated tourniquet pain and subsequent hypertension 20 . first , because bis is not sensitive to n2o administration when the inspired sevoflurane concentration remains high , we do not think we could adequately control the depth of anesthesia for both groups while using bis to monitor 21 . we acknowledge that it would have been better to standardize the concentrations of sevoflurane between groups ; however , it was difficult to maintain patient vital signs and bis within normal limits without the use of much more sevoflurane in the control group than in the remifentanil group . finally , it is unclear whether remifentanil inhibited a hemodynamic response to tourniquet inflation via blockade of the receptor - mediated response . infusion with remifentanil can mitigate the hemodynamic increases associated with the use of a tourniquet in elderly patients under sevoflurane / n2o general anesthesia . | aims : prolonged tourniquet inflation produces a hyperdynamic cardiovascular response .
we investigated the effect of continuous remifentanil infusion on systemic arterial pressure , heart rate , and cardiac output changes during prolonged tourniquet use in elderly patients under sevoflurane / n2o general anesthesia.methods : thirty female patients scheduled for knee replacement arthroplasty were infused with either remifentanil at a target organ concentration of 2.0 ng / ml ( remifentanil group , n = 15 ) or saline ( control group , n = 15 ) after induction of anesthesia .
anesthesia was maintained with sevoflurane and n2o .
heart rate ( hr ) , systolic arterial pressure ( sap ) , diastolic arterial pressure ( dap ) , cardiac index ( ci ) , total systemic vascular resistance index ( tsvri ) , bis , end - tidal sevoflurane concentration ( etsevo ) , and end - tidal carbon dioxide concentration ( etco2 ) were measured during the study period.results : there were significant differences in mean hr , sap , dap , and etsevo over time between the groups ( p = 0.047 , p < 0.001 , p = 0.017 , and p < 0.001 , respectively ) .
there was a statistically significant time trend effect ( p < 0.001 ) in hr , sap , dap , and ci between the groups , with a statistically significant time - group interaction between the two groups ( p = 0.02 , 0.007 , 0.001 , 0.01 , respectively).conclusion : the present study demonstrated that infusion with remifentanil prevented an increase in hemodynamic pressure during tourniquet inflation in elderly patients under sevoflurane / n2o general anesthesia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the pipeline was implanted in 45 patients with 47 unruptured large / giant or fusiform aneurysms in 12 hospitals in korea between november 2012 and march 2015 . except for exceptional uses for proctorship purposes , the majority of the pipeline implants were performed after november 2014 , when reimbursement for the pipeline was allowed . the procedure was conducted with the assistance of the proctors , who had worked in at least 20 pipeline implantations , until the operator completed at least 5 cases . by the end of the study period , one operator completed 10 cases , two operators completed 5 - 9 cases , seven operators completed 2 - 4 cases , and five operators completed 1 case . all patients received dual antiplatelet premedication ( aspirin 100 - 325 mg and clopidogrel 300 mg ) for at least f i ve days . for all patients , antiplatelet resistance was tested before treatment , and antiplatelet medication was adjusted as recommended by proctors in cases where drug resistance was detected . for large or giant aneurysms with mass effect or with a possible increased risk of delayed rupture , after a 6f shuttle ( cook ) or a 6f guiding catheter ( envoy , coddman neurovascular , ca , usa ) was placed in the relevant cervical carotid or vertebral artery , a 0.027-inch marksman catheter ( covidien , irvine , ca , usa ) was advanced over a 0.014-inch guidewire across the aneurysm neck . in cases where catheter navigation across the aneurysm neck into a parent artery branch distal to the aneurysm was difficult , an exchange technique was applied using a 0.010-inch microcatheter and a 300-cm length exchangeable wire ( transend , stryker ) . next , a pipeline that matched the largest diameter of the parent artery was introduced and implanted so that it was fully covering the aneurysm neck . we retrospectively evaluated the presenting symptoms , aneurysm characteristics ( type , location , dome and neck sizes , and the presence of an intrasaccular thrombus ) , the periprocedural events , treatment - related morbidity and mortality , and early clinical and radiological outcomes after pipeline implantation . treatment - related morbidity was defined as any neurological deterioration unrelated to preexisting cranial nerve signs due to the aneurysm 's mass effect . clinical outcome was evaluated according to the modified rankin scale score ( mrs ) where mrs 0 indicates no symptoms and mrs 6 indicates death . the aneurysm 's occlusion at follow - up vascular imaging ( catheter angiography or ct angiography ) was categorized as complete or near - complete occlusion ( aneurysm occlusion > 90% ) , decreased sac size ( 30% < aneurysm occlusion < 90% ) , or no change ( aneurysm occlusion < 30% ) . in addition , the change in the size of the treated aneurysms , including the thrombosed portion , was assessed in cross - sectional follow - up ct or mr images . the institutional review boards of the participating institutions approved this retrospective study and waived patient informed consent based on the study design . the pipeline was implanted in 45 patients with 47 unruptured large / giant or fusiform aneurysms in 12 hospitals in korea between november 2012 and march 2015 . except for exceptional uses for proctorship purposes , the majority of the pipeline implants were performed after november 2014 , when reimbursement for the pipeline was allowed . the procedure was conducted with the assistance of the proctors , who had worked in at least 20 pipeline implantations , until the operator completed at least 5 cases . by the end of the study period , one operator completed 10 cases , two operators completed 5 - 9 cases , seven operators completed 2 - 4 cases , and five operators completed 1 case . all patients received dual antiplatelet premedication ( aspirin 100 - 325 mg and clopidogrel 300 mg ) for at least f i ve days . for all patients , antiplatelet resistance was tested before treatment , and antiplatelet medication was adjusted as recommended by proctors in cases where drug resistance was detected . for large or giant aneurysms with mass effect or with a possible increased risk of delayed rupture , steroid loading was given orally and tapered as previously described . after a 6f shuttle ( cook ) or a 6f guiding catheter ( envoy , coddman neurovascular , ca , usa ) was placed in the relevant cervical carotid or vertebral artery , a 0.027-inch marksman catheter ( covidien , irvine , ca , usa ) was advanced over a 0.014-inch guidewire across the aneurysm neck . in cases where catheter navigation across the aneurysm neck into a parent artery branch distal to the aneurysm was difficult , an exchange technique was applied using a 0.010-inch microcatheter and a 300-cm length exchangeable wire ( transend , stryker ) . next , a pipeline that matched the largest diameter of the parent artery was introduced and implanted so that it was fully covering the aneurysm neck . we retrospectively evaluated the presenting symptoms , aneurysm characteristics ( type , location , dome and neck sizes , and the presence of an intrasaccular thrombus ) , the periprocedural events , treatment - related morbidity and mortality , and early clinical and radiological outcomes after pipeline implantation . treatment - related morbidity was defined as any neurological deterioration unrelated to preexisting cranial nerve signs due to the aneurysm 's mass effect . clinical outcome was evaluated according to the modified rankin scale score ( mrs ) where mrs 0 indicates no symptoms and mrs 6 indicates death . the aneurysm 's occlusion at follow - up vascular imaging ( catheter angiography or ct angiography ) was categorized as complete or near - complete occlusion ( aneurysm occlusion > 90% ) , decreased sac size ( 30% < aneurysm occlusion < 90% ) , or no change ( aneurysm occlusion < 30% ) . in addition , the change in the size of the treated aneurysms , including the thrombosed portion , was assessed in cross - sectional follow - up ct or mr images . the institutional review boards of the participating institutions approved this retrospective study and waived patient informed consent based on the study design . the characteristics of the patients and aneurysms are summarized in table 1 . in two cases of giant intradural aneurysms , several coils were inserted into the sac to more rapidly induce thrombosis . in one case , a stent graft ( jostent graft , abbott vascular devices ) was adjunctively used to anchor the pipeline to the proximal portion of the parent artery because the diameter of the proximal portion was 5.5 mm , while the largest pipeline has a size of 5 mm . specif ically , incomplete expansion of pipeline was detected in 13 cases , of which 11 eventually required balloon angioplasty for full expansion of the pipeline . in - stent thrombosis occurred in two cases , which caused side branch occlusion but completely resolved with intraarterial glycoprotein iib / iiia inhibitor ( tirofiban , 05 - 1.0 mg ) infusion . the other patient had an anterior thalamoperforator infarction due to the retained delivery wire of pipeline in the posterior communicating artery . both patients had modified rankin scale ( mrs ) scores of 2 after the treatment but had an improved mrs score of 0 at 1-month follow - up . of the 18 patients presenting with cranial nerve defects , 15 showed improvements in their presenting symptoms but three patients showed no change . in the 15 patients with improvement , presenting symptoms were initially aggravated 1 - 3 days posttreatment but improved over 3 - 8 weeks after pipeline implantation . the only patient with evidence of brainstem compression also slowly improved in presenting symptoms over three weeks after treatment . all patients had excellent outcomes ( mrs , 0 or 1 ) during the follow - up period with a median of six months ( range , 2 - 30 months ) . vascular imaging follow - up with catheter or ct angiography was available in 31 aneurysms ( 65.9% ) for a median of three months ( range , 1 - 25 months ) . vascular imaging follow - up showed complete or near - complete occlusion in 24 patients ( 77.4% ) and decreased sac size in seven patients ( 22.6% ) . asymptomatic in - stent stenosis was detected in one case at the 6-month follow - up angiography , which markedly improved at the 12-month follow - up angiography ( fig . cross - sectional imaging follow - up at 1 month with ct or mr was available in 35 aneurysms ( 74.5% ) for a median of three months ( range , 1 - 25 months ) . the treated aneurysms , including the thrombosed portions , disappeared in f i ve patients ( 14.3% ) ( fig . 2 ) , showed a decreased size in 24 patients ( 68.6% ) , and showed no change in six patients ( 17.1% ) . in the six cases without changes in the sizes of the thrombosed aneurysm , the latest follow - up cross - sectional images were obtained one to three months after pipeline implantation . the vascular and cross - sectional imaging results on follow - up are detailed in table 3 . in the treatment of cerebral aneurysms , coiling is known to have a higher recurrence rate than clipping , especially in large or giant aneurysms . although a variety of strategies have been attempted to overcome this drawback , they have failed or have shown limited efficacy . furthermore , even with stent assistance , coiling is very difficult to perform and especially risky in blister - like , dissecting , or fusiform aneurysms . the use of single or multiple overlapping stents has helped , to a certain extent , prevent recurrence and treat uncoilable aneurysms . it has also been suggested that overlapping stents could further improve aneurysm healing due to the reinforced flow - diverting effects of increasing the metal density covering the aneurysm neck . the pipeline , a stent - like endoluminal device with high metal density , was invented for the treatment of aneurysms by flow diversion without coiling , and has been shown to have promising results for the durable occlusion of large or giant aneurysms . after the introduction of the pipeline , other flow - diverting devices have been invented and applied to the treatment of aneurysms . according to one recent meta - analysis , the complete aneurysmal occlusion rate was 76% overall and 80% for small aneurysms , 74% for large aneurysms , and 76% for giant aneurysms . the rate of postoperative subarachnoid hemorrhage was 3% and the rate of intraparenchymal hemorrhage was 3% . the perforator infarction rate was 3% , with significantly lower odds of perforator infarction among patients with aneurysms of the anterior circulation as compared with those of the posterior circulation . although the risks of procedure - related morbidity and mortality are not negligible , the treatment of intracranial aneurysms with flow - diverters is feasible and effective with high complete occlusion rates , especially considering the fact that flow - diverters have mainly been used for the treatment of aneurysms that are large / giant in size , uncoilable , or have failed prior treatment . in this study , the pipeline , the f irst flow diverter introduced in korea , showed an approximately 77% complete or near - complete occlusion rate for large / giant or fusiform aneurysms in this multicenter study , although the median follow - up duration was only three months . in the study duration , there have been no cases of intracranial hemorrhage after pipeline implantation , either related or unrelated to the treated aneurysms . the treatment - related morbidity was 4.4% ( n=2 , mrs , 2 in both cases ) , without any cases of disabling morbidity or mortality . several factors might have affected these morbidity and mortality rates , which are lower than those reported in the literature . for one , operators could prepare for the known complications of pipeline implantation by reading previous reports . for example , steroids were given for cases involving giant aneurysms , which have a high risk of delayed aneurysm rupture or an aggravation of the mass effect , as previously described . according to previous reports in addition , antiplatelet premedication was modified according to tests for drug resistance , as recommended by the proctors . finally , in almost all of the cases , the procedure was performed with assistance from experienced proctors . these proctors could decrease treatment - related morbidity by advising operators on how to avoid and manage device - related events . despite these factors that may have reduced morbidity and mortality the most common device - related event was associated with deployment difficulties , such as incomplete expansion and shortening - migration , especially in tortuous parent arteries , which required ballooning post - pipeline and even additional pipeline implantations in a few cases ( fig . this is likely because the pipeline is mainly composed of a co - cr alloy strand that has less self - expanding force than nitinol alloy . another explanation is that the technique for pipeline implantation is quite different from the technique currently used with neurovascular stents that are made by the laser - cutting of a nitinol tube . the operators tended to have little or no experience in the use of the pipeline . in addition , follow - up was not completed in all cases and the follow - up period was not long enough . we also did not compare the pipeline with stent - assisted coiling in the treatment of large or giant aneurysms . despite these limitations , this report was intended to offer early results from an initial multicenter experience with the pipeline device . the results of this report can offer future users of flow diverters in korea with helpful information for improving outcomes . future studies on flow - diverters should focus on aneurysms that are 10 mm in size , ruptured blood blister - like or dissecting , recurrent , and uncoilable . in this initial multicenter experience in korea , the pipeline seemed to be safe and effective for large / giant or fusiform aneurysm . however , a learning period may be required to reduce device - related events , which can potentially lead to treatment - related morbidity . | purposethe purpose of this study was to assess the safety and early outcomes of the pipeline device for large / giant or fusiform aneurysms.materials and methodsthe pipeline was implanted in a total of 45 patients ( mean age , 58 years ; m : f=10:35 ) with 47 large / giant or fusiform aneurysms .
we retrospectively evaluated the characteristics of the treated aneurysms , the periprocedural events , morbidity and mortality , and the early outcomes after pipeline implantation.resultsthe aneurysms were located in the internal carotid artery ( ica ) cavernous segment ( n=25 ) , ica intradural segment ( n=11 ) , vertebrobasilar trunk ( n=8 ) , and middle cerebral artery ( n=3 ) .
procedure - related events occurred in 18 cases , consisting of incomplete expansion ( n=8 ) , shortening - migration ( n=5 ) , transient occlusion of a jailed branch ( n=3 ) , and in - stent thrombosis ( n=2 ) .
treatment - related morbidity occurred in two patients , but without mortality .
both patients had modified rankin scale ( mrs ) scores of 2 , but had an improved mrs score of 0 at 1-month follow - up .
of the 19 patients presenting with mass effect , 16 improved but three showed no changes in their presenting symptoms .
all patients had excellent outcomes ( mrs , 0 or 1 ) during the follow - up period ( median , 6 months ; range , 2 - 30 months ) .
vascular imaging follow - up ( n=31 , 65.9% ; median , 3 months , range , 1 - 25 months ) showed complete or near occlusion of the aneurysm in 24 patients ( 77.4% ) and decreased sac size in seven patients ( 22.6%).conclusionin this initial multicenter study in korea , the pipeline seemed to be safe and effective for large / giant or fusiform aneurysms .
however , a learning period may be required to alleviate device - related events . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the american academy of neurology therapeutics and technology assessment subcommittee states that transcranial doppler ( tcd ) ultrasonography main clinical indications include ischemic cerebrovascular disease , neurointensive care , and periprocedural assistance during carotid and intracranial vascular interventions . our discussion in this second part of our review of tcd clinical applications will focus on its role in the research of the so - named paradoxical embolism through patent foramen ovale ( pfo ) which represents an important cause of cryptogenic stroke , especially in patients under 55 years of age . moreover , tcd also allows to classify the grade of severity of such shunts using the so - called microembolic signals ( mes ) grading score . foramen ovale allows the transit of blood flow from the right cardiac chambers to the left cardiac chambers determinating a so - called right - left shunt ( rls ) . hence , pfo represents a persistence of such fetal communication between the right and left atrium ; it appears as an oblique , slit - shaped defect which functionally looks like a tunnel . the cause of its incomplete closure after birth is not known , but it appears to be associated with multigenic inheritance . in some patients , such interatrial communication can be associated with a thinner and redundant interatrial septum which shows mono- or bi - directional movement during the cardiac cycle ( atrial septal aneurysm [ asa ] ) . the frequency of such a lesion in the general adult population varies between 25% and 30% . the prevalence and size of the defect are similar for males and females and decreases progressively with age . in detail , pfo is diagnosed in 34% of patients at 30s old , into 25% between 30s and 80s old , and finally into 20% over 80s old and this trend is inversely related to the dimensions of the defect . in fact , the average dimensions increase progressively from 3.4 mm in the first decade of life to 5.8 mm after the ninth decade . the explanation of this phenomenon is probably that larger defects tend to persist while those of smaller dimensions go toward spontaneous closure with time . most individuals with a pfo remain completely asymptomatic lifelong , but in some cases , it has been associated with several clinical manifestations due to transient rls , such as decompression sickness in scuba divers or platypnea - orthodeoxia syndrome . the most important potential manifestation related to pfo is represented by cryptogenic stroke due to paradoxical embolism , and migraine and vascular headache although the causal relationship between pfo and migraine is not yet completely understood and is still the object of research . the clinical significance and the pathogenic role of pfo in patients with cryptogenic stroke are still a matter of debate . about 40% of ischemic strokes that occur in people under the age of 55 are cryptogenic . cryptogenic stroke is defined as an ischemic stroke which takes place without any clearly identifiable etiology from cardioembolic source or large vessel atheromasia . this kind of cerebrovascular accident has an embolic origin and typically shows a distribution pattern that is not consistent with small vessel involvement . the prevalence of pfo is higher among subjects hit by a cryptogenic stroke . in a prospective study ( the pfo - asa study ) were included 581 patients with a cryptogenic cerebrovascular ischemic accident of < 55 years of age ( mean 42 ) , 37% had pfo , and 9% had pfo associated with asa . in the pfo in cryptogenic stroke , the study was found an analogous prevalence of pfo ( 39% ) in 250 patients with a mean age of 59 years . moreover , patients with cryptogenic stroke showed a significantly higher rate of large pfos compared to patients with a stroke of known cause ( 20% vs. 9.7% ) . the pathophysiological mechanism underlying stroke of cryptogenic origin in pfo carriers is probably represented by a paradoxical embolism in the setting of a transient rls . in detail , when the right atrial pressure is higher than the pressure in the left atrium , a transient rls possibly occurs through a pfo that becomes a pathway for the passage of emboli from venous to arterial circulation ( paradoxical emboli ) . thus , a transitory occurrence of interatrial right - to - left pressure gradient can cause paradoxical shunting and can commonly be elicitated using specifical maneuvers in patients with no baseline rls ( including both subjects without net shunt at all or with a left - to - right shunt ) . in particular , a short - lived right - to - left gradient can be present in normal individuals during early ventricular systole and after the release of maneuvers which raise intra - abdominal pressure ( such as valsalva maneuver [ vm ] , defecation , cough , and lifting or pushing heavy objects ) . in a community - based study of 148 subjects , carriers of a pfo , 57% showed resting rls and 92% showed elicitable rls after vm or cough . in summary , pfo represents a possible cardioembolic source responsible of cryptogenic stroke and a risk factor for neurological events , especially in subjects under 55 years of age . the diagnosis of pfo in order to achieve a clinical significance should provide both anatomic description and a physiologic assessment of a potential rls . the first is usually obtained by transesophageal echocardiography ( tee ) or by intracardiac echocardiography , while the physiologic assessment of an rls is usually obtained using contrast transthoracic echocardiography ( c - tte ) or tcd ultrasonography . a definite ultrasonographic diagnosis of temporary rls requires the use of contrast enhancement . in clinical practice , in fact , the different density present at the interface separating gas - containing microbubbles from surrounding tissue modifies the acoustic impedance of such interface . moreover , gas microbubbles work very effectively as contrast medium since they are 100,000 times less dense than blood . traditionally , tee supported by agitated saline contrast - enhancement ( c - tee ) has always been considered the gold standard technique both for a demonstration of a rls through a pfo and for morphological description of the interatrial septum . it should be noted that microbubbles with a diameter smaller than 9 m are not able to pass through the pulmonary capillary network , so the finding of any micro - bubble after intravenous contrast administration is diagnostic for rls . contrast enhancement for the research of paradoxical interatrial shunting has been applied also to c - tte [ figure 1 ] , with a reported sensitivity and specificity similar to that of c - tee . this was also due to the introduction of harmonic imaging , which improved the image quality of tte . transthoracic echocardiography showing high - grade right ( a ) to left ( b ) shunt with evident microbubbles in the left heart after intravenous contrast administration however , a more extensive analysis of the different diagnostic methods for the identification of pfo and their relative diagnostic accuracy has been already published in a previous issue of this journal , so from now on our discussion will focus exclusively on tcd . contrast enhanced tcd ( c - tcd ) has gained a growing role for the diagnosis of transient rls , for it allows to recognize the passage of intravenously injected microbubbles directly in cerebral circulation . as stated above about tte , also with c - tcd the finding of a single micro - bubble in cerebral arterial circulation , usually in middle cerebral artery ( mca ) , is considered diagnostic of rls . c - tcd represents a low cost , widely available , noninvasive imaging technique of easy interpretation , which also permits to semiquantitatively estimate the severity of venous - arterial shunt . in order to highlight rls a contrast medium , usually agitated saline is injected into a peripheral vein , usually right antecubital vein in three boluses , at the same time the doppler signal is recorded while the patient performs a vm . in detail , the contrast agent is obtained by combining 9 ml of normal saline solution with 1 ml of air and then it is usually shaken up about 10 times through a system constituted by two 10 ml syringes linked by a 3-way stopcock . the agitated solution is then administrated into the antecubital vein by an 18-gauge . the patient is then invited to perform a forced expiration against the closed glottis for a minimum of 10 s ( vm ) . when a rls is present , the air microbubbles constituting ultrasonographic contrast medium will directly pass from venous to systemic circulation and will be visualized in cerebral arterial vessels as so - called mes . in addition , it is possible to evaluate the entity and functional relevance of a paradoxical rls through the mes grading score , based on the number of doppler signals provoked by microbubbles that reach mca [ figure 2 and table 1 ] . ( a ) low - grade shunt ; ( b ) moderate - grade shunt ; ( c ) high - grade shunt ( shower ) ; ( d ) curtain effect grade of transient right - to - left shunting based on microembolic signal grading score it should be noted that when the number of microbubbles passing through a rls is very low , they may not be able to reach the mca giving a false negative result of absent rls . however , on the other hand , the clinical relevance of such small entity of shunt is uncertain . a very large amount of microbubbles reaching mca is responsible on the doppler spectrum of the so - called curtain effect characterized by impossibility to distinguish on doppler spectrum a single mes . in the work of serena et al . curtain effect is characteristically found in patient hit by cryptogenic stroke , so the identification of this doppler aspect in a subject could denote a higher risk of cerebrovascular events , thus providing useful information for the clinician in order to differentiate nowadays , there is no consensus about a definite time interval from contrast administration until the recording of the first mes on mca doppler spectrum which can be considered specific for pfo diagnosis . in a recent work , 26 patients with stroke ( 16 with pfo vs. 10 without pfo , diagnosed by c - tee ) after a positive ctcd test were evaluated for three parameters : the amount of mes , latency time ( lt ) before the first mes , and the duration time of mes , looking for any difference between pfo carriers and no - pfo . the presence of more than 9 mes with an lt of less than 9 s ( so - called rule of nine ) could be considered a marker for pfo diagnosis by c - tee providing a specificity and positive predictive value of 100% . pfo detection can be increased by asking patient to cough or by releasing a sustained vm since , in practical terms , in the release phase of these strain maneuvers a rls can be elicitated when the right atrial chamber is filled with blood from the abdominal cavity , while the left atrial chamber is still volume depleted before passage of increased blood return through pulmonary circulation , vm should be always performed for the research of rls , it is started 5 s after agitated saline administration ( because it represents the average time interval required for the injected solution to reach the right atrium from the cubital vein ) . the effectiveness of vm strength can be assessed through peak flow velocity of the mca doppler spectrum . mojadidi et al . have published an extensive bivariate meta - analysis of 27 prospective studies with a total of 1968 patients comparing pfo detection with tcd to the c - tee as the gold standard . starting from these data , they could determinate sensitivity in pfo identification for tcd ( index test ) and tee ( considered reference test ) according to type of contrast medium , different provocative maneuvers , different quantitative microembolic cutoffs , different time of onset of provocation maneuver , and insonation of a single or both middle cerebral arteries . no difference in sensitivity and specificity was found between each contrast medium ( agitated saline , echovist , and gelatin - based solutions , p > 0.05 ) . no significant difference between cough or valsalva as provocative maneuver was evident ( p > 0.7 ) . when a cutoff number of 10 microbubbles instead of 1 was chosen to define tcd positivity study , specificity showed a significant improvement from 89% to 100% ( p = 0.04 ) ; nevertheless , this approach did not result in a substantial change in sensitivity ( from 98% to 97% , p = 0.29 ) . duration of valsalva strain , more or less than 5 s , did not show a significant influence sensitivity or specificity of tcd ( p > 0.50 ) . finally , a not significant trend toward an improvement of specificity when a single mca was insonated instead of both ( 95% specificity vs. 89% , respectively , p = 0.09 ) , while no significant difference was seen regarding sensitivity ( p = 0.15 ) . in conclusion , mojadidi et al . found an overall sensitivity of 97% and a specificity of 93% for detection of rls with c - tcd compared with c - tee . increasing the number of microbubbles needed for a positive tcd from 1 to 10 resulted in a predictable significant improvement in specificity . tcd showed a good diagnostic performance with an overall likelihood ratio + of 13.51 and likelihood ratio of 0.04 and a disease probability of 93 - 94% after a positive test and of 4% after a negative test . hence , in the context of a cryptogenic stroke , the clinician is called to choose the best diagnostic technique between c - tcd , c - tee , or c - tte in order to detect a rls . tee provides a detailed morphological description of interatrial septum and is able to identify anatomic characteristics of a pfo . in particular , a diameter > 4 mm or the presence of an associated asa are the risk factors for stroke recurrence . these c - tee high - risk findings may be useful in guiding management toward an interventional strategy instead antithrombotic treatment in patient hit by a cryptogenic stroke . on the other hand , recently published data suggest that tee should not be considered the true gold standard imaging technique for the detection of rls . in fact , in the case of really small shunts ( of 13 bubbles ) , c - tcd may show a better sensitivity because such a small number of microbubbles may be missed on a single tomographic echocardiographic view . moreover , tee is a high cost , semi - invasive technique characterized by poor patient 's compliance ; it is not always available , and contrast administration may be inconclusive or be followed by falsely negative results , mainly due to inability of the patient to carry out an effective vm . directly compared c - tcd , tee , and tte accuracy for pfo diagnosis in a group of patients affected by cryptogenic stroke or migraine . they found a better sensitivity for tee over tte and a very high concordance of tcd with tee , being positive in 97% of subjects that showed pfo at tee examination , with reported 94% sensitivity , 96% specificity , 89% negative predictive value , and 98% positive predictive value . on the other hand , a lower sensitivity of c - tee compared with c - tte and c - tcd was reported by the work of gonzlez - alujas et al . ( 86% sensitivity for tee , vs. 100% for tte and 97% for tcd , p < 0.001 ) , while here was no significant difference in sensitivity between tte and tcd . these results may have a clinical impact because they confirm that tee is not the most accurate diagnostic technique as it was commonly considered in the past years . higher sensitivity shown by c - tcd is also due to its positive results also in the presence of extracardiac shunts , such as pulmonary arteriovenous malformations . it should be reminded that tcd is not able to show the exact anatomic position of the rls although lt from contrast injection in antecubital vein to the appearance of mes in the setting of an intracardiac shunt is about 11 s , while in the presence of a pulmonary arteriovenous , malformation is reported to be about 14 s. interestingly as reported in the work of gonzlez - alujas et al . c - tte performed simultaneously with tcd was able to confirm the presence of an arteriovenous pulmonary malformation in a positive tcd , showing the entrance of microbubbles in the left atrium from a pulmonary vein . following the acute ischemic event , long - term secondary prevention of stroke recurrence is recommended after cryptogenic stroke either by medical therapy or percutaneous closure of pfo . medical therapy consists of antiplatelet therapy with aspirin or oral anticoagulation therapy with a vitamin k antagonist . to date , there is no clear evidence from rcts favoring any class of antithrombotic agents over the other , but according to the latest american heart association / american stroke association ( aha / asa ) guidelines for secondary prevention of stroke , oral anticoagulation is indicated for patients with an ischemic stroke or transient ischemic attack ( tia ) and both a pfo and a venous source of embolism ( class i , level of evidence a ) . for what concerns the choice between medical therapy versus percutaneous closure of pfo three randomized clinical trials ( closure i , pc trial and respect ) failed to show the superiority of device closure in the secondary stroke prevention . thus , the latest aha / asa guidelines state that percutaneous closure might be considered over antithrombotic only in the setting of pfo and deep venous thrombosis ( dvt ) depending on the risk of recurrent dvt ( class ii b , level of evidence c ) . whereas , for patients with a cryptogenic stroke or tia and a pfo without evidence for dvt , aha / asa guidelines do not support a benefit for pfo closure ( class iii , level of evidence a ) . for a detailed discussion of the different management options for pfo carriers after cryptogenic stroke , we refer the reader to the extensive review by falanga et al . published in a previous issue of this journal . american academy of neurology confers a class ii indication for both c - tcd and tee for interatrial shunt detection . on the other hand , italian stroke guidelines ( spread ) consider tcd a better screening tool than tee in the population of patient with suspect shunt through a foramen ovale . in a consensus document published on behalf of italian society of interventional cardiology by pristipino et al . in 2010 , tcd was proposed as the first - choice screening tool for rls in the setting of a cryptogenic stroke in subjects 55 years old or younger , while in patients older than 55 tee was recommended as the first - line test . following the acute ischemic event , long - term secondary prevention of stroke recurrence is recommended after cryptogenic stroke either by medical therapy or percutaneous closure of pfo . medical therapy consists of antiplatelet therapy with aspirin or oral anticoagulation therapy with a vitamin k antagonist . to date , there is no clear evidence from rcts favoring any class of antithrombotic agents over the other , but according to the latest american heart association / american stroke association ( aha / asa ) guidelines for secondary prevention of stroke , oral anticoagulation is indicated for patients with an ischemic stroke or transient ischemic attack ( tia ) and both a pfo and a venous source of embolism ( class i , level of evidence a ) . for what concerns the choice between medical therapy versus percutaneous closure of pfo three randomized clinical trials ( closure i , pc trial and respect ) failed to show the superiority of device closure in the secondary stroke prevention . thus , the latest aha / asa guidelines state that percutaneous closure might be considered over antithrombotic only in the setting of pfo and deep venous thrombosis ( dvt ) depending on the risk of recurrent dvt ( class ii b , level of evidence c ) . whereas , for patients with a cryptogenic stroke or tia and a pfo without evidence for dvt , aha / asa guidelines do not support a benefit for pfo closure ( class iii , level of evidence a ) . for a detailed discussion of the different management options for pfo carriers after cryptogenic stroke , we refer the reader to the extensive review by falanga et al . published in a previous issue of this journal . american academy of neurology confers a class ii indication for both c - tcd and tee for interatrial shunt detection . on the other hand , italian stroke guidelines ( spread ) consider tcd a better screening tool than tee in the population of patient with suspect shunt through a foramen ovale . in a consensus document published on behalf of italian society of interventional cardiology by pristipino et al . in 2010 , tcd was proposed as the first - choice screening tool for rls in the setting of a cryptogenic stroke in subjects 55 years old or younger , while in patients older than 55 tee was recommended as the first - line test . our suggestion in the setting of a cryptogenic ischemic stroke is to use c - tcd as a first line screening tool , due to its diagnostic accuracy , similar to that of c - tee , and its better tolerability . tee may be considered as a complementary imaging technique for a more detailed anatomic definition of the interatrial septum , especially when pfo closure instead of oral antithrombotic therapy is contemplated [ figure 3 ] . diagnostic algorithm including transcranial doppler in the setting of cryptogenic ischemic stroke finally , tcd is also useful for follow - up of patients after pfo closure in order to identify those with residual shunting , due to its repeatability and its sensitivity for the detection of small entity residual shunts . | transcranial doppler ( tcd ) ultrasonography is a noninvasive ultrasound study , which has been extensively applied in both outpatient and inpatient settings .
its main use in current clinical practice is the research for paradoxical embolism , due to migration of thromboembolic material from systemic venous circulation to the left cardiac chambers and arterial circulation through cardiopulmonary shunts such as patent foramen ovale which represents an important cause of cryptogenic stroke , especially in patients under 55 years of age . in this review
, we shall describe the incremental diagnostic role in cryptogenic stroke for this imaging modality .
tcd not only can be used to detect right - left cardiopulmonary shunts but it also allows to classify the grade of severity of such shunts using the so - called microembolic signals grading score . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the sacroiliac joint ( sij ) plays an important role in the axial skeleton s load
distribution for the lower limbs , because it is the transition point between the upper and
lower body1,2,3 . the sij movement pattern is
complex because its anatomical configuration allows displacement in 3 planes and axes in a
combined manner4 . however , the amplitude
of this movement is restricted to approximately 1 to 4 of rotation and 1 to 2 mm of
translation5 , 6 . these values may vary with age , gender , and weight or during
pregnancy , and this variation has been the subject of study for the last two decades . the sij significantly contributes to different motor patterns of the trunk and lower limbs ,
and some of these patterns are highly complex , such as the marching movement . from a
clinical point of view , the sij is a joint with considerable propensity for arthrokinematic
motion alterations , and a small decrease in the range of motion ( rom ) is likely to develop
before important musculoskeletal dysfunctions occur9 ,
10 , such as back pain , hip pain , and
pain radiating to the legs and inguinal region11,12,13,14 . in the clinical setting , diagnosing disorders of the sij by physical examination , especially with regard to mobility ,
is difficult due to low levels of test reliability1 ,
9 , 15 . however , studies have highlighted the need for a combination of 3
or more provocative tests to confirm sacroiliac dysfunction1 , 10 , 13 , 16 , 17 . szadek et al.13
claimed that gaenslen s thigh and thrust tests individually are more reliable in the
detection of sacroiliac dysfunction ; however , several provocative tests should be performed
to obtain a more accurate diagnosis . in such cases , the degree of mobility of the joint is
neglected and is considered only with the presence of sij pain . today , blockade by intra - articular injection of anesthetic is the gold standard method for
the differential diagnosis of sacroiliac dysfunction from the symptomatological point of
view1 , 7 ,
14 , 15 ,
17 . however , substantial evidence is
lacking regarding viable alternatives for evaluation and quantification of sij mobility ,
especially for applicability in clinical practice . among the existing experimental models for sij movement analysis , the most reliable method
for the evaluation of mobility is radiostereometry guided by fluoroscopy with contrast
administration1 , 6 . however , this is an invasive method , the findings can be difficult to interpret , and it is
very expensive . there is no noninvasive gold standard mobility test for the sij . as with the
provocative tests , positional and mobility tests have been the subject of investigation , and
the empirical evidence suggests poor reliability7 ,
13 . among the tests used for sij
mobility assessment , however ,
this test does not have sufficient reliability to be accepted as a good evaluation
parameter13 , 16 , 17 . based on this
information , the present study aimed to determine the reliability of three - dimensional
kinematics during hip flexion in an orthostatic position as a quantitative method of
evaluating sacroiliac mobility . this cross - sectional study analyzed 24 males between the ages of 18 and 25 years in the
laboratory of human movement analysis at augusto motta university center ( lamh / unisuam ) . the inclusion criteria were as follows : no history of spine or lower limb surgery ,
asymptomatic , no central or peripheral nervous system motor impairment , and a body mass
index ( bmi ) between 18.10 and 24.90 kg / m . we excluded subjects with a real lower
limb length discrepancy of more than 1 cm ( confirmed by scanometry ) , patients presenting
with pain for 6 months before the trial , and patients with allergic reactions to tape ( for
marker points ) . the subjects that did not complete the tests due to pain during the
experiment were excluded from the studies . the subjects were invited to participate in this
study , and after being accepted , they signed a consent form . the work was approved by the
ethics and research committee of unisuam ( no . 119.785 / 2012 ) . a three - dimensional kinematic analysis system ( qualysis motion system , qualisys ab ,
gothenburg , sweden ) was used to analyze the movements of the subjects . the apparatus was
composed of three infrared cameras arranged in a semicircle to record the movements of the
reflective markers attached to the anatomical points of interest . the equipment was
calibrated according to the manual on each day of sample collection , and the sampling
frequency was 120 hz . the subjects were asked to wear only a pair of lycra shorts . in the
first stage , we measured the anthropometric data and performed five irritative manual tests
( thigh thrust , gaenslen s , spring , patrick , and sacral thrust tests ) . ( i.e. , subjects
with three or more positive test results were excluded ) . next , reflective markers were fixed
on the following anatomical points : posterior superior iliac spines and the higher
trochanters and epicondyles of the femur . the subjects then stood in a bipedal standing position against a support bar and performed
3 hip and knee push - ups with each lower limb , and the movement was recorded by the qualisys
system . the primary outcome measure was the displacement distance of the posterior superior iliac
spine in relation to the higher contralateral trochanter during active hip flexion in the
range of approximately 90 in the standing position . the characteristics and sociodemographic data of
the subjects were tested for normality using the kolmogorov - smirnov test and are presented
as averages ( x ) and standard deviations ( sd ) . the intraclass correlation coefficient ( icc )
was used to compare the values between the blocks of sacroiliac mobility tests for the right
and left limb with a confidence interval of 99% ( p < 0.01 ) . the sample consisted of 24 individuals , and no subjects were excluded due to sij
dysfunction ( table 1table 1.descriptive variables of subject characteristics expressed as means and standard
deviationssubject characteristics ( n=24)averagestandard deviationage ( years)24.464.36weight ( kg)71.107.91height ( cm)174.925.98bmi ( kg / m)23.201.89 ) . thus , the goal established by the sample calculation was achieved with a
confidence level of 95% , a testing power of 80% , and a margin error of 20% . table 2table 2.icc of sij mobilityright sijleft sijmean ( mm)7.708.50sd0.3460.416icc0.940.91p < 0.01 presents the mean , median , and standard deviations of the measurements and the
icc of the intra - observer reliability . the averages of the 3 blocks were compared for each
hemi - body separately . the results demonstrated a strong correlation between the blocks ( icc
= 0.94 for the right sij and icc = 0.91 for the left sij ) . the assessment of sij mobility has great relevance in the clinical setting because sij
mobility determines the appropriate therapeutic approach1 , 9 , 15 . the difficulties in detecting biomechanical alterations in the sij
during a physical examination are obvious , and manual tests have insufficient reliability
for this purpose10 , 13 , 15,16,17 , 19 . the literature indicates that the main limitation of these tests
is the examiner s inexperience because the evaluated movements are extremely subtle8 , 13 , 14 . in this study the three - dimensional kinematics analysis was implemented as a tool to promote the
enhancement of the measurement of motion replacing palpation used in manual testing10 , 13 , 14 , 20 . our results agree with the literature regarding the use of
laboratory equipment as a possible alternative method of increasing the analysis accuracy . the current devices have sufficient precision to measure displacements of only a few
millimeters20 , 21 . kinematic analysis is a method that has established validity and reliability in the
literature for the evaluation of several human movement patterns22,23,24 . webster , wittwer , and feller21
compared different three - dimensional motion analysis systems and found excellent
coefficients of repeatability and excellent levels of intra - examiner agreement ( iccs ranged
from 0.92 to 0.99 ) . bussey et al.25
tested a kinematic analysis device that performs magnetic tracking of surface markers and
reported results very similar to our results . however , bussey et al.25 evaluated
another movement pattern of the lower limbs because their purpose was to detect sacroiliac
mobility differences between males and females . the studies performed by ahia et al.26 , 27
aimed to determine the validity of the process of setting markers at anatomical reference
points because this step is crucial for obtaining the data . strong correlation values were
observed in the iccs ( 0.90 ) in studies with good methodological quality according to the
inclusion criteria for systematic reviews established by the quality assessment of
diagnostic accuracy studies ( quadas ) . one of the greatest advantages in using video kinematics for the evaluation of movements
( which were previously tested only by palpation ) is the potential to extract reliable
quantitative data on the range of motion , which can not be achieved through the execution of
conventional manual tests , which provide only qualitative data28 , 29 . studies conducted on cadavers with radiographic analysis systems and contrast
administration report that the mobility of the sij varies from 1 to 4 of rotation and 1 to
2 mm of translation5 , 6 , 8 . these results differ from
the findings obtained in this study , where the average displacement value was 8 mm . however ,
the values presented by the previous authors refer to the real mobility of the sij , and , in
the present work , the distance variation between the posterior superior iliac spine ( psis )
and greater trochanter of the contralateral limb was estimated as an indirect estimate of
sij mobility . to establish an accurate means of evaluation and feasibility in physical therapy
practice30,31,32,33 , our experiment mimicked the motor patterns already commonly used
in evaluations through manual testing . thus , the manual test findings can be enhanced
without challenging clinical reasoning and interpretation inherent to the investigative
essence of the test . observation of the movement relationships between the anatomical
reference points chosen not only provides information on the core mobility of the sij but
also clarifies issues related to the biomechanical behavior of the entire lumbo - pelvic
complex . therefore , we analyzed the magnitude of the displacement between the reference
points and did not analyze the individual structures through vector decomposition of their
motion . one of the limitations of the present study is that there is no gold standard methodology
established for the noninvasive assessment of sij mobility18 . thus , it was impossible for us to compare our findings with data
from other studies , which would establish values related to the reliability of the method . therefore , the need for
further studies using the same methodology of analysis remains to gain a better
understanding of the proposed method , especially when applied to symptomatic individuals . we
conclude that three - dimensional kinematic analysis is a good tool for the estimation of sij
mobility . according to our data , the measurements demonstrated a strong correlation among the blocks
of estimated sij range of motion , which confirms the method s intra - observer reliability . however , new studies must also be performed , especially for subjects with sij dysfunction . thus , it may be possible to consolidate the evaluation of sij mobility through a
three - dimensional kinematic analysis . | [ purpose ] physical therapists , osteopathic practitioners , and chiropractors often perform
manual tests to evaluate sacroiliac joint ( sij ) mobility .
however , the available evidence
demonstrates an absence of reliability in these tests and in investigations with kinematic
analysis .
the aim of this study was to verify the three - dimensional kinematic reliability
in sij movement measurements .
[ subjects ] this cross - sectional study analyzed 24 healthy
males , aged between 18 and 35 years .
[ methods ] three - dimensional kinematic analysis was
performed for measurements of posterior superior iliac displacement and greater trochanter
( femur ) displacement during hip flexion movement in an orthostatic position .
the distance
variations were measured from a reference point in 3 blocks .
the intra - observer
reliability was compared with the mean of three 3 blocks using the interclass correlation
coefficient ( icc ) and a 99% significance level .
[ results ] the measurements indicated a
strong correlation among blocks : icc = 0.94 for right side sij and icc = 0.91 for left
side sij .
the mean displacement between the reference points was 7.7 mm on the right side
and 8.5 mm on the left side .
[ conclusion ] our results indicate that three - dimensional
kinematic analysis can be used for sij mobility analyses .
new studies should be performed
for subjects with sij dysfunction to verify the effectiveness of this method . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in a report published in this issue of critical care , trotter et al . draw attention to the possibility that sex might play a role in modulation of the systemic inflammatory response to cardiac surgery . in that study , girls indeed had higher preoperative and postoperative levels of the natural anti - inflammatory cytokine il-10 , and exhibited lower postoperative morbidity than did boys . could it be assumed then that female sex , because of the influence of oestrogen , protects against systemic inflammation ? this question merits further investigation , the outcome of which could have implications for the timing of corrective cardiac surgery in children . the exact mechanisms that initiate and control the systemic inflammatory reaction associated with cardiac surgery have not yet been fully elucidated . it is generally accepted , however , that contact between blood and the foreign surfaces of the extracorporeal circulation circuit , and ischaemia of almost all tissues followed by their reperfusion trigger a cascade of inflammatory events that may finally result in cell damage and cell death . they are synthesized by circulating leucocytes , resident macrophages , and endothelial and parenchymatous cells of various organs , and they play an important role in the initiation and termination of the systemic inflammatory response ( table 1 ) . proinflammatory cytokines such as il-1 and tumour necrosis factor- are representative of the first category of cytokines . il-10 ( the natural anti - inflammatory , macrophage - deactivating cytokine ) controls and terminates inflammation , whereas il-6 ( the main regulator of the acute - phase reaction ) possesses both proinflammatory and anti - inflammatory properties . cytokines are not exclusively inflammatory mediators , and play important roles in the regulation of interactions between the nervous , endocrine and immune systems . in this regard , il-10 enhances corticotropin - releasing factor and adrenocorticotropic hormone , and is therefore believed to regulate activity of the hypothalamo - pituitary axis . conversely , cytokine production is modulated by steroid and sex hormones , and an increasing body of evidence suggests that oestrogen and progesterone participate in modulation of the secretion of proinflammatory and anti - inflammatory cytokines . in their report , trotter et al . raise the question of whether sex , by influencing perioperative cytokine production , modifies the systemic inflammatory response to cardiac surgery and , consequently , postoperative morbidity in infants and children . an interesting observation of the study is that , in the series presented , girls had higher levels of il-10 before and during the intervention than boys . although this was associated with less postoperative morbidity , it was not associated with higher levels of progesterone . that study is limited by the lack of homogeneity of the patient cohort in terms of age , ranging from infancy to adolescence , and preoperative clinical condition , including various cyanotic and noncyanotic heart diseases . however , it draws attention to the possibility that individual factors such as sex could play a role in modulation of the systemic inflammatory response to cardiac surgery . this hypothesis is supported by previous experimental and clinical observations , in which oestrogen was shown to provide protective effects in sepsis - like models . in this regard , 17-oestradiol and a selective oestrogen receptor modulator administered to rats subjected to splanchnic artery occlusion followed by reperfusion led to reduced tissue injury . one mechanism by which oestrogen could provide organ protection in this model is by reduction in endothelial damage induced by tumour necrosis factor-. indeed , oestrogen receptors and mediate inhibition of the activity of nuclear factor-b ( a transcription factor of several proinflammatory cytokines ) and prevent apoptosis of cultured cardiomyocytes . although the results of those experimental studies point toward a protective effect of female sex in clinical situations that involve acute systemic inflammation , the data emerging from clinical trials are conflicting . in adults , female sex is reported to be associated with both decreased or increased morbidity and mortality after sepsis , burn trauma and cardiac surgery . in our own paediatric experience the incidence of multiple organ failure after cardiac surgery did not differ between girls and boys . however , nichols et al . listed male sex as among the predictors of acute respiratory failure after bone marrow transplantation in children . if male sex really does have a negative influence on outcome in critically ill children , as suggested by nichol et al . and trotter et al . , then the question arises of why and how this is the case . indeed , because plasma concentrations of oestradiol are similar in prepubertal girls and boys , it is unlikely that this hormone could mediate protective effects in this age group . however , this does not exclude the possibility that other sex hormones , such as testosterone and follitrophin , plasma levels of which are higher and lower in boys and girls , respectively , could modulate the systemic inflammatory response in the paediatric population . the study of trotter et al . should stimulate further investigation into this important issue . such an endeavour , however , would require the enrolment of a large homogeneous cohort of patients in whom cytokine balance , sex hormone levels and outcome could be related to each other and between patients . ideally , different age groups should be considered in order to identify those who are at low or high risk . because oestradiol levels are higher during the neonatal period than later in infancy , one could address the question of whether neonates who require cardiac surgery profit by their very particular hormonal environment . if this were the case , then it would be a serious argument in favour of corrective cardiac surgery during the neonatal period rather than in later infancy or childhood . | sex hormones have important interactions with the immune system and modulate the inflammatory response . in this
regard , oestrogen inhibits the transcription of proinflammatory cytokines and confers tissue protection in experimental models .
on the basis of this evidence , trotter et al . in this issue of critical care addressed the question of whether , in children , female sex would protect against the deleterious effects of cardiac operations with cardiopulmonary bypass by providing a favourable anti - inflammatory cytokine balance .
the observations made in that study suggest sex - related immunomodulation and organ protection during cardiac surgery in the paediatric population .
prospective trials conducted in large series , including sex hormone determination in neonates , infants and children with congenital cardiac defects , are necessary to test this hypothesis .
the verification of sex - related intraoperative organ protection would provide new opportunities for preventing the uncontrolled systemic inflammatory response that may occur during cardiac surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
non - invasive continuous cardiac output ( cco ) monitors have become popular in operating rooms and intensive care units ( icus ) . however , the inaccuracy of arterial waveform analysis for measuring cco associated with changes in systemic vascular resistance ( svr ) has been well documented [ 1 , 2 ] . sugo et al . developed a new non - invasive cco monitoring system called estimated continuous cardiac output ( escco ) . in the escco system , cco is derived by means of a conventional electrocardiogram ( ecg ) monitor , peripheral pulse oximetry ( spo2 ) system , and arterial pulse pressure . the escco system uses pulse wave transit time ( pwtt ) in place of arterial waveform analysis . pwtt is the sum of the pre - ejection period ( pep ) and the time taken for pulse wave to travel from the ascending aorta to the spo2 probe site ( fig . 1 ) . pwtt is calculated from the interval between the r wave peak of the ecg and the rise point of peripheral spo2 pulse wave when the ecg and spo2 are recorded simultaneously . stroke volume ( sv ) is derived as follows:\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$${\text{sv } } = { \text { k } } \times \ , ( \alpha \times { \text{pwtt } } + \beta ) $ $ \end{document}fig . pwtt pulse wave transit time , spo
2 peripheral pulse oximetry , pep pre - ejection period , pwtt1 transit time from the rising point of the aortic root pressure wave to the rising point of the radial artery pressure wave in the systolic phase , pwtt2 transit time from the rising point of the radial artery wave to the rising point of the spo2 pulse wave in the systolic phase relationship between each time - related component of pulse wave transit time . pwtt pulse wave transit time , spo
2 peripheral pulse oximetry , pep pre - ejection period , pwtt1 transit time from the rising point of the aortic root pressure wave to the rising point of the radial artery pressure wave in the systolic phase , pwtt2 transit time from the rising point of the radial artery wave to the rising point of the spo2 pulse wave in the systolic phase here , is an experimental constant . k and are derived from pwtt , heart rate , pulse pressure , and cardiac output ( co ) at the start of measurement for each patient . accordingly , the escco system requires a continuous measurement of pwtt , but not map after the start of measurement to calculate cco . there have been no clinical studies on the escco system concerning cco estimation during changes in svr or on the impact of the time component of pwtt on the estimation of co , even though changes in svr would have a less impact on escco system compared to cco measurement system with arterial waveform analysis . in our previous multicenter studies [ 46 ] , we identified two cases in which apparent changes in svr developed in a short period of time during data collection . in this report , we retrospectively analyze the time component of peripheral wave transmission in these two cases , and examined the contribution of the time component of pwtt in determination of sv and co. the escco system was connected to a conventional ecg monitor , radial artery pressure monitor , and spo2 system . a cco monitor derived data from a flow directional pulmonary artery catheter ( swan - ganz ccombo cco / svo2 , ref . 744hf75 , baxter healthcare , edwards critical care division , irvine , ca ) and was connected to the escco system . svr is calculated continuously from co , mean arterial pressure ( map ) , and cvp using a standard formula . additionally , the amplitude of spo2 pulse wave was measured continuously , as described by murray et al . . a 79-year - old male with height of 167.5 cm and preoperative body weight of 52.8 kg underwent removal of a pancreatic tumor . total intravenous anesthesia with propofol and remifentanil combined with continuous epidural block using 6 ml / h of 1.0 % carbocaine was given to the patient . approximately 2 h before completion of the surgical procedure , map started to gradually decrease and reached 61 mmhg at 20:00 , and the carbocaine infusion was switched to 0.2 % ropivacaine infusion ( 5 ml / h ) . the lowest map of 55 mmhg was recorded at 20:09 , and map gradually increased thereafter . while cco decreased from 6.5 to 5.2 l / min ( fig . 2 , interval a : 20:1520:45 ) escco decreased from 8.3 to 6.8 l / min , and the amplitude of the spo2 pulse wave also decreased.fig . 2trends in circulatory parameters in case 1 ( interval a ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) trends in circulatory parameters in case 1 ( interval a ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) a 61-year - old male with height of 158.5 cm and preoperative body weight of 56.9 kg underwent quadruple off - pump coronary artery bypass grafting . map increased , and sv slightly decreased immediately after the patient was admitted postoperatively to the icu . svr increased from 1,700 to 2,500 dyne s cm , but neither cco nor escco was obviously changed ( fig . 3 , interval b ) . subsequently , 0.5 mg of iv nicardipine was injected and resulted in a decrease in map from 110 to 89 mmhg , associated with an increase in cco from 4.0 to 4.5 l / min . escco increased from 4.3 to 4.9 l / min , even though an increase in escco preceded that of the cco , reflecting the time delay in cco measurement due to averaging ( fig . 3 , interval c).fig . 3trends in circulatory parameters in case 2 ( intervals b and c ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) trends in circulatory parameters in case 2 ( intervals b and c ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) pwtt can be divided into the following 3 time - related components ( fig . 1):pep : pre - ejection period consisting of the electromechanical delay at the start of systole and isometric contraction time , with the r wave of ecg serving as the starting point.pwtt1 : the time taken for pulse wave transmission from the aorta through the elastic arteries to the muscular arteries ( namely , the radial artery).pwtt2 : the time taken for pulse wave transmission from the radial artery to the further distal peripheral site of spo2 measurement.as pep and pwtt1 can not be measured separately in the escco method , pwtt was divided into two components : pep + pwtt1 , and pwtt2 . pep : pre - ejection period consisting of the electromechanical delay at the start of systole and isometric contraction time , with the r wave of ecg serving as the starting point . pwtt1 : the time taken for pulse wave transmission from the aorta through the elastic arteries to the muscular arteries ( namely , the radial artery ) . pwtt2 : the time taken for pulse wave transmission from the radial artery to the further distal peripheral site of spo2 measurement . when svr increased in case 1 , pwtt increased in association with the decrease in sv and increase in map ( fig . pep + pwtt1 remained unchanged , but pwtt2 increased during interval a. a similar pattern of change was observed during the increase in svr in case 2 ( fig . 5 , interval b ) , even though pep + pwtt1 tended to be slightly shorter.fig . 4trends in time - related components associated with stroke volume and mean arterial pressure from 20:15 to 20:45 in case 1 ( interval a ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel stroke volume ( sv ) ; right panel map . 5trends of the time - related components associated with sv and map from 16:50 to 17:20 in case 2 ( interval b ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time trends in time - related components associated with stroke volume and mean arterial pressure from 20:15 to 20:45 in case 1 ( interval a ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel stroke volume ( sv ) ; right panel map . red arrows indicate directional changes over time trends of the time - related components associated with sv and map from 16:50 to 17:20 in case 2 ( interval b ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time when svr decreased in case 2 , pwtt tended to be shorter in association with the increasing tendency of sv and the decreasing tendency of map ( fig . pep + pwtt1 showed a 1.10-fold prolongation at 19:30 compared with 18:00 , and pwtt2 showed a 1.25-fold shortening at 19:30 compared with 18:00.fig . 6trends in time - related components associated with sv and map from 18:00 to 19:30 in case 2 ( interval c ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time trends in time - related components associated with sv and map from 18:00 to 19:30 in case 2 ( interval c ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time changes in svr in both cases were confirmed by continuous estimation of svr as well as by continuous measurement of the amplitude of the spo2 pulse wave as reported by murray et al . . additionally , contributory factors to induce changes in svr were clearly identified in both cases : switch from carbocaine to ropivacaine infusion for case 1 , and nicardipine injection for case 2 , respectively . therefore , we believe that this case report could preliminarily show the relationship between each component of pwtt and sv during changes in svr . although pep was not assessed separately in the escco system , pep depends on changes in preload , afterload , and cardiac contractility . the inotropic action of the heart mediated by the carotid sinus reflex likely plays a role in this shortening . on the other hand , boudoulas et al . reported prolongation of pep in relation to an elevation in isometric contraction pressure following an increase in afterload induced by vasoconstrictor administration . on the basis of these findings , we speculate that an increase in afterload prolongs pep as observed in case 1 ( fig . 4 ) and case 2 ( fig . 5 ) , while a decrease in afterload shortens pep as observed in case 2 ( fig . pwtt1 indicates pulse wave transit time from pulse waves arising from the aorta to the radial artery through elastic and muscular arteries . the pulse wave velocity of this time component is well known to correlate with arterial capacitance and to be a useful parameter for measuring changes in arterial pressure . when map increases , the pulse wave velocity increases , resulting in shortening of pwtt1 as observed in case 1 ( fig . 4 ) and case 2 ( fig . 5 ) . in contrast , when map decreases , the pulse wave velocity decreases , resulting in prolongation of pwtt1 as observed in case 2 . when observing opposite directional changes in pep and pwtt1 during changes in afterload , changes in pep + pwtt1 are not obvious as observed in case 1 ( fig . 4 ) and case 2 ( figs . 5 , 6 ) , compared with changes shown pwtt2 indicates pulse wave transit time from the radial artery to the further distal arterioles of the spo2 detection site . pulse wave velocity in this part begins to decrease and reflects an increase in viscosity as the vascular diameter decreases . accordingly , prolongation of pwtt2 can be expected when vasoconstriction occurs as observed in case 1 ( fig . 4 ) and in contrast , shortening of pwtt2 can be expected when vasodilation occurs as observed in case 2 ( fig . associated with changes in afterload , pwtt2 is likely to have a significant impact on the determination of pwtt during changes in afterload . sugo et al . analyzed the relationship of each of these components with sv in an animal study , and they found that inclusion of the pwtt2 component can improve the accuracy of sv estimation after phenylephrine injection . if sv is estimated solely from pwtt1 , which reflects mainly arterial pressure , overestimation of sv can be expected during vasoconstriction accompanied by an increase in arterial pressure , while the underestimation during vasodilatation is associated with a decrease in arterial pressure . in fact , meng et al . reported that the trending ability of co derived from arterial waveform analysis versus co derived from esophageal doppler was only 23 % after phenylephrine treatment , even though the former accurately tracked changes in co when preload changed . it seems that the inclusion of pep and pwtt2 can help promote the accuracy of estimating sv based on pwtt when changes in svr occur . first , data of this report were not derived from a prospective clinical study , and it is thus difficult to draw any definite conclusion , even though a canine experimental study on sv estimation after phenylephrine injection supported the hypothesis . therefore , further prospective clinical studies are required to test the hypothesis by simultaneously measuring map , cvp and well accepted cco in comparison with escco . second , the impact of changes in svr on co is only partially understood and consequently any conclusion based on simple observation is difficult . in fact , we could find only two cases where changes in svr mainly affected changes in co , since various factors other than afterload may also have a significant impact on determining co particularly in our previous multi - center study . in summary , data of this report suggest that the time component of pwtt may improve the accuracy of cco estimation during changes in svr . a 79-year - old male with height of 167.5 cm and preoperative body weight of 52.8 kg underwent removal of a pancreatic tumor . total intravenous anesthesia with propofol and remifentanil combined with continuous epidural block using 6 ml / h of 1.0 % carbocaine was given to the patient . approximately 2 h before completion of the surgical procedure , map started to gradually decrease and reached 61 mmhg at 20:00 , and the carbocaine infusion was switched to 0.2 % ropivacaine infusion ( 5 ml / h ) . the lowest map of 55 mmhg was recorded at 20:09 , and map gradually increased thereafter . while cco decreased from 6.5 to 5.2 l / min ( fig . 2 , interval a : 20:1520:45 ) escco decreased from 8.3 to 6.8 l / min , and the amplitude of the spo2 pulse wave also decreased.fig . 2trends in circulatory parameters in case 1 ( interval a ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) trends in circulatory parameters in case 1 ( interval a ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) a 61-year - old male with height of 158.5 cm and preoperative body weight of 56.9 kg underwent quadruple off - pump coronary artery bypass grafting . map increased , and sv slightly decreased immediately after the patient was admitted postoperatively to the icu . svr increased from 1,700 to 2,500 dyne s cm , but neither cco nor escco was obviously changed ( fig . 3 , interval b ) . subsequently , 0.5 mg of iv nicardipine was injected and resulted in a decrease in map from 110 to 89 mmhg , associated with an increase in cco from 4.0 to 4.5 l / min . escco increased from 4.3 to 4.9 l / min , even though an increase in escco preceded that of the cco , reflecting the time delay in cco measurement due to averaging ( fig . 3 , interval c).fig . 3trends in circulatory parameters in case 2 ( intervals b and c ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) trends in circulatory parameters in case 2 ( intervals b and c ) blue heart rate ( hr ) ; red mean arterial pressure ( map ) ; green estimated continuous cardiac output ( escco ) ; brown continuous cardiac output derived from a flow directional pulmonary artery catheter ( cco ) ; purple systemic vascular resistance ( svr ) ; black pulse amplitude ( normalized spo2 pulse wave amplitude ) pwtt can be divided into the following 3 time - related components ( fig . 1):pep : pre - ejection period consisting of the electromechanical delay at the start of systole and isometric contraction time , with the r wave of ecg serving as the starting point.pwtt1 : the time taken for pulse wave transmission from the aorta through the elastic arteries to the muscular arteries ( namely , the radial artery).pwtt2 : the time taken for pulse wave transmission from the radial artery to the further distal peripheral site of spo2 measurement.as pep and pwtt1 can not be measured separately in the escco method , pwtt was divided into two components : pep + pwtt1 , and pwtt2 . pep : pre - ejection period consisting of the electromechanical delay at the start of systole and isometric contraction time , with the r wave of ecg serving as the starting point . pwtt1 : the time taken for pulse wave transmission from the aorta through the elastic arteries to the muscular arteries ( namely , the radial artery ) . pwtt2 : the time taken for pulse wave transmission from the radial artery to the further distal peripheral site of spo2 measurement . when svr increased in case 1 , pwtt increased in association with the decrease in sv and increase in map ( fig . 4 ) . among the components tested , pep + pwtt1 remained unchanged , but pwtt2 increased during interval a. a similar pattern of change was observed during the increase in svr in case 2 ( fig . 5 , interval b ) , even though pep + pwtt1 tended to be slightly shorter.fig . 4trends in time - related components associated with stroke volume and mean arterial pressure from 20:15 to 20:45 in case 1 ( interval a ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel stroke volume ( sv ) ; right panel map . 5trends of the time - related components associated with sv and map from 16:50 to 17:20 in case 2 ( interval b ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time trends in time - related components associated with stroke volume and mean arterial pressure from 20:15 to 20:45 in case 1 ( interval a ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel stroke volume ( sv ) ; right panel map . red arrows indicate directional changes over time trends of the time - related components associated with sv and map from 16:50 to 17:20 in case 2 ( interval b ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time when svr decreased in case 2 , pwtt tended to be shorter in association with the increasing tendency of sv and the decreasing tendency of map ( fig . 6 , interval c ) . pep + pwtt1 showed a 1.10-fold prolongation at 19:30 compared with 18:00 , and pwtt2 showed a 1.25-fold shortening at 19:30 compared with 18:00.fig . 6trends in time - related components associated with sv and map from 18:00 to 19:30 in case 2 ( interval c ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . red arrows indicate directional changes over time trends in time - related components associated with sv and map from 18:00 to 19:30 in case 2 ( interval c ) . left panel pwtt ( pep + pwtt1 and pwtt2 ) ; middle panel sv ; right panel map . changes in svr in both cases were confirmed by continuous estimation of svr as well as by continuous measurement of the amplitude of the spo2 pulse wave as reported by murray et al . . additionally , contributory factors to induce changes in svr were clearly identified in both cases : switch from carbocaine to ropivacaine infusion for case 1 , and nicardipine injection for case 2 , respectively . therefore , we believe that this case report could preliminarily show the relationship between each component of pwtt and sv during changes in svr . although pep was not assessed separately in the escco system , pep depends on changes in preload , afterload , and cardiac contractility . ronn et al . reported that pep shortened when afterload was decreased by vasodilator administration . the inotropic action of the heart mediated by the carotid sinus reflex likely plays a role in this shortening . on the other hand , boudoulas et al . reported prolongation of pep in relation to an elevation in isometric contraction pressure following an increase in afterload induced by vasoconstrictor administration . on the basis of these findings , we speculate that an increase in afterload prolongs pep as observed in case 1 ( fig . 4 ) and case 2 ( fig . 5 ) , while a decrease in afterload shortens pep as observed in case 2 ( fig . pwtt1 indicates pulse wave transit time from pulse waves arising from the aorta to the radial artery through elastic and muscular arteries . the pulse wave velocity of this time component is well known to correlate with arterial capacitance and to be a useful parameter for measuring changes in arterial pressure . when map increases , the pulse wave velocity increases , resulting in shortening of pwtt1 as observed in case 1 ( fig . 4 ) and case 2 ( fig . 5 ) in contrast , when map decreases , the pulse wave velocity decreases , resulting in prolongation of pwtt1 as observed in case 2 . when observing opposite directional changes in pep and pwtt1 during changes in afterload , changes in pep + pwtt1 are not obvious as observed in case 1 ( fig . 4 ) and case 2 ( figs . 5 , 6 ) , compared with changes shown pwtt2 indicates pulse wave transit time from the radial artery to the further distal arterioles of the spo2 detection site . pulse wave velocity in this part begins to decrease and reflects an increase in viscosity as the vascular diameter decreases . accordingly , prolongation of pwtt2 can be expected when vasoconstriction occurs as observed in case 1 ( fig . 4 ) and case 2 ( fig . 5 ) . in contrast , shortening of pwtt2 can be expected when vasodilation occurs as observed in case 2 ( fig . 6 ) . considering these directional changes in the time component of pwtt associated with changes in afterload , pwtt2 is likely to have a significant impact on the determination of pwtt during changes in afterload . analyzed the relationship of each of these components with sv in an animal study , and they found that inclusion of the pwtt2 component can improve the accuracy of sv estimation after phenylephrine injection . if sv is estimated solely from pwtt1 , which reflects mainly arterial pressure , overestimation of sv can be expected during vasoconstriction accompanied by an increase in arterial pressure , while the underestimation during vasodilatation is associated with a decrease in arterial pressure . in fact , meng et al . reported that the trending ability of co derived from arterial waveform analysis versus co derived from esophageal doppler was only 23 % after phenylephrine treatment , even though the former accurately tracked changes in co when preload changed . it seems that the inclusion of pep and pwtt2 can help promote the accuracy of estimating sv based on pwtt when changes in svr occur . first , data of this report were not derived from a prospective clinical study , and it is thus difficult to draw any definite conclusion , even though a canine experimental study on sv estimation after phenylephrine injection supported the hypothesis . therefore , further prospective clinical studies are required to test the hypothesis by simultaneously measuring map , cvp and well accepted cco in comparison with escco . second , the impact of changes in svr on co is only partially understood and consequently any conclusion based on simple observation is difficult . in fact , we could find only two cases where changes in svr mainly affected changes in co , since various factors other than afterload may also have a significant impact on determining co particularly in our previous multi - center study . in summary , data of this report suggest that the time component of pwtt may improve the accuracy of cco estimation during changes in svr . | the inaccuracy of arterial waveform analysis for measuring continuos cardiac output ( cco ) associated with changes in systemic vascular resistance ( svr ) has been well documented . a new non - invasive continuous cardiac output monitoring system ( escco ) mainly utilizing pulse wave transit time ( pwtt ) in place of arterial waveform analysis has been developed .
however , the trending ability of escco to measure cardiac output during changes in svr remains unclear . after a previous multicenter study on escco measurement
, we retrospectively identified two cases in which apparent changes in svr developed in a short period during data collection . in each case , the trending ability of escco to measure cardiac output and time component of pwtt were analyzed .
recorded data suggest that the time component of pwtt may have a significant impact on the accuracy of estimating stroke volume during changes in svr .
however , further prospective clinical studies are required to test this hypothesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the pacific region is a high endemic area for leptospirosis and arboviruses . in french polynesia , leptospirosis , caused by leptospira spp . , occurs annually with a peak in the rainy season , while arboviroses , caused by dengue ( denvs ) , chikungunya ( chikv ) or zika viruses , occur mainly during outbreaks . because of a non - specific clinical presentation , leptospirosis can be misdiagnosed as arboviroses , especially dengue , . in addition , leptospirosis can be missed by erroneous clinical or laboratory diagnosis of arboviroses or co - infections with arboviruses , , . to illustrate this risk we report two co - infections with leptospira spp . and chikungunya virus that occurred during the chikv outbreak in french polynesia in 20142015 ( about 60,000 infections ) , in a context of co - circulation with denv serotypes 1 and 3 . patient 1 , a 70-year - old man with a history of type 2 diabetes , severe chronic renal failure , arterial hypertension and gout , was hospitalized for severe sepsis . he had been unwell for three weeks ( asthenia and diffuse arthralgia ) and had experienced diffuse arthromyalgia for the past week . members of his family had been diagnosed with chikungunya infection . on admission , he presented with severe sepsis including respiratory , hepatic and severe renal failures . results of laboratory tests showed anemia ( hemoglobin : 11.6 g / dl ) , leukocytosis ( 14.9 10/l ) with predominance of neutrophils , lymphopenia ( 700 10/l ) with associated stimulated lymphocytes , thrombocytopenia ( 35 10/l ) , raised liver enzymes and bilirubin ( aspartate aminotransferase : 97 u / l , alanine aminotransferase : 50 u / l ) , total bilirubin : 46 mol / l , severe renal failure ( creatinine : 398 mol / l ) , hyperkalemia ( 4.8 mmol / l ) , increased c - reactive protein ( 351 mg / l ) and procalcitonin ( 34 ng / ml ) . given the clinical picture and the absence of any obvious focus of infection , leptospirosis was suspected . the patient was treated with amoxicillin , intravenous saline and oxygen therapy and was admitted to the intensive care unit . the patient s condition rapidly worsened and he died of multiple organ failure a few hours after admission . patient 2 , a 77-year - old man with treated pharynx cancer , presented with a one - week history of fever and myalgia . on admission , he was found to have septic shock , jaundice , and hepatomegaly . results of laboratory tests showed anemia ( hemoglobin : 9.7 g / dl ) , leukocytosis ( 37.1 10/l ) with predominance of neutrophils , thrombocytopenia ( 5 10/l ) , raised liver enzymes and bilirubin ( aspartate aminotransferase : 257 u / l , alanine aminotransferase : 78 u / l ) , total bilirubin : 370 mol / l , pancreatitis ( lipase : 1133 ui / l ) , severe renal failure ( creatinine : 776 mol / l ) , hyperkalemia ( 5.5 mmol / l ) and increased c - reactive protein ( 180 mg / l ) . the patient was treated with piperacilline + tazobactam and second generation quinolone ( ciprofloxacin ) , and required red blood cell and aphaeresis platelets transfusion and continuous hemofiltration . his condition improved and he was discharged from the intensive care unit 10 days later . for both patients , diagnosis was performed by leptospira spp . and chikv detection from blood by real time pcr using commercial kits for chikv ( realstar chikv , altona diagnostics ) and primers and probes previously reported for leptospira spp . . publication of identified clinical cases was approved by the ethics committee of french polynesia ( n 61 cepf ) , written consent was obtained from the patients for publication . we report the first cases of leptospirosis and chikungunya co - infections , both confirmed by molecular diagnosis . the possibility of leptospirosis and chikungunya co - infections was raised during the chikv outbreak in la reunion island , indian ocean , in 2006 . during this outbreak there was an excess of leptospirosis mortality ( from 6% for the past years to 38% during the outbreak ) resulting mainly from delays in diagnosis or leptospirosis infections being initially mistaken for chikungunya , while the annual number of reported cases was stable over the period . the increased fatality rate was specific to leptospirosis and was not observed for other infectious diseases . the diagnosis of leptospirosis could also have been delayed because of a delay in consulting a doctor in the context of a chikungunya outbreak , as was the case in our two patients . no leptospirosis and chikungunya co - infection was reported during the outbreak in la reunion . leptospirosis and dengue co - infections have been described in mexico , barbados , india , pakistan , jamaica and peru ; including fatal cases in puerto rico , sri lanka and india . increased mortality due to leptospirosis during dengue outbreaks was observed in barbados in 1995 , brazil in 2006 and puerto rico in 20102012 . in barbados , leptospirosis mortality during a dengue outbreak was twice the average suggesting that some leptospirosis cases were misdiagnosed and treated inappropriately . in brazil , it was hypothesized that , during the outbreak , the large number of dengue cases and the publicity about dengue led to missed diagnosis of leptospirosis ; within the first days of the illness , 61% of leptospirosis patients received a diagnosis of dengue . during a dengue epidemic in south india , the highest mortality ( 29.6% ) was observed in dengue / leptospirosis co - infected versus leptospirosis ( 14.6% ) and dengue ( 3.7% ) infected patients . although difficult to assess , the impact of co - infection on case fatality rate of leptospirosis and chikungunya could be influenced by a potential synergistic effect of both pathogens , and/or a delayed diagnosis of one of the pathogens . these data confirm that diagnostic confusion with dengue or chikungunya had a detrimental effect on leptospirosis outcome especially because antibiotic therapy in leptospirosis is widely believed to provide the greatest benefit when initiated in the early phase of the disease . for the two french polynesian co - infected patients , the diagnosis was delayed and performed at admission in hospital because of severe sepsis . the first patient was unwell for three weeks and had experienced diffuse arthromyalgia for the past week before admission in the setting of similar cases in his family diagnosed as chikv infections and the second patient presented with a one - week history of fever and myalgia . the patients do not medical care , had no standard blood tests nor received antibiotics within the first week post symptoms onset . we can not excluded that both patients were first infected by chikv and then presented a a the time of admission , laboratory testing of both patients yielded increase bilirubin , leukocytosis with predominance of neutrophils , increased c - reactive protein , increase creatinine and thrombocytopenia . both patients had severe thrombocytopenia . rapid decrease of platelet count is a warning sign of severe dengue , it is uncommon in chikungunya but can be found in leptospirosis and a slight increased c - reactive protein can be found in chikungunya . we reported in table 1 these laboratory abnormalities in leptospirosis , chikungunya and dengue . in order to avoid such mistake we recommend to patients to seek medical care during arboviruses outbreaks in case of fever and arthralgia , especially during the raining season because of the risk of leptospirosis being misdiagnosed as dengue or chikungunya . if patients seek medical care , we recommend to perform standard laboratory tests at initial presentation of patients presenting with fever and arthralgia , even in the context of arboviruses outbreak , including standard blood count ( to detect leukocytosis and thrombocytopenia ) , renal and hepatic markers and c - reactive protein . several studies have shown that leptospirosis is often confused with dengue and remains underdiagnosed , as previously reported in other pacific islands ( federated states of micronesia ) . following a dengue fever outbreak in 2012 , five diagnosis of leptospirosis the risk of misdiagnosis of leptospirosis is high if the diagnosis of arboviruses relies only on serological assays due false positive results for dengue . in addition , serological testing for leptospirosis detects antibodies from the second week of illness , resulting in false negative results at the acute phase of the disease , the risk is higher when using rapid diagnostic tests that lack sensitivity and specificity for dengue and leptospirosis . in developing countries , including most of the pacific islands , diagnosis at ambulatory health services setting and in regards to overlapping clinical features of leptospirosis with dengue or chikungunya , misdiagnosis are frequent . during arboviruses outbreaks , the attack rate of infections is usually high , especially when it occurs in a population with low levels or no pre - existing immunity as during la reunion and french polynesian chikv outbreaks . an increased rate of leptospirosis is observed during heavy rainfall and flooding . in the setting of arbovirus outbreaks , especially when climatic conditions favors leptospirosis emergence ( as rainy season in french polynesia ) , even if denv or chikv infections are confirmed by reference molecular testing , leptospirosis should be considered if other symptoms or laboratory abnormalities raise a suspicion of leptospirosis . early diagnosis of leptospirosis is essential in order to implement appropriate treatment and reduce severity of illness and mortality . during arboviruses outbreaks , diagnostic strategy should systematically include leptospirosis as a differential diagnosis of dengue - like illness and consider the possibility of co - infection with arboviruses in endemic areas and in travelers returning from these regions . | in endemic areas , leptospirosis can be missed by erroneous clinical or laboratory diagnosis of arboviroses or co - infections with arboviruses and an increase in mortality due to leptospirosis has already been reported during arboviruses outbreaks . during the french polynesian chikungunya virus outbreak in 20142015 , two leptospirosis and chikungunya co - infections were reported , one of which was fatal .
diagnosis of leptospiroses was delayed in the context of chikungunya outbreak . in the context of arbovirus outbreak
, the risk of misdiagnosis of leptospirosis is maximum and clinicians should initiate early antibiotic therapy if leptospirosis is suspected .
a delayed diagnosis of leptospirosis can be responsible for fatal outcome .
leptospirosis should be considered even if dengue or chikungunya virus infections are confirmed by reference molecular testing |
You are an expert at summarizing long articles. Proceed to summarize the following text:
epilepsy is a chronic neurological disorder characterized by recurrent seizures and is often accompanied by cognitive deficits and mood disorders [ 13 ] . because seizures are the result of uncontrollable neural excitation in the brain , epilepsy has been considered to primarily be a neuronal disease . the targeting of neuronal ion channels and both gamma - aminobutyric acid ( gaba ) and glutamate receptors has been the primary approach to eliminate seizures . however , studies that have focused exclusively on neurons fail to address the questions that arise from more complex models of epileptogenesis . to date , studies using animal models and human patients with epilepsy have shown that the pathogenesis of epilepsy may be associated with both neuronal and nonneuronal components such as glial cells , brain vasculature , and leucocytes from the periphery . glial abnormalities , including chronically activated astrocytes and microglia , glial scars , and various gliomas , are likely to form epileptic foci in the brain . the mechanisms through which glial cells can promote epileptogenesis can include increased neuronal excitability and inflammatory processes . the key roles of inflammatory processes in relation to epilepsy have been clarified over the last decade . studies of the mechanisms of antiepileptic drugs ( aeds ) have focused on ion channels , transporters , and excitatory / inhibitory neurotransmission . however , the anti - inflammatory effects of aeds have received recent attention due to their relevance to antiepileptic properties . for example , carbamazepine and levetiracetam can reduce the expression of inflammatory mediators in glial cell cultures [ 8 , 9 ] . one of the anticonvulsive effects of levetiracetam could be mediated through suppression of astroglial activation by inflammatory mediators . in addition , dysfunction of the blood - brain barrier ( bbb ) may be responsible for abnormal neuronal firing . disruption of the bbb causes the leakage of serum protein and leucocyte invasion into the brain . these exogenous inflammatory mediators have the potential to lower seizure thresholds [ 4 , 5 , 10 , 11 ] , which could alter channel sensitivity , neurotransmitter uptake or release , and glia - associated regulation of extracellular environments , such as potassium concentration [ 4 , 5 , 10 , 11 ] . accordingly , brain inflammation is one of the etiological factors that promote epileptogenesis and ictogenesis . in this review , we discuss seizure - induced inflammatory mediators and the mechanisms through which these factors exacerbate epilepsy . direct anti - inflammatory treatments have been reported to suppress some type of epileptic seizures that are resistant to conventional aeds . for example , adrenocorticotropic hormone ( acth ) has been a first - line treatment for infantile spasms . anti - inflammatory effects of increased steroid hormone by acth treatment could play a crucial role in the suppression of refractory epilepsy in west syndrome . in addition , intravenous immunoglobulin ( ivig ) can suppress seizures in some types of intractable epilepsy , an effect that may be partially mediated through a reduction in cytokines and a suppression of astrocyte activation [ 15 , 16 ] . these drugs are also able to confer protection against seizures in mice with some types of epilepsy that are resistant to conventional aeds . combined with antiglial functions of conventional aeds described above , anti - inflammatory medication could be a new promising treatment for refractory epilepsy . research with rodent models of epilepsy has uncovered roles for brain inflammation in epileptogenesis and ictogenesis . pharmacological or electrical stimulation produces epileptic seizures accompanied by robust inflammatory responses in the brains of rodents [ 1832 ] . the administration of proinflammatory or anti - inflammatory reagents has also been used to elucidate the effects of inflammatory mediators on seizure latency , frequency , duration , and severity [ 33 , 34 ] . for instance , lipopolysaccharide , a provocative agent for inflammation , exacerbates seizure severity , whereas an inhibitory peptide against high - mobility group box-1 ( hmgb1 ) inflammatory mediator decreased acute and chronic seizure recurrence . transgenic mouse models have also been used to evaluate the relationship between inflammatory mediators and seizure severity . mice overexpressing cytokines , such as tumor necrosis factor- ( tnf- ) or interleukin-6 ( il-6 ) , within astrocytes developed age - dependent neurological dysfunctions including a reduction in seizure threshold , spontaneous seizure frequency , and neuronal cell loss [ 35 , 36 ] . inflammatory cytokines , including interleukin-1 ( il-1 ) and hmgb1 , are released from astrocytes and microglia after seizures [ 2224 , 37 ] . il-1 and hmgb1 activate il-1r type i and toll - like receptor 4 ( tlr4 ) , respectively . il-1r / tlr signaling can regulate neuronal excitability , including the alteration of synaptic transmission , the reduction in gaba production , and the inhibition of outward current of ca channels [ 10 , 4042 ] . il1r / tlr signaling may activate the src kinase - mediated phosphorylation of n - methyl - d - aspartate ( nmda ) receptor subunit 2b ( nr2b ) . consequently , this nmda - mediated ca influx could be enhanced in neurons , leading to increased neuronal excitability and excitotoxicity [ 34 , 44 ] . thus , the activation of il-1/il-1r or hmgb1/tlr4 signaling resulting from epileptic insults might result in a rapid change in neuronal excitability and a decreased seizure threshold ( figure 1(a ) ) . tnf- is another inflammatory factor , and its expression is also upregulated following seizures [ 18 , 36 ] . tnf- is mainly released by microglia in the brain , and it can stimulate astrocytes to release glutamate . an extracellular increase in glutamate concentration may stimulate glutamatergic neurons , thereby depolarizing their membrane potential . taken together , postseizure production of inflammatory mediators can trigger neuronal hyperexcitability through modulations of ion channels and glutamate release in neurons and glia , respectively ( figure 1(a ) ) . in addition , the endothelial cells that make up the bbb could be another center for inflammatory processes in the brain . the activation of the il-1 system following seizures induces neuronal cell loss and a breakdown in the bbb . albumin entry can induce a further upregulation in inflammatory mediators and reduce the potassium and glutamate uptake of astrocytes , which leads to increased neural excitability [ 4850 ] . these findings indicate that a breakdown in the bbb can increase neuronal excitability by enhancing inflammatory responses in the brain ( figure 1(a ) ) . taken together , epileptic seizures can provoke inflammatory responses , which enhance calcium influx into neurons , activate glial cells to increase extracellular potassium and glutamate , and induce further inflammatory response via bbb break down . , epileptic seizures and inflammatory mediators can form a positive feedback loop , reinforcing each other ( figure 1(a ) ) . in addition to inflammatory cytokines , prostaglandins ( pgs ) are major factors that stimulate inflammation processes . pgs are known to markedly increase following seizures and may contribute to epileptogenesis and reduction in seizure threshold [ 10 , 52 ] . the enzyme cyclooxygenase ( cox ) converts arachidonic acid to pgh2 , and the specific pg synthase converts pgh2 to various pgs such as thromboxane a2 , pgf2a , pge2 , pgi2 , or pgd2 . consistent with the robust production of pgs in the brain following seizures , an inducible type of cox ( cox-2 ) , but not the constitutively expressed cox-1 , is rapidly induced in the brain following seizures [ 16 , 53 ] . because pgs play an important role in inflammatory responses , the functions of pgs in epileptogenesis have been studied for a considerable amount of time [ 52 , 54 ] ; however , data on the roles of cox-2 in epilepsy appear to be bidirectional . for example , following an injection of kainic acid ( ka ) , postseizure treatment with the selective cox-2 inhibitor ns-398 prevented neuronal cell loss in the hippocampus . however , the administration of another cox-2 inhibitor , nimesulide , prior to an injection of ka strongly aggravated ka - induced seizures and increased the mortality rate . these conflicting results might be partly explained by possible dual roles for cox-2 , which has been shown to play early neuroprotective and late neurotoxic roles following seizures . thus , the timing of cox-2 inhibitor administration may be crucial when treating epilepsy ( figure 1(b ) ) . the bifunctional aspects of cox-2 in epileptogenesis can also be explained by the diversity of pgs . pgd2 synthase h - pgds - knockout ( ko ) mice or pgd2 receptor dp1r - ko mice showed more severe seizures after pentylenetetrazol ( ptz ) treatment than wild type ( wt ) mice , whereas deficiencies of the other synthase l - pgds or receptor dp2r did not alter seizure severity . additionally , the intracisternal administration of pgf2 after ka treatment reduced the seizure score and mortality . the administration of pge2 receptor ( ep ) antagonists reduced seizure severity and neuronal injury following pilocarpine- or ptz - induced seizures [ 6163 ] . three pge2 synthase ( pges ) genes have been identified , including membrane - bound pges ( mpges)-1 , mpges-2 , and cytosolic pges ( cpges ) . mpges-1 is induced in the venous endothelia of the brain following an injection of ka , and its expression is upregulated in conditions of inflammation , pain , and fever [ 16 , 65 , 66 ] . mpges-2 and cpges show constitutive levels of expression , and their physiological functions remain unknown . the finding that the activity of mpges-1 is tightly coupled to that of cox-2 could support the importance of pge2 function under epileptic conditions . several lines of evidence suggest that pge2 could have an important role in epileptic neuronal cell death and the reduction in seizure threshold . mpges-1-ko mice show little postictal production of pge2 , and the lack of increased pge2 production resulted in the promotion of neuronal survival following ka injection [ 64 , 68 ] . furthermore , the intraventricular injection of pge2 decreased the latency to methylmalonate- ( mma- ) induced seizures and increased the amplitude of spikes measured by an electroencephalogram ( eeg ) in rats . thus , cox-2-coupled pge2 production can promote seizures through mechanisms that drive epileptogenesis . to determine whether mpges-1-derived pge2 is directly involved in epileptogenesis , we used mpges-1-ko mice . to mimic the gradual exacerbation of epileptic seizures , a subconvulsive dose of ptz was administered to wt or mpges-1-ko mice every other day ( ptz chemical kindling ) . wt mice showed rapid increases in seizure severity , whereas mpges-1-ko mice showed a significantly slower elevation in seizure score ( figure 2(a ) ) . immunohistochemical analyses revealed that glial fibrillary acidic protein- ( gfap- ) positive astrocytes were increased in the hippocampal ca3 region of the wild type mice after the kindling , indicating that pge2 production promotes reactive astrogliosis ( figure 2(b ) ) . interestingly , mpges-1-ko mice did not show any increase in gfap - positive astrocytes after the kindling ( figure 2(c ) ) . reactive astrogliosis is one of the pathological hallmarks of temporal lobe epilepsy , which include segmental neuronal loss and increases in gfap - positive cells in the hippocampus and associated temporal lobe structures . our results indicate that mpges-1-ko mice are resistant to the development of ptz kindling and also to kindling - induced astrogliosis . pge2 acts on four g protein - coupled receptors named ep1 , ep2 , ep3 , and ep4 . ep receptors have been shown to be localized in the brain cells [ 70 , 71 ] ; however , it still remains unclear on which cells pge2 acts to produce its epileptogenic effects . the administration of a selective ep2 antagonist prevented neuronal cell loss after pilocarpine - induced seizures . furthermore , the pharmacological inhibition of other receptors , ep1 , ep3 , or ep4 , resulted in increases in ptz - induced seizure latency . these results suggest that pge2 may cause neuronal cell death and neuronal hyperexcitability via hippocampal ep receptors ( figure 1(b ) ) . the effects of pge2 on neurons might be partly similar to those of other inflammatory mediators in terms of their enhancement of neuronal excitability . several studies have shown that pg synthesis is upregulated by il-1 treatment . in a lung fibroblast cell line , il-1 induced mpges-1 mrna expression . additionally , il-1 treatment increased cox-2 mrna levels in cultured murine primary astrocytes . the application of pge2 led to significant increases in firing frequency and excitatory postsynaptic potential ( epsp ) amplitude in rat hippocampal slice cultures . pge2-induced increases in neuronal excitability may be partly attributable to an inhibition of potassium currents , resulting in boosted ca influx . however , given that the mpges-1 enzyme is preferentially expressed in the brain microvasculature , it may be more likely that pge2 acts on glial cells but not on neurons . we previously reported that the ep3 receptor was localized to astroglial end feet around microvessels . additionally , mpges-1-ko mice showed decreased astrogliosis compared to wt mice following ka treatment . these findings suggest that endothelial pge2 may act on glial ep3 receptors and alter glial function . in fact , glutamate release from astrocytes was drastically reduced in mpges-1-ko mice compared to wt mice [ 66 , 75 ] . thus , pge2 is both an inflammatory mediator and a promoter of extracellular gliotransmission via astrocytic ep receptors ( figure 1(b ) ) . in conclusion , epileptic seizures rapidly induce cox-2 mrna in neurons and afterwards upregulate both cox-2 and mpges-1 mrnas in venous endothelia [ 16 , 6466 ] . treatment with ns-398 and nimesulide prior to seizure induction aggravates neuronal damage in the hippocampus , whereas postseizure treatments with ns-398 prevent the damages [ 55 , 56 ] . neuronal cox-2-derived pgs appear to protect neurons against seizures , whereas endothelial pg ( pge2 ) might participate in seizure - induced neuronal cell death by stimulating astrocytes to release glutamate . thus , pg - mediated inflammation may also form a positive feedback loop to exacerbate epileptic seizures in a late phase after seizures ( figure 1(b ) ) . . however , this neuronal upregulation of cox-2 and pge2 is transient and simultaneous robust increases in brain pgd2 levels could surpass the effects of pge2 , resulting in suppression of seizures . by contrast , late induction of endothelial cox-2 and mpges-1 lasts longer than early phase and this sustained production of pge2 may promote neurodegeneration via astrocytes . thus , time course and cell type - specific expression of cox-2 could cause the dual effects of pg production on epileptogenesis . first , even with optimal aed therapy , 20~30% of patients have poor seizure control and become intractable . second , as these medications act as general central nervous system ( cns ) depressants and must be taken chronically for seizure suppression , they also have marked inhibitory effects on cognitive development . therefore , the development of new aeds that can modulate seizures through another mechanism is required for refractory epilepsy treatment . animal models and clinical evidence have emphasized the involvement of inflammatory mediators in seizure susceptibility and epileptogenesis [ 7678 ] . robust and general inflammatory responses in the brain lower the seizure threshold , enhance neuronal excitability , increase bbb permeability , and promote epileptogenesis . cox-2 and mpges-1 are known to play key roles in the inflammatory responses to insults and consequently increase postseizure inflammation and the resulting hyperexcitability of brain neurons . cox-2 inhibitors such as celecoxib have been developed and prescribed for chronic inflammatory pain and rheumatoid arthritis . hence , they can be used in conjunction with aeds to treat brain inflammation and reduce neuronal hyperexcitability . although celecoxib suppresses epileptogenesis , for example , the development of ptz - kindling , this inhibitor may be more effective for postseizure inflammation than for the prevention of seizure incidence . however , given that chronic celecoxib treatment can be accompanied by serious cardiovascular side effects , persistent cox-2 inhibition would not be beneficial as a therapeutic strategy for intractable epilepsy . by contrast , the regulation of specific pg signaling should offer more selective actions and fewer complicating adverse effects . although pge2 synthase inhibitors may be good candidates for epilepsy treatment , specific inhibitors are still under development . an ep2 inhibitor appears to suppress neurodegenerative pathology following epileptic seizures , and the inhibition of the other ep receptors , ep1 , ep3 , and ep4 , might delay seizure induction [ 6163 ] . the discovery of selective ep receptor antagonist(s ) could contribute to avoid the serious side effects of chronic cox-2 inhibition and provide more selective therapies for refractory epilepsy . modulators of pg receptor function could also improve our understanding of the roles of pgs in the brain immune system and inflammation . consequently , more precise molecular roles of pgs in epileptogenesis will need to be clarified . | epilepsy is one of the most common chronic brain disorders worldwide , affecting 1% of people across different ages and backgrounds .
epilepsy is defined as the sporadic occurrence of spontaneous recurrent seizures .
accumulating preclinical and clinical evidence suggest that there is a positive feedback cycle between epileptogenesis and brain inflammation .
epileptic seizures increase key inflammatory mediators , which in turn cause secondary damage to the brain and increase the likelihood of recurrent seizures .
cytokines and prostaglandins are well - known inflammatory mediators in the brain , and their biosynthesis is enhanced following seizures .
such inflammatory mediators could be therapeutic targets for the development of new antiepileptic drugs . in this review ,
we discuss the roles of inflammatory mediators in epileptogenesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
recent advances in magnetic resonance imaging ( mri ) have facilitated follow - up of intervertebral disc herniation and prospect spontaneous regression1,8 ) . we present a case of spontaneous regression of cervical disc herniation who treated conservative management without any surgical treatment and review related literatures . a 39 year - old woman presented with severe neck pain associated with tingling sensation and numbness of right upper extremity that developed 3 months ago . the mri of the cervical spine was done , which showed a posterior disc extrusion at the c4-c5 level in the right paracentral location ( fig . conservative management was given in the form of non - steroidal - anti - inflammatory drugs and a muscle relaxant . after two years later , she re - visited our hospital because of developed neck pain recently . we performed follow - up cervical mri that revealed significant spontaneous regression of the c4-c5 intervertebral disc extrusion ( fig . the type of disc herniation is more contributable to spontaneous disc regression than the size of disc herniation6 ) . spontaneous regression of herniated disc was seen more frequently in extruded disc than protruded disc7 ) . in general , large - sized herniated disc have been observed to regress more than smaller one4,8 ) , and a sequestrated - type disc herniation is likely to regress more readily than a protruded disc8 ) . extrusion and sequestrated disc into the epidural space induces an inflammatory cascade involving neovascularization and phagocytosis that may lead to disc regression5,6,8 ) . burke et al.2 ) reported that the human disc tissue is capable of spontaneously producing the pro - inflammatory chemokines monocyte chemo - attractant such as protein-1 and interleukin-8 . the chemo - attractants are suspected of initiating an inflammatory recruitment of monocytes from the nearby blood supply . chemotactic for macrophages and capillaries may explain the ingrowth of granulation tissue seen in spontaneous disc herniation resorption . autio et al.1 ) reported that a gadolinium - diethylenetriamine pentaacetic acid ( gd - dtpa ) enhanced mri to evaluate the neovascularization zone and to predict the possibility of spontaneous regression of herniated disc . the extent of peripheral enhancement tends to be greater in sequestration type herniation when compared to bulging or protruding herniation4 ) . they suggested that neovascularization in the outermost areas of herniated disc , presenting as an enhancing rim in gd - dtpa mri , is thought to be a major determinant of spontaneous regression of herniated disc1 ) and thickness of rim enhancement was a stronger determinant of spontaneous regression than extent of rim enhancement also1 ) . kobayashi et al.6 ) reported a case of herniated cervical disc that showed partial spontaneous regression on follow - up mri after 3 weeks and complete spontaneous regression on follow - up mri after 12 months . they also reviewed previous reported 6 cases of spontaneous regression in herniated cervical disc . in their report however , some cervical disc herniation that are likely to regress spontaneously for very specific and predictable reasons . in some cases | spontaneous regression of cervical disc herniation is a rare , and such reports are few .
a 39 year - old woman complained of severe neck pain associated with tingling and numbness of right upper extremity .
the mri of the cervical spine revealed a posterior disc extrusion at the c4-c5 level in the right para - central location .
the patient was treated with conservative management without any surgical treatment .
the patient 's symptoms were significant improvement .
after two years later , we performed follow - up cervical mri that revealed significant spontaneous regression of the c4-c5 intervertebral disc extrusion . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
spinal - induced hypotension ( sih ) for cesarean delivery ( cd ) is a frequently encountered problem , with a reported incidence of approximately 80% . if hypotension is prolonged , impairment in placental blood flow and fetal acidosis may ensue . a common approach to prophylaxis includes a fluid bolus with prophylactic phenylephrine infusion ; although , no single approach has been embraced as the gold standard , each prophylactic treatment comes with accompanying risks . crystalloid preload alone has a poor efficacy in preventing hypotension , due to rapid redistribution into the extracellular space , while colloid has been more effective . although commonly used , synthetic colloids such as hydroxyethyl starch are more expensive than crystalloid ; side effects include pruritis , anaphylactoid reactions , association with kidney injury , and coagulopathy . however , it has been associated with a decreased incidence of hypotension and maternal nausea and vomiting and improved umbilical artery ph . a combination of crystalloid cohydration and phenylephrine infusion decreased the incidence of hypotension to 1.9% . concerns surrounding the use of phenylephrine include maternal bradycardia , a relatively low risk of dysrhythmia , and decreased cardiac output resulting in reduced placental perfusion . however , in ex vivo studies , phenylephrine has been shown to improve fetal arterial perfusion more reliably than ephedrine , which is known to cross the placenta , resulting in increased fetal heart rate ( hr ) , hr variability , and fetal acidosis . considering the encouraging reduction in the incidence of sih demonstrated with the use of a crystalloid load and phenylephrine infusion , as well as supporting literature that colloid is more effective than crystalloid preload in isolation , we rationalized that we might further reduce the incidence of sih by using a colloid load concomitantly with a phenylephrine infusion . in this prospective , randomized , comparative study , we studied two groups of patients receiving prophylactic phenylephrine infusions , combined with either a colloid or crystalloid preload . we hypothesized that patients receiving prophylaxis with a phenylephrine infusion and colloid preload would show a reduced incidence of hypotension ( defined as < 20% below baseline ) in comparison to patients receiving a phenylephrine infusion with crystalloid preload . we selected our secondary outcomes to reflect the clinical evidence of reduced cardiac output ; these included the total dose of phenylephrine , incidence of bradycardia , nausea , and vomiting , as well as apgar scores at 1 and 5 min . after approval by the institutional review board for our research and protocol , 82 pregnant patients scheduled for elective cd under spinal anesthesia were recruited by the investigators from august 2008 to june 2010 . inclusion criteria were : normal singleton pregnancy , beyond 36 weeks gestation , between 18 and 35 years of age , american society of anesthesiologist physical class i or ii status , weight between 50 and 120 kg , and height ranging from 150 - 180 cm . exclusion criteria were : contraindications to spinal anesthesia , complications of pregnancy , pregnancy - induced hypertension , preeclampsia , known uteroplacental insufficiency , multiple gestation , fetal abnormalities , congenital heart abnormalities , known genetic abnormalities , prematurity , or clinical evidence of fetal distress , signs of onset of labor , or history of adverse reactions to hydroxyethyl starch . after obtaining written informed consent , patients were randomized to be in the colloid or crystalloid infusion groups via computer - generated blocked randomization . the result of the randomization for each patient was sealed in sequentially numbered opaque envelopes and was opened by the primary anesthesia team prior to arrival in the operating room . due to the rare , but the potentially catastrophic incidence of anaphylaxis associated with hydroxyethyl starch products , no parties were blinded to the preload used . for all patients , an 18-gauge intravenous ( iv ) catheter was inserted into a forearm vein , and vein patency was maintained with lactated ringer 's solution ( lr ) at a rate of 5 ml / h before administering the preload . colloid preload was 500 ml hydroxyethyl starch in 0.9% normal saline ( ns ) ( mw 600 kda , molar substitution 0.75 , hespan , braun medical , irvine , ca , usa ) , and crystalloid preload was lr ( 1500 ml ) . the volume of crystalloid and colloid preload was chosen based on a 1:3 colloid to crystalloid ratio to achieve a similar degree of volume expansion . after the fluid load was complete , iv patency was maintained at a rate of 5 ml / h and medications were flushed with lr . all patients received 0.3 m sodium citrate ( 30 ml ) orally , 30 min before arrival to the operating room . standard monitoring for all patients consisted of noninvasive blood pressure ( nibp ) measurement , electrocardiography , and pulse oximetry . appropriately sized , reusable adult nibp cuffs ( solaris medical technologies , san francisco , ca , usa ) were applied by the primary anesthesia team . in the operating room , 3 automated measurements of nibp and hr were taken every minute until the systolic bp ( sbp ) measurements were consistent ( no more than 10% variation ) , with the patient lying supine with left lateral tilt . the average sbp and accompanying hr of these 3 measurements were recorded as mean baseline values . spinal anesthesia was performed in the sitting position with a 25-gauge pencil point needle at the l2-l3 or l3-l4 vertebral interspace . a mixture of hyperbaric bupivacaine 0.75% , 12 mg with morphine , 200 mcg was injected intrathecally . bp and hr were measured and recorded at 1-min intervals starting 1-min after intrathecal injection until uterine incision . all patients were placed on a phenylephrine infusion ( 10 mg phenylephrine in 100 ml 0.9% ns ) via an alaris iv infusion system ( pc unit , cardinal health , san diego , ca , usa ) immediately after intrathecal injection at a rate of 100 mcg / min . after uterine incision , further hemodynamic management was at the discretion of the attending anesthesiologist who administered iv fluids and vasopressors as appropriate to replace the surgical losses and maintain perfusion pressure . the infusion was stopped if the hr decreased below 60 beats per minute ( bpm ) , or if the sbp increased to > 20% above baseline ( defined as reactive hypertension ) , and was restarted when the bp decreased to < 20% below baseline ( defined as hypotension ) . the total dose of phenylephrine used during the study period was recorded . to treat hypotension despite concurrent phenylephrine infusion if bradycardia was encountered with sbp 100% baseline , the phenylephrine infusion was temporarily discontinued until the hr increased to > 60 bpm . if the hr was < 60 bpm with a sbp < 100% baseline , iv glycopyrrolate ( 0.2 - 0.6 mg ) was administered . if hypotension with bradycardia persisted , a bolus of 5 mg ephedrine was given , and the study was discontinued . bp and hr were measured and recorded at 1-min intervals starting 1-min after intrathecal injection until uterine incision , and instances of hyper / hypotension were noted . patients were asked if they were nauseated at multiple points ( in average every 5 min ) before and after spinal insertion , and their response was recorded as a yes or no . episodes of emesis were noted . any nausea and vomiting encountered during the course of the study in the setting of normal bp was treated with our institutional protocol for perioperative nausea and vomiting , including ondansetron ( 4 mg ) , and dexamethasone ( 4 mg ) . five minutes after intrathecal injection , sensory levels were checked for loss of temperature sensation with an ice cube . the following parameters were recorded : sensory levels , times of skin incision , uterine incision , delivery , placental delivery , and oxytocin administration . apgar scores were assessed at 1 and 5 min after delivery by the pediatric team and recorded . based on previous studies , we assumed an effective method would reduce the incidence of hypotension to 5% . we calculated that a sample size of 37 patients in each group would have an 80% of power , at 5% of significance level , to detect an incidence of hypotension of 5% or less in the colloid group . the data for the incidence of hypotension and occurrence of nausea and/or vomiting were compared using the chi - squared test or fisher 's exact test as appropriate . data for serial bp measurements and hr were analyzed using a one - way analysis of variance for repeated measures . the student 's t - test was used to compare the phenylephrine dose , whereas the mann - whitney rank sum test was used to compare apgar scores . inclusion criteria were : normal singleton pregnancy , beyond 36 weeks gestation , between 18 and 35 years of age , american society of anesthesiologist physical class i or ii status , weight between 50 and 120 kg , and height ranging from 150 - 180 cm . exclusion criteria were : contraindications to spinal anesthesia , complications of pregnancy , pregnancy - induced hypertension , preeclampsia , known uteroplacental insufficiency , multiple gestation , fetal abnormalities , congenital heart abnormalities , known genetic abnormalities , prematurity , or clinical evidence of fetal distress , signs of onset of labor , or history of adverse reactions to hydroxyethyl starch . after obtaining written informed consent , patients were randomized to be in the colloid or crystalloid infusion groups via computer - generated blocked randomization . the result of the randomization for each patient was sealed in sequentially numbered opaque envelopes and was opened by the primary anesthesia team prior to arrival in the operating room . due to the rare , but the potentially catastrophic incidence of anaphylaxis associated with hydroxyethyl starch products , no parties were blinded to the preload used . for all patients , an 18-gauge intravenous ( iv ) catheter was inserted into a forearm vein , and vein patency was maintained with lactated ringer 's solution ( lr ) at a rate of 5 ml / h before administering the preload . colloid preload was 500 ml hydroxyethyl starch in 0.9% normal saline ( ns ) ( mw 600 kda , molar substitution 0.75 , hespan , braun medical , irvine , ca , usa ) , and crystalloid preload was lr ( 1500 ml ) . the volume of crystalloid and colloid preload was chosen based on a 1:3 colloid to crystalloid ratio to achieve a similar degree of volume expansion . after the fluid load was complete , iv patency was maintained at a rate of 5 ml / h and medications were flushed with lr . all patients received 0.3 m sodium citrate ( 30 ml ) orally , 30 min before arrival to the operating room . standard monitoring for all patients consisted of noninvasive blood pressure ( nibp ) measurement , electrocardiography , and pulse oximetry . appropriately sized , reusable adult nibp cuffs ( solaris medical technologies , san francisco , ca , usa ) were applied by the primary anesthesia team . in the operating room , 3 automated measurements of nibp and hr were taken every minute until the systolic bp ( sbp ) measurements were consistent ( no more than 10% variation ) , with the patient lying supine with left lateral tilt . the average sbp and accompanying hr of these 3 measurements were recorded as mean baseline values . spinal anesthesia was performed in the sitting position with a 25-gauge pencil point needle at the l2-l3 or l3-l4 vertebral interspace . a mixture of hyperbaric bupivacaine 0.75% , 12 mg with morphine , 200 mcg was injected intrathecally . bp and hr were measured and recorded at 1-min intervals starting 1-min after intrathecal injection until uterine incision . all patients were placed on a phenylephrine infusion ( 10 mg phenylephrine in 100 ml 0.9% ns ) via an alaris iv infusion system ( pc unit , cardinal health , san diego , ca , usa ) immediately after intrathecal injection at a rate of 100 mcg / min . after uterine incision , further hemodynamic management was at the discretion of the attending anesthesiologist who administered iv fluids and vasopressors as appropriate to replace the surgical losses and maintain perfusion pressure . the infusion was stopped if the hr decreased below 60 beats per minute ( bpm ) , or if the sbp increased to > 20% above baseline ( defined as reactive hypertension ) , and was restarted when the bp decreased to < 20% below baseline ( defined as hypotension ) . the total dose of phenylephrine used during the study period was recorded . to treat hypotension despite concurrent phenylephrine infusion if bradycardia was encountered with sbp 100% baseline , the phenylephrine infusion was temporarily discontinued until the hr increased to > 60 bpm . if the hr was < 60 bpm with a sbp < 100% baseline , iv glycopyrrolate ( 0.2 - 0.6 mg ) was administered . if hypotension with bradycardia persisted , a bolus of 5 mg ephedrine was given , and the study was discontinued . bp and hr were measured and recorded at 1-min intervals starting 1-min after intrathecal injection until uterine incision , and instances of hyper / hypotension were noted . patients were asked if they were nauseated at multiple points ( in average every 5 min ) before and after spinal insertion , and their response was recorded as a yes or no . episodes of emesis were noted . preoperative risk factors for postoperative nausea and vomiting were not recorded . any nausea and vomiting encountered during the course of the study in the setting of normal bp was treated with our institutional protocol for perioperative nausea and vomiting , including ondansetron ( 4 mg ) , and dexamethasone ( 4 mg ) . five minutes after intrathecal injection , sensory levels were checked for loss of temperature sensation with an ice cube . the following parameters were recorded : sensory levels , times of skin incision , uterine incision , delivery , placental delivery , and oxytocin administration . apgar scores were assessed at 1 and 5 min after delivery by the pediatric team and recorded . based on previous studies , we assumed an effective method would reduce the incidence of hypotension to 5% . we calculated that a sample size of 37 patients in each group would have an 80% of power , at 5% of significance level , to detect an incidence of hypotension of 5% or less in the colloid group . the data for the incidence of hypotension and occurrence of nausea and/or vomiting were compared using the chi - squared test or fisher 's exact test as appropriate . data for serial bp measurements and hr were analyzed using a one - way analysis of variance for repeated measures . the student 's t - test was used to compare the phenylephrine dose , whereas the mann - whitney rank sum test was used to compare apgar scores . a p < 0.05 was considered as significant . eighty - two patients were enrolled in the study , 41 patients in each group . four patients in the crystalloid preload group were excluded because of the following reasons : one had excessively prolonged time to skin incision ( 20 min ) , two had high sensory levels ( above t3 ) , and one had hypotension and bradycardia refractory to treatment . four patients in the colloid preload group were excluded : one patient experienced significant hypertension prior to starting the phenylephrine infusion , which persisted after spinal placement : one patient had a sensory level to t3 , and two patients had inadequate spinal analgesia . patient demographic characteristics , hemodynamic data , and surgical data are presented in table 1 . although patients in the colloid group had a lower incidence of hypotension ( 10.8% ) when compared with the crystalloid group ( 27.0% ) the difference was not statistically significant ( p = 0.12 ) . there was no significant difference in sbp changes over time within each group and between the two groups at each time point . the incidence of bradycardia was not significantly different in the colloid group ( 45.8% ) versus the crystalloid group ( 35.1% ) ( p = 0.4 ) . a significant decrease in hr from the baseline values was observed in both groups ( p < 0.001 ) ; however , no difference was found between the two groups at individual time points . patient demographic data significantly less phenylephrine was used in the colloid group ( 1077 514 mcg ) compared to the crystalloid group ( 1477 591 mcg ) ( p = 0.003 ) [ table 2 ] . the incidence of maternal nausea and vomiting , as well as apgar scores at 1 and 5 min , were not significantly different within each group and between groups [ table 2 ] . the overall incidence of apgar scores below 7 was 2.7% in the crystalloid group and 8.1% in the colloid group respectively , but was not significantly different ( p = 0.358 ) . secondary outcome measures rescue medications were administered to a total of eight patients [ table 3 ] , resulting in improved hemodynamic stability . episodes of self - limited supraventricular tachycardia were documented in one patient in the crystalloid group and four patients in the colloid group . this study demonstrated that the use of a colloid preload required a lower dose of phenylephrine to maintain sbp within 5% of baseline , compared to the crystalloid group . this finding is consistent with previous studies suggesting a beneficial effect of colloids in maintaining sbp . further , while there was a lower incidence of hypotension with colloid preload ( 10.8% ) when compared with the crystalloid group ( 27.0% ) the difference was not statistically significant ( p = 0.12 ) . in addition , despite less need of phenylephrine in the colloid group , we did not observe a difference in the incidence of bradycardia ( < 60 bpm ) , or absolute decreases in hr over time between the two groups . we initiated our fluid bolus of either crystalloid or colloid 30 min prior to arrival in the operation room to ensure the entire bolus would be administered prior to the uterine incision , or the end of the study period . although crystalloid co - loading is reportedly better than preloading for preventing hypotension , the response to a crystalloid co - load is a variable , depending on the rate of infusion and the amount infused . a recent meta - analysis , including studies without vasopressors and various prophylactic regimens , demonstrated no benefit in using co - load in comparison to preload in preventing sih . recently , concerns have been raised about hydroxyethyl starch administration in critically ill patients , particularly those with significant kidney dysfunction . we chose a phenylephrine infusion at a rate of 100 mcg / min as it has been effectively shown to reduce the incidence of sih . the similar gradual decrease in hr in both groups , despite the different dose required , may be attributed to the effect of the spinal anesthetic as well as the phenylephrine infusion . of note , although reductions in cardiac output have been correlated with hr changes , bradycardia has not been shown to affect the neonatal outcome . we found a higher incidence of bradycardia with the use of high - dose phenylephrine infusion than reported in previous studies . this is likely due to our definition of bradycardia as a hr less than 60 bpm and not 50 bpm as reported in other investigations . since the time of the design of our study , lower phenylephrine dosing regimens ( 25 and 50 mcg / min ) have been described to decrease sih with similar fetal and maternal outcomes ; these regimens in combination with co - load are an area of future investigation . although shown to have a relatively low risk of ventricular dysrhythmias , phenylephrine administration has been associated with decreased cardiac output and dysrhythmias , including ventricular tachycardia , supraventricular tachycardia , coronary artery spasm , and myocardial infarction , although these side effects seem to be reduced when compared with ephedrine . in our study , four patients in the colloid group and one patient in the crystalloid group experienced episodes of supraventricular tachycardia whereas the phenylephrine infusion was running , prior to the uterine incision . although an interesting finding , our study was not powered to determine an incidence of supraventricular tachycardia or to detect a difference between the two groups with regards to the occurrence of arrhythmias . apgar scores were not significantly different at 1 and 5 min between the two groups , suggesting no difference in the neonatal outcome . no fetal arterial or venous blood gases were available to demonstrate the presence or absence of fetal acidosis . however , recent evidence indicates that 5-min apgar scores are a better predictor of neonatal outcome than the measurement of umbilical artery ph , even for newborns with severe acidemia . one of our study limitations was the measurement of cardiac output ; direct or indirect measurement is not common practice in healthy pregnant parturients presenting for cd . a number of recent publications have demonstrated a good correlation between invasive and nibp measurements in different clinical settings . ideally , a prospective trial would be double - blinded and randomized ; however , the small risk of anaphylaxis with hydroxyethyl starch had to be considered . if in this scenario the primary anesthesia team was blinded to the fluid being administered , a cause for an adverse reaction may not be immediately recognized and may delay treatment . a phenylephrine sparing effect associated with preloading colloids suggests a possible superiority of colloids against crystalloids in prevention and treatment of sih . | background and aims : patients undergoing elective cesarean delivery ( cd ) have a high - risk of spinal - induced hypotension ( sih ) .
we hypothesized that a colloid preload would further reduce sih when compared with a crystalloid preload.material and methods : eighty - two healthy parturients undergoing elective cd were included in the study .
patients were randomly assigned to two groups ( 41 patients in each group ) to receive either lactated ringer 's solution ( 1500 ml ) or hydroxyethyl starch ( 6% in normal saline , 500 ml ) 30 min prior to placement of spinal anesthesia .
all patients were treated with a phenylephrine infusion ( 100 mcg / min ) , titrated during the study.results:there was no statistical difference between groups with regards to the incidence of hypotension ( 10.8% in the colloid group vs. 27.0% in the crystalloid group , p = 0.12 ) .
there was also no difference between groups with respect to bradycardia , apgar scores , and nausea and vomiting .
significantly less phenylephrine ( 1077.5 514 mcg ) was used in the colloid group than the crystalloid group ( 1477 591 mcg , p = 0.003).conclusion : the preload with 6% of hydroxyethyl starch before cd might be beneficial for the prevention of sih . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the scopolamine model has its roots in the cholinergic hypothesis of aging and ad , and has played a major role in its construction , which we will recall briefly here . from the beginning of the 20th century until the midfifties , scopolamine was used in obstetrics to induce a twilight state and amnesia during childbirth . in the sixties and seventies , it became obvious that regions rich in cholinergic affrents , such as the hippocampus , were involved in memory processes ( see reference 4 for a review ) . in 1965 , drachman and leavitt administered scopolamine to healthy young volunteers , who then displayed a memory profile very close to that observed in elderly people . two to three years later , three independent research teams reported a decreased activity of choline acetyltransferase ( cat ) , the enzyme responsible for acetylcholine ( ach ) synthesis , in the cortex of ad patients . it was soon found that neuronal loss occurs in the forebrain basal nucleus of meynert and medial septal nucleus , which are the source of neocortical and hippocampal cholinergic afferent fibers , respectively . in its early version , the cholinergic hypothesis stated nothing about etiological factors , did not address the additional roles that ach dysfunction may play in other neurobehavioral disturbances of aging and dementia , and did not imply any exclusive or solitary involvement of the cholinergic system in age - related memory loss . model , in which an unknown pathophysiological process induces deficiency in various neurotransmission pathways thought to be responsible for the cognitive and behavioral aspects of aging and dementia . despite obvious shortcomings ( see references 17 - 20 for review and discussion ) , the cholinergic hypothesis legitimized the development of the cholinergic drugs we prescribe today and the administration of scopolamine as a model of investigation for ad research . the scopolamine model was used in cognitive research to study the clinical correlates of ach deficiency ( see reference 21 for a review ) . it was applied to elderly subjects and ad patients as a marker of cholinergic sensitivity , with the purpose of improving the diagnosis and staging of the disease . it failed , however , to predict cognitive decline on the basis of the subjects ' sensitivity . animal studies assessing the reversal of scopolamineinduced memory impairment by various compounds are too numerous to be cited exhaustively . this approach has also been used in humans with the following molecules : physostigmine , velnacrine , choline , ro 15 - 1788 , moclobemide , ru 41656 , l--glycerylphosphoryleholine , oxiracetam , aniracetam and piracetam , tenilsetam , bmy 21502 , d - cycloserine , sdz ens-163 , and zk-93426 . however , the scopolamine model has not become a standard tool in the early assessment of drugs . one reason for this is that the cognitive changes induced by scopolamine do not really mimic the ad picture . the details of the differences listed in figure 1 ( based on references 28 , 40 , and 53 - 63 ) are open to discussion , but there is a general agreement on the fact that , as wesnes wrote , all the scopolamine - induced deficiencies are also observed in ad , while the reverse is not always true . the electrophysiological effects of scopolamine ( reviewed in reference 64 ) are close on eeg and similar on visual evoked potentials to those of ad . in pet and single photon emission computed tomography ( spect ) studies , scopolamine induces cerebral blood flow ( cbf ) and glucose metabolism changes , which are sometimes divergent and region - specific , but in all cases different from the pattern observed in ad . ketamine is a noncompetitive n - methyl - d - aspartate ( nmda ) receptor antagonist . its administration in order to produce a model is the correlate of the glutamatergic hypothesis of ad ( reviewed in reference 72 ) . neuronal and astroglial glutamate transporter dysfunction in ad could result in excess glutamate in the synaptic cleft and in excitotoxic neuronal damage . this hypothesis is consistent with the beneficial effects of memantine and lamotrigine in ad patients . some findings provide a link with the histopathological lesions that are the hallmarks of ad . kainic acid injection in the rat leads to decreased neuronal amyloid precursor protein ( app ) 695 mrna owing to neuronal death , and increased astrocytic app 770 mrna , which has been found selectively increased in ad in comparison with other neurodegenerative disorders and associated with plaques . furthermore , in neuronal culture , glutamate was shown to enhance tau gene expression and induce paired helical filaments similar to those found in ad . the hypoglutamatergic hypothesis has been extensively reviewed elsewhere ( see newcomer et al , in this issue ) . ketamine is mainly used in the field of schizophrenia research to provoke psychotomimetic as well as cognitive effects . these studies did not all assess the same functions or use the same paradigm to assess a particular function . despite this limitation , when these studies are summarized and the profile of ketamine effects compared with that of ad ( figure1 ) , the situation is the same as that for the scopolamine model : the functions affected by ketamine are affected in ad , but the reverse is not necessarily the case . the two main models proposed thus lead to some of the attentional and memory impairment observed in ad , but do not fully reproduce the ad pattern . since multiple neurotransmitter systems are affected in ad , it has been suggested that combination modeling through simultaneous administration of drugs that impair several neurotransmitters or different aspects of a single system could mimic the ad pattern more closely . the fewpublished studies on this strategy add mecamylamine ,
m - chlorophenylpiperazine ( mcpp ) , metergoline , or haloperidol to scopolamine , and report no or marginal cumulative effect . although nmda antagonists were shown to potentiate the amnesic effect of scopolamine in the rat , no study on this combination in humans has been published to date . beyond the weakness of their effects , combined models are so complex that they become difficult to understand - and particularly difficult to manipulate - in the assessment of cognitive enhancers . another method is to take advantage of the recent advances in our understanding of ad . currently available data support the view that neuronal and synaptic loss , rather than secondary neurotransmission disruption , is most likely responsible for cognitive changes in ad . the cholinergic hypothesis in its current version ( figure 2 ) focuses on the reciprocal modulatory influences of cholinergic transmission and app processing ( reviewed in references 100 and 101 ) . -amyloid ( a ) is known to be neurotoxic at high ( micromolar ) concentrations . in vitro , soluble a at picomolar to nanomolar levels is not toxic but does inhibit synthesis and stimulated release of ach . a appears to exert its effect on ach synthesis and release through depletion of ach precursors . it has been shown to disrupt the activity of pyruvate dehydrogenase , which generates acetyl coenzyme a ( coa ) from pyruvate and was found to be decreased in the cortex of ad patients , and to inhibit highaffinity choline uptake . this could have an indirect neurotoxic effect , since cholinergic neurons deprived of choline have been shown to break down phosphatidylcholine from intracellular organelle membranes to provide additional choline . although there is no general consensus ( see reference 109 for review ) , it is thought that postsynaptic muscarinic mi acetylcholine receptor ( achr ) density is unchanged in ad , while those of presynaptic m2 and nicotinic achrs are reduced . it has been shown that activation of protein kinase c through mj ( and m3 ) achrs lowers a production by favoring the nonamyloidogenic processing of app despite their unchanged density , m1 receptors could be dysfunctional because of defective coupling to gq/11 proteins . this could lead to increased a production , which would further impair m1 achr signal transduction . m1 achr - g protein uncoupling could also favor protein tau phosphorylation and thus paired helical filament formation through disinhibition of mitogen - activated protein ( map ) kinases and decreased efficiency of taudephosphorylation .
despite the uncertainties that remain , it is clear that the cholinergic deficiency can no longer be seen as a late consequence of neuropathological changes , but at least as a contributor to the cascade of events leading to fullblown dementia . its current version ( see newcomer et al , in this issue ) reconciles the former hyper- and hypoglutamatergic hypotheses by proposing a two - stage process . in the first stage , a increases the sensitivity of nmda receptors to normal concentrations of glutamate , leading to destruction of nmda - bearing gabaergic ( gaba : gamma - aminobutyric acid ) , noradrenergic ( ne ) , and serotonergic ( 5-ht ) neurons , which have an inhibitory action on basal forebrain cholinergic , anterior thalamic glutamatergic , and cortical neuropeptide y ( npy ) neurons either directly ( gaba , ne ) or through activation of gaba neurons ( 5-ht ) . this loss of inhibition leads to hyperstimulation of cortical and corticolimbic neurons , which then degenerate , as do the hyperactive cholinergic , glutamatergic , and npy neurons . this suggests that for both cholinergic and glutamatergic neurons , the hypoactive , symptomatic stage is preceded by a hyperactive one . these new versions of the cholinergic and glutamatergic hypotheses make it necessary for us to reappraise our models . the goal of an acute pharmacological model is to transiently reproduce the hypoactive , symptomatic stage . according to the scheme proposed by newcomer et al elsewhere in this issue , nmda blockers induce transient hyperactivity of basal forebrain cholinergic , anterior thalamic glutamatergic , and cortical npy neurons . it is likely that the mechanism by which acute administration of nmda blockers produces memory impairment is different and does not involve the two - stage sequence proposed as a chronic model . the finding that pretreatment with haloperidol reduces ketamineinduced impairment in executive cognitive functions nonetheless suggests that the cognitive effect of nmda blockade is indirect and nonselective . higher selectivity , which would also avoid psychotomimetic symptomatology , might be achieved by acting downstream of the nmda receptor . for the particular posterior cingulate and retrosplenial region , the best choice would be to give m3 and/or kainate receptor blockers . another target of choice is the hippocampus , in which the most common muscarinic receptor is the mi subtype ; the m2 subtype represents 15% and the m3 subtype globally less than 12% . moreover , specific blockade of the m1 receptors would best reproduce their status in ad , where they are hypostimulatcd ( because of presynaptic neuronal loss ) and dysfunctional . the only molecule which is more or less selective for it is said to cross the blood - brain barrier poorly , but very few studies have assessed its central effects in man and we think it deserves further study . the way the cognitive symptoms are produced in ad is complex and many therapeutic strategies already in development address a metabolism and toxicity , rather than cholinergic deficiency . however , d - cycloserine , which does not act on the cholinergic system but modulates the nmda receptor , has been shown to attenuate the effect of scopolamine on memory . moclobemide , a selective monoamine oxidase a ( maoa ) inhibitor , and thyrotropin - releasing hormonc ( trh ) were also able to partly reverse the scopolamine - induced deficits . in the animal , the same has been observed with estrogens and gm1 gangliosides . given these data and the current view that we have on the involvement of the cholinergic deficiency , it is very possible that new compounds , which do not act directly on the cholinergic system , could be effective on cholinergic models . neurotransmitter - based models still have a place in our armamentarium , although efforts should be made to develop other approaches . whatever the model chosen , we must admit that it is e impossible to reproduce the full ad cognitive pattern . instead , we can try to produce some aspects of memory it impairment , which is considered as the core symptom of:- the disease . the method used should be as simple and selective as possible in order to allow its manipulation . selective ligands are currently in development ; accelerating the toxicological studies of these compounds could allow us to work this way in the near future . | wider use of pharmacological models would facilitate the development of new drugs for alzheimer 's disease ( ad ) , the two main models currently used are based on the cholinergic and glutamatergic hypotheses of ad , although they lead to some of the attention and memory impairment observed in ad , they do not fully reproduce the ad pattern . the few studies that used a combination modeling approach , ie , the simultaneous administration of several drugs with the aim of impairing several neurotransmitters or different aspects of a single system , have reported no or marginal cumulative effect . on the basis of current understanding of glutamate and acetylcholine involvement in ad pathophysiology , we suggest that models using selective muscarinic-1 ( m1 ) receptor blockers would better mimic the status of the cholinergic system in ad , this kind of model might be suitable for the assessment of drugs that do not act directly on the cholinergic system . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hirsuitism is a common problem of women in reproductive age effecting 5 - 7% of the female population and is most commonly due to underlying metabolic and endocrine abnormalities as a part of polycystic ovarian syndrome ( pcos ) . however in rare cases , it may be the initial presentation of a more serious and life threatening disorder like adrenal or ovarian tumours , cushing 's syndrome , or acromegaly . acromegaly is a rare disorder ( prevalence 30 - 80 cases per million population ) and is associated with 3 fold increased in mortality as compared to the general population mainly due to increased cardiovascular morbidity and cancer . diagnosis of acromegaly in advanced stage is easy once the patient has developed disfiguring skeletal and acral changes . however diagnosis is usually delayed by a mean of 9 years as early diagnosis remains a challenge when the patient may have only subtle features of insulin resistance and pcos in women . a 28 year lady presented to the endocrinology clinic with complaints of increased facial hair , body hair and acne of 3 years duration with unsatisfactory treatment outcomes in spite of multiple sittings of hair removal by electrolysis . she complained of weight gain and increased sweating for last 1 year and 6 months respectively . examination was significant for normal blood pressure , obesity ( body mass index-30.3 kg / m ) , acne , hirsuitism ( modified ferriman gallwey score-24/36 ) , neck and axillary acanthosis , bulbous lips and woody nose [ figure 1 ] . she did not have deepening of voice , macroglossia , skin tags , acral enlargement , increased muscle mass , galactorrhea , breast atrophy or clitoromegaly . investigations were significant for elevated igf-1 ( 1344 ng / ml ; normal : 116 - 384 ng / ml ) , basal ( 45.1 ng / ml ) and post glucose growth hormone ( 39.94 ng / ml ) , elevated androgens and diabetes , which have been elaborated in table 1 . ultrasonography abdomen revealed enlarged bilateral ovaries , presence of multiple follicles and a dominant follicle in the left ovary . mri brain revealed a sellar mass with significant suprasellar extension suggestive of pituitary macroadenoma [ figures 2a and b ] . facial profile of patient showing woody nose , bulbous lips , severe acanthosis and increased terminal hair on the anterior chest wall hormonal and biochemical parameters at the time of diagnosis ( a ) coronal section of t1w mri brain showing pituitary macroadenoma with suprasellar extension ( b ) sagittal section of t1w mri brain showing pituitary macroadenoma . posterior pituitary not visualized metformin was started at 1 gm / day after dinner with glipizide 5 mg in the morning before breakfast leading to normalization of blood glucose . hirsuitism defined as excess body hair in the androgen - sensitive regions of the body of a woman is most commonly due to polycystic ovarian syndrome ( pcos ) and is the result of either the underlying hyperandrogenemia or the increased sensitivity of the pilosebaceous unit to androgens . hirsuitism though not uncommon in acromegaly is almost never the predominant presenting feature . in a series of patients with acromegaly pcos was diagnosed in our patient in view of clinical [ figure 1 ] and biochemical evidence of hyperandrogenism [ table 1 ] , with radiologic evidence of polycystic ovaries even in the presence of regular cycles ( rotterdam criteria ) . she had elevated serum testosterone , very high serum androstenedione with normal dheas [ table 1 ] , confirming that ovary was the source of this androgen excess . she had significant insulin resistance ( homa2ir-2.2 ; table 1 ) and was newly diagnosed to be diabetic . acromegaly was diagnosed in our patient in view of biochemical evidence of increased growth hormone , igf-1 and pituitary macroadenoma . she did not have the classical features of acromegaly except for the woody nose , bulbous lips and history of increased sweating . it is also well known that severe insulin resistance per se may be associated with acromegaloid phenotype . gh decreases sex hormone binding globulin ( shbg ) levels , which leads to increased free testosterone levels in patients of acromegaly with normal testosterone levels . gh directly , indirectly through increased igf-1 , insulin resistance and hyperinsulinemia is believed to increase ovarian androgen production which may have a role in the development of hirsuitism . the idea of presenting this case is to highlight the observation that hirsuitism may rarely be the only prominent feature of acromegaly and this hirsuitism should not be taken lightly as a part of metabolic syndrome in pcos . a high risk of suspicion may be judicious to prevent missing a diagnosis of acromegaly which can be of grave consequence for a patient . a lookout for subtle features of acromegaly in all patients with hirsuitism and going for biochemical evaluation may help us in picking up more patients of acromegaly at an earlier stage of the disease . this approach runs the risk of testing many individuals with severe insulin resistance and acromegaloidism . however , this limitation should be weighed against the benefit of picking up a patient of acromegaly early in the disease state thus reducing morbidity . to summarize , acromegaly due to pituitary macroadenoma with diabetes and pcos was diagnosed in a lady who had presented with long standing hirsuitism . | hirsuitism though not uncommon ( 24% ) , is not considered to be a prominent feature of acromegaly because of its lack of specificity and occurrence .
hirsuitism is very common in women of reproductive age ( 5 - 7% ) and has been classically associated with polycystic ovarian syndrome ( pcos ) .
twenty - eight year lady with 3 year duration of hirsuitism ( modified ferriman gallwey score-24/36 ) , features of insulin resistance ( acanthosis ) , subtle features of acromegaloidism ( woody nose and bulbous lips ) was diagnosed to have acromegaly in view of elevated igf-1 ( 1344 ng / ml ; normal : 116 - 358 ng / ml ) , basal ( 45.1 ng / ml ) and post glucose growth hormone ( 39.94 ng / ml ) and mri brain showing pituitary macroadenoma . very high serum androstenedione ( > 10 ng / ml ; normal 0.5 - 3.5 ng / ml ) , elevated testosterone ( 0.91 ng / ml , normal < 0.8 ) and normal dehydroepiandrosterone sulphate ( dheas ) ( 284 mcg / dl , normal 35 - 430 mcg / dl ) along with polycystic ovaries on ultrasonography lead to diagnosis of associated pcos .
she was also diagnosed to have diabetes .
this case presentation intends to highlight that hirsuitism may rarely be the only prominent feature of acromegaly . a lookout for subtle features of acromegaly in all patients with hirsuitism and going for biochemical evaluation ( even at the risk of investigating many patients of insulin resistance and acromegloidism )
may help us pick up more patients of acromegaly at an earlier stage thus help in reducing disease morbidity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the sad fact is that road traffic accidents constitute the number one killer in libya.1 not a day goes by in libya without the deaths of families , young men , women and children in horrific car accidents.1 it is estimated that more than one million people lose their lives as a result of road accidents.2 a number of factors , including human error , the vehicle , safety measures , environment and place of accident influence the seriousness of the accident . the department of transport and license in benghazi determines the relationship between safety and liability in accidents.3 this had promoted the understanding of the elements of the environment and ideas of safety that greatly influence the driver 's attitude . there will therefore , be practical recommendations , and an enforcement of the road and traffic regulations to reduce the number of road traffic accidents.4 male drivers are responsible for highest number of fatalities in major accidents in the world.5 the purpose of the study was to identify all major factors , responsible for road accidents in benghazi . the department of transport and license in benghazi collects data on the incidence of road traffic accidents . it identifies , any relationship between the development of the culture of safety and the likelihood of accidents . the result is an understanding of the elements of the environment and the culture of safety that tend to have greatest influence on the driver 's attitude . consequently , practical recommendations will emanate on how the ideas of safety and road traffic rules can reduce the road traffic accidents . data was collected from traffic and license department and analyzed statistically according to different parameters such as age , sex , time , environmental factors , type of roads , vehicles running out of control , non - adherence to traffic rules , drunk driving , lack of concentration while driving , change of lanes , etc . a total of 1265 accidents occurred during the years 2006 - 2007 within benghazi city limits , 11.14% were fatal , 67.35% caused severe injuries and 21.51% escaped with minor injuries . this is followed by 13.47% who died on the fly - over , and 2.12% on minor roads connected to main roads within the city . the mean and its standard deviation of accidents were 16.66 25.67 and variance of fatality was 1.54 . fatalities in road traffic accidents according to zones table 2 shows accidents resulting in severe injuries . the major accidents occurred within city limits ( 87.67% ) followed by 5.98% on the coastal highway and least number of accidents was 2.11% on minor roads linking main road . the mean of the severely injured persons in total number of accidents is 16.66 31.82 . severe injuries in road traffic accidents by zones table 3 shows accidents and deaths that occurred within 24 hours : 39.23% occurred between 13:00 - 18:00 hours , followed by 33.84 % from 18:00 to 24:00 hours and the lowest number of accidents 5.38% 0 - 6 hours with a mean of 24.99 13.01 and a variance of 0.52 . road traffic accidents according to time interval and death rate table 4 shows hit and run victims ( both sexes ) . males were 85.93% of the total hit and run victims , while female were 14.06% . one - hundred - thirty people lost their lives between 2006 and 2007 , while 850 people were severely injured ( table 1 and 2 ) . the accidents and deaths were not due to a single cause , but were the result of combination of failures , including driver error , problems with the vehicle , surface of the road and lay - out , weather conditions and the time of day.78 more road accidents occurred here late at night than occurred in developed countries.9 the results , ( table 3 ) , revealed that 33.84% of the accidents occurring between 2006 and 2007 , may have been due to environmental factors such as fog or winter rains . in addition , unlit streets , lack of concentration by drivers , aggression , faulty car tyres , failure of the brake system and vehicle lights and age of the vehicle were contributing factors . collision occurred as a result of obstruction of the roads by broken down vehicles and reduced visibility resulting from bad car lights , which is a typical feature of accidents in benghazi . the study confirmed that reduced visibility as a result of ghibli ( sirocco ) , winter rains also led to accidents.1011 one of the causes of accidents in benghazi city is suburban expansion of benghazi city in the last few years . this has led to a phenomenal increase in the use of motor vehicles . road accidents are inevitable consequences of the increased distances traveled since the tendency is to drive at high speeds to reach destinations more quickly . conflicting desires of drivers and their lack of courtesy , multiple access points and exits on both sides of the road , advertisements that distract drivers attention , signs , visibility , and parked cars may be some of the causes of collisions . it is evident from the results that the highest number of fatalities was recorded near the city ( 73.04% ) compared to 0% on the city 's main roads and rough roads . the accidents and high velocity impact collisions on the highway and main road were due to high speeds and the sudden change of lanes by drivers without due care or regard for other drivers or oncoming vehicles.10 accidents involving pedestrians increase with urbanization . this increased risk - involving pedestrians as a result of the lack of crosswalks and sidewalks and inadequate lighting on small roads . together with other factors such as alcohol abuse and pedestrian carelessness , the number of accidents increase . it is also possible that a large number of these accidents have been noted as having been caused by the distraction of the driver or other observational failures . studies910 have shown that most accidents occur in the early hours of the morning whereas , the study in benghazi showed that most accidents occurred between 13:00 and 24:00 hours . it is concluded from the studies that major road traffic accidents occur as a result of environmental factors and stress . in addition , fatalities and the seriousness of the accidents depend on number of factors such as the age of the vehicle , safety measures , human error and time and place of accident . | objectives : the aim of the study was to evaluate the factors responsible for road traffic accidents in benghazi.material and methods : retrospective and descriptive studies were done in the years 2006 - 2007 .
the data was collected from traffic and license department , benghazi .
the data were analyzed , based on fatalities , the severely handicapped , hit and run victims and were correlated with age , sex , time , environmental factors , type of roads , etc.results:one-thousand-two-hundred-sixty-five accidents occurred between the years 2006 - 2007 within the benghazi city limits ; 11.14% of the injuries were fatal ; 67.35% of the victims had severe injuries and 21.51% escaped with minor injuries .
table 1 shows that 73.04% lost their lives within the city limits , 13.47% on the fly - over , and 2.12% on minor roads connected to main roads within the city limits .
the mean of the accidents and its standard deviation were 16.66 25.67 with a variance of fatality of 1.54.conclusion:it is concluded from the studies that major road traffic accidents occur because of environmental stress factors . in addition ,
fatalities and the seriousness of the accidents depend on a number of factors such as the age of the vehicle , safety measures , human error and time and place of accident . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the early postinfarction period , the treatment of electrical storm ( es ) can be challenging . the potential mechanism is usually macroreentry , and the ablation of an extensive area is usually necessary for success . however , macroreentry may be excluded simply by a detailed evaluation of the clinical and electrophysiological findings , and thus a permanent cure may be achieved by focal ablation . es associated with ischemic cardiomyopathy ( icmp ) is a rare clinical condition that is characterized by recurrent and intractable ventricular tachycardia ( vt ) and high mortality rates.1 treatment options are antiarrhythmic drugs , antitachycardia pacing ( atp ) , electrical cardioversion , and , in refractory cases , deep sedation by general anaesthesia.2 the occurrence of es during the late postinfarction period in patients with icmp is usually scar - related , and macroreentry is usually the underlying mechanism . ablation targets were determined by pace mapping during the sinus rhythm and by entrainment mapping during the sustained vt.3 fractionated and isolated potentials and scars connected to adjacent nonconductive structures ( mitral valve annulus ) are additional ablation targets . on the other hand , focal vt related to icmp is an uncommon arrhythmia , and the underlying mechanism has not been fully elucidated . possible mechanisms include triggered activity , microreentry , abnormal automaticity , and transmural ( epicardial endocardial ) re - entry . we report here the first icmp case of es for which focal application of radiofrequency catheter ablation ( rfca ) was used as a primary approach to successfully terminate the tachycardia . a 48 year - old male was referred to our clinic for refractory vt presenting as es . the tachycardia was nonresponsive to administration of multiple intravenous antiarrhythmic drugs ( 1050 mg amiodarone , 150 mg lidocaine , 15 mg metoprolol succinate , and 2 g magnesium ) and atp . repeated defibrillations with 200j , 200j , and 360j were performed , respectively , and vt continued . in his medical history , he had undergone successful primary percutaneous coronary intervention for acute anterior myocardial infarction 10 days before this incident . he was admitted to the same center with sustained vt 3 days later , and control coronary angiography had revealed thrombolysis in myocardial infarction 3 coronary flow in all coronary arteries . his present admission electrocardiogram ( ecg ) was consistent with vt ; the ecg showed a right bundle branch block morphology , south - west axis , and monophasic r wave in the augmented vector right ( avr , figure 1 ) . no metabolic , acid - based , or electrolyte abnormalities were detected by serum biochemical parameters . hemodynamically significant stenosis was not detected ( figure 2 ) , and acute ischemia was excluded as a cause of vt . the ecg findings were consistent with vt originating from the left ventricle ( lv ) . a 4 mm quadripolar diagnostic catheter was applied to right atrium / right ventricle through the right femoral vein . a 3.5 mm open irrigated tip ablation catheter ( thermocool ; biosense - webster , inc . , diamond bar , ca , usa ) was used for the mapping and the ablation of the lv by using a retrograde aortic approach . electrophysiology study revealed atrioventricular dissociation and confirmed that the vt originated from the lv ( figure 3 ) . a 9f ensite array noncontact mapping catheter ( st jude medical , st paul , mn , usa ) was positioned in the lv . then , the activation mapping of the lv was performed by using the ablation catheter . the earliest local ventricular point was localized to the lateral wall of the lv apex ( figure 4a ) . activation mapping revealed a consistent and centrifugal pattern of activation during the tachycardia ( movie 1 ) . also , there was an absence of substantial conduction delay in the vicinity of the focus of earliest activity and hence made macroreentry unlikely . so , increased automaticity , microreentry , and triggered activity were considered as three potential causative mechanism of focal - originating vt . under these circumstances , microreentry could not be entirely excluded , although we have speculated that mechanisms such as triggering or automaticity might be more likely because the tachycardia had not been responsive to overdrive pacing and degenerated to ventricular fibrillation after atp . in fact , it is well known that entrainment occurs because of a specific response of tachycardia to overdrive pacing , and entrainment of a tachycardia can be a useful method to identify re - entry as a mechanism . because the tachycardia was considered as a focal - originating vt , we chose to perform focal ablation of the earliest site without scar mapping to shorten the procedure . the earliest site was ablated with 35 w , 40 degrees , and vt was terminated after exactly 30 seconds of radiofrequency application ( figure 4b ) . clinical tachycardia was not induced either by the programmed stimuli or an isoproterenol infusion of up to 20 g / min after the procedure . the total duration of the procedure was 35 minutes , and total fluoroscopy time was only 9 minutes . two days later , a single - chamber defibrillator ( icd ) was implanted , and the patient was discharged with beta blocker treatment . es occurring after 24 hours but within 4 weeks of acute myocardial infarction is clinically rare , and the mortality rate with antiarrhythmic drugs is over 50%.1 high mortality rates are related with direct cell injury by frequent delivery of intracardiac defibrillator shocks or with renal and hepatic function impairments caused by low cardiac output for a long period of time.4 there are a lot of studies about rfca for vt in the late postinfarction period . however , for the early postinfarction period , the underlying mechanism of tachycardia and the safety and efficacy of rfca are still not well known . contrary to our case , es occurring in the early postinfarction period is often attributed to acute ischemia or electrolyte abnormalities . a macroreentrant mechanism is the most common arrhythmia mechanism in a postinfarct substrate ; it is particularly difficult to exclude the possibility of triggering or automaticity in our case . to exclude macroreentry from the other potential mechanisms , firstly , noncontact mapping based on virtual unipolar electrograms has limitations in identifying an activation wavefront within the scar because of intrinsically low dv / dt in these regions . secondly , the absence of response to overdrive pacing usually suggests that macroreentry is not likely to be the underlying mechanism , but this factor does not exclude macroreentry entirely , although a consistent response to entrainment may confirm re - entry . the ability to terminate sustained vt by overdrive pacing is influenced by the refractoriness at the stimulation site , the conduction time from the stimulation site to the tachycardia origin , the tachycardia cycle length , and the duration of the excitable gap.5 lastly , a transmural ( epicardial endocardial ) re - entry may exhibit a focal endocardial exit point with centrifugal activation and a lack of classical early - meets - late - activation wavefronts ; when this happens , often a focal mechanism is simulated as a result . radiofrequency ablation of postinfarction vt is often complex because of the necessity for repeated induction attempts and prolonged mapping of sustained vt . the morphology of the vt may help to localize the exit site of the re - entrant circuit from the protected isthmus . the morphology of right bundle branch block in lead v1 identifies a lv exit site , whereas a left bundle branch block morphology suggests a vt exit in the right ventricle or , more commonly , the lv septum . more specific localization can be achieved by using the avr and the augmented vector left ( avl ) leads to distinguish septal from lateral exit , by using leads ii and iii and the augmented vector foot ( avf ) lead to distinguish superior from inferior exit , and by using the precordial leads to identify an apical / mid / basal exit . postinfarction vt is caused by re - entry through diseased myocardium due to prior myocardial infarction . these scar areas consist of fibrotic , unexcitable tissue interspersed with areas of surviving myocytes and areas of functional block that lead to slow conduction and unidirectional block critical to initiating and maintaining re - entry . if vt is sustained , the recording of the earliest activation site can be achieved by using an electroanatomical mapping system showing an activation map . the response to pacing helps to identify the site of the re - entrant circuit as entrance , isthmus , exit , inner loop , outer loop , adjacent bystander , or remote bystander components . after entrainment mapping , rfca of the critical isthmus site is the first ablation target . however , the procedures that were previously described are rather complex , and the procedure time may be as long as 5 hours.6 when we evaluated both the clinical and electrophysiological findings on our patient , the tachycardia was considered to be of focal origin . carbucicchio et al7 prospectively evaluated 95 patients who underwent rfca for es ; 76% of these patients had coronary artery disease . at the end of the 22 month follow - up , in addition , it has been shown that delivery of shocks is associated with impaired quality of life and increased mortality.8 currently , however , the implantation of the icd is the only treatment method that has been shown to reduce the mortality in the patients with icmp who present with vt.9 so , the successful ablation of clinical vt should not be thought of as the clinical end point . we conclude that if macroreentry can be excluded as a mechanism of the tachycardia on the basis of clinical and electrophysiological findings , the ablation of a restricted area is a safe and effective treatment option in an experienced referral center . | electrical storm ( es ) is associated with a poor prognosis if it occurs in the early postinfarction period ( within 4 weeks ) .
there are limited data on the efficacy and safety of catheter ablation in the early period . in the patients with postinfarction cardiomyopathy , ventricular tachycardia ( vt ) is usually caused by re - entry through slowly conducting tissue within areas of a myocardial scar , whereas for the early postinfarction period , the underlying mechanism of es is not fully understood .
we report a case of es for which macroreentry was excluded as a mechanism of vt because of the clinical and electrophysiological properties of the tachycardia . the tachycardia was terminated by focal radiofrequency catheter ablation of the earliest site .
the total procedure time was only 35 minutes . during a 12-month follow - up period ,
the patient has remained free of monomorphic vt episodes . on the basis of this case
, we aimed to discuss the underlying mechanism of es in the early postinfarction period and to evaluate the role of radiofrequency catheter ablation as a primary approach for treating es . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
phototherapy , especially psoralen and ultraviolet , is the first - line treatment used widely for the treatment of rare hypopigmented variant of mycosis fungoides . hypopigmented mycosis fungoides ( hmf ) is an atypical and uncommon variant of mycosis fungoides ( mf ) . psoralen and ultraviolet ( puva ) is the most widely used method for its treatment and is recommended as the first - line therapeutic modality . narrow - band ultraviolet b ( nbuvb ) may be tried with same level of evidence and grade of recommendation as puva , thereby providing an alternative , relatively safe , and effective treatment option . a 30-year - old woman presented to the dermatology outpatient with complaint of asymptomatic hypopigmented lesions all over the body . initially , 23 lesions appeared over trunk 5 years back that gradually progressed to involve almost whole of the body sparing face and flexures . she did not have any systemic complaints or weight loss . her general physical examination including lymph node examination was within normal limits . cutaneous examination revealed generalized , multiple well- to ill - defined hypopigmented , nonscaly macules without overlying atrophy or telangiectasia [ figure 1 ] , sparing face and flexures . skin biopsy revealed slightly thinned out epidermis with single cell infiltration in the basal layer . the lymphoid cells appear enlarged and surrounded by clear halo with increased fibrosis in papillary dermis [ figure 2 ] . at higher magnification , infiltrating atypical hyperchromatic lymphoid cells were seen in the epidermis [ figure 2 ] . immunohistochemistry revealed numerous t - cells arranged in bead - like fashion in the basal layer of epidermis , with focal clustering with anti - cd3 - 3,3'-diaminobenzidine chromogen [ figure 3 ] . her routine hematological and biochemical investigations , radiograph of the chest , and usg of the abdomen revealed no abnormality . she was counseled and started on nbuvb phototherapy , starting with 200 mj / cm that was increased slowly to maximum 2100 mj / cm over 3 months . nbuvb sessions were scheduled initially thrice a week for 3 months ( 50 sessions ) , followed by twice weekly for next 3 months . after 66 nbuvb sessions , the patient showed complete clearance of lesions [ figure 4 ] . posttreatment biopsy showed unremarkable epidermis with lack of any atypical lymphocytes [ figure 5 ] , and immunochemistry for cd3 did not show any evidence of epidermotropism . the patient has not shown any evidence of recurrence after 6 months of follow - up . multiple hypopigmented nonscaly macules over buttocks and trunk thinned out epidermis with single cell infiltration in the basal layer . higher power view of epidermis in inset showing infiltrating atypical hyperchromatic lymphoid cells ( h and e , 1000 ) numerous t cells arranged in bead - like fashion in basal layer of epidermis with focal clustering ( anti - cd3-dab chromogen , 100 ) complete clearance of lesions after narrow - band ultraviolet b therapy posttreatment biopsy showing unremarkable epidermis with lack of any atypical lymphocytes ( h and e , 400 ) primary cutaneous lymphomas ( pcls ) belong to a heterogeneous group of malignant lymphoproliferative neoplasms , affecting primarily skin without any system involvement ( visceral , bone marrow , or lymph nodes ) at the time of diagnosis . several clinical variants of mf have been described ; hypopigmented , hyperpigmented , ichthyosiform , pityriasis lichenoides - like , granulomatous , folliculotropic , pagetoid reticulosis , purpuric , hyperkeratotic , and verrucous . hmf differs from classic mf in having a relatively younger age of onset with female predominance as was seen in our case ; however , the histologic diagnosis may be delayed until 210 years . hmf is reported almost exclusively in dark - skinned and asian patients as against the classical form . clinically , hmf has asymptomatic , hypopigmented , to achromycin - scaly lesions of varying size distributed chiefly over trunk and proximal parts of extremities ( buttocks , pelvic girdle , and trunk ) , with occasional involvement of distal extremities and head . differential diagnoses include hypopigmented lesion of atopic dermatitis , pityriasis alba , leprosy , vitiligo , postinflammatory hypopigmentation , sarcoidosis , pityriasis lichenoides chronica , pityriasis versicolor , and others . histopathological features of hmf include focal parakeratosis , little or no spongiosis , upper dermal lymphocytic infiltrate with coarse collagen bundles and intense epidermotropism whereas pautrier microabscesses are seldom noted . epidermotropism is predominantly by neoplastic cd4 + t - cells in classical mf and by cd8 + cells in hmf . this finding seems to influence the pathogenesis of hmf as the suppressor phenotype limits the disease progression by preventing cutaneous dissemination and onset of aggressive plaque stage , despite the neoplastic nature of these cells . latter coupled with early diagnosis is responsible for better prognosis of hmf as compared to the classic form . atypical neoplastic cells tend to cause melanocytes degeneration and abnormal melanogenesis resulting in hypopigmented lesions . despite good prognosis , potential lethality of hmf should not be underestimated , and therefore , treatment is desirable . complete clinical assessment , peripheral blood examination , quantification of szary cells and t - lymphocytes using flow cytometry as well imaging studies should be performed to exclude visceral involvement . effective therapeutic modalities for hmf include phototherapy , topical nitrogen mustard , topical carmustine , and total skin electron beam therapy . phototherapy , especially photochemotherapy ( puva ) , is most widely used and is recommended as the first - line treatment . a recent review concluded that puva is a safe , effective , and well - tolerated therapy for early stage mf , stage ia ib , and stage iia ( level of evidence 1 + , grade of recommendation b ) . although the evidence for nbuvb is less robust ( level of evidence 2++ , grade of recommendation b ) , it has been considered at least as effective as puva for early - stage mf . maintenance therapy with puva is to be reserved for patients who experience an early relapse . in a recent study , 7/11 patients with hmf achieved complete remission with nbuvb twice weekly ( mean of 40 treatments ) while remaining 4 had partial remission . relapse was seen in three patients after a mean of 10 months . in another series of nine patients , patients treated with nbuvb , disease recurred after a disease - free interval ranging from 2 months to 6 years . yet , another study reported phototherapy to be effective in 86.7% , with success rate of 66.7% with nbuvb and 80% with puva . there are no standard guidelines for phototherapy for hmf as the disease is uncommon . with wider availability of nbuvb , much better safety profile , and comparable efficacy as that of puva , we propose that nbuvb may be tried in more patients with hmf to arrive at a logistic conclusion . to the best of our knowledge , we report for the first time from india , clinical , histopathological , and immunohistochemical remission , following nbuvb therapy in hmf . nbuvb may be used as a relatively safe and effective therapeutic option in indian scenario for hypopigmented variant of mycosis fungoides . nbuvb may be used as a relatively safe and effective therapeutic option in indian scenario for hypopigmented variant of mycosis fungoides . nbuvb may be used as a relatively safe and effective therapeutic option in indian scenario for hypopigmented variant of mycosis fungoides . | mycosis fungoides ( mf ) is the most common type of primary cutaneous lymphomas . several clinical variants of mf have been described .
purely , hypopigmented variant of mf ( hmf ) is rare .
phototherapy , especially photochemotherapy ( psoralen and ultraviolet ) , is the most widely used method and is recommended as the first - line treatment for hmf . however , there are no standard guidelines for phototherapy as the disease is uncommon .
we , hereby , report a 30-year - old woman with hmf in whom clinical , histopathological , and immunohistochemical remission was achieved following narrow - band ultraviolet b therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
root canal therapy of immature teeth poses a special challenge for the clinician . due to absence of apical constriction or apical stop , it is difficult to limit the obturation process within the root canal space . apexification ( a method including long term application of calcium hydroxide to induce apical closure ) , has several disadvantages . susceptibility to fracture , coronal microleakage and aesthetic concerns during this extended treatment period are additional negative points . placement of artificial apical barriers has been considered as an alternative to traditional calcium hydroxide apexification . the material has been widely employed as artificial apical barrier is mineral trioxide aggregate ( mta ) . mta can be placed in one visit , and induce hard tissue formation.[810 ] it is biocompatible,[1114 ] and has good sealing and antimicrobial properties.[1416 ] although , mta has poor handling characteristics and a long setting time . calcium - enriched mixture ( cem ) cement has been developed with clinical applications similar to those of mta . mta and cem cement showed similar favorable biologic responses in repair of furcal perforation , pulp cap and pulpotomy treatment . cem cement has appropriate handling characteristics and exhibited similar sealing properties to mta when used as root - end filling material . compared the response of periradicular tissues to mta and cem cement as root - end fillings and concluded that cem cement and mta were associated with regenerative periapical tissue response when used as root - end filling biomaterials . usually , one or two visits of calcium hydroxide therapy are performed before application of apical barrier , in order to disinfect the root canal system of teeth with nonvital pulps . however , complete removal of calcium hydroxide from the dentinal walls is reportedly impossible . the purpose of this study was to evaluate the effects of residual calcium hydroxide on the marginal adaptation of the cem apical barrier . the teeth were clinically examined to be free of caries , cracks , restoration , and calcification . the teeth were placed in 5.25% sodium hypochlorite ( naocl ) for 5 h. thereafter , they were rinsed and stored in saline solution . clinical crowns were removed from the cement - enamel junction with a high - speed diamond bur ( d and z germany ) under excess water to create a standardized root length of 14 mm . the root canals were instrumented using k - files ( dentsply maillefer , tulsa , usa ) up to master apical file # 45 and gates - glidden drills 14 ( dentsply , maillefer , tulsa , ok ) in a step back manner . then the access opening was sealed with coltozol ( coltene , altstatten , switzerland ) and sulfuric acid was used to produce apical resorption . briefly , the roots were drowned in melted rose wax ( cavex holland , netherlands ) up to 3 mm from the anatomic apex . after that , the teeth were rinsed with a saline solution , the wax was removed with a scalpel ( supa , tehran , iran ) , and temporary filling was removed from the access opening . the teeth were randomly divided into two experimental groups ( n = 20 ) . in medicated group ( n = 20 ) , calcium hydroxide ( pure calcium hydroxide mixed with distilled water ) ( cina bartar , tehran , iran ) was placed in root canals using a lentulo spiral ( moyco union brach , york , pa ) and a radiograph was taken to ensure complete coverage of the canal . after 1 week , the medicament was removed using 0.5% naocl irrigation and stainless steel hand files ( dentsply , maillefer , tulsa , usa ) . in non - medicated group the cem cement was mixed according to the manufacturer 's instructions and using mta carrier , cem cement was placed in the root canals . this process was continued until 4 mm apical plugs were formed at the root apices . the roots were sectioned perpendicular to its long axis at 5 mm of the anatomic root apex using a high - speed diamond saw ( d and z germany ) . the specimens were mounted on aluminum stubs , sputter - coated with gold and assessed from the top at a 300 magnification under scanning electron microscopy ( vega ii xmu , tescan , czech republic ) . marginal adaptation evaluated at the root apices only , and width of largest gap ( maximum distance between cem cement and surrounding dentin ) in each specimen was scored and recorded [ figures 1a and b ] . a gap between the calcium - enriched mixture cement plug and dentinal wall at the root end can be observed in the ( a ) medicated group ( with prior calcium hydroxide dressing and the ( b ) non - medicated group ( without prior calcium hydroxide dressing ) the kolmogorof - smirnov test was used to confirm normal distribution of the data . the results were analyzed by t - test , and significance level was set at = 0.05 . the scanning electron microscope ( sem ) observation of root ends revealed gaps between cem cement and the dentinal walls in all cases . the average gap width in medicated and non - medicated groups was 158/1 67.1 m and 147/1 34/8 m , respectively . several studies have shown that mta has good marginal adaptation in comparison of other root - end filling materials and the gap size is smaller in mta root - end filled teeth.[2832 ] marginal adaptation of cem cement has not been evaluated . the mean gap size in premedicated and non - premedicated root canals was 158.1 m and 147.1 m , respectively . ( 2.68 m ) , bidar , et al . ( 14.8 m ) and xavier , et al . ( 1.051 and 0.812 m ) in evaluation of marginal adaptation of mta . first , in these studies , mta was placed retrogradely in the root canals and the root - end and marginal adaptation were assessed but in the present study , cem cement was placed in root canals orthogradely ( as an apical plug ) . second , the method of measuring the gaps is different ; torabinejad , et al . and bidar , et al . used longitudinally sections to measure gap widths between mta and the root canal walls . xavier , et al . used transverse sections to evaluate the marginal adaptation of mta as a root - end filling material . here , the gaps between cem cement and the root canal walls at the root apices was evaluated , without performing sectioning at the cem cement and dentinal wall interface . finally , in this study sulfuric acid was used to produce open apex teeth . sulfuric acid resorbs the root apex in a disordered manner , producing irregularities at the root end that may hinder adaptation of cem cement to the dentinal walls and thereby increase the gap size . the size of gaps in this study is comparable with those was observed for marginal adaptation of mta by same method ( 70.2 m and 130.0 m in premedicated and non - premedicated root canals , respectively ) . the present study showed that medication with calcium hydroxide had no adverse effect on marginal adaptation of the cem cement plug . hachmeister , et al . also found that calcium hydroxide therapy for one week did not affect the sealing ability of mta in 70 days . porkaew , et al . found decreased dye leakage in canals obturated with gutta - percha following premedication with calcium hydroxide . bidar , et al . also found that premedication with calcium hydroxide improved marginal adaptation of mta . according to the results of this study , calcium hydroxide medication had no effect on the marginal adaptation of cem cement as an apical plug . because the apical plug technique eliminates the lengthy apexification procedure , in vivo studies focused on the success rate of cem cement apical plug are warranted . | background : this study was to evaluate the effects of calcium hydroxide premedication on the marginal adaptation of the calcium - enriched mixture ( cem ) cement as an apical plug.materials and methods : in this in vitro study , forty single rooted teeth were prepared and apical portion of the roots were immersed in sulfuric acid to produce open apices .
the teeth were divided into 2 experimental groups . in medicated group ,
calcium hydroxide was placed in all canals for 1 week and in non - medicated group no dressing was used .
then , a 4-mm apical plug of cem cement was placed in canals ; each root was prepared for observation using scanning electron microscope and the maximum distance between cem cement and surrounding dentin was measured .
the data were analyzed by t - test , and significance level was set at = 0.05.results:the mean width of gap in medicated and non - medicated groups was 158/1 m and 147/1 m , respectively .
there was no significant difference between the two groups ( p > 0.05).conclusion : calcium hydroxide premedication had no adverse effect on the marginal adaptation of cem cement apical plug . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cat scratch disease ( csd ) , caused by bartonella henselae , has been reported very rarely in cardiac transplant recipients . we describe the case of a 65-year - old cardiac transplant recipient whose post transplant course was complicated with graft rejection , pulmonary nocardiosis , and post - transplantation lymphoproliferative disorder ( ptld ) . a contrast enhanced ct scan of chest , abdomen , and pelvis was obtained that revealed lymphadenopathy in the left inguinal region . the suspicion for recurrence of ptld was high , but consideration was given to csd given the history of cat exposure and a skin lesion concomitant with lymphadenopathy , a common finding in csd . the histopathologic testing , however , revealed lymphadenopathy secondary to csd and the skin lesion due to squamous cell carcinoma . a 65-year - old man who had undergone orthotopic heart transplant for ischemic cardiomyopathy 2 years prior to presentation was admitted with fevers of 34 week duration . the fevers were mainly present in the evenings , ranging between 100f and 102f , and were associated with chills and night sweats . for the previous 6 months , the patient had noticed blurred vision , but denied any specific cardiac , respiratory , or abdominal complaints . there was no loss of weight or appetite . three months after the transplant , he was diagnosed with pulmonary nocardiosis for which he completed 9 months of antimicrobial treatment . two months later , he had cardiac graft rejection that was treated and remedied with methylprednisolone alone . a month post - rejection , he was diagnosed with post - transplant lymphoproliferative disorder and treated with rituximab . a pet - ct scan done 2 months prior to the current presentation did not reveal any evidence of malignancy . the patient had 2 dogs at home and a cat that had died 4 months earlier at the age of 14 years . his past medical history was significant for antiphospholipid antibody syndrome , hyperlipidemia , gerd , depression , hiatal hernia , and hypertension . his medication list included tacrolimus , aspirin , sirolimus , warfarin , citalopram , simvastatin , ezetimibe , omeprazole , calcium and vitamin d. on examination , vital signs were within normal range except for an oral temperature of 101f . fundoscopic exam performed by an ophthalmologist did not reveal any retinal lesions and there were no signs of meningismus . a non - tender 3 cm by 1.5 cm erythematous nodule with central scarring was seen over the left knee ( figure 1 ) . the patient reported that the lesion was present for a couple of months , but was not sure about the exact time of onset of the lesion . a lumbar puncture was performed that was unremarkable . given the most recent diagnosis of ptld , the possibility of recurrence was entertained . a contrast enhanced ct scan of chest , abdomen , and pelvis was obtained that revealed lymphadenopathy in the left inguinal region , with the largest node measuring 2 cm by 1.5 cm . this heightened the suspicion for ptld and an excisional biopsy of the lymph node was performed . blood cultures for mac , quantiferon gold , urine histoplasma antigen , serum cryptococcal antigen , and serologies for histoplasma , blastomyces , and coccidioidomyces were sent . given the histopathologic findings and history of previous contact with a cat , serology for bartonella henselae was ordered . the serology for bartonella henselae returned positive for both igm ( 1:200 ; negative : < 100 ) and igg ( > 1:2,560 ; negative : < 1:320 ) . the skin lesion on the knee proximal lymphadenopathy was presumed to represent an unhealed site of inoculation of the bacterium . in contradistinction to our initial diagnostic impression , the histopathologic findings on the skin biopsy revealed infiltrating strands of atypical squamous epithelium within the dermis , highly suggestive of squamous cell carcinoma ( figure 2 ) . a wide excision of the lesion was subsequently performed that confirmed the diagnosis of a skin malignancy . we retrospectively requested a warthin - starry stain on the nodal specimen which revealed coccobacillary pathogens present singly and in clumps , suggestive of bartonella spp ( figure 3 ) . figure 2histopathology of the skin lesion revealing infiltrating atypical squamous cells into the deeper stromal tissue ( h&e stain ) . histopathology of the skin lesion revealing infiltrating atypical squamous cells into the deeper stromal tissue ( h&e stain ) . figure 3short curved microorganisms seen singly and in clusters on the lymph node specimen ( warthin - starry stain ) . short curved microorganisms seen singly and in clusters on the lymph node specimen ( warthin - starry stain ) . the patient was initiated on doxycycline and azithromycin as soon as the serology turned positive , and he responded remarkably to the antimicrobial therapy . twenty four hours after initiation of the antibiotics , his fevers abated and his fatigue , night sweats and headache resolved within a few days . doxycycline was stopped after 3 weeks and azithromycin was continued for a total of 3 months . kemper et al . described a case of hepatosplenic bacillary angiomatosis from b. henselae 2 decades ago in a cardiac transplant recipient who had presented with a fever of unknown origin . analyzed a total of 1073 episodes of infection in 620 heart transplant patients over a 16 year period and found only one case of infection secondary to bartonella henselae ( details of the case were not published in the article ) . to the best of our knowledge , no other cases of csd in a heart transplant recipient have been reported in the medical literature published in english language to date . other than the rarity of csd in cardiac transplant recipients , what makes the case interesting is the presence of a malignancy concomitant with an infection . bartonella can cause a variety of skin lesions and an erythematous papule or nodule with crusting or ulceration is commonly seen with csd . lymphadenopathy is often seen in the lymph nodes that drain the area of the skin affected , a clinical picture seen in the current case . before the results of skin biopsy were obtained , we presumed that the skin lesion probably represented an unhealed site of bacterial inoculation . the coexistence of malignancy and infection in this patient was probably secondary to immunosuppression in this cardiac transplant recipient . infections from bartonella may present atypically and mimic a malignancy clinically as well as radiologically . they may masquerade as a lymphoma and can be mistaken for ptld in organ transplant recipients . this was a consideration in our patient because he had a prior history of ptld . rarely , even the histopathologic findings associated with lesions from bartonella may be mistaken for a malignancy . pseudoepitheliomatous hyperplasia , a term described to denote a marked reactive hyperplasia of the epidermis , may mimic squamous cell carcinoma . a rare association between pseudoepitheliomatous hyperplasia and bartonella infection has been reported in the medical literature . this diagnosis was considered in the differential , but the pattern of infiltration by atypical squamous cells into the deeper stromal tissue confirmed that the underlying disease process was a malignancy and not reactive hyperplasia alone . finally , it has also been demonstrated that bartonella spp stimulate cellular proliferation and may lead to tumor formation . we requested a warthin - starry stain and pcr for bartonella on the skin lesion . pcr for bartonella on the nodal specimen was not performed as there was no available tissue . pcr on the skin lesion was performed 2 weeks after the initiation of the antibiotics and may have affected the result . in addition to the association of bartonella with malignancy , this bacterium has also been associated with rejection in transplant recipients . reported a possible link between acute rejection and csd in 2 patients after pediatric renal transplantation . no similar association , however , has been reported since . while in otherwise healthy individuals csd presents as a skin lesion and lymphadenopathy that may resolve spontaneously , in the immunosuppressed hosts , the disease may progress and present atypically . it may present as fuo and involve visceral organs such as liver , spleen , bone , heart , and lungs . therefore , it is important to obtain a detailed history in patients who present with fuo . bartonella rarely grows on routine bacterial cultures and if tests such as special stains ( warthin - starry or steiner or dieterle stain ) , serology for bartonella , or pcr on tissue and/or blood are not sent , diagnosis may remain elusive . the typical history of scratch from a cat may not be present and absence of this should not preclude one from entertaining a diagnosis of bartonellosis . close contact with cats alone , along with fever and lymphadenopathy should raise a suspicion for it . epidemiological , clinical , and histological data should be obtained and definitive diagnostic testing such as special stains , serology and/or pcr should be ordered in the right setting . while immunocompetent individuals may not even need treatment for csd , it is generally recommended that those with immunodeficiency states such as aids and transplantation received prolonged courses ( at least 3 months ) of antimicrobial therapy . short courses of therapy that may suffice in otherwise healthy hosts may not be adequate in transplant recipients . treated a renal transplant patient with a 5 day course of azithromycin and witnessed a relapse after 8 months . in addition to the rarity of csd in cardiac transplant recipients , certain aspects of the case are worth noting . firstly , there was an unusually long latent period between the introduction of infection and the clinical presentation , the cause of which remains elusive . secondly , the case demonstrates the possibility of coexistence of malignancy and infection in immunosuppressed hosts . the differential diagnosis of fever in immunosuppressed individuals is wide and more than one disease process may coexist in these hosts . finally , the case highlights the importance of history and physical examination in diagnosing patients who present with prolonged fevers . despite the advancement of newer diagnostic techniques , | cat scratch disease has been reported very rarely in cardiac transplant recipients . in a review of 1073 episodes of infection in 620 heart transplant patients over a 16 year period ,
only one case of infection secondary to bartonella henselae was documented .
another case of hepatosplenic bacillary angiomatosis from b. henselae was reported 2 decades ago in a heart transplant recipient who had presented with fevers of unknown origin .
although the typical clinical manifestation is that of a skin lesion accompanied with lymphadenopathy , cat scratch disease may present with persistent fevers without a clinically overt infective focus in immunosuppressed individuals . moreover ,
more than one disease process may coexist in immunocompromised hosts .
while the lymphadenopathy in our patient was secondary to cat scratch disease , interestingly , the adjacent skin lesion that was thought to represent unhealed site of inoculation of bartonella was diagnosed as squamous cell carcinoma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
open nephron - sparing surgery ( nss ) is effective for the management of t1a ( 4 cm ) renal cell carcinoma ( rcc ) . initially reserved for patients in whom preservation of renal function was needed with durable long - term success , nss has been increasingly offered to patients with normal contralateral kidneys . the widespread inclusion of laparoscopic partial nephrectomy ( lpn ) in the surgical armamentarium for the management of renal cancer , however , has evolved slowly because of technical difficulties related to the procedure . originally , lpn was restricted to small , exophytic , and peripheral tumors . with increasing experience , however , indications for lpn have expanded to more complex tumors , albeit in the hands of laparoscopic experts . current advances in laparoscopic surgery , such as knot - tying aids , hemostatic agents , intra - operative maneuvers , and newer laparoscopic instrumentation , have greatly helped to make this procedure technically feasible and reproducible by a wider range of surgeons . lpn is thus becoming a valid alternative when nss is considered . in a european study , lpn provided results similar to open surgery . we present the korean experience comparing lpn with open nss for the management of renal tumors . between january 1998 and may 2009 , 417 consecutive patients underwent lpn for the management of renal tumors by surgeons of 15 institutions in korea . of the 417 patients , 273 met the inclusion criteria of solitary , pathologic t1a tumors ( 4 cm ) without a history of ipsilateral renal surgery . these patients were compared with a cohort of 279 patients who underwent open partial nephrectomy ( opn ) performed by the same surgeons between january 1998 and may 2009 ; these patients also met the same inclusion criteria . renal function was assessed by measurement of serum creatinine . to improve the accuracy of renal function determination , the glomerular filtration rate ( gfr ) was estimated using the mayo clinic quadratic equation ( mcqe ) , thereby lowering the effect of underestimation of a high gfr compared to other estimation formulae . complications were rated as intra- and post - operative and graded according to the national cancer institute common toxicity criteria ( nci - ctc)-based grading system developed by simmons and gill . most of the patients were followed at each institution , with serum creatinine analysis , urinalysis , and renal imaging ( mainly ct scans ) at 6-month intervals for 3 years and thereafter at yearly intervals . the student 's t test was applied for comparison of continuous variables . the pearson chi - square test and fisher 's exact test were used to compare categorical variables . the five - year overall and recurrence - free survival ( rfs ) rates for local and distant relapse in pt1 stage rcc were estimated using the kaplan - meier method with log - rank test statistics . all analyses were performed using the statistical package for the social sciences ( version 17 ; spss , chicago , il , usa ) , with a two - sided p - value<0.05 considered to indicate statistical significance . between january 1998 and may 2009 , 417 consecutive patients underwent lpn for the management of renal tumors by surgeons of 15 institutions in korea . of the 417 patients , 273 met the inclusion criteria of solitary , pathologic t1a tumors ( 4 cm ) without a history of ipsilateral renal surgery . these patients were compared with a cohort of 279 patients who underwent open partial nephrectomy ( opn ) performed by the same surgeons between january 1998 and may 2009 ; these patients also met the same inclusion criteria . renal function was assessed by measurement of serum creatinine . to improve the accuracy of renal function determination , the glomerular filtration rate ( gfr ) was estimated using the mayo clinic quadratic equation ( mcqe ) , thereby lowering the effect of underestimation of a high gfr compared to other estimation formulae . complications were rated as intra- and post - operative and graded according to the national cancer institute common toxicity criteria ( nci - ctc)-based grading system developed by simmons and gill . most of the patients were followed at each institution , with serum creatinine analysis , urinalysis , and renal imaging ( mainly ct scans ) at 6-month intervals for 3 years and thereafter at yearly intervals . the student 's t test was applied for comparison of continuous variables . the pearson chi - square test and fisher 's exact test were used to compare categorical variables . the five - year overall and recurrence - free survival ( rfs ) rates for local and distant relapse in pt1 stage rcc were estimated using the kaplan - meier method with log - rank test statistics . all analyses were performed using the statistical package for the social sciences ( version 17 ; spss , chicago , il , usa ) , with a two - sided p - value<0.05 considered to indicate statistical significance . the groups were similar with respect to age , gender , and body mass index ( table 1 ) . the pre - operative creatinine level was similar in both groups . despite matching for tumors < 4 cm in size , a significant mean difference in tumor size existed between the opn and lpn cohorts ; however , it was only a 2 mm difference on average between the groups . eighty opns used cold ischemia , while all lpns were performed with warm ischemia ( wi ) . other notable findings between the two procedures included a longer mean surgical time in the lpn group compared to the opn group ( 221 min vs. 184 min , p<0.001 ) and a longer ischemia time ( 33.3 min vs. 23.4 min , p<0.001 ) . the surgical and ischemic times of robot - assisted lpn were 24592 min and 30.116.2 min , respectively , which were similar to non robot - assisted lpn ( p=0.231 and p=0.078 , respectively ) . lpns were associated with less estimated blood loss ( ebl ; 293 ml vs. 418 ml , p<0.001 ) . the mean length of follow - up of the opn group was longer than the lpn group ( 28.0 months vs. 17.8 months , p<0.001 ) . the final pathology report revealed clear - cell carcinoma in 86.7% and 85.3% of the opn and lpn patients , respectively ( p=0.611 ) . twelve ( 4.4% ) and 7 positive margins ( 2.5% ) occurred in the lpn and opn cohorts , respectively ( p=0.161 ) . open conversion was required in 2 patients ( 0.7% ) in the lpn group because of intra - operative hemorrhage and radical nephrectomies were performed . radical conversion occurred in 4 of the opn patients ( 1.4% ) due to intra - operative hemorrhage . the overall incidence of intra - operative complications was similar in both arms ( table 2 ) . the following three intra - operative complications occurred in the lpn patients : a spleen injury that was repaired laparoscopically and two open conversions secondary to hemorrhage . the total complications were similar in both cohorts ( opn , 6.8% ; lpn , 6.6% ; p=0.919 ) . when complications were stratified , minor and major complications were similar between the two groups . the majority of these complications were pseudoaneurysms , which were repaired by angioembolization in five patients in both arms . post - operative urine leakage developed in three patients who underwent opns ; two of the patients were managed with prolonged jackson - pratt drainage , and the third patient needed percutaneous drains . three patients with urinary leakage in the lpn cohort were treated conservatively with prolonged jackson - pratt drainage . local recurrences were found in both groups ( lpn , 0.7% [ n=2 ] ; opn , 1.0% [ n=3 ] ) ; 0.7% ( n=2 ) and 2.1% ( n=6 ) of the patients developed distant metastases to the liver , cecum , lymph nodes , or pancreas after lpns and opns , respectively . at 5 years , the kaplan - meier estimates for recurrence - free rates were 96% and 94% after lpns and opns , respectively ( p=0.332 ) . three and four patients died during follow - up after opns and lpns , respectively , but other patients in both groups died due to other causes than rcc ( fig . the decline in post - operative gfr did not differ between the two groups ( p=0.8 ) ( table 3 ) . on multivariate regression analysis , pre - operative gfr and ischemia time independently predicted the post - operative gfr decline . the principal findings of our korean multicenter study were comparable surgical , oncologic , and functional outcomes after laparoscopic and open nss . shorter operative and hospitalization times following the laparoscopic approach reveal advantages in terms of reduced peri - operative morbidity , as well as non - urologic complications . previously , open nss was reserved for patients with a solitary kidney or renal insufficiency . with complication rates and cancer control rates comparable to those for radical nephrectomies for tumors < 4 cm in size , however , partial nephrectomy is now viewed as an acceptable alternative for many patients with renal masses . contrary to laparoscopic radical nephrectomy , lpn has been slow to become an alternative to open nss ; this is caused in large part by the very high level of technical expertise needed to perform the procedure . similar to the large multi - institutional series presented by gill et al , blood loss was minimal while ischemia time was longer for lpns . in our series , however , we did not find a greater rate of intra- or post - operative complications , as reported by gill et al . their series had significantly more post - operative complications in the lpn group ( 24.9% , lpn ; 19.2% , opn ) , although the series presented by schiff and coworkers ( 9% , lpn ; 19% , opn ) and our group ( 6.6% , lpn ; 6.8% , opn ; p=0.919 ) found the opposite . this may be attributed to the small difference in mean tumor size and tumor location between gill 's series and our series . tumors in the opn cohort , however , were on average only 5 mm larger than tumors in the lpn cohort in our series , which is less than that presented by gill et al ( 3.5 cm , opn ; 2.7 cm , lpn ) and schiff ( 3.4 cm , opn ; 2.2 cm , lpn ) . overall complication rates for lpn in the literature range from 6% to 33% and for opn from 4.1% to 38.6% [ 12,20 - 22 ] . our retrospective multicenter study did not regard blood transfusion due to hemorrhage as a post - operative complication because the indications for blood transfusion at each institution and for each physician were different . however , simply adding the transfusion rate to the complication rate for lpns and opns yielded 16.1% and 23.6% , respectively ; these results were similar to a previous western study [ 20 - 22 ] . also in our analysis , data on the oncologic outcome must be interpreted with caution because of the rather short follow - up . the cleveland clinic foundation reported excellent results , with 100% distant and 97.3% local recurrence - free survivals within 5.7 years of lpns . canes presented comparable 97.5% and 98.3% distant and local recurrence - free survival estimates , respectively , at 5 years for opns . our data suggest that open and laparoscopic access yield comparable oncologic efficacy in the treatment of pt1 stage rcc . the impact of positive margins on disease outcome has been discussed controversially . as we observed similar rates of positive surgical margins in lpns and opns , it may be that the limited maneuverability of laparoscopic instruments does not significantly affect the accuracy of tumor excision . a multicenter analysis of lpns showed positive margins in 1.8 - 2.4% of cases , and a slightly higher rate of 6.7% in solitary kidneys . the positive surgical margin rate of opns is similar , with 7% in an analysis of 777 patients by kwon et al . the positive surgical margin rate of lpns and opns was 4.4% and 2.5% , respectively , in the current study . it is important to understand that positive margin status does not necessarily indicate residual disease or translate into disease progression , as only 4% of patients with positive margins will eventually develop local recurrences . marszalek et al reported that the decline in the gfr at the last available follow - up ( lpn , 10.9% ; opn , 10.6% ) was similar in both opn and lpn groups ( p=0.8 ) . in the current study , the decline in renal function was similar after lpns and opns despite a longer wit in lpn patients . based on a multivariate analysis , laparoscopic access was not an independent risk factor for gfr impairment in the post - operative phase . pre - operative renal function was , besides ischemic time , one predictive factor for the long - term decline in gfr in our study . our study did not show the beneficial effect of the robot system on ischemic time because robot - assisted lpn was in its infancy of use in korean institutions for partial nephrectomies . we acknowledge that the retrospective nature of the analysis is a shortcoming of this study . furthermore , non - identical protocols from multi - institutions might have reduced the statistical power in analysis so that some associations were not detected . long - term follow - up is needed to verify long - term oncologic and functional outcomes . the lpn group demonstrated similar rates of recurrence - free survival , complications , and postoperative gfr change compared with opn group . the lpn may be an acceptable surgical option in patients with small rcc in korea . | purposewe analyzed a series of patients who had undergone laparoscopic partial nephrectomies ( lpns ) and open partial nephrectomies ( opns ) to compare outcomes of the two procedures in patients with pathologic t1a renal cell carcinomas ( rccs).materials and methodsfrom january 1998 to may 2009 , 417 lpns and 345 opns were performed on patients with small renal tumors in 15 institutions in korea . of the patients , 273 and 279 patients , respectively , were confirmed to have pt1a rcc .
the cohorts were compared with respect to demographics , peri - operative data , and oncologic and functional outcomes.resultsthe demographic data were similar between the groups .
although the tumor location was more exophytic ( 51% vs. 44% , p=0.047 ) and smaller ( 2.1 cm vs. 2.3 cm , p=0.026 ) in the lpn cohort , the opn cohort demonstrated shorter ischemia times ( 23.4 min vs. 33.3 min , p<0.001 ) .
the lpn cohort was associated with less blood loss than the opn cohort ( 293 ml vs. 418 ml , p<0.001 ) . of note ,
two patients who underwent lpns had open conversions and nephrectomies were performed because of intra - operative hemorrhage .
the decline in the glomerular filtration rate at the last available follow - up ( lpn , 10.9% ; and opn , 10.6% ) was similar in both groups ( p=0.8 ) .
kaplan - meier estimates of 5-year local recurrence - free survival ( rfs ) were 96% after lpn and 94% after opn ( p=0.8).conclusionsthe lpn group demonstrated similar rates of recurrence - free survival , complications , and postoperative gfr change compared with opn group .
the lpn may be an acceptable surgical option in patients with small rcc in korea . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
esophageal cancer represents a serious malignancy and is associated with high mortality . among the different histological subtypes , squamous cell carcinoma ( scc ) and adenocarcinoma represent over 95% of all esophageal carcinomas . whereas prevalence of scc has decreased over the past decades , rising incidence of adenocarcinoma has been observed . this has been partially attributed to the higher occurrence of risk factors like obesity and gastroesophageal reflux disease in western countries . whereas obesity is thought to promote tumor development and progression by pro - inflammatory cytokines , reflux supports the replacement of the regular stratified squamous epithelium lining of the esophagus by simple columnar epithelium with goblet cells . only localized disease with early tnm - stages like tis , t1 or t2 carcinoma are open for surgical treatment strategies without preoperative chemo- or radiotherapy . however , over 50% of all patients have evidence of distant metastases at the time of initial diagnosis . in these cases , the leading cause for hospitalization of patients with advanced disease is dysphagia , due to stenosing tumor formation . in these cases , supportive care includes endoscopic stent implantation to restore luminal patency and thereby enabling oral food intake and improving quality of life . self - expandable metal stents ( sems ) represent the state of the art in endoscopic stent implantation . especially patients with reduced life expectancy benefit from this treatment option and often experience a rapid symptom relief within 2448 h . typical long - term complications ( 6 weeks after implantation ) are pain , bleeding , development of esophagotracheal fistula or recurrent dysphagia due to food bolus impaction or tumor in- and overgrowth and necessitate reinterventions . we report a case of complete remission of advanced metastasized adenocarcinoma of the gastroesophageal junction ( ags ) and unintentional long - term esophageal stenting . he had experienced progressive dysphagia and weight loss in the 3 months prior to hospitalization . food or even liquid intake was no longer possible . the remaining lumen was restricted to about 3 mm , impeding further investigation by endosonography . histological examination revealed a moderately differentiated adenocarcinoma . the tumor marker carcinoembryonic antigen ( cea ) further staging by abdominal and thoracic computed tomography ( ct ) showed various prominent mediastinal lymph nodes and a single hepatic lesion in segment ivb , which was radiologically rather interpreted as a hemangioma than a metastasis , indicating at least a uicc stage iii carcinoma ( fig . as recommended by the interdisciplinary tumor board of our institution , neoadjuvant chemotherapy with epirubicin , oxaliplatin and capecitabin ( eox , epirubicin 50mg / m , oxaliplatin 130 mg / m , capecitabin 1,250 mg / m ) was initiated . restaging after four cycles revealed progressive disease to uicc stage iv , as multiple new metastatic lesions with a maximal diameter of 6 mm in the liver and an increase of cea ( 74.5 g / l ) were detected ( fig . therefore , the chemotherapy protocol was changed to administration of five cycles of folfiri ( 5-fu 2,000 mg / m , folinic acid 500 mg / m , irinotecan 80 mg / m ) , and supportive care was complemented by endoscopic stent implantation ( sems leufen , partially silicone covered , length 14 cm , diameter 2 cm ) . four years later , the patient was admitted with dysphagia and deterioration of the general condition to another hospital . in the meantime , now , current restaging by ct did not reproduce the prediagnosed hepatic metastases ( fig . endoscopy of the upper gastrointestinal tract surprisingly disclosed no relevant stenosis or stent migration ( fig . 2 ) . functional examination by gastrographin x - ray confirmed an undisturbed swallowing function and esophageal passage . histological processing of the biopsy samples of the residual mass at the gej displayed no malignancy but chronic inflammation . the resulting reactive scar tissue formation was suspected to cause the described dysphagia . in summary , this implicates a complete response of an initially uicc stage iv adenocarcinoma of the esophagus to chemotherapy with five cycles of folfiri . the esophageal stent , which was implanted in the context of supportive care to allow oral food intake in the suspected residual life span , remained for at least 4 years in situ without major complications such as bleeding , development of fistulas or stent migration . however , present dysphagia was explained by esophageal motility disorder due to narrowing of the esophageal lumen after long - term stenting rather than relevant stenosis because of scar tissue formation . therefore , the stent was left in situ , as stent removal of the completely ingrown stent was supposed to be associated with high risk of bleeding and perforation . we report for the first time a case of a 51-year - old caucasian man with advanced adenocarcinoma of the gej who showed a complete response to a second - line therapy . in expectancy of a short remaining lifetime , palliative chemotherapy was complemented by endoscopic stent implantation to overcome dysphagia and malnutrition due to stenosing tumor formation . esophageal cancer is associated with a 5-year survival rate below 20% , which is attributable to the frequently observed advanced stage of disease at the time of diagnosis . recommended treatment strategies depend on the current tnm stage . in localized disease with t stages of tis , t1 or t2 , local ablation or surgery whenever distant metastases occur , palliative chemotherapy or radiochemotherapy shall be administered and may be complemented with best supportive care . second line chemotherapy with irinotecan , as was done in our case , has been proven to be effective , and recent phase iii data even demonstrated superior efficacy of folfiri over ecx as first - line therapy in advanced gastric and egj cancer [ 8 , 9 ] . in spite of this activity of irinotecan , cases with complete response to chemotherapy of advanced ags have only been reported from asia [ 10 , 11 , 12 ] . in our case , due to the unexpected complete response , the stent endoscopic stent implantation is an important tool in palliation of gastrointestinal cancer to overcome tumor - associated stenoses . due to the continuous development over the time , a broad spectrum of different stent types with specific advantages and disadvantages has emerged . complications of stent implantation include acute complications like organ perforation , tracheal compression or malposition as well as delayed complications like stent dislocation or bleeding . severe complications often occur at a later stage ( over a week after stent implantation ) and comprise recurrence of dysphagia due to tumor overgrowth or food impaction , stent migration , development of tracheoesophageal fistula or gastroesophageal reflux . therefore , this method should be reserved for palliative settings and patients with a short remaining life expectancy , which limits data on long - term experiences . a study published by schoppmann et al . monitored 70 patients who received stent implantation for different benign and malignant esophageal disorders . stents remained in situ for a mean time of 13.5 11.8 months ( median 294 days ) . they observed low rates for stent - related complications like migration ( 14% ) , perforation ( 1.4% ) and bleeding ( 0% ) . these complications were independent of stent characteristics like length , diameter , material or coating , providing evidence that long - term stenting is safe and effective . however , there are currently no recommendations for timely controlled stent removal or regular follow - up intervals available in a palliative setting . endoscopic stent implantation is an important tool to overcome dysphagia related to advanced esophageal or gastric cancer in patients with a short remaining life expectancy . here , we describe a case with unintentional esophageal stenting for about 4 years , due to an unexpected completed response of an advanced adenocarcinoma of the gej to chemotherapy . in the next years , new systemic treatment strategies like trastuzumab in her2neu - positive cases or new vegf - inhibitors like ramucirumab will hopefully increase the number of long - term survivors of ags [ 14 , 15 ] . in conclusion , as demonstrated by this case , future hopefully improved treatment strategies in ags represent a challenge for the development of new stent techniques in either extraction or by placement of biodegradable stents . | endoscopic stent implantation is a common short - treatment option in palliative settings in patients with esophageal cancer .
advanced disease is associated with low survival rates ; therefore , data on the long - term outcome are limited .
so far , cases of long - term remission or even cure of metastasized adenocarcinoma of the gastroesophageal junction or stomach ( ags ) have only been reported from asia . a 51-year - old male patient primarily diagnosed with metastasized adenocarcinoma of the gastroesophageal junction ( gej ) [ type i , ct3cn+cm1 ( hep ) , cea positive , uicc stage iv ] received palliative esophageal stenting with a self - expandable metal stent . as disease progressed after four cycles with epirubicin , oxaliplatin , and capecitabin , treatment
was changed to 5-fu and irinotecan .
the patient did not return after 5 cycles of folfiri , but presented 4 years later with mild dysphagia .
endoscopy surprisingly revealed no relevant stenosis or stent migration . repeated histological analyses of a residual mass at the gej did not detect malignancy . since the initially diagnosed hepatic metastases were no longer detectable by computed tomography , cure from esophageal cancer was assumed .
dysphagia was ascribed to esophageal motility disorder by a narrowed esophageal lumen after long - term stenting .
thus , endoscopic stent implantation is an important method in palliative treatment of dysphagia related to ags .
new systemic treatment strategies like trastuzumab in her2neu positive cases or new vegf - inhibitors like ramucirumab will lead to more long - time survivors with ags . in conclusion ,
future endoscopic treatment strategies in ags represent a challenge for the development of new stent techniques in either extraction or programmed complete dissolution . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a bacterial artificial chromosome dna containing the kif5b gene ( bacterial artificial chromosome clone 307d12 ) was partially digested with xbai and subcloned into a pbluescript ii - ks plasmid . a plasmid containing a 14.5-kb dna insert , pbs - kif5b , was identified by southern blotting using a labeled probe containing exon 2 , where the atp - gtp - a site is located ( data not shown ) . the tk4 gene from pbs-304 was cloned into the sali site of pbs - kif5b . the first loxp site was introduced into the first intron of kif5b gene by the recombinogenic targeting of a loxp - pgk - tn5-neo - loxp cassette ( pcr amplified from the modified pgk - loxp plasmid with primer : tcttgtgacttagagtttataaaatagagtaattttgaaaacacatagatatctgcaaaccctatgctactccgtcg and cgctctcctgagtaggacaaatccgccgggactataggttgtgtaatgtgtatttcaagtcaaaaaatgaattgaaaaaaa ) into pbs - kif5b , followed by removal of the fragment between the two loxp sites via cre - mediated recombination . the second loxp site accompanying the frt - pgk - tn5-neo - frt cassette was introduced into the second intron of kif5b gene by targeting a frt - pgk - tn5-neo - frt - loxp cassette ( pcr amplified from the modified pbs-246-frt plasmid by pcr primers primer : ggatgcacggctgtgagcacaggactttcctgtgtttggagt and primer : agttggatttaaggaagtactactaaaacttcaattagtcttactaaaaa ) into the pbs - kif5b - loxp to form the final kif5b knockout construct . the kif5b - knockout construct , containing 14.5 kb of the kif5b gene , was linearized by noti and was introduced into cj7 mouse embryonic cells in drs . jenkins and copeland 's lab in national cancer institute ( nci ) , usa , by electroporation and screened by genomic southern blotting . the neo of kif5b targeted allele was removed by crossing the mice with a fple deleter strain tgn(actflpe)9205dym / j ( 23 ) . mice with kif5b and kif5b genotypes were maintained by backcrossing to c57bl/6n females under a specific pathogen - free environment . rip2-cre transgenic mice ( 24 ) ( from jackson laboratory ) were first crossed with kif5b to generate kif5b ; rip2-cre mice . then kif5b ; rip2-cre mice were bred with kif5b mice to generate the final mutant mice ( kif5b : rip2-cre ) as well as their littermates ( kif5b , kif5b , and kif5b : rip2-cre ) . genotyping was performed by pcr using corresponding primers . to avoid hormonal effects in physiological assays , insulin contents in the islet extracts were analyzed by using the insulin elisa kit ( linco research ) and normalized to total protein concentrations determined by bradford method ( bio - rad ) . protein levels were determined by blotting with anti - kif5b primary antibody ( 1:2,000 , against synthesized peptide fdkekanleaftadkdia ) , anti - kif5a ( 1:1,000 , against synthesized peptide ngnatdindnrsdlpc ) , anti - kif5c ( 1:1,000 , against synthesized peptide sakdqkslepc ) , and anti - actin primary antibody ( 1:3,000 , sigma ) . paraffin sections were immunostained by primary antibodies against kif5b ( 1:400 ) , glucagon ( 1:1,000 , dako ) , and insulin ( 1:2,000 , sigma ) . visualization of these proteins was realized by incubating with fitc / cy3 or hrp - conjugated secondary antibodies . blood samples were collected by microvette cb300 ( sarstedt ) and centrifuged at 5,000 rpm for 5 min at room temperature . after centrifugation , supernatant was collected for determining plasma insulin levels by using insulin elisa kit ( linco research ) . paraffin sections of pancreata were processed for hematoxylin and eosin staining and observed by a light microscope ( carl zeiss ) . for transmission electron microscopy ( tem ) study , isolated islets were fixed by 2.5% glutaraldehyde in carcodylate buffer and embedded in 2% soft agar , followed by further embedding in fresh epoxy resin . ultrathin sections were examined on a philips em208s transmission electron microscope operated at 80 kv . -cell division was determined by 5-bromo-2-deoxyuridine ( brdu ) incorporation in 1-month - old mice using brdu staining kit ( zymed laboratory ) . pancreatic paraffin sections were further counterstained by hematoxylin and imaged with a zeiss axioskop microscope to count brdu -cells and total nuclei within islets . sigmastat ( systat software ) was used to analyze all data , which were expressed as mean se . the data were analyzed by one - way anova followed by tukey test or unpaired two - tailed student t test . a bacterial artificial chromosome dna containing the kif5b gene ( bacterial artificial chromosome clone 307d12 ) was partially digested with xbai and subcloned into a pbluescript ii - ks plasmid . a plasmid containing a 14.5-kb dna insert , pbs - kif5b , was identified by southern blotting using a labeled probe containing exon 2 , where the atp - gtp - a site is located ( data not shown ) . the tk4 gene from pbs-304 was cloned into the sali site of pbs - kif5b . the first loxp site was introduced into the first intron of kif5b gene by the recombinogenic targeting of a loxp - pgk - tn5-neo - loxp cassette ( pcr amplified from the modified pgk - loxp plasmid with primer : tcttgtgacttagagtttataaaatagagtaattttgaaaacacatagatatctgcaaaccctatgctactccgtcg and cgctctcctgagtaggacaaatccgccgggactataggttgtgtaatgtgtatttcaagtcaaaaaatgaattgaaaaaaa ) into pbs - kif5b , followed by removal of the fragment between the two loxp sites via cre - mediated recombination . the second loxp site accompanying the frt - pgk - tn5-neo - frt cassette was introduced into the second intron of kif5b gene by targeting a frt - pgk - tn5-neo - frt - loxp cassette ( pcr amplified from the modified pbs-246-frt plasmid by pcr primers primer : ggatgcacggctgtgagcacaggactttcctgtgtttggagt and primer : agttggatttaaggaagtactactaaaacttcaattagtcttactaaaaa ) into the pbs - kif5b - loxp to form the final kif5b knockout construct . the kif5b - knockout construct , containing 14.5 kb of the kif5b gene , was linearized by noti and was introduced into cj7 mouse embryonic cells in drs . jenkins and copeland 's lab in national cancer institute ( nci ) , usa , by electroporation and screened by genomic southern blotting . the neo of kif5b targeted allele was removed by crossing the mice with a fple deleter strain tgn(actflpe)9205dym / j ( 23 ) . mice with kif5b and kif5b genotypes were maintained by backcrossing to c57bl/6n females under a specific pathogen - free environment . rip2-cre transgenic mice ( 24 ) ( from jackson laboratory ) were first crossed with kif5b to generate kif5b ; rip2-cre mice . then kif5b ; rip2-cre mice were bred with kif5b mice to generate the final mutant mice ( kif5b : rip2-cre ) as well as their littermates ( kif5b , kif5b , and kif5b : rip2-cre ) . genotyping was performed by pcr using corresponding primers . to avoid hormonal effects in physiological assays , insulin contents in the islet extracts were analyzed by using the insulin elisa kit ( linco research ) and normalized to total protein concentrations determined by bradford method ( bio - rad ) . protein levels were determined by blotting with anti - kif5b primary antibody ( 1:2,000 , against synthesized peptide fdkekanleaftadkdia ) , anti - kif5a ( 1:1,000 , against synthesized peptide ngnatdindnrsdlpc ) , anti - kif5c ( 1:1,000 , against synthesized peptide sakdqkslepc ) , and anti - actin primary antibody ( 1:3,000 , sigma ) . paraffin sections were immunostained by primary antibodies against kif5b ( 1:400 ) , glucagon ( 1:1,000 , dako ) , and insulin ( 1:2,000 , sigma ) . visualization of these proteins was realized by incubating with fitc / cy3 or hrp - conjugated secondary antibodies . blood samples were collected by microvette cb300 ( sarstedt ) and centrifuged at 5,000 rpm for 5 min at room temperature . after centrifugation , supernatant was collected for determining plasma insulin levels by using insulin elisa kit ( linco research ) . paraffin sections of pancreata were processed for hematoxylin and eosin staining and observed by a light microscope ( carl zeiss ) . for transmission electron microscopy ( tem ) study , isolated islets were fixed by 2.5% glutaraldehyde in carcodylate buffer and embedded in 2% soft agar , followed by further embedding in fresh epoxy resin . ultrathin sections were examined on a philips em208s transmission electron microscope operated at 80 kv . -cell division was determined by 5-bromo-2-deoxyuridine ( brdu ) incorporation in 1-month - old mice using brdu staining kit ( zymed laboratory ) . pancreatic paraffin sections were further counterstained by hematoxylin and imaged with a zeiss axioskop microscope to count brdu -cells and total nuclei within islets . sigmastat ( systat software ) was used to analyze all data , which were expressed as mean se . the data were analyzed by one - way anova followed by tukey test or unpaired two - tailed student t test . the ability of rip2-cre to induce pancreatic -cell specific ablation has previously been reported when these founder mice were crossed with mice carrying various floxed genes including glucokinase ( 26 ) , insulin receptor ( 27 ) , mitochondrial transcription factor a ( 28 ) , and hepatocyte growth factor ( 25 ) . although rip2-cre displays a low level of expression in the hypothalamus , it exhibits high expression level in -cells within the pancreatic islet ( 24 ) . ablation of one kif5b allele was confirmed by southern blot as well as western blot analyses ( fig . p1 and p2 primers were used to differentiate the wild - type and knockout alleles . the distance between p1 and p2 was 6.6 kb in length , which was too long to be amplified by pcr genotyping . because of the deletion of exon 2 , a 219-bp pcr product could be amplified from the kif5b knockout allele accordingly ( fig . p1 and p3 primers , used to differentiate the floxed and wild - type kif5b alleles , result in two bands of 275 and 215 bp , respectively ( fig . targeted disruption of the mouse kif5b gene in es cells . a : targeting strategy with positive negative selection . strategy of genomic southern blot for screening for the homologous recombinant embryonic stem ( es ) cell clones is also included . e1 , e2 , e3 , e4 , and e5 represent exon 1 , exon 2 , exon 3 , exon 4 , and exon 5 of the kif5b gene , respectively . the solid square with bars on each side ( the bar representing an frt site ) represents the 1.7-kb frt - neo - frt cassette . a 15.5-kb fragment in wild - type and a 7.9-kb fragment after homologous recombination were expected by the 5 external probe . a 6.2-kb fragment in wild - type and a 7.6-kb fragment in targeted cells were expected by using the 3 external probe . c : western blot analysis of kif5b protein expression in different tissues in homozygous as well as heterozygous mice for the targeted kif5b mutation . a : schematic illustration of cre - mediated deletion of exon 2 from the kif5b allele . b : representative pictures show pcr analysis of the offspring genomic dna from ear . to detect the presence of the floxed kif5b allele , we used primer p1 5-tgaaggctaagtcagatatggatgc-3 located upstream of loxp site and p3 5-ttactaactgaacctggcttcctag-3 located downstream of loxp site . the presence of kif5b knockout allele was detected by primer p1 5-tgaaggctaagtcagatatggatgc-3 located in intron 1 and p2 5-ggattggcacctttacctagaagg-3 located in intron 2 of the kif5b gene . the rip - cre transgenic mice were identified by amplification of cre allele using primer 5-ggacatgttcagggatcgccaggcg-3 and 5-ggcatgttcagggatcgccaggcg-3. the pcr bands of wild - type ( 215 bp ) , floxed ( 275 bp ) , null allele ( 219 bp ) , and cre ( 250 bp ) are indicated . kif5b was mainly expressed in pancreatic islets ( endocrine portion ) with little expression in exocrine acinar glands ( fig . the positive staining was absent after preincubating the anti - kif5b antibody with the 18-aa synthesized peptides ( fig . the efficiency of rip-2-cre mediated pancreatic -cell specific deletion of exon 2 of kif5b allele , we examined the protein expression levels of kif5a , kif5b , and kif5c in hypothalamus and isolated islets from both mutant and wild - type mice ( fig . 3b ) . inactivation of kif5b by cre - induced ablation resulted in a reduction of kif5b protein level in islets , whereas both kif5a and kif5c were not detectable in islets although they are highly expressed in hypothalamus , consistent with an earlier finding that their expression is neuronal specific ( 29 ) . although rip2-cre displayed a low level of expression in the hypothalamus ( 24 ) , we could not detect significantly decreased kif5b expression in the hypothalamus due to cre expression . in contrast , western blot results showed that kif5b level in the isolated islets was reduced by at least 80% in mutant mice , compared with the wild - type . considering the fact that rip-2 cre is only expressed in 8090% of -cells and that -cells account for 75% of islet cells , the western blot result indicated that kif5b was absent in most -cells in the mutant mice islets . the knockout efficiency was further demonstrated by immunohistochemistry analysis of kif5b expression in pancreatic sections under identical conditions . a significant decrease of kif5b expression was observed in the islets from mutant mice compared with those in wild - type mice ( fig . , these results suggested that rip-2 cre mediated ablation of exon 2 in kif5b allele had efficiently occurred , leading to significantly reduced kif5b expression in the islets of mutant mice . a : immunohistochemistry analysis of kif5b expression in wild - type mice pancreas sections ( left ) and antibody specificity test ( right ) . b : western blot analysis of kif5a / kif5b / kif5c expression in hypothalamus and isolated islets from mutant and control mice . c : immunohistochemistry analysis of kif5b expression level in islets from control ( upper ) and mutant mouse ( lower ) . ( a high - quality color representation of this figure is available in the online issue . ) although there was no significant difference in body weight among newborn mice of different genotypes , the mutant mice had progressively reduced growth comparing to littermate controls after 3 weeks ( fig . the body weight differences between mutant and control littermates were significant ( as shown in the representative photo in fig . 4b ) and there was no significant difference among wild - type and heterozygous controls ( fig . 4a ) . physiological features of kif5b : rip2-cre mice . a : growth curves of male mice , wild - type ( triangle ) , heterozygous ( square ) , and mutant ( circle ) mice ( n = 612 ) . b : photograph of 8-week - old control ( left ) and mutant ( right ) male mice . c and d : blood glucose concentrations of male mice with different ages in nonfasting ( c ) and 16-h fasted ( d ) wild - type , heterozygous , and mutant mice ( n = 822 ) . there is no significant difference of the body weight or blood glucose level between wild - type and heterozygous mice , but these values of mutant mice are significantly different from that of wild - type mice with the same ages . * p < 0.05 , * * p < 0.01 . e and f : plasma insulin levels in nonfasting ( e ) and 16-h fasted ( f ) wild - type ( black bar ) , heterozygous ( white bar ) , and mutant mice ( striped bar ) ( n = 6 mice , 2- to 3-month - old ) . the plasma insulin levels in wild - type and heterozygous mice are not different from each other while they are statistically different from that of the mutant mice . to test the effect of kif5b conditional knockout on glucose homeostasis , we first analyzed the blood glucose level as well as plasma insulin level in both mutant mice and littermate controls . mutant mice had progressively increased hyperglycemia compared with control littermates in both random ( fig . consistent with an elevated glucose level , mutant mice had lower plasma insulin concentrations in fasting conditions ( fig . 4e ) . there were no significant differences in the blood glucose levels as well as plasma insulin concentrations between wild - type and heterozygous controls . we next assessed the impact of inactivation of kif5b on glucose - regulated insulin secretion in vivo ( fig . the responses of 2- to 3-month - old mutant mice and control littermates to glucose challenge were examined by performing an intraperitoneal glucose tolerance test ( gtt ) after 16-h overnight fast . kif5b : cre mice showed slight glucose intolerance compared with wild - type mice , which may be due to cre expression in -cells ( 30 ) in addition to the ablation of one kif5b allele . comparison of the gtt responses between mutant mice and kif5b : cre mice showed that kif5b conditional knockout mice had markedly impaired glucose tolerance and this intolerance was not a result of cre expression . although the mutant mice had hyperglycemia and glucose intolerance compared with wild - type and kif5b : cre mice , the blood glucose levels dropped to a similar level as control mice at 15 min after insulin injection ( fig . a : intraperitoneal ( i.p . ) gtts were performed on overnight - fasted wild - type ( triangle ) , heterozygous ( square ) , and mutant mice ( circle ) . after overnight fasting , mice were injected with glucose ( 2 g / kg body wt i.p . ) and blood glucose levels were monitored immediately before and 15 , 30 , 60 , and 120 min after glucose injection ( n = 56 mice per group , 2- to 3-month - old ) . mutant mice exhibited reduced glucose tolerance compared with wild - type control , as revealed by significantly increased blood glucose concentrations at corresponding time points ( * p < 0.05 , * * p < 0.01 ) . the glucose tolerance ability was not significantly affected by half reduction of kif5b expression , because there is no difference for the blood glucose level between control and heterozygous mice . b : insulin sensitivity test was performed on random - fed mice ( n = 58 mice per group , 2- to 3-month - old ) . blood glucose level was measured at the time points indicated before and after intraperitoneal injection of human regular insulin ( 0.75 units / kg body wt ) . although the blood glucose level is high in mutant mice before insulin administration , there is no difference of the glucose level after insulin intraperitoneal injection among the three genotype mice . c : gsis was carried out on overnight - fasted mice as well as isolated islets . glucose ( 3 g / kg ) was administrated intraperitoneally to overnight ( 16-h ) fasted mice ( n = 5 mice per group , 2- to 3-month - old ) . d : in vitro gsis was carried out on groups of 10 islets of similar sizes obtained from wild - type ( black bar ) , heterozygous ( white bar ) , and mutant ( striped bar ) mice and incubated in krebs - ringer bicarbonate buffer , supplemented with 10% fbs for 30 min with different glucose concentrations . experiments were performed in duplicate , and insulin levels were determined by elisa ( n = 45 groups for each genotype ) . significant decreases in gsis were observed in mutant mice islets incubated at 5 , 10 , and 20 mmol / l glucose compared with wild - type mice at the same glucose concentration , and there was no difference between wild - type and heterozygous mice under any glucose concentration . e : insulin release response to indicated concentrations of kcl treatment ( n = 34 groups for each genotype ) . mutant islets exhibit reduced insulin secretion under the stimulation of high concentration of k. f : islet insulin content from control ( black bar ) and mutant islets ( white bar ) ( n = 5 mice per group ) . . to evaluate the effect of kif5b deletion on -cell function , insulin secretion in response to high glucose challenge was examined in 2- to 3-month old mice ( fig . insulin secretion was increased by about twofold at 2.5 min after intraperitoneal injection of glucose , reaching a peak at about 5 min , and remained higher than base level for at least 1 h. glucose tolerance and insulin release were slightly impaired in kif5b : cre mice compared with wild - type mice in the first 30 min after glucose injection , but the glucose and insulin levels were similar in both genotype mice by 60 min . however , both the early and slow phase of insulin secretion were impaired in kif5b : cre mice . these results indicated that glucose intolerance in kif5b conditional knockout mice was not associated with insulin resistance ( fig . 5b ) but was related to an insulin secretory defect in response to glucose challenge ( fig . it is possible that impaired insulin secretion could be secondary , particularly when considering the expression of cre in hypothalamic or pituitary cells . to address this possibility , we studied gsis in isolated islets from mice with different genotypes ( fig . as expected , mutant islets secreted significantly less insulin than control islets under glucose - stimulated conditions . furthermore , the insulin - secretion defect was progressively enhanced in mutant islets with an increase in glucose concentration . a high level of kcl is known to trigger insulin secretion by inducing plasma membrane depolarization followed by ca influx ( 1 ) . to further investigate the effect of kif5b knockout on insulin secretion , kcl - stimulated insulin release from islets the wild - type islets exhibited stronger secretory responses than mutant islets . to rule out the possibility that insulin is produced at a lower level in the mutant islet than in the wild - type the result demonstrated that the insulin level in mutant mouse was not less than that of wild - type control ( fig . a quantitative analysis of islet insulin content was carried out by elisa to confirm the result . results indicated that more insulin accumulated in mutant islets compared with wild - type , although the difference was not statistically significant ( fig . , it is most likely that the impaired insulin secretion in mutant mice is due to a primary defect in -cell function . kif5b : rip2-cre mice had normal islet morphology , islet cell composition , and -cell size . a slight increase in islet insulin content was observed . a : immunofluorescence staining for insulin ( green ) and glucagon ( red ) in control ( upper ) and mutant mice ( lower ) ( 2- to 3-month - old ) . b : statistical analysis of - and -cell ratio in control ( black bar ) and mutant ( white bar ) mice ( n = 3 mice per group ) ; immunofluorescent staining was carried out on two sections ( > 300 m apart ) for -cell ( red ) and -cell ( green ) , and all islets on the sections were imaged . ( a high - quality color representation of this figure is available in the online issue . ) islets from mutant mice showed similar cellular arrangements and compositions as wild - type mice , with the majority of cells being -cells and with glucagon - positive -cells in the periphery region ( fig . . there were no significant differences of - and -cell ratio between mutant and wild - type islets ( fig . because kif5b has been reported to transport insulin vesicles in -cell lines ( min6 & ins-1 ) ( 18 ) and mitochondria in neurons ( 31 ) , we further analyzed the distribution of these vesicles / organelles in mutant and wild - type -cells by tem studies ( fig . 7 ) . compared with the control , mitochondria in mutant -cells were found to be more likely to cluster in the perinuclear region ( fig . further quantitative analysis of the distribution of mitochondria in -cells confirmed that 70% of mitochondria were closer to the nuclear membrane than to the plasma membrane after kif5b knockout whereas mitochondria in wild - type -cells were evenly distributed in the cells ( fig . this is consistent with earlier findings that kif5b is involved in mitochondria translocation ( 32 ) . ultrastructural insights in pancreatic -cell based on tem study . a : representative tem photos of -cell from control ( left ) and the x - axis represents the ratio of distances from mitochondria to nucleus and to cell membrane . a ratio < 1 indicates that mitochondria are closer to the nucleus , whereas a ratio > 1 indicates that mitochondria are closer to the plasma membrane . ( fifteen and 26 -cells are randomly photographed for wild - type and mutant mice , respectively . ) * p < 0.05 , * * p < 0.01 . the subcellular localization of insulin vesicles was then analyzed and found to not be affected significantly by the decreased kif5b level . the cytoplasm of both wild - type and mutant -cells were filled with insulin vesicles . insulin vesicle numbers per square m were determined by counting all insulin vesicles in randomly photographed -cells ( fig . interestingly , a number of small islets were observed in mutant mice as shown in the representative microphotographs in figure 8a . quantitation of the islet number and size confirmed that the average size of the islet in mutants was smaller than that of the wild - type mice ( fig . however , the total islet mass was not decreased in kif5b deficient mice ( fig . histomorphometric analysis of the size and number of islets in these pancreatic specimens showed that the number of islets < 4,000 m was significantly increased in kif5b conditional knockout mice . however , the number of islets > 4,000 m in mutant mice was comparable to that of wild - type control ( fig . 8f ) ; therefore , the major factor accounting for reduced islet size was reduced cell number in an islet . we analyzed islet cell proliferation rates in pancreatic sections obtained from 1-month - old mice by brdu labeling . as shown in figure 8 g , islet cell proliferation was reduced by 50% relative to the wild - type control . there was no detectable increase in islet -cell apoptotic rate based on tunel analysis ( supplementary fig . kif5b : rip2-cre mice exhibited reduced islet size in pancreas . a : representative microphotographs of pancreatic sections from a control ( left ) and a mutant mouse ( right ) stained by insulin antibody showed the presence of multiples of small islets . b : statistical analysis of the average size of islets in pancreatic samples from control ( black bar ) and mutant mice ( white bar ) ( all islets in ten whole sections [ > 300 m apart ] from three wild - type mice and mutant mice were photographed and analyzed ) . e : histomorphometric analysis of the size and number of islets in these pancreatic samples from control and mutant mice . g : frequency of brdu staining nuclei in islets as the percentage of total islet nuclei ( 59 and 62 islets corresponding to three wild - type and three mutant mice , respectively , were imaged and counted ) . scale bar = 200 m . * ( a high - quality color representation of this figure is available in the online issue . ) the ability of rip2-cre to induce pancreatic -cell specific ablation has previously been reported when these founder mice were crossed with mice carrying various floxed genes including glucokinase ( 26 ) , insulin receptor ( 27 ) , mitochondrial transcription factor a ( 28 ) , and hepatocyte growth factor ( 25 ) . although rip2-cre displays a low level of expression in the hypothalamus , it exhibits high expression level in -cells within the pancreatic islet ( 24 ) . ablation of one kif5b allele was confirmed by southern blot as well as western blot analyses ( fig . p1 and p2 primers were used to differentiate the wild - type and knockout alleles . the distance between p1 and p2 was 6.6 kb in length , which was too long to be amplified by pcr genotyping . because of the deletion of exon 2 , a 219-bp pcr product could be amplified from the kif5b knockout allele accordingly ( fig . p1 and p3 primers , used to differentiate the floxed and wild - type kif5b alleles , result in two bands of 275 and 215 bp , respectively ( fig . targeted disruption of the mouse kif5b gene in es cells . a : targeting strategy with positive negative selection . strategy of genomic southern blot for screening for the homologous recombinant embryonic stem ( es ) cell clones is also included . e1 , e2 , e3 , e4 , and e5 represent exon 1 , exon 2 , exon 3 , exon 4 , and exon 5 of the kif5b gene , respectively . the solid square with bars on each side ( the bar representing an frt site ) represents the 1.7-kb frt - neo - frt cassette . a 15.5-kb fragment in wild - type and a 7.9-kb fragment after homologous recombination were expected by the 5 external probe . a 6.2-kb fragment in wild - type and a 7.6-kb fragment in targeted cells were expected by using the 3 external probe . c : western blot analysis of kif5b protein expression in different tissues in homozygous as well as heterozygous mice for the targeted kif5b mutation . a : schematic illustration of cre - mediated deletion of exon 2 from the kif5b allele . b : representative pictures show pcr analysis of the offspring genomic dna from ear . to detect the presence of the floxed kif5b allele , we used primer p1 5-tgaaggctaagtcagatatggatgc-3 located upstream of loxp site and p3 5-ttactaactgaacctggcttcctag-3 located downstream of loxp site . the presence of kif5b knockout allele was detected by primer p1 5-tgaaggctaagtcagatatggatgc-3 located in intron 1 and p2 5-ggattggcacctttacctagaagg-3 located in intron 2 of the kif5b gene . the rip - cre transgenic mice were identified by amplification of cre allele using primer 5-ggacatgttcagggatcgccaggcg-3 and 5-ggcatgttcagggatcgccaggcg-3. the pcr bands of wild - type ( 215 bp ) , floxed ( 275 bp ) , null allele ( 219 bp ) , and cre ( 250 bp ) are indicated . kif5b was mainly expressed in pancreatic islets ( endocrine portion ) with little expression in exocrine acinar glands ( fig . the positive staining was absent after preincubating the anti - kif5b antibody with the 18-aa synthesized peptides ( fig . the efficiency of rip-2-cre mediated pancreatic -cell specific deletion of exon 2 of kif5b allele , we examined the protein expression levels of kif5a , kif5b , and kif5c in hypothalamus and isolated islets from both mutant and wild - type mice ( fig . 3b ) . inactivation of kif5b by cre - induced ablation resulted in a reduction of kif5b protein level in islets , whereas both kif5a and kif5c were not detectable in islets although they are highly expressed in hypothalamus , consistent with an earlier finding that their expression is neuronal specific ( 29 ) . although rip2-cre displayed a low level of expression in the hypothalamus ( 24 ) , we could not detect significantly decreased kif5b expression in the hypothalamus due to cre expression . in contrast , western blot results showed that kif5b level in the isolated islets was reduced by at least 80% in mutant mice , compared with the wild - type . considering the fact that rip-2 cre is only expressed in 8090% of -cells and that -cells account for 75% of islet cells , the western blot result indicated that kif5b was absent in most -cells in the mutant mice islets . the knockout efficiency was further demonstrated by immunohistochemistry analysis of kif5b expression in pancreatic sections under identical conditions . a significant decrease of kif5b expression was observed in the islets from mutant mice compared with those in wild - type mice ( fig . , these results suggested that rip-2 cre mediated ablation of exon 2 in kif5b allele had efficiently occurred , leading to significantly reduced kif5b expression in the islets of mutant mice . a : immunohistochemistry analysis of kif5b expression in wild - type mice pancreas sections ( left ) and antibody specificity test ( right ) . b : western blot analysis of kif5a / kif5b / kif5c expression in hypothalamus and isolated islets from mutant and control mice . c : immunohistochemistry analysis of kif5b expression level in islets from control ( upper ) and mutant mouse ( lower ) . ( a high - quality color representation of this figure is available in the online issue . ) although there was no significant difference in body weight among newborn mice of different genotypes , the mutant mice had progressively reduced growth comparing to littermate controls after 3 weeks ( fig . the body weight differences between mutant and control littermates were significant ( as shown in the representative photo in fig . 4b ) and there was no significant difference among wild - type and heterozygous controls ( fig . 4a ) . physiological features of kif5b : rip2-cre mice . a : growth curves of male mice , wild - type ( triangle ) , heterozygous ( square ) , and mutant ( circle ) mice ( n = 612 ) . b : photograph of 8-week - old control ( left ) and mutant ( right ) male mice . c and d : blood glucose concentrations of male mice with different ages in nonfasting ( c ) and 16-h fasted ( d ) wild - type , heterozygous , and mutant mice ( n = 822 ) . there is no significant difference of the body weight or blood glucose level between wild - type and heterozygous mice , but these values of mutant mice are significantly different from that of wild - type mice with the same ages . * p < 0.05 , * * p < 0.01 . e and f : plasma insulin levels in nonfasting ( e ) and 16-h fasted ( f ) wild - type ( black bar ) , heterozygous ( white bar ) , and mutant mice ( striped bar ) ( n = 6 mice , 2- to 3-month - old ) . the plasma insulin levels in wild - type and heterozygous mice are not different from each other while they are statistically different from that of the mutant mice . to test the effect of kif5b conditional knockout on glucose homeostasis , we first analyzed the blood glucose level as well as plasma insulin level in both mutant mice and littermate controls . mutant mice had progressively increased hyperglycemia compared with control littermates in both random ( fig . consistent with an elevated glucose level , mutant mice had lower plasma insulin concentrations in fasting conditions ( fig . 4e ) . there were no significant differences in the blood glucose levels as well as plasma insulin concentrations between wild - type and heterozygous controls . we next assessed the impact of inactivation of kif5b on glucose - regulated insulin secretion in vivo ( fig . the responses of 2- to 3-month - old mutant mice and control littermates to glucose challenge were examined by performing an intraperitoneal glucose tolerance test ( gtt ) after 16-h overnight fast . kif5b : cre mice showed slight glucose intolerance compared with wild - type mice , which may be due to cre expression in -cells ( 30 ) in addition to the ablation of one kif5b allele . comparison of the gtt responses between mutant mice and kif5b : cre mice showed that kif5b conditional knockout mice had markedly impaired glucose tolerance and this intolerance was not a result of cre expression . although the mutant mice had hyperglycemia and glucose intolerance compared with wild - type and kif5b : cre mice , the blood glucose levels dropped to a similar level as control mice at 15 min after insulin injection ( fig . a : intraperitoneal ( i.p . ) gtts were performed on overnight - fasted wild - type ( triangle ) , heterozygous ( square ) , and mutant mice ( circle ) . after overnight fasting , mice were injected with glucose ( 2 g / kg body wt i.p . ) and blood glucose levels were monitored immediately before and 15 , 30 , 60 , and 120 min after glucose injection ( n = 56 mice per group , 2- to 3-month - old ) . mutant mice exhibited reduced glucose tolerance compared with wild - type control , as revealed by significantly increased blood glucose concentrations at corresponding time points ( * p < 0.05 , * * p < 0.01 ) . the glucose tolerance ability was not significantly affected by half reduction of kif5b expression , because there is no difference for the blood glucose level between control and heterozygous mice . b : insulin sensitivity test was performed on random - fed mice ( n = 58 mice per group , 2- to 3-month - old ) . blood glucose level was measured at the time points indicated before and after intraperitoneal injection of human regular insulin ( 0.75 units / kg body wt ) . although the blood glucose level is high in mutant mice before insulin administration , there is no difference of the glucose level after insulin intraperitoneal injection among the three genotype mice . c : gsis was carried out on overnight - fasted mice as well as isolated islets . glucose ( 3 g / kg ) was administrated intraperitoneally to overnight ( 16-h ) fasted mice ( n = 5 mice per group , 2- to 3-month - old ) . d : in vitro gsis was carried out on groups of 10 islets of similar sizes obtained from wild - type ( black bar ) , heterozygous ( white bar ) , and mutant ( striped bar ) mice and incubated in krebs - ringer bicarbonate buffer , supplemented with 10% fbs for 30 min with different glucose concentrations . experiments were performed in duplicate , and insulin levels were determined by elisa ( n = 45 groups for each genotype ) . significant decreases in gsis were observed in mutant mice islets incubated at 5 , 10 , and 20 mmol / l glucose compared with wild - type mice at the same glucose concentration , and there was no difference between wild - type and heterozygous mice under any glucose concentration . e : insulin release response to indicated concentrations of kcl treatment ( n = 34 groups for each genotype ) . mutant islets exhibit reduced insulin secretion under the stimulation of high concentration of k. f : islet insulin content from control ( black bar ) and mutant islets ( white bar ) ( n = 5 mice per group ) . . to evaluate the effect of kif5b deletion on -cell function , insulin secretion in response to high glucose challenge was examined in 2- to 3-month old mice ( fig . insulin secretion was increased by about twofold at 2.5 min after intraperitoneal injection of glucose , reaching a peak at about 5 min , and remained higher than base level for at least 1 h. glucose tolerance and insulin release were slightly impaired in kif5b : cre mice compared with wild - type mice in the first 30 min after glucose injection , but the glucose and insulin levels were similar in both genotype mice by 60 min . however , both the early and slow phase of insulin secretion were impaired in kif5b : cre mice . these results indicated that glucose intolerance in kif5b conditional knockout mice was not associated with insulin resistance ( fig . 5b ) but was related to an insulin secretory defect in response to glucose challenge ( fig . it is possible that impaired insulin secretion could be secondary , particularly when considering the expression of cre in hypothalamic or pituitary cells . to address this possibility , we studied gsis in isolated islets from mice with different genotypes ( fig . as expected , mutant islets secreted significantly less insulin than control islets under glucose - stimulated conditions . furthermore , the insulin - secretion defect was progressively enhanced in mutant islets with an increase in glucose concentration . a high level of kcl is known to trigger insulin secretion by inducing plasma membrane depolarization followed by ca influx ( 1 ) . to further investigate the effect of kif5b knockout on insulin secretion , kcl - stimulated insulin release from islets the wild - type islets exhibited stronger secretory responses than mutant islets . to rule out the possibility that insulin is produced at a lower level in the mutant islet than in the wild - type the result demonstrated that the insulin level in mutant mouse was not less than that of wild - type control ( fig . a quantitative analysis of islet insulin content was carried out by elisa to confirm the result . results indicated that more insulin accumulated in mutant islets compared with wild - type , although the difference was not statistically significant ( fig . , it is most likely that the impaired insulin secretion in mutant mice is due to a primary defect in -cell function . kif5b : rip2-cre mice had normal islet morphology , islet cell composition , and -cell size . a slight increase in islet insulin content was observed . a : immunofluorescence staining for insulin ( green ) and glucagon ( red ) in control ( upper ) and mutant mice ( lower ) ( 2- to 3-month - old ) . b : statistical analysis of - and -cell ratio in control ( black bar ) and mutant ( white bar ) mice ( n = 3 mice per group ) ; immunofluorescent staining was carried out on two sections ( > 300 m apart ) for -cell ( red ) and -cell ( green ) , and all islets on the sections were imaged . ( a high - quality color representation of this figure is available in the online issue . ) although there was no significant difference in body weight among newborn mice of different genotypes , the mutant mice had progressively reduced growth comparing to littermate controls after 3 weeks ( fig . the body weight differences between mutant and control littermates were significant ( as shown in the representative photo in fig . 4b ) and there was no significant difference among wild - type and heterozygous controls ( fig . a : growth curves of male mice , wild - type ( triangle ) , heterozygous ( square ) , and mutant ( circle ) mice ( n = 612 ) . b : photograph of 8-week - old control ( left ) and mutant ( right ) male mice . c and d : blood glucose concentrations of male mice with different ages in nonfasting ( c ) and 16-h fasted ( d ) wild - type , heterozygous , and mutant mice ( n = 822 ) . there is no significant difference of the body weight or blood glucose level between wild - type and heterozygous mice , but these values of mutant mice are significantly different from that of wild - type mice with the same ages . * p < 0.05 , * * p < 0.01 . e and f : plasma insulin levels in nonfasting ( e ) and 16-h fasted ( f ) wild - type ( black bar ) , heterozygous ( white bar ) , and mutant mice ( striped bar ) ( n = 6 mice , 2- to 3-month - old ) . the plasma insulin levels in wild - type and heterozygous mice are not different from each other while they are statistically different from that of the mutant mice . to test the effect of kif5b conditional knockout on glucose homeostasis , we first analyzed the blood glucose level as well as plasma insulin level in both mutant mice and littermate controls . mutant mice had progressively increased hyperglycemia compared with control littermates in both random ( fig . consistent with an elevated glucose level , mutant mice had lower plasma insulin concentrations in fasting conditions ( fig . 4e ) . there were no significant differences in the blood glucose levels as well as plasma insulin concentrations between wild - type and heterozygous controls . we next assessed the impact of inactivation of kif5b on glucose - regulated insulin secretion in vivo ( fig . the responses of 2- to 3-month - old mutant mice and control littermates to glucose challenge were examined by performing an intraperitoneal glucose tolerance test ( gtt ) after 16-h overnight fast . kif5b : cre mice showed slight glucose intolerance compared with wild - type mice , which may be due to cre expression in -cells ( 30 ) in addition to the ablation of one kif5b allele . comparison of the gtt responses between mutant mice and kif5b : cre mice showed that kif5b conditional knockout mice had markedly impaired glucose tolerance and this intolerance was not a result of cre expression . although the mutant mice had hyperglycemia and glucose intolerance compared with wild - type and kif5b : cre mice , the blood glucose levels dropped to a similar level as control mice at 15 min after insulin injection ( fig . a : intraperitoneal ( i.p . ) gtts were performed on overnight - fasted wild - type ( triangle ) , heterozygous ( square ) , and mutant mice ( circle ) . after overnight fasting , mice were injected with glucose ( 2 g / kg body wt i.p . ) and blood glucose levels were monitored immediately before and 15 , 30 , 60 , and 120 min after glucose injection ( n = 56 mice per group , 2- to 3-month - old ) . mutant mice exhibited reduced glucose tolerance compared with wild - type control , as revealed by significantly increased blood glucose concentrations at corresponding time points ( * p < 0.05 , * * p < 0.01 ) . the glucose tolerance ability was not significantly affected by half reduction of kif5b expression , because there is no difference for the blood glucose level between control and heterozygous mice . b : insulin sensitivity test was performed on random - fed mice ( n = 58 mice per group , 2- to 3-month - old ) . blood glucose level was measured at the time points indicated before and after intraperitoneal injection of human regular insulin ( 0.75 units / kg body wt ) . although the blood glucose level is high in mutant mice before insulin administration , there is no difference of the glucose level after insulin intraperitoneal injection among the three genotype mice . c : gsis was carried out on overnight - fasted mice as well as isolated islets . glucose ( 3 g / kg ) was administrated intraperitoneally to overnight ( 16-h ) fasted mice ( n = 5 mice per group , 2- to 3-month - old ) . d : in vitro gsis was carried out on groups of 10 islets of similar sizes obtained from wild - type ( black bar ) , heterozygous ( white bar ) , and mutant ( striped bar ) mice and incubated in krebs - ringer bicarbonate buffer , supplemented with 10% fbs for 30 min with different glucose concentrations . experiments were performed in duplicate , and insulin levels were determined by elisa ( n = 45 groups for each genotype ) . significant decreases in gsis were observed in mutant mice islets incubated at 5 , 10 , and 20 mmol / l glucose compared with wild - type mice at the same glucose concentration , and there was no difference between wild - type and heterozygous mice under any glucose concentration . e : insulin release response to indicated concentrations of kcl treatment ( n = 34 groups for each genotype ) . mutant islets exhibit reduced insulin secretion under the stimulation of high concentration of k. f : islet insulin content from control ( black bar ) and mutant islets ( white bar ) ( n = 5 mice per group ) . . to evaluate the effect of kif5b deletion on -cell function , insulin secretion in response to high glucose challenge was examined in 2- to 3-month old mice ( fig . insulin secretion was increased by about twofold at 2.5 min after intraperitoneal injection of glucose , reaching a peak at about 5 min , and remained higher than base level for at least 1 h. glucose tolerance and insulin release were slightly impaired in kif5b : cre mice compared with wild - type mice in the first 30 min after glucose injection , but the glucose and insulin levels were similar in both genotype mice by 60 min . however , both the early and slow phase of insulin secretion were impaired in kif5b : cre mice . these results indicated that glucose intolerance in kif5b conditional knockout mice was not associated with insulin resistance ( fig . 5b ) but was related to an insulin secretory defect in response to glucose challenge ( fig . it is possible that impaired insulin secretion could be secondary , particularly when considering the expression of cre in hypothalamic or pituitary cells . to address this possibility as expected , mutant islets secreted significantly less insulin than control islets under glucose - stimulated conditions . furthermore , the insulin - secretion defect was progressively enhanced in mutant islets with an increase in glucose concentration . a high level of kcl is known to trigger insulin secretion by inducing plasma membrane depolarization followed by ca influx ( 1 ) . to further investigate the effect of kif5b knockout on insulin secretion , kcl - stimulated insulin release from islets was analyzed by 30 mmol / l kcl treatment ( fig . the wild - type islets exhibited stronger secretory responses than mutant islets . to rule out the possibility that insulin is produced at a lower level in the mutant islet than in the wild - type , the result demonstrated that the insulin level in mutant mouse was not less than that of wild - type control ( fig . a quantitative analysis of islet insulin content was carried out by elisa to confirm the result . results indicated that more insulin accumulated in mutant islets compared with wild - type , although the difference was not statistically significant ( fig . it is most likely that the impaired insulin secretion in mutant mice is due to a primary defect in -cell function . kif5b : rip2-cre mice had normal islet morphology , islet cell composition , and -cell size . a slight increase in islet insulin content was observed . a : immunofluorescence staining for insulin ( green ) and glucagon ( red ) in control ( upper ) and mutant mice ( lower ) ( 2- to 3-month - old ) . b : statistical analysis of - and -cell ratio in control ( black bar ) and mutant ( white bar ) mice ( n = 3 mice per group ) ; immunofluorescent staining was carried out on two sections ( > 300 m apart ) for -cell ( red ) and -cell ( green ) , and all islets on the sections were imaged . ( a high - quality color representation of this figure is available in the online issue . ) islets from mutant mice showed similar cellular arrangements and compositions as wild - type mice , with the majority of cells being -cells and with glucagon - positive -cells in the periphery region ( fig . there were no significant differences of - and -cell ratio between mutant and wild - type islets ( fig . because kif5b has been reported to transport insulin vesicles in -cell lines ( min6 & ins-1 ) ( 18 ) and mitochondria in neurons ( 31 ) , we further analyzed the distribution of these vesicles / organelles in mutant and wild - type -cells by tem studies ( fig . 7 ) . compared with the control , mitochondria in mutant -cells were found to be more likely to cluster in the perinuclear region ( fig . further quantitative analysis of the distribution of mitochondria in -cells confirmed that 70% of mitochondria were closer to the nuclear membrane than to the plasma membrane after kif5b knockout whereas mitochondria in wild - type -cells were evenly distributed in the cells ( fig . this is consistent with earlier findings that kif5b is involved in mitochondria translocation ( 32 ) . a : representative tem photos of -cell from control ( left ) and mutant ( right ) mice . nuclei ( n ) were located centrally in both cells . the x - axis represents the ratio of distances from mitochondria to nucleus and to cell membrane . a ratio < 1 indicates that mitochondria are closer to the nucleus , whereas a ratio > 1 indicates that mitochondria are closer to the plasma membrane . ( fifteen and 26 -cells are randomly photographed for wild - type and mutant mice , respectively . ) * p < 0.05 , * * p < 0.01 . the subcellular localization of insulin vesicles was then analyzed and found to not be affected significantly by the decreased kif5b level . the cytoplasm of both wild - type and mutant -cells were filled with insulin vesicles . insulin vesicle numbers per square m were determined by counting all insulin vesicles in randomly photographed -cells ( fig . interestingly , a number of small islets were observed in mutant mice as shown in the representative microphotographs in figure 8a . quantitation of the islet number and size confirmed that the average size of the islet in mutants was smaller than that of the wild - type mice ( fig . however , the total islet mass was not decreased in kif5b deficient mice ( fig . histomorphometric analysis of the size and number of islets in these pancreatic specimens showed that the number of islets < 4,000 m was significantly increased in kif5b conditional knockout mice . however , the number of islets > 4,000 m in mutant mice was comparable to that of wild - type control ( fig . 8f ) ; therefore , the major factor accounting for reduced islet size was reduced cell number in an islet . we analyzed islet cell proliferation rates in pancreatic sections obtained from 1-month - old mice by brdu labeling . as shown in figure 8 g , islet cell proliferation was reduced by 50% relative to the wild - type control . there was no detectable increase in islet -cell apoptotic rate based on tunel analysis ( supplementary fig . 1 , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1078/dc1 ) . kif5b : rip2-cre mice exhibited reduced islet size in pancreas . a : representative microphotographs of pancreatic sections from a control ( left ) and a mutant mouse ( right ) stained by insulin antibody showed the presence of multiples of small islets . b : statistical analysis of the average size of islets in pancreatic samples from control ( black bar ) and mutant mice ( white bar ) ( all islets in ten whole sections [ > 300 m apart ] from three wild - type mice and mutant mice were photographed and analyzed ) . e : histomorphometric analysis of the size and number of islets in these pancreatic samples from control and mutant mice . g : frequency of brdu staining nuclei in islets as the percentage of total islet nuclei ( 59 and 62 islets corresponding to three wild - type and three mutant mice , respectively , were imaged and counted ) . ( a high - quality color representation of this figure is available in the online issue . ) to study the role of kinesin-1 in pancreatic -cells in vivo , we have generated cell - specific kif5b - insko mice ( kif5b : rip2-cre ) by crossing kif5b mice with kif5b : rip - cre mice , in which cre recombinase is expressed under the control of rat insulin gene promoter ( rip2 ) . although rip2-cre in pancreatic -cells may have some effect on glucose tolerance in mice ( 30 ) , this molecular genetic approach allows in vivo studies of specific gene function and could exclude possible side effects of in vitro introduction of anti - kinesin antibodies ( 33 ) and overexpression of dominant - negative - acting kinesin ( 18 ) , which may interfere with biological processes such as endoplasmic reticulum stress . this in vivo study reveals that kif5b plays an important role for -cell function and development . change in -cell function was not coupled with changes in islet cell size , islet morphology , and islet cell composition but was associated with a reduced islet size as a consequence of decreased -cell proliferation rate . physiological examination found that kif5b - insko mice displayed hyperglycemia and decreased plasma insulin levels , together with significantly diminished glucose tolerance and defective insulin secretion , suggesting a role of kif5b in -cell function . our results confirm that kif5b is required for normal gsis in an in vivo model . however , rip2-cre expression in hypothalamus and pituitary ( 24,34 ) may also lead to the knockout of kif5b in insulin - positive cells , although no significant reduction of kif5b level due to cre expression was observed in hypothalamic lysates of kif5b - insko mice . the functions of kif5b in hypothalamic and pituitary endocrine hormone secretion are unknown at the current stage . therefore , we can not rule out the possibility that the observed poor growth is also related to reduced growth hormone and/or insulin - like growth factor secretion . in vitro studies showed that suppression of kif5b by overexpression of dominant - negative - acting kif5b inhibited only the sustained phase of gsis in clonal -cells ( 18 ) . 5a and c ) indicated that the defective insulin response to glucose in a kif5b - insko mouse occurred in both the early phase and the slow phase . the early phase of insulin secretion is accompanied by ca influx induced exocytosis ( 1 ) , which requires the metabolism of glucose to create atp in mitochondria , leading to depolarization of the cell due to the closing of atp - gated potassium channels . kif5b and kif5c have been reported to bind to ranbp2 to determine mitochondria localization and function in neurons ( 31 ) . in the current study , we found that mitochondria significantly accumulate at the perinuclear region in the -cell of kif5b - insko mice . although disruption of kif5b in extraembryonic cells upregulated the mrna expression level of kif5a and kif5c ( 32 ) , there is no apparent upregulation of kif5a / kif5c at the protein level in mutant -cells , indicating that kif5b is the major motor responsible for the dispersion of mitochondria in pancreatic -cells . the deficiency of mitochondria at the cell peripheral regions may attenuate glucose - to - atp conversion and partially account for the defect in the early phase of gsis in response to glucose challenge . to examine whether blocked kif5b - mediated insulin vesicle transportation in kif5b - insko mice may lead to a decrease in predocked vesicles ready for exocytosis however , we observed no significant differences in the number and size of predocked insulin vesicles in kif5b - insko mice compared with control mice at the resolution used . bi et al . ( 33 ) observed that khc ( or kif5b ) antibody suk4 as well as the stalk - tail fragment of khc specifically inhibited ca - regulated exocytosis in lytechinus pictus sea urchins . therefore , exocytosis of insulin vesicles could also be affected in the kif5b knockout islet . in neurons , it was demonstrated that kif5b can directly bind to syntabulin and snap25 to mediate transportation of syntaxin containing vesicles and synaptosome ( 35,36 ) . syntaxin and snap25 constitute the t - snares at the plasma membrane and are functionally required for ca - triggered insulin exocytosis in -cells ( 37 ) . snap25 mutant mice had impaired insulin granule priming , exocytosis , and recycling in pancreatic -cells ( 38 ) . it is possible that knockout of kif5b in pancreatic -cells affects the normal distribution and function of the snare complex , thereby leading to defects in insulin granule exocytosis . furthermore , kif5b functions in several cellular processes including lysosomal distribution and stability in cancer cells and extraembryonic cells ( 32,39 ) , endoplasmic reticulum to golgi transportation in hela cells ( 40 ) , transportation and axonal targeting of kv1 channels ( 41 ) , axonal transport of tubulin heterodimer for microtubule polymerization ( 42 ) as well as ribosome translocation ( 43 ) , etc it is tempting to speculate that weakening of both the early and slow phases of insulin response to glucose in kif5b - insko mice results from defects in a series of cellular functions after knockout of kif5b in pancreatic -cells . taken together , kif5b probably exerts a modulatory effect in regulating insulin granule priming and exocytosis in addition to mechanically transporting insulin vesicles . furthermore , impaired early insulin response is consistent with a defect in glucose tolerance , because the early response is more important for glucose disposal ( 44 ) . insulin secretion defects result in a positive feedback for the synthesis of insulin in -cells , thereby leading to accumulation of insulin in kif5b - insko mice islets . ( 45 ) reported that increased [ ca]i can activate calcineurin in -granules leading to dephosphorylation of khc , which is required for transport of -granules from the storage pool to replenish the readily releasable pool of -granules . the rab3a calmodulin interaction on -granules is required for activation of calcineurin and dephosphorylation of khc ( 46 ) . ( 47 ) found that knockout of rab3a in pancreatic -cells leads to blunted first - phase glucose induced insulin release in vitro and in vivo . our results together with these studies indicate that any defect of synthesis or dephosphorylation process of khc can lead to impaired insulin exocytosis . on the basis of histomorphological investigations , we found a notable increase in the number of small islets in kif5b - insko mice ( fig . 8a and e ) . brdu staining of 1-month - old mice confirmed that the decreased islet size in kif5b - insko mice was due to a defect in islet cell proliferation ( fig . furthermore , decreased cell proliferation rate was also observed in kif5b deficient madin - darby canine kidney cells ( supplementary fig . 2 , available in an online appendix ) , suggesting that kif5b plays a conventional role during cell division . zhu et al . ( 48 ) systematically analyzed the functions of all human kinesin / dynein microtubule motor proteins by rna interference and identified at least 12 human kinesins involved in hela cell division . recently , haraguchi et al . ( 49 ) found that the kinesin-2 complex ( kif3a/3b ) is localized with components of the mitotic apparatus such as spindle microtubules and centrosomes and plays an important role not only in interphase but also in mitosis . both kif5b and kif3a / b are microtubule plus end - directed motors for membrane organelle transportation . therefore , it is of considerable interest to determine whether kif5b has a similar function or another unique function during cell division . one seemingly contradictory result found in this study was that islet mass was not affected ( fig . further analysis of the pancreatic sections found that islet number was significantly increased ( fig . therefore , it is possible that the impaired -cell function in kif5b - insko mice induce -cell neogenesis to provide a compensatory effect , a process difficult to be defined and more difficult to be quantified at the molecular level ( 25,50 ) . in summary , by using kif5b conditional knockout mice , we have demonstrated that kif5b is essential in the maintenance of normal -cell function . kif5b ablation leads to decreased insulin secretion and diminished glucose tolerance with decreased islet size in the pancreas . our results indicate that genetic or epigenetic alteration in kinesin-1 or other related motor proteins may inherit a predisposition to develop diabetes . | objectivesuppression of kinesin-1 by antisense oligonucleotides , or overexpression of dominant - negative acting kinesin heavy chain , has been reported to affect the sustained phase of glucose - stimulated insulin secretion in -cells in vitro . in this study , we examined the in vivo physiological role of kinesin-1 in -cell development and function.research design and methodsa cre - loxp strategy was used to generate conditional knockout mice in which the kif5b gene is specifically inactivated in pancreatic -cells .
physiological and histological analyses were carried out in kif5b knockout mice as well as littermate controls.resultsmice with -cell specific deletion of kif5b ( kif5bfl/:rip2-cre ) displayed significantly retarded growth as well as slight hyperglycemia in both nonfasting and 16-h fasting conditions compared with control littermates .
in addition , kif5bfl/:rip2-cre mice displayed significant glucose intolerance , which was not due to insulin resistance but was related to an insulin secretory defect in response to glucose challenge .
these defects of -cell function in mutant mice were not coupled with observable changes in islet morphology , islet cell composition , or -cell size . however , compared with controls ,
pancreas of kif5bfl/:rip2-cre mice exhibited both reduced islet size and increased islet number , concomitant with an increased insulin vesicle density in -cells.conclusionsin addition to being essential for maintaining glucose homeostasis and regulating -cell function , kif5b may be involved in -cell development by regulating -cell proliferation and insulin vesicle synthesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lung cancer is the leading cause of cancer related deaths worldwide and in china.1,2 non - small - cell lung cancer ( nsclc ) accounts for approximately 87% of all lung cancer cases.3,4 the overall prognosis of nsclc remains poor due to approximately 25 - 30% of patients present with locally advanced disease upon their initial diagnosis , whereas 40 - 50% patients present with metastatic disease5 . the appearance of small - molecule tyrosine kinase inhibitors ( tkis ) of epidermal growth factor receptor ( egfr ) , such as gefitinib and erlotinib , have shown antitumor activity in nsclc patients , especially in those with egfr mutations . egfr mutational status has become the most important determining factor of clinical response to tkis . results from phase ii and phase iii randomized - controlled trials ( rcts ) demonstrated superior clinical benefits of tkis compared with chemotherapy as a first - line therapy for metastatic nsclc patients . 6 it was found that sensitivity to egfr tki is associated with somatic mutations in the egfr genes . the egfr mutations were discovered in the first four exons , i.e. exons 18 - 21 of the tyrosine kinase domain of egfr.7 - 9 two major activating mutations in egfr , which account for almost 85% of all clinically important mutations related to egfr tki sensitivity , are an in - frame deletion of exon 19 encompassing the amino acids from codons l747 to e749 and the single amino acid mutation l858r in exon 21.10 further clinical trials revealed that the overall survival benefit of afatinib , an oral irreversible erbb family blocker , was driven mainly by patients with exon 19 positive tumors ( p=0.0001 ) as first - line therapy , whereas in patients with egfr l858r positive tumors , there was no difference between groups ( p=0.16).11 the result indicated that patients with different egfr mutations show different sensitivities to first - line egfr - tkis . however , studies reported that the significant predictive value of egfr mutations observed in first - line tki treatment has not been maintained in second - line tki treatment.12,13 study also demonstrated that first - line chemotherapy may significantly reduce egfr mutation rate in nsclc patients , and the rate of tumor response to second - line tki therapy was lower than that to first - line therapy in patients with egfr mutations.14 this raises the question : whether different egfr mutations still show different sensitivities to second - line egfr - tkis in the treatment of advanced nsclc ? brain and bone metastases were common complications in advanced nsclc patients , with 30%-40% of patients developed brain and/or bone metastases during the course of disease.15 , 16 studies suggested that the prognosis of brain and/or bone metastases patients from nsclc may be also associated with the status of egfr mutations.17 - 20 different egrf mutations with different egfr - tki responses have also been reported in nsclc patients with brain metastasis.21 so , the purpose of this study is to investigate the clinical outcome of nsclc patients with and without brain and/or bone metastases in different egfr tumor genotypes ( exon 19 deletion vs. exon 21 l858r mutation ) receiving second - line egfr - tkis . consecutive nsclc patients harboring either the exon 19 deletion or the l858r point mutation of egfr treated at the first affiliated hospital of wenzhou medical university between december 2010 and september 2015 were retrospectively reviewed . the eligibility criteria for this study were as follows : histologically or cytologically confirmed non - small - cell lung cancer ; had recurrence or progression after first - line platinum based chemotherapy ; with no brain or bone metastasis before the disease progression ; received a second - line treatment with gefitinib , icotinib or erlotinib ; eastern cooperative oncology group performance status 0 - 2 ( ecog ps ) , with adequate organ functions ( including cardiac , hepatic , and renal function ) and hematologic functions ( absolute neutrophil 1.510/l or platelet count 100 10/l ) . the exclusion criteria were as follows : patients had mixed small cell histology ; unknown egfr mutation status ; without at least one measurable lesion according to the response evaluation criteria in solid tumors ( recist ) 1.1 ; lost to follow - up or died within 1 month after the starting of second - line treatment . patients with brain metastasis who did not receive whole brain radiotherapy ( wbrt ) or the dose of wbrt less than 30 gy were also excluded from the subgroup analysis . the baseline clinical characteristics of enrolled patients were collected through retrospective chart review , which included gender , age at progression , tumor histology , baseline ecog ps at the start of treatment with second - line egfr - tkis , stage of the disease at progression , the type of egfr - tkis administered ( icotinib , gefitinib or erlotinib ) . oral egfr - tkis with gefitinib ( 250 mg / d ) , erlotinib ( 150 mg / d ) or icotinib ( 375mg / d ) were administered to the previously treated nsclc patients until progression or intolerable adverse effects . wbrt ( 30 gy/10f ) with concurrently oral egfr - tkis were administered for patients with brain metastasis progression . for patients with bone metastasis progression , radiotherapy combining with oral egfr - tkis or oral egfr - tkis alone was conducted . re - evaluation was performed at the beginning of oral egfr - tkis treatment and then monthly . evaluation included physical examination , a complete blood count measurement , liver function test , and chest computed tomography ( ct ) scan . brain ct with and without contrast , abdominal ct , or bone scan , as well as magnetic resonance images if necessary , were performed when there were relevant symptoms in patients . pearson chi - square or fisher 's exact tests ( when there were fewer than 5 expected counts in the contingency table ) were applied to compare the baseline characteristics of parents between egfr genotype groups and to evaluate each potential influential factors . tumor response to egfr - tkis was assessed according to the response evaluation criteria in solid tumors 1.1 . os was defined as the interval from the date of first egfr - tkis treatment to the date of death . pfs was defined as interval between the date of first egfr - tkis treatment and the date of confirming disease progression or death from disease progression . consecutive nsclc patients harboring either the exon 19 deletion or the l858r point mutation of egfr treated at the first affiliated hospital of wenzhou medical university between december 2010 and september 2015 were retrospectively reviewed . the eligibility criteria for this study were as follows : histologically or cytologically confirmed non - small - cell lung cancer ; had recurrence or progression after first - line platinum based chemotherapy ; with no brain or bone metastasis before the disease progression ; received a second - line treatment with gefitinib , icotinib or erlotinib ; eastern cooperative oncology group performance status 0 - 2 ( ecog ps ) , with adequate organ functions ( including cardiac , hepatic , and renal function ) and hematologic functions ( absolute neutrophil 1.510/l or platelet count 100 10/l ) . the exclusion criteria were as follows : patients had mixed small cell histology ; unknown egfr mutation status ; without at least one measurable lesion according to the response evaluation criteria in solid tumors ( recist ) 1.1 ; lost to follow - up or died within 1 month after the starting of second - line treatment . patients with brain metastasis who did not receive whole brain radiotherapy ( wbrt ) or the dose of wbrt less than 30 gy were also excluded from the subgroup analysis . the baseline clinical characteristics of enrolled patients were collected through retrospective chart review , which included gender , age at progression , tumor histology , baseline ecog ps at the start of treatment with second - line egfr - tkis , stage of the disease at progression , the type of egfr - tkis administered ( icotinib , gefitinib or erlotinib ) . oral egfr - tkis with gefitinib ( 250 mg / d ) , erlotinib ( 150 mg / d ) or icotinib ( 375mg / d ) were administered to the previously treated nsclc patients until progression or intolerable adverse effects . wbrt ( 30 gy/10f ) with concurrently oral egfr - tkis were administered for patients with brain metastasis progression . for patients with bone metastasis progression , radiotherapy combining with oral egfr - tkis or oral egfr - tkis alone was conducted . re - evaluation was performed at the beginning of oral egfr - tkis treatment and then monthly . evaluation included physical examination , a complete blood count measurement , liver function test , and chest computed tomography ( ct ) scan . brain ct with and without contrast , abdominal ct , or bone scan , as well as magnetic resonance images if necessary , were performed when there were relevant symptoms in patients . pearson chi - square or fisher 's exact tests ( when there were fewer than 5 expected counts in the contingency table ) were applied to compare the baseline characteristics of parents between egfr genotype groups and to evaluate each potential influential factors . tumor response to egfr - tkis was assessed according to the response evaluation criteria in solid tumors 1.1 . os was defined as the interval from the date of first egfr - tkis treatment to the date of death . pfs was defined as interval between the date of first egfr - tkis treatment and the date of confirming disease progression or death from disease progression . as shown in figure 1 , of 355 nsclc patients received egfr - tkis as second - line treatment from december 2010 to september 2015 , 72 patients due to insufficient information for egfr mutational analysis or lost to follow - up , 81 patients due to brain and/or bone metastases at their first hospital visit were excluded . nine patients died within one month after starting the second - line tkis , 15 had other types of egfr mutations ( not exon 19 and l858r mutation ) , and 12 patients with brain metastasis without whole brain radiotherapy were also excluded . table 1 presents the baseline characteristics of enrolled 166 patients with a median age of 60 years ( range , 37 - 87 years ) . the egrf mutation types of exon 19 deletion and exon 21 l858r mutation were 51.8% ( 86/166 ) and 48.2% ( 80/166 ) , respectively . table 2 shows the characteristics of nsclc patients with brain ( 75 patients ) and bone metastasis ( 76 patients ) . the percentage of brain and bone metastases patients with exon 19 deletion and exon 21 l858r mutation were 50.7% , 49.3% , and 44.7% , 55.3% , respectively . the responses of all these 166 patients to egfr - tkis treatment with a disease control rate ( dcr ) of 77.7% ( 129/166 ) , and objective response rate ( orr ) of 11.4% ( 19/166 ) , respectively . the orr and dcr for exon 19 deletion and l858r mutation were 12.8% vs. 10.0% ( p=0.61 ) , and 81.4% vs. 73.8% ( p=0.64 ) , respectively . the overall dcr and orr of brain and bone metastases were 76% ( 57/75 ) , 10.7% ( 8/75 ) , and 68.4% ( 52/76 ) , 3.9% ( 3/76 ) , respectively . the orr and dcr for exon 19 deletion and l858r mutation of brain metastasis patients were 13.2% vs. 8.1% ( p=0.48 ) , and 78.9% vs. 73.0% ( p=0.31 ) , respectively . the orr and dcr for exon 19 deletion and l858r mutation of bone metastasis patients were 5.9% vs. 2.4% ( p=0.44 ) , and 70.6% vs. 66.7% ( p=0.72 ) , respectively . the median progression - free survival ( pfs ) and overall survival ( os ) of enrolled nsclc patients was 5.8 months ( 95% cl , 4.9 - 6.7 months ) and 12.4 months ( 95% cl , 10.6 - 14.1 months ) , respectively . the estimated 6-month and 1-year pfs rates were 57.6% , 13.1% in the exon 19 deletion arm , and 38.8% , 6.7% in the l858r mutation arm , respectively . figure 2 presents the median pfs and os of nsclc patients after second - line egfr - tkis treatment for exon 19 deletion and l858r mutation . the exon 19 deletion group had a significantly longer median pfs compared with the l858r mutation group ( 6.7 vs. 4.5 months , p=0.002 ) as shown in figure 2a . the estimated 6-month and 1-year os rates were 97.4% , 61.6% , and 87.3% , 46.6% for exon 19 deletion and l858r mutation group , respectively . the exon 19 deletion group had a longer median os compared with the l858r mutation group ( 13.7 vs. 11.7 months , p=0.02 ) , as shown in figure 2b . the median pfs and os were 4.7 months ( 95% cl , 3.9 - 5.5 months ) and 10.3 months ( 95% cl , 8.2 - 12.5 months ) for nsclc patients with brain metastasis , respectively . as shown in figure 3a , the probabilities of pfs at 6 months and 1 year were 61.9% and 12.9% in the exon 19 deletion , 20% and 0% in l858r mutation arms , respectively . exon 19 deletion group had a longer median pfs than the l858r mutation group ( 6.7 vs. 3.9 months , p<0.001 ) . the os was shown in figure 3b , in which the probabilities of os at 6 months and 1 year were 93.8% and 54.5% for the exon 19 deletion arm , and 81.6% and 18.5% for l858r mutation arm , respectively . the exon 19 deletion arm had a longer median os compared with the l858r mutation arm ( 13.7 vs. 7.9 months , p=0.006 ) . the median pfs and os for nsclc patients with bone metastasis were 4.8 months ( 95% cl , 4.0 - 5.6 months ) and 12.9 months ( 95% cl , 8.7 - 17.1 months ) , respectively . the estimated 6-month and 1-year dfs rates for exon 19 deletion and the l858r mutation groups were 46.9% , 16.3% , and 31.0% , 10.7% , respectively . there was no significant difference on median pfs ( 5.9 vs. 4.4 months ; p=0.17 ) and median os between patients with exon 19 deletion and l858r mutation , as shown in figure 4b . the estimated 6-month and 1-year os rates were 96.0% , 63.1% , and 91.9% , 45.6% for patients with exon 19 deletion and l858r mutation , respectively . univariate and multivariate analysis on pfs and os for all nsclc patients and for patients with brain and bone metastases were shown in table 3 . egfr genotype and ecog ps were independent predictors of pfs for both nsclc patients with and without brain metastasis . never smoking ( p=0.001 ) , exon 19 deletion ( p=0.03 ) , egoc ps ( 0 - 1 ) ( p<0.001 ) and no brain metastasis ( p=0.01 ) were correlated with longer os for all nsclc patients . for patients with brain metastasis , age at disease progression ( p=0.009 ) , genotype ( p=0.02 ) and egoc ps ( p<0.001 ) were independent predictors of os . for patients with bone metastasis , female ( p=0.01 ) , never smoking ( p=0.005 ) , number of bone metastases ( p=0.03 ) and egoc ps ( 0 - 1 ) ( p=0.002 ) were related to a longer pfs . egoc ps ( 0 - 1 ) ( p<0.001 ) was associated with a longer os . rash ( 47/166 ) , fatigue ( 46/166 ) , and anorexia ( 25/166 ) were the three most frequent side effects observed for nsclc patients treated with second - line egfr - tkis . the common toxicities of grade iii / iv were rash ( 9/166 ) and fatigue ( 7/166 ) . most patients tolerated well with the side effects after symptomatic treatments , except for a dose reduction of egfr - tkis for 15 patients . there was no significant difference on side effects between nsclc patients with exon 19 and 21 mutations . the efficacy of second - line egfr - tkis in the treatment of advanced nsclc patients with and without brain and bone metastases , and the effects of different genotype mutations on pfs and os were investigated in this study . advanced nsclc patients with and without brain metastasis with an exon 19 deletion showed a better pfs and os compared with those with l858r mutation receiving second - line egfr - tkis treatment . no significant difference on pfs and os between exon 19 and 21 mutations was observed for patients with bone metastasis . studies demonstrated that advanced nsclc patients underwent first - line platinum - based doublet chemotherapy need egfr - tkis as second - line or third - line treatment to maximize the survival benefit.22 the orr of our patients was 11.4% , which was similar to the reported 11.3% from a phase ii study on the egfr wild type nsclc patients treated with second - line egfr - tkis , while the dcr in this study was much higher ( 76.5% vs. 28.3%).23 this may be due to the intrinsic sensitivity differences for different type of egfr mutations . the orr and dcr in our study were a bit inferior to the reported 26.7% and 81.6% in the trust study with chinese subpopulation.24 however , no specific egfr mutation types was reported , and the results of second - line and third - line treatment were mixed in that study . the median pfs in our study was close to that of trust study with chinese subpopulation ( 5.8 vs. 6.4 months ) . the median os in our study was 12.4 months ( 95% cl , 10.6 - 14.1 months ) , which was close to the reported 11.5 months in a phase iii study and 13.3 months in a phase ii study using tkis as a second - line in the treatment of advanced nsclc,25,26 but much shorter than reported 27 months in the study of rosell r et al . 27 the difference may be due to a higher percentage ( 45.2% ) of nsclc patients with brain metastasis were enrolled in our study , and due to other patients ' characteristics discrepancies in different studies . it has been reported that more than 25 % patients with lung cancer developed brain metastasis during the disease courses despite systemic treatment and/or local radiotherapy.28 , 29 there was limited data for the response of brain metastasis to egfr - tkis . recently , park et al reported a median pfs and os of 6.6 months ( 95% ci , 3.8 - 9.3 months ) and 15.9 months ( 95% ci , 7.2 - 24.6 months ) , respectively , in a phase ii study in nsclc patients with brain metastasis.30 these results of first - line egfr - tkis treatment were better than the results of our second - line tkis treatment on brain metastasis ( 4.7 and 10.3 months for pfs and os , respectively ) . next to brain , bone is a frequent site of metastasis in nsclc exerting a negative impact on quality of life.31,32 bone metastasis was an independent negative predictive factor for os in patients with mutated and wild - type egfr.33 in this study , we achieved a median pfs and os of 4.8 and 12.9 months for nsclc patients with bone metastasis , respectively . the median os was longer than reported 8 months of bone metastasis nsclc with wild - type egfr.34 several previous studies had investigated the relationship between egfr mutation status and prognosis of nsclc patients . some studies demonstrated the superiority of exon 19 deletion over exon 21 point mutation in nsclc patients treated with erlotinib and/or gefitinib,27 , 35 , 36 while other studies did not.37 , 38 the nct00344773 study demonstrated that orr and dcr were higher in patients with exon 19 deletion than those with l858r mutation ( orr : 62.1% vs 33.3% ; p=0.07 ; dcr : 96.6% vs 66.7% ; p=0.006).39 sun jm et al reported that patients with exon 19 deletion ( n = 58 ) had a significantly longer pfs than patients with l858r mutation ( n = 19 ) ( 9.5 vs. 7.7 months ; p = 0.03 ) in the treatment of 77 patients with egfr - tki . 40 while , igawa s et al demonstrated that there was no significant difference between patients with the exon 19 deletion and l858r point mutation on orr ( p=0.44 ) , pfs ( p=0.81 ) and os ( p=0.95 ) in a study of 124 nsclc patients harboring active egfr mutations ( exon 19 deletion : 68 patients , l858r mutation : 56 patients ) . 41 studies also demonstrated that the significant predictive value of egfr mutations observed in first - line tki treatment has not been maintained in second - line tki treatment 14 . according to a randomized phase iii trial , the qualitative difference in response seen in the first line was not demonstrated in second - line settings.42 in this study , although no significant difference on orr and dcr between exon 19 deletion and l858r mutation groups were observed , the exon 19 deletion arm showed a significant higher pfs and os than l858r mutation arm in advanced nsclc patient with and without brain metastasis receiving second - line egfr - tkis . this was similar to the results of a second - line tki treatment with erlotinib for patients with brain metastasis , in which patients with exon 19 deletion showed longer os than those with exon 21 point mutation ( p = 0.02 ) . 21 this indicated that egfr mutations are good prognostic factors , as well as have potential significant predictive value , for advanced nsclc patients receiving second - line tkis . in this study , multivariate analysis indicated that egfr genotype and ecog ps were independent predictors of pfs for both nsclc patients with and without brain metastasis . never smoking status ( p=0.001 ) , exon 19 deletion ( p=0.03 ) , egoc ps ( 0 - 1 ) ( p<0.001 ) and no brain metastasis ( p=0.01 ) were correlated with longer os for all nsclc patients . for patients with brain metastasis , age at disease progression ( p=0.009 ) , genotype ( p=0.02 ) and egoc ps ( p<0.001 ) were independent predictors of os . similarly , studies reported that the favorable prognostic factors for nsclc patients with brain metastasis were egfr mutations , stable extracranial disease at the time of brain metastasis diagnosis , and egoc ps.43,44 wbrt has been regarded as the standard treatment for brain metastases and applied to all the patients with brain metastasis in this study.30 reports demonstrated a favorable clinical effect of the combination of wbrt and gefitinib or erlotinib therapy with an excellent intracranial disease control rate , which suggested that wbrt might serve as some form of sensitizer for egfr - tki therapy.21 for nsclc patients with bone metastasis in this study , no - smoking ( p=0.005 ) , number of bone metastases ( p=0.03 ) and ecog ps ( 0 - 1 ) ( p=0.002 ) were related to a longer pfs . egoc ps ( 0 - 1 ) ( p<0.001 ) was associated with a longer os . however , egfr mutations were not significant predictors for nsclc patients with bone metastasis , although it had been reported in previous study that epidermal growth factor ( egf ) signaling was an important mediator of bone metastasis in many cancers , as well as in nsclc patients.45 , 46 one limitation of current study is that it is a retrospective methodology from a single - institution experience . the number of patients enrolled may be not sufficient enough and the follow - up duration of the study may be not long enough . external validation by using other large database for evaluating the prognostic effect second - line egfr - tkis in the treatment of nsclc would be of value to further explore the benefit of egfr mutations . in a conclusion , with the advancements in the treatment of nsclc , many patients may be candidates for further systemic therapy using chemotherapy and/or egfr - tkis as second - line and third - line treatments . our study demonstrated nsclc patients harboring exon 19 deletion achieved better pfs and os than those with l858r mutation , indicating that egfr mutations are significant prognostic predictors for advanced nsclc patients with and without brain metastasis receiving second - line egfr - tkis treatment . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 declaration of helsinki and its later amendments or comparable ethical standards . this article does not contain any studies with animals performed by any of the authors . | background : although superior clinical benefits of first - line epidermal growth factor receptor ( egfr ) tyrosine kinase inhibitors ( tkis ) in the treatment of advanced non - small - cell lung cancer ( nsclc ) had been reported with different sensitivity , the sensitivity of second - line tkis in nsclc patients with different efgr mutations was unknown . the purpose of this study is to investigate the clinical outcome of second - line egfr - tkis in the treatment of nsclc patients according to different egfr genotypes.methods : the treatment outcomes of 166 nsclc patients with different egfr mutations treated by second - line tkis were retrospectively reviewed .
the efficacy was evaluated with pearson chi - square or fisher 's exact tests , log - rank test and cox proportional hazards model.results : the disease control rate ( dcr ) and objective response rate ( orr ) of enrolled nsclc patients were 77.7% and 11.4% , respectively .
the exon 19 deletion group had a significantly longer median progression - free survival ( pfs ) ( 6.7 vs. 4.5 months , p=0.002 ) and overall survival ( os ) ( 13.7 vs. 11.7 months , p=0.02 ) compared with the exon 19 l858r mutation group for nsclc patients , as well for patients with brain metastasis [ pfs : ( 6.7 vs. 3.9 months , p<0.001 ) , os : ( 13.7 vs. 7.9 months , p=0.006 ) ] .
no significant difference on pfs and os was observed between exon 19 deletion and l858r mutation group for patients with bone metastasis .
egfr genotype and ecog ps were independent predictors of pfs .
never smoking , exon 19 deletion , egoc ps ( 0 - 1 ) and no brain metastasis were correlated with longer os .
no significant difference on side effect between exon 19 and 21 mutation group was observed.conclusions : nsclc patients harboring exon 19 deletion achieved better pfs and os than those with l858r mutation , indicating that egfr mutation is a significant prognostic factor for advanced nsclc patients with and without brain metastasis receiving second - line egfr - tkis treatment . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a large number of sporadic conventional renal cell carcinomas ( crcc ) are frequently associated with the loss of heterozygosity ( loh ) on the short arm of chromosome 3 , i.e. 3p.[17 ] in crcc , the von hippal lindau ( vhl ) gene at locus 3p25.3 is believed to be a primary targeted tumor suppressor gene ( tsg ) and is inactivated by various mechanisms such as loh , point mutations and epigenetic mechanisms such as hypermethylation . the fragile histidine triad ( fhit ) gene at locus 3p14.2 is one of the universal tsgs ; however , the role of fhit in the pathogenesis of crcc is still not clear . review of literature of loh on 3p in crcc by various groups has shown differential regions on 3p that were targets of deletions by loh analysis.[37 ] braga et al have studied the entire region of 3p by micro satellite markers and found luca ( lung cancer region ) ( centromeric ) and ap20 ( alu - pcr clone 20 ) ( telomeric ) at locus 3p21.31 as hotspot loci of deletion in crcc . on the other hand , velickovic et al studied only the vhl gene at 3p25.3 and the fhit gene at 3p14.2 using a set of micro satellite markers that flanked these genes and found the highest loh at the fhit locus than the vhl locus in low grade tumors . except for velickovic et al , statistical analysis of the association of loh loci on 3p with clinico - pathological parameters such as tumor grade and stage is unknown . therefore , the pathogenetic role of deleted loci in the biology of the disease is still not clear . hence , we performed deletion mapping studies by loh on 3p12-p26 in our series of crcc patients at various stages and grades of disease with an aim to investigate the consistently deleted locus / loci and their specificity in crcc by comparative allelotyping studies in crcc and other major epithelial carcinomas ( mec ) such as breast , lung , and bladder tumors . we collected 70 tumor specimens of rcc in a prospective manner from patients who underwent surgical resection of tumors by radical nephrectomy during the period between 2003 and 2006 . simultaneously , normal kidney specimens were also surgically resected along with the tumor of the same patient . informed consent of all patients enrolled in this study was procured at all collections as per the ethical guidelines of the hospital . staging of the disease was performed by the surgeon according to the american joint committee in cancer ( ajcc ) tumor node metastasis ( tnm ) staging ( 1997 ) , while tumor morphological grading was performed by the pathologist ( dr sb desai ) . the stage and grade wise distribution of these patients is as given below : we categorized the patients into two groups : group i comprising of patients of stage i and ii , and group ii comprising of patients in stage iii and iv for statistical analysis due to inadequate number of patients in stage i and iv . the tumor tissues were minced and digested with collagenase type ii s ( sigma aldrich ) and the single tumor cells obtained after digestion were grown in vitro to obtain cultures containing tumor cells free of fibroblasts . these cultured tumor epithelial cells subjected to dna extraction for loh studies by polymerase chain reaction ( pcr ) . simultaneously , genomic dna was also extracted from the normal kidney tissues by the phenol - chloroform method and subjected for pcr analysis . a part of the tumor was also used to prepare tumor imprints in all 40 tumors of crcc for fluorescent in - situ hybridization ( fish ) studies . comparative allelotyping was also performed on extracted dna of 15 paired normal tumor tissues of three mec 's such as breast , lung , and bladder . collection of these non - renal tissues was also approved by the ethical committee and the specimens were obtained with the help of a pathologist after histopathological investigations . deletion mapping studies by loh were carried out using 15 polymorphic micro satellite markers , which cover the entire region of 3p from 3p12-p26 [ figure 1 ] . the primer sequences , hetero / polymorphic nature of alleles , allele length and their respective loci on 3p were confirmed from genome database ( gdb ) ( http://www.gdb.org ) , location database ( ldb ) ( http://www.cedar.genetics.soton.ac.uk/pub/chrom3/gmap ) and co - operative human linkage centre ( chlc ) ( http://www.chlc.org ) databases and genome directory published by gemmill et al . the primers were custom made from bioserve biotech , hyderabad , india . each pair of micro satellite primers used in the current study were used to amplify corresponding complementary sequence defined within the flanking primers on the respective target sequence on the template . because of their repetitive binding patterns , hot - start pcr was carried out to allow primer - specific binding to the unique target sequence on the template strand . hot - start- pcr was performed on thermal cycler ( techne progene ) in a 25 ls reaction by using 1 pcr buffer ( finnzymes , finland ) , 1.53 mm mgcl2 ( finnzymes , finland ) , 200 m each deoxyribonucleoside triphosphates ( gibco , invitrogen ) , 10 picomole/ l of both forward and reverse primer , and 50 ng of template genomic dna . hot - start pcr program for all micro satellite primers used was set up as follows : chromosome 3p ideogram showing loss of heterozygosity ( loh ) , retention of heterozygosity ( roh ) , and micro satellite instability ( msi ) for micro satellite markers mapped on 3p according to location database ( ldb ) in crcc . 1 cycle ( addition of taq polymerase ) denaturation : 94c for 2045 seconds , annealing : 4256c for 40 seconds1.15 minutes , extension : 72c for 1520 seconds five microliters of the hot - start pcr products were run on 12% or 15% polyacrylamide gel using 1x tbe buffer and stained with 0.2% silver nitrate using protocol of caetano - anolles et al . loh was determined by comparing the intensities of the bands of the normal and tumor dna . thus , three band patterns could be obtained , loh , allelic imbalance ( ai ) , ( loh mosaicism based on band intensity of alleles in both normal and tumor ) , and micro satellite instability ( msi ) by comparing the bands of tumor dna with the corresponding band of the normal dna . aberrant loh patterns for all specimens were repeated three times and confirmed by two independent experts . fluorescent in - situ hybridization ( fish ) studies using fragile histidine triad ( fhit ) bacterial artificial chromosome ( bac ) genomic clone in crcc and other malignancies : fish was performed on tumor imprints of all 40 crccs , 15 samples each of lung , bladder , and breast tumors and 10 samples each of mesenchymal bone marrow specimens of leukemias such as acute lymphoblastic leukemia ( all ) , acute myeloid leukemia ( aml ) and chronic myeloid leukemia ( cml ) to evaluate the deletion status of fhit gene . the fhit bac clone ( rp11 - 170k19 ) was provided to us as a gift by dr . the fhit gene probe was prepared in - house in our laboratory by growing the fhit bac clone in luria - bertanii ( lb ) medium , extracting the bac dna and labeling with flourochromes such as cy-3/fitc-11-dutp by nick translation method . in brief , the fish probe labeling was performed as follows : 1 g of bac dna was mixed with 5 ls of 10 reaction buffer ( 1 ) , 0.5 mm dntp 's of datp , dctp , and dgtp each ( gibco , invitrogen ) , -mercapto - ethanol ( 0.5 m ) , dnase i ( working stock : 0.00023 units ) , dna polymerase i ( roche diagnostics ) ( 10 u / ml ) and 0.5 l ( 0.5 nmole ) of cy3-dutp/ flourescein - dutp in labeling reaction mix of total volume 50 ls . after incubation at 15c for 12 hours , labeled - dna was precipitated with 3 m na acetate and 100% chilled absolute alcohol at 80c for 2 hours . the protocol followed for fhit bac probe fish was as per our laboratory standardized protocols . for fish the probe mixture of volume 9 l was made by mixing 2 l labeled probe with 7 l hybridization buffer . denaturation of target dna in interphase and metaphase cells affixed on slides was carried out by co - denaturing the slides along with the probe mixture at 73c for 5 minutes followed by overnight hybridization on thermobrite ( vysis inc . ) at 37c overnight . next day , the slides were washed at 72c in 0.4 sodium chloride , sodium citrate and nonidet 40 ( sscn ) for 2 minutes , followed by wash in 2 sscn at room temperature for 1 minute . the slides were counterstained and mounted in dapi / antifade ( vysis , inc . ) . signals were observed under epiflourescent axioplan ( carl zeiss , germany ) microscope using triple band pass filter . simultaneously , fish studies were also performed on 10 normal control peripheral blood specimens to evaluate the false positivity , sensitivity and locus specificity of the fhit bac probe . comparison of the loh frequencies at all micro satellite loci on region 3p12-p26 was made with clinico - pathological parameters such as tumor stage and morphological grade to explore the significance of recurrent deleted loci . a two - sided p value of less than 0.05 was considered to be statistically significant . deletion mapping studies by loh were carried out using 15 polymorphic micro satellite markers , which cover the entire region of 3p from 3p12-p26 [ figure 1 ] . the primer sequences , hetero / polymorphic nature of alleles , allele length and their respective loci on 3p were confirmed from genome database ( gdb ) ( http://www.gdb.org ) , location database ( ldb ) ( http://www.cedar.genetics.soton.ac.uk/pub/chrom3/gmap ) and co - operative human linkage centre ( chlc ) ( http://www.chlc.org ) databases and genome directory published by gemmill et al . each pair of micro satellite primers used in the current study were used to amplify corresponding complementary sequence defined within the flanking primers on the respective target sequence on the template . because of their repetitive binding patterns , hot - start pcr was carried out to allow primer - specific binding to the unique target sequence on the template strand . hot - start- pcr was performed on thermal cycler ( techne progene ) in a 25 ls reaction by using 1 pcr buffer ( finnzymes , finland ) , 1.53 mm mgcl2 ( finnzymes , finland ) , 200 m each deoxyribonucleoside triphosphates ( gibco , invitrogen ) , 10 picomole/ l of both forward and reverse primer , and 50 ng of template genomic dna . hot - start pcr program for all micro satellite primers used was set up as follows : chromosome 3p ideogram showing loss of heterozygosity ( loh ) , retention of heterozygosity ( roh ) , and micro satellite instability ( msi ) for micro satellite markers mapped on 3p according to location database ( ldb ) in crcc . initial denaturation : 94c for 5 minutes 1 cycle ( addition of taq polymerase ) denaturation : 94c for 2045 seconds , annealing : 4256c for 40 seconds1.15 minutes , extension : 72c for 1520 seconds five microliters of the hot - start pcr products were run on 12% or 15% polyacrylamide gel using 1x tbe buffer and stained with 0.2% silver nitrate using protocol of caetano - anolles et al . loh was determined by comparing the intensities of the bands of the normal and tumor dna . thus , three band patterns could be obtained , loh , allelic imbalance ( ai ) , ( loh mosaicism based on band intensity of alleles in both normal and tumor ) , and micro satellite instability ( msi ) by comparing the bands of tumor dna with the corresponding band of the normal dna . aberrant loh patterns for all specimens were repeated three times and confirmed by two independent experts . fluorescent in - situ hybridization ( fish ) studies using fragile histidine triad ( fhit ) bacterial artificial chromosome ( bac ) genomic clone in crcc and other malignancies : fish was performed on tumor imprints of all 40 crccs , 15 samples each of lung , bladder , and breast tumors and 10 samples each of mesenchymal bone marrow specimens of leukemias such as acute lymphoblastic leukemia ( all ) , acute myeloid leukemia ( aml ) and chronic myeloid leukemia ( cml ) to evaluate the deletion status of fhit gene . the fhit bac clone ( rp11 - 170k19 ) was provided to us as a gift by dr . the fhit gene probe was prepared in - house in our laboratory by growing the fhit bac clone in luria - bertanii ( lb ) medium , extracting the bac dna and labeling with flourochromes such as cy-3/fitc-11-dutp by nick translation method . in brief , the fish probe labeling was performed as follows : 1 g of bac dna was mixed with 5 ls of 10 reaction buffer ( 1 ) , 0.5 mm dntp 's of datp , dctp , and dgtp each ( gibco , invitrogen ) , -mercapto - ethanol ( 0.5 m ) , dnase i ( working stock : 0.00023 units ) , dna polymerase i ( roche diagnostics ) ( 10 u / ml ) and 0.5 l ( 0.5 nmole ) of cy3-dutp/ flourescein - dutp in labeling reaction mix of total volume 50 ls . after incubation at 15c for 12 hours , labeled - dna was precipitated with 3 m na acetate and 100% chilled absolute alcohol at 80c for 2 hours . the protocol followed for fhit bac probe fish was as per our laboratory standardized protocols . for fish the probe mixture of volume 9 l was made by mixing 2 l labeled probe with 7 l hybridization buffer . denaturation of target dna in interphase and metaphase cells affixed on slides was carried out by co - denaturing the slides along with the probe mixture at 73c for 5 minutes followed by overnight hybridization on thermobrite ( vysis inc . ) at 37c overnight . next day , the slides were washed at 72c in 0.4 sodium chloride , sodium citrate and nonidet 40 ( sscn ) for 2 minutes , followed by wash in 2 sscn at room temperature for 1 minute . the slides were counterstained and mounted in dapi / antifade ( vysis , inc . ) . signals were observed under epiflourescent axioplan ( carl zeiss , germany ) microscope using triple band pass filter . simultaneously , fish studies were also performed on 10 normal control peripheral blood specimens to evaluate the false positivity , sensitivity and locus specificity of the fhit bac probe . comparison of the loh frequencies at all micro satellite loci on region 3p12-p26 was made with clinico - pathological parameters such as tumor stage and morphological grade to explore the significance of recurrent deleted loci . a two - sided p value of less than 0.05 was considered to be statistically significant . deletion mapping studies by loh were carried out using 15 polymorphic micro satellite markers , which cover the entire region of 3p from 3p12-p26 [ figure 1 ] . the primer sequences , hetero / polymorphic nature of alleles , allele length and their respective loci on 3p were confirmed from genome database ( gdb ) ( http://www.gdb.org ) , location database ( ldb ) ( http://www.cedar.genetics.soton.ac.uk/pub/chrom3/gmap ) and co - operative human linkage centre ( chlc ) ( http://www.chlc.org ) databases and genome directory published by gemmill et al . each pair of micro satellite primers used in the current study were used to amplify corresponding complementary sequence defined within the flanking primers on the respective target sequence on the template . because of their repetitive binding patterns , hot - start pcr was carried out to allow primer - specific binding to the unique target sequence on the template strand . hot - start- pcr was performed on thermal cycler ( techne progene ) in a 25 ls reaction by using 1 pcr buffer ( finnzymes , finland ) , 1.53 mm mgcl2 ( finnzymes , finland ) , 200 m each deoxyribonucleoside triphosphates ( gibco , invitrogen ) , 10 picomole/ l of both forward and reverse primer , and 50 ng of template genomic dna . hot - start pcr program for all micro satellite primers used was set up as follows : chromosome 3p ideogram showing loss of heterozygosity ( loh ) , retention of heterozygosity ( roh ) , and micro satellite instability ( msi ) for micro satellite markers mapped on 3p according to location database ( ldb ) in crcc . initial denaturation : 94c for 5 minutes 1 cycle ( addition of taq polymerase ) denaturation : 94c for 2045 seconds , annealing : 4256c for 40 seconds1.15 minutes , extension : 72c for 1520 seconds five microliters of the hot - start pcr products were run on 12% or 15% polyacrylamide gel using 1x tbe buffer and stained with 0.2% silver nitrate using protocol of caetano - anolles et al . loh was determined by comparing the intensities of the bands of the normal and tumor dna . thus , three band patterns could be obtained , loh , allelic imbalance ( ai ) , ( loh mosaicism based on band intensity of alleles in both normal and tumor ) , and micro satellite instability ( msi ) by comparing the bands of tumor dna with the corresponding band of the normal dna . aberrant loh patterns for all specimens were repeated three times and confirmed by two independent experts . fluorescent in - situ hybridization ( fish ) studies using fragile histidine triad ( fhit ) bacterial artificial chromosome ( bac ) genomic clone in crcc and other malignancies : fish was performed on tumor imprints of all 40 crccs , 15 samples each of lung , bladder , and breast tumors and 10 samples each of mesenchymal bone marrow specimens of leukemias such as acute lymphoblastic leukemia ( all ) , acute myeloid leukemia ( aml ) and chronic myeloid leukemia ( cml ) to evaluate the deletion status of fhit gene . the fhit bac clone ( rp11 - 170k19 ) was provided to us as a gift by dr . the fhit gene probe was prepared in - house in our laboratory by growing the fhit bac clone in luria - bertanii ( lb ) medium , extracting the bac dna and labeling with flourochromes such as cy-3/fitc-11-dutp by nick translation method . in brief , the fish probe labeling was performed as follows : 1 g of bac dna was mixed with 5 ls of 10 reaction buffer ( 1 ) , 0.5 mm dntp 's of datp , dctp , and dgtp each ( gibco , invitrogen ) , -mercapto - ethanol ( 0.5 m ) , dnase i ( working stock : 0.00023 units ) , dna polymerase i ( roche diagnostics ) ( 10 u / ml ) and 0.5 l ( 0.5 nmole ) of cy3-dutp/ flourescein - dutp in labeling reaction mix of total volume 50 ls . after incubation at 15c for 12 hours , labeled - dna was precipitated with 3 m na acetate and 100% chilled absolute alcohol at 80c for 2 hours . the protocol followed for fhit bac probe fish was as per our laboratory standardized protocols . for fish the probe mixture of volume 9 l was made by mixing 2 l labeled probe with 7 l hybridization buffer . denaturation of target dna in interphase and metaphase cells affixed on slides was carried out by co - denaturing the slides along with the probe mixture at 73c for 5 minutes followed by overnight hybridization on thermobrite ( vysis inc . ) at 37c overnight . next day , the slides were washed at 72c in 0.4 sodium chloride , sodium citrate and nonidet 40 ( sscn ) for 2 minutes , followed by wash in 2 sscn at room temperature for 1 minute . the slides were counterstained and mounted in dapi / antifade ( vysis , inc . ) . signals were observed under epiflourescent axioplan ( carl zeiss , germany ) microscope using triple band pass filter . simultaneously , fish studies were also performed on 10 normal control peripheral blood specimens to evaluate the false positivity , sensitivity and locus specificity of the fhit bac probe . comparison of the loh frequencies at all micro satellite loci on region 3p12-p26 was made with clinico - pathological parameters such as tumor stage and morphological grade to explore the significance of recurrent deleted loci . a two - sided p value of less than 0.05 was considered to be statistically significant . analyses of deletion mapping studies on 40 paired normal - tumor specimens of crcc are depicted in figures 1 , 2 and 3 . for data interpretation all the markers in regions r1 , r2 , r3 , and r4 are depicted in ascending order of their mapping . ( b ) msi in both alleles at locus 3p21.1 for marker d3s1766 in crcc . ( d ) homozygous allelic pattern at locus 3p21.3 for micro satellite marker d3s2409 in crcc . n : normal dna t : tumor dnal chromosome 3p ideogram showing loci of loh and msi in defined regions r1 , r2 , r3 , and r4 in crcc patients . it also indicates differential loh frequencies in group i ( stage i and ii ) and group ii ( stage iii and iv ) . region 2 : 3p14.2-p21.1 ( d3s1480 , d3s1481 , d3s1300 , d3s1234 , and d3s1766 ) . except for marker d3s1766 , the remaining four markers were mapped within exons 3 to 6 of the fhit gene at locus 3p14.2 . region 3 : 3p21.2-p24.2 [ d3s1568 ( luca ) , d3s2409 , d3s2420 , and d3s1298 ( ap20 ) ] . region 4 : 3p24.2-p26 ( d3s1597 , d3s1317 -vhl gene locus , and d3s1560 ) . we found loh in 3 regions , r1 , r2 , and r4 on 3p [ figure 3 ] . the region r1 , 3p12.2-p14.1 of loh near the pericentromeric region flanked by three markers , d3s2406 , d3s2454 , and d3s1285 revealed loh frequency of 40% , 30% , and 15% , respectively . in region r2 , 3p14.2-p21.1 , loh at three of the five markers , d3s1300 , d3s1234 and d3s1766 , was 18% , 20% and 60% respectively . two of the three markers , d3s1300 and d3s1234 , mapped within the intron 5 of the fhit gene revealed a low loh . the other two proximal markers d3s1480 and d3s1481 of r2 close to r1 region , revealed retention of heterozygosity ( roh ) [ figure 3 ] . the region r4 , 3p24.2-p26 flanked by three markers , d3s1597 , d3s1317 vhl gene locus and d3s1560 revealed loh frequency of 30% . of these three markers , d3s1317 is mapped very closely to vhl , whereas marker d3s1560 is mapped 700 kb distal to the vhl gene . in the region r3 , 3p21.2-p24.2 , the frequency of msi for all markers on 3p12-p26 was low ( 313% ) , except marker d3s1766 at 3p21.1 , which had a higher msi frequency ( 33% ) in addition to a higher loh rate ( 60% ) . among the loh positive cases , more than 40% belonged to group i. the incidence for intragenic fhit gene markers , d3s1300 and d3s1234 and an extragenic marker d3s1766 in region r2 was 30% , 75% , and 40% , respectively in group i patients . loh frequency was significantly higher for marker d3s1234 in group i in comparison to group ii patients ( p < 0.013 ) . the comparative incidence for vhl gene marker , d3s1317 and flanking markers , d3s1597 and d3s1560 in region r4 was 50% , 36% , and 40% , respectively and was comparatively higher in group ii patients [ figure 3 ] . besides fhit and vhl loci , the loh frequency of marker d3s2454 at locus 3p13 also showed a significantly higher loh in group ii ( 83% ) than group i ( 16% ) . except for fhit marker ( d3s1234 ) , loh rates for most of the micro satellite loci were almost double for most of the markers in group ii as compared to group i. loh at the fhit locus did not show any significant correlation with morphological grade of tumors in both groups of patients ( p = not significant ) . comparative allelotyping studies of the affected loh loci of crcc in mec 's such as breast , lung , and bladder carcinomas revealed roh in lung and bladder carcinomas ( data not shown ) . except for low loh frequency at markers d3s2406 ( 20% ) , d3s1766 ( 14% ) , and d3s1560 ( 20% ) at loci 3p12.2 , 3p21.1 , and 3p25-p26 in regions r1 , r2 , and r4 , respectively , rest of the affected loh loci of crcc revealed roh in breast carcinomas [ figure 4 ] . chromosome 3p ideogram showing common loh loci in defined regions r1 , r2 , r3 , and r4 in crcc and breast fish analysis of fhit gene on all 40 tumor imprints of crcc revealed monoallelic deletions in 35 tumors ( 88% ) with almost equal incidence in group i and ii patients . fish analysis of fhit gene in mec 's revealed allelic deletions only in 10% of breast and 30% of lung tumors . ( data not shown ) . none of the leukemias revealed allelic deletions of the fhit gene . the fhit gene probe was initially tested on 10 peripheral blood specimens of normal controls and revealed 5% monoallelic loss . comparative allelotyping studies of the affected loh loci of crcc in mec 's such as breast , lung , and bladder carcinomas revealed roh in lung and bladder carcinomas ( data not shown ) . except for low loh frequency at markers d3s2406 ( 20% ) , d3s1766 ( 14% ) , and d3s1560 ( 20% ) at loci 3p12.2 , 3p21.1 , and 3p25-p26 in regions r1 , r2 , and r4 , respectively , rest of the affected loh loci of crcc revealed roh in breast carcinomas [ figure 4 ] . chromosome 3p ideogram showing common loh loci in defined regions r1 , r2 , r3 , and r4 in crcc and breast fish analysis of fhit gene on all 40 tumor imprints of crcc revealed monoallelic deletions in 35 tumors ( 88% ) with almost equal incidence in group i and ii patients . fish analysis of fhit gene in mec 's revealed allelic deletions only in 10% of breast and 30% of lung tumors . ( data not shown ) . none of the leukemias revealed allelic deletions of the fhit gene . the fhit gene probe was initially tested on 10 peripheral blood specimens of normal controls and revealed 5% monoallelic loss . comparative allelotyping studies of the affected loh loci of crcc in mec 's such as breast , lung , and bladder carcinomas revealed roh in lung and bladder carcinomas ( data not shown ) . except for low loh frequency at markers d3s2406 ( 20% ) , d3s1766 ( 14% ) , and d3s1560 ( 20% ) at loci 3p12.2 , 3p21.1 , and 3p25-p26 in regions r1 , r2 , and r4 , respectively , rest of the affected loh loci of crcc revealed roh in breast carcinomas [ figure 4 ] . chromosome 3p ideogram showing common loh loci in defined regions r1 , r2 , r3 , and r4 in crcc and breast fish analysis of fhit gene on all 40 tumor imprints of crcc revealed monoallelic deletions in 35 tumors ( 88% ) with almost equal incidence in group i and ii patients . fish analysis of fhit gene in mec 's revealed allelic deletions only in 10% of breast and 30% of lung tumors . ( data not shown ) . none of the leukemias revealed allelic deletions of the fhit gene . the fhit gene probe was initially tested on 10 peripheral blood specimens of normal controls and revealed 5% monoallelic loss . deletion mapping on 3p12-p26 revealed three consistently affected loh regions ; r1 - 3p12.2-p14.1 , r2 - 3p14.2-p21.1 and r4 - 3p24.2-p26 . perhaps it could be due to homozygous allelic pattern for two markers d3s2409 and d3s2420 in 5060% of patients . braga et al in their studies revealed 3p21.31 region ( between luca and ap20 region ) to be a hot spot loh region . maestro et al in their study in crcc revealed higher loh frequency at 3p21.2-p21.3 ( d3s1228 ) in comparison to 3p14.1-p14.2 ( d3s1029 ) and 3p25 ( d3s1038 ) . alimov et al in their combined loh and cgh analysis found regions 3p21.2 and 3p21.3-p22 along with 3p13-p14 and 3p25-p26 as regions of frequent loh . stage - wise analysis revealed that loh at 3p14.2 was significantly higher in group i patients than any other affected loh loci on 3p , suggesting that loh at fhit locus may be an early event in crcc and may have a potential pathogenetic role in crcc . further , findings of fhit allelic deletions only in breast and lung tumors suggest that fhit is involved in the tumorigenesis of cancers of epithelial origin rather than mesenchyme origin . the pathogenetic role of fhit in crcc is still unclear because biallelic inactivation of fhit ( point mutations and loh ) as in other classical tsg 's has not yet been identified.[51820 ] fhit mutation analyses have demonstrated loh and hypermethylation as a common mutagenic event in carcinomas . functional analysis of the fhit gene has been only based on the expression profiles in various epithelial carcinomas including kidney tumors . loh and reduced / altered expression of fhit gene due to allelic deletions observed in lung , esophagus , head and neck , gastric , breast and cervical carcinomas have been associated with poor prognosis . various immunohistochemical studies in crcc cell lines have shown that fhit is either down - regulated or absent and are associated with grade i tumors and early clinical stage and absence of fhit expression was associated with progression of tumors in grade g2/g3 . our studies in support with that reported by velickovic et al suggests that fhit gene inactivation by itself may be a primary tumorigenic event and may require the deletions of other tsg loci on 3p as initiating events which are preceded by deletions of fhit gene . a two - time higher frequency of loh at the other affected loci on 3p in group ii patients further suggests genetic instability of tumors during disease progression and increased susceptibility to deletions with higher frequencies , which further reflects the role of these loci in both disease development and progression as well . the vhl tsg has been known to be frequently inactivated by loh , point mutations or methylation in crcc . in our study , we found comparatively low loh frequency ( 30% ) than reported series . the deletions of the vhl gene along with flanking loci , d3s1597 and d3s1560 in region 3p24.2-p26 is suggestive of long terminal deletions in crcc . loh at the vhl locus ( d3s1317 ) and flanking loci ( d3s1560 ) was higher in group ii than in group i patients , suggesting that deletion of vhl and flanking genes occur independently of fhit during the later stages of development and/or progression of crcc . the occurrence of loh at three loci on 3p in breast tumors [ 3p25-p26 ( d3s1560 ) , 3p21.1 ( d3s1766 ) and 3p12.2 ( d3s2406 ) ] in our comparative allelotyping studies suggests the presence of common tsg 's loci that are probably frequently deleted in both crcc and breast tumors or there could be multiple genes in these loci which are differentially deleted and participate in formation of histologically different neoplasms . the findings of loh at regions distal to vhl gene ( d3s1560 ) in breast tumors suggest the involvement of tsg loci flanking vhl gene in breast tumorigenesis . the absence of vhl gene deletions in lung and bladder tumors further suggest specificity and role of vhl gene only in crcc . the vhl gene studies in indian population are nil in literature and our findings of vhl - loh supports the reported literature that vhl gets inactivated by deletions other than mutations and methylation , thereby reflecting the role of vhl as a candidate tsg in the development and/or progression of crcc and probably occurs independent of fhit loh . although fhit and vhl deletion loci were common in reported and our series , the loh pattern of other affected loci of discontinuous deletions was different in their and our series.[4717 ] additionally , our studies disclosed recurrent deletions of flanking loci to fhit and vhl in our series of crcc . the loh of flanking loci of vhl ( 3p24.2-p26 ) is suggestive of long terminal deletion of 3p24.2-p26 is unique finding in our series . homozygous allelic patterns observed in two micro satellite markers in the region 3p21.2-p24.2 suggest the limitations of pcr to detect deletion for homozygous alleles . the dilemma of differential patterns of deletion needs to be resolved by the implementation other sensitive techniques such as real - time quantitative pcr , cgh array , and bac array - fish , which would allow us to validate targeted loh loci on 3p and to narrow down our hunt for hot spot loci on 3p to specific chromosomal sub bands . these studies in future would serve as a platform for positional cloning strategies to identify many putative or candidate rcc - related tsg 's on 3p other than vhl and fhit , which additionally contribute in the pathogenesis of crcc . | objective : loss of heterozygosity ( loh ) studies were undertaken to investigate the consistently deleted loci/ ?
tumor suppressor gene loci ( tsg ) on 3p in conventional renal cell carcinoma ( crcc).materials and methods : loh studies were performed by polymerase chain reaction ( pcr ) using 15 micro satellite markers mapped in region 3p12-p26 on 40 paired crcc tumors and normal kidney at stages i - iv .
simultaneously , fluorescent in - situ hybridization ( fish ) studies were performed to investigate the allelic deletion of fragile histidine triad ( fhit).results : our studies revealed three affected regions ; 3p12.2-p14.1 , 3p14.2-p21.1 , and 3p24.2-p26.1 with differential frequencies in group
i ( stage i and ii ) and group ii ( stage iii and iv ) .
incidence for d3s1234 ( fhit locus ) and d3s2454 ( 3p13 ) was 75% and 83% in group i and ii , respectively . comparative allelotyping in epithelial malignancies like lung , bladder , and breast tumors revealed loh ( frequency 1420% ) only in breast tumors for d3s2406 , d3s1766 ( distal to fhit ) , and d3s1560 ( distal to vhl , von - hippal lindau ) .
fish using fhit gene probe revealed deletions in crcc ( 88% ) , breast ( 30% ) , and lung tumors ( 10% ) with no deletions in bladder tumors and leukemias , signifying the importance of fhit in the pathogenesis of tumors of epithelial origin.conclusion:our findings suggested fhit deletion as an early and vhl deletion as an early and/or late event in crcc .
additionally , studies also disclosed the recurrent deletions of flanking loci to fhit and vhl in crcc .
the dilemma of interstitial or continuous deletion on 3p needs to be resolved by implementation of latest sensitive molecular techniques that would further help to narrow down search for tsg loci specific to crcc , other than vhl and fhit . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
obesity is a highly heritable complex disorder defined by the world health organization ( who ) as a body mass index ( bmi ) 30 kg / m . it is also one of the greatest public health challenges of modern times , given its increasing prevalence to epidemic proportions worldwide . the major concern of the obesity epidemic is that obesity is a preventable risk factor for some of the leading causes of mortality , including heart disease , type ii diabetes , and certain types of cancers [ 2 , 3 ] . this rapid global rise in obesity has been largely driven by lifestyle and environmental changes . despite that , genetic variation plays a major role in determining the interindividual differences in susceptibility or resistance to the current obesogenic environment , which is characterized by easy access to high - calorie food and reduced energy expenditure . indeed , twin and adoption studies have revealed that heritability of obesity is about 4070% [ 5 , 6 ] ; although it may be that current heritability estimates are inflated . furthermore , there are a number of rare monogenic causes of obesity and genetic syndromes that have obesity as a central feature [ 810 ] , which in fact provided the first indications of how obesity development might be strongly influenced by genes . given the estimated heritability of bmi , extensive efforts have been made for the past several years to identify the genetic factors underlying the heritable risk of obesity . while there has been much concentration on genetics research focusing on common obesity susceptibility variants , the so far established loci confer only a small fraction of the inter - individual bmi variation , and there is still much to be learned regarding the biological implications of the associations . this is in sharp contrast to the successful gene identification in rare forms of obesity . in this paper , we review the recent advances in the field of genetics of obesity with an emphasis on genes and genomic regions implicated in highly penetrant forms of human obesity presenting as part of phenotypically well - defined syndromes , or more generally , in the presence of developmental delay ( dd ) , intellectual disabilities ( i d ) , and/or malformative features . the outcome of array genomic hybridization in this patient population will likely enhance our understanding of obesogenic pathways findings that may lead to new targets for drug design and to therapeutic options for each syndrome and obesity in general and also help in developing novel methodological approaches to the study of obesity . one common theory to explain how genes contribute to obesity in the current environment is the accumulation of energy - thrifty genesgenes which enable individuals to efficiently collect and process food to deposit fat during periods of food abundance that have held significant survival advantages in the past when food sources were rather scarce ( thrifty - genotype hypothesis ) . genes that helped our ancestors to survive famines are more susceptible to obesity in modern societies with a constant abundance of food and also explains the variation in how people respond to the same unhealthy environmental pressures . yet , despite a relatively high heritability , the search for obesity susceptibility genes has been a challenging task . early studies aiming to identify the gene variants underlying susceptibility to common obesity suffered from several limitations inherent to the methodologies available at the time ( i.e. , candidate genes and family - based linkage studies ) and had limited success . progress in the field has been swift with the advent of recent hypothesis - free genome - wide association studies ( gwass ) using high - density single - nucleotide polymorphism ( snp ) genotyping arrays , or snp arrays , preceded by sequencing of the human genome and the creation of databases of snps ( such as dbsnps and the international hapmap ) . gwass typically focus on snp markers that capture linkage disequilibrium ( ld ) relationships across the whole genome ( tag snps ) and differ in frequency between cases and controls , or between individuals with different phenotypic values , in samples of sufficient size to reach genome - wide level of statistical significance ( e.g. , p < 10 ) [ 13 , 14 ] . gwas is currently the most commonly used method to identify genetic loci associated with a particular phenotype , but has also already been completed , in a short period of time , for most common human diseases and related traits , mainly in european ancestry populations . as for bmi , there have been to date four large gwas meta - analyses in general populations of european descent , each with increasing sample sizes ( with n ranging from 16876 to 123865 individuals ) to detect variants with smaller effect sizes or lower allele frequencies not detected by the preceding ones . the fourth large - scale gwas meta - analysis performed by the genetic investigation of anthropometric traits ( giant ) consortium has discovered a total of 32 loci robustly ( p < 5 < 10 ; odds ratio = 1.016- to 1.203-fold ) associated with bmi . the three most significantly associated snps for bmi included rs1558902 within intron 1 of the fat mass and obesity - associated ( fto ) gene ( p = 4.8 10 ; odds ratio = 1.203 ) , rs2867125 near tmem18 ( p = 2.77 10 ; odds ratio = 1.134 ) , and rs571312 near mc4r ( p = 6.43 10 ; odds ratio = 1.108 ) . notably , some associations are common even with obesity - related traits and consistent across multiple ethnic groups , most commonly in the fto and near - mc4r loci . however , the effect sizes detected are smaller than anticipated : the combined risk alleles explain only a fraction ( ~1.45% ) of the inter - individual variation in bmi , with the fto locus accounting for the largest proportion in variation ( 0.34% ) ; for each additional risk allele in fto , bmi increases by 0.39 kg / m ( ~1.1 kg for someone 170 cm tall ) [ 16 , 17 ] . it thus follows that the risk alleles discovered in the most recent and largest gwas for bmi are not sufficient to have any clinical value and additional genes or different types of genetic variants remain to be discovered . despite the very limited predictive value and the fact that the causal variants and/or molecular basis of risk etiology remain largely unclear ( very few common variants for disease have been functionally validated ) , gwass have provided valuable insights into the genetics of obesity , particularly about its biology . several of the likely causal genes in predisposition to obesity are highly expressed or known to act in the central nervous system ( cns ) and thus are thought to be involved in obesity susceptibility via cns - mediated effects . fto , for instance , is one of the best investigated obesity - associated genes of the gwas era . the fto mrna is most highly expressed in the brain and especially in the hypothalamus , an area known from rare monogenic forms of obesity to be critical in the control of energy homeostasis . there is additional evidence that fto expression in the arcuate nucleus ( arc ) of the hypothalamus is bidirectionally regulated as a function of nutritional status ( i.e. , feeding and fasting ) , and that changes in fto expression levels in the arc can bidirectionally influence food intake . despite these direct evidences that fto is functionally involved in energy homeostasis by central regulation of food intake , the mechanisms by which fto increases risk of obesity are still not fully understood but may relate to epigenetic processes through fto gain of expression [ 19 , 20 ] . a recent work has shown expression of fourteen likely causal obesity risk genes ( fto , mc4r , bdnf , tmem18 , kctd15 , negr1 , nrxn3 , etv5 , mtch2 , sec16b , tfap2b , gnpda2 , faim2 , and lyplal1 ) in the hypothalamus of both obese and lean rats , which either support or bring new evidence for a potential central effect of these genes on energy homeostasis . another observation reinforcing the role of genes involved in the central regulation of food intake in obesity predisposition is that so far , three obesity susceptibility loci are located near genes ( mc4r , sh2b1 , and bdnf ) that have already been shown to carry deleterious mutations disrupting hypothalamic functions and leading to monogenic forms of early - onset obesity with hyperphagia as a common feature . moreover , synthetic associations , while theoretically possible , are unlikely to be responsible for many of the gwas signals that have been reported , and there is no evidence supporting this hypothesis at the mc4r locus . following this , one can expect that the gwas - derived loci should be useful in clinical practice , if they point towards highly relevant candidate genes that may harbor rare mutations with large effects . one important consideration to address the issue of missing heritability , that is observed not only in obesity but for most of the conditions for which gwass have so far been carried out , is that gwas and snps selection in commercial genotyping arrays have been largely driven by the common disease - common variant ( cdcv ) hypothesis , which states that the heritability of common diseases is more strongly influenced by the additive effects of a few common allelic variants , which are present in more than 15% of the population [ 25 , 26 ] . therefore , the snps that are on the snp chips have been selected to be common ( most have a minor allele frequency ( maf ) of 5% ) , and the proportion of heritability that can be captured with common snps depends on how well causal variants are tagged by these snps . as with bmi , the proportion of heritability explained by genome - wide significant snps is less than 2% , but this percentage rises to almost 20% if the analysis is extended to common snps that do not reach genome - wide significance . this proportion of variance that lacks statistical significance ( false negatives ) is possible due to ungenotyped causal variants that have a lower allele frequency than snps in the gwas ( i.e. , less common or rare variants ) , and that are in low ld with genotyped snps . these findings further give support to the growing interest in the role of low frequency ( 0.5 < maf < 5% ) or rare ( maf < 0.5% ) sequence variants and other forms of genetic variation , in particular genomic structural variants . indeed , genome copy number variants ( cnvs)a form of structural variation instead of snps are now recognized as the prevalent form of genetic variation with potential clinical relevance in a number of diseases [ 2830 ] , and the involvement of cnvs in complex diseases is an area under intense investigation . cnvs are traditionally defined as dna segments greater than 1 kb in length that are present at a variable copy number ( gains and losses of dna ) across individuals . the first evidence that copy - number alterations can influence human phenotypes came from sporadic diseases ( resulting from de novo cnvs ) , termed genomic disorders , which are defined as diseases caused by genomic rearrangements affecting dosage - sensitive genes [ 32 , 33 ] . the most common mechanisms whereby a cnv may convey a phenotype are gene dosage , gene disruption , and position effects . given these observations , cnvs have been predicted to account for a significant component of variation in complex diseases risk . indeed , emerging data suggest that this mechanism of mutation contributes to both common and rare diseases . however , despite the fact that most of the differences between any two individuals ( ~80% ) arise from a limited set of common copy number polymorphisms ( cnps ) ( cnvs at > 5% frequency ) , the release of a reference map of human cnvs in the hapmap populations followed by a comprehensive genome - wide association study of common copy - number variation in eight common human diseases ( ~19000 individuals ) indicated that common cnvs are not likely to contribute to disease susceptibility beyond common snps in ld . this is because , in fact , common cnvs are well captured by snps typed in gwas as a result of strong ld , implying that their role in common diseases has already been explored indirectly via snp - based gwas . nevertheless , the importance of cnvs resides in the fact that , due to their potential functional impact , cnvs in strong ld with the trait - associated snps are expected and some have already been shown to be the functional variants for the association signals of gwas [ 34 , 36 ] . notably , ~88% of currently identified disease- and trait - associated snps are either intronic or intergenic , and most of these variants did not appear to be functional . however , recent encode ( encyclopedia of dna elements ) data demonstrate that an appreciable proportion of gwas snps might represent the actual functional variants . in obesity , using a snp tagging approach , two of the 32 confirmed bmi snps were found to tag common cnvs : rs2815752 tagging a 45 kb deletion near the neuronal growth regulator ( negr1 ) gene and rs12444979 tagging a 21 kb deletion that lies 50 kb upstream of gprc5b . in addition , copy number analysis of gwas data in two discovery samples ascertained for early - onset ( extreme ) obesity confirmed the cnv near negr1 and led to the identification of a cnv at 10q11.22 encompassing one important obesity gene ( ppyr1 ) that was initially described in an adult chinese population - based sample , as well as of another new cnv at 11q11 spanning ~80 kb and covering exclusively three olfactory receptor genes ( or4o , or4s2 , and or4c6 ) . large and rare cnvs ( > 500 kb , < 1%)as opposed to the vast majority of inherited cnps which are much smaller have been shown to contribute significantly to the risk of common complex disorders , such as that 5% of cases of schizophrenia and of autism have each been attributed to cnvs at fewer than half a dozen genomic locations , whose effects are less highly penetrant than mendelian mutations . several rare , obesity - specific cnvs have been detected by genome - wide studies of individuals with extreme phenotypes . in one such study , bochukova et al . examined 300 caucasians patients with early - onset obesity ( half of them also showing developmental disorders ) and observed a twofold enrichment of large and rare deletions in patients compared to 7366 healthy controls examined ( p < 0.001 ) . they also found an enrichment of a number of recurrent ( present in two or more individuals ) cnvs in patients relative to controls . among these , they identified a 220 kb deletion on chromosome 16p11.2 ( 28.728.9 mb , hg18 ; ncbi build 36 ) containing the sh2b1 gene in three patients who had inherited the deletion from obese parents . additionally , two more cases were identified in a replication cohort of 1062 caucasian patients with severe obesity alone , and the deletion cosegregated with obesity in one of these families with available samples . the reported overall prevalence of the sh2b1-containing deletion in patients with severe early - onset obesity alone was 0.41% ( 5 out of 1219 ; 0.41% ) compared to only 2 out of 7366 ( 0.027% ) controls ( p < 0.001 ) . in a parallel study , walters et al . identified a separate , proximal deletion of approximately 600 kb at chromosome 16p11.2 ( 29.530.1 mb , hg18 ; ncbi build 36 ) containing the tbx6 gene in 2.9% ( 9 out of 312 ) of obese children whose ascertainment also included cognitive deficits / malformations . the deletion was also present in 0.4% of individuals ( 15 out of 4197 ) ascertained only for obesity but not in normal weight controls and in 0.6% of patients ( 22 out of 3947 ) with dd and/or malformations but without selection for obesity . pooling the data obtained from a general population cohort ( 11856 subjects in total ) with those from the obesity cohorts in an overall case - control association analysis , the authors found at or near genome - wide significant evidence for association of the 16p11.2 deletions with obesity ( p = 5.8 10 ; odds ratio = 29.8 ) and morbid obesity ( p = 6.4 10 ; odds ratio = 43.0 ) . another study by wang et al . also found strong support for large and rare cnvs , especially gene - disrupting deletions , contributing with higher risk to obesity than common variants . in that study , cnvs > 1.0 mb were found overrepresented among 430 case subjects of european ancestry who had moderate to extreme obesity versus 379 controls subjects who had never been obese ( odds ratio = 1.5 ) , while cnvs > 2.0 mb were present in 1.2% of obese case subjects ( 5 out of 427 ) but absent in the lean controls ( odd ) . a total of eleven cnvs representing major risk factors for obesity were uncovered by this study , several of which disrupting potential candidate genes ( e.g. , ucp1 , il15 ) . finally , a subsequent larger study uncovered 17 additional rare cnvs that were unique to at least three extremely obese children among 1080 european american ( ea ) cases and in none of the 2500 lean controls , of which eight ( 47.1% ) also replicated exclusively in an independent case - control data set from african ancestry . it is important to mention that there are several concerns regarding gwas - based cnv analysis , specifically with regard , the inaccuracy of cnv calling algorithms in detecting particularly small cnvs , common cnvs , and duplications using snp arrays , and the impact of cnv genotyping call errors on association analyses has not been extensively studied [ 47 , 48 ] . the short arm of human chromosome 16 is particularly enriched for large segmental duplications ( sds)duplicated sequences of > 1 kb with 90% or more sequence identity in the reference human genome assembly that serve as substrates for unequal crossover or nonallelic homologous recombination ( nahr ) , resulting in recurrent duplications and deletions and predisposing this region to diseases . several distinct , recurring imbalances of 16p have been associated with abnormal phenotypes by genotyping of large case - control studies , which together with other recurrent genomic imbalances ( e.g. , 1q21.1 and 16p12.1 deletions ) escape syndromic classification , representing instead a subset of genomic disorders that shows association with variable phenotypes ( e.g. , dd / id , congenital malformations , epilepsy , schizophrenia , autism , cardiac and renal anomalies , and obesity ) [ 49 , 50 ] . these cnv loci are also associated with highly variable expressivity ( or reduced penetrance ) in that they are also found at lower frequencies in the control populations as well as in family members who are often unaffected ( or presenting with milder phenotypes ) . although the cause of phenotypic variability remains largely unexplained , recent studies show that the presence of two - hit cnvs ( two - hit model ) with additive or epistatic effects can contribute to variability associated with these cnvs [ 4951 ] . recently , two large copy number variant case - control studies have demonstrated and confirmed the pathogenicity of the aforementioned obesity - associated 16p11.2 deletions . exploiting a large cnv dataset derived from a consortium of clinical laboratories ( the international standards for cytogenomic arrays consortium , isca ; https://www.iscaconsortium.org/ ) involving 15749 cases and 10118 controls , kaminsky et al . observed the proximal 16p11.2 deletion ( tbx6 ) in 67 cases of intellectual and developmental disabilities compared to only five occurrences among the control population ( p = 6.34 , odds ratio = 8.64 ) . in terms of frequency , the 16p11.2 deletion was second only ( and nearly as often as ) to the velocardiofacial / digeorge syndrome ( vcf / dgs ) deletion . compared cnvs in 15767 children with a general diagnosis of dd / id to cnvs in 8329 unaffected adult controls and found 64 instances of 16p11.2 proximal ( tbx6 ) deletions among cases compared to 3 controls ( p = 3.4 10 ; penetrance = 0.96 ) and 15 instances of 16p11.2 distal ( sh2b1 ) deletions among cases versus one control ( p = 0.0107 ; penetrance = 0.94 ) . a previous case - control study in a clinical setting found this recurrent sh2b1-containing microdeletion in 0.13% ( 31 out of 23084 ) of patients with a variety of different clinical findings compared with a single case of deletion among 7700 phenotypically normal controls ( 0.013% ; p = 0.003 ) . notably , the authors not only observed a high frequency of obesity in individuals with this deletion but also dd / id , aside from other variable phenotypic features , highlighting the pathogenicity of the recurrent 220 kb 16p11.2 deletion and its link to both obesity and dd / id . originally , deletions of the more proximal 600 kb region of 16p11.2 were reported as a recurrent microdeletion in individuals with autism spectrum disorder ( asd ) ; this explains why it is usually referred to as the autism - associated proximal 16p11.2 deletion . however , as more case - control studies were undertaken , it became clear that this deletion contributes to the etiology of both dd / id and asd . it was only after that the same event was documented to increase the risk of obesity . interestingly , the reciprocal 16p11.2 duplication was recently shown to confer an increased risk for being clinically underweight ( bmi 18.5 ) , with similar effects among medically ascertained ( id / dd and psychiatric cohorts ) and nonmedically ascertained ( population - based cohorts ) carriers . in fact , the duplication conferred an 8.3-fold increased risk in adulthood of being underweight ( p = 1.53 10 ) . furthermore , gene expression levels of the 27 genes mapping to 16p11.2 were shown to correlate positively with gene dosage in deletion and duplication carriers . thus , deletion and duplication in 16p11.2 demonstrates that reciprocal changes in gene dosage ( i.e. , haploinsufficiency and triplosensitivity ) at this locus have opposite effects on bmi . a major challenge for such cnv hotspots flanked by duplications has been the paucity of patients described with smaller or atypical rearrangements , which would allow reducing the disease - associated critical region . accordingly , the breakpoints of the distal and proximal 16p11.2 deletions have been reported as identical in most individuals , and thus hampering delineation of the dosage - sensitive gene(s ) that underlie the observed phentoypes . however , there is mounting evidence supporting a role for haploinsufficiency of sh2b1 in the obesity phenotype of patients with the 220 kb deletion : it encodes an adaptor protein involved in the leptin and insulin signaling ; it is a likely causal obesity gene from the gwas era ; mice lacking sh2b1 are characterized by obesity and severe insulin resistance [ 17 , 57 ] . on the contrary , there are no data at present pointing towards particular candidate genes for obesity within the more proximal 600 kb region of 16p11.2 , and several might be of potential functional relevance ( e.g. , bola2/b , sult1a4/3 , spn , maz , mvp , kctd13 , taok2 , ppp4c , gdpd3 , and mapk3 ) . the t - box 6 ( tbx6 ) gene , a transcription factor involved in regulation of early developmental processes , has been proposed to play a role in the congenital anomalies among a series of patients . monogenic forms of obesity refer to a highly penetrant form of the disease resulting from mutations in , or deletions of , single genes ( mendelian conditions ) . to date , there are eight well - established monogenic obesity genes : leptin ( lep ) , leptin receptor ( lepr ) , proopiomelanocortin ( pomc ) , prohormone convertase 1 ( pcsk1 ) , melanocortin 4 receptor ( mc4r ) , single - minded homologue 1 ( sim1 ) , brain - derived neurotrophic factor ( bdnf ) , and neurotrophic tyrosine kinase receptor type 2 ( ntrk2 ) . mutations in these eight genes are known to cause early - onset obesity and hyperphagia and may account for up to 10% of severely obese children . originally identified by study of consanguineous families , fully penetrant recessive forms of early - onset severe obesity are associated with complete inactivation of five such genes ( lep , lepr , pomc , pcsk1 , and mc4r ) involved in the leptin - melanocortin signaling pathway . these recessive forms of obesity confirmed the central role of this pathway in the long - term regulation of energy balance . in short , the adipocyte hormone leptin acts via its receptors to inhibit food intake through reciprocal regulation of pomc and agrp / npy ( agouti - related protein / neuropeptide y ) neurons in the arcuate nucleus of the hypothalamus ( arc ) and consequent activation of mc4r in the paraventricular nucleus ( pvh)following the binding of -melanocyte stimulating hormone ( -msh ) , a cleavage product of the pomc transcript by pcsk1 , which in turn provides an anorexigenic / satiety signal through the activation of downstream effectors [ 7 , 12 , 13 ] . the leptin - melanocortin signaling pathway as a molecular therapeutic target for treating obesity leads to the first and until now only effective pharmacotherapy for obesity , that is , recombinant human leptin replacement in the rare cases of congenital leptin deficiency . these recessive and most severe forms of human obesity are accompanied by normal development and typically include additional and more specific features , such as adrenal insufficiency and red hair ( pomc ) , reactive hypoglycemia and intestinal dysfunction ( pcsk1 ) , hyperinsulinaemia and accelerated height ( mc4r ) , extremely low serum leptin levels ( lep ) , and hypogonadotropic hypogonadism and impaired immune function ( lep , lepr ) . on the other hand , heterozygosity for deleterious coding mutations in mc4r , lep , lepr , and pomc has been associated with a less severe , nonfully penetrant form of obesity , implicating these genes in susceptibility to obesity at the population level as well . in fact , mutations in mc4r are the most common recognized cause of monogenic obesity , with the vast majority of cases described so far having heterozygous , dominantly inherited mutations . mc4r mutations have a population prevalence of at least 1 in 2000 ( 0.05% ) , are found in 0.5% to 1% of obese adults , and are accountable for 6% of all severe cases of the disease starting in childhood . additionally , partial deficiency for sim1 , bdnf , and ntrk2 genes , involved in the functioning of the hypothalamus and specifically downstream of mc4r - expressing neurons , lead to severe hyperphagic obesity , accompanied by dd and syndromic features in humans . a single case of haploinsufficiency of sim1 caused by a de novo balanced translocation between chromosomes 1p22.1 and 6q16.2 , which disrupts sim1 , was reported in a girl who had early - onset severe obesity with no other developmental abnormalities or syndromic features described . patients who are obese because of interstitial deletions of chromosome 6q that involve the sim1 locus have been reported with neurodevelopmental issues and specific phenotypes resembling those of prader - willi syndrome ( pws ) , the most common syndromic form of obesity . a single case of functional deficiency of bdnf , caused by a de novo chromosomal inversion that included the bdnf locus , was reported in an 8-year - old girl who presented with hyperphagia , obesity , and additionally impaired cognition . furthermore , bdnf haploinsufficiency was implicated directly in the obesity phenotype of a subset of individuals suffering from wilms tumor - aniridia - genitourinary anomalies - mental retardation ( wagr ) syndrome who , in addition to the obligatory heterozygous deletion of the pax6 and wt1 genes , were demonstrated to have longer deletions including the bdnf locus at 11p14.1 . finally , a de novo missense mutation in the receptor for bdnf , ntrk2 , was found in an 8-year - old male with a complex developmental syndrome and severe obesity . obesity syndromes , sometimes referred to as obesity - related syndromes , are also associated with dd / id , dysmorphic features , and/or congenital anomalies . the latest human obesity gene map update reported 50 loci related to mendelian syndromes relevant to human obesity . syndromic forms of obesity typically arise from chromosomal abnormalities at several genomic regions ( both autosomal and x - linked ) , whilst a few single - gene mutations resulting in pleiotropic syndromes with obesity as a central feature are included in the same category . one of the most well - known forms of syndromic obesity ( also the first to be described in the literature ) is pws , which manifests as infantile hypotonia , genital hypoplasia , and neonatal feeding difficulties , followed by hyperphagia leading to profound obesity in early childhood and into adulthood . other typical examples are albright hereditary osteodystrophy ( aho ) , bardet - biedl ( bbs ) , alstrm ( als ) , carpenter ( or acrocephalopolysyndactyly type ii ) , cohen ( cs ) , brjeson - forssman - lehmann ( bfls ) , and mehmo ( mental retardation , epileptic seizures , hypogenitalism , microcephaly , and obesity ) syndromes [ 810 ] . pws and aho are also examples of imprinting disorders featuring obesity as one of their clinical characteristics . pws is due to the lack of expression of imprinted genes on chromosome 15q11q13 that are usually only expressed on the paternally inherited chromosome . aho is an autosomal dominant disorder characterized by short stature , obesity , skeletal defects , and impaired olfaction , which is caused by germ line mutations that disrupt imprinting in the maternal allele of the gnas1 gene . significant advances in the identification and characterization of the genes implicated in these syndromes have been made in the last few years , revealing interesting genetic pathways involved in syndrome pathology which may be leading to obesity . for example , in pws there is strong evidence in support of a critical role for the c / d box containing small nucleolar rna ( snorna ) genes , especially of the snorna snord116 cluster ( hbii-85 ) , in the major components of the disease phenotype , such as infantile hypotonia , early - onset morbid obesity , and hypogonadism . this comes from recent data from three published patients manifesting the major features of pws , but with normal dna methylation analysis , who were discovered by array comparative genomic hybridization ( array cgh ) investigation with ~174236 kb overlapping microdeletions at 15q11.2 , which reduced the critical region for pws to the c / d box snorna snord116 cluster [ 6971 ] . there exist a number of paternally expressed genes ( e.g. , mkrn3 , magel2 , ndn , snurf - snrpn , and multiple snornas ) within the imprinted 15q11q13 region . however , paternal deficiency of mkrn3 , magel2 , and ndn is not sufficient to cause pws , and the snrpn , initially considered a primary pws candidate gene , was ruled out as having a major role in pws from analysis of pws cases with balanced translocations . pws is likely caused by a hypothalamic dysfunction , but further investigation is still needed to determine how these non - coding rnas , predicted to regulate the level , splicing , or modification of other rnas , could lead to hyperphagia and obesity . importantly , although no known pharmacologic agent that can diminish hyperphagia is effective , early - onset intervention , such as dietary restrictions and behavior modification , has been proven to be successful in preventing the inappropriate weight gain . additionally , growth hormone ( gh ) therapy has resulted in dramatic benefits to the phenotype , including decrease in body fat mass , increase in lean body mass , and linear growth velocity . interestingly , a recent study reported three cnvs ( with occurrence rates higher than 1% ) at the pws 15q11.2 region that were significantly associated with body fat mass ( p < 0.05 ) in the general white populations , with a higher copy number ( cn ) resulting in an increase of 5.089.77 kg in body fat mass . thus , cnvs at the pws critical region may contribute to common obesity . in bbs , als , and carpenter syndromes , all of each of autosomal recessive inheritance , the disease phenotype has been linked to abnormal formation or function of the primary cilia [ 810 ] , which are microtubule - based sub - cellular organelles projecting from the surface of nearly all human cell types that mainly serve as a sensory organelle for the cell . the integrity of primary cilium and maintenance of ciliary function through their coordination with intraflagellar transport ( ift ) , a specialized trafficking system in primary cilia , are both required to properly activate primary cilia - mediated cellular signaling , and defects in genes encoding components of the cilium have been linked to a constellation of phenotypically and genetically overlapping human diseases , which are collectively known as ciliopathies . bbs ( obesity , retinitis pigmentosa , renal anomalies , postaxial polydactyly , learning disabilities , and defects in the urogenital tract ) is the prototypical human genetic disorder associated with ciliary dysfunction and obesity . fifteen bbs genes ( bbs115 ) have been identified accounting for about 80% of the known cases of bbs . among the known bbs proteins , seven proteins ( bbs1 , bbs2 , bbs4 , bbs5 , bbs7 , and bbs9 ) collectively form part of the ift complex of the primary cilium , known as the bbsome . other known bbs proteins appear to be crucial for the recruitment of this complex onto the ciliary membrane ( bbs3 ) or in mediating the assembly of the bbsome ( bbs6 , bbs10 , and bbs12 ) . most of the bbsome cargos are currently unknown but bbs proteins , in particular bbs1 , are required for leptin receptor ( lepr ) signaling in the hypothalamus , and loss of leptin action in pomc neurons due to a defective leptin receptor signaling has been implicated in the obesity phenotype of bbs . variants of several bbs genes seem to increase susceptibility to obesity in non - bbs patients [ 76 , 77 ] , thus exploration of the relevance of bbs proteins for common obesity with regard to leptin receptor trafficking is a worthy effort . als ( cone - rod dystrophy , hearing loss , childhood truncal obesity , insulin resistance and hyperinsulinemia , type 2 diabetes , hypertriglyceridemia , short stature in adulthood , cardiomyopathy , and progressive pulmonary , hepatic , and renal dysfunction ) and carpenter ( peculiar facies , asymmetry of the skull , polydactyly , brachymesophalangy , mild soft tissue syndactyly , obesity , hypogenitalism , congenital heart disease , and i d ) syndromes have a unique genetic cause , that is , mutations in the alms1 and rab23 genes , respectively . alms1 is a ciliary protein and plays a role in normal centrosome / basal body function and intracellular trafficking events . in the brain , alms1 the cellular and molecular mechanisms underlying the disorder remain to be understood , and the consequences of centrosome , ciliary , and/or ift system deficits in the hypothalamic pathways for metabolic abnormalities leading to obesity are not well understood . it has been hypothesized that loss of functioning alms1 could impact the cilia on hypothalamic neurons and lead to alteration in behavior and energy homeostasis through abnormal perception of appetite and satiety cues , such as leptin , resulting in overeating and obesity . rab23 is a member of the rab family of small gtpases that has been identified along with other rab gtpases ( rab5 , rab6 , rab8 , rab10 , and rab11 ) at the primary cilium , which have been shown to function in different ciliary trafficking pathways or processes . disruption of the ciliary localization or the activities of these rab gtpases are associated with several ciliopathies due to impairments in cilium formation and function . rab23 specifically is proposed to act as a negative regulator of hedgehog ( hh ) signaling . thus , the discovery of the genetic basis for carpenter syndrome provided a link between cilia , hh signaling , and obesity . cohen syndrome ( cs ) ( obesity , mental retardation , microcephaly , prominent upper central incisors , and progressive retinochoroidal dystrophy ) is caused by autosomal recessive mutations in the vps13b ( coh1 ) gene , which encodes a golgi matrix protein . the relationship between coh1 mutations and obesity is not yet understood although altered golgi integrity and function probably underlie cohen syndrome . the former is characterized by obesity , severe cognitive impairment , epilepsy , hypogonadism , and marked gynecomastia . mutations in a widely expressed zinc - finger gene , phf6 , at xq26.3 have been identified in nineteen unrelated cases of bfls . although the functional properties of this protein remain unclear , it is localized in the cell nucleus and nucleolus . to date , no single gene has been identified as the genetic cause of mehmo but the disease locus has been assigned to xp21.1p22.13 . more recently , truncating mutations in two x - linked genes , ube2a which encodes a ubiquitin - conjugating enzyme and cul4b which encodes a ubiquitin e3 ligase subunit , were identified as causative genes for x - linked mental retardation ( xlmr ) syndromes associating obesity , seizures , marked hirsutism , and a characteristic facial appearance ( ube2a ) or central obesity , aggressive outbursts , relative macrocephaly , hypogonadism , pes cavus , and tremor ( cul4b ) . in addition to pws , several other obesity - related syndromes are caused by chromosomal rearrangements , especially chromosomal deletions . for these syndromes , obesity is usually manifest in many but not all individuals , suggesting reduced penetrance or variable expressivity , or yet that other unidentified factors may be required for the development of the obesity phenotype . examples include deletions of 1p36 ( monosomy 1p36 syndrome ) , 2q37 ( brachydactyly mental retardation syndrome ; bdmr ) , 6q16 ( pws - like syndrome ) , 9q34 ( kleefstra syndrome ) , 11p13 ( wagr syndrome ) , and 17p11.2 ( smith - magenis syndrome ; sms ) . such syndromes are generally regarded as contiguous gene disorders although haploinsufficiency for specific genes in the critical interval is likely to be responsible for the phenotypes . indeed , sequencing of the likely candidate genes mapping to the smallest region of overlap ( sro ) for some of these syndromes , following the discovery of atypical and smaller deletions among cases with virtually identical phenotypes , has identified disease - causative mutations in hdac4 ( 2q37 ) , ehmt1 ( 9q34 ) , and rai1 ( 17p11.2 ) in patients showing strong phenotypic similarity with the known syndromes , but lacking the expected chromosome abnormalities [ 8589 ] . otherwise , known candidate genes for obesity have been identified in critical map intervals ( e.g. , sim1 ( 6q16 ) , bdnf ( 11p13 ) ) [ 62 , 64 ] . of note , a number of the chromosome deletions named here show some overlap between them and with pws in that affected individuals are likely to have childhood obesity , hyperphagia , learning disabilities / dd , hypotonia , and neonatal feeding difficulties . thus , they often pose significant diagnostic challenges , while having a high likelihood of a shared common underlying mechanism or pathway leading to common phenotypic effects when disrupted , raising the possibility that a group of genetically heterogeneous individuals with obesity could be treated if a common molecular etiology was targeted . in this sense , accumulated evidence reveals that diminished bdnf function , which is associated with hyperphagia , obesity , and neurocognitive deficits in both animals and humans , is involved in several of these conditions . among a subset of wagr patients with deletions that included the 11p14 bdnf locus , bdnf haploinsufficiency was associated with lower levels of serum bdnf ( ~50% lower serum bdnf concentration than patients without bdnf deletions ) and with a 100% prevalence of childhood - onset obesity ( as compared with 20% of patients without bdnf deletions ) . likewise , data showed significantly decreased serum bdnf levels in patients with pws compared with obese controls , which may reflect insufficient central bdnf production . sms is caused by deletion or mutation ( haploinsufficiency ) of the retinoic acid induced 1 ( rai1 ) gene . in addition to dd / id , behavioral abnormalities , and sleep disturbances , a majority of children with sms also have significant early - onset obesity . in a recent model of sms , expression analysis revealed that bdnf is downregulated in the hypothalamus of rai1+/ mice that are obese and hyperphagic due to an impaired satiety response . in addition , reported studies documented rai1 as a direct ( positive ) regulator of bdnf expression . chromosome deletions involving the 2q37 region result in bdmr syndrome , also known as aho - like syndrome . bdmr is a complex disorder that presents with a spectrum of clinical features , including dd / id , obesity , autism spectrum disorder , and craniofacial and skeletal abnormalities . recently , haploinsufficiency of hdac4 ( histone deacetylase 4 ) , which acts as a corepressor for dna - binding transcription factors , was shown to result in bdmr , and two individuals harboring mutations within the hdac4 gene were obese / overweight . data showed that deletion or mutation of hdac4 results in decreased rai1 mrna expression to lower than 50% levels , indicating that rai1 may function downstream of hdac4 and is either directly or indirectly regulated by hdac4 . common features include dd / id , characteristic dysmorphic features , hypotonia , seizures , hearing loss , heart defects , cardiomyopathy , and behavior abnormalities . obesity and/or hyperphagia occur in less than 50% of all cases reported ( in one series 15% of patients exhibited obesity ; in another 13% exhibited hyperphagia ) . similar phenotypes are seen among patients with a variety of deletion sizes , and critical regions harboring causative genes for specific features have been difficult to identify . despite that , genotype - phenotype correlations of 1p36 deletions in five patients with obesity / overweight allowed us to delineate the critical interval to this phenotype between ~2.0 to 3.0 mb from the 1p telomere , with the proximal boundary located to the proto - oncogene ski . a subsequent study by rosenfeld et al . further narrowed this critical interval to a 500 kb region ( ~1.7 to 2.3 mb from the telomere ) containing eight genes ( gnb1 , calml6 , tmem52 , c1orf222 , kiaa1751 , gabrd , prkcz , and ski ) , based on the smallest 1p36 deletion reported in the literature with hyperphagia . among these , gnb1 encodes a g - protein subunit that is ubiquitously expressed and is likely involved in signal transduction in neurons ; tmem52 , c1orf222 , and kiaa1751 are expressed during embryonic development and show expression in the brain ; gabrd , prkcz , and ski are candidate genes for the neurologic features associated with monosomy 1p36 . deletion 6q16 syndrome is a pws - like syndrome characterized by obesity , hyperphagia , hypotonia , small hands and feet , eye / vision anomalies , and global dd . until recently , there were only five patients with overlapping interstitial 6q16 deletions and a pws - like phenotype characterized with high resolution techniques , which allowed narrowing of the sro for the presumed gene(s ) involved in the pws - like features to 4.1 mb located at 6q16.1q16.2 . the sim1 gene , which appears to function downstream of the leptin - melanocortin signaling pathway to control appetite and is implicated with early - onset obesity in a patient with a balanced translocation which disrupts sim1 , lies within this interval and is likely responsible for obesity in these patients . an additional four individuals with a pws - like phenotype and overlapping 6q15q22.2 deletions were recently described , and only two had deletions of sim1 . thus , other genes on 6q may contribute to this phenotype , including a newly proposed candidate , the transcription cofactor gene vgll2 ( vestigial like 2 ) on 6q22.2 , which has strong expression in the developing mice ventromedial hypothalamus ( vmh ) ; rats with vmh lesion demonstrate extreme hyperphagia . deletions of the 9q34.3 subtelomeric region encompassing the ehmt1 ( euchromatic histone methyltransferase 1 ) gene , or loss - of - function mutations in ehmt1 , result in a clinically recognizable syndrome that is characterized by specific craniofacial features , hypotonia , childhood obesity , microcephaly , substantial speech delay , and i d . the true incidence of obesity is unknown , but several patients with either deletion or mutation of the ehmt1 gene have been reported as obese , and some with increased appetite and food seeking behaviour . in one series 45% of patients with ehmt1 mutations were overweight . ehmt1 , which encodes a histone methyltransferase , plays a role in the control of gene transcription through epigenetic modification of chromatin structure . while obesity is known to be associated with several genomic disorders known to result from cnvs ( table 1 ) , array genomic hybridization in patients with obesity syndromes where the genetic causes are unknown has afforded discovery opportunities for cnvs that have not previously been detectable . for example , chromosome 1p21.3 microdeletions comprising dpyd and mir137 were associated with i d and ( tendency ) to overweight ; overlapping deletions of 2p25.3 comprising myt1l were associated with i d and obesity / overweight ; deletions of a 4.2 mb region at 6q14.1q15 containing the genes htr1e , me1 , cyb5r4 , and snx14 were associated with obesity , dd , and a distinctive clinical phenotype ( such as motor delay , hernia , rounded face with full cheeks , epicanthal folds , short palpebral fissures , bulbous nose , large ears , and 2 - 3 toe syndactyly ) ; deletions of a 2.3 mb region on 11p14.1 including the bdnf were associated with dd , behavioral problems , and obesity ; duplications of 19q12q13.2 containing the genes akt2 , ceacam1 , cebpa , lipe , and tgfb1 , which are involved in adipose tissue homeostasis and insulin resistance , were described in three patients who displayed dd and obesity ( table 1 ) . chromosome rearrangements from individuals with syndromic obesity reported in the literature have been extensively reviewed by others . decipher is an interactive web - based resource and database of array genomic hybridization data that catalogues genomic rearrangements and clinical characteristics from patients suffering from developmental disorders , contributed by an international community of academic departments of clinical genetics . there are 189 entries matching the term obesity in the decipher database as of july 2012 . we compiled a list of 54 de novo cnvs ( or familial inherited from a parent with similar phenotype to child ) , thus more likely to be classified as pathogenic , that might represent novel genomic rearrangements playing a role in obesity development ( table 2 ) . in recent years , the ability to identify cnvs using many technology platforms available for array genomic hybridization ( e.g. , oligonucleotide- or snp - based arrays ) has facilitated the identification of several new microdeletion or microduplication syndromes , in addition to refining the critical interval ( or dosage - sensitive region ) of known genomic disorders . these technologies have been used particularly in large cohort studies with a general diagnosis of intellectual and developmental disabilities ( with an average diagnostic yield of 12.2% ) and are now recommended as first - tier genetic tests for the evaluation of this patient population [ 108 , 109 ] , but the overall diagnostic yield of array in patients with syndromic forms of obesity has not been established . although several well - known syndromic forms associate remarkable features allowing to establish or suspect a clinical diagnosis , which can be confirmed by other targeted assays ( e.g. , fish , quantitative pcr ( qpcr ) , multiplex ligation - dependent probe amplification ( mlpa ) , and targeted mutation screening of the corresponding candidate genes ) , in many cases patients lack sufficient specific history or features from physical examination . furthermore , any of the genes involved in mutational events can still be involved in a cnv , as demonstrated in one study in which oligonucleotide array cgh detected a homozygous 80 kb deletion in the chromosomal 1p31.3 region , comprising dnaj6c and lepr , in a 7-year - old patient with early - onset obesity , i d , and epilepsy , and thus confirming the effect of deleterious mutations in the leptin receptor . in another instance , oligonucleotide arrays allowed the detection of intragenic heterozygous deletions in the coh1 gene in three patients with atypical phenotype of cohen syndrome , and subsequent sequencing of the coh1 gene revealed point mutations in the second allele in all three patients . thus , high - resolution arrays can still be used to identify autosomal recessive syndromes , especially in the context of a contiguous gene syndrome ( as deletions in neighboring genes may affect the phenotype ) , and to further extend the phenotypic and mutational spectrum of recessive disorders . the extensive genetic heterogeneity of obesity and significant clinical overlap between obesity syndromes have been major problems for molecular diagnostic and genetic counseling applications . while there have been several studies regarding the use of array cgh among individuals with dd / id , asds , and multiple congenital anomalies , the use of array cgh in clinical practice using obesity ( in the presence of other anomalies ) as an initial paradigm has not been yet systematically explored . array genomic hybridization allows the detection of known abnormalities and the investigation of hitherto unknown abnormalities . besides revealing the genetic basis of obesity and associate phenotypes in selected individuals , such an effort will allow the phenotypic description of new obesity - related syndromes and define previously unidentified genomic regions or genes involved in the development of obesity thus enhancing our understanding of obesogenic pathways . these data will provide a useful list of genomic regions or genes that are worth to investigate further experimentally and will also help developing new diagnostic arrays , such as targeted oligonucleotide arrays , or specifically an exon - targeted clinical array to detect deletions or duplications occurring within genes in which the dosage effect is known or suspected to cause the phenotype as well as to infer a higher risk of inherited obesity . these technologies are likely to be used for cnv detection for some time while structural variation is still challenging to assess using only next - generation sequencing- ( ngs- ) based strategies . in addition , the informatics resources needed for whole genome / exome sequencing data analysis and storage are considerably and can often be a limitation . alternatively , target enrichment approaches coupled with ngs have been developed for efficient mutation detection of patients with diseases showing high genetic heterogeneity . these strategies have allowed the reliable detection of causative mutations in patients without previous molecular diagnosis . similarly , all candidate genes located in cnv intervals implicated in syndromic forms of obesity may be included in a targeted capture strategy for identification of mutations and other potentially pathogenic variants in patients without previously known molecular diagnosis . the availability of dna microarrays and ngs technology as complimentary approaches provides patients with comprehensive mutation analysis and will ultimately help in developing a ngs protocol relevant to clinical practice . identifying genes or molecular pathways common to the obesity phenotype seen in individuals with rare obesity - related disorders and those non - syndromic individuals from the general population may lead in the future to new therapeutic options for each syndrome and obesity in general . | in recent decades , obesity has reached epidemic proportions worldwide and became a major concern in public health . despite heritability estimates of 40 to 70% and the long - recognized genetic basis of obesity in a number of rare cases ,
the list of common obesity susceptibility variants by the currently published genome - wide association studies ( gwass ) only explain a small proportion of the individual variation in risk of obesity .
it was not until very recently that gwass of copy number variants ( cnvs ) in individuals with extreme phenotypes reported a number of large and rare cnvs conferring high risk to obesity , and specifically deletions on chromosome 16p11.2 . in this paper
, we comment on the recent advances in the field of genetics of obesity with an emphasis on the genes and genomic regions implicated in highly penetrant forms of obesity associated with developmental disorders .
array genomic hybridization in this patient population has afforded discovery opportunities for cnvs that have not previously been detectable .
this information can be used to generate new diagnostic arrays and sequencing platforms , which will likely enhance detection of known genetic conditions with the potential to elucidate new disease genes and ultimately help in developing a next - generation sequencing protocol relevant to clinical practice . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in a previous issue of critical care , novel insights into the effects of vasopressin in septic shock are presented . throughout the last 15 years , vasopressin has experienced a lively history as a vasopressor in critical care ( figure 1 ) . during a time when the intensivists ' belief in the beneficial effects of vasopressors and ( sub)normal arterial pressures on tissue perfusion remained unchal - lenged , vasopressin was propagated as a non - adrenergic vasopressor in various shock states . this evolution was fostered by an unrestricted sedation regime accepting over - sedation and , in turn , additional vasodilation . today , the approach to vasopressors and tissue perfusion has dramatically changed given our evolving understanding that macrocirculation and microcirculation correlate only poorly in sepsis . this may explain why a multi - centered randomized controlled trial and meta - analysis failed to detect a mortality benefit of vasopressin in septic shock despite increasing arterial pressure and reducing norepinephrine doses . one of the principal rationales for vasopressin use has been its non - adrenergic mechanism of action . a substantial decrease in heart rate in response timeline of the history of vasopressin , its evolution as a vasopressor agent , and important changes in critical care practice in the last 15 years which have influenced the role of vasopressin . ajrccm , american journal of respiratory and critical care medicine ; aki , acute kidney injury ; ccm , critical care medicine ; icm , intensive care medicine ; icu , intensive care unit ; rct , randomized controlled trial ; vasst , vasopressin in septic shock trial . this hypothesis was specifically tested by mehta and colleagues in a prospective sub - study of the randomized controlled vasopressin in septic shock trial ( vasst ) . in 121 patients , heart enzymes and 12-lead electrocardiograms ( ecgs ) were measured during early septic shock to compare vasopressin and norepinephrine ; 21% to 36% of patients showed elevated troponin levels , and there were no inter - group differences . ecg changes suggestive of myocardial ischemia were recorded in 48% of patients , and there were no differences between groups . in line with the study 's inclusion and exclusion criteria , the results are restricted to myocardial ischemia in septic shock patients with a low to moderate coronary risk profile . patients with acute coronary syndromes or de - compensated heart failure were excluded but made up only a minority of the total septic shock population ( 15% ) screened for eligibility in the vasst project . given that patients with elevated troponin levels in the present study had a higher rate of underlying ischemic heart disease than patients with normal cardiac biomarkers , it can not be excluded that a combined vasopressin / nor - epinephrine infusion reduces the rate / severity of myocardial ischemia in patients with a high coronary risk profile . the authors are to be congratulated on a well - conceived and thoughtfully analyzed study . hemodynamic data shown in the supplementary material reveal that patients given vasopressin exhibited lower heart rates and norepinephrine doses and higher arterial pressures , confirming that the study population met all criteria to adequately test the postulated hypothesis . aside from certain limitations ( for example , non - standardized measurements of troponin ) although theoretically the study may be underpowered to detect a significant inter - group difference in troponin levels of 0 to 0.2 g / l , it is questionable whether such a difference is clinically relevant and whether inclusion of more patients would have increased the practical relevance of the results . another noteworthy finding of this study is the observation that an elevation of cardiac biomarkers or ischemic ecg changes was not independently associated with septic shock mortality but that disease severity assessed by the apache ii ( acute physiology and chronic health evaluation ii ) score was . the key difference between their study and most previous studies is the adjustment of the statistical analysis for disease severity . thus , the prognostic value of troponins in septic shock may still be preserved , but the contributory role of myocardial ischemia to septic shock outcome has become seriously questioned by the present results . the 2012 surviving sepsis campaign guidelines include an ungraded statement that vasopressin can be added to norepinephrine with the intent of raising mean arterial pressure or decreasing norepinephrine . given that vasopressin - mediated increases in arterial pressure to ( sub)normal values are unlikely to improve tissue perfusion and may even result in end - organ hypoperfusion in case of microcirculatory failure , the role of vasopressin to increase arterial pressure in sepsis can be challenged . although a vasopressin - mediated reduction of high norepinephrine doses may have more effects than simply decreasing heart rate , the present study results also question this rationale . however , it is time to realize that there might be shock states other than sepsis in which vasopressin is more likely to exert beneficial effects . scientific data [ 9 - 11 ] and clinical experience indicate that postcardiotomy vasodilatory shock could be such a state . although the macrocirculatory responses to vasopressin in septic and postcardiotomy vasodilatory shock are comparable , the underlying microcirculatory pathologies are likely to differ dramatically . severe microcirculatory dysfunction in sepsis may predispose patients to vasoconstrictor - induced aggravation of tissue hypoperfusion , whereas better preserved microcirculatory integrity in postcardiotomy vasodilatory shock may allow improved tissue perfusion in response to a vasopressor - induced increase in arterial pressure . so , let us not despair of the waning star of vasopressin in sepsis , but let us focus on what really matters in shock : reversal of tissue hypoperfusion instead of correction of macrocirculatory deviations . vasopressin is not lost , but it seems we have to use it where it is likely to affect tissue perfusion more favorably than in septic shock ! this could be the case in pathologies with homogeneous vasodilation and a low grade of microcirculatory dysfunction , such as postcardiotomy vasodilatory or anaphylactic shock . | one of the rationales for the use of vasopressin in septic shock has been its potential cardioprotective mechanisms .
lower heart rates , higher arterial pressures , and fewer norepinephrine doses during vasopressin therapy were hypothesized to protect the heart from myocardial ischemia . in a prospective sub - study of the vasst ( vasopressin in septic shock trial ) project , mehta and colleagues
specifically evaluated this hypothesis but failed to find lower cardiac biomarkers or fewer ischemic electrocardiogram changes in patients receiving vasopressin compared with subjects receiving norepinephrine alone .
after recent evidence of a lacking survival benefit , the present study results further challenge the future role of vasopressin as a vasopressor in septic shock . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
underwater treadmill training is a method of gait training that uses the characteristics of
water . water provides buoyancy , hydrostatic pressure , and viscosity , affecting the human
body1 . water depth supports body weight : water as high as symphysis pubis relieves the
weight by 40% , as high as the navel relieves by 50% , and as high as the xiphoid process
relieves more than 60% of the weight1 . the
water pressure rises as immersion depth increases , and the increase in water pressure
induces movement of bodily fluids . due to the viscosity of water , friction occurs against
the skin , and fluid resistance of the water enables it to be used in resistance
training1 . underwater treadmill gait training utilizes water buoyancy to run a gait training session
with alleviated weight . the training method is similar to the on - ground weight support
treadmill gait training2 , 3 . underwater treadmill training itself is a complete
work - out , by which subjects can practice walking ; therefore , it is one of the gait training
methods that can be normally used2 , 3 . most studies of gait training were of
on - ground techniques and few studies have focused on underwater treadmill training .
considering this background , our working hypothesis is that underwater treadmill training
improves the normal people s gait ability . the selection criteria were as follows :
no history of orthopedic surgery on a lower limb , never taken any drug due to a neurologic
problem , and no musculoskeletal system disease . their average age was 21.20 2.30 years
old , height was 174.51 9.62 cm , and weight was 73.85 7.27 kg . sufficient explanation of
this study s intent and the overall purpose was given , and voluntary consent to
participation in this study was obtained from all of the subjects . information on the study
and written informed consent according to the ethical standards of the declaration of
helsinki were provided to all subjects prior to their participation . gait training is performed using the underwater treadmill ( hydrotrack
underwater treadmill system , conray , inc . , phoenix , az , usa ) , for twenty minutes per
session , five sessions a week for four weeks . the water temperature was set at about 33 c
and the depth was fixed to reach between the subjects xiphoid process and the navel . round
1 is composed of five minutes walking on the underwater treadmill at a comfortable speed . on
round 2 , the speed was slowly increased by 0.5 km / h every two minutes , then when the rating
of perceived exertion ( rpe ) reaches the score of 13 ( somewhat hard ) after the start , that
level of rpe was maintained for ten minutes . if a subject s rpe is not maintained at the
high speed , the previous speed was used instead . finally , during round 3 , the exercise was
completed with five minutes at the comfortable speed4 . the gaitrite is a portable gait anlaysis tool for automated measurement of spatio - temporal
gait parameters . to precisely analyze gait , the subjects were asked to walk along a two
meter long walkway for three sessions , and the average values were used . the subjects , with
heads lifted and looking straight ahead , walked barefoot while lightly shaking their upper
arms5 . the gaitrite system has excellent
reliability for most spatio - temporal gait parameters in both young ( icc=0.880.92 ) and older
subjects ( icc=0.880.91)6 the mean and sd were calculated for each variable . before the intervention , differences in
the general characteristics of the experimental group were analyzed by descriptive
statistics . variables were compared before and after training within experimental group
using paired sample t - tests . the statistical analysis was conducted using spss 20.0 ( spss , chicago , il , usa ) , and
statistical significance was accepted for p values < 0.05 . after the intervention , step length , velocity , and cadence increased significantly
( p<0.05 ) ( table 1table 1.comparison of changes in characteristics of the experimental group ( n=20)pre - testpost - teststep length ( cm)54.17 ( 5.25)57.81 ( 6.54)*velocity ( m / s)86.24 ( 3.54)92.74 ( 4.51)*double support ( % ) 17.24 ( 12.67)21.58 ( 6.81)cadence ( steps / min)102.74 ( 15.42)109.62 ( 13.91)mean sd , significant difference from the pre - intervention
value , * p<0.05 ) . mean sd , significant difference from the pre - intervention
value , * p<0.05 this study conducted underwater treadmill training with normal people , yielding a positive
effect on gait ability . light aerobic exercise , walking , running , side steps to music in
chest - deep water for three thirty - minute sessions a week for eight weeks , enhances maximum
oxygen consumption by 22% , and improves walking speed , walking distance and muscular
strength7 . masumoto et al.8 observed an increase in walking speed due to
strengthened hip flexor muscles , and an increase in cadence from increased step length in
the elderly after underwater treadmill training . underwater treadmill training s use of
buoyancy eases partial support of weight and its stable applicability provides psychological
stability ; these two factors seem to induce increased step length , velocity , and
cadence8 . the underwater treadmill
training session is a method in which patients repeatedly walk a certain length within a
fixed time at a constant rate under a limited depth of water . this provides double support
and improve gait and balancing abilities as it provides stability during the stance period
of walking9 . the limitations of this study were a small sample size , lack of a follow - up test to
determine the carry - over effects , and no constraint of the effects of other joints . further
investigation of the effects of an underwater treadmill training in subjects with
modifications to address the above - mentioned limitations is needed . | [ purpose ] our working hypothesis is that underwater treadmill training improves normal
people s gait ability .
[ subjects and methods ] twenty - five healthy subjects with no
orthopedic history of lower extremity were recruited .
gait training is performed using an
underwater treadmill ( hydrotrack underwater treadmill system , conray , inc . ,
phoenix , az , usa ) , for twenty minutes per session , five sessions a week for four weeks .
the water temperature was set at about 33 c and the depth was fixed to reach between the
subjects xiphoid process and the navel .
[ results ] after the intervention , step length ,
velocity , and cadence increased significantly . [
conclusion ] this study conducted
underwater treadmill training with normal people , with positive effects on gait
ability . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lipid langmuir monolayers are considered a simple but a very efficient model of biological membranes and frequently applied in physics , chemistry , and biomedical sciences . with this technique , it is possible to obtain homogenous distribution of the phospholipid molecules in two - dimensional space , which is the water / air interface . the study of monolayers is of crucial importance in a great number of processes , including cell membrane modeling [ 1 , 2 ] , breathing mechanics [ 3 , 4 ] , vesicle formation [ 5 , 6 ] , and optical and electronic device fabrication [ 7 , 8 ] . monolayer systems are often characterized by their surface pressure area ( a ) isotherms , which provide useful information concerning molecular level interactions between the components [ 911 ] . phospholipids are major fractions of lipids found in biological membranes . since monolayers especially at the air / water interface are commonly used as simplified models of biomembrane , many studies have been concentrated on them [ 12 , 13 ] . phosphatidylethanolamine is one of the most abundant lipids in eukaryotic cell membranes unevenly distributed between the inner and the outer leaflets of the bilayer . the higher ratio of pes in the membrane leaflet facing the inner media in comparison to the external one has called the attention to the topological properties of those surfaces with the expectation that they may be a key to functional roles of this lipid [ 1417 ] . the surface pressure area per molecule ( a ) curves of phosphatidylethanolamine have been reported previously [ 1822 ] . phillips and chapman obtained surface pressure area data for the homologous series of saturated 1,2-diacyl phosphatidylcholines and phosphatidylethanolamines at the air water interface . the results are compared with data already in the literature and the various physical states of the monolayers are described . the phosphatidylcholines formed more expanded films than the phosphatidylethanolamines and this is interpreted in terms of differences in the size and orientation of the polar groups . the heats and entropies associated with the transition from condensed to liquid - expanded film were calculated for dipalmitoylcholine . the values of these thermodynamic parameters were similar to those observed for the transition from gel to smectic mesophase for this phospholipid . this transition occurring in the bimolecular lamellae in water corresponds to the transition from condensed to expanded monolayer . water interface was investigated even earlier , at the beginning of the last century [ 23 , 24 ] . not only the interfacial tension values were recorded but also the ionic properties of a monolayer were studied by means of investigation of its surface potential at a fixed value of area / molecule . while a phosphatidylethanolamine monolayer is not altered by the ph of subphase in some ph regions , a recent study connected with bilayer has shown that there is a maximum of interfacial tension at a certain ph . a careful study is thus pertinent . since the changes in interfacial tension values induce the changes of the values in the area per molecule , it is very important , in context of biological membranes , to know the exact molecular packing in various ph solutions . this paper is a continuation of studies of the effect of ph on phospholipid monolayer at the air / aqueous solution interface . in this work , pe molecule is electrically neutral lipid , because it has two electrostatic charges , one negative ( phosphate group ) and one positive ( ethanolamine group ) , on the specific locations in the hydrophilic head . the phosphatidylethanolamine molecule forms ampholyte ions and can participate in equilibrium with ions h as well as with oh . using the derived equations , we present a model of ion monolayer interaction based on the calculations employing a curves . since the phosphatidylethanolamine molecule ( pe ) possesses a zwitterionic character , it can participate in equilibrium reactions with both hydrogen ions and hydroxyl anions.1\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{pe } } + { \text{h}}^ { + } \leftrightarrow { \text{peh}}^ { + } $ $ \end{document}2\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{pe } } + { \text{oh}}^ { - } \leftrightarrow { \text{peoh}}^ { - } $ $ \end{document}3\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ { \text{pe } } + { \text{hoh } } \leftrightarrow { \text{pehoh } } $ $ \end{document } consequently , equations of associations eqs . ( 1 , 2 , 3 ) can be considering as the description of an adsorption process . as a result of adsorption of h and oh ions on the surface of phosphatidylethanolamine layer , we shall consider the following forms : peh with h adsorbed , peoh with oh adsorbed , pehoh with both h and oh ions adsorbed on the surface , and a free phosphatidylethanolamine molecule pe i.e. , with no ions adsorbed . ( 1 , 2 , 3 ) containing the equilibrium constants of these equilibria . on the basis of these equations , the activity of following phosphatidylethanolamine forms can be calculated : 4\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peh}}^ { + } } } = k_{{{\text{peh}}^ { + } } } a_{\text{pe } } a_{{{\text{h}}^ { + } } } $ $ \end{document}5\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peoh}}^ { - } } } = k_{{{\text{peoh}}^ { - } } } a_{\text{pe } } a_{{{\text{oh}}^ { - } } } $ $ \end{document}6\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pehoh } } = k_{\text{pehoh } } a_{\text{pe } } $ $ \end{document}where \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pe } } , a_{{{\text{peh}}^ { + } } } , a_{{{\text{peoh}}^ { - } } } , a_{\text{pehoh } } $ $ \end{document } is the surface concentration of pe , peh , peoh , and pehoh form of phosphatidylethanolamine ( mol m ) ; \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{h}}^ { + } } } , a_{{{\text{oh}}^ { - } } } $ $ \end{document } are the concentrations of ions in the subphase ( mol m ) ; \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ k_{{{\text{peh}}^ { + } } } , k_{{{\text{peoh}}^ { - } } } , k_{\text{pehoh } } $ $ \end{document } are the equilibrium constants of adsorption process of h or oh ions on phosphatidylethanolamine ( m mol ) . the sum of surface concentrations of any phosphatidylethanolamine forms at the air / water interface has to be equal to total surface concentrations of phosphatidylethanolamine ( s ) . moreover , the sum of the area fractions of these four phosphatidylethanolamine forms should give unity . these relationships are described by following equations:7\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pe } } + a_{{{\text{peh}}^ { + } } } + a_{\text{pehoh } } + a_{{{\text{peoh}}^ { - } } } = s $ $ \end{document}8\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pe } } a_{\text{pe } } + a_{{{\text{peh}}^ { + } } } a_{{{\text{peh}}^ { + } } } + a_{\text{pehoh } } a_{\text{pehoh } } + a_{{{\text{peoh}}^ { - } } } a_{{{\text{peoh}}^ { - } } } = 1 $ $ \end{document}where s , total surface concentration of phosphatidylethanolamine measured by a isotherms ( mol m ) ; \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pe } } , a_{{{\text{peh}}^ { + } } } , a_{{{\text{peoh}}^ { - } } } , a_{\text{pehoh } } $ $ \end{document } , area occupied by one mole of components pe , peh , peoh , and pehoh ( molec . ) . ( 4 , 5 , 6 , 7 , 8) describe quantitatively the model of the influence of ph subphase on a phosphatidylethanolamine monolayer . the different forms of phosphatidylethanolamine would give monolayers , built from one component , that have different stability constant . the value of surface concentrations of any phosphatidylethanolamine forms affects the molecular packing of the head groups , which in a consequence influences the interfacial tension of lipid monolayer . depending on the ph of subphase different forms of phosphatidylethanolamine will have different areas per molecules depending on the contribution of the forms to the total amount of phosphatidylethanolamine molecules . after elimination of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pe } } $ $ \end{document } , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peh}}^ { + } } } $ $ \end{document } , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{\text{pehoh } } $ $ \end{document } and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peoh}}^ { - } } } $ $ \end{document } terms from the eqs . ( 4 , 5 , 6 , 7 , 8) , one obtains : 9\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{1}{s } = \frac{{a_{1 } + a_{{{\text{h}}^ { + } } } a_{{{\text{peh}}^ { + } } } k_{{{\text{peh}}^ { + } } } + a_{{{\text{oh}}^ { - } } } a_{{{\text{peoh}}^ { - } } } k_{{{\text{peoh}}^ { - } } } } } { { a_{2 } + a_{{{\text{h}}^ { + } } } k_{{{\text{peh}}^ { + } } } + a_{{{\text{oh}}^ { - } } } k_{{{\text{peoh}}^ { - } } } } } $ $ \end{document}where:\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{1 } = a_{\text{pe } } + a_{\text{pehoh } } k_{\text{pehoh } } $ $ \end{document}\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{2 } = k_{\text{pehoh } } + 1 $ $ \end{document } the direct form of the eq . ( 9 ) is not convenient for calculations . after substituting the concentration of oh ions by the quotient of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym } \usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ k_{{{\text{h}}_{2 } { \text{o } } } } $ $ \end{document } and h concentration , one can divide the numerator of the above polynomial by its denominator . as a result , we obtain the series of terms containing the decreasing powers of h ions concentration . the equation obtained by multiplication by \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{h}}^ { + } } } $ $ \end{document } is in the form where one can treat the negative terms as negligible . in consequence , such equation would have the linear character . for large h concentrations , i.e. , when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{h}}^ { + } } } \to \infty $ $ \end{document } ; the eq . ( 9 ) will assume the following form : 10\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{{a_{{{\text{h}}^ { + } } } } } { s } = a_{{{\text{peh}}^ { + } } } a_{{{\text{h}}^ { + } } } + \frac{{a_{1 } - a_{2 } a_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peh}}^ { + } } } } } $ $ \end{document } equation ( 9 ) can be treated in the analogous way after substitution of h ion concentrations by concentrations of hydroxyl ions . for large oh concentrations i.e. , when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{oh}}^ { - } } } \to \infty $ $ \end{document } ; one can obtain : 11\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{{a_{{{\text{oh}}^ { - } } } } } { s } = a_{{{\text{peoh}}^ { - } } } a_{{{\text{oh}}^ { - } } } + \frac{{a_{1 } - a_{2 } a_{{{\text{peoh}}^ { - } } } } } { { k_{{{\text{peoh}}^ { - } } } } } $ $ \end{document } using these latter relationships , one can easily calculate the values of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peh}}^ { + } } } $ $ \end{document } and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peoh}}^ { - } } } $ $ \end{document } by regression in the region of large h and oh concentration values , respectively . ( 12 ) can be used for verification of the calculated values against the experimental ones obtained on the basis of eqs . . good agreement between them will mean that the system is well described by the above equations . in order to verify this agreement , the eq . ( 9 ) should be presented in the following form : 12\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{1}{s } = \frac{{\frac{{a_{1 } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{h}}^ { + } } } a_{{{\text{peh}}^ { + } } } \frac{{k_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{oh}}^ { - } } } a_{{{\text{peoh}}^ { - } } } } } { { \frac{{a_{2 } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{h}}^ { + } } } \frac{{k_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{oh}}^ { - } } } } } $ $ \end{document}\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \frac{{k_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peoh}}^ { - } } } } } $ $ \end{document } value is required for further calculations . its value can be calculated using the values of \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peh}}^ { + } } } $ $ \end{document } and \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{peoh}}^ { - } } } $ $ \end{document } at the isoelectric point . on the basis of the assumed model the interfacial tension can be calculated , provided that the interfacial tension value of phosphatidylethanolamine layer is the sum of the contributions from all forms i.e. , ideal mixing of the different forms of phosphatidylethanolamine . as was mentioned above , the values of the molecular area of phosphatidylethanolamine influence the interfacial tension values of the relative phosphatidylethanolamine forms . ( 13 ) and ( 14 ) describe further dependencies in the studied system.13\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{i } = \frac{{\gamma_{i}^{0 } } } { \gamma s } $ $ \end{document}14\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma = \gamma_{{{\text{peh}}^ { + } } } ^{0 } + \gamma_{\text{pehoh}}^{0 } + \gamma_{\text{pe}}^{0 } + \gamma_{{{\text{peoh}}^ { - } } } ^{0 } $ $ \end{document}where ai is the area occupied by one mole of adequate form of phosphatidylethanolamine ( pe , peh , peoh , and pehoh ( molec . ) , \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma_{i}^{0 } $ $ \end{document } is the interfacial tension of the adequate form of phosphatidylethanolamine ( mn m ) ; \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma $ $ \end{document } is the measured interfacial tension obtained from the a isotherms . as the interfacial tension can be treated as the interfacial energy concentrated at the interfaces , we assume based on the additivity rule that the interfacial tension of the phosphatidylethanolamine layer is a sum of the interfacial tensions values of the pe forms . then , the relationship between the surface concentration , the total surface concentration s , and the interfacial tension value is obtained:15\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma = \gamma_{\text{pehoh}}^{0 } \frac{{a_{\text{pehoh } } } } { s } + \gamma_{{{\text{peh}}^ { + } } } ^{0 } \frac{{a_{{{\text{peh}}^ { + } } } } } { s } + \gamma_{{{\text{peoh}}^ { - } } } ^{0 } \frac{{a_{{{\text{peoh}}^ { - } } } } } { s } + \gamma_{\text{pe}}^{0 } \frac{{a_{\text{pe } } } } { s } $ $ \end{document } after the substitution of eqs . 15 ) we obtain : 16\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma = \frac{{\gamma_{1 } + a_{{{\text{h}}^ { + } } } \gamma_{{{\text{peh}}^ { + } } } ^{0 } k_{{{\text{peh}}^ { + } } } + a_{{{\text{peoh}}^ { - } } } \gamma_{{{\text{peoh}}^ { - } } } ^{0 } k_{{{\text{peoh}}^ { - } } } } } { { a_{{{\text{h}}^ { + } } } k_{{{\text{peh}}^ { + } } } + a_{{{\text{oh}}^ { - } } } k_{{{\text{peoh}}^ { - } } } } } $ $ \end{document}where\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma_{1 } = \gamma_{\text{pe}}^{0 } + \gamma_{\text{pehoh}}^{0 } k_{\text{pehoh } } $ $ \end{document } in analogy to the above equations describing the areas per molecules , the polynomial eq . ( 16 ) and adequate approximations lead to the following forms depending on the conditions : for large h concentrations , i.e. , when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{h}}^ { + } } } \to \infty $ $ \end{document } ; 17\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma a_{{{\text{h}}^ { + } } } = \gamma_{{{\text{peh}}^ { + } } } ^{0 } a_{{{\text{h}}^ { + } } } + \frac{{k_{\text{pehoh } } ( \gamma_{\text{pehoh}}^{0 } - \gamma_{{{\text{peh}}^ { + } } } ^{0 } ) + ( \gamma_{\text{pe}}^{0 } - \gamma_{{{\text{peh}}^ { + } } } ^{0 } ) } } { { k_{{{\text{peh}}^ { + } } } } } $ $ \end{document } this approximation enables the calculation of the interfacial tension value of phosphatidylethanolamine form with adsorbed h ions . analogously , for basic solutions , when \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ a_{{{\text{oh}}^ { - } } } \to \infty $ $ \end{document } ; 18\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma a_{{{\text{oh}}^ { - } } } = \gamma_{{{\text{peoh}}^ { - } } } ^{0 } a_{{{\text{oh}}^ { - } } } + \frac{{k_{\text{pehoh } } ( \gamma_{\text{pehoh}}^{0 } - \gamma_{{{\text{peoh}}^ { - } } } ^{0 } ) + ( \gamma_{\text{pe}}^{0 } - \gamma_{{{\text{peoh}}^ { - } } } ^{0 } ) } } { { k_{{{\text{peoh}}^ { - } } } } } $ $ \end{document } the accuracy of the assumed model the additivity of the phosphatidylethanolamine forms can be verified with the help of eq . ( 19 ) .19\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma = \frac{{\frac{{\gamma_{1 } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{h}}^ { + } } } \gamma_{{{\text{peh}}^ { + } } } ^{0 } \frac{{k_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{peoh}}^ { - } } } \gamma_{{{\text{peoh}}^ { - } } } ^{0 } } } { { \frac{{\gamma_{2 } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{h}}^ { + } } } \frac{{k_{{{\text{peh}}^ { + } } } } } { { k_{{{\text{peoh}}^ { - } } } } } + a_{{{\text{oh}}^ { - } } } } } $ $ \end{document}where\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma_{1 } = \gamma_{\text{pe}}^{0 } + \gamma_{\text{pehoh}}^{0 } k_{\text{pehoh } } $ $ \end{document}\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \gamma_{2 } = k_{\text{pehoh } } + 1 $ $ \end{document } the homemade computer - controlled apparatus used for surface tension measurements was presented in previous paper . the surface tension measurements were carried out at the water / air interface at 22 c , and were expressed as surface pressure area per molecule ( a ) isotherms . for all experiments , the trough was filled with triple - distilled water as the subphase . the monolayers were prepared by spreading a defined volume of a lipid solution in 1-chloropropane on the aqueous subphase using a hamilton micro - syringe . ten minutes were allowed for solvent evaporation and monolayer equilibration before an experiment was begun . the monolayer was continuously compressed to obtain the surface pressure area per molecule ( a ) isotherms using the glass barrier ( barrier was moved at a velocity of 0.03 cm s ) . the nima st9002 computer program was used to calculate the surface pressure ( ) of the monolayer as a function of surface area per molecule ( a ) : = 0 = f(a ) , where 0 is the surface tension of the lipid - covered surface and is the surface tension of the bare air / water interface . before each trial , the teflon trough ( trough size 648 cm ) was washed and rinsed with purified water . the subphase surface was cleaned just prior to each measurement by suction with a vacuum pump until the surface tension was constant and equal to the surface tension value of pure water at 22 c ( ~72 mn m ) . all glassware in contact with the samples was cleaned with chromic acid and repeatedly rinsed with purified water before use . the system was enclosed in an acrylic box to minimize water evaporation , to ensure high humidity , and to avoid contamination of the system . all of the reported values are highly reproducible and represent the average of at least five experiments . phosphatidylethanolamine ( 99 % ) was purchased from fluka and was used as received . solutions were prepared by dissolving appropriate amounts of each material in 1-chloropropane at a concentration of 1 mg cm and were stored at 4 c . the water used in the experiments was prepared by triple distillation ( the second distillation was performed over kmno4 and koh to remove organic impurities ) . buffers of 212 ph ranges were prepared according to britton and robinson and used as electrolyte . they were prepared by adding 0.2 m sodium hydroxide to 100 ml of solution having the following composition : 0.04 m 80 % acetic acid produced by polish chemical reagents ( poch ) , 0.04 m phosphoric acid from poch , and 0.04 m boric acid from poch . a suitable ph of the buffer was established depending on the amount of added sodium hydroxide . it changes to e.g. , 3.29 after 20 cm of naoh from poch was added or to 6.80 if 50 cm was added . britton and robinson buffer was used in the experiments because this solution is being applied to biochemical experiments as the standard buffer , because of the wide ph range ( 212 ) and because it does not interact with biological membranes . the homemade computer - controlled apparatus used for surface tension measurements was presented in previous paper . the surface tension measurements were carried out at the water / air interface at 22 c , and were expressed as surface pressure area per molecule ( a ) isotherms . for all experiments , the trough was filled with triple - distilled water as the subphase . the monolayers were prepared by spreading a defined volume of a lipid solution in 1-chloropropane on the aqueous subphase using a hamilton micro - syringe . ten minutes were allowed for solvent evaporation and monolayer equilibration before an experiment was begun . the monolayer was continuously compressed to obtain the surface pressure area per molecule ( a ) isotherms using the glass barrier ( barrier was moved at a velocity of 0.03 cm s ) . the nima st9002 computer program was used to calculate the surface pressure ( ) of the monolayer as a function of surface area per molecule ( a ) : = 0 = f(a ) , where 0 is the surface tension of the lipid - covered surface and is the surface tension of the bare air / water interface . before each trial , the teflon trough ( trough size 648 cm ) was washed and rinsed with purified water . the subphase surface was cleaned just prior to each measurement by suction with a vacuum pump until the surface tension was constant and equal to the surface tension value of pure water at 22 c ( ~72 mn m ) . all glassware in contact with the samples was cleaned with chromic acid and repeatedly rinsed with purified water before use . the system was enclosed in an acrylic box to minimize water evaporation , to ensure high humidity , and to avoid contamination of the system . all of the reported values are highly reproducible and represent the average of at least five experiments . phosphatidylethanolamine ( 99 % ) was purchased from fluka and was used as received . solutions were prepared by dissolving appropriate amounts of each material in 1-chloropropane at a concentration of 1 mg cm and were stored at 4 c . the water used in the experiments was prepared by triple distillation ( the second distillation was performed over kmno4 and koh to remove organic impurities ) . buffers of 212 ph ranges were prepared according to britton and robinson and used as electrolyte . they were prepared by adding 0.2 m sodium hydroxide to 100 ml of solution having the following composition : 0.04 m 80 % acetic acid produced by polish chemical reagents ( poch ) , 0.04 m phosphoric acid from poch , and 0.04 m boric acid from poch . a suitable ph of the buffer was established depending on the amount of added sodium hydroxide . it changes to e.g. , 3.29 after 20 cm of naoh from poch was added or to 6.80 if 50 cm was added . britton and robinson buffer was used in the experiments because this solution is being applied to biochemical experiments as the standard buffer , because of the wide ph range ( 212 ) and because it does not interact with biological membranes . the measurements of interfacial tension values of lipid monolayer are useful for determination of the surface area per molecule . dependence of some physical properties on ph is of interest for applications of biological membranes in biology and medical sciences . the dependence of the surface area per phosphatidylethanolamine molecule versus ph of the subphase could be obtained with the usage of the a isotherms . figure 1 presents the measured values of the inverse of surface concentration of phosphatidylethanolamine as a function of ph subphase . ( 12 ) , as will be discussed later . when subphase is acidic ( ph 2.0 ) , the surface concentration s is equal to 1.84 10 mol m. values of s increase steeply reaching a maximum close to the isoelectric point of phosphatidylethanolamine ( surface concentration maximum value6.32 10 m mol at ph 4.18 ) . it is noteworthy that this maximum is obtained at the isoelectric point ( 4.18 ) of phosphatidylethanolamine , which was established for pe bilayer . when ph of subphase increases further , the values of the phosphatidylethanolamine surface concentration decrease steeply within 4.186.00 ph range . the ph regions between 6 and 12 , as can be seen from fig . 1 , 1the inverse of surface concentration ( 1/s ) of phosphatidylethanolamine as a function of ph subphase at surface pressure of ~30 mn m ( the experimental values are indicated by points and the theoretical values by the curve ) the inverse of surface concentration ( 1/s ) of phosphatidylethanolamine as a function of ph subphase at surface pressure of ~30 mn m ( the experimental values are indicated by points and the theoretical values by the curve ) employing on the assumed model , one can calculate the area of peh form , using the eq . its value is 5.45 10 m mol ( 90.5 molec . ) . however , since the extrapolation from only a few experimental points can produce unreliable results , we have proceeded differently . in order to confirm the obtained result , we calculated the value of peh phosphatidylethanolamine form by fitting the experimental curve using the algorithm for least square estimation of parameters . then , it is equal to 6.28 10 m mol ( 104 molec . ) . it is noteworthy that we can use the extrapolated peoh value of surface concentration for such calculations . from fig . 1 one can see that in the ph range of 612 , we can treat the experimental points as reliable . the respective surface concentration value of peoh form is equal to 5.54 10 m mol ( 92 molec . ) . as it can be seen , the values in the 26 ph range are only slightly changed with increasing ph of subphase . a further decrease in the h concentration results in an abrupt change of the plot . the interfacial tension values start to increase continuously up to ph 810 . for large oh concentrations , the interfacial tension values are almost the same.fig . 2the interfacial tension ( ) values of the phosphatidylethanolamine monolayer at the air / aqueous solution versus ph of this solution the interfacial tension ( ) values of the phosphatidylethanolamine monolayer at the air / aqueous solution versus ph of this solution in the langmuir approach , an air hydrophobic layer interfacial tension value and polar layer - aqueous subphase interfacial tension value make up the monolayer surface tension . the interfacial tension values for the interface of the hydrophobic chains hydrophobic chains in a phospholipid bilayer are assumed negligible . moreover , the values of the interfacial tension at the interface of headgroups of phospholipid - subphase are the same in both cases : for a monolayer and for a bilayer . as a result , the difference between monolayer interfacial tension obtained experimentally and the interfacial tension of bilayer equals the interfacial tension of hydrophobic layer air interface . air by the interfacial tension of n - alkane air interface . since the values of the interfacial tension of the hydrophobic chains air interface are dominating , these values were applied to the system and used in further calculation . in fig . 3 , points denote the calculated values of interfacial tension of lipid monolayer values for interface of the air phosphatidylethanolamine hydrophobic chains . as it was written above , these values are calculated as a difference of the experimental values for monolayer and bilayer composed of the same phosphatidylethanolamine . 3the interfacial tension ( ) of the phosphatidylethanolamine monolayer at the air / hydrophobic chains of examined phospholipid as a function of ph ( the experimental values are indicated by points and the theoretical values by the curve ) the interfacial tension ( ) of the phosphatidylethanolamine monolayer at the air / hydrophobic chains of examined phospholipid as a function of ph ( the experimental values are indicated by points and the theoretical values by the curve ) it is worth emphasizing that for the hydrophobic chains air interface this run is dependent on ph . the latter interface is dominating as far as the values of the interfacial tension are concerned . when the ph value approaches the isoelectric point , we obtain the minimum of the interfacial tension values . 40.65 mn m at ph 4.18 . with the changes of subphase ph , the interfacial tension values increase until the ph reaches 9 . the interfacial tension value of phosphatidylethanolamine monolayer on the basic subphase is then approximately 45.6 mn m. we proceed to calculate the interfacial tension values . then , interfacial tension values of peh and peoh forms are : 43.97 and 47.61 mn m. the calculated values of interfacial tension for ph less than 2 are calculated on the basis of eq . ( remarkably , the experimental values are in good agreement with the calculated ones presented in figure as a solid line . the verification of the assumed model is presented in the form of the eq . ( 19 ) for the interfacial tension values . as can be seen from the fig . 3 , the obtained values ( solid line ) are very close to the experimental results represented by points . the good agreement between points and the solid lines ( representing the calculated values ) means that the proposed model is well derived and the obtained values are correct . the results confirm the existence of four phosphatidylethanolamine forms , no matter whether a phosphatidylethanolamine exists as a monolayer or a bilayer . the phosphate ( p ) end of the phosphatidylethanolamine head group is anchored at the air / water interface , while the hydrocarbon chains are driven toward air , thus the hydrophobic effects drive the methyl and methylene groups around the n charge toward the hydrocarbon . in order to reduce hydrocarbon water contact , this restricts the freedom of the lipid chains and results in them exerting a lateral pressure on the surroundings . the area of hydrophilic heads of lipids determines the whole value of the area per molecule . the surface charge is dependent on ph and thus loosing protons can easily modify it . as we can see , the influence of ph of subphase results in the molecular packing of the phosphatidylethanolamine headgroup , and directly on the area taken up by chains at the air one can see when comparing figs . 2 and 3 that the interfacial tension values for air water interface is no so strongly dependent on ph as it is in the case of air phospholipid chains . the assumed model is based on the additivity of the interfacial tension values and molecular area values of phosphatidylethanolamine forms . the contribution of following phosphatidylethanolamine forms : peh , pe , pehoh , and peoh depends on ph of subphase . the interfacial tension values and the molecular areas values for peh and peoh forms of phosphatidylethanolamine were calculated . these values are equal to 5.45 10 m mol ( 90.5 molec . ) , 5.54 10 m mol ( 92 molec . ) , and 43.97 , 47.61 mn m , respectively . the value of the molecular area of hydrophilic heads of phosphatidylethanolamine determines the surface concentration of phosphatidylethanolamine and , as the result , the interfacial tension values at the air / hydrophobic chains interface . the difference between monolayer interfacial tension obtained experimentally and the interfacial tension of bilayer equals the interfacial tension of hydrophobic layer air interface . the mathematically derived and experimentally confirmed results presented in this paper are of great importance for the interpretation of surface phenomena occurring in lipid monolayers . these results can help provide a better understanding of the physical and physicochemical properties of biological membranes , including ion adsorption on the membrane surface and interfacial tension . for example , the interfacial tension of a biological membrane determines its rigidity and therefore affects its stability . interfacial tension is affected by factors such as ph or the presence of substances incorporated in the lipid bilayer , for example cholesterol , other lipids , fatty acids , amines , amino acids , or proteins . the method proposed in this paper and in earlier studies [ 1 , 2 , 13 , 26 , 27 ] may be used with success to determine lipid lipid and lipid ion equilibria in lipid monolayers . | the dependence of the interfacial tension of a phosphatidylethanolamine ( pe ) monolayer on the ph of the aqueous solution has been studied .
a theoretical equation is derived to describe this dependence .
a simple model of the influence of ph on the phosphatidylethanolamine monolayer at the air / hydrophobic chains of pe is presented .
the contributions of additive phosphatidylethanolamine forms ( both interfacial tension values and molecular area values ) depend on ph .
the interfacial tension values and the molecular area values for peh+ and peoh forms of phosphatidylethanolamine were calculated .
the assumed model was verified experimentally .
the experimental results agreed with those derived from the theoretical equation in a whole range of ph values . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the olden days , the patients depended solely on health professionals to gain health information via conversations or from pamphlets , videos , or books . even prior to surfing the internet as a source of medical information , patients were interested to know more about their disease and discover facts concerning their diagnoses and seek more knowledge about their treatment choices . even the medline searches in libraries and public institutions chiefly provide patients with peer - reviewed medical articles . the main barrier limiting the use of internet to gain information is not the difficulty of finding healthcare knowledge , but rather the difficulty of finding logical and trustworthy information . a large proportion of the population seeks health information on the worldwide web these days [ 46 ] . although patients browsing the internet for health information can look for thousands of websites , it is laborious for them to decide on the believability of the information they obtain . due to concerns about the validity of information available online , many health - care professionals believe that gaining health - related advice from the internet can be harmful . the deficiency of online information can be due to inaccurate , biased , and out - of - date resources and patients may therefore make inappropriate decisions about treatment based on potentially poor - quality information . in a cross - sectional study by griffiths and christensen on the quality of web - based information , they concluded that the information on the web needs to be more evidence based . there are a few studies available on the quality of information in the web about dental treatments . pit and fissure sealants are primary preventive procedures for dental caries . pit and fissure sealants are chemically - active liquid materials that are placed in the occlusal pits and fissures of caries - susceptible teeth forming a micromechanically bonded protective layer that prevents the invasion of cariogenic bacteria and their access to nutrients . the aim of this study was to evaluate the quality of websites providing information about pit and fissure sealants . a pilot study using three different search engines namely google ( www.google.com ) , yahoo ( www.yahoo.com ) , and ask jeeves ( www.ask.com ) was performed at the end of june 2012 . the key terms pit and fissure sealants , patients education and the equivalent farsi word shiarpoosh were searched to obtain information . as it is improbable that patients will investigate beyond initial pages of a search , the first 500 links generated by google were pondered . discussion groups , news , video feeds , and duplicate sites were excluded and only 37 relevant websites suitable for patients remained . these 37 websites were scrutinized using discern instrument which rates the nature of information on treatment options for health problems and includes 16 questions ( table 1 ) . each question can be scored from 1 to 5 depending on how well it supports the specific criteria in the question . the maximum score obtained was 80 and websites were graded to yield a relative index of the parameters of the consumer information they embodied . twenty percent of the cases were used for assessment of inter - rater and intra - rater reliability . the tests were carried out by a researcher and a specialist in dental public health , using discern instrument . there was no controversy between evaluators regarding the descriptive values as the instrument s guidelines explained each topic in detail . the percentage of answers rating the quality of websites according to disern checklist scorings of the answers are as follows : no=1 , partially=24 , and yes=5 american dental association ( ada ) guide - lines for patients and professionals were used as gold standards to check the answers on whether the information was based on high level of evidence . descriptive analysis was applied to report the results of our study using spss version 11.5 . ninety - two percent ( n=468 ) of the websites were excluded from the analysis . these consisted of 3% news and video feeds , 27.3% academic press , 52.4% abstract listings , discussion group , duplicate sites and the sites that only mentioned the name of fissure sealant . of the remaining 37 websites that were scored , 6.8% were e - journals , 21.6% personal websites of dentists , 10.8% governmental health - related websites and 10.8% other websites . according to the quality of the scientific content of websites ( table 1 ) based on the gold standards , the information in the majority of websites ( 74.4% ) was compatible with ada guidelines . answers to questions 115 were yes , partially , and no ( scored between 05 ) . the results showed that 62.2% of the answers were scored 24 and 37.8% of them were scored one ( tables 1 ) . according to the guideline , the last question ( question 16 ) rated the overall quality of the publication as moderate in 62.2% and low in 37.8% ( fig.1 ) . the percentage of the evaluated web pages with different levels of quality the greatest score obtained by one of the websites conforming to the discern tool was 71 out of 80 , and the lowest score achieved was 39 out of 80 . this study was the first to assess the quality of information available on the internet related to pit and fissure sealants in the persian websites . the results of the present study showed that the accuracy of information was at the acceptable level and the majority of studies were in accord with the ada guidelines . in previous studies , the quality of in - formation regarding breast cancer , depression and obesity was evaluated in which the accuracy of information was acceptably high . it can be troublesome for patients to acquire reliable and meticulous information on the internet . the information on websites can occasionally be of a higher value than the information in the leaflets available in clinics . this study indicated that the quality of information on the internet about pit and fissure sealants was moderate . some other studies reported that the quality of information available on the net about osteoarthritis , chronic pain and nutrition was poor [ 9,1722 ] . unlike the results of a study by griffths and christensen , the results of the current study showed that the governmental , organizational and educational websites did not play an important role in providing information about fissure sealants and only four governmental websites were related to the fissure sealant topic . however , diaz et al , in 2002 and hirasawa et al , concluded that the governmental websites had poor quality . the findings of van der marel et al , in 2009 showed that the commercial websites had high quality and governmental websites had moderate quality . in this study , the number of governmental websites was limited ( only four out of 37 ) but there was no significant difference between nongovernmental and governmental websites and both had good quality . totally , the google search engine provided more than a million links on pit and fissure sealants . in spite of the fact that such an enormous number of links is attainable , therefore , we restricted our study to the first 500 websites in line with the studies by hargrave et al , and fox et al , . interestingly , only 37 of the top 500 websites were found to be in persian language and contained relevant information . further advancement of the internet as a logical data source would significantly assist patients searching for supplementary information about pit and fissure sealants in order to ensure the credibility of the information provided in the websites on pit and fissure sealants , websites may perhaps disclose their discern score as a quality symbol for patients and professionals . one limitation of the current study was that there was no organized database for persian health information websites . overall , the quality of information related to fissure sealants on the internet was good , yet they did not cover the entire required information . the main problem was that the websites did not provide credible and up - to - date information . | objectives : despite the increasing use of internet , there is no supervision over the accuracy and quality of the information provided in the web . to deal with this problem , health specialists should take part in planning , publishing and supervision of online health - related information .
the aim of this study was to evaluate the quality of information related to pit and fissure sealants in persian websites.materials and methods : in this cross - sectional study , persian websites providing information about fissure sealants were found using google search engine .
the searched keywords according to the mesh database were
patient education and fissure sealant . after applying the exclusion criteria , 37 websites out of 500 initial links remained in the study .
these websites were evaluated based on a researcher - made checklist . the validity and reliability of the checklist were evaluated and confirmed .
descriptive analysis was applied to report the results of our study using spss version 11.5.results:the average score for the quality of information was 22.46 out of 38 .
the minimum scores were 16 and 30 and belonged to
pezeshkanemrooz.com
and
asa85.blogfa.com
, respectively .
the results showed that 62.2% of the answers were scored 24 and 37.8% were scored 1 ; therefore , the overall quality of the published content was rated to be moderate for 62.2% and low for 37.8% of the websites.conclusions:overall , the quality of information related to fissure sealant provided in persian websites was good ; however , the information given was mostly incomplete and could be improved .
the main problems were doubtful credibility and outdated information . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
c. rectus atcc 33238 was routinely grown in mycoplasma broth base ( bbl microbiology systems , cockeysville , md ) , which was supplemented with 0.2% glucose , 0.2% sodium formate , and 0.2% sodium fumarate ( mbb - gff ) . growth studies were performed using the above medium treated with the chelating resin ( 3 g/100 ml ) chelex 100 ( bio - rad laboratories , mississauga , ontario ) for 2 h at room temperature with constant agitation . this iron - restricted medium was supplemented with either ferrous sulfate , human apotransferrin ( iron - free form ) , or human holotransferrin ( iron - saturated form ) , all at 20 m and obtained from sigma - aldrich canada ( oakville , ontario , canada ) . bacterial growth was evaluated after 48 h of incubation by measuring the optical density at 660 nm ( od660 ) . equal volumes of holotransferrin ( 0.5 mg / ml ) and c. rectus cells ( od660=0.5 ) , treated or not at 60c for 30 min , were incubated at room temperature for 2 h. removal of iron from human holotransferrin was determined by urea / borate / edta - polyacrylamide gel electrophoresis ( page ) analysis and coomassie blue staining ( 13 ) . this electrophoretic procedure allows the differentiation of transferrin in the apo- ( iron - free ) and holo- ( iron - saturated ) forms . ( 15 ) using human apotransferrin and [ fe]fecl3 ( nen life science products inc . , apotransferrin at 1 mg / ml was mixed with 0.0075 mol of [ fe]fecl3 and 0.075 mol of sodium citrate in 40 mm tris hydrochloride buffer ( ph 7.4 ) containing 2 mm sodium carbonate . after incubation at room temperature for 30 min , several rounds of dialysis ( molecular weight cutoff = 1214 kda ; 12 h ) were performed at 4c against 40 mm tris hydrochloride buffer ( ph 7.4 ) containing 2 mm sodium carbonate until no radioactivity was detected in the dialysate using a gamma counter . thereafter , the final concentration of transferrin was determined by the method of lowry ( 16 ) whereas the iron saturation percentage of transferrin was evaluated by a colorimetric assay ( sigma - aldrich canada ) . by performing these assays , the uptake of fe from fe - transferrin by c. rectus cells was determined as follows . bacterial cells were harvested by centrifugation ( 8,000 g for 15 min ) and suspended to an od660 of 1 in mbb - gff medium treated ( iron - restricted condition ) or not ( normal condition ) with the chelex 100 resin . equal volumes of fe - transferrin ( 13 m ) and bacteria were incubated at 37c under anaerobiosis for 0 , 3 , and 24 h. following incubation , cells were harvested by centrifugation ( 8,000 g for 15 min ) , washed twice in pbs , and resuspended in the same buffer to an od660 of 1 . equal volumes of holotransferrin ( 0.5 mg / ml ) and overnight culture of c. rectus in mbb - gff medium were incubated at 37c for 1 , 6 , and 24 h. proteolytic cleavage of holotransferrin was evaluated by sodium dodecyl sulfate ( sds ) page followed by western immunoblotting using an alkaline phosphatase - conjugated goat antihuman transferrin antibody ( 1:3,000 dilution ) . undegraded transferrin and transferrin fragments were visualized following development in 100 mm carbonate buffer ( ph 9.8 ) containing 0.3 mg / ml nitroblue tetrazolium chloride and 0.15 mg / ml 5-bromo-4-chloro-3-indolylphosphate p - toluidine salt . a culture of p. nigrescens atcc 33563 in todd - hewitt broth ( bbl microbiology systems ) supplemented with hemin ( 10 g / ml ) and vitamin k ( 1 g / ml ) was used as a positive control ( 11 ) . the transferrin - binding activity of c. rectus cells was determined by a microplate assay . bacterial suspensions ( 100 l ; od660=1 in 50 mm phosphate - buffered saline [ pbs ] ) prepared from an overnight culture in mbb - gff medium ( treated or not with chelex 100 ) were applied into wells of a flat - bottomed 96-well microplate , which was then covered and incubated overnight at 37c . bacterial suspensions were removed by aspiration and wells were washed with pbs containing 0.5% tween-20 ( pbst ) to remove loosely bound bacteria . bacterial cells attached on the bottom of wells were fixed with 0.05% glutaraldehyde ( 1 h ) and the wells were further washed three times with pbst . the unreacted sites were then blocked with pbs containing 3% gelatin for 1 h. the solution was discarded and 100 l of horseradish peroxidase - conjugated transferrin ( 0.2 g / ml in pbs ; bio / can scientific , mississauga , ontario ) was added . after a 2-h incubation , wells were washed three times for 5 min with pbst prior to adding 100 l of 2,2'-azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ( abts ) substrate was added . following incubation at 37c for 30 min , cells of p. nigrescens atcc 33563 were used as a positive control ( 11 ) . ( 17 ) was used to detect ferric reductase activity in whole cells of c. rectus from an overnight culture in mbb - gff treated with chelex 100 or with no pretreatment . cells were suspended in 1 ml of the assay buffer ( 50 mm sodium citrate , ph 6.5 , 5% glucose , 1 mm ferric chloride ) to an od660 of 1 . bathophenanthroline disulfonate ( bpds ) was then added to a final concentration of 1 mm and samples were incubated at 37c for 30 and 120 min . bacterial cells were then removed by centrifugation and the red fe bps complex was quantified by recording the absorbance of the assay mixture supernatant at 520 nm ( a520 ) . the level of ferrous ions produced was estimated from a reference curve constructed from a solution of known ion concentrations . c. rectus atcc 33238 was routinely grown in mycoplasma broth base ( bbl microbiology systems , cockeysville , md ) , which was supplemented with 0.2% glucose , 0.2% sodium formate , and 0.2% sodium fumarate ( mbb - gff ) . growth studies were performed using the above medium treated with the chelating resin ( 3 g/100 ml ) chelex 100 ( bio - rad laboratories , mississauga , ontario ) for 2 h at room temperature with constant agitation . this iron - restricted medium was supplemented with either ferrous sulfate , human apotransferrin ( iron - free form ) , or human holotransferrin ( iron - saturated form ) , all at 20 m and obtained from sigma - aldrich canada ( oakville , ontario , canada ) . bacterial growth was evaluated after 48 h of incubation by measuring the optical density at 660 nm ( od660 ) . equal volumes of holotransferrin ( 0.5 mg / ml ) and c. rectus cells ( od660=0.5 ) , treated or not at 60c for 30 min , were incubated at room temperature for 2 h. removal of iron from human holotransferrin was determined by urea / borate / edta - polyacrylamide gel electrophoresis ( page ) analysis and coomassie blue staining ( 13 ) . this electrophoretic procedure allows the differentiation of transferrin in the apo- ( iron - free ) and holo- ( iron - saturated ) forms . the fe - transferrin was prepared based on the protocols of pintor et al . ( 14 ) and simonson et al . ( 15 ) using human apotransferrin and [ fe]fecl3 ( nen life science products inc . , apotransferrin at 1 mg / ml was mixed with 0.0075 mol of [ fe]fecl3 and 0.075 mol of sodium citrate in 40 mm tris hydrochloride buffer ( ph 7.4 ) containing 2 mm sodium carbonate . after incubation at room temperature for 30 min , several rounds of dialysis ( molecular weight cutoff = 1214 kda ; 12 h ) were performed at 4c against 40 mm tris hydrochloride buffer ( ph 7.4 ) containing 2 mm sodium carbonate until no radioactivity was detected in the dialysate using a gamma counter . thereafter , the final concentration of transferrin was determined by the method of lowry ( 16 ) whereas the iron saturation percentage of transferrin was evaluated by a colorimetric assay ( sigma - aldrich canada ) . by performing these assays , the uptake of fe from fe - transferrin by c. rectus cells was determined as follows . bacterial cells were harvested by centrifugation ( 8,000 g for 15 min ) and suspended to an od660 of 1 in mbb - gff medium treated ( iron - restricted condition ) or not ( normal condition ) with the chelex 100 resin . equal volumes of fe - transferrin ( 13 m ) and bacteria were incubated at 37c under anaerobiosis for 0 , 3 , and 24 h. following incubation , cells were harvested by centrifugation ( 8,000 g for 15 min ) , washed twice in pbs , and resuspended in the same buffer to an od660 of 1 . the radioactivity associated with the bacteria equal volumes of holotransferrin ( 0.5 mg / ml ) and overnight culture of c. rectus in mbb - gff medium were incubated at 37c for 1 , 6 , and 24 h. proteolytic cleavage of holotransferrin was evaluated by sodium dodecyl sulfate ( sds ) page followed by western immunoblotting using an alkaline phosphatase - conjugated goat antihuman transferrin antibody ( 1:3,000 dilution ) . undegraded transferrin and transferrin fragments were visualized following development in 100 mm carbonate buffer ( ph 9.8 ) containing 0.3 mg / ml nitroblue tetrazolium chloride and 0.15 mg / ml 5-bromo-4-chloro-3-indolylphosphate p - toluidine salt . a culture of p. nigrescens atcc 33563 in todd - hewitt broth ( bbl microbiology systems ) supplemented with hemin ( 10 g / ml ) and vitamin k ( 1 g / ml ) was used as a positive control ( 11 ) . the transferrin - binding activity of c. rectus cells was determined by a microplate assay . bacterial suspensions ( 100 l ; od660=1 in 50 mm phosphate - buffered saline [ pbs ] ) prepared from an overnight culture in mbb - gff medium ( treated or not with chelex 100 ) were applied into wells of a flat - bottomed 96-well microplate , which was then covered and incubated overnight at 37c . bacterial suspensions were removed by aspiration and wells were washed with pbs containing 0.5% tween-20 ( pbst ) to remove loosely bound bacteria . bacterial cells attached on the bottom of wells were fixed with 0.05% glutaraldehyde ( 1 h ) and the wells were further washed three times with pbst . the unreacted sites were then blocked with pbs containing 3% gelatin for 1 h. the solution was discarded and 100 l of horseradish peroxidase - conjugated transferrin ( 0.2 g / ml in pbs ; bio / can scientific , mississauga , ontario ) was added . after a 2-h incubation , wells were washed three times for 5 min with pbst prior to adding 100 l of 2,2'-azino - bis(3-ethylbenzthiazoline-6-sulphonic acid ( abts ) substrate was added . following incubation at 37c for 30 min , the absorbance at 405 nm ( a405 ) was measured using a microplate reader . cells of p. nigrescens atcc 33563 were used as a positive control ( 11 ) . ( 17 ) was used to detect ferric reductase activity in whole cells of c. rectus from an overnight culture in mbb - gff treated with chelex 100 or with no pretreatment . cells were suspended in 1 ml of the assay buffer ( 50 mm sodium citrate , ph 6.5 , 5% glucose , 1 mm ferric chloride ) to an od660 of 1 . bathophenanthroline disulfonate ( bpds ) was then added to a final concentration of 1 mm and samples were incubated at 37c for 30 and 120 min . bacterial cells were then removed by centrifugation and the red fe bps complex was quantified by recording the absorbance of the assay mixture supernatant at 520 nm ( a520 ) . the level of ferrous ions produced was estimated from a reference curve constructed from a solution of known ion concentrations . results of growth studies for c. rectus cultivated under various iron conditions are presented in table 1 . when the mbb - gff medium was rendered iron - restricted by treatment with the cation - chelating resin , only a slight growth of c. rectus occurred . adding either ferrous sulfate or holotransferrin stimulated growth of c. rectus . using apotransferrin , the iron - free form of transferrin , instead of holotransferrin did not promote growth of c. rectus . the medium was rendered iron - restricted by treatment with a cation - chelating resin to correlate the capacity of holotransferrin to support growth of c. rectus with the uptake of bound iron , we first demonstrated iron removal from transferrin by urea / borate / edta - page analysis . while the c. rectus culture supernatant incubated with holotransferrin had no effect on the level of iron saturation ( data not shown ) , cells of c. rectus caused a complete removal of iron ( fig . we then monitored the uptake of iron from fe - transferrin by cells of c. rectus . when bacteria were incubated with fe - transferrin under an iron - restricted condition , a significantly higher capacity to assimilate fe was noted after a 24-h incubation . treating c. rectus cells at 60c ( 30 min ) completely abolished the uptake of iron thus suggesting the involvement of an active enzymatic process . removal of iron from holotransferrin by cells of c. rectus , as determined by urea / borate / edta - page analysis and coomassie blue staining . lane 1 , control holotransferrin ( iron - saturated form ) ; lane 2 , control apotransferrin ( iron - free form ) ; lane 3 , holotransferrin incubated with c. rectus cells ; lane 4 , holotransferrin incubated with c. rectus cells treated at 60c for 30 min . intracellular uptake of iron from fe - transferrin by c. rectus cells incubated under normal and iron - restricted ( treatment with the cation - chelating resin ) conditions . results are expressed as disintegrations per minute ( dpm ) associated to bacteria following incubation with fe - transferrin . assays were performed in triplicate and the meansstandard deviations were calculated . * , significantly different between normal and iron - restricted conditions at p<0.01 using a student 's t - test . to investigate whether proteolytic degradation may be involved in the uptake of iron - bound transferrin , holotransferrin was incubated with a culture of c. rectus for various periods of time . as shown in fig . 3 , no breakdown products were detected by sds - page analysis indicating that proteases active on transferrin are not produced by c. rectus . on the contrary , p. nigrescens used as a positive control degraded holotransferrin into lower molecular weight fragments ( fig . since transferrin - binding activity may represent a mechanism of iron acquisition , we analyzed this property in c. rectus . 4 indicate that c. rectus does not possess the ability to bind holotransferrin , on the contrary of p. nigrescens used as positive control . degradation was monitored after 1 , 6 , and 24 h of incubation of holotransferrin with bacterial cultures . samples were analyzed by sds - page followed by western immunoblotting using an alkaline phosphatase - conjugated goat antihuman transferrin antibody . transferrin - binding activity of c. rectus and p. nigrescens cells grown under normal and iron - restricted ( treatment with the cation - chelating resin ) conditions , as determined by a microplate assay using horseradish peroxidase - conjugated transferrin . lastly , the presence of a cell surface ferric reductase activity in c. rectus was investigated using a colorimetric assay . as reported in table 2 , ferric reduction was detected after 30 min and increased markedly at 120 min . as observed for the uptake of iron from fe - transferrin , the ferric reductase activity was more pronounced for cells grown under iron - restricted conditions . cell surface - associated ferric reductase activity of c. rectus
meanstandard deviation of triplicate assays . although numerous studies have reported on the mechanisms of iron acquisition by periodontopathogens ( 1012 , 1820 ) , there was no data in the literature on c. rectus . in this study , we evaluated the ability of c. rectus to utilize human transferrin as a source of iron and investigated the mechanism by which iron can be obtained from this plasma protein . transferrin , whose major physiological roles are the absorption , transport , and exchange of iron in tissues , plays an important role in host defense by rendering the iron unavailable for microorganisms ( 7 ) . the transferrin concentration in gingival crevicular fluid has been reported to be approximately 70% of that in serum , which is in the range of 2040 m ( 21 ) . the c. rectus was found to grow in the presence of holotransferrin ( iron - loaded form ) as the sole source of iron . using fe - transferrin , we showed that cells of c. rectus were able to efficiently remove and assimilate iron bound to transferrin . this iron - uptake was found to be significantly increased when c. rectus cells were grown under iron - restricted conditions . such a capacity to acquire iron from this host protein may be of utmost importance for the ability of c. rectus to establish and multiply in periodontal sites or to cause infections at distant sites . previous studies have shown that p. gingivalis ( 10 , 12 , 18 ) , p. intermedia ( 11 ) , and p. nigrescens ( 11 ) can also use transferrin as a source of iron . thereafter , experiments were carried out to attempt to identify the mechanism by which c. rectus can sequester iron bound to transferrin . in a previous study ( 11 ) , we reported that the capacity of p. nigrescens to use iron - bound transferrin was related to its capacity to bind the protein on its surface or to proteolytically cleave it . however , c. rectus did not show transferrin - binding activity or proteolytic activity toward transferrin . we then investigated the presence of a cell surface ferric reductase activity in c. rectus since reduction of ferric to ferrous may favor iron release from transferrin . the ferric reductase activity of c. rectus was increased when cells were cultivated under iron - restricted conditions , in agreement with our data on the uptake of iron from fe - transferrin by cells of c. rectus . interestingly , a ferric reductase activity has been previously reported in another species of campylobacter ( jejuni ) , although its role in iron acquisition from transferrin has not been established ( 22 ) . ferric reductase activity as a mechanism of iron acquisition from transferrin has been previously reported in other pathogens including candida albicans ( 23 ) and histoplasma capsulatum ( 24 ) . in summary , we have demonstrated for the first time the ability of c. rectus to use iron - bound transferrin to support its growth . although c. rectus does not appear to possess a specific receptor for transferrin , a surface - associated ferric reductase may physically interact with the substrate to generate reduced ferrous iron that may in turn be captured and transported across the cell envelope by a transporter system that remains to be identified . however , one should not exclude the possibility that c. rectus possesses additional mechanisms for iron acquisition from host iron - containing proteins . ' there is no conflict of interest in the present study for any of the authors . | background and objective
campylobacter rectus is considered as one of the bacterial species of etiological importance in periodontitis .
iron - containing proteins such as transferrin are found in periodontal sites and may serve as a source of iron for periodontopathogens .
the aim of this study was to investigate the capacity of c. rectus to assimilate transferrin - bound iron to support its growth.design growth studies were performed in broth media pretreated with an iron - chelating resin and supplemented with various iron sources .
the uptake of iron by c. rectus was monitored using 55fe - transferrin .
transferrin - binding activity was assessed using a microplate assay while the degradation of transferrin and iron removal was evaluated by polyacrylamide gel electrophoresis .
a colorimetric assay was used to determine ferric reductase activity.results holotransferrin ( iron - saturated form ) but not apotransferrin ( iron - free form ) was found to support growth of c. rectus in an iron - restricted culture medium .
incubation of holotransferrin with cells of c. rectus resulted in removal of iron from the protein .
a time dependent intracellular uptake of iron by c. rectus cells from 55fe - transferrin was demonstrated .
this uptake was significantly increased when bacteria were grown under an iron - limiting condition .
cells of c. rectus did not show transferrin - binding activity or proteolytic activity toward transferrin .
however , a surface - associated ferric reductase activity was demonstrated.conclusion to survive and multiply in periodontal sites , periodontopathogens must possess efficient iron - scavenging mechanisms . in this study
, we showed the capacity of c. rectus to assimilate iron from transferrin to support its growth .
the uptake of iron appears to be dependent on a ferric reductive pathway . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an incidence of 20 - 25% in sexually active and 30 - 35% in all women irrespective of age has been reported . the surgical management of myomas has advanced significantly , there has been a renewed interest in the removal of myoma alone , i.e. , myomectomy rather than hysterectomy , which was carried out historically . with the trends toward minimally invasive endoscopic surgery , procedures have been developed to accomplish myomectomy via either laparoscopic or hysteroscopic route . just as these procedures have come up , they have met with several criticisms like lack of meticulous closure , inadequate hemostasis , chances of rupture in subsequent pregnancy and high - risk of adhesion formation . we report our experience of 417 cases of laparoscopic myomectomy of large and moderate size myomas in a tertiary care hospital . in this article , our objective is to describe our technique of laparoscopic myomectomy and multiple layer closure of myoma bed and discuss its outcomes and advantages , overcoming all the criticisms surrounding laparoscopic myomectomy . in a retrospective study , conducted at our tertiary care hospital , we evaluated 417 patients in the past 5 years with large and moderate size myomas ( more than 7 cm ) , largest being up to 17 cm producing an abdominal mass corresponding to 32 weeks size uterus . inclusion criteria included largely patients being treated for subfertility with myomas causing endometrial distortion or tubal occlusion with normal ovulation and normal male factor.patients with large myomas producing pressure symptoms.asymptomatic large myomas producing palpable abdominal mass up to the umbilicus or above . patients being treated for subfertility with myomas causing endometrial distortion or tubal occlusion with normal ovulation and normal male factor . pre - operative evaluation included history , clinical examination , basic investigation for pre - anesthetic checkup and a detailed trans vaginal scan . sonography included , mapping of myomas in number , size , and location and most importantly differentiating it from adenomyosis and adenomyoma . although , we carry out adenomyomectomy with almost identical technique , but still surgical preparedness is there and patient counseling is done accordingly . in all cases , no patient received gnrh analog prior to surgery as it leads to loss of cleavage plane during surgery . all operations were performed under general anesthesia with inhalational anesthetics avoiding nitrous oxide as it causes bloating of bowel . our innovative technique of port placement involved intra umbilical veress needle insertion without any incision and utilizing right upper 5 mm port for primary trocar insertion . the 10 mm port was optimized supra - umbilically , under direct vision of 5 mm telescope depending on the myoma size , which went even up to the xiphisternum in large myomas . all accessory ports were also made so that they remain above and out - side the biggest myoma . the most common port placement was : two ipsilateral ports for enucleation and suturing , one contralateral port for the assistant anywhere between umbilicus and anterior superior iliac spine ( depending on myoma size ) and a supra pubic port for myoma screw . on peritoneal entry all pelvic and abdominal structures were inspected and other pathologies , if present , were noted . pitressin was injected at the concentration of 20 units/200 ml between serosa and pseudo capsule of myoma to decrease the bleeding and for hydrodissection . hysteroscopy was carried out in the meantime to see and treat any submucous myoma . in most of the cases , we preferred to make a transverse incision over the most bulging part of the myoma with the harmonic scalpel taking care not to extend to cornual ends . in case of multiple myomas , we preferred to give single anterior or posterior incision in such a manner , that most myomas can be enucleated by a single incision from superficial to deepest locations . if incision was expected to extend too far than vertical incision was resorted to very rarely . sharp dissection was carried out in the plane between myoma and the pseudo capsule with harmonic scalpel , coagulating , and cutting all vascular bridges , causing very minimal blood loss . two myoma screws were used in case of very large myomas , one was kept in the constant position from the supra pubic port and the other kept changing to allow for traction near the working end . after enucleation , there was usually no bleeding , but if at all there was , then light minimal bipolar coagulation was carried out . after achieving adequate hemostasis , myoma bed was sutured in transverse , continuous and non - locking fashion in multiple layers . a suture of 4550 cm length , no . 10 vicryl on a taper cut needle was loaded and introduced in the peritoneal cavity using the clark reich method of removing the 5 mm trocar . the angle knot was taken by passing the suture from upper and lower edge of myoma bed and an intracorporeal , tight surgeon 's knot was secured . from this point continuous , non - locking suturing was carried out using needle holders in both hands for a much better grip . first layer of deep myometrium was thus completed and the same suture is used to take second layer of superficial myometrium . third layer of serosa was taken , up to the starting point of the first layer at the angle and tied there . in very large myomas , which were very deep intramural and cause a symmetrical enlargement of the uterus , the myoma bed , which comes after myomectomy was very deep . so , we preferred to go from the deepest myometrium working upwards layer by layer till a total reconstruction is carried out , and uterus appears absolutely in shape with only one knot on the surface . in very large myomas , we sutured in even up to six layers for proper approximation of the defect . while suturing all the layers , care was taken to take bites at equal distances and take adequate tissue to fully obliterate all dead space and give a neat look . to minimize the exposed thread volume , recently we have also applied subserosal baseball sutures in most superficial layer . in this way there was only one knot in the entire myoma bed minimizing the knot volume and decreasing the adhesion formation potential . very large myomas were retrieved by 20 mm sleeve of sawhle morcellator ( karl storz , germany ) . morcellator port site was meticulously closed by port closure needle and 20 mm site required rectus sheath closure [ figures 112 ] . all patients were up and about within 6 h of surgery , were orally allowed , started ambulation and deep breathing and leg raising exercise and were discharged after 24 h. big posterior wall myoma last layer incorporating subserosa and serosa final appearance of myoma bed sutured with single knot on the surface morcellation of myoma in progress blanched look of myoma after injecting diluted vasopressin transverse incision over most bulging part of the myoma with harmonic ace myoma bed after myoma enucleation first stitch in deepest myometrium and knot being tied second layer in progress third layer near completion completed third layer three hundred and fifteen ( 75% ) patients presented with sub fertility , 45 ( 11% ) patients with menorrhagia and 57 ( 14% ) patients with abdominal mass . this was , in fact , a case of large uterus with multiple adenomyomas , which made a pure laparoscopic approach difficult due to lack of plane of cleavage , leading to more bleeding and difficult closure in adenomyotic tissue . blood transfusion was required only in 25 ( 6% ) patients with very large size myomas or multiple myomectomy sites . the mean post - operative stay was 24 h. all patients had an uneventful recovery . two patients reported delayed wound healing of the morcellator site and one patient developed omental hernia at morcellator site on long term follow - up . very low adhesions scores were observed in subsequent second look scopies carried out by us . other colleagues also reported very low adhesions in patients they delivered by caesarian section . amongst the subgroup of patients who presented with infertility , 198 ( 63% ) patients conceived after the surgery had an uneventful antenatal and intra natal course . even the first myomectomy we did conceived after 17 years of married life , just 1 month after myomectomy . she continued pregnancy up to term and an elective caesarean was carried out at term , no adhesions or even depression at myomectomy site was observed . three ( 0.7% ) patients out of these , who were around 35 years of age when myomectomy was performed for menorrhagia , later underwent hysterectomy . two ( 0.5% ) patients desirous of pregnancy had a repeat myomectomy carried out on account of recurrence of myoma during the study period . in this era of minimally invasive endoscopic surgery , laparoscopic myomectomy has become the order of the day . it offers several advantages over laparotomy including , less operative trauma and blood loss , reduced post - operative morbidity , shorter hospital stay and recovery time , earlier return to normal activity , fewer post - operative adhesions , better cosmesis , improved patient compliance and better pregnancy outcome . furthermore , the magnification it provides allows careful micro surgical dissection , development of avascular planes and perfect hemostasis . many surgeons still prefer to do open myomectomy due to technical difficulties or lack of endo suturing skills . one of their major concerns is the risk of hemorrhage and uterine rupture in the subsequent pregnancies . it has been reported that rupture can occur during the course of pregnancy or during delivery after removal of myomas . however , in experienced surgeon 's hands , with superior skill of endo suturing , laparoscopic myomectomy is a very safe procedure and such complications are rare . a long - term survey by dubuisson , et al . , found three cases of spontaneous uterine rupture in 15 pregnancies and only one occurred at the laparoscopic myomectomy site . the strength of scar largely depends upon proper meticulous closure of the incision site . that is why multiple layer closure gives much better results than single or two layer closures . it also gives much better approximation of the defect and a neat finish in the end of procedure . based on the clinical trials and case series , it would appear that the risk of uterine rupture during pregnancy is no higher than 1% when the myomectomy incision is appropriately repaired . we , at our institute , perform continuous suturing of the myoma bed using no . 1 - 0 polygalactin suture on taper cut needle in multiple layers so that there is only one knot on the surface . the amount of adhesions formed per suture line is directly proportional to the number of knots and lesser the number of bulky knots lesser the adhesion scores . we have observed that this technique gives much better results than that of interrupted knotting leading to tremendous knot volume . as the myoma is progressively morcellated and the uterine size reduced , additional space is created for the optimum movement of instruments . the 12 or 15 mm claw forceps of the morcellator offers better grip and steady traction . we took extreme care to remove myomas in longer chips to reduce the morcellation time . exact count of myomas and location of their parking in the abdomen was kept to avoid misplacing any myoma . such misplaced myomas are a common cause of iatrogenic myomas as reported by nezhat et al . in their study . the only complications we observed were that of delayed wound healing of the morcellator site in two patients . this was probably due to jagged margins created by repeated manipulations at the morcellator site . we thus , recommend that one should avoid using towel clips to avoid gas escape around morcellator site , which starts off in prolonged morcellation time . another safer and relatively simpler procedure in the hands of experienced laparoscopist as well as novices is laparoscopic assisted minilap myomectomy . in this procedure through this minilap incision enucleation , morcellation and suturing of beds is carried out of all multiple and big myomas . then minilap incision is sutured back , laparoscope re - inserted and thorough suction irrigation and lavage carried out . however , it should be planned pre - operatively and there is no sudden conversion on table from laparoscopic to laparoscopic assisted myomectomy . our experience demonstrates the feasibility of dealing with even large size myoma successfully laparoscopically and we encourage multiple layer closure to decrease the dead space and avoidance of hematoma formation . and in turn , achieve good reproductive outcome . laparoscopic myomectomy is a safe and favorable alternative to open myomectomy as it offers several advantages over laparatomy with minimal complications . it is equally feasible for even large size myomas in experienced hands with advance suturing skills . multilayer closure of the myoma bed in continuous , non - locking fashion gives excellent reproductive outcomes in terms of very low adhesion scores and negligible risk of scar rupture in subsequent pregnancies . however , one should appropriately select the myoma size according to one 's suturing skills , instruments available and experience . | objective : to assess the feasibility and outcome of laparoscopic myomectomy and multiple layer closure of myoma bed for management of myomas at a tertiary care hospital.materials and methods : four hundred and seventeen patients from september 2005 to september 2010 with large and moderate size myomas were managed by laparoscopic myomectomy .
indications were subfertility , menorrhagia and abdominal mass .
pre - operative evaluation included history , clinical examination and sonographic mapping .
myomas were enucleated and retrieved laparoscopically .
myoma beds were sutured in multiple layers by endoscopic intracorporeal suturing.results:three hundred and fifteen patients presented with subfertility , 45 with menorrhagia and 57 with abdominal mass .
the average maximum diameter of myoma was 9 cm .
the mean duration of surgery was 120 min .
the mean post - operative stay was 24 h. no intra - operative complication occurred and hospital course was uncomplicated . in one case ,
minilap incision was given for retrieval of myoma and suturing of the bed .
two patients had minor delayed wound healing of the morcellator port site .
the patients did not report any complaints during follow - up except one patient who developed omental hernia at morcellator port site .
there was no rupture of scar and very low adhesion scores in subsequent caesarian sections or second look scopies.conclusion:with proper multilayer closure of the myoma bed , laparoscopic myomectomy is feasible for moderate and even large myomas and has excellent outcomes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the eeg frequency spectrum and the distribution of eeg transients vary extensively across the wake - sleep cycle . since most eeg waves are synchronized across several eeg leads , an expansion of the conventional single - channel evaluation to regional and global eeg coupling analysis can reveal complex intracortical interactions . coherence and cross correlation and other linear measures have been applied effectively to the eeg [ 17 ] . however , algorithms that comprise nonlinear as well as linear interactions on short time scales ( within the millisecond range ) often permit a more precise estimation of the dynamics of spatiotemporal eeg synchronization . nonlinear measures like nonlinear interdependences and phase synchronization can detect interhemispheric synchronization with higher sensitivity than cross - correlation and coherence function . like the conventional eeg parameters , these linear and nonlinear synchronization measures seem to be subject to similar changes across the wake - sleep cycle : the amount , the spatial distribution , and the temporal dynamics of eeg synchronization depend on the respective waveforms as well as on the current state of vigilance and alertness [ 2 , 5 , 913 ] . in contrast , in a former study of eeg synchronization during rem sleep , we found evidence that at least a portion of the cortical synchronization seems to be independent of the current state of vigilance . in a previous study , the coupling dynamics of eeg activation phases in nrem sleep was characterized by marked recurrent increases of coupling during eeg activation phases in the central leads . these findings suggest the possible existence of a spatially and temporally stable pattern of eeg synchronization across all levels of vigilance during the sleep - wake cycle . pointwise transinformation ( pti ) provides an algorithm to detect and quantify dynamic coupling processes in the eeg , capturing both linear and nonlinear interactions [ 1619 ] . an outstanding feature of the pti as a measure of eeg synchrony is the combination of a high temporal resolution with a clear separation of high and low synchronization phases . pti can be easily interpreted as the mutual coupling of pairs of eeg leads ; it might also provide indirect information about the synchronization of neuronal assemblies in the corresponding cortical areas [ 19 , 20 ] . the objective of the present study was the identification and quantification of synchronization phases in the waking and nrem and rem sleep eeg using the pti algorithm . based on our previous studies , we expected to find a recurrent pattern of synchronization independent of both specific eeg waves and graphoelements ( like k - complexes , sleep spindles , and delta waves ) and the spectral content of the eeg . if this pattern corresponds to a physiological mechanism which synchronizes different sites of cortical and probably also subcortical networks , the distributions of the durations of synchronized and unsynchronized eeg sections assessed by pti should be consistent for all waveforms and states of vigilance . taking into account the results of other eeg synchronization studies , this would imply that the mean level and the dynamic changes of cortical synchronization depend only partially on the current state of vigilance , while other synchronization patterns are characterized by a constant spatiotemporal distribution ; the latter patterns should be detected by pti . in addition , clinical situations with an instable vigilance are common . in these situations , conventional eeg parameters are subject to marked changes ; in contrast , pti as an eeg synchronization measure that is largely independent of vigilance could provide a valuable approach to measuring fundamental cortical coupling patterns . a database of all adults who had been admitted to the neurological clinic for health checks and had been reported to be healthy sleepers was used to identify eligible participants . we evaluated retrospectively the data of 21 adults12 women and 9 men aged 18.347.2 years . sleep - wake disorders were excluded by medical history , pupillographic sleepiness test , and sleep questionnaires ( pittsburgh sleep quality index , epworth sleepiness scale ) . exclusion criteria were the intake of substances with central nervous effects , a diagnosis of concomitant or former neurological or psychiatric disorders , and abnormal neurological , medical , or psychiatric status . all participants had given informed consent for their eeg data to be used for further evaluation . the waking eegs had been derived in the morning after undisturbed sleep ( with 21 leads according to the 1020 system : fp1 , fp2 , f3 , fz , f4 , c3 , cz , c4 , p3 , pz , p4 , o1 , o2 , f7 , f8 , t3 , t4 , t5 , t6 , a1 , and a2 ; common average reference ) following standard procedure ( 20 minutes ; tc , 0.3 s ; hf , 70 hz ; sampling rate , 250 hz ; ag - ag - cl electrodes ) . the sleep eegs had been derived for a complete night of normal sleep in a laboratory for video - eeg polygraphy with 18 leads ( fp1 , fp2 , f3 , f4 , c3 , c4 , p3 , p4 , o1 , o2 , f7 , f8 , t3 , t4 , t5 , t6 , a1 , and a2 ; common average reference ) and the same technical parameters . sleep eegs with pathological sleep profiles were excluded . all eeg derivations included electromyography ( emg ) of the mental muscles , electrooculogram ( eog ) , and ecg by a d2 lead . the eegs were recorded with a schwarzer brainlab 3.30 - 0.00 system and stored on hard disc . visual sleep scoring by two sleep specialists was based on 30 s epochs of c3 and c4 leads with f3/f4 and o1/o2 as auxiliary channels ( common reference ) . pti was calculated for all eegs with segments of 60 s duration ( 15000 data points ) for fp1-fp2 , f3-f4 , c3-c4 , p3-p4 , o1-o2 , f7-f8 , t3-t4 , t5-t6 , a1-a2 , f3-o1 , and f4-o2 . since circadian changes of the waking eeg have been described , the waking eegs were evaluated separately ( wday ) from the waking phases in the sleep eegs ( wnight ) . mean pti , mean duration of elevated synchronization phases , and mean duration of unsynchronized intervals were assessed separately for each state of vigilance ( wday , wnight , n1 , n2 , n3 , and rem ) . elevated synchronization phases were defined as phases with a pti level mean pti + 1 standard deviation . since absolute values of pti depend on the selection of the embedding parameters and only relative changes of pti were of concern for our study , pti was normalized to 1 by maximal / minimal values . 2 s intervals around all synchronized episodes were also analyzed by an fft spectral analysis with a frequency range of 025 hz and a frequency resolution of 0.5 hz . the frequency bands were defined as delta 0.53.5 hz , theta > 3.58 hz , alpha > 812 hz , sigma > 1214.5 hz , and beta > 14.525 hz . the power spectrum of the 2 s interval beginning with the onset of the elevated coupling was compared to the previous unsynchronized 2 s interval . the dominant frequency shift was then defined by the frequency band with the highest increase of relative power . the distribution of all pti parameters could be approximated by a lognormal distribution , which we confirmed by a kolmogorow - smirnow test . stage dependent differences of the pti parameters were assessed for all patients by an analysis of variance after a logarithmic transformation . significance was assumed for p < 0.05 . since 3 parameters for 11 pairs of eeg leads and 6 states of vigilance were compared , an -adjustment for multiple comparisons was made . the false discovery rate was controlled by the benjamini - hochberg procedure : when m hypotheses are tested , the p values are ordered as p1 p2 pm , and k : = max { i : pi q i / m } is defined with q = the control level of the false discovery rate . the hypotheses h1 , , hk are then rejected . all calculations were performed by a pc - based statistical program ( macanova 5.05 , release 3 , university of minnesota , 2006 ) . all persons had physiological sleep profiles with normal sleep duration , latencies , and percentages of sleep stages ( table 1 ) . a consistent synchronization pattern was found for all states of vigilance , with recurrent increases of pti ( figure 1 ) ; this consistency was verified for intra- and interindividual distributions of pti throughout the single eeg recordings and across all derivations , respectively . the qualitative distribution of the pti parameters did not change during the night across subsequent sleep cycles or for any sleep stage ( figure 2 ) . however , the modulation of this pattern differed regionally : in the frontal , temporal , and central leads , burst - like short phases of elevated synchronization were separated by longer unsynchronized intervals , while in the parietal and occipital leads , more frequent and gradually fluctuating synchronization was present ( figure 1 ) . left- and right - hemispheric synchronization ( f3-o1 and f4-o2 ) had similar characteristics as the frontal synchronization f3-f4 without hemispheric differences . since pti parameters of the waking phases during the day ( wday ) and the night ( wnight ) did not differ , these phases were summarized for all further evaluations and referred to as stage w. the mean pti levels and durations of synchronization phases varied only subtly across the different states of vigilance ( figure 2 ) ; significant differences were found only for the mean pti level of n3 versus w , n1 , and r in f7-f8 and t3-t4 and for n3 versus r also in f3-f4 , t5-t6 , and a1-a2 ( table 2 ) . the intervals separating elevated synchronization phases were 19002200 ms in w , n1 , n2 , and r. in contrast , a significantly shorter duration of ca . 1000 ms was distinguished in n3 for the frontal , anterior temporal , midtemporal , and temporobasal leads ( p < 0.05 ) . this difference was especially prominent for the longest intervals , distinguishable by a significantly reduced p90 value ( p < 0.05 ) for these derivations ( figure 2 ) . however , these differences between n3 and the other stages were removed by division by the relative amount of delta in the respective eeg channels ( see section 4 ) . the eeg transients which caused an increase of synchronization could be identified visually in most cases . as expected , they depended largely on the respective state of vigilance and comprised the characteristic waveforms of each stage . the spectral analysis of the eeg transients confirmed these observations their dominant frequency shift differed significantly for waking and sleep stages ( figure 3 , table 3 ) . in waking , most events occurred in the alpha and to a lesser extent in the beta and theta range ; the automatic spindle identification of the brainlab system confirmed that the events with a dominant frequency shift in the sigma band during waking and rem sleep were not sleep spindles , but single waves or short wavetrains in the upper alpha and lower beta band . in nrem sleep , the alpha - predominance successively decreased , and delta increased markedly with the deepening of sleep . a large proportion of synchronized spindles was observed in n2 and to a lesser extent in n3 . alpha- and beta - dominant events in these stages were mostly correlated to arousals . in rem sleep , a larger proportion of theta events was found compared to waking and n1 , while delta was nearly absent . in contrast to these changes with vigilance , regional differences were small ( figure 3 ) , and hemispheric differences were absent . research on eeg synchronization in sleep has mainly focused on changes of coupling levels and patterns during the sleep cycles and on correlating the different results to the waveforms that characterize , and in some cases define , the respective sleep stages [ 2 , 5 , 913 ] . hence it was unexpected that our two previous studies on eeg coupling during activation phases in nrem sleep and eeg synchronization in rem sleep yielded very similar results as to the temporal and spatial distributions of synchronization patterns . based on these findings , we extended the examination of eeg synchronization dynamics to the entire waking and sleep eeg . we were able to confirm that the fundamental synchronization pattern is independent of the state of vigilance , specific waveforms , and the spectral content of the eeg . for waking and all sleep stages , the durations of synchronized and unsynchronized eeg sections and their distributions were almost identical ; all physiological waveforms contributed to the recurrent synchronizations . the spatial distribution of mean synchronization levels was also constant with frontal and occipital maxima and central and midtemporal minima . due to these results , we expand our proposition of a descriptive pattern of synchronization to all physiological states of vigilance : the recurrent increase of synchronization in the eeg , which we will address in the following as rise . eeg synchronization can be defined as the mutual adjustment of varying rhythms of coupled cortical oscillators ; in this context it is regarded as a continuous dynamical process . the analysis of eeg synchronization patterns provides essential information about how interrelations between brain sites change with the wake - sleep cycle . the coupling of different cortical sites can be measured by transinformation [ 19 , 24 ] , also referred to as mutual information [ 16 , 18 , 25 ] . eeg pointwise transinformation ( pti ) provides insight into the spatiotemporal dynamics of these coupling patterns [ 19 , 20 ] . we applied it successfully to the sleep eeg in two preliminary studies that focused on arousal - correlated activation phases in the nrem sleep eeg and on recurrent increases of synchronization in the rem sleep eeg . some results of the first study were confirmed in another study on arousal - related decoupling of the sleep eeg . methodological issues of pti as a measure of eeg synchronization are discussed in our previous studies [ 14 , 15 ] . however , the issue of volume conduction has to be addressed here , since it can substantially influence the synchronization measures of adjacent eeg electrodes . it is inevitable that volume conduction contributes to rise when large potentials extend across a large area of the scalp ; thus , not all increases of pti are generated by active synchronization of cortical neuronal assemblies . on the other hand , our results point to a predominance of an active synchronization process , because the amount of synchronization measured by rise is independent of the distance of the respective electrodes . in further contrast to our results , volume conduction would cause a parallel temporal dynamics and amplitude - dependent changes of pti with eeg potentials . we can therefore conclude that volume conduction is not the main source of rise , but it restricts the information rise provides about the synchronization dynamics of cortical neuronal assemblies . numerous synchronization measures have been applied to the physiological and pathological eeg [ 4 , 11 , 2831 ] . studies with conventional linear synchronization measures like ordinary and partial coherence and cross correlation [ 1 , 2 , 47 , 32 ] reported spatial synchronization patterns that were reproduced by rise : mean interhemispheric coupling levels were high in the anterior and posterior sites and low in the central and temporal sites . this regional distribution of synchronization also corresponds to the regional eeg slow - wave synchronization during sleep cyclic alternating pattern ( cap ) a1 . since the time scales of the linear algorithms are much larger , a correspondence with the temporal properties of rise was not to be expected . however , the algorithm and the physiological interpretation of pti can be compared to the synchronization likelihood [ 34 , 35 ] . the eeg slow - wave synchronization likelihood during normal sleep indicated higher spatial synchronization levels during cap sleep in comparison to non - cap sleep with fluctuations of the coupling level , probably corresponding to the single eeg slow waves . this matches the moderate increase of mean synchronization levels in sws in our study as well as the shorter intervals between synchronization phases ; however , pti is less affected by vigilance changes . this is somewhat unexpected , since pti reacts to eeg synchrony variations on very short time scales and sensitively detects arousal - associated changes of eeg coupling [ 15 , 26 ] . an obvious explanation is that the majority of eeg waves contributing to rise are not related to arousals , so cap and ncap are not distinguished by eeg synchron . the median durations of pti synchronization phases ( 350450 ms ) and unsynchronized intervals ( 19002200 ms except for sws , see below ) we obtained were comparable to the durations of stable microstates reported by two studies on spatiotemporal patterns of the alpha eeg [ 37 , 38 ] . rise was subtly modulated by sws with increased synchronization levels and shorter unsynchronized segments in the frontal , central , and temporal regions and a higher frequency of synchronization phases in the anterior and midtemporal leads . this could be explained by the different spatial scales and cell population sizes associated with different eeg rhythms . the increase of synchronized intervals we observed in sws might reflect the modulation of activity over larger spatial regions by low frequency oscillations , compared to the modulation in smaller spatial regions and shorter time windows by higher frequency oscillations [ 28 , 39 ] . however , the increase of synchronization in sws is more likely due to a methodological effect : when slow waves are synchronized by the same temporal pattern as other waves with higher frequencies , the longer duration of the slow waves causes a relative increase of mean pti and a decrease of unsynchronized intervals in a given time interval . indeed , the correction of the pti parameters for this frequency - dependent effect by division by the relative amount of delta in the respective eeg channels removed the differences between sws and the other stages . in contrast to rise , conventional spectral parameters vary extensively with the wake - sleep cycle [ 4045 ] . visual and spectral analysis confirmed that a multitude of waveforms and graphoelements contribute to rise . the distribution of the dominant frequency shifts during increased synchronization in our study correlates well to the peaks of the power spectra of waking and sleep stages in previous studies [ 2 , 4649 ] . moreover , the network organization of the eeg synchronization at different frequency bands during sleep might be a trait of all sleep stages , probably reflected by the stable pattern of rise during sleep . this is especially evident for relatively stage - specific waveforms like delta waves and spindles . likewise , the phasic eeg activation phases in nrem sleep induce short burst - like increases of eeg synchronization . the cortical slow oscillation groups spindles , delta waves , and k - complexes and is itself synchronized in corresponding regions of both hemispheres . thus , the interplay of all these waveforms ought to establish the main framework of rise during sws . anterior and posterior alpha patterns of the characteristic waking - alpha rhythm are seemingly interconnected via corticocortical synapses and modulated thalamic inputs ; this could explain the large extension of synchronization peaks in rise with waking - alpha activity as well as the results of eeg coherence studies [ 32 , 5254 ] . rem - specific alpha waves might be due to a distinct pattern of corticocortical coupling [ 3 , 52 ] , but they contribute to rise the same way as alpha waves in waking and n1 . beta and gamma oscillations have been examined preferentially in the context of cognitive processes ; these fast oscillations have been mostly attributed to active brain states in waking , rem sleep , and arousals from sleep [ 50 , 51 , 56 , 57 ] . although the traditional terminology views eeg epochs consisting mainly of fast activity as desynchronized , spontaneous fast activity is synchronized over cortical sites and through thalamocortical circuits . our results show a higher proportion of events in the beta range contributing to rise during wakefulness , light sleep , and rem sleep than in sws , in good agreement with the cited studies . in sws , small amounts of fast activity play a part in rise generation , too , probably during the depolarizing phase of the slow oscillation . a dynamical , but qualitatively stable , pattern of recurrent eeg synchronization seems to continue throughout all physiological waking and sleep phases . rise describes the rapid change of synchronized microstates with eeg waves across the whole spectrum as well as with state - specific eeg graphoelements , but it remains remarkably unaltered by changes of vigilance ; thus , it seems to provide a persistent spatiotemporal framework for recurrent eeg synchronizations during the brain 's resting state . the probable generators of rise could be coupled corticocortical neuronal assemblies , modulated by thalamocortical and other subcorticocortical pathways ; transient , but highly synchronized spatiotemporal configurations of these neuronal networks seem to alternate with phases of low synchronization . rise needs to be evaluated for different pathological eegs in future studies to examine its clinical relevance . | pointwise transinformation ( pti ) provides a quantitative nonlinear approach to spatiotemporal synchronization patterns of the rhythms of coupled cortical oscillators .
we applied pti to the waking and sleep eegs of 21 healthy sleepers ; we calculated the mean levels and distances of synchronized episodes and estimated the dominant frequency shift from unsynchronized to synchronized eeg segments by spectral analysis .
recurrent eeg synchronization appeared and ceased abruptly in the anterior , central , and temporal derivations ; in the posterior derivations it appeared more fluctuating .
this temporal dynamics of synchronization remained stable throughout all states of vigilance , while the dominant frequencies of synchronized phases changed markedly .
mean synchronization had high frontal and occipital levels and low central and midtemporal levels .
thus , a fundamental coupling pattern with recurrent increases of synchronization in the eeg ( rise ) seems to exist during the brain 's resting state .
the generators of rise could be coupled corticocortical neuronal assemblies which might be modulated by subcortical structures .
rise designates the recurrence of transiently synchronized cortical microstates that are independent of specific eeg waves , the spectral content of the eeg , and especially the current state of vigilance .
therefore , it might be suited for eeg analysis in clinical situations without stable vigilance . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
intraventricular hemorrhage is a common complication of parenchymal intracerebral hemorrhage and subarachnoid hemorrhage [ 1 , 2 ] . however , spontaneous primary intraventricular hemorrhage without a recognizable parenchymal component in noncontrast - enhanced computed tomography ( ct ) or magnetic resonance imaging ( mri ) studies is extremely rare . limited data on the clinical characteristics and outcome of patients with spontaneous primary intraventricular hemorrhage is partially due to rarity of the condition and the fact most studies of primary intracerebral hemorrhage are focused on the global assessment of patients with hemorrhagic stroke [ 1 , 2 ] . it has been shown that the clinical spectrum , prognosis , and early mortality in patients with primary intracerebral hemorrhage are reasonably dependent on the site of bleeding . on the other hand , hemorrhages in the thalamus , basal ganglia , and internal capsule are a group of well - known supratentorial cerebral hemorrhages of subcortical topography , with a clinical profile that is clearly different from those of other topographies , including lobar , cerebellar , brainstem , and intraventricular hemorrhages . this single - center retrospective study aimed to further characterize the clinical profile , risk factors , prognosis , and early outcome of patients with primary intraventricular hemorrhage . a secondary objective was to assess clinical differences between patients with primary intraventricular hemorrhage and patients with subcortical hemorrhage . data for this study were collected from a prospective hospital - based stroke registry in barcelona , spain . patients for this study were collected from registro de ictus del hospital del sagrat cor de barcelona , which is an ongoing prospective hospital - based stroke registry , in which data from stroke patients admitted consecutively to the department of neurology of sagrat cor hospital ( an acute - care 350-bed teaching hospital in the city of barcelona , spain ) are entered following a standardized protocol . the cerebrovascular study group of the spanish neurological society was used for the classification of subtypes of stroke , which included transient ischemic attack , cerebral infarction ( thrombotic , cardioembolic , lacunar , unusual etiology , and unknown cause ) , intracerebral hemorrhage , subarachnoid hemorrhage , spontaneous subdural hematoma , and spontaneous epidural hematoma . this classification is similar to that of the national institute of neurological disorders and stroke classification . definitions of cerebrovascular risk factors have been used by our group in previous studies [ 4 , 5 ] . for the purpose of this study , patients were diagnosed with primary intraventricular hemorrhage when brain ct and/or mri studies revealed blood restricted to the ventricular system ( figure 1 ) . patients with intraparenchymatous hemorrhage were excluded even if the hemorrhage was small or very close to the ventricular system or subarachnoid blood , as were patients with history of head trauma . for comparative purposes , data from patients with subcortical hemorrhage ( basal ganglia and internal capsule ) were also collected . prior to conducting the study , all patients were admitted to the hospital within 48 hours of onset of symptoms . on admission , demographic characteristics , salient features of clinical , neurological examination and results of laboratory tests ( blood cell count , biochemical profile , serum electrolytes , urinalysis ) , chest radiography , other investigations , including angio - mri , arterial digital subtraction angiography , echocardiography , and lumbar puncture were obtained at discretion of the attending physician . the degree of clinical disability at discharge from the hospital was evaluated according to modified rankin scale ( mrs ) and causes of death according to the criteria of silver et al . . demographic characteristics , risk factors , clinical events , and outcome of patients with primary intraventricular hemorrhage and those with subcortical hemorrhage were compared using the student 's t - test or the mann - whitney u test for continuous variables and the chi - square ( ) test ( with yate 's correction when necessary ) for categorical variables . variables were subjected to multivariate analysis with a logistic regression procedure and forward stepwise selection if p < 0.10 after univariate testing . the effect of variables on the presence of primary intraventricular haemorrhage was studied in a multiple regression model based on demographic , vascular risk factors , and clinical and neuroimaging variables , in which primary intraventricular hemorrhage was the dependent variable . these cases accounted for 0.31% of all cases of stroke included in the database ( n = 3808 ) and 3.3% of all cases of intracerebral hemorrhage ( n = 407 ) included in the database . there were 5 men and 7 women , with a mean ( standard deviation , sd ) age of 78.9 ( 7.2 ) years . five patients ( 41.7% ) aged 85 years or more , and all of these patients were females . hypertension ( 41.7% ) , vascular anomaly ( 16.7% ) , anticoagulation ( 16.7% ) , and hematological conditions ( 8.3% ) were the main causes of primary intraventricular hemorrhage . median duration of hospital stay was 18.5 days . at the time of hospital discharge , 1 patient ( 8.3% ) was symptom - free ( mrs grade 0 ) . of the remaining 11 patients , 2 had moderate disability ( mrs grade 3 ) , 2 moderately severe disability ( mrs grade 4 ) , and 2 severe disability ( mrs grade 5 ) . a total of 5 patients died , with an in - hospital mortality rate of 41.7% . three of these patients aged 85 years or more ( in - hospital mortality rate 60% ) . the median time from the onset of symptoms to death was 11 days ( 25th75th percentile , 613.5 days ) . causes of death were cerebral herniation in 3 patients , pneumonia in 1 , sepsis in 1 , and unknown cause in 1 . patients with primary intraventricular hemorrhage as compared with patients with subcortical hemorrhage ( n = 133 ) were older ( 78.9 ( 7.2 ) versus 72.2 ( 11.9 ) years , p = 0.51 ) , showed a higher percentage of patients aged 85 years or older ( 41.7% versus 14.3% , p = 0.029 ) , patients with valve heart disease ( 16.7% versus 2.3% , p = 0.055 ) , atrial fibrillation ( 41.7% versus 12.0% , p = 0.016 ) , headache at stroke onset ( 50% versus 24.8% , p = 0.066 ) , altered consciousness ( 66.7% versus 29.3% , p = 0.012 ) , and in - hospital mortality rate ( 41.7% versus 16.5% , p = 0.048 ) . in the multivariate analysis , factors independently associated with primary intraventricular hemorrhage were 85 years old or more , atrial fibrillation , headache , and altered consciousness ( table 2 ) . data regarding the frequency of primary intraventricular hemorrhage in the different hospital - based stroke registries are scarce the present results show that primary intraventricular hemorrhage is a rare subgroup of hemorrhagic stroke that accounted for 0.31% of all cases of stroke and 3.3% of intracerebral hemorrhages . the prevalence of primary intraventricular hemorrhage in different clinical series of intracerebral hemorrhage varies widely from 2% in the series of hameed et al . to 7% in the series of ara et al . . in a subsample of 551 with hemorrhagic stroke reported by flint et al . , primary intraventricular hemorrhage was diagnosed in 15 patients ( 2.7% ) . we found that patients with primary intraventricular hemorrhage and patients with subcortical haemorrhage presented different clinical profiles , with 85 years old or more , atrial fibrillation , headache at stroke onset , and altered consciousness being significantly more frequent in patients with primary intraventricular hemorrhage . a remarkable finding of our study is the advanced mean age of patients with primary intraventricular hemorrhage of 78.9 years , with 41.7% of patients aged 85 years or more as compared with the mean age of patients with subcortical hemorrhage ( 72.2 years ) as well as the mean age of 60 years in patients with primary intraventricular hemorrhage reported by mart - fbregas et al . and of 56 years in the series of hameed et al . also , 85 years of age or older was the main independent factor related to primary intraventricular hemorrhage . this aspect has not been previously reported and may be related to the increasing incidence of stroke in the oldest old segment of the population [ 1418 ] . also , elderly stroke patients are particularly at risk of receiving suboptimal care and there is evidence that brain neuroimaging and other diagnostic tools are less frequently used in the very old patients with acute stroke [ 1921 ] . the present study carried out in the context of a prospective acute stroke registry ensures that all patients independently of their age at presentation underwent the same protocolized work - up studies . it should be noted that we have reviewed our experience with primary intraventricular hemorrhage over 19 years and a limitation is that management practices changed over this time period so this could impact the results . because of the rarity of primary intraventricular hemorrhage , results of the present study should be interpreted taking into account that only 12 patients were included in the study . atrial fibrillation was significantly more frequent in patients with primary intraventricular hemorrhage than in patients with subcortical hemorrhage . the occurrence of atrial fibrillation increases with age and the attributable risk of stroke for atrial fibrillation increased significantly rising from 1.5% for patients in the 5059 years old group to 23.5% for those aged 8089 years . headache at the time of stroke onset is more frequent in hemorrhagic than in ischemic stroke and was found to be also more common in primary intraventricular hemorrhage than in subcortical hemorrhage . headache , probably secondary to acute intracranial hypertension , was experienced by 50% of patients in our study , which is lower than 78% reported in the series of angelopoulos et al . . also , the state of alertness of the patient is a clinical feature that correlates with prognosis in hemorrhagic stroke and , in general , in acute stroke patients . reduced alertness in intracerebral hemorrhage is due to either a generalized increase in intracranial pressure , or to compromise of both hemispheres , to the reticular activating system bilaterally in the brainstem tegmentum [ 1 , 3 ] . primary intraventricular haemorrhage is a severe clinical condition with an in - hospital mortality rate of 41.7% . only one patient ( 8.3% ) was symptom - free at discharge from the hospital . in the series of passero et al . , angelopoulos et al . , and verma et al . , the case fatality was 43% , 36% , and 33.3% , respectively . as shown in table 3 , early mortality rate usually ranges between 20% and 45% , although in a few series lower figures were reported [ 10 , 12 , 27 ] . in the study of tembl et al . , the in - hospital mortality was 0% , which is similar to that observed by our group in hemorrhagic lacunar stroke . we also found that very old patients with acute stroke showed a differential clinical profile , different frequency of stroke subtypes , and a poorer outcome compared with stroke patients who were younger than 85 years of age . death increased with age and in agreement with the study of daverat el al . , age was the most important predictor of death and functional outcome after spontaneous intracerebral hemorrhage . massive primary intraventricular hemorrhage that produces fourth ventricular distension and periventricular cerebral compression is an especially ominous sign associated with rapid and advances neurological deterioration and with early death . this high percentage of female patients among the oldest old is consistent with other studies [ 18 , 19 ] . on the other hand , very old patients showed a worse prognosis as none of the patients was symptom - free at hospital discharge and the in - hospital mortality rate in this subgroup was 60% as compared with 28.6% in the remaining patients . studies in animal models studies have shown that clot removal can improve the acute and long - term consequences of intraventricular extension from intracerebral hemorrhage by using minimally invasive techniques coupled to recombinant tissue plasminogen activator - mediated clot lysis . also it has been shown that thrombolytic drugs administered intraventricularly through an external ventricular drain to lyse an intraventricular clot are safe and may reduce morbidity and mortality . these findings will probably determine a change in the management of patients with acute intracerebral hemorrhage , in which ultraearly clot removal therapy , similar to the efficacy of early thrombolytic therapy in cerebral infarction , followed by careful monitorization in specialized stroke units could be of paramount importance in the care of patients with intracerebral hemorrhage [ 3136 ] . in summary , patients with primary intraventricular hemorrhage showed a differential clinical profile than patients with classical subcortical hemorrhages , mainly the higher frequency of presentation of very old age , a demographic feature that has not been previously observed . primary intraventricular haemorrhage is a severe clinical condition with an in - hospital mortality rate of 41.7% . | purpose . primary hemorrhage in the ventricular system without a recognizable parenchymal component is very rare .
this single - center retrospective study aimed to further characterize the clinical characteristics and early outcome of this stroke subtype .
methods .
all patients with primary intraventricular hemorrhage included in a prospective hospital - based stroke registry over a 19-year period were assessed .
a standardized protocol with 161 items , including demographics , risk factors , clinical data , neuroimaging findings , and outcome , was used for data collection .
a comparison was made between the groups of primary intraventricular hemorrhage and subcortical intracerebral hemorrhage .
predictors of primary intraventricular hemorrhage were identified by logistic regression analysis .
results .
there were 12 patients with primary intraventricular hemorrhage ( 0.31% of all cases of stroke included in the database ) and 133 in the cohort of subcortical hemorrhage .
very old age ( 85 years ) ( odds ratio ( or ) 9.89 ) , atrial fibrillation ( or 8.92 ) , headache ( or 6.89 ) , and altered consciousness ( or 4.36 ) were independent predictors of intraventricular hemorrhage .
the overall in - hospital mortality rate was 41.7% ( 5/12 ) but increased to 60% ( 3/5 ) in patients aged 85 years or older . conclusion . although primary intraventricular hemorrhage is uncommon , it is a severe clinical condition with a high early mortality .
the prognosis is particularly poor in very old patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
robust data assessing the value of procalcitonin ( pct ) for monitoring treatment response in abdominal sepsis are rare , so the study of jung and colleagues published in the previous issue of critical care is most welcome . they concluded that a decrease of pct to 0.5 ng / ml lacked sensitivity to predict treatment response and a decrease of at least 80% from its peak failed to accurately predict treatment response . the value of the study is limited by the small number of patients included , the single - center approach and its observational character . nevertheless , it is to date among the best available evidence we have for these critically ill patients . international databases show that one in four cases of severe sepsis or septic shock is caused by intra - abdominal infection . abdominal sepsis is not just a single disease , but comprises a group of different entities . almost 90% of all intra - abdominal infections are so - called secondary peritonitis and require a primarily surgical approach ( 87% of patients had surgical intervention in the study of jung and colleagues ) . secondary peritonitis consists of community acquired and postoperative nosocomial forms , the latter one following a previous surgical intervention ( anastomotic insufficiency following anterior rectum resection ) . tertiary nosocomial peritonitis is a persistent intra - abdominal infection without a surgically treatable focus , but this point is difficult to assess without an uncontributive reoperation proving that the patient indeed has a tertiary peritonitis . primary inadequate and inappropriate antibiotic regimens for both forms of nosocomial peritonitis are associated with substantially worse prognostic outcome for patients with intra - abdominal infections and result in substantial increases in health care costs . the difficulties associated with abdominal sepsis are complicated by uncertainty about surgical control of the source of the sepsis . do we have any reliable parameters that enable us to decide whether to perform a relaparotomy or not ( in the jung and colleagues study about 20 out of 101 patients required a relaparotomy ) ? an analysis of all investigated markers , including pct , failed to detect specific parameters that can be used under these difficult conditions . current guidelines recommend administration of broad - spectrum antimicrobials within 1 hour of the diagnosis of severe sepsis or septic shock . this recommendation is based on the evidence that delaying antimicrobial therapy in patients with sepsis- related hypotension is associated with increased mortality . pct has been evaluated over recent years as to whether it can be used to detect the presence of different types of infection , treatment failure or adverse outcome . the promising initial publications reporting the results of using serial serum pct concentrations to guide duration of antibiotic therapy in patients with community - acquired pneumonia have only partially been confirmed in critically ill patients . a recent randomized multicenter trial enrolling critically ill patients with mainly respiratory tract infection showed that duration of antibiotic therapy can be reduced by a mean of 2.7 days without impact on mortality . but unfortunately , pct had no influence on the duration of antibiotic therapy in patients with intra - abdominal infections . smaller randomized studies show that significant pct - guided reduction of antibiotic exposure can safely be accomplished in patients with severe sepsis and septic shock and in surgical patients with sepsis . more recently , it has been suggested that pct may be of value as a prognostic marker . daily measurements of pct in a general icu population in a recent large multicenter randomized study were associated with increased use of antibiotics and duration of mechanical ventilation . this commentary has been written by an abdominal surgeon and an intensivist , representing the two disciplines most frequently involved in the treatment of an important subgroup of critically ill patients . in this war against the high mortality from abdominal sepsis , surgeons and intensivists are brothers in arms . the study of jung and colleagues indicates that pct is still a valuable weapon in this war - but far from being the magic bullet . | the ideal management of infection includes not only the early identification and start of effective therapy but also the correct categorization of non - infected patients in order to avoid unnecessary use of antimicrobials .
the availability of a specific and sensitive test for the presence of infection is of paramount importance to improve the prudent use of antimicrobial therapy .
procalcitonin ( pct ) has been evaluated over recent years as to whether it can be used to detect the presence of different types of infection , allows reduced duration of antibiotic therapy , or predicts treatment failure or adverse outcome . in the previous issue of critical care , jung and
colleagues report about the monitoring of treatment response in abdominal sepsis by repetitive determination of pct . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in computer simulation
studies of protein folding , the folding
reaction is most often considered under equilibrium conditions ; i.e. ,
one chooses a temperature at which both the unfolded and folded ( native )
states of the protein are populated ( shea and brooks ) . under these conditions , provided that the simulated trajectory
is sufficiently long , the protein experiences many folding / unfolding
events . the results of the equilibrium simulations are typically organized
in the form of a free energy surface , disconnectivity graph ( becker
and karplus ) or equilibrium kinetic network
( rao and caflisch ) , which describe the
populations of the characteristic states of the system and the rates
of transitions between them in the course of repeating folding and
unfolding . to calculate the time evolution of the system through the
network , the markov process approximation is often employed ( krivov
et al . , no and fischer , and lane et al . ) . under the usual physiological conditions in the organism , then , the folding
reaction corresponds essentially to first - passage folding ( fpf ) , which can be studied with an ensemble of the trajectories that
are initiated in the unfolded state of the protein ( e.g. , as the polypeptide
comes of the ribosome ) and are terminated when the native state is
reached ( chekmarev et al . this raises
the question as to how the equilibrium folding / unfolding results are
related to fpf . in such a comparison , it should be noted that often
the environment conditions used will be different ; e.g. equilibrium
folding ( ef ) requires a higher temperature than the fpf , though of
course , as we do here , it is possible to investigate fpf at the same
temperature as the ef . so far , the fpf simulations have been limited
to coarse - grained protein models . in an early 125-residue lattice protein model study ( dinner and karplus ) , the low - temperature folding pathways resembled the high - temperature
unfolding pathways , but for the same temperature the pathways were
different . a number of nonequilibrium folding experiments have been
made , in which a reagent ( e.g. , gdmcl ) stabilizing the unfolded state
is rapidly diluted and folding ( collapse ) is observed by fret ( lipman
et al . ) . there have been a large
number of studies of unfolding on the assumption
that it is the inverse of folding . because unfolding is
fast at the high temperature usually used , unfolding simulations have been found to
be most meaningful for proteins with two - state kinetics when the unfolded
states and the native state are separated by a single free energy
barrier , though two - state kinetics can
be observed even when there are multiple barriers . if the folding kinetics are more complex , e.g. , when a
range of reaction channels are involved , unfolding is not necessarily
the reverse of folding . to inquire
into the relation between the fpf and the ef at a given
( elevated ) temperature , we examine the antiparallel -sheet
miniprotein ( called beta3s , figure 1 ) , one
of the few systems for which the folding reaction under equilibrium
conditions has been studied in detail with an all - atom representation . the published studies are based on a set trajectories of total length
of 20 s , during which the protein experiences on the order
of one hundred folding / unfolding events . the simulations were performed using the charmm program with an implicit solvent model . to have the
denatured and native state of the protein both significantly populated , the temperature for the simulations was typically chosen to be t = 330 k , which is slightly above the melting temperature
( cavalli et al . ) . the equilibrium folding
of this system has been analyzed in many ways , which we do not review
here ; see ref ( 24 ) for
a listing of some of the studies . in what follows we describe the
first passage folding and compare it with the ef results obtained
in our previous work . section 2 contains a brief survey of the methods we used
to perform simulations and analyze the results . the lower
part of the protein corresponds
to the n - terminal hairpin , and the upper part to the c - terminal hairpin . the method used to simulate and analyze
folding of the beta3s miniprotein
under first - passage folding ( fpf ) conditions is similar to that employed
previously for the ef ( kalgin et al . ) . the system used is the
one studied by caflisch and various co - workers . the designed
three - stranded antiparallel 20-residue peptide ( thr1-trp2-ile3-gln4-asn5-gly6-ser7-thr8-lys9-trp10
-tyr11-gln12-asn13-gly14-ser15-thr16-lys17-ile18-tyr19-thr20 with
charged termini ) , shown in figure 1 , was modeled with the charmm program . all heavy atoms and the hydrogen atoms bound
to nitrogen or oxygen atoms were considered explicitly ; param19 force
field ( neria et al . ) and a default cutoff
of 7.5 for the nonbonding interactions were used . a mean field
approximation based on the solvent - accessible surface ( sas ) was employed
to describe the main effects of the aqueous solvent ( ferrara et al . ) . the simulations were performed with a time
step of 2 fs using the berendsen thermostat ( coupling constant of
5 ps ) at t = 330 k. for the present protein model ,
this temperature is slightly above the melting temperature . two hundred md trajectories started in unfolded
states of the protein and terminated upon reaching the native - like
state were generated . it is expected that small proteins
up to size of 1015 kda do not fold until they have left the
ribosome ( fersht and daggett ) , because ,
as has been shown for barnase fragments and chymotrypsin inhibitor
2 ( neira and fersht ) , the last residues
at the c terminus of the protein have to be free to allow folding . consequently , the initial stage of folding is likely to be independent
of interactions with the ribosome or with chaperones for many proteins . this circumstance is used to justify in vitro experimental studies
of protein folding , where the initial states of the protein are prepared
by thermal ( temperature - jump experiments ) or chemical ( stopped - flow
experiments ) denaturation of the native state of a protein . in the present study , we used the standard charmm protocol to prepare initial conformations . more specifically , an extended conformation of the protein was first minimized ( 200 steps
of the steepest descent followed by 300 steps of the conjugate gradient
algorithm ) and then heated to t = 330 k and equilibrated
for 5 10 time steps . as will be shown below ( section 3 ) , the initial conformations thus obtained are similar
to the most unfolded conformations found under equilibrium folding
conditions starting with the native state at the temperature of interest
( t = 330 k ) . the final state where the fpf
trajectory was terminated is the
native state of the protein . beta3s has a number of native - like conformations
that differ not only by the hydrogen bond distances , which are used
below to characterize the protein conformations , but also by orientation
of the side chains . though the hydrogen bond distances could be used
to define the native contacts , we employed the side - chain distances .
specifically , two criteria were tested : one assumed that a native
contact was formed if the distance between the geometrical centers
of the side chains of two residues dnat was less than 6.5 , and the other that dnat < 7.5 . i| = 1 with i and j the residue
numbers ) , the numbers of native contacts are nnat = 18 at dnat < 6.5
and nnat = 23 at dnat < 7.5 ( figure 2 ) . in the
latter case , five additional contacts appear , which are ( 1,12 ) , ( 4,9 ) ,
( 5,10 ) , ( 13,18 ) , and ( 18,20 ) contacts . among them , four contacts ,
i.e. , ( 1,12 ) , ( 4,9 ) , ( 13,18 ) , and ( 18,20 ) , were listed in ref ( 18 ) as native contacts . therefore ,
we considered dnat < 7.5 to
be the more suitable criterion , though the effect of the difference
between the two is not large . with this definition of the final state
to terminate the trajectory , the fraction of the hydrogen bonds in
the final states was equal to 0.76 on average , i.e. , approximately
6 hydrogen bonds among the bonds indicated in figure 1 were present . contact maps for two different distances between the geometrical
centers of the side chains dnat that were
used to determine native contacts . panels a and b are for dnat < 6.5 and dnat < 7.5 , respectively . to characterize
protein conformations , the hydrogen bond pca ( hb pca ) method was used . in this method , the original conformation
space of the protein in the form of the hydrogen bond distances is
reduced to a three - dimensional space of collective variables g = ( g1 , g2 , g3 ) space with a specialized
principal component analysis ( pca ) . a
distinctive feature of this method is that only the formed bonds are
taken into account to make the folded states more pronounced . the
first three modes corresponding to the largest eigenvalues were chosen
as the variables g1 , g2 , and g3 . because
the collective variables are linear combinations of the original variables ,
they are measured in the same units as the bond distances , i.e. , in
angstroms . figure 3 also makes clear that the
variables g1 , g2 , and g3 are different from those for
the equilibrium folding . this difference is due to the fact that the
set of representative points from which they are calculated in the
fpf is different from that for the ef . triangles and crosses correspond
to the equilibrium and first - passage folding , respectively . the eigenvalues
are normalized so that their sum is equal to 1 . to divide the representative
points of the protein states in the g = ( g1 , g2 , g3 ) space into clusters , the mclust method by fraley and raftery was used . in this method , the collection of
points is approximated by a set of multidimensional ( in our case 3d )
gaussian functions with generally different covariance matrices and
different weights . as
in the previous studies , protein conformations were discriminated
according to the secondary
structure strings ( ssss ) encoded with the dssp alphabet ; i.e. , the letters h , g , i , e , b , t , s , and -
stand for -helix , 310-helix , -helix , extended ,
isolated -bridge , hydrogen bonded turn , bend , and unstructured
segments , respectively . with this coding , the native state ( figure 1 ) using the first passage
folding trajectories , the local probability
flows ( fluxes ) of the transitions j(g ) in
the space of collective variables g = ( g1 , g2 , g3 ) are determined . they are calculated as the 2-fold ( time
and ensemble ) averages of the local transitions . on the basis of these
fluxes , the folding process is viewed as a steady flow of a folding
fluid from the unfolded states to the native state ,
with the density of the fluid being proportional to the probability
for the system to be found at the current point of the g space . streamlines of the folding flows can be constructed ,
which are tangent to the local directions of the j(g ) vectors . in the case of two
dimensions , e.g. , for the projection of the folding flow onto the
( g1 , g2 ) plane ,
the streamlines can be calculated as the lines corresponding to constant
values of the stream function , and in the case of
the three - dimensional space they are visualized with passive tracers
( weightless point particles ) . to study the first passage folding
( fpf ) of beta3s , two hundred
folding trajectories were initiated at an extended state of the protein
and terminated upon reaching a native - like state . because of some
looseness in determining the native contacts ( section 2 ) , the native - like state was considered to be reached if the
number of native contacts was not less than 23 , i.e. , nnat 1 . specifically , the criterion dnat < 7.5 was used to determine a native contact .
the change of this criterion to a more stiff one ( dnat < 6.5 ) , which decreased the number
of native contacts from 23 to 18 , was found to have no significant
effect . in particular , the first passage time distributions for the
two criteria agree not only between themselves but also with the corresponding
distribution obtained by krivov et al . the temperature at which these
simulations were performed was the same as in the equilibrium simulations ,
i.e. , t = 330 k. the representative points were taken
from these trajectories at 20 ps intervals , which resulted in the
total number of points 1.2 10 ; i.e. , the
number of points is approximately equal to that for the ef studies
( 1 10 ) . survival probability distributions of the first
passage time f(t ) = tp(t ) dt , where p(t ) is the distribution of the first passage
times . empty and solid triangles are , respectively , for dnat < 6.5 and dnat < 7.5 in the present work , and the crosses present the
distribution of ref ( 21 ) . the number of trajectories for dnat < 6.5 ( the empty triangles ) was 4 times smaller than for dnat < 7.5 ( the solid triangles ) . the
circles show the distribution corresponding to the first - passage folding
segments of the ef trajectory of ref ( 24 ) . figure 5a presents the distribution
of the
representative points in the 3d space of the collective variables g = ( g1 , g2 , g3 ) obtained with the hb pca
method for ef , and figure 5b shows the corresponding
results for the fpf . the points are colored according to the clusters
of characteristic conformations to which they belong . they are numbered
in accord with tables 1 and 2 , respectively ; the orange points without a number correspond
to other clusters . the variables g1 , g2 , and g3 in figure 5a , b , as well as in similar figures below , are measured
in angstroms . we note that these variables are different for the ef
and fpf calculations because they are calculated from different collections
of representative points . as in the ef , if two points ( 1 and 2 ) in the g space are sufficiently
distant , so that the protein conformations do not overlap in the hydrogen
bond space , the distance between them g = [ i=1i=3(gi(2 ) gi(1 ) ) ] is proportional to the all - atom
rmsd between the corresponding protein conformations ( figure 6 ) ; this holds at approximately for g > 3.6 . due to this relation , the distribution of the spatially
separated clusters in the g space can be viewed as a
distribution in the rmsd space . it should be noted that because the
variables g1 , g2 , and g3 are different for the ef and
fpf ( figure 3 ) , the scaling is different : in
the former case one unit in the g space corresponds to
approximately 0.14 in the rmsd space , and in the latter to
approximately 0.07 . stereoviews of the distribution of the representative
points of
beta3s in the 3d spaces of collective variables g = ( g1 , g2 , g3 ) . panel a is for the equilibrium folding ( reproduced
with permission from ref ( 24 ) ) , and panel b is for the first - passage folding . in both
cases , the g1 , g2 , and g3 variables are in angstroms . all - atom rmsd as a function of the distance
in the g space . the solid and empty triangles correspond
to the equilibrium
and first - passage folding , respectively . the solid and dashed lines
show the best fits to the data with the slopes of the lines 0.14
and 0.07 , respectively . cluster weight equal
to the number
of representative points in the cluster relative to the total number
of the points ( in % ) . weight of the given conformation
in the cluster ( in % ) . corresponds
to figure 4 . cluster weight
equal to the number
of the representative points in the cluster relative to the total
number of the points ( in % ) . tables 1 and 2 show
the clustering of the points obtained with the mclust program for ef and fpf , respectively . in each table ,
the first column is the cluster number , and the second column is the
relative number of points in the cluster ( in percentage of the total
number of 10 and 1.2 10 points , respectively ) .
also , these tables contain information about the protein secondary
structures characteristic of each cluster . the third column presents
the number of conformations that have different ssss , the fourth column
shows the ssss of the two most populated secondary structures , and
the fifth column the weight of these structures in the cluster . finally ,
the last column indicates the type of representative protein conformation
with which the cluster is associated according to the ssss . the representative
conformations are labeled as in the previous studies of folding of
beta3s ; i.e. , native stands for native - like
structures , ns - or for conformations in which the c - terminal
hairpin is formed and the n - terminal hairpin is unstructured ( or means out of register ) , cs - or for
conformations with the n - terminal hairpin formed and the c - terminal
unstructured , ch - curl for conformations that have
a curl - like structure with the c - terminal hairpin formed , and helical
for conformations that contain a helical region . based on the similarity
of the ssss , the clusters for the structured conformations are grouped
into five consolidated clusters , which represented
locally stable characteristic conformations . for the ef , they consist
of clusters 1 and 2 ( native ) , cluster 3 ( cs - or ) , clusters 5 and 6
( ns - or ) , clusters 8 and 9 ( helical ) , and clusters 10 and 11 ( ch - curl ) .
also , two intermediate clusters , 4 and 7 , are observed that present
mixtures of the native - like conformations with the cs - or and ns - or
conformations and are positioned between the native cluster and the
cs - or cluster and the ns - or cluster , respectively . with these intermediate
clusters joined to the native cluster , the residence probabilities
of the system in the consolidated clusters is in good agreement with
the results of the previous studies . the clusters
which present unstructured conformations form a pool of conformations
( an entropic basin ) that
connect the clusters of the structured conformations . the main
difference between fpf and ef is that in the former the
ch - curl conformations become so rare that they do not form a cluster ,
whereas the weight of the helical conformations drastically increases
( tables 1 and 2 and
figure 5a , b ) . this effect appears to be due
to the fact that the ensemble of initial structures in the fpf consists
of conformations that readily form helical conformations . figure 7a shows the points in the g space at
which the trajectories were started . it is seen that they lie on the
boundary of the conformation space visited by the system , or more
specifically , on the part of it that is close to the helical conformations ,
but they do not contain the hydrogen bonds between i and i + 4 residues that are characteristic of helices . secondary structure of these conformations
( i.e. , a hairpin - like form with distant strands and the presence of
local chain bends ) suggests that because they involve short - range
contacts , the formation of helical conformations is dynamically much
more likely than the formation of ch - curl conformations , because the
latter require the n- and c - terminal strands to come into contact
that are distant along the chain . according to the criterion we used
to define the native contacts , dnat <
7.5 ( section 2 ) , the average number
of native contacts in the initial conformations is equal to 8 , i.e. ,
approximately 27% of the total number of native contacts ( nnat = 23 ) . in addition , a comparable number
of non - native contacts ( on average , 11 contacts ) is present in these
conformations . the 200 conformations , which make up the initial states ,
are 200/(1.2 10 ) 0.017% of the total number
of the recorded conformations . for comparison , the number of corresponding
conformations along the 20 s equilibrium trajectory ( i.e. , the conformations that have the numbers
of contacts not exceeding 8 native and 11 non - native contacts ) is
equal to 543 , which is 0.05% of the total number of the conformations
that were included in the analysis . this suggests that the conformations
from which the fpf trajectories were started approximate the most
unfolded conformations that occurred in ef . first - passage
folding . panel a depicts the starting points superposed
on the distribution of the representative points of figure 5b . the clusters of the representative points are
colored according to this figure and , to make the starting points
visible , are shown as semitransparent objects . panel b reproduces
figure 5b in the same orientation as for ( a ) . a closer examination
of the fpf shows that the ch - curl conformations
that constitute a considerable fraction of the conformations observed
in the course of ef are found only in 20 of the 200 trajectories ,
with the total fraction of them ( 1.2 10
0.054 0.014 900 , cluster 14 in table 2 ) being 6.8 times smaller than for the ef ( 1
10 [ 0.033 ( 0.056 + 0.045)+0.044 ( 0.033
+ 0.032 ) ] 6200 , clusters 10 and 11 in table 1 ) . at the same time , the weight of the helical conformations
increases , from 12.8% to 21.8% , which is comparable
with the total weight of the cs - or , ns - or , and helical clusters in
the ef ( tables 1 and 2 ) . it is of interest that if the representative points for the fpf
are projected onto the collective variables g1 , g2 , and g3 for the ef , a cluster for ch - curl conformations emerges and
has a weight 2.2% . the weights of the other clusters also change but
not greatly , staying within the variations of the weights of these
clusters that are obtained with different methods ( table 2 of ref ( 24 ) ) ; for the native , cs - or ,
and helical clusters they decrease by 2030% , and for the ns - or
cluster it increases by 35% . these changes , and particular the appearance
of the ch - curl cluster , indicate that the principal coordinates obtained
with the hb pca method are specific to the manifold of the representative
points to which the method is applied , and thus to the process that
produces this manifold . we note also that the cluster of native - like
conformations at which the trajectories were terminated in the fpf
simulations is as significant as for the ef simulations . this is true
mainly because a variety of conformations corresponding to the condition nnat 1 used to terminate the trajectory
exists that have different coordinates in the g space . the increased contribution of helical conformations also affects
the hydrogen bond composition of the collective variables ( figure 9 ) . the variables g1 and g2 in the fpf have the largest projections onto
the same eight bonds as they had in the case of the ef , and they thus
play a similar role as in the ef ; i.e. , g1 serves as a good reaction coordinate for the overall description
of the folding process , and g2 discriminates
between the ns - or and cs - or conformations . however , the role of the g3 variable
is essentially different : athough in the ef g3 can not be associated with any secondary structure element , in the case of the fpf , it has the largest projections
on the bonds characteristic of helical conformations , i.e. , the hydrogen
bonds between i and i + 4 residues . the most important bonds among them are at the n - terminal end , in
agreement with their ssss in table 2 . fractions of
the hydrogen bonds which make a major contribution
to the collective variables g1 , g2 , and g3 . panel
a is for the equilibrium folding ( reproduced with permission from
ref ( 24 ) ) , and panel
b is for the first - passage folding . the figures at the top of each
bar denote the bond ; the first figure is the number of the residue
with the oxygen atom , and the second figure is that with the nitrogen
atom . the empty and solid bars are for the bond contributions to the
negative and positive directions of the collective variable , respectively . the numbers in percentage at the top of each panel are the total contribution
of the given bonds to the collective variable . panels a and b of figure 10 present
spatial
kinetic networks for the ef and fpf , which show how the clusters of
protein conformations are connected in these cases . the ball volumes
are proportional to the number of intracluster transitions , and the
tube cross sections to the number of intercluster transitions ( the
latter were calculated as one - half of the total number of the forward
and backward transitions between two clusters ) . more clearly , the
difference between the cluster interconnection is seen from the paths
of passive tracers ( figure 11a , b ) and a directed
kinetic network for the fpf ( figure 12 ) . in
figure 11a , b the paths were initiated , respectively ,
at the representative points of figure 5a , b
with the largest fluxes j(g ) and continued
for some time ( for details , see ref ( 24 ) ) ; the number of the points is equal to 900 for
the ef and to 766 for the fpf . it is seen that in the fpf , in contrast
to the ef , there are many tracer paths between the clusters for unstructured
conformations and the native cluster , whereas the direct paths between
the ns - or ( 5 ) and cs - or ( 2 and 3 ) clusters and the native cluster
( 1 ) are absent . because the intensity of a tracer path is proportional
to the ( average ) flux j(g ) , the absence of the path can be a result of either the lack
of the transitions or the presence of detailed balance . as is seen
from figure 10b , the numbers of transitions
between the ns - or and cr - or clusters and the native cluster ( the cross
sections of the tubes ) are comparable with those from the clusters
for unstructured conformations to the native cluster . it follows that
detailed balance between the ns - or and cr - or clusters and the native
cluster exists . this is confirmed by the directed kinetic network ,
depicted in figure 12 , in which the tubes of
the transitions between the clusters are taken to be proportional
to the difference between the upward and backward transitions ( to
make the picture more clear , the tubes with not less than ten transitions ,
among the total number of transition 10 , are not
shown ) . moreover , direct counting of the numbers of transitions between
the cr - or and ns - or clusters and the native cluster shows that detailed
balance between them is satisfied exactly . thus , the overall flow
goes from the unfolded states to the native state directly , not passing
through the structured cs - or and ns - or conformations , which supports
the conclusion that beta3s is a barrierless / low - barrier folder . the most probable pathway is illustrated in
figure 13 , which presents a two - dimensional
kinetic network corresponding to the directed three - dimensional kinetic
network of figure 12 . the red line that connects
clusters 7 , 8 , and 9 , besides which the trajectories were started
( figure 7 ) , with cluster 1 for native - like
conformations shows the shortest pathway , which was calculated using
the bellman panel a is for the
equilibrium folding ( reproduced with permission from ref ( 24 ) ) , and panel b is for the
first - passage folding . clusters are numbered as indicated in the text
and colored according to the palette of figure 5 . the units of the g1 , g2 , and g3 variables are in
angstroms . panel a is for the equilibrium
folding ( reproduced with permission from ref ( 24 ) ) , and panel b is for the
first - passage folding . the balls represent the native , cs - or , ns - or ,
ch - curl , and helical clusters shown in the corresponding panels ( a
and b ) of figure 10 . stereoview of the directed kinetic network of beta3s for the first - passage
folding . clusters are numbered as in table 2 are colored according to the palette of figure 5 . the red line shows the most probable ( shortest ) pathway calculated
with the bellman figures 14 and 15 show the fes , two - dimensional streamlines
and tracer paths of folding
flows for the ef and fpf , respectively . for the fpf the stream function
is normalized such that = 1 corresponds to the total folding
flow from the unfolded states to the native basin , i.e. , to 200 folding
trajectories . for the ef , where there is no net flow from the unfolded
states to the native state , the normalization of the stream function
was performed by assuming that the total number of ( virtual ) trajectories
would be less than for the fpf as the ratio of the numbers of frames
in these cases , i.e. , by 10/1.2 10
0.83 times . because in the case of fpf every folding trajectory initiated
at an extended state reaches and is terminated in the native basin ,
the total folding flow is the same in each ( g2 = constant ) cross - section . as in the ef , local minima corresponding
to the clusters of characteristic conformations are observed ; they
are the clusters indicated in table 2 and
figures 5b , 10b , 11b , and 12 . however , the
flow fields are drastically different from those for the ef , in both
the streamlines and tracer paths . although small vortices are still
present at the minima , similar to the ef , indicating that the system
spends some time in them , there exists a pronounced overall folding
flow from the unfolded states to the native state . it is represented
by streamtubes that originate at the unfolded states of the protein
( large values of g1 ) and converge at the
native state ( g1 10 ) . such a behavior of the streamtubes and tracer paths has
been previously observed in the fpf simulations of an -helical
hairpin and sh3 domain ( streamtubes and tracer
paths ) . for the ef , in contrast , neither
the streamtubes or tracer paths that have such properties are present . protein
folding in two - dimensional ( g1 , g2 ) space , the equilibrium folding
( reproduced with permission from ref ( 24 ) ) . panel a shows the streamlines superimposed
on the free energy surfaces ( in kcal / mol ) . the blue local minima on
the surfaces correspond to the clusters indicated in table 1 and figures 5a , 10a , and 11a . in panel a ,
the white , gray , and black lines correspond to the stream function
values = 0.01 , = 0 , and = 0.01 , respectively . the closed white and black streamlines restrict the vortex regions ,
in which the rotation of folding flows is , respectively , clockwise
and anticlockwise . protein folding in two - dimensional ( g1 , g2 ) space , the
first - passage folding . panel a shows the streamlines superimposed on the free energy surfaces
( in kcal / mol ) . the blue local minima on the surfaces correspond to
the clusters indicated in table 2 and figures 5b , 10b , and 11b . in panel a , the lower and upper black lines correspond
to approximately the lower and upper bounds of the total folding flow ,
and the white lines to the half of the flow ( the values of the normalized
stream function at these lines are = 0.01 , = 0.5 ,
and = 0.9 , respectively ) . panels a and b of figure 16 show the dependence
of the transition rate upon the distance between the clusters of conformations
in the g space . although the scattering of the data for
the fpf is higher than that for the ef , the reduced standard error
of partial slopes is comparable it is equal to 9% for
the ef , and to 11% for the fpf . therefore , in the fpf case
the average decrease of the rates with the distance remains roughly
exponential and is approximately the same as for the ef . as has been
indicated in ref ( 24 ) , this dependence is in accord with the fact that the distance in
the g space is correlated with the change in hydrogen
bonding required to go from one cluster to another . the robustness
of this behavior is of interest ; it shows that though the overall
folding pictures for the fpf and ef are drastically different , the
elementary rates , i.e. , the rates of transitions between the clusters ,
remain the same at the same temperature . rates of transitions
between the clusters of conformations vs the
distances between the centers of the clusters in the g space . panel a is for the equilibrium folding ( reproduced with permission
from ref ( 24 ) ) , and
panel b is for the first - passage folding . in both cases the crosses
and circles are for the transitions from smaller and larger populated
clusters , respectively . in panel a the dashed line corresponds to
the best fit for the crosses [ r exp(0.55dg ) ] , and the solid line to that for the circles
[ r exp(0.58dg ) ] . in panel b the corresponding fits are r exp(0.48dg ) and r exp(0.55dg ) , respectively . it is of interest to
compare the folding time distribution for
the fpf with that obtained from the ef . to determine the latter , we selected all segments of the equilibrium
trajectory of ref ( 24 ) between two successive visits of the native state . if the considered
segment contained a conformation with eight of less native contacts
( similar to those we chosen for the initial conformations to start
the trajectories in the fpf simulations , figure 7a ) , the part of this segment from the point with the lowest number
of native contacts to the native state was taken as a first - passage
trajectory . the distribution of the first - passage times
is very close to that for the fpf ( figure 4 ) . figure 17 also depicts the representative
points of the system that fall into these first - passage trajectories
( colored from blue to red ) and the points that are outside the trajectories
( black ) . comparison of this figure with figure 5a shows that the points within the first - passage trajectories are
mostly related to the conformations that are distant from the native
state , including the helical- and ch - curl - like conformations and unfolded
conformations . the points that are outside the first - passage trajectories
are related to the conformations close to the native state , i.e. ,
those within the cs - or or ns - or clusters , the intermediate clusters ,
and the clusters of native - like conformations . stereoviews of the distribution
of the representative points that
fall into the first - passage segments of the equilibrium trajectory
( colored from blue to red ) and which are outside these trajectories
( colored black ) . figure 11b suggests that the folding flows
are very far from uniform . to illustrate this , figure 18 shows the distribution of the g1-component of the folding flux j(g ) in
a g1 = const cross - section of the g space close to the native state . however , despite all the
heterogeneity of the fluxes ( figure 19 ) , their distribution possesses a well pronounced property of self - similarity ,
similar to what was previously found for folding of sh3 domain . to estimate the degree of the heterogeneity
of the fluxes , we calculated the function g(l ) = |jg1,l|/jg1 , where |jg1,l| is the absolute
value of g1 component of the flow through
the square of linear size l , m is
the number of elementary squares covered by the square of size l , jg1 = ( 1mjg1,i2/m ) is
the average flux in g1-direction , and
the angular brackets denote the averaging over the g1-cross sections of the g = ( g1 , g2 , g3 ) space . the linear size l is measured in
units of the elementary square linear size l , which
was taken to be 1 . it is seen that g(l ) l , where d 0.68 . because d is less than 2 , i.e. , the euclidean dimension expected for a homogeneous
flow , the flows are fractal , with the exponent d being
the fractal dimension . distribution of the
folding flux component j1 in the cross - section g1 = 3.0 .
the first - passage folding . heterogeneity of folding fluxes , the
function g(l ) ( see the text ) . the
symbols show the function g(l ) ,
and the dashed line the best fit to the function g(l ) l ; d 0.68 . in this paper we compare
first - passage folding ( fpf ) ( the process
of going from the unfolded to the folded state ) with folding under
equilibrium conditions ( ef ) ( i.e. , when there are many folding and
unfolding events ) . a reason why this is of interest is that generally
in living systems , the conditions are such that after the protein
is synthesized on the ribosome , the folded ( native ) protein is stable
and unfolding is a rare event . there is considerable uncertainty
concerning the initial conditions
from which folding takes place . it is
possible , for example , that in some cases , partial folding to form
helices takes place before the polypeptide chain leaves the ribosome . however , essentially all of the large number of folding simulations
have been in aqueous solution in the absence of other cellular elements ;
exceptions are folding / unfolding studies of the role of groel , for
example . given that , it is reasonable to argue that the first - passage
folding simulations described here are likely to be more realistic
than equilibrium folding simulations . the initial stage of the
fpf occurs from nearly fully unfolded
conformations , which are relatively rare in the ef simulations , even
at temperatures where the folded and denatured states are both populated .
when the trajectory starts to fold from an extended conformation ,
it first reaches either a helical conformation , which is readily formed
due to the short - range contacts involved , or double hairpin cs - or
or ns - or conformations , which consist of antiparallel -strands . formation of a ch - curl conformation is less probable in fpf than in
ef because it contains a parallel -strand arrangement ; it is ,
thus , less stable because the hydrogen bonds are distorted in comparison
to those of the parallel -strand arrangement , and it is more difficult to form dynamically because it
has distant n- and c - terminal strands . the ch - curl conformations become
so rare that they do not form a cluster , while the weight of the helical
conformations drastically increases , from 12.8% to 21.8% ,
which is comparable with the total weight of the cs - or , ns - or and
helical clusters . the increased contribution of helical conformations
also affects the hydrogen bond structure of the collective variables ,
changing the role of the g3 variable :
although the variables g1 and g2 have the largest projections onto the same
eight bonds as they had in the case of the equilibrium folding . thus ,
they preserve their functions as , respectively , the principal reaction
coordinate and the coordinate that distinguishes between the cs - or
or ns - or conformations , the largest projections of g3 , which did not relate to a specific conformation in
ef , correspond in fpf to the bonds characteristic of helical conformations . in other words , the variable g3 captures
the essential difference between the first - passage and equilibrium
processes . it is of interest that when the representative points for
the first - passage folding are projected onto the collective variables g1 , g2 , and g3 for the equilibrium folding , a cluster for
ch - curl conformations emerges , though with a low weight ( 2.2% ) . this
indicates that the principal coordinates obtained with the hb pca
method are specific to the manifold of the representative points to
which the method is applied , and thus to the process which produces
this manifold . counting the numbers of transitions between the
clusters , the 3d
distribution of the representative points has been represented in
the form of spatial kinetic networks , undirected and directed . these
networks have shown that the folding flows do not go through the cs - or
and ns - or structures that are conformationally close to the native
state , which is consistent with the conclusion that beta3s is a barrierless / low - barrier
folder . easy rearrangement of the cs - or
and ns - or conformations into the native conformation and back leads
to detailed balance between these structures and thus makes the flow
through them negligible ( at least , for the temperature close to the
melting temperature that is used here ) . another essential difference
between the first - passage and equilibrium
folding is revealed by the hydrodynamic analysis . the projection of the passive tracer paths representing the streamlines
of the folding flows onto the fess depending on two variables shows
that in the case of equilibrium folding the folding flow field consists
of a variety of small vortices , not only at the minima corresponding
to the clusters of protein conformations ( native , cs - or , ns - or , ch - curl ,
and helical ) but also in flat regions of the pes . in contrast ,
the streamlines for the first - passage folding are mostly directed
from the denatured to the native state , although they are complex
and do not exactly follow the pes landscape . it is of interest that
despite all the complexity of the folding flows , their distribution
is self - similar and has fractal dimension ( d
0.68 ) . a similar property of folding flows has been previously observed
for folding of the sh3 domain , although
the fractal dimension was different , varying from d 1.5 for the initial ( almost laminar ) stage
of folding to d 1 for the final ( turbulent )
stage . this suggests that the self - similarity of folding flows may
be an inherent property of protein folding . although there are
significant differences in the general picture
of the folding process from the equilibrium and first - passage folding
simulations , some aspects of the two are in agreement . the rate of
transitions between the clusters of characteristic protein conformations
in both cases decreases approximately exponentially with the distance
between the clusters in the hydrogen bond distance space of collective
variables , and the folding time distribution in the first - passage
segments of the equilibrium trajectory is in good agreement with that
for the first - passage folding simulations . also , the first - passage
segments of the ef trajectory that start at an unfolded state of the
protein and converge to the native state are similar to the trajectories
in the fpf simulations in that they have similar folding time distributions . | simulations of first - passage folding
of the antiparallel -sheet
miniprotein beta3s , which has been intensively studied under equilibrium
conditions by a. caflisch and co - workers , show that the kinetics and
dynamics are significantly different from those for equilibrium folding .
because the folding of a protein in a living system generally corresponds
to the former ( i.e. , the folded protein is stable and unfolding is
a rare event ) , the difference is of interest .
in contrast to equilibrium
folding , the ch - curl conformations become very rare because they contain
unfavorable parallel -strand arrangements , which are difficult
to form dynamically due to the distant n- and c - terminal strands .
at the same time , the formation of helical conformations becomes much
easier ( particularly in the early stage of folding ) due to short - range
contacts .
the hydrodynamic descriptions of the folding reaction have
also revealed that while the equilibrium flow field presented a collection
of local vortices with closed
streamlines , the first - passage
folding is characterized by a pronounced overall flow from the unfolded
states to the native state .
the flows through the locally stable structures
cs - or and ns - or , which are conformationally close to the native state ,
are negligible due to detailed balance established between these structures
and the native state .
although there are significant differences in
the general picture of the folding process from the equilibrium and
first - passage folding simulations , some aspects of the two are in
agreement . the rate of transitions between the clusters of characteristic
protein conformations in both cases decreases approximately exponentially
with the distance between the clusters in the hydrogen bond distance
space of collective variables , and the folding time distribution in
the first - passage segments of the equilibrium trajectory is in good
agreement with that for the first - passage folding simulations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
between august 1992 and june 2005 , 1,008 ldlts were performed and followed in our institution ; patients who died within three months of the procedure were excluded from this study . pathologic examination of extracted cirrhotic liver revealed hccs in 252 patients ( 25.0% ) . during the follow - up period after ldlt , 42 of these 252 patients ( 16.7% ) were diagnosed with recurrent hcc in the transplanted liver as well as in extrahepatic organs such as lung or bone . tace was indicated after ldlt for r - hcc with intrahepatic or extrahepatic locations with feeding arteries from the celiac trunk or right inferior phrenic artery or intercostal artery . contraindications were child - pugh class c liver profile ( n = 8) , hyperbilirubinemia > 3 ng / ml ( n = 6 ) , and complete obstruction of the main portal vein ( n = 3 ) . all 28 patients had unresectable r - hcc ( n = 26 ) or refused repeat surgery for resection of r - hcc ( n = 2 ) . there were two female patients and 26 male patients , with a mean age of 53.4 years ( range , 38 - 65 years ) . ldlt was performed in 28 patients as left lobe ( n = 6 ) , right lobe ( n = 18 ) , and dual ldlt from different donors ( n = 4 ) . radiological diagnostic imaging studies and elevation of the alpha fetoprotein ( afp ) values were used to establish the r - hcc diagnosis ; diagnostic imaging studies included ultrasound ( us ) , computed tomography ( ct ) , and angiography . ct of the chest , abdomen , and pelvis was performed in each patient before tace treatment to detect extrahepatic disease . tumors exceeded the milan criteria in the explanted liver in 153 of the 252 patients ( 60.7% ) diagnosed with hcc before ldlt and in 29 of the 42 patients ( 69.0% ) with recurrent hcc ( 12 ) . tumors in the explanted liver of 19 of the 28 study patients ( 67.9% ) also exceeded the milan criteria . the median time from liver transplantation to detection of r - hcc was 15 months ( range , 2 - 57 months ) . tace was performed within one year , between one and three years , between two and three years , or more than three years after ldlt in 16 ( 57.1% ) , seven ( 25.0% ) , four ( 14.3% ) , or one ( 3.6% ) patient , respectively . nine of 26 patients with intrahepatic recurrence had solitary nodular r - hcc ( fig . 1 ) , while the remaining 17 patients had multiple r - hcc ( fig . 2 ) . eighteen study patients ( 64.3% ) were initially diagnosed with r - hcc extrahepatic metastasis , of which lung metastasis was the most common followed by bone and peritoneal metastases ( table 2 ) . afp values were greater than 400 ng / ml in 18 of 28 patients ( 64.3% ) . the tumor size and number , the feeding arteries , and the degree of portal venous thrombosis were evaluated by celiac and superior mesenteric angiography . tace was performed after a 3 fr microcatheter ( microferret , cook inc , bloomington , in ) was advanced into the feeding artery . in the first procedure , cisplatin ( cisplan , dong - a , seosan , korea ) was infused into the hepatic artery for 15 minutes without embolic particle administration . a mixture of iodized oil ( lipiodol , laboratoire guerbet , cedex , france ) and cisplatin was then injected into the feeding arteries followed by embolization with gelatin sponge ( spongostan , pharmacia and upjohn , kalamazoo , mi ) ; the infused dose of cisplatin was 2 mg / kg of the patient 's weight . the injected dose of iodized oil depended on the tumor size , ranging from 1 to 10 ml ( mean : 4.6 ml ) , and the gelatin sponge consisted of cubes measuring 1 - 2 mm . transcatheter arterial chemoembolization was performed in a lobar artery or a segmental artery in 26 patients with intrahepatic recurrence . tace was performed in the left gastric artery and in the right inferior phrenic and right intercostal arteries in two patients with extrahepatic recurrence . one of these two patients had an extrahepatic r - hcc attached to the posterior portion of the transplanted liver that was supplied by right inferior phrenic and right intercostal arteries ( fig . 3 ) . the other patient had r - hcc in the posterior portion of the left lateral segment of the transplanted liver that was supplied by left gastric artery . the included patients underwent 1 - 5 cycles of tace ( mean , 2.5 cycles per patient ) during the follow - up period . tumor response was evaluated based on ct studies performed 1 - 3 months after tace and was classified into five grades as follows : complete response ( cr ) , total disappearance of the tumor ( figs . 1 , 3 ) ; partial response ( pr ) , reduction of 50% or more in maximum tumor size on ct images ; minimal response ( mr ) , reduction of 25 - 50% ; stable disease ( sd ) , change of < 25% in tumor size ; and progressive disease ( pd ) , increase of 25% or more in tumor size ( fig . tumor size was measured by electronic calipers as the maximum perpendicular diameters of each tumor ( a , b ) . the following formula was used to calculate the change in total tumor size : percentage change in tumor size = 100 * (a*b - a'*b')/(a*b ) where a*b represents the product of the longest perpendicular diameters of each tumor before treatment , and a'*b ' is the product of the tumor diameters after treatment . changes in afp values one month after tace were also evaluated in patients with abnormal afp values at the time of tace . between august 1992 and june 2005 , 1,008 ldlts were performed and followed in our institution ; patients who died within three months of the procedure were excluded from this study . pathologic examination of extracted cirrhotic liver revealed hccs in 252 patients ( 25.0% ) . during the follow - up period after ldlt , 42 of these 252 patients ( 16.7% ) were diagnosed with recurrent hcc in the transplanted liver as well as in extrahepatic organs such as lung or bone . tace was indicated after ldlt for r - hcc with intrahepatic or extrahepatic locations with feeding arteries from the celiac trunk or right inferior phrenic artery or intercostal artery . contraindications were child - pugh class c liver profile ( n = 8) , hyperbilirubinemia > 3 ng / ml ( n = 6 ) , and complete obstruction of the main portal vein ( n = 3 ) . all 28 patients had unresectable r - hcc ( n = 26 ) or refused repeat surgery for resection of r - hcc ( n = 2 ) . there were two female patients and 26 male patients , with a mean age of 53.4 years ( range , 38 - 65 years ) . ldlt was performed in 28 patients as left lobe ( n = 6 ) , right lobe ( n = 18 ) , and dual ldlt from different donors ( n = 4 ) . radiological diagnostic imaging studies and elevation of the alpha fetoprotein ( afp ) values were used to establish the r - hcc diagnosis ; diagnostic imaging studies included ultrasound ( us ) , computed tomography ( ct ) , and angiography . ct of the chest , abdomen , and pelvis was performed in each patient before tace treatment to detect extrahepatic disease . tumors exceeded the milan criteria in the explanted liver in 153 of the 252 patients ( 60.7% ) diagnosed with hcc before ldlt and in 29 of the 42 patients ( 69.0% ) with recurrent hcc ( 12 ) . tumors in the explanted liver of 19 of the 28 study patients ( 67.9% ) also exceeded the milan criteria . the median time from liver transplantation to detection of r - hcc was 15 months ( range , 2 - 57 months ) . tace was performed within one year , between one and three years , between two and three years , or more than three years after ldlt in 16 ( 57.1% ) , seven ( 25.0% ) , four ( 14.3% ) , or one ( 3.6% ) patient , respectively . nine of 26 patients with intrahepatic recurrence had solitary nodular r - hcc ( fig . 1 ) , while the remaining 17 patients had multiple r - hcc ( fig . 2 ) . eighteen study patients ( 64.3% ) were initially diagnosed with r - hcc extrahepatic metastasis , of which lung metastasis was the most common followed by bone and peritoneal metastases ( table 2 ) . afp values were greater than 400 ng / ml in 18 of 28 patients ( 64.3% ) . the tumor size and number , the feeding arteries , and the degree of portal venous thrombosis were evaluated by celiac and superior mesenteric angiography . tace was performed after a 3 fr microcatheter ( microferret , cook inc , bloomington , in ) was advanced into the feeding artery . in the first procedure , cisplatin ( cisplan , dong - a , seosan , korea ) was infused into the hepatic artery for 15 minutes without embolic particle administration . a mixture of iodized oil ( lipiodol , laboratoire guerbet , cedex , france ) and cisplatin was then injected into the feeding arteries followed by embolization with gelatin sponge ( spongostan , pharmacia and upjohn , kalamazoo , mi ) ; the infused dose of cisplatin was 2 mg / kg of the patient 's weight . the injected dose of iodized oil depended on the tumor size , ranging from 1 to 10 ml ( mean : 4.6 ml ) , and the gelatin sponge consisted of cubes measuring 1 - 2 mm . transcatheter arterial chemoembolization was performed in a lobar artery or a segmental artery in 26 patients with intrahepatic recurrence . tace was performed in the left gastric artery and in the right inferior phrenic and right intercostal arteries in two patients with extrahepatic recurrence . one of these two patients had an extrahepatic r - hcc attached to the posterior portion of the transplanted liver that was supplied by right inferior phrenic and right intercostal arteries ( fig . 3 ) . the other patient had r - hcc in the posterior portion of the left lateral segment of the transplanted liver that was supplied by left gastric artery . the included patients underwent 1 - 5 cycles of tace ( mean , 2.5 cycles per patient ) during the follow - up period . tumor response was evaluated based on ct studies performed 1 - 3 months after tace and was classified into five grades as follows : complete response ( cr ) , total disappearance of the tumor ( figs . 1 , 3 ) ; partial response ( pr ) , reduction of 50% or more in maximum tumor size on ct images ; minimal response ( mr ) , reduction of 25 - 50% ; stable disease ( sd ) , change of < 25% in tumor size ; and progressive disease ( pd ) , increase of 25% or more in tumor size ( fig . tumor size was measured by electronic calipers as the maximum perpendicular diameters of each tumor ( a , b ) . the following formula was used to calculate the change in total tumor size : percentage change in tumor size = 100 * (a*b - a'*b')/(a*b ) where a*b represents the product of the longest perpendicular diameters of each tumor before treatment , and a'*b ' is the product of the tumor diameters after treatment . changes in afp values one month after tace were also evaluated in patients with abnormal afp values at the time of tace . iodized oil accumulated in the main tumor in all patients , but complete response corresponding to total disappearance of the tumor was only observed in three patients on follow - up ct ( figs . 1 , 3 ) . although complete or partial response of the targeted lesions to tace was observed in 14 of 28 patients ( 50.0% ) , 21 of these 28 patients ( 75.0% ) had another r - hcc during the 3-month follow - up period , and 26 of the 28 patients ( 92.9% ) manifested another r - hcc in an intrahepatic or extrahepatic location during the 6-month follow - up period . six of 28 patients experienced progressive disease ( increased tumor size ) despite tace treatment . two of three patients still living at the time of writing have been in complete remission for 22 and eight months , respectively , since the initial tace therapy ( figs . 1 , 3 ) . the afp levels of eight of 18 patients with abnormal baseline afp levels ( > 400 ng / ml ) had decreased one month after tace . ten of the 18 patients with elevated afp levels had another intrahepatic recurrence or progressive extrahepatic recurrence . overall , the tace procedure was well tolerated by all patients , and no major complications developed during follow - up period . five patients ( 17.9% ) experienced some immediate side effects after tace , including transient nausea , vomiting , diarrhea , hypertension , tachycardia , and right upper quadrant pain , but these effects resolved within a few days of the procedure . survival was measured from the date of ldlt , r - hcc diagnosis after ldlt , or tace treatment until death or until december 2005 . at the time of this writing , the causes of deaths were pneumonia and sepsis ( n = 18 ) , hepatic failure ( n = 5 ) , and organ failure due to extensive metastasis ( n = 2 ) . the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively ( fig . the estimated median survival after ldlt in the included patients was 28 months ( 95% ci , 12.4 - 43.5 months ) . the actual 1- , 3- , and 5-year survival rates after tace for r - hcc were 47.9% , 6.0% , and 0% , respectively ( fig . iodized oil accumulated in the main tumor in all patients , but complete response corresponding to total disappearance of the tumor was only observed in three patients on follow - up ct ( figs . 1 , 3 ) . although complete or partial response of the targeted lesions to tace was observed in 14 of 28 patients ( 50.0% ) , 21 of these 28 patients ( 75.0% ) had another r - hcc during the 3-month follow - up period , and 26 of the 28 patients ( 92.9% ) manifested another r - hcc in an intrahepatic or extrahepatic location during the 6-month follow - up period . six of 28 patients experienced progressive disease ( increased tumor size ) despite tace treatment . two of three patients still living at the time of writing have been in complete remission for 22 and eight months , respectively , since the initial tace therapy ( figs . 1 , 3 ) . the afp levels of eight of 18 patients with abnormal baseline afp levels ( > 400 ng / ml ) had decreased one month after tace . ten of the 18 patients with elevated afp levels had another intrahepatic recurrence or progressive extrahepatic recurrence . overall , the tace procedure was well tolerated by all patients , and no major complications developed during follow - up period . five patients ( 17.9% ) experienced some immediate side effects after tace , including transient nausea , vomiting , diarrhea , hypertension , tachycardia , and right upper quadrant pain , but these effects resolved within a few days of the procedure . survival was measured from the date of ldlt , r - hcc diagnosis after ldlt , or tace treatment until death or until december 2005 . at the time of this writing , the causes of deaths were pneumonia and sepsis ( n = 18 ) , hepatic failure ( n = 5 ) , and organ failure due to extensive metastasis ( n = 2 ) . the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively ( fig . the estimated median survival after ldlt in the included patients was 28 months ( 95% ci , 12.4 - 43.5 months ) . the actual 1- , 3- , and 5-year survival rates after tace for r - hcc were 47.9% , 6.0% , and 0% , respectively ( fig . systemic chemotherapy , surgical resection and nonsurgical treatments , such as tace and ablation , are performed to treat r - hcc after ldlt ( 10 ) . few previous studies have evaluated the tumor responses to various treatment modalities in r - hcc after liver transplantation . in particular , to our knowledge , there were no reports regarding tace treatment of r - hcc after ldlt . however , the targeted lesion tumor response in the present study was the same or more favorable compared with other studies on hcc before transplantation . in many previous studies , tace achieved a partial response or better in 15%-55% of patients with hcc before transplantation ( 14 - 17 ) . studied 72 patients with biopsy - proven , unresectable hcc and focused on 186 individual tumor masses . the patients were classified as responders or non - responders based on ct evidence of altered tumor size and tumor necrosis . in the present study , 28 patients with r - hcc underwent tace . a favorable tumor response in the targeted lesion ( partial response or better ) was observed in 50% of patients after tace . nevertheless , favorable tumor response in the targeted lesion did not reflect favorable survival , and the survival rate in the present study was similar to other reports . recurrence of hcc after liver transplantation clearly has a major impact on outcome . the five - year survival was reported to be significantly lower for patients with recurrence ( 22% ) than for patients without recurrence ( 64% ) ( p < 0.0001 ) ( 18 ) ; the median survival was around nine months after the diagnosis of recurrence . shorter time to recurrence and the presence of bone metastases were the main factors significantly associated with poorer prognosis once recurrence manifested ( 18 ) . in another series , however , 18 of 57 patients with r - hcc underwent potentially curative treatments such as surgical resection or radiofrequency ablation . the five - year post - transplant survival among these patients was 47% ( 10 ) . this is consistent with the 57% survival at four years reported elsewhere for similar patients ( 9 ) . however , it is impossible to determine from these studies whether surgical treatment of recurrence prolongs survival or whether patients who are amenable to surgical treatment are a more favorable group . in the present study , the mean survival periods were 28 months overall and nine months after diagnosis of r - hcc . and the actual 1- , 3- , and 5-year survival rates after ldlt were 71.4% , 31.5% , and 6.0% , respectively , in this study . these mean survival values were similar to or lower than those of the studies mentioned previously . we believe that this resulted from the inclusion of patients with advanced and unresectable r - hcc at the time of r - hcc diagnosis , as mentioned above . the small benefit to survival afforded by tace , in spite of favorable tumor response to targeted r - hcc , may be caused by the aggressiveness of the tumor , which is indicated by the high rate of extrahepatic recurrence and rapid tumor recurrence in the remaining liver after initial tace treatment . early reports suggested that the course of recurrent hcc after transplant is more aggressive than that of recurrence after hepatic resection , presumably due to immune suppression ( 19 ) . nevertheless , the drugs used to prevent transplant rejection have a variety of effects that go beyond immune suppression ( 10 ) . in this study , extrahepatic metastasis were observed in 18 of 28 ( 64.3% ) included patients . in another study , 48 of 57 patients ( 84.2% ) with r - hcc after liver transplantation had extrahepatic metastases ( 18 ) . these patterns of metastases in patients with r - hcc after liver transplantation differ from those in patients with primary hcc without liver transplantation . in one study , for example 65 patients ( 13.5% ) had extrahepatic metastases among 482 patients who were diagnosed with hcc ( 14 ) . there is no standard treatment for extrahepatic metastases , and few previous reports exist regarding its treatment ( 21 ) . in the study by chung et al . , 68 hcc patients with major portal vein thrombosis ( n = 47 ) or distant metastasis ( n = 27 ) were randomly allocated to groups with or without intra - arterial cisplatin infusion . the group receiving intra - arterial cisplatin infusion had a significantly higher 1-year survival rate than the other group ( 22 ) . we also performed intra - arterial cisplatin infusion before embolization with iodized oil and gelatin sponge to treat intrahepatic r - hcc as well as extrahepatic metastasis . most of the included patients had extrahepatic recurrence as well as intrahepatic recurrence , and systemic chemotherapy was not controlled . a controlled study is needed for further evaluation of tace with regard to its effect on the survival of patients with r - hcc after ldlt . in conclusion , tace appears to produce an effective tumor response in targeted r - hcc after ldlt . however , survival of patients with r - hcc after ldlt is poor due to extrahepatic metastasis and additional intrahepatic recurrence . | objectiveto evaluate the tumor response and patient survival rate following transcatheter arterial chemoembolization ( tace ) in recurrent hepatocellular carcinoma ( r - hcc ) after living donor liver transplantation ( ldlt).materials and methodstwenty - eight patients with r - hcc underwent one or more cycles of tace after ldlt ( mean , 2.5 cycles ) .
after a mixture of iodized oil and anti - cancer drugs was injected via the arteries feeding the tumors , these vessels were embolized with a gelatin sponge .
tumor response was determined by follow - up ct imaging on all patients four weeks after each tace procedure .
patient survival was calculated using the kaplan - meier survival curve.resultsafter tace , targeted tumor reduced in size by 25% or more in 19 of the 28 study patients ( 67.9% ) . however , intrahepatic recurrence or extrahepatic metastasis occurred in 21 of the 28 patients ( 75.0% ) during the 3-month follow - up period and in 26 of the 28 patients ( 92.9% ) during the 6-month period following tace .
extrahepatic metastasis was noted in 18 of the 28 patients ( 64.3% ) .
the 1- , 3- and 5-year survival rates following tace were 47.9 , 6.0 and 0% , respectively , with a mean survival of nine months in all patients .
there were no significant complications related to tace.conclusiontace produces an effective tumor response for targeted r - hcc after ldlt .
however , the survival rate of patients with r - hcc after ldlt is poor due to extrahepatic metastasis and intrahepatic recurrence . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the term tendinopathy describes a range of clinical conditions related to tendons and surrounding structures [ 1 , 2 ] . although tendinopathies also include conditions of damage to the tendon in absence of symptoms , these pathologies often occur with pain in the injured tendon , which is accentuated or appears during palpation of the affected area or during active and passive movements involving the tendon . pain is often associated with a reduction in the strength of the muscles attached to the tendons involved in the pathological process [ 3 , 4 ] . chronic tendinopathies are a common problem for patients whose activities require repetitive movements ; for this reason , they are particularly widespread among sportsmen . these conditions can also occur after an acute injury , when the healing process of the injured tendon fails . in the past , the terms tendinitis and tendinosis were widely and indiscriminately used in place of tendinopathy , often considering this condition as an inflammatory pathology , but such definitions should be imposed only after a histological study . actually , histological samples from chronic tendinopathies have confirmed that there is no acute inflammatory condition , but rather a failure of the tendon repair associated with angiofibroblastic degeneration [ 4 , 6 , 7 ] . in fact , histologically , the findings are more typical of a failed healing response , with a haphazard proliferation of tenocytes , intracellular abnormalities in tenocytes , disruption of collagen fibers , and subsequent increase in noncollagenous matrix . however , factors that predispose to tendinopathies have not yet been clarified , although there is evidence to support a role for biomechanical factors , functional alterations , aging , and metabolic disorders [ 7 , 8 ] . particularly , obesity has recently been indicated as important but potentially modifiable risk factor in the onset and progression of some tendinopathies . in fact , in contrast to other conditions , the advantage from studying obesity lies in the possibility of preventing and treating this risk factor . obesity is already a well - known risk factor for many other diseases of the musculoskeletal system . the prevalence of obesity in industrialized countries has increased steadily in recent decades . in the united states , between 2007 and 2008 , the prevalence of obesity in adults was estimated to be 32.2% in men and 35.5% in women , reaching percentages of 72.3% in men and 64.1% in women if both obesity and overweight are considered together . in europe , the prevalence of obesity appears tripled since 1980 and each year four million people become obese [ 10 , 11 ] . the world health organization recommends a standard classification of adult overweight and obesity using the following body mass index ( bmi ) calculations : a bmi of 25.0 to 29.9 kg per m is defined as overweight ; a bmi of 30.0 kg per m or more is defined as obesity [ 10 , 11 ] . other measurements are also used to identify a pathological fat distribution , such as waist circumference ( cm ) or waist / hip ratio . the purpose of this review was to summarise the current literature reporting data on the relationship between obesity and tendons diseases to verify the hypothesis that obesity is a risk factor for the development of tendinopathy . the systematic review was performed following the prisma ( preferred reporting items for systematic reviews and meta - analyses ) statement [ 12 , 13 ] . we searched pubmed , cochrane central , and embase biomedical databases using the keywords obesity , overweight , and body mass index linked in different combinations with the terms tendinopathy , tendinitis , rotator cuff , epicondylitis , we selected articles in english , spanish , french , and italian , according to the authors ' skills . three authors ( francesco franceschi , edoardo franceschetti , and michele paciotti ) independently reviewed the text of each abstract . clinical studies investigating , as declared aim of the study , the association between obesity and one or more types of tendinopathy were selected . the definition of obesity had to be based on instrumental evaluation through body mass index ( bmi ) or waist circumference ( wc ) or waist - to - hip ratio ( whr ) . we screened the references lists of the studies found in order to find additional relevant publications . demographics data , diagnosis , design of the study , objective means of measuring the weight , and main findings concerning the statistical association between increased weight and tendinopathy were independently extracted by all the investigators . biomechanical studies , case reports , literature reviews , technical notes , and instructional courses were excluded . we also excluded articles reporting data of subjects of less than 18 years of age . to avoid bias , the literature search and cross - referencing resulted in 383 references , of which 299 were rejected due to off topic abstract and/or duplication of the results ( figure 1 ) . after reading the remaining full - text articles , another 69 articles were excluded for failing to fulfil the inclusion criteria . the remaining 15 articles , including 5 frequency - matched case - control studies [ 1418 ] , 4 cross - sectional studies [ 1922 ] , 5 retrospective case - control studies [ 2327 ] , and 1 case - series study , were included in the present study . the total number of patients in the included studies was 36,843 , of which 9,002 were the subjects affected by tendinopathy . in this study , we reviewed all the data provided by published studies that focused on analysing the association between obesity and the development of the most frequent kind of tendinopathy . rotator cuff ( rc ) tendinopathy is most frequently observed . rotator cuff disease , which includes a range of clinical and pathological characteristics , is a multifactorial condition , the origin of which is unclear , but the failed healing response typically seen in other tendinopathies is the end result . in fact , the theory , common in the past , based on the mechanical impingement of the rotator cuff has not been demonstrated and does not explain the clinical manifestations of the pathology . some studies suggested a link between shoulder disorders and metabolic factors , such as diabetes mellitus . diabetes was clearly demonstrated to be associated with rc tendinopathy , increasing incidence and affecting postinjury healing process . regarding obesity , in particular , there are very few studies in literature ; none of them is a level i study , and each study has a different design . the prognostic study performed by wendelboe et al . in 2004 , analysing 311 participants , showed that individuals with a bmi 35.0 had an increased risk to require rotator cuff repair with an odd ratio of 3.1 ( ci 1.37.6 ) for males and 3.5 ( 1.86.9 ) for females . moreover , this risk was directly correlated with the grade of obesity for both men ( p = .002 ) and women ( p < .001 ) . in 2010 , rechardt and colleagues carried out a cross - sectional study investigating the national finnish health survey . they evaluated if smoking , waist circumference , and waist - to - hip ratio were related to an increased prevalence of shoulder pain in both men and women . metabolic syndrome , type 2 diabetes mellitus , and carotid intima - media thickness were associated with shoulder pain in men , whereas high level of c - reactive protein was associated with shoulder pain in women . increased waist circumference and type 1 diabetes mellitus were associated with chronic rotator cuff tendinitis in men . a large case - control study was performed by titchener et al . using the health improvement network database to assess and to quantify the relative contributions of some constitutional and environmental risk factors for rotator cuff disease in the community . their data included 5000 patients with rotator cuff disease who were individually matched with a single control by age , sex , and general practice ( primary care practice ) . overweight body mass index of 25.1 to 30 ( or = 1.15 ) was significantly associated with rotator cuff disease , and , contrarily , mass index greater than 30 was not found to be associated with rotator cuff disease . however , the authors declared the impossibility to differentiate comorbid factors such as diabetes mellitus , atherosclerosis , and hyperlipidemia . lateral and medial epicondylitis , also known as tennis elbow and golf elbow , respectively , are the most common tendinopathies of the elbow . they are pathological conditions of the proximal insertion of the forearm muscles at the humeral epicondyles , which mostly involve the common wrist extensor muscle ( lateral epicondylitis ) and the common wrist flexor muscle ( medial epicondylitis ) . the cause of epicondylitis is unknown ; it is hypothesized that the lesions occur because of a combination of mechanical overloading and abnormal microvascular responses . consequently , also the risk factors for this pathology are not well identified . in 2013 , titchener and coworkers matched 4998 participants with controls to evaluate different environmental and constitutional risk factors for epicondylitis . their results showed that patients with a bmi over 40 were at higher risk of being affected by lateral epicondylitis than those with normal bmi [ or 1.41 ( 1.011.97 ) ] . however , this association disappeared when bmi was adjusted for consultation rate using multivariate conditional logistic regression [ or 0.94 ( 0.661.34 ) ] . in the level iv study performed by descatha and colleagues , designed to assess the incidence of epicondylitis in workers exposed physically , the stratification of the risk factors , made by univariate analysis , showed how subjects with bmi > 30 kg / m had higher incidence rates for the disease ( or : 2.4 , ci : 1.24.8 ) . conversely , the cross - sectional study by shiri et al . , developed to primarily investigate the prevalence and the risk factors associated with lateral and medial epicondylitis , assessed a causal relationship only between medial epicondylitis in women and both waist circumference > 100 cm ( or : 2.7 ci : 1.26.0 ) and bmi > 30 kg / m ( or : 1.9 ci : 1.02.7 ) , with no increased risk as regards lateral epicondylitis . knee pathologies such as arthritis are known to be particularly common among obese patients [ 31 , 32 ] . regarding knee tendinopathies , a nosological distinction should be made between extensor apparatus tendinopathies and pes anserinus tendinopathies . diseases of the extensor apparatus , commonly observed among sportsmen , affect quadriceps tendon and patellar tendon at their bony attachments . pes anserinus tendinopathies are characterized by the presence of pain under load , standing , walking , or taking the stairs , at the insertion of muscles semimembranosus , semitendinosus , gracilis , and sartorius in the superomedial surface of the tibia . it is very frequent in obese women with valgus knee because the hamstring tendons rub against the medial condyle of the knee during every movement . the anserine bursa , which lies between the tendons footprint and the posterior surface of the tibia , may be involved in the inflammatory process and leads to the so - called anserine bursitis which is part of the tendinopathy . a case - control study by alvarez - nemegyei , performed in 2007 and involving 22 cases and 38 controls , failed to find a relationship between pes anserinus tendinitis / bursitis and diabetes or obesity . likewise , taunton et al . , retrospectively analysing 96 cases of patellar tendinopathy among a total of 2002 running related injuries , found neither an increased weight nor an increased bmi in those kinds of patients . panasiuk and groblewski presented a case report on a patient with bmi = 41 , without other comorbidities , who atraumatically injured his patellar tendon . according to the authors , the increased load played a crucial role as cofactor in the mechanism of this spontaneous tendon rupture . they underlined the dangerousness of such a high load and how individuals with important obesity have a potential risk of acute tendon injuries due to the increased weight and mass . in literature , there are other case reports [ 35 , 36 ] dealing with the spontaneous ruptures of patellar tendon or quadriceps tendon , and an increased weight of the patient is often reported among the risk factors . however , given the rarity of these conditions , no sufficient clinical studies of high level of evidence have been made on this topic ; therefore , there are no statistically valid information on the possible association between obesity and quadriceps tendon rupture . micro - traumatic tendinopathies of the achilles tendon are functional overload pathologies that can lead to rupture of the tendon , the ultimate result of a long standing process of failed healing response . in achilles tendon rupture patients , this failed healing response process is most often entirely asymptomatic , and , involving the tendon in variable extension , determines a decrease in mechanical strength of the tendon , which can be overcome by a sudden strain , and result in a tear . holmes and lin in 2006 studied some metabolic risk factors ( obesity , diabetes , hypertension , use of oestrogen , and exposure to steroids ) to define and quantify their possible etiological role in achilles tendinopathy . using chi - square analysis to compare observed and expected prevalence in a group of 82 participants versus published national data , they found a statistically significant association for all these conditions and achilles tendinopathy . in particular , as regards obesity , it was associated with achilles tendinopathy for both men and women subjects ( p = .001 and .0025 ) . since the microcirculation is the common denominator between all of these metabolic diseases , alterations of blood flow were suspected to underlie the onset of achilles tendinopathy . a 2007 cross - sectional study by frey and zamora showed a high bmi ( both in overweight and in obese range ) significantly increased the chances of achilles , posterior tibial , and peroneal tendinitis . in particular , 123 ( 65.4% ) of the overweight / obese subjects had a diagnosis of tendinitis compared to 65 ( 34.6% ) normal subjects , and having a bmi > 25 increases the risk of being affected by tendinitis [ or : 1.923 ( 1.392.66 ) p < .0001 ] . also , gaida and coworkers in 2010 investigated the relationship between adiposity and asymptomatic achilles tendinopathy through a cross - sectional study . examining 298 individuals , they found that men with achilles tendon pathology had a central fat distribution , while women with tendon pathology had a peripheral fat distribution . these opposite findings , seemingly paradoxical , according to the authors depend on the effect that oestrogens have on the deposition of fat in women . they concluded that the asymptomatic condition of the participants is a clear and important proof that differences in adipose tissue distribution precede tendon pain . in 2013 , scott and colleagues compared 197 patients affected by achilles tendinopathy versus 100 controls to investigate the relationship between achilles tendinopathy and body mass index . they found a statistically significant difference in terms of bmi ( 34.69 7.54 ( 17.975.9 ) versus 30.56 7.55 ( 19.761.5 ) , p < .001 ) and mean age between the two groups . similarly , in the 10-year retrospective analysis performed by klein et al . on 944 subjects , mean bmi was significantly higher in the group of patients with achilles tendonitis compared to the control group ( 30.2 6.5 versus 25.9 5.3 , p < .001 ) . overweight and obese patients were 2.6 to 6.6 times more likely than patients with normal bmi to be affected by achilles tendonitis ( p < .001 ) . carried out a retrospective case - control analysis of 2002 running related injuries . comparing the 96 cases of achilles tendinopathy they recorded , with the other 1906 patients , they found no statistically significant association between obesity and this tendinopathy . it is intuitive to speculate that an excess of body weight may be a determinant factor in the common feet pain . in obese subjects , the baropodometric examination reveals very often the loss of the transverse foot arch , resulting in discharging the body weight on the central metatarsal heads with pain on walking . riddle and colleagues , in their level ii prognostic study , matched 50 patients affected by plantar fasciitis with 100 controls . they obtained that participants with a bmi > 30 kg / m are 5.6 times ( ci : 1.916.6 ) more likely to be affected when compared with subjects with bmi 25 kg / m . . carried out a retrospective case - control analysis of 2002 running related injuries and reported that a high body weight in women ( > 60 kg ) was associated with plantar fasciitis ( or : 0.378 , ci : 0.2030.706 ) . the australian group of frey and zamora , in 2007 , identified obesity ( along with the pronated foot ) as independent and modifiable risk factor for chronic plantar heel pain , through a univariate analysis performed on 80 patients and 80 controls . considering that this study can not establish causality , it is unclear whether increased bmi existed in the case group participants prior to the development of cphp or whether the pain associated with the condition caused participants to reduce their physical activity , thereby leading to an increase in bmi . however , it is plausible that increased bmi may be a risk factor for cphp as individuals with increased bmi experience higher vertical forces under the heel during gait , leading to higher internal stresses within the heel , which may lead to damage of soft tissue structures and the development of symptoms . an increased incidence of chronic plantar heel pain in individuals with a bmi > 25 kg / m was also demonstrated by a study by irving et al . . they also found an increased chance , although not significant , to be affected by plantar fasciitis if overweight or obese . the authors proposed to relate these data to the effect of an increased weight on musculoskeletal disorders of the lower district ( feet and ankles ) , which are known to be caused by overuse and stress , which are factors made worse by weight . a recent review established that adult obese individuals are three times more affected by chronic plantar heel pain and foot pain compared to normal weight subjects . however , the authors did not exclude the existence of a reverse causality , whereby the presence of plantar pain intervenes by limiting the mobility , thus favouring being overweight . in fact , the studies reviewed did not provide evidence of a recovery from the distressing symptoms following bariatric surgery or other weight - loss strategies . all the 5 frequency - matched case - control studies ( level ii ) , 1418 published on this matter , agree to report the association between obesity measured in terms of bmi ( bmi 30 kg / m ) and tendon diseases , with odds ratios ranging from 1.9 ( 95% ci : 1.12.2 ) to 5.6 ( 1.916.6 ) . all the 4 cross - sectional studies , included in this review , also indicate an association between these two conditions , with the exception of the part of the study by frey and zamora concerning plantar fasciitis , which however finds a correlation , although not significant . nevertheless , such study designs do not allow a precise identification of a cause - effect relationship between pathological body mass index and each type of tendinopathy . at present , in fact , not enough works focused on the mechanism through which excess weight may be responsible for tendinopathies . the largest amount of studies investigating pathophysiological mechanisms focused on achilles tendinopathy . a 2013 murine study by boivin et al . examined both the potential negative effect of obesity on achilles tendon and quadriceps muscle and the potential mitigating effect of exercise and branched - chain amino acid ( bcaa ) on the same structures . after subjecting the mice to a high fat diet ( and its resulting obesity ) , they found significant alterations in the structure of the achilles tendon removed from the mouse , with increased tendon cross - sectional area and decreased modulus . exercises and bcaa integration improved only partially the outcomes , decreasing the stiffness of the achilles tendon . the authors speculated that the exceeding fat intake , causing the enlargement of the diameter of the fibers and the shortening of the modulus of the tendon , actually leads to a stiffer tendon , less able to withstand the loads . in 2012 , another study focused attention on the achilles tendon , using 20 healthy adult males divided into low normal weight and overweight based on bmi . the authors measured , by ultrasound , the thickness of the achilles tendon before and after a session of calf training with ankle weights on . their aim was to assess the cumulative transverse tendon strain defined as the natural log of the ratio of post- to preexercise tendon thickness . while the thickness , in absolute terms , was greater , both before and after training , for the group classified as overweight , in fact , the acute transverse strain response was significantly higher in the group of healthy subjects ( 11% versus 20% , p = .0004 ) . their pathophysiological explanation of the obtained findings is based on the harmful effect that the tensile load exerts on cell matrix and particularly on morphology and disposition of collagen fibers ; this would alter the physiological movement of interstitial fluids , not allowing a proper and normal response to exercise . a similar study was carried out by abate et al . in 2012 recruiting a sample of athletes ( runners ) and a control sample of nonrunning subjects and dividing both groups further into two groups : normal weight and overweight . the results obtained by us ( ultrasound ) showed a statistically significant difference in terms of the thickness of the achilles tendon only between runners and nonrunners among normal weight subjects ( p = .002 ) , indicating that the physiological hypertrophy of the tendon occurs only in normal subjects . conversely , both us abnormalities and intratendinous microvessels were observed more frequently in overweight participants tendons ( p = .0007 and p = .0003 ) and , within this group , were significantly prevalent in runners ( p = .001 and p = .004 ) . the authors attribute these findings to the significantly lower ability of the tendon of an obese subject to resist the stress ( such as running ) and to repair the damage caused by the stress . according to some other hypothesis , a prolonged state of systemic , low - grade inflammation , such as in obesity and states of impaired insulin sensitivity , may act as a risk factor for a failed healing response after an acute tendon insult , thus predisposing affected individuals to development of chronic overuse tendinopathies [ 1 , 6 ] . however , it should be necessary to distinguish what could be the real burden of obesity in the pathophysiological process that leads to tendinopathy . obesity is present in a number of metabolic diseases such as diabetes which have been associated with tendinopathy on cardiovascular grounds , not the obesity per se . it is known that obesity is associated with alterations in glucose metabolism and conditions as dyslipidemia , hypertension , glucose intolerance , and insulin resistance . future studies should carry out clinical observations on obese patients affected by tendinopathy , distinguishing when obesity is associated with other metabolic diseases and when it is not . in addition to metabolic pathophysiological mechanisms , mechanical factors are supposed to play a role in the onset of tendinopathy . in particular , among the studies evaluated in this review , there is a stronger association between lower limb tendinopathies and obesity , compared to upper limbs , which seems to prove the hypothesis that higher loading force can be an important risk factor . our results are consistent with those obtained from the systematic review performed by gaida et al . in 2009 , which analysed studies published until march 2007 . by means of the sensitive analysis , they found 81% of positive association between increased adiposity and tendinopathies considering trials including clinical patients and 77% considering case - control studies . they also reported poorer outcomes among obese individuals after the treatment of a tendon injury . analysing the long - term results and effects of a pathological bmi on the tendinopathy healing process and on the surgical outcomes is certainly an area of research that can provide useful findings , especially if further research will be particularly focused on the differences in results between subjects with obesity compared to those affected by multiple metabolic diseases . obesity is widespread and , therefore , it is very easy to run into patients with tendinous pathologies who are also overweight . in particular , this association seems strong for achilles tendinopathy and for plantar fasciopathy , in which the increased weight creates an increased load for the tendons , stressing these structures . nevertheless , given the low number of high - level studies on the subject , the relationship between obesity and tendinopathies is still enigmatic . much remains to be studied on this matter and further studies should be performed to establish the real strength of the association between each type of tendinopathy and the obesity per se , isolated from all other metabolic diseases . future research will have to go in two directions : clinically , analysing clinical data to confirm and quantify the correlation of obesity with tendinopathies , and experimentally , examining the possible pathophysiological mechanisms underlying this causal relationship . | purpose . in the last few years
, evidence has emerged to support the possible association between increased bmi and susceptibility to some musculoskeletal diseases .
we systematically review the literature to clarify whether obesity is a risk factor for the onset of tendinopathy .
methods .
we searched pubmed , cochrane central , and embase biomedical databases using the keywords obesity , overweight , and body mass index linked in different combinations with the terms tendinopathy , tendinitis , tendinosis , rotator cuff , epicondylitis , wrist , patellar , quadriceps ,
achilles ,
plantar fascia , and tendon .
results .
fifteen studies were included .
no level i study on this subject was available , and the results provided are ambiguous
. however , all the 5 level ii studies report the association between obesity measured in terms of bmi and tendon conditions , with or ranging between 1.9 ( 95% ci : 1.12.2 ) and 5.6 ( 1.916.6 ) . conclusions .
the best evidence available to date indicates that obesity is a risk factor for tendinopathy .
nevertheless , further studies should be performed to establish the real strength of the association for each type of tendinopathy , especially because the design of the published studies does not allow identifying a precise cause - effect relationship and the specific role of obesity independently of other metabolic conditions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the cancer research field , vitamin d has emerged as the most prolific topic in the last decade with work connecting it with risk reduction in various epithelial cancers . aside from calcium homeostasis , vitamin d exerts a wide range of immunogenic and antiproliferative activities in the body . of particular interest to the oncologists is the reduced incidence of breast , colon , and prostate cancers with higher sun exposure , higher intake , or higher serum levels of vitamin d. vitamin d exerts its antiproliferative effect by binding to vitamin d receptor ( vdr ) found in various tissues and cells of the body . several human genes contain vitamin d response elements ( specific dna sequences ) that encode for proteins important in regulation of cell proliferation , differentiation , apoptosis , and angiogenesis . when the serum vitamin d levels are suboptimal these activities are impaired and as a result enhanced cellular growth , neoangiogensis , and cancer development takes place . the breast cells have vdrs in their nuclei and it is postulated that polymorphism of genes for these vdrs results in increased risk for breast cancer . vitamin d from both diet and sun exposure is metabolized in the liver to 25-hydroxy vitamin d ( 25(oh)2d ) and then further hydroxylated by 1 alpha hydroxylase enzyme in kidneys and other tissues like breast cells to 1,25- dihydroxy vitamin d ( 1,25 ( oh)2d ) , the most biologically active form and the natural ligand for vdr . serum concentration of 25(oh)2d are more sensitive to exogenous sources ( dietary and supplemental intake ) and endogenous production ( through synthesis in the skin ) of vitamin d and have a long half - life of 3 weeks and is the predominant form of vitamin d in plasma and the major storage form ; hence the circulating 25(oh)2d is the best indicator of vitamin d status of the body . serum 25(oh)2d concentrations as well as treatment with vitamin d supplementation are significant independent predictors of breast cancer risk . women with serum levels of 25(oh)2d more than 50 ng / ml had a 50% lower risk of breast cancer compared to those with serum values less than 30 ng / ml in various studies from the developing world . it has been documented that consumption of oral calcium and serum levels of vitamin d are associated with reduced risk of breast cancer in premenopausal women but the results were not statistically significantly in postmenopausal women . there are data showing that locally advanced breast cancer patients have more severe vitamin d deficiency than those with early stage disease . low serum levels of vitamin d are common at breast cancer diagnosis and are associated with a poorer prognosis in terms of overall survival and distant disease free survival particularly in postmenopausal females . in another group of breast cancer patients it was found that 94% women with serum levels of vitamin d less than 20 ng / ml were likely to develop metastases and 73% were likely to die of advance disease . vitamin d deficiency is associated with secondary hyperparathyroidism which results in increased bone resorption , release of calcium from bones , and may precipitate or exacerbate osteoprosis with consequent ill effects on bone mineral density ( bmd ) . there has been significant documentation of osteopenia and osteoprosis in breast cancer patients primarily due to early menopause and vitamin d deficiency and later amplified by chemotherapy and endocrine therapy particularly the aromatase inhibitors . thus breast cancer patients must undergo a baseline metabolic bone evaluation with serum vitamin d levels and bone mineral densitometry . the aim of the study was to determine serum levels of 25-(oh)2d in pakistani breast cancer patients at the time of presentation , to assess its risk association with grade and stage of the tumor and to evaluate the bone density in breast cancer patients . the study was approved by the scientific research committee and institutional review board at shaukat khanum memorial cancer hospital and research centre , lahore . all newly diagnosed breast cancer patients who presented to the medical oncology department were recruited into the study as cases after informed consent over a period of 6 months from november 2010 till may 2011 . age - matched healthy females who accompanied the nonbreast cancer patients to hospital were recruited as the control group . the socio - demographics were documented by direct questioning on to the proforma for the whole study population . postmenopausal status of females was defined as last menstrual bleeding at least 12 months before the date of interview or a history of bilateral oophorectomy . the histopathological diagnosis of breast cancer , grade , stage of the tumor , and hormone receptor status ( estrogen receptor - er , progesterone receptor pr , and her2neu ) was recorded from the pathology reports of breast cancer patients . serum 25-(oh)2d levels were studied by the elisa technique on the blood samples drawn of the study population at their initial presentation and the values were documented in ng / ml . vitamin d deficiency was considered at serum level less than 20 ng / ml , suboptimal vitamin d levels were considered between 20 and 39 ng / ml and optimal levels were more than 40 ng / ml . bone mineral density was calculated according to the who criteria from ct bone density scan of the breast cancer patients . the demographic variables and the descriptive measures in cases and controls were presented in frequency and percentages . relation of vitamin d deficiency with grades , stages , histology , and receptor status of tumor was determined by using the chi - square test . comparison of vitamin d levels among various histopathological parameters of tumor was done by using one - way anova . comparison of vitamin d levels between pre- and postmenopausal status was done by using a t - test . the association of vitamin d status with bmd in cases and the serum vitamin d levels among the cases and controls was calculated by using the chi - square . the demographic variables and the descriptive measures in cases and controls were presented in frequency and percentages . relation of vitamin d deficiency with grades , stages , histology , and receptor status of tumor was determined by using the chi - square test . comparison of vitamin d levels among various histopathological parameters of tumor was done by using one - way anova . comparison of vitamin d levels between pre- and postmenopausal status was done by using a t - test . the association of vitamin d status with bmd in cases and the serum vitamin d levels among the cases and controls was calculated by using the chi - square . the mean age of cases was 47.5th 9.8 years and for the control group was 46.2th + 2.6 years . there were 46.7% premenopausal females and 53.3 % postmenopausal females among the breast cancer population . age , marital status , menopausal , residential area , and parda observing status had almost similar distribution among cases and controls . a total of 70% of the cases were multiparous and the 50% of the healthy controls had more than three children . regarding the occupational history , 92% of the cases were house wives while 33% of the controls were office workers . the mean serum vitamin d level in the breast cancer patient was 9.3 ng / ml and in the control group was 14.9 ng / ml and the p value calculated was < 0.001 . vitamin d deficiency was seen in 95.6% ( 86 ) breast cancer patients while 77% ( 69 ) of the control group were deficient , the p value was < 0.001 . suboptimal levels of vitamin d were seen in 4.4% ( 4 ) of the cases and 18.9% ( 17 ) control group , p value < 0.001 . none of the breast cancer patients had an optimal vitamin d level , while four patients in the control group had normal serum levels [ table 1 ] . serum vitamin d level in cases and controls among the breast cancer patients the tumor characteristics ( histology , grade , stage , and receptor status ) did not show any significant associations with serum levels of vitamin d. on analysis of the individual grade of breast cancer with serum vitamin d levels , it was seen that grade iii tumors had a mean vitamin d level of 8.6 ng / ml + sd 3.44 , while similar low levels ( mean 8.5 ng / ml + sd 3.54 ) were also seen in grade i tumors . grade ii breast cancer patients had a mean serum vitamin d level of 10.28 + sd 6.23 . serum vitamin d levels were found to be lower ( mean 8.49 ng / ml and 9.86 ng / ml ) in stage iii and iv breast cancer respectively and 12.75 ng / ml in stage i disease but the p value was 0.247 [ table 2 ] . association of serum vitamin d level with stage of breast cancer on comparing serum vitamin d levels with receptor status , patients with her2neu over expression had a mean vitamin d level of 8.28 ng / ml + sd 2.3 , patients with triple negative tumors had mean serum vitamin d levels 10.3 ng / ml + sd 4.65 , triple positive and er positive / her2 negative had 9.04 ng / ml + sd 3.97 and 9.06 ng / ml + sd 5.5 respectively . the calculated p value was 0.681 . according to the menopausal state of breast cancer patients , premenopausal females had a mean serum vitamin d level of 10.5 ng / ml and postmenopausal females had a mean value of 13.5 ng / ml . the p value by t - test was 0.015 [ table 3 ] . distribution of serum vitamin d level according to menopausal status of breast cancer patients on estimation of bone mineral density ( bmd ) in vitamin d deficient breast cancer patients , 36 patients had normal bone density , 34 patients had osteopenia , and 16 patients had osteoporosis . four patients had suboptimal vitamin d levels , out of which 2 had osteopenia and 1 had normal bone density and osteoporosis each . low bmd ( osteopenia and osteoprosis ) among the postmenopausal breast cancer patients was found in 35/45 ( 73% ) females while only 18/42 ( 43% ) premenopausal females had low bmd ( osteopenia only ) with a p value of < 0.001 [ table 4 ] . low levels of vitamin d are the norm rather than an exception in south east asia . the prevalence of vitamin d deficiency in healthy asymptomatic people is reported in the range of 70 - 97% in pakistan and this is more common in the urban population . studies from united states report 50 - 74% vitamin d deficiency in newly diagnosed premenopausal breast cancer patients . in our study we found that 95.6% breast cancer females and 77% healthy females were vitamin d deficient . our results for the healthy control group lie within the range reported in the pakistani literature . serum levels of vitamin d in breast cancer patients were significantly lower than in non breast cancer pakistani women . hence , the association between breast cancer risk and serum levels of vitamin d parallels other studies from the developed world . our two groups of population were comparable in age , menopausal state , residential area ( rural vs. urban ) and parda observation characteristics . the study consisted of middle - aged females with equal distribution of pre- and postmenopausal females . multiparty was high in the breast cancer women and we expect that the deficiency of vitamin d was compounded by the suboptimal nutrition in this group . ninety - two percent of the breast cancer females were housewives looking after their children and homes and expected to have minimal sun exposure . in the control group 66% females were housewives while 34% were office going ; thus assuming that the healthy subjects did get some solar exposure as they went out of the house , in this study we did not categorically ask about the direct amount of sun exposure . none of the females we interviewed was a field worker , expected to have maximum sun exposure . more than half of the study population in both groups was above the expected normal bmi . twenty - eight ( 31% ) females in the breast cancer group versus eighteen ( 20% ) females in the healthy group were obese ( bmi > 30 ) , revealing a small but sinister causal link of low vitamin d levels with high bmi in breast cancer patients . lower serum levels of vitamin d have been associated with obesity and lower physical activity in various epidemiological studies . serum levels of vitamin d did not correlate inversely with the advance stage and grade of breast cancer in our study . regarding the receptor types of breast cancer ( luminal types a and b , triple negative or her2 neu over - expressed ) all had similar deficient vitamin d levels and there was no difference of statistical importance . recently kim et al . , from korea reported poorer outcomes of vitamin d deficient patients with luminal type breast cancer . also there are data suggesting that triple negative breast cancer patients have the highest percentage of vitamin d deficiency . studies with both pre- and postmenopausal female populations have shown high prevalence of vitamin d deficiency despite supplementation . premenopausal females had slightly more low mean serum levels of vitamin d compared to the postmenopausal females and the results yielded minimum significance . recruited 1295 postmenopausal females and showed that low levels of vitamin d correlated with increased risk of distant recurrence and poor overall survival . examination of bone mineral density in breast cancer patients revealed that osteopenia and osteoporosis was common in postmenopausal female , as expected . more than half of vitamin d deficient breast cancer females had low bmd ( osteopenia or osteoporosis ) but the data did not show statistical significance and hence bmd can not be considered as an indirect marker for evidence of vitamin d status for an individual . vitamin d concentration may be a risk and/or a valuable prognostic factor in breast cancer patients on the basis of various studies but data from large randomized trials are still sparse . the optimal circulating level of 25(oh)2d for reducing breast cancer risk or reducing the risk of recurrence of breast cancer has yet to be defined . it is also known that there are ethnic and racial variations in serum vitamin d levels . asians have low exposure to sunlight , there is high prevalence of various malabsorption syndromes , and use of vitamin d supplementation is rare . few epidemiological efforts have investigated the association between vitamin d concentration and breast cancer risk in asian women . to our knowledge ours is the first study from pakistan to assess the association between breast cancer and serum vitamin d levels . the relatively small size of the study population limited our ability to detect statistically significant trends of vitamin d deficiency with respect to histopathological characteristics of the breast cancer . vitamin d deficiency is rampant in pakistan and also serum 25(oh)2d levels are reflective of a recent and not life time vitamin d intake ; hence one single measurement of vitamin d levels in our study may not be reflective of long term exposure . the relevant time period during which 25(oh)2d levels may affect breast cancer occurrence or survival is currently unknown . regardless of whether vitamin d helps prevent cancer development or its recurrence , the high frequency of vitamin d deficiency in the pakistani population with its adverse impact on bone health and further intolerance to various systemic cancer treatments makes it important for the oncologists to recognize , treat , and prevent vitamin d deficiency . as more studies confirm similar results , dietary vitamin d and casual sunlight exposure will be among the modifiable risk factors for breast cancer . | aim : the aim was to determine serum vitamin d levels in breast cancer patients and to assess its risk association with grade and stage of the tumor.materials and methods : ninety breast cancer patients and equal number of age - matched healthy females were recruited into the study by consecutive sampling over a period of 6 months for this case control study .
serum 25(oh)2d levels and ct bone mineral density was done.results:the mean age was 461.5 years .
age , marital status , menopausal , residential area , parda observing status , and body mass index were similar in distribution among cases and controls .
the mean serum vitamin d level in the breast cancer patients was 9.3 ng / ml and in the control group was 14.9 ng / ml ( p value < 0.001 ) .
vitamin d deficiency was seen in 95.6% ( 86 ) breast cancer patients and in 77% ( 69 ) of the control group ( p value < 0.001 ) . among the breast cancer patients the tumor characteristics ( histology , grade , stage , and receptor status ) did not show any significant associations with serum levels of vitamin d. premenopausal breast cancer females had a mean serum vitamin d level of 10.5 ng / ml and postmenopausal females had a mean value of 13.5 ng / ml ( p value 0.015 ) .
low bmd did not correlate significantly with vitamin d deficiency ( p value 0.787).conclusion : invariably almost all patients with breast cancer were vitamin d deficient .
tumor characteristics did not show any significant associations with serum levels of vitamin d. bone mineral density did not correlate significantly with vitamin d deficiency . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we report on an 8 year old boy with primary cardiac anaplastic large cell lymphoma ( alcl ) , in whom the diagnosis was challenging and who was treated with modified chemotherapy without radiation therapy according to the alcl 99 study protocol . two years and 5 months after completion of therapy the boy is in complete remission with normal cardiac function . the boy was admitted with history of recurrent colds , weight loss , joint pain and fever up to 40 c . laboratory tests showed normal complete blood count and differentiation , normal electrolytes and renal function tests . alat ( 199 u / l ) , asat ( 152 u / l ) , ldh ( 528 u / l ) , nt - probnp ( 735 ng / l ) and troponine - t ( 5.35 ecg showed negative t - waves in v1-v6 and echocardiography ( m - mode ) revealed normal right and left ventricular function , mild pericardial effusion and prominent masses in the left ventricular apex ( largest : 1.3 cm ) . clinically , the boy felt weak , he had palpable precordial heaving , peripheral oedema and hepatosplenomegaly were not noticed . tissue doppler echocardiography measuring myocardial velocity confirmed reduced left ventricular function . due to positive mycoplasma serum - igg and -igm antibodies antibiotic therapy was initiated . it confirmed a tumour in the apex of the left ventricle and showed infiltration of the interventricular septum and the right ventricle . on both sides 1a ) . left heart catheter showed good left ventricular ejection fraction ( ef , 56% ) with muscular thickening and irregular contrast enhancement of soft tissue within the left cavity . , moderate leucopenia ( minimum 2.9/nl , neutrophils 39% , lymphocytes 49% ) prompted bone marrow aspiration , which did not reveal a haematologic malignancy . serologic tests for echo- , coxsackie- , polio- and cytomegaly - virus and hiv remained negative . mri of the abdomen and cns as well as skeletal scintigraphy showed no abnormalities apart from moderate hepatosplenomegaly . since the patients clinical status deteriorated within another 2 weeks , pericardial puncture and second bone marrow aspiration were performed with no pathologic findings . ultimately , open heart biopsy led to the diagnosis of an anaplastic lymphoma kinase-1 ( alk-1 ) positive alcl of lymphohistiocytic subtype ( positivity for cd30 , cd2 , cd3 , granzyme - b , perforin , ema and alk1 ) with monoclonal t - cell receptor rearrangement . however , tumour size did not decrease within the prolonged prephase of 11 days ( fig . despite additional cyclophosphamide ( 2200 mg / m ) , the patient showed deteriorating clinical condition and fever reappeared 1 week later . consequently , the first am block according to alcl99 was started ( no methotrexate due to pericardial effusion ) . during am block , cardiac arrhythmia appeared and on day 6 , ventricular tachycardia with hemodynamic instability resistant to chemical cardioversion occurred . after 6 am / bm blocks , 2-deoxy-2-(f)fluoro - d - glucose positron emission tomography / computed tomography ( fdg - pet / ct ) suggested residual active tumour in the apex of the heart . additionally , cardiac mri revealed a large thrombus within a hypokinetic area in the apex of the left ventricle mandating warfarin therapy . nevertheless , we decided to add 2 am / bm blocks since our patient had tolerated therapy well and cumulative doses of chemotherapeutics with potential late effects ( etoposide , anthracyclines ) permitted intensification . chemotherapy was completed 6 months after initiation of treatment ( cumulative doses : prednisone 1000 mg / m , dexamethasone 400 mg / m , ifosfamide 3200 mg / m , cytosine arabinoside 2400 mg / m , etoposide 800 mg / m , cyclophosphamide 4400 mg / m , doxorubicin 200 mg / m , methotrexate 21 g / m ) . since end of treatment no tumour growth has been seen in cardiac mri ( fig . 1d ) , fdg - pet / ct or echocardiography and the patient is back to his former active life . the only evident sequela two years after completion of therapy is a left ventricular scar , which does not influence myocardial function . non - hodgkin - lymphomas ( nhl ) account for < 10% of malignant tumours in childhood and 1015% of childhood nhl are alk - positive alcl . more than 90% of childhood alk - positive alcl are characterised by npm - alk - fusion proteins from a reciprocal translocation t(2;5 ) . in childhood alcl , different chemotherapy protocols reach an efs of 6575% , the 5 year overall survival is > 90% . relapse later than 3 years after initiation of therapy or 2 years after completion of chemotherapy is rare . primary cardiac tumours are most often observed in adulthood . within the group of cardiac tumours , lymphomas represent < 2% and childhood cardiac lymphomas have only been reported in case reports [ 79 ] . however , primary cardiac childhood alcl has not been described before and in the german paediatric nhl - bfm and the european alcl99 studies , in which nearly 100% of all children with this disease are registered , no patient with cardiac alcl was registered within the last 3 decades . clinically , cardiac tumours are responsible for a variety of symptoms , depending on the cardiac site of involvement . commonly seen are chest pain , pericardial effusion , arrhythmias , coronary sinus obstruction and congestive heart failure . in our patient recurrent colds , weight loss , joint pains and fever prompted the diagnostic work - up . remarkably , even though diagnostic work - up had shown a fdg - pet / ct positive cardiac mass , neither pericardial effusion cytology nor myocardial biopsies via cardiac catheterisation could confirm the diagnosis . our clinical concern was whether myocardial function would be retained after treatment of myocardial lymphoma . since the myocardium showed pathological contrast enhancement throughout the ventricular wall , ventricular rupture would have been the worst complication . treatment was monitored on the paediatric cardiology intensive care unit with standby cardiac surgery and extracorporeal membrane oxygenation facility . however , other than severe cardiac arrhythmias including one episode of ventricular tachycardia , therapy was well tolerated . from the second block ( bm ) to our best knowledge , this is the first report on a child with primary cardiac alcl surviving after chemotherapy without additional treatment . | we report on an 8 year old boy with primary cardiac anaplastic large cell lymphoma ( alcl ) , in whom the diagnosis was challenging and who was treated with modified chemotherapy without radiation therapy according to the alcl 99 study protocol [ 1 ] .
two years and 4 months after completion of therapy the boy is in complete remission with normal cardiac function . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
long - distance transmission of data recorded by implanted electrical devices is fast becoming a technological reality . after initially being adopted for efficient remote follow - up of implanted devices and patient device interactions , use of this technology could be extended to monitor patients hemodynamic conditions . such a shift would enable remote monitoring ( telemonitoring ) of the clinical condition of heart failure ( hf ) patients and pave the way to a broad , multidisciplinary approach to disease management offering potential advantages both in terms of clinical outcome and economic savings . in this article , we will first consider the potential of telemonitoring for follow - up of patients carrying implantable devices in the context of increased usage and widening indications . we will then look at experiences regarding the use of external stand - alone devices to monitor hf patients . this will lead us to consider possible additional benefits of telemonitoring in hf patients who have indications for an implantable cardioverter - defibrillator ( icd ) or pacemaker . the use of implantable electrical devices entails periodic device follow - up to check if the pacemaker system ( device / leads ) is working properly , and to allow detection of lead failure or pulse generator exhaustion / malfunction . proposals to develop transtelephonic monitoring systems as a way of reducing cardiac pacemaker follow - up visits were first made in the 1970s.1 the question of how best to manage the follow - up of patients implanted with a device has become increasingly topical in recent decades , which have also seen vast changes in cardiac device therapy , leading to a greatly expanded population of implanted patients and new technical follow - up requirements.24 along with new pacing functions , novel types of devices ( not primarily intended for treatment of bradycardia ) have been introduced for the treatment of hf and prevention of sudden death.5,6 these developments , combined with the increased life expectancy of patients carrying pacemakers to treat bradycardia,7 have enlarged and diversified the population of device recipients . a key factor in the growing device follow - up burden has been the shift in indications for implantable cardioverter defibrillator ( icd ) from secondary to primary prevention of sudden death.2,8 furthermore , indications to device implantation have been extended to selected groups of hf patients who may benefit from biventricular pacing ( cardiac resynchronization therapy ; crt).6 currently , over 225,000 pacemakers and 150,000 icds appear to be implanted in the usa each year.9 most implanted patients have impaired systolic left ventricular function and are therefore at risk of events such as new - onset ( or worsening ) hf , life - threatening ventricular tachyarrhythmias , atrial fibrillation ( af ) , and stroke . the changing profile of the overall device - carrying population ( larger , more heterogeneous , and affected by more complex disease ) is being met by expanded device capabilities . a single device can deliver multiple therapies , while also monitoring various cardiovascular parameters . information can be obtained on underlying heart rhythm , burden of supraventricular or ventricular arrhythmias , and ( in some devices ) fluid overload.10,11 such advances are likely to provide the premise for relevant changes in follow - up modalities and objectives , as discussed in the rest of this article . jude medical , and boston scientific all currently require patients to perform a device questioning procedure to allow data transmittal to the referral center via the internet or phone network.4 a different approach used by biotronik ( berlin , germany ) involves automatic transmittal ( usually daily , or on appearance of relevant events ) from the device to a service center that processes the data and informs physicians via the internet ( or in cases of alerts , through additional channels such as fax and mobile phone messages).12 current systems for remote icd follow - up provide information on device status , detected events ( including intracardiac electrograms of arrhythmic events ) , and the therapies delivered.4,1215 although still in an experimental phase , telemonitoring can provide a similar quality of data retrieval to conventional office visits,4,13,14 satisfying both clinicians13 and patients.13,15 various clinically relevant points can be identified allowing prompt intervention based on detection of abnormalities in sensing / pacing function , evidence of new af or of therapy appropriately delivered for a ventricular tachyarrhythmia , and so - called phantom shocks ( sensations of device - delivered shocks in the absence of detected events).13,15 telemonitoring of icds has the potential to improve patients safety regarding both spontaneous clinical events and device - related events . the device - driven aspect is of particular interest given the problem of device advisories , which seem to have increased in recent years.16 the availability of patient alert features in some current icds can facilitate early detection of serious ( sometimes life - threatening ) device system complications entailing the need for reprogramming or device / lead replacement.17 the economic potential of telemonitoring was highlighted in a french survey , which indicated that this approach could help cut overall icd follow - up costs , thanks to transport savings , particularly for patients living over 100 km from their referring center.18 when the costs of home monitoring were factored in , the time to onset of cost saving ranged from about 1.5 years ( for patients living > 150 km from the referring center ) to about 4 years.18 telemonitoring may cover a wide range of situations ( including routine follow - up and nonscheduled follow - up because of new or phantom shocks , suspected electromagnetic interference , or suspected onset of new arrhythmias such as af ) , thereby sparing patients the need to travel to the referring center except for reprogramming . there is growing interest in home - based care for hf patients to reduce hospital admissions . hf is a common disease , whose prevalence is increasing alongside the aging of the general population . the impact of hf on health care costs is mainly caused by hospitalization ( in western countries , hf is the most common cardiovascular cause of hospitalization in the elderly , and repeated admissions are often required).19 the conventional approach to home monitoring relies on external devices connected to a telecommunication system.19 regular ( daily or even continuous ) transmittal of data regarding heart rate , blood pressure , ecg , weight , body temperature , oxygen saturation , or transthoracic impedance ( for control of fluid overload ) can provide a basis for disease management decisions . non - randomized clinical trials on strict telemonitoring of hf patients have identified several predictors of mortality or hospitalization , and indicate that telemonitoring is associated with a reduction in the number of hospitalizations in comparison with regular conventional follow - up.19,20 in a randomized controlled study of nyha iii iv hf patients,21 telemonitoring of weight and symptoms led to improved survival in the absence of reduced hospitalization ( the primary outcome measure ) . the trans - european network home - care management system ( ten - hms ) study randomized patients with left ventricular dysfunction and a recent history of hospitalization because of hf either to home telemonitoring ( of weight , blood pressure , and heart rate / rhythm , as recorded by automated external devices ) , to nurse support by telephone , or to usual care . during an 8-month follow - up , furthermore , telemonitoring was associated with shorter hospital stays ( but not lower hospital admission rates).22 so far , the benefits of telemonitoring seem to be less impressive than was originally hoped . despite some cost - effectiveness evaluations,19,20 the overall economic profile of telemedicine awaits clarification.23 whereas telemonitoring has traditionally made use of external devices , the frequent indications for electrical device ( pacemaker , icd , or crt ) implantation in the field of hf suggest the prospect of closer and more detailed monitoring of patients conditions.20 this avenue could become even more attractive if the sensors integrated into implanted devices to monitor hemodynamic conditions are further developed and improved.11,24,25 although further technological evolution is probably necessary before we can gain a true picture of the potential of telemonitoring , even now it does seem to hold out the prospect of improvements in the quality of life , health status , and safety in specific groups of patients , while at the same time enhancing economic efficiency . at present , hf appears to be an ideal target for pilot disease management programs based on telemonitoring via implantable electrical devices . telemonitoring of implanted devices could provide various kinds of useful information ( table 1 ) , suggesting the possibility of an acceptable and efficient strategy to improve patients outcomes while cutting costs . clinical management could greatly benefit from timely information on electrophysiological and hemodynamic parameters ( ventricular tachyarrhythmia burden , new onset of af , rhythm pattern during syncope , evolution of hemodynamic state , fluid overload , etc . ) . table 1types of information that implanted devices ( pacemakers , icds , devices for crt ) with telemonitoring capabilities could potentially provideinformationdetailsdevice informationbattery status and voltagep and r wave amplitudescapture thresholdslead impedanceautocapture thresholdsshock impedanceinformation on patients heart rhythm / arrhythmias and on device therapiesheart rateheart rate variabilityatrial and ventricular electrogramspercentage atrial pacingpercentage ventricular pacingnumber of supraventricular tachyarrythmias ( at , af)number of ventricular tachyarrythmias ( vt , vf)number of non - sustained vtsnumber and outcome of delivered therapies ( atrial , ventricular)number of aborted therapies ( atrial , ventricular)electrograms of detected arrhythmias ( atrial , ventricular)information on patients status and hemodynamic conditionright ventricular dp / dtright ventricular pressureright ventricular impedancevenous oxygen saturationfluid overloadmuscular activityventilationaf atrial fibrillation , at atrial tachycardia , crt cardiac resynchronization therapy , icd implantable cardioverter - defibrillator , vf ventricular fibrillation , vt ventricular tachycardia . types of information that implanted devices ( pacemakers , icds , devices for crt ) with telemonitoring capabilities could potentially provide af atrial fibrillation , at atrial tachycardia , crt cardiac resynchronization therapy , icd implantable cardioverter - defibrillator , vf ventricular fibrillation , vt ventricular tachycardia . in patients with advanced hf ( nyha class iii iv ) , intrathoracic impedance monitored by implanted devices has been found to correlate inversely with pulmonary capillary wedge pressure and fluid balance , and can provide early warning signs of impending decompensation ( about 15 days before onset of symptoms).11 this example illustrates how a device - assisted approach could be applied in clinical practice . the clinical potential and possible cost - effectiveness benefits ( through reductions in hospitalization- and disease - related costs ) are under evaluation.11 the increasing capabilities of implanted devices to monitor patients status suggest a shift in post - implant follow - up objectives from a strictly device - centered perspective ( is the device working properly ? ) to perspectives centered on the patient device interactions and on patient status ( is the device programming appropriate for the patient s status ? has something changed in the patient s status ? what clinical options are most appropriate for this patient ? ) . health care could benefit from automatic or periodic data transmission , coupled with alert features ( when the device detects significant abnormalities ) to warn patients to contact physicians.4,12,20 upfront increases in costs ( physician / nurse surveillance , phone calls , internet / phone checks , etc . ) could eventually be offset by reduced hospitalization costs , thanks to the beneficial effects of timely recognition of changes in patients status and prompt therapeutic response . another innovative technological approach to hf management involves use of stand - alone devices designed exclusively for the telemonitoring of cardiac function by measurement of various indicators.25 obviously , such an approach could also be used for patients without pacemaker or icd indications . however , the need for an invasive intervention entails risk benefit considerations ( implantation side effects versus possible management benefits ) that could make this approach less amenable to study than approaches involving provision of additional telemonitoring capabilities to routinely implanted devices . in any case , experiences garnered in the telemonitoring of pacemakers , icds , and crt devices could be useful for development and application of other implantable monitoring systems . in hf , acute exacerbation is thought to contribute to disease progression , leading to progressive ventricular dysfunction and dilation.26 this concept could stimulate early detection of hemodynamic alterations as a marker of hf exacerbation . telemonitoring of implantable devices could enable timely therapeutic adjustments aimed at preventing severe derangement and disease progression . such strategies might lead to profound changes in care delivery to hf patients based on coordinated multidisciplinary disease management with the potential to improve outcomes.27 patients would be the focus of a network of physicians and other clinicians , including the referral electrophysiologist , hf specialist , family doctor , internists , and other relevant health professionals . similar scenarios might also be considered for diabetes and other chronic diseases , as and when appropriate technologies become available.28,29 for such possibilities to become a reality , several issues must be overcome . the different proprietary technologies for telemonitoring could pose a major obstacle to data integration.4,13,14 although commercial enterprises find it difficult to agree on shared standards , within the health sector ethical pressures might be decisive . propagation of the digital imaging and communications in medicine ( dicom ) standard provides a promising example.30 another issue regards the choice of approach for a specific telemedicine program.31 for example , interactive real - time telemedicine has greater overheads than store - and - forward approaches ( e - mails , pre - recorded images / videos , etc . ) , but permits interaction and provides more immediate results.29 however , the store - and - forward approach may be fully sufficient for the purposes of telemonitoring of patients with implantable devices , where data collection has already been performed by the device itself . although development of dedicated guidelines32 could constitute a key step to improve the consistency and efficiency of telemedicine , this topic remains largely unaddressed . barriers to guideline development include emphasis on technology rather than the principles and targets of telemedicine,33 coupled with medical organizations tendency to feel they lack necessary technical expertise . telemedicine is particularly vulnerable to ethical and legal conflict , mainly because the law - making process tends to lag behind the high pace of technological evolution , and also because of national / federal differences.34,35 new sets of medicolegal regulations will be required to define professional responsibilities for decisions guided by transmitted data , especially with regard to suspected equipment malfunction . response strategies will be required for out - of - hours calls , including emergencies.4 personnel accreditation / certification , jurisdiction , and choice of law in the case of cross - border patient doctor relationships may be complicated ( what to do when doctors certified for given countries are contacted by internet by patients from elsewhere ? ) . widespread implementation of telemedicine will entail management of huge amounts of data , with important privacy implications . it will be essential to define responsibilities for data management / access ( by hospital personnel , providers , public / private institutions , etc . ) , and formulate regulations to protect the rights of both patients and health care professionals . questions regarding protection of intellectual property rights will also have to be addressed . from a societal perspective , implementation of telecardiology using implanted devices will obviously depend on evidence that this option improves efficiency and is cost effective . moreover , research will presumably be needed to identify subgroups of patients for whom use of specific telemonitoring devices is both feasible and cost - effective . in the context of the rapid ongoing evolution of electronic technology , telemedicine has the potential to enhance and rationalize clinical monitoring of patients implanted with pacemakers , icds , and crt devices . it is likely that this prospect will be encouraged by further technological advances in the development of useful novel sensors . a consequent shift from device - centered to patient - oriented telemonitoring could in turn favor a transition to a broader multidisciplinary approach to disease management based on a system of coordinated heath care interventions , not only in the field of cardiovascular medicine . however , a series of economic , regulatory , and organizational issues will have to be faced before such an approach can take root in real - world clinical practice , where institutional , cultural , and financial forces interact in complex ways . the ability to overcome these obstacles so as to take full advantage of the potential benefits offered by telemedicine technology may be relevant for the evolution of our financially challenged heath care systems . | telecardiology may help confront the growing burden of monitoring the reliability of implantable defibrillators / pacemakers .
herein , we suggest that the evolving capabilities of implanted devices to monitor patients status ( heart rhythm , fluid overload , right ventricular pressure , oximetry , etc . ) may imply a shift from strictly device - centered follow - up to perspectives centered on the patient ( and patient - device interactions ) .
such approaches could provide improvements in health care delivery and clinical outcomes , especially in the field of heart failure .
major professional , policy , and ethical issues will have to be overcome to enable real - world implementation .
this challenge may be relevant for the evolution of our health care systems . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dental amalgams have been widely used in dentistry for over 160 years and are still being used due to their good clinical performance , strength , durability and reasonable price . in low - copper amalgams , different electrolytic potentials in various phases make it susceptible to galvanic corrosion in its most electropositive phase ( 2 ) especially in the interface region.[2 - 5 ] corrosion products formed by the interaction of metallic ions from amalgam with chlorine and oxygen in the oral environment fill this gap . they consequently create a potential to seal the tooth / amalgam restoration interface.[6 - 8 ] on the other hand , there are less electrolytic potentials and galvanic corrosion in high - copper amalgams . marginal microleakage due to setting contraction of high - copper amalgams has been a cause for dentists ' concern about patients ' post - operative sensitivity and secondary caries.[9 - 10 ] however , it takes some time for the microleakage of high - copper amalgams to be sealed by corrosion products . it would be advantageous if these interfacial gaps could be sealed as quickly as possible by accelerated corrosion products.[11 - 12 ] in addition to the galvanic corrosion , other types of corrosions are expected to take place in amalgam restorations , as it would be at the vicinity of some factors such as tension,[13 - 14 ] oral bacterial flora,[15 - 16 ] and ph changes . acidic environment accelerate corrosion phenomenon.[17 - 18 ] applying adhesives as an intermediary layer between enamel / dentin and amalgam reduces secondary caries and microleakage significantly.[20 - 22 ] it also increases bonding23 and diminishes postoperative sensitivity.[24 - 26 ] corrosion resistance of alloys is reduced in a lower ph environment . due to the acidic functional monomers of self - etched adhesives ( sea ) , the resultant interfacial structure becomes more hydrophilic and may create an interfacial acidic environment that would be a more efficient condition for interfacial corrosion for amalgam restorations . electrochemical tests ( ects ) can be considered as the testing techniques for evaluation of potential corrosion and its behavior . the aim of this study was to evaluate the effect of seas with different ph levels on corrosion behavior of high - copper amalgams and its induction potential for self - sealing ability in the early post setting hours using ect techniques . thirty intact second mandibular bicuspid teeth extracted for the orthodontic treatment purposes were used in this study . initially , the coronal
segments of teeth were sectioned just short of the cementoenamel junction ( cej ) with a diamond disk ( drendel & zweiling 942fdiamant gmbh ; kalletal ,
germany ) and using a low speed hand piece and cooling water spray . the occlusal part at the cuspal base level was removed just inside the dentinoenamel
junction ( dej ) using the same instruments and technique . to standardize the samples of 5.0 mm occlusogingival thickness and make identical cylindrical
cavity preparations of 4.5 mm in diameter and 4.7 mm in depth with a 0.3 mm remaining dentin base at the occlusal side of the samples , attempts were made
to prepare the occlusal and cervical sections parallel together within the above - mentioned dimensions . ( figures1a and 1b ) schematic model of the sample preparation for the electrochemical tests .
a : tooth sample with a 5.0 mm thickness ,
b : cavity with 4.5 mm diameter and 4.7 mm depth ,
c : coating the external and internal walls of the cavity with hydrophobic resin ,
d : amalgam filling without ar / liner ,
e : prepared d - sample embedded in epoxy resin ,
f : amalgam filling with ar / liner
g : prepared f - sample embedded in epoxy resin . the cavities were prepared from the pulpal toward the occlusal part ( figure 1b ) with a # 57-fissure bur ( brasseler usa dental ; savannah , georgia , usa ) . samples were then placed for two minutes in an ultrasonic device ( micro 10+sonic ; unindent s.a . anios international dental group , genve , switzerland ) with distilled water to clean any remaining cut debris . these samples were then kept in a 37c incubator ( thermo ; hatfield , pa 19440 , usa ) for 12 hours .
to leave the opposing side of the cavity floor intact for the testing purposes , a polyethylene cylinder with 4.5 mm of internal diameter and 3.0 mm length was then carefully placed and secured with cured hydrophobic resin ( margin bond ; coltne / whaledent ag , altstatten , switzerland ) .
to seal the none - testing surfaces , all sample surfaces except for the cavity floor and its opposing external surface were etched with 37% phosphoric acid gel ( ultra - etch ;
ultradent products inc . one layer of mentioned hydrophobic resin was carefully applied on these
surfaces and initially cured by scanning the curing light ( blue phase c8 ; ivoclar/ vivadent , liechtenstein ) for 20 seconds at the intensity of 600 mw / cm . the samples were
post - cured using a laboratory light cure unit ( triad 2000 ; dentsply international , york , pa , usa ) for 80 seconds . a second layer of hydrophobic resin was applied and cured in the same manner (
figure 1c ) . a 33 1/2 inverted cone diamond bur ( dia ; f gso10014 , italy ) was used to refresh the interfacial surfaces ( floor of the cavities ) to guarantee the resin removal . the samples were then washed , cleaned and dried using the same procedures previously described . the samples were randomly divided into five main groups . the first main group was left with no ar/ liner ( no ) as a positive control group . in other main groups ,
each containing of six samples was assigned to a certain ar / liner , which was applied on the cavity floor according to manufacturer s instructions : i - bond ( ib ) ,
clearfil s ( s ) , single bond ( sb ) and varnish ( v ) ( table 1 ) . each main group was divided into two subgroups
according to the types of the used amalgams ( table 1 ) . considering various electrochemical behaviors , one high - copper spherical alloy
( tytin ; kerr , usa ) and one admixed alloy ( ana 2000 ; the mixed amalgam was condensed into the assigned cavity , while a piece of copper
wire of 0.7 mm diameter was inserted about 3.0 mm deep into the cavity and submerged in the condensed amalgam . each prepared sample was then mounted in epoxy resin ( araldit cy219 ;
hardener hy5160 , ciba - geigy , switzerland ) in such a way to leave the opposing surface exposed ( figure 1d-1 g ) . details of the defined groups used in this study
the electrochemical measurements were performed using gill ac laboratory potentiostat ( acm instrument , uk ) . in order to check the steady state , the prepared sample ( working electrode ) as the third electrode was held for 20 minutes in fusayama - meyer artificial saliva solution . the open circuit potential ( ocp ) of each sample was measured in a period of 1200 seconds . the linear polarization resistance ( lpr ) test was performed at a constant sweep rate of 10 mv / min and in the potential range of -15 to + 15 mv around the final monitored ocp value . the ocp and lpr measurements were carried out after the initial set up ( 20 minutes ) , 18 and 44 hours of immersion . in potentio- dynamic polarization ( pdp ) of the samples , the potential was applied by a constant sweep rate of 30 mv / min ranging from - 250 to + 250 mv ( with respect to the sample ocp value ) . a water bath was utilized to control the electrolyte temperature at 371c during the entire exposure times . mean ocp values of the samples with ana 2000 and tytin amalgams showed ( in all samples except ana - no and tytin - v ) that the mean ocp values reached a steady state after 18 hours of immersion ( figure 3a
) . mean ocp values of the ana - v and ana - ib were the highest ( least corrosion potential ) and lowest ( most corrosion potential ) respectively ( figure 3b ) . mean ocp values of the tytin - no and tytin - ib samples were the highest ( least corrosion potential ) and lowest ( most corrosion potential ) respectively ( figure 3 ) . ana 2000 ( a ) and tytin ( b ) groups with varying cavity coatings ( ar / liner or nothing ) .
in lpr tests , the effect of different ar s on polarization resistance ( rp ) values ( electrical resistance ) of ana 2000 and tytin amalgams has been measured and all values are represented in
table 2 . the rp values of almost all samples have reached nearly a steady state and have diminished slightly after the 44-hour immersion time . the rp values
of ana - v and tyt - v were the highest ( lowest corrosion rates ) . contrarily , the ana - ib and tyt - ib samples , with the lowest ph values , represent the lowest rp values ( i.e. highest corrosion rates ) among the other groups ( table 2 ) . lpr values ( rp values ) of ana 2000 and tytin amalgams with different ar / liner in all tested groups
figure 4 shows the pdp curves of all tested groups in artificial saliva media . although the values of ecorr and icorr were different , the diagrams in each group were roughly the same . table 3 represents
the extracted parameters from these curves . according to this table , tyt - ib had the lowest ecorr and the highest icorr among the groups ( i.e. highest corrosion rate ) . the highest value of ecorr was
witnessed in tyt - no and lowest value of icorr was that of tyt - v ( i.e. lowest corrosion rate ) . one of the influential parameters that can affect the corrosion reactions on the amalgam surface is the ph of the aqueous environment.[17 - 18 ] the ar / lining materials used in this study had various ph levels . the ph of the ar could influence the ph of the diffused electrolyte in ar / amalgam interface . as it was expected for ar , consequently , the lowest ocp value of the ana - ib sample could be attributed to its lowest ph value ( table 1 and figure 3 ) . on the other hand , in all samples except ana - no , the mean ocp values reached steady state after 18 hours of immersion ( figure 3 ) . considering this and ocp values of ana - no and ana - v samples , ocp values of the tyt - no and tyt - ib samples were the highest and lowest respectively ( figure 3b ) . notwithstanding the lower ph of clearfil s bond ( table 1 ) in comparison to single bond , the ana - s group presented a higher ocp value . considering the ocp values of ana - no and tyt - no samples , it could be stated that the ana - no sample ( with approximate ocp value of -230 mv / sec ) showed a more active corrosion behavior than tyt - no ( figure 3 ) . like ocp , lpr method is a non - destructive method for evaluation of corrosion resistance . in lpr technique , a potential is applied to a freely corroding sensor element ( here amalgam as
a working electrode ) and the resulting linear current response is measured . in samples with ar layers , the decrease in rp values can be ascribed to the water - uptake phenomenon in such
polymeric layers with microleakage.[28 - 30 ] however , in the groups without ar layers , the significant rp
drop after the initial immersion could be attributed to the occurrence of both the anodic and cathodic reactions at an active state leading to higher dissolution rates . as the results showed ,
the rp values of ana - v and tyt - v were the highest ( i.e. lowest corrosion rates ) in comparison to the other samples in other groups . contrarily , the ana - ib and tyt - ib samples , with the lowest
i - bond ph values , represent the lowest rp values that mean higher corrosion rates . in other words , it can be inferred that the acidic nature of the i - bond results in formation of higher amounts
of corrosion products that can fill the gap at amalgam/ dentin interface and it consequently diminishes the microleakage . a microleakage study is recommended for further substantiating the result .
by comparing the rp values of the ana - no and tyt - no samples , it can be deduced that the corrosion rate of the ana sample is slightly higher than the tytin sample at longer immersion times . this superior corrosion resistance behavior of the tytin sample can be attributed to its more homogenous microstructure.[31 - 32 ]
concerning the ph values of clearfil s bond and single bond , it is expected that the samples with single bond reveal lower rp values while a converse behavior is observed in lpr results . it should be noted
that the above - mentioned samples show the same unpredicted behavior in ocp results . these results can be related to the occurrence of other rate - controlling reactions but the mechanism is not completely
understood . in addition , it may be concluded that other factors such as the chemical composition , the molecular structure , degradability or the microleakage may also outweighed the acidity of the ar s .
in samples without an ar layer , the ana - no sample had a lower ecorr value in comparison with the tyt - no sample ( figure 4a and table 3 ) . concerning their anodic and cathodic tafel slopes , the ana - no sample revealed a more active corrosion behavior ( with a slightly higher icorr value ) as compared to tyt - no sample ( table 3 )
which could lead to lower microleakage in ana - no sample . this can be ascribed to the ana 2000 heterogeneous microstructure ( admixed ) in comparison with more homogenous spherical microstructure in tytin . [ 31 - 32 ] pdp curves of tested groups a : tytin / ana - no , b : tytin / ana - ib , c : tytin / ana - sb , d : tytin / ana - s3 and e : tytin / ana - v . on the other hand , it should be considered that the corrosion rate of different groups is not only influenced by the type of amalgam and ph value [ 17,31 - 32,34 ] but also by the liner properties such as their degradability and water absorption affinity.[27 - 30 ] these factors may also be correlated with the liner porosity , the differences in the molecular structures and the densities of the polymeric chains in self - etch dentin bonding agents as well . besides , as it has already been shown , the degree of polymerization could affect the amount of water absorption , therefore , the authors suggest evaluating the effect of ar degree of polymerization on interfacial corrosion potential and behavior of the amalgams . the application of either chlorhexidine on the dentin surface separately or a new adhesive layer with added chlorhexidine to its formula to control degradability of ar may influence the corrosion production pattern / rate at the amalgam/ dentin interface . comparing the ana - ib and tyt - ib samples , both samples had almost equal ecorr values ( figure 4b and table 3 ) . besides , the tyt - ib sample had a higher icorr value compared to the ana - ib sample ( table 3 ) , which means lower corrosion resistance or higher corrosion rate . therefore , it can be deduced that in presence of the i - bond ( ph= 1.6 ) , the surface activity of the tytin amalgam was more affected as compared to ana 2000 amalgam . on the other hand , the formation of a corrosion product layer was facilitated more , and thus , the gaps at amalgam / dentin interface have been more rapidly filled ( table 3 ) . comparing samples with i - bond liners and the control groups ( without any liner ) , a reduction in ph value resulted at higher corrosion rates . the ana - s sample had a lower ecorr value compared with tyt- s sample while both of them showed almost the same corrosion resistance
( figure 4c and table 3 ) . by comparing the icorr values of clearfil s samples with the control groups , it can be observed that there might have been a competition between the ph and stability of this ar layer , which affected the overall surface activity . as a result , it can be observed that the created microleakage in ana - s3 sample ( with an acidic ph ) could be restored even at a lower rate as compared to the ana - no samples . extracted parameters from pdp curves in figure four of tested groups
both ana - sb and tyt - sb samples again revealed an approximately similar icorr values although the ana 2000 sample value was slightly lower . upon comparing the higher corrosion rates of sb groups with control groups , it can be deduced that the microleakage has been reduced faster .
in the varnish groups , furthermore , in the presence of a more stable layer in the varnish groups , the corrosion rates were considerably lower and hence , the sealing process would be delayed . in addition , it should be noticed that the pdp results were consistent with other previous electrochemical measurements .
therefore , the authors believe that supplementary experiments and investigations should be performed for further confirmation of the suggested method . considering the limitations of this study , it can be concluded that applying some self - etch adhesives as a liner beneath the high - copper amalgam restorations may increase interfacial
corrosion potential and self - sealing ability of high - copper amalgams by increasing corrosion phenomenon potential . the lowest ph level of self - etch adhesive showed the highest whilst ,
the highest ph level of liners revealed the lowest susceptibility to corrosion and self - sealing ability of high - copper amalgams .more specifically , i - bond with the lowest ph value showed
the highest corrosion rate whilst the varnish with the highest ph value revealed the lowest susceptibility to corrosion . clearfil s and varnish demonstrated lower corrosion rates in
comparison to the control group ; therefore , these agents are not suggested for the reduction of microleakage in high copper amalgam restorations . the admixed amalgam had a higher corrosion rate in comparison with the spherical one . | statement of the problem : similar to conventional amalgam , high - copper amalgam alloy may also undergo corrosion , but it takes longer time for the resulting products to reduce microleakage by sealing the micro - gap at the tooth / amalgam interface .
purpose : the aim of this study was to evaluate the effect of self - etch adhesives with different ph levels on the interfacial corrosion behavior of high - copper amalgam restoration and its induction potential for self - sealing ability of the micro - gap in the early hours after setting by means of electro - chemical tests ( ects ) .
materials and method : thirty cylindrical cavities of 4.5 mm x 4.7 mm were prepared on intact bicuspids . the samples were divided into five main groups of application of adhesive resin ( ar)/ liner/ none ( no ) ,
on the cavity floor .
the first main group was left without an ar/ liner ( no ) . in the other main groups ,
the types of ar/ liner used were i - bond ( ib ) , clearfil s3 ( s3 ) , single bond ( sb ) and varnish ( v ) .
each main group ( n=6 ) was divided into two subgroups ( n=3 ) according to the types of the amalgams used , either admixed ana 2000 ( ana ) or spherical tytin ( tyt ) .
the ects , open circuit potential ( ocp ) , and the linear polarization resistance ( lpr ) for each sample were performed and measured 48 hours after the completion of the samples .
results : the tyt - no and tyt - ib samples showed the highest and lowest ocp values respectively . in lpr tests ,
the rp values of ana - v and tyt - v were the highest ( lowest corrosion rate ) and contrarily , the ana - ib and tyt - ib samples , with the lowest ph levels , represented the lowest rp values ( highest corrosion rates ) .
conclusion : some self - etch adhesives may increase interfacial corrosion potential and self - sealing ability of high - copper amalgams . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hypertension affects 29% of male and 25% of female adults worldwide . its impact on mortality mortality gaps in hypertensive versus nonhypertensive patients persist due to its occurrence with other appendages of the metabolic syndrome , thus treatment advances . as treatment has expanded , so has its intensity . recently the question has frequently been raised as to potential harms associated with aggressive treatment of hypertension . a systematic review of aggressive versus standard blood pressure targets did not find any benefit in total mortality when blood pressure is lowered less than 140/90 mmhg . the incidence in cardiovascular events , including mortality , increases with extremes in blood pressure . the paradoxical increase in events at lower blood pressures has been represented by a j - shaped or u - shaped curve . the j - curve phenomenon has been researched since 1979 and has been amplified with individual trials , post hoc analyses , and systemic reviews in support of this finding . not all patients appear to be equally affected by the j - curve , if at all . patient with established coronary artery disease ( cad ) and diabetes are the most affected by an overcorrection of blood pressure . elevation in systolic blood pressure has been a more important predictor of mortality than diastolic blood pressure ( dbp ) . on the other hand , low dbp in patients treated for hypertension has been associated with increased risk of cardiovascular disease [ 8 , 9 ] . this study evaluates the concept of the j - curve in dbp across a large primary care population with a high prevalence of cad , diabetes , and hypertension . we also evaluated low dbp as an independent risk factor for all - cause mortality . a cross - sectional study of predominantly male patients at the va central california healthcare system aged from 45 to 85 years was conducted over a 2-year period . data were collected from the electronic medical record and provided demographic information , vital signs , comorbid diagnoses , and medications . the study was approved by the va northern california health care system institutional review board . all patients at least 45 years of age or older with a minimum of one outpatient encounter with recorded blood pressure were included in the study . the primary outcome , death from any cause , was used as the dependent variable . covariates were included that were thought to contribute to the overall risk of mortality as well as variables that might alter a patient 's blood pressure goals . these included age , body mass index , and the presence of comorbidities including cad , hypertension , diabetes , cerebrovascular disease , and chronic kidney disease . the investigators felt that these conditions were the most likely to contribute to the cardiovascular causes of death and were important potential confounding variables in this study . cad was defined by icd9 code , by a history of myocardial infarction with abnormal electrocardiogram or troponin elevation , coronary artery bypass graft surgery , percutaneous coronary intervention , or coronary stent placement . data were also gathered on the classes of blood pressure medications used to treat the patients . receiver operating characteristic curve was used to determine the optimal cut - off point for dbp as a continuous scale against death . baseline characteristics were compared between the two groups with the use of the chi - square test and the independent samples t - test . interval likelihood ratios were calculated for each interval for dbp against all - cause mortality along with 95% confidence interval ( ci ) . multivariate logistic regression ( lr ) assessed for independence of low dbp as a risk for all - cause mortality . propensity score matching was conducted using dbp grouping as above mentioned for the dependent variable . covariates included age , comorbidities including cad , hypertension , diabetes , chronic kidney disease , cerebrovascular disease , total number of antihypertensive medications , and individual medication classes . finally , subjects were matched based on their scores , looking for the closest match . statistical analyses were carried out with spss statistics software for windows , version 20.0 ( ibm corp . propensity score matching was carried out using r project for statistical computing , version 2.12.0 ( r development core team , vienna , austria ) along with the spss r essentials plug - in . a total of 14,270 patients were included in the study . the mean age of study population was 67 years with 96% male patients . the prevalence of comorbid conditions was as follows : hypertension 66.7% , diabetes 29.5% , cad 19.5% , stroke 9.3% , and chronic kidney disease 6.9% . interval likelihood ratios of all - cause mortality as a function of dbp were calculated and are shown graphically ( figure 1 ) . the lower 95% ci was greater than one for values of a dbp ranging 55 mmhg and less . the only values in the interval likelihood ratio that achieved a 95% ci less than one were dbp ranges from 70 to 85 mmhg . eighteen percent of patients had an ambulatory dbp of 60 mmhg or below , while 49% had a reading of 70 mmhg or less . a receiver operating characteristic curve found that the threshold value of dbp with the greatest specificity and sensitivity for mortality was 70 mmhg ( p < 0.001 ) . patients were grouped according to dbp less than 70 mmhg and those at or above 70 . baseline characteristics of these two groups were significantly different with respect to age , comorbidities , and use of antihypertensive medications ( table 1 ) . to adjust for such differences , the results were a closely paired group of 8856 patients with small differences between the groups . after matching , the comorbidities were similar in the two groups with the exceptions of diabetes ( 31.7% versus 29.7% , p 0.04 ) and cad ( 22.2% versus 18.8% , p < 0.001 ) , with more patients having diabetes and cad in the group with lower dbp . medication use by class was similar in both groups except for a trend in increased use of loop diuretics in the low dbp group ( 7.5% versus 6.4% , p 0.037 ) . there was no difference in the total number of antihypertensive medications in the two groups ( table 2 ) . a multivariate logistic regression was used to adjust for low dbp , pulse pressure , and cad as potential confounders and assess for independence in their association with all - cause mortality . other recorded comorbidities were also included . among the comorbid conditions , low dbp , along with pulse pressure , cad , chronic kidney disease , and cerebrovascular disease were each associated with all - cause mortality after controlling for each comorbid condition . the odds ratio for all - cause mortality in subjects with a dbp less than 70 mmhg was 1.34 ( 95% ci 1.111.61 ) ( table 3 ) . this study of primary care veterans offers additional insight into the relationship between low - dbp and mortality . this study utilizes a large sample size to evaluate the effects of the j - curve in dbp and to define a lower threshold for dbp . in our study population , the risk of death at various diastolic pressures was not continuous but followed the j - shared curve that has been established previously . the majority of studies looking at harm with aggressive bp lowering have not been consistent in defining a limit to which bp should not be lowered beyond . the data in this study suggest that the benefit of lower dbp is limited to the range of 7085 mmhg , with a nonstatistically significant trend between 6065 mmhg . any dbp value less than 60 mmhg increases the likelihood of all - cause mortality . when assessing comorbid conditions for confounding biases , the multivariate logistic regression model identified low dbp ( defined as less than 70 mmhg ) as an individual risk factor for mortality , after adjusting for pulse pressure , cad , chronic kidney disease , or cerebrovascular disease . pulse pressure was included as a potential cofounder due to its association with cardiovascular disease and its unique relationship to dbp : decreases in diastolic blood pressure result in increased pulse pressure . increased pulse pressure has been reported to increase the risk of developing diabetes , lead to progression of kidney disease , and confer a higher risk for cad . in this population , pulse pressure had no significant association with mortality after adjusting for dbp and other comorbidities ( or 1.01 , 95% ci 1.001.02 ) . low dbp was not independent of hypertension or diabetes , which suggests that a low dbp may only be harmful as a consequence of antihypertensive therapy or in patients with diabetes . current literature on aggressive treatment of hypertension among diabetics has failed to show any benefit on mortality . it was startling to learn that 18% of our entire study population had an ambulatory dbp of 60 mmhg or less . these findings underscore a lack of awareness amongst physicians regarding the paucity of evidence showing benefit in aggressive bp lowering and in particular the potential harms associated with it . owing to the debatable nature of the clinical significance of the j - curve [ 1517 ] , major societal guidelines while the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure has been the gold standard for nearly a decade , it fails to address the question as to the potential harms with lowering blood pressure beyond a certain threshold . likewise , indications and targets for aggressive blood pressure control have not been well defined . this report also defines the relationship between blood pressure and cardiovascular events as linear and independent of other factors . while this is likely true for patients without existing cardiovascular disease , patients with atherosclerotic cad and lvh have a more narrow range for which autoregulation of the coronary arterial pressure can occur . different from the coronary circulation , which is mostly dependent on diastole for perfusion , the cerebral vasculature depends mostly on systolic bp which allows it to tolerate a wider range of mean arterial pressures . studies have differed in the clinical impact of low dbp on stroke [ 9 , 19 , 20 ] . our study found that mortality due to low dbp was independent of a history of stroke . a post hoc analysis reveals that the prevalence of cad was 35% in patients with a history of cerebrovascular disease , showing significant overlap in these diseases . the growing body of evidence for j - shaped relationships between blood pressure and cardiovascular outcomes has led to the revision of guidelines from the european society of hypertension . the joint national committee is currently in progress in their draft of blood pressure guidelines for their 8th report . one of the questions we hope it will be addressed is how low blood pressure should be reduced . as with all retrospective studies we were limited by unidentified or incompletely documented potential confounders . the trend towards increased cad in the group with dbp < 70 mmhg , even after matching , poses a particular confounder in the relationship between low dbp and all - cause mortality , though this was accounted for using a multivariate logistical regression model . this bias remains a concern for nearly all trials of bp treatment , that the group which requires the most vigilant treatment could also be the group that possesses the greatest pretreatment cardiovascular risk profile . hence , we can not conclude whether the low dbp was due to underlying heart disease , which also confers higher mortality . the study design also does not allow us to find causation , only association between low blood pressure and mortality . another limitation is that while this was a large population , it was also a specific population . the veterans administration medical record does not routinely record ethnicity as part of patient demographics . while younger veteran groups are more ethnically diverse , world war ii and korean war veterans are more than 88% caucasian . finally , our dataset lacks intervals and averages on the recording of bp , and we are limited to the final reading at the time of data collection . it is not possible to consider trends in bp over time with this limitation . while treatment of hypertension reduces mortality due to cardiovascular events , reduction of dbp below 70 mmhg is associated with increased all - cause mortality in this male predominant study population with significant comorbidities . avoidance of dbp less than 70 mmhg may be advisable in the management of hypertension , although prospective studies are warranted in more representative patient populations . our findings suggest the need of a shift in paradigm with the guidelines including a minimum as well as a maximum bp target . | background . a paradoxical increase in cardiovascular events has been reported with intensively lowering diastolic blood pressure ( dbp ) .
this j - curve phenomenon has challenged the aggressive lowering of blood pressure , especially in patients with coronary artery disease . objective .
our objective was to study the effects of low dbp on mortality and determine a threshold for which dbp should not be lowered beyond .
methods .
we evaluated a two - year cross - section of primary care veteran patients , from 45 to 85 years of age .
receiver operating characteristics ( roc ) were employed to establish an optimal cut - off point for dbp .
propensity - score matching and multivariate logistic regression were used to control for confounders .
all - cause mortality was the primary outcome .
results .
14,270 patients were studied .
an roc curve found a threshold value of dbp 70 mmhg had the greatest association with mortality ( p < 0.001 ) .
49% of patients had a dbp of 70 mmhg or less . using a propensity - matched multivariate logistic regression ,
odds ratio for all - cause mortality in subjects with a dbp less than 70 mmhg was 1.5 ( 95% ci 1.31.8 ) .
conclusions .
reduction of dbp below 70 mmhg is associated with increased all - cause mortality .
hypertension guidelines should include a minimum blood pressure target . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a study performed in the us among children and adolescents aged 6 - 19 years in 2001 - 2002 showed that 31.5% were at risk for overweight or were overweight , and 16.5% were obese compared with 29.9% and 15.0% , respectively in 1999 - 2000 . another study performed in england showed that the prevalence of overweight and obesity among boys aged 7 - 11 years was 17% and for girls in the same age group , the prevalence was 23.6% . in the united arab emirates , the prevalence in the age group of 5 - 17 years was 21.5% for overweight and 13.7% for obesity . a study performed in saudi arabia in a sample of male school children 6 - 18 years of age showed that 11.7% of them were overweight and 15.8% of them were obese . there are several factors that have been found to influence the level of health , such as social environment , education , personal health practices , healthy child development , and culture . social cognition theory suggests that behavior , which occurs in a social context such as eating and physical activity , is not directly determined by the outside stimulus of a situation , but rather by mediating internal mental processes such as knowledge , attitudes , and beliefs . it is important to establish good health knowledge and attitudes toward overweight and obesity because it is associated with and considered to be an important risk factor for several chronic conditions , including diabetes , heart disease , and joint pain . media are not viewing the obesity - related health problems as suggested by the available evidence . previous studies have demonstrated that in different developed countries , the majority of persons reveal limited data concerning obesity co - morbidities and the knowledge is even less when asking about obesity as a known risk factor for cancer [ 12 , 13 ] . the primary aim of this study was to assess obesity awareness and knowledge among intermediate and high schools students using a reliable and validated scale , the obesity risk knowledge ( ork-10 ) scale . additionally , we assessed the prevalence of overweight and obesity among the participants , and the relationship between the awareness level and bmi , type of school , parent s education , and lifestyle habits . this cross - sectional study included students from intermediate and high schools located in taif , saudi arabia . the research proposal was approved by the ethical committee at taif university school of medicine . permission was obtained from the local authority in taif , which represents the local office of the ministry of education , to obtain the clinical data and to assess the level of the awareness about the obesity risk . we included intermediate and high school students , aged 12 - 18 years , who were willing to participate in the study . we excluded students with chronic medical illness , existing psychiatric disorders , and students with learning disabilities . a total of 11 schools were selected randomly : one school was a private boys school and the other 10 schools were public schools ; of these , seven were boys schools and three were girls schools . four schools out of the 11 were boys high schools , four were intermediate boys schools , one was a girls high school , and two were girls intermediate schools . one or two classes were selected randomly from each school that was visited by the researchers . each student s height and weight were measured by the researchers and bmi was calculated . bmi was categorized as follows : underweight ( bmi < 18.5 kg / m ) , normal ( bmi 18.5 24.9 kg / m ) , overweight ( bmi 25 30 kg / m ) , and obesity ( bmi 30 kg / m ) . to assess obesity awareness , we used the ork-10 scale , which contains 10 questions and each question contains three choices : right , wrong , and i do not know . each question answered correctly on the ork-10 form is equal to 1 and the minimum score was 0 and the maximum score was 10 . those who answered 5 questions correctly were considered to be aware and those who answered < 5 questions correctly were considered to be unaware . this questionnaire was tested in one school before the data collection phase to check for errors , ambiguities , and redundancies . the researchers sat with the respondents , explained the rationale of the study and the process , and obtained verbal consent . the respondents were given adequate time to complete the questionnaire and the researchers were available to answer any related questions . information about related factors such as eating habits , including eating breakfast at home , eating fruit daily , the frequency of eating fast food , and physical activity were self - reported . time spent sleeping ( in hours ) per night was obtained and categorized into < 6 h , 6 - 8 h , and > 8 h , and the optimal time was considered to be 6 - 8 h of sleep per night . social - related data such as smoking , parent s education , and working and living situation were also recorded . data were collected and analyzed using the statistical package for the social sciences ( spss ) software version 20 . the chi - squared test was used to study the relationship between variables and the independent t - test was used to compare between means . a total of 528 students were enrolled in this study ( mean age standard deviation ( sd ) , 15.58 1.801 years ) . most participants were male and attending a governmental school , 46% were high school students , and 54% were intermediate school students ( table 1 ) . the mean height was 1.62 0.11 m , mean weight was 59.80 19.85 kg , mean bmi was 22.37 6.006 kg / m , and mean waist circumference was 79.77 14.85 cm . the bmi distribution for both male and female students was as follows : 33.1% were underweight , 39.2% were normal weight , 15.7% were overweight , and 11.9% were obese . most students reported living with both parents and 27.3% of the students reported that both parents were working . overall , 47.1% of the students fathers and 60.2% of the students mothers were reported to have a lower level of education ( high school or less ) . additionally , 79.9% reported using electronic devices on a daily basis and 25.2% report using their devices for 6 h per day . there were 69.6% who ate breakfast daily , and 38.3% reported that they ate breakfast . there were 87.8% and 85.2% who ate lunch and dinner , respectively , with family . additionally , 37.6% reported a sedentary life style and 17.1% participated in sports > 300 min per week . the mean ork-10 score was 3.15 1.9 and 25.4% were considered to be aware . we divided the students based on the ork-10 score into aware and non - aware groups ( table 2 ) . compared to those who were considered to be non - aware , participants in the aware group were more likely to be older ( p < 0.001 ) , male ( p < 0.001 ) , attend high school ( p < 0.001 ) , use electronic devices daily ( p = 0.030 ) , eat dinner with their families ( p = 0.021 ) , eat fruit at least daily ( p = 0.027 ) , and consider obesity to be a disease ( p < 0.001 ) . both groups tended to have a similar bmi and waist circumference measurements ( figs . 1 and 2 ) . there was no statistical difference between groups for the living situation , the parents education , sleeping habits , other eating habits , or smoking . when groups were divided based on bmi category , there was no statistical difference in the obesity awareness level ( p = 0.629 ) or in considering obesity to be a disease ( p = 0.650 ) ( table 3 ) . adjusting for age , sex , school type , living situation , parents education , eating habits , walking to and from school , and activity level showed a non - significant negative partial correlation between bmi and ork-10 score ( r = -0.027 , p = 0.552 ) and between waist circumference and ork-10 score ( r = -0.025 , p = 0.580 ) . our study showed that only 25.4% of the participating students were considered to be aware about obesity according to the ork-10 scale results . older males who were attending high school were more likely to be aware and were more likely to consider obesity to be a disease . there were 27.8% of the students who were either obese or overweight , which is similar to the results of a previous study . the aware group in our study was more likely to eat dinner with their family . the aware students were more likely to eat breakfast daily and at home , but they were also more likely to be active smokers and eat fast food more frequently . a previous study showed that eating meals with a family every day is associated with a lower rate of obesity and maintaining a healthy lifestyle habit . viewing obesity as disease will help health care providers to diagnose and treat obesity earlier , to prevent potentially related complications . most of the aware group in our study considered obesity to be a disease compared with the non - aware group . recently , the medical societies that have also begun considering obesity to be a disease include the american medical association and the american association of clinical endocrinologists . although a previously published study showed that the questionnaire is a valid tool to screen for obesity knowledge in this age group , we are not aware of any other study that was performed to assess the level of awareness in this age group . a recent study used the ork-10 scale to assess the obesity awareness level among nursing , dietetic , and medical students , and the results showed that the awareness level in each group is positively correlated with the year of the training , and that dietetic students scored the highest using the ork-10 scale . our study strengths are using a validated questionnaire ( ork-10 ) and collecting many related variables including socioeconomic , dietary , sleep , and activity habits . our study weaknesses include the predominance of males in the study , the small sample size , most of the sample was from governmental schools , and we included only one city . | backgroundthe primary aim was to assess the prevalence of overweight and obesity among the participants and its relationship to obesity awareness.methodsa cross - sectional study that included intermediate and high schools students was conducted between april 2014 and june 2015 .
anthropometric measurements were obtained by the researchers and body mass index ( bmi ) was calculated .
we used the obesity risk knowledge ( ork-10 ) scale to assess obesity awareness .
participants who answered 5 out of 10 questions correctly were considered to be aware.resulta total of 528 students were enrolled ( mean age , 15.58 years ) .
the mean bmi was 22.37 kg / m2 , and 27.6% were either overweight or obese .
the mean ork-10 score was 3.15 and 25.4% were considered to be aware . compared to those who were
non - aware , participants in the aware group were more likely to be older ( p < 0.001 ) , male ( p < 0.001 ) , attend high school ( p < 0.001 ) , eat dinner with their families ( p = 0.021 ) , eat fruit at least daily ( p = 0.027 ) , and consider obesity to be a disease ( p < 0.001).conclusiononly 25.4% of students who participated were considered to be aware about obesity .
those who were aware were more likely to be older male high school students . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the gastrointestinal tract is endowed with a complex immune network that has a major interface with the external environment and thus presents a site with a significant immunological challenge to maintain homeostasis . the maintenance of immune tolerance and gut homeostasis is achieved by an integrated regulation of innate and adaptive immunity but also involves the microbiome itself . the dysregulation of one of these biological components or a combination thereof often precipitates intestinal inflammation or ibd . in general , ibd encompasses two major chronic relapsing inflammatory conditions in the gastrointestinal tract : ulcerative colitis ( uc ) and crohn 's disease ( cd ) . uc typically involves bloody diarrhea and inflammation involving the rectum that is often extended towards the proximal colon . infiltration of inflammatory cells is chronic and restricted to the superficial layers of the colonic mucosa . on the other hand , cd is more pleomorphic and is characterized pathologically by discontinuous segments of transmural inflammation that can affect all parts of the gi tract , most commonly the ileocecal region . cd is often presented with development of fistulae and/or strictures while histological granulomata are a key feature . importantly , the etiology or how dysregulation of the biological components required for gut homeostasis contributes to uc and cd remains poorly defined . an in - depth understanding in the development and/or causes of ibd will require a critical understanding of the interplay between several factors , including genetic susceptibility loci , the host immune system function , the development and composition of the intestinal microflora , and environmental factors such as diet , antibiotic treatment , appendectomy , and hygiene status [ 13 ] . recent technical advances that allow for whole genome / exome sequencing [ 4 , 5 ] and large scale genome wide association studies ( gwas ) [ 6 , 7 ] have led to a dramatic expansion of genetic studies and significantly advanced our understanding of the importance of susceptibility loci associated with chronic ( auto-)immune diseases including ibd [ 49 ] . not only have ngs approaches been used to identify new and rare variants causing ibd using whole genome and/or whole exome sequencing , but also they have been used to facilitate transcriptome profiling in tissues from ibd patients ( rnaseq analysis ) and perform epigenomic characterization using chip - seq technology . in addition , next - generation sequencing allows for an in - depth analysis of the intestinal microbiome through 16s rrna sequencing and thus promises to identify the role of microflora in ibd development . to date , more than 160 ibd genes and/or loci have been identified by gwas [ 10 , 11 ] , most of them contributing modestly ( relative risk of < 2-fold ) to disease susceptibility . the identified loci predominantly represent polymorphisms in genes involved in the innate and/or adaptive immune function [ 1315 ] but also involve genes required for autophagy [ 16 , 17 ] , epithelial barrier function , and/or activation of the endoplasmic reticulum stress response , indicating the diverse etiology of ibd [ 13 , 20 , 21 ] . the biological consequences and establishment of causality for associated variants still remain a challenging endeavor that relies on in - depth prior knowledge of gene function [ 22 , 23 ] . as a consequence , for a large number of ibd loci , the functional alleles have not been confirmed and often the causal gene itself is unclear . nonetheless , traits that currently have been confirmed as susceptibility genes for ibd and are subject of intense research efforts include nod2 , hla class ii , il23r , and genes involved in autophagy ( e.g. , leucine - rich repeat kinase 2 [ lrrk2 ] , atg16l1 , and immunity related guanosine triphosphate m [ irgm ] ) . for some , gene function is well defined [ 26 , 27 ] ; however , the functional implications of gene variants and how they predispose to colitis often remain elusive [ 8 , 28 , 29 ] . whereas cd and uc behave as polygenic traits , rare cases of early - onset severe ibd presenting in infancy mostly behave as mendelian disorders resulting from autosomal recessive mutations in single genes [ 3034 ] . mutations in il10ra , il10rb , or x - linked inhibitor of apoptosis ( xiap ) that cause severe forms of cd in infants born to consanguineous parents are prime examples . unfortunately , because of the disease severity often seen in early - onset ibd and the low frequency of patients carrying ( unique ) variants that may be life - threatening , identification of the genetic cause has often proved to be challenging . current strategies involve resequencing of candidate genes and/or sequencing the whole genome / exome of individual patients by next - generation sequencing . while ngs has the potential to unveil all genome-/exome - wide variants , the understanding of the biological consequences of such variants again is challenging and requires a priori knowledge of gene function . the use of ( genetic ) animal models has been helpful in providing biological insights into how genetic susceptibility loci affect gut homeostasis and , for instance , has revealed critical immunological pathways that are required for immunological tolerance in the gut [ 22 , 38 , 39 ] . moreover , such models have revealed insight into the intricate balance between ( altered ) immune function and the role of microflora to ibd development . to this extent , both forward and reverse genetic approaches have been valuable tools to improve our understanding of genes function , their regulation , and other complex interactions at the cellular and organismal level . our laboratory has applied an n - ethyl - n - nitrosourea ( enu ) mutagenesis approach to identify genes with nonredundant function in lymphocyte development , priming , or effector function . as a result , we have identified a number of germ - line mutants that exhibit impaired peripheral tolerance , lymphocyte survival , and/or t cell activation [ 22 , 4143 ] . among these , an enu germline , designated sphinx , exhibited reduced peripheral t cell survival while developing spontaneous early - onset colitis development . the development of ibd - like intestinal inflammation in gimap5-deficient mice exhibits hallmark features of ibd development in humans that include ( 1 ) a critical role for microbial flora ; ( 2 ) colitis that is cd4 t cell driven ; and ( 3 ) a concomitant loss of immunological tolerance , exemplified by a progressive decline in regulatory t cells ( treg ) numbers and function . here , we discuss these critical aspects in the context of human ibd and consider the mechanistic pathways by which loss of gimap5 leads to a loss of immunological tolerance ultimately causing the development of early - onset and severe colitis . the intestine represents a potential gateway for microbial pathogens but also contains commensal flora and dietary antigens that require strict immune tolerance . it is therefore no surprise that the gut constitutes the largest lymphoid organ in the body containing an extensive network of secondary lymphoid organs , with an enormous number of leukocytes , including several lymphocyte subpopulations that are uniquely observed in the gut [ 44 , 45 ] . upon activation , the intestinal immune system can mount a range of immune effector functions that have the potential to damage host tissue and reduce epithelial barrier function . thus , a failure to maintain immunological tolerance against commensal flora often results in chronic intestinal inflammation . the intestinal microbiota profoundly affects the immune system development under healthy conditions and thus represents an important environmental determinant of ibd development . this is supported by evidence derived from human studies and studies using mouse models , as reviewed elsewhere [ 9 , 47 , 48 ] . for instance , ( genetic ) mouse models of intestinal inflammation generally do not develop disease when housed under germ - free conditions . moreover , t cell - mediated colitis is largely driven by bacterial antigens and fails to develop following nonspecific activation of host t cells . for example , transfer of ova - specific cd4 t cells from rag-2 ot - ii transgenic mice into rag-2 recipients developed colitis only when recipient mice were colonized with ova - expressing escherichia coli , not with control escherichia coli [ 50 , 51 ] . this finding has led to a particular focus in understanding the role of intestinal microbiota , that is , its composition , regulation , and interaction with the host immune system , in the development of ibd . the gastrointestinal tract harbors more than 10 microorganisms of ~1000 species [ 52 , 53 ] , mostly contained within the colon . over 90% of these consist of bacteroidetes ( gram negative ) and firmicutes ( gram positive ) bacteria . specific bacteroides species directly regulate antimicrobial peptide expression by intestinal epithelium through activation of toll - like receptors ( tlr ) expressed on paneth cells . moreover , the presence of specific bacterial species shapes adaptive immune functions within the intestines , including enterobacteriaceae and bacteroidaceae for tcr intraepithelial lymphocytes ; bacteroides fragilis and a mixture of clostridia strains for t regulatory cells ; and cytophaga - flavobacterium - bacteroidetes and segmented filamentous bacterium for th17 cells [ 5961 ] . thus , changes in the composition of commensal microbiota-(dysbiosis ) may present a critical determinant of host immune responses and thereby contribute to the development of ibd . interestingly , studies involving 16s rrna sequencing from gut biopsy or stool samples revealed a detectable difference between the intestinal microbiota in the two forms of ibd ( cd and uc ) compared to healthy controls . however , whether the observed dysbiosis in microbiota is directly associated with the presence of ibd susceptibility loci or a consequence of intestinal inflammation per se is currently unclear and an area of intense inquiry . a prime example of bacterial species driving colitis is provided by studies involving helicobacter hepaticus a commensal bacterium with opportunistic pathogenic potential [ 57 , 63 ] . although colonization of wild - type c57bl/6j mice with h. hepaticus does not result in inflammation or disease , h. hepaticus induces colitis in il10 or scid / rag2 hosts that received nave cd4cd45rb t cells . this colitis model is driven by homeostatic proliferation of nave t cells through bacterial antigens including the flagellar antigen of h. hepaticus . colitis induction in this model is only observed in the absence of treg cells allowing for robust cd4 t cell effector responses . overall , these observations suggest that perturbations in gut microbiota and host immune system underlie the development of intestinal inflammation and ibd an etiology referred to as the two - hit hypothesis . interestingly , a large number of ibd susceptibility loci identified by gwas studies are shared with other complex ( auto-)immune diseases such as type-1 diabetes , celiac disease , multiple sclerosis , and systemic lupus erythematosus . this is primarily due to the fact that these loci represent genes involved in immune cell signaling , including t cell differentiation , immune tolerance , and/or innate immune responses [ 28 , 67 , 68]immunological pathways that are critical determinants for ( auto-)immune disease . clear examples of such loci are loss - of - function mutations in either il10ra or il10rb . these mutations are linked with severe , early - onset enterocolitis in children a pathology that is also observed in mice lacking either il10 [ 69 , 70 ] or il10rb [ 31 , 35 ] . changes in il-10r variants are functionally linked to alterations in hematopoietic cell function and colitis can generally be cured through hematopoietic stem cell transplantation . interleukin-10 ( il-10 ) is a pleiotropic cytokine with a multitude of anti - inflammatory and immunoregulatory functions , which is secreted by a variety of cell types and is critical for maintaining immune homeostasis of the gut [ 72 , 73 ] . for instance , il-10 modulates the function of apcs through inhibiting phagocytosis , downregulating the expression of mhcs and costimulatory molecules , and decreasing the production of proinflammatory cytokines and chemokines in ibd . moreover , il-10 directly restricts the differentiation of th cells [ 70 , 74 ] and maintains the suppressive activity of treg cells . consistent with this , t cell - specific or foxp3 treg - specific deletion of il10 results in spontaneous colitis , highlighting the importance of treg - derived il-10 in preventing intestinal inflammation . on the other hand , a recent study suggests that macrophages are a prime cell target for il-10 activity in the gut in that loss of il-10ra specifically on macrophages resulted in spontaneous colitis development . overall , these studies establish il-10 as a central mediator in gut homeostasis affecting both innate and adaptive immune responses . the key challenge of the intestinal immune system is to properly respond to pathogens while maintaining immune tolerance towards commensal bacteria and food antigens a process that requires complex cellular and molecular regulatory mechanisms [ 45 , 80 ] . particularly , the presence of unique immunosuppressive cd4 t cell populations has been described in the intestine that control immune homeostasis and prevent inflammation towards harmless foreign antigens . importantly , increased accumulation of cd4 t cells in the intestine is a key feature of inflammatory bowel disease [ 9 , 82 ] and presents an important therapeutic target . intestinal cd4 t cell populations can be broadly classified based on function into effector cd4 t cells and regulatory cd4 t cells . effector cd4 t cells , also referred to as helper t ( th ) cells , play a critical role in the execution of immune functions . these include the development of antigen - specific cd8 t and b cell responses and inflammatory cytokine production causing the recruitment of effector cells such as neutrophils . whereas early studies primarily focused on the functional distinction between th1 ( or ifn- producing cd4 t cells ) and th2 cells ( interleukin 4-producing t cells ) , more in - depth studies in mice suggested that th2 cells were largely absent in healthy mouse colonies in the absence of intestinal parasites . importantly , a third subset , the th17 subset of cd4 t cells , has recently been described as the major t cell population within both healthy and inflamed intestinal mucosa . the identification of this subset has almost entirely shifted the focus on this cell type as a driver of disease in both experimental models and human ibd . th17 cells produce a large number of cytokines , including il-17a and il-17f key cytokines involved in the recruitment and activation of granulocytes and critical to the host response against extracellular bacteria . importantly , microbiota - specific memory th17 cells are far more potent in inducing colitis in recipient mice compared to th1 cells . moreover , a correlation between il17 levels and disease severity in human ibd patients has been observed suggesting a key role for th17 cells and cytokines in ibd . although the classification of these t helper cells suggests a specific and unique cytokine production profile , the cd4 t cells isolated from lamina propria undergoing active colitis can express both il-17 and ifn , indicating the unique plasticity of th17 cells and their ability to convert into th1 cells . given that th17 cells are the main cd4 t cell population in the intestinal tract , this plasticity is thought to be of critical importance to adapt to changes in the local intestinal environment and mount a proper immune response while maintaining gut homeostasis . the importance and dominance of regulatory t cells and their immunosuppressive function are demonstrated by the fact that the majority of individuals do not develop gut inflammation despite an enormous microbial and antigenic load within the intestine . moreover , transfer of nave cd4cd45rb cd4 t cells in lymphopenic hosts such as rag1/2 or scid mice induces lymphopenia - induced t cell activation and colitis only in the absence regulatory t cells ( reviewed in [ 45 , 88 ] ) . thus , tregs cells play a critical role in maintaining immune homeostasis and limiting autoimmune responses by modulating cells of both the innate and the adaptive immune systems . the main types of regulatory cells in the gut are the natural ( thymic ) and adaptive ( induced ) cd4foxp3 tregs , as well as tr1 and th3 cells . the effector pathways by which tregs induce tolerance are multiple and include secretion of inhibitory cytokines such as il-10 and transforming growth factor- ( tgf- ) , granzyme - mediated cytolysis of target cells , expression of cytotoxic t - lymphocyte antigen- ( ctla- ) 4 resulting in t cell inhibition , and metabolic disruption [ 45 , 90 , 91 ] . impaired immune regulation by treg cells will result in a loss of immunological tolerance in the gut and cause colitis . such deficiencies may stem from inadequate numbers of treg cells due to impaired development , proliferation , or survival or defects in immunosuppressive function intrinsic to treg cells . at the site of inflammation , effector t cells are reported to develop mechanisms of resistance to treg regulation [ 92 , 93 ] , although the underlying mechanisms remain poorly defined . in humans , the critical role for treg cells in preventing gut inflammation is further supported by the finding that individuals with genetic abberations in ipex causing functional impairment of the transcription factor foxp3 develop severe bowel inflammation . moreover , patients with genetic mutations in foxp3 who lack or have nonfunctional tregs exhibit severe intestinal inflammation associated with lymphocytic infiltration of the intestinal mucosa [ 95 , 96 ] . similarly , mice lacking foxp3 tregs [ 92 , 97 ] or lacking the ability to suppress via treg - derived cytokines such as il-10 [ 45 , 89 ] , il-35 , and tgf develop severe colitis . together , these studies highlight the importance of cd4 t cells , particularly treg cells , in maintaining gut homeostasis . in addition , they point to monogenic causes of ibd that specifically affect treg function ultimately leading to loss of immunological tolerance and gut inflammation . recently , studies have identified the gtpase of immunity - associated protein 5 ( gimap5 ) as a key factor in maintaining t cell homeostasis and immunological tolerance . gimap5 is part of the family of gimap proteins , which are predominantly expressed in lymphocytes and regulate lymphocyte survival during development , selection , and homeostasis [ 100106 ] . members of this family share a gtp - binding aig1 ( avrrpt2-induced gene-1 ) domain , derived from an aig1 resistant gene first described in arabidopsis thaliana that was induced upon infection with pseudomonas syringae type iii . the aig domain is conserved across vertebrates and angiosperms and , in vertebrates , the family consists of seven ( human and rat ) and eight ( mouse ) members that are clustered within a tight single region on chromosomes 7 , 4 , and 6 , respectively , ( [ 107110 ] and ( figure 1 ) ) . mouse gimap5 is a 308-amino acid protein that contains an aig1 domain ( residues 24227 ) comprising five gtp - binding motifs ( g1g5 ) , a p - loop ntpase domain ( residues 1168 ) , two coiled - coil domains ( residues 187221 and 239265 ) , and a transmembrane domain ( residues 284304 ) ( [ 105 , 106 ] and ( figure 1 ) ) . recent crystallographic studies revealed that the gimap proteins manifest a nucleotide coordination and dimerization mode similar to dynamin gtpase a component essential for the scission and fusion of cellular vesicular compartments such as endosomes [ 111 , 112 ] . members of the gimap family appear to be expressed in different subcellular compartments , with gimap5 localizing in multivesicular bodies ( mvbs ) and lysosomes in lymphocytes . genetic aberrancies of gimap5 have been linked to impaired immunological tolerance , lymphocyte survival , homeostasis , and autoimmunity in a variety of species including humans , mice , and rats . in humans , polyadenylation polymorphisms in gimap5 are associated with increased concentrations of ia2 autoantibodies in type 1 diabetes ( t1d ) patients and an increased risk of systemic lupus erythematosus sle [ 115 , 116 ] . moreover , in patients with t1d , expression of several gimap genes including gimap5 is reduced in treg cells compared to healthy individuals . in a spontaneous rat model of type i diabetes ( the biobreeding diabetic prone ( bb - dp ) rats ) , abnormal thymocyte development and premature death of peripheral cd4 and cd8 t - cells [ 110 , 118 , 119 ] were linked to a frame shift mutation in gimap5 , designated lyp , causing a truncated nonfunctional protein ( gimap5 ) [ 100106 ] . in the presence of the diabetogenic mhc locus iddm1 , this lyp mutation is essential for diabetes onset in bb - dp rats ultimately triggering lethal disease [ 105 , 106 , 110 ] . however , the loss of lymphocyte survival in gimap5 mice is not limited to t cells , but also extends to reduced survival of nk , inkt , and b cells with extensive extramedullary hematopoiesis observed in the liver . these observations were confirmed by an n - ethyl - n - nitrosourea ( enu ) induced gimap5-germline mutant identified in our laboratory designated sphinx . enu is a widely used mutagen to create random germline point mutations in mice and has proven to be an effective approach to probe and identify critical genes for any phenotype of interest , for example , colitis or development / function of the immune system [ 22 , 121 ] . phenotypes causing enu mutations primarily involve missense mutations ( ~61% ) or nonsense mutations ( 10% ) ( source : http://mutagenetix.utsouthwestern.edu/ ) , the type of genetic variants that can be found in humans . the sphinx mutation involved a gt point mutation in gimap5 resulting in a g38c substitution in the predicted gtp - binding domain of gimap5 . the mutation destabilized the protein and caused a complete loss - of - function similar to the published gimap5 ko . specifically , the sphinx mutant exhibited a similar reduced lymphocyte survival , including loss of nk cells , cd4 t , cd8 t , and b cells to the gimap5 knockout mice reported . this mutation resulted in a g38c substitution in the predicted gtp - binding domain of gimap5 , destabilizing the protein and causing a complete loss - of - function . interestingly , from birth until weaning , sphinx ( or gimap5 ) mice appear outwardly healthy . however , after 7 - 8 weeks of age , mice lose weight and develop severe colitis , exemplified by goblet cell depletion , lamina propria leukocyte infiltration , epithelial cell hyperplasia , and crypt loss [ 42 , 43 ] . the severe colitis likely contributed to the early mortality of gimap5 mice , which generally occurred by 14 weeks of age . interestingly , antibiotic treatment blocked intestinal inflammation in gimap5 mice , suggesting a critical role for the microbiome also in this spontaneous model of colitis . overall , inflammation of the gut in gimap5 mice is early - onset and behaves as a monogenic trait , thus very similar to mutations in il10ra , il10rb , or xiap [ 32 , 33 , 122 , 123 ] . gimap5
mice exhibit an absence of nk or cd8 t cell populations in peripheral lymphoid organs . interestingly , relatively normal thymocyte development occurs , including cd4 t cell , cd8 t cell , and foxp3 regulatory t cell lineages . nonetheless , gimap5 mice exhibit a progressive reduction in circulating cd4 t cells and the cd4 t cells that remain after five weeks of age exhibit a lymphopenia - induced proliferation ( lip ) phenotype ( cd44 and cd62l ) , a t cell phenotype associated with autoimmunity . interestingly , despite their reduced survival , gimap5 cd4 t cells produced exceeding amounts of ifn and il-17a compared to wild - type cd4 t cells and exhibited spontaneous activation in the gimap5 gut tissue pointing to a potentially critical role of cd4 t cells in this disease model . indeed , antibody - mediated cd4-depletion in vivo prevented colitis in these mice corroborating the importance of cd4 t cells in the pathogenesis . the lymphopenia and expression of cd44cd62l markers by cd4 t cells ( figure 2 ) are indicative of lymphopenia - induced proliferation and resemble the cd4 t cell phenotype first described in the adoptive transfer t cell model of colitis . as mentioned , the development of cd4 t cell - induced colitis in gimap5 can be prevented by antibiotic - treatment , again confirming the critical role of the microbiota in t cell activation . although the intestinal microbiota provide a potentially large source of foreign antigens that may drive the t cell response towards gut tissue , it is important to note that many autoimmune diseases are associated with immune - deficiencies which result in lymphopenia and subsequent the genetic and molecular basis of how these complex processes are controlled still remains incompletely defined . treg cells have been implicated as a critical factor in the development of disease following homeostatic proliferation and a similar critical role for treg cells was observed in the colitis development in gimap5 mice . specifically , gimap5 mice fail to maintain a treg population with immunosuppressive function . whereas relatively normal numbers of foxp3 treg cells were found in spleen and lns of 3-week - old mice , more importantly , a progressive loss of treg function in mln of gimap5 mice was observed . whereas treg cells from 4-week - old gimap5 mice showed a slight but significant reduction in their ability to suppress wild - type cd8 t cell proliferation in vitro , treg cells from older ( 6-week - old ) gimap5 mice were incapable of suppressing wild - type cd8 t cell proliferation , suggesting a critical loss of treg function and survival to be responsible for colitis development in these mice ( figure 2 ) . indeed , transfer of wild - type cd4cd25 treg cells into gimap5 early on prolonged survival , prevented increased cd4 t cell effector function in the mln , and protected these mice from colitis . together , these data indicate that gimap5 is a critical determinant of treg survival and function , thereby controlling gut homeostasis . the critical role of gimap5 in treg survival / function is also evident in type 1 diabetes in biobreeding rats [ 105 , 106 ] and may clarify why polyadenylation polymorphisms in gimap5 , leading to rather subtle changes in gene expression , are associated with human autoimmune diseases such as t1d and sle . given the loss of treg development / function , key questions currently center on understanding the molecular pathways by which gimap5 controls t cell survival and peripheral tolerance . a number of studies have implicated gimap5 to interact with bcl2 members in mitochondria and implicated a critical role for gimap5 in controlling proapoptotic pathways in t cells . data in our laboratory , however , revealed no improved survival of lymphocytes ( or prevention of colitis for that matter ) when gimap5 mice were crossed to bim - deficient or bax / bak - deficient backgrounds ( aksoylar and hoebe ; unpublished data ) suggesting that the reduced t cell survival is likely independent of the classical proapoptotic pathways . in terms of peripheral tolerance , a striking similarity is observed with the phenotypes reported in mice deficient in the family of fork - head box group o ( foxo ) transcription factors . the family of foxo transcription factors contains 4 members of which three ( foxo1 , foxo3 , and foxo4 ) have overlapping patterns of expression and transcriptional activities and they play an essential role in the quiescence and survival of cd4 t cells [ 126 , 127 ] . in addition , foxo expression has been reported to be essential for treg cell development and function [ 128 , 129 ] . the potential mechanisms by which foxo transcription factors control treg development and function have been described in detail and include their role as coactivators downstream of the tgf signaling pathway by ( 1 ) interacting with smad proteins [ 130 , 131 ] and by ( 2 ) directly regulating the induction of a number of treg cell associated genes , including foxp3 itself but also ctla-4 and cd25 [ 128 , 129 ] . importantly , cd4 t cells from gimap5 mice revealed a complete absence of foxo1 , -3a , and -4 proteins . this effect was predominantly observed at the protein level with relatively normal rna levels in cd4 t cells , suggesting that regulation of foxo3 and foxo4 protein expression occurs predominantly at the posttranslational level . interestingly , the loss of foxo expression was progressive and correlated with the loss of immunological tolerance in gimap5-deficient mice . importantly , the loss of foxo expression in gimap5 cd4 t cells was specifically observed in cells undergoing lip , which may suggest degradation of foxo expression due to constitutive homeostatic activation of t cells ( figure 2 ) . although t cell activation in general results in a brief transient loss of foxo expression , loss of foxo expression is not observed following transfer of wild type cd4 t cells into lymphopenic rag2-deficient hosts ( aksoylar , hoebe ; unpublished results ) , suggesting that the loss of foxo proteins in gimap5-deficient cd4 t cells involves a unique degradation mechanism . importantly , the loss of foxo expression in gimap5 cd4 t cells correlated with a loss of treg population and function and likely represents an important determinant of the colitis pathology observed in these mice . a genetic alteration in gimap5 has been strongly linked with reduced t cell survival and loss of immunological tolerance in both animal models and human studies . this results in predisposition to a variety of autoimmune related diseases including t1d , sle , and colitis . despite the profound impact of gimap5 deficiency in terms of both lymphoid survival and peripheral tolerance , very little is understood about the molecular mechanisms underlying these robust phenotypes . thus , a number of critical questions remain to be addressed that include ( i ) what is the molecular function of gimap5 in t cells following activation ? , ( ii ) what are the mechanistic pathways by which loss of gimap5 causes reduced lymphocyte survival and peripheral tolerance in vivo ? , and ( iii ) why do cd4 t cells in gimap5-deficient mice exhibit loss of foxo expression at the posttranslational level ? finally , given the severe phenotypes related to the host immune system observed in both mouse and rat gimap5-deficient models , a gimap5 null phenotype in humans is expected to result in a severe immunodeficiency , although the phenotype has yet to be described . such a severe immunodeficiency would be predicted to present in infancy as a monogenic trait and , with the current sequencing capacity and efforts , de novo mutations in gimap5 should be considered prime causal candidates . regardless , the detailed mechanistic insight into the loss of t cell survival and immunological tolerance in gimap5 mice may ultimately help our understanding as to how polyadenylation polymorphisms in gimap5 predispose to t1d or sle in humans . in addition , these studies point to a new candidate genetic susceptibility locus that should be taken into consideration for variants identified in early - onset colitis in pediatric patients . | inflammatory bowel disease ( ibd ) including crohn 's disease and ulcerative colitis is often precipitated by an abnormal immune response to microbiota due to host genetic aberrancies .
recent studies highlight the importance of the host genome and microflora interactions in the pathogenesis of mucosal inflammation including ibd .
specifically , genome - wide ( gwas ) and also next - generation sequencing ( ngs)including whole exome or genome sequencing have uncovered a large number of susceptibility loci that predispose to autoimmune diseases and/or the two phenotypes of ibd .
in addition , the generation of ibd - prone animal models using both reverse and forward genetic approaches has not only helped confirm the identification of susceptibility loci but also shed critical insight into the underlying molecular and cellular pathways that drive colitis development . in this review , we summarize recent findings derived from studies involving a novel early - onset model of colitis as it develops in gtpase of immunity - associated protein 5- ( gimap5- ) deficient mice . in humans , gimap5 has been associated with autoimmune diseases although its function is poorly defined . here , we discuss how defects in gimap5 function impair immunological tolerance and lymphocyte survival and ultimately drive the development of cd4 + t cell - mediated early - onset colitis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
human cystic echinococcosis is a parasitic zoonosis caused by the larval form of echinococcus granulosus , the dog tapeworm , which accounts for 95% of human echinococcosis cases . human cystic echinococcosis is present worldwide except in iceland , ireland , and greenland , and remains highly endemic in many rural communities . in developed countries , such as the united states , this is mainly a disease of immigrants although there has been reported local transmission to humans in california , arizona , new mexico , utah and alaska , . cystic echinococcosis has a mortality of 24% and may be more common in the united states than generally recognized , in part because the disease is not reportable , . worldwide , echinococcosis causes an estimated annual loss of us $ 194,000,000 or 285,000 disability - adjusted life years . hydatidosis is usually transmitted by the unintentional ingestion by humans of food or water contaminated with fecal material from infected canines . the tapeworm inhabits the small intestine of canines , the definitive host , and may release thousands of embryonated eggs in the feces each day . the viability of these eggs may exceed 1 year when deposited into a cool , moist environment . when ingested , these eggs hatch in the small intestine releasing an oncosphere which matures into a metacestode . the metacestodes penetrate the bowel wall and migrate via the circulatory system to a number of organs including but not limited to the liver , , . in the liver , or other organ to which the parasite migrates , a cyst develops , enlarges , becomes filled with protoscoleces and daughter cysts and undergoes a predictable evolution over a number of years with characteristic imaging features . the cysts tend to increase in size by about 15 cm per year with calcification occurring 510 years post infection , but this development varies depending on the individual infected as well as the particular genotype of the infecting parasite , . in areas of the world where hydatidosis is endemic , control programs have been established to eradicate it by interrupting the zoonotic cycle , through the use of health education , meat inspection , dog testing , dog treatment , and in some cases large - scale canine culling . although island control programs have been successful in iceland , new zealand , tasmania , falklands and cyprus , outcomes for continental control programs , in africa , asia and south america , have not been as favorable . if the efficacy and feasibility of canine vaccination , which is currently being tested , are established , imaging often plays a large role in the diagnosis of this disease , but despite the greater than 90% sensitivity of ultrasound for hepatic hydatidosis there often is a challenge in distinguishing between an echinococcal cyst and a simple liver cyst . a number of serological tests are available for echinococcal disease including igg elisa , but these tests have less than optimal sensitivity and issues with specificity , . accurately distinguishing an echinococcal cyst from a simple cyst is critical in the management of these infected patients because approximately 10% of the time , the accidental leakage of hydatid cyst contents into the abdominal cavity results in an often fatal anaphylactic reaction , . a 29-year - old immigrant from bangladesh was admitted to long island jewish hospital in february 2013 with fever , abdominal pain and chills . this young woman was married with two young children and had a past medical history of migraines treated with sumatriptan as needed , a benign ovarian cyst , and a prior episode of nephrolithiasis . she moved to the united states in 2008 , at the age of 24 years , and had returned to bangladesh only once when she visited her family in january 2010 . the patient reported contact with her family 's dogs while in bangladesh . upon admission , she was diagnosed with influenza b on the basis of symptoms and a positive polymerase chain amplification test from a respiratory viral panel test . although the patient 's immediate symptoms resolved after several days without any specific therapy , an abdominal computed tomography ( ct ) scan was performed as part of the evaluation of her abdominal pain . the abdominal ct scan revealed a heterogeneous hypoattenuating mass in the liver ( 8.4 cm 5 cm 5.2 cm ) ( fig . scan of the liver suggested that this was a complex cyst , without surrounding edema , showing numerous serpiginous septations . the patient was discharged from the acute care setting and was scheduled for follow - up care in the outpatient setting . the patient was seen in the outpatient clinic several weeks later , in the beginning of april , and noted to have a negative echinococcal igg elisa . despite this negative test the clinical suspicion was high enough that the patient was started on albendazole and a repeat imaging test was ordered . in the beginning of may a portion of the fluid was sent for immediate microscopic evaluation , performed at the time of surgery , and the remaining fluid was sent to the diagnostic parasitology division of the nsljhs core lab . the cyst was injected with 20% hypertonic saline and then , after a 10-min dwell time , reaspirated . the cyst was then opened and explored . at the time of surgery , only a simple cyst was evident with no septations ; no smaller cysts and no obvious daughter cysts were noted . the patient tolerated the procedure well and was discharged to home after her hospital stay to complete a several month course of albendazole . evaluation of the cyst contents in the parasitology lab revealed numerous hooklets in the aspirated fluid confirming the diagnosis of an echinococcal cyst . there are a number of features of this case of human hepatic hydatidosis that make it both interesting and challenging for the clinician . the travel and exposure history , the negative serology and the negative microscopic evaluation of the cyst contents reported during the time of surgery are three aspects that deserve a bit more attention . since certain parasitic diseases are characterized by long incubation periods between exposure and disease or diagnosis , an extensive travel and exposure history is required to be taken by the clinician in order to introduce infection with e. granulosus , the dog tapeworm , into the differential diagnosis . on initial history this patient was noted to be a young woman living in the urban environment of queens , new york , with no travel within the last 3 years and no exposure to pets or other animals . a deeper exploration of this woman 's past history revealed that she was born and raised in a rural part of bangladesh where her family was involved in animal husbandry and she was exposed to dogs . this woman had moved out of this environment 5 years previously , but just over 3 years prior to this liver cyst coming to medical attention she had traveled back to visit her family in the endemic area . with the very variable course of e. granulosus it is not possible to be certain whether her infection was acquired during her return to bangladesh in january 2008 or whether this was acquired prior to her emigrating to the us , although the stage of the cyst would favor infection during her january 2008 visit . in addition to the long period between exposure and diagnosis is the fact that this woman falls into the identified high - risk group of international traveler termed traveler visiting friends and relatives ( vfrs ) . even an adventurous traveler to a destination is unlikely to have the exposure that this woman had upon visiting her family 's home and directly interacting with the family dogs . despite the history and other features of the case being so compelling a number of the neglected diseases ( ntds ) , less common in the developed world , have diagnostic assays lacking the high level of sensitivity of many elisas commonly ordered in these areas . a negative serology does not rule out cystic echinococcosis ( ce ) as clearly demonstrated in this case . not only may a patient have an echinococcal cyst with a negative serology , but there may also not be a consistent relationship between the extent of the infection and serological results , . in some series 3040% of patients with hepatic cystic echinococcosis are antibody negative and this may be due to the ability of e. granulosus antigens to inhibit b cell activity and proliferation . although the sensitivity of serological testing is not clearly dependent on the extent of disease , it does appear to be dependent on cyst stage . patients with cystic echinococcosis can be staged according to the who criteria and may fall in the spectrum between ce1 and ce5 ( fig . patients with early or inactive cyst stages may only have positive serologies as little as 54.8% , and patients with simple cysts staged at ce1 may only be positive 73.7% of the time . the sensitivity of the elisa increases for patients with active disease staged as ce2 and ce3 . we used an echinococcal igg elisa , which in our lab reflexes to a confirmatory western blot when positive . this test has perhaps the highest positive predictive value among the available serological tests , but unfortunately may only have a negative predictive value of < 90% . one possible approach to a compelling clinical case with negative igg elisa is to perform several serological tests using different modalities such as indirect hemagglutination , latex agglutination , immunoelectrophoresis , or radioallergosorbent testing . it has been demonstrated that since the size , location and clinical stage of the cyst affect the accuracy of the various serological tests , a combination of several tests can improve diagnostic accuracy . one might also consider repeating the same serological test at different laboratories as change in sensitivities can occur due to the batch - to - batch variation in the prepared antigens . due to the limitations of current serological assays , a number of researchers are actively investigating the use of specific echinococcal peptides and echinococcus protoscolex soluble somatic antigens ( pssas ) . the use of specific echinococcal peptides and echinococcus pssas may increase our sensitivity and specificity and even allow staging of the disease with serological rather than imaging tests . in our case , we chose to proceed with a clinical diagnosis of cystic echinococcosis despite the negative serology , considering that further testing would not have changed our planned management . in this woman 's case , microscopic fluid evaluation during the surgical procedure was unrevealing and there was no reported visualization of protoscoleces , hooklets or fragments of laminated membrane . visualizing diagnostic hydatid elements in wet , unstained mounts of cystic fluid sediment is challenging and time consuming ; thus researchers are searching for potentially superior techniques such as rapid antigen detection assays , . our institution 's access to a parasitology laboratory with technicians experienced in the identification of hydatid fluid sediment was critical for the correct diagnosis and appropriate management of this patient . at institutions without access to a parasitology lab , clinicians should refer patients with possible hydatidosis to a center with such access if hydatidosis diagnosis would be critical in the proper care of the patient . critical to the successful outcome in this case was that , despite the distant history of exposure , the negative serology , and the negative microscopic examination during the time of surgery , the patient was still optimally treated . the patient was pretreated with albendazole , the cyst was properly aspirated without leakage , a protoscolicide ( hypertonic saline ) was injected , with an appropriate dwell time , and then the cyst was re - aspirated prior to surgical removal . optimal management of cystic echinococcosis is guided by cyst stage and an expert consensus for guiding the clinical management of these patients has been generated under the aegis of the world health organization informal working group on echinococcosis ( who - iwge ) . the appearance , classification of cyst stage , description and recommended treatments are presented in fig . 3 . every effort should be made to prevent protoscolex spillage and sterilize the germinal layer as the mortality rate of 24% usually seen in cases of cystic echinococcus may be increased if patients are improperly treated . spillage of viable protoscoleces from a cyst may result in anaphylaxis , secondary cystic echinococcus or death . despite the staging of echinococcal cysts being based on ultrasound characteristics of the identified cysts , in developed countries , ct scans and mri scans may be selected by the clinicians responsible for the management of these patients . following an initial ct , this patient underwent two mri scans , the first to further characterize the cyst and the second to evaluate any change in the cyst . it is suggested that mri is superior to ct in reproducing the ultrasonic features and heavily t2-weighted mri series may even be superior to ultrasound for certain cyst location or patient - specific reasons . | human cystic echinococcosis ( hydatidosis ) is a parasitic zoonosis with almost complete worldwide distribution .
echinococcus granulosus , the dog tapeworm , causes hydatidosis which accounts for 95% of human echinococcosis .
although this tapeworm is found in dogs as a definitive host and a number of intermediate hosts , humans are often infected from close contact with infected dogs .
humans are not part of the parasitic lifecycle and serve as accidental hosts .
hydatidosis is an important consideration in the differential diagnosis of hepatic cysts in individuals from endemic areas .
clinicians should be aware of the long incubation period , the high frequency of negative serological tests , and the possibility of intraoperative evaluations of the cyst aspirate being non - diagnostic .
we describe a case of serology negative hydatidosis that came to medical attention as an incidental finding in a young woman from bangladesh . the patient underwent imaging and was then started on albendazole .
after several weeks of albendazole , the cyst was punctured , aspirated , injected with hypertonic saline , re - aspirated , and then fully excised .
diagnosis was confirmed by microscopic evaluation of the cyst aspirate .
serological tests for hydatidosis may be negative in patients with early disease and thus should not be used to rule out this disease .
consideration of this diagnosis allows clinicians to avoid the catastrophic spillage of cystic contents risking an anaphylactic reaction , which might prove fatal . despite world health organization hydatidosis staging being based on ultrasound
, radiologists in resource - rich setting may prefer mri in the management and staging of cystic echinococcosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the 23-gauge cannula transconjunctival sutureless vitrectomy has been widely used for treatment of vitreous and retinal diseases , including intraocular silicone oil removal . as compared to conventional 20-gauge cannula , the 23-gauge cannula system has some advantages , such as more secure surgical procedure and faster wound healing [ 1 , 2 ] . new approaches for injecting and removing silicone oil in sutureless vitreoretinal surgery have been developed accordingly [ 15 ] . however , the silicone oil is difficult to be completely removed from the vitreous chamber even when using the 23-gauge cannula system . many postoperative complications related to intraocular silicone oil have been reported , including secondary glaucoma , corneal endothelial decompensation , and intraconjunctival oil inclusion cysts . furthermore , the patients often complain about floaters , which interfere with their vision and quality of life . in order to remove the silicone oil and emulsified silicone oil drops completely , we report a new surgical approach with temporal head positioning and passive fluid - air exchange through two 23-gauge cannulas . twenty - four silicone oil eyes of 24 patients , from the eye hospital of wenzhou medical university , were enrolled between december 2013 and june 2014 . the study followed the tenets of the declaration of helsinki and was approved by the ethics committee of wenzhou medical university . all patients with primary vitreous or retinal disease , such as vitreous hemorrhage , rhegmatogenous retinal detachment , and proliferative vitreoretinopathy , who previously underwent 23-gauge transconjunctival sutureless vitrectomy and silicone oil ( 5,000 cst ) injection in the eye hospital of wenzhou medical university , were included in this study . silicone oil was used as tamponade for all eyes for at least 3 months before removal . the binocular indirect ophthalmoscope , optical coherence tomography ( oct ) , and b - scan all indicated that the retina was attached preoperatively . all procedures were performed by the same surgeon ( zhi sheng ke ) using 23-gauge ( midlaps , us ) valve casing transconjunctival sutureless vitrectomy system after retrobulbar anesthesia with a 50% mixture of 2% lidocaine and 0.75% bupivacaine . to begin the surgery , two 23-gauge cannulas , that is , the superior - nasal infusion cannula and the inferior - temporal operation cannula , were established . a trocar was inserted into the intended sclerotomy site at an angle of approximately 30 parallel to the limbus with the bevel up . once past the trocar sleeve , the angle was made perpendicular to surface and the cannula was inserted into the eye . the cannula was held in place with forceps , and then the trocar was removed . the adaptor of a blood transfusion tube ( model : is - v9 ; shanghai kindly enterprise development group , shanghai , china ) was cut with scissors ( figure 1 ) . the inferior - temporal cannula valve was removed and connected to one side of the blood transfusion tube . the diameter of the cannula without the valve was 1.96 mm , and the diameter of the blood transfusion tube was 2.00 mm . the negative pressure of the vitrectomy instrument was adjusted to approximately 600 mmhg ( 1 mmhg = 0.133 kpa ) . the silicone oil removal was started through the blood transfusion tube . during the oil removal , anterior chamber wash was performed to assist the removal of oil drops when necessary . after that , the fundus status was examined by inserting a 23 g light probe . additional procedures , such as endolaser and membrane peeling , were performed as needed through the cannula(s ) . if the fundus was in good condition , the blood transfusion tube was removed from the inferior - temporal cannula . at the same time , the patient 's head was gradually turned temporally by approximately 90. a passive fluid - air exchange was started to remove the residual silicone oil as well as balanced salt solution ( bss ) out of vitreous cavity ( figure 2 ) . the air irrigation pressure was reduced to 1015 mmhg . at this time , the temporal sclera and cannula were observed directly , since they were turned out of the visual field of microscope . if leakage was noticed and continued beyond 1 minute , a suture was placed to close the wound . the time taken for silicone oil removal and total surgery postoperative residual silicone oil in the anterior chamber and vitreous chamber was verified by slit lamp examination and b - scan , respectively , within 2 days after surgery . preoperative iop and postoperative iop at one day , three days , one week , one month , and three months were recorded . all statistical analyses were performed with statistical analysis system for windows version 9.1.3 ( sas inc . , cary , nc ) . a p value of < 0.05 was considered statistically significant . the mean time interval between pars plana vitrectomy with silicone oil tamponade and removal of silicone oil was 3.5 0.8 months . fifteen eyes were aphakic , 8 eyes were pseudophakic with an intact posterior capsule , and 1 eye was phakic . no severe postoperative complications were noted , such as severe decrease of intraocular pressure , corneal edema and opacity , intraocular tissue damage , intraocular hemorrhage , and retinal detachment . postoperatively , all the patients had a clear anterior chamber and vitreous cavity on slit lamp and b - scan examination , respectively ( figure 3 ) . one patient with sutured scleral incisions complained of foreign body sensation ( 4.2% ) and 1 ( 4.2% ) patient complained of floaters postoperatively . the mean time taken for silicone oil removal and besides , 8 eyes underwent posterior capsulotomy , intraocular lens was implanted in 10 aphakic eyes , 1 eye underwent phacoemulsification , 7 eyes underwent an additional cannula to peel epiretinal membrane , and 6 eyes underwent retinal laser photocoagulation . the mean iop before surgery and 1 day , 3 days , 1 week , 1 month , and 3 months after surgery was 13.7 3.9 mmhg , 9.0 5.8 mmhg , 11.3 7.6 mmhg , 16.1 6.9 mmhg , 17.7 4.8 mmhg , and 17.1 3.5 mmhg , respectively . at 3 months postoperatively , the bcva improved compared to that preoperatively ( snellen , 0.28 0.31 versus 0.12 0.15 ) . previous studies reported that residual silicone oil may cause keratopathy and secondary glaucoma and even migrate along the intracranial portion of the optic nerve and into the lateral ventricles of the brain . compared to conventional 20-gauge cannula transconjunctival suture to remove silicone oil , silicone oil removal by 23-gauge cannula transconjunctival sutureless vitrectomy system has some advantages , such as better eye closure and less incision leakage [ 1 , 2 ] . however , the main problem of silicone oil removal is still the residue of silicone oil . in this study the principle behind this method is related to the physical property of silicone oil itself . first , the silicone oil easily floats above water , since its density ( 0.97 g / cm ) is lower than water ( 1.0 g / cm ) . second , the silicone oil tends to form oil droplets above water when it coexists with air , since its surface tension is lesser ( 35 mn / m ) than that of air ( approximately 80 mn / m ) . third , silicone oil droplets tend to fuse together above water , since it has high viscosity ( 5000 cst ) . the present silicone oil removal approach was performed not only through 23 g transconjunctival sutureless vitrectomy system , but also combined with the passive fluid - air exchange . at the beginning of the passive fluid - air exchange operation , the residual silicone oil drops at the bottom of the vitreous cavity rose up , while the bss went into the vitreous cavity . the emulsified silicone oil droplets adhering to the retinal surface would be pushed into the vitreous cavity , while the air entered into the vitreous cavity . the silicone oil droplets would float up because of buoyancy and finally form a thin oil layer between the air ( upper layer ) and the bss ( bottom layer ) . at that time , the patient 's head was gradually turned temporally by approximately 90 , so that the silicone oil layer together with bss would flow out of the eyeball through the inferior - temporal cannula due to gravity ( figures 2 and 4 ) . in this study , the mean time intervals of silicone oil removal and total surgery were 8.0 1.4 minutes and 12.4 2.5 minutes , respectively . since the passive fluid - air exchange of this approach does not require the use of corneal contact lens , noncontact observation lens , vitrectomy probe , or backflush needle , the time is apparently shorter than traditional method . however , the small sample size , lack of controlled group , and relatively short follow - up time are the limitations . second , there is no need for the vitrectomy probe or backflush needle to be inserted into the vitreous cavity during the fluid - air exchange operation of this approach . third , the fluid - air exchange operation can be performed even without transparent refractive media . , this new approach of silicone oil removal uses negative pressure of traditional microinvasive vitrectomy system to aspirate most of the silicone oil . the technique also uses passive fluid - air exchange to remove the remaining emulsified silicone oil droplets . | purpose . to report a new approach for removal of silicone oil .
methods .
all surgeries were performed using 23-gauge vitrectomy system with two transconjunctival sutureless cannulas . at the beginning ,
most of the silicone oil was removed by traditional microinvasive vitrectomy system through inferior - temporal cannula .
then , the blood transfusion tube is removed from the inferior - temporal cannula , and the fluid - air exchange is performed .
a passive fluid - air exchange was performed to aspirate the residual silicone oil after gradually turning the patient 's head temporally by approximately 90 gradually .
results . after the surgery
, all patients had a clear anterior chamber and vitreous cavity on slit lamp and b scan examination , respectively . the mean time taken for silicone oil removal and
total surgery was 8.0 1.4 minutes and 12.4 2.5 minutes , respectively .
the mean intraocular pressure 1 day , 3 days , 1 week , 1 month , and 3 months after surgery was 9.0 5.8 mmhg , 11.3 7.6 mmhg , 16.1 6.9 mmhg , 17.7 4.8 mmhg , and 17.1 3.5 mmhg , respectively .
conclusion
. this new approach may provide a safe and fast method to remove the silicone oil . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
granulomatosis with polyangiitis ( gpa ) , previously known as wegener s granulomatosis , is multisystemic disease characterized by systemic necrotizing and/or granulomatous vasculitis . inflammation in gpa typically affects the small- to medium - sized arteries of the upper airways , lungs , and kidneys . this may lead to aneurysm formation in these arteries as well as in larger arteries . aneurysm formation is a very rare complication of gpa , and only a few cases have been reported . this is the first report of gpa complicated by aneurysm rupture in an accessory left gastric artery ( alga ) . an alga is also a rare variant gastric artery with an incidence of 3% to 14% in angiographic studies . we herein discuss the management strategy of gpa complicated by aneurysms occurring in this anatomic variant . a 57-year - old japanese man was admitted to our hospital with a 1-month history of pedal edema . his medical history included hypertension , hyperlipidemia , and atrial fibrillation , for which he had undergone atrial ablation 4 years previously . he had no history of using anticoagulant agents . on physical examination , he was afebrile . his blood pressure was 110/68 mmhg , pulse 74 beats / minute , respiration rate 15 breaths / minute , height 168 cm , and weight 68 kg . his respiratory sounds were clear , and his heart sounds were regular without any murmur . the abdomen was soft , and there were no dermatologic manifestations , nasopharyngeal abnormalities , or inflamed joints . laboratory data were as follows : leukocyte count , 7.5 10/l ( 80% neutrophils , 7% lymphocytes , 9% monocytes , and 4% eosinophils ) ; hemoglobin , 7.4 g / dl ; hematocrit , 23.3% ; platelet count , 34.8 10/l ; c - reactive protein , 12.3 mg / dl ; blood urea nitrogen , 56.7 mg / dl ; serum creatinine ( scr ) , 3.2 mg / dl ( 2 years prior to the current presentation , his scr level was 0.93 mg / dl ) ; and albumin , 1.8 mg / dl . urinalysis showed protein of 2 + , occult blood of 3 + , and many dysmorphic red blood cells and red blood cell casts . the proteinase-3 antineutrophil cytoplasmic antibody ( pr3-anca ) level was 157 iu / ml ( reference range , < 3.5 ) , while myeloperoxidase antineutrophil cytoplasmic antibody , antinuclear antibody , and antiglomerular basement antibody were negative . viral serology for human immunodeficiency virus , hepatitis b virus , and hepatitis c virus was unremarkable . serum protein electrophoresis showed that igg , iga , and igm were within normal limits . chest x - ray revealed an infiltrative shadow in the left upper lobe ( fig . chest computed tomography ( ct ) showed multiple intraparenchymal cavitate nodules in the left lung ( fig . chest x - ray on admission , showing an infiltrative shadow in the left upper lobe . chest computed tomography scan on admission , showing multiple intraparenchymal cavitate nodules in the left lung . fiberbronchoscopic biopsy was performed , and periodic schiff - methenamine staining showed no granulomas ; however , numerous neutrophils and macrophages were infiltrating the interstitium . ziehl neelsen and grocott staining were negative . based on renal insufficiency , chest radiographic abnormalities , and pr3-anca positivity , the patient was diagnosed with gpa and began pulse therapy with methylprednisolone at 500 mg / day for 3 days followed by maintenance with prednisolone at 60 mg / day . eleven days after starting steroid therapy , he complained of sudden - onset persistent epigastric pain . laboratory data revealed a hemoglobin level of 7.2 mg / dl , which was 2 mg / dl lower than that 1 day prior . the leukocyte count was 12.8 10/l ( 90% neutrophils , 5.9% lymphocytes , 3.0% monocytes , and 0.8% eosinophils ) , c - reactive protein was 0.76 mg / dl , bun was 70.7 mg / dl , scr was 3.14 mg / d , and pr3-anca was 161 iu / ml . abdominal contrast - enhanced ct confirmed the presence of stringing 5- to 10-mm - diameter aneurysms located on a branch of the left hepatic artery . 2 ) . abdominal contrast - enhanced computed tomography scan performed at the onset of persistent epigastric pain . ( a ) edema and a hematoma are present in the lesser omentum , and accumulation of fluid is present in the abdominal cavity . ( b ) three - dimensional image reconstruction shows the presence of stringing aneurysms located on a branch of the left hepatic artery . rupture of these aneurysms with continuous bleeding was suspected , and angiography of the common hepatic artery was performed on an emergency basis . angiography showed four stringing aneurysms located on the alga arising from the left hepatic artery ( fig . 3 ) . arterial coil embolization to interrupt blood flow in the alga failed , and emergency surgery was performed . ( a ) stringing aneurysms ( white arrows ) are located on an alga ( black arrow ) arising from the left hepatic artery(void arrow ) . surgery revealed accumulation of a large amount of blood in the abdominal cavity and a hematoma in the lesser omentum ; other bleeding sources were not identified . the patient was therefore diagnosed with lesser omental hemorrhage caused by ruptured aneurysms of the alga and underwent partial resection of the lesser omentum , which contained all four aneurysms ( fig . , both the left gastric artery and alga were ligated because they were thought to be feeders of the aneurysms . histopathological examination showed no granulomas , but necrotizing inflammation of the aneurysmal wall was present ( fig . this was consistent with the diagnosis of gpa and thought to be the main factor involved in the pathogenesis of this aneurysmal rupture . resected lesser omentum containing all four aneurysms . postoperative recovery was uneventful , and prednisolone was restarted at 60 mg / day from the first postoperative day . from postoperative day 14 , 900-mg cyclophosphamide pulses were administered intravenously six times on a monthly basis . treatment for gpa was continued , and a follow - up ct scan showed no new signs of vascular inflammation or other aneurysms . gpa is a rare disease ; in japan , its estimated annual incidence is 2.3 cases per million individuals . this rate is much lower than that observed in northern european countries ( norway , 14.4 per million ; sweden , 11.9 per million ) . however , the number of patients with gpa in japan has been gradually increasing and doubled in the past 10 years . the pathogenesis of gpa begins with expression of glycoprotein enzymes such as pr3 on the surface of cytokine - primed neutrophils . pr3-anca then binds to this antigen , activating neutrophils and resulting in cytotoxicity to vascular endothelial cells via release of superoxides , lytic enzymes , and proinflammatory cytokines . pr3-anca is observed in 96% of patients with gpa and helps to establish the diagnosis of gpa . gpa tends to affect the medium and small arteries of the respiratory tract and kidneys . this inflammation can also lead to aneurysm formation in these and larger arteries , although aneurysm formation is a very unusual feature . a medline search of the medical literature revealed that 20 published cases described medium- and large - vessel aneurysms in patients with gpa ( table 1 ) . the mean age of the 21 patients ( including the patient in the present case ) was 44.9 years ( range , 2267 years ) . arterial aneurysms were observed more commonly in men ( n = 17 ) and diagnosed within 1 month from disease onset ( n = 12 ) . most patients had symptoms of vascular ischemia or aortitis ( n = 16 ) , such as abdominal pain ( n = 8) and back pain ( n = 5 ) . four of these nine patients had begun prednisone and other immunosuppressants , but rupture occurred in one patient as long as 22 years after beginning prednisone ; the remaining five patients had never used such drugs when aneurysmal rupture occurred . aneurysms were commonly diagnosed by ultrasound ( n = 5 ) , ct ( n = 12 ) , angiography ( n = 8) , or their combination . with respect to site , 7 cases were large - vessel aneurysms and 14 cases were medium - vessel aneurysms : branches of the celiac axis ( n = 8) , branches of the renal artery ( n = 5 ) , craniocervical artery ( n = 2 ) , coronary artery ( n = 1 ) , and superficial femoral artery ( n = 1 ) . ours is the first reported aneurysm of an alga in a patient with gpa . summary of large- and medium - sized vessel aneurysms in patients with gpa : literature review ns , not stated ; us , ultrasound ; pd , pancreaticoduodenal an alga is a variant gastric artery that arises from the left hepatic artery and supplies the cardia and fundus of the stomach . ishigami et al . stated that this vessel tends to be seen more frequently in japanese than european individuals . an accessory or replaced left hepatic artery arises from the left gastric artery and supplies the lateral segment of the left hepatic lobe . some variant arteries have been reported around the superior mesenteric artery and celiac axis , which contains the left gastric artery , hepatic artery , and splenic artery . these vessels provide a rich blood supply to aid in the digestive process and protect the stomach and liver from potential ischemia or infarction . tandler stated that four primitive vitelline arteries arise from the dorsal abdominal aorta in the fetus and are interconnected through a ventral anastomotic channel . regression or persistence of these vitelline segments or their ventral anastomosis causes the development of variation around the superior mesenteric artery and celiac axis . based on these reports , song et al . hypothesized that an anatomic channel connects the left gastric artery and hepatic artery and that an identical embryonic remnant of this channel is the original form of an alga and an accessory or replaced left hepatic artery . both arteries run through the fissure of the ligamentum venosum , supporting the hypothesis . considering this hypothesis , we ligated not only the alga but also the left gastric artery to block multiple blood supplies to the aneurysms in the present case . treatment of aneurysmal vasculitis in patients with gpa should involve the combination of surgical or endovascular interventions with immunosuppressive agents such as high - dose prednisone , cyclophosphamide , and rituximab to prevent aneurysm rupture or control hemorrhage . our patient was treated by both surgical and endovascular interventions combined with high - dose prednisone and cyclophosphamide , resulting in a good prognosis . hybrid therapy combining both surgical and endovascular interventions for aneurysms in patients with gpa has never been reported , but such therapy would be a good approach especially for patients with ruptured aneurysms or aneurysms located on variant arteries , as in our case . detecting the site of the rupture in a massive hematoma and recognizing anatomical blood supplies to aneurysms is sometimes difficult in open surgery and may be much more complicated in patients with variant arteries . in the present case , we failed to interrupt the blood flow to the aneurysms by an endovascular approach , but this approach was helpful to restrain the blood supply to the aneurysms , detect the site of rupture , and determine which artery to ligate in open surgery . in fact , we could immediately detect the aneurysms with the massive hematoma in the lesser omentum by touching the embolized coils .
in conclusion , we have presented a rare case of gpa complicated by aneurysm rupture in an alga . aneurysm formation is a rare complication of gpa but can be life - threatening if rupture occurs . immediate diagnosis and therapy should be performed for patients with symptoms of vascular ischemia or aortitis . endovascular intervention is the first - choice therapy especially for hemodynamically stable patients with ruptured aneurysms or aneurysms located on variant arteries ; notably , however , variant arteries may have multiple blood supplies . in the present case of aneurysm rupture in an alga , although we failed to interrupt the blood flow to the aneurysms by an endovascular approach , this approach was helpful to restrain the blood supply to the aneurysms , detect the site of rupture in a lesser omental hematoma , and determine the efficacy of ligating not only the alga but also the left gastric artery to block retrograde blood flow to the aneurysms during open surgery . all authors certify that they have no personal financial or institutional interest in the subject matter , materials , or drugs in this article . | abstractaneurysm formation is a potential complication of granulomatosis with polyangiitis ( gpa ) , previously known as wegener s granulomatosis .
it is a very rare complication , but immediate diagnosis and therapy should be performed because an aneurysm can be life - threatening if it ruptures .
an accessory left gastric artery ( alga ) is also a rare variant gastric artery that may obtain its blood supply from the left hepatic artery and left gastric artery .
we herein describe a 57-year - old japanese man who was diagnosed with gpa complicated by aneurysm rupture in an alga .
emergency surgery was performed after failure of arterial coil embolization to interrupt blood flow in the alga .
the patient underwent partial resection of the lesser omentum , which contained all aneurysms . during partial resection of the lesser omentum ,
both the left gastric artery and alga were ligated because they were thought to be feeders of the aneurysms .
postoperative recovery was uneventful ; no bleeding or recurrence of the aneurysms occurred .
immediate diagnosis and therapy should be performed for patients with gpa with symptoms of vascular ischemia or aortitis .
endovascular intervention is the first - choice therapy especially for hemodynamically stable patients with ruptured aneurysms or aneurysms located on variant arteries , which may have multiple blood supplies . in the present case , although endovascular treatment failed , the approach described herein was helpful during open surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
often known as hepatic osteodystrophy , these disorders are a common complication of liver cirrhosis with a reported prevalence of 12% to 86% [ 14 ] . it is related to the severity of cirrhosis and affects 38% of patients awaiting liver transplantation [ 6 , 7 ] . osteoporosis is characterized by low bone mass and microarchitectural deterioration of bone tissue leading to bone fragility and increased fracture risk , a source of morbidity and mortality in patients already weakened by their chronic liver disease . it is most often multifactorial and many factors affecting directly or indirectly bone turnover have been implicated : insulin growth factor - i , interleukin-1 , tumor necrosis factor- , and osteoprotegerin , which promote osteoclastic bone resorption in addition to the receptor activator of nf kappa beta ( rank ) and the receptor activator of nf kappa beta ligand ( rankl ) . the serum level of these factors is disturbed during cirrhosis leading to a decrease in osteoblast activity and increased bone resorption by osteoclasts , which is responsible for a decrease in bone mineral density in these patients . these disorders have been studied mainly in cholestatic liver diseases such as primary biliary cirrhosis and less frequently in viral hepatitis . the aim of this prospective study was to report the prevalence of metabolic bone disorders ( mbds ) in a cohort of moroccan patients with viral b and c cirrhosis , to study their characteristics and to identify the associated factors to their development . between january 2011 and may 2012 , all consecutive patients with viral b and c cirrhosis regularly followed in our unit were enrolled , in a prospective , monocentric , descriptive , and analytical study . all included patients fulfilled the following criteria : age over or equal to 18 years;liver cirrhosis proven histologically , or diagnosed using noninvasive markers of fibrosis ( fibrotest or fibroscan ) or diagnosed on clinical , biological ( hypoalbuminemia , reduced prothrombin activity ) , echographic ( dysmorphic liver , portal hypertension 's signs , ascites ) , and endoscopic ( oesophageal or gastric varices , portal hypertensive gastropathy ) criteria;b and c viral etiology of cirrhosis , respectively , defined by the presence of serum hepatitis b surface antigen ( hbsag ) or hepatitis c virus antibodies . age over or equal to 18 years ; liver cirrhosis proven histologically , or diagnosed using noninvasive markers of fibrosis ( fibrotest or fibroscan ) or diagnosed on clinical , biological ( hypoalbuminemia , reduced prothrombin activity ) , echographic ( dysmorphic liver , portal hypertension 's signs , ascites ) , and endoscopic ( oesophageal or gastric varices , portal hypertensive gastropathy ) criteria ; b and c viral etiology of cirrhosis , respectively , defined by the presence of serum hepatitis b surface antigen ( hbsag ) or hepatitis c virus antibodies . patients with other etiology of liver cirrhosis , those coinfected by human immunodeficiency virus or presenting endocrine disorders or renal failure , and patients receiving medications that could influence bone metabolism ( bisphosphonates , estrogens , androgens , corticosteroids , vitamin d , or calcium supplementation ) were excluded from the study . the following clinical items were collected at enrolment for each patient : age , gender , height , weight , body mass index ( bmi ) , and the duration of the liver disease . all patients underwent liver function tests including serum bilirubin , alanine , and aspartate aminotransferase activities , alkaline phosphatase , gamma - glutamyl transferase in addition to prothrombin time , and serum albumin using standard laboratory methods . the severity of cirrhosis was evaluated by the child - pugh score that allows the classification of patients into three grades of increasing severity : a ( 5 - 6 ) , b ( 79 ) , and c ( 1015 ) . serum calcium , serum phosphorus , 24 hours urinary calcium , and phosphorus were measured in all patients with an enzymatic colorimetric assay method . 25-hydroxyvitamin d ( 25 ( oh ) d ) was measured using chemiluminescence immunoassay , normal ranges were between 20 and 70 g / l , insufficiency was defined as 25 ( oh ) d level below 20 g / l and deficiency as below 10 intact parathyroid hormone 184 ( ipth ) was measured with chemiluminescence immunometric method , and normal ranges were between 15 and 65 pg / ml . bone mineral density ( bmd ) was measured in all patients at the lumbar spine ( l1l4 ) and total hip using dual energy x - ray absorptiometry dxa ( lunar prodigy , general electric healthcare , usa ) . results were expressed in t - score ( difference in standard deviation ( sd ) between the patient 's measured bmd value and the maximum mean bmd of young adult of same gender ) and z - score ( difference in sd between the patient 's measured bmd value and the normal reference for age and gender ) . according to the world health organization criteria ( who ) , osteoporosis was defined as a t - score below 2.5 sd and osteopenia as t - score between 1 and 2.5 sd . continuous variables were expressed as mean sd if they are normally distributed , and if not they were expressed as median ( quartiles ) . pearson 's chi - square test ( ) and fisher 's exact test for categorical variables , student 's test for normally distributed continuous variables , and mann - whitney test for nonnormally distributed continuous variables were applied to analyze differences between patients . data analysis was performed using spss software version 18.0 for windows ( spss inc . , the mean age of patients was 64 9.16 years ( range : 3682 years ) . forty patients ( 87% ) had hepatitis c related cirrhosis and 6 patients ( 13% ) had postviral hepatitis b cirrhosis . forty patients ( 87% ) were classified grade a of child - pugh classification and 6 patients ( 13% ) were grade b. the mean bmi was 23.25 2.97 kg / m . the mean level of serum 25 ( oh ) d was 13.2 5.1 g / l ( range : 425.4 g / l ) . decreased 25 ( oh ) d was found in 44 patients ( 95.6% ) , and 15 of them ( 32.6% ) had vitamin d deficiency and 29 patients ( 63% ) had vitamin d insufficiency . two patients ( 4.4% ) had normal levels of vitamin d. among patients with decreased vitamin d , 13 ( 28.2% ) had secondary hyperparathyroidism with pth levels between 70 pg / ml and 217 pg / ml . thirty - seven patients ( 80.4% ) out of 46 had decreased bmd , and 24 ( 52.2% ) of them had osteopenia , while 13 ( 28.2% ) had osteoporosis at least at one site . osteopenic patients ( n = 24 ) included 10 women and 14 men ( mean age : 64.2 9.3 years ) infected with hepatitis c virus in 21 cases and hepatitis b virus in 3 cases . osteoporotic patients ( n = 13 ) included 7 women and 6 men ( mean age : 67.8 6 years ) with viral hepatitis c in 12 cases and hepatitis b in one case . bone loss was more frequent and more severe in the lumbar spine . at the lumbar spine , 31 patients ( 67.4% ) had decreased bmd with osteopenia in 21 cases ( 45.7% ) and osteoporosis in 10 cases ( 32.7% ) . at the total hip , bone loss was found in 27 patients ( 58.7% ) , and 20 ( 43.5% ) of them had osteopenia and 7 ( 15.2% ) had osteoporosis . bmd 's results expressed in g / cm , t - score , and z - score are summarized in table 2 . t - scores were significantly different between men and women at the lumbar spine ( p = 0.02 ) and total hip ( p = 0.04 ) ; accordingly , bmd was significantly lower in women in both sites with p = 0.007 in the lumbar spine and p = 0.01 in total hip ( table 3 ) . patients were divided into 2 groups : low bmd ( osteopenia / osteoporosis ) group and normal bmd group and were compared ( table 4 ) . patients with low bmd were significantly older than those with normal bmd ( p = 0.02 ) , and they had a lower bmi ( p = 0.01 ) , a long duration of liver disease ( p = 0.04 ) , and their vitamin d level was lower ( p = 0.01 ) . in univariate analysis , age , bmi , duration of liver disease , and vitamin d level were associated with the presence of osteoporosis and osteopenia . in multivariate analysis , none of these variables was an independent factor associated with metabolic bone disorders in cirrhotic patients ( table 5 ) . during the study period , no pathological fracture has occurred in our patients . in case of bone demineralization assessed by dxa , a systematic treatment was given to patients . with progress in the therapy of liver cirrhosis and its complications , there has been an increase in patient survival and , hence , an increased incidence of metabolic bone disorders especially osteoporosis and its fracture risk . the prevalence of these osteometabolic changes in chronic liver disease varies from 13% to over 80% , depending on the population studied and the diagnostic criteria used to define bone disease [ 4 , 9 , 10 ] . this prospective study assessed bmd , measured using the reference radiological method , and defined according to the who 's criteria . it showed a high prevalence of bmd abnormalities in the evaluated cirrhotic patients with a rate of 80.4% . osteoporosis was found in 28.2% of cases and osteopenia in 52.2% of cases with a higher prevalence in the lumbar spine . our results were similar to those found in a previous study who noted low bmd in 80% of a comparable patient 's population . two egyptian studies recently published have also found high rates of bone loss in patients with cirrhosis : 86.6% in ahmed et al . these findings allow us to suggest that moroccan cirrhotic patients have approximately the same osteodensitometric profile to the rest of north - african population . in javed et al . 's study which included 100 pakistani patients with viral hepatitis related cirrhosis , the prevalence of metabolic bone disease was 68% . this rate was lower than that found in our study , and this is probably due to the ethnic difference between the populations studied , but the prevalence of osteoporosis observed in our patients was similar to the rate reported by javed et al . 's series which showed osteoporosis in 56% of cases and the study of salama et al this is probably due to the very good liver function of our patients in contrast of the two other studies . indeed , the level of liver failure is correlated with the risk of osteoporosis , and the progression of liver disease from grade a to grade c of the child - pugh classification is associated with an increase in bone loss . we noticed like other series [ 10 , 14 , 16 ] that bone loss in lumbar spine ( trabecular bone ) was more frequent and more severe than in the hip ( cortical bone ) . this finding can be explained by a much lower turnover of cortical bone compared to trabecular bone , and probably some risk factors for osteoporosis have lesser deleterious effects on bone with lower rates of turnover . the mechanism of bone mass loss in viral cirrhosis is not fully understood ; it is probably multifactorial , and several risk factors may be involved . tumor necrosis factor - alpha and transforming growth factor- have been implicated in the bone injury during viral hepatitis . insulin - like growth factor - i which is produced by the liver and the bone and stimulates osteoblast 's proliferation was found decreased in viral cirrhosis related osteoporosis . suggested that leptin , a strong inhibitor of bone formation , may play a role in the pathogenesis of osteoporosis in postviral cirrhosis . in our study , old age , female gender , low bmi , long duration of liver disease , and vitamin d deficiency have been found to be associated with low bmd , but none of them was an independent factor associated with bone disorders . it is well established that the risk of osteoporosis increases with age , especially among females regardless of the presence of hepatic disease . the influence of these two factors on bmd in chronic liver disease was evaluated in several studies . one study has found that the advanced age of patients was an independent risk factor of osteoporosis in patients with chronic liver disease . female gender emerged in several series [ 3 , 16 ] as a predictive factor of the occurrence of metabolic bone disorders particularly osteoporosis in patients with cirrhosis . our study showed that patients with low bmd have a lower bmi compared with those with normal bmd . in contrast , other studies [ 12 , 20 ] did not find any correlation between bmi and osteoporosis or osteopenia . according to the authors , this finding can be biased by the overestimation of the weight of child b or c patients due to the presence of ascites . javed et al . showed that osteoporosis was more frequent in cirrhotic patients with long duration of liver disease ( 5 years and above ) which is in agreement with our result . the severity of cirrhosis assessed by the child - pugh score emerged in the majority of series [ 3 , 4 , 12 , 14 , 15 ] as being a factor which is strongly associated with a bone mass deficit especially osteoporosis . in our study , the child - pugh score did not influence bmd , and this can be explained by the fact that almost all patients in our study had a compensated cirrhosis ( child a ) , while few of them were child b , unlike other studies in which the scores b and c of child - pugh classification were predominant . our result agrees with javed et al . and loria 's finding ; they showed no correlation between the severity of cirrhosis and bmd . the etiology of cirrhosis had no influence on bmd in our series , which agrees with the results of javed et al . . most studies have not shown correlation between serum 25 ( oh ) d and the presence or severity of osteoporosis [ 21 , 22 ] . in opposition to this , a high prevalence of vitamin d deficiency ( 95.6% ) was found in our study , and it is associated with low bmd . in hepatocellular dysfunction , some authors reported high levels of serum pth , while others reported unchanged levels or low level . . showed that an increased level of pth was an independent risk factor associated with low bmd . in our study , 28% of patients had a high pth level with no difference between patients with normal bmd and those with osteoporosis or osteopenia . fractures occurrence is the most feared complication of hepatic osteodystrophy ; a rate of 5 to 20% was reported in the literature . despite the high prevalence of metabolic bone disorders and vitamin d deficiency observed in our study , no case of vertebral or peripheral fracture was noticed during the study period . this fracture risk in a patient 's population already weakened by cirrhosis would justify a systematic evaluation of bmd in all cirrhotic patients in order to prevent this risk through the implementation of therapeutic measures appropriate to the degree of bone demineralization . the british and american societies of gastroenterology recommend actually bmd assessment in all patients with cirrhosis . our prospective study showed a high prevalence of bmd disorders in patients with viral cirrhosis with an osteoporosis rate of 28.3% . old age , female gender , low bmi , long duration of liver disease , and vitamin d deficiency were found to be significantly associated with low bmd , but none of them was an independent factor associated with bone disorders . consequently , bmd assessment and vitamin d dosage must be a part of systematic monitoring of viral cirrhosis in order to select patients with high risk of fractures requiring appropriate treatment . | background / aim .
metabolic bone disorders are well - recognized extrahepatic complications of cirrhosis .
the aim was to report their prevalence and the associated factors to their development in patients with viral cirrhosis .
patients and methods .
all consecutive patients with viral cirrhosis were prospectively enrolled .
parathyroid hormone , 25-hydroxyvitamin d , liver function , and phosphocalcic tests were measured in all patients .
bone mineral density was measured at the lumbar spine and total hip by dual - energy x - ray absorptiometry .
data were analyzed using spss software .
results .
forty - six cirrhotic patients were included with hepatitis c ( 87% ) and hepatitis b ( 13% ) .
the child - pugh score was grade a in 87% of cases and grade b in 13% .
thirty - seven patients had decreased bone mineral density with osteopenia in 24 patients and osteoporosis in 13 patients . decreased 25-hydroxyvitamin d
was found in 95.6% of cases .
bone disorders were significantly more frequent in old patients with low body mass index , long duration of liver disease , and low 25-hydroxyvitamin d level .
none of these factors was an independent factor associated with bone disorders . conclusion .
our study revealed a high prevalence of metabolic bone disorders among viral cirrhotic patients .
consequently , bone mineral density assessment should be performed systematically in all cirrhotic patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the human intrahepatic biliary epithelium is classified by size : hepatic ducts ( > 800 m ) , segmental ducts ( 400800 m ) , area ducts ( 300400 m ) , septal bile ducts ( 100 m ) , interlobular ducts ( 15100 m ) , and bile ductules ( < 15 m).9 , 10 , 11 the intrahepatic biliary epithelium of rodents is formed by ducts of different sizes , small ( < 15 m in diameter ) and large ( > 15 m).12 , 13 the cholangiocytes lining small and large bile ducts have been morphologically and functionally categorized into small and large cholangiocytes , respectively.12 , 13 , 14 , 15 with regards to cellular structure , the small cholangiocytes are cuboidal , but the larger cholangiocytes in larger bile ducts are more columnar in shape.9 , 10 , 11 moreover , small cholangiocytes are poorly specialized and have a high nucleus / cytoplasm ratio whereas large cholangiocytes are supplied with plenty of organelles and a small nucleus / cytoplasm ratio . the large , but not the small , cholangiocytes have cilia , which act as chemo- and mechanosensors within the bile duct lumen . the expression of molecules involved in secretin - stimulated biliary secretion also differs along the biliary epithelium . sr , cftr , and anion exchanger 2 ( ae2 ) are only expressed by large cholangiocytes and are responsible for the majority of biliary fluid secretion through the activation of a camp - dependent pathway.12 , 13 in small cholangiocytes , on the other hand , ca - activated signaling pathways seem predominant . indeed , the activation of purinergic receptors in small and large cholangiocytes induces ca - dependent cl secretion via transmembrane member 16a ( tmem16a ) , providing an alternative route to the secretin - stimulated camp - dependent ductal fluid secretion.18 , 19 functionally , large camp - dependent cholangiocytes are more susceptible to damage whereas small cholangiocytes are more resistant to liver injury.12 , 20 , 21 , 22 during damage of large cholangiocytes , small cholangiocytes replenish the biliary epithelium . again , the amplification of ca - dependent signaling pathways in small cholangiocytes is essential in driving the de novo acquisition of large cholangiocyte phenotypes ( see figure 1).20 , 21 cholangiocytes are normally quiescent in the liver , but they respond to injury or stress by enhanced proliferation.3 , 23 , 24 compensatory responses to liver injury include biliary hyperplasia , ductular reaction , and ductopenia . biliary hyperplasia ( characterized by proliferation / loss of cholangiocytes as observed in cholestatic liver diseases such as primary sclerosing cholangitis ) is associated with enhanced biliary secretion of hco3 in bile , which may be a compensatory protective mechanism for the injured biliary epithelium . ductopenia is evidenced by the damage of bile ducts in response to toxins or in certain diseases such as biliary atresia.15 , 20 , 21 , 26 , 27 the hepatic artery is the main blood supplier of the biliary epithelium within the peribiliary vascular plexus ( pbp ) . the pbp secretes a number of angiogenic factors such as vascular endothelial growth factor ( vegf ) that have been shown to regulate biliary proliferation in experimental models of cholestasis.28 , 29 , 30 , 31 cholestatic liver diseases represent a heterogeneous group of diseases characterized by an impairment of bile formation or bile flow that can arise at the hepatocellular or cholangiocellular level . emblematic diseases in this group are primary biliary cirrhosis ( pbc ) and primary sclerosing cholangitis ( psc ) . the current various animal models allow a better insight into the signaling pathways involved in the development of cholestasis . such studies may provide potential treatment strategies to restore impaired secretory functions of hepatocytes and cholangiocytes , or to modulate the response of these cells to liver injury . specific types of liver injury activate the proliferation of particular cholangiocyte subpopulations ( ie , large / small).15 , 20 , 21 in most instances , biliary proliferation contributes to the major part of the ductular reaction . however , new ductules may also originate from activated progenitor cells or from cells that have entered from the circulation and differentiate into liver cells.23 , 34 , 35 cholangiocyte response to injury is an articulated event , which retains a this modification is functional to compensate for the anatomic loss of biliary cells and also to sustain their secretory activities . in most instances , however , biliary proliferation eventually subsides , and apoptotic mechanisms become prevalent with the development of ductopenia . along with proliferation , cholangiocyte response to injury is characterized by the so - called neuroendocrine - like transdifferentiation , which plays an essential role not only in sustaining biliary proliferation itself but also in immune responses , hepatic inflammation , and development of liver fibrosis.4 , 23 to this extent , a number of neuroendocrine factors are synthesized de novo by reactive cholangiocyte and have been shown to modulate biliary damage by autocrine / paracrine mechanisms ( table 1 ) . in an elegant morphologic study , gaudio et al provided strong evidence for the autocrine / paracrine role of vegf in the regulation of biliary damage . after cholestasis induced by bile duct ligation ( bdl ) , the pbp undergoes extensive proliferation to support the increased nutritional and functional needs of the proliferating biliary epithelium . however , the proliferation of the pbp only occurs after cholangiocytes support the autocrine role of the biliary system by secreting angiogenic factors in the regulation of biliary function . to demonstrate the important role of angiogenic factors in sustaining biliary growth , we have shown that secretin stimulates biliary proliferation by microrna 125b and let7a - dependent up - regulation of vegf - a and nerve growth factor ( ngf ) , respectively . knockout of the sr ( which is only expressed by large cholangiocytes ) decreases biliary hyperplasia in cholestatic mice by down - regulation of camp signaling . other studies have demonstrated the proproliferative effect of vegf - a and vegf - c , which increase biliary growth of normal rats by interaction with vegf receptors 2 and 3 , respectively . the same study also showed that the in vivo administration of neutralizing antibodies for vegf - a / c decreased bdl - induced biliary hyperplasia . the paracrine effect of vegfs on biliary functions was also demonstrated in experiments where the ligation of the hepatic artery resulted in disappearance of the pbp ( the source of angiogenic factors such as vegfs ) , significant reduction of biliary growth ( accompanied by enhanced apoptosis ) , and reduced secretion of vegf and bicarbonate by cholangiocytes . another study has shown that inhibition of vegf expression in cholangiocytes by overexpression of microrna-125b ( mir-125b ) and knockdown of histidine decarboxylase ( the enzyme that regulates histamine synthesis ) decreased bdl - induced biliary hyperplasia . consistent with the role of vegf on biliary functions , ren et al have shown that vegf plays an important role in the infection - induced increase of biliary cystogenesis in cholangiocytes of the polycystic kidney rat model . prolonged feeding of taurocholic acid to bdl rats prevents biliary damage induced by hepatic artery ligation or caffeic acid by overexpression of vegf - a.41 , 42 also , cholangiocyte neuroendocrine - like transdifferentiation , driven by the de novo expression of pancreatic duodenal homeobox-1 , has been associated with enhanced biliary vegf expression . another study has shown that cholangiocytes generate a vegf gradient that is key during arterial vasculogenesis , whereas angiopoietin-1 signaling from hepatoblasts participates in the remodeling of the hepatic artery to sustain the nutritional demands of the proliferating biliary epithelium . biliary hyperplasia is also promoted by a number of growth factors such as ngf , follicle - stimulating hormone ( fsh ) , gonadotropin - releasing hormone ( gnrh ) , estrogens , and the biogenic amine histamine by the interaction with their specific receptors.22 , 45 , 46 , 47 for example , we have shown that 1 ) intrahepatic bile ducts secrete ngf and express ngf receptors , and 2 ) ngf stimulates ( in combination with estrogens ) biliary proliferation by activating the erk pathway as well as the phosphatidylinositol 3-kinase pathway . the decrease in intrahepatic bile duct mass ( concomitant with reduced expression of estrogen receptor and and enhanced biliary apoptosis ) supports the role of endogenous estrogens in sustaining the enhanced proliferative and secretory activities of cholangiocytes during cholestasis , which may be important during ductopenic states . also supporting this concept , another study has shown that estrogens maintain biliary mass and reduce apoptosis after biliodigestive anastomosis in cholestatic bdl rats . a recent study has also shown that cholangiocytes express fsh and its receptor and also secrete fsh . in vivo , fsh increases biliary mass , whereas administration of antide ( a gnrh antagonist blocking fsh secretion ) and anti - fsh antibody to bdl rats decreases camp - dependent cholangiocyte proliferation and biliary mass . modulation of biliary fsh expression may be a target for the management of cholestatic liver diseases . fsh as well as other growth factors including estrogens either directly or by synergizing ngf , insulin - like growth factor 1 , fsh , and vegf have been shown to regulate the proliferative and secretive activities of cystic epithelium of polycystic liver diseases in rodent models and human cell lines . also , gnrh ( secreted by the hypothalamus as well as cholangiocytes ) has been shown to stimulate biliary proliferation by both paracrine / autocrine pathways . disruption of the gnrh / gnrh - receptor cascade may be an important target for the management of cholangiopathies . for example , the activation of serotonin 1a and 1b receptors inhibits biliary hyperplasia in cholestatic rats by enhanced ip3/ca / protein kinase c signaling and subsequent inhibition of the camp / protein kinase a / src / extracellular signal - regulated kinase 1/2 pathway . cholangiocytes also secrete serotonin that reduces biliary proliferation during the course of cholestasis in an autocrine fashion . in addition , they express the neuronal isoform of neuronal tryptophan hydroxylase , synthesize serotonin , and use serotonin as an autocrine / paracrine signal to regulate biliary remodeling . other studies have provided evidence for the growth - limiting function of the hormone melatonin ( mt ) . in cholestatic bdl rats , mt both in vivo and in vitro decreased biliary hyperplasia by camp - dependent down - regulation of clock gene expression through the interaction with mt1 receptor subtype . furthermore , when bdl rats were housed in prolonged darkness there was reduced biliary hyperplasia and fibrosis , which was accompanied by a significant increase in the serum levels of mt likely originating from the pineal gland . hepatic inhibition of arylalkylamine n - acetyltransferase ( the rate - limiting enzyme regulating mt synthesis ) by vivo - morpholino sequence of arylalkylamine n - acetyltransferase ( which decreases mt hepatic secretion ) increases biliary growth and the expression of angiogenic factors in cholestatic rats.55 , 56 a number of elegant studies have also been performed to evaluate the role of histamine on cholangiocyte proliferation . it has been found in rodent models of cholestasis that histamine increases or inhibits biliary proliferation by interacting with either h1-h2 histamine receptors ( stimulatory ) or h3-h4 histamine receptors ( inhibitory).22 , 47 , 57 , 58 stimulation of h3 histamine receptors by h3 histamine receptor agonist decreases bdl - induced cholangiocyte hyperplasia via inhibition of camp signaling , thus suggesting a possible beneficial effect of histamine in cholangiopathies . histamine also interacts with the h1 histamine receptor and increases the proliferation of small cholangiocytes by activation of ip3/ca / calmodulin - dependent kinase i / camp response element - binding protein dependent signaling.58 , 59 this differential response induced by histamine may be employed in variable conditions of liver diseases where either reduction in biliary hyperplasia or regeneration of liver would be desirable , depending on the injury . it is evident from these studies that modulation of the different receptors could be of prime importance while managing the balance between biliary growth / loss in cholangiopathies or posttransplantation . in vivo , gaba induces the damage of camp - dependent large cholangiocytes concomitant with de novo proliferation of small cholangiocytes , which amplify their ca - dependent signaling and acquire phenotypes of large cholangiocytes to repair the damaged biliary epithelium.20 , 21 the hippo signaling pathway is an evolutionarily conserved pathway that regulates bile duct differentiation and homeostasis in the liver . the core hippo signaling pathway is a kinase cascade . the apical membrane - associated four - point - one , ezrin , radixin , moesin ( ferm ) domain protein neurofibromin 2 ( nf2 ) directly binds and recruits the nuclear dbf2-related family kinase large tumor suppressor homolog 1/2 ( lats1/2 ) to the plasma membrane . membrane recruitment , in turn , promotes lats1/2 phosphorylation by the ste-20 family protein kinase mammalian ste20-like protein kinase 1/2 ( mst1/2 ) , together with the adaptor protein salvador homolog 1 ( sav1 ) . in turn , lats1/2 , in a complex with small regulator protein mps one binder homolog a ( mob1 ) , phosphorylates yes - associated protein ( yap ) , a transcription coactivator . yap is highly expressed in cholangiocytes of both mouse and human livers , which suggests that yap plays a role in cholangiocyte biology.62 , 63 by use of genetically modified mouse models , zhang et al found that transcriptional regulation activity of yap was required for bile duct development . liver - specific yap deletion leads to postnatal bile duct paucity due to failure formation of primitive ductal structures around e18.5 . accordingly , increasing yap activity through ablating upstream negative regulator nf2 significantly increases the number of primitive ductal structures and results in bile duct hyperplasia . however , the yap downstream targets involved in regulating bile duct development remain to be elucidated . yap is also important for determining biliary cell fate.62 , 65 compared with cholangiocytes , hepatocytes maintain a lower yap activity . increasing hepatocyte yap activity through ectopic yap expression or ablating upstream negative regulator mst1/2 dedifferentiates periportal hepatocytes into ductal cells . furthermore , yimlamai et al demonstrated that yap regulates hepatic cell fate determination directly through notch signaling , another critical signaling pathway for bile duct development . the notch signaling pathway contains four transmembrane notch receptors ( notch-1 , -2 , -3 , -4 ) and two types of cell surface ligands , serrate / jagged ( jag-1 , -2 ) or delta - like ( dll-1 , -3 , -4 ) . the activation of the notch signaling requires a cell - cell interaction between the transmitting cell expressing notch ligands and the receiving cell expressing notch receptors . upon ligand engagement , the notch receptor is cleaved by the -secretase complex , leading to the cytoplasmic release of the notch intracellular domain ( nicd ) . nicd will then translocate into the nucleus where it binds to the recombination signal binding protein immunoglobulin j ( rbp - j ) to displace the rbp - j-associated corepressors , thereby allowing the transcription of the notch target genes . among them , the hairy / enhancer of split homologs transcription factors ( he s and hey ) , the family of the hepatocyte nuclear factors ( hnf ) and the sex - determining region y - box 9 ( sox-9 ) are involved in biliary cell differentiation . mouse models deficient in notch receptor notch-2,67 , 68 , 69 notch ligands jag-1,70 , 71 notch nuclear effector rbp - j,72 , 73 notch transcription target hes-1 , sox-9 , and hnf175 , 76 all show defects in intrahepatic bile duct tubulogenesis during fetal development and early postnatal life . consistently , constitutive activation of the notch-2 intracellular domain ( nicd ) in hepatoblasts during development leads to ectopic formation of tubular and cystic structures , resembling early malignant biliary lesions.77 , 78 in agreement with their physiologic role in the commitment of the biliary lineage , notch2 , jagged1 , hes1 , sox-9 , and hnf1 are highly expressed in biliary cells.73 , 74 both immature and mature cholangiocytes produce and respond to the hedgehog ( hh ) signaling ligands sonic hedgehog ( shh ) and indian hedgehog ( ihh).79 , 80 , 81 shh and ihh ligands then bind to their transmembrane hedgehog receptor patched ( ptc ) , which relieves the suppression of smoothened ( smo ) and leads to activation of the glioblastoma ( gli ) family of transcription factors ( gli1 , gli2 , gli3 ) . the important role of the hedgehog pathway in cholangiocyte pathogenesis has been demonstrated with a cholestatic injury model.80 , 82 dramatic increases in hepatic expression of hh ligands and up - regulation of hh pathway activity occur after bdl in rodents . moreover , mice with a genetic ablation of ptc exhibit exacerbated ductular and fibrogenic responses . however , the physiologic role and the molecular mechanism of hedgehog signaling during maintenance of bile duct homeostasis are not fully understood and remain to be further investigated . signaling mechanisms fueling psc development are being studied in several different animal models . among the different rodent models , mdr2 mice have a decreased concentration of phosphatidylcholine in bile , which is known to potentiate the toxicity of bile acids . additionally , mdr2 mice demonstrate leakage of bile into portal tracts , caused by disrupted tight junctions of the biliary epithelium , which is responsible for causing inflammation and fibrosis . for example , tissue inhibitor of metalloproteinase-1 ( timp-1 ) mrna expression is increased , whereas matrix metalloprotease 13 ( mmp-13 ) is suppressed in this model . additionally , a number of proinflammatory molecules such as tnf , interleukin-1 ( il-1 ) , il-6 , transforming growth factor- ( tgf-1 ) , and interferon- are overexpressed in mdr2 mice compared with controls . mainly based on experiments on mdr2 mice , new possible treatment options for psc tabibian et al isolated cholangiocytes from livers of psc patients , cultured the intrahepatic cholangiocytes , and further confirmed their purity by immunofluorescence studies for cholangiocyte specific markers such as cytokeratin-19 . they showed that psc cholangiocytes expressed fewer tight junction proteins ( zo1 , indicating impaired epithelial junctions ) and were enlarged in size with robust filamentous structures throughout the cell body . further , these cholangiocytes exhibited the characteristics of cellular senescence when compared with normal human cholangiocytes and h69 . next generation sequencing confirmed the elevated expression of proinflammatory cytokines and chemokines compared with controls . thus , their study has provided targets that could potentially be used for devising treatment protocols for the management of psc . as for many other diseases , genomewide association studies represent a promising approach not only for dissecting the pathophysiology of psc but also for the identification of possible therapeutic targets . to date , a total of 16 genes have been associated with an increased risk of psc . among others , the single - nucleotide polymorphism located at chromosomal region 2q35 has attracted the interest of researchers . this particular single - nucleotide polymorphism is in close proximity to the g protein - coupled bile acid receptor ( tgr5 ) gene and has been associated both with psc and ulcerative colitis . tgr5 is the first g - protein coupled receptor for bile acids that has important roles in energy expenditure and basal metabolism . interestingly , five mutations in the tgr5 gene have been shown to reduce or abolish the function of the protein . the activation of tgr5 in cholangiocytes is thought to stimulate bicarbonate secretion , possibly contributing to the protection of the biliary epithelium via the biliary bicarbonate umbrella . pbc is an immune - mediated pathology of the biliary tree characterized by the generation of antimitochondrial antibodies directed against the pyruvate dehydrogenase complex ( pdc - e2 ) . recent studies have shown that tlr9 and cd86 expression is enhanced in b cells of pbc patients.93 , 94 profiling studies for cytokines and chemokines have shown that these molecules are important in the pathogenesis of pbc . further , there is often involvement of autoreactive cd4 and cd8 t cells in pbc . despite the fact that none of them can perfectly recapitulate the complex interactions of the human disease , they have proved to be valuable tools to study pbc alterations and explore possible therapeutic targets . briefly , the nod.c3c4 mouse was the first animal model to develop pbc - like characteristics . the second mouse model , which is most frequently used for studying pbc , owing to the similarity of human pbc , is the one expressing the dominant negative form of tgf- receptor ii ( dntgf-rii ) . this particular mouse model is characterized by higher serum level of tnf , interferon- , and il-6 when compared with control animals . similarly , elevated serum cytokines , lymphocyte infiltration around portal tracts , and cholangiocyte injury are noted in a third rodent model of pbc , the il-2r knockout mice model . in genetically susceptible individuals , environmental factors may trigger an immune - mediated injury of cholangiocytes . the immunologic events then occur in a step - by - step manner , starting from antigen presentation , t - cell differentiation , proliferation , and recruitment , and finally resulting in an effector - cell response and production of autoantibodies . in this context , a number of different signaling pathways have been implicated in this disease development or progression , and as such any of these steps could theoretically be targeted for treatment of pbc . because many pathophysiologic events of the human disease remain obscure and may differ from the animal models , caution should be implemented while evaluating the experimental effects of the manipulation of signaling pathways . nonetheless , antibody - mediated therapy , targeted inhibition of cellular pathways relevant to immune regulation , and cell therapy methods directed toward reprogramming the immunomodulatory axis remain an intriguing opportunity to treat pbc patients.100 , 101 , 102 biliary atresia ( ba ) is a disease caused by obstructive cholangiopathy resulting from inflammation and fibrosis of extrahepatic bile ducts . inflammatory reactions triggered by viral infection have been proposed as the possible cause of ba by several population studies as well as studies in murine models . population studies have proved the presence of human papillomavirus , cytomegalovirus , and reovirus in the livers of ba patients.104 , 105 , 106 evidence from studies in a rhesus - rotavirus infected murine model of ba as well as from fixed liver tissues from ba patients have shown that there are structural as well as pathologic changes in the extrahepatic cholangiocytes only . it was observed that primary cilia were selectively lost from the extrahepatic and not the intrahepatic cholangiocytes after rotavirus infection in experimental mice.107 , 108 jafri et al found that chemokine expression levels were also increased in cholangiocytes isolated from rotavirus - infected mice as well as in virus - infected cholangiocytes in culture . in their quantitative and qualitative assessments of several chemokines , they found that macrophage inflammatory protein-2 and monocyte chemotactic protein-1 were up - regulated after rotavirus infection when compared with normal in vivo and in vitro conditions . cholangiocyte proliferation and subsequent enlargement of extrahepatic bile ducts in ba have been linked to overexpression of il-33 and activation of th2 helper t cells . li et al found that serum levels of il-33 are elevated in ba patients and in the livers and bile ducts of experimental mice . moreover , treatment of normal wild - type mice with il-33 promoted cholangiocyte proliferation and cell growth that culminated in significantly enlarged extrahepatic bile ducts . they also found that bile ducts genetically primed to cholangiocarcinoma ( by constitutive activation of the protein kinase b yap pathway ) responded to administration of il-33 via development of advanced tumors with intrahepatic metastases compared with controls . such data suggest that activation of the il-33 pathway may help biliary repair and that disruption of the same may halt carcinogenesis . other studies have implicated the involvement of factors such as granzymes , which are secreted by hepatic natural killer and cd8 t cells and injure cholangiocytes in short - term culture . consistent with in vitro data , it has been noted that in infants with ba there is increased hepatic mrna expression of granzymes a and b. thus , these studies offer multiple targets that could be manipulated to manage cholangiocyte proliferation accompanying liver conditions such as ba . for example , microrna-21 ( mir-21 ) was found to be up - regulated during the early stages of liver regeneration by targeting the pellino-1 antibody . the let-7 family members mir-127 , mir-26a , mir-34a , and mir-23b were all found dysregulated during liver regeneration . similarly , during treatment of mice with rhesus rotavirus , microrna expression profiles were found altered in a time - dependent fashion in the extrahepatic bile ducts from the experimental animals . for instance , changes in expression pattern of mir-30b / c , mir-133a / b , mir-195 , mir-200a , mir-365 have been proposed in the development of ba . expansion on these reports could provide alternative treatment protocols for life - threatening conditions such as ba in small children . despite the enormous progress in recent years , the pathophysiology of cholangiopathies is far from being completely understood , which has severe consequences for the development of effective new treatments . , orthotopic liver transplantation remains the only curative treatment of cholestatic liver diseases , representing as much as 20% of the transplantation indications in adults . moreover , symptoms such as fatigue and pruritus are often scarcely alleviated by the standard medical approaches.116 , 117 ursodeoxycholic acid ( udca ) remains the only approved drug for the treatment of fibrosing cholangiopathies . udca exerts its effects on multiple levels , from the protection of cholangiocytes against toxic bile acid to the stimulation of choleresis through posttranscriptional effects on hepatocellular and cholangiocyte transporters.118 , 119 the administration of udca in a daily dose of 1315 mg / kg has had well - established , favorable effects on the long - term survival of pbc patients.120 , 121 transplant - free survival in early - stage pbc patients treated with udca has been shown to be similar to healthy controls matched for age and gender.122 , 123 however , not all pbc patients respond to udca administration . a good biochemical response was achieved only in 61% of pbc patients treated with udca , as defined by the paris criteria which strongly correlate with transplant - free survival at 10 years . although the administration of udca is universally recognized as the standard treatment for pbc , definitive evidence to recommend its use in psc is still lacking . moreover , the high daily doses of 2830 mg / kg of udca in psc patients have been associated with an increased risk of liver transplantation and development of esophageal varices . in fact , the latest available european guidelines do not propose any specific recommendation for udca use in psc . under these circumstances , the development of alternative therapies for cholestatic liver diseases is required , and intense research is ongoing . promising results have recently emerged from the study of two bile acids derivatives : obeticholic acid and norursodeoxycholic acid . obeticholic acid ( oca ) , also known as int-747 , is a semisynthetic analogue of chenodeoxycholic acid that possesses a strong farnesoid x receptor ( fxr ) affinity . endogenous bile acids bind to fxr , which in turn represses or induces the expression of various genes involved in their synthesis and secretion , such as cytochrome p450 7a1 ( cyp7a1 ) , bile salt export pump ( bsep ) , and sodium - taurocholate cotransporting polypeptide 115 ( ntcp 115 ) . chenodeoxycholic acid is the most potent endogenous fxr ligand ( with a 100-fold less affinity than oca ) whereas udca has no affinity . interestingly , fxr mice have elevated serum bile acid levels , and the infusion of oca in rats can stimulate bile flow and protect against lithocholic acid - induced liver damage.127 , 128 given these premises , the efficacy and safety of oca has been recently tested in 165 pbc patients who failed to achieve a good biochemical response to udca alone . the results of the study demonstrated that the administration of 10 , 25 , or 50 mg of oca significantly reduced levels of alkaline phosphatase , -glutamyltransferase , and alanine aminotransferase compared with placebo . however , a significant increase in pruritus was also registered ; for all three oca dosages the severity itching was worse compared with placebo , but the incidence of pruritus was higher only in the two higher - dosing groups . phase 2 and phase 3 studies involving oca are currently under way , with extremely promising preliminary results . indeed , the administration of 5 or 10 mg of oca has been shown to be superior to placebo in determining the improvement of biochemical parameters correlated with clinical outcome in patients with inadequate response to udca . norursodeoxycholic acid ( norudca ) is a c23 homologue of udca with one fewer methylene group in the side chain of the molecule . the biology of norudca has peculiar characteristics ; in fact , this bile acid derivative is usually not conjugated with taurine or glycine . it is secreted into the bile canaliculi and reabsorbed by cholangiocytes , and from there it returns to the liver . the resulting cholehepatic shunting leads to a bicarbonate rich - choleresis , which is thought to protect cholangiocytes against the toxicity of bile acids.131 , 132 fickert et al have tested the possible therapeutic effect of norudca in mdr2 mice , a model for sclerosing cholangitis . they demonstrated that the administration of norudca ameliorated liver tests and liver histology in mdr2 mice , in contrast with udca which had detrimental effects . a recent study of the same group confirmed that norudca improved liver injury in the selective bdl model in mice , where udca administration again was significantly more toxic than norudca . based on these results , a phase 2 trial is currently recruiting patients to test the safety and efficacy of norudca in psc patients . monoclonal antibodies have also attracted the interest of researches as a possible therapeutic tool to treat cholangiopathies . given the encouraging results obtained with anti - cd20 antibodies in the dntgf-rii mouse model , the monoclonal antibody rituximab has been tested in a phase 1 trial in six pbc patients who have an incomplete response to udca . rituximab treatment proved to be safe in pbc patients and transiently reduced serum levels of total igg , igm , and iga and antimitochondrial antibodies . based on the results of recent genomewide association studies showing a genetic association between variants of the il-2 and il-23 pathways and pbc,136 , 137 a phase 2 clinical trial is currently under way to evaluate the safety and efficacy of ustekinumab , an anti - p40 monoclonal antibody . the safety and efficacy of two different monoclonal antibodies ( btt1023 and simtuzumab ) are being investigated in psc patients . btt1023 is a human monoclonal antibody targeting the vascular adhesion protein-1 ( vap-1 ) , a molecule that has been shown to stimulate the recruitment of effector lymphocytes to the liver through the up - regulation of the endothelial cell adhesion molecule madcam-1.138 , 139 simtuzumab is directed against the lysyl oxidase - like protein 2 ( loxl2 ) , an enzyme that favors the cross - linking of collagen and elastin fibers . the results of these studies will hopefully lay the basis for possible new and effective treatments for biliary diseases . our knowledge of the mechanisms regulating biliary cell responses to injury has grown enormously in the last few decades . studies from recent years have clarified that cholangiocytes are not the passive targets of biliary diseases . indeed , reactive cholangiocytes undergo a series of profound modifications and acquire a neuroendocrine - like phenotype that allows cells to regulate the complex molecular interactions that occur in the diseased liver.4 , 23 as discussed in our review , a number of molecular pathways have been shown to deeply influence the cholangiocyte response to injury . moreover , animal models have proved an invaluable tool for dissecting the pathophysiologic changes that occur in the biliary tree in response to injury , providing important clues on the complex interactions occurring in vivo . as a result of these continuous efforts , new potential treatments for pbc and psc however , the etiology of many cholangiopathies is still obscure , and much work remains to be done to translate the large amount of data that have been collected on disease pathogenesis into effective medical treatments that can influence the natural history of biliary diseases . | cholangiocytes are the epithelial cells that line the bile ducts . along the biliary tree ,
two different kinds of cholangiocytes exist : small and large cholangiocytes .
each type has important differences in their biological role in physiologic and pathologic conditions . in response to injury , cholangiocytes become reactive and acquire a neuroendocrine - like phenotype with the secretion of a number of peptides .
these molecules act in an autocrine / paracrine fashion to modulate cholangiocyte biology and determine the evolution of biliary damage .
the failure of such mechanisms is believed to influence the progression of cholangiopathies , a group of diseases that selectively target biliary cells .
therefore , the understanding of mechanisms regulating cholangiocyte response to injury is expected to foster the development of new therapeutic options to treat biliary diseases . in this review
, we discuss the most recent findings in the mechanisms driving cholangiocyte adaptation to damage , with particular emphasis on molecular pathways that are susceptible of therapeutic intervention .
morphogenic pathways ( hippo , notch , hedgehog ) , which have been recently shown to regulate biliary ontogenesis and response to injury , are also reviewed as well as the results of ongoing clinical trials evaluating new drugs for the treatment of cholangiopathies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
adenomatous polyposis coli endothelin a receptor endothelin b receptor epithelial to mesenchymal transition epithelial ovarian cancer g - protein coupled receptor glycogen synthetase kinase 3 matrix metalloproteinase 2 t - cell - specific transcription factor-4 -transducin repeat containing protein vascular endothelial growth factor receptor-2 epithelial ovarian cancer ( eoc ) is a disease plagued by recurrences and progressive chemoresistance . eoc cells assure their growth advantage and resistance to chemotherapy through the appropriation of key pathways , such as those controlled by g - protein coupled receptors ( gpcrs ) . accumulating molecular and in vivo evidence demonstrates that the activation of autocrine and paracrine signaling by the binding of endothelin-1 ( et-1 , edn1 ) to its gpcrs , endothelin a receptor ( etar , ednra ) and endothelin b receptor ( etbr , ednrb ) , elicits pleiotropic effects in tumor cells and in the host microenvironment , modulating the epithelial to mesenchymal transition ( emt ) , chemoresistance , and the expansion of vascular networks . of particular interest , etar was shown to be aberrantly activated in eoc and its expression has been correlated with platinum resistance and emt marker expression . this discovery was followed by analysis of eoc samples from the cancer genome atlas ( tcga ) that showed evidence for worse survival in eoc patients with etar overexpression . in addition to etar overexpression in chemoresistant eoc cells , etbr also appears to have protumorigenic activity by promoting angiogenesis and lymphangiogenesis and evasion of the immune response . hence , etar and etbr , which are heterogeneously expressed in eoc cells , have emerged as key targets for cancer therapy . emerging evidence demonstrates that acquisition of chemoresistance is highly dependent on contextual cues such as interactions with the tumor microenvironment and crosstalk with other signaling pathways . noting that crosstalk between et-1 signaling and other growth factor pathways drives tumor progression via the scaffold protein -arrestin-1 ( arrb1 ) that serves as a co - pilot to organize complex signaling networks , we hypothesized that an -arrestin-1mediated mechanism in et-1 signaling may play a particularly important role in evasion of the drug response . to investigate the mechanism underlying this resistance , we used resistant eoc cell lines generated by prolonged treatment with cisplatinum or taxol . upon etar activation of these resistant cells , -arrestin-1 formed a nuclear complex with -catenin and p300 , resulting in histone acetylation that led to chromatin reorganization and enhanced transcription of genes such as et-1 that are responsible for regulating the rate limiting step of the drug response . similarly , 13 of 13 platinum - resistant patients had increased recruitment of -arrestin-1 and -catenin on the et-1 promoter , providing further evidence that etar/-arrestin-1 cooperates with wnt signaling to acquire a chemoresistant phenotype through amplification of the et-1 autocrine loop . this work expands what was previously known about the chemoresistance - associated functions of etar , outlining a model in which et-1 co - opts wnt components for its own agenda , thus sustaining emt , stemness features , cell invasion , and metastasis ( fig . . in chemoresistant ovarian cancer cells , binding of endothelin-1 ( et-1 , edn1 ) to its receptors leads to recruitment of -arrestin-1 ( arrb1 ) . -arrestin inhibits the destruction complex composed of glycogen synthetase kinase 3 ( gsk3 ) , axis inhibition 1 ( axin1 ) , -transducin repeat containing protein ( -trcp ) , and adenomatous polyposis coli ( apc ) , and thus promotes the accumulation of a non - ser / thr phosphorylated active form of -catenin . -arrestin-1 shuttles with -catenin into the nucleus , where it interacts with p300 histone acetyltransferase to enhance -catenin / t - cell - specific transcription factor-4 ( tcf4)-transactivation , thus promoting the transcription of genes such as edn1 , matrix metalloproteinase 2 ( mmp-2 ) , or cyclin d1 ( ccnd1 ) and leading to enhanced chemoresistance , epithelial to mesenchymal transition ( emt ) , stemness , cell plasticity , invasion , and metastasis . as a signal transducer , endothelin a receptor ( etar , ednra)/-arrestin-1 initiates transactivation of the vascular endothelial growth factor receptor-2 ( vegfr-2 ) through src . in parallel , paracrine production of et-1 activates endothelin b receptor ( etbr , ednrb ) expressed on endothelial cells , promoting expansion of vascular networks . the dual etar and etbr antagonist macitentan targets not only cancer cells ( which express etar and etbr ) but also tumor - associated stromal elements ( which express etbr ) . interplay between etar/arrestin-1 and wnt/-catenin drives chemoresistance in ovarian cancer . in chemoresistant ovarian cancer cells , binding of endothelin-1 ( et-1 , edn1 ) to its receptors leads to recruitment of -arrestin-1 ( arrb1 ) . -arrestin inhibits the destruction complex composed of glycogen synthetase kinase 3 ( gsk3 ) , axis inhibition 1 ( axin1 ) , -transducin repeat containing protein ( -trcp ) , and adenomatous polyposis coli ( apc ) , and thus promotes the accumulation of a non - ser / thr phosphorylated active form of -catenin . -arrestin-1 shuttles with -catenin into the nucleus , where it interacts with p300 histone acetyltransferase to enhance -catenin / t - cell - specific transcription factor-4 ( tcf4)-transactivation , thus promoting the transcription of genes such as edn1 , matrix metalloproteinase 2 ( mmp-2 ) , or cyclin d1 ( ccnd1 ) and leading to enhanced chemoresistance , epithelial to mesenchymal transition ( emt ) , stemness , cell plasticity , invasion , and metastasis . as a signal transducer , endothelin a receptor ( etar , ednra)/-arrestin-1 initiates transactivation of the vascular endothelial growth factor receptor-2 ( vegfr-2 ) through src . in parallel , paracrine production of et-1 activates endothelin b receptor ( etbr , ednrb ) expressed on endothelial cells , promoting expansion of vascular networks . the dual etar and etbr antagonist macitentan targets not only cancer cells ( which express etar and etbr ) but also tumor - associated stromal elements ( which express etbr ) . the challenge that lies ahead is integrating our improved understanding of the interconnected molecular mechanisms promoted by the et-1 axis in chemoresistant eoc cells with novel therapeutic options to improve patient outcomes . can et-1 receptors be directly targeted to resensitize eoc cells to cisplatinum or taxol ? treatment of resistant cells with the approved small molecule macitentan , a dual etar / etbr antagonist that prevents formation of the -arrestin-1/-catenin / p300 complex on the target , caused a strong reduction in growth and invasiveness . in vivo , macitentan significantly inhibited tumor growth , neovascularization , intravasation , and peritoneal dissemination in chemoresistant eoc xenografts by interfering with etar expressed on eoc cells and etbr expressed on endothelial cells . one striking observation is that the combination of macitentan and chemotherapy restored sensitivity to cisplatinum and taxol . consistent with the in vitro results , analysis in human platinum - resistant eoc tissues showed that etar overexpression is significantly associated with chemoresistance and poor prognosis , emphasizing etar as a potential predictive marker of drug response . taken together , the results of our study provide novel mechanistic insights into how wnt/-catenin signaling is wired to etar/-arrestin-1 to enable eoc cells to become unresponsive to chemotherapeutics . in the nucleus , the -arrestin-1-catenin connection represents the initial scaffold on which transcriptional regulatory complexes could be built to regulate epigenetic modifications . furthermore , in the cytosol , distinct -arrestin-1 complexes can recruit factors that activate crosstalk with tyrosine kinase receptor , such as vascular endothelial growth factor receptor-2 ( vegfr-2 ) , indicating that -arrestin-1 might control an intriguing spectrum of pathway interactions that regulate drug sensitivity . although these findings reveal the interplay between etar and wnt/-catenin signaling , a number of questions remain . for example , does nuclear -arrestin-1 have a common role in mediating -catenin transcription in other et-1-driven tumors ? how does -arrestin-1 translocate to the nucleus in response to etar activation and is the receptor part of the nuclear complex ? what causes the relatively high level of etar in chemoresistant eoc ? these and other issues , such as whole - genome chip - seq analysis to identify new -arrestin-1 partners , are currently being addressed to understand the early events leading to the acquisition of chemoresistance in eoc and other et-1-driven malignancies . targeting multiple networks using the dual etar and etbr antagonist macitentan to overcome compensatory mechanisms of therapy escape provides the potential advantage of targeting not only cancer cells ( which typically express etar ) but also microenvironment - associated elements , such as vascular , lymphatic , and inflammatory cells and fibroblasts , which all express etbr . the present study therefore has biological and clinical relevance for the development of new prognostic tools and novel treatments to overcome chemoresistance , and offers a strong rationale for translation of the experimental approach of combining macitentan with chemotherapy into immediate clinical evaluation in this disease setting . | knowledge of the mechanisms underlying chemoresistance is important in the development of novel targeted treatments for ovarian cancer . we recently reported that targeting endothelin a receptor/-arrestin-1 , a binding partner of wnt/-catenin , is sufficient to sensitize ovarian cancer to chemotherapy .
this result highlights endothelin-1 receptor antagonists as potential anticancer therapeutics . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mitochondria exert multiple roles in cells ; in addition to atp synthesis through oxidative phosphorylations ( oxphos ) , they are at the crossroad of numerous metabolic pathways , contribute to heat production , and control cell - cycle / apoptosis and regulation of several anaplerotic reactions [ 1 , 2 ] . oxphos occur within the respiratory chain ( rc ) that is composed of four protein complexes ( complexes i iv ) . these proteins transfer electrons and protons across the inner mitochondrial membrane generating the electrochemical gradient for atp synthesis , which is performed by the atp synthase ( complex v ) ( reviewed in [ 14 ] ) . within the mitochondrial rc , ubiquinone or coenzyme q10 ( coq10 ) plays a crucial role in accepting and shuttling electrons ( figure 1 ) . coq10 is a ubiquitous lipophylic vitamin - like substance that is found in high concentrations in tissues with elevated energy turnover ( heart , brain , liver , and kidney ) . in humans , coq10 is comprised of a quinone group and a tail of 10 isoprenyl units ( figure 1 ) . it is endogenously synthesized through a multienzyme mitochondrial complex , that is encoded by at least 16 genes ( pdss and coq genes ) ( figure 1 ) . coq10 is also a cofactor for several dehydrogenases , a modulator of the mitochondrial permeability transition pore ( mpt ) that acts as a gating channel for apoptosis , a cofactor for pyrimidine biosynthesis , and an important antioxidant . approximately 0.2% of oxygen molecules are not reduced into water during oxphos and form reactive oxygen species ( ros ) that can be converted by the fenton reaction into highly reactive hydroxyl radicals ( oh ) , causing oxidative damage of mitochondrial dna ( mtdna ) , peroxidation of lipids and proteins , and activation of the mpt [ 1 , 2 ] ( figure 1 ) . accumulation of free radicals plays a crucial role in the physiopathology of many mitochondrial diseases . in normal conditions , ros are scavenged by superoxide dismutase , catalase , glutathione peroxidase , and thioredoxin peroxidase ( figure 1 ) ; coq10 , vitamin c , vitamin e , and other small molecules also contribute to the mitochondrial defense arsenal against oxidation [ 1 , 5 ] . mtdna is composed of a 16,569 bp circular string that encodes for 37 genes , including all 22 trnas , 2 rrna subunits , and 13 structural proteins of the rc ; the remaining 75 proteins that compose the rc and other structural or functional mitochondrial proteins ( more than 1000 ) are encoded by nuclear genes [ 3 , 9 ] . in particular and relevant to several mitochondrial disorders , the biogenesis of the rc requires a number of assembly factors that are encoded by nuclear genes ; although these proteins are not structural components of mature rc complexes , they control correct folding and maturation of protein subunits , and the delivery and insertion of prosthetic groups into the holoenzymes of the rc . mitochondria are transferred from mothers to their progeny in the oocyte ; therefore , genetic diseases involving mitochondrial genes follow a maternal inheritance . the first mutations in mitochondrial genes have been reported in the late 1980s [ 1013 ] . since then , a large number of mutations in mtdna have been reported and are collected in the mitomap human mitochondrial genome database ( http://www.mitomap.org/ ) . their prevalence in the general population may be as high as 1 - 2 : 10000 live births ; mutations can be maternally inherited or sporadic . in addition , mtdna disorders can follow a mendelian pattern of inheritance if they are secondary to mutations of nuclear genes that control mtdna copy number or integrity . as opposed to nuclear genes , the genetic information encoded by mtdna is present in hundreds of copies per cell ; mutations may affect all mtdna copies ( homoplasmy ) or only a portion of the mtdna endowment of cells ( heteroplasmy ) . symptoms of patients with heteroplasmic mutations depend on the relative proportion between mutated and wild - type mtdna copies . cell dysfunction generally occurs when the proportion of mutated mtdna exceeds a given threshold ; tissues with high metabolic rates such as brain , skeletal muscles , heart , and renal tubules are particularly exposed . the degree of heteroplasmy is also variable from oocyte to oocyte , causing significant differences in disease expression among siblings . mutations in nuclear dna may affect genes involved in mtdna maintenance and replication , mitochondrial protein synthesis , protein subunits of individual complexes ( they are common for complex i , but rare for other rc complexes ) , and assembly factors [ 1 , 3 ] . despite mendelian inheritance , high variability in the clinical expression also characterizes nuclear mutations . phenotypes associated with individual genes , however , tend to be more homogeneous ; surf1 mutations , for example , cause leigh syndrome , sco2 mutations are always associated with cardiomyopathy , complex i deficiencies ( regardless of the gene involved ) tend to present with isolated encephalopathy , and tubulopathy is a common feature of bcs1l mutations . differences among patients with mutations in the same gene can be ascribed to the severity of individual mutations , degree of residual activities , modulating genes , or to the redundancy of the system . nearly all organs can be affected in mitochondrial cytopathies , resulting in very heterogeneous clinical presentations . skeletal muscles are very frequently affected ( myopathy , hypotonia , and exercise intolerance ) . central nervous symptoms develop over time in most patients ; virtually all types of neurological symptoms have been described in these disorders , including apnea , hypotonia , lethargy , psychomotor regression , ataxia , stroke - like episodes , hemiparesis , spasticity , seizures , dementia , leukodystrophy , myoclonus , cortical blindness , migraine , polyneuropathy ( sensory and/or motor ) , and neurogenic bladder . sensorineural deafness and cardiac diseases ( myocardiopathy , arrhythmias , and heart block ) are also commonly observed but may remain subclinical and should always be excluded . endocrine complications include diabetes mellitus , hypoparathyroidism , hypothyroidism , hyporeninemic hypoaldosteronism , and growth hormone deficiency . gastrointestinal symptoms may be related to liver dysfunction , to intestinal dysmotility ( vomiting , diarrhea , and pseudoobstruction ) , or malabsorption . many patients have ocular problems , including progressive external ophthalmoplegia , ophthalmoparesis , pigmentary retinal degeneration , ptosis , cataract , optic atrophy , and blindness . finally , various skin and hair lesions have also been described . from the renal stand point , patients may present with signs of tubulopathy , proteinuria , nephrotic syndrome , tubulointerstitial nephritis , cystic kidney disease , myoglobinuria , or renal failure ( see below ) . although the above list of symptoms highlights the extreme variability of phenotypes , a major characteristic of these diseases is the progressive involvement of different organs over time . to date , more than 40 clinical syndromes have been described , based on the association of different symptoms [ 1 , 3 ] . when suspecting a mitochondrial defect , the first step is generally to measure serum lactate , which is frequently elevated . in oligosymptomatic renal diseases , brain lactate can also be directly measured in the cerebrospinal fluid or estimated by brain mr spectroscopy . the diagnostic workup requires a combination of different approaches , including biochemistry and enzymology analyses , molecular genetics , pathology ( histology , histochemistry , and electron microscopy ) , and neuroradiology studies . measurement of urine organic acids by gas - chromatography / mass spectrometry ( gc - ms ) represents a helpful tool for diagnosing mitochondrial cytopathies ( figure 2 ) . impaired rc activity causes the accumulation of reduced nadh / nadph promoting the conversion of acetoacetate into 3oh - butyrate in the mitochondrion and the conversion of pyruvate into lactate in the cytosol ( figure 1 ) . these compounds are often observed in excess in urines , in association with intermediary products of the krebs cycle ( e.g. , 2-ketoglutarate , fumarate , malate , or succinate ) . in some cases , specific profiles of urinary organic acid in combination with abnormal patterns of blood acylcarnitines allows the diagnosis of specific defects , such as ethylmalonic encephalopathy ( ethe ) or sucla2- , suclg1- , and tmem70-related diseases [ 1720 ] . in addition , low cytosolic atp impairs the activity of the -glutamyl cycle , which generates glutathione using the energy provided by the hydrolysis of atp . we have observed in several cases of renal mitochondrial cytopathies increased urinary excretion 5-oxoproline , the upstream metabolite of the -glutamyl cycle ; this finding is not specific of mitochondrial dysfunctions but is highly evocative of a mitochondrial defect if found in conjunction with high urinary excretion of 3oh - butyrate and lactate . further indications may be obtained by quantitative analysis of plasma aminoacids , which typically shows high alanine ( figure 1 ) and/or low citrulline levels . these tests require specialized laboratories , but represent first - line analyses allowing to investigate mitochondrial cytopathies with minimal invasiveness . further investigations usually require to obtain tissue samples ; the general rule is to perform tests on samples collected from the most affected organs . however , in some cases , this approach may be unreasonably aggressive , and studies can be performed on cultured fibroblasts . measurement of the rc complexes in the kidney , for example , may require an open surgical biopsy to obtain enough material . similarly , coq10 determination has been traditionally performed on skeletal muscle , which is an invasive procedure in infants . fortunately , the metabolic defects observed in skeletal muscles , heart , liver , or kidneys are generally present in fibroblasts , which can be easily expanded and shipped to specialized laboratories for diagnosis . in addition and contrary to other biopsy specimens , treatment of metabolic defects ( coq10 biosynthesis defects , e.g. ) can be started before obtaining a skin biopsy , because oral supplementations do not influence the results of analyses performed on cultured fibroblasts [ 23 , 24 ] . several methods have been developed to assess the rc activity in tissues ( reviewed in ) . polarographic studies are usually used to measure oxygen consumption in the presence of oxidative substrates such as pyruvate , glutamate , malate , or succinate . spectrophotometric studies allow to measure the activity of each rc complex ; in addition , they allow to test the combined activity of [ complex ii + complex iii ] that depends on coq10 . when the combined activity of [ complex ii + complex iii ] is markedly lower than the activity of each complex tested separately , results strongly suggest a ubiquinone biosynthesis defect . in tissues sections , the activity of mitochondrial enzymes , such as cytochrome c oxidase ( cox ) and succinate dehydrogenase ( sdh ) , can be easily assessed with histochemistry techniques [ 3 , 2729 ] . these assays are routinely performed on frozen muscle biopsy specimens but can also be applied to other tissues , such as the renal cortex . because cox is encoded in part by mtdna , and sdh is entirely encoded by nuclear genes , these studies can demonstrate heteroplasmy by showing cells with high sdh activity secondary to compensatory mitochondrial proliferation and low cox activity ; in other cases , they may show a more diffuse decrease in the activity of both enzymes . electron microscopy , when available , generally demonstrates abnormal mitochondria , proliferation of mitochondria , or mitochondria depletion ( figure 3 ) . depletion of mitochondria is particularly apparent in proximal tubular cells , which are very rich in these organelles ; mitochondrial proliferation in podocytes of patients with steroid - resistant nephritic syndrome ( srns ) is very evocative of a coq10 defect . several renal diseases have been reported over the past 2 decades , including tubular disorders , chronic tubulointerstitial nephritis , cystic renal disease , and glomerular diseases . in addition , two distinct entities that have primarily glomerular involvement have been identified ; these include mtdna mutations in the trna gene and coq10 biosynthesis defects . inherited disorders of mitochondrial fatty acid oxidation can also present with renal involvement . in a large series of 107 patients , saudubray et al . since massive rhabdomyolysis represents a frequent event during episodes of acute metabolic decompensation , acute renal failure is generally secondary to myoglobinuria in these patients . transient renal tubular acidosis has been observed in carnitine palmitoyltransferase type 1 deficiency in combination with reye - like syndrome . deficiency of carnitine palmitoyltransferase ii causes a neonatal onset lethal multiorgan disease with cystic kidney dysplasia associated with dysmorphic features , central nervous system malformations , liver failure , and cardiomyopathy [ 34 , 35 ] . similar findings can be observed in glutaric aciduria type ii ( or multiple acyl - coa dehydrogenase deficiency ) , an autosomal recessive defect of mitochondrial energy metabolism . in both conditions , cystic kidneys can be detected prenatally or at birth through routine ultrasonography examination , showing hyperechoic and enlarged kidneys . these abnormalities are also observed in zellweger syndrome and other disorders of peroxisomal -oxidation suggesting that , regardless of the subcellular localization of the biochemical defect , abnormalities of fatty acid oxidation can lead to abnormal organogenesis . not surprisingly , the most frequent renal tubular finding is a proximal tubular defect , which has been reported in more than 60 patients ; of these , 39 have been summarized by niaudet and rotig in 1997 ; 21 additional patients could be identified in the literature [ 3742 ] , including a large spanish cohort reported by martn - hernndez et al . in 2005 . in approximately one - third of patients , the remaining patients had more restricted and generally less overt tubular losses and presented with proximal renal tubular acidosis , glycosuria , hyperphosphaturia , and/or aminoaciduria . nearly all patients had extrarenal symptoms , although cases of isolated tubulopathy have been reported [ 38 , 39 ] , indicating that serum and urine lactate should be investigated in all patients presenting with idiopathic de toni - debr - fanconi syndrome . from a biochemical stand point , the most frequent findings are complex iii and/or complex iv defects , followed by complex i defects . from a genetic stand point , all types of mutations have been reported , but large mtdna deletions are particularly frequent . tubular involvement is a relatively frequent feature in severe , neonatal - onset rc defects with autosomal recessive inheritance and multisystem involvement ; among genes associated with this phenotype are cox10 , bcs1l , rrm2b , mrps22 , and sars2 [ 4448 ] . symptoms were present in the neonatal period in one - third of patients and in 80% of cases by 2 years of age . renal biopsies , when available , showed chronic tubulointerstitial changes with damaged proximal tubular epithelia ; electron microscopy often showed proliferation of abnormal mitochondria ( figure 3 ) [ 31 , 37 ] . few patients with a bartter - like phenotype have also been reported [ 30 , 49 ] . finally , severe hypomagnesemia is often mentioned in the descriptions of patients with mitochondrial tubulopathies . of notice , abnormal renal tubular findings remain subclinical ( or are overlooked because of the prominence of neurological symptoms ) in nearly 2/3 of patients with tubulopathy . when approaching patients with a mitochondrial tubulopathy , clinicians should keep in mind that mitochondrial damage can also be secondary to other causes , including metabolic diseases ( tyrosinemia type i , e.g. , ) , drugs ( ifosfamide , e.g. , ) , or toxic agents , in particular heavy metals ( cadmium , e.g. , ) . a de toni - debr - fanconi syndrome secondary to antimitochondrial antibodies in two patients with primary biliary cirrhosis has also been described . rare cases presenting with chronic renal failure secondary to tubulointerstitial nephritis , without evidence of a primary tubular defect , have been reported ; they all had extrarenal symptoms [ 5557 ] . sclerotic glomerular lesions are often described in renal mitochondrial diseases and are probably secondary to tubular and tubulointerstitial lesions . at least nine patients presenting with primary glomerular lesions have been described in the literature [ 31 , 58 , 6163 ] . all patients had or developed over time neurological symptoms ( encephalomyopathy ) ; most patients progressed to chronic renal failure if they survived their extrarenal symptoms . the renal pathology , when available , was consistent with focal segmental glomerular sclerosis ( fsgs ) ; by em , depletion or proliferation of abnormal mitochondria in glomerular cells has been described . the 3243 a > g point mutation in the leucine trna gene is the most prevalent mtdna defect . this mutation was initially described in children with melas syndrome ( myopathy , encephalomyopathy , lactic acidosis , and stroke - like episodes ) [ 2 , 3 ] ; however , investigations of mothers that carried the same mutation showed that the clinical spectrum can be more restricted to diabetes mellitus , deafness , and/or neuromuscular symptoms [ 2 , 64 ] ; nearly 1% of the diabetic population carries this mutation . in 1997 , a large systematic screening of diabetic patients with a history of maternally inherited diabetes and/or sensorineural hearing loss showed a disproportional number of patients with end - stage renal failure secondary to a proteinuric renal disease in this subset of patients . since then , at least 27 cases ( and their relatives ) have been described [ 6472 ] . patients with deafness and proteinuria can also be misleadingly diagnosed with alport syndrome ; a total of 90 alport patients have been screened in two studies for a melas mutation , allowing to identify 2 misdiagnosed cases [ 65 , 69 ] . overall , 2/3 of reported patients are females ; diabetes and/or deafness is generally present in the proband 's mother and other family members [ 65 , 6769 ] . four cases of chronic tubulointerstitial nephritis and one case presenting with cystic kidney disease have also been described [ 64 , 72 ] . a peculiar vasculopathy with hyalinosis of small arteries and myocyte necrosis has been noticed in 2 reports [ 66 , 67 ] . all patients had high - urinary protein excretion ; nephrotic syndrome developed in approximately one - third of cases . proteinuria generally began in the second or third decade of life , with the youngest patient diagnosed at the age 5 . chronic or end - stage renal failure developed within 10 years in approximately 50% of cases . nearly 80% of patients had sensorineural deafness or diabetes mellitus at diagnosis ; some , in particular younger patients , developed these symptoms during followup [ 6472 ] . primary coq10 deficiencies deserve a special place among mitochondrial renal defects because they represent the only treatable mitochondrial disorder . they were first reported in 1989 in association with myopathy and encephalopathy , and later with cerebellar ataxia . the link between coq10 and renal disease was established in 2000 when three siblings were diagnosed with progressive encephalopathy and srns ; neurological symptoms improved significantly after treatment with oral ubidecarenone . two additional siblings that developed srns at 1 year of age were reported in 2005 . the first child developed progressive encephalomyopathy and stroke - like episodes at 18 months but improved after oral coq10 therapy , while the younger sister , who was diagnosed following her brother disease , was treated immediately after developing proteinuria and never developed neurological symptoms . mutations in the coq2 gene were identified in these two siblings as the first report of a genetic defect associated with primary coq10 deficiency . coq2 encodes for parahydroxybenzoate polyprenyl transferase , the enzyme that joins the polyprenoid tail to the quinone group of coq10 ( figure 1 ) . coq2 mutations have been found in four additional patients , all presenting with congenital or early - onset srns [ 26 , 79 ] . mutations in two other genes involved in the biosynthesis of coq10 have been identified in patients with similar clinical features , namely , in the pdss2 gene ( 1 patient ) and in the coq6 gene ( 11 patients from 5 different kindreds ) . symptoms always began within the first years of life ; srns was the presenting symptom in most cases , and unless treated , renal disease progressed to end - stage renal failure within few years . other clinical features included deafness and encephalomyopathy in coq6 patients ; severe forms with neonatal onset may also present with liver failure and severe lactic acidosis [ 26 , 79 ] . other genes required for coq10 biosynthesis can present with different phenotypes : coq9 mutations , for example ( 1 patient ) , cause a severe multisystem disorder with a renal tubulopathy , but no apparent glomerular involvement ; patients with mutations in the coq8 or pdss1 have no apparent renal disease [ 78 , 83 , 84 ] . the renal pathology varies from focal segmental glomerulosclerosis to collapsing glomerulopathy [ 26 , 85 ] ; electron microscopy generally shows numerous dysmorphic mitochondria in the cytoplasm of podocytes [ 26 , 85 ] . our understanding of coq10 has largely benefitted from the availability of the kd mouse model that recapitulates the renal phenotype of many coq10-deficient patients . these animals were described in the early 1970s , but their genetic defect was identified only in 2008 , when it was shown that they harbor a homozygous mutation in the pdss2 gene . kidneys are normal at birth and develop progressive interstitial nephritis associated with focal segmental glomerulosclerosis or collapsing glomerulopathy ; most animals progress to end - stage renal disease by 48 months of age and die of renal failure . glomerular podocytes play a central role in this animal model , while tubular dilatations and interstitial nephritis represent a downstream consequence of the glomerular disease , as demonstrated by conditional knock - out experiments of the pdss2 gene in podocytes or tubular cells . furthermore , it has been shown that dietary supplementation with coq10 prevents proteinuria and renal changes in mutant mice . to date in particular , the prevalence of lesions in glomerular cells , which are less energy dependant than tubular cells , raises the possibility that cell damage may not be entirely related to the role of coq10 in bioenergetics . in addition , growth of coq10-deficient fibroblasts can be corrected by uridine , suggesting that impairment of nucleotide metabolism ( coq10 is required for the biosynthesis of pyrimidines ) may also play a role in the pathogenesis of these disorders . the important role of coq10 as an antioxidant may also be responsible for glomerular damage ; an inverse relationship between the severity of coq10 deficiency and ros production has been demonstrated in patient 's fibroblasts [ 90 , 91 ] ; this hypothesis , however , is not substantiated by in vitro data showing that quinone analogues such as idebenone , which are good antioxidants but can not rescue the mitochondrial respiratory defect , are probably not effective in the treatment of these diseases [ 74 , 92 ] . finally , a number of studies in kd mice indicate that environmental factors are important in the development and progression of renal disease . for example , it has been shown that calorie restriction dramatically increases survival of these animals , while protein restriction has no effect ; other studies have shown that placing mice in a germ - free environment slows disease progression , underscoring the complexity of factors that are involved in the pathophysiology of coq10 renal defects . regardless of the mechanisms underlying coq10 defects , one of the most important aspects is the clinical response to oral supplementations . initial reports failed to show benefits on renal lesions because patients had already advanced kidney disease [ 74 , 75 ] . conversely , when treatment was initiated immediately after the onset of renal symptoms in one girl , prompt reduction of proteinuria was observed ; this patient has normal renal function nearly 8 years after starting treatment . empirically , coq10 doses of 3050 mg / kg / day have been used , but appropriate pharmacokinetic studies are lacking [ 76 , 81 ] , whereas pdss2 mutant mice were treated with doses of 200 mg / kg / day . different pharmaceutical formulations are commercially available ; aqueous or oleous suspensions should probably be preferred to tablet preparations that contain crystalline forms of coq10 . in summary , current evidences indicate that ubiquinone treatment should be started very early to prevent the development of irreversible lesions , especially in brain and kidneys . a suspicion of a coq10 deficiency should always arise in patients with early - onset srns , especially when podocyte mitochondrial abnormalities are observed by electron microscopy , in the presence of lactic acidosis or when neurologic or muscular symptoms are present . | renal diseases in mitochondrial cytopathies are a group of rare diseases that are characterized by frequent multisystemic involvement and extreme variability of phenotype .
most frequently patients present a tubular defect that is consistent with complete de toni - debr - fanconi syndrome in most severe forms . more rarely , patients present with chronic tubulointerstitial nephritis , cystic renal diseases , or primary glomerular involvement . in recent years , two clearly defined entities , namely 3243 a > g trnaleu mutations and coenzyme q10 biosynthesis defects , have been described .
the latter group is particularly important because it represents the only treatable renal mitochondrial defect . in this paper , the physiopathologic bases of mitochondrial cytopathies ,
the diagnostic approaches , and main characteristics of related renal diseases are summarized . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
numerous cases of acute and chronic pulmonary conditions are accompanied by extravasation of erythrocytes to the lower respiratory tract ( lung hemorrhage ) . these pathological events are frequently associated with marked leukocyte influx and an increase in inflammatory markers [ 17 ] . in cases of moderate to intense hemolysis that succeed hemorrhagic events , the scavenging of free heme by blood - derived hemopexin or albumin collapses , leading to the accumulation of free heme in the extracellular milieu . it has been previously reported that high expression of haptoglobin , the major protein responsible for the removal of free hemoglobin , reduces tissue injury associated to blood exposure . accordingly , the induction of heme oxygenase-1 ( ho-1 ) can promote cytoprotective responses in some models of lung injury [ 810 ] . this stress - inducible enzyme controls the deleterious effect of large amounts of free heme , catabolizing this porfirin in biliverdin , carbon monoxide , and free iron , which are addressed , both directly and indirectly , as cytoprotective agents . these observations support the hypothesis that free heme may be involved in the onset and/or amplification of pulmonary inflammatory responses . the proinflammatory role of heme has been extensively demonstrated [ 1114 ] . in mononuclear cells , for instance , heme impairs cytokine release and induces ltb4 production in a superoxide dismutase and 5-lypoxigenase - dependent manner , respectively [ 12 , 13 ] . furthermore , heme induces peritoneal macrophage necrosis through two distinct and complementary signaling pathways involving autocrine tumor - necrosis - factor- ( tnf- ) and reactive oxygen species ( ros ) production . in addition , heme reduces mice survival and augments cytokine secretion induced by lps both in vivo and in vitro . some of these data suggest that a toll - like receptor ( tlr ) and a g - protein coupled receptor ( gpcr ) are molecular targets for free heme resulting in proinflammatory effects [ 1214 ] . however , the impact of heme on alveolar macrophage ( am ) physiology has not been investigated . ams patrol the alveolar epithelial environment , eliminating microorganisms by phagocytosis / killing , triggering an inflammatory response that can be amplified by the macrophages themselves through the production of inflammatory mediators . activation of am by soluble and particulate stimuli can induce an oxidative burst , catalyzed by nox-2-containing nadphox enzyme complexes , which generate high amounts of o2 through the reduction of molecular oxygen . cell activation results in phosphorylation and translocation of cytoplasmic components of nadphox ( p40 , p47 , and p67 ) to the plasma membrane and consequent association to the membrane - bound subunits ( p22 , gp91 ) comprising the catalytic active nadphox [ 1821 ] . furthermore , the activation of macrophages by bacterial products and cytokines can also induce the activation of inducible nitric oxide synthase ( inos ) with the subsequent production of high amounts of no , another known microbicidal molecule produced by phagocytes [ 2225 ] . our group characterized free heme as a proinflammatory agent , able to activate polymorphonuclear neutrophils ( pmn ) and delay the spontaneous apoptosis of these cells by a mechanism that relies on nadphox - generated ros [ 8 , 26 , 27 ] . furthermore , these heme - induced proinflammatory effects involve the activation of the redox - sensitive transcription factor nuclear factor-b ( nf-b ) . nf-b activation mediates the transcription of cytokines such as il-1 , il-6 , and tnf- . these observations support the idea that free heme could be involved in the development of pulmonary inflammatory responses . however , the role of heme on am functions requires further investigation . in this study , we demonstrate that heme stimulates ros and no production ; enhances il-1 , il-6 , and il-10 release ; increases inos and ho-1 expression ; and potentiates phagocytosis and bacterial killing by rat am . the data point to a key role of heme in lung inflammatory processes and may lead to the development of new strategies to ameliorate tissue damage associated with hemorrhagic episodes . all experimental procedures used throughout this study were approved by our institutional ethics committee and are in accordance with the national institute of health animal care guidelines . three - month - old wistar rats free from any infection / pathogen were obtained from animal facilities of the oswaldo cruz foundation ( rio de janeiro , brazil ) and were kept in a room at a controlled temperature ( 25 1c ) and with an artificial dark - light cycle ( light from 7:00 a.m. to 7:00 p.m. ) . dulbecco modified eagle medium ( dmem ) , rpmi 1640 , and penicillin / streptomycin / amphotericin b solution were purchased from life technologies , invitrogen ( carlsbad , ca ) . sds , antibodies , and type iv horseradish peroxidase ( hrp ) were purchased from sigma ( st louis , mo ) . compounds requiring reconstitution were dissolved in either ethanol or dmso . required dilutions of all compounds were prepared immediately before use , and equivalent quantities of vehicle were added to the appropriate controls . rat resident ams were obtained via ex vivo lung lavage as previously described and resuspended in rpmi 1640 . cell suspension density was determined using a hemocytometer , and the appropriate number of am was allowed to adhere in flat - bottom 6- , 24- , and/or 96-well plates ( bd biosciences ) for 1 h at 37c in a 5% co2 atmosphere . nonadherent cells were removed by washing the monolayers with serum - free medium , resulting in more than 99% of adherent cells identified as ams by use of a modified wright - giemsa stain ( diff - quik ; american scientific products , mcgraw park , il ) . the cells were washed and the medium was replaced by dmem without serum 20 min before assays . none of the treatments affected am viability , as determined by mtt ( 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ) reduction assay and trypan blue dye exclusion ( data not shown ) . ams were suspended in hank 's balanced salt solution ( hbss ) and placed in a white 96-well plate ( 2 10 cells / well , final volume 200 l ) . cells were then pretreated or not with dpi ( 10 m ) or apocynin ( 10 m ) for 15 min at 37c in 5% co2 atmosphere and loaded with luminol ( 500 m ) . next , cells were stimulated with heme ( 130 m ) or pma 10 ng / ml , a known nadphox inducer as a positive control . the plate was placed in an envision plate reader ( perkinelmer ) and ros production was accessed by measuring the chemiluminescence in each well for 20 seconds , performing time kinetics every 10 min for an hour . ams ( 3 10 cells / ml ) were plated in 6-well tissue culture dishes and incubated with heme ( 10 m ) for different periods of time at 37c . after incubation , the macrophage monolayers were lysed in lysis buffer containing 50 mm tris - hcl ( ph 7.4 ) , 150 mm nacl , 1.5 mm mgcl2 , 1.5 mm edta , triton x-100 ( 1% v / v ) , glycerol ( 10% v / v ) , aprotinin ( 10 g/l ) , leupeptin ( 10 g/l ) , pepstatin ( 2 g/l ) , and 1 mm pmsf . lysates ( 2 g/l ) were incubated overnight at 4c with an anti - p47 antibody ( 1 : 200 ; santa cruz biotechnology ) . then , protein a / g agarose ( 20 l / mg protein ; santa cruz biotechnology ) was added and samples were incubated at 4c under rotation for 2 h . ams ( 1 10/ml ) were plated in 6-well tissue culture dishes and incubated with heme ( 330 m ) for 3 h at 37c , followed by immediate freezing in an ice bath to stop the reaction and centrifuged at 10,000 rpm for 5 min at 4c . the supernatants were collected and tnf- , cinc , il-1 , il-10 and il-6 levels were determined by an enzyme - linked immunosorbent assay ( elisa ) . briefly , microtitre plates ( nunc - maxisorb ) were coated overnight at 41c with a specific antibody . after blocking the plates , 50 l of samples were added in triplicate and maintained at room temperature for 2 h. standard curves were obtained by serial dilution of rat tnf- , cinc , il-1b , il-10 , and il-6 . sheep anti - tnf- , cinc , il-1b , il-10 , and il-6 biotinylated polyclonal antibodies were added ( 1 : 500 ) followed by incubation at room temperature for 1 h. finally , 100 l of avidin - hrp ( 1 : 5000 ) was added to each well and , after 30 min , the plates were washed and the color reagent opd ( 40 mg / ml ; 50 l / well ) was added . after 15 min , the reaction was terminated with h2so4 ( 1 mm ; 50 l / well ) and the optical density measured at 490 nm . no release by am was determined by the accumulation of the stable end - product nitrite in cell - free culture supernatants using a modified griess reaction method . briefly , ams ( 2 10 cell / ml ) were incubated in rpmi-1640 medium ( sigma , st . louis , mo ) supplemented with 10% heat inactivated fcs ( fetal calf serum ; invitrogen , carlsbad , ca ) , 100 u / ml penicillin , and 100 mg / ml streptomycin . after 8 h incubation with 5% co2 and 95% o2 at 37c , samples were made to react with the griess reagent ( 1% sulphanilamide in 5% phosphoric acid , 0.1% naphtylethylenodiamine ) at room temperature for 10 min . thereafter , the nitrite concentration was measured by absorbance at 490 nm , referring to the standard curve of sodium nitrite ( dissolved in culture medium solution ) within a concentration range . am ( 1 10/ml ) were seeded in 6-well tissue culture dishes , incubated with different concentrations of heme ( 330 m ) for different periods of time at 37c , followed by immediate freezing in an ice bath to stop the reaction , and centrifuged at 10,000 rpm for 5 min at 4c . to obtain the whole cell extracts , ams were resuspended in proper lysis buffer ( 50 mm mes , ph 6.4 , 1 mm mgcl2 , 10 mm edta , 1% triton x-100 , 1 g / ml dnase , 0.5 g / ml rnase , and the following protease inhibitors : 1 mm phenylmethyl - sulfonyl fluoride ( pmsf ) , 1 mm benzamidine , and 1 m soybean trypsin inhibitor . proteins present in whole cell extracts were recovered by acidic precipitation and dissolved in 1% ( v / v ) sds solution . the total protein content in the cell extracts was determined by the method of bradford . cell lysates were denatured in laemmli 's sample buffer ( 50 mm tris - hcl , ph 6.8 , 1% sds , 5% 2-mercaptoethanol , 10% glycerol , 0.001% bromophenol blue ) and heated in a boiling water bath for 3 minutes . samples ( 30 g total protein from cell extracts ) were resolved by sds - page and proteins were transferred to pvdf membranes . the membrane was blocked with 5% fat - free milk in tris - buffered saline ( tbs ) containing 0.1% tween-20 for 1 h , washed 3 times , and then probed with anti - ho-1 ( 1 : 1000 ) , anti - p47 ( 1 : 1000 ) , anti - pser ( 1 : 1000 ) , anti - inos ( 1 : 500 ) , anti - arginase-1 ( 1 : 100- ) , anti - tubulin ( 1 : 1000 ) , and anti - actin ( 1 : 1000 ) antibodies for 2 hours . after that , the membrane was washed and incubated with a horseradish - peroxidase- ( hrp- ) conjugated sheep anti - rabbit secondary antibody ( 1 : 10000 ; amersham pharmacia biotech , piscataway , nj ) . bands were visualized using the enhanced chemiluminescence system ( ecl , amersham ; arlington heights , il ) . relative band densities were determined by densitometric analysis using national institutes of health image software , and the ratios calculated . in all instances , band density values were corrected by subtraction of the background values . ams ( 1 10 cells ) plated onto cytopreps in rpmi 1640 were pretreated with dpi ( 10 m ) and incubated in the presence of heme ( 10 m ) for 1 or 2 h at 37c . after incubation , cells were fixed with 4% paraformaldehyde and 4% sucrose in pbs for 20 min at room temperature . cells were then permeabilized for 5 min in pbs containing 0.2% triton x-100 , washed with pbs , and incubated with a rabbit anti - p65 subunit of nf-b antibody ( 1 : 50 ) , for 1 h at room temperature . following this step , cells were incubated with a cy3-conjugated anti - rabbit antibody . cytopreps were mounted on a slide using a solution of n - propyl gallate ( 20 mm ) and glycerol ( 80% ) in pbs before examination under an epifluorescence microscope ( olympus model bx40f4 ) . the phagocytosis of sheep red blood cells ( srbcs biocampo , nova friburgo , rj , brazil ) by rat ams was assessed as previously described . briefly , ams were plated at a density of 2 10 cells / well in 96-well plates . srbcs were opsonized with a subagglutinating concentration of rabbit polyclonal anti - srbc igg ( cappel organon teknika , durham , nc ) . ams were washed twice with warm dmem and preincubated with heme ( 0.130 m ) . following treatment , opsonized srbcs were added at a ratio of 20 : 1 ( srbc : am ) and the cocultures were incubated for further 90 min at 37c . cells were washed five times with pbs to remove noningested erythrocytes and treated with 100 l of 0.3% sds in pbs for 10 min , and 100 l of 3 3 5 5-tetramethyl - benzidine ( tmb ) was added to each well as a chromogen . following 5 min incubation ( at 22c ) in the dark , the absorbance at 450 nm was evaluated with an automated reader ( envision plate reader , perkinelmer ) . a standard curve was derived for each experiment , made through serial dilutions of known amounts of srbcs , sds solution , and tmb . the number of srbcs per well was derived from absorbance data at 450 nm using the standard curve . the absorbance represented the number of srbcs in an experimental well ( ingested plus adhered srbcs ) . rat ams ( 2 10/ml ) , prepared as described above , were seeded in duplicate on 96-well tissue culture dishes . klebsiella pneumoniae strain 43816 , serotype 2 , was obtained from the american type culture collection ( manassas , va ) , and aliquots were grown in tryptic soy broth ( difco , detroit , mi ) for 18 h at 37c . cells were then treated with heme ( 3300 m ) for 20 min and infected with a 0.1 ml suspension of opsonized k. pneumoniae ( 1 10 colony - forming units ( cfu)/ml ; multiplicity of infection ( moi ) , 50 : 1 ) for 30 min to allow phagocytosis to occur . cell monolayers were washed , tetrazolium dye reduction assay was performed , and bacterial killing was assessed by the intensity of the absorbance at 595 nm , which is directly proportional to the number of viable bacteria associated with the macrophages . preliminary experiments compared and validate this colorimetric assay with a conventional cfu - based ( serial dilution ) assay , and similar results were obtained ( data not shown ) . the data are representative of different experiments and expressed as mean standard deviation ( s.d . ) . the values of different treatments were compared using student 's t - test and anova , followed by bonferroni t - test for unpaired values . the activation of am caused by exposure to different stimuli might result in the production of ros that can be measured using luminol as a chemoluminescent probe . we observed that heme triggered robust accumulation of ros throughout the experiment ( 160 min , figure 1 ) . pretreatment of am with dpi ( 10 m ) , an inhibitor of nadphox activity , or with apocynin ( 10 m ) , which inhibits the translocation of p47 to the membrane , both significantly reduced ros production by am . supporting a role for nox2 in heme - induced ros production , figure 2 shows that heme ( 10 m ) , after 30 min of incubation , induces p47 phosphorylation in ams . we investigated the profile of cytokine release by am stimulated with different concentrations of heme ( 330 m ) . the treatment with heme ( figure 3 ) markedly induced il-1 and il-6 release , peaking at 30 m . interestingly , heme ( 1030 m ) was also able to induce the secretion of il-10 , an anti - inflammatory cytokine . the treatment with heme ( 10 m ) triggers an increase in inos expression with the concomitant decrease in arginase expression , an enzyme that catabolizes arginine , the main substrate for nos ( figure 4(a ) ) . the increase of inos / arginase-1 ratio was accompanied by a significant no production by am , as shown in figure 4(b ) . the treatment of am with heme ( 1030 m ) induces expression of ho-1 , as shown in figure 5 . furthermore , heme - induced ho-1 expression is both concentration and nadphox dependent , as this phenomenon was significantly inhibited by pretreatment of the cells with dpi , a nadphox inhibitor ( figure 5 ) . to investigate whether heme activates nf-b in am , cells were stimulated with heme ( 10 m ) and the nuclear translocation of the p65 nf-b subunit was accessed by immunocytochemistry . as shown in figure 6 , heme induced the nuclear accumulation of p65 , which was comparable to the increase evoked by lps ( 1 g / ml ) . moreover , heme - induced nf-b activation was abolished in the presence of dpi , a nadphox inhibitor ( figure 6 ) . in order to evaluate the effect of heme on phagocytosis , isolated rat am were pretreated with heme ( 0.130 m ) for 10 min ( figure 7(a ) ) or 24 h ( figure 7(b ) ) before incubation with igg - opsonized sheep red blood cells ( igg - srbc ) . heme , in a dose - dependent manner , increases fcr - mediated phagocytosis . both treatments with heme , acute and overnight , induced a consistent increase in igg - srbc phagocytosis , which reached maximum levels in a concentration range between 10 and 30 m . furthermore , the treatment of ams with heme ( 3300 m ) for 10 min significantly decreased intracellular survival of phagocytosed klebsiella pneumoniae ( figure 7(c ) ) . lung hemorrhagic episodes are accompanied by a severe hemolysis and can occur during pathological states such as chronic bronchitis , cystic fibrosis , lung cancer , pulmonary embolism , pneumonia , tuberculosis , and traumatic injury , resulting in intrapulmonary high levels of free heme [ 13 ] . studies have shown heme 's proinflammatory properties [ 8 , 9 , 1215 , 26 , 27 ] , supporting its role as a putative inductor of lung inflammation . ams are the first line of defense and , in case of lung hemorrhagic episodes , could interact with free heme [ 3 , 4 ] . we are now showing , for the first time , that heme activates inflammatory and oxidative responses in am , triggering the production of oxygen and nitrogen species , via nadphox and inos , respectively . heme also promotes cytokine production and improves phagocytic and microbicidal activities , two phenomena involved in the immune defense against bacterial infection . coherently with its attributed role as a double - edge sword , displaying both protective and deleterious actions [ 11 , 37 ] , heme also induces ho-1 expression and il-10 production , two players involved in the control and resolution of inflammation [ 3 , 10 , 38 , 39 ] . il-10 can downregulate the production of tnf- , ifn- , and certain chemokines [ 40 , 41 ] . recently , it was suggested that il-10 mediates many of its anti - inflammatory effects via upregulation of ho-1 . in our study , we show that heme induced il-10 production , suggesting that this cytokine could be involved in the increased ho-1 expression in heme - stimulated am . the overexpression of ho-1 accelerates the removal of free heme at the same time it generates carbon monoxide and biliverdin , agents that may act as anti - inflammatory / cytoprotective molecules [ 4245 ] . here , we show that ho-1 was detected in am , only after 24 hours after incubation with heme . this late ho-1 expression may both represent the induction of a counterregulatory , anti - inflammatory response , and a self - preservation mechanism by which these cells prevent continuous cell damage caused by oxidative stress . our group and others have demonstrated that heme signals through pkc activation to activate nadphox in different cell types [ 20 , 27 , 46 ] . the endogenous production of ros can modulate redox - sensitive pathways involved in cell functions and fate [ 47 , 48 ] . in mouse peritoneal macrophages , heme induces tnf- secretion dependently on tlr4 activation and ros generation , two apparently independent effects [ 9 , 13 ] . in line with these results , rat am showed , in a heme - rich milieu , an improvement of their already activated profile , increasing ros production through activation of nox2 , the nadphox family member in phagocytes , since it was shown that heme triggered p47 phosphorylation and apocynin , which impairs p47 translocation , inhibited ros generation . ams also play a prominent role in orchestrating inflammatory and immune responses through the release of mediators such as cytokines and chemokines [ 8 , 28 ] . accordingly , we demonstrate that stimulation of am with heme induced il-1 and il-6 release , but did not affect tnf- and cinc-1 . these results are in contrast with previous reports in mouse peritoneal macrophages , which demonstrate that heme stimulates tnf- and cxc chemokine production . we believe that these differences are due to the unique physiology of ams and should be exclusively addressed as am activation by heme . supporting this hypothesis , the experimental protocol involves the incubation of adherent ams overnight , prior to any treatment , which ensures a virtually exclusive am population . we suppose that the disparity in the response to heme displayed by am and peritoneal macrophages is most probably related to the influence of dramatically different microenvironment surrounding each of these cells . ams are found in the alveoli and alveolar ducts of the lung , living in an aerobic environment , and are considered ready to act / react to external stimuli , not only as phagocytes but also as potent secretory cells in various lung conditions . these observations are consistent with the results depicted in figure 3 , in which resting ams ( controls ) already secrete significant amounts of tnf- and cinc-1 , indicating a basal activated profile . moreover , another indication of the activated state of nonstimulated ams , is the high expression of inos found in these cells ( figure 4 ) . interestingly , even though the treatment with heme did not significantly increase inos expression , it triggered an expressive production of no in am . on the other hand , the minor changes in inos protein content were accompanied by an important decline in arginase expression , resulting in an increase in the inos / arginase ratio . these results indicate that an increased offer of substrate ( arginine ) can be related to an increased efficiency in the production of no by inos . several observations have shown that once exposed to different microenvironments , macrophages acquire either m1- or m2-polarized phenotypes , which are associated with distinct physiological events , such as inflammation and tissue remodeling , respectively . the m1-phenotype is related to the classical activation by ifn- , tnf- , or lps and characterized by a high capacity of antigen presentation and production of proinflammatory cytokines , such as il-12 , il-1 , il-6 , fc receptor , and ros and no generation , and increased microbicidal activity [ 25 , 49 ] . in contrast , the m2 phenotype produces high amounts of tgb- , arginase-1 , and il-1ra , but low levels of proinflammatory cytokines [ 25 , 49 ] . our results strongly suggest that heme can drive am to a strong m1 profile that leads to an increase in macrophage microbicidal activity , enhancing both fc receptor - dependent phagocytosis and killing of opsonized bacteria . heme was previously shown to activate tlr4 and to synergize with microbial products , such as lps , increasing cytokine production by mouse peritoneal macrophages , which correlates with nf-b activation . furthermore , the same authors demonstrated that generation of ros by heme was essential for its potentiating effects upon lps stimulation . the increased basal levels of tnf- and cinc-1 found in the supernatant of am would respond to the high expression of inos detected in control cells . however , as arginase levels were high in nonstimulated cells , the production of no would be rather downregulated in am . on the other hand , the stimulation of am with heme induces nox2 activation and the generated ros would act on activating redox - sensitive pathways , such as nf-b , which could lead to the decrease in arginase levels , giving rise to a massive no production , and an improvement in the phagocytic activity . the increased production of ros and no , which can react to produce the highly cytotoxic mediator peroxynitrite , would be the main factor responsible for the potent microbicidal activity displayed by free heme - stimulated am . taken together , our data indicate that , in the presence of free heme , ams , which are possibly primed by their own microenvironment , become activated cells displaying an m1-like profile . it leads to the generation of nadphox - derived ros and no , activation of the redox - sensitive nf-b pathway , and an increase in cytokine expression , which improves am antimicrobicidal activities ( figure 8) . recent advances in the study of heme 's role as a proinflammatory molecule brings up hope for the development of new strategies to ameliorate acute and chronic inflammation related to hemolytic episodes . however , further investigations are required in order to elucidate how heme interacts with the cell membrane and modulates the activity of other cells of the immune system . | clinical and experimental observations have supported the notion that free heme released during hemorrhagic and hemolytic episodes may have a major role in lung inflammation . with alveolar macrophages ( am ) being the main line of defense in lung environments ,
the influence of free heme on am activity and function was investigated .
we observed that heme in a concentration range found during hemolytic episodes ( 330 m ) elicits am to present a proinflammatory profile , stimulating reactive oxygen species ( ros ) and nitric oxide ( no ) generation and inducing il-1 , il-6 , and il-10 secretion .
ros production is nadph oxidase - dependent , being inhibited by dpi and apocynin , and involves p47 subunit phosphorylation .
furthermore , heme induces nf-b nuclear translocation , inos , and also ho-1 expression .
moreover , am stimulated with free heme show enhanced phagocytic and bactericidal activities .
taken together , the data support a dual role for heme in the inflammatory response associated with lung hemorrhage , acting as a proinflammatory molecule that can either act as both an adjuvant of the innate immunity and as an amplifier of the inflammatory response , leading tissue injury .
the understanding of heme effects on pulmonary inflammatory processes can lead to the development of new strategies to ameliorate tissue damage associated with hemorrhagic episodes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
fluorescence photoswitching constitutes
the core of new and powerful
imaging techniques that are able to greatly improve spatial resolution
in fluorescence microscopy . techniques use different illumination strategies to control the fluorescence
of photoswitchable molecules , allowing an improvement of spatial resolution
that goes beyond the diffraction limit of light . recent advances in fluorescence photoswitching have been
driven by the dramatic expansion of super - resolution microscopy , and have also impacted the development of techniques such as optical
lock - in detection ( olid ) imaging . olid imaging
uses fluorescence photoswitching to improve image contrast , instead
of spatial resolution , in fluorescence microscopy by modulating the
fluorescence emission through optical control . subsequent cross - correlation
analysis with a reference waveform isolates the modulated signal of
interest from the unmodulated background signal . to fully realize
the great potential of these advanced imaging
methods , novel strategies to label cell components with photoswitchable
fluorophores in high density are needed . high - density labeling is
crucial for super - resolution microscopy , as labeling density directly
affects the best achievable spatial resolution . while many options
exist to label proteins with photoswitchable fluorescent molecules ,
the choices for dna are very limited . so far , super - resolution imaging of dna by single - molecule localization
has been possible by stochastic blinking or transient binding of dyes
that can associate noncovalently to dna , as well as by click chemistry . here we describe a strategy for reversible fluorescence photoswitching
in dna with high - density substitution and control over sequence . it
was recently reported that high - density labeling of dna with cyanine
dyes can be achieved by polymerase chain reaction ( pcr ) using a modified
dna polymerase that has been evolved to efficiently incorporate the
cytosine base analogues cy3- and cy5-dctp ( dctp = 5-aminopropargyl-2-deoxycytidine
5-triphosphate ) into double - stranded dna . the resulting biopolymer , termed cydna ,
can be up to about 1.5 kbp long , and displays hundreds of fluorophores
per dna strand . cydna is strongly colored and highly fluorescent ,
although previous observations suggest that fluorescence quenching
at such high density might be a concern , especially for cy5 . herein , we first investigate the mechanisms
of fluorescence quenching in cydna . in addition , we show that cydna
can be re - engineered to perform reversible fluorescence photoswitching
by using the properties of the cy3cy5 pair . by bringing cy3 and cy5 into close contact in the presence of a
thiol compound and in the absence of oxygen , the pair acts as a fluorescence
photoswitch that can be activated at 532 nm and deactivated at 633
nm . we have incorporated the cy3cy5 pair into cydna using
two different approaches , and we demonstrate the potential of this
strategy in olid and other advanced fluorescence microscopy methods
for imaging of dna with sequence specificity . in order to identify
the sources of fluorescence quenching , steady - state spectroscopy was
performed on cy3- and cy5-substituted cydna ( hereafter cy3dna and
cy5dna , respectively ) . figure 1a shows the
absorption spectra of 1.3 kbp fragments of cydna ( 50% gc content )
with different cy5 labeling densities , up to an estimated 25% labeled
base pairs ( see table s1 and text in the supporting information for details ) . the most
striking feature in these spectra is the band at about 600 nm , which
increases concomitantly with the labeling density . this band is blue - shifted
with respect to the s0 s1 band of cy5
at 650 nm , and its excitation does not result in fluorescence emission ,
as seen in the excitation spectra of this species ( figure 1b ) . this observation suggests that the band at 600
nm can be ascribed to the presence of nonfluorescent h - aggregates . dye aggregate
that can be described as a stacked dye dimer in parallel arrangement
( distance between dyes of 35 ) , and whose formation
is characterized by a decrease in the monomeric dye absorption band
and an increase in a nonfluorescent , blue - shifted band . there is also evidence for h - aggregate formation
in cy3dna , although it is much less prominent than for cy5dna ( figure 1c ) . these aggregates are likely to be in the dna
major groove , which is thought to be the location of the dyes in cydna . h - aggregate formation by these dyes has been
observed previously in multiply labeled dna , polyelectrolytes and antibodies , and was also more pronounced for cy5 than for
cy3 . ( a ) normalized absorption spectra of cy5-dctp
( 66 nm , black ) and
cy5dna at increasing labeling density ( see table
s1 in the supporting information ) in tris - edta buffer ( blue , red , green ) . the band at 600 nm strongly
suggests the formation of h - aggregates at higher labeling densities . ( b ) absorption ( black ) , fluorescence emission ( red ) , and excitation
( green ) of cy5dna at a maximum estimated labeling density of 25% . ( c ) absorption ( black ) , fluorescence emission ( red ) , and excitation
( green ) of cy3dna at similar labeling density as ( b ) . in addition to the formation of nonfluorescent
aggregates , further
steady - state fluorescence experiments point to the existence of another
fluorescence quenching mechanism . solutions of cy5-dctp monomer and
cy5dna optically matched ( i.e. , equally absorbing ) and excited at
644 nm ( within the s0 s1 absorption
band ) , showed very different fluorescence intensity ( figure s1 in the supporting information ) . quenching of cy5dna was 79% compared to free cy5-dctp , and 84%
for cy3dna compared to cy3-dctp ( excitation wavelength was 532 nm
in the latter case ) . this additional quenching channel is likely due
to resonance energy transfer ( ret ) or energy hopping between fluorophores ,
which may be trapped in low - energy nonemissive sites , as suggested
before for densely labeled antibodies . due to the
small residual absorption of the nonfluorescent h - aggregates at the
excitation wavelengths , the contribution of other processes such as
ret mentioned above might be slightly overestimated . it is worth
noting that besides the interaction between dyes attached
to the same dna strand , it is also possible to have interactions with
dyes that are attached to the complementary strand . this results in
a range of possible distances and angles , which in turn will be reflected
in a range of coupling strengths and ret efficiencies . moreover , the
linker that connects the cytosine base with the dye is fairly long
( c5 ) , adding additional flexibility and modes of interaction . to introduce reversible fluorescence photoswitching in cydna , we
took advantage of the switching properties of the cy3cy5 pair . as mentioned above , when cy3 and cy5 are closer than 3 nm and in
the presence of a switching buffer ( a thiol compound
and an enzymatic oxygen scavenging system ) , the pair acts as a fluorescence
photoswitch that can be activated at 532 nm and deactivated at 633
nm . the mechanism of fluorescence photoswitching involves the metastable
formation of a dark cy5-thiol adduct , although the role of cy3 as
an activator is still unclear . we introduced fluorescence photoswitching in cydna using two different
strategies . in a first approach , we produced a cy3cy5 heteroduplex
cydna in which each strand was substituted by only one type of dye
( cy3/5dna ) . in the other approach , we produced mixed cydna by randomly
incorporating an equal mixture of cy3 and cy5 during pcr ( cy*dna ) .
in both cases , 1.3 kbp fragments were produced , of which a maximum
of 25% were labeled ( see supporting information for more details ) . figure 2 depicts the number
of fluorescent molecules as a function of time , with 532 nm activation
pulses every 5 s , and confirms that both strategies yielded samples
that were able to photoswitch in a reliable and reversible manner
( panels a and b ) . at least 20 photoswitching cycles could be achieved
with no significant photobleaching ( only about 30% ) . fluorescence
photoactivation of both types of cydna was much more efficient than
pure cy5dna ( figure 2c ) , even though the fluorescence
of the latter could be slightly activated with 532 nm pulses , consistent
with previous observations . switching
from the bright to the dark state was faster in cy*dna , with an average
rate constant of 2.7 s , compared to 1.5 s for cy3/5dna , suggesting that incorporating cy5 in
both strands increases the likelihood of interaction with thiols . fluorescence
photoswitching of ( a ) cy3/5dna , ( b ) cy*dna , and ( c )
cy5dna . the sample was immobilized onto a polylysine - coated coverglass
and imaged in a chamber containing switching buffer . the molecules
were continuously excited at 633 nm , and pulses of 532 nm were used
to photoactivate fluorescence ( represented by the dashed lines ) . the trace in figure 3a highlights
the reliability
of cydna photoswitching even at the single - molecule level , in contrast
with the stochastic blinking of cy5dna and cy5-dctp ( figure 3 , b and c , respectively ) . the fluorescence intensity
values in highly substituted cydna compared to cy5-dctp monomers point
once again to efficient fluorescence quenching , consistent with our
data above . single - molecule intensity traces with excitation at 633 nm and
532 nm photoactivation in switching buffer of ( a ) cy3/5dna , ( b ) cy5dna ,
and ( c ) cy5-dctp . reliable photoswitching at the single - molecule level
is clear in ( a ) , in contrast to stochastic blinking in ( b ) and ( c ) . we have applied cydna photoswitching in proof - of - concept
photoactivated localization microscopy ( palm ) ( figure s2 in the supporting information ) , showing that the structure of a cydna fragment can be resolved . moreover , the introduction of reliable and reversible fluorescence
photoswitching in dna ( as opposed to stochastic photoblinking ) opens
up the possibility of performing olid imaging on labeled dna . as described
above , olid is a technique designed to enhance image contrast in fluorescence
imaging , and necessarily needs controllable and reversible fluorescence
photoswitching . a mixture of cy3/5dna and cy5dna ( 2:1 ) was imaged
at 633 nm and activated at 532 nm every 5 s ( 0.4 mw , 50 ms per pulse ) . movies consisting of 200 frames were collected , and every pixel was
compared to a reference waveform , which was generated from the average
intensity of each frame in the movie . the resulting correlation image ,
with values ranging from 0 to 1 , figure 4b shows the overlay between
the correlation image ( blue ) and the mean image of the 200 frames
( red ) , and represents a color - coded map in which photoswitchable molecules
( cy3/5dna ) appear in blue and nonphotoswitchable molecules ( cy5dna )
in red . two - thirds of the molecules appear as blue in the overlaid
image , consistent with the sample composition . four representative
examples are shown in figure 4c , for which
the mean and correlation images are shown as well as the correlation
coefficients . molecules s1 and s2 are faint in the mean image , suggesting
that they did not fluoresce for significant time during the experiment .
however , they appear as bright spots in the correlation image , consistent
with high correlation values . this indicates that they reproduced
well the photoswitching behavior of the reference waveform and can
be assigned to cy3/5dna . the method can readily distinguish two molecules
with different photoswitching behaviors that are close to each other ,
as seen in panel s1 . the low correlation values in panels n1 and n2
suggest that these two molecules are cy5dna . the pixel intensity traces
of these panels and their similarity with the reference waveform are
shown in figure s3 in the supporting information . olid imaging of a mixture of cy3/5dna
and cy5dna immobilized on
a polylysine - coated coverglass . ( b ) overlay of correlation image ( blue ) and mean image
of the 200-frame movie ( red ) , which reflects a color - coded map of
switching and nonswitching molecules , respectively . ( c ) zoom of the
boxed areas in ( b ) : comparison of mean and correlation images , and
correlation coefficients of the central pixel of each box . in conclusion , the unique properties of
cydna can be exploited
for a wide range of applications in fluorescence labeling . we have studied the potentially detrimental
effect of overlabeling on fluorescence emission , and we have shown
that two different mechanisms , aggregate formation and ret , are responsible
for fluorescence quenching at high labeling densities . while ret has
a similar effect for both cy3- and cy5dna , the formation of nonfluorescent
h - aggregates in cy5dna results in higher overall quenching efficiency
for this biopolymer . on the other hand , we have been able to
engineer cydna to perform
reversible and reliable fluorescence photoswitching , which opens up
a range of potential applications in super - resolution imaging . this
novel dna biopolymer , which combines high - density labeling and controllable
fluorescence photoswitching , constitutes a new class of photoactive
dna - based nanomaterial . the dna scaffold , which
is nuclease resistant , provides a biocompatible
and photoswitchable macromolecule that is of great interest for advanced
microscopy of cellular components . moreover ,
sequence specificity in labeling , which is crucial for applications
such as fluorescence in situ hybridization ( fish ) and the study of
chromosome structure , can be achieved
by using the appropriate template in pcr - mediated synthesis of cydna . fluorescence photoswitching in cydna can greatly improve imaging of
chromosome loci with advanced fluorescence microscopy methods such
as olid and super - resolution imaging in combination with fish and
fiber - fish , offering great potential
for high - resolution cytogenetics . | we describe the engineering of reversible fluorescence
photoswitching
in dna with high - density substitution , and its applications in advanced
fluorescence microscopy methods .
high - density labeling of dna with
cyanine dyes can be achieved by polymerase chain reaction using a
modified dna polymerase that has been evolved to efficiently incorporate
cy3- and cy5-labeled cytosine base analogues into double - stranded
dna .
the resulting biopolymer , cydna , displays hundreds
of fluorophores per dna strand and is strongly colored and highly
fluorescent , although previous observations suggest that fluorescence
quenching at such high density might be a concern , especially for
cy5 .
herein , we first investigate the mechanisms of fluorescence quenching
in cydna and we suggest that two different mechanisms , aggregate formation
and resonance energy transfer , are responsible for fluorescence quenching
at high labeling densities . moreover , we have been able to re - engineer
cydna into a reversible fluorescence photoswitchable biopolymer by
using the properties of the cy3cy5 pair .
this novel biopolymer
constitutes a new class of photoactive dna - based nanomaterial and
is of great interest for advanced microscopy applications .
we show
that reversible fluorescence photoswitching in cydna can be exploited
in optical lock - in detection imaging .
it also lays the foundations
for improved and sequence - specific super - resolution fluorescence microscopy
of dna . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cutaneous tuberculosis is common even in immunocompetent patients.tuberculosis verrucosa cutis commonly presents as solitary or localized verrucous growths , but multifocal extensive lesions are uncommon . tuberculosis verrucosa cutis commonly presents as solitary or localized verrucous growths , but multifocal extensive lesions are uncommon . world health organization ( who ) estimates that one - third of worldwide population is at risk of developing the disease . tuberculosis verrucosa cutis ( tvc ) , which is also known as warty tuberculosis , prosector 's wart , anatomist 's wart , or verruca necrogenica usually manifests as verrucous plaques . it occurs due to direct inoculation of the organism into skin of previously infected patients . we herein present a case of extensive multifocal tvc , which has rarely been reported in literature . a 30-year - old male , a farmer by occupation , presented with multiple raised dark colored lesions over his right lower limb of 3 years duration . initially he had noticed a small asymptomatic raised papular lesion over his right foot , which later increased in size [ figure 1 ] . he progressively developed more lesions on his right leg and thigh over duration of two and a half years . extensive multifocal lesions of tuberculosis verrucosa cutis on entire right lower limb general and systemic examination was normal . dermatological examination revealed multiple well defined discrete to coalescent verrucous , hyperpigmented plaques , and erythematous nodules on the dorsolateral and posterior aspect of right foot , entire right leg , and medial aspect of right thigh [ figures 1 and 2 ] . close up of the lesions on right thigh the lesions were not fixed to deeper structures . enzyme linked immunosorbent assay ( elisa ) for human immunodeficiency virus ( hiv ) was negative . radiographs of the right foot , leg , and thigh showed only soft - tissue swelling without bony involvement . the dermis showed well defined epithelioid cell granulomas with langhans giant cells [ figures 3 and 4 ] . he was started on isoniazid 300 mg , rifampicin 600 mg , ethambutol 800 mg , and pyrazinamide 2 g , each taken once daily for 2 months , which was followed by isoniazid 300 mg and rifampicin 600 mg once daily for 4 months . within 3 months , the lesions flattened out and at the end of 6 months , all the lesions had completely resolved [ figure 5 ] . histopathology of the skin lesions revealing pseudoepitheliomatous hyperplasia and multiple well formed granulomas in the dermis . ( h and e , 10 ) langhan 's giant cell in a epithelioid cell granuloma from the dermis . cutaneous tuberculosis forms a continuous spectrum , with tvc and lupus vulgaris at one end and scrofuloderma and orificial tuberculosis at the other , corresponding to declining cell - mediated immunity . in india , tvc is probably the third most common form after lupus vulgaris and scrofuloderma . patients may also have more than one clinical form of tuberculosis concurrently . tvc results from direct inoculation of the bacilli into skin of previously infected patients having moderate to high degree immunity against the bacilli . the diagnosis is based on history , evolution of lesion , cardinal morphological features , and histopathological characteristics . psoriasiform , keloidal , crusted , exudative , sporotrichoid , destructive , tumor - like , and exuberant granulomatous forms are the main variants of tvc , which have been described . differential diagnosis includes lichen planus hypertrophicus , lichen simplex chronicus , blastomycosis , chromoblastomycosis , other deep fungal infections , and atypical mycobacterial infections . polymerase chain reaction ( pcr ) is found to be useful in cases were histopathology and culture is inconclusive . appropriate , good quality , and concentrated specimens may yield more positive results especially since normal pcr may be negative in tvc , which is a paucibacillary form . nucleic acid probes and radioimmunoassay are few of the newer modalities to investigate such cases . surgical excision and co2 laser ablation may be used to debulk the lesions in resistant cases after completion of medical therapy . multifocal cutaneous lesions without any other tubercular focus in the body , is quite rare . a solitary previous case of such extensive multifocal involvement has been reported by prasad et al . in 2002 . our case is even more unusual as there was no evidence of immune suppression in the patient . the multifocal and extensive pattern of the disease in this patient may be attributed to multiple sites of entry of the organism , as there was no other focus that was discovered . the patient being a farmer could have sustained multiple microtrauma , facilitating entry by tubercle bacilli into the lower limb . extensive cutaneous tuberculosis can occur even in immunocompetent patients.extensive multifocal tvc is a rare presentation and can occur probably due to repeated microtrauma . extensive multifocal tvc is a rare presentation and can occur probably due to repeated microtrauma . | tuberculosis is probably as old as the human race itself .
cutaneous tuberculosis constitutes a very small proportion of extra pulmonary tuberculosis .
extensive , multifocal involvement of cutaneous tuberculosis is a very rare manifestation .
we report one such case of extensive , multifocal tuberculosis verrucosa cutis in a 30-year - old immunocompetent male patient in the absence of any primary tubercular focus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the pig was most likely one of the first animals to be domesticated over 9,000 years ago . pork is an important food source now representing forty - three percent of red meat consumed in the world 1 and is a valuable resource economically in many parts of the world . there are over 250 ' non - extinct ' breeds of swine 2 world wide , many which are pictured at http://www.ansi.okstate.edu/breeds/swine/ ) . for most of the commercial pork industry less than 10 of these breeds are actively used for pork production as either purebreds or in synthetic crosses . coordinated efforts to better understand the pig genome were initiated in the early 1990s with the development of the international pigmap gene mapping project as well as projects by the usda and us agricultural universities . there were two significant linkage maps published by the mid-1990s 3 , 4 of which the largest contained over 1,200 microsatellite markers . since that time , growth of the linkage map has slowed though new gene markers such as microsatellites , amplified fragment length polymorphism ( aflps ) , and single nucleotide polymorphisms ( snps ) have been continuously identified and mapped with limited integration of large linkage maps taking place . substantial pig bioinformatics efforts have been undertaken by the roslin institute , scotland ( www.thearkdb.org ) and in the us ( http://www.animalgenome.org ) supporting pig genome efforts as well as displaying the gene maps and other features of interest to pig genomics researchers . a review of factors affecting pork 's efficient production have been recently summarized 5 and include traits important for efficient production and traits that affect consumer preferences and pork consumption . briefly , the most important traits for pork production in the growing phase are lean growth , feed intake , and pig survival . arguably however , the two most economically important traits overall to pork production are reproductive traits and disease resistance . though consumers are most concerned about the degree of fatness or carcass merit as well as pork quality , pork producers must also pay attention to the ever - growing demand by consumers that the pigs be grown without the use of antibiotics as growth promoters and in facilities that are more welfare conscious . additionally , pork producers must do all of this while becoming more environmentally friendly by having pigs reduce feed wastage , improve feed efficiency , and produce waste that contains less contaminants . initially many qtl experiments were undertaken by using initial linkage maps to help determine regions underlying traits of importance to the pig industry . these early qtl scans used families developed by generally crossing european wild boar with a commercial breed or crossing the exotic chinese meishan breed with a commercial breed . the first such qtl that was discovered was a major locus for fat deposition on chromosome 4 6 . such scans generally used 300 to 700 pigs and usually produced in a f2 design . more recently researchers have used two commercial breeds for f2 families or large commercial synthetic lines or breeds for candidate gene studies and large scale snp association analyses . previous papers 7 , 8 have reviewed qtl results with an emphasis on each trait . however , given the level of database development such efforts seem redundant here . an extensive summary can be found at a new database called pigqtldb ( http://www.animalgenome.org/qtldb/pig.html ; figure 1 ) that combines all the published qtl information into one searchable database and allows the user to search by either , chromosome , trait , or key words from the publications 9 . for completeness as can be seen some traits have extensive numbers of qtl ( i.e. fatness ) while others ( i.e. health , disease resistance ) have had few being discovered . perhaps more interesting is the fact that only a limited number of these qtl have been further investigated to the point that a known causative mutation has been implicated or proven 5 . these include igf2 for muscling and cast for tenderness on chromosome 2 , and prkag3 for meat quality on chromosome 15 . for some qualitative traits like coat color or some single gene abnormalities scans have proved quite useful . interestingly , the first qtl found on chromosome 4 for fatness has yet to be identified . four genes ( esr , prlr , rbp4 , fshb ) identified to date have shown significant associations with litter size with effects ranging from 0.25 to over 1 pig per allele per gene copy with variations depending on breed background 8 . over 20 genes have been examined in multiple laboratories for growth and backfat traits with a causative mutation in mc4r being clearly identified affecting feed intake , growth and backfat 5 . extensively examined meat quality genes ( hal , rn ) have been reported and genetic markers identified within these genes now permit genetic testing and therefore have allowed producers to remove the alleles deleterious to meat quality . several candidate genes or gene regions ( k88 , fut1 , sla , nramp ) have been identified to be associated with differences in immune response or disease resistance with fut1 being currently used to reduce post weaning diarrhea in commercial pork production . recently , a polymorphism has been identified as showing an association with resistance to k88 e. coli 10 . a swine genome community effort produced a ' white paper ' that outlined the role pigs play in agriculture and as biological models for humans . efforts to sequence the pig genome have come from many fronts using multiple approaches 11 . sequences for the pig genome have been generated from ests of cdna clones from various tissues , the sequencing of candidate genes , and more recently large scale genomic sequencing efforts from the swine genome community . most recently , the efforts of the sino - danish generated ~3.84 million shotgun sequences of the pig genome resulting in a 0.66x coverage of the porcine genome translating to 48% of the pig genome being sequenced by this project 12 . for the past 3 years , collaboration has taken the form of an international swine genome sequencing committee , which is active in pushing the pig genome sequencing agenda . sequencing efforts are taking place at the sanger institute in the uk , through this international collaboration composed of many different laboratories . these efforts are also being directed at snp identification for future large scale association trials . private efforts by at least two commercial companies have also produced large snp maps for association studies within commercial company breeding lines and these snps are being actively used for genetic improvement . traditional qtl analyses in the pig have been generally limited to the usual traits affecting growth , carcass composition , reproduction and meat quality . a very limited number of qtl analyses have been devoted to health , disease susceptibility or immune response traits . given the importance of disease susceptibility to the overall pork production economic enterprise furthermore , while the approach to directly associate genomic regions with traits of interests has been effective in looking for useful markers for marker assisted selection to make genetic improvement , it should be realized that the composition of a trait is a complex process that involves physiological , biochemical , genetic , and often environmental factors . traditional qtl analyses , because of their usual requirements to easily and inexpensively measure traits might have limited our view of understanding the nature of how a trait has developed . systematic studies of factors that may contribute to the ultimate trait outcome may help to illustrate the underlying cause of a specific phenotype with better accuracy . for example , including ovulation rate , follicle stimulation hormone levels , uterine length and feed intake and environmental factors may likely add value to qtl analyses and functional evaluation of candidate mutations affecting litter size . a second advance for qtl analyses was the development of imprinting models to look for imprinted qtl in pigs . many of these imprinted qtl make good sense when compared to imprinted gene information from other species such as the mouse . further opportunity to understand the underlying genes to date such analyses have however been rare in most species and no large epistatic model in the pig has been considered . the development of expression arrays and the measurement of expression under different environmental conditions 14 have led to the opportunity of eqtl which measure and treat each observation for gene expression from an array or chip as a new trait . this creates the opportunity for tens of thousands of new traits and the possibility to discover underlying genes and mutations affecting certain traits . several eqtl experiments are underway but at this time none in the pig are fully published . one opportunity , apart from in silico approaches to combine qtl have been to do joint qtl analyses . these are complicated by a lack of similar markers and often by slightly different trait definitions and measurements . on the other hand , there are many repeated discoveries of some qtl , each with limited population size , slightly different testing methods and experimental designs . combining of the existing results will help to better utilize the resources and correct for possible experimental bias , and add power for detecting the emergence of new approaches will definitely improve multi - factorial and complex trait analysis for qtl 17 . the active development of the qtldb 18 has provided a powerful tool for qtl comparisons and alignment of related structural genomic information for positional qtl mining . however , in order to fully utilize the power of meta - analysis , it is necessary to emphasize that individual qtl experiments should be standardized in order for the ease of future such analysis . these may include but not limited to , standardized terminology and measurement methods for traits , well described experimental design , clear criteria to define a qtl , minimum required statistical parameters to find a qtl , and common reference maps to name a few . furthermore , the qtl identified in the porcine genome contributes to construction of concordant qtl maps in mammals . although the organization of mammalian genomes by chromosomal rearrangements has been ongoing since their divergence from a common ancestor approximately 60 110 million years ago , evidence has shown that most orthologous genes were retained within each genome 19 . therefore , the same orthologous gene may have conserved functions in biological or biochemical pathways , and thus explain the same or similar variations of the concordant qtl among different species . for example , wang and colleagues 20 - 21 reported that 93% of high density lipoprotein cholesterol qtl , 100% of low density lipoprotein cholesterol qtl , 80% of triglyceride qtl and 63% of atherosclerosis qtl were found to be concordant between human and mouse . as indicated in table 3 , more than 400 fat qtl have been identified in the pig genome . initial research examined some of these genes 22 in pigs and humans and now a more advanced pilot study by jiang et al . 23 has assigned pig , human , mouse and cattle fat qtl to the human ortholgous regions and has indicated that there are at least six putative concordant qtl regions for lipogenesis on human chromosomes 1 and 2 ( hsa1 and hsa2 ) , corresponding to pig chromosomes 4 , 6 , 9 , 10 , 14 and 3 , 15 , respectively ( figure 2 ) . on one hand , these data provide evidence that the pig is a unique model organism to study and validate obesity qtl and candidate genes in humans 22 , on the other hand , qtl information from other species may be used to accelerate the qtl discoveries in pigs . traditional traits with moderate heritabilities ( > 25% ) can be measured in qtl experiments with relative ease and with family or population sizes of 500 to 700 f2 individuals qtl effects of 3% or larger are usually detected . however , it is clear from the review of many experiments that for traits like reproduction and disease susceptibility with heritabilities of approximately 10% , such sample sizes are inadequate to find the effects desired . furthermore , researchers often dismiss discoveries from candidate gene analyses because they are not found in qtl studies . such conclusions are the result of faulty reasoning since qtl experiments are often much smaller and have less power than association or candidate gene studies . the bottom line however is that much larger experiments must be formulated to find small qtl effects . additionally , specialized families segregating for genetic abnormalities or special disease problems must be developed if the underlying mutations are to be found . collection of health and disease susceptibility phenotypes has been previously discussed . however , additional phenotypes of underlying traits might also yield interesting and useful information . for instance , for reproduction more attention could be paid to ovulation rate , hormone levels and other underlying factors . for growth and muscle composition levels of certain hormones and metabolites . such collection of more useful and descriptive traits would aid in qtl discovery and ultimately in discovering the underlying genes of real interest . qtl discovery in the pig has advanced rapidly but the ultimate goal of discovery of the underlying mutations affecting certain traits has been limited . funding remains a limiting factor as does the development and maintenance of specialized pig families and populations for certain traits and disorders . new methods and experiments , combined with the pig genome sequence , which is expected in the next year should aid in these efforts . ultimately qtl discovery will improve efficiency of pig production , cut costs , make it possible to have healthier products for consumers and make the pig a more useful biomedical model . front page of the pig qtldb ( http://www.animalgenome.org/qtldb/pig.html ) , showing database summaries and ways the database may be accessed . example of mammalian concordant lipogenesis qtl maps for human chromosomes 1 and 2 ( hsa1 and hsa2 ) as references according to number of obesity / fat qtl reported in pig ( purple ) , human ( green ) , mouse ( yellow ) , and cow ( orange ) . number of publications and qtl by years reported source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by general trait classification source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by pig trait types source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) top 20 traits in terms of number of qtl reported . source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) number of qtl by chromosomes source : pigqtldb ( http://www.animalgenome.org/qtldb/ , 9 ) | over the past 15 years advances in the porcine genetic linkage map and discovery of useful candidate genes have led to valuable gene and trait information being discovered .
early use of exotic breed crosses and now commercial breed crosses for quantitative trait loci ( qtl ) scans and candidate gene analyses have led to 110 publications which have identified 1,675 qtl . additionally , these studies continue to identify genes associated with economically important traits such as growth rate , leanness , feed intake , meat quality , litter size , and disease resistance .
a well developed qtl database called pigqtldb is now as a valuable tool for summarizing and pinpointing in silico regions of interest to researchers .
the commercial pig industry is actively incorporating these markers in marker - assisted selection along with traditional performance information to improve traits of economic performance .
the long awaited sequencing efforts are also now beginning to provide sequence available for both comparative genomics and large scale single nucleotide polymorphism ( snp ) association studies . while these advances are all positive , development of useful new trait families and measurement of new or underlying traits still limits future discoveries .
a review of these developments is presented . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
synthesized in the mitochondrial inner membrane , coq10 is comprised of a ubiquinone head group attached to a tail of 10 five - carbon isoprenoid units , that anchors the molecule to the membranes . in additions to its central role in the mitochondrial respiratory chain as electrons carrier from complex i and ii to complex iii , coq10 is now thought to be involved in a number of cellular functions ( table 1 ) . intracellular synthesis is the major source of coq10 , although a small proportion is acquired through diet . 1 ) suggests that defects in different biosynthetic enzymes or regulatory proteins may cause different clinical syndromes . table 1functions of coenzyme q ( modified from ) electron carrier in mitochondrial respiratory chain extra - mitochondrial electron transport antioxidant regulation of mitochondrial permeability transition pore regulation of physiochemical properties of membranes modulation of the amount of -integrins on the surface of blood monocytes modulator of endothelial function oxidation of sulfide in yeast introduction of disulfide bonds in bacteria fig . coq10 is composed of a benzoquinone and a decaprenyl side chain . while the quinone ring is derived from amino acids tyrosine or phenylalanine , the isoprenoid side chain is produced by addition of isopentenyl pyrophosphate molecules to geranylgeranyl pyrophosphate ( derived from mevalonate pathway ) by decaprenyl diphosphate synthase . after para - hydroxybenzoate and decaprenyl pyrophosphate are produced , at least seven enzymes ( encoded by coq2 - 8 ) catalyze condensation , methylation , decarboxylation , and hydroxylation reactions to synthesize coq10 functions of coenzyme q ( modified from ) coq10 biosynthetic pathway with eight known biosynthetic enzymes denoted as coq1 - 8 . coq10 is composed of a benzoquinone and a decaprenyl side chain . while the quinone ring is derived from amino acids tyrosine or phenylalanine , the isoprenoid side chain is produced by addition of isopentenyl pyrophosphate molecules to geranylgeranyl pyrophosphate ( derived from mevalonate pathway ) by decaprenyl diphosphate synthase . after para - hydroxybenzoate and decaprenyl pyrophosphate are produced , at least seven enzymes ( encoded by coq2 - 8 ) catalyze condensation , methylation , decarboxylation , and hydroxylation reactions to synthesize coq10 primary coq10 deficiency is an autosomal recessive condition with a clinical spectrum that encompasses at least five major phenotypes : ( 1 ) encephalomyopathy characterized by the triad of recurrent myoglobinuria , brain involvement and ragged red fibers ; ( 2 ) severe infantile multisystemic disease ; ( 3 ) cerebellar ataxia ; ( 4 ) leigh syndrome with growth retardation , ataxia and deafness ; and ( 5 ) isolated myopathy [ 1226 ] . generalized weakness , exercise intolerance , and recurrent myoglobinuria are the distinctive features in the first four patients reported with the encephalomyopathic form , [ 1215 ] ; however , myoglobinuria was absent in another patient . all the patients described so far have proximal muscle weakness [ 1216 ] the brain involvement is variable ; seizures are a common finding [ 12 , 13 ] , in association with cognitive impairment and cerebellar symptoms [ 12 , 15 , 16 ] . the second variant , described in three families , manifests as an infantile encephalopathy with renal involvement . rtig and colleagues initially described two siblings with defects of multiple quinone - dependent enzymes ascribed to a deficiency of coq10 in various tissues . the patients presented with retinitis pigmentosa , optic nerve atrophy , bilateral sensorineuronal deafness , nephrotic syndrome , progressive ataxia , and cardiomyopathy . in rahman s patient , hypothermia , lactic acidosis , cerebral and cerebellar atrophy , and developmental delay were associated with renal tubulopathy and ventricular hypertrophy . last year , we described two siblings who presented with nephrotic syndrome due to glomerulosclerosis , and the older sibling developed hypotonia , psychomotor delay , seizures , stroke - like episodes , and cerebellar and cerebral atrophy . interestingly , in these infantile - onset patients , deficiency of coq10 is present not only in skeletal muscle , but also in other tissues and cells including skin fibroblasts . in addition , two adult sisters with encephalopathy , growth retardation , infantilism , ataxia , deafness and lactic acidosis have been described by van maldergam . cerebellar ataxia is the most common phenotype associated with coq10 deficiency with 21 reported patients [ 2022 , 26 ] . epilepsy is the most common associated feature , but pyramidal signs , mental retardation , myopathic weakness , and delayed motor milestones are other variably associated symptoms and signs . except for two adult brothers with cerebellar ataxia and hypogonadism muscle morphology does not show ragged - red fibers and lipid storage myopathy and coq10 is moderately reduced in skin fibroblasts . the clinical presentation of the variant isolated myopathy , recently described in four patients , is subacute onset of exercise intolerance and proximal limb weakness at variable ages . all patients have lipid storage and ragged - red fibers in muscle , as well as increased serum lactate and creatine kinase ( ck ) [ 24 , 25 ] . in all the patients with different phenotypes , respiratory chain enzymes analyses show reduced activities of complex i + iii and ii + iii with normal activities of isolated complex i and iii . in most of the reported patients , the exact site and nature of the defects in the biosynthesis of coq10 have not yet been identified . because ubiquinone biosynthesis is complex and not fully defined ( fig . 1 ) , identification of the molecular genetic defect is not straightforward . undetectable coq10 and low levels of decaprenylpyrophosphate , an intermediate compound in the synthesis of the lateral chain of coq10 were found in the fibroblasts of the patient reported by rtig and colleagues suggesting a defect in the synthesis of the decaprenyl side - chain , but they did not find any mutation in the cdna of coq1 , the gene encoding transprenyltransferase , the enzyme that synthesizes decaprenylpyrophosphate . this year , in two siblings with the infantile form of coq10 deficiency , we reported a homozygous missense mutation ( y297c ) in the coq2 gene , which encodes para - hydroxybenzoate ( phb ) polyprenyl transferase . phb - polyprenyl transferase mediates the conjugation of the benzoquinone ring with the decaprenyl side chain . biochemical assays measuring incorporation of radiolabeled phb or decaprenyl - pp into coq10 in skin fibroblasts from the proband showed 2325% of control fibroblasts activity confirming the defect of coq10 biosynthesis . the finding of a homozygous stop codon mutation in the aptx gene which is known to cause ataxia - oculomotor - aprataxia 1 ( aoa1 ) , in three siblings with cerebellar ataxia and coq10 deficiency , supports the hypothesis that the ataxic form is a genetically heterogeneous disease in which coq10 deficiency can be secondary . aprataxin is a member of the histidine triad superfamily and may be involved in nuclear dna single strand break repair [ 2931 ] . despite the lack of an obvious link between aprataxin and regulation of coq10 synthesis or catabolism , our findings , coupled with the clinical improvement of patients after coq10 supplementation , suggest that coq10 deficiency plays a pathogenic role in aoa1 . intriguingly , both coq10 and cholesterol share a common biosynthetic pathway , therefore , in aoa1 , altered levels of these molecules could be due to aberrant biosynthesis . patients with all forms of coq10 deficiency have shown clinical improvement with oral coq10 supplementation . the beneficial effects of exogenous coq10 require high doses and long - term administration [ 32 , 33 ] ; its oral bioavailability is poor due to its extreme hydrophobicity ; therefore , only a small fraction of orally administered coq10 reaches the circulatory system , and augmentation of mitochondrial coq10 content is even less effective . beneficial effects of coq10 supplementation are supported by in vitro correction of biochemical and histological abnormalities [ 1214 , 17 ] . however , while muscle abnormalities improve clinically and biochemically , in general , cerebral symptoms are only partially ameliorated . this difference could be explained by the presence of irreversible structural brain damage before treatment or the poor penetration of coq10 across the blood - brain barrier . increases in plasma concentrations of coq10 after oral supplementation in both humans and animals has been well - documented , but early work questioned whether coq10 accumulates in tissues and studies of 45-day - old rodents showed little or no change in rodent brain coq10 concentrations after oral administration perhaps because levels of coq10 are tightly regulated in young animals or may be saturated in membranes [ 34 , 35 ] . in contrast , administration of very high doses of coq10 ( 200 mg / kg daily ) to 1224 month - old rats produced significant increases in brain coq10 levels , but a more recent study of the regional distribution of coq in 16 week - old rat brain before and after 4 weeks of moderately high exogenous dietary coq10 ( 20 mg / kg daily ) supplementation showed that the concentration of coq was essentially unchanged in the cortex and in the striatum . that study also demonstrated that the cerebellum , of the 7 brain regions dissected , contains the lowest levels of coq . if human brain has the same regional distribution of coq10 as rat brain , the cerebellum may have the narrowest safety margin and therefore would be the first tissue to suffer from a pathological shortage of coq10 . moreover , to function as an antioxidant , coq10 must be in the reduced form but normally only 20% of the lipid is reduced in the brain . the high proportion of oxidized coq10 in the brain could be a reflection of the high oxygen consumption in this tissue , causing an increased demand of anti - oxidants . therefore , coq10 deficiency could be another form of inherited ataxia due to oxidative damage , as vitamin e deficiency . oxidative damage and mitochondrial dysfunction have also been implicated in neurodegenerative diseases such parkinson disease ( pd ) , alzheimer disease ( ad ) , and friedreich s ataxia ( frda ) [ 3941 ] . preclinical studies have indicated that coq10 can protect the nigrostriatal dopaminergic system and high doses ( 1200 mg daily ) of coq10 for 16 months appeared to slow progression pd [ 40 , 42 ] . in 10 frda patients treated for 47 months high doses of coq10 ( 400 mg daily ) with vitamin e ( 2100 iu daily ) , improved bioenergetics in heart and skeletal muscle , improved cardiac function by echocardiography , and , possibly less clinical decline compared to historical controls . larger studies are necessary to better define the short- and long - term effects of coq10 as primary or adjunctive therapy in neurodegenerative diseases . deficiency of coq10 has been associated with a variety of neurological disorders that respond to oral supplementation . we have demonstrated that coq10 deficiency can be primary due to a defect of biosynthesis or secondary as in patients with aptx mutations . the response of both groups of patients to oral supplementation suggests that exogenous coq10 is taken up by affected tissues and can correct biochemical derangements . further studies to define coq10 deficiency syndrome will reveal new causes , enhance our understanding of its pathogenesis , and may provide novel insights that may be relevant to other neurodegenerative diseases . | ubiquinone ( coenzyme q10 or coq10 ) is a lipid - soluble component of virtually all cell membranes and has multiple metabolic functions .
deficiency of coq10 ( mim 607426 ) has been associated with five different clinical presentations that suggest genetic heterogeneity , which may be related to the multiple steps in coq10 biosynthesis .
patients with all forms of coq10 deficiency have shown clinical improvements after initiating oral coq10 supplementation .
thus , early diagnosis is of critical importance in the management of these patients .
this year , the first molecular defect causing the infantile form of primary human coq10 deficiency has been reported .
the availability of genetic testing will allow for a better understanding of the pathogenesis of this disease and early initiation of therapy ( even presymptomatically in siblings of patients ) in this otherwise life - threatening infantile encephalomyopathy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
sepsis , the host response to infection , involves a series of clinical , hematological , inflammatory and metabolic responses that can ultimately lead to organ failure . severe sepsis is typically associated with activation of the coagulation system , leading to deposition of thrombin in the microvasculature . these alterations , which are recognized by the clinician as disseminated intravascular coagulation ( dic ) , are commonly associated with multiple organ dysfunction , and have important prognostic implications . dic , therefore , can be seen as both a thrombotic and a bleeding disorder , as an index of disease severity , or as an inflammatory disorder . it is now recognized that acute sepsis involves a complex interaction between the coagulation system and the inflammatory system that may result in organ dysfunction . in addition to its well - known procoagulation effects , thrombin may have anticoagulation effects through protein c activation and induction of prostacyclin ( fig . 1 ) . thrombin may also cause cell proliferation and inflammation through induction of adhesion molecules and platelet - activating factor activation . paf , platelet - activating factor ; pgi2 , prostacyclin ; pmn , polymorphonuclear leukocyte . the interaction between coagulation and inflammation has been demonstrated in a number of animal studies in which anticoagulant therapies , including heparin , antithrombin , tissue factor ( tf ) pathway inhibitor and activated protein c , were shown to influence the inflammatory response . it is also now clear that both the coagulation and the fibrinolytic systems may be altered in acute sepsis , with the balance tipped in favour of procoagulation ( through increased tf and thrombin expression , with decreased activation of thrombomodulin and protein c ) and antifibrinolysis ( through plasminogen activator inhibitor [ pai]-1 expression ) . in experimental models in which very small doses of endotoxin or tumour necrosis factor ( tnf ) are given to volunteers , there is initially a profibrinolytic response , followed by an antifibrinolytic response , which corresponds to a procoagulant state ( fig . 2 ) . experimental model of sepsis in volunteers : effect of small doses of endotoxin ( lipopolysaccharide [ lps ] ) or tnf on the fibrinolysis system . pap , plasmin - antiplasmin complex ; t - pa , tissue plasminogen activator . considering the coagulation cascade as a whole , it is the extrinsic pathway ( via tf and thrombin activation ) rather than the intrinsic pathway that is of primary importance in sepsis . once coagulation has been triggered by tf activation , leading to thrombin formation , this can have further procoagulant effects , because thrombin itself can activate factors viii , ix and x. this is normally balanced by the production of anticoagulant factors , such as tf pathway inhibitor , antithrombin and activated protein c. however , there are other contributors to the processes of pro-/anticoagulation and inflammation , including monocytes , macrophages , platelets and , importantly , endothelial cells . in recent years , it has been recognized that endothelial cells play a key role in the pathogenesis of sepsis , and that they produce important regulators of both coagulation and inflammation . they can express or release a number of substances , such as tf , endothelin-1 and pai-1 , which promote the coagulation process , as well as other substances , such as antithrombin , thrombomodulin , nitric oxide and prostacyclin , which inhibit it ( fig . that is , the binding of thrombin to thrombomodulin on endothelial cells results in protein c activation . once activated , protein c binds to its cofactor , protein s ( either freely circulating or bound to c4b - binding protein ) , and activated protein c inhibits the coagulation factors va and viiia . activated protein c may also neutralize pai-1 , resulting in increased fibrinolysis , which represents an important difference between activated protein c and other anticoagulant substances , such as antithrombin . it may inhibit e - selectin - mediated cell adhesion , or generation of interleukin-1 and tnf by monocytes , and may also uncouple the lipopolysaccharide ( endotoxin ) interaction with cd14 receptors . procoagulant and anticoagulant substances that are expressed / released by endothelial cells . at , antithrombin ; no , nitric oxide ; pgi2 , prostacyclin ; tfpi , tf pathway inhibitor . protein c is the source of activated protein c. although protein c is a biomarker or indicator of sepsis , it has no known specific biological activity . protein c is converted to activated protein c in the presence of normal endothelium . in patients with severe sepsis , the vascular endothelium becomes damaged , levels of endothelial thrombomodulin significantly decrease , and the body 's ability to convert protein c to activated protein c diminishes . only when activated does protein c have antithrombotic , profibrinolytic and anti - inflammatory properties . a number of studies have now shown that protein c levels are reduced in patients with severe infection . in the study by powars et al , protein c levels were reduced to approximately 50% of normal levels in patients with moderate meningococcaemia , and to approximately 30% of normal levels in critically ill patients ( fig . similarly , a study by hemmer et al in patients with malaria showed that those with complications had much higher levels of tnf and greatly reduced protein c activity ( fig . 5 ) . in patients who have undergone bone marrow transplantion , low antithrombin and protein c levels are also the best predictors of multiple organ dysfunction . in a subgroup of 70 patients with sepsis included in an ibuprofen trial , 90% were shown to have low protein c levels and most also had other alterations in coagulation factors ( elevated d - dimers , low fibrinogen level and low platelet count ) . in that study , there was a significant correlation between the increase in protein c levels from 0 to 44 h , and 30-day mortality ( p < 0.01 ) . furthermore , mortality was higher in patients with persistently low protein c levels than in those whose protein c levels recovered spontaneously without any treatment ( 45% versus 26% ) . protein c levels ( % of normal ) in patients with meningococcaemia . adapted from powars et al . tnf- levels ( normal range < 15 pg / ml ) and protein c activity ( normal range 60 - 140% ) in malaria . adapted from hemmer et al . coagulation abnormalities can occur in all types of infection , including both gram - positive and gram - negative bacterial infections , or even in the absence of infection , such as in inflammatory states secondary to trauma or neurosurgery . interestingly , they can also occur in patients with localized disease , such as those with respiratory infection . in a study by gnther et al , procoagulant activity in bronchial lavage fluid from patients with pneumonia or acute respiratory distress syndrome was found to be increased compared with that from control individuals , with a correlation between the severity of respiratory failure and level of coagulant activity ( fig . coagulation abnormalities in pneumonia ( pneu ) and acute respiratory distress syndrome ( ards ; n = 222 ) . spv , spontaneous ventilation ; mv , mechanical ventilation . adapted from gnther et al . it is well documented that dic in septic shock is associated with higher mortality rates than is septic shock without dic ( 77% versus 32% ) . higher sequential organ failure assessment scores and pai-1 levels have also been correlated with increased mortality . furthermore , coagulation is inter - related with inflammation . because animal studies indicated that therapeutic intervention may result in improved outcome , a number of clinical studies were initiated . early clinical studies with antithrombin iii ( atiii ) achieved promising results . in a study by fourrier et al , patients who were treated with atiii had a shorter duration of dic with no side effects , and no change in protein c or protein s levels . however , a meta - analysis of three placebo - controlled , randomized clinical trials with atiii in sepsis demonstrated a nonsignificant reduction in 30-day all - cause mortality . a phase ii clinical trial has identified the optimum dosage regimen for recombinant human activated protein c , and this has subsequently been used in a large , multicenter , placebo - controlled , phase iii trial . severe sepsis , defined as sepsis associated with acute organ dysfunction , results from a generalized inflammatory and procoagulant host response to infection . the ultimate cause of acute organ dysfunction in sepsis is injury to the vascular endothelium , which can result in microvascular coagulopathy . the extrinsic pathway ( via tf and thrombin activation ) is of primary importance in sepsis . thrombomodulin on endothelial cells converts protein c to activated protein c , which has multiple mechanisms of action that support its anti - inflammatory , antithrombotic and profibrinolytic properties . in patients with severe sepsis , the vascular endothelium becomes damaged , levels of endothelial thrombomodulin significantly decrease , and the body 's ability to convert protein c to activated protein c diminishes . the complex interactions between coagulation and inflammation support the development and use of strategies that are aimed at improving endothelial cell function , and thus providing therapeutic intervention to modulate inflammation and coagulopathy in patients with sepsis and organ dysfunction . atiii = antithrombin iii ; dic = disseminated intravascular coagulation ; pai = plasminogen activator inhibitor ; tf = tissue factor ; tnf = tumour necrosis factor . | severe sepsis , defined as sepsis associated with acute organ dysfunction , results from a generalized inflammatory and procoagulant host response to infection .
coagulopathy in severe sepsis is commonly associated with multiple organ dysfunction , and often results in death .
the molecule that is central to these effects is thrombin , although it may also have anticoagulant and antithrombotic effects through the activation of protein c and induction of prostacyclin . in recent years
, it has been recognized that chemicals produced by endothelial cells play a key role in the pathogenesis of sepsis .
thrombomodulin on endothelial cells coverts protein c to activated protein c , which has important antithrombotic , profibrinolytic and anti - inflammatory properties .
a number of studies have shown that protein c levels are reduced in patients with severe infection , or even in inflammatory states without infection .
because coagulopathy is associated with high mortality rates , and animal studies have indicated that therapeutic intervention may result in improved outcomes , it was rational to initiate clinical studies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
most people know from personal experience that muscles increase in mass when loaded and decrease in mass during a period of physical inactivity . this adaptation of bone mass to mechanical demands is facilitated by the activity of osteoblasts and osteoclasts . osteoclasts remove bone in places of relative unloading , while osteoblasts form bone in places of relative high mechanical loading , leading to a constant adaptation of bone mass and structure . as a result , healthy bones are able to withstand the forces placed upon them , while using a minimum of material . during osteoporosis , this delicate balance between bones resistance against mechanical loads and bone mass is clearly disturbed , mostly as a result of enhanced bone loss . although most studies have focused on the role of osteoblasts and osteoclasts in the emergence of osteoporosis , osteocytes may well be involved in the pathogenesis of this disease . it is well known that osteocytes produce signaling molecules in response to mechanical loading which affect osteoclast and osteoblast recruitment and activity [ 3 , 4 ] . our group has shown that nitric oxide and prostaglandin production in response to mechanical loading of cultured osteocytes from osteoporotic individuals differs from that of osteocytes derived from people with a high bone mass . as such , alterations in the osteocyte responses to mechanical loading , in terms of signaling molecule production , may well be involved in the etiology of osteoporosis . in recent years , a defined picture is emerging of osteocytes as signaling centers , actively communicating with osteoblasts , osteoclasts , marrow cells , cells of the lymphatic system , and the kidney . in addition , potential lines of communication between bone and muscle are currently under much scrutiny [ 69 ] . if bones indeed communicate with muscle , the most likely source of the paracrine and endocrine signal is the osteocyte , which is by far the most abundant cell in adult bones , and osteocyte - derived signals have been shown to reach remote organs . presuming that osteocyte communication with muscles affects muscle mass , the opposite may also be true . muscles may communicate to osteocytes , or muscles could communicate directly with osteoblasts and osteoclasts via similar signals that osteocytes employ to dictate osteoclast and osteoblast behavior . osteocytes and muscle cells show considerable overlap in the molecules they use to regulate their mass in response to mechanical cues . our group recently showed that differentiated myotubes and osteocytes alike cells produce factors such as nitric oxide ( no ) , hepatocyte growth factor ( hgf ) , vascular endothelial growth factor ( vegf ) , insulin - like growth factor 1 ( igf-1 ) , and interleukin 6 ( il-6 ) in response to mechanical loading [ 11 , 12 ] . short - lived molecules are unlikely to do more than autocrine and some paracrine signaling , but elevated levels of muscle - derived il-6 and igf-1 are found in the circulation after vigorous exercise [ 1315 ] . this indicates that communication between muscle and bone is theoretically possible . whether muscle and bone indeed communicate via the production of soluble factors is difficult to establish , but some evidence is available in support of this hypothesis [ 6 , 16 ] . one complicating factor is that muscles exert mechanical forces in bone , thereby affecting bone mass regardless of the existence of an exchange of biochemical factors . considering this , it is possible that osteoporosis is simply related to a decrease in the number and/or magnitude of mechanical stimuli in bone , caused by the loss of muscle mass that is common with aging . maintenance of muscle mass could thus be a therapeutic option in elderly , in order to preserve bone integrity and mass . even if it turns out that biochemical communication between muscle and bone does not play a significant role in bone homeostasis , it is likely that , considering the similarities in signaling molecules employed by both tissue types , much can be learned from the muscle field in order to generate a better understanding of bone mass regulation and vice versa . it is produced primarily by the liver under the control of growth hormone , plays an important role in regulating growth in children , and has anabolic effects in adults . by far , the largest amount of igf-1 in the body is bound to igf - binding proteins ( igfbps ) , which affect the activity of igf-1 . for instance , igfbp-2 and igfbp-5 bind igf-1 at a higher affinity than its receptor , and an increased serum level of these igfbps thus result in lower igf-1 signaling . several splice variants from the igf-1 gene have been identified , of which igf-1ea and igf-1eb / c ( also known as mechano growth factor ( mgf ) ) play a role in muscle and bone homeostasis . these two splice variants differ with respect to their nucleotide sequence in exon 5 which encompasses an insert of about 23 amino acids , coding for the e - peptide . the 70 kd igf-1 domain , coded by exons 3 and 4 of the igf-1 gene , stimulates osteocyte and osteoblast survival [ 20 , 21 ] , as well as osteoblast differentiation and matrix production , while the e peptide in mgf promotes mc3t3-e1 osteoblast proliferation . in addition to these anabolic effects in bone , the 70 kd igf-1 domain has been shown to promote osteoclastogenesis [ 24 , 25 ] . besides being an endocrine molecule , igf-1 also exerts effects in a paracrine / autocrine manner in many tissues . igf-1 is produced locally in bone and is able to exert effects in bone in an autocrine manner . since then , the question how much of the anabolic effect of igf-1 in bone is autocrine in nature ? has remained unsolved until elis et al . showed that , in the absence of tissue - specific igf-1 gene expression , maintaining long - term elevated igf-1 levels in serum by igf-1 gene overexpression in the liver was sufficient to restore skeletal architecture and mechanical function [ 27 ] . in addition , conditional disruption of the igf-1 gene in osteocytes under the control of the dmp-1 promoter slightly reduces bone mineral content , but not mineral density , and igf-1 knockout in osteocytes does not alter plasma levels of igf-1 . this suggests that igf-1 produced locally in bone has a minor role in bone development compared to igf-1 produced in the liver . however , the importance of local production of igf-1 in bone in response to mechanical loading may be a different story altogether . mechanical loading is anabolic for bone , and osteocytes have been shown to produce igf-1 in response to mechanical loading in vitro and in vivo [ 29 , 30 ] . in addition , mechanical loading increases bone formation in wild - type mice but not in mice with osteocytes deficient in igf-1 [ 31 ] . from the above , it was concluded that igf-1 plays a pivotal role in the response of bone to mechanical forces . in skeletal muscle , the application of mechanical loading , either applied passively by stretching or actively by neuronal - initiated contractile activity , stimulates the expression of igf-1 ea and mgf . igf-1 ea acts on the muscle stem cells ( i.e. , satellite cells ( musc ) located between the sarcolemma and the basal lamina ( fig . 1 ) by stimulation of their differentiation into myotubes [ 32 , 33 ] . in contrast , mgf e peptide has been shown to stimulate proliferation and migration of myoblasts [ 33 , 34 ] . for an injured muscle fiber , mgf will enhance the capacity for regeneration while for intact mechanically overloaded muscle fibers this will lead to an expansion of the pool of myonuclei within the muscle fiber and as such an increase in the amount of dna serving as template for transcription . besides the effects of igf-1 splice variants on muscs , igf-1 signaling also occurs in the mature muscle fiber . like insulin , the 70 kd igf-1 domain stimulates muscle fiber hypertrophy ( i.e. , increases muscle fiber diameter ) [ 35 , 36 ] by concurrently stimulating the rate of protein synthesis and inhibiting the rate of protein degradation . this dual role makes igf-1 in muscle an autocrine and paracrine growth factor with a strong potency to induce muscle hypertrophy.fig . 1insulin - like 1 ( igf-1 ) and interleukin-6 ( il-6 ) signaling in the regulation of skeletal muscle adaptation and bone metabolism . a in skeletal muscle , the machinery for protein synthesis and degradation resides within the muscle fibers , which are multinucleated cells . the muscle satellite cells ( muscs ) reside between the sarcolemma ( i.e. , plasma membrane ) and the basal lamina . b in bone , osteoid is synthesized by osteoblasts ( ob ) which are derived from osteogenic progenitor cells and differentiate into osteocytes ( oc ) when buried in their own matrix . osteocytes have long extensions embedded within the canaliculi and are highly sensitive to mechanical loading . in response to mechanical stimuli , myofibers ( mf ) produce paracrine / endocrine factors such as il-6 , and both splice variants of igf-1 , i.e. , mechano growth factor ( mgf ) and igf-1ea . these factors are able to affect myofibers , muscs , and cells in other organs such as the liver and potentially bone . il-6 slows down the rate of translation in myofibers while enhancing the rate of protein breakdown via 5 adenosine monophosphate - activated protein kinase ( ampk ) , resulting in a net catabolic effect . on the other hand , il-6 stimulates the proliferation and differentiation of satellite cells via the janus kinase / signal transducer and activator of transcription ( jak / stat ) pathway , which would be an anabolic response . igf-1 stimulates the rate of protein translation in myofibers via the phosphatidylinositol 3 kinase ( pi3-k)/akt / mammalian target of rapamycin ( mtor ) pathway while inhibiting the expression of catabolic ubiquitin e3 ligases resulting in an increase in muscle mass . mgf stimulates satellite cell proliferation and differentiation , but it is so far unclear via which pathway this occurs . mechanically - loaded osteocytes and osteoblasts produce igf-1 ( likely both splice variants ) , and igf-1 is released from the matrix during osteoclastic ( ocl ) bone resorption . igf-1 enhances differentiation of osteoblast precursors cells ( obpc ) via the pi3-k / aktt / mtor pathway ( not shown ) and activity and formation of osteoclasts via stimulation of rankl expression in osteoblasts and osteocytes . il-6 also stimulates osteoblast precursor differentiation and osteoclast formation , via an increase in rankl expression by osteoblasts . whether il-6 and igf-1 affect the rate of protein translation in osteoblasts or osteoclasts is currently unknown . irs-1 insulin receptor substrate-1 ; eif4e eukaryotic initiation factor 4e ; 4e - bp eif4e - binding protein ; p70s6k p70s6 kinase ; eif2b eukaryotic initiation factor 2b . gsk3 glycogen synthase kinase 3 insulin - like 1 ( igf-1 ) and interleukin-6 ( il-6 ) signaling in the regulation of skeletal muscle adaptation and bone metabolism . a in skeletal muscle , the machinery for protein synthesis and degradation resides within the muscle fibers , which are multinucleated cells . the muscle satellite cells ( muscs ) reside between the sarcolemma ( i.e. , plasma membrane ) and the basal lamina . b in bone , osteoid is synthesized by osteoblasts ( ob ) which are derived from osteogenic progenitor cells and differentiate into osteocytes ( oc ) when buried in their own matrix . osteocytes have long extensions embedded within the canaliculi and are highly sensitive to mechanical loading . in response to mechanical stimuli , myofibers ( mf ) produce paracrine / endocrine factors such as il-6 , and both splice variants of igf-1 , i.e. , mechano growth factor ( mgf ) and igf-1ea . these factors are able to affect myofibers , muscs , and cells in other organs such as the liver and potentially bone . il-6 slows down the rate of translation in myofibers while enhancing the rate of protein breakdown via 5 adenosine monophosphate - activated protein kinase ( ampk ) , resulting in a net catabolic effect . on the other hand , il-6 stimulates the proliferation and differentiation of satellite cells via the janus kinase / signal transducer and activator of transcription ( jak / stat ) pathway , which would be an anabolic response . igf-1 stimulates the rate of protein translation in myofibers via the phosphatidylinositol 3 kinase ( pi3-k)/akt / mammalian target of rapamycin ( mtor ) pathway while inhibiting the expression of catabolic ubiquitin e3 ligases resulting in an increase in muscle mass . mgf stimulates satellite cell proliferation and differentiation , but it is so far unclear via which pathway this occurs . mechanically - loaded osteocytes and osteoblasts produce igf-1 ( likely both splice variants ) , and igf-1 is released from the matrix during osteoclastic ( ocl ) bone resorption . igf-1 enhances differentiation of osteoblast precursors cells ( obpc ) via the pi3-k / aktt / mtor pathway ( not shown ) and activity and formation of osteoclasts via stimulation of rankl expression in osteoblasts and osteocytes . il-6 also stimulates osteoblast precursor differentiation and osteoclast formation , via an increase in rankl expression by osteoblasts . whether il-6 and igf-1 affect the rate of protein translation in osteoblasts or osteoclasts is currently unknown . irs-1 insulin receptor substrate-1 ; eif4e eukaryotic initiation factor 4e ; 4e - bp eif4e - binding protein ; p70s6k p70s6 kinase ; eif2b eukaryotic initiation factor 2b . il-6 is a pleiotropic cytokine which is produced by a variety of cell types such as t - cells and macrophages , but il-6 is also readily produced by other cell types , such as smooth muscle cells , fibroblasts , skeletal muscle fibers , osteoblasts , and osteocytes [ 38 , 3 ] . il-6 requires gp130 ( ubiquitously expressed ) and il-6 receptor ( il-6r ) for signaling . il-6r is expressed by a limited population of cells , amongst which osteoblasts and osteoclasts as well as muscle cells . human osteocytes express high amounts of il-6r at week 8 and 14 during gestation , and mlo - y4 osteocytes have been shown to express il-6r mrna . even if a cell does not express il-6r , it can respond to il-6 because il-6r exists in a soluble form in the serum where it acts as an agonist . il-6r can end up in the serum because it is shed from cell membranes through cleaving by adam17 or adam10 . il-6 was first discovered to mediate bone loss associated with estrogen - withdrawal in mice . more recently , it has been described that increased circulating il-6 levels in patients with duchenne muscular dystrophy seem responsible for increased osteoclastic bone resorption . il-6 most likely stimulates osteoclastogenesis indirectly , by increasing rankl gene expression by osteoblasts [ 44 , 39 , 45 ] . elevated il-6 levels could thus explain why the low grade systemic inflammation as occurs after the menopause enhances osteoclastogenesis and reduces bone mass . on the other end of the spectrum , mice lacking il-6 also have a low bone mass . indeed , il-6-type cytokines promote differentiation of committed osteoblastic cells toward a more mature phenotype , and il-6 has been shown to enhance osteoblast differentiation in stem cells . this double edged role of il-6 in bone , i.e. , both stimulatory for osteoclasts and osteoblasts , is also reflected in the production of il-6 by osteocytes . fluid shear stress at low physiological levels stimulates il-6 production in osteocytes in vitro [ 38 ] . on the other hand , il-6 has also been shown to be expressed by osteocytes when they undergo apoptosis in response to bone unloading . overall , these data indicate that in bone il-6 has a key role in bone metabolism . in skeletal muscle , contractile activity stimulates il-6 expression in humans and rodent skeletal muscle [ 51 , 52 ] , which is paralleled by elevated serum levels in humans [ 14 , 53 ] . il-6 produced by muscle is generally known for its role in glycogen metabolism and insulin signaling , but il-6 may also be involved in the regulation of muscle fibers size . however , recovery of gastrocnemius muscle from disuse atrophy is attenuated in il-6 knockout mice , and overload - induced muscle hypertrophy is blunted in il-6 deficient mice . these reports suggest opposite roles of il-6 in the regulation of muscle fiber size and regeneration , similarly to bone . in skeletal muscle , igf-1 stimulates the rate of protein synthesis via two ways : ( 1 ) igf-1 increases the rate of mrna transcription of myofilaments such as -skeletal actin , a major constituent of the muscle contractile apparatus [ 36 , 58 ] , and ( 2 ) igf-1 stimulates the phosphatidylinositol 3 kinase ( pi3-k)/akt ( also known as protein kinase b ) pathway which activates the mammalian target of rapamycin ( mtor ) . downstream targets of mtor are p70s6 kinase ( p70s6k ) and heat- and acid - stable protein 1 ( phas-1 , also referred to as 4e - bp ) . activated mtor phosphorylates p70s6k , thereby activating the ribosomal protein s6 , which is involved in the translation of mrnas ( fig . 1 ) . in addition , mtor inhibits 4ebp , which is a negative regulator of the translation initiation factor eif4e , thereby further enhancing the rate of translation [ 59 , 60 ] . akt also inactivates glycogen synthase kinase 3 ( gsk3 ) , thereby preventing the inhibitory effect of gsk3 on eukaryotic initiation factor 2b ( eif2b ) , which results in an enhanced rate of mrna translation ( fig . 1 ) . apart from its potency to enhance the rate of protein synthesis , igf-1 also attenuates the rate of protein degradation via pi3-k / akt / foxo pathway . activated akt phosphorylates the transcription factor foxo , causing its cytoplasmic localization , which reduces the rate of transcription of muscle - specific ubiquitin e3 ligases ( fig . 1 ) . muscle e3 ligases will tack contractile proteins with ubiquitin , which marks them for degradation within the 26s - proteasome system . taken together , igf-1 is a highly potent growth factor resulting in muscle hypertrophy by reducing protein degradation and stimulating the rate of protein synthesis through a combination of increasing mrna content of contractile proteins and increasing the rate of translation per mrna . although the role of the mtor pathway in igf-1-induced muscle hypertrophy has been extensively studied , this pathway attracted little attention in the bone world , until it has been shown recently that igf-1 may have an anabolic effect on bone via stimulation of the pi3-k / akt / mtor pathway [ 63 ] . igf-1 released from the bone matrix during bone remodeling stimulates osteoblastic differentiation of recruited mesenchymal stem cells ( mscs ) by activation of akt / mtor [ 63 ] . the observation that mtor mediates osteoblast differentiation has also been shown in experiments where rapamycin , a potent mtor inhibitor , suppressed wnt7b - induced osteoblast differentiation in st2 mouse bone marrow derived cells , as determined by assessing alkaline phosphatase activity and von kossa staining . as mentioned before , activated akt not only affects mtor , but also inhibits gsk3. thereby , akt activates cellular -catenin signaling in osteocytes [ 65 ] , explaining why conditional disruption of igf-1 in osteocytes abolishes the loading - induced increase in -catenin protein levels in osteocytes [ 31 ] . the activation of -catenin by mechanical loading in osteocytes inhibits osteocyte apoptosis [ 66 , 67 ] . il-6 signaling occurs through binding of il-6 with the il-6 receptors ( il-6r ) , which subsequently bind to gp130 receptors . in skeletal muscle , both muscs and myofibers express il-6 , il-6r , and gp130 receptor . in muscs , il-6-induced proliferation and migration occurs via the jak / stat pathway , which stimulates the expression of proliferation - associated transcription factors cyclin d1 and c - myc [ 57 , 69 ] . regarding the effects of il-6 on the myofiber ( mf ) , several studies have shown that il-6 modulates both the rate of protein synthesis and that of protein breakdown [ 7073 ] . primary human muscs differentiated into myotubes showed increased phosphorylation of akt after exposure to il-6 [ 70 , 71 ] suggesting an enhancement of the mtor signaling . il-6 attenuated the activity of mtor via its stimulatory effect on 5-adenosine monophosphate - activated protein kinase ( ampk ) [ 72 ] . this enzyme is phosphorylated and activated by a low energy status ( i.e. , increased ratio amp / atp ) , but is also a downstream target of il-6 . activated ampk has a multitude of regulatory functions in skeletal muscle : ( 1 ) stimulation of biosynthesis of mitochondria and fatty acid oxidation and glucose uptake , ( 2 ) inhibition of mtor , and ( 3 ) stimulation of expression of muscle - specific e3 ligases [ 76 , 77 ] which is linearly related to increased muscle protein degradation . the actual effects of il-6 on the pi3-k / akt / mtor pathway within muscle fibers remain to be determined . note that there may also an indirect way by which il-6 affect the akt / mtor signaling within muscle . transgenic overexpression of il-6 or its exogenous injection in mice is associated with reduced circulating igf-1 levels , likely due to increased proteolysis of the igf-1 binding protein 3 ( igfbp3 ) and enhanced clearance of igf-1 . in bone , il-6 signals via gp130/il-6r thereby activating the jak / stat pathway , which leads to activation of the transcription factor nuclear factor kappa - light - chain - enhancer of activated b cells . il-6 also activates the ras / raf pathway leading to the activation of the transcription factor c / ebp , also known as the latter binds promoter sequences of amongst others inos and cox2 genes and stimulates igf-1 expression , which all play a role in the regulation of bone metabolism . the c / ebp gene gives rise to three proteins : lap * , lap , and lip . lap mediates osteoblast maturation and osteoblast - stimulated osteoclastogenesis while lip inhibits osteoblast - stimulated osteoclastogenesis . in osteoclasts , the balance between lap and lip expression is determined by mtor activity , i.e. , low mtor activity favoring lap , while high mtor activity favors lip . from the foregoing , it is clear that there are similarities and dissimilarities in the way igf-1 and il-6 are employed by bone and muscle to achieve changes in tissue mass , and that much can be learned from one field in order to generate a better understanding of regulation of tissue mass in the other field . a similarity between muscle and bone is that the balance between protein formation and degradation determines tissue mass . in order for protein formation to increase in muscle , the muscle increases the amount of nuclei ( dna ) per fiber , the amount of rna per available myonucleus ( rate of transcription ) , as well as the rate of translation per mrna molecule . in bone , the protein matrix is deposited outside of the cells rather than intracellular , and bone formation and degradation occur by two separate cell types , but otherwise it makes sense that in order for bone matrix production to increase , the same principles apply as for muscle . indeed , an increase in proliferation and differentiation of osteoblast precursors increases the number of osteoblast nuclei ( dna ) per volume bone . for example , mgf enhances the number of osteogenic cells in bone through stimulation of proliferation . one might then question : what is next ? in order to increase bone formation rate in an efficient manner , the activity per osteoblast needs to be enhanced as well . the master switch in the rate of protein translation in muscle , as in many other cell types , is the pi3-k / akt / mtor pathway , as discussed above . it is possible that mtor plays a very analogous role in osteoblasts , although the little evidence that is currently available for such a role is ambiguous . on the one hand , genetic disruption of mtor signaling by deleting raptor for 3 weeks in the osteoblast lineage in 1-month - old mice did not affect bone mass or strength , suggesting that mtor signaling in osteoblasts may not be essential for maintaining bone homeostasis on the short term . on the other hand , targeted induction of the wnt7b gene in osteoblasts dramatically enhanced bone mass due to increased osteoblast number , activity , and significantly stimulated bone formation , but not when the cofactor for mtor signaling raptor was absent . in addition , the importance of mtor signaling for osteoblasts is exemplified by the experiments in which pi3k / mtor inhibitors , designed as oncostatic drugs , were tested in vivo . male mice received amongst others the pi3-k / mtor inhibitors ez235 and pi103 , which reduced bv / tv by 36 and 37 % , respectively [ 85 ] . of course , this could still be through an effect of mtor on osteoblast differentiation rather than on the rate of translation . whether the mtor pathway is important for osteocytes is unknown , but it stands to reason that this pathway affects osteocyte biology . when oxygen and nutrients are not abundant , for instance in osteocytes that are not in direct contact with the vasculature , it makes sense that these cells slow down their metabolism and recycle cell components as much as possible through autophagy . since mtor activation enhances the energy consuming process of protein translation and inhibits autophagy [ 86 ] , one could deduce that mtor activity needs to stay low in unstimulated osteocytes . alterations in mtor activity could thus have profound effects on osteocyte survival and bone metabolism . taken together , il-6 and igf-1 are extremely important regulators of bone and muscle metabolism , which makes them interesting targets for the treatment of osteopenia or sarcopenia . however , igf-1 and il-6 are ubiquitously expressed and signal in many cell types , which makes it difficult to target these molecules only in bone and muscle but not in other tissues . the same holds for the signaling pathway that igf-1 and il-6 have in common , i.e. , the mtor pathway . as the mtor pathway is ubiquitously involved in many cells types , activation of this pathway specifically in bone will be a challenge , although targeted delivery of chemicals using bisphosphonates may be an option . however , even if bone can be reached as a single target , igf-1 , il-6 , and mtor signaling seem to be a two - edged sword : all seem to stimulate osteogenic differentiation and might be essential in bone development and healing . knockout of il-6 in otherwise healthy animals and inhibition of mtor with compounds such as rapamycin certainly have deleterious effects in bone mass . however , both igf-1 and il-6 may also stimulate bone resorption , and mtor activation in osteoclast precursors stimulates osteoclast formation . il-6 inhibitors are available in the clinic for suppression of inflammation in rheumatoid arthritis , where they seem to be osteoanabolic , rather than catabolic . pharmacological intervention in these pathways will thus require fine tuning of dose and kinetics ( e.g. , continuous or intermitted ) in order to achieve an adequate anabolic effect . alternatively , one could try to specifically target il-6 and igf-1 signaling in muscle by pharmacological means , in order to increase both muscle and bone mass . indeed , overexpression of igf-1 in the musculature of mice enhanced bone mass as well . increased muscle mass could be anabolic for bone since muscles exert mechanical forces in bone . exercise , which stimulates il-6 and igf-1 production in bone and muscle , as well as the production of a large quantity of other growth factors and signaling molecules , may be a safe and efficient way to enhance both bone and muscle mass . in muscle , the mtor pathway is activated via the food supplement leucine , which transiently stimulated the rate of translation in muscle cells in vitro [ 90 , 91 ] . whether supplements can be applied to affect the proliferation of osteoblasts and the rate of translation in these cells is yet unknown and remains to be determined . however , until very fine tuned and tissue - specific pharmacological interventions are available , a combination of sufficient exercise and a balanced diet containing sufficient amounts of for example leucine are a safe and cheap way to help maintain muscle and bone mass . | insulin - like growth factor 1 ( igf-1 ) and interleukin 6 ( il-6 ) play an important role in the adaptation of both muscle and bone to mechanical stimuli . here , we provide an overview of the functions of il-6 and igf-1 in bone and muscle metabolism , and the intracellular signaling pathways that are well known to mediate these functions .
in particular , we discuss the akt / mammalian target of rapamycin ( mtor ) pathway which in skeletal muscle is known for its key role in regulating the rate of mrna translation ( protein synthesis ) . since the role of the mtor pathway in bone is explored to a much lesser extent , we discuss what is known about this pathway in bone and the potential role of this pathway in bone remodeling .
we will also discuss the possible ways of influencing igf-1 or il-6 signaling by osteocytes and the clinical implications of pharmacological or nutritional modulation of the akt / mtor pathway . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the electron delocalization is a commonly occurring phenomenon [ 13 ] leading to unique physico - chemical properties of molecular systems due to characteristic structural , energetic , magnetic and reactivity consequences . there is common consensus [ 413 ] that aromaticity is characterized by a collection of properties of a cyclic -electron system independent of whether the cause of aromatic stability is considered due to the -electron or -electron structure . the multi - dimensionality of this quantity makes the problem of quantification a non - trivial fact and despite numerous aromaticity measures that were introduced by different authors [ 414 ] there is no one unambiguous criterion that can be used for all molecular systems . for example one of the most widely used structural index of aromaticity , harmonic oscillator model of aromaticity ( homa ) [ 15 , 16 ] , assumes the idea of non - alternation of chemical bonds in aromatic systems . however , bond - length alternation ( bla ) is not always a univocal indicator of aromaticity as it was demonstrated by feixas et al . [ it has been demonstrated that significant bla of distorted benzene structures do not affect its aromaticity measured by large negative nics values . confirmed that benzene tends to stay highly aromatic and highly diatropic even if strong bond - length alternation is introduced artificially into the -electron system and within annulene family benzene -electron delocalization is the least sensitive to bond - length alternation . interestingly , two decades ago aihara suggested that also aromatic stabilization energy ( ase ) is quite insensitive to bond length alternation . on the other hand aromaticity is strongly associated with the rings planarity but even this feature is not a sine qua non condition which was documented by numerous experimental [ 2126 ] and theoretical investigations [ 418 , 27 , 28 ] . benzene ring can undergo large out - of - plane distortions [ 2128 ] but its aromaticity and ring - current diamagnetism seem to be quite insensitive to such deformations of the molecule [ 1730 ] . even benzene itself in crystalline state at 20 k is non - planar which has been attributed to intermolecular interactions in the crystal lattice . van zijl et al . noted that meta - cyclophane is highly diatropic despite its strongly bent benzene ring and observed cc bond lengths of the ring are uniform within an experimental error . furthermore , on the basis of the magnetic criterion of aromaticity , rice et al . reported that paracyclophanes should be classified as aromatic notwithstanding the considerable non - planar distortions of the benzene ring . polycyclic benzenoid hydrocarbons also appear to retain aromaticity even if they are heavily distorted [ 33 , 34 ] . another interesting aspect is related to reaction of aromatic compounds . recently , rozgonyi et al . have used an unbiased ab initio molecular dynamics for demonstration that aromaticity remains the organizing force even at high temperature and the ground - state reaction paths continue to proceed through aromatic configuration . furthermore , the transition state of a diels alder reaction between ethylene and butadiene is formally iso--electronic with bond - alternate benzene [ 36 , 37 ] . this pericyclic transition state also exhibits a large negative nics value at the central region and should reasonably be regarded as an aromatic specie . interestingly aromatic ring elasticity was documented also as the common phenomenon not only to benzene analogues but also characteristic for heterocyclic compounds [ 3843 ] . this is of particular importance since it provides additional degrees of freedom to biomolecules interacting in native environments . the structural non - rigidity of selected numbers of aromatic and heteroaromatic molecules has been investigated by quantum chemical optimization and quantum chemistry molecular dynamics . demonstrated in a series of publications [ 3843 ] that lowest - lying molecular vibrations stand for high flexibility of the aromatic rings . an energy increase between a planar equilibrium conformation and a non - planar deformed structures can be characterized by rising of the endocyclic torsion angles up to 20 degrees with an increase of only 1.2 - 1.8 kcal mol depending on the system . this indicates that such molecular motions , even for highly aromatic compounds such as benzene or adenine , can be the source of non - trivial deformations that can potentially lead to alterations of electron delocalization . despite great interest in the flexibility of aromatic and hetero - aromatic rings no systematic study was performed till now for methodical inclusion thermally available aromatic ring deformations . this paper intends to fill this gap and provides detailed analysis of in - plane and out - of - plane flexibilities of six- and five - membered rings in terms of homa index of aromaticity . the subject of our investigations comprises a series of compounds possessing aromatic or heteroaromatic rings . these compounds form quite a diverse set in the sense of broad range of aromatic nature . the influence of the structural flexibility on the aromatic character was quantified by means of geometric criterion ( homa ) [ 15 , 16 ] . the thermodynamics computations were performed for ensuring that no imaginary frequencies were assigned and obtained structures characterized ground states . then , paths along normal coordinates were identified for each of the analyzed compounds based on hessian estimated on the same level of theory . only those modes of vibrations were considered that are present in room temperature at least in 2% of the whole population . this corresponds to excitation energy not higher than 1.5 kcal mol with respect to the lowest state . the amplitudes of vibrations were estimated according to absorbed energies at 298 k. for this reason for every vibrational mode the series of structures were generated along the normal coordinate with arbitrary steps and corresponding energies were estimated by means of single point computations at the same level as frequencies computations . then six - order polynomials were used for approximation of energy function changes along the normal coordinate path . based on this approximation the values of amplitudes of vibrations were obtained for the first , or in some cases for second , excitation levels . the actual excitation energies corresponded to those vibration modes that are induced at room temperature ( up to 1.5 kcal mol ) . 1schematic representation of structures of analyzed aromatic and heteroaromatic compounds schematic representation of structures of analyzed aromatic and heteroaromatic compounds this way of modeling of molecular motions overestimates the molecular deformations due to the very nature of quantum oscillator . in the case of classical vibrations this is not the case for quantum vibrations for which the most probable is the ground state . thus , alternative ways of structure deformations are also considered by adopting shishkin approach [ 23 , 39 ] . it is obvious that vibrations along normal modes can be decomposed into different structural deformations as bond or torsion angles stretching , bending , out - of - plane breathing , etc . the distribution of potential energy ( ped ) [ 4547 ] in each internal coordinate is commonly used for determination of such contributions . among them there are two of the most important deformations that seem to be crucial from the perspective of aromaticity changes . the torsion angles constituting the ring skeleton are responsible for out - of - plane distortions and similarly the in - plane deformations are dependent on the bond angle changes . at room temperature significant amount of kinetic energy is available to molecular motions and this is modeled by allowing for partial relaxation of molecule coordinates . thus , a series of geometry optimizations were performed with fixing of only one coordinate and allowing for relaxation of the remaining parts . in this procedure each of six ( or five ) bond or torsion angles constituting the ring were kept frozen and the rest of molecule was allowed to relax . the extension of scanning along such coordinate was controlled by energetic criterion and expansion of in - plane or out - of - plane deformations was continued until 1.5 kcal mol increase of energy was achieved . the averaged values of bond angles or dihedrals corresponding to such energy increase were used as the measure of the ring deformability ( rd ) . it is worth mentioning that the proposed scanning procedure does not include all possible in - plane deformations since there are some modes that do not involve bond angle changes of the ring . for example in the case of benzene molecule for b2u symmetry or the breathing mode of a1 g symmetry there are active clamping deformations of hydrogen atoms ( or in general side groups ) . these modes were not studied as separate items , since they were included in the first approach . the influence of molecular vibrations on structural index of aromaticity was studied for compounds presented in fig . 1 . due to different substituents connected to the rings the considered compounds can significantly differ in aromatic character . this also allows for analysis of the influence of side groups on the ring flexibility . indeed the span of homa values corresponding to optimized geometries ranges from 0.465 ( thymine ) up to 0.989 ( phenol ) for six - membered rings and from -0.403 ( no - fulvene ) up to 0.871 ( imidazole ring of guanine ) , for five - membered rings , respectively . benzene analogues ( group i ) and fulvene derivatives ( group ii ) represent typical carbon - based rings while heteroaromatic compounds were included in group iii ( purines ) and group iv ( pyrimidines ) . in the first part the influence of thermal vibrations on aromaticity was estimated according to three procedures described in the methodology section . finally , the correlation between obtained here heterogeneities of rings aromaticities imposed by thermal fluctuations with standard way of aromaticity assessments is presented and discussed . the distribution of homa values corresponding to three alternative models of ring vibrations were presented in fig . 2 for selected and most representative structures defined in fig . 1 . all values of structural index of aromaticity are related to conformations that are destabilized by at most 1.5 kcal mol from the ground state . as it is documented in fig . 2 each of analyzed compounds is characterized by a set of homa values of varying range . usually the less aromatic compound the higher diversities of structural index of aromaticity is observed . among three ways of the molecular motions modeling the deformations obtained along normal even benzene has some modes of vibrations that are associated with serious reduction of its aromaticity . for example 13 mode of vibration leads to occurrence of a triangle like structure . this can impose serious linearization of every second bond - angle of the ring and consequently reduce the homa value down to 0.765 if considered amplitude of vibration corresponds to absorption of 1.48 kcal mol of energy . the third mode of vibration of benzene corresponds to occasional trapezoid - like structure formation in 7% amount with reduction of homa value down to 0.912 . however , it is worth mentioning that ir intensities of both modes are very low and corresponding peaks are not present in the infra red spectrum due to the lack of dipole moment changes . most of aromatic compounds can also gain their aromaticity as a result of vibrations along normal coordinates . a very spectacular example can be found for thymine and uracil , which both are considered as ultra low aromatic compounds . for example 13 modes of vibration of thymine corresponds to symmetric in - plane breathing with significant increase of n1-c2 and c4-c5 bond lengths . this is accomplished with a rise of homa values up to 0.692 , which stands for an almost 50% increase of aromaticity with respect to canonical structure . there are about 3% of such conformations in the total population . in the case of 2% of uracil conformations there are observed out of plane vibrations of c4-c5-c6-n1 torsion angle that lead to increase of homa values up to 0.572 with only 1.4 kcal mol rise of the total energy . thus , due to low energy penalty the deformations of molecular structure imposed by intrinsic vibration modes can significantly alter planar and symmetrical structure of the ring affecting aromatic characters expressed in terms of homa index . similar patterns can also be observed for higher modes , that are not available to molecular motions at room temperature . thus , one can speculate that irradiation of molecule with specific wave length can alter aromatic character by promoting fraction of particular conformation in the whole population . such modes of vibration , which reduces aromaticity , are expected to be less important from the reactivity point of view and only have influence on the averaged value of aromaticity . however , these modes which lead to increase of homa values might be responsible for more aromatic reactivity than can be deduced from the ground state conformation and may potentially be involved in speeding up of substitution reactions of vibrating molecules at any , not only room temperature . 2the heterogeneity of aromatic character induced by thermal vibrations ( black circles ) , in - plane deformations ( gray circles ) and out - of - plane distortions ( open circles ) . all geometry alterations correspond to increase of system energy not extending 1.5 kcal / mol the heterogeneity of aromatic character induced by thermal vibrations ( black circles ) , in - plane deformations ( gray circles ) and out - of - plane distortions ( open circles ) . all geometry alterations correspond to increase of system energy not extending 1.5 kcal / mol in fig . 2 there are also presented in - plane and out - of - plane rings deformations with inclusion of relaxation energy . the first and direct conclusion is that obtained distributions of homa values are much more contracted than ones obtained from normal coordinate analysis . especially relaxation of molecular geometry accomplished with out - of - plane ring distortions can be easily diminished by mutual changes of other geometric molecular coordinates . the modification of one of dihedral angles is accomplished with alterations in opposite direction of two neighboring torsion angles of the ring if geometry relaxation is allowed . thus , ring flexibility need not directly lead to strong variation of homa values if partial optimization is allowed . however , even in this model majority of aromatic compounds are characterized by relatively broad sets of homa values . for example in case of guanine the reduction of c2-n3-c4 or n3-c4-c5 bond angle by about 5 from the canonical form leads to an increase of aromatic character up to 0.710 with only 1.5 kcal mol raise of the total energy . in order to quantify the elasticity of aromatic ring the mean values of bond angles or torsion angles constituting the ring the resulting values are termed ring deformability ( expressed in degrees ) and are presented in fig . 3 , where data for all four analyzed sets of compounds are included . both in - plane and out - of - plane deformations were averaged over all parameters defining the ring for structures obtained after scanning procedures or normal coordinate following . thus , the size of the ring defined the number of angles and dihedrals for averaging . consequently , the higher value of ring deformability the stronger ring deformations are allowed with the same energy rise . 3 the highest ring flexibility is observed for out - of - plane distortions if relaxation of the remaining coordinates is allowed . however , the values of rd are almost the same for all of analyzed benzene analogues and slightly exceed 14. for heterocyclic compounds much stronger relationship with aromaticity is observed and usually increase of ring deformability is correlated with decrease of aromatic character . it is interesting to see if there is any correspondence between ring deformability and homa values . apparently , there is quite acceptable relationship ( with correlation coefficient exceeding 0.93 ) between structural index of aromaticity and six - membered ring deformability obtained during scanning procedure . also out - of - plane deformability of five - membered rings resulting from scanning procedure can be correlated with homa vales , although the correlation coefficient is slightly smaller in this case ( r = 0.81 ) . for other cases the averaged in - plane deformations via geometry scanning as well as all deformability obtained along normal coordinates are almost the same irrespectively of ring size and its aromatic character . for example averaged values of bond angles constituting the ring are close to 5 irrespectively of the ring type . the only exception is observed in the case of benzene , for which this values is much smaller and equals 1.3. interestingly , the lack of correlation with aromaticity is also observed for out - of - plane vibrations for five - membered rings . the spectrum of analyzed rings is quite extended since it encompasses both anti - aromatic compounds as some fulvenes and highly aromatic imidazole rings in purines . thus , it seems that ring flexibility is directly correlated with aromaticity only for six - membered aromatic and heteroaromatic rings if partial geometry relaxation is allowed . 3the ring deformability ( rd are expressed in degrees ) corresponding to averaged values of bond angles or torsion angles changes that were correlated with 1.5 kcal mol increase of energy from the ground state of aromatic or heteroaromatic compounds . in - plane vibrations are defined as bond angle changes , while torsion changes are responsible for out - of - plane fluctuationfig . 4the ring deformability ( expressed in degrees ) corresponding to averaged changes of bond angles or torsion angles associated with not higher than 1.5 kcal / mol energy increase with respect of the ground state the ring deformability ( rd are expressed in degrees ) corresponding to averaged values of bond angles or torsion angles changes that were correlated with 1.5 kcal mol increase of energy from the ground state of aromatic or heteroaromatic compounds . in - plane vibrations are defined as bond angle changes , while torsion changes are responsible for out - of - plane fluctuation the ring deformability ( expressed in degrees ) corresponding to averaged changes of bond angles or torsion angles associated with not higher than 1.5 kcal / mol energy increase with respect of the ground state the ring deformability can be even more pronounced by analysis of structural properties of cyclophanes . this interesting group of compounds is well - studied [ 37 , 38 ] in organic chemistry because they adopt unusual chemical conformations due to build - up aromatic unit and an aliphatic chain that forms a bridge between two non - adjacent positions ( typically para or meta ) of the aromatic ring . some of derivatives possess two p - phenylene groups held face to face by [ch2]n bridges . the interesting thing about cyclophanes is that they are forced to adopt unusual chemical conformation of aromatic ring due to steric restrictions of the build - up chain . in this respect they are ideally suited for the purpose of this paper and can serve as interesting illustration of the very nature of six - membered aromatic ring . resulting correlation between aromaticity and ring deformability along with chemical structures are presented in figs . 5 and 6 . it is worth mentioning that ring deformability coming from averaged bond angle and torsion angle constituting the ring do not come this time from distorted but rather optimized structures . from fig . 5 it is clearly visible that structures , which possess out - of - plane deformation up to 15 are practically as aromatic as benzene itself . within this scope of ring deformability there is fairly linear correlation between homa values and mean torsion angles constituting the ring . exceeding deformations of the ring beyond this value imposes significant reduction of -electron delocalization and correlation becomes non - linear . the ring deformation with respect to bond angles and torsion angles are related to each other , although this correlation is not linear as it is presented in fig . 6 . again the resistance of the ring toward in - plane distortions is much higher if compared with out - of - plane deformations . interestingly presence of amino- or hydroxyl- side groups does not change these conclusions irrespectively of their position in the cyclophane ring . 5the correlation homa values and out - of - plane phenyl ring deformations in a variety of cyclophane systemsfig . 6the correlation between in - plane and out - of - plane deformations for optimized structures of different cyclophanes analogues ( see fig . 5 for chemical structures ) the correlation homa values and out - of - plane phenyl ring deformations in a variety of cyclophane systems the correlation between in - plane and out - of - plane deformations for optimized structures of different cyclophanes analogues ( see fig . 5 for chemical structures ) the above discussed data suggest that significant heterogeneities of ring aromaticities can be imposed by thermal vibrations . although modeled out - of - plane fluctuations have quite a small influence on the homa values if relaxation of the geometry is allowed , there are still non - trivial distributions of this index for many aromatic compounds . it is interesting to see if there is any correlation between homa values that are commonly obtained based on the ground state geometry and averaged ones coming from the considered here series of structures . for proper estimation of average values of aromaticity index for modeled thermal fluctuations , thus , the standard deviation ( sdv ) expressed as the square root of population variance were estimated after summing up all values corresponding to structures within 1.5 kcal mol with weighting factor obtained based on boltzmann probabilities at room temperature . the results corresponding to all three ways of modeling of thermal vibrations were presented in fig . 7 . it clearly documents that at room temperature there is perfect correlation between aromaticities averaged over thermal fluctuation and coming from the ground state structure . the close to unity value of r suggests that ground state conformations although corresponding to zero kelvin temperature , hence not present in the real population at any temperature , is a very good representation of properties of aromatic compounds . although ignoring of the thermal fluctuations in the description of aromaticity does not change the mean values of structural index of aromaticity and leads essentially to the same quantity there is a sense in using representative spectrum of conformations . fortunately the values of sdv for homa are quite small as can be seen in fig . 7correlation between homa values characterizing ground state and mean value of thermally excited geometries at room temperature . values of sdv ( standard deviation of population variance ) were also provided correlation between homa values characterizing ground state and mean value of thermally excited geometries at room temperature . the distribution of homa values corresponding to three alternative models of ring vibrations were presented in fig . 2 for selected and most representative structures defined in fig . 1 . all values of structural index of aromaticity are related to conformations that are destabilized by at most 1.5 kcal mol from the ground state . as it is documented in fig . 2 each of analyzed compounds is characterized by a set of homa values of varying range . usually the less aromatic compound the higher diversities of structural index of aromaticity is observed . among three ways of the molecular motions modeling the deformations obtained along normal even benzene has some modes of vibrations that are associated with serious reduction of its aromaticity . for example 13 mode of vibration leads to occurrence of a triangle like structure . this can impose serious linearization of every second bond - angle of the ring and consequently reduce the homa value down to 0.765 if considered amplitude of vibration corresponds to absorption of 1.48 kcal mol of energy . the third mode of vibration of benzene corresponds to occasional trapezoid - like structure formation in 7% amount with reduction of homa value down to 0.912 . however , it is worth mentioning that ir intensities of both modes are very low and corresponding peaks are not present in the infra red spectrum due to the lack of dipole moment changes . most of aromatic compounds can also gain their aromaticity as a result of vibrations along normal coordinates . a very spectacular example can be found for thymine and uracil , which both are considered as ultra low aromatic compounds . for example 13 modes of vibration of thymine corresponds to symmetric in - plane breathing with significant increase of n1-c2 and c4-c5 bond lengths . this is accomplished with a rise of homa values up to 0.692 , which stands for an almost 50% increase of aromaticity with respect to canonical structure . there are about 3% of such conformations in the total population . in the case of 2% of uracil conformations there are observed out of plane vibrations of c4-c5-c6-n1 torsion angle that lead to increase of homa values up to 0.572 with only 1.4 kcal mol rise of the total energy . thus , due to low energy penalty the deformations of molecular structure imposed by intrinsic vibration modes can significantly alter planar and symmetrical structure of the ring affecting aromatic characters expressed in terms of homa index . similar patterns can also be observed for higher modes , that are not available to molecular motions at room temperature . thus , one can speculate that irradiation of molecule with specific wave length can alter aromatic character by promoting fraction of particular conformation in the whole population . such modes of vibration , which reduces aromaticity , are expected to be less important from the reactivity point of view and only have influence on the averaged value of aromaticity . however , these modes which lead to increase of homa values might be responsible for more aromatic reactivity than can be deduced from the ground state conformation and may potentially be involved in speeding up of substitution reactions of vibrating molecules at any , not only room temperature . 2the heterogeneity of aromatic character induced by thermal vibrations ( black circles ) , in - plane deformations ( gray circles ) and out - of - plane distortions ( open circles ) . all geometry alterations correspond to increase of system energy not extending 1.5 kcal / mol the heterogeneity of aromatic character induced by thermal vibrations ( black circles ) , in - plane deformations ( gray circles ) and out - of - plane distortions ( open circles ) . all geometry alterations correspond to increase of system energy not extending 1.5 kcal / mol in fig . 2 there are also presented in - plane and out - of - plane rings deformations with inclusion of relaxation energy . the first and direct conclusion is that obtained distributions of homa values are much more contracted than ones obtained from normal coordinate analysis . especially relaxation of molecular geometry accomplished with out - of - plane ring distortions can be easily diminished by mutual changes of other geometric molecular coordinates . the modification of one of dihedral angles is accomplished with alterations in opposite direction of two neighboring torsion angles of the ring if geometry relaxation is allowed . thus , ring flexibility need not directly lead to strong variation of homa values if partial optimization is allowed . however , even in this model majority of aromatic compounds are characterized by relatively broad sets of homa values . for example in case of guanine the reduction of c2-n3-c4 or n3-c4-c5 bond angle by about 5 from the canonical form leads to an increase of aromatic character up to 0.710 with only 1.5 kcal mol raise of the total energy . in order to quantify the elasticity of aromatic ring the mean values of bond angles or torsion angles constituting the ring the resulting values are termed ring deformability ( expressed in degrees ) and are presented in fig . 3 , where data for all four analyzed sets of compounds are included . both in - plane and out - of - plane deformations were averaged over all parameters defining the ring for structures obtained after scanning procedures or normal coordinate following . thus , the size of the ring defined the number of angles and dihedrals for averaging . consequently , the higher value of ring deformability the stronger ring deformations are allowed with the same energy rise . 3 the highest ring flexibility is observed for out - of - plane distortions if relaxation of the remaining coordinates is allowed . however , the values of rd are almost the same for all of analyzed benzene analogues and slightly exceed 14. for heterocyclic compounds much stronger relationship with aromaticity is observed and usually increase of ring deformability is correlated with decrease of aromatic character . it is interesting to see if there is any correspondence between ring deformability and homa values . apparently , there is quite acceptable relationship ( with correlation coefficient exceeding 0.93 ) between structural index of aromaticity and six - membered ring deformability obtained during scanning procedure . also out - of - plane deformability of five - membered rings resulting from scanning procedure can be correlated with homa vales , although the correlation coefficient is slightly smaller in this case ( r = 0.81 ) . for other cases the averaged in - plane deformations via geometry scanning as well as all deformability obtained along normal coordinates are almost the same irrespectively of ring size and its aromatic character . for example averaged values of bond angles constituting the ring are close to 5 irrespectively of the ring type . the only exception is observed in the case of benzene , for which this values is much smaller and equals 1.3. interestingly , the lack of correlation with aromaticity is also observed for out - of - plane vibrations for five - membered rings . the spectrum of analyzed rings is quite extended since it encompasses both anti - aromatic compounds as some fulvenes and highly aromatic imidazole rings in purines . thus , it seems that ring flexibility is directly correlated with aromaticity only for six - membered aromatic and heteroaromatic rings if partial geometry relaxation is allowed . corresponding to averaged values of bond angles or torsion angles changes that were correlated with 1.5 kcal mol increase of energy from the ground state of aromatic or heteroaromatic compounds . in - plane vibrations are defined as bond angle changes , while torsion changes are responsible for out - of - plane fluctuationfig . 4the ring deformability ( expressed in degrees ) corresponding to averaged changes of bond angles or torsion angles associated with not higher than 1.5 kcal / mol energy increase with respect of the ground state the ring deformability ( rd are expressed in degrees ) corresponding to averaged values of bond angles or torsion angles changes that were correlated with 1.5 kcal mol increase of energy from the ground state of aromatic or heteroaromatic compounds . in - plane vibrations are defined as bond angle changes , while torsion changes are responsible for out - of - plane fluctuation the ring deformability ( expressed in degrees ) corresponding to averaged changes of bond angles or torsion angles associated with not higher than 1.5 kcal / mol energy increase with respect of the ground state the ring deformability can be even more pronounced by analysis of structural properties of cyclophanes . this interesting group of compounds is well - studied [ 37 , 38 ] in organic chemistry because they adopt unusual chemical conformations due to build - up aromatic unit and an aliphatic chain that forms a bridge between two non - adjacent positions ( typically para or meta ) of the aromatic ring . some of derivatives possess two p - phenylene groups held face to face by [ch2]n bridges . the interesting thing about cyclophanes is that they are forced to adopt unusual chemical conformation of aromatic ring due to steric restrictions of the build - up chain . in this respect they are ideally suited for the purpose of this paper and can serve as interesting illustration of the very nature of six - membered aromatic ring . resulting correlation between aromaticity and ring deformability along with chemical structures are presented in figs . 5 and 6 . it is worth mentioning that ring deformability coming from averaged bond angle and torsion angle constituting the ring do not come this time from distorted but rather optimized structures . from fig . 5 it is clearly visible that structures , which possess out - of - plane deformation up to 15 are practically as aromatic as benzene itself . within this scope of ring deformability there is fairly linear correlation between homa values and mean torsion angles constituting the ring . exceeding deformations of the ring beyond this value imposes significant reduction of -electron delocalization and correlation becomes non - linear . the ring deformation with respect to bond angles and torsion angles are related to each other , although this correlation is not linear as it is presented in fig . 6 . again the resistance of the ring toward in - plane distortions is much higher if compared with out - of - plane deformations . interestingly presence of amino- or hydroxyl- side groups does not change these conclusions irrespectively of their position in the cyclophane ring . 5the correlation homa values and out - of - plane phenyl ring deformations in a variety of cyclophane systemsfig . 6the correlation between in - plane and out - of - plane deformations for optimized structures of different cyclophanes analogues ( see fig . 5 for chemical structures ) the correlation homa values and out - of - plane phenyl ring deformations in a variety of cyclophane systems the correlation between in - plane and out - of - plane deformations for optimized structures of different cyclophanes analogues ( see fig . 5 for chemical structures ) the above discussed data suggest that significant heterogeneities of ring aromaticities can be imposed by thermal vibrations . although modeled out - of - plane fluctuations have quite a small influence on the homa values if relaxation of the geometry is allowed , there are still non - trivial distributions of this index for many aromatic compounds . it is interesting to see if there is any correlation between homa values that are commonly obtained based on the ground state geometry and averaged ones coming from the considered here series of structures . for proper estimation of average values of aromaticity index for modeled thermal fluctuations , thus , the standard deviation ( sdv ) expressed as the square root of population variance were estimated after summing up all values corresponding to structures within 1.5 kcal mol with weighting factor obtained based on boltzmann probabilities at room temperature . the results corresponding to all three ways of modeling of thermal vibrations were presented in fig . 7 . it clearly documents that at room temperature there is perfect correlation between aromaticities averaged over thermal fluctuation and coming from the ground state structure . the close to unity value of r suggests that ground state conformations although corresponding to zero kelvin temperature , hence not present in the real population at any temperature , is a very good representation of properties of aromatic compounds . although ignoring of the thermal fluctuations in the description of aromaticity does not change the mean values of structural index of aromaticity and leads essentially to the same quantity there is a sense in using representative spectrum of conformations . such an analysis can provide the magnitude of variability of the aromaticity index . fortunately the values of sdv for homa are quite small as can be seen in fig . . however , the sdv values can very rapidly increase if the temperature rises . 7correlation between homa values characterizing ground state and mean value of thermally excited geometries at room temperature . values of sdv ( standard deviation of population variance ) were also provided correlation between homa values characterizing ground state and mean value of thermally excited geometries at room temperature . although aromaticity is a commonly used term its multidimensional character and enumerative nature make its application and interpretation a non - trivial task . this is proved by the enormous number of papers published every year that address this old phenomenon . the most commonly accepted assumes that aromaticity is correlated with the higher energetic stability ( in comparison to non - aromatic analogues ) , the -electron delocalization expressed in terms of non - alternation of bond lengths ( or related properties as bond orders , electron densities at bond critical points , etc . ) , ring critical points characteristics or magnetic susceptibilities and also as higher reactivity toward substation rather than addition reactions . however , all these aspects are mainly related to the ground state that corresponds to the global minimum on the configuration hyperspace . it is obvious that real molecules possess many more degrees of freedom that might potentially affect its aromaticity . in this paper one of such aspects the first observation is that the molecular structures adopted during vibrations at room temperature can lead to significant heterogeneity of structural index of aromaticity . the averaged values obtained for such fluctuations almost perfectly match homa values of molecule in the ground state . although ignoring of the thermal fluctuations in the description of aromaticity does not change the mean values of structural index of aromaticity and leads to essentially the same quantity , the distribution of aromaticity indices can be available . the standard deviation expressed as the square root of population variance ( sdv ) which includes boltzmann probabilities is small for highly aromatic compounds and increases with reduction of aromaticity . the deformability of the ring imposed by thermal fluctuations can also be expressed as the mean change of bond angles or torsion angles constituting the ring that are correlated with a given increase of the system energy . here the arbitral value of 1.5 kcal mol level was used since such energy increase can be observed for at least 2% of vibration structures at room temperature . it has been demonstrated that the ring deformability imposed by bond angle changes is much smaller than for dihedral angles with the same rise of system energy . interestingly only in the case of out - of - plane vibrations modeled by scanning procedure lead to linear correlation with homa index . proposed in this paper method for inclusion of thermal vibrations in the framework of electron delocalization provides natural extension of the way of thinking about aromaticity from static quantity to dynamic and heterogeneous one for inclusion of a more realistic object of analysis . from this perspective | the consequences of thermal fluctuations occurring at room temperatures on the aromatic character of a broad group of compounds were analyzed in three distinct ways .
first of all , the ring deformations were modeled along normal coordinates coming from quantum thermo - chemistry computations .
the amplitudes of vibrations were estimated according to absorbed energies at room temperature .
alternatively , in - plane and out - of - plane ring deformations were modeled via scanning procedure with partial relaxation of the molecular geometry .
the influence of ring deformations on electron delocalization was expressed in terms of homa values . besides , the ring deformability was defined as the averaged change of bond angles or dihedral angles constituting the ring that was associated with 1.5 kcal mol-1 increase of the system energy .
the molecules structures adopted during vibrations at room temperature can lead to significant heterogeneity of structural index of aromaticity .
the broad span of homa values was obtained for analyzed five- or six - membered aromatic and heteroaromatic rings .
however , the averaged values obtained for such fluctuations almost perfectly match homa values of molecule in the ground state .
it has been demonstrated that the ring deformability imposed by bond angle changes is much smaller than for dihedral angles with the same rise of system energy .
interestingly in the case of out - of - plane vibrations modeled by scanning procedure there is observed linear correlation between ring deformability and homa values . proposed method for inclusion of thermal vibrations in the framework of electron delocalization
provides natural shift of the way of thinking about aromaticity from a static quantity to a dynamic and heterogeneous one due to inclusion of a more realistic object of analysis thermally deformed structures . from this perspective
the thermal fluctuations are supposed to be non - negligible contributions to aromaticity phenomenon . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
type i diabetes is associated with increased risk of atherosclerotic macrovascular disease [ 1 , 2 ] . while nonglycemic risk factors associated with the metabolic syndrome contribute to risk for cardiovascular ( cv ) events in type ii diabetes , hyperglycemia has an independent effect to increase risk [ 24 ] . the nonenzymatic reaction between glucose and proteins known as glycation or glycosylation produces increased levels of glycoxidation products or advanced glycation endproducts ( ages ) in vascular endothelial cells and extracellular space . ages as well as other inflammatory ligands interact with a multiligand cell receptor ( receptor for advanced glycation endproducts rage ) and initiate a positive feedback loop whereby more binding leads to further rage upregulation . rage and its ligands play a critical role in vascular inflammation , endothelial dysfunction , and atherosclerotic plaque development [ 57 ] . in an autopsy study of coronary arteries from sudden cardiac death subjects , analysis of carotid plaques from patients with and without diabetes showed rage expression associated with inflammatory cells and matrix metalloproteinase ( mmp ) expression , markers of vulnerability , and correlated linearly with levels of glycated hemoglobin hga1c . glycemic control has been shown to reduce the risk of cv events in insulin dependent type i diabetes [ 1 , 10 ] . while results from multicenter prospective trials have shown either no effect or a deleterious effect of glucose control on cv events in type ii diabetes , when patients with earlier stage disease and no history of overt events were analyzed separately a beneficial effect of glucose control was found . in murine models of atherosclerosis with either type i or type ii diabetes , atherosclerotic lesion development is accelerated compared to atherosclerosis alone [ 1214 ] . treating with soluble rage ( s - rage ) that binds ligands and thereby decreases rage expression reversed the effect of diabetes to accelerate lesion growth in apolipoprotein e null ( apoe ) diabetic mice [ 15 , 16 ] . we undertook this study to investigate in live animals using molecular imaging the effects of glucose control with insulin on rage expression and atherosclerotic lesion size and progression . all animal experiments were performed with the approval of the institutional animal care and use committee of columbia university . apoe mice with the genetic background of c57bl/6 mice were purchased from the jackson laboratories ( bar harbor , maine ) . at 6 weeks of age , mice ( n = 30 ) were made diabetic via 5 daily intraperitoneal injections of streptozotocin ( stz , sigma ) , 50 mg / kg in citrate buffer ( 0.05 mol / l , ph 4.5 ) as described elsewhere . blood glucose levels were monitored weekly via tail vein sampling using blood glucose monitor ( freestyle lite , abbott ) . after 6 weeks of diabetes , fifteen mice received implants ( linbits , linshin canada inc . , toronto , canada ) that release insulin at a rate of ~0.1 u / day / implant for > 30 days . briefly , mice were anesthetized with isoflurane ( 4% to induce , 1% to maintain ) and the insulin implant was briefly immersed in 2% betadine and implanted subcutaneously using a 12-gauge trocar . the number of initial implants was determined based on weight : 2 linbit implants for the first 2024 g in body - weight and a third weight 25 g. the average weight for the mice was 28 g and mice received 2 - 3 implants . if the glucose level was > 288 mg / dl , additional implants were inserted based on blood glucose level . mice were monitored for signs of dehydration , weight loss , and loss of grooming which none of the mice in this study developed . over the course of the 15 weeks mice received an average of 7 implants ( range 611 ) . in addition , blood pool clearance for tc - anti - rage f(ab)2 was measured in apoe mice at 34 weeks with larger lesions and at 20 weeks with small lesions . monoclonal anti - rage antibody was developed as previously described [ 17 , 18 ] . an aliquot of anti - rage f(ab)2 ( 1 mg ) reacted with 5-fold molar excess of bicyclic anhydride of diethylenetriaminepentaacetic acid ( dtpa ) in 0.5 ml of dimethyl sulfoxide ( dmso ) for 30 min at room temperature while stirring . the reaction mixture was dialyzed against excess ( 4 l ) 0.1 mol / l nahco3 in 0.1 mol / l nacl , ph 7.6 at 4c overnight . an approximate 50100 g aliquot of dtpa modified anti - rage f(ab)2 reacted with 30 mci ( 1100 mbq ) of tco4 in 50 g of sncl2 in 100 l of 0.1 n hcl that was flushed with n2 for 20 min . after 30 min of incubation , the tc - anti - rage f(ab)2 was separated from free tc by sephadex - g25 ( 10 ml ) column ( pharmacia ) equilibrated with pbs . fractions ( 1.0 ml ) were collected , and those fractions containing tc - anti - rage f(ab)2 in the void volume were pooled . the mean specific activity was 48.7 9.3 ci/g ( 1.8 0.34 mbq/g ) , and the mean radiochemical purity was 95 1.6% by instant thin - layer chromatography . each mouse was anesthetized with isofluorane ( 4% to induce , 1% to maintain ) and injected with tc - anti - rage f(ab)2 ( 15.14 1.23 mbq ) via femoral vein catheter and 4 - 5 hours later ( allowing for radiotracer blood pool clearance ) were injected with 0.10.15 ml of ct contrast agent ( exia 160 ) ( binitio biomedicals , ottawa on ) . for control antibody experiment , tc - mouse nonimmune igg f(ab)2 ( 18.64 0.4 mbq ) was injected in 3 untreated mice . ct images were acquired with an integrated ct scanner using an x - ray tube at 45 kvp and an exposure time of 1000 ms per view . following ct acquisition , helical spect scans were acquired using dual - headed detectors each outfitted with collimators with nine pinholes . each pinhole has a diameter of 1.4 mm with each collimator providing a transaxial field - of - view ( fov ) of 70 mm and an axial fov up to 35 mm . spect data were acquired with the following parameters : step and shoot rotation , 30 step in 360 rotation using 24 projections , 60 s per projection , 256 256 frame size with 1.0 mm pixels , and 140 kev with 10% energy window . the projection data were reconstructed by ordered subset expectation - maximization ( osem ) algorithm with subset and iteration number set to 16 and 8 , respectively , and a voxel size of 300 m and spect and ct datasets fused . following imaging , mice were euthanized by an intraperitoneal injection of pentobarbital ( 100 mg / kg ) . the scans were reconstructed and processed using invivoscope software ( invicro , boston , ma ) . the cephalocaudal limits of tracer uptake in the ascending aorta and arch and brachiocephalic vessels were identified from coronal and/or sagittal images using contrast in the vessels on the cta for anatomical localization . regions of interest ( rois ) were then drawn around focal uptake in the transverse image and counts in these volumetric rois converted to mci using a calibration standard and conversion algorithm ( figure 1 ) . quantification of tracer uptake in mci in the reconstructed spect images was performed in interview xp software ( mediso ) using region - of - interest drawings in the transaxial plane . the system is calibrated for absolute quantification using specially designed rat- and mouse - shaped phantoms filled with known levels of tc imaged with the same protocol used for the animal studies . this quantification technique has been shown to be better than 4% accurate when performed with the same methodology ( hispect and mediso software ) on a comparable imaging system for imaging targets including vascular lesions . the quantitative uptake in mega - becquerel 's was divided by total injected dose ( decay corrected ) to obtain % i d . the summed activity from all the volumetric rois for the ascending aorta and arch was correlated with ex vivo gamma counting of the same tissue . to compare total vascular uptake of tracer on scans between groups , all tracer uptakes including the brachiocephalic vessels were summed for each animal . to confirm that blood glucose levels did not affect blood pool activity of the anti - rage probe at the time of imaging and contribute to differences in lesion uptake , using the cta scans to identify the lv cavity , uniform sized rois were drawn in the center of the lv cavity on transverse slices . activity in these samples of lv cavity blood pool was measured as % i d applying the calibration hardware / software as described above . the proximal aorta ( ascending aorta and arch ) was dissected and weighed and the radioactivity was determined in a gamma well counter ( wallac wizard 1470 , perkinelmer , waltham , ma ) and expressed as the percentage of injected dose per gram ( % id / g ) of tissue . the radiotracer activity in the samples was corrected for background , decay time , and tissue weight . the proximal aorta was fixed for 24 h in formalin ( 10% ) and was paraffin embedded . tissue blocks were sectioned ( 5 m - thick ) and stained with hematoxylin and eosin ( h&e ) for morphology . for immunohistochemical analyses , serial sections were deparaffinized in xylene and treated with 0.3% hydrogen peroxide for 20 min , followed by incubation in protein - free block ( dako , carpinteria , ca ) for 10 min to inhibit the nonspecific binding of primary antibody . staining for rage was performed using monoclonal anti - rage antibody ( 50 g / ml ) . macrophages were identified using marker mac-3 ( 1 : 20 , bd pharmingen ) . secondary staining was performed with hrp - conjugated respective secondary antibody , followed by diaminobenzidine ( dab substrate kit for peroxidase , vector laboratories ) and counterstaining with gill 's hematoxylin solution . morphometric and immunohistochemical analyses of the arterial segments were performed using a nikon microscope and image - pro plus software ( media cybernetics inc . , silver spring , md ) . the lesion in the proximal aorta was measured from the h&e stained sections as percent lesion area per total area of the aorta . staining for rage and macrophages was quantified as area with positive staining in the lesion over total cross - sectional area of the aorta . the mean serum glucose levels for the apoe mice with 6 weeks of diabetes and prior to insulin treatment were 364 66 mg / dl for the mice that received the insulin implants and 360 57 mg / dl for the mice that were followed as hyperglycemic controls . the initial weight of the mice that received the implants averaged 27 3 g. the average of weekly glucose levels over the 15-week treatment period for the insulin treated mice was 140 23 mg / dl and for the untreated hyperglycemic controls was 354 14 mg / dl . at necropsy there was extensive atherosclerosis involving the ascending aorta and arch and extending into the brachiocephalic and carotid vessels in the untreated mice . in the treated mice , the lesions were smaller and confined to the ascending aorta and arch ( figure 3 ) . all insulin treated mice showed lower tracer uptake in the thorax and neck corresponding to the location of the proximal aorta , arch , and brachiocephalic branches on the coregistered ct scan compared with untreated mice . an example from each experiment is shown in figure 3 . using the method described above to measure tracer uptake as % i d , the average was significantly lower in the glycemic controlled mice ( 3.15 1.82 10 ) compared to the uncontrolled mice ( 8.69 4.58 10 ) ( p = 0.001 ) ( figure 4 ) . uptake measured from the ascending aorta and arch alone was 6.49 3.87 10 in the untreated group and also significantly higher than for the same segments for the treated group ( p = 0.02 ) . none of the treated mice showed uptake in the brachiocephalic branch vessels , while all but 2 of the untreated mice did . uptake in the brachiocephalic and carotids in the untreated mice was 2.71 2.46 10 . minimal to no focal uptake of tracer was seen in these vascular territories on scans from untreated diabetic mice injected with control antibody ( figure 3 ) . analysis of lv cavity rois as representing samples of blood pool activity showed that blood glucose levels did not contribute to the observed differences in lesion uptake . values for the treated group were 0.28 0.17 10 and for the untreated group 0.39 0.36 10 ( p = 0.47 ) . the lower tracer uptake in the proximal aorta and arch of the treated mice was confirmed by ex vivo gamma well counting . uptake of the radiotracer in the treated group was 0.11 0.03%id / g which is significantly lower than uptake in the untreated group ( 0.24 0.10%id / g ) ( p < 0.0001 ) ( figure 4 ) . radiotracer uptake as % id / g for the control antibody was 0.07 0.01% . regression analysis of individual values for tracer uptake in the ascending aorta and arch from scans ( % i d ) and ex vivo gamma counts ( % id / g ) showed significant correlation ( r = 0.69 ; p = 0.01 ) ( figure 4 ) . the mean cross - sectional area of the proximal aortic lesions , expressed as percent lesion area over total aortic area , in the insulin treated group ( 14.2 7.8% ) was significantly smaller than the untreated mice ( 27.7 8.3% ; p = 0.01 ) . histological sections through the proximal aorta showed less staining for rage expressed as % positive staining cell area divided by total vessel area in the treated group ( 2.9 2.0% ) compared with untreated group ( 6.13 2.5% ; p = 0.04 ) ( figure 5 ) . serial sections stained for macrophages also showed less staining in the treated group ( 0.80 0.69 ) compared with untreated group ( 4.68 2.11 ) ( p = 0.01 ) . the results of this study show the beneficial effect of reducing rage expression by glycemic control on atherogenesis in diabetic apoe mice . this reduction in rage expression in the insulin treated mice as documented by lower uptake of tc - anti - rage f(ab)2 in the proximal aorta was associated with less extensive disease at necropsy and fewer lesion macrophages . none of the treated mice showed tracer uptake in the brachiocephalic vessels , while all but 2 of the untreated mice showed uptake in these vessels . these data support the value of in vivo imaging to document the effects of an intervention on target expression and disease progression . overexpression of rage in vascular endothelial cells and monocytes plays a critical role in development of atherosclerosis in nondiabetic apoe mice and with the addition of diabetes atherosclerosis development is accelerated [ 1214 ] . similar effect of rage expression on atherosclerosis was shown in apoe db / db mice , a murine model of type ii diabetes . blocking rage with soluble rage ( s - rage ) reduced the rate of atherogenesis to the nondiabetic pattern [ 15 , 16 ] . in these experimental studies we have shown that uptake of the antibody as % i d correlates with both quantitative immunohistological staining for rage in vascular tissue and with atheroma size in apoe mice and that rage colocalizes with both endothelial cells and monocytes in the atherosclerotic plaque [ 17 , 18 ] . in this current study we have shown that this imaging approach provides quantitative data on effects of treatment to reduce rage expression . epidemiological studies linking hyperglycemia to macrovascular atherosclerosis in diabetes have implicated glycated endproducts through inflammatory pathways and suggest that lowering glucose should reduce atherogenesis in diabetic patients . the diabetes control and complications trial ( dcct ) randomly assigned 1441 patients with type i diabetes to intensive or conventional insulin therapy . they first reported that intensive glucose control delays the onset and slows the progression of microvascular complications of retinopathy , nephropathy , and neuropathy . further study of the same cohort for cv events reported in 2005 showed that intensive therapy defined by strict fasting and low postprandial glucose levels conferred a long - term reduction in risk from cv events . in our animal model , the extent and severity of atherosclerosis in 12-week apoe mice with 6 weeks of diabetes are minimal and therefore beginning insulin at this time point corresponds to early treatment . while directly relating this model to human disease is difficult , the closest fit would be to establish and maintain glucose control in young patients with type i diabetes . we found rage staining on aortic tissue colocalized with macrophage staining and quantitatively fewer macrophages were found in the atheroma of insulin treated compared to the hyperglycemic controls . immunohistological analysis of human atherosclerotic plaque showed that rage expression correlated with poor glucose control and with plaque inflammation . while we can not conclude that rage was the only inflammatory pathway contributing to atherogenesis affected by glucose lowering , the established link between hyperglycemia and nonenzymatic glycosylation of proteins to produce the age ligands that bind to rage and stimulate further rage expression suggests that lowering blood glucose lowers circulating ages and reduces ligand binding and receptor mass which in turn reduces rage activated downstream inflammatory pathways . this effect we were able to detect using in vivo molecular imaging was associated with reduction in atherogenesis when compared with hyperglycemic controls . we did not perform autoradiography on explanted tissue in this study but we have previously shown using dual - labeled probe ( fluorescent plus radionuclide ) the colocalization of the anti - rage f(ab)2 and fluorescent probe in the atheroma . while the spatial resolution of nuclear imaging is less than ct or mri , the small probe size of a nuclear tracer allows access to binding sites within the plaque , and hot spots on in vivo imaging can be localized and quantified . using consistent techniques for designating regions of interest , activity which relates to target expression can be assessed in live animals allowing group comparisons at single time points and serial time points in the same animal . these data further support the important role of rage expression in atherogenesis in diabetes and support the value of molecular imaging to demonstrate and quantify responses to therapies targeting rage expression in atherosclerosis . | objective .
receptor for advanced glycated endproducts ( rage ) plays an important role in atherogenesis in diabetes .
we imaged rage to investigate the effect of glucose control to suppress rage and reduce atherosclerosis in apolipoprotein e null ( apoe/ ) diabetic mice .
methods and results . thirty - three apoe/ mice received streptozotocin and
6 weeks later 15 began treatment with insulin implants .
blood glucose measurements during study averaged : 140 23 mg / dl ( treated ) and 354 14 mg / dl ( untreated ) .
after 15 wk 30 mice were injected with 99mtc - anti - rage f(ab)2 , 3 with 99mtc - nonimmune igg f(ab)2 , and all with ct contrast agent and underwent spect / ct imaging . at necropsy ,
the proximal aorta was weighed , counted , and sectioned and the % injected dose per gram ( % id / g ) was calculated . from the merged spect / ct scans , tracer uptake localized to arteries was lower in the treated mice : 3.15 1.82 103 versus 8.69 4.58 103%id ( p = 0.001 ) .
percent cross - sectional lesion area was smaller in the treated ( 14.3 7.8% versus 29.5 10.9% ) ( p = 0.03 ) .
rage uptake on scans ( % i d ) correlated with quantitative rage staining in the atheroma and with % id / g ( r = 0.6887 ; p = 0.01 ) .
lesion size as percent cross - sectional area was smaller in the treated ( 14.3 7.8% versus 29.5 10.9% ) ( p = 0.03 ) .
rage uptake on scans ( % i d ) correlated with quantitative rage staining in the atheroma and with % id / g ( r = 0.6887 ; p = 0.01 ) .
conclusions .
these results support the importance of suppressing rage to reduce atherosclerotic complications of diabetes and value of molecular imaging to assess treatment effect . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is well - documented that overweight and obesity are increasing in both developed and developing countries . it is estimated that in 2030 , > 2 billion individuals would be overweight , and 1 billion would be obese . globally , high amounts of expenditures are allocated for obesity due to its indispensable role in chronic and complicated diseases such as cardiovascular diseases , cancers , hypertension , and type 2 diabetes . moreover , obesity is associated with inflammation that may be because of the entrance of macrophages in adipose tissues and their cytokine production , which in turn would contribute in the development of type ii diabetes and other metabolic disorders . different studies show that vitamin d , as an endocrine hormone , has not only crucial roles in metabolic pathways including glucose metabolism , and insulin secretion and functions , but this hormone might also modify the immune responses . for instance , the level of 25-hydroxy vitamin d ( 25(oh)d ) , which is the most important form of vitamin d , inversely correlates with glucose intolerance and type ii diabetes ; some studies showed direct correlation between 25(oh ) d levels and obesity . the latter collaboration occurs when lipogenesis and inhibition of lipolysis are induced by vitamin d in vivo and in vitro , respectively . nonetheless , some studies did not document any evidence about the correlation of vitamin d and obesity . different factors might significantly affect vitamin d level , e.g. , demographic variables , gender , aging , ethnicity , dietary habits , sunlight exposure , and season . vitamin d deficiency is a pandemic problem , even in sunny regions . this study aims to determine the association of serum 25(oh)d ) levels with measures of general and abdominal obesity in a nationally - representative sample of iranian adolescents . this nationwide cross - sectional study was conducted as part of the third national survey of a school - based surveillance system entitled the childhood and adolescence surveillance and prevention of adult noncommunicable disease - iii study . after explanation of the study aims and methods , verbal assent was obtained from students and written informed consent from their parents . this sub - study was conducted in 2009 - 2010 among 1090 students , aged from 10 to 18 years . they were selected by random cluster sampling from urban and rural areas of 27 provinces in iran . trained health professionals conducted the physical examination under standard protocols and by using calibrated instruments . height ( ht ) and weight ( wt ) were measured , by trained research assistants , according to standardized protocols , without shoes and with light clothing to the nearest 0.1 unit of measure ( cm for height and kg for weight ) . body mass index ( bmi ) was calculated as weight ( kg ) divided by height squared ( m ) . waist circumference ( wc ) was measured over the skin , midway between the lower border of the rib margin and the iliac crest at the end of the normal expiration , to the nearest 0.1 cm . waist - to - height ratio was calculated by dividing wc ( cm ) to ht ( cm ) , and levels greater than 0.5 were considered as abdominal obesity . serum concentration of 25(oh)d was analyzed quantitatively by direct competitive immunoassay chemiluminescence method using liason 25 oh vitamin d assay total ( diasorin , inc . ) , with a coefficient of variation of 9.8% . serum 25(oh)d level of < 10 ng / ml was considered as vitamin d deficiency and levels between 10 and 30 ng / ml as vitamin d insufficiency . continuous variables are expressed as mean ( standard deviation ) and categorical variables are presented as number ( percentage ) . the values of vitamin d are presented as median and interquartile range ( iqr ) . association between continuous and categorical variables with sex was assessed using t - test and chi - square test , respectively . the median value of vitamin d between sexes was compared using mann - whitney u - test . association between vitamin d status with bmi levels and abdominal obesity was assessed using chi - square test . multivariate linear regression was used to assess association of vitamin d status ( as categorical variable ) and vitamin d concentration ( as continuous variable ) with anthropometric measures ( bmi and wc ) after adjusting for age , sex , and living area . multivariate logistic regression was used to examine the association of vitamin d status ( as categorical variable ) and vitamin d concentration ( as continuous variable ) with generalized and abdominal obesity after adjusting for age , sex , and living area . this nationwide cross - sectional study was conducted as part of the third national survey of a school - based surveillance system entitled the childhood and adolescence surveillance and prevention of adult noncommunicable disease - iii study . after explanation of the study aims and methods , verbal assent was obtained from students and written informed consent from their parents . this sub - study was conducted in 2009 - 2010 among 1090 students , aged from 10 to 18 years . they were selected by random cluster sampling from urban and rural areas of 27 provinces in iran . trained health professionals conducted the physical examination under standard protocols and by using calibrated instruments . height ( ht ) and weight ( wt ) were measured , by trained research assistants , according to standardized protocols , without shoes and with light clothing to the nearest 0.1 unit of measure ( cm for height and kg for weight ) . body mass index ( bmi ) was calculated as weight ( kg ) divided by height squared ( m ) . waist circumference ( wc ) was measured over the skin , midway between the lower border of the rib margin and the iliac crest at the end of the normal expiration , to the nearest 0.1 cm . waist - to - height ratio was calculated by dividing wc ( cm ) to ht ( cm ) , and levels greater than 0.5 were considered as abdominal obesity . serum concentration of 25(oh)d was analyzed quantitatively by direct competitive immunoassay chemiluminescence method using liason 25 oh vitamin d assay total ( diasorin , inc . ) , with a coefficient of variation of 9.8% . serum 25(oh)d level of < 10 ng / ml was considered as vitamin d deficiency and levels between 10 and 30 ng / ml as vitamin d insufficiency . continuous variables are expressed as mean ( standard deviation ) and categorical variables are presented as number ( percentage ) . the values of vitamin d are presented as median and interquartile range ( iqr ) . association between continuous and categorical variables with sex was assessed using t - test and chi - square test , respectively . the median value of vitamin d between sexes was compared using mann - whitney u - test . association between vitamin d status with bmi levels and abdominal obesity was assessed using chi - square test . multivariate linear regression was used to assess association of vitamin d status ( as categorical variable ) and vitamin d concentration ( as continuous variable ) with anthropometric measures ( bmi and wc ) after adjusting for age , sex , and living area . multivariate logistic regression was used to examine the association of vitamin d status ( as categorical variable ) and vitamin d concentration ( as continuous variable ) with generalized and abdominal obesity after adjusting for age , sex , and living area . study participants consisted of 1090 adolescents with a mean age , bmi , and wc of 14.7 ( 2.6 ) years , 19.3 ( 4.2 ) kg / m and 67.82 ( 12.23 ) cm , respectively . the median serum 25(oh)d was 13.0 ng / ml ( iqr : ( 20.6 ) . overall , 40% of participants were vitamin d deficient and 38.9% were vitamin d insufficient . the demographic characteristics , anthropometric measures , and vitamin d status of study participants according to sex are presented in table 1 . overweight and generalized obesity were significantly more prevalent in boys compare to girls , while no association was found between sex and abdominal obesity . the association of bmi levels and abdominal obesity with vitamin d status is presented in table 2 . it shows that no association was observed between bmi level and abdominal obesity with vitamin d status . table 3 shows -coefficients ( se ) for wc and bmi by vitamin d status and vitamin d concentration . as presented in this table , there was neither not significant association between the vitamin d concentration ( as a continuous variable ) nor the vitamin d status ( as categorical variable ) with wc and bmi . the association of vitamin d status and vitamin d concentration with generalized and abdominal obesity in multivariate logistic regression is presented in table 4 . it shows that the association between vitamin d with generalized and abdominal obesity in both sexes and whole population was not statistically significant . distribution of demographic characteristics , anthropometric measures , and vitamin d status by sex : the caspian - iii study relationship of categorical bmi and abdominal obesity with serum 25(oh)d association between vitamin d concentration and vitamin d status with bmi and wc according to sex and in the whole population : the caspian - iii study association between vitamin d concentration and vitamin d status with generalized and abdominal obesity according to sex : the caspian - iii study we did not document significant association between serum 25(oh)d levels and measures of general and abdominal obesity . our findings are consistent with the study of nesby - odell et al . and kamycheva et al . however , it is demonstrated that vitamin d could significantly induce both in vitro and in vivo lipogenesis . it is documented that obese individuals have significantly higher vitamin d levels than their other counterparts . furthermore , 25(oh)d and intracellular ca are considered as causative factors for lipogenesis and inhibition of lipolysis . on the other hand , some other studies showed an inverse correlation between the levels of 25(oh)d and obesity . for instance , parikh et al . found that vitamin d levels in obese individuals were 23% lower than others . therefore , it is presumed that vitamin d would be probably diminished due to its entrapment in fatty masses . furthermore , wong et al . found that the alteration of gene expression encoding vitamin d regulation in mice induces both basic metabolism and beta oxidation reduction . the discrepancies between the results of different studies are based on the assumption that different methods for vitamin d measurement ( such as radio receptor assay , radioimmunoassay , and chemiluminescence ) would result in various findings . moreover , other factors as sample size , climate circumstances , nutritional patterns , environmental conditions , and lifestyle habits might contribute in the diverse results of the previous studies . the main limitation of this study is its cross - sectional design , which limits the causal relationship of variables . furthermore , single blood sampling for every individual was another limitation . the strengths of this study were its nationwide coverage , the large sample size , and including participants from different parts of the country with various lifestyle habits and environmental conditions . the main limitation of this study is its cross - sectional design , which limits the causal relationship of variables . furthermore , single blood sampling for every individual was another limitation . the strengths of this study were its nationwide coverage , the large sample size , and including participants from different parts of the country with various lifestyle habits and environmental conditions . this finding may be , at least in part , because of considerably high prevalence of hypovitaminosis d in the study population . mq contributed in the study design , statistical analysis , drafting , and revising the manuscript . mem contributed in the study design and conduct , drafting , and revising the manuscript . mk contributed in the study design , drafting , and revising the manuscript ga contributed in the study design and conduct , drafting , and revising the manuscript . rk was the study pi , contributed in the study design , drafting , and revising the manuscript . | background : this study aimed to determine the association of serum 25-hydroxy vitamin d ( 25(oh)d ) levels with measures of general and abdominal obesity in iranian adolescents.materials and methods : this nationwide cross - sectional study was conducted among 1090 students , aged 10 - 18 years , living in 27 provinces in iran .
serum concentration of 25(oh)d was analyzed quantitatively by direct competitive immunoassay chemiluminescence method .
body mass index ( bmi ) and waist - to - height ratio ( whtr ) were considered as measures of generalized and abdominal obesity , respectively.results:study participants consisted of 1090 adolescents ( 51.9% boy and 67.1% urban residents ) with mean age , bmi , and waist circumference of 14.7 ( 2.6 ) years , 19.3 ( 4.2 ) kg / m2 , and 67.82 ( 12.23 ) cm , respectively .
the median serum 25(oh)d was 13.0 ng / ml ( interquartile range : 20.6 ) .
overall , 40% of participants were vitamin d deficient , and 39% were vitamin d insufficient .
serum 25(oh)d level was not associated with bmi and whtr.conclusion:we did not document any significant association between serum 25(oh)d level and anthropometric measures in adolescents .
this finding may be because of considerably high prevalence of hypovitaminosis d in the study population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
anterior inferior cerebellar artery ( aica ) aneurysms account for less than 1.0% of all intracranial aneurysms , and distal aica aneurysms are even more rare and constitute only about 0.1% . most aica aneurysms are found after rupture , and in such situations , it is not always easy to detect the presence of thrombus in the dome preoperatively from computed tomography ( ct ) and digital subtraction angiography ( dsa ) findings . in the presence of intra - aneurysmal thrombus , neck clipping of the aneurysm sometimes becomes difficult , necessitating an alternative treatment strategy such as trapping . we report two rare cases of ruptured partially thrombosed distal aicaposterior inferior cerebellar artery ( pica ) variant aneurysms , in one of which , preservation of the occipital artery ( oa ) as a donor artery for revascularization was helpful in avoiding ischemic complications . head ct showed the presence of subarachnoid hemorrhage distributed dominantly in the posterior fossa and clot packing the fourth ventricle ( fig . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 2-mm saccular aneurysm on the distal portion of the left aica , which was also supplying the distribution of the pica ( fig . general anesthesia , left lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . after dural incision , the facial , vestibulocochlear , and lower cranial nerves were identified , and the aneurysm was exposed , which was partially thrombosed and much larger ( 10 mm in diameter ) than noted on preoperative dsa . the neck of the aneurysm was clipped successfully , and there developed no ischemic lesion in the distribution of the parent artery ( figs . acomputed tomography scan ( ct ) on admission showing subarachnoid hemorrhage distributing dominantly in the posterior fossa associated with clot packing the fourth ventricle . bleft vertebral angiograms : ( 1 ) anteroposterior view , ( 2 ) lateral view , and ( 3 ) right anterior oblique view demonstrating a 2-mm saccular aneurysm ( arrow ) on the distal portion of the left anterior inferior cerebellar arteryposterior inferior cerebellar artery variant . cintraoperative photograph showing the neck of the aneurysm ( arrow ) . * : left lower cranial nerves . dpostoperative three - dimensional computed tomographic angiography demonstrating obliteration of the aneurysm ( arrow ) with a patent parent artery . his gcs score was e3v5m6 , and he had mild right hemiparesis , mild right facial paralysis , right abducens nerve palsy , and dysarthria . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 4-mm saccular aneurysm on the distal portion of the right aica , which was also supplying the distribution of the pica ( fig . right lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . the aneurysm was partially thrombosed and much larger ( 13 mm in diameter ) than noted on the preoperative dsa . because of thrombus , the neck of the aneurysm was hard and not amenable to clipping . therefore , an oaaica anastomosis was performed , and the aneurysm was trapped ( fig . postoperative magnetic resonance imaging demonstrated the thrombosed aneurysm clearly in the right cerebellomedullary cistern and absence of ischemic lesions in the cerebellum ( fig . 2e ) . in the subacute period , his right hemiparesis showed some improvement and his right abducens nerve palsy remained unchanged , so he was transferred to a rehabilitation hospital with his modified rankin scale score of 3 . b(1 ) right vertebral angiogram , anteroposterior view , showing that the right anterior inferior cerebellar artery ( aica ) is an aicaposterior inferior cerebellar artery variant ; ( 2 ) left vertebral angiogram , anteroposterior view , demonstrating a 4-mm saccular aneurysm ( arrow ) on the distal portion of the right aica . cintraoperative schema showing anatomical location and appearance of the aneurysm ; the aneurysm was partially thrombosed and its diameter was about 13 mm . dpostoperative magnetic resonance images ; ( 1 ) t2-weighted image showing the real size of the thrombosed aneurysm ( arrow ) . head ct showed the presence of subarachnoid hemorrhage distributed dominantly in the posterior fossa and clot packing the fourth ventricle ( fig . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 2-mm saccular aneurysm on the distal portion of the left aica , which was also supplying the distribution of the pica ( fig . general anesthesia , left lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . after dural incision , the facial , vestibulocochlear , and lower cranial nerves were identified , and the aneurysm was exposed , which was partially thrombosed and much larger ( 10 mm in diameter ) than noted on preoperative dsa . the neck of the aneurysm was clipped successfully , and there developed no ischemic lesion in the distribution of the parent artery ( figs . acomputed tomography scan ( ct ) on admission showing subarachnoid hemorrhage distributing dominantly in the posterior fossa associated with clot packing the fourth ventricle . bleft vertebral angiograms : ( 1 ) anteroposterior view , ( 2 ) lateral view , and ( 3 ) right anterior oblique view demonstrating a 2-mm saccular aneurysm ( arrow ) on the distal portion of the left anterior inferior cerebellar arteryposterior inferior cerebellar artery variant . cintraoperative photograph showing the neck of the aneurysm ( arrow ) . * : left lower cranial nerves . dpostoperative three - dimensional computed tomographic angiography demonstrating obliteration of the aneurysm ( arrow ) with a patent parent artery . a 62-year - old man presented with occipital headache and nausea . on admission , his gcs score was e3v5m6 , and he had mild right hemiparesis , mild right facial paralysis , right abducens nerve palsy , and dysarthria . dsa was performed , and left vertebral angiogram showed a hypoplastic pica and a 4-mm saccular aneurysm on the distal portion of the right aica , which was also supplying the distribution of the pica ( fig . right lateral suboccipital craniotomy was performed following a hockey stick - shaped skin incision . the aneurysm was partially thrombosed and much larger ( 13 mm in diameter ) than noted on the preoperative dsa . because of thrombus , the neck of the aneurysm was hard and not amenable to clipping . therefore , an oaaica anastomosis was performed , and the aneurysm was trapped ( fig . postoperative magnetic resonance imaging demonstrated the thrombosed aneurysm clearly in the right cerebellomedullary cistern and absence of ischemic lesions in the cerebellum ( fig . his right hemiparesis showed some improvement and his right abducens nerve palsy remained unchanged , so he was transferred to a rehabilitation hospital with his modified rankin scale score of 3 . b(1 ) right vertebral angiogram , anteroposterior view , showing that the right anterior inferior cerebellar artery ( aica ) is an aicaposterior inferior cerebellar artery variant ; ( 2 ) left vertebral angiogram , anteroposterior view , demonstrating a 4-mm saccular aneurysm ( arrow ) on the distal portion of the right aica . cintraoperative schema showing anatomical location and appearance of the aneurysm ; the aneurysm was partially thrombosed and its diameter was about 13 mm . dpostoperative magnetic resonance images ; ( 1 ) t2-weighted image showing the real size of the thrombosed aneurysm ( arrow ) . most aica aneurysms are located at the proximal portion , and distal aica aneurysms are very rare , constituting only about 0.1% . to the best of our knowledge , only a few partially thrombosed distal aica aneurysms have been reported in the english literature ( table 1 ) . most aica aneurysms are found after rupture . in cases of non - ruptured aica aneurysms , patients present with headache , facial hypesthesia , trigeminal neuralgia , hearing disorder , or facial paralysis , and an intrameatal aneurysm may be diagnosed as a tumor involving the internal auditory canal preoperatively . reported cases of partially thrombosed anterior inferior cerebellar artery aneurysms aica : anterior inferior cerebellar artery , n.a . : not available , oa : occipital artery aica aneurysms have been treated by microsurgery , endovascular therapy , or a combination of the two . occlusion of the aica may lead to ataxia , nystagmus , dysarthria , trigeminal sensory impairment , lateral gaze palsy , facial palsy , hearing loss , and motor weakness . on the other hand , some authors have reported that therapeutic occlusion of the aica resulted in no deficits . factors affecting these neurological outcomes include the site of parent artery occlusion , the volume of blood supply from the collateral circulation , and involvement of nerve - related branches such as the labyrinthine artery , the recurrent perforating arteries , and the subarcuate artery . for example , if the lesion is located distal to the meatal loop or a supplementary aica is present , hearing preservation may be possible after occlusion of the affected site . it has been reported that the size of the infarcted area due to aica occlusion is inversely related to the sizes of the pica and superior cerebellar artery . in both of our cases , ruptured aneurysms were located in the distal portion of the aicapica variant , suggesting preservation of the parent artery was necessary to avoid serious cerebellar infarction . as in case 2 , it is sometimes difficult to place a clip appropriately across the neck of a partially thrombosed aneurysm . in such a case , trapping of the aneurysm with an oaaica anastomosis trapping of aica aneurysms or dissection in combination with oaaica anastomosis has been reported by several authors . another option for revascularization of the aica is aneurysm excision with end - to - end anastomosis of the aica . depending on the situation , the former may be easier than the latter because of a more shallow site of anastomosis . we also think that building a good anastomosis may have an advantage to maintain enough distal tissue circulation in case of vasospasm in the proximal portion of the parent artery . neurological deficits at the time of discharge in case 2 were mostly related to the first impact of hemorrhage . in conclusion , when treating aicapica variant aneurysms surgically , it is safer to preserve enough length of the oa in a hockey stick - shaped musculocutaneous flap as a donor for oaaica anastomosis in case of partially thrombosed aneurysms that necessitate trapping for obliteration . the authors have no personal , financial , or institutional interest in any of the drugs , materials , or devices presented in this article . all authors who are members of the japan neurosurgical society ( jns ) have registered online using the self - reported coi disclosure statement forms through the website for jns members . | abstractaneurysms arising from the distal anterior inferior cerebellar artery ( aica ) are very rare . when the parent artery is an aicaposterior inferior cerebellar artery ( pica ) variant , occlusion of the artery , even distal to the meatal loop , leads to a significant area of cerebellar infarction .
we report two cases of ruptured partially thrombosed distal aica aneurysms . in both cases ,
the parent artery was an aicapica variant .
the aneurysms were clipped in one case and trapped following occipital artery ( oa)aica anastomosis in another case .
it is important to keep the oa as a donor artery for revascularization in the treatment of the aicapica variant aneurysms , especially when the absence of intra - aneurysmal thrombus is not comfirmed preoperatively . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mechanism of action of rapamycin : intracellularly rapamycin binds to fkbp12 protein and binds to mtorc1 thereby inhibiting its downstream pathway . protein products of tsc 1 and tsc 2 gene i.e. hamartin and tuberin inhibits the functioning of mtorc1 pathway via rheb protein and thus mutation of these tsc proteins causes constitutive activation of mtor pathway leading to cellular proliferation rapamycin belongs to the class of macrocyclic immunosuppressive drugs that are active only when bound to immunophilins . cyclosporine and tacrolimus ( fk506 ) are other members who also act via binding to immunophilins . intracellularly , rapamycin binds to fkbp12 ( fk binding protein 12 kda ) , an immunophilin and forms a complex fkbp12-rapamycin . mtor possess a binding domain portion called fkbp12-rapamycin binding domain ( frb ) . after binding to frb domain of mtor protein , fkbp12-rapamycin complex potently inhibits the activity of mtorc1 complex via autophosphorylation and dissociation of mtorc1 complex and thus blocking the binding of mtor to its substrates . inhibition of mtor pathway blocks cytokine - driven t - cell proliferation by inhibiting the progression from the g1 to the s phase of the cell cycle , thus explaining its role in immunosuppression . currently , the only fda approved indication for rapamycin is to prevent organ rejection after transplant surgery . off - label indications include topical treatment of facial angiofibromas systemic treatment for renal angiomyolipoma lymphangioleiomyomatosis . brain tumors associated with tuberous sclerosis and for chemotherapy of various malignancies ( renal and hepatocellular cancer and mantle cell lymphomas ) . other conditions where rapamycin has been used are kaposi sarcoma , psoriasis and lichen planus . congeners of rapamycin have been developed with better pharmacokinetic properties i.e temsirolimus ( cci-779 ) , everolimus ( rad001 ) and ridaforolimus ( ap23573 ) and are collectively known as rapalogs . currently rapamycin ( sirolimus ) is available in the market in two formulations : rapamune oral solution ( 60 mg per 60ml in an amber colored bottle ) and rapamune tablet available in 1 mg ( white triangular - shaped tablet ) and 2 mg ( yellow - to - beige triangular - shaped tablet ) strength . oral solution needs to be kept at cold temperature of 2 - 8 centigrade . angiofibromas shows prominent vascular component owing to increased expression of angiogenic factors like vascular endothelial growth factor ( vegf ) and mtor overactivation that promotes angiogenesis as discussed earlier . inhibition of mtor pathway decreases the output of vegf by inhibiting hypoxia - inducible factor ( hif ) expression and by directly repressing vegf - stimulated endothelial cell proliferation . facial angiofibromas are a chief cause of concern among the patients having tsc owing to unsightly appearance of facial papules . various investigators have used different concentrations of topical rapamycin for the management of facial angiofibromas [ table 1 ] . topical rapamycin used for treatment of facial angiofibromas irritation and burning sensation is the most common side effect seen after topical rapamycin . patients should be prescribed topical hydrocortisone 0.1% cream or desonide 0.05% lotion along with liberal emollients to counteract any irritation and ensure compliance . it is practical to use commercially available oral solution of rapamycin ( 1 mg / ml ) as a topical formulation since compounding pharmacies are not always readily accessible and the stability and efficacy of compounded preparation can not be ensured . the major limiting factor in prescribing topical rapamycin is the high cost of the medication . haemel et al . compounded topical rapamycin from crushed rapamycin tablet into a 30 ml of 1% ointment and it priced about $ 3000 . topical rapamycin can be safely prescribed in children in whom angiofibromas are still in the growing phase . patients receiving rapamycin therapy should avoid taking grapefruit juice as it inhibits the metabolism of rapamycin akin to cyclosporine . if facilities are available , trough drug levels should be monitored by chromatographic and immunoassay methodologies . more robust studies are required to evaluate the extent of systemic absorption of topically applied rapamycin and to determine the safety of topically administered rapamycin . mechanism of action of rapamycin : intracellularly rapamycin binds to fkbp12 protein and binds to mtorc1 thereby inhibiting its downstream pathway . protein products of tsc 1 and tsc 2 gene i.e. hamartin and tuberin inhibits the functioning of mtorc1 pathway via rheb protein and thus mutation of these tsc proteins causes constitutive activation of mtor pathway leading to cellular proliferation rapamycin belongs to the class of macrocyclic immunosuppressive drugs that are active only when bound to immunophilins . cyclosporine and tacrolimus ( fk506 ) are other members who also act via binding to immunophilins . intracellularly , rapamycin binds to fkbp12 ( fk binding protein 12 kda ) , an immunophilin and forms a complex fkbp12-rapamycin . mtor possess a binding domain portion called fkbp12-rapamycin binding domain ( frb ) . after binding to frb domain of mtor protein , fkbp12-rapamycin complex potently inhibits the activity of mtorc1 complex via autophosphorylation and dissociation of mtorc1 complex and thus blocking the binding of mtor to its substrates . inhibition of mtor pathway blocks cytokine - driven t - cell proliferation by inhibiting the progression from the g1 to the s phase of the cell cycle , thus explaining its role in immunosuppression . currently , the only fda approved indication for rapamycin is to prevent organ rejection after transplant surgery . off - label indications include topical treatment of facial angiofibromas systemic treatment for renal angiomyolipoma lymphangioleiomyomatosis . brain tumors associated with tuberous sclerosis and for chemotherapy of various malignancies ( renal and hepatocellular cancer and mantle cell lymphomas ) . other conditions where rapamycin has been used are kaposi sarcoma , psoriasis and lichen planus . congeners of rapamycin have been developed with better pharmacokinetic properties i.e temsirolimus ( cci-779 ) , everolimus ( rad001 ) and ridaforolimus ( ap23573 ) and are collectively known as rapalogs . currently rapamycin ( sirolimus ) is available in the market in two formulations : rapamune oral solution ( 60 mg per 60ml in an amber colored bottle ) and rapamune tablet available in 1 mg ( white triangular - shaped tablet ) and 2 mg ( yellow - to - beige triangular - shaped tablet ) strength . oral solution needs to be kept at cold temperature of 2 - 8 centigrade . angiofibromas shows prominent vascular component owing to increased expression of angiogenic factors like vascular endothelial growth factor ( vegf ) and mtor overactivation that promotes angiogenesis as discussed earlier . inhibition of mtor pathway decreases the output of vegf by inhibiting hypoxia - inducible factor ( hif ) expression and by directly repressing vegf - stimulated endothelial cell proliferation . facial angiofibromas are a chief cause of concern among the patients having tsc owing to unsightly appearance of facial papules . various investigators have used different concentrations of topical rapamycin for the management of facial angiofibromas [ table 1 ] . topical rapamycin used for treatment of facial angiofibromas irritation and burning sensation is the most common side effect seen after topical rapamycin . patients should be prescribed topical hydrocortisone 0.1% cream or desonide 0.05% lotion along with liberal emollients to counteract any irritation and ensure compliance . it is practical to use commercially available oral solution of rapamycin ( 1 mg / ml ) as a topical formulation since compounding pharmacies are not always readily accessible and the stability and efficacy of compounded preparation can not be ensured . the major limiting factor in prescribing topical rapamycin is the high cost of the medication . compounded topical rapamycin from crushed rapamycin tablet into a 30 ml of 1% ointment and it priced about $ 3000 . topical rapamycin can be safely prescribed in children in whom angiofibromas are still in the growing phase . patients receiving rapamycin therapy should avoid taking grapefruit juice as it inhibits the metabolism of rapamycin akin to cyclosporine . if facilities are available , trough drug levels should be monitored by chromatographic and immunoassay methodologies . however , whether this applies to topical rapamycin therapy needs to evaluated . more robust studies are required to evaluate the extent of systemic absorption of topically applied rapamycin and to determine the safety of topically administered rapamycin . topical rapamycin appears to be a promising and effective way of treating facial angiofibromas which are cosmetically disfiguring in patients with tsc . topical rapamycin needs to be studied in a larger cohort of subjects to determine the duration and frequency of application . the major disadvantage is the cost of therapy which is prohibitively expensive at the present date in our resource poor setting . | rapamycin ( sirolimus ) is a fungal fermentation product that inhibits the proper functioning of a serine / threonine protein kinase in mammalian cells eponymously named mammalian target of rapamycin , or mtor .
rapamycin is a novel class of anticancer and immunosuppressant drugs targeting the proteins at molecular level .
rapamycin ( sirolimus ) is routinely incorporated in drug - eluting stents used for cardiac angioplasty . in recent years , rapamycin was found to be efficacious in managing the symptom complex of tuberous sclerosis , i.e. renal angiomyolipoma , giant cell astrocytoma and pulmonary lymphangiomyomatosis .
various investigators have also proved that topically applied rapamycin causes regression of facial angiofibromas , giving better cosmetic results . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
posttransplant lymphoproliferative disorders ( ptld ) are among the most dangerous and potentially fatal complications after transplantation . with the cumulative incidence of 13% in the first five years after renal transplantation , they are among the most common malignancies complicating solid organ transplantation 1 . ptld are lymphoid and/or plasmatic proliferations , which develop under the condition of continuous immunosuppression and consequently decreased t - cell surveillance and are in most cases related to an epstein - barr virus infection 2 . the management of ptld varies significantly according to the type and site of the presenting disease , ranging from reducing immunosuppression to administration of rituximab , chemotherapy or radiotherapy , or a combination of all of these . the prevalence of ptld in central nervous system ( cns ) is 27% 3 , thus cns is an uncommon site of ptld , particularly when appearing as a first manifestation site , and its diagnosis and treatment are difficult 4 . the administration of high - dose methotrexate ( hdmtx ) is an established therapy for patients with primary central nervous system lymphoma 5 . there is also evidence showing the effectiveness of hdmtx in transplanted patients with ptld 6 . hdmtx can be administered safely in patients with normal renal function inducing vigorous hydration and alkalinization of the urine as well as the use of leukovorine rescue to prevent a potentially lethal mtx toxicity 7 . renal excretion is the main way of mtx clearance 8 , thus , an impaired kidney function delays the excretion of mtx resulting in a marked increase in toxicity , in particular , bone marrow toxicity , which could be fatal for the patient . this consideration limits the use of hdmtx in patients with an impaired kidney function . in our case report , we describe the successful use of high - flux hemodialysis ( hfhd ) for add - on clearance of mtx after administering hdmtx to a patient with a cerebral manifestation of ptld and a preexisting impaired function of a renal transplant . a 26-year - old male patient ( height : 180 cm ; weight : 74 kg ) was admitted to the local hospital in march 2013 because of a new - onset headache and blurred vision . he received a kidney transplant in 1997 because of an end - stage kidney disease of unknown origin since 1989 . immunosuppression on admission consisted of mycofenolate sodium 720 mg bid and methylprednisolone 4 mg qd . the estimated glomerular filtration rate ( egfr ) was 35.9 ml / min/1.73 qm according to ckd - epi equation with a proteinuria of 117 mg / d , corresponding to chronic kidney transplant disease stage 3ba1 according to kdigo classification . the reasons for established chronic transplant nephropathy were status post vascular rejection 1997 and chronic calcineurin - inhibitor toxicity . several contrast - enhancing intracerebral lesions with perifocal edema were seen on cranial ct- and mri scans . a methylprednisolone therapy was stopped and dexamethasone was administered to reduce the brain edema . the patient was transmitted to the university department of nephrology and , after an initial evaluation , to the department of neurosurgery for confirming the diagnosis of suspected brain lymphoma through a brain biopsy . histologically , the diagnosis of cerebral ptld ( diffuse large b - cell lymphoma positive for ebstein - barr virus ) was established . no additional manifestations of lymphoma were evident in a ct scan of the thorax , abdomen sonography , and bone marrow biopsy . after an initial chemotherapy regime ( five cycles high - dose cytarabin [ 3 g / qm ] und rituximab [ 375 mg / qm ] intravenous ) , an mri scan confirmed complete remission of ptld . however , the impairment of the transplant function aggravated ( egfr 25.4 ml / min/1.73 qm , ckd - epi equation ) . in august september 2013 cytomegalovirus ( cmv ) reactivated and pneumocystis jirovecii pneumonia occurred , so the chemotherapy was changed to rituximab only in higher dose ( 500 mg / qm ) and the patient received antiviral and antibiotic therapy . the dose of mycofenolate sodium was tapered to 360 mg bid because of sustained leukopenia and infections . in december 2013 the patient received intravenous hdmtx ( 4 g / m)/leukovorine ( 30 mg / m ) , and rituximab ( 500 mg / m ) under vigorous hydration . the baseline kidney transplant function was still markedly reduced without any evidence of acute kidney injury and thus the hdmtx therapy was administered under supportive hfhd . dialysis procedures started 24 h after administration of hdmtx until mtx - level in serum was no longer measurable . a nadir of leucocytes of 1.11/nl occurred 10 days after hdmtx - use but did not require administration of granulocytes colony - stimulating factor . on the thirteenth day after the administration of the chemotherapy the patient developed severe cmv- and e.coli pneumonia with consecutive sepsis and acute kidney transplant failure requiring transmission to an intensive care unit and invasive ventilation . the sepsis was successfully managed with discontinuation of mycofenolate sodium and administering of antiviral and antibiotic therapy . the follow up cerebral mri scan ( january 2014 ) showed only a small regredience of ptld and because of the life - threating septic event after chemotherapy the only remaining opportunity of cerebral radiation was offered to the patient . the data collection of dialysis parameters , mtx - level measurements and details on mtx administration were performed according to the proposed methodology from the guidelines for reporting case studies on extracorporeal treatments in poisonings 9 . all dialysis procedures were performed with a gambro machine ak 200 with high - flux dialyser ( polyflux 170h ) and dialysate selectbag one ax 450 g ( potassium 4 mmol / l , calcium 1.50 mmol / l , glucose 1.0 the dialysate flow was 500 ml / min and the blood flow was 250 ml / min . the first dialysis session was conducted 24 h after administration of hdmtx , the second after 36 h , the third after 48 h , and the fourth after 72 h. measurements of mtx - level were introduced in serum with fluorescence polarization immunoassay on the tdx analyser ( fa . in this report , we demonstrated a case of successful hdmtx use without development of severe bone marrow toxicity and acute kidney failure in a patient with an impaired kidney function , using a supportive hdhf ( figure 1 ) . ( a ) changes in methotrexate ( mtx ) level and leucocytes ( leu ) and ( b ) changes in mtx level and estimated glomerular filtration rate ( egfr ) during high - flux haemodialysis sessions ( hd ) ; high - dosis mtx was administered on 12 december 2013 ; 1- first hd session ; 2- second and third hd session ; 3- fourth hd session . renal impairment appears to be one of the most important risk factors for mtx toxicity giving already low - dose mtx 10 . more than 90% of mtx are cleared by the kidneys through glomerular filtration and proximal tubular secretion . thus , impaired kidney function causes sustained elevated plasma mtx concentrations , which in turn may lead to increased hematological toxicity . mtx can also lead to an acute renal dysfunction , which is believed to be mediated through the precipitation of mtx and its metabolites in the renal tubules or by a direct toxicity of mtx on the renal tubules 11 . consequently , the therapy with hdmtx has traditionally been avoided or used with great caution in patients with impaired renal function . our patient suffered a recurrence of his ptld after a first modality of the chemotherapy , so the switch to hdmtx therapy was necessary despite the sustained impaired kidney function , given that hdmtx is an established therapy of central nervous system lymphoma with studies demonstrating its superiority over radiation or chemotherapy regimes without hdmtx 12 . in order to prevent mtx toxicity in the patient with significantly impaired baseline kidney function hfhd was arranged for add - on mtx elimination in addition to vigorous hydration and alkalinization of the urine and leucovorin rescue . mtx is a small molecule ( 454 kd ) and thus dialysis - based methods would be feasible for mtx clearance . however , approximately 50% of mtx is protein bound and the substance has a large distribution volume 11,13 , making dialysis a possible but not a perfect method to clear mtx . nevertheless , a successful elimination of mtx was described for different modalities of renal replacement therapy such as hemodialysis , hemodiafiltration , charcoal hemoperfusion / hemofiltration with majority of evidence favoring hfhd 13,14 . to our knowledge , there are only several case reports describing the successful use of hfhd for mtx elimination , including , thus far , either patients with preliminary normal kidney function and acute kidney failure following hdmtx use and requiring dialysis or patients with end - stage renal disease already on dialysis 1518 . we noted a successful elimination of mtx after only several dialysis sessions in our patient without a significant rebound of mtx level after the dialysis was finished . though the measured mtx - levels at 24 , 48 , and 72 h were highly predictive for greater risk of nephrotoxicity 13 , no changes in the estimated glomerular filtration rate occurred after termination of the dialysis ( figure 1 ) . with the support of hfhd , the hematological toxicities were limited : the level of leucocytes dropped to 1.1/nl but the patient did not require any granulocyte colony - stimulating factor ; preexisting anemia did not impair significantly , and no changes in the number of thrombocytes occurred . it is noteworthy that our patient had already a preexisting cmv - colonization and had developed frequent relapses of cmv - activation in the past , so he was at a high risk of a new cmv reactivation . substantial additional risk factors such as posttransplant immunosuppressive therapy , impaired kidney function , and rituximab could also have contributed to the development of the infection . this case is unique as we used hdmtx in a patient with a preliminary significantly impaired kidney function but not on dialysis for the first time and showed a feasibility of administering hdmtx in such patients using add - on hfhd for mtx clearance without any major hematological toxicity and without an onset of an acute on chronic kidney failure . this case underpins the limited evidence of a successful elimination of mtx with hfhd , though the administration of hdmtx did not achieve a remission of ptld in this particular patient . we used hdmtx as an ultima ratio , as it was the last chemotherapy option for the recurrent ptld . as demonstrated in our report , an administration of hdmtx is also possible in a transplant kidney with already preliminary impaired function . however , it should be considered that such patients have other comorbidities , which limit their tolerance of an aggressive therapy . the question about the right time to start the dialysis after hdmtx administration and appropriate duration of dialysis sessions is still not answered conclusively and requires further research . the results presented in this paper have not been published previously in whole or part , except in abstract format . additional supporting information may be found in the online version of this article : data s1 . | key clinical messagea young patient develops cerebral posttransplant lymphoproliferative disorder . despite concurrent significantly impaired transplant kidney function use of add - on high - flux hemodialysis for additional clearance made the administration of high - dose methotrexate feasible in this patient without occurence of acute chronic kidney failure and significant hematological toxicity . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.