text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
the fxr plays key roles in regulating bile acid metabolism ( figure 1 ) . the primary bile acids in human beings , chenodeoxycholic acid ( cdca ) and cholic acid ( ca ) , are synthesized in the liver by way of a multistep process , starting from cholesterol . the cytochrome enzyme cyp7a1 is the key regulatory step ; c4 is a marker of new bile acid synthesis measurable in serum . ca and cdca are conjugated with either glycine or taurine , and these more hydrophilic bile acids are secreted from the hepatocyte through the bile salt export protein and are stored as a component of bile in the gallbladder . upon ingestion of a meal , gallbladder contraction is induced by cholecystokinin and bile acids are released into the small intestine where they are critical for lipid digestion and absorption . in the ileum , they are reabsorbed , with approximately 95% being recovered . the molecular pathway for bile acid uptake in ileal enterocytes comprises the apical sodium - linked bile transporter ( asbt , also called ileal bile acid transporter , gene symbol slc10a2 ) , the ileal bile acid binding protein ( gene symbol fabp6 ) , and the basolateral membrane organic solute transporters and . bile acids enter the portal blood , are taken back up in the liver by the na - taurocholate co - transporting polypeptide ( slc10a1 ) , and are recycled ; a process known as enterohepatic circulation ( ehc ) . recycling of bile acids is very efficient and the daily amount of bile acids entering the intestine is 46 times that of the total bile acid pool size , with new bile acid synthesis contributing to only a small proportion of this . with each cycle of the ehc a small proportion ( 5% ) of circulating bile acids enter the colon . here , conjugated primary bile acids are metabolized by enzymes in the microbiota through deconjugation , dehydroxylation , and epimerization to form the secondary bile acids , most notably in human beings , deoxycholic acid ( dca ) from ca , and ursodeoxycholic acid and lithocholic acid ( lca ) from cdca . metabolism of bile acids by the microbiota in this way makes them more lipophilic , enabling their passive reabsorption in the colon and recirculation to the liver where they are reconjugated and re - used in the bile . in human beings , the predominant colonic bile acid is normally dca , and is present in the range of 50200 mol / l in the cecal water . however , it should be noted that considerable differences in the nature of the colonic bile acid pool exist between different species , a fact that must be taken into account when translating experimental observations from animal models into human beings . for example , in mice , muricholic acid is a major primary bile acid , and is present in the colon at concentrations similar to those of dca , but has opposing effects on fxr activation . at the molecular level , however , it is now clear that the fxr has key roles to play ( figure 1 ) . the involvement of fxr as a bile acid receptor was first recognized in 1999.13 , 14 , 15 fxr dimerizes with the retinoid x receptor , another zinc - finger dna - binding nuclear hormone receptor , and the heterodimer binds to specific bile acid response elements and regulates the transcription of many genes . this has been shown to down - regulate cyp7a1 transcription in the liver and also asbt expression in the ileum . organic solute transporter and ileal bile acid binding protein in the ileum both are transcriptionally up - regulated by fxr . the most fxr - responsive gene in human ileum is fgf19 , and the rodent orthologue is fgf15 . fgf19 is a 24-kilodalton protein , produced mainly in enterocytes , and enters the portal circulation and acts as a hormone to provide feedback inhibition in the liver to regulate new bile acid synthesis . fgf15/19 binds the fgf receptor 4 in the liver , which interacts with -klotho ( klb ) as a co - receptor . through a kinase signaling pathway , fgf15/19 inhibits the action of cyp7a1 , resulting in reduced new bile acid synthesis . this provides a feedback mechanism to ensure that if sufficient bile acids are being absorbed in the ileum , hepatic synthesis of new bile acids is inhibited . malabsorption of bile acids occurs when the normal ileal bile acid transport systems described earlier are impaired . in human beings , this is most likely to occur as a result of surgical resection of the small intestine or as a consequence of inflammation , such as that associated with crohn s disease , leading to reduced expression of asbt . inhibition of asbt function also can be induced pharmacologically by ileal bile acid transporter inhibitors , such as elobixibat , which currently are undergoing development for the treatment of patients with constipation . in patients with the primary idiopathic form of bad , the mechanism for increased colonic bile acid concentrations does not appear to be caused by impaired bile acid absorption.20 , 21 instead , ileal production and reduced serum levels of fgf19 have been shown.20 , 22 this defect results in reduced feedback inhibition of hepatic synthesis , and , consequently , overproduction of bile acids . previous human studies showing unimpaired bile acid uptake in the ileum and a larger pool size support this mechanism of disease pathogenesis . similarly , studies in mouse models , where the genes for fxr ,
fgf15 , fgfr4 , and klb were knocked out , also showed excessive bile acid synthesis and fecal bile acid loss ( reviewed by walters ) , whereas monkeys treated with antibodies to fgf19 developed severe watery diarrhea . these findings all suggest a central role for fgf19 and fxr in the pathogenesis of bad . further evidence comes from studies of human ileal biopsy specimens in short - term culture where fgf19 messenger rna expression was shown to be stimulated potently by physiological concentrations of natural bile acids . in keeping with their known potency as fxr agonists , cdca was the most potent natural fgf19 inducer , followed by ca , dca , and then lca . the semisynthetic bile acid , obeticholic acid ( oca ) , was effective at even lower concentrations , reflecting findings from other experimental models . in a prospective study , serum levels of fgf19 were confirmed to be low in patients with bad and were a reliable predictor of responses in patients with chronic diarrhea . patients with bad also were shown to have reduced fasting and bile acid stimulated levels of ileal fgf19 transcripts . together , these observations have led to the establishment of a model in which dysregulation of the fxr / fgf19 axis , leading to increased hepatic synthesis of bile acids , is the critical step in the pathogenesis of primary bad . when the ehc is functioning normally , relatively low levels of bile acids enter into the colon . mmol / l , the median concentration in the cecum is reported to be approximately 0.4 mmol / l . dca is the most prominent colonic bile acid , and is present in the colonic fluid at concentrations in the range of 0.10.2 however , in conditions of bile acid malabsorption , levels of luminal bile acids may be higher . a study from the mayo clinic showed that 24-hour fecal bile acid loss was 363 mol/24 h ( interquartile range , 194762 mol/24 h ) in healthy controls ( n = 23 ) , compared with 864 mol/24 h ( interquartile range , 4531213 mol/24 h ) in a mixed group of patients ( n = 21 ) with undefined diarrhea - predominant ibs . because bile acids in high concentrations are toxic molecules , the body must respond appropriately to such abnormally high levels in the lumen if it is to prevent mucosal damage , ulceration , and inflammation . one of the primary mechanisms by which it does so is through the induction of diarrhea . the cellular and molecular mechanisms by which increased colonic delivery of bile acids promotes fluid accumulation in the colon have been studied extensively in animal models and cultured epithelial cells . early studies in animal models have shown that the effects of bile acids are mediated by both inhibition of fluid absorption across surface enterocytes and stimulation of secretion from the crypts.30 , 31 , 32 , 33 although there is some variation in the concentration dependence by which bile acids exert their actions across different species , it is clear that in human beings such effects only occur at high pathophysiological levels.29 , 34 it also is apparent that there is a strict structure activity relationship for bile acids in inducing their cathartic effects , with only dihydroxy bile acids , such as dca and cdca , being effective.33 , 35 , 36 sulfation of bile acids abolishes their effects on fluid transport , whereas conjugated bile acids are effective only from the basolateral side of the epithelium.36 , 37 , 38 thus , the metabolizing activity of the colonic microbiota , which alters bile acids by dehydroxylation , epimerization , deconjugation , and sulfation , has important consequences for their capacity to cause diarrhea . bile acids exert their effects on colonic fluid transport through both direct and indirect actions on the epithelium . direct effects have been investigated in cultured epithelial cell lines and primary isolated colonic crypts . when cultured monolayers of crypt epithelial cells are exposed to high concentrations of bile acids , rapid ip3-mediated increases in intracellular ca result . in turn , this leads to activation of the transport proteins that drive epithelial cl secretion , the primary osmotic driving force for intestinal fluid secretion.39 , 40 , 41 furthermore , studies on isolated human colonic epithelial cells have shown that bile acids also inhibit na absorption , the main osmotic driving force for colonic fluid absorption . this effect appears to be mediated , at least partly , by ca - dependent inhibition of na / h and cl / hco3 exchangers in the apical membrane , transport proteins that constitute the pathway for electroneutral na absorption.42 , 43 in addition to their direct actions on epithelial cells , bile acids also can regulate colonic fluid transport indirectly through recruitment of cells within the underlying lamina propria . for example , studies in animal models show that luminal bile acids can trigger local neural reflexes that result in activation of secretomotor neurons that synapse directly with the epithelium . such effector nerves release transmitters , such as acetylcholine , into the neuroepithelial junction to promote cl secretion and enhance epithelial permeability.44 , 45 , 46 recruitment of these reflex arcs is initiated by activation of sensory neuroendocrine cells interspersed among the transporting enterocytes . upon activation by bile acids these cells release 5-hydroxytryptamine to stimulate afferent neurons . bile acid activation of intrinsic neural pathways also contributes to the onset of diarrhea by enhancing colonic motility , thereby increasing the speed at which its contents are expelled from the body.48 , 49 , 50 recent studies have shown that the g - protein coupled bile acid receptor tgr5 is expressed on enteroendocrine cells and the ganglia of the myenteric and submucosal plexuses where it appears to mediate bile acid induced peristalsis in the colon . bile acids also have been shown to regulate epithelial transport function indirectly through recruitment of mucosal immune cells . in particular , mast cells degranulate in response to increased levels of bile acids , resulting in the release of histamine , which then acts directly at epithelial h1 receptors to promote secretion . other mast cell mediators with well - established actions on epithelial transport , such as prostaglandins , leukotrienes , and adenosine , also are likely to be involved , although this has yet to be shown directly . it also should be noted that enteric nerves and mucosal mast cells are located in close proximity to each other within the mucosa , enabling bidirectional communication to occur between the 2 cell types in the regulation of epithelial function . this capacity for high concentrations of luminal bile acids to recruit neuroimmune pathways in the colonic mucosa serves to amplify their direct actions on epithelial cells , rapidly leading to induction of diarrhea . although high levels of colonic bile acids have long been associated with induction of diarrhea , only recently have studies from our laboratory begun to address what their role may be in regulating epithelial transport under more normal circumstances . in these studies , we found that , in contrast to their acute prosecretory actions at high concentrations , more physiologically relevant levels of bile acids exert antisecretory actions on colonic epithelial cells . thus , exposure of cultured monolayers of colonic epithelia to relatively low concentrations of either dca or cdca ( 50200 mol / l ) led to a slow - onset ( > 6 h ) decrease in their capacity to subsequently evoke secretory responses . we have proposed that such down - regulation of epithelial cl secretion by low levels of bile acids may serve a physiological role in dampening fluid secretion into the lumen , thereby promoting normal colonic absorptive function . subsequent studies have shown that the antisecretory actions of dca and cdca are mimicked by the fxr agonists gw4064 and oca . thus , activation of the fxr with either of these agonists led to a dose - dependent inhibition of subsequent ca and adenosine 3,5-cyclic monophosphate dependent cl secretory responses , both in cell culture and in ex vivo colonic tissues from mice . further studies have shown that the antisecretory actions of fxr activation are mediated by direct inhibition of key components of the cl secretory pathway . in particular , fxr activation inhibits the activity of the cystic fibrosis transmembrane conductance regulator cl channels , which are the primary exit pathway for cl across the apical membrane of the colonic epithelium . fxr activation also inhibits the activity of basolateral na / k adenosine triphosphatase pumps , but in this case reduced expression of either the catalytic or regulatory subunits of the pump does not appear to be involved . such effects of fxr agonists on the activity and expression of the transport proteins that comprise the epithelial secretory pathway suggest that these agonists have the potential for development into a new class of directly acting drugs to treat secretory diarrhea . this idea is supported by our findings that administration of gw4064 was effective in preventing luminal fluid accumulation and severity of diarrhea in 2 different models of secretory diarrhea in mice . a schematic representation summarizing how increased colonic delivery of bile acids causes bad and how this can be prevented by fxr agonists is shown in figure 2 . as described earlier , the pathogenic basis of bad has been assumed to result from a dysregulated ehc , with increased delivery of bile acids to the colon resulting from malabsorption in the ileum . this does appear to be the predominant defect occurring in crohn s disease or after ileal resection . however , excess bile acid synthesis , resulting from impaired feedback inhibition by fgf19 , is an additional pathway that also may be involved in the diarrhea associated with crohn s disease , and which is likely the predominant pathophysiology underlying primary bad . increased colonic delivery of bile acids , leading to increased fluid secretion into the lumen , is considered to be a protective mechanism by which toxic secondary bile acids , such as dca or lca , are flushed from the colon before they can cause damage to the mucosa . this hypothesis is supported by the observation that , despite the severe toxicity of bile acids , primary bad is not associated with dramatic changes in mucosal histology.56 , 57 however , as discussed earlier , in patients with an underlying pathology that causes prolonged increases in colonic bile acids , the associated symptoms of chronic diarrhea , urgency , and incontinence can impact quality of life severely . given that currently available therapies only address symptoms and often are tolerated poorly , new approaches to the treatment of bad are required urgently . based on their ability to prevent hepatic overproduction of bile acids , together with their antisecretory actions in the colon , fxr agonists have excellent therapeutic potential in this regard . currently , there are several fxr agonists at differing stages of therapeutic development for various hepatic , intestinal , and metabolic disorders ( table 1 ) . in 2016 , oca became the first member of this class of drugs to receive food and drug administration approval for clinical use in the treatment of primary biliary cholangitis . however , results from a recent phase ii clinical trial of oca in patients with bad support the idea that fxr agonists also have potential for the treatment of this disease . in a population of patients with primary bad , daily oral administration of oca ( 25 mg / kg ) significantly increased serum levels of fgf19 , decreased bile acid synthesis ( as measured by serum c4 levels ) , and improved stool form and symptoms of diarrhea . oca also was effective in some patients with secondary bile acid diarrhea caused by crohn s disease , but only in patients with relatively short ileal resections ( < 45 cm ) . importantly , symptomatic improvement was seen in 1 week and oca was well tolerated , with only minor adverse effects including a predicted change in lipids , mild headache in 11% of patients , and no reports of pruritus . these proof - of - concept studies support a future role for fxr agonists in the treatment of bad . further trials using a double - blind , placebo - controlled design with larger numbers of patients clearly are required for a more definitive assessment of long - term efficacy , both in patients with primary and secondary bad . further studies into the molecular mechanisms underlying the effects of fxr agonists also are required in both clinical and preclinical models . for example , studies of the expression and activity of epithelial transporters in patients treated with fxr agonists are necessary to define the contribution of alterations in fluid and electrolyte transport to their therapeutic actions , while at the molecular level , the mechanisms by which fxr agonists regulate transport protein function remain to be defined . also critical to our understanding of bad pathogenesis and how we can better diagnose and treat the disease is developing our understanding of changes that occur in the colonic microbiota and how these affect the make - up of the colonic bile acid pool . for example , changes in microbial populations that alter the expression of bile salt hydrolases will influence the hydrophobicity of luminal bile acids , in turn , altering their capacity to permeate the epithelium and activate fxr . conversely , activation of fxr can influence antibacterial defense mechanisms in the small intestine and colon , and drugs that act in this way would be expected to alter the make - up of microbiota significantly.59 , 60 although many of these complex studies can be addressed using animal models , it is important to bear in mind that significant interspecies differences exist , not only in how bile acids are synthesized and metabolized , but also in how they evoke intestinal responses . as research moves forward into the era of the microbiome and metabolome , there is a need for new models that will facilitate rapid translation of findings from in vitro and preclinical models into human beings . it also is likely that differences will be apparent in how patients with bad respond to different fxr agonists . it is possible that some of these drugs also may have effects at the cell surface bile acid receptor , tgr5 , and bioavailability will affect their tissue distribution and site of action . for example , similar to the naturally occurring bile acids , oca undergoes enterohepatic circulation , and therefore primarily will act in the ileum and liver , with unabsorbed drug potentially having effects in the colon . non bile acid agonists would not be accumulated into the ehc and therefore may have greater effects on the colon . for example , fexaramine , an fxr agonist that has not yet been studied in human beings , appears to have only intestinal actions and does not act systemically . in conclusion , fxr agonists are an exciting new class of drug that , in addition to the several therapeutic benefits already identified in liver diseases , have significant potential for development in treating patients with diarrheal diseases . further studies , particularly clinical trials in patients diagnosed with bad , are likely to help understand the pathogenesis of this disorder and how to better treat it , thereby benefitting a large neglected patient population . | diarrhea is a feature of several chronic intestinal disorders that are associated with increased delivery of bile acids into the colon . although the prevalence of bile acid diarrhea is high , affecting approximately 1% of the adult population , current therapies often are unsatisfactory . by virtue of its capacity to inhibit colonic epithelial fluid secretion and to down - regulate hepatic bile acid synthesis through induction of the ileal fibroblast growth factor 19 release , the nuclear bile acid receptor , farnesoid x receptor , represents a promising target for the development of new therapeutic approaches . here
, we review our current understanding of the pathophysiology of bile acid diarrhea and the current evidence supporting a role for farnesoid x receptor agonists in treatment of the disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the systems for controlled delivery
of the medicaments in the body are causing real revolution in the medicine and
pharmacy in the recent years , and all in favor of better medical treatments of
the patients . using the system for the controlled and balanced release of
medicaments , opposing to standard and conventional methods , constant and uniform concentration of medicament in the body is achieved throughout longer period of time . copolymer poly(d , l - lactide - co - glycolide ) is used for the
controlled delivery of several classes of medicaments like anticancer agents ,
anti - hypertensive agents , immunomodulatory drugs , hormones , and macromolecules
like nucleic acid , proteins , peptides , antibodies , dlplg nanospheres are very
efficient mean of transdermal transport of medicaments in the body , for
example , ascorbic acid . dlplg
polymer particles allow the encapsulation of the medicament within the polymer
matrix , where the principle requirement for the controlled and balanced release
of the medicament in the body is the particle 's ideal spherical shape and narrow distribution of its size . the size and
shape of the particles play key role in their adhesion and interaction with the
cell . dynamic of the release ( pace and concentration ) depends of the
morphology , that is , structure of the copolymer . the chemical structures ,
molecular weight , composition , as well as the synthesis conditions , are
parameters which influence the final morphology of the polymer . the direct
relation between these parameters and morphology is inadequately examined thus
making it a topic of many researches . depending on the nature and matrix of the selected
material , methods of obtaining polymer particles can be divided in general into
dispersion of the polymer solution method , polymerization of the monomer method ,
and coacervation [ 36 ] . the plga spheres obtained with emulsion process are in
range of 150200 m , 45 m , 30 m . with
modified emulsion method , further modification of the process for synthesis of the particles , that is , emulsification solvent evaporation method , the obtained particles are in nanometer scale of 570970 nm and 244260 nm [ 1214 ] . the latest researches in this field indicated the possibility of producing dlplg spheres with average diameter
under 100 nm . controlling the conditions of
obtaining dlplg by solvent / nonsolvent method , changing the parameters like
aging time , after adding nonsolvent , time and velocity of centrifugal
processing , it is possible to influence on morphology ( size and shape ) and
uniformity of dlplg polymer powder . dlplg powder with short aging time with nonsolvent and longest time and velocity of the centrifugal processing has
smallest particles and highest uniformity . dlplg
copolymer has potential to be used for transport of ascorbic acid in the body ,
thus considerably increasing its efficiency . ascorbic acid reduces free radicals , and in that way damages created by oxidative stress which is a root cause of , or at least
associated with , many diseases are minimized . the aim of this research is obtaining the
nanoparticles of copolymer poly(d , l - lactide - co - glycolide ) in which ascorbic
acid is encapsulated , as well as examining the influence of the synthesis
method on morphological characteristics of poly(d , l - lactide - co - glycolide )
particles with the different content of ascorbic acid . poly(d , l - lactide - co - glycolide )
( dlplg ) was obtained from durect , lactel , adsorbable
polymers international and
had a lactide to glycolide ratio of 50 : 50 . time of complete resorption of
this polymer is 48 weeks .
molecular weight of ascorbic acid was 176.13 g / mol . copolymer powder dlplg was obtained
by means of physical methods from commercial granules using solvent / nonsolvent
systems ( figure 1 ) . commercial granules poly(d , l - lactide - co - glycolide ) ( 0.05 g )
were dissolved in 1.5 ml of acetone and , after approximately two hours , 2 ml of
methanol was added into solvent mixture . the polymeric solution thus obtained
was very slowly poured into 20 ml of aqueous pva solution ( 0.02% w / w ) while
continuous stirring at 1200 rpm by a stirrer . pva is used
as a stabilizer which creates negative charge of the dlplg particles , that is ,
it creates negative zeta potential . by creating specific zeta potential the ascorbic acid was encapsulated into the
polymer matrix by means of homogenization of water and organic phases . the
water solution with the variable ratio of the ascorbic acid was added to the polymer
solution . this was followed by the precipitation using alcohol methanol . in the
particles of dlplg copolymer , different concentration of ascorbic acid has been
encapsulated with ratios 85% dlplg to 15% ascorbic acid , 70% dlplg to 30%
ascorbic acid , 50% dlplg to 50% ascorbic acid , and 30% dlplg to 70% ascorbic acid . the ir measurements were performed on
perkin - elmer 983 g infrared spectrophotometer , using the kbr pellet technique ,
in the frequency interval of 4004000 cm . the morphology of obtained particles
of dlplg was examined by scanning electron microscope ( sem ) jeol jsm-646olv . the powder samples for sem analysis were coated with gold using the physical
vapor deposition ( pvd ) process . samples were covered with gold ( scd 005 sputter
coater ) , using 30 ma current from the distance of 50 mm during 180 seconds . the particle size and morphology were
examined using the area analysis method [ 18 , 19 ] by semiautomatic image analyzer ( videoplan , kontron ) , connected with a scanning electron microscope ( sem ) . from 200 to 300 particles in the sem were measured and the following
parameters were determined : area section aa , perimeter lp , maximal diameter of
the particle dmax , feret x and feret y , and form factor ( fl ) ( figure 2 ) . release of the ascorbic acid from dlplg particles in vitro in physiological solution ( 0.9% sodium chloride in water ) was studied with uv spectroscopy . the uv measurements were performed on
perkin - elmer lambda 35 uv - v is spectrophotometer in the frequency interval of
200400 nm . the ir spectra in figure 3 illustrate
all characteristic groups for copolymer poly(d , l - lactide - co - glycolide ) . the ir
spectra of dlplg show peaks at 2994 , 2946 , 2840 ( ch bend ) , 1769 ( c = o
ester ) , 1460 , 1424 , 1371 ( ch3 ) , 1150 ,
1069 984 ( co stretch ) , 732 509 ( ch - bend ) cm while
the band on 31003600 cm belongs
to the oh group of the water molecule . comparing the obtained ir spectra for
dlplg and ascorbic acid ( figure 4 ) with the ir spectra charecteristics for
ascorbic acid shown in the literature [ 21 , 22 ] , it is confirmed that obtained nanoparticles are composed of
poly(d , l - lactide - co - glycolide ) and ascorbic acid . besides the characteristic groups for copolymer dlplg , the four oh bands of ascorbic acid could be assigned by means
of infrared investigations at 3528 , 3411 , 3317 , 3217 cm . the spectra show bands that can be assigned to ch3 , ch2 ,
or ch groups in the ascorbic acid environment at 2720 cm and the
spectra also clearly show the band corresponding to c = o groups at 2916 cm . the bands that correspond to the wave number 1754 cm belong to c = c groups , 1673 cm coc ,
and 1020 cm co ,
respectively . the morphological characteristics of
the obtained dlplg particles , with and without encapsulated ascorbic acid , were
examined with a scanning electron microscope . from the sem recordings of dlplg
particles without ascorbic acid ( figure 5(a ) ) , it is visible that the
particles have spherical shape , smooth surface , low level of agglomeration , and
high level of uniformity higher than other samples . from the sem recordings
of the second sample ( figure 5(b ) ) , where dlplg copolymer has encapsulated ascorbic acid in ratio dlplg / ascorbic acid 85/15% , it is visible that
particles also have spherical shapes , that is , spherical shape of the initial
dlplg dlplg / ascorbic acid 85/15% nanoparticles are
uniform with sizes from 130 to 200 nm depending on which stereological
parameters are considered ( dmax , maximum diameters , feret x , or feret y ) . the
particles of the sample dlplg / ascorbic acid 70/30% ( figure 5(c ) ) also have spherical shapes , but their sizes are increased . in case of the fourth sample ,
dlplg / ascorbic acid 50/50% ( figure 5(d ) ) uniformity is perturbated , particles have both spherical and irregular shapes and they are much agglomerated . for
the fifth sample , dlplg / ascorbic acid 30/70% ( figure 5(e ) ) , the stereological analysis is giving us
the parameters which are characterizing the particle sizes ( area section dmax , and feret 's diameters ) and parameter which is characterizing
the particle shape ( perimeter form factor maximum , and mean values were recorded and presented in table 1 . based on the obtained results of the
stereological analysis of dlplg particles , it is visible that they are uniform ,
their average mean size varies from 0.15 to 0.23 m depending on the
stereological parameter taken in consideration ( dmax , feret x , or feret y )
( table 1 ) . dmax values range from 0.09 to 0.39 m with particle 's mean size
0.23 m ( figure 6 ) . figures
7 and 8 present comparative results of dlplg particles with and without ascorbic acid based on their area section and
perimeter form factor . from the comparative results of the
stereological analysis of the area section ( aa ) of dlplg with and without
encapsulated ascorbic acid ( figure 7 ) as well as comparative results of the
perimeter form factor ( fl ) , ( figure 8) we can see that dlplg particles without
ascorbic acid have the smallest area section ( minimum value for aa is 0.02 mand maximum is 0.08 m ) and the highest mean value of perimeter
form factor which is 0.89 . nanoparticles dlplg / ascorbic acid 85/15% have
minimum dmax of 0.09 m and maximum dmax of 0.49 m ,
where their mean size is 0.20 m
( figure 6 ) . the mean value of the area section is 0.03 m ( figure 7 ) and of the perimeter form factor is 0.87 ( figure 8) . for particles dlplg / ascorbic acid 70/30% , minimum dmax is 0.30 m
and maximum dmax is 2.59 m , where their mean size is 0.67 m ( figure 6 ) , which indicates that the uniformity
is decreased and size is increased . the mean value of the area section is 0.41 m ( figure 7 ) and of the perimeter
form factor is 0.77 ( figure 8) . for particles dlplg / ascorbic acid 50/50% , minimum dmax is 0.28 m
and maximum dmax is 4.51 m , where their mean size is 1.60 m ( figure 6 ) . the
mean size of the area section is 2.30 m ( figure 7 ) and of the perimeter form factor is 0.74 ( figure 8) . in case of dlplg / ascorbic acid
30/70% the release amount of the ascorbic acid
from the polymer particles was determined periodically during the eight weeks
with uv spectroscopy . a calibration curve of the ascorbic acid in physiological
solution at different concentrations has been prepared using the specific
absorbance peak of the ascorbic acid at 264 nm . figure 9 shows the dependence of the maximum absorption from the degradation time in cases of dlplg without ascorbic
acid , dlplg / ascorbic acid 85/15% , dlplg / ascorbic acid 70/30% , and
dlplg / ascorbic acid 50/50% . this absorbance is correlated with the calibration
curve and amount of ascorbic acid is determined in percentages . figure 10 gives cumulative curves of the release of the ascorbic acid in percentages over the period of
time of the degradation . figure 10 also shows the relative review in
percentages of the ascorbic acid release in periods of up to two days , 211 , 1117 , 1724 , 2431 ,
3139 , 3946 , and 4655
days . in the first 24 days of the degradation , for all samples , less than 10%
of the encapsulated ascorbic acid have been released .
for all dlplg / ascorbic
acid samples , the overall quantities of the encapsulated ascorbic acid have
been released in 8 weeks of the degradation . the particles obtained with solvent / nonsolvent physical
method and technique of the centrifugal processing have potential use in transdermal systems for controlled delivery of ascorbic acid . it is possible to encapsulate ascorbic acid into dlplg particles in various concentrations thus
producing particles with different morphological characteristics . the
nanoparticles of dlplg / ascorbic acid with lesser ratio of ascorbic acid have
higher uniformity , lower level of agglomeration , and smaller sizes . the
nanoparticles of dlplg / ascorbic acid 85/15% have spherical shapes and their
sizes are from 130 to 200 nm . | this paper is covering new , simplistic method of obtaining the system for controlled delivery of the ascorbic
acid .
copolymer poly ( d , l - lactide - co - glycolide ) ( dlplg ) nanoparticles are produced using physical method
with solvent / nonsolvent systems where obtained solutions were centrifuged .
the encapsulation of the
ascorbic acid in the polymer matrix is performed by homogenization of water and organic phases .
particles of
the dlplg with the different content of ascorbic acid have different morphological characteristics , that is , variable degree of uniformity , agglomeration , sizes , and spherical shaping .
mean sizes of nanoparticles , which contain dlplg / ascorbic acid in the ratio 85/150% , were between 130 to 200 nm depending on which stereological parameters are considered ( maximal diameters dmax , feret x , or feret y ) . by introducing up to 15% of ascorbic acid , the spherical shape , size , and uniformity of dlplg particles are preserved .
the samples were characterized by infrared spectroscopy , scanning electron microscopy , stereological analysis , and ultraviolet spectroscopy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
measurement of disease activity is critical for longitudinal assessments in both observational studies and clinical trials . in the field of rheumatology , more than 250 assessment tools have been developed and validated to evaluate pathology , symptoms , function , and health status of patients with rheumatic diseases . such instruments should be compatible with regulatory requirements of the food and drug administration ( fda ) and generally require prospective studies for completion of the validation process . igg4-related disease ( igg4-rd ) is an increasingly recognized immune - mediated disease that is characterized by a lymphoplasmacytic infiltrate enriched with igg4-positive plasma cells and a distinctive storiform fibrosis of affected organs . commonly involved organs include the pancreas , biliary tree , orbits , salivary glands , and retroperitoneum , among many others . the serum igg4 level is often but not always elevated . because of the novelty of igg4-rd , little effort to date has been devoted to the development of outcome measures for this newly recognized condition . a disease responder index is a tool designed to detect any changes in disease activity and identify improvement and worsening in the same and/or different organ systems . a responder index permits objective quantification of the treatment response by providing standardized outcome measures . assessing clinical response and not simply serologic response is increasingly important to establish endpoints in randomized control trials . glucocorticoids are the standard first - line treatment for igg4-rd and patients whose disease has not reached an advanced stage of fibrosis generally respond well to this treatment , at least initially . the first is the complex , multiorgan system nature of this disease , which makes it difficult to summarize the state of disease activity across all organs . the second is the fact that the stage of disease activity can differ across organs , such that a patient can have active inflammation likely to respond to immunosuppression in one organ and advanced fibrosis ( less likely to respond to treatment ) in another . we have developed an igg4-rd responder index ( igg4-rd ri ) for use as an outcome measure in an ongoing pilot trial of rituximab in this condition . we intend that this instrument will measure not only disease activity but will also incorporate features that capture the need for urgent treatment and catalogue disease - related damage . this paper is designed to provide information on the development and implementation of the igg4-rd ri . we report the philosophy behind the development of the igg4-rd ri to date , the steps taken to create the instrument through the enlistment of assistance of international experts in this condition , and the plans for completion of the igg4-rd ri validation process . the igg4-rd ri was designed to assess disease activity from visit to visit using clinician - generated assessments of both objective and subjective measures . the igg4-rd ri uses a scoring system from 04 for each organ system or site and asks the clinician to rate the extent of disease activity and damage at the time of the clinical encounter . the igg4-rd ri was revised by the organizing committee of the international igg4-related disease symposium , held in boston in october , 2011 [ http://www2.massgeneral.org/pathology/symposium/igg4_related_systemic_dis.asp ] . this group was comprised of 39 experts from 9 countries , with subspecialty expertise in rheumatology , gastroenterology , allergy / immunology , nephrology , surgery , pathology , and radiology . further revisions were made following a simulation exercise involving six paper case descriptions of real patients , completed by igg4-rd symposium participants . finally , both the igg4-rd ri that emerged from these development steps and a physician global assessment ( pga ) were used to assess the disease retrospectively in terms of disease activity and damage . the pearson 's correlation coefficient was then calculated to compare the igg4-rd ri and pga responses . the igg4-rd ri was modeled on the birmingham vasculitis activity score for wegener 's granulomatosis ( bvas / wg ) . the bvas / wg is a formally validated and widely used instrument for the measurement of disease activity in granulomatosis with polyangiitis ( formerly wegener 's granulomatosis ) and microscopic polyangiitis , a pair of distinct but overlapping conditions often termed antineutrophil cytoplasmic antibody ( anca)-associated vasculitides ( aavs ) . the bvas / wg is a clinician - scored instrument in which each disease activity in each organ system is graded persistent , worse , or none at each clinic visit . the number of items of persistent or worse for each organ system is totaled and used to quantify the states of disease flare , persistent disease , or remission . the bvas / wg was selected because of the experience of one of the authors ( j. h. stone ) as a lead developer of this instrument ; similarities between anca - associated vasculitis and igg4-rd , including the propensities for multi - organ system involvement ; the broad range of disease activity between flare and remission ; the high frequency of disease - related damage ( which must be distinguished from active disease ) ; the absence of reliable biomarkers that necessitates reliance upon clinical indices for longitudinal assessments . the igg4-rd ri , designed to emphasize ease of use , includes specific reminders to consider activity within all organs involved commonly in igg4-rd ( figure 1 ) . physicians enter a score from 04 for each organ / site affected , indicating whether the organ / site is normal , improved , new or recurrent , or worse on treatment . the physician also provides yes / no answers for each organ site to the questions of whether the disease is symptomatic ; whether the disease activity requires treatment urgently ; whether the organ dysfunction observed is related to damage rather than ( or in addition to ) active disease . at the end of this table , the serum igg4 concentration in milligrams per deciliter is entered along with a score of 04 , indicating whether the igg4 concentration has improved , become newly or recurrently elevated , or increased despite treatment since the last visit . the scoring scheme for serum igg4 concentration , therefore , parallels the schemes for individual organ system activity assessment . the cumulative glucocorticoid dose ( in prednisone equivalents ) since the last visit and total igg4-rd ri score the numbers for each organ score refer to disease activity , distinguished from organ dysfunction related to damage : 0 signifies the absence of active disease in that organ . a score of 0 is appropriate when the organ system has never been affected by active igg4-rd , or when previously evident disease within that organ has resolved ; 1 indicates that disease activity within an organ has improved but still persists to some degree ; 2 indicates that the disease within that organ has remained persistent and unchanged since the last visit ; 3 indicates the presence of new or recurrent disease activity ; 4 refers to disease that has worsened despite treatment . the organ sites were selected for inclusion in the igg4-rd ri based on a review of the existing literature ( table 1 ) . for ease of conceptualization , the sites of potential organ involvement are listed from head to toe . this structure is similar to that of the bvas / wg scoring sheet , on which disease activity is scored by organ system , and each disease site is assigned a designation of normal , persistent disease activity , and new / worse disease activity , with numerical scores corresponding to each state . the igg4-rd ri category of other organ / site involvement is important because the protean nature of this disease makes it impossible to capture all potential sites of disease . in addition , we anticipate that new clinical manifestations of this disease and possible even new sites of organ involvement will be described as the clinical phenotype of this disease is understood more fully . lists of the most common symptoms and signs within a given organ system are included in the igg4-rd ri instructions ( see the appendix ) , principally as a reminder to the clinician of the possible disease manifestations to consider when scoring disease activity and damage . the physician simply denotes on the form the presence or absence of symptoms for a given igg4-rd site . good clinical judgment and a thorough knowledge of the disease manifestations of this condition are essential , as with any clinical responder index . some disease manifestations of igg4-rd require the immediate institution of treatment to prevent permanent organ damage . for example , igg4-related sclerosing cholangitis can lead to cirrhosis within several months of diagnosis and requires the prompt initiation of therapy . in contrast , the lymphadenopathy of igg4-rd remains unchanged for prolonged periods in many patients and may never require treatment . the urgent column in the igg4-rd ri is designed to capture aspects of the disease that require the immediate start of immunosuppression in order to preserve organ function . the score for an organ site is doubled when the need to initiate treatment for active igg4-rd at a particular or organ / site is considered urgent . for example , if a patient has new igg4-related sclerosing cholangitis , the total score for that organ / site would be 6 instead of 3 . similarly , if the patient 's biliary status has worsened despite therapy since the time of the last visit and an urgent escalation of therapy is required to treat the igg4-related sclerosing cholangitis , then that organ score would be 8 rather than 4 . only the score of the individual organ site is doubled in this setting , not the total igg4-rd ri score . organ damage results from active disease and in some cases both active disease and damage can be present in the same organ system simultaneously . in other cases , immunosuppression must be targeted to active igg4-rd , not to damage resulting from previously active therapy . the most appropriate use of immunosuppression is to control active disease and prevent disease - related damage . it is particularly ideal to employ immunosuppression at a stage of disease when the histopathology is characterized by a lymphoplasmacytic infiltrate rather than a predominance of acellular fibrosis . radiographic studies such as computed tomography ( ct ) and positron emission tomography with ct ( pet - ct ) can aid the clinician in determining which organs have been damaged . for example , even conceding that active disease might be present simultaneously with damage within the pancreas , the finding of atrophic changes by ct scan within that organ would be considered to be the result of damage . in such a case , both active disease and disease - related damage should be scored . the serum igg4 level may become elevated in a patient experiencing an active flare [ 6 , 10 ] . however , not every patient with igg4-rd has an elevated serum igg4 level at baseline , even before treatment . it is well established that classic igg4-rd can be active in the absence of elevated serum igg4 concentrations . the igg4-rd serum level in the igg4-rd ri is scored according to normal , improved , persistent , new , recurrent , or worsened despite treatment . the sum of the disease activity in all of the organ sites plus the serum igg4 concentration score ( also graded on a 04 scale ) yields the total activity score . an individual active organ site is doubled for urgency and added to the other organ sites . this number can be compared between visits to assess the disease activity over time as well as being used for a clinical trial endpoint . the longitudinal recording of damage , though not included in the overall disease activity score , is essential to the formulation of the patient 's overall outcome . glucocorticoids are the cornerstone of igg4-rd treatment , and most patients respond promptly to this treatment , at least initially . thus , careful recording of the dose of prednisone ( or prednisone equivalent ) in the interval between the current visit and the preceding one is essential to a full understanding of the degree of disease activity . the igg4-rd ri went through several development stages and iterations before arriving at its current format . a simulation exercise using paper case descriptions of six real patients was sent to attendees of the international igg4-rd symposium ( held in boston , ma , usa october 2011 ) . the participants received written instructions on how to apply the igg4-rd ri but did not attend a training session ( the appendix ) . twenty - one individuals participated in this exercise , providing valuable feedback from a cross - section of investigators interested in igg4-rd . the physicians who completed the exercises included a variety of subspecialists , particularly rheumatologists and pathologists ( figure 2 ) . the simulation exercises were presented as clinical vignettes , including data from histories , physical examinations , laboratory results , and radiologic findings for each case . accompanying each clinical vignette was at least one clinical photograph , radiology study , or histologic image to illustrate the case effectively . the physicians then used all of the information presented in the simulation exercise to complete a separate igg4-rd ri scoring sheet for each case . the results were scored for each participant against standardized answers prepared by consensus of the four authors . the purpose of this exercise was to solicit feedback on the igg4-rd ri from physicians who were experts in the evaluation of patients with this disorder from different perspectives . these included scoring organ involvement in which clinical symptoms and signs had resolved entirely as improved but persistent ( i.e. , 1 ) rather than resolved ( i.e. , 0 ) . another scoring discrepancy resulted from incorrectly scoring patients off treatment who were recurrent ( 3 ) as if they were receiving treatment ( 4 ) . a third error was failing to double the organ / site score , when disease requiring treatment urgently was present . comments from the participants in this exercise contributed substantially to important revisions of the draft instrument . we reformatted the scoring sheet in order to address the common scoring differences from the simulation case exercises . the next step in the development of the igg4-rd was the retrospective use of the instrument for fifteen individual clinic and in - patient evaluations among patients in the massachusetts general hospital igg4-rd registry . two blinded rheumatology experts scored an igg4-rd patient visit using either the igg4-rd ri or the physician 's global assessment scale ( pga ) . as the field of igg4-rd is poised to move beyond the descriptive phase of the disease , validated outcome measures are required to advance the understanding of this condition and the assessment of new treatment approaches . the current iteration of the igg4-rd ri marks an important step toward the availability of useful outcome measures in this disease . we anticipate that additional validation steps for this instrument will be required , but this paper describes accurately the philosophy and goals behind the igg4-rd ri . the development efforts to date have created a one - page instrument supported by the instruction manual shown in the appendix . data included on this single page include indications of disease activity across a full spectrum of potential organ involvement ; the serum igg4 concentration ; assessments of the need for treatment on an urgent basis ; the recording of damage in organ systems ; the sum of recent glucocorticoid use . expertise with the use of the igg4-rd ri may , therefore , become a concise and important tool for clinical trials and other investigations related to this disorder . although the developers of the igg4-rd ri have relied significantly upon the bvas / wg in creating this instrument , the igg4-rd ri differs in important ways from the bvas / wg . the urgent column in the igg4-rd ri highlights features of the disease that require the prompt institution of treatment and is , therefore , analogous to the major designations given to some organ system manifestations in the bvas / wg . however , the bvas / wg does not record disease damage on the same page . rather , clinical trials in aav have generally used a separate instrument , the vasculitis damage index , for this purpose . although it is critical that the concepts of disease activity and damage be kept separate and recorded appropriately during clinical assessments , it may be useful to have an indication of damage on the same one - page case report form even if damage does not contribute to the overall disease activity score . this model matches more closely the decision - making process that clinicians undertake on a daily basis in encounters with patients : are the signs of organ dysfunction due to active disease , or are they more accurately a reflection of damage rather than a process that requires more intensive immunosuppression ? the igg4-rd ri will find its greatest use in the research setting , either in the context of clinical trials or in other types of investigations that require the careful longitudinal assessments of patients ' clinical status . because consistency of its application from visit to visit is critical , it will be most useful to ensure whenever possible that the same investigators complete the igg4-rd ri for the same patient across all visits . significant debate now exists within the community of igg4-rd investigators about the utility of serum igg4 concentration measurements in the diagnosis and management of this disorder . inclusion of the serum igg4 concentration in the igg4-rd ri at this point permits an analysis of the value of this measurement in the context of other organ disease assessments . we hypothesize that further analysis of these data will confirm the utility of serial measurements , at least in a subset of patients . this hypothesis , however , requires confirmation through studies of larger numbers of patients in a variety of states of disease activity . the simulation case exercises illustrated some shortcomings in early iterations of the igg4-rd ri that led to appropriate revisions of the original index . the experience with the simulation exercise highlighted the importance of adequate training with the instrument prior to its use in the research setting . the igg4-rd ri is simpler than many clinical assessment tools for multiorgan diseases , but both a thorough understanding of the clinical breadth of igg4-rd itself and a high degree of familiarity with the index are required in order to employ it effectively . we anticipate that a focused period of instruction for investigators in the context of a formal training course will be required before this tool can be used in the context of a clinical trial . in conclusion , progress in igg4-rd will be contingent upon the ability to assess patients rigorously in a longitudinal manner , using validated outcome measures . the igg4-rd ri described in this paper represents a broad effort at the development of a disease activity and responder index that can be employed in clinical trials and other investigations of patients with this emerging immune - mediated condition . the next steps in validation will include a multicenter study of patients recruited from a core group of sites with extensive experience in the diagnosis and management of this disease . | igg4-related disease ( igg4-rd ) is a multiorgan inflammatory disease in which diverse organ manifestations are linked by common histopathological and immunohistochemical features .
prospective studies of igg4-rd patients are required to clarify the natural history , long - term prognosis , and treatment approaches in this recently recognized condition .
patients with igg4-rd have different organ manifestations and are followed by multiple specialties .
divergent approaches to the assessment of patients can complicate the interpretation of studies , emphasizing the critical need for validated outcome measures , particularly assessments of disease activity and response to treatment .
we developed a prototype igg4-rd responder index ( igg4-rd ri ) based on the approach used in the development of the birmingham vasculitis activity score for wegener 's granulomatosis ( bvas / wg ) .
the igg4-rd ri was refined by members of the international igg4-rd symposium organizing committee in a paper case exercise .
the revised instrument was applied retrospectively to fifteen igg4-rd patients at our institution .
those scores were compared to physician 's global assessment scale for the same visits .
this paper describes the philosophy and goals of the igg4-rd ri , the steps in the development of this instrument to date , and future plans for validation of this instrument as an outcome measure . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prognosis in patients with breast cancer depends mainly on the extent of lymph node involvement , size of the tumor , and the histological grade of the tumor . among these factors , axillary lymph node status is regarded as the single best marker of prognosis [ 1 , 2 ] . for axillary nodal involvement , treatment in the form of level but it is also associated with a number of complications including self - limiting complaints of numbness ( 70% ) , pain ( 33% ) , weakness ( 25% ) , swelling ( 24% ) , and stiffness ( 15% ) which can interfere with daily living in upto 39% of cases . the risk of arm edema varies from 8% to 37% being related to the level of dissection and the number of nodes removed . axillary vein thrombosis and injury to the motor nerves of axilla are extremely uncommon [ 2 , 3 ] . following the introduction of sentinel lymph node ( sln ) biopsy for breast cancer , this technique has been widely adopted by cancer centers around the world for node - negative early breast cancer . if the sentinel lymph node ( sln ) is negative , the likelihood for other lymph nodes in the axilla to be negative ranges from 95 to 100% . so unnecessary alnd can be avoided in patients with negative axillae , and the associated morbidity of alnd can be reduced . several studies could demonstrate a significant reduction in tumor size and a significant increase in breast - conserving surgery in operable breast cancer [ 5 , 6 ] . response to treatment is also an excellent indicator of chemotherapy effectiveness [ 5 , 79 ] . in locally advanced breast cancer ( labc ) , controversy continues over the appropriate timing of sln biopsy in labc patients receiving neoadjuvant chemotherapy as it could offer them the potential benefit of axillary downstaging and avoidance of axillary dissection . recently , it has been shown that in locally advanced breast cancer , patients with a complete pathologic axillary response had a significantly higher overall survival than patients with residual disease . their study validated the prognostic stratification of patients with a complete pathological axillary response to neoadjuvant chemotherapy . the aim of this study was to evaluate the feasibility and accuracy of sln biopsy in locally advanced breast cancer patients with cytology - proven axillary nodal metastasis who become clinically node - negative after neoadjuvant chemotherapy . the present prospective observational study was conducted by the departments of surgery and pathology at lady hardinge medical college , new delhi . a total of 30 consecutive patients ( accrued over a period of 18 months ) with cytology / biopsy - proven locally advanced breast cancer labc ( ajcc stage iii ) and cytology - proven axillary nodal metastasis , who became clinically node - negative ( on clinical examination ) after neoadjuvant chemotherapy , were included in the study . patients who had prior axillary surgery and those with inflammatory breast cancer were excluded from the study . all patients were subjected to a detailed clinical evaluation , routine investigations , and metastatic workup at the time of presentation . investigations included a complete hemogram , blood sugar , liver function tests , kidney function tests , ecg , echocardiogram , chest x - ray , an ultrasound of the abdomen , and a bone scan . breast investigations included a mammogram , breast ultrasound , cytology , and trucut biopsy for er / pr / her2 status . breast ultrasound was used to define clinical response of the breast tumor to chemotherapy . the patients were given three cycles of neoadjuvant chemotherapy ( caf : cyclophosphamide 600 mg / m , adriamycin 50 mg / m , 5-flurouracil 600 mg / m ) , and patients who satisfied the inclusion criteria were subjected to sentinel node biopsy , axillary lymph node dissection , and breast surgery . after the administration of anesthesia , the planned incision was marked by a marking pencil on the skin of the breast containing tumor . 2 to 5 ml of sterile 1% isosulphan blue ( patent blue ) dye was injected peritumourally ( upper outer aspect of tumor ) using a syringe and a 22 g needle . the incision was planned in such a way as to be included in the mastectomy incision in patients undergoing modified radical mastectomy . dissection was rapidly done in the axilla to the clavipectoral fascia , and on reaching the fascia , the blue stained lymphatic(s ) was carefully identified and traced up to the blue sentinel node(s ) . standard axillary dissection ( alnd ) was then performed removing level i and ii axillary lymph nodes . patients were observed for any immediate or late complications associated with dye injection . for the purpose of histopathological examination ( which included cytokeratin immunohistochemistry ) , sentinel node and nonsentinel nodes were submitted separately for histopathological analysis . in cases where more than one sentinel node was found , data collection from all the patients was then analyzed using spss statistical software ( version 9.0 ; spss inc , chicago , ill , usa ) . the study group comprised of 30 consecutive patients of locally advanced breast cancer ( ajcc stage iii ) with cytology - proven axillary lymphadenopathy at presentation who became clinically node - negative ( on clinical examination ) after completion of three cycles of neoadjuvant chemotherapy . these patients were then subjected to sentinel lymph node biopsy followed by axillary lymph node dissection at the same operation . out of these 30 patients , 29 patients underwent modified radical mastectomy while one patient had breast conserving surgery done . in the present study , the mean age of the patients was 49.45 years ( range from 25 to 65 years , median age 45 years ) . all the patients in the present study were females . out of the 30 patients , 9 ( 30% ) were premenopausal , while 21 ( 70% ) were postmenopausal . none of the patients had a family history of breast , colon , ovary , or any other cancer . 60% ( 18/30 ) of patients had primary tumor in the left breast , while 40% ( 12/20 ) patients had tumor in the right breast . the size of the primary tumor varied from 3 cm to 7.5 cm ( t2 , t3 , and t4b ) . all the 30 patients had infiltrating ductal cancer , out of which 1 was well differentiated ( grade 1 ) , 21 were moderately differentiated ( grade 2 ) , and the remaining 8 were poorly differentiated ( grade 3 ) . 14 patients were estrogen receptor positive , 12 were progesterone receptor positive , and 11 patients had her2 overexpression . out of these 30 patients , minimal response ( less than 50% reduction in size ) to neoadjuvant chemotherapy was seen in 14 patients ( 46.67% ) , partial response ( more than 50% reduction in size ) was seen in 14 patients ( 46.67% ) , and complete response was seen in the remaining 2 patients ( 6.67% ) . breast ultrasound was used to define clinical response of the breast tumor to chemotherapy . out of the total of 30 patients who underwent sln biopsy in the present study , the number of sentinel nodes removed per patient ranged from 1 to 4 ( 1(n = 18 ) , 2(n = 8) , 3(n = 3 ) , 4(n = 1 ) ) . median number of nsn identified was 13 . out of the total 26 cases in which a sentinel node was identified , the sentinel node was positive for tumor metastasis in 15 cases , the rest were negative on histopathology . in the 15 cases when the sentinel node was positive for metastasis , the nonsentinel nodes were positive for tumor metastasis in 12 cases . in the rest 3 cases in which the sentinel node was positive , the nonsentinel nodes were found to be negative for tumor metastasis on histopathology ( table 1 ) . it appears that in these 3 patients , the sentinel nodes were the only involved nodes . out of the 11 cases when the sentinel node was negative for metastasis , in 8 cases the nonsentinel nodes were also negative for tumor metastasis on histopathology , while in the remaining 3 cases , the nonsentinel nodes were positive for tumor metastasis , thereby accounting for 3 false negatives in the study ( table 1 ) . out of these 3 patients , 2 had only one non - sentinel node positive for tumor , while the third had 2 non - sentinel nodes showing tumor . it is possible that fibrosis around the involved nodes could have resulted in the false negatives . thus in our study , sentinel node dissection was attempted in 30 patients , out of which sentinel nodes were successfully identified in 26 patients , with a sentinel node identification rate of 86.67% . we achieved a sensitivity of 83.33% ( 15/18 ) , false negative rate of 20% ( 3/15 ) , a negative predictive value of 72.73% ( 8/11 ) , and an overall accuracy of 88.46% ( 23/26 ) . no complications were observed as a result of dye injection in any of the patients . all of the patients had a bluish green discoloration of the body ( especially the face ) and observed green - colored urine for 12 to 24 hours after surgery . although the impact of resecting axillary lymph nodes on survival is currently a subject of controversy , accurate assessment of axillary nodal status provides the most important prognostic information for patients with primary breast cancer . it also directs selection of adjuvant systemic therapy and reduces the risk of regional recurrence of breast cancer in the axilla [ 2 , 11 , 12 ] . following the introduction of sentinel lymph node ( sln ) biopsy for early breast cancer , this technique has been widely adopted by cancer centers around the world . if the sln is negative , the likelihood for other lymph nodes in the axilla to be negative ranges from 95 to 100% . so unnecessary axillary lymph node dissection ( alnd ) can be avoided , and its attendant morbidity can be reduced , in many patients with small breast cancers and negative axillae [ 4 , 1316 ] . most of the reported experience with sln biopsy includes patients with clinical stage t1 - 2 n0 . however , recent studies have now shown that sln biopsy can be considered if axillary lymph nodes are negative for metastases even in locally advanced breast cancer [ 10 , 18 , 19 ] . neoadjuvant chemotherapy has become the standard of care for the treatment of patients with locally advanced breast cancer and has also been prospectively evaluated in patients with earlier - stage disease [ 2023 ] . neoadjuvant chemotherapy allows for individual in vivo assessment of primary tumor and metastatic lymph node response to chemotherapy . in addition , although chemotherapy is primarily thought of as important in eradicating occult distant disease , it can have a significant effect on locoregional disease as well . tumor downstaging with neoadjuvant chemotherapy can convert inoperable disease to operable disease and can allow breast - conserving surgery in patients for whom mastectomy is initially the only option for control of locoregional disease [ 2325 ] . during their study in locally advanced cases , kuerer et al . concluded that neoadjuvant chemotherapy can completely clear the axilla of microscopic disease before surgery , and occult metastases ( isolated tumor cells - ajcc pn0(i+ ) ) were found in only 10% of patients with a histologically negative axilla ( ajcc pn0 : no regional lymph node metastasis histologically ) . the results of their study have implications for the potential use of sentinel lymph node biopsy as an alternative to axillary dissection in patients treated with neoadjuvant chemotherapy . their finding that only 10% of patients with complete axillary conversion ( histologically negative axilla ) have occult nodal metastases suggests that sln biopsy may be appropriate in patients whose disease is downstaged with neoadjuvant chemotherapy . . reported on a series of 89 patients with locally advanced breast cancer subjected to sln biopsy before neoadjuvant chemotherapy . 27% of their patients had a complete pathologic axillary response ; these patients had a significantly higher overall survival than patients with residual disease . their study validated the prognostic stratification of patients with a complete pathological axillary response to neoadjuvant chemotherapy . during the last few years , there have been a number of clinical trials on the effectiveness and role of sln biopsy in patients after preoperative chemotherapy , mainly in early - stage breast cancer with negative nodes [ 2628 ] . a retrospective analysis of 428 of 2,365 patients in the nsabp 27 trial who received chemotherapy followed by sentinel node biopsy and an axillary dissection was done . 2,411 patients were randomly assigned to nsabp protocol b-27 . in the 2,365 patients ( 98.1% ) for whom operative and pathology reports were available , there were 428 ( 18.1% ) who had lymphatic mapping and for whom an attempt was made to identify and remove a sentinel node . there were significant differences in the distribution of some of the patient and tumor characteristics between the group of patients who had an sln biopsy attempted and the group of 1,937 patients ( 81.9% ) who did not . patients in whom an sln biopsy was attempted had smaller tumors and clinically uninvolved axillary nodes and are more likely to be lumpectomy candidates . of the 428 patients in whom lymphatic mapping was attempted , at least one sentinel node was identified and removed in 363 . of the 363 patients in whom at least one sentinel node was identified and removed , 20 patients ( 5.5% ) did not have the required axillary node dissection , leaving 343 patients in whom the accuracy of the sentinel node in correctly staging the axilla could be assessed . because sln biopsy was not mandated in the study , there was no predefined protocol dictating the method of lymphatic mapping or the approach to sln biopsy . in the majority of the cases , nodal positivity was determined by hematoxylin and eosin staining only . however , in a handful of cases , additional immunohistochemical staining was performed to further evaluate the status of sentinel nodes . the analysis of these cases demonstrated an 85% sentinel node identification rate and a false - negative rate of 11% , which are similar to those observed in patients undergoing an initial sentinel node biopsy during the same period . conducted a meta - analysis of twenty - one studies ( total of 1273 patients ) that examined the results of sln biopsy after chemotherapy . the sensitivity of sln biopsy in the individual studies ranged from 67 to 100 percent , the negative predictive value ranged from 56 to 100 percent , and the overall accuracy ranged from 77 to 100 percent . however , the majority of patients in these studies had stage ii breast cancer with negative axillary nodes at presentation . the ongoing acosog z1071 trial a phase ii study of sentinel lymph node surgery and axillary lymph node dissection following neoadjuvant chemotherapy in women with stage ii - iiib node - positive breast cancer attempts to determine the false negative rate for sentinel lymph node ( sln ) surgery in women with node - positive breast cancer who have completed or plan to undergo neoadjuvant chemotherapy . however , this study includes both stage ii and iii breast cancer and also includes patients who are node positive after completing the chemotherapy . studies on the feasibility and accuracy of sln biopsy after preoperative chemotherapy in locally advanced breast cancer patients with documented axillary metastasis are few and the results are inconclusive . shen et al . studied 69 patients with cytology - confirmed axillary metastasis who underwent sln biopsy after chemotherapy . however , out of these , only 23 were labc ( ajcc stage iii ) . the overall sln identification rate was 92.8% , and a false negative rate of 25% . they concluded that the status of the sln can not be used as a reliable indicator of the presence or absence of residual disease in the axilla in this patient population . newman et al . evaluated 54 breast cancer patients with biopsy - proven axillary nodal metastasis . the sln identification rate after delivery of neoadjuvant chemotherapy was 98% , with a false negative rate of 8.6% . they concluded that sln biopsy after neoadjuvant chemotherapy in patients with documented nodal disease at presentation accurately identified cases that may have been downstaged to node - negative status and can spare this subset of patients from the morbidity of an alnd . another recent study from korea concluded that sln identification rate , but not accuracy , is significantly decreased after preoperative chemotherapy in axillary node - positive breast cancer patients . they also suggested that for patients who achieve complete axillary clearance by chemotherapy , sln biopsy could replace alnd . in the present study , although having a small sample size , we have showed that sln biopsy is feasible and safe in locally advanced carcinoma breast who become clinically node - negative after neoadjuvant chemotherapy . our accuracy rate , identification rate , and false negative rate are comparable to reports in the literature in node - negative labc patients after chemotherapy . blue dye method is a safe procedure and none of the patients developed any complications of the dye injection . however , even in this group , the subgroup of labc patients in whom there is a complete axillary response to neoadjuvant chemotherapy have a good prognosis having shown to have a significantly higher overall survival than patients with residual disease . identification of this subgroup of labc patients can help target treatment modalities for improved outcomes . most of the studies in the literature on sln biopsy after neoadjuvant chemotherapy involved earlier stage disease , smaller tumors , with negative nodes at presentation . our study focuses on the likely feasibility and role of sln biopsy in this good prognosis subgroup of labc patients with complete axillary response to neoadjuvant chemotherapy . additional studies are needed to answer the on - going debate regarding optimal treatment of the axilla in labc patients who are rendered clinically node - negative after neoadjuvant treatment . following neoadjuvant therapy , accurate evaluation of the axilla by sln biopsy is feasible in these patients . sentinel lymph node biopsy as a therapeutic option in locally advanced breast cancer patients who become clinically node - negative after neoadjuvant chemotherapy is a promising option that can spare axillary dissection and its morbidity , and which should be further investigated . | introduction .
controversy continues over the appropriate timing of sentinel lymph node ( sln ) biopsy in locally advanced breast cancer ( labc ) patients receiving neoadjuvant chemotherapy .
we evaluated the feasibility and accuracy of sln biopsy in labc patients with cytology - proven axillary nodal metastasis who become clinically node - negative after neoadjuvant chemotherapy .
materials . 30 consecutive patients with labc , who had become clinically node - negative after 3 cycles of neoadjuvant chemotherapy , were included in the study .
they were then subjected to sln biopsy , axillary lymph node dissection , and breast surgery .
results .
sentinel nodes were successfully identified in 26 of the 30 patients , resulting in an identification rate of 86.67% , sensitivity of 83.33% , false negative rate of 20% , negative predictive value of 72.73% , and an overall accuracy of 88.46% .
no complications were observed as a result of dye injection .
conclusions .
sln biopsy is feasible and safe in labc patients with cytology - positive nodes who become clinically node - negative after neoadjuvant chemotherapy .
our accuracy rate , identification rate , and false negative rate are comparable to those in node - negative labc patients .
sln biopsy as a therapeutic option in labc after neoadjuvant chemotherapy is a promising option which should be further investigated . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dentigerous cyst ( dc ) is the second most common odontogenic cyst , after radicular cyst in the jaw . dc comprises 24% of all true cysts in jaws , and its prevalence in the general population is approximately 1.44 cysts for every 100 unerupted teeth . the world health organization ( who ) classified the cysts developed on germs of non - erupted teeth as epithelial odontogenic cysts ( follicular ) ; these cysts have the following characteristics :
they develop on non - erupted teeth;they can manifest at any age , though the majority of cases occur during the 2 and 3 decades;they are unilateral;usually the teeth involved are the mandibular third molars and the maxillary canines ;
dcs are usually asymptomatic and have no pain . they develop on non - erupted teeth ; they can manifest at any age , though the majority of cases occur during the 2 and 3 decades ; usually the teeth involved are the mandibular third molars and the maxillary canines ; a 10-year - old boy was referred with the chief complaint of bilateral expansion of the mandible . he had had tooth - ache 2 years previously , and referred himself to a dentist , where he had undergone a pulpectomy and filling of his bilateral mandibular deciduous molars . the posterior areas of his mandible began to expand bilaterally about 18 months ago and this continued until 2 months ago . intra - oral examination revealed bilateral bony expansion at buccal of the mandible ( at right side from mesial # 83 to distal # 85 and at left side from mesial # 74 to distal # 36 ) . there were bilateral well - defined unilocular radiolucencies at the pericoronal of the permanent second premolars ( figure 1 ) . according to clinical and radiographic features , bilateral dentigerous cysts were considered as the first differential diagnosis of the lesions . to treat the lesion , a left side marsupialization was carried out , and 2 months later , after primary healing of the left side , the same surgery was done on the right side . dc is solitary in most patients , and bilateral or multiple dcs are usually associated with syndromes such as cleidocranial dysplasia , basal cell syndrome maroteaux - lamy syndrome , and hunter s syndrome . the occurrence of bilateral dcs in non - syndrome patients is rare . to our knowledge , only 29 cases of bilateral dcs in non - syndromic patients have been reported ( table 1 ) . third molarsenucleation*not defined in the literature;the original article in korean
not defined in the literature ; the original article in korean most reports of bilateral dentigerous cysts are associated with third molars , and first molars . choeyoungcheol reported bilateral dentigerous cysts associated with mandibular first premolar , and mcdonnell reported a case associated with permanent mandibular second premolar and molar . we did not find any previous reports of bilateral permanent mandibular second premolars without any syndrome . dcs have unilocular radiolucencies in different sizes , with well - defined sclerotic borders of unerupted tooth crowns . normal size of the follicular space is considered about 34 mm in radiographs , so if this space is more than 5 mm , dentists should suspect dcs . other pericoronal radiolucencies such as odontogenic keratocyst ( okc ) , ameloblastoma , odontogenic fibroma , adenomatoid odontogenic tumor ( aot ) , pindborg tumor , and odontoma can have similar radiographic features to dc . radicular cyst of deciduous teeth must be considered , especially in the apex of deciduous molars , which can mimic dc of permanent premolars . microscopic characteristics of okc are uniform thickness , palisading of basal cells with hyperchromatic nuclei , keratinized pattern with a corrugated surface , and a stratified squamous epithelium with few layers . pindborg tumor , aot , and odontoma are radiolucent lesions that most often exhibit amorphous calcification within their lytic space . the varying size of multiple radiolucent areas and bony septa are the common features of odontogenic fibromixoma , but unilocular lesions also have been reported . our case showed no sign of syndrome , indicating that although bilateral or multiple dcs are common in syndromic patients , detection of bilateral dcs do not necessarily indicate any syndrome . | the dentigerous cyst is one of the most common developmental odontogenic cysts in the jaw .
occurrence of the bilateral dentigerous cyst is uncommon , and frequently associated with syndromes like basal cell nevus syndrome or cleidocranial dysplasia .
there are few reports on the presence of bilateral dentigerous cyst in nonsyndromic patients , and most of these are associated with first and third molars .
the reported case in this paper is bilateral dentigerous cysts associated with mandibular permanent second premolars , in the absence of any signs of syndrome . to our knowledge bilateral dentigerous cysts in these locations have not been previously reported . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
af is the most common cardiac arrhythmia , with an estimated risk of development during lifetime of 1 in 4 men and women with at least 40 years of age [ 1 - 3 ] . the clinical interest in this condition derives from the fact that it increases the risk of mortality by two - fold , of congestive heart failure by three - fold , and of stroke by five - fold . the treatment of af has two targets : the prevention of the thrombo - embolic complications and the reduction of symptoms and consequences related to the arrhythmia by rhythm or rate control therapies . vitamin k antagonists reduced the relative risk of stroke by 64% , corresponding to an absolute annual risk reduction in all strokes of 2.7% . it is universally recognized that the oral anticoagulation ( oac ) is the mainstream therapy for the reduction of thrombo - embolic complications related to af . several scores have been developed to identify patients with high risk of thrombo - embolic events and those who need anticoagulation . however , given the high efficacy of oac and the enormous consequences of strokes , it would be better to change our approach from the identification of many patients who need oac to the research of the few patients who do not need oac . cardiologists should therefore consider the presence of af itself as an indication to anticoagulation therapy , unless the patient has a truly low risk . the latest european society of cardiology guidelines suggest that , for the correct evaluation of patients with non - valvular af , the use of the cha2ds2-vasc congestive heart failure / left ventricular dysfunction , hypertension , age of at least 75 ( doubled ) , diabetes , stroke ( doubled)-vascular disease , age 65 to 74 , and sex category ( female)score is more sensible compared with the previously used chads2 score . patients with af who have at least one stroke risk factor are recommended to receive oac with either well - controlled vitamin k antagonist therapy international normalized ratio ( inr ) 2 - 3 , with more than 70% of time in the therapeutic range or one of the new oral anticoagulants ( noacs ) . only patients with lone af who are less than 65 years old have very low absolute stroke rates and do not require oac . the oac usually revives in the physician 's mind the ghost of major bleeding ; this fear is the main reason for the frequent denial of such an effective therapy to a high number of patients . the guidelines suggest the assessment of the bleeding risk in all patients with af with the has - bled hypertension , abnormal renal / liver function , stroke , bleeding history or predisposition , labile inr , elderly ( e.g. age more than 65 years and frailty ) , drugs / alcohol concomitantly score . the score should be used to balance the risk of stroke against potential major bleeding events ; however , a high - risk score should not exclude patients from oac , but favor the identification and correction of potentially reversible risk factors , such as uncontrolled blood pressure , concomitant use of aspirin / non - steroidal anti - inflammatory drugs , and labile inrs . in patients who are not candidates for oac the weapon used in this battle , however , appears not to be pathophysiologically adequate to the setting ; in fact , thrombi in patients with af are predominantly fibrin - rich ( the so - called red clots ) , while thrombi found in coronary artery lesions tend to be platelet - rich ( white clots ) . therefore , such an effective therapy in athero - thrombotic vascular disease becomes of limited value in patients with af . the meta - analysis by hart et al . reviewed seven randomized control trials evaluating the antithrombotic therapy for stroke prevention in non - valvular af ( 3990 participants in aspirin - only trials ) . the result was a reduction of risk of stroke with anti - platelet therapy compared with placebo by 19% ( 95% confidence interval [ ci ] 1% to 35% ) with a 95% ci that included zero ; this raises the possibility of non - significant clinical effect . aspirin has been frequently used in elderly patients , with the hope of fewer side effects . this belief was not confirmed by the birmingham atrial fibrillation treatment of the aged ( bafta ) trial , which randomly allocated patients over 75 years of age to receive oac with warfarin or 75 mg of aspirin daily ; in the oac group , the yearly risk of the primary endpoint ( disabling stroke , intracranial hemorrhage , or arterial embolism ) was 1.8% and significantly lower than the 3.8% obtained with aspirin ; warfarin treatment in the elderly was associated with a 52% relative risk reduction compared with aspirin . even when a second anti - platelet agent , such as clopidogrel in the active - w ( atrial fibrillation clopidogrel trial with irbesartan for prevention of vascular events ) trial , is added , the effect is clearly inferior to the one obtained by the oac treatment . following the hypothesis that double anti - platelet association was an effective replacement of oac , the active - a trial randomized 7554 patients with af to aspirin plus clopidogrel or to warfarin . double anti - platelet therapy reduced the risk of stroke by 28% , but it increased the risk of major bleeding by 50% . with the advent of noacs , which promise the efficacy of standard oac without any increased risk of bleeding , it is not difficult to foresee that both aspirin and the double anti - platelet therapy for af will become obsolete or restricted to rare cases . noacs , in contrast to warfarin ( which blocks multiple active vitamin k - dependent coagulation factors ) , block the activity of one single step in the coagulation process . dabigatran acts as an oral direct thrombin inhibitor , while rivaroxaban and apixaban both inhibit factor xa . all noacs have shown non - inferiority in stroke and systemic embolism prevention , compared with warfarin . in the re - ly ( randomized evaluation of long - term anticoagulation therapy ) trial , dabigatran 150 mg bis in die ( twice a day b.i.d . ) was superior to warfarin , with no significant difference in the safety endpoint of major bleeding ; the reduced dosage of 110 mg b.i.d . was non - inferior to warfarin , with 20% fewer major bleeds ; both dosages were associated with a non - significant increase of 28% in myocardial infarction . in the aristotle ( apixaban for reduction in stroke and other thrombotic events in atrial fibrillation ) trial , apixaban 5 mg b.i.d . reduced the primary endpoint of stroke or systemic embolism by 21% compared with warfarin , with a 31% reduction in major bleeding and a significant 11% reduction in all - cause mortality . edoxaban , a new factor xa inhibitor , has completed late - stage clinical assessment . a meta - analysis pooling more than 40,000 patients from four randomized controlled trials comparing noacs with warfarin has been recently published ; compared with warfarin , the noacs , as a class , reduced all - cause mortality by about 10% in the populations enrolled in the clinical trials . stroke and systemic embolic events were significantly reduced in patients receiving noacs ; the benefit was driven mainly by substantial protection against hemorrhagic stroke , while they had similar efficacy in the prevention of ischemic stroke . several trials in recent years tried to assess whether restoration of sinus rhythm offers any advantage compared with the strategy of rate control . although sinus rhythm restoration is theoretically supposed to be the best option , many studies such as piaf ( pharmacological intervention in atrial fibrillation ) , affirm ( atrial fibrillation follow - up investigation of rhythm management ) , race ( rate control versus electrical cardioversion for persistent atrial fibrillation ) , and staf ( strategies of treatment of atrial fibrillation ) failed to report any survival benefit from rhythm - control strategy . also , in the population of patients with heart failure , no clear benefit was demonstrated for this strategy . later on treatment analysis of the affirm trial showed that the presence of sinus rhythm is associated with a lower risk of death ; this analysis suggested that the adverse effects of anti - arrhythmic drugs ( aads ) overcome the beneficial effects of sinus rhythm restoration ; it is also conceivable that the efficacy of currently available aads is so limited and transient that any positive effect of sinus rhythm does not have enough time to develop . this raised the interest in other treatments , such as catheter ablation ( ca ) of af , whose effects are supposed to be more durable . wilber et al . compared the efficacy of catheter ablation with aad treatment in treating symptomatic patients with paroxysmal af who had not responded to at least 1 aad ; the invasive treatment resulted in a longer time to treatment failure ( 66% of patients in the catheter ablation group remained free from protocol - defined treatment failure compared with 16% of patients treated with aad therapy ) during the 9-month follow - up period . the efficacy of ca is dependent on the type of af , the presence of cardiac structural heart disease , and co - morbidities . presence of left atrial scar is an independent predictor of arrhythmia recurrence after the ablation . magnetic resonance imaging studies demonstrated that recurrence rate after ca is directly related to the amount of left atrial scar : patients with minimal late gadolinium enhancement ( 8.0% 4.2% ) have fewer recurrences ( 14.0% ) compared with patients with moderate enhancement ( 21.3% 5.8% , recurrence rate = 43.3% ) and patients with extensive enhancement ( 50.1% 15.4% , recurrence rate = 75% ) . when confirmed by large population studies , the extension of left atrial scar can be included in the pre - operative assessment of af patients in order to reduce the number of procedures in patients with expected low efficacy . the best results of the ca procedure are actually obtained in patients with paroxysmal af in the absence of cardiac structural disease and co - morbidities [ 26 - 33 ] . in those patients , af is related to the presence of triggers in the pulmonary veins ( pvs ) ; therefore , pv isolation is the cornerstone treatment for patients with paroxysmal af [ 34,36 - 38 ] . in a recent meta - analysis of 19 studies , rates of single - procedure success for paroxysmal af ablation were 68.6% ( 95% ci 58.9% to 77.0% ) at 1 year , 61.1% ( 95% ci 49.8% to 71.2% ) at 3 years , and 62.3% ( 95% ci 39.8%to 80.5% ) at 5 years . the pooled 12-month success rate for paroxysmal af ablation after a single procedure was 66.6% ( 95% ci 58.2% to 74.2% ) ; it increased to 79.0% ( 95% ci 67.6% to 87.1% ) when multiple procedures were used ( average number of procedures : 1.45 ) . the most common cause of arrhythmia recurrence is reconduction across pv isolation ; nanthakumar et al . found reconduction in 42 of 51 previously isolated veins in 15 patients with recurrent symptoms after a first ablation for paroxysmal af . in the experience of verma et al . , all veins were still isolated in 81% of patients undergoing a repeat procedure after the index ablation ; this rate dropped to 5% and 0% in the patients maintaining sinus rhythm on aads and in patients with arrhythmia despite aads . ablation has been performed for many years with the point - by - point approach with continuous catheter dragging during radiofrequency delivery or by repeated short - time radiofrequency shots . this approach is highly dependent on the operator 's skill and the contact between the tip of the catheter and the target tissue ; freedom from arrhythmia recurrences is best achieved when ablation lesions are placed with an average contact force ( cf ) of more than 20 g , and clinical failure is frequent with an average cf of less than 10 g . recently developed catheters allow pv isolation with one or a few shots of radiofrequency , cryo - energy , or laser pulses . medtronic pvac ( medtronic ablation frontiers , carlsbad , ca , usa ) and nmarq ( biosense webster , diamond bar , ca , usa ) catheters have a circular shape that fits with pulmonary veins ostia ; radiofrequency can be delivered simultaneously by a variable number of electrodes . the arctic front advance cardiac cryoablation catheter ( arctic front ; medtronic ) consists of a balloon that can be placed at each pv ostium in order to obtain pv occlusion ; ablation is then performed by cryo - energy . ma , usa ) is a visually guided laser ablation catheter with a variable - diameter balloon that accommodates a 2-fr endoscope ; it provides real - time visualization of the balloon contact and blood during the ablation . in a multicenter experience enrolling 200 patients with paroxysmal af , it showed an efficacy similar to that of radiofrequency ablation . reported major complications were cardiac tamponade ( 2% ) and phrenic nerve palsy ( 2.5% ) . pv isolation is still mandatory for the treatment of persistent and long - standing af . however , recurrent and chronic af induces progressive electrical and tissue structural remodeling , thus making af a self - perpetuating disease ; to interrupt this looping process , the ablation procedure in non - paroxysmal af patients usually requires some kind of substrate modification . three approaches were developed : linear lesions , complex fractionated atrial electrogram ( cfae ) ablation , and electrical rotor elimination . linear lesions have been applied on the left atria roof and on the mitral isthmus with the aim of preventing macro - re - entry - dependent arrhythmias ; several studies reported that additional lines improve the efficacy of the procedure . the downside of this approach becomes evident when the lines are not electrically continuous ; in those cases , atrial tachycardia frequently develops . in order to reduce macro - re - entry arrhythmias recurrences , the operator should validate the presence of a bidirectional conduction block across all ablation lines . cfae ablation was proposed by nademanee et al . ; it can be used alone or in combination with pv isolation . manifest controversies still exist concerning the usefulness of this approach because it frequently requires wide left atrial ablation , and it is hampered by a high post - procedural atrial tachycardia rate . in the rasta ( randomized ablation strategies for the treatment of persistent atrial fibrillation ) study , 1-year af - free survival was significantly lower in patients treated with the standard approach ( pv isolation + ablation of documented non - pv triggers identified by a standard stimulation protocol ) plus cfae ablation compared with the standard approach alone or the standard approach combined with the empirical ablation at common non - pv trigger sites . recent evidence demonstrated that electrical rotors have a key role in sustaining af in humans . a computational approach was used to analyze the repolarization and conduction dynamics with the aim of reconstructing spatio - temporal af maps ; ablation guided by identification of focal impulses and rotors improved the overall procedure success . results of catheter ablation in patients with non - paroxysmal af are still not satisfactory . in the meta - analysis by ganesan , rates of single - procedure success for non - paroxysmal af ablation were 50.8% ( 95% ci 34.3% to 67.2% ) at 1 year and 41.6% ( 95% ci 24.7% to 60.8% ) at 3 years . the pooled 12-month success rate after a single procedure was 51.9% ( 95% ci 33.8% to 69.5% ) ; it increased to 77.8% ( 95% ci 68.7% to 84.9% ) when multiple procedures were used ( average number of procedures : 1.67 ) . | atrial fibrillation ( af ) is associated with increases in the risk of mortality , congestive heart failure , and stroke .
medical treatment is aimed at preventing thrombo - embolic complications and reducing symptoms and consequences related to the arrhythmia . in the first section of this review , we discuss the principles of mainstream oral anticoagulant therapy and the possible advantages of the new oral anticoagulants . in the second section ,
we review the catheter ablation approaches to paroxysmal and persistent / long - standing af , their results , and the current application of new catheters . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the major complication of type 2 diabetes mellitus ( t2 dm ) is atherosclerosis , and it is the main cause of death in diabetic patients [ 13 ] . however , the mechanism remains poorly understood , especially the direct relation between microalbuminuria and vascular wall elasticity in t2 dm . several researches studied the relation between arterial stiffness and microalbuminuria in diabetes by pulse wave velocity ( pwv ) and echo - tracking technique [ 46 ] . in this study , we used real - time ultrasound ( us ) elastography to evaluate the elasticity of carotid arterial wall in t2 dm with microalbuminuria . the real - time us elastography is a newly developed ultrasound technique which provides an estimation of tissue stiffness . and it became a focus in recent years . the us elastography has been mainly applied to the studies of breast , thyroid gland , and prostate [ 79 ] . the study included 210 consecutive patients of t2 dm in the department of endocrinology of 2nd affiliated hospital of dalian medical university from february 2009 to february 2011 . type 1 diabetes mellitus , hypertension , history of ischemic heart disease , renal impairment ( serum creatinine > 150 umol / l ) , and valvular heart diseases were excluded . the clinical conditions that could cause transient elevations in urinary albumin excretion , such as exercise , urinary tract infection , and febrile illness , were also excluded . according to the level of urinary albumin excretion ( uae ) , 210 patients of t2 dm were divided into two groups : t2 dm without microalbuminuria ( t2dm1 group , uae < 30 mg/24 h ; 120 cases , 65 males and 55 females ; mean age , 55.33 9.58 years ; age range , 2778 years ; diabetes duration , 6 months5 years ; treatment with diet or oral drugs ) and t2 dm with microalbuminuria ( t2dm2 group , 30 mg/24 h < uae < 300 mg/24 h ; 90 cases , 48 males and 42 females ; mean age , 58.89 12.20 years ; age range , 4180 years ; diabetes duration , 6 months10 years ; treatment with diet or oral drugs ) . carotid artery us elastography was performed using a real - time ultrasound scanner : hitachi eub 7500 with a linear 315 mhz probe ( hitachi medical systems , tokyo , japan ) . the scanner is equipped with a dedicated software to provide an accurate measurement of tissue elasticity . b - mode sonographic examinations were performed in transverse and longitudinal planes of the right carotid with the patients supine . in b - mode display , the elastographic mode was performed to show double images of b - mode and elastography in the meantime . a rectangular region of interest ( roi ) box covered at least 3 times of diameter of carotid artery . the probe compression on the carotid region was standardized by real - time measurement displayed on a numerical scale ( levels from 15 ) . the levels from 24 the ultrasound elastographic images were displayed with different color mapping including red ( softest component ) , green ( intermediate stiffness ) , and blue ( hardest component ) according to the different levels of strain . on a representative static image , the relative strain ratio ( sr , blood to carotid arterial wall strain ratio ) was measured . the first roi ( a ) for the arterial wall strain was manually drawn and placed in approximate midpoint of posterior wall of displayed carotid artery . the second roi ( b ) for the blood strain was placed in the center of arterial cavity . the distance between roi ( a ) and roi ( b ) should be almost the same in different scannings . sr was calculated by dividing strain value of the blood by that of carotid arterial wall . and sr was calculated automatically by an embedded software in the ultrasound scanner . the mean intraobserver and interobserver coefficients of variation were 4.5% and 3.1% for mean sr , respectively . the between - observer pearson 's correlation coefficient was 0.90 for mean sr . all laboratory assays were performed at the clinical laboratory unit of the second affiliated hospital of dalian medical university . the following laboratory parameters were obtained : total cholesterol ( tc ) , triglyceride ( tg ) , low density lipoprotein ( ldl ) , high density lipoprotein ( hdl ) , hemoglobin a1c ( hba1c ) , fasting plasma glucose ( fpg ) , postprandial 2 hours plasma sugar ( 2hpg ) , and urinary albumin excretion ( uae ) . serum concentrations of tc , tg , ldl , hdl , fbg , and 2hpg were measured by enzymatic method . hba1c was measured by high performance liquid chromatography ( bro - rad company , usa ) . uae was obtained by a 24-hour urine collection ( by one determination ) . body mass index ( bmi ) blood pressure was measured with a standard mercury sphygmomanometer after at least 10 min rest in the sitting position . the software of spss version 13.0 for windows ( spss inc , il , usa ) was used for statistical analysis . during the 24-month study period , 210 consecutive t2 dm patients with or without microalbuminuria were screened . the mean sr value sd of t2dm2 group ( 1.56 0.45 ) was significantly higher than that of t2dm1 group ( 1.10 0.24 , p < 0.05 ) ( figures 1 and 2 , table 1 ) . the mean values sd of 2hpg , bmi , tc , uae , and hba1c of t2dm2 group were significantly higher than those of t2dm1 group ( p < 0.05 for all ) ( table 1 ) . there were no significant difference in systolic blood pressure , diastolic blood pressure , tg , ldl , hdl , fpg between t2dm1 and t2dm2 groups ( p > 0.05 for all ) ( table 1 ) . in univariate analysis , sr was positively and significantly associated with uae ( r = 0.456 , p < 0.05 ) and hba1c ( r = 0.435 , p < 0.05 ) , systolic blood pressure ( r = 0.235 , p < 0.05 ) . the real - time us elastography is a newly developed dynamic technique which can obtain information on tissue stiffness and strain noninvasively [ 10 , 11 ] . it can evaluate the degree of distortion of a tissue under an external force on the basis that the softer tissues deform easier than the harder one . in term of strain in real - time us elastography , the strain images are showed in a color map . the red represents greatest elastic strain which is the softest , and the blue represents no strain which is the hardest . the present study has clearly shown that the mean sr value sd of t2 dm patients with microalbuminuria was significantly higher than that in t2 dm patients with normoalbuminuria . and sr was positively and significantly associated with uae . the results suggested that microalbuminuria in t2 dm may have an effect on elasticity of carotid arterial wall . our findings were in accordance with the previous studies which evaluated the arterial wall elasticity in t2 dm patients with microalbuminuria by pulse wave velocity ( pwv ) and echo - tracking technique [ 68 ] . but the mechanism underlying the relationship between microalbuminuria and atherosclerosis in t2 dm patients is still unknown ; in particular , little is known on the direct relationship between microalbuminuria and carotid arterial wall properties . there were reports that increased uaer could reflect a generalized vascular dysfunction which was caused by structural alterations , such as a reduction in the density of heparan sulfate - proteoglycan ( hs - pg ) and/or the sulphation of hs within the extracellular matrix of the glomerular basement membrane and vascular wall [ 12 , 13 ] . it is a normal component of glomerular basement membrane , endothelial vascular surface , and basement membrane of vascular smooth muscle cells . furthermore , many proteins , such as lipoprotein lipase , tissue factor pathway inhibitor , platelet factor 4 , and antithrombin iii , are anchored to the vascular wall through interaction with the chains of hs - pg , which may enhance albuminuria and processes involved in atherogenesis [ 1416 ] . stehouwer et al . found that microalbuminuria was linearly associated with impaired endothelium - dependent , flow - mediated vasodilation in elderly individuals without and with diabetes . it is possible that endothelial leakiness , as reflected by uae , is in part a primary and possibly genetically determined vascular risk factor or that it mirrors the endothelial dysfunction featuring the atherosclerotic process or arises from the action of yet unknown risk factors . in the present study , the result showed that the value of hba1c in t2 dm patients with microalbuminuria was significantly higher than that in t2 dm patients with normoalbuminuria . hba1c maybe play an important role in the relationship between carotid arterial wall elasticity and microalbuminuria . clinically , hba1c is regarded as a useful method of screening and diagnosing diabetes . and the previous study showed that ages are widespread in the diabetic vascular system and contribute to the development of atherosclerosis . ages contribute to many microvascular and macrovascular complications through the formation of bridgings between molecules in the basement membrane of the extracellular matrix by joining the receptor for advanced glycation end products ( rage ) . concerning microalbuminuria , it was reported that the accumulation of ages in the glomerular and tubulointerstitial spaces correlates with the severity of diabetic nephropathy . first , some t2 dm patients have already been treated for diabetes and hyperlipidemia which may lead to inaccuracy of the results . second , in the process of real - time us elastography , in order to get a relevant conclusion , either high or overly low pressure on the skin must be avoided . we chose the pressure of moderate degree according to a visual indicator displayed by a numerical scale on the screen . our data show that there is an association between microalbuminuria and carotid arterial wall elasticity in t2 dm patients . the decreased arterial wall elasticity caused by atherosclerosis real - time us elastography can evaluate carotid arterial wall elasticity in t2 dm with microalbuminuria accurately and efficiently . however , larger and further studies are needed to confirm our results and hypothesis . | the aim of this study was to evaluate carotid arterial wall elasticity in type 2 diabetes mellitus ( t2 dm ) with microalbuminuria by real - time ultrasound elastography .
two hundred and ten t2 dm patients were divided into two groups according to levels of urinary albumin excretion ( uae ) : t2 dm without microalbuminuria ( t2dm1 group , 120 ) and t2 dm with microalbuminuria ( t2dm2 group , 90 ) .
the right common carotid arteries were examined by real - time ultrasound elastography .
the strain ratio ( sr , blood to arterial wall strain ratio ) was calculated by dividing the strain value of the blood by that of the carotid arterial wall .
the correlation between sr and general data was analyzed .
the mean sr value sd of t2dm2 group was significantly higher than that of t2dm1 group ( p < 0.05 ) .
sr was positively and significantly correlated with uae , hba1c , and systolic blood pressure ( r = 0.456,0.435,0.235 , p < 0.05 for all ) .
the mean value sd of uae , hba1c , 2hpg , bmi , and tc of t2dm2 group was significantly higher than that of t2dm1 group ( p < 0.05 for all ) . in conclusion
, there is an association between microalbuminuria and carotid arterial wall elasticity in t2 dm patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the intensive care unit ( icu ) is a place where physicians and nurses provide continuous monitoring and life support care . despite improving patients ' outcomes the care of patients should ultimately serve as to provide optimal outcome as well as the adequate use of resources . in addition , length of stay standardized for severity and type of illness and unplanned readmission rates are important outcomes ; the classic outcome variable is mortality rate the appropriate timelines of care and availability of complex tests and therapy are even more important in the first hours after admission to an icu , when patients are more likely to be unstable and require extreme resuscitative measures . although admission of patients who are unstable to icus occurs 24 h a day , not all icus maintain the same level of staffing during off - hours , that is , during nighttime , weekends , and holidays . a number of studies have demonstrated that icus with mandatory intensivist consultation or closed icu are associated with reduced mortality when compared with units with low - intensity physician staffing . several cohorts have shown an increased risk of death for patients admitted during off - hours , while others showed a surprising protective effect . among various approaches , pabon lasso 's ( pl ) model has proved itself to be one of the most useful models in assessing performance in patient health services . this model makes an overall assessment of hospital performance with the use of three indices ; bed turnover ( bto ) , bed occupancy rate ( bor ) , and average length of stay ( als ) . our objective was to compare different variables concerning icu performance and mortality to optimize icu performance and patient care . from march 2008 to march 2012 , all admission records of 10-bed medical icu of a teaching general hospital with 358 beds were retrieved from hospital information system ( his ) . the outputs of his included the chart and card numbers , age , gender , date of admission and discharge , and outcome . to evaluate the icu performance during this 5-year period , we calculated the als , bto , bor , and turnover interval ( ti ) through the following definitions and formula . als refers to the average number of days that a patient stays in a hospital . bto is a measure of productivity hospital beds and represents the number of patients treated per bed in a defined period of time ( usually a year ) . bor indicates the percentage of beds occupied by patients in a defined period of time , usually a year . bor = 100 ( als admissions / number of beds 365 ) . pl technique provides a graphical method that makes use of the three indicators ( bto , bor , and als ) concurrently in assessing the relative performance of hospital wards . according to figure 1 , the horizontal and vertical demarcations represent the mean values of the bto ratio and 70% bor based on the standard of iranian ministry of health . the pabon lasso 's model and the interpretation of each zone ( bto ; bed turnover , bor ; occupancy rate ) all data were analyzed by the statistical package for the social sciences software version 11.5 ( spss inc . comparisons between groups were analyzed using unpaired two - tailed t - test , mann whitney test , chi - square test , or fisher 's exact test as appropriate . a total of 1719 patients were studied from march 2008 to march 2012 . the mean sd ( median ) of age and length of icu stay were 44.28 21 ( 40 ) and 9.16 12.9 ( 4.65 ) , respectively . more men were admitted in our medical icu than women ( 54% vs. 46% ) . the overall mortality rate was 29.1% during the period of study [ table 1 ] . as shown in figure 2 , the peak of admission was between 10 pm and 4 am and the least was between 6 am to 8 am and 9 am to 11 am that could be explained by the shifting time of nursing staffs . figure 3 shows admissions on different days of the week , with the highest admission rate on wednesdays . mean length of stay , age , and time of admission of patients based on outcome in a medical intensive care unit of a teaching hospital , shiraz , iran , 2008 - 2012 the frequency and distribution of admissions and mortality based on time of admission in a medical intensive care unit of a teaching hospital , shiraz , iran , 20082012 . the frequency and distribution of admissions and mortality based on day of the week of admission to a medical icu of a teaching hospital , shiraz , iran , 20082012 . pl 's graph of icu performance showed an ascending trend from 2008 to 2010 , and then it became flat to descending during 20112012 [ figure 4 ] . while during 20082010 , the slope of the median of icu stay increased slowly it has had sharp increment in 2012 and subsequently our medical icu accepted fewer patients with higher occupancy rate than 20082011 [ table 2 ] . the status of the medical intensive care unit of shahid faghihi hospital , shiraz , iran , based on pabon lasso 's model 20082012 . data on the performance indicator of a medical intensive care unit in a teaching hospital , shiraz , iran , 2008 - 2012 there were no significant differences in icu mortality and length of stay between patients admitted during office hours and nonoffice hours . moreover , statistical analyses showed that hospital mortality rates were not significantly higher on weekends , at night , or any day of the week . this implies that our icu had a good quantitative performance 24 h a day , 7 days a week . our study showed that 20.1% of icu admissions occurred during weekends and 55% during nights ( 21:007:00 ) . as a result , a remarkably high proportion ( 75.1% ) of patients was admitted during nonoffice hours . other studies have reported similar findings where 65.6%69% of icu admissions occurred during weekends or at night . appropriate management during the first few hours after admission in the icu is crucial for the clinical outcomes of critically ill patients ; it is very important to maintain a good quantitative performance during nonoffice hours . the 2003 society of critical care medicine guidelines for adult icus have recommended a 24-h in - house coverage by intensivists who are dedicated to the care of icu patients and do not have conflicting responsibilities . although the differences were not significant , the rate of hospital death was lower for patients admitted to the icu at night ( 14.1% ) , compared to those admitted during the day ( 15% ) ( p = 0.417 ) . mortality was also higher during nonoffice hours during the day ( 13:0021:00 ) compared with office hours ( 7:0013:00 ) . on the other hand , the rate of hospital death was not higher for patients admitted to the icu on weekends ( 5.7% ) , compared with those admitted on weekdays ( 23.4% ) ( p = 0.735 ) . these results could be related to the staffing pattern in our icu where resident physicians and critical care nurses staffed the icu in - house at constant levels every day of the week and 24 h a day , while dedicated intensivists led the morning rounds on every day of the week but did not stay in - house overnight . we had fewer icu admissions ( 20.1% ) and no conferences or classes on weekends . with the same staffing levels , the lighter workload might have resulted in better patient care and therefore , lower hospital mortality for patients admitted on weekends . table 2 shows bto , length of stay , and occupancy in our icu throughout the 5 years of our study . according to pl 's model , except for 2012 , our icu was in zone iii , with a high bto rate and a high occupancy [ figure 4 ] . although the aging of population and increases in underlying comorbidities in community could prolong icu stay , we think the main explanation for decrement in bto in 2012 was due to changes in intensivist 's team controlling icu admissions and management . during 20082010 , four pulmonologists were in charge for patients ' admission and their management , while during 20112012 , two of them retired and two newly graduated pulmonologists were involved . nevertheless , we had an acceptable quantitative performance in our icu with a small proportion of unused beds . while his was started in late 2007 in our hospital , the clinical information system ( cis ) section has not been accepted by our physicians hence , data regarding the underlying comorbidities and apache scores were not available and we could not exactly compare the severity of diseases among our patients during the study period . another limitation was that our study was single centered and based on a university hospital . in conclusion , our results showed that nonoffice hour icu admissions were not associated with poorer outcomes in a medical icu equipped with patient management guidelines and staffed by intensivists who were on - call for 24 h and led the morning rounds on every day of the week , but did not stay in - house overnight . moreover , the time of day and day of the week admissions to our icu were not associated with significant differences in hospital mortality . | patient care in the intensive care unit ( icu ) is complex and expensive , serving to provide optimal outcome as well as the adequate use of resources .
our objective was to determine variables associated with admission practices , processes of care , and clinical outcomes for critically ill patients .
admission records of a 10-bed icu were gathered during a 5-year period .
variables such as average length of stay , bed turnover , bed occupancy rate , and turnover interval were evaluated . of the 1719 patients evaluated , 54% were men .
mortality was highest between 10 pm and 2 am .
there was no significant difference in icu mortality during different days of the week .
we showed that nonoffice hour admissions were not associated with poorer clinical outcomes , and significant differences in icu mortality and icu length of stay were not seen .
moreover , hospital mortality rates were not significantly higher for patients admitted to our icu on weekends , at nights , or any day of the week . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
arthroscopic debridement and bone marrow stimulation is considered the primary treatment of osteochondral talar defect ( ocd ) and yields 85% success . in case of failure of the primary treatment , current secondary treatment options include repeat arthroscopic debridement and bone marrow stimulation , osteochondral autograft transfer , autogenous cancellous bone graft , and autologous chondrocyte implantation [ 4 , 8 , 9 , 20 , 23 ] . however , these techniques are sometimes associated with donor - site morbidity or involve two - stage surgery [ 2 , 3 , 13 , 14 ] . in order to treat ocds of the medial talar dome after failed primary treatment , a contoured articular inlay implant ( hemicap , arthrosurface inc . , franklin , ma , usa ) with a diameter of 15 mm was developed . fifteen articular component offset sizes are available , based on the surface anatomy of the medial talar dome . in a cadaveric study , the offset sizes were found appropriate for a variety of talar specimens . furthermore , it was shown that a slightly recessed implantation level prevents high contact pressures . clinical goals of the implant are to offer relief of pain and swelling , return to activity , and prevent ( further ) cyst formation . a two - year result of the first patient who was treated with the novel implant is reported . the last procedure was 1 year and 2 months before her presentation . at presentation , the patient s predominant symptom was pain deep in the ankle joint during and after activity . she used to play korfball at competitive level but had stopped due to the pain . korfball is a mixed gender team ball game , similar to mixed netball and basketball , and is very popular in the netherlands . at physical examination , leg alignment was neutral , the range of motion was normal and symmetric , and both ankle joints were stable . radiographs of the right ankle revealed a large cystic osteochondral defect of the medial talar dome ( fig . 1 ) . a computed tomography scan confirmed the osteochondral defect , measuring 17 8 8 mm , accompanied by some small subchondral cysts and a loose fragment . 1preoperative anteroposterior mortise view and lateral radiographs of the affected ankle showing a radiolucent osteochondral defect in the medial talar dome ( arrow ) preoperative anteroposterior mortise view and lateral radiographs of the affected ankle showing a radiolucent osteochondral defect in the medial talar dome ( arrow ) a curved skin incision was made over the medial malleolus . after two screw holes were predrilled in the medial malleolus , a medial malleolar osteotomy was made at an angle of 30 degrees relative to the long tibial axis , exposing the osteochondral defect ( fig . a the talar lesion was exposed through an oblique medial malleolar osteotomy , and the necrotic fragment was excised ( arrow ) . b after the insertion of a screw and the determination of the appropriate offset sizes , a trial articular component ( arrow ) was placed . c the final articular component ( a ) was orientated in the correct plane and placed on the screw ( s ) . d final view of the talus after engagement of the articular component ( arrow ) . note that the edges of the implant are slightly recessed compared to the adjacent cartilage level intraoperative pictures of the operative technique . a the talar lesion was exposed through an oblique medial malleolar osteotomy , and the necrotic fragment was excised ( arrow ) . b after the insertion of a screw and the determination of the appropriate offset sizes , a trial articular component ( arrow ) was placed . c the final articular component ( a ) was orientated in the correct plane and placed on the screw ( s ) . d final view of the talus after engagement of the articular component ( arrow ) . note that the edges of the implant are slightly recessed compared to the adjacent cartilage level the defect was debrided . utilizing a drill guide , a guide pin was placed into the center of the defect , perpendicular to the curvature of the medial talar dome . a contact probe was used to determine the radius of curvature ; an offset size of 0.5 3.5 mm was measured . the osteotomy was fixated with two 3.5-mm lag screws , and the wound was closed . the postoperative management was initiated with a plaster cast for 1 week and continued with a functional brace ( walker , ssur , son en breugel , the netherlands ) for 5 weeks . after this 6-week period , radiographs of the operated ankle confirmed consolidation of the malleolar osteotomy . initially , there was a small area of numbness about the scar but this had resolved at 3 months follow - up . the patient was able to play korfball at the preinjury level after 1 year and continued to play at this level at 2 years follow - up . the sagittal range of motion arc remained slightly reduced : 15 of dorsiflexion to 45 of plantar flexion compared to 20 of dorsiflexion to 45 of plantar flexion in the left ankle . using numeric rating scales , the patient preoperatively rated the pain as 0 when at rest , 8 when walking , and 10 when running . these numbers improved to 0 , 0 , and 1 at final follow - up , respectively . the foot and ankle outcome score improved from preoperatively to final follow - up on four of five subscales ; the subscale other symptoms decreased due to subjective inability to fully straighten and bend the ankle . the american orthopaedic foot and ankle society ankle - hindfoot score improved from 74 preoperatively to 90 at 1 and 2 years . the implant remained in position , and there were no signs of osteolysis or progressive degenerative changes in the ankle joint ( fig . there are no implant - related complications or progressive degenerative changes of the ankle joint when compared to preoperatively radiographs after 2 years follow - up . there are no implant - related complications or progressive degenerative changes of the ankle joint when compared to preoperatively after two screw holes were predrilled in the medial malleolus , a medial malleolar osteotomy was made at an angle of 30 degrees relative to the long tibial axis , exposing the osteochondral defect ( fig . a the talar lesion was exposed through an oblique medial malleolar osteotomy , and the necrotic fragment was excised ( arrow ) . b after the insertion of a screw and the determination of the appropriate offset sizes , a trial articular component ( arrow ) was placed . c the final articular component ( a ) was orientated in the correct plane and placed on the screw ( s ) . d final view of the talus after engagement of the articular component ( arrow ) . note that the edges of the implant are slightly recessed compared to the adjacent cartilage level intraoperative pictures of the operative technique . a the talar lesion was exposed through an oblique medial malleolar osteotomy , and the necrotic fragment was excised ( arrow ) . b after the insertion of a screw and the determination of the appropriate offset sizes , a trial articular component ( arrow ) was placed . c the final articular component ( a ) was orientated in the correct plane and placed on the screw ( s ) . d final view of the talus after engagement of the articular component ( arrow ) . note that the edges of the implant are slightly recessed compared to the adjacent cartilage level the defect was debrided . utilizing a drill guide , a guide pin was placed into the center of the defect , perpendicular to the curvature of the medial talar dome . a contact probe was used to determine the radius of curvature ; an offset size of 0.5 3.5 mm was measured . the osteotomy was fixated with two 3.5-mm lag screws , and the wound was closed . the postoperative management was initiated with a plaster cast for 1 week and continued with a functional brace ( walker , ssur , son en breugel , the netherlands ) for 5 weeks . after this 6-week period , radiographs of the operated ankle confirmed consolidation of the malleolar osteotomy . initially , there was a small area of numbness about the scar but this had resolved at 3 months follow - up . the patient was able to play korfball at the preinjury level after 1 year and continued to play at this level at 2 years follow - up . the sagittal range of motion arc remained slightly reduced : 15 of dorsiflexion to 45 of plantar flexion compared to 20 of dorsiflexion to 45 of plantar flexion in the left ankle . using numeric rating scales , the patient preoperatively rated the pain as 0 when at rest , 8 when walking , and 10 when running . these numbers improved to 0 , 0 , and 1 at final follow - up , respectively . the foot and ankle outcome score improved from preoperatively to final follow - up on four of five subscales ; the subscale other symptoms decreased due to subjective inability to fully straighten and bend the ankle . the american orthopaedic foot and ankle society ankle - hindfoot score improved from 74 preoperatively to 90 at 1 and 2 years . the implant remained in position , and there were no signs of osteolysis or progressive degenerative changes in the ankle joint ( fig . there are no implant - related complications or progressive degenerative changes of the ankle joint when compared to preoperatively radiographs after 2 years follow - up . there are no implant - related complications or progressive degenerative changes of the ankle joint when compared to preoperatively this prospective case report is the first clinical report of a metal implant for ocds of the talus and gives an insight into the surgical technique and clinical follow - up . treatment of osteochondral lesions or osteonecrosis by means of metal resurfacing implants is relatively new . during the past 3 years , promising clinical results were reported for the treatment of the femoral and humeral head , as well as the first metatarsal and patellar surface . two biomechanical cadaveric studies provided foundations for use of the talus implant in the ankle joint [ 1 , 22 ] . the ideal indications for treatment with this implant are not yet known . the authors consider its use in patients with a large ocd on the medial talar dome who have clinically significant pain more than 1 year after primary surgical treatment . the following are regarded as contraindications : age < 18 years , ocd size > 20 mm , ankle osteoarthritis grade ii or iii , concomitant ankle pathology , advanced osteoporosis , infection , diabetes , or a known allergy to implant material . the surgical approach is an important part of the implantation technique because the accuracy of implantation of this device strongly depends on the approach and quality of vision . for adequate exposure the osteotomy is ideally directed toward the intersection between the tibial plafond and medial malleolus at an angle of 30 relative to the long tibial axis . although there are other osteotomy options , including anterior tibial , step - cut , and inverted v or u osteotomies , the oblique osteotomy is our preferred technique because it is relatively simple , exposure of the talus is excellent , and congruent reduction is well possible [ 12 , 17 , 21 ] . the surface of the prosthetic device should be placed slightly recessed relative to the surrounding surface of the talar cartilage because talar cartilage deforms during weight bearing while the implant does not . wan et al . measured a peak cartilage deformation of 34.5 7.3% under full body weight in persons with a medial talar dome cartilage thickness of 1.42 0.31 mm . we therefore aim at an implantation level of 0.5 mm below the adjacent cartilage . this implantation level was found appropriate in a previous cadaveric study . when the prosthetic device is correctly implanted , excessive contact pressures of the implant are avoided . while there are various offset sizes , each articular component has a diameter of 15 mm . this is based on the finding that primary arthroscopic treatment is generally successful for lesions up to 15 mm , while this treatment is less successful for larger lesions . the part of the ocd that was not covered by the implant is expected to be filled by fibrocartilaginous tissue . alternative current treatment methods for this patient are osteochondral autograft transfer system ( oats ) , cancellous bone grafting , an allograft , ankle arthrodesis or prosthesis . oats and cancellous bone grafting carry the risk of donor - site pain and are available in limited amounts [ 19 , 2 ] . ankle arthrodesis or prosthesis is definite solutions for a recurrent ocd but are rather not used in young patients . recently reported other treatment options are matrix - induced autologous chondrocyte implantation ( maci ) and engineered osteochondral grafts [ 5 , 16 ] . the metallic implantation technique appears to be a promising treatment for osteochondral defects of the medial talar dome after failed primary treatment . although the clinical and radiological results of this prospective case report with 2 years follow - up are promising , more patients and longer follow - up are needed to draw any firm conclusions and determine whether the results continue with time . | the primary treatment of most osteochondral defects of the talus is arthroscopic debridement and bone marrow stimulation .
there is no optimal treatment for large lesions or for those in which primary treatment has failed .
we report a 20-year - old female patient with persistent symptoms after two previous arthroscopic procedures . computed tomography showed a cystic defect of the medial talar dome , sized 17 8 8 mm .
the patient was treated with a novel contoured metal implant . at 1 and 2 years after surgery ,
the patient reported considerable reduction in pain and had resumed playing korfball at competitive level.level of evidence iv . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
gaucher disease is a glucosylceramide lipidosis caused by deficient acid -glucosidase ( glucocerebrosidase , gba ; ec 3.2.1.45 ) enzymatic activity mainly due to gba gene mutations , inherited as an autosomal recessive trait [ 1 , 2 , 3 ] . gaucher disease has been classified into three types according to clinical symptoms : non - neuronopathic ( type 1 ) , acute neuronopathic ( type 2 ) and subacute neuronopathic ( type 3 ) . type 1 is the most common variant and characterized by relatively later onset and slower progress than the neuronopathic types . while bleeding complications can be caused as a result of thrombocytopenia , spontaneous intestinal bleeding is extremely rare . we describe a patient with type 1 gaucher disease who was diagnosed with the disease by chance because of spontaneous intestinal hemorrhage . a 21-year - old male patient suffering from sudden rectal hemorrhage was admitted to a general hospital in july 2009 . emergent colonoscopy was performed with the findings of ( 1 ) a large amount of blood in the rectum and sigmoid colon and ( 2 ) oozing from eroded rectal mucosa . although the hemorrhage stopped spontaneously and did not occur again , the patient was referred to our hospital for further examinations . his past medical history was unremarkable except for occasional nasal bleeding during childhood . on physical examination , the abdomen was soft and flat ; a non - tender liver edge descended to 8.5 cm below the right costal margin , and the splenic tip was palpable 11.5 cm below the left costal margin . the laboratory data are summarized in table 1 . there were thrombocytopenia and slight leukocytopenia ( platelets 6.7 10/l , white blood cells 3,180/l ) . other laboratory findings disclosed : total bilirubin 1.4 mg / dl ( reference range 0.21.3 ) , direct bilirubin 0.5 mg / dl ( reference range 00.3 ) , and prothrombin time activity 77.0% ( reference range 90130 ) . to find out the cause of thrombocytopenia and leukocytopenia , we performed serology tests for infection with hepatitis b virus , hepatitis c virus , epstein - barr virus and helicobacter pylori ; however , there were no remarkable findings . anti - dna antibody test showed a titer of 1:40 ( reference range < 1:40 ) . his platelet - associated immunoglobulin g ( paigg ) level was elevated to 166 ng/10 cells ( reference range 9.025.0 ) , however anti - platelet antibody ( anti - platelet - binding igg ) was negative . the splenic and the superior mesenteric vein were dilated and tortuous , whereas no apparent cirrhotic change of the liver was observed ( fig . for further examination , especially for the differential diagnosis of idiopathic portal hypertension , we performed a liver biopsy . the liver biopsy specimen showed that numerous large cells with striated cytoplasm assembled in glisson 's capsule ( fig . the cells had abundant eosinophilic cytoplasm with a striated or fibrillar appearance like that of crumpled tissue paper , which is typical of gaucher cells . there was fibrous expansion of most portal tract areas , but bridging fibrosis was not seen . additional blood investigations revealed high values of acid phosphatase and angiotensin - converting enzyme ( ace ) concentrations ( table 1 ) , which is compatible with gaucher disease . the enzymatic activity of leukocyte -glucosidase , the measurement of which is necessary for the definitive diagnosis of gaucher disease , had decreased to 11.67 nmol / h / mg ( reference range 56.7674.85 ) [ 6 , 7 ] . we analyzed the seven common mutations ( n370s , 84gg , f213i , ivs2 + 1 , l444p , r463c and d409h ) in the gba gene as previously reported [ 8 , 9 , 10 ] with the informed consent of the patient and found the compound heterozygous mutations l444p / d409h . based on these results , we diagnosed the patient with gaucher disease type 1 . 60 u / kg body weight imiglucerase , a macrophage - targeted recombinant human glucocerebrosidase , was injected every 2 weeks . the liver and the spleen were sized down ( liver : from 23.3 15.4 20.3 cm to 22.1 15.3 17.9 cm ; spleen : from 12.8 10.5 21.1 cm to 11.8 9.4 17.3 cm ) . platelet counts number and ace concentration , a biomarker of the progress of gaucher disease , were also improved from 7.4 to 11.3 10/l and from 42.5 to 24.7 iu/l , respectively ( fig . gaucher disease patients are generally diagnosed by symptoms of hepatosplenomegaly or bone disease in childhood , whereas lesser degrees of hepatosplenomegaly occur in adults [ 2 , 3 ] . it is extremely rare that a patient with type 1 gaucher disease is diagnosed by chance because of spontaneous intestinal hemorrhage . some reports have described hemorrhagic complications as one of the clinical features of gaucher disease , which is mostly associated with thrombocytopenia due to splenomegaly or esophageal varices due to liver cirrhosis . hemorrhage of the stomach or intestine is uncommon ; a few cases of gastrointestinal hemorrhage associated with gastric ulcer or ileal lymphoid hyperplasia have been reported . in the present case , the patient did not have esophageal varices and hemorrhage was recognized at the rectum and sigmoid colon . the endoscopic biopsy specimen of rectal epithelium showed neither particular etiological features leading to hemorrhage nor gaucher cells ( data not shown ) . however , ct images showed that the splenic and the superior mesenteric vein were dilated and tortuous , suggesting portal hypertension . it is possible that portal hypertension due to liver enlargement participated in leading to rectal and colonic hemorrhage in the present case . the number of platelets immediately after sudden rectal hemorrhage was 10.3 10/l , which seems not enough to lead to hemorrhage . however , another possible candidate for the etiology of sudden hemorrhage is abnormality of platelet function . keisey et al . reported two gaucher disease patients complicating pseudo - pseudo bernard - soulier syndrome despite normalization of platelets counts after spleen removal . reported the occurrence of a high level of paigg in a case of gaucher disease with concurrent immune thrombocytopenic purpura . although anti - platelet antibody was negative , the paigg level was elevated in the present case ( table 1 ) . treatments for gaucher disease to be considered are reported to be ert , splenectomy and bone marrow transplantation [ 6 , 7 ] . the number of platelets increased at a rate of 53% , and the size of both liver and spleen decreased at the rate of roughly 20% within 6 months . patients with type 1 gaucher disease generally do not have neuropathic symptoms and lesser degrees of hepatosplenomegaly when their symptoms appear in adulthood . thus , the adult type 1 gaucher disease patient without bone disease , as in the current case , has poor presentation of specific symptoms , resulting in the disease being difficult to find unless a special event like hemorrhage occurs . in conclusion , although gaucher disease tends to be considered as a pediatric disease , we have to pay attention to adult gaucher disease as a differential diagnosis for cryptogenic thrombocytopenia . | a 21-year - old man with a history of sudden rectal hemorrhage was referred to our hospital .
examination disclosed thrombocytopenia and hepatosplenomegaly . a liver biopsy specimen demonstrated gaucher cells in glisson 's capsule .
additional investigations revealed a low level of leukocyte -glucosidase activity and common mutations of the glucocerebrosidase gene , l444p / d409h .
we diagnosed the patient with gaucher disease type 1 .
he underwent enzyme replacement therapy .
thrombocytopenia and hepatosplenomegaly improved at a rate of approximately 50 and 20% , respectively , within 6 months .
this case suggests that we must pay attention to adult gaucher disease as a differential diagnosis for cryptogenic thrombocytopenia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
apparatus
( note : if the project needs to be completed in a single test day , two mazes will be needed ) . the floor is constructed from plywood and walls from 1.5 cm ( 3/4 in ) shelving lumber cut to a 9 cm width . to permit visibility , the apparatus is composed of a start area , the arms of the y and a goal area . the start area is 9 8 cm , the arms are 5 19 cm and the goal area is 12 21 cm . all compartments of the maze need to be separated with manually operated guillotine doors that can be constructed of plexiglas . the two doors separating the arms from the goal area should have holes drilled in them such that odors from the goal area can reach the pups . a wood block ( 7 3.5 8.5 cm ) is used as a barrier between the start box and entry to an arm . a 7 cm notch is removed from the center divider permitting placement of an anesthetized reclining dam . with the goal area so divided , when pups enter from one of the arms , their access is restricted to either the rostral or caudal nipples of the lactating female . modeling clay placed around the reclining dam further restricts pups movements in the goal area . it is important that the pups , after entering the goal area , have essentially nowhere else to explore and nothing to distract them from nipple attaching . subjects the rats pups you will use need to be 15 and 18 days of age at testing . at 15 days , the eyes of the pups are just about ready to open . although pups as young as 12 days of age have been tested successfully in this procedure , the activity and mobility of the 15 day old pups make them ideal . if possible , pups from the same litter should be tested at each age , however , if it is necessary to test animals at both ages on one day , cross - litter comparisons should yield comparable results . design you will be comparing the non - match - to - sample performance of 15 and 18 day old pups . if you have two mazes and two litters of rats , you can complete the procedure in about two hours . if you have only one maze and one litter , you should not use the same pups for the two tests . you can ear punch the pups you used or paint their tails with a permanent marker pen to identify them . deprivation and adaptation groups of four to six pups are placed in the y - maze 14 to 16 hours prior to testing . all guillotine doors are removed permitting the animals to explore and adapt to the apparatus . the plastic lids over the various compartments must be secured firmly if not , you may find yourself hunting high and low for your subjects at the time of testing . the apparatus should be housed in a room that is maintained at normal room temperature . just prior to testing sodium pentobarbital ( 45 mg / kg ) can be used as the anesthetic but any injected anesthetic that will keep the dam deeply anesthetized for approximately 90 minutes will suffice . supplementary injections may have to be administered . although it may be more convenient , it is not necessary to use the mother of the litter being tested . figure 1 shows the dam lying on her side with all her nipples easily accessible . shape modeling clay around the dorsal surface of the dam and between the two goal compartments to keep pups from climbing behind her . insert the two guillotine doors that separate the goal area from the arms and place each pup in each goal compartment until it attaches to a nipple for 15 sec . testing a test trial on the forced run , only one arm is accessible , access to the other is blocked with the barrier . the pup is placed in the start box for a few seconds with the guillotine door down . the door is lifted and the rat allowed to find its way down the available arm until it reaches the goal door . when the animal contacts the goal door , lift it and allow the pup to attach to a nipple for 15 sec . detach the pup from the nipple and then immediately return it to the start box with the guillotine door in place . remove the arm barrier . open the door and allow the pup to choose an arm . to non - match - to - sample if it chooses that arm allow it to reach and touch the goal door , lift it , and allow the pup to attach to a nipple . if the pup selects the same arm as on the forced run , allow it to touch the goal door , but do not lift it . after the pup completes the two components of the trial , return it to the holding cage and select a new pup and repeat the procedure . test each pup in the same sequence to maintain a comparable inter - trial interval . if the pup made the correct choice on a previous trial , use the other arm as the sample on the next trial . if the animal incorrectly chooses , maintain the same arm from the previous trial as the sample . this procedure prevents the animal from developing a position preference and equalizes the reward given for each arm choice . design you will be comparing the non - match - to - sample performance of 15 and 18 day old pups . if you have two mazes and two litters of rats , you can complete the procedure in about two hours . if you have only one maze and one litter , you should not use the same pups for the two tests . you can ear punch the pups you used or paint their tails with a permanent marker pen to identify them . deprivation and adaptation groups of four to six pups are placed in the y - maze 14 to 16 hours prior to testing . all guillotine doors are removed permitting the animals to explore and adapt to the apparatus . the plastic lids over the various compartments must be secured firmly if not , you may find yourself hunting high and low for your subjects at the time of testing . the apparatus should be housed in a room that is maintained at normal room temperature . just prior to testing you should number the pups on their backs with a permanent marker pen . anesthetize a nursing dam and position her in the goal area . sodium pentobarbital ( 45 mg / kg ) can be used as the anesthetic but any injected anesthetic that will keep the dam deeply anesthetized for approximately 90 minutes will suffice . supplementary injections may have to be administered . although it may be more convenient , it is not necessary to use the mother of the litter being tested . figure 1 shows the dam lying on her side with all her nipples easily accessible . shape modeling clay around the dorsal surface of the dam and between the two goal compartments to keep pups from climbing behind her . insert the two guillotine doors that separate the goal area from the arms and place each pup in each goal compartment until it attaches to a nipple for 15 sec . testing a test trial is composed of two components , a forced run and a choice run . on the forced run , only one arm is accessible , access to the other is blocked with the barrier . the pup is placed in the start box for a few seconds with the guillotine door down . the door is lifted and the rat allowed to find its way down the available arm until it reaches the goal door . when the animal contacts the goal door , lift it and allow the pup to attach to a nipple for 15 sec . detach the pup from the nipple and then immediately return it to the start box with the guillotine door in place . to non - match - to - sample the pup must select the arm that was previously blocked . if it chooses that arm allow it to reach and touch the goal door , lift it , and allow the pup to attach to a nipple . if the pup selects the same arm as on the forced run , allow it to touch the goal door , but do not lift it . after the pup completes the two components of the trial , return it to the holding cage and select a new pup and repeat the procedure . test each pup in the same sequence to maintain a comparable inter - trial interval . if the pup made the correct choice on a previous trial , use the other arm as the sample on the next trial . if the animal incorrectly chooses , maintain the same arm from the previous trial as the sample . this procedure prevents the animal from developing a position preference and equalizes the reward given for each arm choice . at 15 days of age , rat pups should non - match - to - sample close to chance ( 50% of the time ) . at 18 days of age , the pups should non - match - to - sample more frequently than the 15-day - old pups . a t - test can be used to compare frequency of alternation in the two groups . the data is to track the acquisition of the alternation habit by calculating trial to successive criteria level . in learning studies , researchers often define a criterion level to be an indicator of learning , for example eight correct responses in ten trials . you can track an animals progress in acquiring nmts by computing the criterion level achieved at each trial within groupings of ten trials ( e.g. , trials 110 , 211 , 312 , etc . ) and recording the trial at which each successive criterion level has been achieved ( 1/10 at trial 1 , 2/10 at trial 3 , the older pups are likely to reach the 8/10 criterion level by the end of testing while the younger pups hover around 5/10 . you can use a t - test to compare the criterion level achieved by the pups in each age group . compute the mean trial at which each successive criteria level was achieved for each group . graph with criterion level on the ordinate and trial number on the abscissa to track the different acquisition rate of the pups at 15 and 18 days of age to structurally describe what you observed , you should analyze what the animal needs to remember in order to perform accurately . does accurate performance necessitate habitual repetition of a movement , generally termed reference memory , or does it seem to require a more transient memory of preceding events , i.e. , working memory ? you may want to read olton ( 1977 ) for a discussion of the relation between working and spatial memory . a functional explanation might make reference to foraging theory . according to foraging theory , when an animal visits one location , presumably depleting the resources at that location , it is adaptive to visit an alternate , non - depleted location ( olton et al . , 1981 ) . consider foraging behavior as an explanation for the behavior of the older pups and then critique it . the alternation behavior you observed has been analyzed as motivated by the detection of novelty ( gaffan and davies , 1982 ) . it is speculated that animals are attracted to a stimulus that is novel relative to previous stimuli experienced . how does this type of explanation help establish a linkage between the behavior seen in rats and the nmts performance of monkeys ? what evolutionary factors might account for the similarities and differences in the task used for rats and the task used for monkeys ? in just three days of development , the behavior of the rat pups has changed qualitatively . in that the older pups could successfully live independently from the dam , can you think of reasons why nmts behavior appears in the 18 day old pups ? describe ways to connect the pattern of behaviors you observed to the weaning process itself . finally , a lactating dam is not a design a variation of this experiment to evaluate whether the behavior of the younger pups is more adapted to a non - patchy resource . generate several hypotheses and see if you can design an experiment to test these hypotheses . what neural systems are needed to mediate the mechanisms that you hypothesized ? a classic analysis of the linkage of working memory to the hippocampus is olton ( 1977 ) . recent developments linking working memory to the frontal lobes in humans and primates can be found in beardsley ( 1997 ) . these results suggest there is a stage - like transition between the behavior of the younger and older pups . draw parallels between the behaviors you observed in this project and some models of human cognitive development . how might you be able to apply the insights obtained from animal behavior to principles of neural and cognitive development in people ? | between 15 and 18 days of age , rat pups develop an alternation strategy in a spatial non - match - to - sample task . adapting the rat pups to the apparatus by housing them in it overnight , the difference in behavioral patterns
can readily be observed in a single laboratory session .
the opportunity of the pups to nipple attach to an anesthetized dam serves as the reinforcer .
discussion questions are formulated that encourage students to analyze the behaviors structurally , functionally and developmentally . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
other signs and symptoms are the medial canthus mass , recurrent conjunctivitis , or infection ( dacryocystitis).4 in the kingdom of saudi arabia , dtc has become the second most common malignancy , behind only breast cancer , accounting for more than 10% of all cancers among women.5 the majority of these patients require adjuvant i therapy at some point ; only a small proportion of these patients can be at risk of i therapy - acquired nldo , which was the aim of our study . we also aimed to determine the correlation between nldo and i therapy along with other clinical and treatment parameters in dtc patients receiving i therapy in our population . after formal approval from the institutional ethics committee , the medical records of 864 patients , among a total of 1,192 patients , with confirmed dtc who were treated with i therapy in two major tertiary care hospitals during the period from july 2000december 2012 were reviewed using a computer - based institutional database system . patients with nldo were retrieved in the following manner : demographic information ( age at diagnosis and sex ) , as well as data regarding symptomatology , clinical procedures ( anterior rhinoscopy and jones fluorescein dye test ) , and i therapy doses in millicurie ( mci ) were collected . information on the different diagnostic imaging modalities used , including dacryoscintigraphy , computed tomography ( ct ) dacryography of the neck , and fluorodeoxyglucose positron emission tomography , was collected . data regarding the surgical intervention used , including balloon dilation , stenting , dacryocystorhinostomy ( dcr ) , type of dcr ( external or endoscopic endonasal ) , symptoms relief , and duration of relief were also recorded . any discrepancies in data acquisition were resolved by directly questioning the patients and treating physicians ( ear , nose , and throat , oncology , ophthalmology , and nuclear medicine ) . however , no attempt to systematize other associated sinonasal problems ( potential confounders ) of the patients was performed . the secondary endpoint was the correlation of nldo with i therapy ( as tested by pearson s correlation coefficients ) . efforts were made to minimize the effects of potential confounders , which were controlled using multivariate analysis . the kaplan meier method was used to predict the cumulative risk of nldo in our series . the secondary endpoint was the correlation of nldo with i therapy ( as tested by pearson s correlation coefficients ) . efforts were made to minimize the effects of potential confounders , which were controlled using multivariate analysis . the kaplan meier method was used to predict the cumulative risk of nldo in our series . among the 864 dtc patients who were treated with i therapy , 19 ( 2.2% ) were identified with nldo ( table 1 ) . no event of nldo was seen in any patient who was untreated with i therapy or was treated with i therapy doses below 150 mci . the mean age of the study population was 51.910.5 years ( range : 3972 years ) , and our population consisted of 15 females ( 78.9% ) and four males ( 21.1% ) , with a female - to - male ratio of 3.7:1 . the mean duration between the date of i therapy and the occurrence of apparent nldo was 11.64.1 months ( range : 6.520 months ) . dacryoscintigraphy allowed for the detection of 16 nldo with a sensitivity of 84.2% ( 95% confidence interval [ ci ] : 60.496.4 ) and a specificity of 99.6% ( 95% ci : 98.999.9 ) , while ct dacryography detected all cases of nldo with a sensitivity of 100% ( 95% ci : 82.2100 ) and a specificity of 100% ( 95% ci : 82.2100 ) . dcr was performed in 32 completely stenosed nasolacrimal ducts of 18 ( 94.7% ) patients either bilaterally ( 63.2% ) or unilaterally ( 26.3% ) . observation was planned for one patient ; but the patient had partial relief and was considered for dcr . among the dcr patients , complete recovery was obtained in 14 ( 73.7% ) patients , and partial relief was obtained in three ( 15.8% ) patients . the success rates of external dcr and endoscopic endonasal dcr were 85.7% and 66.7% , respectively . a significant correlation between nldo and i therapy doses above 150 mci multivariate analysis showed that i therapy doses above 150 mci and an age > 45 years were important prognosticators ( figure 1 ) . acquired nldo secondary to i therapy is an extremely rare complication in patients with dtc . in our cohort , the frequency of nldo of 2.2% is consistent with other reported results ( table 2).610 the incidence rate of nldo in the general population is lacking , despite a detailed medical literature search . in the majority of cases , the diagnosis is made upon the basis of spontaneous reporting of epiphora by the patients.6 this diagnostic delay leads to complete stenosis of the nasolacrimal ducts , and thus renders these patients to aggressive treatment.6 in the clinical setting , the jones fluorescein dye test is of significant value in nldo patients . one australian study has demonstrated that a negative single - drop jones fluorescein dye test is also predictive of symptomatic improvement after dcr in patients with nldo.11 the postulated mechanism for i therapy - acquired nldo is the direct uptake of i in the nasolacrimal duct membrane epithelial cells via the sodium ( na+)/iodide ( i ) symporter ( nis ) leading to radiation - induced cell damage ( inflammation and fibrosis / stenosis).9 the nis is a membrane glycoprotein that mediates i uptake in the thyroid gland and several other extrathyroid tissues ( salivary glands , lacrimal glands , and ciliary body of the eye).12 recently , morgenstern et al13 have reported the overexpression of nis in the nasolacrimal ducts using reverse transcriptase polymerase chain reaction and immunohistochemical analyses . in addition to the presence of sinonasal disease at the time of i therapy , the treatment may theoretically further decrease the flow in the nasolacrimal ducts and thus increase the exposure to i , which is secreted through the lacrimal system.3 the diagnosis of i therapy - acquired nldo is challenging . other possible causes ( allergic or viral conjunctivitis , keratoconjunctivitis sicca , trichiasis , canaliculitis , iritis , and functional causes of excessive tears ) should be ruled out to reach a definitive diagnosis of i therapy - acquired nldo.14
i therapy - acquired nldo is defined as : 1 ) the presence of nldo in i therapy - treated patients ; 2 ) an i dose nldo relationship ; 3 ) immediate onset of symptoms after i therapy ; and 4 ) the bilateral nature of nldo in most of cases . ct dacryography using diluted contrast medium was found to be an easy and highly sensitive tool to evaluate nldo in our cohort , which endorsed the findings of garcier et al.15 patients with incomplete nldo have an excellent outlook with the use of balloon dilation and stenting , as complete recovery of symptoms is observed in 100% of cases.3 although the literature supports the hypothesis of complete symptom recovery with observation alone , in a few cases of incomplete nldo , we did not find that observation was a feasible option . the reason for this can be explained by the fact that nldo is possibly a chronic radiation - induced injury that progresses over a period of time.16 the dcr success rate of 78.9% in our cohort is consistent with the findings of fonseca et al.6 however , the endoscopic endonasal dcr success rate of 60% is much inferior to that reported in the literature , which warrants more personnel training in this area in our region.17 because nldo impairs the quality of life of a patient significantly , prevention of nldo is a key issue . currently , there is no mechanism available to stop the blockage of i uptake in the nasolacrimal ducts via the nis during i therapy,3 and there is scant data available regarding the prophylactic use of 2-(s)-(3-aminopropylamino ) ethylphosphorothioic acid ( amifostine ) during i therapy.18 further , the effectiveness of topical saline drops , nasolacrimal duct massage , and delaying i therapy in patients with acute or chronic sinonasal problems as preventive measures needs to tested . low i therapy doses , whenever possible , can reduce the incidence of nldo.19 the limitations of our study were : 1 ) no systematic attempt to screen for nldo or the presence of other potential confounders ( sinonasal problems ) was performed ; and 2 ) the presence of possible selection and recall bias in our cohort . in conclusion , nldo following i therapy in dtc patients is an under - recognized and rare complication , especially at higher i doses ( .150 mci ) . a multidisciplinary approach ( nuclear medicine / oncology , ear , nose , and throat , and ophthalmology ) is very important in the prevention and treatment of nldo . | backgroundradioactive iodine 131 ( 131i ) therapy has long been used in the treatment of differentiated thyroid cancers ( dtc ) .
while salivary and lacrimal glandular complications secondary to 131i therapy are well documented , there is little in the literature addressing nasolacrimal duct obstruction ( nldo ) .
we aimed to evaluate the frequency of 131i therapy - acquired nldo , its correlation to 131i therapy doses , and the surgical treatment outcome of this rare side effect.methodsfrom 20002012 , a retrospective review of 864 among 1,192 patients with confirmed dtc who were treated with 131i therapy was performed to examine the frequency of nldo , its causative factors , as well as imaging , surgical intervention , and outcomes.resultsnineteen ( 2.2% ) patients were identified with nldo .
the mean age was 51.910.5 years ( range : 3972 years ) .
fifteen ( 78.9% ) were female and four were male ( 21.1% ) .
the mean individual 131i doses were 311.1169.3 millicurie ( mci ) ( range : 150600 mci ) .
the mean duration between the date of 131i therapy and the occurrence of nldo was 11.64.1 months ( range : 6.520 ) .
fourteen ( 73.7% ) patients had bilateral epiphora . computed tomography dacryography allowed for the detection of all nldo .
eighteen ( 94.7% ) patients underwent dacryocystorhinostomy .
complete recovery was obtained in 14 ( 73.7% ) patients .
age > 45 years and 131i therapy doses > 150 mci were significantly correlated with nldo ( p=0.02 and p=0.03 , respectively).conclusionnldo is an underestimated complication of 131i therapy in dtc patients .
clinicians should be aware of this rare complication for prompt intervention . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
vertebral artery dissection ( vad ) is an important cause of posterior circulation stroke in young and middle - aged patients . we present a case of a middle - aged male , who came with the complain of sudden onset headache , left - sided neck pain , and right - sided weakness which on neuroimaging revealed an extracranial left vad . a 46 years , nonhypertensive , nondiabetic , male presented with sudden onset headache , left - sided neck pain followed by difficulty in walking and right - sided weakness . no other significant history was found . on clinical examination , there was grade ii , power in the right upper and lower limb . contrast magnetic resonance imaging ( mri ) angiography with diffusion weighted sequence was performed which revealed acute infarcts in left occipital lobe [ figure 1a and b ] along with left vad involving cervical segment [ figure 2 ] . computed tomography ( ct ) brain and neck angiography with intravenous contrast was performed on siemens somatom definition flash 128 slice dual source , dual energy ct scanner which revealed linear , short segment ( 2.6 cm ) dissection of the left vertebral artery at the level of c5-c6 vertebrae with associated aneurysmal dilatation [ figures 3 and 4 ] . patient underwent digital subtraction angiography ( dsa ) which revealed , elevated intimal flap in the left vertebral artery with the development of false lumen showing stagnant contrast , suggestive of dissection , commonly referred as double barrel lumen [ figure 5 ] . apparent diffusion coefficient and diffusion - weighted ( b = 800 s / mm ) image showing acute infarct in the left occipital region . ( b ) apparent diffusion coefficient and diffusion - weighted ( b = 800 s / mm ) image showing acute infarct in the left occipital region ( a ) axial t1 fat suppressed image showing hypointense intimal flap . ( b ) contrast magnetic resonance imaging angiography showing left vertebral artery dissection ( a ) three - dimensional maximum - intensity projection computed tomography angiography showing vertebral artery dissection with focal dilatation of the involved segment . ( b ) three - dimensional volume rendering technique image showing vertebral artery dissection with focal dilatation of the involved segment computed tomography angiography axial section at c5-c6 vertebral level , shows hypodense intimal flap ( arrow ) digital subtraction angiography of left vertebral artery showing double barrel lumen with different contrast density since the extracranial vertebral artery was involved , conservative management was planned and the patient was started on oral anticoagulants and heparin . follow - up ct angiography after 6 months showed near complete regression of the left vad [ figure 6 ] . follow - up computed tomography angiography after 6 months showing near complete resolution of arterial dissection in the involved segment vad is an uncommon disorder with estimated annual incidence of approximately 1 - 1.5 cases/10,000 . however , it is an important cause of posterior circulation ischemia in young and middle - aged patients , female preponderance , and accounts for nearly one - fifth of such cases . dissection occurs , when blood under pressure finds its way into the vessel wall either leading to luminal narrowing and/or occlusion if the tear is sub - intimal , or formation of a pseudoaneurysm with potential risk of bleeding , if the dissection is sub - adventitial . headache and neck pain ( on the side of arterial dissection ) are important warning symptoms of dissection . although conventional catheter angiography has been the criterion standard for the diagnosis of arterial dissection , ct scanning , and magnetic resonance angiography are increasingly been used because of the inherently noninvasive nature of these modalities . various mri angiography techniques have been used ; these include three - dimensional time of flight , phase contrast techniques , a t1 or , occasionally , with a t2-weighted , fat suppression technique . computed tomography angiography ( cta ) has practical advantages such as the rapid acquisition of information in uncooperative patients , and in whom mri is contraindicated . dual energy technique provides an additional edge in vertebral arteries by enabling effective bone removal as most of the extracranial vertebral artery is covered by vertebral foramina . the most common finding seen in approximately 65% of patients with sub - intimal arterial dissection is a relatively smooth or slightly irregular , tapered , or spiraled luminal narrowing of the dissected segment . the double - barrel sign demonstrates a patent false lumen or the accumulation of blood beneath an intimal flap . management depends on the site of involvement . which states anticoagulation with heparin followed by oral warfarin therapy for extradural vad dissection and balloon / coil embolization or a surgical aneurysm clipping in cases of an intracranial involvement . imaging modality such as dual energy cta and mri can reliably and safely demonstrate the direct and indirect features of spontaneous vad . the routine use of dual energy cta and mri in stroke increases the detection of vad , therefore , promotes early diagnosis of vad , facilitating prompt initiation of appropriate management . | spontaneous vertebral artery dissection ( vad ) is relatively rare but an important cause of posterior circulation stroke .
a 46-year - male complaining of sudden onset headache , neck pain with right - sided neuro deficit in the form of hemiparesis was evaluated by contrast magnetic resonance imaging and dual - energy computed tomography ( ct ) and brain neck angiography which revealed a short segment extracranial left - sided vad , associated with acute infarct in the left occipital region .
the patient was managed conservatively and followed up for 6 months .
follow - up ct angiography after a period of 6 months revealed the near complete resolution of the arterial dissection in left vertebral artery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the allergic response in people with atopic disorders involves exposure of the immune system to the antigen ( leung 1998 ) , antigen presentation ( fokkens et al 1991 ) , mediator release with amplification signals ( grewal and flavell 1996 ; vercelli et al 1989 ) , and production of antigen specific ige , which binds to mast cells . ( ishizaka and ishizaka 1977 ) . upon re - exposure to the allergen , bridging of the mast cell bound allergen specific ige results in the release of preformed and newly synthesized bioactive and pro - inflammatory mediators ( hirano 1989 ) , which results in the symptoms of allergic rhinitis and chronic idiopathic urticaria , and contributes to the symptoms of atopic dermatitis and allergic asthma . the us food and drug administration ( fda ) approved an oral suspension of fexofenadine on october 16 , 2006 . the approval is for twice - daily dosing , for the treatment of symptoms associated with seasonal allergic rhinitis , in patients 2 to 11 years of age , and for the treatment of symptoms of chronic idiopathic urticaria , in patients 6 months to 11 years of age . the studies cited in this text provide information based upon other oral formulations of fexofenadine . information based upon efficacy studies financially supported only by the manufacturer is not included , unless stated in the text . morrison and sahasranaman ( 2007 ) administered fexofenadine 30 mg by tablet or by oral suspension to 53 normal adult subjects . their subjects reached maximum blood fexofenadine concentrations at 1 hour for the oral suspension and 1.5 hour for the tablet . they found equivalent areas under the curves for the oral suspension and the tablet formulation , suggesting bioequivalence of fexofenadine oral suspension and fexofenadine capsules . in a study focusing on the oral formulations , grubbe et al ( 2007 ) evaluated the pharmacokinetics of fexofenadine oral suspension in 50 children , aged 2 to 5 years , which demonstrated the mean maximum plasma concentration of 224 ng / ml , and the mean area under the plasma concentration curve of 898 ng - h / ml . in capsule formulations in a double - blind , two - way crossover study in children with allergic rhinitis ( with a mean age of 9.8 years , a mean height of 134 cm and a mean weight of 32.1 kg ) , simons et al ( 1996 ) administered 30 or 60 mg of fexofenadine as a capsule and demonstrated the mean maximum plasma concentrations after the 30 mg dose of 78 ng / ml , and the mean maximum concentrations after the 60 mg dose of 286 ng / ml . they found no dose - dependent kinetics in the doses studied and no difference in the clearance rates or the mean terminal elimination half - life values after both doses . in another capsule and tablet formulation study designed as open - label , randomized crossover studies in healthy male non - smokers 18 to 43 years of age , within 10% of ideal body weight , stoltz et al ( 1997 ) found that the relative bioavailability of fexofenadine capsules is 89% to 93% compared to the tablet formulation . food decreased the area under the curves by 17% for the capsule and by 25% for the tablet compared to administration of the fexofenadine under a fasting state . in an industry - based1 study , robbins et al ( 1998 ) studied the pharmacokinetics of fexofenadine in 24 healthy male adult volunteers . the drug was undetectable at 48 hours after a single dose , and percent drug recovered in the urine ranged from 7.6% to 11.8% . in another industry - based study , russell et al ( 1998 ) found similar pharmacokinetics , in healthy male adults , for both the single dose and twice - daily dose of fexofenadine , administered as an oral solution , with 80% of the administered drug passing through the intestinal tract ( russell et al 1998 ) . these two studies suggest that the majority of the drug is excreted through the intestinal tract , with a small component via the kidneys , mostly unchanged . although high doses of fexofenadine do not appear to provide much toxicity , interaction with other drugs that use the p450 cyp3a4 degradation pathway , p - glycoprotein and the organic anion transporter peptides , prominent transporter proteins , may increase the risks of adverse events ( shukla et al 2008 ) . concomitant exposure to prescription and non - prescription drugs , as well as food , may significantly alter the blood and tissue levels of medications , as well as alter the risks to those medications . factors that may affect the drug drug and drug food interactions include biodegradative pathways and transport mechanisms , particularly via the multi - drug transporters p - glycoprotein and organic anion transporter ( table 1 ) ( adenot et al 2004 ; akiyama et al 1988 ; baltes et al 2007 ; charuk et al 1994 ; chiou et al 2000 ; choi et al 1998 ; crowe et al 2006a , b ; didiodato and sharom 1997 ; doran et al 2005 ; ejsing et al 2007 ; elsinga et al 2004 ; faassen et al 2003 ; feng et al 2008 ; fromm 2000 ; garrigues et al 2002 ; gouaze et al 2005 ; hanko et al 2003 ; hayeshi et al 2006 ; ibrahim et al 2000 ; ito et al 1997 ; jette et al 1995 ; johnson 2002 ; ketabi - kiyanvash et al 2003 ; kim and kim 2002 ; king et al 2001 ; lee and lee 2002 ; leung and bendayan 1999 ; ling 1992 ; litman et al 2003 ; loo et al 2003 ; makowski and pikula 1997 ; mollgard et al 2001 ; neuhoff et al 2000 ; orlowski and garrigos 1999 ; pascaud et al 1998 ; rebbeor and senior 1998 ; safa and safa 2004 ; savolainen et al 2002 ; schinkel et al 1996 ; sharom 1997 ; shirasaka et al 2006 ; shukla et al 2008 ; smit et al 1998 ; storch et al 2007 ; terao et al 1996 ; wang et al 2006 ; weiss et al 2003 ) . although sterioisomers are commonly found to have some preferential biological and pharmacological effects ( bielory et al ) , miura et al ( 2007 ) did not find any difference in the pharmacokinetics of fexofenadine enantiomers in healthy subjects . in addition , alfentanil , a selective inhibitor of the p450 cyp3a4 degradative pathway , did not significantly compete with fexofenadine ( kharasch et al 2005 ) . therefore , it appears that fexofenadine does not significantly interact with the p450 cyp3a degradative pathway . however , in a study using mdr1a/1b knockout mice , tahara et al ( 2005 ) showed that p - glycoprotein does have a role in moving fexofenadine from the brain to the plasma , and from the plasma to the liver , but had no effect on fexofenadine biliary excretion . cvetkovic et al ( 1999 ) found that the human organic anion transporting polypeptide mediates c - labeled fexofenadine cellular uptake . the bile acid transporter , human sodium taurocholate co - transporting polypeptide , did not exhibit such activity . the authors identified p - glycoprotein as a fexofenadine efflux transporter , using the llc - pk1 cell , a polarized epithelial cell line that lacks p - glycoprotein , and a derivative cell line ( l - mdr1 ) , which overexpresses p - glycoprotein . oral and intravenous administration of c - labeled fexofenadine to mice lacking mdr1-encoded p - glycoprotein resulted in 5- and 9-fold increases in the drug s plasma and brain levels , respectively , compared with wild - type mice . a number of drug inhibitors of p - glycoprotein effectively inhibited organic anion transporting polypeptide . because organic anion transporting polypeptide transporters and p - glycoprotein co - localize in organs of importance to drug disposition , such as the liver , their activity may provide an explanation for the mechanism(s ) responsible for fexofenadine disposition , and suggests potentially similar roles in the disposition of other xenobiotics ( cvetkovic et al 1999 ) . inhibitors of p - glycoprotein ( ketoconazole , itraconazole , verapamil , and erythromycin ) inhibited the intestinal absorption of fexofenadine . however , inhibitors of multidrug resistant associated protein ( indomethacin , probenecid ) and organic anion transporting polypeptide ( rifamycin ) had no effect upon fexofenadine transport . rifampin increases fexofenadine clearance , presumably by the induction of p - glycoprotein ( hamman et al 2001 ) . fexofenadine does not appear to affect the pharmacokinetics of omeprazole , a substrate of p - glycoprotein , suggesting that these two drugs have different transport mechanisms , or fexofenadine does not saturate p - glycoprotein . drescher et al ( 2002 ) described a number of distinct p - glycoprotein mutations that may affect the transport of fexofenadine . the mdr1 g2577t / c3435 t haplotype of p - glycoprotein , in the presence of itraconazole , altered the disposition of fexofenadine , with no change in the elimination half - life and the renal clearance of fexofenadine . itraconazole resulted in a 3-fold increase in the peak concentration of fexofenadine and the area under the curve . this suggests that the interaction between itraconazole and fexofenadine may occur at the gut wall before reaching the portal vein circulation . however , subjects with the 2677aa/3435cc haplotype had lower plasma fexofenadine concentrations than those with the g2677t / a and c3435 t haplotypes ( yi et al 2004 ) . these findings suggest that p - glycoprotein is responsible for the intestinal absorption of fexofenadine . van heeswijk et al ( 2006 ) studied the time - dependent interaction between lopinavir / ritonavir and fexofenadine . ritonavir and lopinavir / ritonavir increased the area under the plasma concentration - time curve for fexofenadine . they did not observe a change in the fexofenadine elimination half - life . they postulated that the increased area under the curve related to increased bioavailability due to p - glycoprotein inhibition . st john s wort , in a single dose of 900 mg , inhibits the intestinal transport of fexofenadine , increasing the maximum plasma concentration of fexofenadine by 45% . st john s wort decreases the oral clearance of fexofenadine by 20% , without changing the half - life and renal clearance ( milne et al 2000 ; petri et al 2004 ; shon et al 2005 ; takahata et al 2004 ; tannergren et al 2003 ; uno et al 2006 ; wang et al 2002 ) . these data suggest that fexofenadine may affect the blood levels of other drugs through its interaction with p - glycoprotein . probenecid has been shown to inhibit the interaction of fexofenadine with the organic anion transporter 3 ( oat3 ) in the kidney ( tahara et al 2006 ) . however , as the renal excretion of fexofenadine is small ( < 10% ) , the effect upon systemic fexofenadine levels is limited ( robbins et al 1998 ) . organic anion transporter protein 1b3 preferentially accepts fexofenadine over organic anion transporter proteins 1b1 and 2b1 in human embryonic kidney cells , suggesting that organic anion transporter protein 1b3 is a transporter involved in hepatic uptake of fexofenadine ( shimizu et al 2005 ) . although fexofenadine does not undergo significant metabolism by the p450 cyp 3a4 , it does interact with a numbers of drugs at p - glycoprotein and the organic anion transporter polypeptides . these interactions may increase the blood levels of a number of drugs , and increase the risk of adverse effects with concomitant administration of those drugs . administration of fexofenadine with grapefruit juice reduces the bioavailability of fexofenadine ( banfield et al 2002 ) . this reduction in bioavailability , which also occurs with apple juice , appears to result from preferential inhibition of organic anion transporter polypeptide mediated transport ( dresser et al 2002 , 2005 ; kamath et al 2005 ) . these data have led to the recommendation that patients should not ingest apple or grapefruit juice while taking fexofenadine . at 1 to 2 hours following the ingestion of fexofenadine , both the 30 mg and 60 mg doses suppressed the epicutaneous wheal response to histamine through 24 hours post dosing and suppressed the epicutaneous flare response to histamine through 8 hours post dosing ( simons et al 2003 ) . in another study , fexofenadine inhibited the histamine - induced wheal and flare with a maximum effect reached between 1 and 2 hours and lasting through the 12-hour dosing schedule for 60 mg , while the fexofenadine 120 mg dose inhibited the histamine - induced wheal and flare for 23 hours . the authors did not note tolerance to the anti - histamine effect over a period of 28 days ( russell et al 1998 ) . allocco et al ( 2002 ) , with grants from the nih and industry , studied the effect of fexofenadine upon the early response to nasal allergen challenge and demonstrated that fexofenadine reduced symptoms and vascular permeability . their data suggest that while fexofenadine antagonizes mediators of the acute allergic response , it does not prevent mast cell degranulation . older anti - histamines have anti - cholinergic properties that may induce increased intraocular pressure , leading to glaucoma and prostatism associated with urinary retention . however , in a cholinergic linked capsaicin - induced cough model , pretreatment with fexofenadine had no adverse effect ( dicpinigaitis et al 2003 ) . in an industry - sponsored study , juergens et al ( 2006a ) evaluated the effect of fexofenadine on arachidonic acid metabolism in cultured human monocytes . lipopolysaccharide stimulated human monocytes from healthy volunteers co - cultured with and without fexofenadine , followed by stimulation with zymosan , led to inhibition of ltc4 , ltd4 , and lte4 production . fexofenadine also inhibited lipopolysaccharide - stimulated production of pge2 and pgf2 , which the authors suggest may explain the beneficial effects of fexofenadine upon nasal congestion . in addition , fexofenadine selectively inhibited cyclo - oxygenase 2 , which may also contribute to its apparent anti - inflammatory properties ( juergens et al 2006b ) . sakairi et al ( 2005 ) , in an industry - based study , demonstrated that fexofenadine inhibited the increase in nasal airway resistance in a guinea pig antigen - induced model of rhinitis . the authors suggest that fexofenadine may inhibit the release of chemical mediators , including thromboxane , to reduce antigen - induced nasal airway resistance , in part by its inhibitory effect on cyclo - oxygenase 2 . asano et al ( 2007 ) , in an industry - sponsored study , evaluated the effect of nitric oxide production by fexofenadine from nasal fibroblasts , which demonstrated inhibition of inos mrna , with the suppression of tnf-induced no production from nasal fibroblasts . mice treated for 2 and 3 weeks with fexofenadine had diminished lps - induced no production with inhibition of inos mrna expression in lung tissues , suggesting a role for fexofenadine in asthma . however , brannan et al ( 2001 ) and fardon et al ( 2005 ) did not show a direct benefit of fexofenadine in patients with asthma . fexofenadine treatment appeared to decrease endothelial leukocyte adhesion molecule-1 ( elam-1 ) , vascular cell adhesion molecule-1 ( vcam-1 ) , and tryptase in subjects with chronic idiopathic urticaria , suggesting that fexofenadine may express other anti - inflammatory properties by the modulation of these cytokines ( cassano et al 2002 ) . abdelaziz et al ( 1998 ) studied the effects of fexofenadine on eosinophil - induced changes in electrical resistance and adherence to human nasal endothelial cells , as well as the effects of fexofenadine on eosinophil adherence and chemotaxis , in the presence and absence of opsonized latex beads . fexofenadine significantly attenuated the decrease in electrical resistance of the human nasal epithelial cells with exposure to both eosinophils and opsonized latex beads . human nasal epithelial cells , on exposure to eosinophils with opsonized latex beads , released rantes , il-8 , gm - csf , and sicam-1 . fexofenadine diminished the release of these chemokines with human nasal epithelial cell exposure to eosinophils and opsonized latex beads . in the presence of ifn and tnf , fexofenadine decreased the expression of icam-1 , increased the percentage of apoptotic cells , but did not change the expression of lfa-1 . fexofenadine did not change the expression of keratinocyte expression of il-8 and mig , but fexofenadine did down - modulate keratinocyte rantes , i - tac , mdc , and tarc , suggesting that fexofenadine had a selective effect on th2 cytokines , a mechanism by which fexofenadine provided an anti - inflammatory effect . however , fexofenadine significantly inhibited the ability of peripheral blood leukocytes to produce il-4 , but not ifn- with cry j 1 stimulation ( asano et al 2004b ) . fexofenadine pretreatment reduced the intranasal levels of il-6 and tnf in subjects given an intranasal challenge of parietaria officinalis ( ciprandi et al 2004 ) . watanabe et al ( 2004 ) studied the effect of fexofenadine upon eosinophilia and systemic anaphylaxis in mice infected with trichinella spiralis . fexofenadine provided a dose - dependent suppression of eosinophilia in c57bl/6 mice but not in mast cell - deficient w / w mice . fexofenadine suppressed rectal temperature , a marker for systemic anaphylaxis , in c57bl/6 mice . in an ige - anti - ige model of anaphylaxis in cbf1 mice , fexofenadine suppressed this same marker of anaphylaxis , without an effect on peripheral il-5 or eotaxin levels . fexofenadine diminished mrna expression of rantes , as well as limited the elaboration of eotaxin from nasal polyp fibroblasts , in response to lps ( asano et al 2004a ) . fexofenadine inhibited the production of matrix metal - loproteinases ( mmp ) mmp-2 and mmp-9 from nasal polyp and mucosal fibroblasts in response to tnf- , and inhibited mmp mrna expression and nf-b , but not tissue inhibitor of metalloproteinase ( timp-1 and timp-2 ) ( asano et al 2004c ) . fexofenadine improved performance on the digit symbol substitution test , but it did not have a blocking effect upon the dopamine transporter ( theunissen et al 2006a , b ) fexofenadine is primarily prescribed for its h1 antagonist activity . however , it appears to have effects upon other mast cell mediators , as well as mediators produced by other cell types . fexofenadine , in addition to antagonizing h1 receptors , decreases the production of ltc4 , ltd4 , and lte4 , pge2 , and pgf2 , inhibits cyclo - oxygenase 2 , inhibits the generation of thromboxane ( perhaps through cyclo - oxygenase 2 ) , and limits the inos generation of no , as well as the generation of icam-1 , elam-1 , vcam-1 , rantes , i - tac , mdc , tarc , mmp-2 , mmp-9 , and tryptase . these effects may decrease the inflammatory responses initiated by an acute allergic reaction and provide a basis for future development of h1 antagonists with stronger anti - inflammatory effects . fexofenadine reduced airway sensitivity to mannitol compared to placebo . however , fexofenadine did not alter the final percent reduction in fev1 ( brannan et al 2001 ) . in transfer experiments , fexofenadine prevented the development of airway hyper - responsiveness as well as primary sensitization and challenge , with a decrease in bronchoalveolar lavage and tissue eosinophilia , lymphocyte numbers , and th2 cytokine production ( gelfand et al 2002 ) . however , fexofenadine did not have an additive effect to inhaled corticosteroid therapy or on inflammatory markers in subjects with atopic asthma ( fardon et al 2005 ) . in children aged 2 to 5 years with allergic rhinitis , fexofenadine had a frequency of adverse effects no different from placebo . the most frequently involved adverse events were upper respiratory tract infection , fever , infection , and vomiting . of the adverse events , 8.2% were attributable to the placebo , and 9.5% to fexofenadine . there were no clinically relevant differences for laboratory measures , vital signs , and physical examinations ( milgrom et al 2007 ) . grubbe et al ( 2007 ) evaluated effects of fexofenadine oral suspension in 50 children , aged 2 to 5 years . ngamphaiboon et al ( 2005 ) studied the efficacy and safety of fexofenadine 30 mg in pediatric patients with allergic rhinitis . , they did not appreciate meaningful change in any electrocardiogram . in a double blind , two - way crossover study , simons et al ( 1996 ) administered 30 or 60 mg of fexofenadine as a capsule to 14 children with allergic rhinitis ( mean age of 9.8 years , with a mean height of 134 cm and a mean weight of 32.1 kg ) . somnolence occurred in one child 10 hours after the ingestion of a 30 mg dose . they found that fexofenadine administered before or after the onset of cedar pollinosis prevented or controlled nasal obstruction , sneeze , and rhinorrhea . in a multi - center placebo controlled safety and efficacy study of 861 subjects with moderate to severe autumn allergic rhinitis , fexofenadine at doses of 120 mg and 180 mg fexofenadine , given once daily , significantly reduced total symptom score ( for nasal congestion ) , through the 24-hour trough . there were no differences between the two doses of fexofenadine and placebo groups in adverse events , as both subjects and controls reported headache as the most common adverse event ( casale et al 1999 ) . fexofenadine had no effect on the quality of life and work productivity in adult subjects with seasonal allergic rhinitis during the peak season for cedar pollinosis ( okubo et al 2005 ) . bronsky et al ( 1998 ) studied 550 subjects who had previously responded to other anti - histamines for seasonal allergic rhinitis , for 17 days . subjects sustained significant improvements in total symptom score 1 to 3 hours after the first dose at doses of 40 mg , 60 mg , and 120 mg , all twice daily . these authors did not find increases in the qtc intervals in their subjects treated with fexofenadine . in an industry - sponsored study , meltzer et al ( 2004 ) studied the safety and efficacy of fexofenadine in children with seasonal allergic rhinitis . they polled data from 3 double - blind , randomized , placebo - controlled , parallel group , 2-week trials in children ages 6 to 11 years with seasonal allergic rhinitis . the studies used 30 mg twice daily while 2 other studies also used 15 or 60 mg twice daily . fexofenadine at 30 mg twice daily significantly reduced the total symptom score , sneeze , rhinorrhea , itchy nose / mouth / throat / ears , itchy watery red eyes , and nasal congestion . kawashima et al ( 2002 ) found that doses as low as 20 mg twice daily were effective in the treatment of chronic idiopathic urticaria , and in another study , kawashima et al ( 2003 ) found that fexofenadine improved the pruritus associated with atopic dermatitis more than placebo . with assistance from industry , nelson et al ( 2000 ) tested the efficacy of fexofenadine in the treatment of chronic idiopathic urticaria . they noted no significant differences in the responses to doses between 60 mg twice daily and 240 mg twice daily . all subjects noted improvement in pruritus severity , number of wheals , and interference with sleep . handa et al ( 2004 ) did not find great benefit of fexofenadine n the treatment of chronic idiopathic urticaria . in an open - label , non - comparative study , kulthanan et al ( 2001 ) studied the efficacy and toxicity of fexofenadine in the treatment of chronic idiopathic urticaria . fexofenadine reduced the number of wheals , the severity of itch , interference with sleep , and interference with daily activities . the adverse events included headache , drowsiness , dizziness , increased appetite with weight gain , and cough . with industry support , russell et al ( 1998 ) studied the fexofenadine dose and subject tolerance to fexofenadine , as well as the drug single dose and steady - state pharmacokinetics in 87 adult subjects . their subjects tolerated doses of fexofenadine ranging from 10 to 800 mg , with no clinically significant trends for cardiac conduction parameters , vital signs , adverse event reporting , or clinical laboratory parameters despite exposure to fexofenadine plasma concentrations as high as 12,250 ng / ml . at doses of 15 and 30 mg twice daily in children aged 6 months to 2 years with allergic rhinitis , treatment - emergent adverse events were similar between the placebo and treatment groups . there were no differences between fexofenadine and placebo for vital signs , electrocardiographic results , or physical examination results ( hampel et al 2007 ) . an industry study of the effect of fexofenadine in a single dose up to 800 mg and multiple doses of 690 mg did not appear to change the qtc interval ( pratt et al 1999 ) . pinto et al ( et al 1999 ) described a patient on fexofenadine with a prolonged qtc interval . while on fexofenadine , the patient experienced an episode of syncope , with injury to a tooth . taken off the fexofenadine , the patient s qtc interval normalized . when replaced on fexofenadine 180 mg daily , qtc interval increased and the patient experienced an episode of polymorphic ventricular tachycardia , which progressed to ventricular fibrillation . the authors did not find an alternative reason for the prolonged qtc interval or the ventricular arrhythmia . craig - mcfeely et al ( 2000 , 2001 ) surveyed general practitioners in britain for adverse events to fexofenadine . they found no reports of drug interactions . cardiac events , including palpitations , chest pain , arrhythmia , and chest tightness , but without reports of qtc interval lengthening , resolved upon cessation of the drug . hindmarch et al with industry support , studied the effect of fexofenadine upon cognitive and psychomotor function ( hindmarch et al 1999 , 2002 ; kamei et al 2003 ; ridout et al 2003a , b ) . the authors tested critical flicker fusion ( cff ) , choice reaction time ( crt ) , and assessment of subjective sedation ( lars ) after up to 180 mg fexofenadine , from 1 to 24 hours . stone et al ( 1999 ) studied the central effects of fexofenadine ( 120 , 180 and 240 mg ) on digit symbol substitution , tracking and vigilance tasks and on objective sleepiness ( multiple sleep latency test ) and subjective sleepiness . potter et al ( 2003 ) were unable to find differences in reaction time , decision - making , and driver behavior with and without fexofenadine 180 mg compared to placebo . nicholson et al ( 2000 ) found that fexofenadine in doses of 120 g , 180 mg , and 240 mg did not affect digit symbol substitution , tracking , vigilance tasks , multiple sleep latencies , and subjective sleepiness . mansfield et al ( 2003 ) found that fexofenadine at a dose of 180 mg did not change self - reported drowsiness , omission errors , and response time . bower et al ( 2003 ) studied the effects of single - dose fexofenadine , diphenhydramine , and placebo on cognitive performance in flight personnel . although diphenhydramine resulted in significant psychomotor decrements , the effect of fexofenadine was not different from placebo . in an industry - supported study , tashiro et al ( 2005 ) studied the effect of fexofenadine upon brake reaction time , while using a cellular phone . compared to hydroxyzine , fexofenadine did not impair brake reaction time in otherwise healthy subjects . weiler et al ( 2000 ) compared the effects of fexofenadine , diphenhydramine , and alcohol on driving performance . subjects received one of these drugs or placebo , weekly , 1 hour prior to driving . lane keeping ( steering instability and crossing the centerline ) was impaired after alcohol and diphenhydramine use compared with fexofenadine use . self - reported drowsiness did not predict lack of coherence and weakly related to the minimum following distance , steering instability , and left lane excursion . in a review by banerji et al ( 2007 ) , the authors found that fexofenadine was less sedating than diphenhydramine . graft et al ( 2001 ) , in an industry - sponsored study , demonstrated the safety of fexofenadine in 875 children , 6 to 11 years of age , treated for seasonal allergic rhinitis . ten of their subjects ( 5 in the fexofenadine group and 5 in the placebo group ) stopped the medication because of an adverse event , which included upper respiratory congestion , otitis media , and asthma , although the authors could not link any of the adverse events to the drug . saraswat et al ( 2006 ) presented a case of stable psoriasis , who developed a severe pustular flare within 24 hours of taking fexofenadine . following resolution of the pustular psoriasis , they rechallenged the patient with fexofenadine , with recurrence of the rash . these studies support the contention that fexofenadine is effective for the treatment of allergic rhinits and chronic idiopathic urticaria , perhaps without benefit to patients with asthma . with the possible exception of rare adverse cardiac and cutaneous events , fexofenadine appears no more toxic than placebo when administered in the absence of other drugs . the fda approved fexofenadine for treatment of the symptoms of allergic rhinitis and chronic idiopathic urticaria . however , concern remains regarding fexofenadine s interactions with other medications that use the p - glycoprotein and the organic anion transporter peptides , which may result in an increased risk of adverse events to those other medications . this concern comes from the pharmacokinetic data , which suggest that although only a small proportion of fexofenadine is metabolized , fexofenadine moves into and out of the blood and tissues by at least p - glycoprotein and organic anion transporter peptides , which transport a number of other medications . in addition to blocking h1 receptors , fexofenadine appears to diminish the production of ltc4 , ltd4 , and lte4 , pge2 , and pgf2 ; inhibits cyclo - oxygenase 2 ; inhibits the generation of thromboxane ( perhaps through cyclo - oxygenase 2 ) ; and limits inos generation of no , as well as icam-1 , elam-1 , vcam-1 , rantes , i - tac , mdc , tarc , mmp-2 , mmp-9 , and tryptase , which may contribute to its benefit . | fexofenadine is a selective , non - sedating h1 receptor antagonist , marketed in the united states since 2000 .
the fda approved an oral suspension in 2006 , for the treatment of seasonal allergic rhinitis and chronic idiopathic urticaria in children .
the tablet , capsule , and oral suspension are bioequivalent .
although fexofenadine does not use p450 cyp 3a4 it does interact with a number of drugs at p - glycoprotein and organic anion transporter polypeptides
. the risk of toxicity from other drugs may increase with the administration of fexofenadine .
orange and grapefruit juices reduce the bioavailability of fexofenadine .
fexofenadine has been shown to have an impact on inflammatory mediators , other than histamine , such as decreasing the production of ltc4 , ltd4 , lte4 , pge2 , and pgf2 ; inhibiting cyclo - oxygenase 2 , thromboxane ; limiting inos generation of no ; decreasing cytokine levels ( icam-1 , elam-1 , vcam-1 , rantes , i - tac , mdc , tarc , mmp-2 , mmp-9 , tryptase ) ; and diminishing eosinophil adherence , chemotaxis , and opsonization of particles .
these effects may provide benefit to some of the inflammatory responses of an acute allergic reaction and provide a basis for future development of h1 antagonists with stronger anti - inflammatory effects .
these studies also support the contention that fexofenadine is effective for the treatment of allergic rhinits and chronic idiopathic urticaria . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
maintaining the integrity of the natural dentition is important for proper function and natural esthetics . one of them is perforation of root canal wall , which can significantly impact the long - term prognosis of the tooth . furcation perforation refers to a mid - curvature opening into the periodontal ligament space and is the worst possible outcome in root canal treatment . it has been reported that perforations were the second greatest cause of failure . to prevent bacterial contamination an ideal perforation repair material should provide an adequate seal , be biocompatible , not affected by blood contamination , not be extruded during condensation , bactericidal , induce bone formation and healing , radiopaque , induce mineralization , cementogenesis and easy in manipulation and placement . these materials include zinc - oxide eugenol cement ( intermediate restorative material , super- ortho ethoxy benzoic acid ) , glass ionomer cement , resin cements , resin modified glass ionomer cement and mineral trioxide aggregate . however , the divergent outcomes have demonstrated that so far no material has satisfied all the ideal requirements . today , most preferred furcation repair materials are bioactive materials like mineral trioxide aggregate , biodentine . recently , endosequence root repair material have been developed as ready to use , premixed bioceramic material recommended for perforation repair , apical surgery , apical plug , and pulp capping . thus , the present study is designed to evaluate the sealing ability of micro - mega mineral trioxide aggregate , endosequence , and biodentine in repair of furcation perforations using dye extraction method . forty extracted human mandibular molars with non - fused and well developed roots were used in this study . they were then cleaned from any debris and washed under tap water and kept in normal saline until next step . a standardized access cavity was prepared in every molar with a round bur # 2 , and the root canal orifices were located . sticky wax was placed over the orifices of each canal and the sectioned root surface including pulpal floor . it was then coated with two successive layers of varnish in an attempt to increase the marginal seal . to ensure each perforation was centered between the roots , a black marker pen was used to mark the location of the defect . artificial perforation of 1 mm in diameter was created from the external surface of the tooth with a # 2 round carbide bur mounted on a high - speed hand piece with air water coolant [ figure 1a ] . group i : ten molars , in which perforations were left unsealed ( positive control ) . group ii : ten molars , in which perforations were repaired with micro - mega mineral trioxide aggregate . group iv : ten molars , in which perforations were repaired with biodentine [ figure 1b ] . 1a : pulpal floor view of perforation 1b : view of perforation from external surface 1c : placement of samples in petri dishes each group was placed in separate petri dishes containing 2% methylene blue such that all the teeth were immersed in dye up to the cej for retrograde dye challenge , and dye was added to access chamber of each teeth so that it was filled for orthograde dye challenge [ figure 1c ] . after removal from the dye , teeth were rinsed under running water for 40 minutes and varnish was removed with a polishing disc . the teeth were placed in vials containing 1 ml of concentrated ( 65 wt % ) nitric acid until complete dissolution . two hundred l of the supernatant from each sample was then analyzed in a uv - visible spectrophotometer at 545 nm wavelength using concentrated nitric acid as the blank , and readings were recorded as absorbance units . one - way anova and tukey 's multiple comparison test [ table 1 ] were done using the statistical package spss ( statistical package for social science , version 4 ) mean values of four different experimental groups the mean absorbance values of experimental groups and controls in the current study showed that the positive control samples ( group i ) in which perforations were left unrepaired had the highest dye absorbance ( 0.87 0.09487 ) of all groups denoting the accuracy of the technique . this was followed by biodentine ( group iv ) , which had dye absorbance values ( 0.49 0.07379 ) significantly higher than mm - mta ( group ii ) and endosequence ( group iii ) showed lower dye absorbance than remaining groups . the perforations irrespective of location or etiology may interfere with the prognosis of endodontic treatment . this iatrogenic or mechanical or pathological communication between root canal system and external tooth surface should be sealed with a biocompatible materials as soon as possible . the present study evaluated the sealing ability of micro - mega mineral trioxide aggregate , endosequence , and biodentine as furcation repair materials in mandibular molars using a dye extraction leakage method . dye penetration technique has long been used in endodontics because of its ease of performance and difficulty of other available techniques . dye extraction methodology was employed in this study , which according to camps j and pashley gave similar results to the fluid filtration technique as both are based on quantitative measurements of liquid passage within interfaces . in this study , an ultraviolet spectrophotometry was adopted since it is widely used technique because of its rapid analysis and the cost of the analysis is less expensive . ultraviolet - visible spectrophotometry refers to absorption spectroscopy or reflectance spectroscopy in the ultraviolet - visible spectral region . this means , it uses light in the visible and adjacent ( near - uv and near- infrared ) ranges . the absorption or reflectance in the visible range directly affects the perceived color of the chemicals involved . mineral trioxide aggregate was actually introduced as a root - end filling material ; however , because of its biocompatibility , it is now also considered as a material of choice to seal perforations . however , mineral trioxide aggregate has certain drawbacks such as difficulty in handling and very slow setting reaction , which might contribute to leakage , surface disintegration , loss of marginal adaptation , and continuity of the material . in order to overcome these difficulties , micro - mega introduced endodontic repair cement micro - mega mineral trioxide aggregate . it is a modified portland cement with added calcium carbonate , which allows the reduction of the setting time . biodentine is a calcium silicate - based material that has polycarboxylate - based hydro - soluble polymer system described as water - reducing agent to reduce the overall water content of the mix , along with cacl2 as a setting accelerator . endosequence is a bioceramic material composed of calcium silicates , zirconium oxide , tantalum oxide , calcium phosphate monobasic thickening agents , and proprietary fillers . endosequence has been manufactured to overcome some of the difficult handling characteristics of mineral trioxide aggregate . the manufacturers of endosequence material claim that premixed endosequence putty has a working time of approximately 30 + minutes , a setting reaction initiated by moisture and a final set achieved approximately four hours later with the calcium silicate portion of the material produces a calcium silicate hydrate gel and calcium hydroxide . the water produced continues to react with the calcium silicates to precipitate additional gel like calcium silicate hydrate . according to the developers of the endosequence , the water supplied through this reaction is an important factor in controlling the hydration rate and the setting time of this material . shokouhinejad n et al . tested the bioactivity of endosequence by exposing the set material on phosphate - buffered saline . endosequence has been shown to have negligible cytotoxicity and capability to induce cytokine expression . in the current study , a significant difference with this material is its particle size , which allows the premixed material to penetrate into the dentinal tubules and bond to adjacent dentin . according to ghattas sm et al . , endosequence root repair material showed sealing ability similar to white mineral trioxide when used as a root - end filling material . in the current study , another root repair material used is mm - mta ( micro - mega ) an endodontic repair cement , developed in order to overcome handling properties of mineral trioxide aggregate . it is biocompatible , radiopaque material with properties like faster setting time , homogenous pasty consistency for easy handling and placement . in this study , micro - mega mineral trioxide aggregate showed less dye absorbance followed by endosequence but statistically no significant difference when compared with biodentine . based on the results of this study , biodentine showed high dye absorbance than endosequence and micro - mega mineral trioxide aggregate . , mechanical strength of biodentine is time - dependent ; at least two weeks are necessary to reach a final setting stage . even after the initial setting , this material continues to improve in terms of internal structure towards a more dense material with a decrease in porosity . within the limitations of this study , it was observed that endosequence showed better sealing ability in furcation repair when compared with other repair materials like micro - mega mineral trioxide aggregate and biodentine . | aim : to evaluate the sealing ability of micro - mega mineral trioxide aggregate , endosequence , biodentine as furcation repair materials using a dye extraction leakage method.materials and methods : forty mandibular molars were randomly divided according to the material used for perforation repair .
group i- ( left unsealed ) control , group ii - micro - mega mineral trioxide aggregate , group iii - endosequence , group iv - biodentine .
all samples were subjected to orthograde and retrograde methylene blue dye challenge followed by dye extraction with 65% nitric acid .
samples were then analyzed using ultra violet ( uv ) visible spectrophotometer.results:biodentine showed highest dye absorbance , whereas endosequence showed lowest dye absorbance when compared with other repair materials.conclusion:within the limitations of this study , it was observed that endosequence showed better sealing ability when compared with other root repair materials . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in gynecology endosalpingiosis is a benign condition in which fallopian tube - like epithelium is found outside of the fallopian tube . endosalpingiosis is associated with the formation of psammoma bodies , which may lead to the misdiagnosis of malignancy such as serous carcinoma.1 the significance of endosalpingiosis is not settled ; medical experts differ on whether it causes pelvic pain , or is an incidental ( asymptomatic ) finding discovered in the course of investigating pelvic pain , menstrual irregularities or infertility . endosalpingiosis is occasionally found in lymph nodes , and may be misinterpreted as an adenocarcinoma metastasis . in one study , they found that 34.5% of endosalpingiosis cases had concurrent endometriosis ; 40% of the endosalpingiosis group were postmenopausal . in contrast , there was no significant link between endosalpingiosis and infertility nor chronic pelvic pain . a 75-year - old woman , gravida 2 , postmenopausal women , presented with vaginal bleeding which occurred a week ago . she had hyperlipidemia and took medical therapy . under the impression of pelvic mass , cancer antigen 125 ( ca-125 ) , ca 19 - 9 , complete blood cell count , serum chemistry , contrast enhanced - abdomen - computer tomography were done . ca 19 - 9 is 9.8 u / ml , ca-125 is 13.5 u / ml and glucose is 118 mg / dl . in contrast enhanced chest computer tomography , image showed multiseptated cystic mass in left adnexa which adhesion with left psoas muscle , adjacent small and large bowel loops and there is possibility of underlying chronic inflammatory process with abscess ( fig . vaginal bleeding is caused by the atrophic vaginitis considering that the patient 's age is 75 years old . endosalpingiosis is a non - neoplastic process and is generally considered to be derived from the secondary mllerian system , which consists of structures covering the peritoneal mesothelium , the adjacent mesenchyme in the small pelvis and the lower part of the female abdominal cavity.3 proliferation of these structures can result in the creation of three different types of lesions : endometriosis , which occurs most frequently , and the less common endosalpingiosis and endocervicosis.4 the symptom of endosalpingiosis is not settled ; medical experts differ on whether it causes pelvic pain,5 or is an incidental ( asymptomatic ) finding discovered in the course of investigating pelvic pain , menstrual irregularities or infertility.6 the causes of the endosalpingiosis are unknown . in this case however , it is almost always an incidental finding , either at the time of operation or , more commonly , on microscopic examination.7 it is most commonly encountered on the pelvic peritoneum covering the uterus , fallopian tubes , ovaries and culde - sac . less frequent sites include the pelvic parietal peritoneum , omentum , bladder and bowel serosa , paraaortic area and skin.8 only a few examples of tumor - like cystic endosalpingiosis localized to the female pelvis have been described , and most of these cases are reported to be derived from the serosal surface of the uterus and the ovary 6 - 10 or from the paraovarianregion.8 for diagnosis of endosalpingiosis , pathology on excision ( e.g. biopsy ) , is needed . it is characterized by cysts with tubal - type epithelium ( e.g. ciliated epithelium ) surrounded by a fibrous stroma . unlike endometriosis , it is not associated with hemorrhage . a tubal - type epithelial surrounded by endometrial - type stroma is a variant of endometriosis , not endosalpingiosis . endosalpingiosis is occasionally found in lymph nodes , and may be misinterpreted as an adenocarcinoma metastasis.9 the pathological differential diagnosis of endosalpingiosis is discussed in detail in previously reported cases.7,10,11,12,13,14 however , the clinical differential diagnosis of an intramural mass , whether it causes any symptoms or not , is more important for clinicians when discussing further surgery with the patient . therefore the symptoms and the imaging findings of this rare entity are very important . as endosalpingiosis , endosalpingiosis appears to affect an older age group , with 40% of endosalpingiosis cases occurring in postmenopausal women.2 premenopausal women with endosalpingiosis were more likely to have a gynecologic malignancy.2 endosalpingiosis appears to affect postmenopausal women at a much higher rate than previously thought , and in consequence the average age of women presenting with endosalpingiosis was higher than expected.2 in this case , 75-year - old woman , gravida 2 , postmenopausal women , presented with vaginal bleeding was reported . however , it must be kept in mind that vaginal bleeding can be caused by endosalpingiosis , especially in the postmenopausal elderly women . possibility of endosalpingiosis must be considered in the differential diagnostic spectrum of vaginal bleeding , thus avoiding the problem of misdiagnosis of endosalpingiosis . | in gynecology , endosalpingiosis is a benign condition in which the fallopian tube - like epithelium is found outside the fallopian tube .
the thirty - four point five percent of endosalpingiosis cases have concurrent endometriosis and 40% of the endosalpingiosis group are in postmenopausal states .
in contrast with endometriosis , there are no significant links between infertility , chronic pelvic pain and endosalpingiosis .
the symptoms of endosalpingiosis are not yet settled .
endosalpingiosis is almost always an incidental finding ; it is commonly found through microscopic examinations , and is then confirmed by pathologists for excision and biopsy .
therefore , the clinical differential diagnosis of an intramural mass is more important for clinicians when discussing further surgery with the patients .
we report case of woman who has endosalpingiosis and is presented with vaginal bleeding .
we first suspect the disease during physical examination . under the impression of pelvic mass , laboratory tests and radiological images of contrast
enhanced chest computer tomography are taken .
images show multisepted cystic masses in left adnexa . to rule out the pelvic mass , we executed exploratory laparotomy .
pathologic results show endosalpingiosis near the ovary section .
but the endosalpingiosis , is not generally considered a pathology , and thus , no treatment is necessary . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we have investigated photochemical reactions of dab with qds at ensemble and single - molecule levels by recording and analyzing pl spectra of qd solutions and pl intensity trajectories of single qds both in the presence of dab and under high - intensity photoactivation . 1a shows the effect of concentration of dab on the pl spectra of a qd solution . as the concentration of dab also , we have examined temporal changes in the pl intensity of qds under continuous photoactivation . 1b shows pl spectra of a qd solution in the presence of dab and under continuous photoactivation . here , pl intensity of qds continuously decreased with time but without any changes in the concentration of dab . ( a ) pl spectra of a 1 m qd solution in toluene and in the presence or absence of dab : top to bottom are spectra recorded without adding dab and with an increase in the concentration of dab . ( b ) pl spectra of a 1 m qd solution in toluene supplemented with 3 mm dab solution : top to bottom are spectra recorded at 1 min intervals after photoactivation ( 400 nm ) . a decrease in the pl intensity of qds with an increase in the concentration of dab ( fig . 1a ) and a temporal decrease in the pl intensity of qds under continuous photoactivation ( fig . 1b ) are attributed to photochemical reactions of dab with qds and the formation of qd - dab adducts having lower pl quantum efficiencies than pristine qds . to validate the photochemical reaction of dab with qds , we have recorded and analyzed the pl intensity trajectories of single qds in the presence and absence of dab and under low- ( 0.22 kw / cm ) and high- ( 2.2 kw / cm ) intensity photoactivation . 2 shows pl intensity trajectories of single qds tethered on a cover slip , immersed in water , and recorded in the presence or absence of dab . interestingly , in the presence of dab and under high - intensity photoactivation , we detected a continuous decrease in the pl intensity of single qds ( fig . f ) . on the other hand , pl intensities of single qds under high - intensity photoactivation but without dab remained intact even after several minutes ( fig . 2a ) . the excitation power density ( 2.2 kw / cm ) applied in these experiments was high enough to activate multiple exciton pairs and induce auger ionization in qds , which is apparent from intermittent pl blinking of single qds . our hypothesis for the gradual decrease in the pl intensity of single qds in the presence of dab is that auger - ionized qds react with dab and form qd - dab adducts having pl quantum efficiencies lower than that of qds . the reaction of dab with qd probably took place by the transfer of an electron from dab to auger - ionized qd followed by the elimination of a proton from qd - dab adduct . steps involved in the photochemical reactions of dab with photoactivated qd is schematically presented in fig . , a large number of dab molecules can be added onto the surface of qds . thus , the continuous decrease in the pl intensity can be attributed to the formation of poorly luminescent qd-(dab)n adducts . pl intensity trajectories of single qds recorded under high - intensity photoactivation ( at 532 nm , 2.2 kw / cm ) : ( a ) without dab , ( b ) with 10 m dab solution , ( c ) with 10 m dab solution and at 15s intervals of photoactivation , ( d ) with 10 m dab solution and at 60s intervals of photoactivation , ( e ) with 0.1 mm dab solution , and ( f ) with 1 mm solution . schematic presentation of electron transfer from dab to an auger - ionized qd and subsequent formation of qd-(dab)n adducts . the above hypothesis was investigated by intermittent photoactivation of single qds in the presence of dab and under high excitation intensity ( 2.2 kw / cm ) . d shows pl intensity trajectories of single qds excited at 15s and 60s laser on/off intervals . we found that the pl intensities of single qds remained essentially unaffected before and after each laser off period , which indicates that the reaction of dab with qd should be absolutely photoinduced . our hypothesis was further investigated by photoactivating single qds in the presence of dab but under low excitation intensity ( 0.22 kw / cm ) , which is insufficient to activate multiple excitons and induce auger ionization . under these conditions , we found that pl intensities of single qds remained essentially intact even after 10 min . the relation between the concentration of dab and pl intensities of single qds is shown in fig . 2b , e , and f. here , as the concentration of a dab solution in a single qd sample was increased ( 10 m for fig . 2f ) , the rate at which pl intensities of single qds decreased was also increased . these results and the gradual decrease in the pl intensity of single qds support our hypothesis that auger - ionized qds react with dab . the photochemical reaction between qd and dab was further investigated by recording and analyzing pl decay profiles of qd solutions . 4 shows pl decay profiles of a qd solution recorded at 2 min intervals in the presence of dab and under high - intensity ( 2.2kw / cm ) photoactivation . auger ionization of qds under such high - intensity photoactivation is apparent from evolution of a fast component in the decay profiles ( fig . interestingly , we detected a gradual increase ( from 5.9 ns to 9.8 ns , 66% ) in the pl lifetime of qds with time under photoactivation ( fig . the spontaneous increase in the pl lifetime of qds is associated with an increase in the pl quantum efficiency , which originates from an increase in the contribution of radiative carrier recombination in the surface states ( 16 , 17 ) . however , an increase in the pl lifetime of qds under high - intensity photoactivation in the presence of dab is associated with a gradual but irreversible decrease in pl intensity . because amines are known to passivate surface defects in qds , we attribute the changes in the pl properties of qds to surface passivation of qds by photoinduced electron transfer reaction with dab and the formation of qd-(dab)n adducts . the contribution of dab to an increase in the pl lifetime of qds was further investigated by recording and analyzing pl decays of qds under low - intensity photoactivation . 4b shows pl decay profiles of a qd solution recorded at 2 min intervals in the presence of dab and under low ( 0.22 kw / cm ) excitation intensity , which is insufficient to activate multi - exciton pairs and induce auger ionization . therefore , photochemical reactions of dab with qd takes place only under high - intensity photoactivation . in other words , the decrease in the pl intensity of qds with time under photoactivation in the presence of dab can be attributed to photoinduced electron transfer reactions between auger - ionized qd and dab and subsequent formation of poorly luminescent qd-(dab)n adducts . pl decay profiles of qd solutions : ( a ) decays recorded at 2 min intervals in the presence of dab and under high - intensity ( 2.2 kw / cm ) photoactivation , and ( b ) decays recorded at 2 min intervals in the presence of dab and under low - intensity ( 0.22 kw / cm ) photoactivation . inset of a : decays recorded at 2 min intervals without dab and under high - intensity photoactivation . in short , single - molecule photochemical reactions of an aliphatic amine on the surface of quantum dots were detected by analyzing photoluminescence intensity trajectories and lifetimes of quantum dots at ensemble and single particle levels . as qds were photoactivated in the presence of dab , we found continuous decrease in the photoluminescence intensity of quantum dots and concomitant increase in their photoluminescence lifetime values . these changes in the luminescence properties were apparent only under high - intensity photoactivation of quantum dots , during which auger ionization is operational . thus , the changes in the luminescence properties of single quantum dots are attributed to photoinduced electron transfer reaction of amine with auger - ionized quantum dots and the formation of quantum dot - amine adducts . such photochemical reactions of organic molecules on the surface of quantum dots and other nanoparticles would be of great value for energy management and environment remediation . cdse / zns ( pl maximum 600/655 nm ) qds were obtained from invitrogen corporation ( japan ) and dab from sigma aldrich ( japan ) . single - molecule samples were prepared by tethering qds on cover slips . the procedure for preparation of single - molecule samples cover slips were cleaned by dipping in a nascent chlorine solution and silanized using a 0.5% solution of 3-aminopropyltriethoxysilane in acetone . silanized cover slips were copiously washed with water and acetone , and biotinylated by dipping in a 10 m aqueous solution of biotin 3-sulfo - n - hydroxysuccinimide ester ( sigma aldrich , japan ) for 30 min . biotinylated cover slips were copiously washed with deionized water and successively , cdse / zns qds were uniformly tethered on the cover slips by placing a 10 pm solution of qd655-streptavidin conjugate on one side of the cover slip . after incubation for 30 min at room temperature , unbound qds were removed by washing with deionized water . finally , qds were dipped in deionized water and recorded single - molecule images , pl intensity trajectories , and pl lifetimes . single - molecule experiments were carried out in an inverted optical microscope ( olympus ix 70 ) equipped with a 60objective lens ( olympus , na 0.98 ) . fluorescence signals collected using the objective lens were filtered through a 620 nm long pass filter , magnified using a 2.5telescopic lens , and recorded using an image intensifier , charge - coupled device assembly ( hamamatsu photonics , japan ) . for pl lifetime measurements , samples were excited with 400 nm fs laser pulses from an optical parametric amplifier ( opa ) . the opa was pumped by 800 nm pulses ( 200 khz ) from a regenerative amplifier that was seeded by a mode - locked ti : sapphire laser ( 76 mhz ) . fluorescence decay profiles were recorded using an assembly of a polychromater and a streak - scope ( hamamatsu photonics , japan ) . there is no conflict of interest in the present study for any of the authors . | photoinduced electron transfer in donor - acceptor systems composed of quantum dots ( qds ) and electron donors or acceptors is a subject of considerable recent research interest due to the potential applications of such systems in both solar energy harvesting and degradation of organic pollutants .
herein , we employed single - molecule imaging and spectroscopy techniques for the detection of photochemical reactions between 1,4-diaminobutane ( dab ) and cdse / zns single qds .
we investigated the reactions by analyzing photoluminescence ( pl ) intensity and lifetime of qds at ensemble and single - molecule levels . while dab was applied to single qds tethered on a cover slip or qds dispersed in a solution , pl intensity of qd
continuously decreased with a concomitant increase in the pl lifetime .
interestingly , these changes in the pl properties of qd were predominant under high - intensity photoactivation .
we hypothesize that the above changes in the pl properties surface due to the transfer of an electron from dab to auger - ionized qd followed by elimination of a proton from dab and the formation of a qd - dab adduct .
thus , a continuous decrease in the pl intensity of qds under high - intensity photoactivation is attributed to continuous photochemical reactions of dab with single qds and the formation of qd-(dab)n adducts .
we believe that detection and analysis of such photochemical reactions of single qds with amines will be of considerable broad interest due to the significant impact of photoinduced electron transfer reactions in energy management and environmental remediation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is largely incurable once tumor cells begin to metastasize and colonize in distant organs . metastasis is initiated by tumor cells dislodging from the primary tumor and intravasating into the blood stream . this process is supported by a specific genetic program , epithelial - mesenchymal transition ( emt ) , which enables tumor cells to detach from the tumor tissue and invade the surrounding tumor stroma as a single cell 1 . then , after entering the blood stream , tumor cells are carried into the vasculature of distant organs , where they extravasate or proliferate within the vasculature 2 , 3 . this stage represents an important switch from tumor cell dissemination to metastatic colonization , which depends on cell - autonomous processes such as tumor initiation and mesenchymal - epithelial transition 4 , 5 . another important determinant for metastatic colonization is the nature of the tissue environment , which needs to provide critical survival and proliferative cues in order for tumor cell colonization to succeed 6 - 8 . the ability of tumor cells to generate colonies in distant organs depends in large parts on their capacity to proliferate . starting out as a single cell , this process requires adhesive interactions of integrins with the extracellular matrix , which result in focal adhesion formation and subsequent activation of map kinases or pi3-kinase 4 , 9 . in line with this , adhesive pathways that modulate f - actin and stress fiber assembly are often up - regulated in metastatic tumor cells and their inhibition has been shown to be anti - metastatic 2 , 7 . the capacity to generate productive adhesive interactions is also determined by the properties of the surrounding extracellular matrix 6 , 10 . to this end , it has been demonstrated that fibrin is significantly more efficient in supporting colony formation than collagen i 6 . this effect is highly relevant in vivo as embedding in a 3-dimensional ( 3d ) matrix of fibrin specifically conveys tumor- and metastasis - initiating capabilities while treatment with clotting inhibitors or knocking down fibrin(ogen ) severely impairs the capacity of tumor cells to metastasize 6 , 11 , 12 . we previously showed that blood clotting specifically supports lung metastasis but not metastasis to the liver 13 . conversely , we found that tumor cells from cancers that predominantly metastasize to the lung , such as renal cell carcinoma ( rcc ) and soft tissue sarcoma ( sts ) , display a specific fibrin - invasive phenotype 10 . invadopodia formation in these tumor types depends on a constitutively active form of integrin v3 , which promotes fibronectin matrix formation in fibrin - embedded tumor cells . fibronectin in turn has been shown to activate dormant tumor cells and to induce tumor cell metastasis 7 . in line with this , it has been shown that high levels of fibronectin correlate positively with poor outcome in patients with rcc and other malignancies 14 , 15 . based on the apparent role of clotting in tumor metastasis , we aimed to define the function of fibronectin matrix formation for kidney tumor cell colonization in fibrin . rcc4 , 786 - 0 ( renal cell carcinoma , rcc ) and ht1080 cells ( soft tissue sarcoma , sts ) were purchased from atcc and cultured per manufacturer 's specifications . primary human tumor cells were isolated from kidney tumors of 2 patients with metastatic rcc ( pt3bn0m1 , pt3bn2mx ) and 2 patients with localized rcc ( ea . tumor cells embedded in various 3d matrices were analyzed for invadopodia and colony formation using phase contrast or confocal microscopy as previously described 10 , 13 , 16 , 17 . y-27632 rho kinase inhibitor ( emd millipore ) or recombinant human hgf ( r&d systems ) were added to cultures where indicated . lungs from female , 6 - 8 weeks old athymic nude mice ( charles rivers ) were isolated 6 weeks after intravenous injection ( tail vein ) with 2.5x10 786 - 0 kidney cancer cells in the presence or absence of 500 iu hirudin ( emd millipore ) . lungs were subsequently fixed in bouin 's solution and analyzed for tumor multiplicity as well as tumor size using a stereo microscope ( zeiss stemi 2000-c ) . shrna mediated gene silencing . to achieve stable knockdown of fibronectin , we transduced ht1080 cells with lentiviral shrna vectors compared to a scrambled control shrna ( university of pittsburgh cancer institute vector core facility ) as previously described 10 . data were analyzed using unpaired two - tailed student 's t test or one - way anova followed by the posthoc tukey 's multiple comparisons test ( graphpad prism 5 ) . treatment differences with a two - sided p value < 0.05 were considered significantly different . fibrin matrices have been shown to promote the tumorigenic potential in several tumor types 6 . to determine the role of fibrin for tumor cell proliferation in kidney cancer , we embedded primary tumor cells from patients with clear cell rcc in fibrin and scored the clots for tumor colonization over time . surrounded by 3d fibrin , tumor cells from metastatic rcc began to proliferate soon after embedding with a doubling in cell number after 24 hours and a tripling after 48 hours ( fig . cells from non - metastatic tumors on the other hand did not grow at all in fibrin but rather slightly declined in numbers , demonstrating that the clotting cascade specifically promotes colony formation in an aggressive , metastatic subset of kidney tumors . to determine if clotting is also pro - metastatic in vivo , we injected 786 - 0 kidney tumor cells into the tail vein of athymic nude mice in the presence of the thrombin inhibitor hirudin . notably , a single application of anticoagulant significantly reduced the overall appearance of metastatic kidney tumors in the lung over time ( fig . in addition , we found that lung tumors had a significantly smaller diameter after co - injection with hirudin indicating that inhibiting clot formation at the time of tumor cell seeding in the lung is associated with reduced tumor formation as well as growth ( fig . moreover , the in vivo results are in line with our data that fibrin promotes colony formation of primary tumor cells from patients with metastatic rcc in vitro . if the capacity of tumor cells to colonize in 3d culture depends on specific extracellular matrix properties , we embedded a panel of tumor cells side by side in fibrin versus matrigel . while 786 - 0 , rcc4 and ht1080 tumor cells replicated the previously observed colony formation of clinical rcc cells in fibrin , cell numbers remained largely unchanged after embedding the same cell lines in matrigel ( fig . paralleling this result , we made the observation that fibrin - embedded tumor cells generated an extensive fibronectin matrix , which was necessary to support tumor cell spreading as well as proliferation in fibrin ( fig . matrigel - embedded tumor cells , in contrast , displayed a round morphology and an apparent lack of fibronectin matrix deposition unless cells were treated with hepatocyte growth factor , a cytokine that has been shown to induce kidney tumor cell sprouting ( fig . interestingly , tumor cell growth in fibrin was impaired whether we embedded fibronectin shrna - transformed tumor cells in fibrin or in fibrin - fibronectin suggesting that tumor cell sprouting depended on endogenous fibronectin ( fig . together , these results suggest a close connection between fibronectin expression , tumor cell spreading and colony formation in fibrin compared to other extracellular matrices such as matrigel we previously demonstrated that fibronectin is necessary for stress fiber formation in fibrin 10 . to further evaluate the role of stress fiber formation in fibrin - embedded tumor cells , we stained 786 - 0 cells cultured for 48 hours in 3d fibrin with an antibody for phosphorylated myosin light chain ( pmlc ) . subsequent analysis with confocal microscopy documented that spread 786 - 0 cells expressed high levels of pmlc , which co - localized completely with f - actin in stress fibers ( fig . , we treated fibrin - embedded 786 - 0 cells with the rho kinase inhibitor y-27632 , which inhibits stress fiber formation through dephosphorylation of mlc . as a consequence , moreover , the inability of cells to generate stress fibers correlated with a significant reduction in expression of slug ( snail2 ) , a transcription factor involved in tumor initiation as well as epithelial - mesenchymal transition ( emt ) ( fig 3d ) . together , these results indicate that tumor cell spreading depends on rho kinase activity , which in turn generates important signals for tumor colonization in 3d fibrin . primary kidney cancer cells have been shown to generate an elaborate fibronectin matrix if they are derived from patients with metastasis , while non - metastatic rcc cells are largely devoid of a fibronectin matrix 10 . to determine if fibronectin matrix assembly correlates with stress fiber formation in clinical cancer , we embedded primary tumor cells from rcc patients with or without metastasis in fibrin and stained with an antibody against phosphorylated myosin light chain ( pmlc ) as well as phalloidin to visualize f - actin . subsequent confocal microscopy revealed co - localization of pmlc as well as f - actin in extensive stress fibers in metastatic rcc cells ( fig . pmlc staining was significantly weaker while f - actin was diffusely distributed throughout the cell ( fig . together , these results show that stress fiber formation in fibrin is a specific function of metastatic rcc cells embedded in fibrin . moreover the results indicate a link between cell spreading and colony formation in fibrin that correlates with kidney cancer metastasis . blood clotting and subsequent fibrin formation are important factors for tumor cell seeding to the lungs 11 . the objective of this study was to determine the role of fibrin formation for kidney cancer metastasis in comparison to other 3-d matrices such as matrigel , an ecm mixture consisting of the basement membrane components collagen iv , laminin and fibulin . here , we show that fibrin supports colonization of metastatic kidney tumor cells in an animal model in vivo as well as in 3d culture in vitro . colony formation was more efficient in 3d fibrin than in matrigel and depended on the ability of metastatic cells to generate a fibronectin matrix as a prerequisite for subsequent spreading . together our results show that fibrin promotes fibronectin matrix formation and kidney tumor cell spreading . moreover , they suggest that these functions are important for the initiation of lung metastasis in renal cell carcinoma . the role of the clotting system for tumor metastasis has long been established 12 , 19 . to this end , it has been demonstrated that tumor cell seeding is strongly reduced in transgenic mice deficient for platelet activators , fibrinogen or other coagulation factors 20 , 21 . more recently , it has been shown that blood clotting is specifically important for metastasis to the lung , which features blood vessels with a tight layer of endothelium and a continuous basement membrane 10 , 22 , 23 . as a result of these distinct vascular features , tumor cell extravasation is much more elaborate in the lung vasculature than in the liver vasculature , which lacks a basement membrane underneath a fenestrated endothelium 24 . in this situation , adhesive interactions with a provisional matrix of platelets and fibrin can provide critical cues for tumor cell survival and invasion in the lung vasculature 10 . consequently , fibrin formation plays a major role in promoting metastatic pathways in malignancies that predominantly metastasize to the lung such as renal cell carcinoma and soft tissue sarcoma 10 . the function of the clotting cascade is to protect tumor cells from the cytotoxic effects of circulating natural killer cells 19 , 21 . in addition , it has been shown that components of the clotting system support tumor cell extravasation by promoting epithelial to mesenchymal transition as well as the retraction of endothelial cells 3 , 10 , 25 . extravasation also requires tumor cells to penetrate the basement membrane of the pulmonary vasculature , which depends on a specific set of properties including the auto- or paracrine expression of hgf to promote c - met - dependent invasion and subsequent tumor cell sprouting 18 . alternatively , tumor cells can survive and proliferate in the lumen of pulmonary blood vessels 2 . such a mechanism for metastatic outgrowth is supported by our data showing that clotting promotes colony formation of primary metastatic kidney tumor cells in vitro and metastatic outgrowth in a model of experimental metastasis in vivo . this is also in line with a recent report demonstrating that fibrin promotes stem cell - like properties in tumor cells 6 . we and others have shown that colonization of fibrin with tumor cells depends on integrin v3 , which in its activated form participates in the generation of a fibronectin matrix 6 , 10 . this is significant as we previously demonstrated that spreading and fibronectin matrix formation in 3d fibrin is a prerequisite of metastatic rcc cells 10 . mechanistically , integrin v3 and fibronectin promote the expression of the emt master regulator slug , which also has been shown to promote tumor initiation 10 , 26 . here we show that slug was reduced in kidney cancer cells when we inhibited stress fiber formation with the rho kinase inhibitor y-27632 suggesting that the tensile strength generated through cell matrix interaction is relevant for the up - regulation of a critical pro - metastatic transcription factor . this function correlates directly with fibronectin expression because in absence of fibronectin , fibrin or matrigel alone were unable to provide the tensile strength necessary to promote stress fiber formation in tumor cells . interestingly , while both spreading and colony formation depended on the expression of tumor cell fibronectin , this function was not rescued by the addition of plasma fibronectin to fibrin . this difference in function could be owed to the specific expression of alternatively spliced modules in cellular fibronectin 27 . alternatively , it is conceivable that the formation of compact fibrin fibrils is impaired as free diffusion of plasma fibronectin is hindered following the fxiii - mediated cross - linking activity of fibronectin to fibrin 28 . overall , our data suggest that fibronectin matrix formation is a prerequisite for tumor cell spreading and colonization in 3d . in agreement with this , it has been shown that 786 - 0 kidney cancer cells are unable to assemble fibronectin fibers when cultured on 2d plastic even though they generate an elaborate fibronectin matrix in 3d fibrin as well as matrigel 29 . lack of fibronectin matrix assembly in 2d has been attributed to the loss of functional von - hippel - lindau protein ( vhl ) , which supports fibronectin fibril formation through a distinct mechanism involving 1 integrin in combination with rhoa 29 - 31 . however , while these vhl - related functions induce spreading and extracellular matrix formation in 2d , they are largely insufficient for mediating spreading of vhl - positive kidney tumor cells in 3d matrigel 18 . vhl - negative 786 - 0 cells on the other hand spread in matrigel , albeit to a lesser extent than in fibrin , and this function correlates with fibronectin matrix assembly . interestingly , kidney tumor cell spreading and fibronectin matrix formation in matrigel can be induced through stimulation of the receptor tyrosine kinase c - met , which has been shown to promote cell scattering through cross - talk with 1 integrin 32 . a similar mechanism involving crosstalk between 3 integrin and other receptor tyrosine kinases activated in rcc such as pdgfr or egfr could account for spreading and subsequent fibronectin assembly in 3d fibrin 33 , 34 . in addition to fibronectin matrix formation , we found that kidney tumor cells generated extensive stress fibers following embedding in fibrin . both stress fiber and fibronectin matrix formation have been shown to be relevant for the metastatic outgrowth of dormant breast tumor cells 7 . this process appears to be highly relevant because primary tumor cells from patients with kidney cancer metastasis where significantly more prone to stress fiber formation than cells from patients where the tumor was limited to the kidney . moreover , inhibition of actomyosin contraction with the rho kinase inhibitor y-27632 inhibited fibronectin matrix assembly as well as colony formation in fibrin - embedded tumor cells . while the mechanism of fibronectin and stress fiber formation is relevant for tumor cell colonization , it does not appear to play a role in kidney tumor cell survival 17 . based on these results , we propose a mechanism where fibrin promotes adhesive interactions that result in fibronectin matrix and stress fiber assembly . this in turn appears to be a prerequisite for expression of the emt master regulator and cancer stem cell factor slug / snail ( fig . therefore , inhibiting actomyosin dynamics in kidney cancer could be an attractive strategy to prevent and treat metastasis . fig . s1
knockdown of fibronectin , western blotting for fibronectin ( fn ) to demonstrate knockdown in shfn ht1080 clone compared to shscr control . | fibrin plays an important role in lung metastasis . here
we show that fibrin promotes colony formation in primary kidney tumor cells from patients with kidney metastasis . in addition
, we found that inhibition of fibrin formation with the thrombin inhibitor hirudin in nude mice in vivo significantly reduced the metastatic outgrowth of kidney tumor cells .
colony formation was significantly more efficient in tumor cells embedded in fibrin compared to matrigel and this effect correlates with the capacity of tumor cells to assemble a fibronectin matrix and generate stress fibers .
interestingly , stress fiber formation in fibrin was a specific function of metastatic kidney tumor cells while non - metastatic cells remained round .
inhibition of stress fiber formation with the rho kinase inhibitor y-27632 , in turn , reduced fibronectin matrix assembly and colony formation in fibrin suggesting that spreading is a critical mechanism for the outgrowth of metastatic kidney tumor cells .
overall , our results indicate that adhesive interactions with fibrin play an important role for the progression of renal cell carcinoma and that inhibiting these interactions could be a promising strategy for treatment and prevention of kidney cancer metastasis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a clinical pathway ( cp ) is a structured care plan that indicates the sequence and timing of care actions necessary to achieve goals with optimal efficiency1,2,3 ) . cps have been found to be efficient and have advantages for high volume procedures that lack substantial unexpected events4,5 ) . it was previously revealed that implementation of a cp could reduce hospital stay , cost and complication rate when applied to relevant indications in various fields of medicine1,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25 ) . for patients undergoing total knee arthroplasty ( tka ) , an increase in functional outcome and a decrease in pain after implementing the cp were reported6,25 ) . however , there are also concerns about cps . thus , a cp may not be an optimal approach for a patient and/or disease with great variability during treatment . under such circumstances , frequent unexpected events during the treatment may lead to the frequent changes of the care plan or dropouts from the cp . because tka is primarily performed in elderly patients with frequent comorbidities , a concern about unexpected events related to these comorbidities has led to the question of whether tka is an ideal procedure for the application of a cp . nonetheless , it is possible to establish an advanced cp system that enables us to cope with individual differences among tka patients and unexpected events that arise during their care , based on various perioperative management methods for tka patients reported by recent studies and the accumulated experience of health care providers . it is expected that this improved cp can reduce the dropout rate of tka patients and improve the health care providers ' perception about the cp . if these were accomplished , the cp would become a more optimal , standardized care system for tka patients by continuous improvement of the contents of the cp for tka . however , no previous studies have rigorously studied these issues of a cp for tka . we , therefore , aimed to determine 1 ) whether the dropout rate decreased and 2 ) whether health care providers ' perceptions were changed with continued improvements of the contents of our cp for tka . we hypothesized that the continued improvements of the cp contents would reduce the dropout rate and improve the health care providers ' perceptions about the cp for tka . this observational study was performed using medical chart review and self - administered questionnaires , and involved two separate analyses : 1 ) analysis of the patients who underwent primary tka and 2 ) analysis of the health care providers . this study was approved by institutional review board of the authors ' hospital . since december 2007 , a cp was applied to all the patients undergoing primary tka in our institute , without exception . analysis of dropout rate from the cp included 626 patients who underwent primary tka with application of the cp . the first time period group consisted of 384 patients who underwent primary tka from april 2009 to march 2010 at our institution . the second time period group included 242 patients who underwent primary tka from april 2012 through march 2013 . the time period groups did not differ in sex distribution ; however , they differed in terms of age , height , weight and body mass index ( bmi ) ( table 1 ) . in total , 98 health care providers were included ; they comprised the residents and the nurses who had experiences with both the cp care and non - cp care in the department of orthopedic surgery at our institution . there were 11 residents and 21 nurses who completed the survey of 2010 ; 15 residents and 51 nurses completed the survey of 2013 . between the two periods , we improved the cp in terms of medical and non - medical contents . for preemptive pain management , one hour before surgery , multimodal oral analgesic drugs were administered in addition to celecoxib 200 mg on as - needed basis26 ) . to manage blood loss , the use of tranexamic acid ( tna ) was added . in unilateral tkas , patients were given a 10 mg / kg of body weight dose of tna 30 minutes before tourniquet deflation , and the same dose was repeated 3 hours after the commencement of the first injection . in simultaneous bilateral tkas , the same dose of tna was administered 30 minutes before tourniquet deflation for the 1st operation , then 30 minutes before tourniquet deflation for the 2nd operation , and finally , the same dose was repeated 3 hours after the commencement of the second injection27 ) . to prevent postoperative emesis , patients received 10 mg intravenous dexamethasone 1 hour before surgery26 ) . for deep vein thrombosis prophylaxis , postoperative rivaroxaban was added . for the non - medical contents of the cp , we made convenient icons to add an order in the electron medical record system , made a cp for diabetes mellitus patients , and had regular meetings so that it was easier to operate in terms of selection of the cp , reporting problems about the patients , and communication among health care providers . the dropout rate and the reasons for dropout were investigated by reviewing the medical records . the patients were classified as ' completion ' of the cp or ' dropout ' from the cp . according to the cp protocol , all elective patients undergoing primary tka are admitted the day before surgery , the patients undergoing unilateral primary tka are discharged 7 days after surgery , the patients undergoing staged bilateral primary tka are discharged 7 days after the second knee surgery ( i.e. , 14 days after the first knee surgery ) , and the patients undergoing simultaneous bilateral primary tka are discharged 9 days after surgery in our hospital . this schedule for discharge the outcome was defined as ' dropout ' if the patient failed to complete the cp for any reason , including a prolonged hospital stay of > 2 days . the reasons for dropout were classified into non - medical reasons and 8 medical reasons . the non - medical reasons included earlier or later discharge attributable to the patients ' desire . medical reasons were classified into the following 8 categories : 1 ) delayed rehabilitation , 2 ) wound complication , 3 ) acute postoperative infection , 4 ) minor systemic problem , 5 ) major systemic problem , 6 ) other management problem not related to the knee joint , 7 ) intraoperative complication , and 8) mortality . delayed rehabilitation was defined as withdrawal from the cp because of the problems related to ambulation and/or range of motion of the knee joint . cardiopulmonary complication was classified as a major systemic problem , while the other systemic complications were classified as a minor systemic problem . if a medical problem unrelated to the operated knee joint , such as voiding difficulty , required management , this reason was classified as other management not related to knee joint . in addition , complications such as neurovascular injury or additional ligament injury that occurred during the operation were classified as intraoperative complication . a death associated with the operation , either directly or indirectly , was classified as mortality . health care providers ' perceptions about the cp were evaluated using a self - administered questionnaire that consisted of 16 questions ( appendix ) . it had the following three sections : 9 questions about potential benefits , 4 questions about potential concerns , and 3 questions about valuation . the question about satisfaction with cp in the valuation section was evaluated using visual analog scale that graded 11 steps from 0 to 10 , and the remaining 15 questions were assessed by the likert scale ( 5 : strongly agree , 4 : agree , 3 : neutral , 2 : disagree , 1 : strongly disagree ) . the same survey was carried out twice , in april 2010 and in april 2013 . armonk , ny , usa ) , and p - values of < 0.05 were considered significant . to compare the dropout rate between the two time - period groups , the proportions of the dropout patients were cross - tabulated across the time - period groups , and statistically significance differences were determine using the chi - square test . to compare the frequencies of the dropout reasons between the two time - period groups , the proportions of each reason were calculated for each time - period group , and analyzed using the chi - square test . to compare the perceptions of health care providers about the cp between two time - period groups , the answers for the questions assessed by the likert scale were dichotomized into ' agree ' and ' disagree ' ( ' agree ' ; strongly agree , agree and ' disagree ' ; neutral , disagree , strongly disagree ) , and the proportions of the responders who were in the agree category were cross - tabulated across the time - period groups , and the proportions were compared using the chi - square test or fisher - exact test . to compare the residents and nurses regarding perceptions of health care providers about the cp , the answers for the questions assessed by the likert scale were also dichotomized into ' agree ' and ' disagree ' ; the proportions of the responders who were in the agree category were cross - tabulated across the health care provider groups , and analyzed using the chi - square test or fisher - exact test . to compare health care providers ' satisfaction with the cp between the two time - periods , the means and standard deviations of the scores were calculated and analyzed using student 's t - test . since december 2007 , a cp was applied to all the patients undergoing primary tka in our institute , without exception . analysis of dropout rate from the cp included 626 patients who underwent primary tka with application of the cp . the first time period group consisted of 384 patients who underwent primary tka from april 2009 to march 2010 at our institution . the second time period group included 242 patients who underwent primary tka from april 2012 through march 2013 . the time period groups did not differ in sex distribution ; however , they differed in terms of age , height , weight and body mass index ( bmi ) ( table 1 ) . in total , 98 health care providers were included ; they comprised the residents and the nurses who had experiences with both the cp care and non - cp care in the department of orthopedic surgery at our institution . there were 11 residents and 21 nurses who completed the survey of 2010 ; 15 residents and 51 nurses completed the survey of 2013 . between the two periods , we improved the cp in terms of medical and non - medical contents . for preemptive pain management , one hour before surgery , multimodal oral analgesic drugs were administered in addition to celecoxib 200 mg on as - needed basis26 ) . to manage blood loss , the use of tranexamic acid ( tna ) was added . in unilateral tkas , patients were given a 10 mg / kg of body weight dose of tna 30 minutes before tourniquet deflation , and the same dose was repeated 3 hours after the commencement of the first injection . in simultaneous bilateral tkas , the same dose of tna was administered 30 minutes before tourniquet deflation for the 1st operation , then 30 minutes before tourniquet deflation for the 2nd operation , and finally , the same dose was repeated 3 hours after the commencement of the second injection27 ) . to prevent postoperative emesis , patients received 10 mg intravenous dexamethasone 1 hour before surgery26 ) . for deep vein thrombosis prophylaxis , postoperative rivaroxaban was added . for the non - medical contents of the cp , we made convenient icons to add an order in the electron medical record system , made a cp for diabetes mellitus patients , and had regular meetings so that it was easier to operate in terms of selection of the cp , reporting problems about the patients , and communication among health care providers . the dropout rate and the reasons for dropout were investigated by reviewing the medical records . the patients were classified as ' completion ' of the cp or ' dropout ' from the cp . according to the cp protocol , all elective patients undergoing primary tka are admitted the day before surgery , the patients undergoing unilateral primary tka are discharged 7 days after surgery , the patients undergoing staged bilateral primary tka are discharged 7 days after the second knee surgery ( i.e. , 14 days after the first knee surgery ) , and the patients undergoing simultaneous bilateral primary tka are discharged 9 days after surgery in our hospital . this schedule for discharge the outcome was defined as ' dropout ' if the patient failed to complete the cp for any reason , including a prolonged hospital stay of > 2 days . the reasons for dropout were classified into non - medical reasons and 8 medical reasons . the non - medical reasons included earlier or later discharge attributable to the patients ' desire . medical reasons were classified into the following 8 categories : 1 ) delayed rehabilitation , 2 ) wound complication , 3 ) acute postoperative infection , 4 ) minor systemic problem , 5 ) major systemic problem , 6 ) other management problem not related to the knee joint , 7 ) intraoperative complication , and 8) mortality . delayed rehabilitation was defined as withdrawal from the cp because of the problems related to ambulation and/or range of motion of the knee joint . cardiopulmonary complication was classified as a major systemic problem , while the other systemic complications were classified as a minor systemic problem . if a medical problem unrelated to the operated knee joint , such as voiding difficulty , required management , this reason was classified as other management not related to knee joint . in addition , complications such as neurovascular injury or additional ligament injury that occurred during the operation were classified as intraoperative complication . a death associated with the operation , either directly or indirectly , was classified as mortality . health care providers ' perceptions about the cp were evaluated using a self - administered questionnaire that consisted of 16 questions ( appendix ) . it had the following three sections : 9 questions about potential benefits , 4 questions about potential concerns , and 3 questions about valuation . the question about satisfaction with cp in the valuation section was evaluated using visual analog scale that graded 11 steps from 0 to 10 , and the remaining 15 questions were assessed by the likert scale ( 5 : strongly agree , 4 : agree , 3 : neutral , 2 : disagree , 1 : strongly disagree ) . the same survey was carried out twice , in april 2010 and in april 2013 . statistical analyses were conducted using spss ver . 20.0 ( ibm corp . , armonk , ny , usa ) , and p - values of < 0.05 were considered significant . to compare the dropout rate between the two time - period groups , the proportions of the dropout patients were cross - tabulated across the time - period groups , and statistically significance differences were determine using the chi - square test . to compare the frequencies of the dropout reasons between the two time - period groups , the proportions of each reason were calculated for each time - period group , and analyzed using the chi - square test . to compare the perceptions of health care providers about the cp between two time - period groups , the answers for the questions assessed by the likert scale were dichotomized into ' agree ' and ' disagree ' ( ' agree ' ; strongly agree , agree and ' disagree ' ; neutral , disagree , strongly disagree ) , and the proportions of the responders who were in the agree category were cross - tabulated across the time - period groups , and the proportions were compared using the chi - square test or fisher - exact test . to compare the residents and nurses regarding perceptions of health care providers about the cp , the answers for the questions assessed by the likert scale were also dichotomized into ' agree ' and ' disagree ' ; the proportions of the responders who were in the agree category were cross - tabulated across the health care provider groups , and analyzed using the chi - square test or fisher - exact test . to compare health care providers ' satisfaction with the cp between the two time - periods , the means and standard deviations of the scores were calculated and analyzed using student 's t - test . dropout rate decreased from 19.1% in the first time period to 10.4% in the second time period ( p=0.004 ) . the reduction in overall dropout rate was largely attributable to the reduction in dropouts caused by medical reasons ( from 12.8% to 5.4% , p=0.003 ) : decreases in delayed rehabilitation and wound complications were the major reasons ( table 2 ) . there was no change in overall satisfaction with the cp between the first and second periods ; however , residents had a more favorable perception than nurses in both time periods ( table 3 ) . the health care provider 's perceptions of the potential concerns about the cp were improved . in contrast , the perceptions on potential benefits , except for economic perspectives , and the levels of satisfaction with cp were maintained . all significant changes in the perceptions of potential benefits between two time periods were observed in nurses . after continued improvement of the cp contents , nurses agreed that the cp facilitates the transfer of a duty ( 43% vs. 71% , p=0.027 ) . the perceptions of whether the cp can improve quality of care and safety were not changed . the perceptions on potential economic benefits , namely reducing hospital cost and length of stay , were changed negatively ( table 4 ) . regarding the potential concerns about the cp , the negative perceptions of the cp were reduced in the second time period : only 18% of the health care providers responded that the cp inhibited creative thinking as a trainee in the second time period compared to 41% in the first time period ( p=0.017 ) . this reduction was largely due to the reduction in negative perception of the residents ( from 55% to 7% , p=0.021 ) ( table 5 ) . the perceptions about the cp regarding valuation showed no difference between in 2010 and in 2013 . however , 83% of the health care providers included in this study were willing to use the cp if they were given a choice ( table 6 ) . the cp is optimal for routine procedures without substantial unexpected events and has some inherent limitation in flexibility to adjust to patient 's individual conditions . therefore , the typical characteristics of tka patients , i.e. , elderly individuals frequently with medical comorbidities , have raised concerns about whether tka is an ideal procedure for applying a cp . in addition , health care providers may have negative perceptions about the application of a cp to tka patients . however , continued improvements of the cp contents , which enables coping with individual differences in tka patients , may reduce dropout rates or health care providers ' negative views about the cp . to address these issues , we investigated changes in dropout rates in patients who underwent tka and health care providers ' perceptions between two time - periods over an interval of 3 years during which continued improvements of the cp contents for tka were made . first , this study was conducted using heterogeneous patient groups . in the analysis of dropout rate from the cp the characteristics of more aged patients in more recent time - period group corresponded to our national trend of tka candidates28 ) , consistent with the extremely rapid increase of the elderly in our country . however , considering that the rate of dropout was reduced in the second time period group despite their older age , we believe that the integrity of our study was not jeopardized by demographic differences . second , we did not examine the changes in health care providers ' perceptions among the same providers that worked during the time periods of the two patient cohorts . instead , we included the residents and the nurses who were available at the time of the each survey . however , we only included the residents and the nurses who had been trained with the same program under the same environment , and thus , the bias originating from different study cohorts would be minimal . our results support the hypothesis that continued improvements of cp contents would decrease the dropout rate . in the literature related to the cp for tka , most studies excluded the patients with american society of anesthesiologists physical status score 3 and 412 ) , chronic opioid use or chronic pain syndrome29 ) , high comorbidities , severe cardiac / respiratory disease , and severe multiple joint involvement30 ) . this restrictive strategy could reduce dropout , but also reduce the application rate of the cp . in contrast , we applied the cp to the patients undergoing primary tka without exception . even with the 100% application , the dropout rate was reduced to a reasonable level after continued improvement of cp contents . moreover , the rate of dropout due to medical reasons markedly decreased in the more recent time - period group ( 12.8% in the first time - period group vs. 5.4% in the second time period group ) while the dropouts due to nonmedical reasons were not significantly changed . thus , we believe that a contemporary cp , when its contents have been continuously improved , would be valuable for systematic perioperative care of tka patients . findings of our study affirm the hypothesis that the continued improvements of cp contents would improve the health care providers ' perceptions about the cp for tka . in contrast , the health care providers ' perceptions became worse in economic perspective in terms of the hospital cost and length of hospital stay . these are somewhat discordant with the result of previous studies that revealed that a cp was an effective method to reduce hospital cost and length of stay without compromising quality of patient care and safety8,20,30 ) . it can be explained by the fact that we did not change the discharge plans of the cp during the study period although we changed the contents of the cp to add new drugs and/or interventions for pain and postoperative emesis control . thus , health care providers might have thought that the hospital cost was increased because of the additional orders for drugs and interventions . this study demonstrates that , with continuing improvements in the contents of the cp , this cp has increased feasibility for tka patients and reduced health care providers ' concern about its value . our findings suggest that cp can be safely implemented and actively used as an optimal perioperative care strategy for patients undergoing tka , regardless of the rotation of care providers . | purposewe aimed to determine 1 ) whether dropout rate decreased and 2 ) whether health care providers ' perceptions were changed with continued improvements of contents of clinical pathway ( cp ) for total knee arthroplasty ( tka).materials and methodsthis retrospective study included two separate analyses of patients and health care providers . in the analysis of patients , dropout rates and reasons
were evaluated in two cohorts of patients who underwent tka with cp applied at two different time periods ( 384 patients from 2009 to 2010 and 242 patients from 2012 to 2013 ) .
contents of cp were continuously improved during the 3-year interval .
self - administered questionnaire surveys targeted to health care providers were carried out twice ( 2010 and 2013 ) and compared.resultsdropout rate decreased from 19.1% in the first time period to 10.4% in the second time period .
although overall satisfaction of care providers was high at both time - points , doctors had more favorable perceptions than nurses ; most positive changes of perception were noted in nurses .
the health care providers ' perceptions for potential concerns of cp were improved while the perceptions for potential benefits and satisfaction were maintained.conclusionscontinuously improved cp has increased feasibility for tka patients and reduced health care providers ' concern about its value .
we propose that cp can be implemented and actively used to improve the outcomes and efficacy of patient care for tka , regardless of the rotation of care providers . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
risk - reducing salpingo - oophorectomy ( rrso)the removal of the fallopian tubes and ovaries to reduce the risks of breast and ovarian cancer is a cancer prevention strategy used by many women who carry germline mutations in the brca1 and/or brca2 genes ( brca1/2 ) . however , the magnitude of the risk reductions in women with brca1/2 mutations who have undergone rrso compared with those who have not is unclear . a fixed - effects meta - analysis of pooled results from 10 published reports of rrso and the risks of breast and/or ovarian or fallopian tube cancer in brca1/2 mutation carriers . rrso was found to be strongly associated with substantial reductions in the risks of breast , ovarian , and fallopian tube cancers among women who carry mutations in brca1 or brca2 . the summary risk reduction estimates should provide guidance to women in planning cancer risk reduction strategies . data were not available to evaluate the effects of birth cohort , timing of surgery , or other factors that may influence the risk reduction estimates associated with rrso . risk - reducing salpingo - oophorectomy ( rrso)the removal of the fallopian tubes and ovaries to reduce the risks of breast and ovarian cancer is a cancer prevention strategy used by many women who carry germline mutations in the brca1 and/or brca2 genes ( brca1/2 ) . however , the magnitude of the risk reductions in women with brca1/2 mutations who have undergone rrso compared with those who have not is unclear . a fixed - effects meta - analysis of pooled results from 10 published reports of rrso and the risks of breast and/or ovarian or fallopian tube cancer in brca1/2 mutation carriers . rrso was found to be strongly associated with substantial reductions in the risks of breast , ovarian , and fallopian tube cancers among women who carry mutations in brca1 or brca2 . the summary risk reduction estimates should provide guidance to women in planning cancer risk reduction strategies . data were not available to evaluate the effects of birth cohort , timing of surgery , or other factors that may influence the risk reduction estimates associated with rrso . to identify all reports of rrso in brca1/2 mutation carriers , we searched the pubmed database using the search terms oophorectomy and brca1 or brca2 . this search yielded 346 studies that were published between january 1999 and december 2007 : 309 that included the term brca1 in the title and 267 that included the term we then evaluated the full text of these citations to identify articles presenting primary data that provided estimates of risk reduction due to rrso . no publications were excluded based on quality , sample size , language of publication , or other objective criteria related to study design and analysis . however , some publications that reported rrso in brca1/2 mutation carriers were not included because they did not estimate risk reduction . these included case reports , psychosocial or behavioral studies , commentaries , and clinical recommendations . because the number of brca1/2 mutation carriers is relatively limited and most research groups studying these women are in routine communication and collaborate with one another , we also undertook personal communications with all of the researchers or consortia that have large series of brca1/2 mutation carriers and were known to have data that could have been used to report data on this topic . we undertook a fixed - effects meta - analysis using the hazard ratios ( hrs ) and/or odds ratios ( as published in the original reports ) to estimate the pooled relative risks and 95% confidence intervals ( cis ) . when two or more studies had overlapping study samples , we included only one published report from each group . of the studies identified here , sample overlaps were noted in the studies of rebbeck et al . ( 16 ) , which had the largest sample size of these five studies , was chosen for inclusion in the meta - analysis . there were no apparent overlaps among the other datasets , although we can not rule out the possibility that a few individuals had participated in more than one study . we carried out separate meta - analyses in brca1 mutation carriers , brca2 mutation carriers , and among women who carried either brca1 or brca2 mutations ( denoted brca1/2 ) . a chi - square test of homogeneity among the individual risk ratio estimates of the identified studies was also performed . to evaluate potential for publication bias , we used the adjusted rank correlation test of begg and mazumdar ( 20 ) . all analyses were conducted using stata / se v9.0 ( statcorp , college station , tx ) . to identify all reports of rrso in brca1/2 mutation carriers , we searched the pubmed database using the search terms oophorectomy and brca1 or brca2 . this search yielded 346 studies that were published between january 1999 and december 2007 : 309 that included the term brca1 in the title and 267 that included the term we then evaluated the full text of these citations to identify articles presenting primary data that provided estimates of risk reduction due to rrso . no publications were excluded based on quality , sample size , language of publication , or other objective criteria related to study design and analysis . however , some publications that reported rrso in brca1/2 mutation carriers were not included because they did not estimate risk reduction . these included case reports , psychosocial or behavioral studies , commentaries , and clinical recommendations . because the number of brca1/2 mutation carriers is relatively limited and most research groups studying these women are in routine communication and collaborate with one another , we also undertook personal communications with all of the researchers or consortia that have large series of brca1/2 mutation carriers and were known to have data that could have been used to report data on this topic . we undertook a fixed - effects meta - analysis using the hazard ratios ( hrs ) and/or odds ratios ( as published in the original reports ) to estimate the pooled relative risks and 95% confidence intervals ( cis ) . when two or more studies had overlapping study samples , we included only one published report from each group . of the studies identified here , sample overlaps were noted in the studies of rebbeck et al . ( 16 ) , which had the largest sample size of these five studies , was chosen for inclusion in the meta - analysis . there were no apparent overlaps among the other datasets , although we can not rule out the possibility that a few individuals had participated in more than one study . we carried out separate meta - analyses in brca1 mutation carriers , brca2 mutation carriers , and among women who carried either brca1 or brca2 mutations ( denoted brca1/2 ) . a chi - square test of homogeneity among the individual risk ratio estimates of the identified studies was also performed . to evaluate potential for publication bias , we used the adjusted rank correlation test of begg and mazumdar ( 20 ) . all analyses were conducted using stata / se v9.0 ( statcorp , college station , tx ) . the studies that formed the basis of this meta - analysis included case control studies as well as prospective and retrospective cohort studies ( table 1 ) . as can be seen in this summary , limitations of the currently available data regarding rrso in brca1/2 mutation carriers include variable study designs , small sample sizes for individual studies , many of which are retrospective in nature , and short post - rrso follow - up times in prospective studies . eight studies ( 8 - 10,12 - 16 ) estimated the risk of breast cancer in brca1/2 mutation carriers who were treated with rrso relative to brca1/2 mutation carriers who did not receive this treatment ( table 2 ) . as summarized in table 3 and figure 1 , three nonoverlapping studies ( 1416 ) , which included 5703 participants , estimated the risk of breast cancer in brca1/2 mutation carriers who received rrso relative to brca1/2 mutation carriers who did not receive the procedure , giving a summary hr estimate of 0.49 ( 95% ci = 0.37 to 0.65 ) . four nonoverlapping studies ( 12,1416 ) estimated the risk reduction associated with rrso for breast cancer in brca1 mutation carriers , giving a summary hr estimate of 0.47 ( 95% ci = 0.35 to 0.64 ) . finally , three nonoverlapping studies ( 1416 ) estimated the relative risk for breast cancer in brca2 mutation carriers , giving a summary hr estimate of 0.47 ( 95% ci = 0.26 to 0.84 ) ( table 3 , figure 1 ) . published studies of risk - reducing salpingo - oophorectomy and cancer risk in brca1/2 mutation carriers * in all but one of the prospective cohort studies , women with a prior diagnosis of breast cancer were included for the ovarian endpoint . in domchek et al . ( 13 ) all patients were unaffected with breast or ovarian cancer at the start of follow - up , as the study was designed to evaluate the impact of rrso on cancer incidence as well as disease - specific and overall survival . b1 = brca1 mutation carriers ; b2 = brca2 mutation carriers ; b1/2 = combined brca1 or brca2 group ; pc = prospective cohort ; rc = retrospective cohort ; cc = case control ; namc = north american multicenter cohort ; sis = single - institution study ; imc = international multicenter cohort ; ismc = israeli multicenter cohort ; emc = european multicenter cohort ; myfu = mean years of follow - up ; py = person - years ; nr = not reported ; and na = not applicable ; rrso = risk - reducing salpingo - oophorectomy . in the original publications , the prospective and retrospective cohorts were analyzed by survival / failure time analysis methods ; the case control studies were analyzed by logistic regression . six studies ( 8,10,11,13,16,17 ) ( table 2 ) estimated the risk of gynecologic cancer in brca1/2 mutation carriers treated with rrso relative to brca1/2 mutation carriers who did not receive this treatment . based on data from the three nonoverlapping datasets ( 11,16,17 ) , which included 2840 participants , the summary hr was 0.21 ( 95% ci = 0.12 to 0.39 ) ( table 3 , figure 1 ) . only one study ( 16 ) estimated the risk of gynecologic cancer in brca1 mutation carriers treated with rrso relative to untreated brca1 carriers ( hr = 0.15 , 95% ci = 0.04 to 0.56 ) ( table 2 ) . ( 16 ) did investigate risk reduction in 294 women with brca2 mutations , but observed no post - rrso gynecologic cancers in this sample . published studies of risk - reducing salpingo - oophorectomy and cancer risk in brca1/2 mutation carriers * hazard ratios ( hrs ) , odds ratios ( ors ) ( with 95% confidence intervals ) , and sample size ( n ) are presented . na = not applicable . not included in summary hr estimate because the sample set overlaps with that of other reports . studies included in the summary estimate were chosen to maximize the sample size ( power ) of the meta - analysis . we found no evidence of publication bias of any of our estimates based on the begg and majumder test statistics presented in table 3 . no evidence of study heterogeneity was found based on the x test ( table 3 ) . summary estimates for ovarian / fallopian tube cancer and breast cancer risk reduction associated with salpingo - oophorectomy in brca1/2 mutation carriers * na = not applicable ; hr = hazard ratio ; ci = confidence interval . according to begg and mazumder ( 20 ) . the clinical management of cancer risk in brca1 and brca2 mutation carriers is complex and should consider patient preferences ; these preferences can be informed by accurate knowledge of the risks and benefits of the interventions considered ( table 4 ) . the results of our meta - analysis suggest an 80% reduction in ovarian / fallopian tube cancer risk and a 50% reduction in breast cancer risk associated with rrso in women who carry mutations in brca1 or brca2 . the consistency of these findings across the included studies confirms the strong association of rrso with reduced risks of breast and ovarian cancer in brca1 or brca2 mutation carriers . in addition , modeling studies have also demonstrated that salpingo - oophorectomy has a large effect on years of life added , particularly when adjusted for quality of life ( 31 ) . furthermore , in a prospective study with short - term follow - up , rrso was associated with a 90% reduction in breast cancer specific mortality , a 95% reduction in gynecologic cancer specific mortality , and a 76% reduction in overall mortality ( 13 ) . therefore , all of the available data demonstrate the utility of salpingo - oophorectomy in this population of patients . synopsis of management strategies available to brca1 and brca2 mutation carriers * rrso = risk - reducing salpingo - oophorectomy ; er = estrogen receptor ; mri = magnetic resonance imaging . despite the consistent evidence favoring rrso in women with mutations in brca1 or brca2 , first , the influence of cohort effects on cancer risk over time remain unclear , despite evidence that differences in risk over time may reflect changing exposures , lifestyle , reproductive history , and use of screening or preventive surgeries ( 32 ) . we lacked the data necessary to evaluate the effects of birth cohort , timing of surgery , or other factors that may influence the risk reduction estimates associated with rrso . therefore , at this time it is difficult to infer whether specific cohorts , exposure groups , or other strata may experience different risk reduction effects than others . to limit the possibility that reporting bias influenced our findings however , we did not include any studies that reported the association of rrso with cancer risk without providing estimates of risk reduction because these data would not contribute to pooled estimates of risk reduction . because some studies included in the this analysis were limited in sample size and statistical power , their effect estimates for rrso were large but not statistically significant , suggesting that a meta - analysis and presentation of summary statistics was appropriate . two studies ( 15,17 ) were included in the summary estimates even though they used case control designs , and therefore they yielded odds ratios rather than hazard ratios . although odds ratios may slightly overestimate the risk reduction associated with rrso , the annual incidence of ovarian and breast cancer in brca1/2 mutation carriers is no more than 2%4% , with the result that odds ratios are likely to be similar to hazard ratios in this setting . some of the variability in the individual study estimates reported may reflect study design differences , including the use of retrospective vs prospective samples and poorly characterized selection biases . despite these differences , we noted no statistically significant heterogeneity in the estimates of risk reduction after rrso . in addition , cohort studies estimated a greater reduction in cancer risk associated with rrso ( particularly ovarian / fallopian tube cancers ) compared with the case control studies ( table 1 ) . as a result , there is some variability in the estimates obtained using case control and cohort studies ; nonetheless , the estimates all consistently reflect risk reduction associated with rrso . we have included all of the large collaborative group studies that addressed the question of reduced risk conferred by rrso and whose study populations come from and are representative of mutation carriers in north america and europe . no studies of rrso in nonwhite populations have been reported , and additional data may be needed to understand the role of rrso in these groups . finally , the samples of women with brca1/2 mutations reported here represent those who have generally been identified through high - risk clinics . however , they do represent the population of women who receive genetic testing and may be candidates for rrso . therefore , the populations summarized here represent the most relevant group in whom rrso may be applied at this time . despite the strength and consistency of the data in the literature as reflected in our meta - analysis , a number of questions remain . there are only a few estimates of the association of rrso with cancer risk in populations composed exclusively of brca1 mutation carriers or brca2 mutation carriers ( 12,1416 ) , and it is critical to understand how risk reduction may differ by gene . using a prospective cohort approach and a large consortium dataset , we recently estimated gene - specific risks and found that hormonal modulation by rrso may be associated with a greater reduction in breast cancer risk in brca2 mutation carriers than in brca1 mutation carriers ( 16 ) . in contrast , the studies that used retrospective cohort ( 14 ) or case control approaches ( 14,15 ) did not observe this difference , and therefore , there was no difference in the pooled estimates of breast cancer risk reduction reported in table 1 . thus , differences in study design may influence the inferences we can make about the differences in risk reduction associated with rrso in brca1 vs brca2 mutation carriers . the potentially larger risk reduction associated with rrso in brca2 vs brca1 mutation carriers is of interest , given the high proportion of estrogen receptor ( er)negative breast tumors in brca1 mutation carriers compared with brca2 mutation carriers ( 33 ) . our observation of a higher risk in brca2 mutation carriers should be followed up in larger studies that specifically evaluate tumor markers . in addition , attention needs to be given to the time interval between rrso and breast cancer diagnosis . for example , it is possible that there is greater breast cancer risk reduction in brca2 mutation carriers , in whom the majority of tumors are er positive , given that rrso may treat some subclinical breast tumors . in contrast , in brca1 mutation carriers , who have predominantly er - negative breast cancer , it is unclear whether a treatment effect may exist , and any primary prevention effect may require more time to emerge . eisen et al . ( 15 ) reported that the breast cancer risk reduction with rrso was greater in brca1/2 mutation carriers who underwent surgery before age 50 than in women who underwent surgery after age 50 . among brca1 mutation carriers older than age 50 , no statistically significant association of rrso at any age with risk reduction was observed in brca2 mutation carriers . although these findings are consistent with effects of removal of hormone exposures in premenopausal women and not in postmenopausal women , the sample sizes in this analysis ( 15 ) were relatively small . the importance of understanding the optimal age at which a woman should consider rrso is underscored by a recent study ( 34 ) conducted in the general population that suggests that rrso in women younger than age 45 is associated with an increased mortality , particularly if hormone replacement therapy ( hrt ) is not used . an initial report of hrt use after rrso suggests that women can undergo rrso and take hrt for a short time if needed after surgery because breast cancer risk is not substantially elevated in hrt users after rrso ( 35 ) . although data on postmenopausal women do not demonstrate a cardiovascular benefit from hrt ( 36 ) , an important limitation of this study ( 36 ) was the older age of the participants . more recent data have suggested that younger women going through natural menopause may indeed derive a cardiovascular benefit from hrt ( 36,37 ) , and it is possible that brca1/2 mutation carriers undergoing abrupt surgical menopause to reduce ovarian cancer risk who receive hrt may in fact derive important cardiovascular , bone health , and quality - of - life benefits . although the risk benefit ratio of rrso is very different in brca1/2 mutation carriers than in the general population , and rrso in brca1/2 mutation carriers has been associated with improved overall survival in the short term , these studies pointing to the potentially complex relationship of rrso and hrt exposure raise important and difficult questions . for example , it is not yet clear whether the long - term effects of long - term hrt in unaffected mutation brca1/2 carriers will ultimately be more beneficial in preventing noncancer mortality in these women or more harmful by increasing their risk of breast cancer ( or potentially increasing cardiovascular events ) compared with the general population . given this possibility , studies that address the type , timing , and length of administration of hrt as well as its long - term effects on the association between rrso and cancer risk and on other health factors in brca1/2 mutation carriers , we provide a summary of clinical recommendations related to the detection and prevention of cancer in brca1/2 mutation carriers ( table 4 ) . finally , although rrso has become the standard of care for cancer risk reduction in women who have inherited brca1/2 mutations , other options for risk reduction also exist . women with brca1/2 mutations who have been treated with risk - reducing mastectomy have a substantially reduced breast cancer risk ( 30 ) . furthermore , a study of breast cancer screening that added yearly magnetic resonance imaging to screening mammography suggested that combination of these modalities may also have benefit in the early detection of breast cancer in this group of women ( 28 ) . in conclusion , the summary risk reduction estimates presented here confirm that brca1/2 mutation carriers who have been treated with rrso have a substantially reduced risk of both breast and ovarian cancer . therefore , additional cancer risk reduction and screening strategies are required to maximally reduce cancer incidence and mortality in this high - risk population . forest plots of relative risk ( rr ) estimates for risk reduction associated with risk - reducing salpingo - oophorectomy ( rrso ) . the box sizes reflect the relative sample sizes of the individual studies ; horizontal lines represent 95% confidence intervals ( cis ) . estimates less than a value of 1.0 suggest a favorable reduction in cancer risk associated with rrso . national institutes of health ( r01-ca083855 and r01-ca102776 to trr ) ; the department of defense breast cancer research program ( damd17 - 03 - 1 - 0375 to ndk ) ; the cancer genetics network ( hhsn21620074400c to smd ) ; the eileen genet fund and the project hope fund for ovarian cancer research and education . | backgroundrisk - reducing salpingo - oophorectomy ( rrso ) is widely used by carriers of brca1 or brca2 ( brca1/2 ) mutations to reduce their risks of breast and ovarian cancer . to guide women and their clinicians in optimizing cancer prevention strategies
, we summarized the magnitude of the risk reductions in women with brca1/2 mutations who have undergone rrso compared with those who have not.methodsall reports of rrso and breast and/or ovarian or fallopian tube cancer in brca1/2 mutation carriers published between 1999 and 2007 were obtained from a pubmed search .
hazard ratio ( hr ) estimates were identified directly from the original articles .
pooled results were computed from nonoverlapping studies by fixed - effects meta-analysis.resultsten studies investigated breast or gynecologic cancer outcomes in brca1/2 mutation carriers who had undergone rrso .
breast cancer outcomes were investigated in three nonoverlapping studies of brca1/2 mutation carriers , four of brca1 mutation carriers , and three of brca2 mutation carriers .
gynecologic cancer outcomes were investigated in three nonoverlapping studies of brca1/2 mutation carriers and one of brca1 mutation carriers .
rrso was associated with a statistically significant reduction in risk of breast cancer in brca1/2 mutation carriers ( hr = 0.49 ; 95% confidence interval [ ci ] = 0.37 to 0.65 ) .
similar risk reductions were observed in brca1 mutation carriers ( hr = 0.47 ; 95% ci = 0.35 to 0.64 ) and in brca2 mutation carriers ( hr = 0.47 ; 95% ci = 0.26 to 0.84 ) .
rrso was also associated with a statistically significant reduction in the risk of brca1/2-associated ovarian or fallopian tube cancer ( hr = 0.21 ; 95% ci = 0.12 to 0.39 ) .
data were insufficient to obtain separate estimates for ovarian or fallopian tube cancer risk reduction with rrso in brca1 or brca2 mutation carriers.conclusionthe summary estimates presented here indicate that rrso is strongly associated with reductions in the risk of breast , ovarian , and fallopian tube cancers and should provide guidance to women in planning cancer risk reduction strategies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tooth surface loss results in the functional loss of tooth tissues including enamel , dentin , and cementum . it can occur due to abrasion ( physical wear by objects or substances other than teeth ) , attrition ( direct tooth - to - tooth rubbing ) , or erosion ( non bacterial acid dissolution ) . however , in most individual cases , it is difficult to ascribe the cause of tooth surface loss to any one category of etiology.1,2 currently , erosion is believed to be the most common cause of tooth surface loss , even though it is not easy to make a definitive diagnosis in this regard.2 the distribution of tooth surface loss caused by erosion shows a predominance on occlusal surfaces ( especially the mandibular first molars ) , followed by facial surfaces ( the anterior maxillary teeth).3 the clinical appearances of erosion include broad concavities within smooth surface enamel , cupping of occlusal surfaces or incisal grooving with dentin exposure , and increased incisal translucency.2 when a patient suffers from tooth surface loss , restorative treatment should be considered . common complaints include dentine hypersensitivity and an unacceptable esthetic condition , and a pulpal exposure is also likely.2 hence , an appropriate restoratives treatment must be chosen . the materials used should form an intimate adaptation with cavity interfaces to resist microleakage and the influx of oral irritants . in other words , the restoration should not lead to postoperative sensitivity , interfacial staining , or recurrent caries . a variety of restorative materials are currently recommended for erosive lesions , including glass ionomer cement , reinforced glass ionomer cement , resin - modified glass ionomer cement , resin composite , and amalgam.4 each material has its own advantages and disadvantages , which are considered before selecting them as restorative materials . it is based on a polymethacrylate resin matrix along with a silane - coated , inorganic filler.5 resin composites can bind to the tooth structure and provide an acceptable esthetic result . however , resin composite is not effective in restoring large defects in posterior teeth , including its technical sensitivity to moisture . glass ionomer cement , mainly composed of calcium fluoroaluminosilicate glass in a powder form , reacts with aqueous polyacrylic acid or related polymeric acids.6 it is especially effective for treating erosive lesions because of its potential to release fluoride ions into the underlying dentine to protect tooth structure . in addition , it provides the ability of forming chemical bonds to the enamel and the dentin . however , glass ionomer cement is susceptible to fracture and exhibits low wear resistance.7 one of the development of glass ionomer cement was cermet cement ( metal - reinforced glass ionomer cement ) performed by mclean and gasser.8 this process fixed the ratio of glass to silver at 60:40 ( w : w ) . the silver particles would improve certain mechanical properties of the cement and increase its wear resistance.9,10 resin - modified glass ionomer cement was recently introduced as a restorative material . polyacids in a conventional glass ionomer cement were modified with a pendant methacrylate group.11 some studies claimed that it improved the mechanical properties of resin - modified glass ionomer cement.12,13 however , resin - modified glass ionomer cement , used particularly for occlusal restoration , still has a high rate of degradation when compared to resin composite and amalgam.5,14 amalgam has been used as a restorative material for almost 200 years . amalgam is an alloy made from reacting mercury with silver , tin , and copper.14 although amalgam has good physical properties for posterior restoration , it requires mechanical retention and more tooth preparation than other materials . the acid resistance property is another criterion considered while selecting materials for restoring erosive lesions . previous studies have shown that some dietary foods and beverages that are chemically acidic can cause surface degradation of restorative materials.13,15,16 these acidic foods and beverages can alter the surface hardness of glass ionomer cement , but cause only minor changes to the resin composite.16 little is known about the effect of dietary acids on other restorative materials , such as metal - reinforced glass ionomer cement and amalgam . beverages tested in previous studies13,15,16 include orange juices , apple juice , and cola soft drinks ; the acids most frequently found in these juices are citric , malic and phosphoric and carbonic acids , respectively.1719 in general , the habit of eating or chewing sour fruits , such as green mangoes , pineapples , and limes , is most commonly found in tropical countries such as australia , cuba and some countries in southeast asia.2023 one study conducted in thailand,23 with an emphasis on the southern region , showed that the risk factors associated with tooth wear included age , gender , number of teeth lost , frequency of alcohol consumption , carbonated drinking , and especially sour fruit intake . previous studies have shown that some beverages ( cola soft drinks , apple juice , and orange juices ) are harmful to restorative materials ( glass ionomer cement and resin composite),13,15,16 but little is known about the effect of these sour fruits ( green mangoes and pineapples ) on other restorative materials ( metal - reinforced glass ionomer cement and amalgam ) . therefore , the purpose of this study was to investigate the erosive potential and the titratable acidity of several acidic agents ( sour fruit juices ) on the surface hardness of four restorative materials : metal - reinforced glass ionomer cement , resin - modified glass ionomer cement , resin composite , and amalgam . the null hypothesis tested was that there was no difference in the surface microhardness of the four restorative materials after immersion in the acidic agents being tested . these included a metal - reinforced glass ionomer cement ( ketac silver aplicap ( ketac - s ) ) , a resin - modified glass ionomer cement ( fuji ii lc ) , a resin composite ( filtek z250 ) , and an amalgam ( valiant - ph.d . ) . fuji ii lc , supplied in a powder / liquid form , was used as the hand - mixing material . the ketac - s and the valiant - ph.d . were obtained as pre - loaded capsules , and were mixed using an electrical tritulator ( promix , dentsply detray gmbh , konstanz , germany ) at 4300 hz for 10 seconds . the fuji ii lc and the filtek z250 were polymerized for 40 seconds with a light - activated polymerization unit . ( 12 mm in diameter and 2.5 mm in thickness ) , forty - seven specimens of each restorative material were made . a polyethylene sheet and a glass slide the specimens were allowed to mature in their molds in an incubator at 37c for 1 hour after mixing . four storage media were used in this study : deionized water ( control ) , citrate buffer solution ( comparator ) , green mango juice ( magnifera indica l. ) , and pineapple juice ( ananas comosus l. ) . these juices were prepared from fresh pineapples and mangoes using a juicer and then sieved with double layers of filter cloth . the ph of each storage media ( except the deionized water ) was determined using a ph meter ( orion 900a , orion research , boston , ma , usa ) . ten ph readings of the freshly prepared juices were obtained in order to give a mean ph measurement for each solution . to determine titratable acidity ( buffering capacity ) , 24 20 ml of each acidic agent was added by 0.5 ml increments of 1 n sodium hydroxide ( naoh ) . the amount of naoh required to reach ph levels of 5.5 , 7.0 , and 10.0 was recorded . the titrations for each solution were also repeated ten times to obtain a mean value . the buffering capacity was assessed by plotting the ph against the quantity ( ml ) of naoh that was required to raise the ph to 5.5 , 7.0 , and 10.0 . after 1 hour in an incubator , the specimens of each material were transferred into the storage media while still in their molds . the reason for keeping the molds in the incubator for one hour before exposure to solutions is an estimated time for restorations being to exposed in the oral environment . the specimens were stored in individual plastic storage pots containing 20 ml of the storage media , which was a sufficient volume to completely cover the specimens and the mold . the immersed specimens were retained in their molds at 37c for the appropriate test period . twenty specimens of each restorative material were divided into four groups ( 5 discs / group ) . the hardness value ( kg / mm ) of each specimen was determined using a microhardness tester ( micromet ii , buehler , lake bluff , il , usa ) with a diamond vickers indenter . the specimens were placed on the platform with the surface to be tested facing the indenter . five indentations , equally spaced over a circle , were made on the surface of each specimen . the surface hardness test was carried out at the following intervals : 1 hour after mixing ( before immersion ) and then subsequently at 6 hours and at 1 , 2 , 3 , 4 , and 7 days . the long period of immersion here was performed to examine the extensive effect of those agents . during the test period , the plastic storage pots , containing the specimens for investigation , were kept in an incubator at 37c before hardness measurements were made . in order to maintain the original ph level of the storage solution , the juices were refreshed daily throughout the experiment . using scanning electron microscopy ( sem ) ( jsm model 5800lv , jeol , tokyo , japan ) , the effect of each storage agent on the surface micromorphology of the materials before and after immersion were determined . three specimens of each restorative material from each of the four storage media at day 3 and 7 were examined . the specimens were rinsed with distilled water for 5 minutes , dried and fixed onto an aluminium cylinder ( 13 mm in diameter and 10 mm in height ) . consequently , the specimens were sputter - coated with a gold - palladium alloy ( spi - module sputter , spi supplies , west chester , pa , usa ) and examined using sem . surface microhardness values were tested for significant differences ( at =.05 ) using a two - way anova with repeated measurement and tukey s honestly significant difference ( hsd ) for multiple comparisons . using a polytetrafluoroethylene cylindrical mold ( 12 mm in diameter and 2.5 mm in thickness ) , forty - seven specimens of each restorative material were made . a polyethylene sheet and a glass slide were then placed over the filled mold after which light pressure was applied . the glass slide and the specimens were allowed to mature in their molds in an incubator at 37c for 1 hour after mixing . four storage media were used in this study : deionized water ( control ) , citrate buffer solution ( comparator ) , green mango juice ( magnifera indica l. ) , and pineapple juice ( ananas comosus l. ) . these juices were prepared from fresh pineapples and mangoes using a juicer and then sieved with double layers of filter cloth . the ph of each storage media ( except the deionized water ) was determined using a ph meter ( orion 900a , orion research , boston , ma , usa ) . ten ph readings of the freshly prepared juices were obtained in order to give a mean ph measurement for each solution . to determine titratable acidity ( buffering capacity ) , 24 20 ml of each acidic agent was added by 0.5 ml increments of 1 n sodium hydroxide ( naoh ) . the amount of naoh required to reach ph levels of 5.5 , 7.0 , and 10.0 was recorded . the titrations for each solution were also repeated ten times to obtain a mean value . the buffering capacity was assessed by plotting the ph against the quantity ( ml ) of naoh that was required to raise the ph to 5.5 , 7.0 , and 10.0 . after 1 hour in an incubator , the specimens of each material were transferred into the storage media while still in their molds . the reason for keeping the molds in the incubator for one hour before exposure to solutions is an estimated time for restorations being to exposed in the oral environment . the specimens were stored in individual plastic storage pots containing 20 ml of the storage media , which was a sufficient volume to completely cover the specimens and the mold . the immersed specimens were retained in their molds at 37c for the appropriate test period . twenty specimens of each restorative material were divided into four groups ( 5 discs / group ) . the hardness value ( kg / mm ) of each specimen was determined using a microhardness tester ( micromet ii , buehler , lake bluff , il , usa ) with a diamond vickers indenter . the specimens were placed on the platform with the surface to be tested facing the indenter . the indenter was brought in contact with the specimen surface . five indentations , equally spaced over a circle , were made on the surface of each specimen . the surface hardness test was carried out at the following intervals : 1 hour after mixing ( before immersion ) and then subsequently at 6 hours and at 1 , 2 , 3 , 4 , and 7 days . the long period of immersion here was performed to examine the extensive effect of those agents . during the test period , the plastic storage pots , containing the specimens for investigation , were kept in an incubator at 37c before hardness measurements were made . in order to maintain the original ph level of the storage solution , using scanning electron microscopy ( sem ) ( jsm model 5800lv , jeol , tokyo , japan ) , the effect of each storage agent on the surface micromorphology of the materials before and after immersion were determined . three specimens of each restorative material from each of the four storage media at day 3 and 7 were examined . the specimens were rinsed with distilled water for 5 minutes , dried and fixed onto an aluminium cylinder ( 13 mm in diameter and 10 mm in height ) . consequently , the specimens were sputter - coated with a gold - palladium alloy ( spi - module sputter , spi supplies , west chester , pa , usa ) and examined using sem . surface microhardness values were tested for significant differences ( at =.05 ) using a two - way anova with repeated measurement and tukey s honestly significant difference ( hsd ) for multiple comparisons . the mean ph and standard deviations ( sd ) of green mango juice was 2.56 ( 0.08 ) , pineapple juice was 3.68 ( 0.08 ) and citrate buffer solution was 5.00 ( 0.02 ) . titratable acidity of the storage media with 1 n naoh is shown in table 2 and figure 1 . the results of two - way anova with repeated measurement revealed that there were statistically significant differences among the four types of materials , the four types of storage media , and the interactions between type of material and type of storage media ( p<.001 for all comparisons ) . the effect of the various storage media on surface microhardness of the four types of restorative materials over 7 days is shown in tables 3 through 6 . before immersion ( at 1 hour ) , valiant - ph.d . had the highest surface hardness value , followed by filtek z250 , while ketac - s was comparable to fuji ii lc . after immersion ( 6 hours through 7 days ) , all materials tested had various softening characteristics depending on the types of storage media except for the valiant - ph.d . amalgam . for ketac - s ( table 3 ) , surface hardness significantly reduced after immersion in green mango juice for 6 hours ( p=.02 ) and in citrate buffer solution for 1 day ( p=.03 ) . it was noted that changes in surface hardness for ketac - s were not recordable after immersion in green mango juice for 2 days , while immersion in pineapple juice produced a significant hardness reduction at day 2 ( p=.001 ) . the result of fuji ii lc ( table 4 ) were similar to those of ketac - s ; surface hardness significantly reduced after immersion in green mango juice for 6 hours ( p=.03 ) and in citrate buffer solution for 1 day ( p=.001 ) . after pineapple juice immersion for 2 days , the surface hardness of filtek z250 ( table 5 ) significantly reduced after immersion in citrate buffer solution and pineapple juice for 3 days ( p<.001 for both comparisons ) and after immersion in mango juice for 2 days ( p<.001 ) . on the contrary , valiant - ph.d . became harder between 1 hour and 1 day , and there was little alteration in surface hardness up to the day 7 evaluation . surface hardness after immersion in green mango juice seemed to have the lowest value , but there was no significant difference among the four storage media ( p=.67 ) . the effect of the four storage agents on the hardness values of the evaluated materials was tested by tukey s hsd multiple comparison . this revealed that the green mango juice provided the greatest reduction in hardness value for all materials ( p<.001 for all comparisons ) . the deionized water produced the least reduction of hardness value for all materials , followed by pineapple juice ( p<.001 for all comparisons ) . according to the extent of changes in surface hardness , the four restorative materials can be arranged as follows : ketac - s > fuji ii lc > filtek z250 > valiant - ph.d . the ranking order of the erosive potential of the storage agents was as follows : mango juice > citrate buffer solution > pineapple juice > deionized water . figures 1 through 4 show the gradual surface changes of the various restorative materials tested . before immersion , the ketac - s and the valient - ph.d . specimens demonstrated rough surfaces and the protrusion of filler particles ( figures 1a and 4a , respectively ) . the fuji ii lc specimens showed a few rough surfaces ( figure 2a ) , while the filtek z250 specimens demonstrated the smoothest surfaces ( figure 3a ) . after immersion in the various storage media for 3 and 7 days , the sem photomicrographs of fuji ii lc showed more rough surfaces with pits , which increased with time in the citrate buffer solution ( figures 2d and 2e , respectively ) and the mango juice ( figures 2f and 2 g , respectively ) . cracks seen on the surfaces of the glass ionomer cements were artifacts caused by vacuum dehydration during processing . similar results were found for ketac - s ( figures 1d through 1 g ) and valiant - ph.d . ( figures 4d through 4 g ) ; after citrate buffer solution and mango juice immersion for 3 and 7 days , their sem photomicrographs displayed roughening patterns which increased with immersion time . filler particles were more clearly seen after 7 days immersion than after 3 days immersion . conversely , the filtek z250 specimens ( figure 3 ) still showed mostly smooth surfaces after 3 and 7 days immersion in all storage media . it was noted that after the materials were tested and immersed in pineapple juice ( figures 1i , 2i , 3i and 4i ) , the specimen surface seemed to have a two such variables are changes in temperature and acidic - base conditions from food and drinks . therefore , the restorative materials used in the mouth should resist or show minimal change in these situations . in the present study , this method was performed solely to examine erosion by static immersion of the restorative materials in the solutions over a period of 7 days and to detect subsequent changes in hardness . this study did not aim to investigate the effects of attrition from chewing habits because the oral cavity is a complex environment and is difficult to simulate experimentally . therefore , a long immersion time was used as an alternative for presenting the extensive effect of acidic solutions . the four restorative materials selected in the present study are those most commonly used for restoring teeth that have erosive conditions.10 in this present study , the results showed that immersion of restorative materials in the acidic agents tested could reduce the surface hardness and could cause rough surface which increased with time , as observed with sem photomicrographs . ketac - s metal - reinforced glass ionomer cement and fuji ii lc resin - modified glass ionomer cement decreased in surface hardness more than valiant - ph.d . amalgam and fltek z250 resin composite . in the comparison between ketac - s and fuji ii lc , the results showed that ketac - s was degraded to a greater extent by acidic agents than was fuji ii lc . this confirmed the result of ketac - s at day 2 wherein the hardness value could not be measured . possible reasons for those results might be the difference in the composition of the materials and the set structure of each material , including the titratable acidity of the acidic agents . it has been generally accepted that titratable acidity is a better indicator of erosive potential than ph alone.25,26 from the present study , green mango juice provided the greatest titratable acidity and also degraded the restorative materials tested ( except valiant - ph.d . although pineapple juice had a lower ph value ( 3.68 ) than citrate buffer solution ( 5.00 ) , the pineapple juice had a lesser titratable acidity than the citrate buffer solution . another possible explanation might be that pineapple contains some components that may provide a protective effect against erosion . this explanation is consistent with the sem photomicrographs which observed a plaque - like covering layer . after ketac - s was immersed for 2 days or more in green mango juice , it became increasingly soft until the hardness could no longer be measured . this may result from extensive dissolution of this material by acid attack at the interfacial bonding between the silver alloy fillers and the polyacrylate matrix.27 these results suggest that in clinical decision - making , this material may not be suitable for patients who have the habit of eating sour fruits , which has acidic ingredients , like green mangoes . with fuji ii lc , the reduction in surface hardness may be caused by a selective attack on the polysalt matrix among the residual particles.28 the polysalt matrix of the set cement results from the formation of contact cation - anion ion pairs or complexes between the carboxylic groups of the polyalkenoic acid and metallic ions , especially trivalent aluminium , leached from the glass particles . another possible explanation is that resin - modified glass ionomer cement may release additional fluoride after immersion in acidic environments . this can result from the dissolution of matrix - forming constituents within the restorative material.28 however , some research indicates that it may also resist acid better than a conventional glass ionomer cement , as was found in studies by shabanian and richards,12 mckenzie et al13 and aliping - mckenzie et al.29 as regards filtek z250 resin composite , the deterioration of its physical and mechanical properties could be due to a hydrolytic breakdown of the bond between silane and the filler particles , filler - matrix debonding , or even hydrolytic degradation of the fillers.30,31 alternately , it could be due to chemical degradation occurring via hydrolysis . progressive degradation altered the microstructure of the composite bulk through the formation of pores.31 in this present study , filtek z250 resisted acid solution better than did fuji ii lc , which is consistent with the results found in other studies.12,15,32,33 here in this study , surface hardness results showed that amalgam was harder than the other materials in all storage solutions after immersion for all evaluated time periods . the results of this present study showed that immersion in the acidic agents tested could not degrade this material . this demonstrates that valiant - ph.d . tends to tolerate acidic conditions better than the other three materials . amalgam and filtek z250 resin composite could withstand acidic solutions better than ketac - s metal - reinforced glass ionomer cement and fuji ii lc resin - modified glass ionomer cement . this in vitro study thus might recommend that , in terms of resistance to degradation , amalgam or resin composite should be the materials of choice while restoring teeth affected by erosion . however , the degradation of materials is not the only factor involved in making this choice . the role of saliva was not taken into consideration.34 furthermore , the oral cavity presents a challenging testing environment that can not be precisely replicated under experimental conditions . for example , temperature changes , ph level , and the presence of water in the oral cavity may also considerably affect properties of restorations . within the limitations of this study , the following conclusions were drawn :
the acidic agents tested ( citrate buffer solution , green mango juice , and pineapple juice ) have an effect on the reduction of surface microhardness of restorative materials.amalgam ( valiant - ph.d . ) and resin composite ( filtek z250 ) were more resistant to acid attacks , and were better than both types of glass ionomer cement ( ketac - s and fuji ii lc).for clinical decision - making , amalgam and resin composite are the most suitable materials for restorations in patients who are at high risk for erosive conditions . the acidic agents tested ( citrate buffer solution , green mango juice , and pineapple juice ) have an effect on the reduction of surface microhardness of restorative materials . amalgam ( valiant - ph.d . ) and resin composite ( filtek z250 ) were more resistant to acid attacks , and were better than both types of glass ionomer cement ( ketac - s and fuji ii lc ) . for clinical decision - making , amalgam and resin composite are the most suitable materials for restorations in patients who are at high risk for erosive conditions . | objectives : this study investigated the titratable acidity and erosive potential of acidic agents on the microhardness and surface micromorphology of four restorative materials.methods:forty-seven discs of each restorative material ; metal - reinforced glass ionomer cement ( ketac - s ) , resin - modified glass ionomer cement ( fuji ii lc ) , resin composite ( filtek z250 ) and amalgam ( valiant - ph.d . ) , 12 mm in diameter and 2.5 mm in thickness , were divided into four groups ( 5 discs / group ) .
specimens were then immersed for 7 days into four storage media ; deionized water ( control ) , citrate buffer solution , green mango juice and pineapple juice .
microhardness testing before and after immersions was performed .
micromorphological changes were evaluated under a scanning electron microscope ( sem ) . statistical significance among each group was analyzed using two - way repeated anova and tukey s tests.results:the fuji ii lc and the ketac - s showed the highest reduction in microhardness ( p<.05 ) . the valiant - ph.d .
and the filtek z250 showed some minor changes over the period of 7 days .
the mango juice produced the greatest degradation effect ( p<.05).conclusions : this study suggested that for restorations in patients who have tooth surface loss , materials selected should be considered . in terms of materials
evaluated , amalgam and resin composite are the most suitable for restorations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
all of them had presented to their treating ophthalmologist with painless , gradually progressive vision loss . except for a diffuse , dull headache at presentation to us in only one patient , none of them had any neurological symptoms . all , except the last , presented to us with progressive vision loss despite adequate treatment for glaucoma . cited a low index of suspicion as a main culprit in the delayed diagnosis of chiasmal compression in 1973 . this series illustrates why one should be extra - vigilant when diagnosing ntg even today . all these patients had signs that should have raised suspicion about the presumptive diagnosis of ntg [ table 2 ] . notably , the morphology of the pupils and that of the optic nerve head excepting the vertical cup - to - disc ratio were not recorded in any of these patients . prominent pallor that was more than loss of the neuroretinal rim , at least when we examined , was seen in all , except the fifth patient . misinterpretation of the visual fields is another significant factor for the misdiagnosis in these cases . for example , patchy visual field loss in the right eye of the second patient 's earliest visual field [ fig . on careful evaluation , the visual field defects in the earliest visual field respected the vertical meridian . thinning of retinal nerve fiber layer ( rnfl ) on optical coherence tomogram might have been considered to represent glaucomatous optic neuropathy in the fourth patient [ figure 10a ] . thinning of rnfl is the end result of any pathological process causing optic neuropathy and does not necessarily mean glaucoma . a comprehensive ophthalmic evaluation and appropriate interpretation of the clinical and/or investigational findings could have saved the second , third , and fifth patients from an erroneous diagnosis of glaucoma and glaucoma filtering surgeries . moreover , neuroimaging at least when the visual loss was progressive despite achieving low iop could have prevented further visual loss in them as well as in the first patient . probable factors that lead to misdiagnosis in the presented cases case 1 the earliest available visual fi eld in 2003 ; left eye ( a ) and right eye ( b ) . advanced fi eld loss in the left eye and superotemporal quadrantanopia in the right eye case 1 minimal pallor of the temporal rim in the right eye ( a ) and gross pallor of the rim in the left eye ( b ) case 1 the visual field of the right eye at presentation to us in february 2008 . note the progression in the fi eld defect case 1 magnetic resonance imaging of brain ( sagittal section ) shows a well - circumscribed , lobulated sellar mass lesion suggestive of pituitary macroadenoma ( outlined by arrows ) . superiorly , it is displacing and compressing the optic chiasm case 2 thin and pale neuroretinal rim of both optic discs case 2 ( a ) the visual fi eld of the right eye in 2007 . note the defects respect the vertical meridian case 2 axial computed tomography scan shows a suprasellar mass ( outlined by arrows ) suggestive of pituitary adenoma case 3 area of pallor more than that of cupping in both optic discs case 3 coronal section on magnetic resonance imaging of brain shows a well - circumscribed , lobulated , homogeneous , solid suprasellar mass lesion consistent with meningioma ( outlined by arrows ) . intracranial optic nerves and optic chiasm could not be identified separately from the lesion case 4 optical coherence tomogram ( a ) and automated perimetry ( b ) in the left eye . the pattern deviation is misleading in advanced visual field loss case 4 magnetic resonance imaging of brain ( sagittal section ) shows a cystic lesion in the suprasellar cistern ( outlined by arrows ) suggestive of craniopharyngioma case 5 optic disc photographs . note the absence of pallor of the neuroretinal rim case 5 visual field in the left ( a ) and right ( b ) eye . note gross intereye asymmetry in the visual field despite symmetrical optic disc cupping [ fig . the field defect in the left eye respects the vertical meridian case 5 computed tomography scan of brain ( axial section ) shows a well - defined , cystic suprasellar lesion with calcifi cation ( outlined by arrows ) suggestive of craniopharyngioma case 6 right ( a ) and left ( b ) optic disc photographs . note appreciable pallor only of the temporal rim in the left eye ( arrow ) case 6 asymmetric bi - superotemporal quadrantanopia . note that the visual field respects the vertical meridian in both eyes case 6 magnetic resonance imaging of brain ( sagittal section ) revealing a pituitary adenoma distinguishing glaucomatous from nonglaucomatous optic disc cupping on clinical examination is difficult . generally , the optic disc in patients with intracranial compressive lesions is pale and lacks cupping as seen in glaucoma . kupersmith demonstrated cupping of the optic nerve resembling glaucoma in 16 patients with lesions compressing the anterior visual pathway . bianchi - marzoli demonstrated an increased median cup - to - disc area in patients with compressive lesions compared to age - matched controls . similarly , pallor of the optic disc might also be lacking in intracranial compressive lesions ( e.g. , in the fifth case ) , especially in early compression . at presentation , unequivocal pallor of one or both optic discs was noted in only 28 of 50 ( 56% ) patients with chromophobe pituitary adenoma causing visual field defects . a total of 13 out of 29 ( 44% ) eyes with nonglaucomatous optic neuropathy were classified as glaucomatous by at least one observer , demonstrating that even experts can misdiagnose glaucomatous cupping on isolated stereo photographs . however , since the arcuate distribution of the optic nerve fiber bundles remains intact as distal as the anterior chiasm , compression of the intracranial optic nerve or the anterior chiasm can produce arcuate visual field defects resembling glaucoma with sparing of central vision . ahmed prospectively performed neuroimaging in ntg patients who presented with classic glaucoma features without overt neurologic signs . compression of the anterior visual pathway was found in 4 of 62 ( 6.5% ) patients , all of whom had visual field defects typical of glaucoma . routine neuroimaging for patients with presumed ntg is considered unnecessary due to a low yield for detecting intracranial pathology . the south east asia glaucoma interest group ( seagig ) recommends appropriate neuroradiological investigation only in a small proportion of patients with ntg , especially those who are younger and/or have unilateral disease , optic disc pallor out of proportion with cupping , atypical visual field defects , and color deficiency . greenfield compared eyes of 23 ntg patients with eyes with optic disc cupping associated with intracranial masses . age younger than 50 years , optic nerve pallor in excess of cupping , and vertically aligned visual field defects individually were only 46.4% , 45.5% , and 47.7% , respectively , sensitive for nonglaucomatous cupping . one needs a highly sensitive examination or test to rule out nonglaucomatous cupping in patients with presumed ntg if a routine neuroradiological investigation is to be avoided . in day - to - day clinical practice , we suggest combining the results of one or more factors listed in table 3 to distinguish glaucomatous from nonglaucomatous cupping . if a patient lacks one characteristic of nonglaucomatous visual loss , there is a significant likelihood that another characteristic is present . for example , even though there was no neuroretinal rim pallor in either optic disc in the fifth patient , the nature of the visual field defect was a tipoff for the nonglaucomatous etiology . performing a careful evaluation of the total clinical picture initially and maintaining a high index of suspicion during follow - up , while investigating appropriately if visual acuity , optic disc , or visual fields do not follow the expected pattern , we can minimize the chance of a potential diagnostic error . distinguishing glaucomatous from nonglaucomatous optic neuropathy in conclusion , it is important to remember that space occupying lesion in the parasellar and suprasellar region may be associated with contour abnormalities of the optic disc ophthalmoscopically indistinguishable from glaucomatous optic neuropathy . an accurate and early diagnosis can make a real difference to the lives of such patients by preventing visual impairment and significant morbidity . similar to the article by thomas , this report points toward nonadherence to the routine comprehensive eye examination . this practice should change | we present a series of six patients who had been receiving treatment for normal tension glaucoma ( ntg ; five patients ) or primary open angle glaucoma ( one patient ) .
all of them were found to have optic neuropathy secondary to compression of the anterior visual pathway . even though uncommon
, compression of the anterior visual pathway is an important differential diagnosis of ntg .
diagnosis of ntg should be by exclusion . here
the possible causes of misdiagnosis are discussed .
we present an approach to distinguish glaucomatous from nonglaucomatous optic neuropathy .
the article also emphasizes how important it is for the clinicians to consider the total clinical picture , and not merely the optic disc morphology , to avoid the mismanagement of glaucoma , especially the ntg . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hemolytic uremic syndrome ( hus ) is a hematological disease characterized mainly by the triad of microangiopathic hemolytic anemia , thrombocytopenia , and acute renal failure . it is commonly caused by infections of shiga - like toxin producing bacteria , such as escherichia coli strain o157:h7 , o111:h8 , o103:h2 , o123 , and o26.1 diarrhea is often present in such cases which can also be referred to as typical hus . on the other hand , atypical hus ( ahus ) is characterized by the absence of diarrheal illness and can be acquired , genetic , or idiopathic . ahus represents approximately 10% of all hus cases.2 currently , plasma exchange and/or plasma infusions is the recommended first - line management for ahus.3 this paper presents the technical challenges faced while treating a patient who had ahus with therapeutic plasma exchange ( tpe ) . a 21-year - old female with a known history of ahus presented to our emergency department in september 2012 . she had three relapses before when she was aged 8 , 10 , and 20 . she presented with 3 days of fever and sore throat followed by dark urine . on examination , she was found to be afebrile , alert , oriented , and she was talking in full sentences . her sitting blood pressure was 140/90 mmhg and her heart rate was 70 beats per minute with an oxygen saturation of 99% on room air . hematological investigations revealed a hemoglobin ( hb ) count of 96 g / l , platelet count 16 10/l , red cell count 3.01 10/l , and a hematocrit of 0.27 there was also marked thrombocytopenia and microangiopathic anemia on the film , features suggestive of relapse of known hus . biochemistry results showed a lactate dehydrogenase ( ldh ) level of 1,201 u / l , haptoglobin < 0.06 g / l , potassium 3.7 mmol / l , urea 20.7 mmol / l , creatinine 202 umol / l , estimated glomerular filtration rate 27 ml / minute , and c - reactive protein ( crp ) of 27 mg / l . high levels of ldh and low haptoglobin levels pointed to severe hemolysis while the renal markers , such as creatinine , urea , and estimated glomerular filtration rate showed a deteriorating renal function . earlier attempts to perform the biochemical tests had been futile due to severe hemolysis . after a multidisciplinary team collaboration that involved the intensive care unit , hematology , nephrology , and the emergency department , a left femoral vascath was inserted with the view of commencing tpe using 3 l of fresh frozen plasma ( ffp ) . the procedure was scheduled to be done in the emergency department using a membrane based tpe machine ( mtpe ) . plasma flux psu 2s plasma exchange filters manufactured by fresenius se & co ( bad homberg , germany ) were used . these filters have a surface area of 0.6 m , blood priming volume of 70 ml , and a plasma sulphone membrane . filtration is primarily based on pressure gradients allowing filtration of molecules of up to 1,000 kda including immunoglobulins , complement factors , and albumin . soon after commencing tpe , the machine showed a blood leak alarm and it was evident that the membrane had ruptured gauging by the color of the effluent ( figure 1 ) . the filter was replaced with another one which also did not last long before the machine showed a blood leak alarm . an attempt was made to resume treatment with a centrifuge based tpe machine ( ctpe ) . the centrifugal device we used was a spectra optia apheresis system , a product of terumo bct ( lakewood , co , usa ) . this machine operates by separating blood products according to their specific gravity using centrifugal force . the spill over alarm persisted on ctpe and red blood cell detected was shown on the machine . at this point , it was agreed to stop tpe due to the nature of the technical problems which were attributed to severe hemolysis . on day 2 , it was agreed that the patient could be treated with eculizumab ( complement c5 blocker ) , but the drug was not available for compassionate access . disable the red blood cell detector and ctpe was initiated successfully using a very low inlet flow rate ranging from 2070 ml / minute with an anticoagulant infusion rate of 1.0 ml / minute . the patient continued to receive daily ctpe until day 16 when a decision was made that she had reached clinical remission , and she was discharged home . her hematological ( table 1 ) and biochemical ( figure 3 ) results continued to improve . a follow up of this patient after 6 weeks revealed that she was clinically well and had resumed her normal daily routines . however , plans had been made for her to have a permanent vascular access in the form of an arterio - venous fistula ( avf ) in the setting of these recurrent ahus episodes which seem to resolve after aggressive tpe treatment . both machines ( mtpe and ctpe ) were fitted with safety mechanisms to prevent loss of red blood cells during treatment and if there was a blood leak , an alarm was triggered and the machine would stop automatically . interestingly , in our case , we knew that the effluent was very rich in hemolysis products and the machine that won the day was one that we could manipulate easily to tailor our treatment plan ; this was the ctpe . furthermore , another dilemma with using the mtpe is that plasma has different optical properties from ultrafiltrate , which can set off the blood leak alarm and stop the pump even if there is no actual blood leak . in this respect , nursing staff were not comfortable overriding the mtpe blood leak alarm since it is challenging to determine whether there is an actual blood leak or not . the ctpe also gave us an opportunity to assess the color changes of the patient s effluent and this boosted our confidence as we visually noticed some positive results of the treatment . we believe that our patient received the best tpe treatment we could offer since some clinical cross over trials have reinforced the notion that ctpe allows a higher plasma exchange rate compared to mtpe without adverse effects on treatment quality and tolerability.4 this sentiment has been shared by another researcher who has found that plasma removal is more efficient with ctpe compared to mtpe systems , which have a lower plasma extraction ratio and therefore require longer procedure times.5 the ctpe treatment also ensured that our patient received the 3 l of ffp that was ordered and that an equal volume of patient plasma was removed . from our experience with dialysis , in patients whose post dialysis weight does not correlate with the reported ultrafiltration , the preciseness of the built - in ultrafiltration controller in the mtpe machine is questionable . ffp was used as a substitution solution during tpe despite the high rate of side effects , such as anaphylactic reactions6,7 that may actually require cessation of plasmatherapy.8 we used ffp because it provides normal amounts of complement factors ( cfh , cfi , cfb , and c3 ) and functional proteins9 which are vital for treating ahus . it was unfortunate that our patient could not access eculizumab , which is an anti - complement factor 5 ( c5 ) monoclonal antibody that binds to c5 thereby preventing activation of the terminal complement cascade . recent impressive improvement in the management of ahus has been reported with the use of eculizumab which is becoming the new breakthrough treatment option for patients with primary ahus , providing improved control of the disease over plasma exchange , with a good safety profile.10 however , it is still not quite clear whether life - long or recurrence - specific treatment is necessary and how genetics may or may not impact care of persons on eculizumab.11 what is known , however , is that defects in more than one complement regulator in ahus cases may pose significant therapeutic challenges.12 recent reports indicate that mutations in dgke ( which encodes diacylglycerol kinase ) were found in several ahus patients and this may have an impact on the successful treatment of individuals with eculizumab.13 nevertheless , we are delighted that we successfully delivered first line treatment8 for ahus through ctpe . traditionally , ctpe is the method preferred by hematology or blood bank based physicians for plasma exchange while , on the other hand , nephrology based physicians prefer mtpe . from our experience , it may be better to individualize these treatment options since patient needs vary . for a patient with ahus , treating with centrifuge devices such as the spectra optia apheresis system ( terumo bct ) may result in better outcomes . clinicians also seem to be more comfortable managing the technical challenges , such as the continuous activation of blood leak alarms caused by severe hemolysis for patients on ctpe compared to mtpe . | atypical hemolytic uremic syndrome ( ahus ) is a very rare , life - threatening , progressive disease that frequently has a genetic component and in most cases is triggered by an uncontrolled activation of the complement system .
successful treatment of ahus with plasma infusions and therapeutic plasma exchange ( tpe ) is well reported .
tpe has been the treatment of choice in most adult patients with ahus .
however , due to severe hemolysis , which is common among ahus patients , there are some technical challenges that can affect tpe treatment such as the continuous activation of the blood leak alarm due to hemolysis .
our experience shows that such patients can be managed better on a centrifuge based tpe machine compared to a membrane based tpe machine . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during weeks 1020 ( march may ) 2014 , scarlet fever notifications in north - west london increased 38-fold compared with the same period in previous years ( figure , panel a ) . although health protection regulations in england require clinicians to report suspected cases of scarlet fever , molecular surveillance of noninvasive s. pyogenes is not feasible because testing for s. pyogenes is not routinely advised for patients with a sore throat in the united kingdom ( 3 ) . nonetheless , a limited number of urt swab specimens are submitted by clinicians for culture . since 2009 , we have stored all s. pyogenes urt isolates identified in our west london diagnostic laboratory , which serves a population of 2 million , overlapping with the north - west london region . increase in north - west london scarlet fever notifications and association with emm4 and emm3 , 2014 . a ) weekly scarlet fever notifications in north - west london during 20092014 . during weeks 1020 ( march a total of 308 isolates were from 20092013 ; however , of these , 134 were from 2009 , and 174 were from 20102013 , reflecting a fall in submission rates and affecting the availability of strains for study . thus , isolates from 20092013 were considered a single group ( january december ) and the following emm - types were identified : emm12 20% ( 62/308 ) , emm89 16% ( 48/308 ) , emm1 15% ( 47/308 ) , emm3 7% ( 22/308 ) , emm28 6% ( 19/308 ) , emm4 3% ( 10/308 ) . a similar pattern was observed during march may in 20092013 ( n = 72 ) . a total 96 isolates were available from 2014 , all of which were from march may , submitted following alerts to clinicians regarding scarlet fever activity . during march may 2014 , isolates typed as emm4 increased significantly , from 3% ( 2/72 ) to 17% ( 17/96 ) , ( (1df ) = 9.478 . a borderline significant increase occurred in emm3 , from 10% ( 7/72 ) in 20092013 to 20% ( 20/96 ) in 2014 ( (1df ) = 3.766 , p = 0.0523 ) . this constituted a 3-fold increase in emm3 and emm4 combined , from 13% in 20092013 to 37% in 2014 ( march may ) . molecular testing , with standard dna extraction , emm typing , and superantigen typing methods ( 4 ) , was performed on all 404 viable s. pyogenes urt isolates identified . of all isolates obtained from march through may 20092013 ( n = 72 ) , predominant emm genotypes were emm12 ( 26% ) , emm89 ( 13% ) , and emm1 ( 14% ) ( figure , panel b ) . these proportions were almost identical to proportions for all 308 isolates obtained throughout 20092013 ( figure , panel b ) . in contrast , during march may 2014 ( n = 96 ) , dominating emm types changed , with a borderline significant increase in emm3 ( from 10% in march may 20092013 to 20% in 2014 ; (1df ) = 3.766 , p = 0.0523 ) , and a significant > 5-fold increase in emm4 ( from 3% to 17% ; (1df ) = 9.478 , p = 0.0021 ) . among 96 urt samples submitted in march emm4 was significantly associated with age 5 years ( (1df ) = 6.046 , p = 0.0139 ) , and the rise was largely attributable to disease in this age group ( 12/17 emm4 isolates ) . isolates from march may 2014 were categorized by at least one of the following clinical features ( provided by submitting physician ) : 1 ) tonsillitis , pharyngitis , or sore throat and no mention of scarlet fever ( n = 44 ) ; 2 ) any mention of scarlet fever , regardless of other information ( n = 16 ) ; 3 ) any other illness ( n = 6 ) ; and 4 ) no details provided ( n = 30 ) . the 16 scarlet fever associated isolates were limited to patients ages 1.2511 years , a significant proportion of whom were 5 years ( 12/16 ; (1df ) = 7.619 , p = 0.0058 ) ; 7/16 were emm3 and 3/16 were emm4 . the remainder were emm12 ( 3 ) , emm28 ( 2 ) , and emm87 ( 1 ) . on the basis of these limited data , emm3 was significantly associated with scarlet fever in 2014 ( (1df ) = 5.964 , p = 0.0146 ) . clinical data were not collected in earlier years routinely , although in 2009 a total of 3/3 isolates from scarlet fever case - patients were emm3 . associated emm4 strains from 2014 ( n = 3 ) carried superantigens spec , ssa , and smez ; the same superantigen profile was found in emm4 strains from patients for whom scarlet fever was not mentioned ( n = 14 ) . all 7 scarlet fever associated emm3 strains carried spea , ssa , speg , and a known mutation in smez . antimicrobial drug resistance was identified in 10/96 urt isolates from 2014 ; however , none of these isolates were associated with scarlet fever and none were emm4 . erythromycin resistance was found in 2/20 non scarlet fever emm3 isolates , in combination with clindamycin resistance in 1 isolate . an increase in emm3 and emm4 s. pyogenes urt isolates was detected in north - west london , during the period in 2014 when scarlet fever notifications peaked . the increase in emm4 infections was also found predominantly in 4- to 5-year - old children , the group we and others found to be most at risk for scarlet fever ( 1 ) . the percentage of children 4 years old in north - west london ( an urban population ) is similar to the national average of 1.3% ; therefore , our findings are probably relevant to the rest of the united kingdom . emm4 isolates accounted for only 3/16 cases in which scarlet fever was mentioned , although , because of the study s retrospective nature and paucity of clinical data supplied , we can not dismiss the possibility that other emm4 isolates were also associated with scarlet fever . on the basis of the limited analysis of isolates from infections in which scarlet fever was mentioned , we found an association between scarlet fever and s. pyogenes
emm3 strains . the results of our historical comparison must be interpreted with caution ; obtaining swab samples from patients with urt infections in england is not routine . thus , the 20092013 samples may reflect persistent infections , in contrast to 2014 samples , when clinicians were encouraged to submit swab specimens for scarlet fever case - patients . furthermore , the number of strains available for emm typing was limited . nonetheless , this was the only collection of strains available to us that permitted historical comparison . both emm3 and emm4 s. pyogenes strains have been associated with scarlet fever ( 5 ) . in the far east , emm1 and emm4 isolates were the leading causes of scarlet fever in the late 1990s ( 6 ) , although more recently , antimicrobial drug resistant emm12 s. pyogenes has dominated in this region ( 79 ) . we found that the proportion of emm12 isolates fell during the scarlet fever surge and found no antimicrobial drug resistance among emm3 or emm4 isolates associated with scarlet fever . emm4 isolates are associated with pharyngitis in children ( 10,11 ) ; these isolates are entirely acapsular , a phenotype linked to enhanced adhesion to surfaces ( 12 ) . surges in scarlet fever are believed to require a population susceptible to pharyngeal infection with specific strain types and specific superantigens . both emm3 and emm4 strains in our study possessed 2 prophage - associated superantigens , either spea and ssa , or spec and ssa . although these toxin genes were found in emm3 and emm4 strains not associated with scarlet fever , the probability of triggering scarlet fever may be enhanced through production of 2 such superantigens . periodic increases in scarlet fever are well recognized , although the magnitude of the upsurge in the united kingdom was unexpected . consultation rates for sore throat diminished in the 1990s ( 14 ) , and the 2008 uk national guidelines advise against diagnostic testing and recommend a policy of nonprescribing or delayed prescribing for sore throat when the centor score is <3 ( 3 ) . these recommendations contrast with those of north america and of some european countries ( 15 ) . whether exceeding a threshold level of community s. pyogenes transmission is required for such a marked upsurge is unclear ; increased scarlet fever activity was not reported elsewhere in europe , to our knowledge . apart from natural fluctuations in population immunity , emergence of hypertransmissible lineages , acquisition of novel phage - encoded toxins , or antimicrobial drug resistance may contribute to scarlet fever surges ( 6,7 ) . notably , isolates we found associated with scarlet fever were not resistant to common antimicrobial agents . as part of the national response , clinicians were advised to treat scarlet fever to minimize complications and reduce transmission . whether use of more refined molecular diagnostics could assist future community prevention and management of s. pyogenes infection will require careful evaluation . increased scarlet fever activity has continued in england in 2015 and 2016 , underscoring the need for ongoing surveillance and further investigation . | scarlet fever notifications surged across the united kingdom in spring 2014 .
molecular epidemiologic investigation of streptococcus pyogenes infections in north - west london highlighted increased emm4 and emm3 infections coincident with the upsurge .
unlike outbreaks in other countries , antimicrobial resistance was uncommon , highlighting an urgent need to better understand the drivers of scarlet fever activity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
since 1930 , testosterone has been used to treat various gynecological problems such as uterine hemorrhage , myoma , dysmenorrhea , chronic mastitis , malignant endometrial tumors , and malignant breast tumors ; the correlation between testosterone and the female libido was first reported by loeser ( in 1940 ) and was subsequently confirmed by greenblatt et al . ( in 1942 ) and salmon et al . ( in 1943 ) ( 1 ) . however , the sexual response is multifactorial and depends on psychological and social aspects ; on the effects of hormones such as estrogen , prolactin , progesterone , and oxytocin ; and on the effects of neurotransmitters and neuropeptides , including nitric oxide , dopamine , serotonin , and gamma - aminobutyric acid ( 1 - 10 ) . therefore , it is difficult to determine the specific effects of testosterone on female hypoactive sexual desire disorder ( hsdd ) ( 10 ) . in the last decade , increasing attention has been given to the neurobiology of sexual function due to the high prevalence of sexual difficulties in men and women as well as the successful use of phosphodiesterase type 5 ( pde5 ) inhibitors in the treatment of erectile dysfunction ( 2 ) . a study conducted in the united states showed that 26.7% of all women of reproductive age and 54.2% of all postmenopausal women complain of decreased libido ( 11 ) . in a study investigating the sexual life of the brazilian population , 5.8% of the women in the 18 - 25 year age bracket reported inhibited sexual desire , as did 8.6% of those in the 41 - 50 year age bracket , 15.25% of those in the 51 - 60 year age bracket , and 19.9% of those over 60 years of age ( 12 ) . ( 13 ) correlated sexual behavior and low androgen production in aging women , concluding that the decline in androgen production coincides with decreased sexual motivation and fantasies . in contrast , the results of a study of women in the 42 - 52 year age bracket varied by ethnicity , abdominal obesity , physical activity , mood , and smoking ( 14 ) . studies investigating the correlation of appetite , sexual arousal , and orgasm with measurements of total testosterone , free testosterone , androstenedione , and dehydroepiandrosterone sulfate have yielded inconclusive results . in those studies , it was impossible to determine a cut - off point for androgen levels that would define and assist in the diagnosis of female androgen insufficiency ( 1,15,16 ) . in contrast , the study of women 's health across the nation showed a correlation between increased complaints of hsdd and decreased free testosterone levels but not between decreased libido and total testosterone levels in aging women ( 17 ) . in aging individuals , sexual behavior in addition to experiencing the end of ovarian function , menopausal women undergo physiological changes involving hormones and general health . depression , relationship changes or partner loss , religious issues , and anxiety about the future are also important . all of these elements are interconnected , and social and emotional factors directly affect the somatic factors ( 18 ) . fluctuations in estrogen levels in perimenopausal women can precipitate vasomotor symptoms , sleep disturbances , and mastalgia , all of which impair the female sexual response ( 19 ) . the decline in serum estrogen levels after menopause results in vaginal mucosal atrophy , vaginal muscle atrophy , and reduced vaginal acidity , which culminate in dyspareunia and can impair female sexual desire ( 20 ) . therefore , the fact that the prevalence of hsdd increases with age does not necessarily imply that the age - related changes occur as a direct result of decreased endogenous androgen levels . the 2002 princeton consensus statement on the definition , classification , and assessment of female androgen insufficiency ( 21 ) assessed the problems related to testosterone insufficiency in women and found that the current studies of those steroids are unsatisfactory , principally due to the lack of sensitivity or reliability in the determination of the normal levels . therefore , the consensus statement recommended that equilibrium dialysis methods be developed for the adequate assessment of bioavailable testosterone in women and , in the absence of an ideal method , the free testosterone index be calculated for that purpose . because increased sex hormone - binding globulin levels can also determine androgen insufficiency even in the presence of normal total testosterone levels , they should be considered for the calculation of bioavailable testosterone , and psychosocial causes should be evaluated . finally , the consensus statement recommended that further studies be conducted , given that the physiological mechanisms regulating androgen homeostasis in women have yet to be clearly defined ( 21 ) . the 2006 endocrine society clinical practice guidelines on androgen therapy ( 22 ) recommended against the use of androgen therapy in women . the recommendation was based on the lack of the following : well - defined criteria for the diagnosis of androgen insufficiency syndrome in women ; normative data on the serum levels of total and free testosterone during the life cycle of women ; data on the safety of long - term androgen administration ; a correlation between sexual disorders and plasma testosterone levels ; and accurate and reliable assays for determining circulating free and total testosterone . in addition , because clinical studies are limited and there are no long - term studies , the guidelines recommended that further studies be conducted and that the use of testosterone for the treatment of female hsdd be discouraged ( 22 ) . ( 23 ) disagreed with the 2006 endocrine society clinical practice guidelines on androgen therapy ( 22 ) statement that there were no normative data on the serum levels of total and free testosterone during the life cycle of women , arguing that the panel ignored studies such as those by davison et al . ( 25 ) , which compared the levels of testosterone in healthy premenopausal women complaining of hsdd and defined the normal ranges for calculated free testosterone . in figure 1 , traish et al . ( 15 ) found no correlation between total testosterone levels and sexual dysfunction , they found a correlation between low dehydroepiandrosterone sulfate levels and female hsdd . ( 23 ) concluded that the lack of reliability of the results was solely due to the difficulty in accurately measuring free testosterone levels in women . the authors also refuted the argument that there was a lack of data on the safety of long - term testosterone administration in women ( 22 ) , stating that various studies , such as those by simon et al . ( 27 ) , davis et al . ( 28 ) , and braunstein et al . ( 29 ) , had shown only skin changes ( oily skin , acne , and hirsutism ) and that the beneficial effects of testosterone use ( increased libido , sexual satisfaction , and quality of life ) should be given greater weight . the aforementioned findings show that the use of testosterone for the treatment of female hsdd remains controversial . testosterone administration in women raises concerns because of the effects of testosterone on breast tissue . the relationship between male steroids and breast cancer is complex because although epidemiological studies have shown an association between elevated androgen levels and the risk of breast tumors , experimental studies have shown conflicting results depending on the cell lineage , the dose and type of androgen , and the presence or absence of the estrogen receptor on the cell . in addition , in vivo studies involving rodents and rhesus monkeys suggest that androgens limit estrogen - induced mitogenic activity and cancer development in the breast ( 30 ) . normal breast cell proliferation and breast tumor cell proliferation are regulated by the balance between the stimulating effects of estrogens and the inhibitory effects of androgens . however , the levels of androgen and estrogen required for these opposing mechanisms to occur have yet to be well established ( 31 ) . in addition , because testosterone undergoes aromatization and is converted to estradiol , it can have opposing effects on breast tissue , meaning that it can either inhibit or stimulate breast cell proliferation ( 32 ) . regarding the effects of testosterone on the cardiovascular system , testosterone receptors are distributed throughout the vasculature and are present on endothelial cells , smooth muscle , and myocardial fibers . first , through a nongenomic pathway , testosterone stimulates the production of nitric oxide and inhibits the influx of calcium into the vascular endothelium , inducing vasodilation ( 33 ) . second , through a genomic pathway , testosterone acts through coregulatory proteins , which act on the androgen receptor , stimulating or restricting transcription ; knowledge regarding this mechanism remains limited ( 33 ) . third , it also acts through the conversion of testosterone to estrogen via the aromatase enzyme ( 34 ) . in addition , by binding to its receptor in ischemic conditions , testosterone can promote endothelial cell apoptosis , which consequently induces increased platelet adhesiveness , thrombus formation , and atherogenesis ( 35 ) . furthermore , primary atherosclerotic lesions are fatty streaks that consist of t lymphocytes and lipid - laden macrophages known as foam cells . a study conducted in the united states showed that 26.7% of all women of reproductive age and 54.2% of all postmenopausal women complain of decreased libido ( 11 ) . in a study investigating the sexual life of the brazilian population , 5.8% of the women in the 18 - 25 year age bracket reported inhibited sexual desire , as did 8.6% of those in the 41 - 50 year age bracket , 15.25% of those in the 51 - 60 year age bracket , and 19.9% of those over 60 years of age ( 12 ) . ( 13 ) correlated sexual behavior and low androgen production in aging women , concluding that the decline in androgen production coincides with decreased sexual motivation and fantasies . in contrast , the results of a study of women in the 42 - 52 year age bracket varied by ethnicity , abdominal obesity , physical activity , mood , and smoking ( 14 ) . studies investigating the correlation of appetite , sexual arousal , and orgasm with measurements of total testosterone , free testosterone , androstenedione , and dehydroepiandrosterone sulfate have yielded inconclusive results . in those studies , it was impossible to determine a cut - off point for androgen levels that would define and assist in the diagnosis of female androgen insufficiency ( 1,15,16 ) . in contrast , the study of women 's health across the nation showed a correlation between increased complaints of hsdd and decreased free testosterone levels but not between decreased libido and total testosterone levels in aging women ( 17 ) . in aging individuals , in addition to experiencing the end of ovarian function , menopausal women undergo physiological changes involving hormones and general health . depression , relationship changes or partner loss , religious issues , and anxiety about the future are also important . all of these elements are interconnected , and social and emotional factors directly affect the somatic factors ( 18 ) . fluctuations in estrogen levels in perimenopausal women can precipitate vasomotor symptoms , sleep disturbances , and mastalgia , all of which impair the female sexual response ( 19 ) . the decline in serum estrogen levels after menopause results in vaginal mucosal atrophy , vaginal muscle atrophy , and reduced vaginal acidity , which culminate in dyspareunia and can impair female sexual desire ( 20 ) . therefore , the fact that the prevalence of hsdd increases with age does not necessarily imply that the age - related changes occur as a direct result of decreased endogenous androgen levels . the 2002 princeton consensus statement on the definition , classification , and assessment of female androgen insufficiency ( 21 ) assessed the problems related to testosterone insufficiency in women and found that the current studies of those steroids are unsatisfactory , principally due to the lack of sensitivity or reliability in the determination of the normal levels . therefore , the consensus statement recommended that equilibrium dialysis methods be developed for the adequate assessment of bioavailable testosterone in women and , in the absence of an ideal method , the free testosterone index be calculated for that purpose . because increased sex hormone - binding globulin levels can also determine androgen insufficiency even in the presence of normal total testosterone levels , they should be considered for the calculation of bioavailable testosterone , and psychosocial causes should be evaluated . finally , the consensus statement recommended that further studies be conducted , given that the physiological mechanisms regulating androgen homeostasis in women have yet to be clearly defined ( 21 ) . the 2006 endocrine society clinical practice guidelines on androgen therapy ( 22 ) recommended against the use of androgen therapy in women . the recommendation was based on the lack of the following : well - defined criteria for the diagnosis of androgen insufficiency syndrome in women ; normative data on the serum levels of total and free testosterone during the life cycle of women ; data on the safety of long - term androgen administration ; a correlation between sexual disorders and plasma testosterone levels ; and accurate and reliable assays for determining circulating free and total testosterone . in addition , because clinical studies are limited and there are no long - term studies , the guidelines recommended that further studies be conducted and that the use of testosterone for the treatment of female hsdd be discouraged ( 22 ) . ( 23 ) disagreed with the 2006 endocrine society clinical practice guidelines on androgen therapy ( 22 ) statement that there were no normative data on the serum levels of total and free testosterone during the life cycle of women , arguing that the panel ignored studies such as those by davison et al . ( 25 ) , which compared the levels of testosterone in healthy premenopausal women complaining of hsdd and defined the normal ranges for calculated free testosterone . in figure 1 , traish et al . ( 15 ) found no correlation between total testosterone levels and sexual dysfunction , they found a correlation between low dehydroepiandrosterone sulfate levels and female hsdd . ( 23 ) concluded that the lack of reliability of the results was solely due to the difficulty in accurately measuring free testosterone levels in women . the authors also refuted the argument that there was a lack of data on the safety of long - term testosterone administration in women ( 22 ) , stating that various studies , such as those by simon et al . ( 29 ) , had shown only skin changes ( oily skin , acne , and hirsutism ) and that the beneficial effects of testosterone use ( increased libido , sexual satisfaction , and quality of life ) should be given greater weight . the aforementioned findings show that the use of testosterone for the treatment of female hsdd remains controversial . testosterone administration in women raises concerns because of the effects of testosterone on breast tissue . the relationship between male steroids and breast cancer is complex because although epidemiological studies have shown an association between elevated androgen levels and the risk of breast tumors , experimental studies have shown conflicting results depending on the cell lineage , the dose and type of androgen , and the presence or absence of the estrogen receptor on the cell . in addition , in vivo studies involving rodents and rhesus monkeys suggest that androgens limit estrogen - induced mitogenic activity and cancer development in the breast ( 30 ) . normal breast cell proliferation and breast tumor cell proliferation are regulated by the balance between the stimulating effects of estrogens and the inhibitory effects of androgens . however , the levels of androgen and estrogen required for these opposing mechanisms to occur have yet to be well established ( 31 ) . in addition , because testosterone undergoes aromatization and is converted to estradiol , it can have opposing effects on breast tissue , meaning that it can either inhibit or stimulate breast cell proliferation ( 32 ) . regarding the effects of testosterone on the cardiovascular system , testosterone receptors are distributed throughout the vasculature and are present on endothelial cells , smooth muscle , and myocardial fibers . first , through a nongenomic pathway , testosterone stimulates the production of nitric oxide and inhibits the influx of calcium into the vascular endothelium , inducing vasodilation ( 33 ) . second , through a genomic pathway , testosterone acts through coregulatory proteins , which act on the androgen receptor , stimulating or restricting transcription ; knowledge regarding this mechanism remains limited ( 33 ) . third , it also acts through the conversion of testosterone to estrogen via the aromatase enzyme ( 34 ) . in addition , by binding to its receptor in ischemic conditions , testosterone can promote endothelial cell apoptosis , which consequently induces increased platelet adhesiveness , thrombus formation , and atherogenesis ( 35 ) . furthermore , primary atherosclerotic lesions are fatty streaks that consist of t lymphocytes and lipid - laden macrophages known as foam cells . we searched the medline ( pubmed ) , latin - american and caribbean health sciences literature , scientific electronic library online , excerpta medica , and cochrane library databases using the search terms disfuno sexual feminina / female sexual dysfunction , desejo sexual hipoativo / female hypoactive sexual desire disorder , testosterona / testosterone , terapia andrognica em mulheres / androgen therapy in women , and sexualidade / sexuality as well as combinations thereof . we then selected articles written in english , portuguese , or spanish that included middle - aged human females or human females over 45 years of age . a form was designed that contained the following items : 1 ) reviewer name ; 2 ) article title ; 3 ) author(s ) ; 4 ) year of publication ; 5 ) source ; 6 ) keywords ; and 7 ) abstract . the reviewers ( i.e. , the authors of the present study ) independently read and evaluated the article titles and abstracts retrieved from the abovementioned databases to determine whether the articles were suitable for inclusion in the present review . subsequently , the results were compared to determine the concordance between the reviewers , with discordant results being resolved by consensus . a total of 3880 articles were retrieved initially . by reading the titles of the articles , we selected 531 potentially relevant studies . after reading the respective abstracts , we selected 274 articles , all of which were read in their entirety . after reading those articles in their entirety , we excluded 194 . of those , 99 were studies examining the use of therapies other than testosterone administration for the treatment of sexual dysfunction in women , 61 were studies examining the use of testosterone for purposes other than treating sexual dysfunction in women , and 34 were duplicate entries . a total of 80 articles remained and were classified by the type of study . from among those , seven of the reviewed articles showed results already described in our study and were excluded . figure 2 shows the distribution of the articles over the last 22 years , by year of publication . as seen in figure 2 , the number of studies began to increase in 2000 , with peaks in 2003 , 2005 , and 2007 . on the basis of the results of the 20 selected studies , we evaluated the effect of testosterone on the sexual response and identified the risks of testosterone administration . figure 3 shows the distribution of the randomized , placebo - controlled trials by the year of publication . as shown in figure 3 , the number of randomized , placebo - controlled trials began to increase in 2000 and peaked in 2005 , 2007 , and 2008 . of the 20 randomized , placebo - controlled trials included in the present review , 2 ( 10% ) were published in the 1988 - 1998 period and 18 ( 90% ) were published in the 1999 - 2012 period , with peaks in 2005 , 2007 , and 2008 ( figure 3 ) . therefore , after 1998 , with the advent of pde5 inhibitors , there was a significant increase in the number of studies examining the use of testosterone for the treatment of hsdd in women . ( 1 ) reviewed the studies published in 1930 - 2000 that examined androgens , sexual function , and sexual dysfunction in women . the number of studies examining those issues peaked in the 1940s ( when the effect of testosterone on the libido was first observed ) but subsequently dropped and began increasing again in the 1990 - 2000 period . as shown in figure 4 , our findings corroborate those of traish et al . ( 1 ) . on the basis of our analysis of 20 randomized , placebo - controlled trials , we can conclude that the male hormone has a positive effect on sexual response , having been reported to increase pleasure from masturbation ( 37 ) , sexual desire ( 26 - 28 ) , , the frequency of sexual activity ( 26,27,38,40 ) , , sexual satisfaction ( 38,40 - 43,47 ) , , and orgasm ( 28,38,45,46 ) . one of the trials ( 52 ) began in 2008 and is still under way ( with an expected trial duration of approximately 5 years ) . these findings are consistent with those of other studies showing increases in sexual desire , the frequency of sexual activity , and sexual satisfaction in women receiving androgen therapy ( 53 - 55 ) . testosterone was found to have beneficial effects on libido regardless of the route of administration ( oral administration , transdermal administration , or implants ) . however , in studies comparing two different doses of transdermal testosterone ( i.e. , 150 g and 300 g ) in terms of their efficacy , testosterone was reported to have a beneficial effect on sexual response only when a 300-g dose was used ( 40,45,46,56 ) . of the 20 randomized , placebo - controlled trials included in the present review , 2 examined the risk that androgen administration poses to the cardiovascular system . ( 41 ) reported that the use of testosterone increased the frequency of cardiac events . studies with the specific objective of evaluating the effect of testosterone on the cardiovascular system showed a risk of atherogenesis and thrombosis ( 35,36,57 - 59 ) . 60 ) reported that testosterone provided cardiovascular protection , whereas other authors found neither an increased cardiovascular risk nor cardiovascular protection ( 61 - 63 ) . the randomized trials shown in table 1 do not allow us to draw conclusions because they were all short - term studies ( the maximum duration being 24 weeks ) . of the 5 studies that analyzed the relationship between the administration of testosterone and the risk of breast cancer ( 64 - 68 ) , only 1 showed a 2.5-fold increase in the risk of breast cancer ( a relative risk of 2.48 ) among women receiving estrogen in combination with testosterone ( 65 ) , whereas another showed that testosterone inhibited the cell proliferation induced by the estrogen - progestogen combination ( 64 ) . the remaining 3 studies showed that the addition of testosterone did not induce the development of breast cancer ( 66 - 68 ) . ( 69 ) stated that the long - term administration of testosterone for the treatment of hsdd in women merits further investigation . one of the 20 randomized , placebo - controlled trials shown in table 1 examined the risk of liver disease in women receiving androgens and showed no change in hepatic enzymes ( 41 ) . in the literature , this has been reported only in cases in which the blood testosterone levels increased to supraphysiological levels ( 26,45,70 ) . other adverse effects of the use of testosterone in women , such as hirsutism ( 55 ) , deep voice , and an enlarged clitoris ( 71 ) , should not be neglected . however , the most common adverse effects are acne and increased oiliness of the skin and hair ( 55 ) , which were also reported in 3 of the studies shown in table 1 ( 26,27,29 ) . in addition , 10% of patients receiving 1.25 mg / day or 2.5 mg / day of methyltestosterone and 45% of those receiving 10 mg / day of the same were reported to have experienced these side effects ( 72,73 ) . implants containing up to 300 g / day of testosterone initially produce supraphysiological blood peaks , although these are transient and do not induce virilization ( 55 ) . although the evidence shows that androgen administration positively affects the female sexual response , the impact that the long - term administration of androgens has on the physical health of women has yet to be clarified . no studies in the literature have evaluated the use of testosterone for the treatment of female hsdd or compared this treatment modality before and after the advent of the pde5 inhibitors . in the present review , we found that in the years preceding the commercial release of sildenafil , vardenafil , and tadalafil , studies involving androgens were primarily conducted with the objective of treating myomas , perimenopausal symptoms , breast cancer , dysmenorrhea , and uterine hemorrhage and only showed that the male hormone had an effect on the female sexual response . as of 1998 , the proportion of randomized studies investigating the effect of testosterone on female hsdd had increased from 10% to 90% , those studies having confirmed the positive effect of testosterone on libido . that increase was significant and suggests that the advent of pde5 inhibitors motivated further studies aimed at resolving complaints of low libido in women with sexual dysfunction so that such women became sexually adjusted to their partners . we suggest that future research on other therapeutic approaches for sexual dysfunctions in women , investigating whether a correlation exists between the number of studies and the discovery of pde5 inhibitors as well as the risks and benefits of such therapies , will be required . although there is no doubt about the positive effect of testosterone on the female sexual response , all the randomized trials examining this issue and published from 1998 - 2012 were short - term studies ( the maximum duration being 24 weeks ) . therefore , it is impossible to draw definitive conclusions regarding the side effects of the long - term administration of testosterone . however , it can be stated that during the study periods , testosterone administration was found to have no significant negative impact on the physical health of the treated women . in addition , the controversy regarding the diagnosis of female hypoandrogenism ( this controversy existed before the advent of pde5 inhibitors ) remains unresolved . therefore , although the number of studies has increased in recent years , there is still no consensus regarding the use of testosterone for the treatment of hsdd in women . | with advancing age , there is an increase in the complaints of a lack of a libido in women and erectile dysfunction in men .
the efficacy of phosphodiesterase type 5 inhibitors , together with their minimal side effects and ease of administration , revolutionized the treatment of erectile dysfunction . for women ,
testosterone administration is the principal treatment for hypoactive sexual desire disorder .
we sought to evaluate the use of androgens in the treatment of a lack of libido in women , comparing two periods , i.e. , before and after the advent of the phosphodiesterase type 5 inhibitors .
we also analyzed the risks and benefits of androgen administration .
we searched the latin - american and caribbean health sciences literature , cochrane library , excerpta medica , scientific electronic library online , and medline ( pubmed ) databases using the search terms disfuno sexual feminina / female sexual dysfunction , desejo sexual hipoativo / female hypoactive sexual desire disorder , testosterona / testosterone , terapia andrognica em mulheres / androgen therapy in women , and sexualidade / sexuality as well as combinations thereof .
we selected articles written in english , portuguese , or spanish.after the advent of phosphodiesterase type 5 inhibitors , there was a significant increase in the number of studies aimed at evaluating the use of testosterone in women with hypoactive sexual desire disorder .
however , the risks and benefits of testosterone administration have yet to be clarified . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
h and c - nmr spectra : varian unity-400 spectrophotometers , at 400 ( h ) and 100 ( c ) mhz , with me4si as internal standard ; in ppm , j in hz . the meoh extract was applied to a si gel column and eluted with chcl3 to yield justicidin e ( 5 mg ) . elution with n - hexane - etoac ( 8:1 ) yielded diphyllin ( 13 mg ) and 11 ( 11 mg ) . elution with n - hexane - etoac ( 4:1 ) yielded justicidin a ( 105 mg ) , 10 ( 15 mg ) , 14 ( 35 mg ) , 12 ( 10 mg ) . elution with n - hexane - etoac ( 3:1 ) yielded 9 ( 12 mg ) . elution with n - hexane - etoac ( 2:1 ) yielded 16 ( 15 mg ) . the isolated compounds were identified by spectroscopic methods and comparison with the spectroscopic data reported in literature . platelet aggregation in human prp assays were performed by the method described previously . the reaction mixture ( 0.1 m tris - hcl , ph 8.0 , 5 mm tryptophan , 8 mm hematin , test drugs , and 10 g / ml of ram seminal vesicles cox was incubated for 3 min at 30 c . the velocity of oxygen consumption in the reaction mixture was monitored continuously with a clark - type oxygen electrode using a ysi biological oxygen monitor ( model 5300 ) . the coordinates for the x - ray crystal structure of the enzyme cox-1 was obtained from the rcsb protein data bank and hydrogens were added . the docking experiment on cox-1 was carried out by superimposing the energy - minimized ligand on flp in the pdb file 1cqe after which flp was detected . the chemistry at harvard molecular mechanics force field ( charmm ) was employed for all docking purposes . the optical binding orientation of the ligand - enzyme site obtained after docking was further minimized for 1000 iterations using the conjugate gradient method until a convergence of 0.001 kcal / mol - . s. e. m. one - way analysis was used for multiple comparison , and if there are significant variation between the treatment groups and the inhibitor - treated groups , they were then compared with control group by student s t - test . h and c - nmr spectra : varian unity-400 spectrophotometers , at 400 ( h ) and 100 ( c ) mhz , with me4si as internal standard ; in ppm , j in hz . the meoh extract was applied to a si gel column and eluted with chcl3 to yield justicidin e ( 5 mg ) . elution with n - hexane - etoac ( 8:1 ) yielded diphyllin ( 13 mg ) and 11 ( 11 mg ) . elution with n - hexane - etoac ( 4:1 ) yielded justicidin a ( 105 mg ) , 10 ( 15 mg ) , 14 ( 35 mg ) , 12 ( 10 mg ) . elution with n - hexane - etoac ( 3:1 ) yielded 9 ( 12 mg ) . elution with n - hexane - etoac ( 2:1 ) yielded 16 ( 15 mg ) . the isolated compounds were identified by spectroscopic methods and comparison with the spectroscopic data reported in literature . the reaction mixture ( 0.1 m tris - hcl , ph 8.0 , 5 mm tryptophan , 8 mm hematin , test drugs , and 10 g / ml of ram seminal vesicles cox was incubated for 3 min at 30 c . the reaction was initiated by adding 100 m aa . the velocity of oxygen consumption in the reaction mixture was monitored continuously with a clark - type oxygen electrode using a ysi biological oxygen monitor ( model 5300 ) . docking experiments were performed using ds modeling 1.2 ( accelrys inc . ) . the coordinates for the x - ray crystal structure of the enzyme cox-1 was obtained from the rcsb protein data bank and hydrogens were added . the ligand molecules were constructed using ds modeling 1.1 and energy - minimized . the docking experiment on cox-1 was carried out by superimposing the energy - minimized ligand on flp in the pdb file 1cqe after which flp was detected . the chemistry at harvard molecular mechanics force field ( charmm ) was employed for all docking purposes . the optical binding orientation of the ligand - enzyme site obtained after docking was further minimized for 1000 iterations using the conjugate gradient method until a convergence of 0.001 kcal / mol - . s. e. m. one - way analysis was used for multiple comparison , and if there are significant variation between the treatment groups and the inhibitor - treated groups , they were then compared with control group by student s t - test . | the known flavonoids ginkgetin ( 1 ) , taiwanhomoflavone a ( 2 ) , taiwanhomoflavone b ( 3 ) , and taiwanhomoflavone c ( 4 ) and eight known lignans : justicidin b ( 9 ) , justicidin c ( 10 ) , justicidin d ( 11 ) , chinensinaphthol methyl ether ( 12 ) , procumphthalide a ( 13 ) , procumbenoside a ( 15 ) , and ciliatosides a ( 16 ) and b ( 17 ) were isolated from cephalotaxus wilsoniana and justicia species , respectively .
the antiplatelet effects of the above constituents on human platelet - rich plasma ( prp ) were evaluated . of the compounds tested on human prp , compounds 1 , 4 , 9 , and 11 showed inhibition of secondary aggregation induced by adrenaline .
compound 1 had an inhibitory effect on cyclooxygenase-1 ( cox-1 ) .
molecular docking studies revealed that 1 and the related compounds apigenin ( 5 ) , cycloheterophyllin ( 6 ) , broussoflavone f ( 7 ) , and quercetin ( 8) were docked near the gate of active site of cox-1 .
it indicated that the antiplatelet effect of 1 , 4 , 9 , and 11 is partially owed to suppression of cox-1 activity and reduced thromboxane formation .
flavonoids , 1 , 5 , 6 , 7 , and 8 may block the gate of the active site of cox-1 and interfere the conversion of arachidonic acid to prostaglandin ( pg ) h2 in the cox-1 active site . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the clearance of apoptotic cells by tissue macrophages and nonprofessional phagocytes is an essential process in tissue homeostasis , immunity , and resolution of inflammation . apoptotic cell recognition actively leads to the production of anti - inflammatory mediators such as tgf- , il-10 , and pge2 [ 1 , 2 ] . interactions between apoptotic and phagocytic cells play important roles in the regeneration and repair of damaged tissues by induction of growth - maintenance factors , such as vegf , hgf , and pge2 , which can reconstitute the damaged tissue leading to decrease in fibroproliferative sequelae [ 3 , 4 ] . the cox-2 enzymatic product , pge2 , is a lipid mediator that , similar to tgf- , has been shown to have pro- or anti - inflammatory properties under differing circumstances . in the lung , pge2 , which is generated via the conversion of arachidonic acid to pgh2 via the cox-1 or cox-2 enzymes , is the major eicosanoid produced by lung fibroblasts and many other lung cells , including alveolar macrophages . through e - prostanoid receptor 2 ( ep2)-mediated increases in intracellular cyclic amp , pge2 directly inhibits several major pathobiologic functions of fibroblasts , including chemotaxis , proliferation , collagen synthesis , and differentiation into myofibroblasts . diminished pge2 production and/or signaling can be observed in human and animal lung fibrosis [ 9 , 10 ] . in studies by fadok and colleagues , the exogenous addition of pge2 to lps - stimulated macrophages decreased their production of proinflammatory cytokines , such as tnf- , il-1 , and il-8 . addition of indomethacin restored suppression of proinflammatory cytokine production caused by apoptotic cells in macrophages stimulated with lps . recently , we demonstrated in vitro that apoptotic cell - induced hgf reduces inflammatory cytokine expression in macrophages . moreover , we found that in vivo exposure to apoptotic cells induces anti - inflammatory effects through induction of cox-2/pge2 , and hgf signaling in bleomycin - stimulated lungs , using pharmacologic approaches [ 11 , 12 ] . our previous studies also demonstrated that in vivo exposure to apoptotic cells resulted in enhanced expression of hgf and cox-2 and secretion of pge2 until the late fibrotic phase in bleomycin - induced lung injury . these data indicate that the anti - inflammatory and antifibrotic effects in the lung following apoptotic cell instillation are correlated with coordinated increases in hgf and cox-2/pge2 signaling . however , the mechanism underlying the prolonged induction of hgf and cox-2 by apoptotic cells is not clearly understood at the cellular model in vitro . therefore , a key issue is whether recognition of apoptotic cells by macrophages can direct the signaling pathways toward coordinated induction of these anti - inflammatory and growth - maintenance factors . in the present study , we first characterized induction of cox-2 and pge2 by in vitro exposure of raw 264.7 cells and murine primary peritoneal macrophages to apoptotic cells . we then determined how macrophages programmed by apoptotic cells orchestrate the interaction between cox-2/pge2 and hgf signaling . actinomycin d , cycloheximide , and indomethacin were purchased from sigma - aldrich ( st . louis , mo ) , and ns-398 , ah-6809 , gw-627368x , and pge2 were purchased from cayman chemical ( ann arbor , mi ) . the gene - specific relative rt - pcr kit was obtained from invitrogen ( carlsbad , ca ) , and m - mlv reverse transcriptase was purchased from enzynomics ( hanam , korea ) . elisa kits for hgf and tgf-1 were obtained from r&d systems , and the enzyme immunoassay ( eia ) kits for pge2 and 15-deoxy-12 , 14-pg j2 ( 15d - pgj2 ) were obtained from assay designs ( ann arbor , mi ) . the antibodies used in this study were against cox-1 and cox-2 ( cayman chemical ) , hgf- ( santa cruz biotechnology ) , and -actin ( sigma - aldrich ) . murine raw 264.7 macrophages ( american type culture collection , rockville , md ) were plated at 3 10 cells / ml and incubated overnight in dulbecco 's modified eagle 's medium ( dmem , media tech inc . , washington , dc ) supplemented with 10% heat - inactivated fbs , 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin at 37c and 5% co2 . before stimulation , the macrophages were stimulated with apoptotic or viable cells ( 1.5 10 cells / ml ) . resident peritoneal macrophages were isolated from 6- to 7-week - old pathogen - free male c57bl/6 mice ( orient bio , sungnam , korea ) weighing 2022 g. the animal care committee of the ewha medical research institute ( seoul , republic of korea ) approved the experimental protocol ( number 11 - 0171 ) . resident peritoneal macrophages were isolated by lavage with 5 ml of ice - cold sterile hbss after mice were euthanized with co2 . the lavage fluid was centrifuged and resident peritoneal cells were plated at 1 10 cells / well and cultured in a humidified 5% co2 atmosphere at 37c in dmem supplemented with 10% heat - inactivated fbs , 2 mm l - glutamine , 100 g / ml of streptomycin , and 100 u / ml of penicillin . the isolated macrophages were stimulated with apoptotic jurkat t cells ( 3 10 cells / ml ) . suspended peritoneal macrophages were over 95% viable , as determined by trypan blue dye exclusion . individual thymocytes were isolated from 3- to 4-week - old mice by mincing the thymus through a 70 m pore size cell strainer ( bd biosciences , bedford , ma ) . human neutrophils were obtained from normal , healthy donors in accordance with a protocol reviewed and approved by the institutional review board . using endotoxin - free reagents and plastic ware , human neutrophils were isolated by the plasma percoll method previously . human jurkat t lymphocytes , hela epithelial cells , and murine thymocytes were exposed to uv irradiation at 254 nm for 10 min followed by incubation in rpmi-1640 with 10% fetal bovine serum for 2 h at 37c and 5% co2 . human neutrophils ( > 95% purity ) were either cultured overnight at 9 10/ml in rpmi 1640 at 37c in 5% co2 or uv - irradiated for 10 min followed by incubation for 2 h before addition to macrophages ( 3 10/ml ) . evaluation of nuclear morphology using light microscopy on wright - giemsa stained samples indicated that the irradiated cells were approximately 7080% apoptotic . apoptosis was confirmed by annexin v - fitc / propidium iodide ( bd biosciences , san jose , ca ) staining followed by flow cytometry analysis on a facscalibur system ( bd biosciences ) . human aged neutrophils were shown to be typically 6070% apoptotic by assessment of nuclear condensation on wright - giemsa stained samples and necrosis was less than 2% by trypan blue exclusion . g / ml of either sirna specifically targeting cox-2 or cox-1 or control sirna ( bioneer , seoul , korea ) using 5 l of sirna transfection reagent ( genlantis , san diego , ca ) according to the manufacturer 's protocol . the sequences used for cox-2 knockdown were 5-cua uga uag gag cau gua a-3 ( sense ) and 5-uua cau gcu ccu auc aua g-3 ( antisense ) . the sequences used for cox-1 knockdown were 5-gag gua gga acu uug acu a-3 ( sense ) and 5-uag uca aag uuc cua ccu c-3 ( antisense ) . the sequences for control sirna were 5-ccu acg cca cca auu ucg u-3 ( sense ) and 5-acg aaa uug gug gcg uag g-3 ( antisense ) . before further experiments , cells were incubated in serum - free medium for 6 h for cox-2 sirna or 48 h for cox-1 sirna . for rhoa sirna , raw 264.7 cells were transiently transfected with 10 nm rhoa - targeting sirna ( sense : 5-gaa guc aag cau uuc ugu ctt-3 ; antisense : 5-gac aga aau gcu uga cuu ctt-3 ) premixed with 6 g / ml of lipofectin ( invitrogen ) . cells were then incubated in serum - free medium for 24 h before further experimentation . total rna was isolated from cultured cells using trizol reagent ( life technologies , carlsbad , ca ) . the concentration and purity of rna were evaluated by spectrometry at 260 and 280 nm . reverse transcription was conducted for 60 min at 42c with 3 g of total rna using m - mlv reverse transcriptase . the levels of cox-1 , cox-2 , hgf , and tgf-1 mrna were determined using a semiquantitative rt - pcr kit . the primer sequences were used as follows : mouse - specific cox-1 ( sense : 5-ggt tga ggc act ggt gga tg-3 ; antisense : 5-aga cag acc cgt cat ctc ca-3 ) , mouse - specific cox-2 ( sense : 5-ttc aaa aga agt gct gga aaa ggt-3 ; antisense 5-gat cat ctc tac ctg agt gtc ttt-3 ) , mouse - specific hgf ( sense : 5-gga caa gat tgt tat cgt gg-3 ; antisense : 5-gtt gat caa tcc agt gta gc-3 ) , mouse - specific tgf-1 ( sense : 5-ctt cag ctc cac aga gaa gaa ctg c-3 ; antisense : 5-cac aat cat gtt gga caa ctg ctc c-3 ) , and mouse - specific -actin ( sense : 5-gat gac gat atc gct gcg ctg-3 ; antisense 5-gat gac gat atc gct gcg ctg-3 ) . the cdna was denatured for 5 min at 94c and then amplified using a geneamp pcr system 2400 ( perkinelmer , waltham , ma ) . the levels of pge2 and 15d - pgj2 in the supernatants were determined using eia kits . hgf and tgf-1 concentrations were measured by elisa , according to the manufacturer 's instructions . cells were lysed in 0.5% triton x-100 lysis buffer and proteins were resolved on 10% sds - page gels and then electrophoretically transferred onto nitrocellulose membranes . the membranes were blocked for 1 h at room temperature with tris - buffered saline ( 100 mm tris - cl , ph 7.5 , 150 mm nacl , and 0.1% tween-20 ) containing 5% skim milk and then incubated with various primary antibodies at 4c overnight and probed with a mouse anti - mouse hrp - conjugated secondary antibody . membranes were developed using an enhanced chemiluminescence system ( ge healthcare , buckinghamshire , uk ) . cells were fixed with 4% paraformaldehyde , permeabilized with triton x-100 , and stained overnight at 4c with rabbit polyclonal anti - cox-2 antibody ( 1 : 400 ; abcam , cambridge , uk ) . subsequently , cells were washed with pbs three times and incubated with fluorescent isothiocyanate - conjugated donkey anti - rabbit igg ( 1 : 500 ; jackson immunoresearch ) . the slides were mounted with vectashield mounting medium with dapi ( vector laboratories , inc . ) and examined using a confocal microscope ( lsm5 pascal ; carl zeiss ) equipped with a filter set with excitation at 488 and 543 nm . excel 2007 software ( microsoft , seattle , wa ) was used for statistical analyses . before evaluation of the interaction between the cox-2/pge2 and hgf signaling pathways in macrophages following in vitro exposure to apoptotic cells , we determined the characteristics of cox-2 expression and pge2 production in macrophages . first , to evaluate cox-1 and cox-2 mrna expression , semiquantitative rt - pcr was performed using total rna extracted from raw 264.7 cells . cox-2 mrna expression was distinct at 2 h after in vitro exposure to apoptotic jurkat t cells and increased gradually up to 6 h , and slightly declined at 12 h , but at 24 h the level of cox-2 mrna declined ( figure 1(a ) ) . in contrast , viable jurkat cells did not affect cox-2 mrna expression over this time period ( figure 1(b ) ) . there was no change in cox-1 mrna expression within 24 h of exposure to apoptotic or viable jurkat cells ( figure 1(a ) ) . in addition , cox-2 mrna expression was also measured following exposure to various cell types . exposure to apoptotic neutrophils , apoptotic hela cells , and apoptotic thymocytes also induced cox-2 mrna expression , but the timing of peak expression differed ( figures 1(c)1(e ) ) . the peak increase in cox-2 mrna expression was observed at 1 , 2 , and 8 h after exposure to apoptotic hela cells , neutrophils , and thymocytes , respectively . why the kinetics of cox-2 mrna expression are different is not clearly explained in this experimental setting , but different cell types may cause that . we analyzed the levels of cox-2 mrna expression following exposure to uv - irradiated apoptotic and aged apoptotic human neutrophils after standardization of the amount of these apoptotic cells , since the proportion of apoptotic cells in aged neutrophils is lower compared to uv - irradiated neutrophils ( 61% positive for apoptotic aged neutrophils as detected by annexin v staining versus 80% positive for uv - irradiated apoptotic neutrophils ) . in addition to uv - irradiated apoptotic cells , aged apoptotic human neutrophils induced significantly cox-2 mrna expression ( figure 1(c ) ) . these findings suggest that cox-2 mrna expression induced by exposure to apoptotic cells in macrophages is a global phenomenon independent of cell type and apoptotic process . expression of cox-1 and cox-2 protein was evaluated by immunoblot analysis of lysates of cultured raw 264.7 cells . cox-2 expression increased progressively up to 24 h after addition of apoptotic jurkat cells , but cox-1 expression did not change over this time period ( figure 1(f ) ) . exposure to viable cells had no effect on either cox-2 or cox-1 expression over the period examined ( figure 1(g ) ) . pretreatment of raw 264.7 cells with either actinomycin d or cycloheximide for 1 h before stimulation with apoptotic cells completely inhibited cox-2 expression , indicating that cox-2 mrna de novo synthesis is required for its protein expression ( figure 1(h ) ) . confocal microscopy also demonstrated progressive increase in cox-2 protein in raw 264.7 cells from 2 to 24 h after in vitro exposure to apoptotic cells ( figure 1(i ) ) . pge2 secretion , as measured by eia , increased significantly in raw 264.7 cells following exposure to apoptotic jurkat cells ( figure 2(a ) ) . a significant increase in pge2 production was observed 2 h after in vitro exposure to apoptotic cells , and pge2 production continued to increase up to 24 h. to confirm that cox-2 induction by exposure to apoptotic cells mediates the enhanced pge2 production in macrophages , raw 264.7 cells were pretreated with the highly selective cox-2 inhibitor ns-398 ( 1~50 m ) or the nonselective cox inhibitor indomethacin ( 10 m ) and incubated with apoptotic jurkat t cells for 2 or 24 h. ns-398 reduced apoptotic cell - induced pge2 secretion in a dose - dependent manner ( figure 2(b ) ) . these data suggest that the apoptotic cell - induced increase in pge2 production in raw 264.7 cells derives predominantly from induction of cox-2 expression . the expression of another product of the cox-2 pathway , 15d - pgj2 , was similarly enhanced ( figure 2(c ) ) . apoptotic cell - induced 15d - pgj2 secretion was also reduced by 1 m ns-398 or 10 m indomethacin ( figure 2(d ) ) . these data suggest that the apoptotic cell - induced increase in pge2 and 15d - pgj2 production in raw 264.7 cells derives predominantly from induction of cox-2 expression . park et al . reported that enhanced hgf mrna expression in raw 264.7 cells following apoptotic cell exposure peaks at 2 h and that secretion of hgf protein is increased 24 h after exposure . in the present study , the role of cox-2 in apoptotic cell - induced hgf expression was also evaluated at these time points . experiments were performed using pharmacologic inhibitors , such as ns-398 , indomethacin , and sirnas targeting cox-2 or cox-1 . raw 264.7 cells were pretreated with ns-398 or indomethacin and were then cultured with apoptotic jurkat cells for 2 h to assess the effect on hgf mrna expression and 24 h to assess the effect on hgf protein production . ns-398 ( 1 , 10 , and 50 m ) and indomethacin ( 10 m ) completely inhibited apoptotic cell - induced hgf mrna ( figures 3(a ) and 3(b ) ) . complete inhibition of hgf protein expression was also shown by treatment with 10 and 50 m ns-398 and 10 m indomethacin ( figure 3(c ) ) . to further examine the contribution of cox-2 to apoptotic cell - induced hgf expression in raw 264.7 cells , the negative control sirna did not alter the cox-2 protein level in cells stimulated with apoptotic cells . cox-2 protein expression was completely inhibited at 2 and 24 h after apoptotic cell exposure in cells transfected with cox-2 sirna by 67 and 100% , respectively , ( figures 3(d ) and 3(e ) ) but cox-1 protein levels were unchanged , as determined by immunoblot analysis . knockdown of the cox-2 gene prevented apoptotic cell - induced hgf mrna and protein expression without affecting the mrna and protein expression of the endogenous control , -actin ( figures 3(f ) and 3(g ) ) . in contrast , when cox-1 expression was silenced by transfection with cox-1-specific sirna , hgf protein secretion was unaffected ( figures 3(h ) and 3(i ) ) . these data strongly suggest that only cox-2 induction is required for the induction of hgf mrna and protein expression in raw cells exposed to apoptotic cells in vitro . treatment of raw 264.7 cells with 1 or 10 nm pge2 resulted in increases in the level of hgf protein in the culture medium ( figure 4(a ) ) . we then examined the involvement of pge2 in mediating the effects of cox-2 on hgf induction . raw 264.7 cells were treated with pge2 together with apoptotic cells in the presence of 10 m ns-398 . addition of 1 or 10 nm pge2 completely restored hgf mrna expression suppressed by cox-2 inhibition ( figure 4(b ) ) . similarly , the reduced hgf secretion by cells treated with ns-398 or transfected with cox-2-specific sirna was completely restored by addition of pge2 ( figures 4(c ) and 4(d ) ) . a number of pge2-specific receptors have been identified , including ep1 , ep2 , ep3 , and ep4 [ 17 , 18 ] , and it has been reported that macrophages can express both ep2 and ep4 . to determine which receptors are involved in the apoptotic cell - induced pge2 signaling pathway , raw 264.7 cells were pretreated with the ep2 receptor antagonist ah-6809 or the ep4 receptor antagonist gw-627368x for 1 h before apoptotic cells were added . the ep2 receptor antagonist , but not the ep4 receptor antagonist , blocked apoptotic cell - induced hgf secretion ( figure 4(e ) ) . when raw 264.7 cells were incubated with apoptotic jurkat cells over a 24 h period , kinetic analysis showed that the rise in pge2 preceded the increase in hgf production ( figure 4(f ) ) . regarding the effects of cox-2 inhibition using pharmacologic and genetic approaches , these results demonstrate that the cox-2/pge2/ep2 axis induced by apoptotic cell exposure is instrumental in upregulating hgf production . in addition to raw 264.7 macrophages , we also examined cox-2/pge2 signaling in a primary cell model by isolating resident peritoneal macrophages by lavage from naive mice and then incubating these cells with apoptotic or viable jurkat t cells . apoptotic cell stimulation resulted in increased cox-2 mrna and protein expression by the peritoneal macrophages , whereas exposure to viable cells did not ( figures 5(a ) and 5(b ) ) . hgf mrna expression induced by apoptotic cell exposure was inhibited by pretreatment with 10 m ns-398 ( figure 5(c ) ) . furthermore , inhibition of cox-2 mrna expression with ns-398 ( 10 m ) and inhibition of the ep2 receptor with ah-6809 ( 10 m ) significantly reduced hgf secretion ( figure 5(d ) ) . immunoblot analysis of peritoneal macrophage lysates using anti - hgf -chain antibody indicated that intracellular hgf protein expression was also reduced by treatment with ns-398 or ah-6809 ( figure 5(e ) ) . to confirm that cox-2 is required for apoptotic cell - induced hgf expression , peritoneal macrophages were transfected with cox-2-specific sirna or a negative control sirna , before addition of apoptotic jurkat cells . apoptotic cell - induced cox-2 protein expression decreased by approximately 60% in cells transfected with cox-2-specific sirna , but cox-1 protein expression did not change ( figure 5(f ) ) . upon exposure of primary peritoneal macrophages to apoptotic cells , the sirna - mediated silencing of cox-2 mrna expression significantly inhibited hgf production ( figure 5(g ) ) , as was observed in raw 264.7 cells . a previous report suggested that cox-2 and pge2 are downstream mediators of hgf expression in fibroblasts , which encouraged us to investigate the effect of hgf in mediating in vitro apoptotic cell - induced cox-2 and pge2 expression by macrophages . we evaluated the effect of pha-665752 , a selective inhibitor of the hgf receptor c - met , on cox-2 mrna and protein expression . at 2 and 6 h after in vitro exposure to apoptotic jurkat cells , cox-2 mrna expression was significantly inhibited by 10 m pha-665752 but not by 1 m pha-665752 ( figure 6(a ) ) . cox-2 protein expression was significantly inhibited in a dose - dependent manner by 1 and 10 m pha-665752 at 6 and 24 h after in vitro exposure to apoptotic cells ( figure 6(b ) ) . similarly , the pattern of pge2 production after inhibition of hgf signaling paralleled that of cox-2 protein expression . at 6 and 24 h after in vitro exposure to apoptotic cells , pge2 secretion was suppressed by both 1 and 10 m pha-665752 in a dose - dependent manner ( figure 6(c ) ) . to confirm the effect of hgf on pge2 production in raw 264.7 cells , c - met blocking antibody this antibody suppressed pge2 secretion by approximately 40% at 24 h after exposure to apoptotic cells ( figure 6(d ) ) . furthermore , 10 m pha-665752 decreased partially hgf production at 24 h after in vitro exposure to apoptotic jurkat cells , implicating the possibility of a positive feedback loop between cox-2/pge2 and hgf signaling pathways ( figure 6(e ) ) . the involvement of hgf signaling in enhancing induction of cox-2 and pge2 expression in response to apoptotic cell exposure was also shown in primary murine peritoneal macrophages , in which 1 or 10 m pha-665752 inhibited cox-2 mrna and protein expression as well as pge2 production ( figures 7(a)7(c ) ) . the suppressive effects of pha-665752 on cox-2 mrna and protein expression as well as pge2 production were consistent and dose - dependent , indicating that hgf partially mediates cox-2 expression and pge2 production induced by apoptotic cells . tgf- expression is also induced by apoptotic cells but is reciprocally balanced with hgf . different regulatory systems are thought to be involved in the induction of hgf and tgf- expression . thus , we examined whether cox-2/pge2 signaling functions differently in tgf-1 production following apoptotic cell exposure . neither ns-398 nor indomethacin reduced apoptotic cell - induced tgf-1 mrna expression in raw 264.7 cells ( figure 8(a ) ) . similarly , tgf-1 protein secretion did not decrease significantly following cox-2 inhibition ( figure 8(b ) ) . cox-2-specific sirna resulted in limited inhibition of tgf-1 secretion ( 24% reduction ) ( figure 8(c ) ) . compared to the effect on hgf expression , which was suppressed to the basal level following cox-2 inhibition , the reduction in tgf-1 secretion was not remarkable . in resident peritoneal macrophages from naive mice , apoptotic cell - induced tgf-1 mrna and protein expression were unaffected or only minimally decreased by pharmacologic inhibition of cox-2 and pge2 signaling using 10 m ns-398 and 10 m ah-6809 ( figures 8(d ) and 8(e ) ) . similarly , cox-2-specific sirna did not inhibit induction of tgf-1 mrna and protein expression in peritoneal macrophages ( figures 8(f ) and 8(g ) ) . these findings demonstrate that cox-2/pge2 signaling is not required for apoptotic cell - induced upregulation of tgf-1 mrna and protein expression in macrophages . data from previous and present studies provide evidence that cox-2/pge2 and hgf activation are not involved in tgf- production in unstimulated raw 264.7 cells in response to apoptotic cells . therefore , we wondered whether cox-2/pge2 and hgf activation mediate tgf- production in stimulated raw 264.7 cells in response to apoptotic cells . macrophages were treated with 1.0 g / ml lps ; at the same time , apoptotic cells were added . similar to the findings of fadok and colleagues , the levels of tgf- by lps - stimulated macrophages were enhanced significantly in response to apoptotic cells when compared with lps - treated macrophages ( figure 8(h ) ) . by adding the effect of pharmacologic inhibitors , including ns-398 , ah-6809 , or pha-665752 , tgf- production in lps - stimulated macrophages these data indicate that anti - inflammatory response after apoptotic cell recognition is mediated , at least in part , via tgf- derived from the positive cross talk between cox-2/pge2/ep2 and hgf / c - met signaling pathways . the present study adds to the emerging view that macrophages recognizing apoptotic cells themselves can reinforce signaling pathways toward greater production of anti - inflammatory and antifibrotic mediators in a feedforward manner . we first demonstrated that expression of cox-2 ( but not cox-1 ) mrna and protein increased in raw 264.7 cells as well as primary peritoneal macrophages exposed to apoptotic jurkat t cells . the cox-2 mrna induction was also observed when raw 264.7 cells were exposed to other types of apoptotic cells , such as those of human neutrophils , hela epithelial cells , murine thymocytes , indicating the universality of the phenomenon independent of cell type . in addition to uv - irradiated apoptotic cells , aged apoptotic human neutrophils also induced cox-2 mrna expression . these data suggest that macrophages have switched their functional program in response to dying cells and triggered the cox-2-dependent pathways for production of immunosuppressive and/or regenerative mediators . various pgs are autocrine mediators derived from metabolism of arachidonate through the action of cox . in this study we focused on pge2 synthesis because of its physiologic effects , which include limitation of the immune - inflammatory response and control of tissue repair processes . in vitro exposure of raw 264.7 cells to apoptotic jurkat cells increased pge2 production . moreover , our time course study showed rapid induction and a continuous increase in pge2 production up to 24 h. previous reports suggested that increased pge2 production along with decreased expression of proinflammatory eicosanoids , thromboxane b2 , and leukotriene c4 in human monocyte - derived macrophages in response to apoptotic cell exposure is indicative of a selective effect of apoptotic cell uptake on macrophage eicosanoid generation . in the present study , using the highly selective cox-2 inhibitor ns-398 , we provide evidence that pge2 production in macrophages is enhanced by exposure to apoptotic cells , predominantly via induction of cox-2 expression . pharmacologic inhibition of cox-2 activity and sirna - mediated knockdown of cox-2 expression reduced apoptotic cell - induced hgf mrna and protein expression in raw 264.7 cells and primary peritoneal macrophages . however , knockdown of cox-1 expression did not affect hgf production in response to apoptotic cell exposure . these findings suggest that cox-2 , but not cox-1 , is specifically involved in the production of hgf . addition of pge2 restored hgf mrna and protein expression , which were suppressed by pharmacologic inhibition or genetic knockdown of cox-2 activity or expression . these data provide evidence that the effects of cox-2 on hgf induction in response to apoptotic cells are mediated by a direct effect of cox-2-derived pge2 on macrophages . moreover , inhibition of pge2 signaling by an ep2 receptor antagonist ( but not an ep4 antagonist ) suppressed apoptotic cell - induced hgf production . transcription of the hgf gene and hgf production are well known to be stimulated by substances that increase cyclic amp , including pge2 [ 21 , 22 ] . it is therefore likely that cox-2-derived pge2 induces transcriptional hgf production by macrophages in response to apoptotic cells via the cyclic amp pathway after interaction with an ep2 receptor . however , the cox-2/pge2/ep2 axis is not the only signaling pathway involved in apoptotic cell - induced hgf production . a series of experiments in a previous study emphasized the importance of the rhoa / rho kinase / pi3k / akt / mapk ( including p38 mapk , erk , and jnk ) axis , which is required for the upregulation of hgf mrna and protein expression in raw 264.7 cells in response to apoptotic cell exposure . the pi3k / akt and mapk pathways also reportedly play a role in the regulation of cox-2 expression in response to a variety of extracellular stimuli . following mapk signaling , the activation of transcriptional factors such as e-26 like protein 1 ( elk-1 ) , activating transcription factor 2 ( atf-2 ) , stat , c - fos , c - jun , and ap-1 in the cox-2 promoter region can increase cox-2 expression . our data indicate that rhoa is not involved in apoptotic cell - induced cox-2 expression because neither knockdown of rhoa nor inhibition of rhoa with the specific inhibitor c3 transferase suppressed cox-2 protein production ( data not shown ) . however , the role of the pi3k / akt and mapk pathways in cox-2 induction by apoptotic cells requires further investigation . likewise , production of another cox-2-derived pg , 15d - pgj2 , was also enhanced by in vitro exposure of macrophages to apoptotic jurkat cells . indeed , in vitro exposure of macrophages to apoptotic cells has been shown to increase the intracellular levels of pge synthase1 as well as pgd synthase . similar to pge2 , 15d - pgj2 secretion in response to apoptotic cells was derived predominantly via induction of cox-2 expression . in addition , 15d - pgj2 induces expression of hgf in mesangial cells via a peroxisome proliferator response element in the hgf promoter through activation of peroxisome proliferator - activated receptors ( ppar)-. here , we demonstrated 15d - pgj2-induced hgf production in macrophages ( data not shown ) . thus , 15d - pgj2 may also participate in the upregulation of hgf expression by macrophages exposed to apoptotic cells , although this effect was not examined in our current study . a number of prosurvival factors , including hgf and cox-2/pge2 , normally promote survival of epithelial and endothelial cells , fibroblast quiescence , and normal regulation of the extracellular matrix . hgf signaling via the met receptor upregulates cox-2 expression in different cell types , including fibroblasts and epithelial cells , and animal models have revealed a role for hgf as a mediator of cox-2/pge2 signaling - driven antifibrosis in vivo . thus , we investigated the possibility of cross talk between the hgf and cox-2/pge2 signaling pathways by exposing raw 264.7 cells and peritoneal macrophages to apoptotic cells in vitro . the c - met inhibitor pha-665752 suppressed expression of cox-2 mrna and protein in macrophages in response to apoptotic cells . similarly , this inhibitor reduced pge2 production in a dose - dependent manner . based on data from the time course study , decrease in pge2 production in raw 264.7 cells was minimal at 24 h ( ~35% reduction ) and maximum at 6 h ( ~60% reduction ) after exposure to apoptotic cells . using another c - met inhibitor , a blocking antibody , we found a similar effect on pge2 production at 24 h ( ~40% reduction ) . these data suggest that hgf / c - met signaling alone does not fully exert positive effect on synthesis of pge2 by exposure to apoptotic cells . moreover , pha-665752 also reduced partially hgf production after in vitro exposure to apoptotic jurkat cells . collectively , our data suggest that the hgf / c - met and cox-2/pge2 signaling pathways are interrelated through positive cross talk in macrophages stimulated by apoptotic cells over a 24 h period . this positive feedback loop may provide , at least in part , greater pge2 and hgf production in macrophages , which contribute to anti - inflammatory and antifibrotic activities induced by the interaction with apoptotic cells . however , other mediators are likely involved and might participate in cox-2 and pge2 expression through different mechanisms since the c - met inhibitor inhibited in part the pge2 as well as hgf production . in studies by freire - de - lima and colleagues , arachidonic acid release , cox-2 protein expression , and pge2 production are significantly dependent on the tgf- production in response to apoptotic cells . indeed , macrophages expressing the truncated tgf- receptor did not show upregulation of cox-2 and pge2 in response to apoptotic cells . thus , although not explored directly herein , it seems reasonable to assume that released tgf- contributes to greater cox-2 and pge2 expression , leading to hgf production . even though tgf- has been shown to play pivotal roles in the anti - inflammatory and anti - immunogenic responses to apoptotic cell clearance , it often acts as an antiproliferative or profibrotic agent . administration of exogenous hgf accelerates tissue repair in several organs after acute injury or ischemia [ 27 , 28 ] . tgf- is a potent negative regulator of hgf expression , and hgf seems to have biological activities that oppose those of tgf- through diverse mechanisms . notably , our data indicate that cox-2/pge2 signaling is involved in transcription of hgf but not tgf-1 in unstimulated macrophages in response to apoptotic cells . in addition , data from previous studies using anti - c - met blocking antibody showed that hgf activation is not involved in tgf- production in unstimulated raw 264.7 cells in response to apoptotic cells . however , in lps - stimulated macrophages , our in vitro studies using pharmacological inhibitors provide evidence that cox-2/pge2 and hgf signaling pathways are involved in enhancement of tgf- production in response to apoptotic cells . thus , in this limited context , we see the possibility that anti - inflammatory response after apoptotic cell recognition is mediated , at least in part , via tgf- derived from the positive cross talk between cox-2/pge2/ep2 and hgf / c - met signaling pathways in the inflammatory lesion . on the other hand , prolonged inhibition of the cox-2/pge2 or hgf signaling pathway reversed the reduction of tgf-1 production and the hydroxyproline content in lung tissue following in vivo exposure to apoptotic cells at the late fibrotic phase . thus , the cox-2/pge2 and hgf signaling pathways may provide an important additional control of the balance between hgf and tgf- , favoring antifibrotic effects in the efferocytosis system . in conclusion , the findings of this study reveal a novel function of cox-2/pge2/ep2 signaling in macrophages exposed to apoptotic cells in vitro that results in enhanced hgf expression . furthermore , the cox-2/pge2 pathway showed different regulatory effects for tgf-1 , and hgf activation was shown to mediate cox-2 and pge2 expression induced by exposure to apoptotic cells in vitro . therefore , it is likely that the ability of cox-2/pge2/ep2 signaling to promote hgf synthesis is part of a positive feedback loop that results in amplification of macrophage cox-2 and pge2 expression ( figure 9 ) . this positive cross talk mechanism between cox-2/pge2/ep2 and hgf / c - met signaling pathways may contribute to the anti - inflammatory and antifibrotic consequences of apoptotic cell recognition . | recognition of apoptotic cells by macrophages is crucial for resolution of inflammation , immune tolerance , and tissue repair .
cyclooxygenase-2 ( cox-2)/prostaglandin e2 ( pge2 ) and hepatocyte growth factor ( hgf ) play important roles in the tissue repair process .
we investigated the characteristics of macrophage cox-2 and pge2 expression mediated by apoptotic cells and then determined how macrophages exposed to apoptotic cells in vitro and in vivo orchestrate the interaction between cox-2/pge2 and hgf signaling pathways .
exposure of raw 264.7 cells and primary peritoneal macrophages to apoptotic cells resulted in induction of cox-2 and pge2 .
the cox-2 inhibitor ns-398 suppressed apoptotic cell - induced pge2 production . both ns-398 and cox-2-sirna , as well as the pge2 receptor ep2 antagonist , blocked hgf expression in response to apoptotic cells . in addition , the hgf receptor antagonist suppressed increases in cox-2 and pge2 induction .
the in vivo relevance of the interaction between the cox-2/pge2 and hgf pathways through a positive feedback loop was shown in cultured alveolar macrophages following in vivo exposure of bleomycin - stimulated lungs to apoptotic cells .
our results demonstrate that upregulation of the cox-2/pge2 and hgf in macrophages following exposure to apoptotic cells represents a mechanism for mediating the anti - inflammatory and antifibrotic consequences of apoptotic cell recognition . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
usually , gartner 's duct cysts are on the anterolateral vaginal wall and its chances of being present on the posterior vaginal wall are relatively rare . its incidence of all the vaginal cysts is 12.5% . as it may arise from remnants of wolffian duct vaginal cyst can be histologically classified as epithelial , inclusion , mullerian , mesonephric , and urothelial in addition to other rare types . these present with symptoms of visible palpable mass , dyspareunia , voiding disturbances , vaginal discharge , and pain . a patient , 54-year - old para 4 live 4 , presented herself in the outpatient department of gynaecology , sgrdimsr , amritsar , with chief complaints of mass protruding out from vagina for the last 7 years . on eliciting further history , she narrated that this mass initially was of lemon size which gradually progressed to the size of orange due to which the patient started having discomfort while changing posture / walking . she also gave h / o irregular periods for last 2 years with one episode of profuse bleeding with clots for 10 days prior to visit to the hospital . previous menstrual history was uneventful with menstrual flow of 3 - 4 days/28 days / regular with moderate flow . p / v revealed a pedunculated posterior vaginal wall cyst with smooth pale pink intact surface lining hanging from middle level with 1.5 cm base protruding out of introitus [ figure 1 ] . k 90 catheterization in situ , cyst separate from posterior lip of cervix , cyst arising from posterior vaginal wall , and protruding out of introitus polypoidal / rectum ( p / r ) rectal mucosa was free , base of polypoidal cyst was free , and anterior rectal wall was otherwise smooth and normal . on investigations : hemoglobin 12.4 g% , platelet count 2.9 lacs / cmm , total leukocyte count 6600/cmm , blood urea 24 mg% , serum creatinine 0.7 mg / dl , and cancer antigen 125 - 12 /ml . tvs a well - defined cystic mass lesion of 6.5 cm 4.5 cm 3.7 cm protruding out of the vagina . cyst contained fluid with dense internal echoes with no solid component suggestive of bartholin 's cyst . right ovary had a well - defined anechoic cyst of 3.8 cm 2.2 cm with no solid component in it . left ovary was normal and no adnexal mass was seen in the pouch of douglas . posterior vaginal wall cyst was excised by dissecting posterior vaginal wall from fourchette upward and identifying the base . stalk was ligated , postvaginal wall cyst was removed , and posterior colpoperineorrhaphy was done [ figures 26 ] . cervix felt normal , canal was regular , sound was passed up to two and half inches , scanty curettings were obtained , and specimen was sent for histopathological examination ( hpe ) . excision of posterior vaginal wall from fourchette to the base of cyst repaired vaginal wall p / r : rectal mucosa was found to be intact . globular cystic skin covered soft tissue piece measuring 5 cm in diameter . on cut section , unilocular cyst is identified filled with thick jelly such as brownish fluid . photomicrograph showing tall columnar cell lining of cyst wall ( h and e , 100 ) photomicrograph of the same at higher magnification ( h and e , 400 ) postoperative period was uneventful , and the patient was discharged in satisfactory condition . rare histopathological report has aroused the interest to report this case , as mesonephric duct cysts commonly present in anterior / anterolateral wall only on the rarest occasions if residual tissue of wolffian duct persists , then mesonephric cyst may grow from that abnormal site . posterior vaginal wall cyst was excised by dissecting posterior vaginal wall from fourchette upward and identifying the base . stalk was ligated , postvaginal wall cyst was removed , and posterior colpoperineorrhaphy was done [ figures 26 ] . cervix felt normal , canal was regular , sound was passed up to two and half inches , scanty curettings were obtained , and specimen was sent for histopathological examination ( hpe ) . excision of posterior vaginal wall from fourchette to the base of cyst repaired vaginal wall p / r : rectal mucosa was found to be intact . globular cystic skin covered soft tissue piece measuring 5 cm in diameter . on cut section , unilocular cyst photomicrograph showing tall columnar cell lining of cyst wall ( h and e , 100 ) photomicrograph of the same at higher magnification ( h and e , 400 ) postoperative period was uneventful , and the patient was discharged in satisfactory condition . rare histopathological report has aroused the interest to report this case , as mesonephric duct cysts commonly present in anterior / anterolateral wall only on the rarest occasions if residual tissue of wolffian duct persists , then mesonephric cyst may grow from that abnormal site . gartner 's ducts are identified in approximately 25% of all adult women , and nearly 1% evolves into gartner 's duct cysts . during embryological development , remnants often remain , however , until they develop a secretory mechanism , cause dilation of surrounding cells , and thus yield a gartner 's duct cyst , most often during and after late adolescence . classically , the cysts are solitary , unilateral , < 2 cm in diameter , and are located in the anterolateral vaginal wall of the proximal , a third of the vagina . gartner 's duct cysts are generally asymptomatic and most commonly diagnosed upon routine gynecologic examination , but patients ' complaints can include that of skin tag , dysuria , pressure , itching , dyspareunia , pelvic pain , or protrusion from the vagina if it enlarges to a detectable size , making it a candidate for surgical removal if large enough to cause obstetrical complications , the cyst can be drained to facilitate delivery . to define the course of the gartner 's duct cyst and differentiate it from other pathologic considerations and structures , magnetic resonance imaging can be a useful tool . histologic examination may be employed to correctly identify the cellular remnants composed of nonmucin secreting low columnar or cuboidal epithelium [ figures 7 and 8 ] . the differential diagnosis can be included , but is not limited to bartholin 's gland cyst or abscess , prolapsed urethra , prolapsed uterus , vaginal wall inclusion cyst , endometriosis , leiomyoma , sarcoma botryoides , malignant mass , skene 's gland cyst , or abscess and ureterocele . only in exceptionally rare and isolated cases , large vaginal wall cysts are always symptomatic which compels the patient to visit a gynecologist . they mostly present with discomfort with vaginal discharge on and off , dyspareunia , or urinary complaints . not all patients presenting with mass per vaginum are necessarily a case of uterovaginal prolapse . | cyst of posterior vaginal wall is very rare .
this case relates to a patient who presented with polypoidal mass protruding out from vagina which could have been easily mistaken as uterovaginal prolapse , but appropriate clinical evaluation supported with investigations clinched the diagnosis easily . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the intracellular protozoan parasite trypanosoma cruzi is the causative agent of chagas disease , which is a health threat for an estimated 10 million people , living mostly in latin america . although this infection occurs mainly in latin america , in the past decades it has been increasingly detected in the united states of america , canada , many european , and some western pacific countries . this is now a new worldwide challenge to nonendemic countries [ 1 , 2 ] . the infective trypomastigote form invades macrophages and other cell types , where it is converted into the amastigote form and replicates . progression from the acute to the chronic phase coincides with the clearance of parasites from the blood stream and tissues . after years or even decades of primary infection , up to 30% of chronically infected people develop cardiac alterations , and up to 10% develop digestive , neurological , or mixed alterations . despite nearly a century of research , the most intriguing challenge for understanding the pathophysiology of chagas ' heart disease still lies in the complex host - parasite interrelationship . different mechanisms have been defined to explain the pathogenesis of human and experimental chagas disease . among the mechanisms described , autoimmunity is the one that has received the most experimental evidence but also controversy [ 36 ] . nevertheless , there are studies suggesting that parasite persistence in the host tissues is relevant in the pathogenesis of the disease [ 79 ] . both theories recognize the transcendental role of innate immunity during host defense as well as in the development and progression of myocarditis during chagas disease . geographical variation in the severity of different forms of the disease indicates the importance of t. cruzi genetic variation in addition to host genetic background . unfortunately , it remains as a neglected disease in the world , and , despite considerable research , effective vaccines and adequate drugs for t. cruzi infection are still lacking . in this paper , we discuss the evidence of innate immunity to the parasite developed by the host , with emphasis on the crosstalk between immune and nonimmune cell responses , and its role in sustaining defense as well as injurious processes . the innate immune response is initiated by pattern - recognition receptors ( prrs ) , which recognizes pathogen - associated molecular patterns [ 10 , 11 ] . the broad specificities of the prrs and their ability to form functional multireceptor complexes allow large combinatorial repertoires . this further diversifies the recognition and signaling of cooperating prrs and enables the host to detect almost any type of pathogen , discriminate between different microorganisms , and mount a competent immune response . this receptor family comprises 10 and 13 functional members in humans and mice , respectively . besides sensing pathogens , ranging from bacteria to fungi , parasites , and viruses , it is now thought that they recognize endogenous ligands which have an important role in the regulation of inflammation as well as in noninfectious disease . studies focusing on host innate immunity against t. cruzi infection demonstrated that these receptors are crucial for many aspects of microbial elimination , including recruitment of phagocytes to infected tissues and subsequent killing [ 1012 ] . however , it has been reported that , activated to excess , tlrs can mediate pathology . the tlr signaling pathways consist of two cascades : a myeloid differentiation primary - response - gene-88- ( myd88- ) dependent pathway and a toll / il1r - domain containing adaptor protein inducing ifn ( trif- ) dependent ( myd88-independent ) pathway . the myd88-dependent pathway mediates the production of proinflammatory cytokines through all tlrs except for tlr3 , while the trif - dependent way is indispensable for the induction of type i ifns through tlr3 and tlr4 . taking into account that proinflammatory cytokines produced by tlr activation play an important role in the immunopathology of chronic chagas ' cardiopathy , it has been proposed that a single - nucleotide polymorphism in the genes that encode proteins in tlr signaling could play an important role in differential susceptibility to chagas disease . thus , it was recently demonstrated that t. cruzi - infected individuals who are heterozygous for the mal / tirap s180l variant lead to a decrease in signal transduction upon ligation of tlr2 or tlr4 to their respective ligands , which is associated with lower risk of developing chronic chagas ' cardiomyopathy . tlrs are expressed on different immune cell populations , including macrophages , dendritic cells ( dcs ) , b lymphocytes , specific t - cell subsets , and even on nonimmune cells such as fibroblasts , parenchyma cells , and epithelial cells . the importance of tlrs during t. cruzi immune response was initially evidenced by studies performed with professional antigen - presenting cells , in which the authors remark the importance of tlr2 as a mediator of the defense mechanisms during the early stages of the host response to infection . internalization of intracellular parasites by phagocytosis is a key event in the initiation of the immune response , with phagosomal maturation being central to microbial killing and antigen presentation . regarding the t. cruzi entry process , several studies have examined the mechanisms of invasion or internalization of this parasite , being the host cells and the host molecules involved in this interaction still not completely understood . interestingly , we have recently demonstrated that activation of small guanine - phosphonucleotide - binding proteins ras - related protein- ( rab- ) 5 , fusion of early endosomes , and phagocytosis induced by trypomastigotes in macrophages , involved tlr2 but were independent of tlr4 ( figure 1 ) . signaling through the tlr2 by the parasite - released - antigen tc52 stimulated the maturation of dcs and strikingly rescued immunized mice from lethal infection . moreover , the activation of tlr2 leaded to the secretion of chemokines inducing leukocyte recruitment . thus , parasite antigens and the cytokines locally released may act together to promote dc maturation and subsequent development of protective th1 response . in our lab we also found that the inoculation of tlr2-synthetic ligand prior to infection in vivo improved the survival of lethally infected mice . noticeably , other authors showed that infected tlr2(/ ) mice produced enhanced levels of cytokines suggesting that , in vivo , tlr2 may have a predominant immunoregulatory role during acute infection with t. cruzi parasites , at least with the y strain . however , these authors observed no major difference in parasitemia and mortality between infected tlr2 knockout and wild - type mice . furthermore , myd88 knockout mice were more susceptible to t. cruzi , with higher parasitemia and greater mortality . additional studies attributed most of the myd88-dependent host resistance to the cooperative activation of tlr2 and tlr9 ( figure 1 ) . the activation of tlr9 by t. cruzi came from early studies showing that parasite genomic dna stimulates cytokine responses in professional presenting cells . the study of linkage between t. cruzi innate immunity and the generation of adaptive immune response has been scarcely explored . recently , it was proposed that a weak tlrs activation might contribute to the relatively slow expansion despite strong cd8 + t cell response during acute t. cruzi infection . this study was performed evaluating the frequency of parasite - specific cd8 t cells among other parameters . the authors found an earlier but transient induction of this cell population by the administration of the combination of tlr9 plus tlr2 agonist concomitantly with the infection . otherwise , oliveira and colleagues ( 2010 ) found that t. cruzi - infected tlr2(/ ) , tlr4(/ ) , tlr9(/ ) or myd88(/ ) mice generated both specific cytotoxic responses and ifn-secreting cd8 + t cells at levels comparable to wild - type mice , although the frequency of ifn+ cd4 + cells was diminished in infected knockout myd88 mice . thus , the authors concluded that neither the lack of each tlr2 , tlr4 , or tlr9 nor the absence of all myd88-mediated pathways affect the development of cytotoxic function and number of cd8 + t cells , which are crucial effectors against this parasite . the potent immune response elicited by t. cruzi requires the generation of immunoregulatory network in order to prevent or minimize reactivity to selfantigens or an excessive response to the parasite . it has become clear that active suppression mediated by regulatory t - cell ( treg ) populations is crucial for the control of the immune response both in human and experimental t. cruzi infection [ 26 , 27 ] . it has been demonstrated that tregs display an increased level of tlr2 , tlr4 , tlr5 , tlr7/8 , and tlr10 expression compared to conventional effector cd4 + cd25 t cells , suggesting that the expansion and function of this regulatory cells may be closely influenced by tlr ligands [ 2831 ] . in line with this , the immunoregulatory role for tlr2 reported during the acute infection could be explained by the fact that the suppressive function of tregs is directly controlled by the triggering of tlr2 but not tlr4 or tlr9 . tlr2 ligands activate the expansion of tregs by an indirect effect via antigen - presenting cells or by direct tlr2 triggering of tregs . moreover , signaling through tlr2 strongly enhance cd25 expression inducing an increased sensitivity to interleukin ( il ) 2 . it is believed that the increase in il2 receptor expression on tregs and il2 production by effector t cells temporally abrogate the suppressive capacity of the tregs in vivo ( figure 1 ) . therefore , it is plausible to think that tlr2 ligands provided by the parasite could first expand tregs and abrogate their suppressive phenotype . when low numbers of the pathogen are present , as in the persistent phase of infection , tregs regain their immune - suppressive phenotype and could be responsible for the pathogen persistence . t. cruzi display numerous ligands for the tlrs . in 2001 , gazzinelli 's team found two potent tlr2 activators ; the protozoan trypomastigote surface - highly purified glycosylphosphatidylinositol ( gpi ) anchors linked to the surface mucin - like glycoproteins , and free gpi anchors named glycoinositolphospholipids ( gipls ) were recognized through tlr2 . these parasite ligands trigger il12 , tnf , and nitric oxide ( no ) production by inflammatory macrophages [ 15 , 33 ] . regarding other parasite molecules , it was reported that the t. cruzi tc52-released protein induces human dc maturation signaling through tlr2 . tc52 comprises two homologous domains , which contain a glutathione - binding site and a hydrophobic c - terminal region , and is essential for parasite survival and virulence . authors proposed that tc52 would be one candidate molecule to design a multicomponent vaccine to control t. cruzi infection . on the other hand , oliveira et al . ( 2004 ) observed that t. cruzi - derived gipl ceramide , in high concentration , could activate mouse cells through tlr4 in vitro . furthermore , tlr4-mutated c3h / hej mice were highly susceptible to t. cruzi infection . in addition , bafica and colleagues demonstrated that t. cruzi - dna , a tlr9 agonist , stimulated cytokine production by antigen - presenting cells and cooperatively participated in the control of infection . a more recent study identified the odns containing cpg motifs in the t. cruzi genome responsible for the immunostimulatory activation of tlr9 from mouse and human infected cells , suggesting that the killing of parasites may be required to release agonists of tlr9 . remarkably , infected double knockout tlr2(/)tlr9(/ ) mice developed a parasitemia equivalent to animals lacking myd88 but did not show the mortality displayed by myd88(/ ) animals . authors suggest that tlr9 has a primary role in the myd88-dependent induction of il12/ifn synthesis during infection . summing up , although some parasite ligands have been reported as tlr agonists , it is plausible to think that other molecular patterns from this complex parasite may activate different combination of tlrs on target / effector cells . the combined activation of these receptors would drive the final outcome of host cellular response determining the defense as well as tissue damage . as was discussed above , it is well established that the tlr - dependent pathway initiates an effective innate immune responses against t. cruzi . however , infection of cells deficient for expression of the tlr adaptor proteins trif and myd88 still produces cytokines in response to this protozoan , suggesting that other tlr - independent pathways also may be activated during the early immune response . in this sense , new families of prrs have emerged as important components of the innate immune system that sense the presence of this microorganism and drive the host defense to a protective phenotype . the nod - like receptors ( nlrs ) comprise a large family of intracellular prrs responsible for the recognition of microorganisms independent of tlr signaling . the first and better characterized members of this family are nod1 and nod2 [ 37 , 38 ] . although these receptors were extensively characterized as prrs for bacterial and viral infection , little is known regarding their role in the recognition of intracellular parasites , that is , t. cruzi . in this regard , silva and coworkers ( 2010 ) recently demonstrated that the effective response required for host resistance to infection was exclusively mediated by nod1 but not by nod2 receptor . despite normal cytokine production in the sera , nod1(/ ) mice were highly susceptible to this infection , as judged by the high parasite load in spleen and heart tissues and succumbed to the infection in a similar way to myd88 and nitric oxide synthase ( inos ) knock - out mice . in light of their results , the authors concluded that the nod1-dependent response may be implicated in host resistance to t. cruzi by mechanisms independent of cytokine production ( figure 2 ) . strikingly , t. cruzi infection is able to activate other innate immune pathways in the absence of tlr signaling , although the sensing molecules that recognize the parasite ligands are still unknown . studies performed in vitro showed that trypomastigotes trigger ifn expression in immune and nonimmune cells by engaging a novel tlr - independent pathway that requires both tank - binding kinase 1 ( tbk1 ) and ifn - regulatory factors ( irf)3 ( figure 2 ) . although the role of ifn in the protection against parasite infection remains controversial [ 41 , 42 ] , it was demonstrated that ifn is responsible for resistance of macrophages infected with t. cruzi mainly in the absence of myd88 . furthermore , the activation of one member of the nuclear factor of activated t - cell ( nfat ) family transcription factors nfatc1 mediated ifn production by macrophages and dc , developing an effective th1 response and dc maturation during t. cruzi infection in double - knockout mice ( myd88/ and trif/ ) , despite high sensitivity to the infection . a pivotal signaling for the activation of nfatc1 previously , it was demonstrated that the parasite increases intracellular ca through interaction of kinins ( bradykinin ) with the bradykinin b2 receptor , which is another defense mechanism ( figure 2 ) . in infected tissues , trypomastigotes induce a robust secretion of chemokines and plasma extravasations in macrophages via tlr2 , thus providing the substrates for the proteolytic generation of kinins , which are also involved in dc maturation and il12 production [ 4548 ] . it is known that innate immune cells , including macrophages and dcs , play pivotal roles in immune response ; however , nonimmune cells such as parenchyma cells , epithelial cells , endothelial cells , and fibroblasts , among others , also contribute to immunity development . thus , the outcome of the immune response in a target tissue depends not exclusively on the immune cells but also on the intricate network and signals given by immune and nonimmune cells . furthermore , although the dominant feature of the innate immune system is to protect the host from infectious agents , it may have other roles in mammalian biology . for example , tlrs on parenchyma cells have been demonstrated to be involved in tissue repair and homeostasis [ 50 , 51 ] . accumulative evidence demonstrates that the liver has specific immunological properties and contains a large number of resident and nonresident cells that participate in the regulation of inflammatory and immune responses [ 52 , 53 ] . although kupffer cells are considered the primary cells to respond to pathogen - associated molecular patterns , recent studies provide evidence that multiple populations of nonhematopoietic liver cells , including sinusoidal , endothelial cells , stellate cells , and hepatocytes , express and respond to prr signaling as well as taking on the roles of antigen - presenting cells [ 5254 ] . liver cells express a variety of tlrs , which have been shown to participate in hepatic tissue injury and repair , and contribute to the pathogenesis of a variety of liver diseases [ 52 , 55 ] . however , the action of tlrs on liver cells in host defense against invading pathogens is less clear . the liver is the target of a wide range of microbes including listeria , salmonella , and plasmodium species . however , there are few data related to the implication of t. cruzi experimental infection and the relevance of the innate immune response against this parasite in this organ [ 56 , 57 ] . we have reported a severe hepatic injury in b6 mice infected with tulahuen t. cruzi trypomastigotes . we noted that this mouse strain showed a higher mortality than balb / c mice , associated with an unbalanced proinflammatory cytokine profile , a decreased tlr2 and tlr4 , and an increased tlr9 expression in liver . supporting our results , it was demonstrated that t. cruzi - infected tlr2 knockout mice produced higher levels of proinflammatory cytokines and no than wild - type mice . these results suggest that tlr2 has an important immunoregulatory role preventing excessive activation of innate immunity and uncontrolled production of proinflammatory cytokines . furthermore , we also showed that infected balb / c mice developed a softer environment where the balance between cytokine storm and immunomodulatory signaling given by tlr2 and tgf may modulate the inflammatory damage in the liver ( figure 3 ) . we additionally demonstrated a stronger expression of hepatic inos and a higher no production by liver leukocytes of infected b6 compared to balb / c mice . several authors have described that reactive oxygen species ( ros ) can induce cell death by either apoptosis or necrosis in liver pathologies [ 58 , 59 ] . in this sense , an enhanced and sustained nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase p47-phox expression and the coexpression of gp91 and p47-phox were found only in liver from infected b6 . thus , the activation of nadph oxidase enzymatic complex would be a key player in the liver damage , probably as an instrument contributing to liver apoptosis and necrosis during infection in b6 mice ( figure 3 ) . in addition , we found that while tlr2 and tlr4 expression on hepatic immune infiltrating cells was similar in both mouse strains , tlr9 expression showed a clear difference in hepatic leukocytes . thus , only leukocytes from infected b6 mice sustained high expression of tlr9 throughout the acute phase . these results support the hypothesis that continuous tlr9 signaling might contribute to excessive and harmful inflammatory response in infected b6 mice . in accordance with our results , a crucial role of tlr9 during t. cruzi infection interestingly , in hepatocytes we found that tlr2 and tlr4 are differentially modulated in infected balb / c and b6 mice , suggesting that these innate immune receptors would play a role not only in immune cells but also in liver parenchyma cells ( figure 3 ) . in this sense , it has been postulated that tlr signaling in parenchyma cells would be a key mechanism to prevent death caused by excessive cytokine release [ 60 , 61 ] . there are increased evidences demonstrating the potential role of tlr - ligands treatment as therapeutic approach and they have shown to be highly effective in the protection against protozoan , among them t. cruzi [ 14 , 39 , 40 ] . in our study we further observed that pretreatment with pam3csk4 , a tlr2/tlr1 agonist , before infection induced a marked reduction of proinflammatory cytokines , nitrite , and transaminase levels and a decrease in the number of hepatic inflammatory foci and consequently in the mortality of infected mice . in this study we postulate that the inadequate integration of signals involving molecular ( tlrs , cytokines , no , and ros ) and cellular ( immune and parenchyma cells ) components influences the outcome of local immune response during this parasite infection . moreover , the differential tlr and cytokine modulation in the liver , induced by t. cruzi infection , emphasize the importance of local innate immune response in hosts with different genetic background and could contribute to the understanding and the design of novel immune strategies in controlling liver pathologies . on the other hand , local innate immunity also has a key role in the pathophysiology of several cardiovascular diseases . the heart muscle , initially thought to be a bystander in the immune response to t. cruzi , has been found to be an active participant in the innate response , a hypothesis firstly postulated by postan et al . , cardiomyocytes are actively integrated in the inflammatory response releasing no , cytokines , and chemokines which , in turn , attract leukocytes to the inflammatory site and control intracellular parasite replication [ 6367 ] . cardiac cell exposure to proinflammatory cytokines may pre - condition the myocardium environment to temporarily protect cardiomyocytes from growth factor deprivation - induced apoptosis . in fact , we found that t. cruzi infection protects isolated cardiac myocytes from apoptotic cell death induced by serum deprivation , and this effect was due to an increase in bcl-2 molecule . interestingly , we also found that the infected cardiomyocyte culture pretreated with inactive cruzipain , a major parasite antigen , enhances antiapoptotic protection as well [ 69 , 70 ] . in a recent study , we explored the nature of the crosstalk between cardiac innate immunity and t. cruzi infection . we found that the triggering of tlr2 signaling could be playing an important role in cardiomyocyte protection elicited by t. cruzi ( ponce et al . another study indicates that signaling through tlr2 and nf-b activation also led to the production of il1 , which mediated the cardiomyocyte hypertrophy observed in chagas ' myocarditis . adipose tissue has also emerged as an important target for infection , since a significant number of parasites are found within this tissue during the chronic phase of infection . because the adipocyte act as an active endocrine cell , it is plausible to speculate that these cells may be critically involved in the progression and reactivation of the disease . a massive macrophage ( f4/80-positive cells ) influx was observed in adipose tissue during acute infection . thus , macrophages and adipocytes combined may be important contributors to systemic inflammation . in adipose tissue , tnf , ifn , and il1 protein expression were upregulated at least 10-fold compared with noninfected mice . in vitro studies with a cell line model for adipocytes ( 3t3-l1 ) revealed that the levels of tlr2 and tlr9 but not tlr4 expression were upregulated . in addition , ifn , tnf , and il1 were also increased under infection . taken together , the results cited here make it clear that tlr signaling contributes in the beginning and development of the immune response , but the resolution does not depend on individual pathways but on the integration of multiple signals . the combined activation of different prrs can result in complementary , synergistic , or antagonistic effects that modulate innate and adaptive immunity . arginine and tryptophan metabolism in macrophages depends on cytokine - inducible enzymes and produce mediators involved in microbicidal or suppressive mechanisms in the context of infection . classical activation of macrophages by th1 cytokines during infection by intracellular parasites is thought to be protective , whereas alternative activation by th2 cytokines is involved in the survival of extracellular parasites . thus , inos and arginase have been involved in the regulation of the th1/th2 balance during immune processes , and have been used as markers for m1/m2 activation , respectively . arginase and inos metabolize l - arginine , a semi - essential amino acid , to l - citrulline plus no and urea plus l - ornithine , respectively . arginase i is cytoplasmic and is highly expressed in liver and alternatively activated macrophages by th2 cytokines ( il4 , il13 ) [ 76 , 77 ] and also by il10 , tgf , gm - csf , and prostaglandin e2 ( pge2 ) [ 76 , 78 , 79 ] . arginase ii is mitochondrial and expressed in a wide variety of tissues and cell types , mainly in kidney and cardiomyocytes , and is induced by tlr ligands . the product of arginase activity , l - ornithine , can be metabolized by ornithine aminotransferase giving l - proline , which is required for collagen synthesis and by ornithine decarboxylase ( odc ) , which results in polyamine synthesis needed for proliferation of all eukaryotic cells . there are three nos isoforms : neural nos ( nnos ) , endothelial nos ( enos ) , and inos , which catalyze the oxidation of l - arginine to l - citrulline and no . activated inos is found in a diversity of cell types in the immune system and also in cardiomyocytes . the most common inducer for inos is ifn combined with lps , but other cytokines such as il12 , il1 , and tnf are also able to induce it .
in vitro t. cruzi infection triggers the induction of potent no - dependent trypanocidal activity in infected cardiomyocytes and macrophages [ 8489 ] . in addition , the interaction of macrophages with apoptotic cells through vitronectin receptor increases tgf and pge2 release , which promoted parasite proliferation by increasing odc activity . the in vivo role of inos in t. cruzi infection is still debated , because experiments with inos - deficient mice are contradictory [ 9193 ] . however , the administration of inos inhibitors to infected mice results in increased parasitemia and mortality , indicating a protective role . on the other hand , when excessive , no can also have a cytotoxic effect in the host and lead to immune suppression of t cells . in addition , no production during acute t. cruzi infection in rats was inhibited in peripheral blood monocytes , due to the increase of arginase activity . in the mouse model of acute infection , it has been described that the expression of both arginase isoforms and odc is higher in susceptible balb / c mice than in c57bl/6 mice . interestingly , arginase ii was expressed by cardiomyocytes , whereas arginase i was found in infiltrating cd68 macrophages . these results suggest that infection induces arginase expression , which may not only influence host cell and parasite survival but which might also downregulate the counterproductive effects triggered by inos in the heart during infection . the myeloid - derived suppressor cells ( mdscs ) , which increase during acute t. cruzi infection , also express inos and arginase , and they are highly efficient in suppressing activated t cells . it is possible that the induction of inos and arginase seen in infected hearts suppresses t - cell activation , allowing parasite replication . in this direction , it is possible that arginase - expressing infiltrated macrophages are mdscs . moreover , the immunization of susceptible balb / c mice with cruzipain resulted in enhanced anti - inflammatory cytokine secretion , associated with the induction of a cd11b gr1 spleen immature myeloid population that exhibited arginase , but not inos , activity . furthermore , cruzipain - stimulated naive macrophages released il10 and tgf and displayed enhanced arginase activity , favoring t. cruzi growth [ 98 , 99 ] . by contrast , the immunization of resistant c57bl/6 mice with cruzipain resulted in the secretion of il12 and ifn and consequently the induction of inos messenger and protein expressions as well as high no production . in another study , macrophages from mice , immunized with a plasmid dna containing the gene encoding the catalytic domain of t. cruzi transsialidase , were able to effectively kill intracellular parasites by a no - dependent mechanism . furthermore , cd4 and cd8 t - cell clones are able to produce ifn that inhibits parasite replication into macrophages . the inflammatory cytokines also induce the enzyme indoleamine - pyrrole 2,3-dioxygenase ( ido ) in macrophages , which converts the essential amino acid l - tryptophan to n - formylkynurenine . during t. cruzi infection , there is a systemic activation of ido , and its inhibition induces an exacerbated parasite load and infection - associated pathology . further , the authors demonstrated that treatment of t. cruzi - infected mice with the ido downstream metabolite , l - kynurenine , was able to kill the parasite and to improve the survival of lethally infected mice . moreover , ido activity was critical to control in vitro parasite 's replication despite the high production of no produced by ido - blocked t. cruzi - infected macrophages . in summary , ido activation and a high inos / arginase balance are related to a better outcome of the disease . these evidences suggest that intervention of ido and inos / arginase pathways could be useful in antitrypanosomatid therapeutic strategies for acute infection . the production of superoxide anion ( o2 ) by neutrophils and other phagocytes is an important event in innate immune response . this metabolite is the precursor of a range of chemicals referred to as reactive oxygen species . although these act as microbicidal agents and kill invading microorganisms , there is growing evidence to suggest that myocardium from patients with chagas disease is exposed to sustained oxidative stress - induced injuries involved in disease progression . the superoxide anion is mainly produced by the multiprotein enzyme complex nadph oxidase , which is inactive in resting phagocytes but becomes activated after interaction with pathogens and their subsequent engulfment in the phagosome . in response to a pathogen stimulus , the soluble subunits p47phox , p67phox , and p40phox translocate en bloc to the membrane , where they bind flavocytochrome b558 . it is clear that inflammatory cytokines are key players in the induction of the oxidative metabolism . macrophages exposed to ifn and tnf became primed to a state of enhanced responsiveness by the respiratory burst with the induction of membrane and cytosolic components . during t. cruzi infection , neutrophils , murine splenocytes [ 106 , 107 ] , blood monocytes , and macrophages produced ros and destroyed intracellular forms of this parasite [ 108 , 109 ] . however , ros are also produced by infected cardiomyocytes , and signal the production of proinflammatory cytokines through the activation of nf-b , thereby contributing to maintaining the sustained inflammatory state observed in chagas disease . in our laboratory , we recently demonstrated that cruzipain was able to induce ros production by splenocytes and macrophage line raw 264.7 . this parasite glycoprotein triggered nadph oxidase activation and induced the production of several ros in vitro , mainly o2 . as expected , macrophages , derived from cruzipain - immune mice , primed in vivo with ifn and tnf , produced more ros than naive macrophages . this work was the first to report that oxidative stress can be induced by a t. cruzi antigen . it has been proposed that strong oxidants , macrophage - derived peroxynitrites ( onoo ) , arising from the reaction of no with superoxide radical ( o2 ) participate in cytotoxic mechanisms against t. cruzi inside the phagosome . more recently , it was demonstrated that internalization of trypomastigotes by macrophages triggers onoo formation when no and o2 were produced simultaneously intraphagosomally . this microbicidal mechanism was evidenced by amastigote killing , detected by nitroxidative protein modifications and parasite ultrastructural alterations . summing up , no , ros , and additionally onoo [ 113 , 114 ] are also very efficient mechanisms in the fight against pathogens . however , these reactive oxygen and nitrogen species are very cytotoxic and , when excessive , can result in tissue damage and promote inflammatory diseases . in this paper we emphasized the importance of the tlr signaling pathway in the innate immune response to the protozoan parasite t. cruzi . this parasite has multiple ligands that elicit a potent innate immunity and the subsequent development of adaptive immune response . this activation pathway leads to pro- and antiinflammatory cytokine synthesis . while there is much evidence indicating that myd88 is a crucial molecule for activation of this type of receptor , other tlr - independent mechanisms in host - parasite interaction thus , it has been demonstrated that nlrs which recognize pathogens in the cytoplasm are involved in parasite recognition . furthermore , several other mechanisms that induce intracellular ca influx as well as activation of nfatc1 and bradykinin b2 receptor can be activated by this parasite infection . the combined activation of tlrs and other cytoplasmic receptors opens new and interesting viewpoints in our understanding of the synergistic or antagonistic combined action of different prrs . the knowledge of the role of tlrs in the pathogenesis of chagas disease and the identification of new t. cruzi - derived tlr ligands is not only important for developing better adjuvant to be used in vaccines , but also new immunotherapy to prevent or minimize chagas disease pathology . in addition , new pharmacological drugs that disrupt tlr signaling may be attractive when excessive pathology - associated inflammation occurs , as well as in experimental acute infection . | chagas myocarditis , which is caused by infection with the intracellular parasite trypanosoma cruzi , remains the major infectious heart disease worldwide .
innate recognition through toll - like receptors ( tlrs ) on immune cells has not only been revealed to be critical for defense against t. cruzi but has also been involved in triggering the pathology .
subsequent studies revealed that this parasite activates nucleotide - binding oligomerization domain- ( nod-)like receptors and several particular transcription factors in tlr - independent manner .
in addition to professional immune cells , t. cruzi infects and resides in different parenchyma cells .
the innate receptors in nonimmune target tissues could also have an impact on host response .
thus , the outcome of the myocarditis or the inflamed liver relies on an intricate network of inflammatory mediators and signals given by immune and nonimmune cells . in this paper
, we discuss the evidence of innate immunity to the parasite developed by the host , with emphasis on the crosstalk between immune and nonimmune cell responses . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
obesity is a risk factor for the development of gestational diabetes mellitus ( gdm ) , and increased maternal body mass index ( bmi ) is associated with a greater frequency of complications in pregnancy , at birth and postpartum [ 2 , 3 ] . an analysis of a combination of retrospective databases from a european multicentre study was performed to assess the prevalence of gdm and obesity in pregnancy . this paper reports an overview of the data as well as an analysis of the independent association of gdm and obesity on caesarean section , macrosomia , and neonatal morbidities . data on pregnancy and birth outcomes were requested from the ten participating countries over a 6-month period between 2008 and 2009 . seven countries provided sufficient data for inclusion , and a minimum dataset was formed including age , pre - pregnancy bmi , gdm , smoking status , pih , pet , and caesarean section ( cs ) for the mother and gestational age , birth weight , gender , still birth / neonatal death , and neonatal morbidities for the offspring . finland submitted full data on gdm pregnancies only , ireland and austria had nearly complete data on both maternal bmi and gdm , while the uk , italy , spain , and the netherlands had missing data in maternal bmi or gdm status or both . the uk and ireland databases were population based , while all other databases were from selective groups . the presence of pih or pet or both were combined in hypertensive disease . gdm was defined according to the international association of diabetes in pregnancy study groups ( iadpsg ) criteria ( 75 g oral glucose tolerance test ( ogtt ) results fasting glucose levels > 5.1 mmol / l or 1 hr > 10 primary outcomes were cs , macrosomia ( birth weight at or above 4 kg ) , and neonatal morbidities . the uk did not record hypoglycaemia and only jaundice or rds was included for neonatal morbidities . variables were compared between women with and without gdm with univariate tests . a multilevel logistic regression analysis ( patients within countries ) was performed allowing for differences between countries , and adjusted odds ratios and 95% ci were calculated for all risk factors . data analysis was performed using pasw 18.0 for univariate analysis ( spss version 18.0 ) and mlwin for multilevel analysis . four of the centres ( austria , italy , spain , and the netherlands ) were specialised tertiary referral centres for high - risk pregnancies , and the uk , spain , and italy used a two - step approach for gdm diagnosis with full ogtt data only available for women with a positive challenge test . full data were available from seven countries ( 3343 pregnant women ) for which an overview of the percentage of gdm and gdm by maternal bmi category is shown in table 1 . the heterogeneity between countries in maternal bmi is high , and the percentage of obese women ranges from 12.0% in spain to 41.5% in finland . the three multilevel models included all variables with a significant association with at least one outcome ( table 2 ) . increasing maternal bmi category and maternal age and a lower gestational age were significantly associated with the risk of a caesarean . increasing maternal bmi and gestational age and the baby 's gender being male the presence of gdm in the mother was significantly associated with neonatal morbidities but only significantly associated with maternal bmi when categorised into two groups ( normal / overweight ( < 30 kg / m ) and obese ( 30 kg / m ) , odds ratio 1.48 ( 95% ci 1.012.08 ) ) . smoking status was not found to be a significant factor in any of the models . both obesity and gdm have an adverse effect on pregnancy outcome even though their relative influence is not always easy to separate [ 69 ] . our analysis of european data showed that high maternal bmi and gdm are independent risk factors of perinatal complications . in particular , gdm was independently associated with an increased risk of neonatal morbidities , but only a maternal bmi over 30 compared to under 30 was significant . these results are in line with the analysis performed on irish data ( atlantic dip ) from a three - year period where a cutoff point for maternal bmi of 28 kg / m was found to be associated with a significant rise in adverse pregnancy outcomes . for cs and macrosomia , a significant dose - dependent association was identified , increased risk of cs / macrosomia with increasing maternal bmi . the relative greater independent influence of increased maternal bmi compared to gdm on the risk of macrosomia and cs confirmed findings from other studies [ 6 , 10 , 11 ] . the size of the international database allowed the analysis of associations of maternal bmi and gdm with relative rare adverse outcomes , but the inclusion of more high - risk pregnancies due to the type of participating centre resulted in a selective sample and a higher prevalence of gdm in most countries was due to the selected sample and type of participating centre . italy , the netherlands , and spain have data from a high - risk group , which reflects the nature of the centre from which the data were obtained . in contrast , ireland has a true population - based database , complete for all variables in the presented analysis . the uk and austria have inflated prevalences ; the uk because their population - based data only contained maternal bmi measurements for a selected group of high - risk patients , the austrian centre , even though population - based , includes more pregnant women from high - risk groups as an academic gynaecology unit . the higher prevalence of gdm in most countries is due to the selected sample as well as type of participating centre . differences in screening practice and policy were discussed in a review of gdm in europe , which also highlights the need for a uniform european approach to gdm . these differences in prevalence of gdm do not influence the association with the outcomes but they affect the generalisability of the findings . however , cautious comparison with other studies is recommended as the presented outcomes were posttreated gdm and not untreated hyperglycemia as in the hapo study . clear guidelines on gdm are in place following the hapo study and new iadpsg criteria for diagnosis . even though maternal bmi is shown to be an important risk factor of adverse pregnancy outcomes , european guidelines for the management of obesity in pregnancy are not yet available . a major strength of our study is that it includes data from 7 european countries . this strengthens our analysis in that the number of adverse outcomes is sufficient to observe associations . a weakness of the study is that not all countries report all variables . as the prevalence of neonatal morbidities is likely to be higher , our results most likely underestimate the association of neonatal morbidities with maternal bmi and gdm . a limitation of the analysis was that the database of four countries included relatively more high - risk pregnancies . as a result this dataset is not a representative sample and findings have to be interpreted within this framework . however , the findings do reiterate previous findings from other more representative populations ( association of cs and macrosomia with maternal bmi ) and confirm new information ( association of neonatal morbidities with gdm and obesity ) . even though the population is not representative , the risk factors are suggestive that this might be applicable beyond this varied population as the associations remain similar irrespective of the inclusion or exclusion of variables and countries . another limitation of the study was the limited data available from some counties on various associated risk factors , such as socioeconomic status , ethnicity , prior cs , parity , and weight gain during pregnancy . to obtain comprehensive and uniform information from all countries , information on all these factors should be collected . nevertheless , this analysis highlights that maternal bmi shows a strong association with adverse pregnancy and birth outcomes and that gdm is an independent predictor of neonatal morbidities . this european database analysis showed gdm to be independent risk factors of neonatal morbidities as well as confirmed that increased maternal bmi increases the risk of caesarean section , macrosomia , and neonatal morbidities . the effect of the worldwide obesity and diabetes epidemics is extending into the health of the next generation . | objective . assess the impact of gestational diabetes mellitus ( gdm ) and obesity on neonatal and maternal pregnancy outcomes
. methods .
cross - sectional data ( 3343 pregnancies ) from seven european centres were included in a multilevel analysis of the association between gdm / obesity and caesarean section , macrosomia and neonatal morbidities . results .
comparison of databases identified reporting differences between countries due to the inclusion of true population based samples or pregnancies from specialised tertiary centres , resulting in higher prevalences of gdm for some countries .
the analysis showed that obesity and gdm were independent risk factors of perinatal complications .
only bmi had a dose - dependent effect on the risk of macrosomia and caesarean section .
both obesity ( bmi > 30 kg / m2 ) and gdm were independent risk factors of neonatal morbidities .
conclusions . obesity and gdm
were independent risk factors of perinatal complications .
the effect of the worldwide obesity and diabetes epidemic is extending to the next generation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
aerobic organisms produce intracellular thiols such as glutathione ( gsh ) , homoglutathione , -glutamylcysteine ( -glu - cys ) , -glutamylcysteinylserine and mycothiol for protection against reactive oxygen species formed as by - products of aerobic metabolism . in addition to buffering the redox status of the cytoplasm and protecting biomolecules against oxidative damage , gsh provides reducing equivalents to several enzymes ( including ribonucleotide reductase , 3'-phosphoadenosine 5-phosphosulfate reductase and arsenate reductase ) , and serves as a substrate for glutathione - s - transferases , which detoxify potentially dangerous electrophiles . gsh is found primarily in gram - negative bacteria and eukaryotes , and only rarely in gram - positive bacteria ( figure 1 ) . it is not found in the archaea or in amitochondrial eukaryotes such as entamoeba histolytica , giardia duodenalis , trichomonas vaginalis and trichomonas foetus . this distinctive pattern led to the proposal that the genes for gsh biosynthesis may have been transferred to eukaryotes from bacteria via the progenitor of mitochondria . if this hypothesis is true , then the genes for gsh biosynthesis in eukaryotes should resemble those from alpha - proteobacteria , the modern relatives of the mitochondrial progenitor . -glu - cys ligase ( gsha ) catalyzes the formation of a peptide bond between the -carboxylate of glutamate and cysteine . gsh synthetase ( gshb ) catalyzes the subsequent formation of a peptide bond between the cysteinyl carboxylate of -glu - cys and the amino group of glycine . each of these reactions requires hydrolysis of atp to drive formation of the peptide bond . we have analyzed the sequences of genes encoding gsha and gshb and have discovered that the evolutionary history of these genes is more complex than expected . the most likely possibility is that gsha arose in the bacterial domain , and the gene was transferred to eukaryotes at an early stage in their evolution . a second , less appealing , possibility is that a gsha gene was present in the last common ancestor and was subsequently lost from many organisms , primarily those that live under anaerobic conditions . gshb appears to have arisen independently within bacteria and eukaryotes subsequent to the acquisition of the gsha gene . notably , in each domain , the scaffold typical of the atp - grasp superfamily was utilized to provide gshb . multiple examples of lateral transfer of the gsha gene are evident , the most dramatic being a trans - domain transfer from an alpha - proteobacterium to a plant sometime before 300 million years ago . we assembled an initial set of gsha sequences by searching the ncbi protein database using either gsha or glutamate - cysteine ligase as query words . the set was expanded using the output of blast searches with the sequences from escherichia coli , saccharomyces cerevisiae and arabidopsis thaliana . some of the sequences found in the blast searches correspond to hypothetical proteins whose functions have not been experimentally verified . for organisms that are known to synthesize gsh , these sequences are likely to encode gsha . however , the assignment of function is uncertain for the sequences from mycobacterium tuberculosis , streptomyces coelicolor and clostridium acetobutylicum because these organisms are not known to synthesize gsh . the sequences in the gsha set fall into three distinct groups ( table 1 ) that have no significant relationship to each other on the basis of pairwise sequence identities . the first group consists primarily of gamma - proteobacteria , the second of non - plant eukaryotes and the third primarily of flowering plants and alpha - proteobacteria . pairwise sequence identities within each group range from 24 to 93% for group 1 , from 32 to 98% for group 2 , and from 45 to 93% for group 3 . psi - blast is an iterative form of blast in which sequence information from hits found with an initial query sequence is incorporated into a profile that is used in subsequent searches . we carried out psi - blast searches using gsha sequences from e. coli ( group 1 , gi12517129 ) , drosophila melanogaster ( group 2 , gi7290879 ) , and mesorhizobium loti ( group 3 , gi13475748 ) . in each case , psi - blast converged within a few iterations ( three , two and five , respectively ) , and no members of the other groups were found , even with statistically insignificant scores ( data not shown ) . cyanobacterial sequences ( not shown in table 1 ) are found in the psi - blast output for group 3 , but are quite distantly related to the other group 3 sequences ( typically less than 20% sequence identity ) . the lack of significant overall sequence identity between the members of these groups could indicate that these proteins arrived at a common function by convergent evolution from different progenitors , or that the sequences have diverged so far that evolutionary relationships are no longer readily apparent . for truly related but very divergent proteins , it is often possible to identify locally conserved regions that are important for structure and/or function . ( it would be ideal to search for motifs with a divergent set of proteins in which the pairwise identities are less than about 40% , so that the motifs found are highly conserved because they are important for structure and/or function . however , the high pairwise identities between plant and alpha - proteobacterial sequences in group 3 made this impossible . ) using a query set containing six group 1 sequences , seven group 2 sequences , seven group 3 sequences , and four cyanobacterial sequences , block maker identified three blocks of conserved sequence ( figure 3 ) . a search of the non - redundant database using a pssm ( position - specific scoring matrix ) generated from these blocks retrieved a total of 81 sequences with e - values less than 10 . no proteins with identified functions other than gsha were found with e - values less than 7 . thus , the pssm was very effective at discriminating between gsha and non - gsha sequences in the database . many of the sequences were duplicate entries of a single sequence or sequences from multiple strains of the same organism . taking this into account , the search retrieved 44 sequences of known or putative gshas with e - values less than 1 . a subset of these sequences representing all three groups and cyanobacteria is shown in table 2 . the p - values for each occurrence of the three motifs , as well as the e - values for each sequence , are very low in all three groups . these data provide support for a real but distant relationship between the three groups of sequences , as well as the cyanobacterial sequences . it is difficult to generate reliable phylogenetic trees in cases such as this in which only small blocks of conserved sequence can be identified . figure 4 shows a tree generated from the three conserved blocks using the parsimony method in paup 4.0b . the tree topology supports the findings reported above in that the sequences cluster into three distinct groups , with the cyanobacterial sequences being most closely associated with the group 3 ( plant and alpha - proteobacteria ) sequences . the available information does not provide reliable information about the order of branching within each of these groups . a general association of eukaryotic and alpha - proteobacterial sequences that would support the hypothesis that the eukaryotic gene arose by transfer from the mitochondrial progenitor is not seen . the striking association of plant sequences with alpha - proteobacterial sequences will be addressed below . figure 5 shows the distribution of known and putative gsha genes mapped onto a universal tree of life generated using rrna sequences . first , a gsha gene might have arisen early in either the bacterial or eukaryotic lineage and undergone a lateral transfer to the other domain . alternatively , a gsha gene could have been present in the last common ancestor , but have been lost in nearly all archaea , the deepest - branching eukaryotes and many bacteria . although the possibility of massive loss of gsha at first glance seems unlikely , careful perusal of figures 1 and 5 reveals that most of the genera that lack gsh and/or gsha lack aerobic metabolism and therefore do not need gsh for protection against reactive oxygen species . many archaea ( all of the methanogens , as well as archaeoglobus , pyrodictium , thermoproteus and thermofilum ) are anaerobes . the deepest - branching eukaryotes ( giardia , trichomonas , vairimorpha and encephalitozoon ) lack mitochondria , and therefore aerobic metabolism . however , a problem with this hypothesis is that it requires that the gsha gene , which appears to be important only to aerobes , must have originated in the last common ancestor before the emergence of o2 , which occurred only after the evolution of cyanobacteria about 2.6 billion years ago . the possibility that gsha arose early in the bacterial lineage and then was transferred to the eukaryotic lineage and into at least one archaeon ( halobacterium ) is perhaps more appealing . gsha may have arisen in cyanobacteria concomitant with the origin of oxygenic photosynthesis , a particularly attractive hypothesis because this would have been the first time protection against reactive oxygen species would have been important . later , as proteobacteria developed aerobic metabolic processes that took advantage of the growing o2 concentration in the atmosphere , the consequent production of reactive oxygen species would have given a selective advantage to microbes that acquired a gsha gene by lateral gene transfer from cyanobacteria . gsha would have been advantageous to aerobic eukaryotes as well , providing selective pressure for the acquisition and retention of a bacterial gsha gene . transfer of a gsha gene from the alpha - proteobacterial progenitor of mitochondria , as postulated previously , is one possible mechanism for the spread of gsha into eukaryotes . our analysis does not show a significant association between eukaryotic and alpha - proteobacterial sequences that would support this mechanism ( figure 4 ) . however , the extreme divergence of the sequences limits our ability to resolve phylogenetic relationships , so this mechanism remains a possibility . there are other possible mechanisms for an early trans - domain lateral gene transfer , as well . for example , doolittle has proposed that protists that consume bacteria as food may incorporate bacterial genes into their genomes . lateral transfer of genes between bacteria is recognized to occur very frequently , especially for genes involved in metabolism . lateral transfers of genes into eukaryotic nuclear dna from the alpha - proteobacterial progenitor of mitochondria and into plant nuclear dna from the cyanobacterial progenitor of chloroplasts are well documented . examples include transfer of the phosphoglucose isomerase gene from a eukaryote to a bacterium and displacement of several aminoacyl - trna synthetases in parasitic and symbiotic bacteria by eukaryotic and archaeal counterparts . our results show clear evidence of a trans - domain transfer of a gsha gene from alpha - proteobacteria to plants . figure 4 shows that the data provide 100% bootstrap support to the clustering of plant sequences with the group 3 alpha - proteobacterial sequences , and table 3 illustrates the strikingly high pairwise sequence identities between plant and alpha - proteobacterial sequences . many of the alpha - proteobacteria are either plant pathogens ( for example , agrobacterium tumefaciens ) or plant commensals ( for example , sinorhizobium meliloti and zymomonas mobilis ) . the close physical association between these bacteria and plants apparently provided an opportunity for lateral transfer of the gsha gene , perhaps more than 300 million years ago . a partial sequence is available for gsha from the conifer picea abies ( gi12580873 ) . this sequence has 77% identity to the a. thaliana sequence and thus belongs to group 3 . conifers diverged from the lineage leading to flowering plants 300 - 350 million years ago . thus , lateral transfer of the alpha - proteobacterial gsha gene may have occurred before the divergence of conifers . additional sequences from other conifers and more primitive plants are needed to pin down the timing of this transfer . lateral gene transfer from alpha - proteobacteria to plants is particularly intriguing because transfer and retention of a foreign gene in a sophisticated multicellular organism is more difficult than in bacteria . bacteria can acquire dna from their environment in multiple ways ( transformation , transduction and conjugation ) . furthermore , a transferred gene can be easily transmitted to progeny after recombination into genomic or plasmid dna . the best understood mechanism is the transfer of t - strand dna from the ti - plasmid of agrobacterium tumefaciens into wounded plant tissues , a process resulting in the formation of tumors . it is not known whether foreign genes can be transferred into plants by this mechanism in nature , but such a process is plausible . perpetuation of a transferred gene is also not as easily achieved in seed plants as it is in bacteria , because the gene must be incorporated into genomic dna in apical meristem cells , undifferentiated stem cells that produce new organs , including the cones or flowers that generate male and female gametes . an interesting issue is whether the group 3 alpha - proteobacterial gene displaced an ancestral group 2 eukaryotic gene , or whether the ancestral gene was first lost , allowing the alpha - proteobacterial gene to fill the functional gap . gsha from xylella fastidiosa , a gamma - proteobacterium , clusters with group 3 , rather than with the other gamma - proteobacterial sequences in group 1 . this organism is a plant pathogen , and its physical association with plants has apparently provided an opportunity for gene transfer , either from a plant or , more likely , from an associated alpha - proteobacterium . sequences from halobacterium sp . nrc-1 ( archaeon ) , mycobacterium tuberculosis and streptomyces coelicolor ( high - gc gram - positive bacteria ) , and streptococcus pneumoniae ( low - gc gram - positive bacterium ) cluster with the plant and alpha - proteobacterial sequences in group 3 , and a sequence from clostridium acetobutylicum , a low - gc gram - positive bacterium , clusters with the gamma - proteobacterial sequences in group 1 . the occurrence of gsha homologs in these organisms could reflect persistence of an ancestral gsha in only some genera in the archaea and in the gram - positive bacteria , or could be the result of lateral transfer into a limited number of organisms . as discussed above , it is difficult to distinguish between these two explanations , although the lateral gene transfer hypothesis is most appealing . the three groups of gsha sequences are so divergent that it was difficult to demonstrate an evolutionary relationship between them . the gamma - proteobacteria represented in group 1 are reasonably closely related to the alpha - proteobacteria in group 3 , and the crown eukaryotes in group 2 are reasonably closely related to the plants in group 3 . orthologous relationships between these groups can often be identified . of the 1,923 cogs ( clusters of orthologous groups ) identified in p. aeruginosa ( a gamma - proteobacterium ) , 80% are also found in the combined group containing mesorhizobium loti and caulobacter crescentus ( both alpha - proteobacteria ) . as a specific example , the gshb sequences from e. coli ( a gamma - proteobacterium ) and c. crescentus have 41% identity , and those from arabidopsis and human have 43% identity . detection of orthologs in even more distantly related organisms is also possible in many cases . we have used psi - blast to find orthologs of enzymes that use glutathione ( including glutaredoxins , glutathione - s - transferases , glutathione reductases and glutathione peroxidases ) in both bacteria and eukaryotes ( data not shown ) . a second reason that homologous sequences may be very divergent is that little selective pressure has been required to maintain function at the level required for the organism to succeed . this situation may occur if the reaction being catalyzed is not very demanding , or if the product of the reaction does not contribute to the fitness of the organism in an important way . an example of the first scenario is o - succinylbenzoate synthase , which catalyzes the dehydration of 2-hydroxy-6-succinyl-2,4-cyclohexadiene carboxylate to form o - succinylbenzoate synthase in the biosynthetic pathway for menaquinone synthesis . o - succinylbenzoate synthases from various organisms have very low pairwise sequence identities compared to those seen for other members of the enolase superfamily . the low sequence identities in these enzymes have been interpreted as reflecting relatively low constraints upon the sequence because the reaction is quite facile even in the absence of the enzyme ( because it forms an aromatic product ) , and thus the enzyme is not required to provide a great deal of assistance . this scenario is unlikely to account for the divergence of the gsha genes , as formation of a peptide bond is a quite difficult reaction . in fact , members of the atp - grasp superfamily that catalyze comparable reactions ( that is , gshbs ( see further below ) , ribosomal s6 modification enzymes , d - ala - d - ala ligases ) are sufficiently well conserved to be easily detected by psi - blast , even though they utilize different substrates . with respect to the second scenario , bacteria and yeast that lack functional gsha are viable , but are hypersensitive to oxidative damage . gsha - deficient strains of a. thaliana are viable , but are hypersensitive to cadmium . mice in which -glu - cys ligase has been knocked out die before gestational day 13 . thus , low selection pressure can not account for the high levels of divergence among the gsha sequences . finally , sequences of homologs may diverge if they are subject to different selective pressures in different lineages . this might occur if the protein has a second function ( a ' moonlighting ' function ) in some lineages and is subject to selective pressure that alters regions of the protein involved in that function . alternatively , if a protein interacts with other proteins , then differences in those partner proteins will drive changes in the regions of the protein involved in the interaction . the possibility that the high level of divergence in gsha proteins is due to one of these factors is intriguing and worth experimental exploration . a set of gshbs was assembled by searching the ncbi protein database using either gshb or glutathione synthetase as query words , and from the outputs of blast searches with the e. coli and s. cerevisiae proteins as query sequences . the sequences in the gshb set fall into two distinct groups , corresponding to bacteria and eukaryotes , that have no significant relationship to each other on the basis of pairwise sequence identities . as seen with gsha , psi - blast searches with gshb sequences from either group did not find gshb sequences from the other group . a psi - blast search with the human gshb converged after two iterations . the output contained only eukaryotic gshbs , a few putative homoglutathione synthestases , and a few eukaryotic proteins of unknown function . after multiple iterations , a psi - blast search using the e. coli gshb ( gi121663 ) as an initial query sequence found 509 sequences of enzymes in the atp - grasp superfamily , to which the bacterial enzyme is known to belong , but no eukaryotic gshb sequences . the atp - grasp superfamily includes at least 15 families of enzymes that catalyze formation of a bond between a carboxylate group of one substrate and an amino , imino or thiol group of a second substrate . the bacterial gshbs are most closely related to ribosomal s6 modification enzymes , which catalyze the addition of glutamate to the carboxyl terminus of ribosomal protein s6 . other members of the superfamily include carbamoyl phosphate synthases , cyanophycin synthetases and d - ala - d - ala ligases . for example , a. thaliana has at least three superfamily members in the psi - blast output , including carbamoyl phosphate synthetase , 3-methylcrotonyl - coa carboxylase , and acetyl coa carboxylase . . thus , atp - grasp superfamily members in eukaryotes are more closely related to bacterial gshbs than to eukaryotic gshbs . crystal structures of gshbs from e. coli and human are available , so we are able to consider the evolutionary relationship between the two groups of sequences in the context of the structural information ( figure 6 ) . the e. coli and human enzymes have the same overall structural fold , which is typical of the atp - grasp superfamily . the human enzyme has a number of insertions , and in addition , has a circular permutation of the sequence that results in the movement of part of the carboxy - terminal domain to the amino - terminal domain . the sequence identity between the e. coli and human enzymes is strikingly low . even in the regions that can be structurally superimposed , it is only 10% . furthermore , only 2 out of 11 residues involved in binding gsh are conserved between the two enzymes . the structural similarity between the e. coli and human gshbs indicates that the bacterial and eukaryotic enzymes could be related to each other , but is not sufficient to prove that they are related to each other because the common structure might have arisen by convergent evolution from different progenitors . this consideration is especially worth noting in light of the very low conservation of residues in the active site . consequently , we looked for evidence of an evolutionary relationship by attempting to find proteins that might be distantly related to the bacterial and eukaryotic gshb proteins and therefore might bridge the sequence gap between them using the shotgun algorithm , which was designed to facilitate searches for distant relations between proteins . it then sorts the hits found by all of the proteins , and for each hit , identifies the query sequences that found that hit . a hit that is found by multiple members of two distinct groups of proteins , even with low blast scores , can be examined closely to determine whether it provides a link between the groups . we ran shotgun with a query set containing six eukaryotic gshbs , eight bacterial gshbs , eight s6 modification enzymes ( four from bacteria and four from archaea ) , and four proteins of unknown function ( three from bacteria and one from the archaeon methanococcus jannaschii ) . generally , sequences were found by either bacterial gshbs and the s6 modification enzymes , or by eukaryotic gshb proteins , but not by both groups . there was only one exception , which was a protein ( a putative gshb from medicago truncatula , gi 4808539 ) found by all six of the eukaryotic gshbs with blast scores above 194 ( blast probabilities less than 5.2e-31 ) , and one bacterial gshb , with a blast score of 63 ( blast probability of 1.0 ) . given the number of bacterial gshb sequences in the query set , the finding of one bacterial sequence with an insignificant p - value can be regarded as a chance occurrence . thus , we were unable to establish any relationship between the two groups of gshb sequences using shotgun . demonstration of conserved sequence motifs would provide supporting evidence for an evolutionary relationship between eukaryotic and bacterial gshbs . in this case , the block maker algorithm used to analyze the gsha proteins did not perform well . the circular permutation of the eukaryotic sequences with respect to the bacterial sequences , as well as the extremely low sequence identities , make alignment difficult and preclude the identification of blocks in the permuted region . therefore , a different motif - finding algorithm , meme 3.0 , was used to analyze a divergent set of gshbs , along with several of the proteins related to the bacterial gshbs . twelve strongly conserved motifs were identified ( table 4 ) . the pattern of distribution of these motifs in eukaryotic gshbs , bacterial gshbs and s6 modification enzymes ( the enzymes most closely related to the bacterial gshbs ) is illustrated in figure 8 . motifs 11 and 12 are peculiar to the bacterial gshb proteins and map to the substrate - binding region of the protein . these motifs are replaced by others in the s6 modification enzymes and in d - ala - d - ala ligases ( data not shown ) , while the motifs involved in the atp - binding site ( 1 , 4 , 6 and 5 ) are conserved . this protein scaffold clearly provides a modular structure that is easily adapted to bind different substrates in proximity to bound atp . two motifs ( 1 and 5 ) that contribute to the atp - binding pocket were found in both eukaryotic and bacterial gshbs , as well as other members of the atp - grasp super - family . these motifs were present in different orders in the bacterial and eukaryotic gshbs ( see figure 8) because motif 5 is involved in the circular permutation that moves part of the carboxy - terminal domain to the amino - terminal domain of the eukaryotic enzymes . the lack of conserved motifs in the substrate - binding region is consistent with the comparison of the e. coli and human gshb structures , which shows remarkably little similarity in this region of the protein . in a case such as this one , it can be difficult to determine whether common sequence motifs have arisen by divergence from a common progenitor , or by convergent evolution driven by a common function . the two common motifs found in the bacterial and eukaryotic gshbs correspond to the atp - binding pocket . thus , we examined the possibility that motifs 1 and 5 arose by convergent evolution driven by the need to bind atp by looking for these motifs in other proteins that bind atp . we searched the non - redundant database with motifs 1 and 5 using the mast algorithm . searches with motif 1 and 5 retrieved 145 and 40 sequences with e - values less than 10 , respectively . nearly all of the proteins with known functions in the output were gshbs or other members of the atp - grasp superfamily . all of the 145 proteins found by motif 1 were members of the atp - grasp superfamily except for two transcriptional regulators with e - values of 4.8 ( gi15613287 ) and 7.8 ( gi15224768 ) , dihydroorotate dehydrogenases with e - values greater than 7 from several organisms , and a proline / betaine transporter ( gi1589297 ) with an e - value of 9.9 . all of the proteins with known functions found by motif 5 were members of the atp - grasp superfamily except the lim - containing protein kinase 2 t ( gi3273207 ) , which had an e - value of 6.2 . thus , motifs 1 and 5 are characteristic of the atp - binding region of the atp - grasp superfamily enzymes . the question of whether eukaryotic gshbs are members of the atp - grasp superfamily is difficult to answer with certainty because the eukaryotic gshbs are so dramatically different from the other superfamily members . the two conserved sequence motifs involved in atp binding do provide a link between eukaryotic gshbs and the atp - grasp superfamily , but it is rather tenuous , as it is possible that these sequences provide the best way to bind atp within the context of this structural fold and have evolved by convergent evolution in eukaryotic gshbs and the atp - grasp superfamily members . the lack of conservation in the glutathione - binding region of bacterial and eukaryotic gshbs is also an important consideration . we feel that the evidence for a true evolutionary relationship between the eukaryotic gshbs and the atp - grasp superfamily is rather weak given the evidence available at this time . for our purposes here , it is sufficient to conclude , in agreement with polekhina et al . , that eukaryotic gshbs did not evolve directly from bacterial gshbs , but rather that both evolved from ancestors that had the characteristic fold of the atp - grasp superfamily . in most organisms , gsha and gshb are encoded by separate genes that are not in close proximity . an interesting variation on clostridium perfringens , listeria monocytogenes , listeria innocuans and pasteurella multocidans have an open reading frame ( orf ) that could encode a gsha homolog fused to an atp - grasp superfamily member , raising the possibility that this protein might combine the two activities required for synthesis of gsh . c. perfringens and l. monocytogenes contain low levels of gsh ( 0.25 mol / g residual dry weight ) that are about 20-fold lower than those found in e. coli , but it is not known whether they synthesize gsh or simply import it from the medium . the amino - terminal part of the fusion proteins is most closely related to group 1 gshas , although the sequence identities are not high ( table 5 ) . the carboxy - terminal parts of these proteins are most closely related to cyanophycin synthetase , which catalyzes the synthesis of a polypeptide storage polymer in cyanobacteria , and more distantly related to d - ala - d - ala ligase , which is involved in peptidoglycan biosynthesis in many bacteria . these enzymes are members of the atp - grasp superfamily , to which gshb also belongs . however , there is no significant relationship between the carboxy - terminal region of these putative fusion proteins and known gshbs ( see table 5 ) . if this part of the protein does indeed function as a glutathione synthetase , then this would be another example of independent recruitment of an atp - grasp superfamily member to provide this function . the occurrence of an orf for the fusion protein in this cluster of bacteria is curious because c. perfringens , l. monocytogenes and l. innocuans are low - gc gram - positive bacteria , while p. multocida is a gamma - proteobacterium . c. perfringens is found in soil and sewage and l. monocytogenes and l. innocuans are ubiquitous contaminants of soil and water , and l. monocytogenes causes listeriosis , a serious food - borne illness . p. multocida colonizes the nasopharynx and gastrointestinal tract of many animals and birds , and causes a wide range of illnesses . thus , the association of these bacteria with animals as either commensal or pathogenic organisms has apparently provided an opportunity for lateral transfer of the gene encoding the fusion protein . the orf for the putative fusion protein in p. multocida is particularly intriguing because gamma - proteobacteria typically have a group 1 gsha and a typical bacterial gshb . p. multocida has neither of these , and neither does its close relative , haemophilus influenzae . the lineage leading to p. multocida and h. influenzae diverged from other gamma - proteobacteria approximately 270 million years ago . p. multocida and h. influenzae have considerably smaller genomes ( 2,014 and 1,743 predicted coding regions , respectively ) than e. coli ( 4,288 predicted coding regions ) , suggesting that this lineage has undergone substantial genome reduction . it is possible that the lineage leading to p. multocida and h. influenzae lost gsha , and p. multocida subsequently acquired the fused gsha - atp - grasp superfamily homolog in its place . the pathway for gsh biosynthesis involves two enzymes , and it is of interest to consider which of these evolved first . horowitz has postulated that biosynthetic pathways evolve in a retrograde fashion , beginning with the last enzyme in the pathway . this hypothesis rests on the assumption that organisms had , at one time , access to a supply of precursors for biological polymers such as dna , rna , proteins and polysaccharides . as the supply of a given precursor dwindled , the most successful organisms would be those that ' invented ' an enzyme with which to catalyze formation of that precursor from compounds present in the environment . thus , there would be continuous selective pressure to add enzymes in the retrograde direction to catalyze synthesis of precursors from ever more simple constituents . evolution of a biosynthetic pathway in the forward direction was deemed unlikely , as there would be no selective pressure for evolution of enzymes to produce intermediates of no further use to the organism . there are cases , however , in which forward evolution of a pathway seems more likely . for example , many organisms make complex natural products whose roles generally involve killing or manipulating other organisms . the pathways for building these complex structures have probably evolved in a forward direction by addition of enzymes capable of adding to the complexity of a pre - existing molecule and thereby contributing to its biological potency . if the pathway had evolved in a retrograde direction , the horowitz theory would postulate that gshb arose to take advantage of -glu - cys present in the environment . it is unlikely that -glu - cys would have been available because formation of the high - energy amide bond would be unlikely to occur abiotically . however , evolution of the gsh biosynthesis pathway in the forward direction makes considerable sense . -glu - cys can serve some of the functions of gsh , and therefore could be advantageous to an organism even in the absence of gshb . indeed , halobacteria contain millimolar levels of -glu - cys , but do not convert it further to gsh . however , -glu - cys is not an ideal solution , as it is more easily oxidized than gsh . furthermore , the reactivity of a thiol depends upon its pka , as thiolates are orders of magnitude more nucleophilic than thiols . the nucleophilicity of the thiol in -glu - cys should be diminished by the proximity of the negatively charged carboxylate . further reaction of -glu - cys with gly to form gsh would improve its properties with respect to both oxidation and nucleophilicity , thus , providing selective pressure for evolution of a gsh synthetase ( gshb ) . one possible source for an enzyme to catalyze the next step in a pathway evolving in the forward direction is the enzyme that catalyzed the last step , as this enzyme has a binding site that accommodates the product of the last reaction , and that product is the substrate for the next reaction . this type of enzyme recruitment , which takes advantage of already existing substrate - specificity determinants , but requires changes in catalytic groups , appears to occur rather infrequently . for example , among 510 proteins involved in the small - molecule metabolic pathways in e. coli , homology between consecutive enzymes in a pathway occurs only six times . most often , enzymes are recruited to catalyze new reactions by virtue of the catalytic abilities of their active sites , and interactions required for substrate binding are then optimized . the gsh biosynthesis genes , however , appear to be an optimal case for recruitment of one enzyme to catalyze a subsequent reaction . as gsha has a binding site that accommodates -glu - cys , it would appear to be an ideal progenitor of gshb , which uses -glu - cys as a substrate and also catalyzes the atp - dependent formation of an amide bond . there are no experimental structures for gshas , but recent work suggests that gshas are homologs of glutamine synthetases . thus , the data support a scenario in which emergence of gsha was followed , in most organisms , by the recruitment of a different protein to serve as the progenitor of gshb . it is particularly interesting that , in both the bacterial and eukaryotic lineages , the atp - grasp structural fold provided the starting point for the evolution of gshb . we assembled an initial set of gsha sequences by searching the ncbi protein database using either gsha or glutamate - cysteine ligase as query words . the set was expanded using the output of blast searches with the sequences from escherichia coli , saccharomyces cerevisiae and arabidopsis thaliana . some of the sequences found in the blast searches correspond to hypothetical proteins whose functions have not been experimentally verified . for organisms that are known to synthesize gsh , these sequences are likely to encode gsha . however , the assignment of function is uncertain for the sequences from mycobacterium tuberculosis , streptomyces coelicolor and clostridium acetobutylicum because these organisms are not known to synthesize gsh . the sequences in the gsha set fall into three distinct groups ( table 1 ) that have no significant relationship to each other on the basis of pairwise sequence identities . the first group consists primarily of gamma - proteobacteria , the second of non - plant eukaryotes and the third primarily of flowering plants and alpha - proteobacteria . pairwise sequence identities within each group range from 24 to 93% for group 1 , from 32 to 98% for group 2 , and from 45 to 93% for group 3 . psi - blast is an iterative form of blast in which sequence information from hits found with an initial query sequence is incorporated into a profile that is used in subsequent searches . we carried out psi - blast searches using gsha sequences from e. coli ( group 1 , gi12517129 ) , drosophila melanogaster ( group 2 , gi7290879 ) , and mesorhizobium loti ( group 3 , gi13475748 ) . in each case , psi - blast converged within a few iterations ( three , two and five , respectively ) , and no members of the other groups were found , even with statistically insignificant scores ( data not shown ) . cyanobacterial sequences ( not shown in table 1 ) are found in the psi - blast output for group 3 , but are quite distantly related to the other group 3 sequences ( typically less than 20% sequence identity ) . the lack of significant overall sequence identity between the members of these groups could indicate that these proteins arrived at a common function by convergent evolution from different progenitors , or that the sequences have diverged so far that evolutionary relationships are no longer readily apparent . for truly related but very divergent proteins , it is often possible to identify locally conserved regions that are important for structure and/or function . ( it would be ideal to search for motifs with a divergent set of proteins in which the pairwise identities are less than about 40% , so that the motifs found are highly conserved because they are important for structure and/or function . however , the high pairwise identities between plant and alpha - proteobacterial sequences in group 3 made this impossible . ) using a query set containing six group 1 sequences , seven group 2 sequences , seven group 3 sequences , and four cyanobacterial sequences , block maker identified three blocks of conserved sequence ( figure 3 ) . a search of the non - redundant database using a pssm ( position - specific scoring matrix ) generated from these blocks retrieved a total of 81 sequences with e - values less than 10 . no proteins with identified functions other than gsha were found with e - values less than 7 . thus , the pssm was very effective at discriminating between gsha and non - gsha sequences in the database . many of the sequences were duplicate entries of a single sequence or sequences from multiple strains of the same organism . taking this into account , the search retrieved 44 sequences of known or putative gshas with e - values less than 1 . a subset of these sequences representing all three groups and cyanobacteria is shown in table 2 . the p - values for each occurrence of the three motifs , as well as the e - values for each sequence , are very low in all three groups . these data provide support for a real but distant relationship between the three groups of sequences , as well as the cyanobacterial sequences . it is difficult to generate reliable phylogenetic trees in cases such as this in which only small blocks of conserved sequence can be identified . figure 4 shows a tree generated from the three conserved blocks using the parsimony method in paup 4.0b . the tree topology supports the findings reported above in that the sequences cluster into three distinct groups , with the cyanobacterial sequences being most closely associated with the group 3 ( plant and alpha - proteobacteria ) sequences . the available information does not provide reliable information about the order of branching within each of these groups . a general association of eukaryotic and alpha - proteobacterial sequences that would support the hypothesis that the eukaryotic gene arose by transfer from the mitochondrial progenitor is not seen . the striking association of plant sequences with alpha - proteobacterial sequences will be addressed below . figure 5 shows the distribution of known and putative gsha genes mapped onto a universal tree of life generated using rrna sequences . first , a gsha gene might have arisen early in either the bacterial or eukaryotic lineage and undergone a lateral transfer to the other domain . alternatively , a gsha gene could have been present in the last common ancestor , but have been lost in nearly all archaea , the deepest - branching eukaryotes and many bacteria . although the possibility of massive loss of gsha at first glance seems unlikely , careful perusal of figures 1 and 5 reveals that most of the genera that lack gsh and/or gsha lack aerobic metabolism and therefore do not need gsh for protection against reactive oxygen species . many archaea ( all of the methanogens , as well as archaeoglobus , pyrodictium , thermoproteus and thermofilum ) are anaerobes . the deepest - branching eukaryotes ( giardia , trichomonas , vairimorpha and encephalitozoon ) lack mitochondria , and therefore aerobic metabolism . however , a problem with this hypothesis is that it requires that the gsha gene , which appears to be important only to aerobes , must have originated in the last common ancestor before the emergence of o2 , which occurred only after the evolution of cyanobacteria about 2.6 billion years ago . the possibility that gsha arose early in the bacterial lineage and then was transferred to the eukaryotic lineage and into at least one archaeon ( halobacterium ) is perhaps more appealing . gsha may have arisen in cyanobacteria concomitant with the origin of oxygenic photosynthesis , a particularly attractive hypothesis because this would have been the first time protection against reactive oxygen species would have been important . later , as proteobacteria developed aerobic metabolic processes that took advantage of the growing o2 concentration in the atmosphere , the consequent production of reactive oxygen species would have given a selective advantage to microbes that acquired a gsha gene by lateral gene transfer from cyanobacteria . gsha would have been advantageous to aerobic eukaryotes as well , providing selective pressure for the acquisition and retention of a bacterial gsha gene . transfer of a gsha gene from the alpha - proteobacterial progenitor of mitochondria , as postulated previously , is one possible mechanism for the spread of gsha into eukaryotes . our analysis does not show a significant association between eukaryotic and alpha - proteobacterial sequences that would support this mechanism ( figure 4 ) . however , the extreme divergence of the sequences limits our ability to resolve phylogenetic relationships , so this mechanism remains a possibility . there are other possible mechanisms for an early trans - domain lateral gene transfer , as well . for example , doolittle has proposed that protists that consume bacteria as food may incorporate bacterial genes into their genomes . lateral transfer of genes between bacteria is recognized to occur very frequently , especially for genes involved in metabolism . lateral transfers of genes into eukaryotic nuclear dna from the alpha - proteobacterial progenitor of mitochondria and into plant nuclear dna from the cyanobacterial progenitor of chloroplasts are well documented . examples include transfer of the phosphoglucose isomerase gene from a eukaryote to a bacterium and displacement of several aminoacyl - trna synthetases in parasitic and symbiotic bacteria by eukaryotic and archaeal counterparts . our results show clear evidence of a trans - domain transfer of a gsha gene from alpha - proteobacteria to plants . figure 4 shows that the data provide 100% bootstrap support to the clustering of plant sequences with the group 3 alpha - proteobacterial sequences , and table 3 illustrates the strikingly high pairwise sequence identities between plant and alpha - proteobacterial sequences . many of the alpha - proteobacteria are either plant pathogens ( for example , agrobacterium tumefaciens ) or plant commensals ( for example , sinorhizobium meliloti and zymomonas mobilis ) . the close physical association between these bacteria and plants apparently provided an opportunity for lateral transfer of the gsha gene , perhaps more than 300 million years ago . a partial sequence is available for gsha from the conifer picea abies ( gi12580873 ) . this sequence has 77% identity to the a. thaliana sequence and thus belongs to group 3 . conifers diverged from the lineage leading to flowering plants 300 - 350 million years ago . thus , lateral transfer of the alpha - proteobacterial gsha gene may have occurred before the divergence of conifers . additional sequences from other conifers and more primitive plants are needed to pin down the timing of this transfer . lateral gene transfer from alpha - proteobacteria to plants is particularly intriguing because transfer and retention of a foreign gene in a sophisticated multicellular organism is more difficult than in bacteria . bacteria can acquire dna from their environment in multiple ways ( transformation , transduction and conjugation ) . furthermore , a transferred gene can be easily transmitted to progeny after recombination into genomic or plasmid dna . however , known mechanisms for transfer of dna into plants are more limited . the best understood mechanism is the transfer of t - strand dna from the ti - plasmid of agrobacterium tumefaciens into wounded plant tissues , a process resulting in the formation of tumors . it is not known whether foreign genes can be transferred into plants by this mechanism in nature , but such a process is plausible . perpetuation of a transferred gene is also not as easily achieved in seed plants as it is in bacteria , because the gene must be incorporated into genomic dna in apical meristem cells , undifferentiated stem cells that produce new organs , including the cones or flowers that generate male and female gametes . an interesting issue is whether the group 3 alpha - proteobacterial gene displaced an ancestral group 2 eukaryotic gene , or whether the ancestral gene was first lost , allowing the alpha - proteobacterial gene to fill the functional gap . gsha from xylella fastidiosa , a gamma - proteobacterium , clusters with group 3 , rather than with the other gamma - proteobacterial sequences in group 1 . this organism is a plant pathogen , and its physical association with plants has apparently provided an opportunity for gene transfer , either from a plant or , more likely , from an associated alpha - proteobacterium . sequences from halobacterium sp . nrc-1 ( archaeon ) , mycobacterium tuberculosis and streptomyces coelicolor ( high - gc gram - positive bacteria ) , and streptococcus pneumoniae ( low - gc gram - positive bacterium ) cluster with the plant and alpha - proteobacterial sequences in group 3 , and a sequence from clostridium acetobutylicum , a low - gc gram - positive bacterium , clusters with the gamma - proteobacterial sequences in group 1 . the occurrence of gsha homologs in these organisms could reflect persistence of an ancestral gsha in only some genera in the archaea and in the gram - positive bacteria , or could be the result of lateral transfer into a limited number of organisms . as discussed above , it is difficult to distinguish between these two explanations , although the lateral gene transfer hypothesis is most appealing . the three groups of gsha sequences are so divergent that it was difficult to demonstrate an evolutionary relationship between them . the gamma - proteobacteria represented in group 1 are reasonably closely related to the alpha - proteobacteria in group 3 , and the crown eukaryotes in group 2 are reasonably closely related to the plants in group 3 . orthologous relationships between these groups can often be identified . of the 1,923 cogs ( clusters of orthologous groups ) identified in p. aeruginosa ( a gamma - proteobacterium ) , 80% are also found in the combined group containing mesorhizobium loti and caulobacter crescentus ( both alpha - proteobacteria ) . as a specific example , the gshb sequences from e. coli ( a gamma - proteobacterium ) and c. crescentus have 41% identity , and those from arabidopsis and human have 43% identity . detection of orthologs in even more distantly related organisms is also possible in many cases . we have used psi - blast to find orthologs of enzymes that use glutathione ( including glutaredoxins , glutathione - s - transferases , glutathione reductases and glutathione peroxidases ) in both bacteria and eukaryotes ( data not shown ) . a second reason that homologous sequences may be very divergent is that little selective pressure has been required to maintain function at the level required for the organism to succeed . this situation may occur if the reaction being catalyzed is not very demanding , or if the product of the reaction does not contribute to the fitness of the organism in an important way . an example of the first scenario is o - succinylbenzoate synthase , which catalyzes the dehydration of 2-hydroxy-6-succinyl-2,4-cyclohexadiene carboxylate to form o - succinylbenzoate synthase in the biosynthetic pathway for menaquinone synthesis . o - succinylbenzoate synthases from various organisms have very low pairwise sequence identities compared to those seen for other members of the enolase superfamily . the low sequence identities in these enzymes have been interpreted as reflecting relatively low constraints upon the sequence because the reaction is quite facile even in the absence of the enzyme ( because it forms an aromatic product ) , and thus the enzyme is not required to provide a great deal of assistance . this scenario is unlikely to account for the divergence of the gsha genes , as formation of a peptide bond is a quite difficult reaction . in fact , members of the atp - grasp superfamily that catalyze comparable reactions ( that is , gshbs ( see further below ) , ribosomal s6 modification enzymes , d - ala - d - ala ligases ) are sufficiently well conserved to be easily detected by psi - blast , even though they utilize different substrates . with respect to the second scenario , bacteria and yeast that lack functional gsha are viable , but are hypersensitive to oxidative damage . gsha - deficient strains of a. thaliana are viable , but are hypersensitive to cadmium . mice in which -glu - cys ligase has been knocked out die before gestational day 13 . thus , low selection pressure can not account for the high levels of divergence among the gsha sequences . finally , sequences of homologs may diverge if they are subject to different selective pressures in different lineages . this might occur if the protein has a second function ( a ' moonlighting ' function ) in some lineages and is subject to selective pressure that alters regions of the protein involved in that function . alternatively , if a protein interacts with other proteins , then differences in those partner proteins will drive changes in the regions of the protein involved in the interaction . the possibility that the high level of divergence in gsha proteins is due to one of these factors is intriguing and worth experimental exploration . a set of gshbs was assembled by searching the ncbi protein database using either gshb or glutathione synthetase as query words , and from the outputs of blast searches with the e. coli and s. cerevisiae proteins as query sequences . the sequences in the gshb set fall into two distinct groups , corresponding to bacteria and eukaryotes , that have no significant relationship to each other on the basis of pairwise sequence identities . as seen with gsha , psi - blast searches with gshb sequences from either group did not find gshb sequences from the other group . a psi - blast search with the human gshb converged after two iterations . the output contained only eukaryotic gshbs , a few putative homoglutathione synthestases , and a few eukaryotic proteins of unknown function . after multiple iterations , a psi - blast search using the e. coli gshb ( gi121663 ) as an initial query sequence found 509 sequences of enzymes in the atp - grasp superfamily , to which the bacterial enzyme is known to belong , but no eukaryotic gshb sequences . the atp - grasp superfamily includes at least 15 families of enzymes that catalyze formation of a bond between a carboxylate group of one substrate and an amino , imino or thiol group of a second substrate . the bacterial gshbs are most closely related to ribosomal s6 modification enzymes , which catalyze the addition of glutamate to the carboxyl terminus of ribosomal protein s6 . other members of the superfamily include carbamoyl phosphate synthases , cyanophycin synthetases and d - ala - d - ala ligases . for example , a. thaliana has at least three superfamily members in the psi - blast output , including carbamoyl phosphate synthetase , 3-methylcrotonyl - coa carboxylase , and acetyl coa carboxylase . thus , atp - grasp superfamily members in eukaryotes are more closely related to bacterial gshbs than to eukaryotic gshbs . crystal structures of gshbs from e. coli and human are available , so we are able to consider the evolutionary relationship between the two groups of sequences in the context of the structural information ( figure 6 ) . the e. coli and human enzymes have the same overall structural fold , which is typical of the atp - grasp superfamily . the human enzyme has a number of insertions , and in addition , has a circular permutation of the sequence that results in the movement of part of the carboxy - terminal domain to the amino - terminal domain . the sequence identity between the e. coli and human enzymes is strikingly low . even in the regions that can be structurally superimposed , furthermore , only 2 out of 11 residues involved in binding gsh are conserved between the two enzymes . the structural similarity between the e. coli and human gshbs indicates that the bacterial and eukaryotic enzymes could be related to each other , but is not sufficient to prove that they are related to each other because the common structure might have arisen by convergent evolution from different progenitors . this consideration is especially worth noting in light of the very low conservation of residues in the active site . consequently , we looked for evidence of an evolutionary relationship by attempting to find proteins that might be distantly related to the bacterial and eukaryotic gshb proteins and therefore might bridge the sequence gap between them using the shotgun algorithm , which was designed to facilitate searches for distant relations between proteins . it then sorts the hits found by all of the proteins , and for each hit , identifies the query sequences that found that hit . a hit that is found by multiple members of two distinct groups of proteins , even with low blast scores , can be examined closely to determine whether it provides a link between the groups . we ran shotgun with a query set containing six eukaryotic gshbs , eight bacterial gshbs , eight s6 modification enzymes ( four from bacteria and four from archaea ) , and four proteins of unknown function ( three from bacteria and one from the archaeon methanococcus jannaschii ) . generally , sequences were found by either bacterial gshbs and the s6 modification enzymes , or by eukaryotic gshb proteins , but not by both groups . there was only one exception , which was a protein ( a putative gshb from medicago truncatula , gi 4808539 ) found by all six of the eukaryotic gshbs with blast scores above 194 ( blast probabilities less than 5.2e-31 ) , and one bacterial gshb , with a blast score of 63 ( blast probability of 1.0 ) . given the number of bacterial gshb sequences in the query set , the finding of one bacterial sequence with an insignificant p - value can be regarded as a chance occurrence . thus , we were unable to establish any relationship between the two groups of gshb sequences using shotgun . demonstration of conserved sequence motifs would provide supporting evidence for an evolutionary relationship between eukaryotic and bacterial gshbs . in this case , the block maker algorithm used to analyze the gsha proteins did not perform well . the circular permutation of the eukaryotic sequences with respect to the bacterial sequences , as well as the extremely low sequence identities , make alignment difficult and preclude the identification of blocks in the permuted region . therefore , a different motif - finding algorithm , meme 3.0 , was used to analyze a divergent set of gshbs , along with several of the proteins related to the bacterial gshbs . the pattern of distribution of these motifs in eukaryotic gshbs , bacterial gshbs and s6 modification enzymes ( the enzymes most closely related to the bacterial gshbs ) is illustrated in figure 8 . motifs 11 and 12 are peculiar to the bacterial gshb proteins and map to the substrate - binding region of the protein . these motifs are replaced by others in the s6 modification enzymes and in d - ala - d - ala ligases ( data not shown ) , while the motifs involved in the atp - binding site ( 1 , 4 , 6 and 5 ) are conserved . this protein scaffold clearly provides a modular structure that is easily adapted to bind different substrates in proximity to bound atp . two motifs ( 1 and 5 ) that contribute to the atp - binding pocket were found in both eukaryotic and bacterial gshbs , as well as other members of the atp - grasp super - family . these motifs were present in different orders in the bacterial and eukaryotic gshbs ( see figure 8) because motif 5 is involved in the circular permutation that moves part of the carboxy - terminal domain to the amino - terminal domain of the eukaryotic enzymes . the lack of conserved motifs in the substrate - binding region is consistent with the comparison of the e. coli and human gshb structures , which shows remarkably little similarity in this region of the protein . in a case such as this one , it can be difficult to determine whether common sequence motifs have arisen by divergence from a common progenitor , or by convergent evolution driven by a common function . the two common motifs found in the bacterial and eukaryotic gshbs correspond to the atp - binding pocket . thus , we examined the possibility that motifs 1 and 5 arose by convergent evolution driven by the need to bind atp by looking for these motifs in other proteins that bind atp . we searched the non - redundant database with motifs 1 and 5 using the mast algorithm . searches with motif 1 and 5 retrieved 145 and 40 sequences with e - values less than 10 , respectively . nearly all of the proteins with known functions in the output were gshbs or other members of the atp - grasp superfamily . all of the 145 proteins found by motif 1 were members of the atp - grasp superfamily except for two transcriptional regulators with e - values of 4.8 ( gi15613287 ) and 7.8 ( gi15224768 ) , dihydroorotate dehydrogenases with e - values greater than 7 from several organisms , and a proline / betaine transporter ( gi1589297 ) with an e - value of 9.9 . all of the proteins with known functions found by motif 5 were members of the atp - grasp superfamily except the lim - containing protein kinase 2 t ( gi3273207 ) , which had an e - value of 6.2 . thus , motifs 1 and 5 are characteristic of the atp - binding region of the atp - grasp superfamily enzymes . the question of whether eukaryotic gshbs are members of the atp - grasp superfamily is difficult to answer with certainty because the eukaryotic gshbs are so dramatically different from the other superfamily members . the two conserved sequence motifs involved in atp binding do provide a link between eukaryotic gshbs and the atp - grasp superfamily , but it is rather tenuous , as it is possible that these sequences provide the best way to bind atp within the context of this structural fold and have evolved by convergent evolution in eukaryotic gshbs and the atp - grasp superfamily members . the lack of conservation in the glutathione - binding region of bacterial and eukaryotic gshbs is also an important consideration . we feel that the evidence for a true evolutionary relationship between the eukaryotic gshbs and the atp - grasp superfamily is rather weak given the evidence available at this time . for our purposes here , it is sufficient to conclude , in agreement with polekhina et al . , that eukaryotic gshbs did not evolve directly from bacterial gshbs , but rather that both evolved from ancestors that had the characteristic fold of the atp - grasp superfamily . in most organisms , gsha and gshb are encoded by separate genes that are not in close proximity . an interesting variation on clostridium perfringens , listeria monocytogenes , listeria innocuans and pasteurella multocidans have an open reading frame ( orf ) that could encode a gsha homolog fused to an atp - grasp superfamily member , raising the possibility that this protein might combine the two activities required for synthesis of gsh . c. perfringens and l. monocytogenes contain low levels of gsh ( 0.25 mol / g residual dry weight ) that are about 20-fold lower than those found in e. coli , but it is not known whether they synthesize gsh or simply import it from the medium . the amino - terminal part of the fusion proteins is most closely related to group 1 gshas , although the sequence identities are not high ( table 5 ) . the carboxy - terminal parts of these proteins are most closely related to cyanophycin synthetase , which catalyzes the synthesis of a polypeptide storage polymer in cyanobacteria , and more distantly related to d - ala - d - ala ligase , which is involved in peptidoglycan biosynthesis in many bacteria . these enzymes are members of the atp - grasp superfamily , to which gshb also belongs . however , there is no significant relationship between the carboxy - terminal region of these putative fusion proteins and known gshbs ( see table 5 ) . if this part of the protein does indeed function as a glutathione synthetase , then this would be another example of independent recruitment of an atp - grasp superfamily member to provide this function . the occurrence of an orf for the fusion protein in this cluster of bacteria is curious because c. perfringens , l. monocytogenes and l. innocuans are low - gc gram - positive bacteria , while p. multocida is a gamma - proteobacterium . c. perfringens is found in soil and sewage and l. monocytogenes and l. innocuans are ubiquitous contaminants of soil and water , and l. monocytogenes causes listeriosis , a serious food - borne illness . p. multocida colonizes the nasopharynx and gastrointestinal tract of many animals and birds , and causes a wide range of illnesses . thus , the association of these bacteria with animals as either commensal or pathogenic organisms has apparently provided an opportunity for lateral transfer of the gene encoding the fusion protein . the orf for the putative fusion protein in p. multocida is particularly intriguing because gamma - proteobacteria typically have a group 1 gsha and a typical bacterial gshb . p. multocida has neither of these , and neither does its close relative , haemophilus influenzae . the lineage leading to p. multocida and h. influenzae diverged from other gamma - proteobacteria approximately 270 million years ago . p. multocida and h. influenzae have considerably smaller genomes ( 2,014 and 1,743 predicted coding regions , respectively ) than e. coli ( 4,288 predicted coding regions ) , suggesting that this lineage has undergone substantial genome reduction . it is possible that the lineage leading to p. multocida and h. influenzae lost gsha , and p. multocida subsequently acquired the fused gsha - atp - grasp superfamily homolog in its place . the pathway for gsh biosynthesis involves two enzymes , and it is of interest to consider which of these evolved first . horowitz has postulated that biosynthetic pathways evolve in a retrograde fashion , beginning with the last enzyme in the pathway . this hypothesis rests on the assumption that organisms had , at one time , access to a supply of precursors for biological polymers such as dna , rna , proteins and polysaccharides . as the supply of a given precursor dwindled , the most successful organisms would be those that ' invented ' an enzyme with which to catalyze formation of that precursor from compounds present in the environment . thus , there would be continuous selective pressure to add enzymes in the retrograde direction to catalyze synthesis of precursors from ever more simple constituents . evolution of a biosynthetic pathway in the forward direction was deemed unlikely , as there would be no selective pressure for evolution of enzymes to produce intermediates of no further use to the organism . there are cases , however , in which forward evolution of a pathway seems more likely . for example , many organisms make complex natural products whose roles generally involve killing or manipulating other organisms . the pathways for building these complex structures have probably evolved in a forward direction by addition of enzymes capable of adding to the complexity of a pre - existing molecule and thereby contributing to its biological potency . if the pathway had evolved in a retrograde direction , the horowitz theory would postulate that gshb arose to take advantage of -glu - cys present in the environment . it is unlikely that -glu - cys would have been available because formation of the high - energy amide bond would be unlikely to occur abiotically . however , evolution of the gsh biosynthesis pathway in the forward direction makes considerable sense . -glu - cys can serve some of the functions of gsh , and therefore could be advantageous to an organism even in the absence of gshb . indeed , halobacteria contain millimolar levels of -glu - cys , but do not convert it further to gsh . however , -glu - cys is not an ideal solution , as it is more easily oxidized than gsh . furthermore , the reactivity of a thiol depends upon its pka , as thiolates are orders of magnitude more nucleophilic than thiols . the nucleophilicity of the thiol in -glu - cys should be diminished by the proximity of the negatively charged carboxylate . further reaction of -glu - cys with gly to form gsh would improve its properties with respect to both oxidation and nucleophilicity , thus , providing selective pressure for evolution of a gsh synthetase ( gshb ) . one possible source for an enzyme to catalyze the next step in a pathway evolving in the forward direction is the enzyme that catalyzed the last step , as this enzyme has a binding site that accommodates the product of the last reaction , and that product is the substrate for the next reaction . this type of enzyme recruitment , which takes advantage of already existing substrate - specificity determinants , but requires changes in catalytic groups , appears to occur rather infrequently . for example , among 510 proteins involved in the small - molecule metabolic pathways in e. coli , homology between consecutive enzymes in a pathway occurs only six times . most often , enzymes are recruited to catalyze new reactions by virtue of the catalytic abilities of their active sites , and interactions required for substrate binding are then optimized . the gsh biosynthesis genes , however , appear to be an optimal case for recruitment of one enzyme to catalyze a subsequent reaction . as gsha has a binding site that accommodates -glu - cys , it would appear to be an ideal progenitor of gshb , which uses -glu - cys as a substrate and also catalyzes the atp - dependent formation of an amide bond . there are no experimental structures for gshas , but recent work suggests that gshas are homologs of glutamine synthetases . thus , the data support a scenario in which emergence of gsha was followed , in most organisms , by the recruitment of a different protein to serve as the progenitor of gshb . it is particularly interesting that , in both the bacterial and eukaryotic lineages , the atp - grasp structural fold provided the starting point for the evolution of gshb . our analysis of the sequences of gshas and gshbs suggests that the evolutionary history of these proteins is more complex than expected on the basis of the distribution of gsh in extant organisms . our results , as well as the observation that gsha and gshb genes are generally not found in proximity in microbial genomes , suggest that these genes did not evolve together . although the origin of the gsha gene can not be unequivocally determined , it is most plausible to suppose that it arose in cyanobacteria , which would have been the first cells to require the protection conferred by -glu - cys against reactive oxygen species . if this hypothesis is correct , then subsequent lateral gene transfers must have occurred to spread the gene to the proteobacteria and eukaryotes , as well as to at least one archaeon and possibly to some gram - positive bacteria . because of the high level of sequence divergence , there is no clear indication in the sequence data as to whether eukaryotes acquired a gsha gene from a cyanobacterium or a proteobacterium . after the acquisition of gsha , a further improvement in protection against reactive oxygen species was obtained in most organisms by recruitment of an enzyme to convert -glu - cys to gsh . this recruitment apparently took place independently in the bacterial and eukaryotic lineages , since the sequence of the eukaryotic gshb is remarkably different from that of the bacterial gshbs , despite the structural similarities between these two proteins . at least for gshb , therefore , we can eliminate the possibility of transfer from the mitochondrial progenitor into an early eukaryote . the emerging picture of the evolution of the glutathione biosynthesis pathway is significant because it suggests that the pathway evolved in a forward direction , in contradiction to the horowitz hypothesis . blast and psi - blast searches were carried out at the ncbi website . pairwise sequence identities were determined using the distances algorithm in the gcg package at the pittsburgh supercomputing center . motif analyses were carried out using meme at the san diego supercomputing center and block maker at the fred hutchinson cancer center . we thank norman pace , william friedman and scott kelley for helpful discussions , and patricia babbitt for carrying out the shotgun analysis . financial support was provided by the nasa astrobiology program and a research computing grant from the pittsburgh supercomputing center . distribution of glutathione mapped onto a universal tree of life based on 16s rrna sequences . information was obtained from an extensive search of the literature on the occurrence of glutathione in various organisms and was supplemented by data obtained from the sequence database . green dots indicate that glutathione is present in the indicated organisms , whereas red dots indicate that glutathione is absent . the light green dot indicates that glutathione is found in some strains of some low - gc gram - positive bacteria ( streptococcus , enterococcus , clostridium and listeria ) but not in others ( staphylococcus ) . some strains of gram - positive bacteria ( for example , streptococcus thermophilus , streptococcus agalactiae and enterococcus faecalis ) appear to synthesize gsh , whereas others ( streptococcus mutans ) just import it from the medium . in others ( clostridium and listeria ) , this question has not been resolved . sequences from groups 1 , 2 and 3 are highlighted in red , green and blue , respectively . bgsha.ec , gsha , e. coli ( gi12517129 ) ; bgsha.pa , gsha , pseudomonas aeruginosa ( gi11348607 ) ; bgsha.ps , putative gsha , pseudomonas sp . ( gi6634496 ) ; bgsha.ba , gsha , buchnera aphidicola ( gi11386815 ) ; bgsha.ca , gsha ( putative ) , clostridium acetobutylicum ( gi15024489 ) ; bunk.pm , unknown protein , pasteurella multocida ( gi12721383 ) ; egsha.ca , gsha , candida albicans ( gi12002873 ) ; egsha.hs , gsha , homo sapiens ( gi 4557625 ) ; egsha.pb , gsha , plasmodium berghei ( gi4713921 ) ; egsha.sc , gsha , saccharomyces cerevisiae ( gi6322360 ) ; egsha.sp , gsha , schizosaccharomyces pombe ( gi2130201 ) ; egsha.tc , gsha , trypanosoma cruzi ( gi3747103 ) ; hyp.ce , hypothetical protein , caenorhabditis elegans ( gi7500706 ) ; egsha.at , gsha , arabidopsis thaliana ( gi1742963 ) ; bgsha.cc , gsha , caulobacter crescentus ( gi13425126 ) ; bgsha.xf , gsha , xylella fastidiosa ( gi11282603 ) ; bgsha.at , gsha , agrobacterium tumefaciens ( gi15155610 ) ; hyp.halo , hypothetical protein , halobacterium sp . nrc-1 ( gi10580902 ) ; hyp.mt , hypothetical protein , mycobacterium tuberculosis ( gi6831717 ) ; hyp.stc , hypothetical protein , streptomyces coelicolora3(2 ) ( gi8246826 ) ; hyp.nostoc , hypothetical protein , nostoc punctiforme ( doe 63737 , contig399 revised gene10 protein ) ; hyp.prochl , hypothetical protein , prochlorococcus marinus ( doe 59919 , contig26 gene 578 ) ; hyp.syn , hypothetical protein , synechocystis sp . ( strain pcc6803 ) ( gi7469602 ) ; hyp.synech , hypothetical protein , synechococcus sp . phylogenetic tree constructed from the blocks identified by block maker using the parsimony method in paup 4.0b . sequences from groups 1 , 2 and 3 are colored red , green and blue , respectively . , gi7469602 ; nostoc punctiforme , gnl|doe_63737|contig399 ; prochlorococcus marinus , doe 59919 contig26 gene 578 ; synechococcus sp . however , cyanobacteria are known to contain gsh and the function of gshb in synechococcus sp . question marks indicate genera for which the ability to synthesize glutathione has not been demonstrated . mapping of gsha genes and homologs onto a universal tree of life generated from 16s rrna sequences . group 1 , 2 and 3 sequences are designated by red , green and blue dots , respectively . light blue or light red dots indicate that gsha homologs are found in only some genera in the indicated group . question marks indicate that some of the gram - positive bacteria are not known to synthesize gsh , so the functions of the gsha homologs in these cases are uncertain . ( a ) human ; ( b ) e. coli . reproduced with permission from . sample shotgun output . bacterial , archaeal and eukaryotic sequences are shown in blue , red , and green , respectively . the query set consisted of the following sequences . bgshb_pa , gshb , p. aeruginosa ( gi11348620 ) ; bunk_sc , unknown protein , streptomyces coelicolor ( gi 6752313 ) ; bgshb_ec , gshb , e. coli ( gi121663 ) ; as6mod_af , ribosomal s6 protein modification enzyme , archaeglobus fulgidus ( gi 11499884 ) ; bgshb_ac , gshb , anaplasma centrale ( gi544429 ) ; bgshb_cc , gshb , caulobacter crescentus ( gi13421252 ) ; bunk_bh , unknown protein , bacillus halodurans , ( gi10175219 ) ; bgsh_ss , gshb , synechocystis ( gi8134484 ) ; as6mod_ha , ribosomal s6 protein modification enzyme , halobacterium sp . nrc-1 ( gi10579747 ) ; bs6mod_dr , ribosomal s6 protein modification enzyme , deinococcus radiodurans ( strain r1 ) ( gi7473852 ) ; bgshb_an , gshb , anabaena sp . pcc 7120 ( gi17231351 ) ; aunk_me , unknown protein , methanococcus jannaschii y620 ( gi2496080 ) ; bunk_me , unknown protein , methylobacterium extorquens ( gi11193062 ) ; as6mod_ap , s6 modification enzyme , aeropyrum pernix ( gi14601423 ) ; as6mod_ss , ribosomal protein s6 modification protein , sulfolobus solfataricus ( gi6015830 ) ; bs6mod_mx , ribosomal protein s6 modification protein , myxococcus xanthus ( gi2625142 ) ; bs6mod_st , ribosomal protein s6 modification protein , salmonella typhimurium ( gi16764237 ) ; brimk_pm , rimk protein , pasteurella multocida ( gi12721133 ) ; egshb_lm , gshb , leishmania major ( gi7940268 ) ; egshb_ce , unknown protein , c. elegans , ( gi7506074 ) ; egshb_hs , gshb , homo sapiens ( gi4504169 ) ; egshb_at , gshb , arabidopsis thaliana ( gi5531229 ) ; egshb_sp , gshb , schizosaccharomyces pombe ( gi1708058 ) ; egshb_pc , gshb , pneumocystis carinii ( gi11596248 ) . motifs found by meme 3.0 in a divergent set of eukaryotic gshbs , bacterial gshbs , and members of the atp - grasp superfamily , mapped onto bacterial and eukaryotic gshbs and ribosomal protein s6 modification enzymes . ( the colors of the motifs bear no relationship to the colors used to designate domains in figure 6 . ) three groups of known and putative gshas members of each group have no statistically significant relationship with members of other groups on the basis of pairwise sequence identities . parentheses designate cases for which assignment of function is tentative because the ability of these organisms to synthesize -glu - cys has not been demonstrated . psi - blast outputs for the group 3 gshas include proteins not listed here that may be distant homologs in archaeoglobus fulgidus ( gi11499888 ) , e. coli ( gi15800294 ) , s. typhimurium ( gi16763960 ) , s. enterica ( gi16759543 ) , and p. aeruginosa ( gi15597377 ) . these proteins have only about 15% identity to group 3 gshas over part of their lengths , and their functions are unknown . p - values for blocks found in some known and putative gshas e - values are given for the entire sequence except for cases in which the algorithm found a second occurrence of block 1 with a low and probably insignificant p - value and included that p - value in the calculation of the e - value . pairwise sequence identities between gsha sequences from plants and alpha - proteobacteria 1 - 7 are bacteria and 8 - 13 are plants . motifs found in gshbs and related proteins motifs found in the entire set of proteins are highlighted in bold ( as shown in figure 8) percentage identities between fused gsha - atp - grasp superfamily homologs and gsha , gshb and cyanophycin synthetase | backgroundglutathione is found primarily in eukaryotes and in gram - negative bacteria .
it has been proposed that eukaryotes acquired the genes for glutathione biosynthesis from the alpha - proteobacterial progenitor of mitochondria . to evaluate this
, we have used bioinformatics to analyze sequences of the biosynthetic enzymes -glutamylcysteine ligase and glutathione synthetase.results-glutamylcysteine ligase sequences fall into three groups : sequences primarily from gamma - proteobacteria ; sequences from non - plant eukaryotes ; and sequences primarily from alpha - proteobacteria and plants .
although pairwise sequence identities between groups are insignificant , conserved sequence motifs are found , suggesting that the proteins are distantly related .
the data suggest numerous examples of lateral gene transfer , including a transfer from an alpha - proteobacterium to a plant .
glutathione synthetase sequences fall into two distinct groups : bacterial and eukaryotic .
proteins in both groups have a common structural fold , but the sequences are so divergent that it is uncertain whether these proteins are homologous or arose by convergent evolution.conclusionsthe evolutionary history of the glutathione biosynthesis genes is more complex than anticipated .
our analysis suggests that the two genes in the pathway were acquired independently . the gene for -glutamylcysteine ligase most probably arose in cyanobacteria and
was transferred to other bacteria , eukaryotes and at least one archaeon , although other scenarios can not be ruled out . because of high divergence in the sequences , the data neither support nor refute the hypothesis that the eukaryotic gene comes from a mitochondrial progenitor . after acquiring -glutamylcysteine ligase , eukaryotes and
most bacteria apparently recruited a protein with the atp - grasp superfamily structural fold to catalyze synthesis of glutathione from -glutamylcysteine and glycine .
the eukaryotic glutathione synthetase did not evolve directly from the bacterial glutathione synthetase . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
wound healing is a complex process involving four distinct , but overlapping phases of hemostasis , inflammation , proliferation and remodeling . the unique structure of the periodontium makes periodontal regeneration a more complex process compared to the healing of other soft tissue components . it requires an interaction between the soft and hard tissues , gingival connective tissue , periodontal ligament , cementum and bone . in general , studies on periodontal wound healing indicate that conventional periodontal therapy most commonly results in repair by collagenous fibrous tissue and apical migration of gingival epithelium between the gingival connective tissue and the root surface . this healing process does not fully restore the form and function of the lost structures and hence does not constitute regeneration . wound healing process is stimulated and regulated by biologically active substances known as growth factors , which regulate key cellular processes such as mitogenesis , chemotaxis , cell differentiation and metabolism . in early stages of wound healing , platelets play a pivotal role in release of growth factors . it can have beneficial effects for soft and hard tissue healing by significantly reducing the wound healing time . the philosophy behind its use refers to the increased level of growth factors present in a well - prepared platelet - rich plasma ( prp ) concentrate . beneficial effects of prp on tissue regeneration have been investigated for several clinical applications in oral and maxillofacial surgery , periodontology , plastic surgery , orthopedics and treatment of chronic cutaneous ulcers . although the majority of these studies have shown excellent outcomes , many had no control groups and many were only small case studies . additionally , some studies were unable to yield any additional benefit of prp in tissue regeneration . in 1999 the term prgf identifies exclusively 100% autologous and biocompatible formulations elaborated by a one - step centrifugation process using sodium citrate and calcium chloride as anticoagulant and activator , respectively . plasma rich in growth factors has a moderated platelet concentration and does not contain leukocytes , with the aim of avoiding the proinflammatory effects of proteases and acid hydrolases in white blood cells . platelet - rich fibrin described by choukroun et al , is a second - generation platelet concentrate produced without any anticoagulants . compared with other autologous platelet concentrates , there are few references in the literature about the biological properties of prf . since basic studies are insufficient to support the efficacy of prf and prgf and because of many controversies on the effects of prp on bone and soft tissue regeneration , more in vitro studies are still needed . the aim of the present in vitro study was to compare the effect of prgf and prf on proliferation of hgfs . blood samples were obtained from a healthy 28 year - old , nonsmoker iranian woman , after obtaining her written informed consent . this study was approved by the ethics committee of shahid beheshti university of medical sciences . twenty - seven milliliters of venous blood was collected in three dry glass tubes ( 9ml in each ) ( blood collecting tubes , process , nice , france ) without any anticoagulant . according to the standard choukroun s protocol , tubes were immediately centrifuged at 2,700 rpm ( approximately 400 g ) for 12 minutes . a fibrin dense clot was then obtained in the middle of the tube , between the red cells at the bottom and the liquid serum called platelet poor plasma at the top . the prf box ( process , nice , france ) was used to prepare standardized prf membranes in a sterile environment ( class ii biological hood ) . fifteen milliliters of venous blood was drawn and transferred to three vacutainer tubes ( blood collecting tubes , bti biotechnology institute , araba , spain ) containing 3.8% sodium citrate as anticoagulant ( 5ml in each ) . the tubes were centrifuged at 460 g for eight minutes ( prgf system iii , bti biotechnology institute , araba , spain ) to separate the different phases of the blood . the 0.5 ml fractions located immediately above the buffy coat were collected from each tube and transferred to a sterile petri dish . in order to initiate clotting and activation of platelets to release growth factors , prgf activator ( 10% calcium chloride ) the dishes were incubated at 37c for 30 minutes until a consistent easily - handled gelatinous layer was formed . a hgf cell line ( hgf.1-pi , ncbi : c-165 ) was obtained from the national cell bank of iran ( ncbi , pasteur institute of iran , tehran ) . the cells after passage four were seeded into 12 culture dishes ( 60 mm diameter ; nunc international , ny , usa ) at density of 50,000 cells per dish in complete medium consisting of dulbecco s modified eagle s medium ( dmem ) + 10% fetal bovine serum ( fbs ) . after 24 hours , complete medium was exchanged with low - serum medium ( dmem+ 1% fbs ) in order to stop proliferation ( cell synchronization ) . twelve groups were set and incubated as follows : three cultures were supplemented with 1% fbs ( negative control group ) , three cultures received 10% fbs ( positive control group ) , three received prf membrane ( test group 1 ) and three received prgf gel ( test group 2 ) . after a culture period of 24 , 48 , and 72 hours , a culture dish of each group was removed and washed twice with sterile phosphate buffered saline ( pbs ) solution and hgf proliferation and viability were evaluated using the methyl thiazol tetrazolium ( mtt ) assay . the mtt colorimetric assay was used to monitor cell proliferation and viability . in this method , the mtt solution ( mtt , sigma chemical co. , baltimore , md , usa ) with the final concentration of 0.5mg / ml was added to each culture dish at each experimental time . the dishes were placed in an incubator at 37c . after four hours of incubation , the produced insoluble formazan , dissolved with dimethyl sulfoxide ( dmso ) , was added to each dish . the culture dishes were agitated on a shaker for 10 minutes at room temperature to ensure the dissolution of formazan crystals . then , 100 l of the purple solution was transferred into a well of a 96-well elisa reader plate ( nunc international , ny , usa ) ( eight replicates for each treatment ) . the spectrophotometric absorbance ( optical density ) was read at 570 nm with 620 nm as a reference using an elisa reader ( bio - tek instruments inc . , statistical analysis was performed using one - way anova followed by tukey - kramer s multiple comparisons and p values less than 0.05 were considered significant . blood samples were obtained from a healthy 28 year - old , nonsmoker iranian woman , after obtaining her written informed consent . this study was approved by the ethics committee of shahid beheshti university of medical sciences . twenty - seven milliliters of venous blood was collected in three dry glass tubes ( 9ml in each ) ( blood collecting tubes , process , nice , france ) without any anticoagulant . according to the standard choukroun s protocol , tubes were immediately centrifuged at 2,700 rpm ( approximately 400 g ) for 12 minutes . a fibrin dense clot was then obtained in the middle of the tube , between the red cells at the bottom and the liquid serum called platelet poor plasma at the top . the prf box ( process , nice , france ) was used to prepare standardized prf membranes in a sterile environment ( class ii biological hood ) . fifteen milliliters of venous blood was drawn and transferred to three vacutainer tubes ( blood collecting tubes , bti biotechnology institute , araba , spain ) containing 3.8% sodium citrate as anticoagulant ( 5ml in each ) . the tubes were centrifuged at 460 g for eight minutes ( prgf system iii , bti biotechnology institute , araba , spain ) to separate the different phases of the blood . the 0.5 ml fractions located immediately above the buffy coat were collected from each tube and transferred to a sterile petri dish . in order to initiate clotting and activation of platelets to release growth factors , prgf activator ( 10% calcium chloride ) the dishes were incubated at 37c for 30 minutes until a consistent easily - handled gelatinous layer was formed . a hgf cell line ( hgf.1-pi , ncbi : c-165 ) was obtained from the national cell bank of iran ( ncbi , pasteur institute of iran , tehran ) . the cells after passage four were seeded into 12 culture dishes ( 60 mm diameter ; nunc international , ny , usa ) at density of 50,000 cells per dish in complete medium consisting of dulbecco s modified eagle s medium ( dmem ) + 10% fetal bovine serum ( fbs ) . after 24 hours , complete medium was exchanged with low - serum medium ( dmem+ 1% fbs ) in order to stop proliferation ( cell synchronization ) . twelve groups were set and incubated as follows : three cultures were supplemented with 1% fbs ( negative control group ) , three cultures received 10% fbs ( positive control group ) , three received prf membrane ( test group 1 ) and three received prgf gel ( test group 2 ) . after a culture period of 24 , 48 , and 72 hours , a culture dish of each group was removed and washed twice with sterile phosphate buffered saline ( pbs ) solution and hgf proliferation and viability were evaluated using the methyl thiazol tetrazolium ( mtt ) assay . the mtt colorimetric assay was used to monitor cell proliferation and viability . in this method , only the mitochondria of viable cells can reduce mtt to formazan . briefly , the mtt solution ( mtt , sigma chemical co. , baltimore , md , usa ) with the final concentration of 0.5mg / ml was added to each culture dish at each experimental time . the dishes were placed in an incubator at 37c . after four hours of incubation , the medium containing mtt was removed carefully . the produced insoluble formazan , dissolved with dimethyl sulfoxide ( dmso ) , was added to each dish . the culture dishes were agitated on a shaker for 10 minutes at room temperature to ensure the dissolution of formazan crystals . then , 100 l of the purple solution was transferred into a well of a 96-well elisa reader plate ( nunc international , ny , usa ) ( eight replicates for each treatment ) . the spectrophotometric absorbance ( optical density ) was read at 570 nm with 620 nm as a reference using an elisa reader ( bio - tek instruments inc . , statistical analysis was performed using one - way anova followed by tukey - kramer s multiple comparisons and p values less than 0.05 were considered significant . for the mtt assay , the viability of the negative control cultures ( 1% fbs ) was set at 100% . the mean optical density of the test groups was divided by that of the control group and expressed as percentage of the control value . the microscopic effects of prgf and prf on proliferation and viability of hgf cells at 24 , 48 , and 72 hours after treatment are shown in fig . microscopic analysis of hgf cells in four different conditions : hgf+ medium + 1% fbs ( negative control group ) , hgf+ medium + 10% fbs ( positive control group ) , hgf + medium + 1% fbs + prf - membrane ( test group 1 ) , and hgf + medium + 1% fbs + prgf ( test group 2 ) . the effects of prf and prgf on proliferation and viability of hgf cells compared to controls at 24 , 48 and 72 hours after treatment . negative control contained culture medium supplemented with 1% fbs and positive control contained culture medium supplemented with 10% fbs . the results were calculated as the viability ( percent control ) compared to the negative control ( 100% viability ) and presented as mean sd . p < 0.001 according to our results , prgf treatment induced statistically significant ( p < 0.001 ) proliferation of hgf cells as compared with the negative control ( 100% viability ) at all three time points ; the increase in proliferation was 123% 2.25 at 24 hours , 102% 2.8 at 48 hours and 101% 3.92 at 72 hours . data showed that the viability of cells treated with prgf significantly increased as compared to the positive control ( 100% viability ) at 24 , 48 and 72 hours in values of 104 , 126 and 116% , respectively . the prf membrane treatment of hgf cells had a statically significant effect on cell proliferation ( 21% 1.73 , p < 0.001 ) at 24 hours compared to the negative control group . however , at 48 and 72 hours after treatment , prf had a negative effect on hgf cell proliferation and caused 38% and 60% decrease in viability and proliferation compared to the negative control and 61% and 78% decrease compared to the positive control , respectively . according to this study , the highest hgf cell proliferation and viability was obtained with prgf and the difference between the effect of prgf and prf on cells was statistically significant ( p < 0.001 ) . our results showed that both prf and prgf at 24 hours , and prgf at 48 and 72 hours significantly increased hgf proliferation and viability . furthermore , prgf had a significantly greater proliferative effect than prf at 48 and 72 hours after treatment . these observations are likely to be of great interest and are truly complex to interpret . our findings were different from those of dohan ehrenfest et al , who showed that prf significantly induced the proliferation of gingival fibroblasts at three , seven , 14 and 21 days as compared with the control groups . different results may be due to individual variations in terms of platelet count and the time intervals between blood sample centrifugation , obtaining fibrin membranes and treating the cell culture . it has been shown that the effect of prp on cell proliferation does not necessarily improve with increasing concentration of platelets , but there is a range of optimal concentration of platelets . as shown in previous studies , platelet concentration equivalent to 2.5 times the final platelet concentration of prgf ( two to three times the normal level ) is the optimal concentration range of platelets . since platelets are trapped within the dense fibrin network of prf , it is not possible to count the number of platelets in prf . liu et al . proposed that the lower proliferation was ph dependent , and that high platelet concentration resulted in ph changes that negatively affected fibroblast proliferation . furthermore , all other studies recruited more than one volunteer to prepare prp or prf . as previously reported for the transforming growth factor beta ( tgf- ) , platelet - derived growth factor ( pdgf ) , vascular endothelial growth factor ( vegf ) and basic fibroblast growth factor ( bfgf ) , important variations in growth factor concentrations were detected among individuals having very similar platelet counts and this may affect the results . in our study , prf and prgf were obtained from the same donor to eliminate any possible confounding effect . the inter - individual variations may explain , in part , some of the controversial results . for example , platelet granules include angiogenesis stimulators including bfgf and vegf and angiostatic factors such as endostatin and thrombospondin-1 ; each having confounding effects . others have shown that the mitogenic activity of platelet supernatant is not confined to its growth factors , and platelet particles and membrane fragments also play an important role in this regard . this is a major limitation of these studies , since only growth factors and proteins found in the exudate of these products were tested and the actual effects of the product as a whole were overlooked . platelet rich fibrin is a dense fibrin matrix with specific structure and cell content and its exudate is not the only component of this product . similarly , although prp is a homogenous liquid product , its exudate is not its only active component . since platelets aggregate to create a fibrin gel , which also stimulates many biological mechanisms , examining prf and prgf as a whole rather than their components separately is of great importance . to study the platelet product as a whole , use of large enough culture plates is essential to receive a complete piece of platelet clot or membranes , without compressing the cultivated cells . a minimum diameter of 60 mm has been suggested in previous studies to allow the interaction of cells and platelet cytokines . in a normal healing process , there is a fibrin matrix in prf , in which the platelets and probably the released cytokines are trapped after a certain period of time . indicated the role of fibrin in tissue repair and demonstrated the ability of fibroblasts to reconstruct a fibrin matrix and to produce collagen . on this basis , dense prf matrix may be effective in stimulating the wound healing process . in the study by dohan ehrenfest et al , primary cell cultures were used to eliminate the potential effects of leukocytes involved in the immune response on the cultured cells . however , considering the similar results of our pilot study on prgf and prf supernatant ( data not shown ) , a definite conclusion on this topic can not be drawn , since all factors and cells except for growth factors are eliminated in the supernatant . no consensus has been reached on the inclusion of leukocytes in platelet products either . despite emphasizing on the potential ability of leukocytes in proliferation , differentiation and immunity in some studies , the deleterious biological effects of matrix metalloproteinases 8 and 9 produced by neutrophils have been well described . in addition , neutrophils may induce tissue damage by releasing reactive oxygen species in the inflammatory phase of tissue injury . according to a recent study , synthesis of thrombin - induced interleukin ( il)-1 could be observed in platelet suspension containing at least one leukocyte per 10 platelets . on the other hand , nevertheless , the effects of leukocytes existing in platelet concentrates have not yet been assessed and their overall effects remain unclear . further studies focusing on the function of these cells are required to fully determine the relationship between these components and to help develop products with specifically required components . consequently , until confirmation of the effects of leukocytes in future studies , use of platelet products lacking leukocytes is more prudent . in vitro experiments are helpful for assessing the biological efficacy of blood products ; but these studies have limitations in mimicking the clinical conditions the majority of studies on both anitua s prgf and choukroun s prf were conducted by companies that developed these products . it seems that more extensive , independent studies are required to obtain more valuable results . we studied the effects of prf and prgf supernatant and membrane on hgf cell line using the mtt proliferation and viability assay . it is highly recommended to design further studies on the effects of prf and prgf on more cell lines and primary cells with different in vitro proliferation assays and in vivo trials . this study demonstrated that prgf had a strong stimulatory effect on hgf cell viability and proliferation as compared with prf . | objectives : platelet preparations are commonly used to enhance bone and soft tissue regeneration . considering the existing controversies on the efficacy of platelet products for tissue regeneration , more in vitro studies are required .
the aim of the present study was to compare the in vitro effects of plasma rich in growth factors ( prgf ) and platelet - rich fibrin ( prf ) on proliferation and viability of human gingival fibroblasts ( hgfs).materials and methods : anitua s prgf and choukran s prf were prepared according to the standard protocols . after culture periods of 24 , 48 and 72 hours , proliferation of hgfs was evaluated by the methyl thiazol tetrazolium assay .
statistical analysis was performed using one - way anova followed by tukey - kramer s multiple comparisons and p - values<0.05 were considered statistically significant.results:prgf treatment induced statistically significant ( p<0.001 ) proliferation of hgf cells compared to the negative control ( 100% viability ) at 24 , 48 and 72 hours in values of 123%2.25% , 102%2.8% and 101%3.92% , respectively . the prf membrane treatment of hgf cells had a statistically significant effect on cell proliferation ( 21%1.73% , p<0.001 ) at 24 hours compared to the negative control . however , at 48 and 72 hours after treatment , prf had a negative effect on hgf cell proliferation and caused 38% and 60% decrease in viability and proliferation compared to the negative control , respectively .
the hgf cell proliferation was significantly higher in prgf than in prf group ( p < 0.001).conclusion : this study demonstrated that prgf had a strong stimulatory effect on hgf cell viability and proliferation compared to prf . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lifestyle.2 according to the world health organization ranking , saudi arabia stands second in the middle east region and seventh globally for the incidence of diabetes.3 there is sufficient evidence to show that patients with type 2 diabetes ( t2d ) have a greater tendency to acquire several complications , including hypogonadism.4,5 male hypogonadism is defined as a clinical condition in which the men exhibit the symptoms / signs and biochemical evidence of testosterone deficiency . the fact that t2d is linked to hypogonadism was first recognized about 20 years ago when a high frequency of men with t2d revealed low testosterone levels . the low testosterone levels have also been identified as reliable predictors of insulin resistance and the likelihood of developing t2d in the future.6 furthermore , many studies have shown that the testosterone levels reported in men with diabetes was much lower than those of the nondiabetic ones.7,8 from the cross - sectional studies done , it is clear that between 20% and 64% of men with diabetes have hypogonadism ; generally , there is a slow and continuous decrease in testosterone production among older population.9 furthermore , the prevalence of hypogonadism varies between racial , ethnic groups.10 hypogonadism can pose high risk for the development of diabetes and metabolic syndrome via several mechanisms including alterations in body composition , polymorphism in the androgen receptors , glucose transport , and decreased antioxidant effect.911 however , diabetes and the metabolic syndrome can be risk factors for hypogonadism via certain similar , but most often , well - defined mechanisms , such as body weight increase , drop in the levels of the sex hormone binding globulin ( shbg ) , suppression of gonadotropin release or leydig cell testosterone secretion , cytokine - mediated inhibition of the release of the testicular steroid , and a rise in the aromatase activity leading to a relative estrogen surplus.911 type 2 diabetes associated hypogonadism might exacerbate sexual dysfunction by reducing libido and mood and further compromising penile vascular reactivity and lipid metabolism . hence , testing the circulating testosterone is strongly recommended in patients with type 2 dm with erectile dysfunction.12,13 observational studies consistently show that men with diabetes have lower total testosterone ( tt ) levels compared with the nondiabetic controls.14 at least 25% of men with type 2 dm show evidence of secondary hypogonadism , and an additional 4% have primary hypogonadism . given the strong correlation between diabetes and testosterone deficiency , the endocrine society recommends the routine measurement of testosterone levels in patients with type 2 dm . the relationship between testosterone and type 2 dm is complex and likely mediated by obesity.15 as the incidence of diabetes is steadily rising in all the age groups and a notable number will most probably be in their prime reproductive years , in fact that one - third of the men with t2d possess low testosterone causes a considerable public health burden with respect to deficient sexual function and potential infertility.16 in comparison with the developed countries , there is a paucity of research on hypogonadism in saudi arabia . therefore , the aim of this study was to determine the occurrence of hypogonadism and its related risk factors present in the men with t2d in saudi arabia . this cross - sectional study involved 157 men with type 2 diabetes , between 30 and 70 years , registered with the diabetes treatment center , prince sultan military medical city ( psmmc ) , riyadh , saudi arabia . patients with a history of hypopituitarism and chronic debilitating diseases such as renal failure , liver cirrhosis , malignancy , autonomic neuropathy , and those on testosterone replacement therapy were excluded from this study . written consent to participate in the study was collected from each patient . this study was conducted based on the helsinki declaration of 1975 ( revised in 2000 ) , and the study protocol received approval from the research ethics committee of psmmc , riyadh , saudi arabia . their demographic features were gathered during the patients routine visits to the center using a prestructured questionnaire . the duration of diabetes , smoking habits , presence of retinopathy , neuropathy , and nephropathy were noted from the medical records . calculation of the body mass index ( bmi ) was done by dividing the weight in kilograms by the square of the height in meters . blood pressure was taken by a trained nurse , using a standardized sphygmomanometer with the patient in the sitting posture , keeping the arm at heart level , and repeated after 5 minutes of rest . hypertension is defined as elevated systolic ( 140 mm hg ) or diastolic ( 90 mm hg ) blood pressure.5 after an overnight fast , a venous blood sample ( 20 ml ) was drawn using a disposable syringe from the cubital fossa and/or dorsum of the hand veins from each patient , between 8:00 and 10:00 am . the blood sample was transferred into a plain complete blood count tube ; once centrifugation was done , the serum was aliquoted and stored at 20c to determine tt , free testosterone ( ft ) , shbg , follicle - stimulating hormone ( fsh ) , luteinizing hormone ( lh ) , prolactin ( prl ) , glycosylated hemoglobin a1c ( hba1c ) , total cholesterol , high - density lipoprotein ( hdl ) cholesterol , low - density lipoprotein ( ldl ) cholesterol , and triglyceride . axsym ( abbott laboratories , usa ) was employed to assess ft based on a microparticle enzyme immunoassay.8 immunochemiluminometric assay was used to test shbg . chemiluminescent immunometric assays were used to determine lh , fsh , and prl . high - performance liquid chromatography method ( bio - rad total cholesterol , triglyceride , hdl , and ldl were checked using an automated spectrophotometer , enzymatic colorimetric method , and cobas integra with the commercial kits from roche diagnostics ( roche diagnostics limited , switzerland ) . bioavailable and ft levels were recorded using the tt and shbg applying the vermeulen equation.17 diabetes mellitus was diagnosed based on the criteria of the american diabetes association.18 nephropathy , according to the nephrologists ( in view of the microalbuminuria present is defined as the concentration of microalbuminuria 30 - 299 mg/24-hour urine collection sample or the presence of macroalbuminuria 300 mg/24-hour urine collection sample)19 was taken from the patients records . diabetic neuropathies are heterogeneous , either focal or diffuse , and affect various portions of the nervous system , producing various clinical manifestations.20 retinopathy is one such example , defined according to the american academy of ophthalmology.21 all the patients were required to complete an arabic version of the androgen deficiency in aging male ( adam ) questionnaire.22 this 10-item screening questionnaire was employed to assess the androgen insufficiency in aging men . a positive response is based on lowered libido or erectile dysfunction or any 3 nonspecific queries that include fatigability , reduced muscle strength , mood alterations and height loss . as this questionnaire has 88% sensitivity and 60% specificity , it must be employed only when the testosterone level is low.23 hypogonadism was defined as the combination of symptoms ( positive adam score ) along with tt level 8 nmol / l . primary hypogonadism implies fsh or lh 10 iu / l , whereas secondary hypogonadism means fsh or lh < 10 iu / l . data analysis was performed employing microsoft excel 2010 ( microsoft corporation , seattle , wa , usa ) and the spss version 22 ( spss inc . , chicago , il , usa ) . besides the descriptive analysis , the test and independent t test were also done to identify the differences among the group . the description of the adam and tt level of the population is shown in figure 1 . the total frequency of hypogonadism was 22.9% ( 36/157 ) . of the total number of 157 patients ( from 30 to 70 years ) , 123 ( 78.3% ) revealed adam positive , whereas 34 ( 27.7% ) showed adam negative . among the adam positive , 90 ( 73.2% ) showed a reduction in libido , 116 ( 94.3% ) had weaker erections , and 99 ( 80.5% ) showed more than 3 positive answers in adam . of these hypogonadic patients , 22.2% ( n = 8) revealed primary hypogonadism , whereas 77.8% ( n = 28 ) showed secondary hypogonadism . the study cohort had a mean age of 52.6 10.8 ( mean sd ) years . the duration of diagnosis of dm showed a mean of 8.9 7.4 ( mean sd ) . the mean values of the gonadal hormone levels were as follows : lh : 7.1 , fsh : 8.4 , shbg : 50 , prl : 208.4 , and tt : 14.7 , with the bioavailable testosterone being 15.2 and calculated ft being 0.95 . a major part of the study population , 67 patients ( 42.7% ) , belonged to the 51 to 60 years age category . no significant differences were identified in the age , duration of diabetes , hba1c , hypertension , smoking , waist measurement , and diabetes - related impairments of retinopathy , nephropathy , and neuropathy . the mean age of patients those with hypogonadism was 54.3 10 years and those patients without hypogonadism was 47.2 11 years . similarly , the mean bmi of those patients with hypogonadism was 30.4 5.19 and those patients without hypogonadism was 28.7 4.16 ( p < .042 ) . among patients with hypogonadism , the mean total cholesterol , triglycerides , ldl , and hdl were observed as 4.57 1.2 , 1.98 1.37 , 2.7 0.95 , and 1.09 0.28 , respectively . among patients without hypogonadism , the mean total cholesterol , triglycerides , ldl , and hdl were observed as 4.14 1.8 , 2.44 1.76 , 2.3 0.96 , and 1.27 1.8 , respectively . no statistically significant differences were observed on lipid profile among the patients with and without hypogonadism ( p > .05 ) . the gonadal hormone levels among the study population are shown in table 3 . in comparison with the normal patients , those with hypogonadism revealed significantly reduced differences in the calculated bioavailable testosterone , as well as the ft , lh , and shbg . compared with the normal patients , those with hypogonadism revealed significantly higher differences in the fsh and prl levels . all the variables showing statistical significance in the test were submitted to regression analysis , which demonstrated that bmi was the independent risk factor for hypogonadism ( table 4 ) . it must be noted that the male patients with t2d have reduced serum testosterone and a greater tendency to develop hypogonadism than the nondiabetic ones , regardless of the metabolic disease control.24 the underlying mechanisms controlling the lowered testosterone could possibly be connected with age , obesity , and insulin resistance , commonly evident in the patients with t2d.24 the objective of this work attempted to determine hypogonadism in the men with t2d in the adult saudi population . from this study , recent works have established beyond doubt that a minimum of 25% of the men with t2d have subnormal ft levels linked with inappropriately low lh and fsh levels.7,15 in light of this fact , the endocrine society has now recommended the routine verification of the testosterone concentrations in patients with t2d.15 these confirmatory tests have been recently done to include even the younger patients with t2d in the 18 to 35 years age category , who revealed hypogonadotropic hypogonadism at a rate of 33% as against the normal range for the middle - aged ; also , 58% was the rate considered when the age - specific normal range for ft for the young was used.25 further studies reported that generally there is a slow and continuous decrease in testosterone production among older population , and the prevalence of hypogonadism varies between racial , ethnic groups.9,10 decreasing testosterone levels are often linked with aging even in healthy men.12,26,27 findings from a longitudinal study on aging,8,12,19 and 28% of men aged > 40 , 50 , 60 , and 70 years , respectively , revealed serum tt levels under the normal range.28 however , in another study , the differences in the testosterone levels between the diabetic and nondiabetic patients were found to be remarkable in the sixth decade , although it disappeared later . in fact , in diabetic patients above 60 years , hypogonadism does not occur more frequently than in their counterparts.28 in this study , a higher occurrence of hypogonadism was observed in all the age groups barring those in the 60 years and above age group ( 12.9% , 23.7% , 29.8% , and 19.4% in the age groups of 30 - 40 , 41 - 50 , 51 - 60 , and 61 - 70 years , respectively ) . the mean total and bioavailable testosterone levels reported for the men with diabetes in this study were also lower , concurring with the findings of the earlier studies.28 furthermore , this study discovered that men with low testosterone levels also appear to have a high tendency to express symptoms indicating hypogonadism such as libido ( 73.2% ) and erectile dysfunction ( 94.3% ) once again concurring with earlier findings.8,29 in a cross - sectional study , there was evidence to show a high incidence of low libido ( 64% ) , erectile dysfunction ( 74% ) , and fatigue ( 63% ) in hypogonadal men with t2d.28 however , these symptoms were present in similarly high levels even in eugonadal men with t2d ( 48% , 65% , and 57% , respectively).8,15 it is noteworthy that no correlation was found between age , duration of diabetes , hba1c , smoking status hypertension , waist circumference , retinopathy , nephropathy , and neuropathy in patients with hypogonadism and those without the disease . other works have reported , similar to the findings in this work , that low testosterone levels have no bearing on glycosylated hemoglobin or duration of diabetes , although there was an association with obesity.15 in a study exploring the occurrence of low testosterone levels in a large number of obese men and men with diabetes , 44% of the men with diabetes and 33% of the age - matched nondiabetic ones revealed subnormal ft concentrations , respectively.30 furthermore , 40% of the obese men and 50% of the obese diabetic ones revealed subnormal ft levels.30 this study also showed that patients with a higher bmi value had a significant link with hypogonadism . from the regression analysis done in this study , it is therefore evident that bmi is connected with a high incidence of hypogonadism and having diabetes augments that risk . similar to bmi , significant difference was noted among diabetes treatment groups of the study population by univariate analysis . however , regression analysis done in this study showed that type of diabetes treatment was not an independent risk factor for hypogonadism . testosterone occurs in the circulation in 3 major fractions : free ( 2%-3% ) , albumin - bound ( 20%-40% ) , and shbg ( 60%-80% ) . both the free and albumin - bound fractions include the bioavailable testosterone as they constitute the biologically active component , readily available to the tissues ; the shbg - bound testosterone , however , is strongly bound and inactive . sex hormone binding globulin regulates the bound serum testosterone . therefore , it becomes essential to determine the bioavailable testosterone or ft in men with diabetes.31 in this study , patients with hypogonadism , when compared with the normal patients , revealed significantly lower differences in the calculated bioavailable testosterone , calculated ft , lh , and shbg . on the contrary , when compared with the normal patients , the hypogonadic men exhibited significantly greater differences in the fsh and prl ; these findings concur with findings from earlier researches.31,32 there are a few limitations in this study including its cross - sectional nature and its performance in a single center . furthermore , the lack of a control group against which to compare the study group restricts the results from being generalizable and applicable to real - life situations . more studies conducted on a larger scale / multicenter are required to overcome these limitations . in the face of these limitations , this study gives significant data for the occurrence of hypogonadism among saudi men with t2d . this study identified the fact that the testosterone levels are often low in men with t2d , and that most of these patients exhibit symptoms of hypogonadism . body mass index was identified as the independent risk factor of hypogonadism in the t2d men . therefore , more effective strategies in patient education and communication must be implemented to ensure sufficient attention being paid to sexual health issues in men with diabetes ; besides , a multidisciplinary team of professionals is mandatory to render optimal comprehensive care . the endocrinologist has a vital part in screening patients for low testosterone , offering patient education , and raising the awareness of hypogonadism among those providing health care . | background / objectivesa high incidence of hypogonadism in men with type 2 diabetes ( t2d ) has been globally reported .
this study aimed to determining the frequency of hypogonadism and related risk factors among men with t2d in a single - site hospital in saudi arabia.design and methodsa cross - sectional study was performed on 157 men with t2d ( between 30 and 70 years of age ) . using a prestructured questionnaire , the demographic features of these patients
were gathered and their medical records were referred to gather information regarding the duration of the diabetes , smoking habits , and the presence of retinopathy , neuropathy , and nephropathy . besides these , the biochemical parameters , total testosterone ( tt ) , free testosterone , sex hormone binding globulin , follicle - stimulating hormone , luteinizing hormone , prolactin , serum lipids , and glycosylated hemoglobin were also recorded .
all the patients submitted the fully completed androgen deficiency in aging male ( adam ) questionnaire .
the combination of symptoms ( positive adam score ) plus a tt level 8 nmol / l constituted the condition of hypogonadism.resultsthe total frequency of hypogonadism was 22.9% ( 36/157 ) .
of the 157 total patients , 123 ( 78.3% ) were shown to be adam positive , and of these , 90 ( 73.2% ) exhibited decreased libido , 116 ( 94.3% ) had weak erections , and 99 ( 80.5% ) reported more than 3 symptoms of adam .
of these hypogonadic patients , 22.2% ( n = 8) revealed primary hypogonadism , whereas 77.8% ( n = 28 ) showed secondary hypogonadism .
from the univariate analysis conducted , significant relationship was observed between treatment type , body mass index ( bmi ) , and hypogonadism .
the regression analysis showed bmi acting an independent risk factor of hypogonadism.conclusionssaudi men with t2d revealed a high incidence of hypogonadism .
body mass index was identified as an independent risk factor for hypogonadism . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
when they occur , the ovaries are most often affected , and the uterus , especially the uterine cervix , is rarely involved by metastatic tumors . in cases of metastatic involvement of the cervix , most present with abnormal vaginal bleeding or abnormal cervical cytology in the follow - up of known primary cancers . here we report a case of metastasis of breast cancer to the cervix appearing as a large cervical leiomyoma which was diagnosed before the discovery of the primary tumor . a 52-year - old woman , gravida 1 , para 1 , without significant past medical or family history , presented with a 2-week history of lower abdominal discomfort and pollakisuria . vaginal inspection revealed a fibroid - like lesion protruding into the vaginal cavity without abnormal bleeding . an ultrasound scan showed a solid large mass in the cervix measuring over 10 cm in diameter appearing as a leiomyoma . magnetic resonance imaging revealed several tumors in the uterine corpus and cervix , suggestive of multiple leiomyomas ( fig . serum levels of ca125 , ca19 - 9 , ldh and estradiol were 30.1 u / ml , 5.5 u / ml , 182 iu / l , and 131 pg / ml , respectively . ( a ) t2-weighted mri shows a large mass with heterogeneous signal intensity in the cervix ( arrows ) . ( b ) gross appearance of the resected uterus . a total abdominal hysterectomy with bilateral salpingo - oophorectomy was performed . a bulging 11-cm mass in the cervix had a whitish appearance on cut section and seemed to be a leiomyoma which was not unusual grossly ( fig . unexpectedly , however , microscopic examination of the cervical tumor showed carcinoma cells displaying the linear , indian - file arrangement characteristic of invasive lobular carcinoma ( ilc ) of the breast ( fig . immunohistochemical staining of the tumor was positive for estrogen receptor and cytokeratin 903 ( 34 e12 ) , also suggestive of breast origin . several microscopic foci of carcinoma cells were also observed in the stroma of the endometrium . after the diagnosis of cervical metastasis of probable breast origin , mammography and ultrasound detected a 5-cm lesion in the left breast . a left modified radical mastectomy with axillary lymph node dissection was performed ( the histologic appearance of the tumor is shown in fig . estrogen and progesterone receptors were positive while epidermal growth factor receptor 2 ( her2/neu ) was negative . postoperative adjuvant therapy was anastrozole for 3.5 years , which was changed to s-1 ( an oral fluoropyrimidine derivative composed of tegafur , 5-chloro-2,4-dihydroxypyridine and oteracil potassium ) due to the rise in serum ca15 - 3 levels . seven years after laparotomy , the patient remains alive and well with elevated ca15 - 3 levels . ( a ) histologic aspect of the cervical tumor showing indian - file pattern of tumor cell infiltration ( he 400 ) . ( b ) histology of the primary breast tumor with pleomorphic variant pattern of invasive lobular carcinoma ( he x400 ) . although adenocarcinoma of the cervix as direct spread of an adenocarcinoma of the endometrium is not unusual , metastasis to the cervix from extragenital sites is a rare occurrence . mazur et al . reported that , among 149 metastatic tumors to the female genital tract from extragenital primaries , the ovary and vagina were the most frequent locations of metastases ( 75.8% and 13.4% , respectively ) , and only 8.1% were to the uterus ( 4.7% to the endometrium , 3.4% to the cervix ) . breast was the second most common primary site next to gastrointestinal tumors ; of 52 breast cancer cases metastatic to the gynecologic organs , ovaries were affected in 88.5% cases , vagina in 5.8% , endometrium in 3.8% , vulva in 1.9% and no case to the cervix . limoine and hall found 33 cases of distant metastasis to the cervix , four of which ( 12.1% ) were from a breast primary . breast cancer includes a number of histological subtypes of which the two most common are invasive ductal carcinoma ( idc ) and ilc . more than seventy percent of all breast cancers are idcs while ilc represents 515% . with respect to metastasis , ilc spreads more frequently to gynecologic organs than idc . ilc is often a poorly circumscribed tumor , which can be difficult to detect by palpation or by mammography . this feature may lead to a delay in diagnosis , as is the case in the present patient . in fact , she had taken a mammography showing no abnormality three years previously , and she was unaware of any breast masses at the time of presentation . to date , approximately 35 cases of breast cancer metastases to the cervix have been reported and , in the majority of the cases , the primary tumor was diagnosed before the discovery of the metastasis . a review of the english literature disclosed only seven cases in which the presenting symptoms due to metastatic cervical tumor precede diagnosis of the primary tumor in the breast ( summarized in table 1 ) . at presentation , the previously reported cases seemed to be advanced primary cervical cancer , which contrasts with the present case in that the initial diagnosis was a cervical leiomyoma . presence of multiple fibroids in the corpus , serum ca125 and ldh levels within normal limits , and serum estradiol level in premenopausal state favored that diagnosis rather than a malignant tumor . this case highlights the difficulty and the importance to consider a metastatic tumor in the differential diagnosis of a cervical mass without abnormal vaginal bleeding or abnormal cervical cytology in women of perimenopausal ages . reported cases of breast cancer with synchronous metastasis to the uterine cervix avb : abnormal vaginal bleeding ; pap : pap smear ; np : not performed ; nm : not mentioned ; aar : alive at time of report | abstractmetastasis to the uterine cervix is a complication of breast cancer that is not commonly known .
detection of cervical metastasis before the diagnosis of the primary tumor is even rarer .
the present report describes a case of a 52-year - old woman who had a large cervical tumor appearing as a leiomyoma .
she underwent a total abdominal hysterectomy with bilateral salpingo - oophorectomy .
histopathological examination of the cervical tumor showed patterns characteristic of invasive lobular carcinoma of the breast , leading to the discovery of the primary in the left breast .
she subsequently underwent mastectomy , hormone therapy and chemotherapy , and is alive at 7-year follow - up . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it has been found out that 0.2% to 1% of all primary intracranial tumors are epidermoid tumor . intracranial epidermoid tumors are histologically benign , slow - growing , congenital neoplasms of the central nervous system . cp angle and prepontine epidermoid tumors are challenging lesions because they grow along the subarachnoid spaces around the very important neurovascular structures and often extend into the supratentorial compartment . they have typically been removed through a variety of anterolateral , lateral , and posterolateral cranial base microsurgical approaches . sometimes they are removed by endoscope - assisted microneurourgical techniques.[24 ] so far our knowledge , in the literature pure use of endoscope ( i.e. ecm ) in the removal of prepontineepidermoid had not reported . here we report a preontineepidermoid tumor extended to supratentorial compartment presented with trigeminal neuralgia that was removed by pure endoscopic visualization through retrosigmoid retromastoid lateral suboccipital approach . a right - handed 45-year- old man presented with headache and progressively increasing left - sided trigeminal neuralgia involving all three division of 5 nerve for the last 2 years . initially the attack of neuralgic pain was less frequent and had been easily controlled by carbamazepin . he had no history of vomiting , visual disturbance , unconsciousness , convulsion , or other complaints that suggest cranial nerves or cerebellar dysfunctions . his physical examination including neurological examination was absolutely normal . ct scan of brain showed a hypodense left cp angle and prepontine mass lesion with supratentorial extension into basal cistern that did not enhance after contrast injection [ figures 1a f ] . mri of brain showed a space occupying hypointense mass ( t1w images ) in the prepontine area ( left > right ) with supratentorial extension into interpeduncular cistern that did not enhance after contrast injection . it became hyperintense in t2w images and flair images differentiated it from cerebro spinal fluid ( csf ) . preoperative ct scan of brain serial axial sections ( a - f ) showing hypodence epidermoid tumor in left cerebello - pontine angle and prepontine area as well as supratentorial extension with displacement of brainstem a left - sided retromastoid retrosigmoid lateral suboccipital 22.5 cm craniectomy was done in park bench position . left - sided cerebello - pontine angle ( cpa ) was opened and facio - vestibulocochlear nerve complex and the tumor were identified by free hand 0 endoscope [ figures 2a and b ] . a self - retaining retractor was placed to support and to open the upper cpa.the pearly white materials that confirmed the epidermoid tumor were removed near totally with dynamic free hand endoscopy and static endoscopy with endoscope holder . petrosal vein and trigeminal nerve were entrapped by the tumor that was completely freed and preserved by careful dissection [ figures 3a c ] . before decompression petrosal vein was identified as a small vein surrounded by tumor ; after decompression it became larger . during the decompression of trigeminal nerve root , we found that a small part of tumor was deeply impinged into the nerve entry zone ; extra time and very careful dissection was needed in the removal of this part of tumor . endoscope , surgical dissector , and suction were negotiated in prepontine and interpeduncular cistern either above or below the trigeminal nerve and petrosal vein or in combination with elevation of tentorial margin . tumor overlying the basilar artery was also carefully removed with preservation of arachnoid membrane overlying it . opposite sixth nerve , medial temporal lobe , third nerve , superior cerebellar artery , posterior cerebral artery , upper basilar trunk , posterior part of pituitary stalk , and right mamillary body were nicely seen through the arachnoid membranes and kept intact [ figures 4a d ] . but these structures on the same side were not seen clearly even with angled ( 30 ) endoscope . supratentorial part of tumor was removed near totally . in the last part of surgery we used 30 endoscope to see if any residual part of the tumor was there . we left the small part capsule in a few places where it seemed that capsule was firmly adhering to brain stem and related structures . fv - facial and vestibulo cochlear nerve complex ; p - petrous ; e - epidermoid ; r - retractor ; and t - tentorialcerebelli ( a - c ) endoscopic views after removal of cp angle and prepontine portions of epidermoid ( trigeminal nerve if freed from tumor with preservation of petrosal vein ) . fv - facial and vestibulo cochlear nerve complex ; p - petrous ; e - epidermoid ; r - retractor ; pv - petrosal vein , tr - trigeminal nerve ; po - pons ; cl - clivus ; and t - tentorialcerebelli endoscopic views after removal of supratentorial portion of epidermoid showing right - sided part of interpeduncular fossa and rightsided medial temporal lobe . ( a ) : ps - pituitary stalk ; po - pons ; ds - dorsum sellae ; and cl - clivus . ( b ) : ps - pituitary stalk ; mtl - medial temporal lobe ; on - oculomotor nerve ; mb - midbrain ; an - abducent nerve ; and po - pons . ( c):on - oculomotor nerve ; mtl - medial temporal lobe ; and sca - superior cerebellar artery . ( d ) : ps - pituitary stalk ; ma - right mamillary body ; ba - basillar artery ; pca - posterior cerebral artery ; and sca - superior cerebellar artery we used injection dexamethasone and injection phenytoin peroperatviely and postoperatively to prevent chemical meningitis and seizure , respectively . postoperative ( two weeks after operation ) ct scan showed reduction of hypodense area with persisted deformity of brain stem with large dead space [ figures 5a f ] . ( a - c ) axial bone window images showing craniectomy site in left retor sigmoid retromastoid suboccipital area . ( c - f ) axial images showing with residual dead space of tumor with distorted brainstem histopathology of epidermoid : microphotograph a right - handed 45-year- old man presented with headache and progressively increasing left - sided trigeminal neuralgia involving all three division of 5 nerve for the last 2 years . initially the attack of neuralgic pain was less frequent and had been easily controlled by carbamazepin . he had no history of vomiting , visual disturbance , unconsciousness , convulsion , or other complaints that suggest cranial nerves or cerebellar dysfunctions . his physical examination including neurological examination was absolutely normal . ct scan of brain showed a hypodense left cp angle and prepontine mass lesion with supratentorial extension into basal cistern that did not enhance after contrast injection [ figures 1a f ] . mri of brain showed a space occupying hypointense mass ( t1w images ) in the prepontine area ( left > right ) with supratentorial extension into interpeduncular cistern that did not enhance after contrast injection . it became hyperintense in t2w images and flair images differentiated it from cerebro spinal fluid ( csf ) . preoperative ct scan of brain serial axial sections ( a - f ) showing hypodence epidermoid tumor in left cerebello - pontine angle and prepontine area as well as supratentorial extension with displacement of brainstem a left - sided retromastoid retrosigmoid lateral suboccipital 22.5 cm craniectomy was done in park bench position . left - sided cerebello - pontine angle ( cpa ) was opened and facio - vestibulocochlear nerve complex and the tumor were identified by free hand 0 endoscope [ figures 2a and b ] . a self - retaining retractor was placed to support and to open the upper cpa.the pearly white materials that confirmed the epidermoid tumor were removed near totally with dynamic free hand endoscopy and static endoscopy with endoscope holder . petrosal vein and trigeminal nerve were entrapped by the tumor that was completely freed and preserved by careful dissection [ figures 3a c ] . before decompression petrosal vein was identified as a small vein surrounded by tumor ; after decompression it became larger . during the decompression of trigeminal nerve root , we found that a small part of tumor was deeply impinged into the nerve entry zone ; extra time and very careful dissection was needed in the removal of this part of tumor . endoscope , surgical dissector , and suction were negotiated in prepontine and interpeduncular cistern either above or below the trigeminal nerve and petrosal vein or in combination with elevation of tentorial margin . tumor overlying the basilar artery was also carefully removed with preservation of arachnoid membrane overlying it . opposite sixth nerve , medial temporal lobe , third nerve , superior cerebellar artery , posterior cerebral artery , upper basilar trunk , posterior part of pituitary stalk , and right mamillary body were nicely seen through the arachnoid membranes and kept intact [ figures 4a d ] . but these structures on the same side were not seen clearly even with angled ( 30 ) endoscope . supratentorial part of tumor was removed near totally . in the last part of surgery we used 30 endoscope to see if any residual part of the tumor was there . we left the small part capsule in a few places where it seemed that capsule was firmly adhering to brain stem and related structures . fv - facial and vestibulo cochlear nerve complex ; p - petrous ; e - epidermoid ; r - retractor ; and t - tentorialcerebelli ( a - c ) endoscopic views after removal of cp angle and prepontine portions of epidermoid ( trigeminal nerve if freed from tumor with preservation of petrosal vein ) . fv - facial and vestibulo cochlear nerve complex ; p - petrous ; e - epidermoid ; r - retractor ; pv - petrosal vein , tr - trigeminal nerve ; po - pons ; cl - clivus ; and t - tentorialcerebelli endoscopic views after removal of supratentorial portion of epidermoid showing right - sided part of interpeduncular fossa and rightsided medial temporal lobe . ( a ) : ps - pituitary stalk ; po - pons ; ds - dorsum sellae ; and cl - clivus . ( b ) : ps - pituitary stalk ; mtl - medial temporal lobe ; on - oculomotor nerve ; mb - midbrain ; an - abducent nerve ; and po - pons . ( c):on - oculomotor nerve ; mtl - medial temporal lobe ; and sca - superior cerebellar artery . ( d ) : ps - pituitary stalk ; ma - right mamillary body ; ba - basillar artery ; pca - posterior cerebral artery ; and sca - superior cerebellar artery we used injection dexamethasone and injection phenytoin peroperatviely and postoperatively to prevent chemical meningitis and seizure , respectively . postoperative ( two weeks after operation ) ct scan showed reduction of hypodense area with persisted deformity of brain stem with large dead space [ figures 5a f ] . ( a - c ) axial bone window images showing craniectomy site in left retor sigmoid retromastoid suboccipital area . ( c - f ) axial images showing with residual dead space of tumor with distorted brainstem histopathology of epidermoid : microphotograph this so - called beautiful tumor has an irregular cauliflower - like outer surface that grows and encases vessels and nerves . the cyst content is characteristically composed of a pearly white material that results from desquamation of the cyst wall . about 90% intracranial epidermoids are intradural and 7% of cerebello - pontine angle ( cpa ) tumors . approximately 60% of all intracranial epidermoids occur in cpa and 15% epidermoids occur in middle cranial fossa . recurrent aseptic meningitis is uncommon but recognized complication and is similar to that of the less common dermoid cyst.trigeminal neuralgia is not uncommon with cpa epidermoids . the major differential diagnoses for an epidermoid cyst are arachnoidal cysts , hamartomatous lipomas , dermoid cysts , and cystic neoplasms . conventional mr images sometime can not reliably be used to distinguish epidermoid tumors from arachnoid cysts . in contrary , flair and dw sequences hydrocephalus is said to be uncommon because of the long - standing nature of the lesion and also because csf can permeate through the crevices of the lesion . the surgical approach is generally determined by the location and the extent of the lesion . the lesion , when confined to the cpa , is approached microsurgically by a retromastoid craniectomy , whereas significant supratentorial extension needs a combined retromastoid and subtemporal approach or a staged procedure . however , the tumor commonly extends into the hiatus and this incisural part can be completely removed with the posterior fossa approach . prepontine retroclival tumors have typically been removed through a variety of anterolateral , lateral , and posterolateral cranial base approaches . sometimes endoscopic - assisted microscopic removal are useful for removal of such tumors.[24 ] esposito et al . reported two epidermoids occupying the posterior suprasellar , premesencephalic , and prepontine cisterns , with significant mass effect on the brainstem were removed endonasal transsphenoidal transclival cranial base tumor removal with the operating microscope and endoscopic assistance . one patient developed a postoperative cerebrospinal fluid leak and meningitis requiring two re - operations to repair . in our case epidermoid from prepontine area and supratentorial area was removed by the endoscope with excellent vision . in microscopic approach , visualization is limited by long , narrow surgical corridor and limited space for change of angle of vision as light source and lens are long away from the operating field . the endoscope overcomes this problem by bringing the light source and lens closer to the surgical lesion along with panoramic view of pathology and surrounding structures . visualization provided by endoscope is outstanding and this advantage can minimize the risk of morbidity to vital neurovascular structures . in addition , because the lens and light source are at the tip of the endoscope , the endoscopic approach does not limit visibility in the lateral dimension , as occurs with the microscope . thus , endoscope reaches to supratentorial compartment to visualize third ventricular floor , interpeduncular cistern , pituitary stalk , and medial temporal lobe . another advantage of endoscopic - controlled approach over a classical microscopic approaches is the avoidance of much cerebellar retraction and the possible cerebellar injury . the main disadvantage of endoscope over microscope is the absence of 3-d perception of surgical field ( though 3-d endoscope is now available ) . in dynamic endoscopy , third surgical hand of assistant both surgeon 's hands can be used for dissection in static endoscopy where endoscope is holded by endoscope holder but still endoscope is occupying its space in the surgical road another disadvantage of endoscopy is longer learning curve in learning endoneurosurgical skill than that of microneurosurgical skill . although the aim of surgery is for complete removal , few authors advocate total removal of the tumor due to adherence of the capsule to the important neurovascular structures in and around the brain stem . a conservative approach with decompression and the removal of the nonadherent portion of the capsule had been suggested by others . chemical meningitis can occur by spillage of the cyst contents during operation , which usually is transient and self - limiting and often responds to steroids . nevertheless , epidermoids are often the most troublesome to cure because of their insinuating growth into different spaces and cisterns in addition to engulfing cranial nerves and vessels which make it difficult for radical excision . it is not surprising that , prior to the microsurgical era , operative mortality ranged from 20% to 57% . but nowadays , surgery - induced mortality is very low , as a result of tremendous improvement in neuroimaging and microsurgical skills with endoscopic skill as well as conservative radical approach in intracranial epidermoid excision . partial removal of a lesion leads to recurrence after a prolonged period . as the hypodense areas revealed by ct persist for a prolonged period , even after complete removal of the tumor , possibly because of a long - standing deformation of the neural structures , a diagnosis of recurrence at an early stage is often not possible . | cerebello - pontine(cp ) angle and prepontine epidermoid tumors are challenging lesions because they grow along the subarachnoid spaces around the very important neurovascular structures and often extend into the supratentorial compartment .
they have typically been removed through a variety of anterolateral , lateral , and posterolateral cranial base microsurgical approaches .
sometime they were removed by the endoscope - assisted microneurosurgical ( eam ) techniques . here
we report a cp angle and preontine epidermoid tumor extended to supratentorial compartment presented with trigeminal neuralgia that was removed by pure endoscopic visualization through retrosigmoid retromastoid lateral suboccipital approach .
( the method of using endoscope along with surgical instruments passing along the sides of endoscope is termed as endoscope - controlled microsurgery ecm . )
so far our knowledge , in the literature this type of report is probably very rare . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
changes in body composition can very often cause chronic diseases , and as a result have become a primary concern.1 lean body mass ( lbm ) and fat mass ( fm ) are body composition states that change continuously and are closely related to the aging process when compared with other factors.2,3 moreover , a strong link has been established between decreased muscle strength , physical capacity , quality of life , and the loss of fat - free mass.4 these changes can be seen in variations in body composition after middle age,5 through the increase of fm , reduction in lbm,6,7 and through the loss of height due to compression of the vertebrae and progressive curvature of the back.8 consequently , another deterioration has been identified from the age of approximately 65 to 7580,9 where the loss of muscle mass becomes 25%.10 physical activity ( pa ) is considered to be one of the most important health indicators which produces benefits for all age groups,1113 is used as an effective intervention to prevent functional loss related to age,1417 and promotes an improved quality of life and , as a result , greater longevity , coupled with appropriate eating patterns.1821 physical exercise also improves quality of life due to the reduction of fm and obesity,22,23 and prevents a rapid reduction in the size and number of muscle fibers.24 the practice of exercise should be consistent and controlled by specific programs . if the subject chose to do the opposite , ie , not follow a specific exercise program , body composition might not be affected.25 thanks to a progressive strength program which lasted 12 months , improvements in the health of elderly women with metabolic diseases were reflected in their body composition.26 according to sims et al there are studies that do not show clear links between pa programs and changes in fm in women aged between 50 and 79 , and which do not show prevention of loss of lbm in aerobic activities , regardless of the level.27 however , pa in the elderly is a widely studied and corroborated factor that improves quality of life.28 in turn , it helps to reduce the loss of functionality and the implications of such during the aging process.29 the american college of sports medicine ( acsm)30 recommends , as part of a guide on basic exercises , that the elderly use training programs that focus on resistance , strength , aerobic capacity , and flexibility exercises . part of its content focuses on the pilates method through the activation of brain cells , stimulation of the mind , and the positive impact on the body.31 the acsm ranked this method in seventh place as an emerging pa in 2008 and 2009,32 and in the us alone , the number of users reached 10.5 million in 2004 . the pilates method coincides with the modern principles of fitness , personal training , and mental happiness through exercises that maintain a neutral spine position and appropriate use of the floor and equipment to develop strength and balance.33 aerobic capacity and endurance can also help to maintain muscle mass and strength in the elderly as well as the pilates method.22 according to de cocker et al , there are relatively few studies related to muscle strengthening activities compared with other aerobic activities.34 some of the studies provide beneficial effects , while others do not offer any significant changes35 in terms of intensity , duration , frequency,36 or activity.35 this research project aimed to assess the differences in body composition and anthropometric measurements of a sample of serbian women over the age of 60 , in a 24-week clinical intervention study , through a guided program that combined aerobics and pilates . a total of 303 elderly serbian females and eight males over the age of 60 voluntarily participated in this study . subjects were informed about the experimental procedures , completed a medical history form , and signed an informed consent statement . the inclusion criteria were that the participants were women aged greater than 60 and less than 70 years . the exclusion criteria included having any chronic disease , limited functional mobility and taking medications . a blood test was carried out to check that the participants had no problems related to the following biological parameters : glucose ( 4.68 g / l ) , triglycerides ( 1.29 mmol / l ) , high density lipoprotein ( 1.48 mmol / l ) , and low density lipoprotein ( 3.78 mmol / l ) . no participants were medicated during the training process , and none of the participants performed any other pa . measurements obtained were : height , weight , body mass index , subcutaneous skinfold thickness ( triceps , subscapularis , suprailiac , abdomen , front thigh , and medial calf ) , muscular girths ( upper arm relaxed , upper arm flexed and tensed , abdominal , thigh , and maximum calf ) , and four diameters ( wrist , femur , humeral , and ankle ) . bodyweight was measured to 0.1 kg on an electronic scale ( seca gmbh & co , kg , hamburg , germany ) , with participants wearing light indoor clothing and no shoes . measurements were performed following the standardized techniques adopted by the international society for the advancement of kinanthropometry.37 the technical error of measurement was lower than 5% for skinfold thickness and lower than 1% for the other measurements . skinfold thickness was taken using a caliper with a precision of 0.2 mm ( holtain ltd , crymych , uk ) . girths were performed with a flexible metallic tape measure with a precision of 0.1 mm . body mass index was calculated as weight ( kg ) height2 ( m ) . womersley38 = 1.1567 0.0717 log ( subscapularis skinfold + triceps skinfold + forearm skinfold + biceps skinfold ) and fm equation39 ( % ) = [ 4.57/corporal density 4.142 ] 100 . this present study was initiated in order to establish the influence of pa ( through a program of educational activity and pa based on pilates and aerobics ) on the elderly , with different bodyweights and fm . a medical and sociodemographic questionnaire was completed to collect social , demographic , and medical variables . the training program consisted of music - based aerobics and pilates , basic to intermediate level . following these sessions , concepts of health education were given to orientate participants towards a more healthy posture and the practice of food hygiene in their daily lives . the diet regime was established according to the recommendations of acsm13 and was followed by 91% of the participants . the sessions included in this program took place twice per week and lasted 5560 minutes per day - session , with an effective pa time of 45 minutes , in line with the requirements laid out by the acsm.23 the program comprised pilates exercises for upper- and lower - body strength , agility , and aerobic capacity . during the first session of the intervention process , participants were asked their perceived level of exertion on a scale of 010 ( borg scale ) to establish the initial level and then gradually increase exercise intensity . this course lasted 24 weeks and was based initially on a pilot study in which changes in behavior and body composition of the participants were expected.40 this study was approved by the ethical committee of the university of novi sad . data were analyzed using the spss ( spss , chicago , il , usa ) statistical program , version 17.0 . repeated - measurement tests were used to determine the differences between times ( wilcoxon test ; repeated - measures test ) . for all analyses , a total of 303 elderly serbian females and eight males over the age of 60 voluntarily participated in this study . subjects were informed about the experimental procedures , completed a medical history form , and signed an informed consent statement . the inclusion criteria were that the participants were women aged greater than 60 and less than 70 years . the exclusion criteria included having any chronic disease , limited functional mobility and taking medications . a blood test was carried out to check that the participants had no problems related to the following biological parameters : glucose ( 4.68 g / l ) , triglycerides ( 1.29 mmol / l ) , high density lipoprotein ( 1.48 mmol / l ) , and low density lipoprotein ( 3.78 mmol / l ) . no participants were medicated during the training process , and none of the participants performed any other pa . measurements obtained were : height , weight , body mass index , subcutaneous skinfold thickness ( triceps , subscapularis , suprailiac , abdomen , front thigh , and medial calf ) , muscular girths ( upper arm relaxed , upper arm flexed and tensed , abdominal , thigh , and maximum calf ) , and four diameters ( wrist , femur , humeral , and ankle ) . bodyweight was measured to 0.1 kg on an electronic scale ( seca gmbh & co , kg , hamburg , germany ) , with participants wearing light indoor clothing and no shoes . measurements were performed following the standardized techniques adopted by the international society for the advancement of kinanthropometry.37 the technical error of measurement was lower than 5% for skinfold thickness and lower than 1% for the other measurements . skinfold thickness was taken using a caliper with a precision of 0.2 mm ( holtain ltd , crymych , uk ) . girths were performed with a flexible metallic tape measure with a precision of 0.1 mm . body mass index was calculated as weight ( kg ) height2 ( m ) . womersley38 = 1.1567 0.0717 log ( subscapularis skinfold + triceps skinfold + forearm skinfold + biceps skinfold ) and fm equation39 ( % ) = [ 4.57/corporal density 4.142 ] 100 . this present study was initiated in order to establish the influence of pa ( through a program of educational activity and pa based on pilates and aerobics ) on the elderly , with different bodyweights and fm . a medical and sociodemographic questionnaire was completed to collect social , demographic , and medical variables . the training program consisted of music - based aerobics and pilates , basic to intermediate level . following these sessions , concepts of health education were given to orientate participants towards a more healthy posture and the practice of food hygiene in their daily lives . the diet regime was established according to the recommendations of acsm13 and was followed by 91% of the participants . the sessions included in this program took place twice per week and lasted 5560 minutes per day - session , with an effective pa time of 45 minutes , in line with the requirements laid out by the acsm.23 the program comprised pilates exercises for upper- and lower - body strength , agility , and aerobic capacity . during the first session of the intervention process , participants were asked their perceived level of exertion on a scale of 010 ( borg scale ) to establish the initial level and then gradually increase exercise intensity . this course lasted 24 weeks and was based initially on a pilot study in which changes in behavior and body composition of the participants were expected.40 this study was approved by the ethical committee of the university of novi sad . data were analyzed using the spss ( spss , chicago , il , usa ) statistical program , version 17.0 . repeated - measurement tests were used to determine the differences between times ( wilcoxon test ; repeated - measures test ) . for all analyses , participants had a lower height and had gained more weight after the training period , although these data were not significant . however , the fm was lower after the pilates - gym program ( p<0.01 ) . blood pressure , both systolic and diastolic , increased ( p<0.05 ) . these data show no significant differences between pre- and post - test ( table 2 ) . waist - to - thigh ratio was higher post - test than pre - test . as for skinfold thickness , various results were obtained ( p<0.05 ) . in some participants , they were higher such as skinfold thickness of triceps , inner forearm , and the abdomen , and in others , the results were lower , such as in skinfold thickness in the subscapularis , outer forearm , mid - thigh , and calf ( table 3 ) . lastly , bone diameters were similar in the pre- and post - tests ( p>0.05 ) ( table 4 ) . regarding correlations , there was a strong relationship between fm ( % ) and waist - to - hip ratio ( rho , 0.80 ; p<0.01 ) . this is the first study assessing the effects of 24 weeks of pilates - aerobic exercise on older , serbian women . the aim of this study was to examine body composition ( fm and lbm ) at the beginning and end of an aerobic - pilates program . to ensure a full collaboration of participants over the period of 24 weeks , it was especially important that they were motivated in these longitudinal studies so that the practice of pa was done on a daily basis.41 when there is an increase in fm , there is a reduction in muscle strength , physical capacity , and quality of life , along with a loss of fat - free mass.4 the elderly , with more sedentary lifestyles , lose fat - free mass faster than people who perform pas through a combination of strength training42 and force balance training,43 the latter being the reason for the prevention of weight loss and in maintaining functional capacity in people above the age of 70.44 low mortality values and less muscle fat have even been linked to an increase in aerobic exercise through walking speed.44 this body fat ( % ) is related to the waist - to - hip ratio , as in the study by bae et al1 with a sample of the elderly . however , the correlation between the two that we have obtained is stronger ( r=0.80 ; p<0.01 ) due to the homogeneity of the study sample . joseph pilates developed a system of exercises which is defined as a unique method of physical fitness that uses a combination of muscle strengthening , lengthening and breathing to develop trunk muscles and restore muscle balance.45 the pilates method is considered by european practice guidelines as an adequate treatment for correct modification of posture,46,47 but it is not effective in the diminution of disability.48 despite there being no clear evidence of improved functionality in elderly people through the practice of pilates , except balance,49,50 an improvement in body composition in healthy people has been found,51 as observed in the present study , as well as a reduction in risk situations and cardiovascular mortality.52 various aerobic exercise programs have shown improvements in functional capacity and particularly cardiovascular type exercises in women during the aging process.53 the participants had an improved fm level of 32.89%8.65% and at the end of the pilates - aerobic program ( 24 weeks ) , the fm levels had decreased to 28.25%6.58% . skinfold thickness variations were very small ( p>0.05 ) ; however , table 3 shows that in all cases it decreases . this decline in fm is linked to the completion of pa controlled and planned,41 in addition to following a balanced diet . however , other authors such as dias et al54 and lim et al55 have not found any improvements in their participants who took part in a pilates program . the reason for this is thought to be due to the short duration of the course ( 6 weeks ) . fm in the elderly does not only remain stable through the practice of the pilates - aerobic program , but it can also decrease significantly ( table 1 ) . hence , as a result of the human aging process , there is a considerable loss of skeletal muscle mass over time , especially in women.53 however , our results are similar pre - post after 24 weeks of pa ( p>0.05 ) , although pereira et al report an increase in skeletal muscle mass , thanks to the pilates programs . in conclusion , a combined program of aerobic and pilates , carried out under the supervision of an instructor , at least twice a week , produces health benefits in functionally independent women over the age of 60 . furthermore , initial muscular mass values remained stable , whereas fm decreased , without causing deterioration of health during the practice of exercises . we need to conduct further research , using fitness tests and comparing benefits of physical programs , especially pilates and aerobic activity . finally , it is important to note that the present study has its limitations with this population . according to some authors , data of the serbian elderly sample is limited56 because there are not many studies related to this area of europe and in particular regarding the elderly . | backgroundthe purpose of this study was to examine the differences in anthropometric measurements using an aerobic and pilates exercise program which lasted 24 weeks.methodthis was a clinical intervention study of 303 women over the age of 60 living in novi sad , serbia .
changes in body mass index and skinfold thickness were estimated through height , weight , and anthropometric measurements .
the program comprised pilates exercises for upper- and lower - body strength , agility , and aerobic capacity.resultsfat mass ( fm ) improved significantly ( pre - test , 32.89% , 8.65 ; post - test , 28.25% , 6.58 ; p<0.01 ) .
bone diameters and muscle perimeters showed no significant changes pre- and post - test ( p>0.05 ) , but there was a higher correlation between fm ( % ) and waist hip ratio ( rho , 0.80 ; p<0.01).conclusiona mixed program of aerobics and pilates , controls and improves baseline muscle mass and decreases fm values , without causing deterioration during practice and follow - up exercises . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
general practice research database ( gprd ) , the world s largest computerized database , representing the primary care longitudinal records of more than 11 million patients from across the u.k . general population , with age and sex distributions comparable to those reported by the u.k . national population census ( 13 ) . all information collected in the gprd has been subjected to validation studies and been proven to contain consistent and high - quality data ( 14 ) . the study protocol was approved by the independent scientific advisory committee of the gprd and the research ethics committee of the jewish general hospital , montreal , quebec , canada . within the gprd population , we assembled a cohort of all patients , aged at least 40 years , who had received at least one antidiabetic prescription between 1 january 1988 and 31 december 2009 . cohort entry was defined as the date of a first prescription for an oral hypoglycemic agent ( oha ) during this period . all patients included in the study were from up - to - standard general medical practices , thus meeting gprd research quality standards , and were required to have at least 1 year of medical history in the gprd before their cohort entry . patients who received insulin as their first antidiabetic treatment were not included because they likely represented patients with type 1 diabetes or patients with advanced type 2 diabetes ; however , patients who eventually required insulin during follow - up were retained . finally , patients diagnosed with lung cancer at any time before cohort entry were excluded . all patients were monitored until a first - ever diagnosis of lung cancer , death from any cause , end of registration with a general practice , or end of the study period ( 31 december 2009 ) , whichever came first . a nested case all incident cases of lung cancer occurring during follow - up were identified on the basis of read diagnostic codes , which is the standard clinical terminology system used in general practice in the u.k . the date of each case subject s lung cancer diagnosis was defined as the index date . for the purposes of the analyses , only case subjects with at least 1 year of follow - up were retained to consider a latency period . up to 10 control subjects , randomly selected from the case subject s risk set , were matched to each patient on year of birth ( age ) , sex , calendar year of cohort entry , and duration of follow - up . to avoid excluding patients three individuals were matched with a control subject who had the same year of cohort entry 1 year , and one patient was matched to control subjects with a year of birth 3 years and the year of cohort entry 2 years . control subjects were assigned the same index date as the patients , thus ensuring that case subjects and matched control subjects had equal duration of follow - up before the index date . by definition , all control subjects were alive , not previously diagnosed with lung cancer , and were registered with a general practice when matched to a given case subject . cancer diagnoses , including lung cancer , have shown high validity in the gprd , with sensitivities and positive predictive values exceeding 90% ( 1619 ) , resulting in case ascertainment rates comparable to u.k . cancer registries ( 20 ) . for both case and control subjects , we obtained information on all antidiabetic agents prescribed between cohort entry and the index date . exposures initiated in the year before the index date were excluded from the analysis to account for a latency time window , because these are unlikely to be associated with the outcome . the primary exposure definition was ever use of metformin , defined as receiving at least one prescription between cohort entry and the year before the index date . in secondary exposure definitions , we considered whether a dose response relationship existed between the use of metformin and lung cancer . therefore , among patients deemed to have ever used metformin in the primary exposure definition , we investigated whether lung cancer risk varied with the total number of prescriptions received , cumulative duration , and cumulative dose . the total number of metformin prescriptions was tabulated by summing all metformin prescriptions received between cohort entry and index date . cumulative duration was calculated by summing the prescribed duration associated with each metformin prescription received between cohort entry and index date , and cumulative dose was computed by multiplying the daily dose of each metformin prescription by its specified prescription duration and adding these prescription - specific values across all prescriptions received by a given patient between cohort entry and index date . all three dose response variables were categorized in quartiles , based on the distribution of use in the control subjects . the risk estimates were adjusted for comorbid clinical conditions and exposures known to be associated with lung cancer that might also influence the choice of antidiabetic therapy . these conditions and exposures were measured at any time from at least 1 year before cohort entry up to 1 year before the index date . thus , the following potential confounders were considered : smoking status ( ever , never , or unknown ) , bmi ( 30 vs. < 30 kg / m ) , excessive alcohol use , last recorded glycated hemoglobin a1c ( hba1c ) at least 1 year before index date , diabetes duration before cohort selection ( defined as a diagnosis of type 2 diabetes or an hba1c level > 7.0% , whichever appeared first in the medical record ) , chronic obstructive pulmonary disease , and asthma ( 18 ) , previous cancer ( other than nonmelanoma skin cancer ) , and ever use of statins , aspirins , nonsteroidal anti - inflammatory drugs , and other antidiabetic agents that were individually adjusted for in the model , including metformin , sulfonylureas , thiazolidinedione , insulins , and others , consisting of meglitinides , dipeptidyl peptidase-4 inhibitors , -glucosidase inhibitors , glucagon - like peptide analogs , and guar gum . the characteristics of the case subjects and matched control subjects were summarized using descriptive statistics . the overall lung cancer incidence rate with 95% ci based on a poisson distribution was calculated by dividing the total number of patients with incident lung cancer occurring during follow - up by the total number of person - years of follow - up . conditional logistic regression was used to estimate rate ratios ( rrs ) along with 95% cis of lung cancer associated with the use of metformin . the regression models were conditioned on the four matching factors ( age , sex , calendar year of cohort entry , and duration of follow - up ) and adjusted for the potential confounders listed above . in the primary analysis , we evaluated whether ever use of metformin , when compared with never use , was associated with a decreased risk of lung cancer . , we determined whether there was a dose response between the use of metformin and lung cancer in number of prescriptions , cumulative duration of use , and cumulative dose . response variables in the conditional logistic models as continuous variables . in the second analysis , we stratified case and control subjects on smoking status to determine whether smoking was an effect modifier of the metformin - lung cancer association . all analyses were conducted with sas 9.2 software ( sas institute , cary , nc ) . initially , all analyses were restricted to case and matched control subjects with at least 1 year of follow - up and excluded antidiabetic medications initiated during the year before the index date to consider a latency time window . thus , the first sensitivity analysis consisted of repeating the analyses by using latency time windows of 6 months and 2 years . in the second sensitivity analysis , we assessed potential misclassification of exposure by redefining ever use of metformin as receiving at least three prescriptions within a 12-month period , thus minimizing the inclusion of patients who may not have been regular users or who used these drugs sporadically . finally , in the third sensitivity analysis to assess the effect of adjusting for variables potentially on the casual pathway , we repeated the analysis , adjusting for the potential confounders measured at cohort entry . general practice research database ( gprd ) , the world s largest computerized database , representing the primary care longitudinal records of more than 11 million patients from across the u.k . general population , with age and sex distributions comparable to those reported by the u.k . national population census ( 13 ) . all information collected in the gprd has been subjected to validation studies and been proven to contain consistent and high - quality data ( 14 ) . the study protocol was approved by the independent scientific advisory committee of the gprd and the research ethics committee of the jewish general hospital , montreal , quebec , canada . within the gprd population , we assembled a cohort of all patients , aged at least 40 years , who had received at least one antidiabetic prescription between 1 january 1988 and 31 december 2009 . cohort entry was defined as the date of a first prescription for an oral hypoglycemic agent ( oha ) during this period . all patients included in the study were from up - to - standard general medical practices , thus meeting gprd research quality standards , and were required to have at least 1 year of medical history in the gprd before their cohort entry . patients who received insulin as their first antidiabetic treatment were not included because they likely represented patients with type 1 diabetes or patients with advanced type 2 diabetes ; however , patients who eventually required insulin during follow - up were retained . finally , patients diagnosed with lung cancer at any time before cohort entry were excluded . all patients were monitored until a first - ever diagnosis of lung cancer , death from any cause , end of registration with a general practice , or end of the study period ( 31 december 2009 ) , whichever came first . all incident cases of lung cancer occurring during follow - up were identified on the basis of read diagnostic codes , which is the standard clinical terminology system used in general practice in the u.k . the date of each case subject s lung cancer diagnosis was defined as the index date . for the purposes of the analyses , only case subjects with at least 1 year of follow - up were retained to consider a latency period . up to 10 control subjects , randomly selected from the case subject s risk set , were matched to each patient on year of birth ( age ) , sex , calendar year of cohort entry , and duration of follow - up . to avoid excluding patients , three individuals were matched with a control subject who had the same year of cohort entry 1 year , and one patient was matched to control subjects with a year of birth 3 years and the year of cohort entry 2 years . control subjects were assigned the same index date as the patients , thus ensuring that case subjects and matched control subjects had equal duration of follow - up before the index date . by definition , all control subjects were alive , not previously diagnosed with lung cancer , and were registered with a general practice when matched to a given case subject . cancer diagnoses , including lung cancer , have shown high validity in the gprd , with sensitivities and positive predictive values exceeding 90% ( 1619 ) , resulting in case ascertainment rates comparable to u.k . for both case and control subjects , we obtained information on all antidiabetic agents prescribed between cohort entry and the index date . exposures initiated in the year before the index date were excluded from the analysis to account for a latency time window , because these are unlikely to be associated with the outcome . the primary exposure definition was ever use of metformin , defined as receiving at least one prescription between cohort entry and the year before the index date . in secondary exposure definitions , we considered whether a dose response relationship existed between the use of metformin and lung cancer . therefore , among patients deemed to have ever used metformin in the primary exposure definition , we investigated whether lung cancer risk varied with the total number of prescriptions received , cumulative duration , and cumulative dose . the total number of metformin prescriptions was tabulated by summing all metformin prescriptions received between cohort entry and index date . cumulative duration was calculated by summing the prescribed duration associated with each metformin prescription received between cohort entry and index date , and cumulative dose was computed by multiplying the daily dose of each metformin prescription by its specified prescription duration and adding these prescription - specific values across all prescriptions received by a given patient between cohort entry and index date . all three dose response variables were categorized in quartiles , based on the distribution of use in the control subjects . the risk estimates were adjusted for comorbid clinical conditions and exposures known to be associated with lung cancer that might also influence the choice of antidiabetic therapy . these conditions and exposures were measured at any time from at least 1 year before cohort entry up to 1 year before the index date . thus , the following potential confounders were considered : smoking status ( ever , never , or unknown ) , bmi ( 30 vs. < 30 kg / m ) , excessive alcohol use , last recorded glycated hemoglobin a1c ( hba1c ) at least 1 year before index date , diabetes duration before cohort selection ( defined as a diagnosis of type 2 diabetes or an hba1c level > 7.0% , whichever appeared first in the medical record ) , chronic obstructive pulmonary disease , and asthma ( 18 ) , previous cancer ( other than nonmelanoma skin cancer ) , and ever use of statins , aspirins , nonsteroidal anti - inflammatory drugs , and other antidiabetic agents that were individually adjusted for in the model , including metformin , sulfonylureas , thiazolidinedione , insulins , and others , consisting of meglitinides , dipeptidyl peptidase-4 inhibitors , -glucosidase inhibitors , glucagon - like peptide analogs , and guar gum . the characteristics of the case subjects and matched control subjects were summarized using descriptive statistics . the overall lung cancer incidence rate with 95% ci based on a poisson distribution was calculated by dividing the total number of patients with incident lung cancer occurring during follow - up by the total number of person - years of follow - up . conditional logistic regression was used to estimate rate ratios ( rrs ) along with 95% cis of lung cancer associated with the use of metformin . the regression models were conditioned on the four matching factors ( age , sex , calendar year of cohort entry , and duration of follow - up ) and adjusted for the potential confounders listed above . in the primary analysis , we evaluated whether ever use of metformin , when compared with never use , was associated with a decreased risk of lung cancer . , we determined whether there was a dose response between the use of metformin and lung cancer in number of prescriptions , cumulative duration of use , and cumulative dose . response variables in the conditional logistic models as continuous variables . in the second analysis , we stratified case and control subjects on smoking status to determine whether smoking was an effect modifier of the metformin - lung cancer association . all analyses were conducted with sas 9.2 software ( sas institute , cary , nc ) . initially , all analyses were restricted to case and matched control subjects with at least 1 year of follow - up and excluded antidiabetic medications initiated during the year before the index date to consider a latency time window . thus , the first sensitivity analysis consisted of repeating the analyses by using latency time windows of 6 months and 2 years . in the second sensitivity analysis , we assessed potential misclassification of exposure by redefining ever use of metformin as receiving at least three prescriptions within a 12-month period , thus minimizing the inclusion of patients who may not have been regular users or who used these drugs sporadically . finally , in the third sensitivity analysis to assess the effect of adjusting for variables potentially on the casual pathway , we repeated the analysis , adjusting for the potential confounders measured at cohort entry . a total of 115,923 patients ( 55.2% men ) newly treated with ohas met the study inclusion criteria ( fig . 1 ) . mean age was 64.1 ( sd 12.0 ) years , and the median hba1c was 8.2% at cohort entry . with respect to ohas received at cohort entry , 67.4% of patients received metformin monotherapy , 29.6% received sulfonylureas monotherapy , 1.3% received other ohas in monotherapy , and 1.7% were taking a combination of at least two ohas . the mean follow - up was 5.6 ( sd 3.6 ) years , generating 528,356 person - years of follow - up . during this time , 1,061 patients were diagnosed with lung cancer , resulting in an overall lung cancer rate of 2.0/1,000 person - years ( 95% ci 1.92.1 ) . the nested case - control analysis was restricted to the 808 case subjects and 7,765 matched control subjects with at least 1 year of follow - up . as reported in table 1 , case subjects and matched control subjects were similar on several characteristics , such as duration of diabetes before cohort entry , hba1c , bmi , and ever use of nonsteroidal anti - inflammatory drugs . as expected , the prevalence of smoking was higher in case subjects than in matched control subjects ( 85.2 vs. 60.0% , respectively ) . furthermore , case subjects were more likely than control subjects to have had a history of chronic obstructive pulmonary disease , to have had a history of asthma , to have used alcohol excessively , and to have ever used aspirin and statins ( table 1 ) . characteristics of lung cancer case subjects and matched control subjects at index date table 2 presents the results of the primary analysis . overall , the use of metformin was not associated with a decrease rate of lung cancer ( adjusted rr 0.94 [ 95% ci 0.761.17 ] ) . in secondary analyses , no dose - response was observed in number of metformin prescriptions received , cumulative duration , and cumulative dose , with all adjusted rrs around the null value ( table 2 ) . crude and adjusted rrs of lung cancer incidence associated with the use of metformin when case and control subjects were stratified on a smoking status , no effect modification was observed with respect to this variable ( table 3 ) . in nonsmokers , ever use of metformin was not associated with a decreased rate of lung cancer ( adjusted rr 1.19 [ 95% ci 0.622.26 ] ) . likewise , no association was observed in smokers ( 0.90 [ 0.701.15 ] ; table 3 ) . crude and adjusted rrs of lung cancer incidence associated with the use of metformin stratified by smoking status in the first sensitivity analysis , varying the latency time window to 6 months and 2 years yielded results consistent with those of the primary analysis ( adjusted rr 1.02 [ 95% ci 0.831.26 ] and 1.02 [ 0.801.29 ] , respectively ) . in the second analysis , we assessed the effect of potential exposure misclassification by redefining ever use of metformin as receiving at least three prescriptions within a 12-month period . this analysis yielded null results , consistent with those of the primary analysis ( 0.97 [ 0.801.17 ] ) . finally , adjusting for potential confounders at baseline did not materially change the results ( 0.97 [ 0.781.20 ] ) . in the first sensitivity analysis , varying the latency time window to 6 months and 2 years yielded results consistent with those of the primary analysis ( adjusted rr 1.02 [ 95% ci 0.831.26 ] and 1.02 [ 0.801.29 ] , respectively ) . in the second analysis , we assessed the effect of potential exposure misclassification by redefining ever use of metformin as receiving at least three prescriptions within a 12-month period . this analysis yielded null results , consistent with those of the primary analysis ( 0.97 [ 0.801.17 ] ) . finally , adjusting for potential confounders at baseline did not materially change the results ( 0.97 [ 0.781.20 ] ) . the results of this large population - based study indicate that the use of metformin is not associated with a decreased risk of lung cancer in patients with type 2 diabetes . these results remained unchanged in secondary analyses , which considered dose - response , by smoking status , as well as in several sensitivity analyses . as such , our findings do not support laboratory models that focused on the direct and indirect effect of metformin on lung cancer and tumor proliferation ( 11,12 ) . although laboratory data have provided evidence for plausible mechanisms of action of biguanides that may reduce cancer risk and/or improve cancer prognosis , such plausibility of course does not necessarily demonstrate that metformin has clinical antineoplastic activity . the models do not fully recapitulate the clinical situation in many respects , but one obvious area for future investigation concerns pharmacokinetics and drug exposure levels in lungs clinically as compared with in the models . ( 8) , where ever use of metformin , compared with never use , was not associated with a decreased risk of lung cancer ( hazard ratio 1.0 [ 95% ci 0.81.1 ] ) . ever use of metformin was associated with a significant decreased risk of lung cancer ( 0.55 [ 0.370.88 ] ) ( 9 ) . interestingly , similar risk reductions were observed in that study with other antidiabetic treatments , such as thiazolidinediones ( 0.55 [ 0.320.94 ] ) and -glucosidase inhibitors ( 0.61 [ 0.380.98 ] ) , while null results were observed for insulin ( 1.00 [ 0.681.45 ] ) and sulfonylureas ( 1.27 [ 0.752.15 ] ) ( 9 ) . such impressive risk reductions are likely due to immortal time bias , a bias that is introduced with time - fixed analyses that misclassify unexposed person - time as exposed ( 21,22 ) . first , our study avoided immortal time bias by using a design and analysis that inherently considered exposure to metformin as time - dependent ( 21,22 ) . second , we were able to assemble a large cohort of patients with type 2 diabetes with a significant number of patients with lung cancer . third , data are prospectively collected in the gprd and thus recall bias is avoided . fourth , the gprd records information on a number of potential confounders , such as smoking , bmi , and hba1c levels , which are often absent in administrative databases . finally , we adjusted the models for hba1c , duration of diabetes before cohort entry ( i.e. , duration of nontreated diabetes ) , and matched case and control subjects on duration of follow - up ( i.e. , duration of treated diabetes ) . we believe that all efforts went into controlling for the effects of diabetes and its severity , which may be independently associated with an increased risk of lung cancer ( 18 ) . although the gprd contains information on variables such as smoking , which is perhaps the most important potential confounder in this study , the database lacks information on family history of lung cancer , race , level of physical activity , diet , past lung biopsies , bronchoscopies , computed tomography scans , and other hospital procedures related to lung cancer ( 23 ) . thus , residual confounding due to unmeasured or incompletely measured covariates may still be present , although these unmeasured variables are not strongly associated with the outcome and thus are unlikely to have affected the validity of the results ( 24 ) . another limitation of the gprd is the lack of information on compliance with the prescribed treatment . the gprd only contains information on prescriptions written by general practitioners , and therefore , whether prescriptions were actually filled or taken as indicated by patients is unknown . however , the results of our sensitivity analysis requiring at least three prescriptions within a 12-month period suggests that this misclassification was likely minimal . finally , although cancer diagnoses have been shown to be well recorded in the gprd ( 1619 ) , the database does not contain specific information on tumor grade and stage , and thus , it was not possible to stratify the patients by using these parameters . in summary , this large population - based study provides evidence that the use of metformin is not associated with a decreased risk of lung cancer in patients with type 2 diabetes . our observations , however , do not detract from the plausibility of the mechanisms of antineoplastic action of biguanides demonstrated by laboratory models ( 17,25,26 ) but suggest that these mechanisms do not operate clinically , at least at the conventional doses used in the treatment of type 2 diabetes . therefore , further translational research , including careful attention to drug exposure levels in relevant organs , is suggested before launching large - scale randomized controlled trials of metformin for proposed indications in oncology . | objectiveobservational studies have associated metformin use with a decreased risk of lung cancer incidence in patients with type 2 diabetes , but the studies had important methodological shortcomings .
the objective of this study was to determine whether metformin use is associated with a decreased risk of lung cancer in patients with type 2 diabetes , while avoiding previous biases.research design and methodsusing the u.k .
general practice research database , we assembled a cohort of patients newly treated with oral hypoglycemic agents ( ohas ) between 1988 and 2009 . a nested case
control analysis was conducted , where case subjects with lung cancer occurring during follow - up were matched with up to 10 control subjects for age , sex , calendar time , and duration of follow - up .
conditional logistic regression was used to estimate adjusted rate ratios of lung cancer associated with ever use of metformin , along with measures of duration and cumulative dose .
models were adjusted for potential confounders , which included smoking.resultsthe cohort included 115,923 new users of ohas , with 1,061 patients diagnosed with lung cancer during follow - up ( rate 2.0/1,000 person - years ) .
metformin use was not associated with a decreased rate of lung cancer ( rate ratio 0.94 [ 95% ci 0.761.17 ] ) .
no dose - response was observed by number of prescriptions received , cumulative duration of use , and dose.conclusionsmetformin use is not associated with a decreased risk of lung cancer in patients with type 2 diabetes .
the decreased risk reported in other observational studies is likely due to bias from methodological shortcomings .
nonetheless , greater consideration should be given to clarify inconsistencies between experimental models and population studies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in patients who have degenerative spondylolisthesis and isthmic spondylolisthesis with low slipping rate , radicular symptoms occur secondary to narrowed neural foramina . nerve roots are extremely compressed between the pedicle and posterior part of the corpus vertebra10 ) . classically restoring of disc height and alignment of the spine with rigid instrumentation provides a normal foraminal space and nerve root compression findings may improve69 ) . however , this procedures need to fusion of the segment and decreased motion in the spine . in elderly patient these operations have some potential risks such as pseudoarthrosis , adjacent segment disease and infection . moreover , to achieve a fusion might not be possible in those old patients if there is accompanying osteoporosis . we also know that if the patient has no sign of sagittal balance problem , it is not necessary to restore the alignment of the spine with a major surgery as spinal fusion . we know that new technologies lead new surgical techniques as motion preservation in lumbar spine . the dynamic instrumentation systems allow enough stabilization while preventing fusion - related complications . in this technical note , we describe to create a wide neural foramen with pedicle removal to decompress the nerve roots and dynamic instrumentation for stabilization of spine . surgical decompression technique in this article is also suitable for performing the dynamic stabilization to prevent pseudoarthrosis . a 45-year - old woman was admitted with complaints of back and both leg pain for 6 months . however when she attempts to walking , she feels severe pain on her buttocks and legs . magnetic resonance imaging ( mri ) scan and computed tomography ( ct ) revealed grade ii spondylolisthesis at l5-s1 level . the compression of nerve roots between the vertebral corpus with disc remnants and l5 pedicle was also shown in diagram ( fig . there was not any sign of coronal imbalance on x - ray of the patient . we performed our decompression and stabilization technique and the patient was discharged 3 days after surgery without any complaints . midline skin incision was performed and l5 lamina was exposed following bilateral paravertebral muscle dissection . gill 's procedure was considered ineffective for this patient because l5 nerve roots were extremely compressed between the vertebral corpus with disc remnants and l5 pedicle bilaterally45 ) . the l5 pedicles were removed with high speed drill using the surgical microscope and a new and large fora men was created between l4 and s1 pedicles ( fig . osteotomy was not considered since there was no spinal balance problem . moreover , l4-s1 bilaterally dynamic stabilization was performed and operation was completed ( fig . a 45-year - old woman was admitted with complaints of back and both leg pain for 6 months . however when she attempts to walking , she feels severe pain on her buttocks and legs . magnetic resonance imaging ( mri ) scan and computed tomography ( ct ) revealed grade ii spondylolisthesis at l5-s1 level . the compression of nerve roots between the vertebral corpus with disc remnants and l5 pedicle was also shown in diagram ( fig . there was not any sign of coronal imbalance on x - ray of the patient . we performed our decompression and stabilization technique and the patient was discharged 3 days after surgery without any complaints . midline skin incision was performed and l5 lamina was exposed following bilateral paravertebral muscle dissection . gill 's procedure was considered ineffective for this patient because l5 nerve roots were extremely compressed between the vertebral corpus with disc remnants and l5 pedicle bilaterally45 ) . the l5 pedicles were removed with high speed drill using the surgical microscope and a new and large fora men was created between l4 and s1 pedicles ( fig . osteotomy was not considered since there was no spinal balance problem . moreover , l4-s1 bilaterally dynamic stabilization was performed and operation was completed ( fig . spondylolisthesis is one of the reasons of low back and leg pain with most often compression of l4 , l5 , and s1 nerve roots7 ) . the nerve root compression within the foramina is the main problem in patients with spondylolisthesis who has radicular signs . especially in patients who have degenerative spondylolisthesis or low - grade dysplastic type spondylolisthesis , foraminal stenosis gets worse in time due to disruption of the disc . the volume of the foraminal space starts to decrease when sliding of vertebra begins , and this decrease gets worse in time with destruction of the disc28 ) . thus , all these changes lead to pain and numbness after the decrease of foraminal volume and compression of the nerve root . in this techniqule , removing of the pedicles in both sides will give extra place to the nerve roots via additionally unroofing the neural foramens . the removal of the lamina and inferior facet joints together with the pedicle leads to decompression of both upper and lower nerve roots . in patients who have degenerative spondylolisthesis or spondylolisthesis with low severity index , stabilization can be provided using with any transpedicular dynamic stabilization systems if they have spontaneous fusion in slipped segment . the pedicles of the l4 vertebra are used for screw insertion for patients who have l5-s1 spondylolisthesis . in classical approach , to restore the disc height and realignment of the motion segment with interbody fusion and posterior transpedicular instrumentation may solve the problem . we know that , in elderly patient these operations have potential risks as pseudoarthrosis , infection and adjacent segment disease . the presence of osteoporosis is also a problem to achieve a solid fusion in those patients . moreover , if the patients have no balance problem in both degenerative spondylolisthesis and low - dysplastic developmental spondylolisthesis , restoration of the alignment is not necessary . in these patients , the nerve roots still get crushed in the foramens , and the problem still persists even sometimes worsens . it is known that , spontaneous fusion occurs between the bodies of vertebra over the years in some patients . gill 's procedure has been proposed in such cases , however only unroofing the foramens do not resolve the problem because of the compression between the pedicle , and posterior part of thevertebra1 ) . the fusion surgery is also suitable in these patients after pedicle and facet removal for decompression . however , this is a simple and safe operation when one compares with fusion procedures . advantages of this technique are early mobilization , less painful period and participation in social life in a short time . hospital cost is also low than fusion operations . the dynamic stabilization instead of fusion also prevents the risks pseudoarthrosis and adjacent segment disease in these patients3 ) . we believe that this procedure is suitable as an alternative surgical technique in patients who have degenerative spondylolisthesis or low - grade dysplastic type spondylolisthesis with radicular signs secondary to nerve root compression in decreased neural foramina . the decrease in disc height causes compression of nerve root in neural foramen and this leads clinical symptoms . the application of posterior dynamic stabilization to support posterior tension band together with decompression procedure offers the optimal physiologic treatment modality . | it is well known that the cause of radiculopathy is the compression of the nerve root within the foramina which is narrowed secondary to sliding of the corpus and reduced disc height . in some patients , unroofing the foramen does not resolve this problem .
we described a new decompression technique using pedicle removal and transpedicular dynamic instrumentation to stabilization the spine .
we performed this operation in 2 patients and achieved very good results . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lymphoblastoid cell lines ( lcls ) , immortalized by epstein - barr virus transformation of lymphocytes isolated from whole blood , were derived from european - american participants in the cap trial , a six - week 40mg / day simvastatin trial ( supplementary table 8) . ( whitehouse station , nj ) , converted to active form ( beta - hydroxy simvastatin acid , sva ) and quantified by liquid chromatography - tandem mass spectrometry as described . lcls were normalized to a uniform cell density and exposed to 2m sva ( simvastatin - exposed ) or control buffer ( control - exposed ) for twenty - four hours as described . this concentration was selected by assessing dose - response effects on expression profiles ( n=8 lcls at 4 doses ) , wherein a more robust change in expression profiles was observed with 2m simvastatin exposure ( 7.8% of genes , q=0.001 ) than lower doses ( < 0.1% of genes for 0.02m or 0.2m , q=0.001 , data not shown ) . pre - experiment cell density was recorded as a surrogate for cell growth rate . following exposure , cells were lysed in rnalater ( ambion ) , and rna was isolated using the qiagen miniprep rna isolation kit with column dnase treatment . rna quality and quantity were assessed by nanodrop nd-1000 spectrophotometer and agilent bioanalyzer , respectively . paired rna samples , selected based on rna quality and quantity , were amplified and biotin labeled using the illumina totalprep-96 rna amplification kit , hybridized to illumina humanref-8v3 beadarrays ( illumina ) , and scanned using an illumina beadxpress reader . data were read into genomestudio and samples were selected for inclusion based on quality control criteria : ( 1 ) signal to noise ratio ( 95:5 percentiles ) , ( 2 ) matched gender between sample and data , and ( 3 ) average correlation of expression profiles within three standard deviations of the within - group mean ( r=0.990.0093 for control - exposed and r=0.980.0071 for simvastatin - exposed beadarrays ) . in total , viable expression data were obtained from 1040 beadarrays including 480 sets of paired samples for 10195 genes . treatment specific effects were modeled from the data following adjustment for known covariates using linear regression . ontological enrichment in differentially expressed gene sets was measured using gsea ( 1000 permutations by phenotype ) using gene sets representing gene ontology biological processes as described in the molecular signatures v3.0 c5 database ( 10 - 500 genes / set ) . for association mapping , we use a bayesian approach implemented in the software package bimbam that is robust to poor imputation and small minor allele frequencies . gene expression data were normalized as described in the supplementary methods for the control - treated ( c480 ) and simvastatin - treated ( t480 ) data and used to compute d480 = t480 - c480 and s480 = t480 + c480 , where t480 is the adjusted simvastatin - treated data and c480 is the adjusted control - treated data . to identify eqtls and deqtls , we measured the strength of association between each snp and gene in each analysis ( control - treated , simvastatin - treated , averaged , and difference ) using bimbam with default parameters . bimbam computes the bayes factor ( bf ) for an additive or dominant response in expression data as compared with the null , which is that there is no correlation between that gene and that snp . bimbam averages the bf over four plausible prior distributions on the effect sizes of additive and dominant models . we used a permutation analysis ( see supplementary methods ) to determine cutoffs for eqtls in the averaged analysis ( s480 ) at an fdr of 1% for cis - eqtls ( log10 bf > 3.24 ) and trans - eqtls ( log10 bf > 7.20 ) . for cis - eqtls , we considered the largest log10bf above the cis - cutoff for any snp within 1 mb of the transcription start site or the transcription end site of the gene under consideration . for trans - eqtls , we considered the largest log10bf above the trans - cutoff for any snp , and if that snp was in the cis - neighborhood of the gene being tested , we ignored any potential trans - associations ; there were 6130 for which the snp with the largest log10bf was not in cis with the associated gene . correspondingly , we only considered those 6130 genes when computing the permutation - based fdr for the trans - associations . we define cis - snps as being within 1 mb of the transcription start site or end site of that gene . to identify differential eqtls , we first computed associations between all snps and the log fold change using bimbam as above . 3 indicate that there are a few possible patterns of differential association . while these patterns may have different mechanistic or phenotypic interpretations , they are not distinguished by a test of log fold change . we used the interaction models introduced in maranville et al . to compute the statistical support ( assessed with bayes factors , or bfs ) for the four alternative eqtl models described in results versus the null model ( no association with genotype ) . these methods are based on a bivariate normal model for the treated data ( t ) and control - treated data ( u ) . note that simply quantile transforming t and u to a standard normal distribution is not sufficient to ensure that they are jointly bivariate normal , and so we employed the following more extensive normalization procedure . let d = qt - qu and s = qt+qu , where q indicates that the vector following it has been quantile normalized . we then quantile normalize and scale d and s to produce s = ( sqs ) and d = ( dqd ) , where s , d are robust estimates of the standard deviations of s and d respectively ( specifically , they are the median absolute deviation multiplied by 1.4826 ) . note that this transformation ensures that s and d are univariate normal . . finally let u = ( s d ) and t = ( s + d ) . the bf when the eqtl effect is identical in the two conditions ( model 1 ) uses the linear model l(s ~ d + g ) , where g is the vector of genotypes at a single snp . the bf when the eqtl is only present in the control - treated samples ( model 2 ) uses the model l(u ~ t + g ) . the bf when the eqtl is only present in the simvastatin - treated samples ( model 3 ) uses the model l(t ~ u + g ) . the bf when the eqtl effect is in the same direction but unequal in strength ( model 4 ) uses the model l(d ~ s + g ) . we averaged each bf for each gene and each cis - snp over four plausible effect size priors ( 0.05 , 0.1 , 0.2 , 0.4 ) . to find eqtls that interact with treatment ( i.e. , conform best to one of the differential models 2 - 4 , rather than the null model or the stable model ) we defined an interaction bayes factor ( ibf ) as ibf = 2(bf2 + bf3 + bf4 ) / 3(bf1 + 1 ) , where bfi denotes the bf for model i compared with the null model ( the 1 in the denominator represents the null model bf0 ) . large values of the ibf represent strong support for at least one interaction model ( 2 - 4 ) compared with the two non - interacting models ( 0 - 1 ) , and hence strong support for a differential association . marshfield cohort : cases of myopathy were identified from electronic medical records of patients treated at the marshfield clinic ( wisconsin , usa ) using a combination of automated natural language processing and manual review as described . 72 cases of incipient myopathy ( creatine kinase concentrations > 3-fold normal with evidence in the charts of muscle complaints ) were identified for which patients were not also undergoing treatment with concomitant drugs known to increase incidence of statin - induced myopathy ( fibrates or niacin ) . the study population included residents living in central and northern wisconsin , served by the marshfield clinic , a large multispecialty group practice . search and heart protection study collaborative groups : a total of 100 myopathy cases were identified from participants with genotyping data in the search trial , including 39 definite myopathy cases ( creatine kinase > 10 uln with muscle symptoms ) and 61 incipient myopathy cases ( defined as creatine kinase 5.0 times baseline value and alanine transaminase 1.7 times baseline value and creatine kinase > 3.0 uln ) . genotypes were available from the illumina human610-quad beadchip for 25 myopathy cases ( 12% of which had definite myopathy ) and from the illumina humanhap300-duo beadchip for 75 myopathy cases ( 48% of which had definite myopathy ) . genotypes for rs9806699 were only available in individuals genotyped on the illumina human610-quad beadchip so proxy snps were used . all myopathy cases were compliant with statin therapy ( 95 myopathy cases occurred whilst the patient was taking simvastatin 80 mg daily , and 5 cases whilst taking simvastatin 20 mg daily ) . controls were identified from the search study and the heart protection study as well as from the heart protection study ( where considerably more participants had been genotyped ) . controls from the heart protection study had similar baseline characteristics to those in the search study and inclusion of this large number of additional controls improved statistical power . multicentre ethics approval was obtained from the south east research ethics committee for the search study , and from the local ethics committees covering each of the 69 uk hospitals involved in the heart protection study . meta - analysis was performed using a random effects model and , for bayesian analysis , considering an expected effect size to 0.2 . associations of rs9806699 with plasma creatine kinase in the cap and jupiter trials were also assessed using linear regression . the cap trial ( clinicaltrials.gov number , nct00451828 ) was approved by the institutional review boards located at children s hospital oakland research institute ( oakland , ca ) and all enrollment sites . the jupiter trial ( clinicaltrials.gov number , nct00239681 ) was approved by the institutional review board of brigham and women s hospital . gatm knockdown was achieved by 48-hour transfection of ambion silence select sirna or non - targeting control into 80,000 hepg2 or huh7 cells / well in 12-well plates . to assess the influence of sterol depletion , cell culture media was replaced with media containing 10% lipoprotein deficient serum ( hyclone ) or fetal bovine serum ( omega scientific ) at 24-hr transfection . cell culture media was collected from all samples at time of harvest , and apob ( mp biomedicals ) , apoai ( meridian life sciences ) , and apoe ( biodesign ) were quantified in triplicate by sandwich - style elisa . lymphoblastoid cell lines ( lcls ) , immortalized by epstein - barr virus transformation of lymphocytes isolated from whole blood , were derived from european - american participants in the cap trial , a six - week 40mg / day simvastatin trial ( supplementary table 8) . ( whitehouse station , nj ) , converted to active form ( beta - hydroxy simvastatin acid , sva ) and quantified by liquid chromatography - tandem mass spectrometry as described . lcls were normalized to a uniform cell density and exposed to 2m sva ( simvastatin - exposed ) or control buffer ( control - exposed ) for twenty - four hours as described . this concentration was selected by assessing dose - response effects on expression profiles ( n=8 lcls at 4 doses ) , wherein a more robust change in expression profiles was observed with 2m simvastatin exposure ( 7.8% of genes , q=0.001 ) than lower doses ( < 0.1% of genes for 0.02m or 0.2m , q=0.001 , data not shown ) . pre - experiment cell density was recorded as a surrogate for cell growth rate . following exposure , cells were lysed in rnalater ( ambion ) , and rna was isolated using the qiagen miniprep rna isolation kit with column dnase treatment . rna quality and quantity were assessed by nanodrop nd-1000 spectrophotometer and agilent bioanalyzer , respectively . paired rna samples , selected based on rna quality and quantity , were amplified and biotin labeled using the illumina totalprep-96 rna amplification kit , hybridized to illumina humanref-8v3 beadarrays ( illumina ) , and scanned using an illumina beadxpress reader . data were read into genomestudio and samples were selected for inclusion based on quality control criteria : ( 1 ) signal to noise ratio ( 95:5 percentiles ) , ( 2 ) matched gender between sample and data , and ( 3 ) average correlation of expression profiles within three standard deviations of the within - group mean ( r=0.990.0093 for control - exposed and r=0.980.0071 for simvastatin - exposed beadarrays ) . in total , viable expression data were obtained from 1040 beadarrays including 480 sets of paired samples for 10195 genes . treatment specific effects were modeled from the data following adjustment for known covariates using linear regression . ontological enrichment in differentially expressed gene sets was measured using gsea ( 1000 permutations by phenotype ) using gene sets representing gene ontology biological processes as described in the molecular signatures v3.0 c5 database ( 10 - 500 genes / set ) . for association mapping , we use a bayesian approach implemented in the software package bimbam that is robust to poor imputation and small minor allele frequencies . gene expression data were normalized as described in the supplementary methods for the control - treated ( c480 ) and simvastatin - treated ( t480 ) data and used to compute d480 = t480 - c480 and s480 = t480 + c480 , where t480 is the adjusted simvastatin - treated data and c480 is the adjusted control - treated data . to identify eqtls and deqtls , we measured the strength of association between each snp and gene in each analysis ( control - treated , simvastatin - treated , averaged , and difference ) using bimbam with default parameters . bimbam computes the bayes factor ( bf ) for an additive or dominant response in expression data as compared with the null , which is that there is no correlation between that gene and that snp . bimbam averages the bf over four plausible prior distributions on the effect sizes of additive and dominant models . we used a permutation analysis ( see supplementary methods ) to determine cutoffs for eqtls in the averaged analysis ( s480 ) at an fdr of 1% for cis - eqtls ( log10 bf > 3.24 ) and trans - eqtls ( log10 bf > 7.20 ) . for cis - eqtls , we considered the largest log10bf above the cis - cutoff for any snp within 1 mb of the transcription start site or the transcription end site of the gene under consideration . for trans - eqtls , we considered the largest log10bf above the trans - cutoff for any snp , and if that snp was in the cis - neighborhood of the gene being tested , we ignored any potential trans - associations ; there were 6130 for which the snp with the largest log10bf was not in cis with the associated gene . correspondingly , we only considered those 6130 genes when computing the permutation - based fdr for the trans - associations . we define cis - snps as being within 1 mb of the transcription start site or end site of that gene . to identify differential eqtls , we first computed associations between all snps and the log fold change using bimbam as above . while these patterns may have different mechanistic or phenotypic interpretations , they are not distinguished by a test of log fold change . we used the interaction models introduced in maranville et al . to compute the statistical support ( assessed with bayes factors , or bfs ) for the four alternative eqtl models described in results versus the null model ( no association with genotype ) . these methods are based on a bivariate normal model for the treated data ( t ) and control - treated data ( u ) . note that simply quantile transforming t and u to a standard normal distribution is not sufficient to ensure that they are jointly bivariate normal , and so we employed the following more extensive normalization procedure . let d = qt - qu and s = qt+qu , where q indicates that the vector following it has been quantile normalized . we then quantile normalize and scale d and s to produce s = ( sqs ) and d = ( dqd ) , where s , d are robust estimates of the standard deviations of s and d respectively ( specifically , they are the median absolute deviation multiplied by 1.4826 ) . note that this transformation ensures that s and d are univariate normal . . finally let u = ( s d ) and t = ( s + d ) . the bf when the eqtl effect is identical in the two conditions ( model 1 ) uses the linear model l(s ~ d + g ) , where g is the vector of genotypes at a single snp . the bf when the eqtl is only present in the control - treated samples ( model 2 ) uses the model l(u ~ t + g ) . the bf when the eqtl is only present in the simvastatin - treated samples ( model 3 ) uses the model l(t ~ u + g ) . the bf when the eqtl effect is in the same direction but unequal in strength ( model 4 ) uses the model l(d ~ s + g ) . we averaged each bf for each gene and each cis - snp over four plausible effect size priors ( 0.05 , 0.1 , 0.2 , 0.4 ) . to find eqtls that interact with treatment ( i.e. , conform best to one of the differential models 2 - 4 , rather than the null model or the stable model ) we defined an interaction bayes factor ( ibf ) as ibf = 2(bf2 + bf3 + bf4 ) / 3(bf1 + 1 ) , where bfi denotes the bf for model i compared with the null model ( the 1 in the denominator represents the null model bf0 ) . large values of the ibf represent strong support for at least one interaction model ( 2 - 4 ) compared with the two non - interacting models ( 0 - 1 ) , and hence strong support for a differential association . marshfield cohort : cases of myopathy were identified from electronic medical records of patients treated at the marshfield clinic ( wisconsin , usa ) using a combination of automated natural language processing and manual review as described . 72 cases of incipient myopathy ( creatine kinase concentrations > 3-fold normal with evidence in the charts of muscle complaints ) were identified for which patients were not also undergoing treatment with concomitant drugs known to increase incidence of statin - induced myopathy ( fibrates or niacin ) . the study population included residents living in central and northern wisconsin , served by the marshfield clinic , a large multispecialty group practice . search and heart protection study collaborative groups : a total of 100 myopathy cases were identified from participants with genotyping data in the search trial , including 39 definite myopathy cases ( creatine kinase > 10 uln with muscle symptoms ) and 61 incipient myopathy cases ( defined as creatine kinase 5.0 times baseline value and alanine transaminase 1.7 times baseline value and creatine kinase > 3.0 uln ) . genotypes were available from the illumina human610-quad beadchip for 25 myopathy cases ( 12% of which had definite myopathy ) and from the illumina humanhap300-duo beadchip for 75 myopathy cases ( 48% of which had definite myopathy ) . genotypes for rs9806699 were only available in individuals genotyped on the illumina human610-quad beadchip so proxy snps were used . all myopathy cases were compliant with statin therapy ( 95 myopathy cases occurred whilst the patient was taking simvastatin 80 mg daily , and 5 cases whilst taking simvastatin 20 mg daily ) . controls were identified from the search study and the heart protection study as well as from the heart protection study ( where considerably more participants had been genotyped ) . controls from the heart protection study had similar baseline characteristics to those in the search study and inclusion of this large number of additional controls improved statistical power . multicentre ethics approval was obtained from the south east research ethics committee for the search study , and from the local ethics committees covering each of the 69 uk hospitals involved in the heart protection study . meta - analysis was performed using a random effects model and , for bayesian analysis , considering an expected effect size to 0.2 . associations of rs9806699 with plasma creatine kinase in the cap and jupiter trials were also assessed using linear regression . the cap trial ( clinicaltrials.gov number , nct00451828 ) was approved by the institutional review boards located at children s hospital oakland research institute ( oakland , ca ) and all enrollment sites . the jupiter trial ( clinicaltrials.gov number , nct00239681 ) was approved by the institutional review board of brigham and women s hospital . gatm knockdown was achieved by 48-hour transfection of ambion silence select sirna or non - targeting control into 80,000 hepg2 or huh7 cells / well in 12-well plates . to assess the influence of sterol depletion , cell culture media was replaced with media containing 10% lipoprotein deficient serum ( hyclone ) or fetal bovine serum ( omega scientific ) at 24-hr transfection . cell culture media was collected from all samples at time of harvest , and apob ( mp biomedicals ) , apoai ( meridian life sciences ) , and apoe ( biodesign ) were quantified in triplicate by sandwich - style elisa . | statins are widely prescribed for lowering plasma low - density lipoprotein ( ldl ) concentrations and cardiovascular disease risk1 , but there is considerable interindividual variation in treatment response2,3 and increasing concern regarding the potential for adverse effects , including myopathy4 and type 2 diabetes5 .
despite evidence for substantial genetic influence on ldl concentrations6 , pharmacogenomic trials have failed to identify genetic variations with large effects on either statin efficacy7 - 9 or toxicity10 , and have yielded little information regarding mechanisms that modulate statin response . here
we identify a downstream target of statin treatment by screening for the effects of in vitro statin exposure on genetic associations with gene expression levels in lymphoblastoid cell lines derived from 480 participants of a clinical trial of simvastatin treatment7 .
this analysis identified six expression quantitative trait loci ( eqtls ) that interacted with simvastatin exposure including rs9806699 , a cis - eqtl for the gene gatm that encodes glycine amidinotransferase , a rate - limiting enzyme in creatine synthesis .
we found this locus to be associated with incidence of statin - induced myotoxicity in two separate populations ( meta - analysis odds ratio = 0.60 , 95% confidence interval = 0.45 - 0.81 , p=6.010 - 4 ) .
furthermore , we found that gatm knockdown in hepatocyte - derived cell lines attenuated transcriptional response to sterol depletion , demonstrating that gatm may act as a functional link between statin - mediated cholesterol lowering and susceptibility to statin - induced myopathy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the patent data are a valuable resource , not only for the intellectual property world but also for the scientific community ( 1,2 ) . during the past 15 years , the number of biological sequences appearing in patent documents has been increasing constantly ( 3 ) . today , > 30 million nucleotide and protein sequences extracted from patent documents are available in the public domain ( shown by the black lines in figure 1 ) . searching this large amount of patent sequence data has become one of the key approaches in patent - related studies ( 4,5 ) . proprietary data also exist from the commercial sector providing alternative annotations of patent sequence data , such as geneseq ( thomson reuters , http://thomsonreuters.com/products_services/science/science_products/a-z/geneseq/ ) , gq - pat ( genomequest , http://wiki.genomequest.com/index.php/gq_pat ) , usgene(sequencebase , http://www.sequencebase.com/usgene-sequences-database ) , but these require commercial licenses , which impose usage restrictions on the data . the left - side y - axis shows the number of sequence entries ; the right - side y - axis indicates the number of patents and patent families ; the x - axis represents the release timeline . the black lines show the increasing number of source biological sequences ; other coloured lines illustrate the trends of the nr patent sequence databases following the increase in source data . note : the number of entries of level-2 clusters ( nrnl2 and nrpl2 ) can decrease due to deletions and merging of patent family assignments and patent corrections , for example , in the cases of release 10 ( oct 2011 ) and release 13 ( oct 2012 ) . the left - side y - axis shows the number of sequence entries ; the right - side y - axis indicates the number of patents and patent families ; the x - axis represents the release timeline . the black lines show the increasing number of source biological sequences ; other coloured lines illustrate the trends of the nr patent sequence databases following the increase in source data . note : the number of entries of level-2 clusters ( nrnl2 and nrpl2 ) can decrease due to deletions and merging of patent family assignments and patent corrections , for example , in the cases of release 10 ( oct 2011 ) and release 13 ( oct 2012 ) . the embl - european bioinformatics institute ( embl - ebi ) offers free and unrestricted access to patent sequence resources , providing a valuable service to the intellectual property and bioscience communities ( 6 ) . the two - level non - redundant ( nr ) patent sequence databases , based on sequence identity and patent family clusters , are comprehensive repositories for patent information on nucleotide and protein sequences provided by the european patent office ( epo ) , the us patent and trademark office ( uspto ) , the japanese patent office ( jpo ) and the korean intellectual property office ( kipo ) and include the world intellectual property organization ( wipo ) patents from these offices . the nr patent sequences are enriched with biological annotation and additional data from patent documents . these databases , serving as a repository of scientific innovation and inspiration , are an important resource for patent - related searches , especially for determining potential commercial use of biological sequences and their patentability . in this article , we describe the sequence collection and annotation of the nr patent sequence databases , and introduce improvements and development of the databases over the past 3 years . the nr patent sequence data sources cover nucleotide and protein sequences in patent applications from the epo , the jpo , the kipo and the uspto . the patent sequence data deposited to ena ( 7 ) , genbank ( 8) or the ddbj ( 9 ) are exchanged between these databases through the international nucleotide sequence database collaboration ( figure 2a ) . sequence submissions by the inventors can be made as part of the patent application process using tools , such as bissap ( http://www.epo.org/bissap/ ) , an application developed to facilitate the creation of sequence listings ( wipo st.25 and proposed xml format ) for patent applications containing biological sequences by the epo in collaboration with national patent offices and the embl - ebi . ( a ) data sources consist of patent sequences from the patent offices of the epo , the jpo , the kipo and the uspto , as well as the patent family data from the ops . the resulting databases include the sequence clusters level-1 ( nrnl1 , nrpl1 , epopnr , jpopnr , kpopnr and uspopnr ) and level-2 ( nrnl2 and nrpl2 ) , the patent equivalent database and other relevant result files . ( c ) data access through ftp , dbfetch , srs , ebi - search and sss ( sequence similarity / homology search ) . data flow for the nr patent sequence databases . ( a ) data sources consist of patent sequences from the patent offices of the epo , the jpo , the kipo and the uspto , as well as the patent family data from the ops . the resulting databases include the sequence clusters level-1 ( nrnl1 , nrpl1 , epopnr , jpopnr , kpopnr and uspopnr ) and level-2 ( nrnl2 and nrpl2 ) , the patent equivalent database and other relevant result files . ( c ) data access through ftp , dbfetch , srs , ebi - search and sss ( sequence similarity / homology search ) . the nr patent sequence databases have been created at two levels to remove sequence redundancy by using sequence md5 ( message - digest algorithm 5 , http://www.faqs.org/rfcs/rfc1321.html ) checksums and patent family information , comprising nr patent nucleotides level-1 and -2 and nr patent proteins level-1 and -2 . level-1 sequences are 100% identical over their entire lengths , arising from either the same or different patent families ; level-2 sequences are 100% patent family information for source sequences is retrieved from the epo open patent services ( ops ) ( 10 ) . level-1 databases include nr nucleotide patent sequence clusters level-1 ( nrnl1 ) , nr protein patent sequence clusters level-1 ( nrpl1 ) and nr protein patent sequence clusters from individual patent offices ( epopnr for the epo , jpopnr for the jpo , kpopnr for the kipo and uspopnr for the uspto ) . level-2 databases contain nr nucleotide patent sequence clusters level-2 ( nrnl2 ) and nr protein patent sequence clusters level-2 ( nrpl2 ) ( figure 2b ) . the method used to remove sequence redundancy is detailed in an article by li et al . the patent equivalents database is also developed to provide patent family information extracted from the ops service for the sequences collected in this study ( figure 2b ) . in patents , a right of priority is a time - limited right triggered by the first filing of a patent application ; a patent family refers to several patent applications or publications for an individual invention , claiming exactly the same priority or priorities ; all of these family equivalents are related to each other by common priority numbers and associated priority dates ( http://www.epo.org/searching/essentials/patent-families/about.html ) . the family information in the database covers patent family numbers , patent priority , master publications , patent equivalents , subsequent publication levels and patent classification . the annotation of the nr sequences comprises cluster member annotation , patent family information and biological features . the cluster member annotation includes source sequence information , e.g. identifier ( i d ) , molecular type , sequence length , source database , patent number and a general description . the patent family information consists of family number , master publication , patent priority , earliest publication date and the epo and international classifications . the earliest publication date is determined to identify relevant prior art of the patent by comparing the patent publication dates of all the members of a nr sequence cluster . the biological features contain information on organisms , coding sequence regions , genes , variations , combined for both contig and singleton members . this combined annotation allows better exploration of the original patent applications for related intellectual property data . it also provides better cross - references to external data resources and improves the biological context at the sequence level . the nr patent sequence databases are released every 3 or 4 months , but usually following embl - bank s quarterly release cycles . the current release ( release 13 , oct 2012 ) contains 12 279 969 nrnl1 , 14 920 929 nrnl2 , 2 580 442 nrpl1 and 3 697 317 nrpl2 , 2.4- , 2.2- , 1.9- and 1.6-fold in size compared with the first release of nrnl1 , nrnl2 , nrpl1 and nrpl2 , respectively , covering over 6 571 318 proteins and 24 364 832 nucleotides from 184 447 patents ( 130 538 unique patent families ) , which are provided by the patent offices of the epo , the jpo , the kipo and the uspto ( table 1 , figure 1 ) . the data coverage is slightly larger than the commercial patent sequence database geneseq , which included > 27 million sequences from > 150 000 patents in oct 2012 ( http://thomsonreuters.com/products_services/science/science_products/a-z/geneseq/ ) . table 1summary of the nr patent sequences and the patent families in release 13number of entriesredundancy beforepatent nucleotides24 364 832 nrnl112 279 9691.98 nrnl214 920 9292.22patent proteins6 571 318 nrpl12 580 4421.88 nrpl23 697 3171.62patents184 447unique patent families130 5381.41 summary of the nr patent sequences and the patent families in release 13 patent publication numbers , sequence kind - codes and patent equivalents are corrected or updated in each release using the latest patent family data from the epo s ops . across all releases , 43 111 patent numbers and 14 330 sequence kind - codes have been corrected ; 102 227 patent numbers have been involved in the patent family assignment . the corrected publication numbers link to the correct full - text patent documents ; the corrected publication kind codes and the publication levels indicate the legal status and progress through the patent application process . the i d mappings between level-1 and level-2 databases have been generated since release 10 to clearly illustrate how identical sequences from level-1 databases are mapped to level-2 database entries according to their patent family information . figure 3 has two examples that illustrate how sequences from level-1 nucleotide and protein sequences are clustered into level-2 entries . these mappings offer a useful explanation of the relationship between identical sequences within or outside of a patent family . ( a ) the nrnl1 entry nrn_ax241249 contains five member sequences , which are 100% identical over their full - length but clustered into four nrnl2 entries according to their patent family information : nrn00208e35 ( family number 22673211 , containing the member sequences ax241249 and dj381174 ) , nrn00208e36 ( family number 27401191 , containg the member sequence ax487735 ) , nrn00208e37 ( family number 32911719 , containing the member sequence ar579342 ) and nrn00208e38 ( di090734 as member sequence and family number unknown ) . ( b ) the nrpl1 entry nrp_ax240833 contains four member sequences that are clustered into three nrpl2 entries according to their patent family information . ( a ) the nrnl1 entry nrn_ax241249 contains five member sequences , which are 100% identical over their full - length but clustered into four nrnl2 entries according to their patent family information : nrn00208e35 ( family number 22673211 , containing the member sequences ax241249 and dj381174 ) , nrn00208e36 ( family number 27401191 , containg the member sequence ax487735 ) , nrn00208e37 ( family number 32911719 , containing the member sequence ar579342 ) and nrn00208e38 ( di090734 as member sequence and family number unknown ) . ( b ) the nrpl1 entry nrp_ax240833 contains four member sequences that are clustered into three nrpl2 entries according to their patent family information . members of level-2 clusters in an old release can move to other clusters in a new release . the i d versioning has been provided since release 6 for direct tracking of entry history . this functionality is necessary for recovering information from old entries that have moved or have become obsolete in a new release . data access to the nr patent sequence resources has become more and more important to the user community as the volume of sequence data increases . the nr patent sequence databases can be accessed through four major routes ( figure 2c ) at embl - ebi :
the flat files can be downloaded through the databases website ( http://www.ebi.ac.uk/patentdata/nr/ ) and through the ftp site ( ftp://ftp.ebi.ac.uk/pub/databases/patentdata/).the embl - like formatted annotation data can be retrieved on a per - accession through the dbfetch / wsdbfetch service ( http://www.ebi.ac.uk/tools/dbfetch/dbfetch/ ) and also through the srs server ( http://srs.ebi.ac.uk/).sequence similarity / homology searches including fasta ( 11 ) , blast ( 12,13 ) and psi - search ( 14 ) against the databases are available through the web form submissions ( http://www.ebi.ac.uk/tools/sss/ ) and also through the corresponding embl - ebi soap / rest web services ( 15).keyword searches can be made using the ebi - search engine ( 16 ) through both a web form ( http://www.ebi.ac.uk/ebisearch ) and the corresponding soap web services . the flat files can be downloaded through the databases website ( http://www.ebi.ac.uk/patentdata/nr/ ) and through the ftp site ( ftp://ftp.ebi.ac.uk/pub/databases/patentdata/ ) . the embl - like formatted annotation data can be retrieved on a per - accession through the dbfetch / wsdbfetch service ( http://www.ebi.ac.uk/tools/dbfetch/dbfetch/ ) and also through the srs server ( http://srs.ebi.ac.uk/ ) . sequence similarity / homology searches including fasta ( 11 ) , blast ( 12,13 ) and psi - search ( 14 ) against the databases are available through the web form submissions ( http://www.ebi.ac.uk/tools/sss/ ) and also through the corresponding embl - ebi soap / rest web services ( 15 ) . keyword searches can be made using the ebi - search engine ( 16 ) through both a web form ( http://www.ebi.ac.uk/ebisearch ) and the corresponding soap web services . approximately 10 000 sequence similarity / homology searches were performed using the databases during 2010 . this grew to > 36 000 searches in 2011 , and it is estimated that 37 500 searches will have taken place during 2012 . the same trend is seen for data retrieval via dbfetch / wsdbfetch , which have grown from 450 000 in 2011 to a projected 510 000 for 2012 . ftp downloads of these sequence data have also grown from 394 downloads in 2011 to a projected 540 for 2012 . the nr patent sequence databases are the first publicly available collection of nr patent sequences , at both the sequence and patent - family levels . other efforts in the public domain have been made to collate nr patent sequence data to improve access and use of these data , such as patgen ( 17 ) and patome ( 18 ) . unfortunately , patgen is no longer available online ; the sequence redundancy in patome was defined according to the patent number and the sequence i d in the sequence listing . as a result , identical sequences granted with different patent numbers by different patent offices are not classified . sequence similarity / homology searching against the nr patent sequence databases has become a fundamental approach in patent - related studies . searches against nr sequences are faster and more sensitive than the equivalent searches against redundant libraries , and the search results are easier to interpret . searches against level-1 clusters can result in identical or similar patent sequences ; searches against level-2 clusters can result in identical or similar sequences from the same invention . these searches can be used to find the published patents that cite a sequence and the patent families associated with a sequence , to discover the earliest priority data and the equivalents of a patent family , and to retrieve biological annotation extracted from patent documents . the nr patent sequence databases are an important resource for patent - related searches , especially for determining potential commercial use of biological sequences . the earliest publication dates offer direct tracking of patent - application history , enabling effective searches on prior art . the corrections on the publication numbers and kind codes enhance the data quality , enabling proper cross - referencing to full - text patent documents . for example , to broaden data coverage by including data from other national and regional patent offices , to shorten the release cycle to a monthly schedule and to integrate cross - references to claimed sequences and provide claimed status . currently , users can download the i d history tables to track entry changes , such as status , and entry additions , deletions , merging and unmerging ; in the future , an online searchable system will be implemented . this work has been supported by european molecular biology laboratory ( embl ) and the european patent office ( epo ) . | the embl - european bioinformatics institute ( embl - ebi ) offers public access to patent sequence data , providing a valuable service to the intellectual property and scientific communities .
the non - redundant ( nr ) patent sequence databases comprise two - level nucleotide and protein sequence clusters ( nrnl1 , nrnl2 , nrpl1 and nrpl2 ) based on sequence identity ( level-1 ) and patent family ( level-2 ) .
annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context .
corrections in patent publication numbers , kind - codes and patent equivalents significantly improve the data quality .
data are available through various user interfaces including web browser , downloads via ftp , srs , dbfetch and ebi - search .
sequence similarity / homology searches against the databases are available using blast , fasta and psi - search . in this article
, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009 .
apart from data growth , these changes include additional annotation for singleton clusters , the identifier versioning for tracking entry change and the entry mappings between the two - level databases.database url :
http://www.ebi.ac.uk/patentdata/nr/ |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the proposed study was submitted for ethical committee approval and the same was approved based on icmr guidelines . a total of 154 patients who attended department of orthodontics for fixed orthodontic appliance treatment were selected . patients and their parents were informed about the procedure and informed consent was obtained for the same . a detailed case history which included past dental , past medical , allergic to any specific drugs the selection criteria were as follows :
should be in the age group of 14 - 21 yearsno previous orthodontic treatmentshould not be under any medication for systemic problems.should not be allergic to nsaid'sshould not have a history of asthma , gastritis , bleeding disordersno teeth extraction at least 2 weeks before or after separator placementshould not have any missing teeth .
should be in the age group of 14 - 21 years no previous orthodontic treatment should not be under any medication for systemic problems . should not be allergic to nsaid 's should not have a history of asthma , gastritis , bleeding disorders no teeth extraction at least 2 weeks before or after separator placement should not have any missing teeth . group 1 : paracetamol 650 mggroup 2 : ibuprofen 400 mggroup 3 : aspirin 300 mggroup 4 : placebo . group 1 : paracetamol 650 mg group 2 : ibuprofen 400 mg group 3 : aspirin 300 mg the patients and the research assistant were blind to experimental groups . the patients were instructed to take two tablets , one tablet 1 h before separator placement and the other one after 6 h. separators ( alastik s-2 separator modules , 3 m unitek , monrovia , calif ) were placed for first molars in all 4 quadrants preferably in the morning between 10 a.m. and 12 noon . all patients were provided with a questionnaire which is in a form of seven page booklet that contained 100 mm horizontal visual analog scale ( vas ) . the patients were advised to mark the degree of pain as per the instructed time period in vas . pain intensity was recorded by the patients 2 h , 6 h after separator placement , bed time on the day of appointment , next day morning , and 2 day morning , 3 day , 7 day morning after separator placement . patients were advised to record the severity of pain with teeth not touching ( tnt ) , biting back teeth ( bbt ) together , and chewing food ( cf ) . patients who did not take the given drug or who did not completely fill the questionnaire or who lost / removed the separators were excluded from the study . the above data 's were subjected to statistical analysis using spss ibm version 20 ( chicago , usa ) systems . descriptive measures like mean values and standard deviations for continuous variables and percentage for categorical variables were calculated . the proposed study was submitted for ethical committee approval and the same was approved based on icmr guidelines . a total of 154 patients who attended department of orthodontics for fixed orthodontic appliance treatment were selected . patients and their parents were informed about the procedure and informed consent was obtained for the same . a detailed case history which included past dental , past medical , allergic to any specific drugs the selection criteria were as follows :
should be in the age group of 14 - 21 yearsno previous orthodontic treatmentshould not be under any medication for systemic problems.should not be allergic to nsaid'sshould not have a history of asthma , gastritis , bleeding disordersno teeth extraction at least 2 weeks before or after separator placementshould not have any missing teeth .
should be in the age group of 14 - 21 years no previous orthodontic treatment should not be under any medication for systemic problems . should not be allergic to nsaid 's should not have a history of asthma , gastritis , bleeding disorders no teeth extraction at least 2 weeks before or after separator placement should not have any missing teeth . group 1 : paracetamol 650 mggroup 2 : ibuprofen 400 mggroup 3 : aspirin 300 mggroup 4 : placebo . group 1 : paracetamol 650 mg group 2 : ibuprofen 400 mg group 3 : aspirin 300 mg the patients and the research assistant were blind to experimental groups . the patients were instructed to take two tablets , one tablet 1 h before separator placement and the other one after 6 h. separators ( alastik s-2 separator modules , 3 m unitek , monrovia , calif ) were placed for first molars in all 4 quadrants preferably in the morning between 10 a.m. and 12 noon . all patients were provided with a questionnaire which is in a form of seven page booklet that contained 100 mm horizontal visual analog scale ( vas ) . the patients were advised to mark the degree of pain as per the instructed time period in vas . pain intensity was recorded by the patients 2 h , 6 h after separator placement , bed time on the day of appointment , next day morning , and 2 day morning , 3 day , 7 day morning after separator placement . patients were advised to record the severity of pain with teeth not touching ( tnt ) , biting back teeth ( bbt ) together , and chewing food ( cf ) . patients who did not take the given drug or who did not completely fill the questionnaire or who lost / removed the separators were excluded from the study . the above data 's were subjected to statistical analysis using spss ibm version 20 ( chicago , usa ) systems . descriptive measures like mean values and standard deviations for continuous variables and percentage for categorical variables were calculated . there were 38 patients in group 1 ( paracetamol 650 mg ) with 18 boys and 20 girls and the dropouts were 3 and 1 , respectively . group 2 ( ibuprofen 400 mg ) comprised 39 patients with 20 boys and 19 girls and the dropouts were 2 and 1 , respectively . group 3 ( aspirin 300 mg ) comprised 36 patients with 18 boys and 18 girls and the dropouts were 2 and 0 , respectively . group 4 ( placebo ) comprised 41 patients with 21 boys and 20 girls and the dropouts were 4 and 3 respectively . the mean age of boys in group 1 , 2 , 3 , and 4 were 19.8 , 19.5 , 19.1 , and 18.9 years , respectively . similarly , mean age of girls in group 1 , 2 , 3 , and 4 were 19.5 , 18.9 , 18.6 , and 18.0 years , respectively [ table 1 ] . vas pain index scores recorded at different time intervals during tnt , bbt , and cf in four groups pain experience of group 1 ( patients taking paracetomol 650 mg one at 1 h before separator placement and another tablet 6 h after separator placement ) [ figure 1 ] : when tnt , pain intensity gradually increased from mild pain after 2 h and 6 h to peak pain at bed time . the peak intensity at bedtime was found to be moderate pain . the pain then gradually decreased from next day morning to mild pain and was in decreasing intensity of mild pain thereafter . mean pain scores at teeth not touching when bbt [ figure 2 ] , pain gradually increased from mild pain after 2 h to moderate pain until 2 day morning and then decreased to mild pain on 3 - and 7 - day morning . mean pain scores at biting back teeth together when cf [ figure 3 ] , pain gradually increased from mild pain after 2 h to moderate pain which peaked at bed time . the pain was perceived as moderate until 3 day morning and then decreased to mild pain on 7 day morning . mean pain scores at chewing foo pain experience of group 2 ( patients taking ibuprofen 400 mg one at 1 h before separator placement and another tablet 6 h after separator placement ) [ figure 1 ] : when tnt , pain intensity was mild throughout the time intervals . the pain intensity showed a gradual increase and peaked at next day morning after which there was a gradual decrease in pain intensity till 7 day morning . when bbt pain perceived was mild pain thorough out the time interval [ figure 2 ] . there was a gradual increase in pain , which peaked at next day morning and then gradually reduced at 7 day morning and was nearing no pain on the 7 day morning [ figure 3 ] . when cf [ figure 3 ] , pain gradually increased from mild pain after 2 h and 6 h to moderate pain which peaked at next day morning . the pain then decreased to mild pain on the 3 day morning and was nearing no pain on the 7 day morning . pain experience of group 3 ( patients taking aspirin 300 mg one at 1 h before separator placement and another tablet 6 h after separator placement ) [ figure 1 ] : when tnt and back teeth biting , the pain perceived was mild throughout the time interval . there was a gradual increase in discomfort which peaked at next day morning and then gradually reduced thereafter nearing no pain from 3 - and 7 - day morning when tnt and when back teeth biting respectively [ figure 2 ] . when cf [ figure 3 ] , pain gradually increased from mild discomfort after 2 h to moderate pain at next day morning and then gradually decreased to mild discomfort on 2 , 3 day and was nearing no pain on 7 day morning . pain experience of group 4 ( patients taking placebo one at 1 h before separator placement and another tablet 6 h after separator placement ) [ figure 1 ] : when tnt , the pain perceived was mild after 2 h and then gradually increased to moderate pain and peaked at bedtime . there was a gradual decrease in pain thereafter and reduced to mild pain on 7 day morning . when bbt [ figure 2 ] , pain gradually increased from mild pain after 2 h to severe pain until next day morning and then decreased to moderate pain from 2 day morning onwards . peak intensity of pain was felt at bedtime , which was of severe intensity . when cf [ figure 3 ] , pain gradually increased from moderate pain after 2 h to severe pain after 6 h to 2 day morning . in group 4 , on 7 day pain intensity was mild when tnt and moderate pain when bbt and cf . whereas in group 1 pain was nearing no pain on 7 day morning when tnt . in group 2 and 3 , pain was nearing no pain on the 3 day morning when tnt and on the 7 day morning when bbt and cf . it was observed that pain peaked at bedtime in all groups and pain intensity was maximum while cf . in group 4 , pain was severe at bedtime on the day of separator placement , whereas pain was perceived as moderate pain in group 1 and 2 and as mild pain in group 3 . overall results showed group 3 ( aspirin 300 mg ) patients experienced very less pain in terms of mild discomfort , closely followed by group 2 ( ibuprofen 400 mg ) . group 1 ( paracetamol 650 mg ) patients experienced mild to moderate pain on bed time and next day morning , after which gradually reduced to no pain from 3 day morning . however , group 4 ( placebo ) patients had a bitter experience of moderate to severe pain at all - time intervals . maximum pain is perceived on the 1 and 2 day of orthodontic movement and decrease to minor levels after 5 days . the sources for the pain in connection with orthodontic treatment are primarily due to the periodontal inflammatory reactions and consequent inflammatory reaction in pulpal tissues . the pulp circulation and tissue metabolism and even vitality may be affected or compromised by the applied forces . during orthodontic separator placement , initial healing of wounds in the periodontal ligament begins with blood clot and granulation tissue formation subsequent to necrosis regardless of the type of the periodontal challenge . during organization of granulation tissue , vascular , and nervous components as well as new periodontal connective tissue nociceptive nerve fibers of periodontal ligament transmit pain impulses centrally and also release neuropeptides peripherally . nerve sprouting within the pulp in response to orthodontic forces , affect the functional properties of the intradental nerves and might potentiate dental pain sensitivity by multiplying the receptor sites . all these factors induce pain , which peaks in 1 or 2 days of tooth movement . the vas is a direct pain intensity scaling method in which the subjects evaluate the level of pain by making a mark on a continuous line . one end of the line means no pain and the other end worst pain . the advantages of using the vas over observational , self - report , behavioral , physiological , or verbal rating scales , are the higher sensitivity , reproducibility , and reliability of the direct scaling techniques . the limitation of vas is that the recorded values are mostly related to the intensity component of pain . in this study , pain started 2 h after separator placement reached to peak level at the bed time and next day morning , approximately 24 h after separator placement . omur polat and karaman have reported that pain intensity reached the maximum peak value 24 h after archwire placement . since any orthodontic procedure creates periodontal vasodilatation , injury , pain and inflammation , analgesics should be prescribed for the effective control of pain . preoperative analgesics reduces inflammatory response by effectively controlling prostaglandin production . in this study , the analgesics taken both pre- ( 1 h before ) and post - operatively ( 6 h after ) created significant reduction in pain intensity compared to the placebo group . 2 h after separator placement , the patients taking paracetamol , ibuprofen , aspirin showed low pain values at tnt , bbt together and cf . this is because of the preoperative analgesic effect , whereas the placebo group felt moderate pain . 6 h after , analgesics had a good control of pain . aspirin and ibuprofen group felt mild pain during cf and bbt together , whereas in paracetamol group , the pain was moderate . visual analog scale scores measured at bed time and next day morning showed good pain control by analgesics . paracetamol group again had moderate pain on next day morning , particularly during bbt together and cf . it inhibits prostaglandin synthesis within the central nervous system and has little influence on peripheral prostaglandin synthesis , especially within inflamed tissues . onwards , there was no pain in analgesic groups , whereas the pain slowly reduced in intensity in placebo group . throughout the course , nsaid 's ( aspirin and ibuprofen ) elicited good control of pain followed by paracetamol ( acetaminophen ) . nsaids are contraindicated for patients who have a current history of nephropathy , erosive or ulcerative conditions of the gastrointestinal mucosa , anticoagulant therapy , hemorrhagic disorders , or intolerance or allergy to any nsaid . they also should be avoided during pregnancy because prostaglandins maintain patency of the ductus arteriosus during fetal development . in all cases , where nsaids are contraindicated , paracetamol is the conventional nonopioid alternative and it can be given for orthodontic pain management , since it has analgesic efficiency comparable with other nsaids . the vas is a direct pain intensity scaling method in which the subjects evaluate the level of pain by making a mark on a continuous line . one end of the line means no pain and the other end worst pain . the advantages of using the vas over observational , self - report , behavioral , physiological , or verbal rating scales , are the higher sensitivity , reproducibility , and reliability of the direct scaling techniques . the limitation of vas is that the recorded values are mostly related to the intensity component of pain . in this study , pain started 2 h after separator placement reached to peak level at the bed time and next day morning , approximately 24 h after separator placement . omur polat and karaman have reported that pain intensity reached the maximum peak value 24 h after archwire placement . since any orthodontic procedure creates periodontal vasodilatation , injury , pain and inflammation , analgesics should be prescribed for the effective control of pain . preoperative analgesics reduces inflammatory response by effectively controlling prostaglandin production . in this study , the analgesics taken both pre- ( 1 h before ) and post - operatively ( 6 h after ) created significant reduction in pain intensity compared to the placebo group . 2 h after separator placement , the patients taking paracetamol , ibuprofen , aspirin showed low pain values at tnt , bbt together and cf . this is because of the preoperative analgesic effect , whereas the placebo group felt moderate pain . 6 h after , analgesics had a good control of pain . aspirin and ibuprofen group felt mild pain during cf and bbt together , whereas in paracetamol group , the pain was moderate . visual analog scale scores measured at bed time and next day morning showed good pain control by analgesics . paracetamol group again had moderate pain on next day morning , particularly during bbt together and cf . it inhibits prostaglandin synthesis within the central nervous system and has little influence on peripheral prostaglandin synthesis , especially within inflamed tissues . onwards , there was no pain in analgesic groups , whereas the pain slowly reduced in intensity in placebo group . throughout the course , nsaid 's ( aspirin and ibuprofen ) elicited good control of pain followed by paracetamol ( acetaminophen ) . nsaids are contraindicated for patients who have a current history of nephropathy , erosive or ulcerative conditions of the gastrointestinal mucosa , anticoagulant therapy , hemorrhagic disorders , or intolerance or allergy to any nsaid . they also should be avoided during pregnancy because prostaglandins maintain patency of the ductus arteriosus during fetal development . in all cases , where nsaids are contraindicated , paracetamol is the conventional nonopioid alternative and it can be given for orthodontic pain management , since it has analgesic efficiency comparable with other nsaids . the present study was performed to assess the experienced pain as reported by the patients at different times after the placement of separators . pre- and post - operative analgesics were found to be more effective in controlling orthodontic pain , after separator placement at all - time intervalsaspirin 300 mg effectively controls pain than 400 mg ibuprofen , followed by 650 mg paracetamolthe safety of analgesics should be considered while choosing an analgesic . pre- and post - operative analgesics were found to be more effective in controlling orthodontic pain , after separator placement at all - time intervals aspirin 300 mg effectively controls pain than 400 mg ibuprofen , followed by 650 mg paracetamol the safety of analgesics should be considered while choosing an analgesic . only intensity of pain further studies are required to evaluate and access the duration of pain to determine the dosage of drug , which is equally important . | introduction : pain - free treatment to the patients is considered as an important treatment objective for orthodontic health care providers .
however , many orthodontists underestimate the degree of pain experienced by the patients .
hence , this study was conducted as a randomized , double - blinded clinical trial with the following objectives.objective:to study the pain characteristics after separator placement ; to compare the efficacy of various commonly used analgesics in pain management and to determine the efficacy of pre- and post - operative analgesics in pain management.subjects and methods : data were collected from 154 patients ( 77 males and 77 females , age group of 14 - 21 years , with mean age of 18.8 years ) who reported to department of orthodontics . patients were randomly divided in to four groups .
group 1 : paracetamol 650 mg , group 2 : ibuprofen 400 mg , group 3 : aspirin 300 mg , group 4 : placebo and the study were conducted as a randomized , double - blinded clinical trial .
the patients were instructed to take two tablets , one tablet 1 h before separator placement , and the other one after 6 h. the pain evaluations were made by the patients , when teeth not touching ( tnt ) , biting back teeth together , chewing food ( cf ) using a 100-mm visual analogue scale for 7 days after separator placement .
patients were advised to record the severity of pain.results:group 3 ( aspirin 300 mg ) showed lowest pain values , followed by group 2 ( ibuprofen 400 mg ) , and group 1 ( paracetamol 650 mg ) .
all nsaid 's achieved good pain control compared to group 4 ( placebo ) , where the intensity pain was maximum.conclusion : pre- and post - operative analgesics were found to be more effective in controlling orthodontic pain , after separator placement at all - time intervals . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in 2009 , over 374,000 individuals received emergency department based care in the united states for non - fatal self - inflicted injuries . the most common reported methods include self - immolation , chemical or medication ingestion , attempted hanging , jumping from a height , and penetrating trauma . suicide by stabbing is uncommon , constituting only 1.6 - 3.0% of suicide attempts . given its relatively low incidence and the fact that mortality associated with self - inflicted stab wounds is surprisingly low , only a few investigations have studied this at risk population . the purpose of this investigation was to evaluate the clinical management , psychosocial profile , and psychiatric diagnoses of those admitted following a non - fatal , self - inflicted stabbing . a retrospective chart review was conducted on patients with non - fatal , self - inflicted stab wounds who were admitted to rhode island hospital ( a level one trauma center ) from january 2005 to october 2009 . inclusion criteria included patient age greater than 18 and admission to the hospital for treatment of traumatic injuries following a self - induced stabbing . exclusion criteria included adults who have a recurrent history of self - injurious behavior ( self - mutilation ) that present with intentional superficial self - slashing injuries , and confirmed unintentional ( accidental ) stab wound injury at the time of primary emergency department assessment . all patients were admitted to the trauma service for acute management and subsequently referred to the psychiatric consult liaison service for suicide assessment . a data summary sheet was created that included information on demographics ( gender , age , marital status , education , employment , and insurance levels ) , psychiatric history , substance abuse history , contextual factors related to the suicide act , stab wound site and their management , implement used for self - stabbing , and patient disposition upon hospital discharge . simple descriptive statistics were used to analyze the data . the rhode island hospital internal review board approved this study . fifty - four patients with a presumed suicide attempt by self - inflicted stabbing were admitted during the study period . ages ranged from 19 to 82 , with an average of 45 years of age . patient demographics can be found in table 1 . in regards to substance abuse , alcohol blood levels ranged from 61 - 308 mg/ dl with a mean of 169 mg / dl . the most commonly used illicit substances included : benzodiazepines ( 9 ) , opiates ( 8) , cocaine ( 5 ) , cannabis ( 5 ) , and barbiturates ( 2 ) . nine ( 17% ) patients used more than one illicit substance together and five ( 9% ) of patients used elicit substances in combination with alcohol . eight patients overdosed on medications such as insulin , methylphenidate , selective serotonin reuptake inhibitors , aspirin , acetaminophen , ibuprofen , trazodone , or benzodiazepines . fifteen patients ( 28% ) did not have a blood alcohol level performed and seventeen ( 32% ) patients did not have a urine toxicology screen performed . upon trauma team evaluation , forty patients ( 74% ) presented with a single self - inflicted stab wound whereas 14 ( 26% ) presented with multiple injuries . the most common site of peripheral injury was the wrist ( 8 patients ) , all of which necessitated operative intervention . of the 18 stab wounds to the neck , all were located in zone two . two patients underwent tracheal laceration repair with one individual requiring tracheotomy due to thyroid cartilage fracture . self - inflicted stab wound sites of injury , operative interventions , and rates of therapeutic intervention of 11 patients with stab wounds to the chest , 5 required operative interventions and all of these were therapeutic . one patient required operative removal of a knife from the chest and a subsequent chest tube for hemo - pneumothorax . the remaining 6 patients did not require operative exploration and were managed either with serial chest x - rays or tube thoracostomies . of the 25 patients with stab wounds to the abdomen , nine underwent successful non - operative management through our admission protocol for serial exams . of the 16 that required operative intervention , three patients were noted to have a lacerated liver that was managed non - operatively . one patient sustained a gallbladder laceration , developed bile peritonitis , and underwent a cholecystectomy . three patients had various small and large bowel injuries resulting in resection , primary repair , or ostomy . another patient had an exploratory laparotomy , pericardial window , phrenic artery branch repair , and right ventricular laceration repair . seven patients were found to have no acute organ injury following laparotomy . within 48 hours from admission contextual factors associated with their self - inflicted stab wounds as endorsed by patients are reported in table 3 . following their interview , fifty - three patients ( 98% ) met criteria for a formal axis 1 and/or axis 2 psychiatric diagnosis . table 4 describes the specific psychiatric diagnoses of our patient population . during the initial interview , forty - four patients ( 81% ) readily described suicidal intentions during their psychiatric evaluation whereas ten patients ( 19% ) reported that their stab wounds were accidental . of these ten patients who reported that their stab wounds were accidental , 8 of the 10 patients injuries were subsequently found to be intentional following serial psychiatric interviews while in the post - operative care unit . in this subgroup , patient injuries included the neck ( 1 ) , chest ( 2 ) , and abdomen ( 5 ) . in patient with the neck injury , superficial bilateral neck lacerations were encountered that the patient stated was related to a chain saw accident . the patient denied that his lacerations were self - inflicted , however , the patient had a history of prior suicidality and the wounds were not reflective of a chainsaw related injury . of the chest traumas , one individual reported that a band saw blade dislodged into his chest , however , the patient could not explain how he sustained a wrist laceration at the same time thus indicating the high likelihood for suicidality . additional information obtained from the patient 's family confirmed the accident was in fact a suicide attempt . of the abdominal traumas , five patients reported accidental abdominal injuries including : hitting the wrong button on a switchblade knife ( 1 ) , tripping while putting a knife away ( 2 ) , or falling on a knife ( 2 ) . their stories were subsequently found not to be credible based on the injury pattern and/or conflicting stories later obtained from the families and/ or the patient . such mechanisms were only fully understood and acknowledged following serial interviews conducted by the consulting psychiatric service . contextual factors leading to self - inflicted injury formal psychiatric diagnosis in the remaining two patients in which non - intentional circumstances were questioned , the first individual was intoxicated and presented with penetrating trauma to the neck . police later confirmed that an arrest was made in connection with the patient 's injuries . the other patient was non - intoxicated and presented with a stab to the abdomen . the patient reported fixing the screw on his glasses at which time the knife slipped , puncturing his abdomen . despite the suspicious wound and circumstances , information obtained later on supported that the injury may have been accidental . at discharge , 33 ( 61% ) one patient with a cluster b personality disorder was able to leave against medical advice following a protracted surgical hospital stay . another patient eventually died not of the self - inflicted stab wound , but as a result of a selective serotonin reuptake inhibitor overdose . nationally , suicide represents the 11 leading cause of death in the united states . in general , men complete suicide more frequently than women . adolescents and older adults ( > 65 ) caucasians or people of lighter skin color have a higher rate of suicide than those with darker skin color . qin , agerbo , and montensen report that single marital status , unemployment , low income , retirement , disability , sickness - related absence from work , family history of suicide , and/or psychiatric history are also significant risk factors for suicide . in regards to those who abuse elicit substances and alcohol , some studies showed an increased association with suicidal behavior . sher et al . found that acute alcohol use increased the lethality of suicide attempts in those individuals with mood disorders . subsequent research demonstrated the association between alcohol and suicidality in the absence or presence of mood disorders . given that our population shared many of these characteristics , the recognition of risk factors and the implementation of targeted interventions prior to an acute suicidal event continue to challenge our local community . compared to previous reports of stab wounds among trauma patients , patients with self - inflicted stab wounds may have a higher incidence of operative interventions and significant injuries depending on the location of the stab wound . further characterized the incidence of injuries by structure , with vascular injury being the most common ( 14% of the presenting stab wounds ) . in our population , the incidence of significant injury to the neck requiring operative intervention was higher at 66% with all of the operations being therapeutic . in regards to chest injuries , mattox and allen reported only 12 - 15% of patients require operative interventions for penetrating trauma to the chest . among our patients , 45% required a therapeutic operative intervention . the patient 's desire to induce significant self - harm may explain the higher incidence of significant injuries compared to the general population when the site of stab is in the neck or chest . in terms of those with abdominal stab wounds , it has been well established that those who undergo laparotomy for an anterior stab wound may not receive a therapeutic benefit . in one of the most recent reports , biffl et al . reports in a multi - institutional study of anterior abdominal stab wounds using a variety of diagnostic modalities to direct operative management , 48% of the patients received a laparotomy with only 74% being therapeutic . in our series , a higher number of patients went to laparotomy ( 64% ) , while a lower number received therapeutic benefit ( 56% ) . as mentioned previously , our method of deciding operative intervention for stable anterior abdominal stab wounds is that of serial abdominal exams . given that this population maintains several risk factors including psychiatric illness and poly - substance abuse , potentially unreliable subjective and objective findings elicited at the bedside may have contributed to the higher incidence of non - therapeutic operations . also , in contrast to neck and chest - based injuries that typically manifest hard signs on physical exam that direct operative management , the nature of the abdominal viscera makes significant injury less likely in stabbing . this forces the practitioner to depend on a variety of indirect indicators that may falsely lead to an operation . this high rate of psychiatric disorders underscores the importance of a multidisciplinary approach to patients presenting with non - fatal self - inflicted injuries . this is particularly imperative among patients who deny self - inflicted stabbing despite a presenting history or clinical exam suspicious for intentional self - harm . with 80% of these patients eventually found to have had suicidal ideation , ongoing follow - up with trauma team members , social workers , substance abuse counselors , and psychiatric consultants would contribute to identifying these at risk patients . as a result of identifying suicidal intent , patients were more likely to be transferred to an inpatient psychiatric facility at the time of acute hospitalization discharge . while it remains an ongoing challenge to prospectively prevent suicide , it is left to the trauma care team to truly question suspicious circumstances and provide effective treatment so that any future attempts could be averted . in regards to study limitations , this study is reflective of the population of the northeastern united states and therefore may be different than other parts of the country . even though each self - inflicted stabbing patient was interviewed on at least two separate occasions to determine the consistency and veracity of information provided , the information obtained was still subject to substance intoxication , omission , and interpretation at the time of the interview(s ) . due to the retrospective nature of the study and the fact that different personnel performed the initial interviews , variations in documentation limited our ability to fully define the specific stressors leading up to each suicidal event . also , as a result of inconsistent blood alcohol level and urine toxicology screen ordering , the full impact of substance usage and its contribution to the acute event can not be fully evaluated . finally , given the lack of long - term follow - up and focus on acute hospitalization , it is unknown how surviving the non - fatal suicide attempt influenced future at - risk behavior . self - inflicted stabbing is rarely a fatal event during the acute hospitalization ; however , the need for operation and its therapeutic benefit may be greater than the general population depending on the location of injury . when managing these patients , a collaborative approach between surgery and psychiatry is imperative to effectively manage the life threatening issues acutely and ultimately treat the psychological factors that led to the suicidal event in the first place . | background : suicide by means of self - inflicted stab wounds is relatively uncommon and little is known about this population and their management.materials and methods : retrospective review of adult trauma patients admitted to our level-1 trauma center between january 2005 and october 2009 for management of non - fatal , self - inflicted stab wounds.results:fifty-eight patients were evaluated with self - inflicted stab wounds .
four patients died due to their injuries ( mortality , 7% ) .
of the non - fatal stab wounds , 78% were male ranging in age from 19 - 82 ( mean : 45 years ) .
the most common injury sites were the abdomen ( 46% ) , neck ( 33% ) , and chest ( 20% ) . in terms of operative interventions ,
56% of abdominal operations were therapeutic , whereas 100% of neck and chest operations were therapeutic .
when assessing for suicidal ideation , 44 patients ( 81% ) admitted to suicidal intentions whereas 10 patients ( 19% ) described accidental circumstances .
following psychiatric evaluation , 8 of the 10 patients with
accidental injuries were found to be suicidal .
overall , 54 patients ( 98% ) met criteria for a formal psychiatric diagnosis with 48 patients ( 89% ) necessitating inpatient or outpatient psychiatric assistance at discharge.conclusions:compared to previous reports of stab wounds among trauma patients , patients with self- inflicted stab wounds may have a higher incidence of operative interventions and significant injuries depending on the stab location
. when circumstances surrounding a self - inflicted stabbing are suspicious , additional interviews by psychiatric care providers may uncover a suicidal basis to the event . given the increased incidence of psychiatric illness in this population ,
it is imperative to approach the suicidal patient in a multidisciplinary fashion . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the development of
controllable and scalable growth , processing ,
and interfacing techniques remains the largest challenge in realizing
the application potential of two - dimensional ( 2d ) materials . chemical vapor deposition ( cvd ) has emerged as the most viable route
for high - quality graphene synthesis , and a lot of progress has also
been made in developing cvd processes for other 2d materials , such
as hexagonal boron nitride ( h - bn ) and related
2d heterostructures . essential to the development of process rationales for 2d material
cvd is an understanding of the underlying growth mechanisms , in particular the role of typically used process catalysts . while
graphene cvd relies on the interactions of carbon with the surface ,
sub - surface , and bulk of the catalyst , the growth mechanisms for compound 2d materials such
as h - bn are inherently more complex , as two elements need to be fed
and incorporated into the growing nanostructure and bond polarity
can affect the structural formation . there is typically
a range of poly - types for compound materials , and hence selective
growth becomes increasingly challenging . monolayer
and few - layer h - bn has received considerable attention
recently , reflecting an ever increasing demand for ultrathin dielectric ,
support , or barrier layers in electronics , photonics , and many other
applications . while progress has been made in synthesizing h - bn
on several catalyst metals , the focus has remained limited to catalyst surface pre - treatment
and tuning of precursors and/or exposure conditions . further progress and , for instance , control of layer texture , grain
structure , and number of layers require a more detailed understanding ,
in particular of the basic interactions of b and n with the catalyst .
the interaction of h - bn with the catalyst also affects h - bn transfer
and an increasing number of applications , such as oxidation barriers
and corrosion protection , that utilize h - bn as - grown on top of the
catalyst metal . unlike bulk h - bn which
is typically thermally and chemically very stable , the use of few - layer
h - bn as a high - temperature oxidation barrier on ni , cu , and stainless
steel has recently highlighted that the
stability and maximum possible temperatures of these ultrathin films
are critically linked to their support and environment . here ,
using a combination of in situ x - ray photoelectron spectroscopy
( xps ) and x - ray diffraction ( xrd ) during actual synthesis
conditions , we fingerprint the entire h - bn cvd growth process on polycrystalline
cu using borazine , ( hbnh)3 , as the precursor . we focus
on the important questions of how the precursor and constituent b
and n as well as the as - grown h - bn interact with the catalyst during
and after growth . polycrystalline cu foil catalysts are currently
most widely used for graphene cvd , motivated by the rationale that
the low carbon solubility of cu offers a relatively error - tolerant
growth window for monolayer graphene formation via a mainly cu surface - based
mechanism . based on the ease of processing ,
polycrystalline cu foils are now also used for h - bn cvd . our data show that , at the typically used growth temperatures , the
borazine molecule decomposes and b incorporates into the bulk of the
cu catalyst . during h - bn growth the cu is in the metallic face - centered - cubic
( fcc ) phase ; whereby , we can measure a lattice dilation due to the
dissolved b. upon post - growth cooling we observe precipitation of
b from the fcc cu . compared to graphene cvd , the role of the surface ,
sub - surface , and bulk of the catalyst is more complex , considering
that n has a considerably lower solubility in cu and its incorporation into the cu bulk is not detected . we invoke
a comparison to catalytically mediated iii v nanowire growth ,
i.e. , the cvd of 1d nanomaterials , where the growth kinetics crucially
depend on the different solubilities of the group iii and v constituents
in the catalyst and where atomically sharp and controlled heterostructures
can be grown despite a comparably high bulk solubility of the group
iii element . we further show that after h - bn
cvd and during commonly used further processing of h - bn on the cu
catalyst in ambient air , oxygen intercalation readily occurs under
as - grown h - bn and negatively affects the stability of h - bn on the
catalyst . for extended air exposure cu oxidation is observed , and
upon reheating in vacuum an oxygen - mediated disintegration of the
h - bn film via volatile boron oxides occurs . of key importance is that
this disintegration is catalyst mediated , i.e. , occurs at the catalyst / h - bn
interface and depends on the level of oxygen present at this interface . in turn , however , we demonstrate that pre- and co - exposure with oxygen
species can be used to influence h - bn growth morphologies . we discuss
the implications of these observations in the context of corrosion
protection and relate them to challenges
for process integration and heterostructure growth . we adopt a simple cvd process , and figure 1 outlines the nomenclature for the process steps that will be used
throughout this study . cvd of h - bn was performed at 9501000
c in customized cold - wall cvd reactors using borazine , ( hbnh)3 , as precursor on commercially
available cold - rolled polycrystalline cu foils as catalyst ( see methods ) . process diagram illustrating the salient stages
of h - bn cvd on
polycrystalline cu . figure 2 highlights via various ex situ
characterization techniques , the representative h - bn film quality
for the cvd recipe used throughout this study . transmission electron
microscopy images at high magnification show a hexagonal lattice structure
( figure 2a ) , and selected area diffraction
( figure 2b ) shows the typical hexagonal spot
pattern of h - bn , confirming the high crystalline quality at the microscopic
level . figure 2c shows an optical microscopy image of a continuous h - bn film transferred
to a sio2(300 nm)/si wafer . the image shows large areas
of uniform contrast indicating the macroscopic uniformity of the h - bn
films along with specs of residual polymethylmethacrylate ( pmma )
typically seen for such transferred films . the pmma contamination
toward the edge of the layer helps to guide the eye to distinguish
the film from the substrate in spite of the low optical contrast of
h - bn placed on sio2(300 nm)/si wafer support . raman spectra ( figure 2d ) taken on the transferred
h - bn film on sio2 ( 300 nm)/si ( see figure 2c ) show a single peak at 1368 cm consistent with the signature for h - bn . the corresponding ex situ xps core - level signatures [ i.e. , post
ambient air exposure ( step 7 , figure 1 ) ] acquired
on the h - bn films on cu show in the b1s region a main component at
190.6 ev ( figure 2e , inset additionally
shows the bond shake up satellite at 200 ev ) and in the n1s
region a main component at 398.1 ev ( figure 2f ) . from the intensities we estimate a b : n ratio of 1 ,
again consistent with h - bn . we also note that our measured binding
energies ( bes ) are consistent with previous xps characterization studies
of h - bn . further additional fitted components
are seen in the ex situ xps spectra at b1s 191.1 , 191.9 ev
and in the n1s at 398.6 , 399.3 ev , respectively , and we will
discuss the assignment of these peaks in the sections below . ( a ) high - magnification
tem image showing the hexagonal lattice structure of h - bn . ( b ) selected
area diffraction pattern for the h - bn film . ( c ) optical microscopy
image for h - bn film transferred onto a sio2(300 nm)/si
wafer . the h - bn layer can be clearly distinguished in spite of the
low contrast due to the edge where pmma residue accumulates . ( d ) raman
spectrum for the transferred h - bn film in ( c ) . ( e , f ) xps b1s ( e , inset
shows the bond shake - up satellite at 200 ev ) and n1s ( f ) core - level
signatures for h - bn on the cu foil . figure 3a and figure s1 in the supporting information show post - growth ( step
7 , figure 1 ) scanning electron microscopy ( sem )
images of as - grown h - bn on polycrystalline cu foil for 5 ,
15 , and 30 min of borazine exposure . while the sem contrast mechanisms
of such 2d materials supported on metallic foils / films is still an
area of active research , in figures 3a and
s1 the h - bn appears darker than the uncovered cu . figure 3a and s1 highlight that a typical h - bn cvd film
grows via multiple nucleation points within each facet of the polycrystalline
cu foil ( see figure s1 ) which then expand as isolated h - bn domains
and eventually merge to form a continuous polycrystalline h - bn film . in contrast to graphene , the isolated
h - bn domains often adopt more strict geometrical shapes ( figure 3a , 300 s and figure s1a ) , such as triangles
or other simple polygons , due to the bond polarity and related larger
energetic differences between different edge terminations . longer exposures lead here to the formation of more irregular - shaped
domains ( figure 3a , 900 s ) , which eventually
cover the entire cu surface , as indirectly confirmed by the wrinkles
in the resulting h - bn film ( figure 3a , 1800
s , and figure s1c ) . analogous to graphene , extended exposure times also lead here to the nucleation of further
h - bn layers , i.e. , multilayer formation via secondary nucleation , as highlighted by the darker contrast regions ( figure 3a , 1800 s ) . atomic force microscopy ( afm ) with step heights
measured on the edges of such a h - bn film transferred to sio2 ( 300 nm)/si wafer ( see supporting information , figure s2 ) indeed confirms the growth of few - layer h - bn films for
extended ( 30 min ) exposure times under our experimental conditions . having confirmed the growth of atomically thin h - bn ( monolayer islands
for short exposures ; full - coverage few - layer films for longer exposure
times ) under the given cvd conditions we now turn to study the growth
process using in situ experiments . ( a ) ex situ high - magnification sem images
for experiments with
300 , 900 , and 1800 s of borazine exposure . corresponding low - magnification
images are presented in the supporting information , figure s1 . ( b , c ) in situ xps confirming isothermal h - bn growth
on cu : in situ cvd process - resolved xps b1s ( b ) and n1s ( c ) core - level
scans at 975 c before ( step 3 ) , during ( step 4 ) , and
after borazine exposure ( step 5 ) , after cooling ( step 6 ) , and after
air exposure ( step7 ) . figure 3b , c shows cvd process - resolved
xps
b1s and n1s core - level signatures measured in situ at steps 27
( figure 1 ) , respectively . to simplify assignments ,
we refer to pairs of b1s / n1s components for b n compound species
while giving separate respective b1s and n1s bes for other species .
during annealing in h2 ( step 2 ) the flat lines in the respective
b1s and n1s spectra ( figure 3b , c ) indicate
a clean cu surface as baseline for the subsequent borazine exposure . the time - resolved b1s spectra during borazine exposure ( inset in figure 3b , step 4 ) show that upon borazine introduction
a broad peak in the b1s spectra emerges after 290 s. this
is consistent with the time scale of the nucleation and growth of
h - bn domains observed ex situ by sem ( figure 3a ) . at 880 s the broad b1s peak can be resolved into two
components , which are also reflected in the matching n1s scans with
be pairings of 191.1/398.6 ev and 190.6/398.1 ev . around this exposure time the islands have grown in size but have
not coalesced yet ( figure 3a ) . for continued
exposures ( up to 2270 s ) the component at 190.6/398.1 ev starts
to dominate the spectrum , while the 191.1/398.6 ev peak strongly
decreases in relative intensity . concurrently , the ex situ sem now
shows coalescence of the islands into a closed few - layer h - bn film . the 191.1/398.6 ev
component could be attributed to cubic boron nitride ( c - bn ) , but is also consistent with a slightly higher be of monolayer h - bn
( as compared to few - layer h - bn at 190.6/398.1 ev ) . we exclude significant homogeneous c - bn formation based
on the ex situ characterization of our films ( figure 2 ) and also based on the observation of a bond shake - up
satellite at 200 ev in the b1s spectra ( see inset of figure 2e ) . therefore , we interpret
the observed initial emergence of the two peaks at 190.6/398.1 and
191.1/398.6 ev at equal intensities followed by domination of the
spectrum by the 190.6/398.1 ev component for extended exposure times
as evidence for isothermal growth of monolayer h - bn that interacts
with the cu substrate ( 191.1/398.6 ev ) and some fraction of multilayer
h - bn nuclei ( 190.6/398.1 ev ) , where the initial monolayer domains
further evolve to multilayers with extended exposure time ( hence the
decrease of 191.1/398.6 ev contribution relative to the 190.6/398.1
ev peaks ) . we suggest that the observed peak shift between 191.1/398.6
and 190.6/398.1 ev is caused by interactions of h - bn with the cu substrate , similar to monolayer graphene
i.e. , charge transfer between the substrate and the growing 2d material . in turn this interaction is not present for multilayer h - bn , where
the top layer ( which contributes most significantly to the xps signal )
is supported by the other h - bn layers and thus shows the be at 190.6/398.1
ev . further evidence for this interpretation
of h - bn / cu interactions for monolayer h - bn is provided below . in addition to the assignment of the monolayer h - bn ( 191.1/398.6
ev ) and multilayer h - bn ( 190.6/398.1 ev ) xps components , we note that ,
due to the overlap of be positions for multiple species , part of the
signal at 191.1/398.6 ev may also be assigned to local cubic - like
sp bonding arrangements at h - bn island edges or defects . also such a cubic - like
sp contribution from nuclei edges would similarly decrease
in relative intensity with exposure time as the islands increase in
area and therefore exhibit a decreasing fraction of signal from edges . our ex situ characterization however excludes significant cubic - like
bn contributions . besides the 191.1/398.6 and 190.6/398.1 ev
components , we also
observe small xps fitted components at 191.9/399.3 and 189.8/397.5
ev . we note that borazine is known to dissociate on metal catalyst
surfaces at the given growth temperature , meaning that these remaining unassigned b n - related components
during growth can not be ascribed to adsorption of intact borazine
molecules on the catalyst surface . instead we find that the 191.9/399.3
ev component also emerges when we sputter ex situ grown h - bn on cu
post air exposure ( see supporting information , figure s3 ) . as sputtering is known to induce defects and dangling
bonds , we assign the very small components at b1s / n1s 191.9/399.3
ev to h - bn defect species saturated with residual oxygen . similarly ,
we also assign the 189.8/397.5 ev components to defects in
the h - bn . our observations so far
indicate isothermal growth of h - bn on cu
with initial monolayer nucleation ( which then evolve toward few - layer
h - bn ) with a small amount of defects incorporated in the h - bn films
( lattice , edges , grain boundaries ) . such an isothermal growth scenario
is consistent with ultra - high vacuum ( uhv)/single crystal studies ,
where the precursor pressure however remained below the threshold
for multilayer nucleation . the in situ xps b1s and n1s fingerprints of growing h - bn are
preserved
upon removal of borazine at temperature ( step 5 , figure 1 ) , but interestingly one small additional component emerges
upon cooling of the sample in vacuum in the b1s at 188.1 ev
( step 6 , figure 1 ) . this be is known to correspond
to atomic b diffused to the catalyst surface or sub - surface . this assignment of atomic b ( non - nitrogen bonded ) is also corroborated
by the lack of a concurrently emerging n1s component upon cooling ,
as well as by the disappearance of the 188.1 ev signal upon subsequent
air exposure , since atomic boron is known to quickly oxidize in ambient
air and desorb as highly volatile boron oxides . the emergence of atomic b on the catalyst surface upon
cooling strongly implies b precipitation from the catalyst bulk and
in turn suggests dissolution of b in the polycrystalline cu subsurface / bulk
during the high - temperature borazine exposure . to confirm this
b dissolution , we employ in situ xrd to characterize
the crystalline structure of the catalyst bulk during cvd . figure 4a shows xrd patterns recorded during cvd , starting
with as loaded cu catalyst ( before step 1 , figure 1 ) , after h2 anneal ( step 3 , figure 1 ) , during borazine exposure ( step 4 , figure 1 ) , and after ambient air exposure ( step 7 , figure 1 ) . the growing h - bn layers are not seen in the xrd
patterns due to the setup geometry / sensitivity used here ( see methods ) . from the xrd patterns we observe metallic
fcc cu as the state of the catalyst bulk during the entire growth
process . importantly , no ( non - equilibrium ) boride or borate phases
are observed . rietveld refinement of the patterns in figure 4a reveals that when borazine is introduced the cu
lattice constant expands by 0.0006 ( figure 4b ) compared to a vacuum baseline . this lattice expansion
is indicative of interstitial uptake of a borazine - derived component
into the cu lattice . we note that this lattice constant change remains
after borazine exposure with the sample still at temperature ( step
5 , figure 1 ) . in order to get some indication
of the nature of the dissolving species , we characterized by xrd the
cu catalyst exposed to ammonia ( nh3 , i.e. , a nitrogen and
hydrogen source without b ) instead of borazine under similar pressures .
for this ammonia exposure , no expansion in the cu lattice constant
is found . as ammonia is known to dissociate on cu in this temperature
regime , our data imply that n and h uptake is not
responsible for the increase in the cu lattice constant , and instead
b is dissolved into the cu during growth . therefore , our combined
xps and xrd data suggest that the h - bn growth mechanism on cu is not
limited to a pure surface mechanism as previously suggested . rather our data indicate element - specific feeding
mechanisms including the bulk of the catalyst . we suggest that b is
taken up in the cu catalyst while n is not ( by relative amounts ) ,
which is also in agreement with thermodynamic phase diagrams . bulk crystallography of the cu catalyst during
isothermal growth
of h - bn by cvd measured using in situ xrd . ( a ) xrd patterns during
salient stages of cvd as loaded ( before step 1 ) , after h2 anneal ( step 3 ) , during borazine exposure ( step 4 ) , and after ambient
air exposure ( step 7 ) . ( b ) rietveld refinement derived change in fcc
cu lattice parameter during vacuum and borazine and nh3 exposure ( corrected for thermal expansion via measuring a baseline
temperature series in vacuum ) . returning to the xps data in figure 3b , c ,
we find that after extended air exposure the n1s spectra show an additional
small component at 400.5 ev that does not have a b1s counterpart
and is attributed to the formation of n o bonds . we note that the final in situ xps fingerprint after air exposure
( step 7 ) in figure 3b , c resembles our x - ray
photoelectron spectra of the ex situ grown few - layer h - bn in figure 2e , f which highlights the validity and relevance
of our in situ measurements for scalable high - quality h - bn growth
under realistic process conditions . in addition to following
the evolution of b and n species during
h - bn cvd , in situ xps also allows us ( within its detection limits )
to observe the surface chemistry of the cu catalyst by simultaneously
monitoring the cu2p , culmm , o1s ( figure 5 ) ,
and valence band ( supporting information , figure s4 ) regions . we find that ,
before cvd , the as - loaded cu foil surface is heavily oxidized due
to storage and transportation in ambient air ( before step 1 ) . following an anneal ( step 2 ) in h2 the cu surface is reduced to metallic cu ( step 3 ) and remains metallic
during growth ( step 4 ) and cooling post - growth ( step 6 ) . this is in
good agreement with the xrd data in figure 4a that suggested the cu bulk to be metallic during h - bn growth . upon
air exposure ( step 7 ) the h - bn covered cu surface oxidizes again . the oxidation of the cu upon air exposure implies that the inherent
polycrystallinity of cvd grown h - bn film provides diffusion pathways
for species to reach the cu / h - bn interface . this suggests that h - bn
films as - grown on cu per se are not as perfect oxidation barriers
as recently reported . we emphasize here that the o1s
and culmm are more sensitive to measure the oxidation of the cu than
the cu2p . the observation of oxidation
upon air exposure is also consistent with the disappearance of the
elemental b peak ( desorbed as volatile boron - oxides , figure 3b ) and the formation of n o bonds ( figure 3c ) upon air exposure . surface chemistry of
the cu catalyst during isothermal growth of
h - bn by cvd : in situ xps ( a ) cu2p3/2 , ( b ) culmm auger ,
and ( c ) o1s spectra after h2 anneal in vacuum ( step 3 ) ,
during borazine exposure ( step 4 ) , after exposure ( step 5 ) , after
cooling in vacuum ( step 6 ) , and after ambient air exposure ( step 7 ) . to further probe this evolution
of h - bn on cu catalysts during
ambient air exposure ( step 7 , figure 1 ) , we
undertake complementary experiments with ex situ grown h - bn islands
on cu , for which the borazine exposure was limited to 5 min
to obtain islands of monolayer h - bn . this significantly increases
the direct contribution of the cu / h - bn interface . we measure xps on
these ex situ grown h - bn islands on cu exposed to ambient air for
4 days after cvd ( figure 6 ) . the as - loaded
sample shows a b1s peak centered at 190.6 ev and a n1s peak
centered at 398.1 ev , and the o1s and culmm peaks indicate
an oxidized cu surface . the bes of the
b1s and n1s peaks are surprising , as we established above that monolayer
h - bn should exhibit a be of 191.1/398.6 ev . interestingly , however ,
upon annealing the sample in vacuum ( 10 mbar )
we observe a shift of the xps peak centers to the expected positions
for monolayer h - bn , i.e. , the b1s to 191.1 ev and n1s to 398.6
ev . concurrently , we see a reduction of the cu in the o1s and culmm
spectra during vacuum annealing and the appearance of a defect related
component at 191.9/399.3 ev . in turn , after cooling and upon subsequent
room temperature re - exposure to air for 2 days , the initial as - loaded
positions of the b1s and n1s are recovered ( 190.6/398.1 ev ) along
with a re - oxidation of cu . re - heating of triangular h - bn nuclei on cu in
10 mbar vacuum , after sample was stored
in ambient air for 4
days . in situ x - ray photoelectron spectra of ( a ) b1s , ( b ) n1s , ( c )
cu auger ( lmm ) , and ( d ) o1s region of as - loaded sample , during subsequent
heating in vacuum up to 650 c , post - cooling , and after re - exposure
to air ( from bottom to top ) . this behavior , where changes in the xps bes of h - bn are linked
to reversible support oxidation / reduction cycles , closely resembles
previous observations of oxygen intercalation phenomena under graphene
on metals . to the best of our knowledge oxygen intercalation has not been reported yet for h - bn on metals ,
but previous studies of au intercalated under h - bn on ru , ni , and hydrogen
intercalated under h - bn on rh showed
xps peak shifts consistent with our interpretation . therefore , our
data strongly suggest that air exposure of h - bn on cu leads to oxygen
intercalation under the h - bn , i.e. , at the h - bn / cu interface . in this
intercalated state monolayer h - bn has a xps fingerprint of 190.6/398.1
ev , resembling the be of few - layer h - bn but being different to the
191.1/398.6 ev measured in figure 3b , c for
monolayer h - bn during growth directly on cu . upon vacuum annealing the intercalated oxygen is de - intercalated and desorbed , and thus
direct contact between h - bn and cu is ( re-)established albeit with
a small number of defects introduced into the h - bn layer . the weak
but nevertheless present electronic interaction of cu and monolayer
h - bn leads to a small shift
in the b1s / n1s bes to 191.1/398.6 ev ( same as during growth ) . thus ,
our data in figure 6 evidence the decoupling
( upon air exposure ) and recoupling ( upon vacuum annealing )
of monolayer h - bn and the cu support . we emphasize here that coupling
does not necessarily imply a strong interaction with the substrate .
in the case of few - layer h - bn only the decoupled bes
190.6/398.1 ev are observed , as for the top h - bn layers ( which mainly
contribute to the xps signal ) the interaction with the cu support
is screened by the h - bn layers below . therefore , in our in situ growth experiments in figure 3b , c where few - layer h - bn was eventually grown , no
b1s / n1s peak shifts were observed upon air exposure . while our
data strongly suggest intercalation of oxygen , we however
note that a second possible scenario could also explain the b1s / n1s
peak shifts , where oxygen species decorate edges ( which are present
in large number for h - bn islands ) or defect sites on top of the h - bn . oxygen in this scenario is
not intercalated under the h - bn but rather adsorbed onto it and then
removed by heating . we note that the already slightly back shifting
b1s / n1s bes during cooling in vacuum in figure 6 could point to fast oxygen decoration of edge / defects sites from
residual oxygen groups in the vacuum chamber accompanied by a small
amount of degradation / defect generation in h - bn due to atmospheric
contaminants . thus , a combination of fast oxygen decoration of defects on top of h - bn and oxygen intercalation under h - bn at higher oxygen pressures is also conceivable as a combined
source of the observed b1s / n1s be shifts upon air exposure / vacuum
annealing cycles . irrespective of the detailed configuration
of the oxygen causing
the b1s / n1s shifts , we find that the evolution upon vacuum - annealing
of ex situ grown h - bn samples on cu is highly dependent on their length
of exposure to ambient air . in contrast to the short - term air - exposed
monolayer sample in figure 6 ( 4 days , termed
fresh sample for the remainder of the text ) , figure 7 shows b1s , n1s , and o1s xps core - level signatures
for an ex situ grown , full - coverage few - layer h - bn film on cu foil
stored in ambient air for 10 months ( termed aged
sample ) . the as - loaded b1s and n1s spectra show peaks corresponding
to h - bn , and the o1s spectrum shows the presence of copper oxide species
( cu2o ) . for this aged sample , upon heating
in vacuum ( 10 mbar ) to 500 c , the
intensity of the b1s and n1s increases which is attributed to desorption
of adsorbed atmospheric dirt . the b1s and n1s bes remain consistent
with few - layer h - bn as expected . concurrently , the o1s spectrum shows
the onset of reduction of the cu2o and reaches a state
that resembles a sub - stoichiometric oxide or adsorbed o. when the sample is further heated to 700 c
all three spectra change drastically . the b1s and n1s peaks reduce
dramatically in intensity , and the b1s shows predominantly features
of boron oxide ( bxoy ) species at > 191.5 ev . this is accompanied
by a corresponding increase in the o1s intensity , also indicating
an increase in boron oxide species . this points toward oxygen - mediated
disintegration of the h - bn film on the cu foil upon vacuum annealing ,
where the oxygen was fed from the cu oxide underneath the h - bn . the
formed boron oxides are largely volatile resulting in loss of b and n into the gas phase . this is in stark
contrast to the higher stability of the fresh h - bn
islands in figure 6 which under similar treatment
only showed signs of minor degradation . we suggest that the higher
degree of oxidation of the aged cu foil provided a
larger oxygen reservoir where instead of simple de - intercalation
under the h - bn , catalytic oxygen - mediated etching of h - bn occurs ( which
in the case of the fresh h - bn on cu is much milder
due to the smaller oxygen reservoir in the less oxidized cu ) . reheating of
full - coverage , few - layer h - bn films on cu in vacuum
( 10 mbar ) , after sample was stored in
ambient air for 10 months : ( a ) b1s , ( b ) n1s , and ( c ) o1s .
from top to bottom : as loaded , at 500 c , at 700 c , and
post - cooling . to cross - check this hypothesis ,
we return to annealing similarly
fresh h - bn islands as in figure 6 but now anneal in the presence of 1 10 mbar oxygen ( figure 8) . these experimental
conditions can be considered as heating the fresh
h - bn sample in an infinite oxygen reservoir . figure 8 shows that in the presence of oxygen the islands quickly
disintegrate on heating ( confirmed by sem in the inset ) , similar to
the aged h - bn film in figure 7 . this confirms our assertion that when sufficient amounts of oxygen
are provided ( either from a heavily oxidized cu as in the aged
sample or via the gas phase as in figure 8)
h - bn on cu is etched via a reaction with oxygen . we emphasize that
control experiments with h - bn that was transferred to sio2 , i.e. , removed from the cu catalyst , did not lead to such a drastic
disintegration during annealing in air up to 700 c . this highlights
the role of the cu catalyst in the proposed oxygen - mediated etching
of h - bn . such catalytically mediated oxygen - based etching of h - bn
is consistent with recent uhv - based reports of etching of h - bn on
ir and ru . re - heating
of triangular h - bn nuclei on cu in 1 10 mbar o2 , after sample was stored in ambient air for 15
days : ( a ) b1s , ( b ) n1s , ( c ) o1s , and ( d ) culmm as loaded and during
subsequent heating in 1 10 mbar o2 ( from top to bottom ) . the insets show low- and high - magnification
sem images before ( left ) and after ( right ) re - heating in o2 . heating in o2 causes the h - bn on cu to disintegrate
in contrast to figure 6 but similar to the
observations in figure 7 . having established that oxygen can have a drastic detrimental
influence
on the stability of h - bn on cu during ambient air processing after cvd , we now study whether this impact of oxygen can
also be used advantageously during h - bn growth to
controllably influence h - bn characteristics by controlled etching . in analogy to graphene cvd we expect that oxygen
feeding prior / during borazine exposure will have an impact on nucleation and might change the balance between growth
and etching reactions , and thus strongly modify the resulting h - bn
film morphologies . confirming this hypothesis ,
figure 9a , b demonstrates a reduction in nucleation
density of h - bn on cu by dosing 1 10 mbar
of air after annealing in hydrogen and before borazine exposure , i.e. ,
between steps 2 and 4 . in the case of air - dosing ( figure 9b ) , the nucleation density is reduced by an order
of magnitude compared to the standard oxygen - free growth conditions
( figure 9a ) . the short exposure to air / oxygen
after h2 pre - treatment partly re - oxidized the cu surface ,
and subsequently , upon borazine exposure , boro - thermal reduction ( see
figure 5c ) of these surface copper oxides to
active metallic cu ( confirmed by xrd measurements ) takes place , which
significantly reduces catalyst activity and thus the resulting nucleation
density . in figure 9c we show the effect of
co - exposure of air and borazine : co - dosing a small air partial pressure
alongside the borazine changes the h - bn domain morphology toward an
flower - like shape ( figure 9c ) . we suggest that
this change of growth morphology is due to increased selective etching
reactions occurring concurrent with the growth reactions which might
also contribute to a less defined h - bn termination . these observations
introduce oxygen pre - treatment and co - feeding as highly relevant parameters
toward optimizing h - bn cvd . sem images of h - bn nuclei on cu after 5 min
growth , ( a ) similar
to figure 3a ( pborazine 1 10 mbar ) and ( b ) with 5
10 mbar air exposure prior to step 3 . air exposure
caused an order of magnitude reduction in nucleation density of h - bn
on cu for identical processing conditions . ( c ) co - exposure of air
( 1 10 mbar ) and pborazine 1 10 mbar for
30 min leads to nuclei that are irregular in shape . in order to put these
results in context , we start by outlining
the growth models introduced for graphene . without going into the
details of the specific chemistry for each catalyst material , graphene
nucleation requires a certain carbon surface concentration which is
fed by the precursor dissociation and can be balanced by carbon diffusion
in to and out from the catalyst subsurface and bulk . the growth kinetics thereby strongly depend on any possible
phase changes of the catalyst surface / bulk , if the carbon incorporates
from the catalyst surface or via the bulk , and how the graphene layer
edges are anchored on the catalyst surface . in the case of h - bn the growth mechanism is expected to be
more
complex than for graphene since a balance of two elements , b and n ,
are needed to form h - bn on the catalyst . while a stoichiometric balance
can be introduced into the cvd reactor by selecting a precursor with
a pre - defined stoichiometry ( i.e. , borazine in this case with a b : n
= 1 ) , the interaction of the constituent elements with the catalyst
will dictate the actual supply of the elements during cvd . in this
context , diffusion rates and solubility of b , n , or both into the
catalyst sub - surface or bulk , metastable or stable boride / nitride
formation , and the phase of the catalyst will critically affect the
supply of the constituent elements . further , the rate of supply of
the constituent elements based on dissociation kinetics , impingement
flux of the precursor on the catalyst surface , sticking coefficients ,
and any related change in interaction between the growing h - bn and
the catalyst need to be carefully considered . figure 10a schematically puts forward key
points of a kinetic growth model that we propose for h - bn cvd on the
basis of a consistent interpretation of the experimental data . our
data show no signatures of adsorbed borazine molecules on cu , indicating
that at the given conditions borazine dissociates on the reduced cu
surface . we also observe a lattice expansion during borazine exposure
which suggests uptake of boron into the cu bulk , in agreement with
our conjectures from the xps b1s data , where upon post - growth cooling
we observe b precipitation from cu . we further see no evidence of
bulk nitrogen dissolution or surface nitrogen species in bonding configurations
other than those related to bn compounds during exposure . further ,
the cu catalyst remains in its metallic state during the entire cvd
process , and no borides or nitride phases are seen . n phase diagrams as well as with previous uhv
measurements of h - bn cvd on rh and ir catalysts
and the general metallurgy literature . the simplified
schematic of figure 10a neglects a certain
level of cu sublimation under low - pressure cvd conditions , but this can be minimized or indeed might be
significantly suppressed with h - bn coverage , and hence this complexity
is not further discussed here . ( a ) schematic diagram for h - bn growth
mechanism on cu , where ji is the impingement
flux of the precursor ( borazine ) , rd is
the rate of dissociation of the precursor , jb is the diffusion flux of b into the cu subsurface / bulk , jn is the diffusion flux of n away from the catalyst
surface , and jb = jn is the flux of b and n required for the formation
of h - bn on the catalyst surface . we propose that multilayer h - bn grows
beneath the first layer in contact with the catalyst surface as seen
for graphene . the schematic neglects a certain level of cu sublimation
under low - pressure cvd conditions . ( b ) schematic
diagram for stability of h - bn on cu and the oxygen - mediated catalytic
dissociation mechanism while heating in air or an oxygen reservoir . the nucleation and growth of h - bn
layers is found to occur isothermally ,
i.e. , at a constant elevated temperature . although a stoichiometrically
balanced precursor is used , our data show that the boron and nitrogen
supply routes for h - bn growth can be different . the boron dissolution
could leave a nitrogen excess at the cu surface which might be balanced
by nitrogen desorption , as indicated in figure 10a . whereas boron can enter the growing h - bn either via the bulk or
the catalyst surface , the nitrogen is fed only via the catalyst surface ,
and nitrogen desorption can lead to a situation where the h - bn growth
is limited by the nitrogen supply . this is reminiscent of the situation
for catalytic iii v nanowire growth , where the group v constituent
typically has a low solubility in the conventionally used au catalyst ,
and despite a high bulk solubility of the group iii element atomically
sharp heterostructures can be obtained . the focus
of prior literature on h - bn cvd has been on the balance of gaseous
precursors . our data here highlight that , for further process optimization ,
it is crucial to consider and understand the catalyst - mediated flux
balance as highlighted for cu in figure 10a . considering the growth of 2d multilayer films and heterostructures , the complexity of the kinetics of catalyst mediated flux balances
increases for h - bn . growth of h - bn multilayers can be seen analogous
to graphene cvd , where additional layers nucleate and grow only in
contact with the metal catalyst , i.e. , at the interface between the
catalyst and an existing graphene layer . the feeding of such additional layer will depend on the leakage
rate of both ( b , n ) constituent species through an existing 2d layer . further , for the growth of h - bn / graphene heterostructures
via , e.g. , sequential exposure to carbon and boron / nitrogen precursors ,
complex interactions can be expected not only for the catalytic precursor
dissociation on the catalyst surface but also for the catalyst - mediated
flux balances . sutter et al . have studied
potential smear - out effects during h - bn - graphene heterostructures
synthesis and reported techniques such a pulsed oxygen etch to address
reservoir effects and improve the sharpness of transitions , albeit
this has been very specific so far to the exposure sequence and catalyst
material ( ru ) . we see our insights here as being highly relevant as
a framework for the understanding and further optimization of a range
of compound 2d materials and more complex cvd grown heterostructures . the catalyst support is relevant not only to the cvd growth process
but , as our data show , also to the post - growth stability of as - grown
h - bn , which is crucial to post - growth processing and numerous applications . practically all current use and processing of cvd grown h - bn involves
some stage of ambient air exposure when the material is still on the
catalyst . figure 10b schematically summarizes
the key points regarding catalyst- and oxygen - mediated thermal h - bn
stability . we find that post growth ambient air exposure leads to
intercalation of oxygen under h - bn on cu . while oxygen can reach the
interface through inherent defects in the h - bn layer ( including point
defects , vacancy defects , stone wales defects , or out - of - plane bonds ) and domain boundaries , even when the
catalyst surface is completely covered with monolayer and few - layer
h - bn , the rate of arrival at the interface is expected to reduce significantly
with increasing number of h - bn layers . interacts with cu . for extended air exposure
cu oxidation is observed , and upon re - heating in vacuum an oxygen - mediated
disintegration of the h - bn film occurs via volatile boron oxides . i.e. , occurs at the catalyst / h - bn interface and depends on the catalyst
and the level of oxygen fed to this interface ( figure 10b ) . this mechanism is in conceptual agreement
with uhv - based reports of h - bn etching on ir and ru . it is important to note that
annealing of h - bn films transferred to a 300 nm sio2 /si
wafer support in air up to 700 c did not lead to such a drastic
disintegration consistent with recent reports . hence our data highlight that key to the thermal stability
are the catalyst interaction and the level of oxygen fed to the catalyst
interface . for few - layer and multilayer h - bn this means that
the layer most
likely to be etched is the one in contact with the catalyst as long
as an oxygen leakage pathway is provided . we note that for certain
catalysts , in particular ni , which more strongly interact with the
2d layer on its surface , graphene has been shown
to passivate the catalyst surface and prevent oxygen from reaching
the catalyst / graphene interface . this
further highlights the importance of the catalyst interaction , and
the resultant different levels of oxygen intercalation can explain
previous reports in literature for instance on the stability of few - layer
h - bn on cu being limited to 500 c compared to 1100 c for
ni . combining the discussion of
the h - bn growth kinetics ( figure 10a ) and thermal
stability ( figure 10b ) , it is obvious that
the presence of oxygen during cvd can
affect the h - bn formation in multiple ways . a more oxidized catalyst
surface is likely to reduce the h - bn nucleation density , assuming
a catalyst surface reduction is required . the presence of oxygen might
also change the catalyst / h - bn interaction and change the b and n flux
balance , hence affecting the shape of growing h - bn domains and their
growth rate . similar to graphene cvd , we note oxygen ( co-)exposure
should be considered an important aspect of the parameter space for
h - bn cvd . although a detailed study of
the effect of gaseous additions to the cvd atmosphere is beyond the
scope of this paper , we emphasize that the insights provided here
give a fundamental framework and highlight multiple avenues toward
more advanced integrated growth and integration of h - bn and other
related compound 2d materials . in summary , we have
used a combination of complementary in situ
xps and xrd during h - bn cvd to gain a fundamental
understanding of the mechanisms underlying the growth of h - bn on polycrystalline
cu under scalable cvd conditions . h - bn was shown to grow isothermally
on cu during exposure to borazine at elevated temperature . the growth ,
however , is not limited to a surface - mediated growth mechanism as
previously reported . expansion of the cu lattice during borazine exposure
at high temperature and elemental b precipitation from cu upon cooling
confirm b incorporation into the bulk of the catalyst . cu maintains
its metallic state during h - bn cvd , and no additional boride or borate
phases are seen . our in situ insights into the mechanisms of h - bn
growth provide guidelines for future rational cvd process engineering
towards controlled h - bn film characteristics such as film quality ,
domain size , or number of layers . the element - specific mechanistic
insights obtained here are highly relevant as a framework for the
understanding and further optimization of a range of compound 2d materials
and more complex cvd - grown heterostructures . after cvd , we find that
exposure to ambient air leads to intercalation of oxygen under h - bn
on cu . the stability of h - bn following this air exposure is strongly
dependent on the catalyst interaction and accumulated oxygen dose ,
where high oxygen levels lead to drastic catalytically mediated h - bn
etching and h - bn disintegration on cu upon processing at elevated
temperatures . in turn , however , these etching effects could potentially
open new routes to control the growth morphology of h - bn when oxygen
is pre - dosed or co - fed under controlled conditions during h - bn cvd . large - scale processing schemes for h - bn integration and processes
involving growth of in - plane / out - of - plane h - bn/2d material heterostructures will have to carefully consider these findings in terms of allowable
levels of oxygen exposure during ( re-)processing and suggested use
of h - bn as high - temperature passivation layers . cvd of h - bn using borazine
( ( hbnh)3 , fluorochem , uk )
as precursor was performed in customized in situ compatible cold - wall
cvd reactors on cold - rolled polycrystalline
cu foils ( alfa aesar , 25 m thick , 99.999% purity ) at 9501000
c and at pborazine 1
105 10 mbar
for 530 min . borazine vapor was introduced
into the reaction chambers via leak valves from liquid borazine reservoirs . the cvd process commonly consisted of a h2 pre - treatment
step ( 0.2 mbar ) , followed by pump - down to base pressure , and
then the precursor was introduced to initiate h - bn growth . after a
pre - defined growth time the borazine precursor was removed , followed
by pump - down to base pressure and cooling in vacuum . figure 1 summaries the salient steps during the h - bn cvd
process . for experiments with air pre - dosing , the dosing was performed
after h2 annealing , i.e. , between steps 2 and 3 in figure 1 . the isiss end station of fhi mpg at the
bessy ii synchrotron was
used for in situ xps measurements . further details on the experimental
setup / measurements can be found elsewhere . in situ xrd ( 2 geometry ) was performed
at
the bm20 beamline ( rossendorf beamline ) of the european synchrotron
radiation facility ( esrf ) in a cold - wall stainless steel reactor mounted
on a high - precision six - circle goniometer . the kapton windows of the reaction chamber allow transmission of
x - rays at different scattering geometries . a monochromatic x - ray beam
of 11.5 kev ( corresponding wavelength of 1.078 ) was used , and
the diffracted x - rays were measured with a 1d line detector ( mythen ) . cu powder ( alfa aesar , < 5 m , 99.9% purity ) pressed into
a thick granular film onto a sapphire wafer was used as the model
system since the high degree of texture in cold rolled cu foils prevented
reliable measurement of the powder diffraction geometry . a boron nitride - coated graphite resistive heating
element ( boralectric ) was used to heat the sample inside the chamber . the sample was clamped down with alumina spacers ,
and the temperature was measured with a thermocouple in contact with
the sapphire substrate . gases were fed
via computer - controlled mass flow controllers and the borazine via
a manual leak valve . quantitative lattice parameters were derived
by rietveld refinement using xpert plus and file 64699 ( fcc
cu ) from the inorganic crystal structure database ( icsd ) . scanning
electron microscopy ( sem , carl zeiss sigma vp , 12
kv ) and raman spectroscopy ( renishaw in - via 532 nm laser ) after transfer ,
using a pmma support layer as described in detail elsewhere , were used to characterize h - bn
growth . we note that the presented sem images are representative of
measurements across several macroscopically separated points on the
samples . an fei titan 80 - 300 etem equipped with a monochromator at
the electron gun and a spherical aberration ( cs)-corrector
for the objective lens was used for acquiring tem images . samples
are heated for 1 h at 350 c in a vacuum prior to imaging . images
were acquired at 80 kv , energy spread < 0.3 ev , and corrector alignment
to minimize cs to obtain a resolution better than 0.12
nm . | using
a combination of complementary in situ x - ray photoelectron
spectroscopy and x - ray diffraction , we study the fundamental mechanisms
underlying the chemical vapor deposition ( cvd ) of hexagonal boron
nitride ( h - bn ) on polycrystalline cu . the nucleation and growth of
h - bn layers is found to occur isothermally , i.e. , at constant elevated
temperature , on the cu surface during exposure to borazine .
a cu lattice
expansion during borazine exposure and b precipitation from cu upon
cooling highlight that b is incorporated into the cu bulk , i.e. , that
growth is not just surface - mediated . on this basis
we suggest that
b is taken up in the cu catalyst while n is not ( by relative amounts ) ,
indicating element - specific feeding mechanisms including the bulk
of the catalyst . we further show that oxygen intercalation readily
occurs under as - grown h - bn during ambient air exposure , as is common
in further processing , and that this negatively affects the stability
of h - bn on the catalyst . for extended air exposure cu oxidation is
observed , and upon re - heating in vacuum an oxygen - mediated disintegration
of the h - bn film via volatile boron oxides occurs .
importantly , this
disintegration is catalyst mediated , i.e. , occurs at the catalyst / h - bn
interface and depends on the level of oxygen fed to this interface .
in turn , however , deliberate feeding of oxygen during h - bn deposition
can positively affect control over film morphology .
we discuss the
implications of these observations in the context of corrosion protection
and relate them to challenges in process integration and heterostructure
cvd . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
metabolic complication of obesity is rising not only in developed countries but also in developing countries . in fact , obesity can be presented as ( new world syndrome ) the greatest health problem in the modern industrial world . significant changes that occur from adolescence to middle age affect health and can increase the tendency to the disease . two major patterns of fat distribution are : central obesity or apple shape ( android ) , the density and greater fat accumulation in the abdominal region is seen either as visceral or subcutaneous obesity and pear - shaped peripheral ( gynoid ) in which fat density in the lower extremities ( hips , thighs , and legs ) is observed . there are fundamental differences between these two types of obesity because most heart disease and metabolic are associated with vascular and visceral fat stores . obesity reduces vascular compliance and work with the stiffness and hardness and increased resistance to blood vessels in the long term and by factors such as additional energy absorption , low used energy , low level of basal metabolism , reduce fat oxidation , and sympathetic activity . the researchers reported that obesity and decreased levels of high - density lipoprotein ( hdl ) and increased low - density lipoprotein ( ldl ) levels and triacylglycerol are the factors related to heart disease . two months of aerobic activity three times a week for 60 minutes have desirable effects on body composition and blood lipid profiles in young women . the researchers found that aerobic exercise reduces fat mass and decreased body weight that followed . regular exercise may cause a gradual reduction of triglycerides ( tg ) , total cholesterol ( tc ) , ldl , body mass index ( bmi ) , body mass , body fat and increased hdl , body mass , and basal metabolic rate ( bmr ) . a low - calorie diet improves the lipid profile , which if combined with exercise , is targeted at improving body composition . people who associated diet with physical activity achieve better results in reducing body fat , particularly visceral fat than in other areas affected by activities . some researchers reported that those who follow appropriate diet and aerobic exercise for 60 to 90 minutes in 5 to 7 days a week increase the values of vo2 max and hdl and achieve decreased waist circumference . aerobic exercise ( aerobic ) is more effective than other exercises in reducing body fat percentage . american college of sports medicine ( acsm ) and centers for disease control have recommended that adults should ( if not possible each day ) exercise most days of the week for 3 minutes or more . longitudinal studies show that many factors are effective in reducing obesity of whole - body reduced by aerobic exercise training . these infinite factors include characteristics ( gender , baseline obesity , and genetic background ) and various aspects of exercise program ( duration , intensity , and type of exercise ) . most studies show that exercise training , has the potential capacity in changing the body composition . unfortunately , weight loss through diet alone reduces fat - free mass during the intervention period , and weakens fat oxidation after the intervention period , which may cause re - weight . in order to prevent re - weight gain after losing weight , researchers suggest that obesity should be associated with exercise and reducing energy consumption . aerobic exercise reduces acyl - coa synthesis and markedly acyl - coa synthesis mrna levels , lipoprotein lipase , and glut4 in intra - abdominal fat . lipoprotein lipase and glut4 , two important factors for metabolic energy , respectively , are fat and glucose in adipose tissue . lipoprotein lipase and glut4 , thus aerobic activity can be controlled with diet , positive effects on reducing abdominal fat and whole body fat is under a weight loss program . body composition is considered as one of the most important aspects of health for people of all ages , gender , and ethnic groups . it has been well - estimated that aerobic activity can be used as an important component of a comprehensive plan for intervention in reducing weight and lowering the weight , however , there is always this debate that which duration and intensity of exercise would be a stronger stimulus in reducing body fat content . it seems that aerobic activity ( endurance ) is one of the best forms of exercise in weight control programs . changes in body composition are often overlooked in weight control programs . however , reducing the fat mass of body mass loss by maintaining lean body mass , compared to all programs should be the real targets and exercise training appears to be necessary for developing this purpose . the result of the study of narayani and sudhan ( 2010 ) indicate that the body fat percentage and total cholesterol decreases and increase hdl cholesterol in obese women after 6 weeks of endurance training . low - calorie diet plus exercise can reduce body fat through a small cell size but does not change the number of cells . jaafari and colleagues ( 2007 ) in their study investigated the effect of walking sessions per week on the changed body composition , sedentary 36 women who had no history of disease . results showed the mean weight , percent body fat , waist - to - hip ratio ( whr ) and bmi were significantly altered . the effects of regular exercise on middle - aged females can be seen in literature and research samples . deformation in the body composition and increased blood pressure caused by overweight and age can be observed in middle - aged individuals . it has been proved that the negative effects of sedentary living on individuals can be lowered with exercise . according to literature , sports activities promote life quality , and general physical performance completely affects positively the functional capacity of the systems . rahmaninia and hojati ( 2000 ) investigated 20 minutes of aerobic exercise for 6 weeks on body composition and aerobic power of the girl students . results showed significant decrease fat and increase aerobic power in the experimental group than the control group changes in body weight , fat weight and lean body weight with that decrease , but this reduction was not significant . soory and colleagues ( 2007 ) investigated the effect of exercise intensity on cardiovascular risk factors - vascular of non - athlete male students in the two different intensity aerobic training on blood lipid profile concentrations were measured in 47 sedentary male students . comparing the results of the exercise group and control group , there was no significant effect of varying the intensity of exercise on triglyceride levels and also significant effect of moderate intensity exercise on cholesterol levels , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) , and low - density lipoprotein ( vldl ) while aerobic training . although intense exercise had significant effect on some factors such as hdl - c , ldl - c , and had high cholesterol . afzal poor and colleagues ( 2003 ) studied the effects of extreme and moderate aerobic exercise on lipid profile and paraoxonase activity in healthy non - athletes male . the results suggest the existence of significant differences in levels of hdl - c , the ratio of hdl - c to ldl - c as well as its ratio tg , diastolic blood pressure , vo2 max , resting heart rate and indexes of body composition between the control group and the group with aerobic exercise was so high and there was a significant difference between groups in the amounts of ldl - c , tc , and tg . exercise program accompanied with diet makes the individuals feel psychologically good , healthy , and safe enabling them to escape from atherosclerotic risk factors of obesity . it has been proved with the obtained results that the negative effects of sedentary living on individuals are decreased with exercises . de souza e silva and colleagues ( 2009 ) studied effects of two types of aerobic exercise on body fat content and lipid profiles in 45 university male - students . and the results showed significant decrease in body fat content , waist circumference , and ldl levels in both aerobic training and military exercises in the control group . ghroubi and colleagues ( 2009 ) investigated the effects of physical exercise along with diet in treating obesity in young people through a combination of the two exercise protocols . control group without training and experimental group with diet and activity intensity were 60% of maximum heart beat on the treadmill and the third group had a diet plus strength training . reduction in waist circumference , respectively , in the second and third groups was significant . barbara and colleagues ( 2009 ) studied the combined effect of resistance exercise on body composition and lipid profiles of older women and found a significant reduction in tg , hdl , in combination with aerobic exercise and concluded that a combination of aerobic exercise training is more effective than resistance training in improving body composition and lipid profiles . elmahgoub and colleagues ( 2009 ) studied the effect of combined exercise program on indices of body composition , physical fitness and lipid profiles of mentally retarded young people and observed that the exercise group compared with the control group , decreased their weight , bmi , waist circumference , fat mass , levels of ldl , tg , and cholesterol , while hdl levels significantly increased . wong and colleagues ( 2008 ) examined 12-week exercise program on aerobic fitness , body composition , blood lipids in obese adolescents . results showed that exercises significant reduction in bmi , body mass index , net tg levels , and body weight is effective comparing to the control group . irving and colleagues ( 2008 ) investigated the effect of exercise intensity on abdominal visceral fat and body composition in obese middle - aged 27 women participated in the period with a 16-week intervention of aerobic activity . the step aerobic dance program proved to be a useful exercise modality for weight loss and in terms of body composition . there was a clear response to the 8-week step aerobic dance program in terms of central obesity in sedentary obese turkish women . regular physical activity leads to significant changes in terms of increased health - related fitness , and can reduce risk factors for developing a range of disabling medical conditions which occur in inactive people . in general , exercise is beneficial for health and physical fitness , while a sedentary lifestyle has a negative effect on a person 's well - being . unfortunately , because of the conflicting studies , the effect of aerobic exercise intensity on body composition in obese / overweight is still unclear . the aim of this study is to compare the effects of moderate and vigorous aerobic exercise on body composition and some blood parameters in women with obesity and overweight . obese / overweight , 25 to 40 years who went to iranian health clinic to treat obesity formed the statistical community . we selected them based on having a bmi 25 to 30 kg / m and without any disease . approximately 60 people volunteered as a sample to participate in the project and 45 people continued until the cooperation so that the evaluations based on all participants in terms of diet and activity levels ( prescribed by professionals community health clinic ) were matched and randomly assigned to three groups of 15 . two experimental groups were under the effect of each independent variable separately , 1 . with aerobic exercise light intense ( 45 - 50% of maximal hrr ) and 2 . aerobic exercise with moderate intensity ( 70 - 75% maximal hrr ) , and 3 . data collection : selected participants appeared in physiology laboratory at the faculty of physical education of isfahan university for pretest measurements included height , weight , waist circumference , hip circumference , and skin fold in four regions ( ventral , anterior femoral , triceps , and above the pelvis ) to estimate fat percentage , fat weight , lean body weight . auto analyzer method for measuring levels of lipid profiles with bt3000 assay kit was production of pars company . exercise program : aerobic exercise program consists of two protocols with different intensity of the stretching and movement so that each group will perform its own protocol . training groups are working under the control of the researchers 10 weeks , three sessions per week and about 60 minutes each session . polar heart beat meter was used to control the intensity of exercise in each session , and after 10 weeks , all variables were measured in three groups . statistical methods used in this study consisted of calculating descriptive statistics for the central and dispersion parameters , one - way analysis of variance ( anova ) and comparison groups to evaluate the homogeneity of each of the variables included in the three studied group using scheffe test . all operations were performed with spss and statistical significant level of tests was ( p < 0.05 ) . noticing the results of this research in the following tables , we can see that aerobic exercise has caused a significant change in weight ( p < 0.000 ) , fat percent ( p < 0.045 ) , bmi ( p < 0.000 ) , fat weight ( p < 0.031 ) , lean body weight ( p < 0.02 ) , whr ( p < 0.000 ) , and hdl ( p < 0.000 ) of experimental group has been created [ table 1 ] . comparison the mean and sd indicators studied in experimental and control groups according to these results , significant changes resulting from the variance analysis for detecting differences between groups with scheffe post hoc test were investigated [ table 2 ] . comparing the data obtained from the aerobic exercise group with the control group , we found out that significant changes in aerobic exercise with moderate intensity , was more obvious . statistical methods used in this study consisted of calculating descriptive statistics for the central and dispersion parameters , one - way analysis of variance ( anova ) and comparison groups to evaluate the homogeneity of each of the variables included in the three studied group using scheffe test . all operations were performed with spss and statistical significant level of tests was ( p < 0.05 ) . noticing the results of this research in the following tables , we can see that aerobic exercise has caused a significant change in weight ( p < 0.000 ) , fat percent ( p < 0.000 ) , fat weight ( p < 0.031 ) , lean body weight ( p < 0.02 ) , whr ( p < 0.000 ) , and hdl ( p < 0.000 ) of experimental group has been created [ table 1 ] . comparison the mean and sd indicators studied in experimental and control groups according to these results , significant changes resulting from the variance analysis for detecting differences between groups with scheffe post hoc test were investigated [ table 2 ] . comparing the data obtained from the aerobic exercise group with the control group , we found out that significant changes in aerobic exercise with moderate intensity , was more obvious . epidemiologic studies have shown that sedentary life relates to the increases of age and heart disease . although the data are contradictory in this regard , it is proposed that increase in hdl and reduction in tg content after exercise may be associated with gradual effects of exercise training . however , prolonged exercise has been recognized as an important factor for weight loss . proper amount of exercise is needed to improve long - term weight loss is still debated . moreover , owning an appropriate diet and keeping the amount of energy consumption is of equal importance . mild to severe levels of exercise in combination with reduced energy consumption during a 12-month intervention , reduces body weight by 8 - 10% . determining the level of exercise intensity and maintaining it at least 150 minutes per week of moderate - intensity exercise is important until the power of person goes beyond the prescribed amount of exercise , which thus brings it to 60 minutes a day . it is suggested that the combination of strength and aerobic exercise is effective in improving body composition . evaluation has shown that the combination of exercise reduced fat mass and increased body weight in obese middle - aged women , which is probably a result of growth hormone . in order to treat obesity researchers recommended 30 minutes of activity most days a week . aerobic exercise combined with controlled diet significant changes in bmi , body fat mass and body mass in pure aerobic exercise group compared with control groups is interesting . aerobic , adds up the exercise capability of your body to use fat as a substrate increases and total fat oxidation during . in addition , there is a high correlation between the content within the muscle and insulin resistance . it may be suggested that the body mass increases due to increased blood flow and capillary in skeletal muscle and adipose tissue . lipolyze triacylglycerol is high , and the transfer of fatty acids from blood to muscle sarcoplasm is high ; these are the effects on fat during exercise and these effects support by activation of certain enzymes in the oxidative pathway , supports this process . aerobic exercise activates lipoprotein lipase and increased lipoprotein lipase ( lpl ) activity may play an important role in reducing insulin resistance during exercise . most people can take 30 minutes a day walking or converted to jogging activity that is of higher intensity than walking for 20 minutes . the importance of central obesity as an independent risk factor for heart disease - cardiovascular , diabetes type 2 , and hypertension has been found . comparing the high and low intensity physical exercise has shown that the net mass of more vigorous activity has increased , while this finding was not statistically significant . minimum levels of activity can include walking to the 6/9 km during the week , which reduces the amount of central fat and total body fat . the amounts of activity can be balanced without a change in diet and more exercise may lose weight of inborn obese people . particularly vigorous activity decreases significantly the weight , bmi , fat percentage , fat mass , and waist . this could indicate that strenuous exercise can be the subject of total energy intake and energy expenditure during exercise is more effective than moderate activity . there is about 400 kcal difference in energy consumption between high and low intensity activity during 16 weeks of activity , which is approximately 25 kcal per week of vigorous activity and oxygen consumption fare much worse . high - intensity activity to mild activity in visceral fat , the abdominal fuel cycle is more effective , because the lipolytic hormones are sprinkled and after exercise provide the needed energy , fat oxidation and add a negative energy balance . researches have shown that people who do regularly certain exercises , loss much weight than those without a particular sport . metabolic rate increases after exercise , however , does not seem to affect metabolism of people who are not physically able to prepare the necessary amount of time to maintain the metabolic rate after exercise . following a diet , aerobic activity , and strength activity normally decrease lean mass and increase strength and vo2 max when compared to diet alone . training program twice a week during 12 weeks of aerobic fitness improves , while not effective in improving the parameters of adipose tissue in obese and normal weight gain for the higher intensity exercise training and dietary interventions are needed . add a program that improves strength and power to be obese and to provide useful physiological overload for them to increase their energy intake , and prevent further weight gain , it is important . we can also guess that lipid lowering reduces body fat mass can be explained and justified . two months aerobic exercise for 60 minutes , three times a week , has a desirable effect on body composition and blood lipid profile of young women . body weight and bmi are factors that are directly associated with heart disease have vascular connections . the researchers found that aerobic exercise reduces fat mass and decreased body weight that followed . time needed to change some parameters are based on : 2 weeks for the levels of tumor associated glycoprotein ( tag ) , 4 weeks for vo2 max , 6 weeks , and 8 weeks for body weight and bmi , body fat mass , and to change hdl levels in blood . regular exercise may be a gradual reduction of tg , tc , ldl , bmi , body mass , body fat and increase hdl , body mass , and bmr is the net . some researchers reported that people who adhere to diet and aerobic exercise for 60 to 90 minutes in 5 to 7 days a week due to the increase in vo2 max and hdl levels are achieved and their waist circumference decreased . since physical activity significantly reduces body fat content for the treatment of heart disease , it is very important in cardiovascular exercise ( aerobics ) compared to other training is more effective in reducing body fat percentage , so most studies , exercises offer aerobics . perhaps the increased skeletal muscle lipoprotein lipase activity and increased lipoprotein lipase mass index , blood lipids during exercise is one of the factors . increase in capillary density , the greater the potential for harvest and use of fatty acids that may increase the density function of hdl in people who provide training . differences in severity , type , and duration of exercise protocols may be differences between individuals . degrees of glucose tolerance and body fat distribution between the individual participants may be from other causes . in sedentary overweight women , with aerobic activity , three days a week for 60 minutes of moderate intensity can be remarkably improved their body composition . it can be said that in the obese and overweight women , the applied exercise protocol have an important effect on the antropometric and hematologic levels , regular aerobic exercises will reduce the body fat percentage without the loss of the muscle . thus , to exercise longer is a need for significant reduction in body fat mass . to improve health and body composition furthermore , diet program in addition to exercise program will provide more prolific results with obese people . it has been proved with the obtained results that the negative effects of sedentary living on individuals are decreased with exercises . | background : obesity is a threat to the health of modern urban citizens , especially women .
aerobic is an effect of exercise which rapidly is developing among urban women .
this study was designed to examine the effects of light and moderate aerobic intensity on body composition and serum lipid profile in obese / overweight women living in isfahan.methods:forty-five middle - aged obese / overweight volunteer women ( 25 - 40 years , and body mass index ( bmi ) 25 to 30 kg / m2 ) were randomly assigned into three groups : 1 . light aerobics [ 45 - 50% heart rate reserve maximum ( hrrmax ) ] , 2 .
moderate aerobics ( 70 - 75% hrrmax ) , 3 .
no exercise training ( control ) . training program lasted for 10 weeks and included three sessions of 60 minutes aerobics per week .
the intensity of aerobics was controlled by monitoring heart rate .
body composition was measured using skin fold thickness method .
serum lipid was measured.results:both light and moderate aerobics significantly improved weight ( p < 0.000 ) , fat percent ( p < 0.045 ) , bmi ( p < 0.000 ) , fat weight ( p < 0/031 ) , lean body weight ( p < 0.02 ) , waist - to - hip ratio ( whr ) ( p < 0.000 ) , high - density lipoprotein ( hdl ) ( p < 0.000).conclusions : our findings showed that both light and moderate aerobics improved body composition and serum lipid profile in obese / overweight women .
our findings support the application of aerobics for obese / overweight women .
initially , they can start with light programs and proceed to more intense programs . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
of the inner disorders that result in vertigo the most common cause is benign paroxysmal positional vertigo ( bppv ) accounting for between 17% and 40% of all vertigo cases presenting in the clinic ( 1 - 3 ) . bppv most commonly affects the posterior canal and the primary symptom is of brief episodes of true rotatory vertigo upon specific head movements . in most cases bppv can be treated with particle repositioning manoeuvres ( 4 ) . however in a small number of cases this does not work and surgical intervention is required . of the surgical options available most popular is the posterior semicircular canal occlusion technique which has high success rates with low post - operative complications ( 5,6 ) . the technique involves gaining access to the posterior canal via a cortical mastoidectomy and then occluding the canal preventing endolymphatic flow and thereby rendering the canal dysfunctional . whilst complications are rare , one problem that can occur is the formation of an iatrogenic fistula . traditionally , a combination of bone dust , fat , temporalis fascia , perichondrium and bone wax are used to repair the fistula . these materials are primarily chosen because they are easy to apply and do not provoke a foreign body reaction . however they can fail and as result revision surgery is needed ( 7 ) . in this report we describe a case of an iatrogenic fistula following posterior canal occlusion surgery in which the revision repair was done using a novel technique utilising a synthetic material ( tissuepatchdural90 ) . a 49 year old woman was referred to our specialist ent balance service following a two year history of brief intermittent bouts of true rotatory vertigo coupled with continuous imbalance . there were no reported complaints of hearing loss , tinnitus , aural fullness or other otological symptoms . repeated dix - hallpike tests were positive for left sided posterior semicircular canal bppv despite multiple particle repositioning procedures over a period of three years . the lateral semicircular canal and incus were identified and the bony labyrinth was seen suspended in the fine cancellous bone of the mastoid . this was blue lined over a long length and then cautiously opened to expose the membranes ( figure 1 ) . bone dust and bone wax were then used to pack and occlude the canal ( figure 2 ) . a further patch of bone dust was applied over this repair and gel - foam placed on top of this . exposed membranous posterior semicircular canal insertion of bone dust into posterior semicircular canal following surgery there was some initial imbalance but the bppv was absent . however over the coming weeks episodes of short spinning began to occur following sudden pressure changes such as when blowing her nose or straining on the toilet . as a result a perilymph fistula was suspected and a revision mastoidectomy planned . during the operation however at the superior limit of the posterior canal a defect remained . to repair this defect the existing bone dust this was covered by temporalis fascia graft ( figure 3 ) onto which a piece of tissuepatchdural90 was placed to secure the graft firmly ( figure 4 ) . placement of temporalis fascia placement of tissuepatchdural90 at a three month post - operative review there had been no recurrences of vertiginous symptoms and there was also improvement in overall balance . further physical therapy exercises were given and at the time of writing this article , nine months post - operation , the patient remains symptom free . for a small number of patients with intractable posterior canal bppv surgical occlusion of the semicircular canal is warranted . this procedure carries a small risk of creating an iatrogenic fistula which can result in recurrence of bppv as well as chronic imbalance . in this paper we have shown that such fistulas can be reliably repaired using tissuepatchdural90 as an adjunct to the materials already utilised by surgeons . the key advantage of using this material is that it is easy to cut to shape and size and apply . furthermore it forms a seal quickly and acts as an excellent anchor for the bone graft to take . we suggest that it is indicated in the repair of defects created by posterior canal occlusion surgery as well as other procedures such as intra - operative csf leaks during mastoid surgery or endolymphatic sac repairs . as it now seems safe with both csf and perilymph we can not identify specific contraindications for use in ear surgery . for these reasons we believe publicising the potential of this material may prove useful to other surgeons . to our knowledge this is the first reported case of tissuepatchdural90 used in otological surgery and in this case the resulting repair has been excellent with no complications nine months post operatively . | benign paroxysmal positional vertigo ( bppv ) is a common disorder caused by the dislocation of otoconia most commonly into the posterior canal .
the primary symptoms are brief episodes of head - position related vertigo which may be accompanied by nausea and disequilibrium .
bppv is usually managed conservatively with excellent results , however in a small number of cases the symptoms can become persistent and incapacitating .
the most common treatment in such cases involves the surgical occlusion of the canal .
this procedure carries a small risk of post operative perilymph leakage via an iatrogenic fistula.in this paper we outline a case of a patient who developed a perilymph leak following occlusion surgery for intractable bppv .
we describe a novel surgical method that was used to close the fistula using a synthetic polymer based patch ( tissuepatchdural90 ) , which has not been applied in the field of otology previously . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 68-year - old woman presented with symptoms of a constricted visual field in her right eye . although the best - corrected visual acuity ( bcva ) was 20/25 in both eyes , a fundus examination revealed multiple telangiectatic and aneurysmal retinal vessels , retinal hemorrhages , and subretinal exudates at the inferior mid - periphery of her right eye . a fluorescein angiography showed early and persistent leakage in the abnormal vessels at the inferior mid - periphery and hypofluorescence corresponding to the subretinal exudates in the right eye . with the diagnosis of adult coats ' disease , scatter laser photocoagulation was applied to the abnormal retinal vessels . at 9 months after presentation , a fundus examination revealed about 1 disc diameter extension of the subretinal exudates to the fovea . pdt was used to treat the 2 large active areas of abnormal telangiectatic and aneurysmal retinal vessels ( fig . after the pdt treatment , intravitreal bevacizumab was injected in order to decrease exudation and to block the regeneration of abnormal retinal vessels which were obliterated by pdt . at 2 months post - pdt , a second intravitreal bevacizumab injection was given . at 4 months post - pdt , a third intravitreal bevacizumab injection was given and an additional scatter laser photocoagulation was applied to the area where the pre - existing abnormal retinal vessels and subretinal exudates had been located . at 6 months post - pdt , a fundus examination of the right eye showed a significant regression of the abnormal retinal vessels and subretinal exudates ( fig . at 9 months post - pdt , the subretinal exudates withdrew further from the fovea and the patient 's visual acuity remained stable with a bcva of 20/25 in both eyes ( figs . the conventional treatment for coats ' disease involves laser photocoagulation or cryotherapy to ablate abnormal telangiectatic vessels and preserve visual acuity . the subretinal exudates regress after laser photocoagulation or cryotherapy . however , in our case the high intensity laser photocoagulation applied to the abnormal retinal vessels was not absorbed sufficiently , due to the massive retinal exudates . we thought that pdt would be more effective than laser photocoagulation at obliterating the multiple abnormal retinal vessels that were surrounded by the massive retinal exudates . laser photocoagulation is not an efficient treatment modality if subretinal exudates obscure a target tissue . however , pdt utilizes an exogenous agent , photosensitizing the abnormal retinal vessels that are surrounded by exudates and the interaction between the laser beam and the agent produces a photochemical reaction that results in cellular damage and vascular thrombosis of target tissue . we considered that an additional use of anti - vegf agent could prevent the regeneration of abnormal retinal vessels that were obliterated by pdt and could suppress exudation induced by inflammatory cytokines . abnormal retinal vessels and exudates in coats ' disease may impair the oxygenation of the outer retina , and the secondary over - expression of vegf that gets produced as a result may cause microvascular changes . this mechanism suggests that anti - vegf is a potentially good treatment modality for coats ' disease , which was evident in case reports . in addition , anti - vegf had a synergistic effect on pdt for the treatment of choroidal neovascularization . . suggested that anti - vegf might prolong choriocapillaris hypoperfusion induced by pdt , thus leading to a secondary effect on perfusion of choroidal neovascularization . we are unable to comment on the potential long - term effect of the combined treatment of pdt and intravitreal bevacizumab injection , based on this single case . further research is needed to determine the efficacy of this combined therapy for the treatment of coats ' disease . however , we are optimistic about the role of this combined treatment in cases of coats ' disease that are refractory to conventional laser photocoagulation or cryotherapy - based treatment , and in vision - threatening conditions needing urgent treatment . in conclusion , combined treatment of pdt and intravitreal bevacizumab injection is a kind of treatment modality for cases of adult coats ' disease which can not be treated by cryotherapy and are refractory to laser photocoagulation . | a 68-year - old woman presented with a visual field defect in her right eye .
the fundus of her right eye showed multiple telangiectatic vessels , retinal hemorrhages , and subretinal exudates in the inferior peripheral retina .
nine months later , the subretinal exudates extended to the fovea despite treatment with laser photocoagulation .
cryotherapy was not possible at the time because of the posterior location of the retinal telangiectatic vessels .
she was treated with a combination of photodynamic therapy ( pdt ) and intravitreal bevacizumab injection : three injections were given at 2-month intervals .
after this combined therapy , her right fundus revealed a significant regression of abnormal retinal vessels and subretinal exudates .
a fluorescein angiography showed no leakage from the abnormal retinal vessels . at 9 months after the combined therapy
, she was able to maintain a stable visual acuity and visual field .
this is the first case report that demonstrates the efficacy of the combined treatment of pdt and intravitreal bevacizumab injection in coats 's disease .
this combined therapy is a kind of treatment modality for adult coats ' disease in cases which cryotherapy can not be employed and are refractory to laser photocoagulation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prostate cancer is one of the most commonly diagnosed cancers in men in western developed countries , and the morbidity is increasing in china with the aging of the population and the advance of diagnostic techniques [ 14 ] . for patients with localized disease , unfortunately , approximately 30% of patients will experience recurrence after the initial therapy and then subsequently developing metastatic disease [ 58 ] . currently , the conventional clinicopathological parameters , such as serum prostate - specific antigen ( psa ) , pathological gleason score , and tumor stage , are commonly used to predict patient outcome after initial management , but the accuracy of this prediction remains unsatisfactory for many patients [ 911 ] . prostate cancer is a heterogeneous , multifocal disease with the outcome difficult to predict , thus new biomarkers are urgently needed to predict the outcome of patients and distinguish which patients need more aggressive adjuvant therapy after initial curative treatment . like many other human cancers , the initiation and progression of prostate cancer is characterized by gradual accumulation of multiple genetic and epigenetic changes [ 1214 ] . dna methylation is one of the most studied epigenetic changes in human cancers , which occurs in the cpg islands in the gene promoter regions . aberrant promoter methylation results in the silencing of tumor suppressor genes and plays an important role in the development and progression of prostate cancer [ 1214 ] . the identification of novel methylated genes may be helpful in the diagnosis , monitoring , prognosis , and individualization of treatment strategy . in recent years , more and more researchers found that the association between cadherin and tumors is a fascinating field of cancer research . cadherin is a superfamily , including classical cadherins , protocadherins ( pcdhs ) , and cadherin - related proteins . pcdhs , a subfamily of cadherin superfamily , are divided into 2 groups : clustered pcdhs and non - clustered pcdhs . studies have demonstrated that promoter methylation and transcriptional silencing of non - clustered pcdhs genes occur frequently in numerous human cancer types . pcdh17 is a member of the non - clustered pcdhs , and the association of pcdh17 with human cancers has been proposed . pcdh17 functions as a tumor suppressor in several human cancers , such as laryngeal squamous cell carcinoma , gastric cancer , colorectal cancer , and bladder cancer [ 1621 ] . moreover , the pcdh17 gene is located on the chromosome 13q21.2 in humans , and is often inactivated by promoter methylation in human cancers , including prostate cancer . however , the methylation status of pcdh17 in prostate cancer and its clinical significance remain largely unknown . in the current study , the methylation status of pcdh17 in prostate cancer tissues and non - tumoral prostate tissues was examined by msp . subsequently , we analyzed the potential associations between pcdh17 methylation and clinicopathological characteristics , including patient outcome , to evaluate its clinical significance . a total of 152 prostate cancer patients who underwent radical prostatectomy between january 2004 and january 2007 at the third hospital of hebei medical university were investigated . none of the patients received radiotherapy , chemotherapy , or androgen deprivation therapy prior to surgery . the tumor samples were reviewed on he - stained tissue sections to confirm diagnosis and tumor content of at least 70% of tumor cells in the tissue samples . non - tumoral prostate tissues were obtained from 51 patients with benign prostatic hyperplasia ( bph ) who were treated by transurethral resection of the prostate during the same time in the same hospital ; these tissues were examined pathologically to exclude the possibility of incidental tumors . the tissue samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until dna extraction . the clinicopathological parameters of prostate cancer patients , including preoperative serum prostate specific antigen ( psa ) , pathological stage , pathological gleason score , lymph node status , angiolymphatic invasion , margin status , seminal vesicle invasion , bcr , bcr - free survival , and overall survival , were recorded . the pathological parameters were evaluated by 2 senior genitourinary pathologists ( yang sh and wang ll ) in our center . the bcr was defined as the measurement of 2 successive values of serum psa level 0.2 ng / ml . the overall survival time was defined as the period between radical prostatectomy and the death from any cause or the last contact if the patient was still alive , ranging from 20 months to 60 months ( median 60 months ) . written informed consent was obtained from all participants , and this study was approved by the ethics committee of the third hospital of hebei medical university ( no . the genomic dna was extracted from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) following the manufacturer s instructions . the extracted dna was modified with bisulfite to convert unmethylated cytosines to uracils prior to msp using the epitect bisulfite kit ( qiagen , valencia , ca ) . the methylation status of pcdh17 was examined using primers specific for pcdh17 unmethylated and methylated sequences , as reported previously [ 20 , 21 ] . the following primers were used : unmethylated : forward 5-agattattgggtgttgtagttt-3 and reverse 5-aaccctaacacaacatacaca-3 ; methylated : forward 5-gattatcgggtgtcgtagttc-3 and reverse 5-ccctaacgcaacgtacgcg-3. the pcr amplification consisted of 1 cycle of 95c for 10 min , 40 cycles of 94c for 30 s , 60c for 30 s , and 72c for 30 s for the methylated reaction or 42 cycles of 94c for 30 s , 60c for 30 s , and 72c for 30 s for the unmethylated reaction . water blanks were included with each assay . in vitro methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) pcr products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis . samples were scored as methylation - positive when methylated alleles were present in the methylated dna lane and methylation - negative when bands were present only in the unmethylated dna lane . statistical analysis was performed using sas version 8.0 ( sas institute , cary , n.c . fisher s exact test was used to assess the difference of pcdh17 methylation status between prostate cancer patients and patients with bph . the chi - square test or fisher s exact test was used to identify associations between pcdh17 methylation and clinicopathological features . kaplan - meier survival analysis and log - rank test were used to assess the differences of bcr - free survival and overall survival between patients with pcdh17 methylated and unmethylated . multivariate cox proportional hazard model analysis was used to assess the independent prognostic effect of pcdh17 methylation in prostate cancer . a total of 152 prostate cancer patients who underwent radical prostatectomy between january 2004 and january 2007 at the third hospital of hebei medical university were investigated . none of the patients received radiotherapy , chemotherapy , or androgen deprivation therapy prior to surgery . the tumor samples were reviewed on he - stained tissue sections to confirm diagnosis and tumor content of at least 70% of tumor cells in the tissue samples . non - tumoral prostate tissues were obtained from 51 patients with benign prostatic hyperplasia ( bph ) who were treated by transurethral resection of the prostate during the same time in the same hospital ; these tissues were examined pathologically to exclude the possibility of incidental tumors . the tissue samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until dna extraction . the clinicopathological parameters of prostate cancer patients , including preoperative serum prostate specific antigen ( psa ) , pathological stage , pathological gleason score , lymph node status , angiolymphatic invasion , margin status , seminal vesicle invasion , bcr , bcr - free survival , and overall survival , were recorded . the pathological parameters were evaluated by 2 senior genitourinary pathologists ( yang sh and wang ll ) in our center . the bcr was defined as the measurement of 2 successive values of serum psa level 0.2 ng / ml . the overall survival time was defined as the period between radical prostatectomy and the death from any cause or the last contact if the patient was still alive , ranging from 20 months to 60 months ( median 60 months ) . written informed consent was obtained from all participants , and this study was approved by the ethics committee of the third hospital of hebei medical university ( no . the genomic dna was extracted from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) following the manufacturer s instructions . the extracted dna was modified with bisulfite to convert unmethylated cytosines to uracils prior to msp using the epitect bisulfite kit ( qiagen , valencia , ca ) . the methylation status of pcdh17 was examined using primers specific for pcdh17 unmethylated and methylated sequences , as reported previously [ 20 , 21 ] . the following primers were used : unmethylated : forward 5-agattattgggtgttgtagttt-3 and reverse 5-aaccctaacacaacatacaca-3 ; methylated : forward 5-gattatcgggtgtcgtagttc-3 and reverse 5-ccctaacgcaacgtacgcg-3. the pcr amplification consisted of 1 cycle of 95c for 10 min , 40 cycles of 94c for 30 s , 60c for 30 s , and 72c for 30 s for the methylated reaction or 42 cycles of 94c for 30 s , 60c for 30 s , and 72c for 30 s for the unmethylated reaction . methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) were used as methylation and non - methylation positive controls . pcr products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis . samples were scored as methylation - positive when methylated alleles were present in the methylated dna lane and methylation - negative when bands were present only in the unmethylated dna lane . statistical analysis was performed using sas version 8.0 ( sas institute , cary , n.c . fisher s exact test was used to assess the difference of pcdh17 methylation status between prostate cancer patients and patients with bph . the chi - square test or fisher s exact test was used to identify associations between pcdh17 methylation and clinicopathological features . kaplan - meier survival analysis and log - rank test were used to assess the differences of bcr - free survival and overall survival between patients with pcdh17 methylated and unmethylated . multivariate cox proportional hazard model analysis was used to assess the independent prognostic effect of pcdh17 methylation in prostate cancer . in the current study , we first examined the methylation status of pcdh17 in prostate cancer tissues and non - tumoral prostate tissues using msp . the results showed that pcdh17 methylation occurred in 102 ( 67.1% ) prostate cancer patients , but no pcdh17 methylation was detected in non - tumoral prostate tissues and the difference was significant ( p<0.0001 ) . this finding indicated that pcdh17 methylation is a frequent tumor - specific event in prostate cancer . the main purpose of this study was to investigate the clinical significance of pcdh17 methylation in prostate cancer , and then to correlate the methylation status of pcdh17 with clinicopathological parameters . we found that pcdh17 methylation in prostate cancer tissues was associated with higher pathological gleason score ( p=0.0315 ) , advanced pathological stage ( p=0.0260 ) , higher level of preoperative psa ( p=0.0354 ) , positive angiolymphatic invasion ( p=0.0461 ) , positive lymph node metastasis ( p=0.0362 ) , and bcr ( p=0.0018 ) . these results are summarized in table 3 . to determine the prognostic value of pcdh17 for patients with prostate cancer after radical prostatectomy , bcr - free survival and overall survival were analyzed and patients were divided into 2 groups : patients with pcdh17 methylated and pcdh17 unmethylated . kaplan - meier survival analysis and log - rank test indicated that patients with pcdh17 methylated had significantly shorter bcr - free survival ( figure 1 , p=0.0028 ) and overall survival ( figure 2 , p=0.0187 ) than patients with pcdh17 unmethylated . to determine if pcdh17 methylation is an independent predictor of bcr - free survival or overall survival after radical prostatectomy , multivariate cox proportional hazard model analysis was performed . the results suggested the pcdh17 methylation was simultaneously an independent prognostic factor for bcr - free survival and overall survival . in the current study , we first examined the methylation status of pcdh17 in prostate cancer tissues and non - tumoral prostate tissues using msp . the results showed that pcdh17 methylation occurred in 102 ( 67.1% ) prostate cancer patients , but no pcdh17 methylation was detected in non - tumoral prostate tissues and the difference was significant ( p<0.0001 ) . this finding indicated that pcdh17 methylation is a frequent tumor - specific event in prostate cancer . the main purpose of this study was to investigate the clinical significance of pcdh17 methylation in prostate cancer , and then to correlate the methylation status of pcdh17 with clinicopathological parameters . we found that pcdh17 methylation in prostate cancer tissues was associated with higher pathological gleason score ( p=0.0315 ) , advanced pathological stage ( p=0.0260 ) , higher level of preoperative psa ( p=0.0354 ) , positive angiolymphatic invasion ( p=0.0461 ) , positive lymph node metastasis ( p=0.0362 ) , and bcr ( p=0.0018 ) . to determine the prognostic value of pcdh17 for patients with prostate cancer after radical prostatectomy , bcr - free survival and overall survival were analyzed and patients were divided into 2 groups : patients with pcdh17 methylated and pcdh17 unmethylated . kaplan - meier survival analysis and log - rank test indicated that patients with pcdh17 methylated had significantly shorter bcr - free survival ( figure 1 , p=0.0028 ) and overall survival ( figure 2 , p=0.0187 ) than patients with pcdh17 unmethylated . to determine if pcdh17 methylation is an independent predictor of bcr - free survival or overall survival after radical prostatectomy , multivariate cox proportional hazard model analysis was performed . the results suggested the pcdh17 methylation was simultaneously an independent prognostic factor for bcr - free survival and overall survival . aberrant dna methylation is a common event in human cancers and plays important roles in the initiation and progression of many cancer types , including prostate cancer [ 1214 ] . the identification of dna methylation involved in the development and progression of prostate cancer can identify novel therapeutic targets as well as being used as diagnostic and prognostic markers . prostate cancer is one of the most commonly diagnosed cancers in elderly men in the world . currently , the majority of prostate cancers can be detected at a localized stage , as a result of the widely used psa - based screening program . however , a considerable number of the patients will experience biochemical recurrence and many patients inevitably develop metastatic disease . since prostate cancer is a heterogeneous disease and can present as indolent or aggressive disease , reliable predictive biomarkers are urgently needed to guide individualized therapy strategy , disease monitoring , and adjuvant treatment at the time of diagnosis [ 5,2327 ] . currently , the only biomarker used for detection and monitoring treatment efficacy of prostate cancer is psa , but psa has several limitations . it is not specific for prostate cancer , as it is commonly elevated in benign conditions , such as bph ; and it is unable to distinguish indolent disease from aggressive disease at the time of diagnosis . in addition , psa is not sensitive , as demonstrated by the recent prostate cancer prevention trial , which demonstrated that 15% of men with psa of 04.0 ng / ml have prostate cancer , and with 15% of them having high gleason grade disease . protocadherins are a subfamily of the cadherin superfamily , and some protocadherins act as tumor suppressors , such as pcdh8 , pcdh10 , pcdh17 , and pcdh20 [ 2932 ] . recent studies demonstrated that pcdh8 is frequently inactivated by promoter methylation in several human cancers , and functions as a tumor suppressor . moreover , pcdh8 methylation is a common event in bladder cancer , and is associated with worse outcomes of patients with bladder cancer [ 3335 ] . pcdh10 and pcdh20 are also frequently downregulated by promoter methylation and may serve as tumor suppressors in several human cancers [ 3639 ] . pcdh - pc is another member of the non - clustered pcdhs , and recent studies demonstrated that it is enriched in advanced castration - resistant prostate cancers and their metastases . in addition , ectopic expression of pcdh - pc in human prostate cancer cells induces cell growth and survival in vitro , and causes tumorigenesis in castrated mice . these findings indicate that not all non - clustered pcdhs function as tumor suppressors in human cancer . in addition , our previous study found that pcdh17 methylation is associated with the development and poor prognosis of bladder cancer . these findings prompted us to investigate the clinical significance of pcdh17 methylation in prostate cancer . in the present study , we firstly investigated the methylation status of pcdh17 in prostate cancer tissues and non - tumoral prostate tissues . the results suggested that pcdh17 is a frequent tumor - specific event in prostate cancer , and may be used as potential biomarker . to the best of our knowledge , this is the first report to describe the associations between pcdh17 methylation and clinicopathologic features . interestingly , pcdh17 methylation significantly correlated with higher pathological gleason score , advanced stage , higher level of preoperative psa , positive angiolymphatic invasion , positive lymph node metastasis , and biochemical recurrence , which are all risk factors for prostate cancer progression and poor outcome . these findings suggest that pcdh17 methylation may be a potential prognostic factor for the outcome of prostate cancer patients . we then analyzed the bcr - free survival and overall survival according to the methylation status of pcdh17 in tumor samples . kaplan - meier survival analysis and log - rank test indicated that patients with pcdh17 methylated had significantly shorter bcr - free survival and overall survival , respectively ; indicating that pcdh17 methylation in tumor samples is a potential prognostic biomarker for predicting worse outcome after radical prostatectomy . the multivariate analysis showed that pcdh17 methylation was an independent predictor of shorter bcr - free survival and overall survival in prostate cancer patients after radical prostatectomy . taken together , these findings indicate that pcdh17 methylation may play crucial roles in the pathogenesis and aggressiveness of prostate cancer , and correlate with worse outcome in prostate cancer . furthermore , dna methylation can be reversed by demethylating agents and the crucial role of pcdh17 methylation in human cancer , suggesting the possibility of making it a potential therapeutic target for anticancer treatment . reported that the methylation status of pcdh17 in esophageal squamous cell carcinoma cells can be reversed by 5-aza-2-deoxycytidine , and reduced cell proliferation , migration , and invasion in vitro . to the best of our knowledge , there has been no published report about using pcdh17 as anticancer therapy target in prostate cancer . in the future , we will focus on investigating the possibility of using pcdh17 methylation as a therapeutic target in vitro and in vivo . in addition , the precise cause and mechanism of pcdh17 methylation in prostate cancer remains unclear , and additional studies are needed to elucidate it in the future . our current data demonstrated that pcdh17 methylation in tumor samples is a frequent tumor - specific event in prostate cancer , and is significantly correlated with higher pathological gleason score , advanced stage , higher level of preoperative psa , positive angiolymphatic invasion , positive lymph node metastasis , and biochemical recurrence . in addition , patients with pcdh17 methylated had significantly shorter bcr - free survival and overall survival . pcdh17 methylation is a potential prognostic biomarker for predicting worse outcome after radical prostatectomy . for patients with pcdh17 methylated in tumor samples , more aggressive adjuvant therapy should be performed after radical prostatectomy in order to achieve better outcome . however , our findings need to be verified in future multi - center studies with larger sample sizes of patients with prostate cancer . | backgroundaberrant methylation of protocadherin 17 ( pcdh17 ) has been reported in several human cancers .
however , the methylation status of pcdh17 in prostate cancer and its clinical significance remains unclear .
the aim of this study was to investigate the methylation status of pcdh17 and its clinical significance in patients with prostate cancer after radical prostatectomy.material/methodsthe methylation status of pcdh17 in 152 prostate cancer tissues and 51 non - tumoral prostate tissues was examined by methylation - specific pcr ( msp ) .
then the association between pcdh17 methylation and clinicopathologic parameters was analyzed .
kaplan - meier survival analysis , log - rank test and multivariate cox proportional hazard model analysis were used to analyze the correlation between pcdh17 methylation and prognosis of patients with prostate cancer.resultsour data demonstrated that pcdh17 methylation occurred frequently in prostate cancer .
pcdh17 methylation was significantly associated with higher pathological gleason score ( p=0.0315 ) , advanced pathological stage ( p=0.0260 ) , higher level of preoperative psa ( p=0.0354 ) , positive angiolymphatic invasion ( p=0.0461 ) , positive lymph node metastasis ( p=0.0362 ) , and biochemical recurrence ( bcr ) ( p=0.0018 ) . in addition ,
pcdh17 methylation was an independent predictor of poor biochemical recurrence - free ( bcr - free ) survival and overall survival for patients with prostate cancer.conclusionspcdh17 methylation is a frequent tumor - specific event in prostate cancer , and is significantly correlated with shorter bcr - free survival and overall survival of patients with prostate cancer after radical prostatectomy .
pcdh17 methylation in tumor samples after radical prostatectomy may be used as an independent prognostic biomarker . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pablo luis mirizzi , an argentine surgeon , first described the syndrome in 1948 : biliary obstruction resulting from impacted stone in the cystic duct or the gallbladder neck . anatomical variations with long cystic duct parallel to the common hepatic duct or a low insertion of the cystic duct predispose to development of this syndrome . it has been noted to occur in up to 5.7% of all cholecystectomies , and 89.5% of patients with cholecystoenteric fistula had an associated mirizzi syndrome in a retrospective analysis . four types of mirizzi syndrome have been described which are detailed later in this article . mirizzi syndrome needs to be considered in the differential diagnosis of any patient presenting with obstructive jaundice . ct scan does not add to sonographic findings with respect to imaging of the stone and biliary obstruction ; however it can help detect malignancy if enlarged porta hepatis lymph nodes or hepatic metastases are noted . when suspected , preoperative cholangiography can be used to determine the presence or absence of a fistula . only 10 out of 25 patients with this condition who were studied by zhong and gong were diagnosed preoperatively . magnetic resonance cholangiopancreatography ( mrcp ) , endoscopic retrograde cholangiopancreatography ( ercp ) and percutaneous transhepatic cholangiography ( ptc ) are the options for preoperative cholangiography . therapeutic intervention would be possible during ercp or ptc , but not during mrcp . ercp can also be advantageous since visualization of the extrahepatic bile ducts is superior to ptc . endoscopic treatment with or without lithotripsy can also be used as a temporizing measure prior to surgery or as a definitive treatment in poor surgical risk candidates . electrohydraulic lithotripsy along with sphincterotomy , mechanical lithotripsy , dissolution therapy with methyl tert - butyl ether , extracorporeal shockwave lithotripsy and common bile duct ( cbd ) stents have been utilized during endoscopic treatment . open cholecystectomy is the major modality of management although a laparoscopic approach may be justified in some patients with type 1 variant of this syndrome [ 9 , 10 ] . surgery for mirizzi syndrome constitutes a laparoscopic challenge and conversion to open surgery has been recommended if local anatomy is not clear . herein , we describe a 66-year - old man who presented with obstructive jaundice and was diagnosed with mirizzi syndrome type 1 on endoscopic ultrasound ( eus ) exam . to our knowledge , there is only one other case report with published an eus image of mirizzi syndrome . a 66-year - old man with a history of severe peripheral vascular disease and left iliac artery stent placement was seen in his primary care doctor 's clinic for acute onset of jaundice , malaise and dark urine over 34 days . he had a dull , aching epigastric and right upper abdominal pain for 2 weeks prior to presentation . he could not relate worsening pain to meals and could not identify any inciting factors for the pain . pain lasted from a few minutes to an hour once it occurred and it happened approximately 34 times daily . jaundice developed rapidly in the 34 days prior to presentation , which made him visit his primary care doctor . laboratory testing showed elevated liver enzymes : ast 92 u / l ( normal 740 u / l ) , alt 145 u / l ( normal 756 u / l ) , alp 443 u / l ( normal 25110 u / l ) and total bilirubin 25.3 mg / dl ( normal 0.31.2 mg / dl ) , direct bilirubin 18.9 mg / dl . ct scan of the abdomen revealed intrahepatic biliary ductal dilation , a 1.5 cm cbd above the pancreas and rounded radiopaque densities ( possibly stones ranging from 3 to 4 mm ) in the cbd within the pancreas . his primary care provider referred him to a community gastroenterologist who performed ercp . during ercp , the cbd could not be cannulated or opacified and the pancreatic duct was normal . l , alt 159 u / l , alp 1,024 u / l , total bilirubin 33.7 mg / dl , wbc 18,100/l ( normal 4,50011,000/l ) and inr 1.3 ( range 0.81.2 ) . eus was performed prior to ercp to evaluate the bile ducts and pancreas further and to determine the cause of biliary obstruction . 1 ) , showing proximal cbd dilation , narrowing of the cbd due to extrinsic compression from cystic duct stone , acoustic shadow from cystic duct stone , stone in the cystic duct and distal cbd stone . a mid cbd narrowing , distal cbd stones , proximal cbd and extrahepatic duct dilation were noted , and biliary sphincterotomy was performed . 2a ) showed a dilated cystic duct and a dilated cbd , proximal to the obstructing stone in the cystic duct . figure 2b depicts a stone in the cystic duct which moved slightly with catheter use during ercp , causing relief of obstruction in the cbd . 3a ) was used to crush the stone , which was now lying in the cbd . a dilated cystic duct and cbd were noted at the end of the procedure after complete stone extraction ( fig . type 1 mirizzi syndrome refers to extrinsic compression of the cbd with intact ( 1a ) or obliterated ( 1b ) cystic duct without a cholecystocholedochal fistula . three other types have a cholecystocholedochal fistula and vary in terms of size , expressed as percentage of the cbd width . type 2 includes all cholecystocholedochal fistulas under 33% of the cbd width ; type 3 encompasses all cholecystocholedochal fistulas ranging from 33 to 66% of the cbd width ; type 4 includes cholecystocholedochal fistulas more than 66% of the cbd width . diagnosis of mirizzi syndrome prior to surgery is important so that bile duct injury can be avoided , however preoperative diagnosis is possible only in a small percentage of patients . detailed the surgical approach depending on the variants of mirizzi syndrome . in type 1 syndrome , for mirizzi syndrome types 2 and 3 , partial cholecystectomy without removal of the portion of the gallbladder around the fistula margin may be attempted . in some cases , a bilioenteric anastomosis may be required depending on the size of the fistula in type 3 mirizzi syndrome . for mirizzi syndrome type 4 , the entire wall of the cbd would be destroyed , so bilioenteric anastomosis with roux - en - y hepaticojejunostomy was the preferred method of surgical management . the laparoscopic approach to mirizzi syndrome is controversial and has been recommended to be restricted to type 1 patients with careful patient selection [ 9 , 10 ] . the syndrome needs to be suspected in any patient who presents with obstructive jaundice , and surgery remains the mainstay of therapy . | we describe a 66-year - old caucasian man with type 1 mirizzi syndrome diagnosed on endoscopic ultrasound .
he presented with acute onset of jaundice , malaise , dark urine over 34 days , and was found to have obstructive jaundice on lab testing .
ct scan of the abdomen showed intrahepatic biliary ductal dilation , a 1.5 cm common bile duct ( cbd ) above the pancreas , and possible stones in the cbd , but no masses .
endoscopic retrograde cholangiopancreatography ( ercp ) by a community gastroenterologist failed to cannulate the cbd . at the university center ,
type 1 mirizzi syndrome was noted on endoscopic ultrasound with narrowing of the cbd with extrinsic compression from cystic duct stone . during repeat ercp
, the cbd could be cannulated over the pancreatic duct wire
. a mid cbd narrowing , distal cbd stones , proximal cbd and extrahepatic duct dilation were noted , and biliary sphincterotomy was performed .
a small stone in the distal cbd was removed with an extraction balloon .
the cystic duct stone was moved with the biliary balloon into the cbd , mechanical basket lithotripsy was performed and stone fragments were delivered out with an extraction balloon . the patient was seen 7 weeks later in the clinic .
skin and scleral icterus had cleared up and he is scheduled for an elective cholecystectomy .
mirizzi syndrome refers to biliary obstruction resulting from impacted stone in the cystic duct or neck of the gallbladder and commonly presents with obstructive jaundice .
type 1 does not have cholecystocholedochal fistulas , but they present in types 2 , 3 and 4 .
surgery is the mainstay of therapy .
endoscopic treatment is effective and can also be used as a temporizing measure or definitive treatment in poor surgical risk candidates . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
percutaneous coronary intervention ( pci ) for saphenous vein graft ( svg ) lesions has higher complication rates and poor long - term outcomes as compared to native coronaries . the perioperative complications may include no - reflow , abrupt closure , distal embolization causing perioperative myocardial infarction and rarely svg perforation . here , we report a case of svg perforation managed successfully with a covered stent and discuss about its predictors and management . a 76-year - old male known case of hypertension and diabetes mellitus was admitted to our institute with complaints of crescendo angina and dyspnea for 1 week . he had undergone coronary artery bypass graft ( cabg ) surgery with left internal mammary artery ( lima ) to left anterior descending ( lad ) artery , radial artery graft to right coronary artery ( rca ) , and svg to obtuse marginal ( om ) artery 9 years ago and pci to svg - om graft with drug - eluting stent 2 years ago . two - dimensional ( 2d ) transthoracic echocardiography ( tte ) was normal with normal left ventricular systolic function ( left ventricular ejection fraction ( lvef ) ~ 60% ) . after informed consent , coronary angiography by right transradial approach revealed native triple vessel disease , patent lima - lad graft , patent radial - rca graft , and significant short discrete eccentric lesion in svg - om graft distal to the patent stent [ arrow , figure 1a ; s video 1 ] . pci to svg - om graft was planned and the ostium was cannulated with jr4/6f guide catheter , but was exchanged with ar2/6f guide catheter ( launcher , medtronic inc , minneapolis , mn ) for better backup support . the lesion was crossed with 0.014 " whisper guide wire ( abbott vascular , santa clara , ca ) and the direct stenting was planned . the stent 3.5 18 mm xience pro ( abbott vascular , santa clara , ca ) was positioned across the lesion ( arrow , figure 1b ) . while inflating the stent at 14 atmosphere , there was sudden extravasation of contrast revealing class iii perforation at the stent site [ arrow , figure 2 ; s video 2 ] . even after prolonged balloon inflation there was still persistent leakage and therefore , the perforation was sealed with 3 18 mm covered stent at 12 atmosphere ( jostent graftmaster , abbott vascular , santa clara , ca ) with timi iii flow [ figure 3 ; s video 3 ] . patient remained hemodynamically stable during the procedure and hospital stay and was aymptomatic at 1-month follow - up . angiogram revealing significant stenosis in saphenous vein graft to major obtuse marginal branch ( arrow , panel a ) . angiogram showing drug eluting stent positioned across the lesion ( arrow , panel b ) angiogram while deploying the drug eluting stent at high pressure causing class iii perforation ( arrow ) final angiogram after deployment of covered stent showing complete sealing of the perforation svg perforation was first reported by drummer et al . , and may be catastrophic if immediate measures are not taken . the predisposing factors for perforation are old degenerated grafts , ulcerated plaque , eccentric fibrotic or calcified lesion , and use of oversized stent . it may be procedure related due to guide wire penetration , subintimal balloon inflation , overexpansion of balloon , or stent and rarely due to intravascular ultrasound ( ivus ) catheter or during atheroablative procedure . in a case series of 12 patients with svg perforation by marmagkiolis et al . , most of them occurred in elderly males with more than 9 years of graft age . the main site of perforation was svg body and in majority of the cases occurred during stent deployment at high pressure as in our case or during post dilatation . usually , svgs perforation does not cause cardiac tamponade because of pericardiotomy during cabg and extrapericardial course of proximal svgs , but localized tamponade due to extensive pericardial adhesions can occur and may cause persistent hypotension . the hypotension may also be due to continuous hemorrhage into the mediastinum necessitating immediate intervention . rarely , svg perforation may occur in right atrium or also may cause localized pulmonary artery compression . management of svg perforation includes immediate balloon occlusion proximal to perforation site , reversal of anticoagulation with protamine , and if needed covered stent . covered stent should preferably be deployed using dual guide catheter technique to decrease the extravasation of blood during the procedure . emergency pericardiocentesis and very rarely coil embolization may be needed after covered stent if persistent leakage and hypotension is present . selection of undersized stent may prevent svg perforation without increase in 1 year event rate . pci to svgs is a challenge for an interventional cardiologist and needs adequate experience and expertise . use of undersized stent and balloons may prevent this fatal complication without compromising short- and long - term results . | percutaneous coronary interventions ( pcis ) of saphenous vein grafts ( svgs ) is challenging and is associated with adverse short- and long - term clinical outcome as compared to native coronary arteries .
svg perforation is rare but catastrophic and needs immediate attention .
various factors predisposing for svg perforation are old degenerated graft , ulcerated plaque , severe fibrotic , or calcified lesion necessitating high pressure balloon or stent inflation , use of intravascular ultrasound ( ivus ) or other atheroablative devices .
management includes prolonged balloon occlusion , reversal of anticoagulation , use of covered stent , and emergency pericadiocentesis if required . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it can be classified according to the primary constituent as trichobezoar or hairball , phytobezoar ( food particles ) , trichphytobezoar ( mixed ) , pharmacobezoar , lactobezoar , mycobezoar ( fungal agglomerations ) or pseudobezoar . occasionally , trichobezoars have a tail that extends to the cardia , pylorus , and duodenum , or even further to the jejunum and ileum . a 12-year - old female was referred to our surgical clinic with a history of abdominal pain , distension , weight loss , and attacks of vomiting of 4 months duration . abdominal palpation revealed a mobile well - defined mass occupying the upper half of the abdomen . the computed tomography ( ct ) scan revealed a well - circumscribed lesion in the region of the stomach that comprised of concentric whorls of different densities with pockets of air enmeshed within it . oral contrast filled the more peripheral interstices of the lesion with a thin band of contrast circumscribing the lesion [ figure 1 ] . removal of the trichobezoar endoscopically failed as it was possible to pull only few fibers of this huge ball of hair . ct scan demonstrates a mixed density mass with a whorled configuration containing multiple small pockets of air . oral contrast circumscribes the lesion the patient underwent surgery , and through upper midline incision gastrotomy was done . a huge trichobezoar was identified which took the shape of the stomach [ figure 2 ] . there was a long tail of hair extending through the pylorus into the proximal jejunum [ figures 3 and 4 ] . by this feature sertraline hydrochloride , starting from 50 mg / day to 100 mg / day , was given to the patient to provide additional help in reducing her hair - pulling urges . after several months of weekly psychotherapy and pharmacotherapy , the patient is presently reported to have no hair - pulling events . trichobezoar . it is almost exclusively seen in young females , often associated with psychiatric problems . in our case , the presentation is in a very young age with hair extending down to the proximal jejunum , causing symptoms , which could mimic gastrointestinal infections and infestation especially in endemic areas . it is postulated that hair strands too slippery to be propulsed are initially retained in the mucosal folds of the stomach and become enmeshed over a period of time . trichobezoars are usually black from denaturation of protein by acid , glistening from retained mucus and foul smelling from degradation of food residue trapped within it . the patient generally presents with epigastric discomfort , pain , nausea , vomiting , satiety exacerbated at meal times , or complete gastric outlet obstruction . contiguous extension of a trichobezoar into the small bowel can lead to the rapunzel syndrome. this syndrome is named after a tale written in 1812 by the brothers grimm about a young maiden , rapunzel , with long hair who lowered her hair to the ground from a castle , which was a prison tower to permit her young prince to climb up to her window and rescue her . the commonly accepted definition is that of a gastric trichobezoar with a tail extending to the jejunum , ileum , or the ileocecal junction . the complications of the rapunzel syndrome ranges from attacks of incomplete pyloric obstruction to complete obstruction of the bowel to perforation to peritonitis and mortality . trichobezoars with small bowel extensions may produce other complications , namely bleeding , perforation , protein losing enteropathies , steatorrhea , pancreatitis , appendicitis , and intussusceptions . diagnosis of trichobezoars rest on the clinical evidence of long standing trichophagy , abdominal mass and radiological investigations or ct scan and abdominal ultrasound but obtaining pieces of matted hair through endoscope is pathognomonic . the characteristic appearance on ct is of an inhomogenous non - enhancing mass within the lumen of the stomach / bowel . surgical removal at laparotomy or laparoscopically is the treatment of choice . if small , they may be removed endoscopically . biopsy devices , water jets , bezotomes , and laser devices may be used to fragment larger bezoars and lavaged out of the stomach . psychiatric follow - up is important although no conclusion has been reached with respect to whether the use of medication makes any difference in the progression of this condition . this follow - up care should be extended to family members , who should be vigilant with patients , since recurrences of the problem have been described . no clear evidence - based practice guidelines for the treatment of patients with ( trichotillomania ) ttm are available , and more research is needed . behavioral techniques and selective serotonin reuptake inhibitors ( ssris ) are the most commonly used treatment modalities , having the most evidence for efficacy . the behavioral approaches , including habit - reversal therapy , have been shown to be effective . in habit - reversal therapy , patients learn to be aware of the times , cues , and situations in which they pull their hair . they practice movements such as those in knitting , crochet , and needlepoint that redirect their urges to pull their hair . thus , they learn to substitute a different and more adaptive behavior and receive social approval for efforts to interrupt the hair pulling . other approaches such as cognitive - behavioral treatment , negative practice , and variations of these interventions have been tried . the ssris are the pharmacologic agents used most frequently in the treatment of patients with ttm . other psychotropic agents that have been used for treating patients with ttm include the tricyclic antidepressants , the antipsychotic medications , and mood - stabilizing ( anticonvulsant ) medications . clomipramine hydrochloride and fluoxetine hydrochloride have been used successfully . the need for adequate follow - up should be emphasized to avoid recurrences , although these are rare since the trauma of surgery may prevent the patient from provoking another episode . | bezoar is a tightly packed collection of undigested material that is unable to exit the stomach .
most bezoars are of indigestible organic matter such as hair - trichobezoars ; or vegetable and fruit phytobezoars ; or a combination of both
. trichobezoars commonly occur in patients with psychiatric disturbances who chew and swallow their own hair . in very rare cases ,
the rapunzel syndrome hair extends through the pylorus into the small bowel causing symptom and sign of partial or complete gastric outlet obstruction .
a case report of trichobezoar in the stomach causing rapunzel syndrome in a 12-year - old female is reported . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
quackery is rampant among many parts of india.many types of skin diseases and eruption can occur due to practices employed by quacks . many types of skin diseases and eruption can occur due to practices employed by quacks . various religious beliefs , socio - cultural and religious practices , and quackery to treat varied medical problems often result in a host of secondary dermatoses . with increasing civilization and migration of population , herein , we describe a case of quackery aimed to improve abdominal discomfort , however , leading to peculiar skin eruption thereafter . a 44-year - old immunocompetent married male was referred for an opinion on multiple strange appearing blisters on the abdominal wall since 3 days . on examination , multiple flaccid to tense bullae of size ranging from 1 to 3 cm over erythematous base arranged in a circumferential pattern with a well - defined erythematous margin were present on periumbilical area [ figure 1 ] multiple hemorrhagic blisters on abdominal skin in a periumbilical area with circumferential distribution on further enquiry , the patient gave the history of abdominal pain and loss of appetite since last 7 days for which he was investigated on the surgical side and was diagnosed to have a small bowel obstruction . an operative procedure of resection and anastomosis was planned by the surgical team . however , the patient refused to get operated and returned home and visited a traditional healer accompanied by his wife . the healer gave the patient some unknown pills to consume , which made him to lose his consciousness . the traditional healer then placed five burning lamps made of wheat dough over his abdomen in the umbilical region and then placed a utensil upside down over his abdomen covering those lamps . when the patient regained his consciousness , there was a temporary cessation of abdominal cramps , but the patient noticed multiple painful blisters over his abdomen in the later part of the day . we made a diagnosis of thermal burns resulting from burning lamps and managed the blisters symptomatically via draining and sterile dressings . we counseled the patient about graveness of his abdominal complaint and made him to get operated for obstructive pathology . quack is a fraudulent or ignorant pretender to medical skill or a person who pretends , professionally or publicly , to have skill , knowledge or qualifications , he or she does not possess . in our case , the traditional healer placed the burning lamps around the umbilicus with a belief that disease ( evil forces ) may exit the body via natural body orifice ( umbilicus ) [ figures 2 and 3 ] . lamps made of wheat flour dough arranged circumferentially over periumbilical area ( the procedure was demonstrated on a ward attendant after due permission ) burning lamps and utensil used in the procedure ( not placed on actual patient due to ethical reasons ) branding as a preventive or therapeutic measure for many diseases is widely practiced in many rural parts of india . practitioners of branding believe that the offending agent can get out of the brand site relieving the body of disease . . the practice may continue even in later part of life , as the local traditional healer administers the brand mark on different body parts based on the anatomical localization of disease pathology . tip of a hot metal rod , heated nails , wires , incense sticks , and hot bangles are the commonly used objects to brand the child . the forehead , face , chest wall , and abdomen are the usual sites of branding . the pediatric patient usually belongs to a poor illiterate rural family where branding is a continuing tradition prevalent through many generations . neem ( azadirachta indica ) is one of the most ancient known traditional ayurvedic medicinal plants and is considered to have numerous medicinal properties . various parts of neem tree are used to treat various dermatological conditions ( leprosy control , syphilitic sores and indolent ulcer , itching , skin ulcers , and eczematous dermatoses ) . however , a large dose of neem can cause adverse effects including rashes , itching , and swelling and , in more severe cases labored breathing . neem is considered to be unsafe in pregnancy when taken orally , as it can cause miscarriage . semecarpus anacardium ( biba ) , also known as marking nut , commonly used by washerman , is well - known for its value in ayurvedic and siddha system of medicine . it is believed to be helpful in treating illnesses related to the heart , blood pressure , respiration , cancer , and neurological disorders . however , it has been widely used by quacks for the treatment of rheumatic arthritis , nervous disorders to decrease pain , which often leads to irritation , painful blisters , and irritant contact dermatitis . in developing countries , neonatal tetanus and cord infections continue to be an important cause of neonatal morbidity and mortality . infants with neonatal tetanus often have a concomitant cord infection , which points to a common cause ( unclean delivery and cord care practices ) . a wide variety of traditional practices and beliefs are associated with cord care . instead of cord clamp , unqualified midwives use blades of grass , bark fibers , reeds , or fine roots are used to tie the cord , which are often laden with clostridium tetani spores and increase the risk of neonatal tetanus . cord cutting / crushing is usually done with a variety of unsterile sharp instruments ( scissors , knives , broken glass , stones , sickles , or used razor blades ) . in most cultures , some kind of substance is applied to the umbilical stump to prevent bleeding from the stump , to promote separation of the stump , and to keep spirits away . cow , chicken or rat dung ; ash , oil , butter , spice pastes , herbs , mud , and ghee are the substances applied , associated with high risk of tetanus as they can be contaminated with bacteria and spores . this can help them avoid unnecessary investigations in case of dermatoses due to quackery and arrive at prompt diagnosis . practice of quackery can result in unusual dermatological eruptionsa thorough history and a replay of events can provide useful clue in diagnosis . practice of quackery can result in unusual dermatological eruptions a thorough history and a replay of events can provide useful clue in diagnosis . practice of quackery can result in unusual dermatological eruptionsa thorough history and a replay of events can provide useful clue in diagnosis . practice of quackery can result in unusual dermatological eruptions a thorough history and a replay of events can provide useful clue in diagnosis . practice of quackery can result in unusual dermatological eruptionsa thorough history and a replay of events can provide useful clue in diagnosis . practice of quackery can result in unusual dermatological eruptions a thorough history and a replay of events can provide useful clue in diagnosis . | a wide prevalence of socio - religious , cultural , and tribal practices in india often leads to a multitude of skin conditions , which can misled the dermatologists in arriving at a diagnosis . with increasing globalization and migration , the practice of indigenous customs and traditions are crossing boundaries , making it imperative for the dermatologists to be acquainted with the cutaneous side effects of these practices . here
, we report a unique case of thermal burn in a circumferential pattern over the umbilical region , a result of the placement of burning lamp over umbilicus to alleviate abdominal discomfort . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during the last 400 years , there has been an influenza epidemic approximately every three years and a pandemic about three times every century . in recent times , the spanish influenza of 1918 - 1919 is best remembered , which resulted in a lethality of about 0.5% and up to thirty million deaths worldwide.1 this unfavorable behavior is explained by frequent mutation of the viral genome and possible reassortment with genetic material from related viruses in animal hosts , which may permit evasion of the host immune response . the current swine influenza a is a variant of the h1n1 influenza strain that was responsible for the spanish influenza . fortunately , the current pandemic strain responds to oseltamivir , a neuraminidase inhibitor that reduces symptoms and accelerates recovery.2,3 according to directives of the brazilian ministry of health and in agreement with the world health organization , institutions in various parts of brazil were charged with the local production of oseltamivir during the 2009 pandemic . our institution has published a number of reports on the management of this outbreak.4 - 6 the central pharmacy of hospital das clinicas , so paulo ( cphc ) , was assigned the responsibility of preparing the oseltamivir solution.7 the cphc met this unusual demand without overlooking pharmacotechnical safety and accuracy or the requirements of good manufacturing practices ( gmp).8 these concerns are not exceptional within the pharmaceutical industry because they are addressed on a daily basis by large and specially trained teams . the challenge is greater within hospital pharmacies , which have less abundant labor and resources as well as less experience in handling such unconventional tasks . if one adds the urgency of a serious epidemic , then the equation becomes even more complex . nevertheless , the mission of the cphc was to prepare multiple batches of oseltamivir solution for oral administration to affected patients at short notice . the aims of this study are to present the processes and controls adopted by the cphc that led to the successful achievement of the set targets . within the period of august 6-september 16 , 2009 , an emergency task force was defined with the goal of preparing oseltamivir phosphate vials for clinical use . the main responsibility was assumed by the pharmacists of the pharmacotechnical unit of the division of pharmacy , hospital das clinicas . the sector of non - sterile oral fluids was mobilized , and selected professionals were assigned to production , quality control and supervision responsibilities . the compounding process was based upon the process described in the product literature provided for oseltamivir by roche , sao paulo , brazil , 2 which included basic information about the salt and its handling . a protocol that included raw material testing , characterization , dissolution , progress along the flowchart was monitored by the appropriate physico - chemical tests , and full accountability was provided by means of careful registration of the final products , yields and losses , in agreement with gmp . the production end point was bottles containing 50 ml of 15 mg / ml oral oseltamivir solution ( table 1 ) . this concentration is the german standard , as described in the german national formulary nrf 31.2.3 a minor discrepancy with standard manufacturer recommendations can be noticed ( 12 mg / ml instead of 15 mg / ml ) ; however , this dose was considered the most convenient in the pandemic context . ( table 2).2,3 international guidelines for quality control were strictly adopted.9 these guidelines included the analysis of raw materials , packaging and finished products by the quality control pharmacist . the identification and inspection of raw materials was routinely conducted , including initial high performance liquid chromatography ( hplc ) testing . safe packaging materials were employed ( amber - colored prescription bottles ) , and finished products were examined for cracked or broken units and incorrect labeling . batch processing records included the name of the product , lot number , time of start and completion of the compounding process , total yield , accidental losses and the name of the professional in charge . finished lots were quarantined until analytical and general quality control procedures were completed and filed , and samples were retained . weekly post - production controls of oseltamivir molecular content were conducted by hplc analysis of production lot samples according to the following schedule : 0 ( immediately after compounding ) , 7 , 14 , 21 and 28 days after compounding . the varian auto - sample prostar 410 hplc system ( varian inc . , palo alto , ca , usa ) , equipped with a prostar 325 uv - vis photodiode array detector , prostar 500 column valve module , and prostar 230 solvent delivery module was used for method development and validation . a microsorb - mv c8/5-m ( 4.6 250 mm ) column with a mobile phase of phosphate buffer ( ph 6 ; 0.05 m ) , methanol and acetonitrile ( 620:245:135 , v / v ) was used at a flow rate of 1.0 ml / min . sotalol hydrochloride ( bristol - myers - squibb , so paulo , brazil ) was selected as an internal standard , and an oseltamivir phosphate standard sample ( roche , so paulo , brazil ) was selected as the external standard . galaxie software ( varian , palo alto , ca , usa ) was employed for data acquisition . within the period of august 6-september 16 , 2009 , an emergency task force was defined with the goal of preparing oseltamivir phosphate vials for clinical use . the main responsibility was assumed by the pharmacists of the pharmacotechnical unit of the division of pharmacy , hospital das clinicas . the sector of non - sterile oral fluids was mobilized , and selected professionals were assigned to production , quality control and supervision responsibilities . the compounding process was based upon the process described in the product literature provided for oseltamivir by roche , sao paulo , brazil , 2 which included basic information about the salt and its handling . a protocol that included raw material testing , characterization , dissolution , progress along the flowchart was monitored by the appropriate physico - chemical tests , and full accountability was provided by means of careful registration of the final products , yields and losses , in agreement with gmp . the production end point was bottles containing 50 ml of 15 mg / ml oral oseltamivir solution ( table 1 ) . this concentration is the german standard , as described in the german national formulary nrf 31.2.3 a minor discrepancy with standard manufacturer recommendations can be noticed ( 12 mg / ml instead of 15 mg / ml ) ; however , this dose was considered the most convenient in the pandemic context . international guidelines for quality control were strictly adopted.9 these guidelines included the analysis of raw materials , packaging and finished products by the quality control pharmacist . the identification and inspection of raw materials was routinely conducted , including initial high performance liquid chromatography ( hplc ) testing . safe packaging materials were employed ( amber - colored prescription bottles ) , and finished products were examined for cracked or broken units and incorrect labeling . batch processing records included the name of the product , lot number , time of start and completion of the compounding process , total yield , accidental losses and the name of the professional in charge . finished lots were quarantined until analytical and general quality control procedures were completed and filed , and samples were retained . weekly post - production controls of oseltamivir molecular content were conducted by hplc analysis of production lot samples according to the following schedule : 0 ( immediately after compounding ) , 7 , 14 , 21 and 28 days after compounding . , palo alto , ca , usa ) , equipped with a prostar 325 uv - vis photodiode array detector , prostar 500 column valve module , and prostar 230 solvent delivery module was used for method development and validation . a microsorb - mv c8/5-m ( 4.6 250 mm ) column with a mobile phase of phosphate buffer ( ph 6 ; 0.05 m ) , methanol and acetonitrile ( 620:245:135 , v / v ) was used at a flow rate of 1.0 ml / min . sotalol hydrochloride ( bristol - myers - squibb , so paulo , brazil ) was selected as an internal standard , and an oseltamivir phosphate standard sample ( roche , so paulo , brazil ) was selected as the external standard . galaxie software ( varian , palo alto , ca , usa ) was employed for data acquisition . this amount of powder was sufficient to produce 9 lots of the solution for a total of 32,175 units of oseltamivir solution with a net loss of 2.6% . during 2009 , oseltamivir represented about one - quarter of the total output of the non - sterile oral fluid unit of the division of pharmacy . the actual percentages according to released drug bottles or packages were as follows : potassium chloride syrup , 25.8% ; oseltamivir phosphate , 25.1% ; codeine drops , 9.4% ; aluminum hydroxide , 9.2% ; liquid vaseline , 7% ; sodium bicarbonate , 6.9% ; 50% oral glucose solution , 4.5% ; and miscellaneous drugs , 12.1% . several techniques adopted in the production flowchart can be followed in figures 1 - 3 . the shelf life of the drug was established as 21 days , although evaluations indicated excellent stability for longer periods ( figure 4 ) . the actual concentration of oseltamivir corresponded to 97.5%-102.0% of the nominal value , which is within the acceptable range for pharmacological and legal purposes.3,11,12 this amount of powder was sufficient to produce 9 lots of the solution for a total of 32,175 units of oseltamivir solution with a net loss of 2.6% . during 2009 , oseltamivir represented about one - quarter of the total output of the non - sterile oral fluid unit of the division of pharmacy . the actual percentages according to released drug bottles or packages were as follows : potassium chloride syrup , 25.8% ; oseltamivir phosphate , 25.1% ; codeine drops , 9.4% ; aluminum hydroxide , 9.2% ; liquid vaseline , 7% ; sodium bicarbonate , 6.9% ; 50% oral glucose solution , 4.5% ; and miscellaneous drugs , 12.1% . several techniques adopted in the production flowchart can be followed in figures 1 - 3 . the shelf life of the drug was established as 21 days , although evaluations indicated excellent stability for longer periods ( figure 4 ) . the actual concentration of oseltamivir corresponded to 97.5%-102.0% of the nominal value , which is within the acceptable range for pharmacological and legal purposes.3,11,12 the handling of an oral pharmaceutical solution is not only a matter of solubility , dosage and excipients . multiple other variables , such as characterization of the dissolved drug , stability , dose - uniformity , and palatability or the absence of chemical irritants , are also important.13 ingredients must be suitable and compatible , and appropriate physical and physico - chemical control methods must be applied to ensure technical success and to comply with quality control routines . they encompass the design , production , storage and disposal of the agent , related chemicals , solvents and other materials . an important feature of such practices is full accountability of all manipulation steps.9,11,12 raw materials , intermediates , and final products should be weighed and measured or calibrated to ensure accurate results within appropriate ranges . actual yields and percentages of theoretical yields must be determined at the conclusion of each phase of processing , packaging , and storage of the drug solution , and the data must be saved in specific files . all calculations require independent confirmation , with the report of a single professional being insufficient.9,11,12 oseltamivir phosphate is a precursor of the active metabolite oseltamivir carboxylate , which is a selective inhibitor of influenza a and b neuraminidase enzymes . neuraminidase participates in viral entry into the cell and in the subsequent release of virus particles and dissemination of the infection . extensive worldwide experience confirms its value both in the prophylaxis and treatment of endemic and epidemic influenza outbreaks.2 oseltamivir is licensed for use in all groups with the exception of pediatric patients . dosage flexibility makes it ideal for epidemics , and although compounding of capsules was not overlooked by the brazilian ministry of health , much emphasis was placed on the rapid release of the solution formulation.7,10 in the report by albert and bockshorn , refrigerated samples of extemporaneously prepared oseltamivir solution were stable for 84 days , as validated by hplc . however , due to the possibility of toxic metabolites , this limit was lowered to 46 days . in contrast to sterile water , the ph gradually increased and shelf life diminished to 14 days with the formation of a precipitate when potable water was selected.3 winiarski et al . reported worse results when converting oseltamivir capsules into oral solutions . although high - quality pharmacotechnical procedures were adopted , the stability under refrigeration was not more than 35 days , and it decreased to as little as 5 days at room temperature.10 in the current study , excellent stability was demonstrated for at least 21 days at room temperature , with no detection of metabolites by hplc , change in ph or formation of precipitates . the results demonstrate that the product was successfully processed and manufactured , with careful documentation of each technical step , and that there were negligible errors or losses . the hurdles of a comparatively small team and limited resources were circumvented without compromising the quality or reliability at cphc , which is not a standard industrial facility . as mentioned above , its institutional role is the compounding of commercially unavailable drugs along with special formulations for patient use within the 2,000bed hospital complex . the 2009 outbreak now looks mild and is partially forgotten ; however , it was a major issue in the initial months of the pandemic . swine flu was first reported in mexico on april 26 , 2009 . within less than 50 days , on june 15 , it had assumed pandemic proportions with 35,928 cases and 163 deaths in 76 countries.14 repeated announcements by the world health organization to all member states warned about a problem of large proportions . it was predicted that if the virus achieved equivalent virulence to that of the 1918 - 19 pandemic strain , 62 million people could die . emergency alerts included travel advisories , stockpiling of antiviral drugs , vaccine development , and planning for business continuity and maintenance of essential services.15 various countries mobilized their disaster management authorities,15 eventually including the armed forces,16 to control the outbreak of the swine flu . the european society of intensive care medicine established a task force and issued a special supplement of its journal , defining recommendations and standard operating procedures for dealing with the pandemic , which had the potential to progress to a massive disaster.17,18 emergency departments in new york hospitals were overwhelmed in april and may of 2009 , and authorities braced for a public health crisis.19 all of these facts notwithstanding , the priorities were epidemiological ( information exchange and biosurveillance efforts ) , clinical ( screening and therapy ) and logistical ( manpower , infrastructure and drug stockpiling).14 - 19 no report regarding pharmacotechnical bottlenecks and how to handle them has been found in the literature . the principal contribution of this study was not the creation of innovative manufacturing processes or quality control criteria , as these were mostly adapted from published guidelines and pharmacopeias as well as from existing cphc routines.2,3,9 - 12 instead , the advance was achieved by the prompt reaction to the emergency challenge and the fulfillment of a labor - intensive and exacting mission within a nontraditional framework of pressing time schedules , heavy workloads and limited resources . production glitches , accidents including the development of impurities and precipitates , and drug losses adversely influenced the product yield and shelf life . as shown , catastrophes were avoided and end points were quite successfully reached , demonstrating that indispensable pharmacotechnical standards must be adhered to at all times . this unique experience could serve as a model for emergency episodes in the future in case similar difficulties emerge . it should also stimulate the improvement of the existing infrastructure and contingency plans so that daunting or last - minute tasks are minimized . every infectious outbreak exhibits different features and circumstances , and people should be careful not to stockpile dated ammunition or to fight yesterday 's war . one of the most important components of the preparedness of any society is institutional memory ; it is important that lessons and abilities taught by past events be remembered . such intellectual and technical patrimony should not be simply documented and filed ; instead , it should be critically examined and periodically updated so that it is ready to be retrieved at any moment . a slow step - wise approach would be the most sensible choice for the adoption of a new process such as the preparation and use of oseltamivir solution ; however , the health care system needed the drug immediately . an urgent solution was thus adopted , with simultaneous planning , testing and execution of all techniques , following initial studies for the development of pharmacotechnical methods and procedures . although this approach is not recommended as a template for ordinary circumstances , important lessons were learned about reactivity and rational crisis management within the hospital pharmacy . | aims : pandemics impose large demands on the health care system .
the supply of appropriate chemotherapeutic agents , namely oseltamivir solution , presented a serious challenge in the recent influenza pandemic .
this study reports on the rational series of pharmacotechnical steps that were followed to appropriately handle bulk oseltamivir powder to meet the increased demand.methods:during a six - week period in august and september of 2009 , a task force was created in the central pharmacy of hospital das clnicas to convert imported oseltamivir phosphate into ready - to - use solution for utilization by physicians and public health authorities .
the protocol included dissolution , physico - chemical tests and the bottling of a liquid microdose formulation for emergency room and outpatient dispensing with adequate quality control during all phases.results:the successful production routine was based on a specially designed flowchart according to which a batch of 33210 g of oseltamivir powder was converted into 32175 solution units during the aforementioned period with a net loss of only 2.6% .
the end products were bottles containing 50 ml of 15 mg / ml oseltamivir solution .
the measured concentration was stable and accurate ( 97.5% - 102.0% of the nominal value ) .
the drug was prescribed as both a prophylactic and therapeutic agent.discussion:hospital pharmacies are conventionally engaged in the manipulation of medical prescriptions and specialty drugs .
they are generally responsible for only small - scale equipment used for manufacturing and quality - control procedures .
the compounding of oseltamivir was a unique effort dictated by exceptional circumstances.conclusion:the shortage of oseltamivir solution for clinical use was solved by emergency operationalization of a semi - industrial process in which bulk powder was converted into practical vials for prompt delivery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
vitamin d has important roles in physiological processes , and is primarily involved in calcium and phosphorus homeostasis and bone metabolism.1 the active form of vitamin d , or 1 alpha , 25-dihydroxyvitamin d3 ( calcitriol ) , binds to its vitamin d receptor ( vdr ) , a kind of nuclear receptor , and activates the vdr to interact with the retinoid x receptor ( rxr ) to form the vdr / rxr / co - factor complex , which binds to vitamin d response elements in the promoter region of the target gene . the ubiquitous vdr distribution in the human body ( intestine , kidney , bone , parathyroid gland , immune system , smooth muscle , and myocardium ) is responsible for the pleiotropic effects of vdr activation.2 namely , despite its classical action on the musculoskeletal system , vitamin d acts on the cardiovascular system , systemic inflammation , oxidative stress , and immune regulation.3 vitamin d has multiple effects on the immune system , including an anti - inflammatory effect.4 indeed , in many epidemiological studies , vitamin d deficiency has been identified as a risk factor for many diseases not traditionally associated with vitamin d and mineral metabolism , such as cancer , cardiovascular disease , hypertension , and diabetes.5 a meta - analysis of observational studies examined the association of 25(oh ) vitamin d concentrations with cardiometabolic disorders , and the highest concentrations of 25(oh ) vitamin d in serum were associated with a 43% reduction in cardiometabolic disorders , in comparison with the lower concentrations . the conclusions from the meta - analysis indicated that higher levels of vitamin d among middle - aged and elderly populations were associated with a substantial decrease in cardiovascular disease , type 2 diabetes , and metabolic syndrome.6 there was also an association of 25(oh ) vitamin d concentrations with blood pressure , where each incremental increase in 25(oh ) vitamin d ( 10 nmol / l ) correlated with a decrease in systolic blood pressure , by approximately 0.2 mmhg.7 evidence showed an inverse association between vitamin d and visceral adiposity.8 the mechanisms for these observed relationships remain unclear . some suggested mechanisms are the higher atherosclerosis risk factors prevalent in vitamin d deficiency states , such as diabetes and hypertension . namely , these effects beyond the mineral and bone metabolism could be a consequence of the ubiquitous distribution of vdrs in the cardiovascular system ( cardiomyocytes , vascular smooth muscle cells , and endothelial cells).9 stimulation of vdrs with vitamin d has been shown to have a direct impact on the cardiovascular system . several mechanisms have been proposed in the model of vitamin d s protective effects on the cardiovascular system , including its influence on inflammation , endothelial dysfunction , vascular compliance , inflammation , cell proliferation , and differentiation , as well as its effects relating to parathyroid hormone ( pth ) and the renin - angiotensin system . these latter two processes are involved in the initiation and development of endothelial damage and atherosclerosis.10,11 there is clear evidence of vdr agonism s impact on the inhibition of cytokines involved in calcification and atheroma formation,12,13 on the inhibition of proteins implicated in arterial calcification,14 and on preventing thrombosis.15 data from animal models also suggest a direct effect of vitamin d on cardiac and vascular structure . vdr knockout mice show hypertrophic hearts , cardiac fibrosis , and increased cardiac mass.16 a protective effect of vdr agonists against cardiac hypertrophy and cardiac fibrosis , possibly through a reduction in cardiac oxidative stress , has also been demonstrated.17 vitamin d therapy also ameliorates oxidative stress injury in some experimental models.18 in vitro , vitamin d reduces interleukin ( il)-6 synthesis and nuclear factor-b activity , and prevents advanced glycation end - product - induced inhibition of endothelial nitric oxide - synthase production.18 despite observational and epidemiological data , it is unclear from interventional studies how vitamin d would affect cardiovascular risk . a women s health initiative study19 showed no effect of calcium plus low - dose ( 10 g / d ) vitamin d supplementation on coronary or cerebrovascular risk in 36,282 postmenopausal women followed for 7 years.19 zittermann et al20 studied overweight subjects with pronounced vitamin d deficiency ( < 30 nmol / l ) , and observed a significant improvement in risk markers ( triglycerides and tumor necrosis factor- ) after supplementation for 1 year with a daily dose of 83 g vitamin d3 . recently elamin et al21 conducted a systematic review and meta - analysis to find evidence of vitamin d s effect on cardiovascular - event risk factors . they summarized randomized trials of vitamin d used in an interventional mode , and they could not demonstrate a significant effect of vitamin d on death , stroke , myocardial infarctions , lipid fractions , blood pressure , or blood glucose values . it is also important to mention that they analyzed randomized trials with enrolled participants without severe vitamin d deficiency . in contrast , a previous meta - analysis22 of randomized controlled trials on vitamin d supplementation demonstrated that vitamin d supplements were associated with decreases in total mortality rates . cross - sectional studies have demonstrated an inverse relationship between vitamin d levels and cardiovascular disease in both the general23 and chronic kidney populations.24 additionally , there is a higher prevalence of vitamin d deficiency in populations with chronic kidney disease.25 there is mineral homeostasis deterioration in renal failure , with disturbances in phosphorus , calcium , pth , 25-hydroxyvitamin d , 1,25-dihydroxyvitamin d , and fibroblast growth factor-23 concentrations . kidneys can not excrete phosphorus , which leads to hyperphosphatemia , and consequently to elevated serum pth and decreased serum 1,25-dihydroxyvitamin d.26 such abnormalities are recognized as disease called chronic kidney disease mineral and bone disorder ( ckd mbd ) , a broad clinical syndrome encompassing mineral , bone , and calcific cardiovascular disturbances ( vascular and valvular calcifications).27 lower 1,25(oh)2 vitamin d levels have been also associated with worsened coronary calcification,28 suggesting a pth - independent link between vitamin d and survival . teng et al29 reported in a historical cohort study among 51,037 chronic hemodialysis patients ; the group that received vitamin d had a significant 2-year survival advantage over patients who did not receive it . traditionally , because of the kidney s lack of 1-alfa hydroxylation , in chronic kidney disease patients , 1,25-dihydroxyergocalciferol ( calcitriol ) is used for treatment of secondary hyperparathyroidism.30 secondary hyperparathyroidism is the main clinical feature of ckd mbd , characterized by abnormally elevated serum concentrations of pth , and abnormalities in serum calcium , phosphorous , and vitamin d concentrations . it can lead to many clinical complications , such as bone fractures and vascular calcifications . vascular calcifications and consequently increased arterial stiffness could produce higher pulse pressure and lead to left - ventricular hypertrophy,31 arrhythmias , or finally to death . indeed , arterial calcifications are correlated with cardiovascular mortality , left - ventricular hypertrophy , and the presence of coronary artery disease.32 atherosclerotic cardiovascular disease is the most common cause of mortality in the dialysis population.33 the mortality rate from cardiovascular disease in patients with end - stage renal disease varies between 40% and 50%.34,35 vitamin d is often administered to chronic kidney patients to mitigate the detrimental effects on bone health and mineral metabolism , although this treatment may be limited by elevations in serum calcium and phosphorus . the main action of vitamin d used for ckd mbd is based on the suppression of high pth production in the chief - cells of parathyroid glands and on the control of secondary hyperparathyroidism . synthetic 1,25-dihydroxyvitamin d ( calcitriol ) binds more selectively to the vdr than does vitamin d or 25-hydroxyvitamin d. in chronic kidney patients , calcitriol effectively suppresses pth production and improves bone histology.36 the therapeutic use of calcitriol mainly aims to raise the intestinal absorption of calcium , to protect bone against osteomalacia , and to control parathyroid function . as vitamin d can promote the increase of serum calcium and phosphorus levels , there are concerns about the possible side effects of vitamin d preparations . hyperphosphatemia and hypercalcemia have been shown to promote calcification of the vasculature , myocardium , and cardiac valves . undesirable effects of vitamin d , such as an increase in calcium and phosphate , may favor the development of vascular calcifications . vascular calcification and calcification of arteriolar media are the main pathophysiological features of cardiovascular disease in the kidney disease population . vascular calcification is currently accepted as an actively regulated process similar to bone formation , with changes in the phenotype of vascular smooth muscle cells resulting in osteoblast - like cells that produce calcification - regulating proteins.37 bas et al38 demonstrated that high doses of calcitriol given to uremic rats produced aortic calcifications ; these changes were partially reversible several weeks after discontinuation of calcitriol administration . this process of vascular calcification was not correlated with vitamin d alone . indeed , in animals , vitamin d excess would not induce calcification if serum phosphate was controlled , and it seems that phosphorus has a pivotal role in the promotion of vascular calcification in a vitamin d - administration environment.39 newer vitamin d analogs have been suggested to be less calcemic than is calcitriol.40 several new vitamin d analogs have been developed for treatment of secondary hyperparathyroidism , with a reduced risk of hypercalcemia and hyperphosphatemia . the third generation of vitamin d analogs comprises a group of 1- and 25-hydroxylated vitamin d compounds with structure modifications ( 19-nor-1,25-dihydroxyvitamin d2 or paricalcitol ) , which have fewer calcemic and less phosphatemic effects when compared to calcitriol.41 vitamin d analogs have different effects on nuclear vdrs than does calcitriol , through different response elements in various target genes . experimental work shows that for similar serum concentrations of calcium and phosphate , paricalcitol produces less vascular calcification than does calcitriol , suggesting differential effects at the cellular level.42 such new vitamin d analogs , because of the unique properties of nuclear vdrs , are named selective vitamin d receptor activation agents . the term selective means that the molecule acts mostly on the parathyroid gland , more so than on intestine and bone , resulting in lower serum calcium and phosphorus blood concentrations . such selective vdr - activation agents are reported to have anti - inflammatory and antithrombotic effects , and could inhibit vascular smooth muscle cell proliferation , the renin - angiotensin system , and vascular calcification and stiffening , and could regress left - ventricular hypertrophy.43 paricalcitol is the third generation of vitamin d analog , and is a selective activator of vdr used for the treatment of secondary hyperparathyroidism.44 compared with calcitriol , paricalcitol reduces pth , with significantly fewer episodes of hypercalcemia in hemodialysis patients.45 reduced episodes of hypercalcemia among patients who received paricalcitol compared to calcitriol could be explained due to reduced stimulation of intestinal calcium transport proteins.46 calcitriol in uremic rats fed with a high - phosphorus diet enhances intestinal calcium absorption , because calcitriol promotes calbindin expression , whereas paricalcitol does not.47 there are also data on lower absorption rates of calcium and phosphorus among patients receiving paricalcitol , compared with calcitriol.48,49 the vascular calcification process in chronic kidney disease is also directly influenced by paricalcitol . activation of vdr has been shown to decrease the process of vascular calcification , the main cardiovascular feature of chronic kidney disease , through suppression of calcification inducers such as type i collagen , bone sialoprotein , interleukin-1 , and tumor necrosis factor - alpha , or through activation of calcification supressors : matrix gla protein , osteopontin , and osteocalcin.50 li et al51 demonstrated direct protection from vascular calcifications with paricalcitol , and found that paricalcitol could influence proteins involved in the smooth muscle cell calcification process , including bone morphogenetic protein-2 ( bmp2 ) , tumor necrosis factor - alpha , and osteopontin . osteopontin could directly regulate vascular calcification and was found to contribute to the inhibitory actions of paricalcitol in the calcification of smooth muscle cell . the direct influence of paricalcitol on vdrs located on vascular smooth muscle cells could be explained by different effects of paricalcitol on target genes involved in the pathogenesis of vascular calcifications , independently of previously suggested mechanisms , such as modulation of the inflammatory response or different hyperphosphathemic and hypercalcemic effects . paricalcitol seems to have several mechanisms of action , because activation of the vdr intervenes in pathways associated with cardiovascular disease ( suppression of renin transcription , antiproliferative effects , antifibrotic effects).52 data support a potential role of selective vdr activation in preventing the pathogenesis of atherosclerosis in chronic kidney disease . activation of vdr also impacts the cardiovascular system by decreasing the activation of the renin - angiotensin - aldosterone system . there is evidence of an inverse relationship between vitamin d levels and plasma renin activity.53 paricalcitol was found to decrease angiotensinogen , renin , renin receptor , and vascular endothelial growth factor mrna levels in a rat model of chronic renal failure.54 in a rat model of gentamicin - induced renal injury , paricalcitol prevented upregulated inflammatory cytokines ( tumor necrosis factor - alpha , interleukin-1beta , interferon - gamma ) , nuclear factor - kappab and phosphorylated erk1/2 expression , and adhesion molecules ( monocyte chemoattractant protein-1 , icam-1 , vcam-1 ) , and they reversed the transforming growth factor ( tgf)-beta1-induced epithelial - to - mesenchymal transition process and extracellular matrix accumulation.55 paricalcitol has significant immunomodulatory activity via vdr agonism , based on its inhibition of dendritic cells , which are important in the pathogenesis of atherosclerosis.56 the antioxidative properties of paricalcitol were demonstrated , in an animal model of contrast - induced nephropathy , by lower levels of serum malondialdehyde and kidney thiobarbituric acid - reacting substances in the paricalcitol group.57 antifibrotic effects of paricalcitol were reported by meems et al58 in an animal model : paricalcitol reduced myocardial fibrosis and preserved diastolic left - ventricular function due to pressure overload associated with reduced fibrosis . a similar study revealed the protective effect of enalapril and paricalcitol , alone or in combination , on cardiac oxidative stress in uremic rats.59 paricalcitol prevented cisplatin - induced kidney injury by suppressing fibrotic , apoptotic , and proliferative factors in an animal model ; paricalcitol suppressed expression of tgf-1 , smad signaling , mitogen - activated protein kinase signaling , p53-induced apoptosis , and p27(kip1).60 additionally , combination of enalapril and paricalcitol reduced glomerulosclerosis , proteinuria , and inflammation when measured as monocyte chemoattractant protein-1 ( mcp-1 ) in uremic rats via suppression of tgf-1 and smad2.61 paricalcitol combined with enalapril had an additional protective effect on aortic inflammatory and oxidative injury biochemical markers in atherosclerotic mice.62 kong et al63 tested , in an interesting study of spontaneously hypertensive rats , the effects of losartan , paricalcitol , doxercalciferol , a combination of losartan and paricalcitol , or a combination of losartan and doxercalciferol , on the development of left - ventricular hypertrophy . echocardiograpy demonstrated a 65% to 80% reduction in left - ventricular wall thickness with losartan , paricalcitol , or doxercalciferol monotherapy , and almost complete prevention of left - ventricular hypertrophy with the combination therapies . renal and cardiac renin expression was markedly increased in losartan - treated animals , but nearly normalized with combination therapy . these data demonstrate that vitamin d analogs have potent antihypertrophic activity , partly by suppressing renin in the kidney and heart . paricalcitol also suppresses the progression of left - ventricular hypertrophy , myocardial and perivascular fibrosis , and myocardial arterial vessel thickness in uremic rats by upregulating the vdrs.64 fraga et al65 demonstrated that paricalcitol prevented decrease in myocardial vdr expression . as vdrs are expressed in cardiac myocytes , the effect of paricalcitol could have a clinical impact on uremic cardiomyopathy , a common complication in patients with chronic kidney disease , characterized by cardiac fibrosis , cardiac hypertrophy , and diastolic dysfunction . wu - wong et al66 demonstrated that vdr activation with paricalcitol improved endothelial function , measured as endothelial - dependent vasorelaxation in a chronic kidney disease rat model , independently of the parathyroid hormone suppression effect . as vascular calcification is associated with cardiovascular disease in chronic kidney patients , there is concern over vitamin d s possible effects on calcium , phosphorus , and consequently , on vascular calcifications . mizobuchi et al67 demonstrated that paricalcitol , in contrast to calcitriol and doxercalciferol , had no effect on the serum calcium - phosphate product or aortic calcium content in uremic rats . a higher dose of paricalcitol still had no effect , but lowering doxercalciferol levels did not increase the calcium - phosphate product ; rather , it increased the aortic calcium content , suggesting independent paricalcitol - mediated mechanisms for protection from vascular calcification . cards et al68 tested the effects of calcitriol and paricalcitol on vascular smooth muscle - cell calcification in an animal end - stage renal disease model , and concluded that calcitriol , but not paricalcitol , increased calcification of vascular smooth muscle cells , independently of the levels of calcium and phosphate . besides these experimental data , observational studies in hemodialysis patients reported improved cardiovascular and all - cause survival among those receiving selective vdr activation therapies . the selective vdr activation agent paricalcitol has been associated with greater survival than nonselective vdr activators such as calcitriol . indeed , one observational study demonstrated a better 36-month survival rate of patients on dialysis treated with paricalcitol , compared with calcitriol.69 a possible explanation for the differential effects of paricalcitol and calcitriol on survival is mineral metabolism . calcitriol could have a larger gastrointestinal absorption rate of calcium and phosphorus than does paricalcitol , so vascular calcification and death from cardiovascular causes could be increased in patients receiving calcitriol . another observational study among 7731 hemodialysis patients also demonstrated better survival in patients on doxercalciferol and paricalcitol , versus calcitriol.70 a recent observational study71 also revealed that paricalcitol was associated with improved 2-year survival in dialysis patients , even with low serum ipth levels , so the differential effects of paricalcitol and calcitriol on survival are not correlated only with different effects on mineral metabolism or on pth ; they could be related to additional pleiotropic effects of paricalcitol . despite some animal models and small studies of human participants , there are only a few human randomized trials that might clarify the influence of selective vdr activation on the cardiovascular system in chronic kidney and/or chronic heart failure patients . paricalcitol appears to block the renin - angiotensin - aldosterone system , and could have an effect on proteinuria via the suppression -catenin - mediated gene transcription and prevention of podocyte dysfunction.72 in a small study on diabetic and nondiabetic nephropathy , paricalcitol reduced proteinuria mostly in patients with diabetic nephropathy.73 another study demonstrated , in 220 chronic kidney patients , the reduction in proteinuria through paricalcitol treatment , independent of any concomitant use of agents to block the renin - angiotensin - aldosterone system.74 in the vitamin d and omega-3 trial ( vital),75 a randomized clinical trial , paricalcitol demonstrated the additional effect of lowering albuminuria in patients with diabetic nephropathy . the study enrolled 281 patients being treated with angiotensin - converting enzyme inhibitors or angiotensin receptor blockers . this renal protective effect seemed to be associated with renin transcription suppression , together with an antifibrotic and antiproliferative effect , and possibly with lower blood pressure in the paricalcitol group . these antiproteinuric effects were correlated with paricalcitol , and returned to baseline values upon paricalcitol withdrawal . as albuminuria is a surrogate end point , further clinical data are needed to establish the potential effects of selective vdr activation on hard end - point markers in chronic renal disease . despite plenty of observational data on the association of vitamin d with decreased cardiovascular - related morbidity and mortality , paricalcitol capsule benefits in renal failure- induced cardiac morbidity ( primo),76 a randomized controlled trial on a group of 227 patients with chronic kidney disease with mild - to - moderate left - ventricular hypertrophy and preserved left - ventricular ejection fraction , could not demonstrate the influence of 48 weeks of paricalcitol therapy on the left - ventricular mass index or on doppler measures of diastolic dysfunction . the anti - inflammatory and anti - oxidative properties of paricalcitol could influence clinical end points and result in improvement of cardiovascular and inflammatory parameters in chronic heart failure patients , chronic kidney patients , and uremic patients on renal replacement therapy . the effect of the selective activation of vdr on the cardiovascular system , inflammation , and oxidative stress is not fully understood . although one study76 examined the impact of paricalcitol on heart function , participants in this study were chronic renal patients , and were not receiving renal replacement therapy , despite uremic cardimyopathy being the most prevalent among dialysed patients . studies in future should emphasize the influence of oral or intravascular treatment with paricalcitol on cardiac function , endothelial function ( flow - mediated dilatation ) , vascular morphology ( plaque formation and intima media thickness ) , and markers of inflammation and oxidative stress in chronic kidney and heart failure patients . paricalcitol should provide additional cardioprotective and renoprotective effects , with significant clinical benefits for chronic kidney and heart failure , especially in concomitant kidney and heart dysfunction , which is a common clinical presentation recognized today as cardiorenal syndrome . paricalcitol could produce notable and measurable clinical benefits , superior to those of standard cardiorenal syndrome treatments . | the ubiquitous distribution of vitamin d receptors in the human body is responsible for the pleiotropic effects of vitamin d - receptor activation .
we discuss the possible beneficial effects of a selective activator of vitamin d receptor , paricalcitol , on the cardiovascular system in chronic heart failure patients and chronic kidney patients , in light of new trials .
paricalcitol should provide additional clinical benefits over the standard treatment for chronic kidney and heart failure , especially in cases of cardiorenal syndrome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
particle size analysis
is fundamental to nanomaterials characterization
but must be conducted in an appropriate context . nanoparticle analysis
by transmission electron microscopy ( tem ) is arguably one of the more
popular methods but is typically performed in a dry or vacuum state
and is challenged by low particle counts . tem is also less appropriate
for estimating the hydrodynamic ( hd ) size of nanoparticles in solution ,
especially those with organic layers of unknown thickness . statistically
robust methods for hd analysis include dynamic light scattering ( dls ) ,
tunable resistive pulse sensing ( trps ) , and nanoparticle tracking
analysis ( nta ) . dls uses a second - order correlation
function to convert fluctuations in scattering intensity into a one - dimensional
parameter defining hydrodynamic size ( dh ) . while dls supports high sampling volumes
( n = 1010 ) , its peak
distributions are broad ( effective resolution > 30% ) and requires
an
intensity - weighted correction factor ( z - average )
due to size - dependent scattering . trps
is an electrokinetic method that measures the dh of nanoparticles passing through nanopores of defined size . trps offers better resolution than dls but is
only useful for particles above 60 nm , limited by the pore diameter
of the supporting membrane . nta produces size distributions
by recording the brownian motion
of thousands of individual particles under optical darkfield conditions . from the stokes einstein equation , dh can be expressed simply as1where kb is the
boltzmann constant , t is temperature , t is recording time per frame ( 0.02 s ) ,
is viscosity , and (x , y)
is mean - squared displacement in two dimensions . nta is capable of tracking nanoparticles at moderate volumes
( sample size n = 1010 ) and can record dh values as small as
20 nm , depending on the particles scattering cross sections . in addition , recent developments in nta data
processing can be applied to produce dh values with relative standard deviations ( rsds ) of 1012% . nta has become an accepted method for characterizing
colloidal
size distributions in aqueous suspensions and can also measure incremental changes in hd size as a function
of surface conjugation . for example , james and driskell have reported
size changes in colloidal gold nanoparticles exposed to protein a
at various concentrations , reminiscent of an adsorption isotherm . however , nta has not been fully validated for
anisotropic particles such as gold nanorods ( gnrs ) due to possible complications in data analysis introduced
by additional diffusion tensors as well as challenges
in preparing anisotropic particles of sufficient uniformity and purity . the presence of residual surfactants is a also potentially confounding
factor in the hd analysis of colloidal suspensions , as it can compromise
dispersion quality by promoting interparticle attraction instead of
repulsion . as a case in point , gnrs with low aspect ratio ( ar
< 4 ) can be synthesized with narrow size dispersity ( 1015% )
in the presence of cetyltrimethylammonium bromide ( ctab ) , a micellar
surfactant . however , the hd analysis of diluted
gnr suspensions can produce variable outcomes : samples with excess
ctab ( > 1 mm ) are contaminated with micelles , whereas nta of gnrs
with
low levels of ctab ( < 10 m ) produce multiple or asymmetric
mode peaks , suggestive of incomplete
dispersion . the removal of residual ctab from gnrs is a vexing problem ;
in addition to particle aggregation , its
persistence can contribute toward cytotoxicity and nonspecific cell uptake . this issue has recently been resolved by a protocol that reliably
exchanges ctab with citrate , using polystyrenesulfonate ( pss ) as a
detergent to remove residual surfactant . here we show that nta can precisely characterize the hydrodynamic
size of low - aspect - ratio gnrs stabilized with citrate ( cit - gnrs ) . the dh values obtained from nta correlate
closely with gnr length , with greater accuracy and precision than
dls and with comparable resolution to tem . the cit - gnrs
are also readily functionalized with other ligands using standard
surface exchange methods and can be evaluated
by nta to reveal incremental changes in dh as a function of ligand or surfactant structure . deionized
water was obtained from an ultrafiltration system ( milli - q , millipore )
with a measured resistivity above 18 mcm and passed through
a 0.22 m filter . particle - free water for nta analysis was obtained
in polyethylene containers from a local supermarket . gnrs were synthesized
on a 200 ml scale in 0.1 m ctab solutions at an optical density ( od )
of 1.3 using previously reported methods . excess ctab was removed by subjecting gnrs to centrifugation and
redispersion ( c / r ) in water , followed by three rounds of c / r using
dilute solutions of na - pss ( mw = 70 kda )
as described in a companion paper . the
pss - washed gnrs were then subjected to two c / r cycles using 5 mm sodium
citrate ( na3-cit ) , yielding stable suspensions of citrate - coated
gnrs ( cit - gnrs ) with od values ranging from 6 to 12 . in a typical
experiment , 0.1 ml of cit - gnrs ( od 7.5 ) was diluted with 3 ml of water ,
centrifuged for 30 min at 7500 g , and then carefully
separated from the supernatant . a 0.9 ml solution of 5 kda mpeg - thiol
( 0.7 wt % in water ) was prepared separately and treated with 0.1 ml
of 15 mm nabh4 for 30 min to reduce residual disulfides
and then combined with the pelleted gnrs by vortex mixing . after 12
h , the redispersed gnrs were centrifuged at 7500 g for 30 min , and redispersed in water to a final volume of 1 ml . similar procedures were performed using other surfactant solutions
( peg - dithiocarbamate , tween-20 , hsa )
without nabh4 treatment . mercaptoundecanoic acid ( mua)-stabilized
gnrs were prepared by treating 0.75 ml of cit - gnrs in water ( od 0.6 )
with 0.25 ml of 4 mm mua in etoh for 20 h , then diluted with 2 ml
of water , centrifuged at 7500 g for 30 min , and then
redispersed in 1 ml of water . tem images were obtained
using a philips cm-10 ( fei ) with an accelerating voltage of 100 kv . dls and zeta potential analysis was performed with a zetasizer nano
( malvern instruments ; = 633 nm ) ; data analysis was supported
by zetasizer v.7.02 . dls was performed in glass cuvettes or disposable
capillary cells ( dts 1060c ) , with an assumed viscosity for water at
25 c ( = 0.8872 mpa ) and refractive indices for water
and au at 633 nm ( n = 1.330 and 0.2 ) . samples were
allowed to equilibrate for 30 s inside the instrument prior to analysis ;
measurements were then accumulated over 1216 runs at rates
of 3070 kcps . nta was performed using a nanosight lm-10
system ( malvern instruments ) with 405 nm laser excitation and particle - free
distilled water stored in polyethylene containers . the imaging chamber was
cleaned with acetone and a microfiber cloth prior to use and then
rinsed until no background signals were observed . water was removed
from the nta chamber with a sterile plastic syringe just prior to
use and replaced with a dilute solution of surfactant - stabilized gnrs
( 100 l , od 0.010.05 ) . coated gnrs were prepared using
the surfactant concentrations described above ( initial od 0.42.0 )
and then diluted 20150-fold just prior to nta . five tracking
videos were collected per sample ; 50 l of fresh solution was
injected in between each run to prevent particles from settling , followed
by a 60 s recording at a shutter speed of 700 and a gain of 400 . a
minimum of 2000 particle tracks were recorded , which yielded dh values based on mode peak analysis . optimized
parameters for video analysis ( advanced mode ) included a detection
threshold of 18 , a 9 9 blur setting , and automated
settings for track length and minimum particle size . statistical analysis
of gnr size distribution was performed by applying gaussian fits to
the mode peaks . finally , calibration measurements on standardized
100 nm polystyrene beads were routinely performed to ensure the accuracy
of the nta studies . tem analysis of the cit - gnrs
indicated a mean length and width
of 44.4 3.9 nm and 12.2 1.2 nm , respectively , corresponding
to a rsd of 8.8% ( figure 1a ) . the uniform quality
of the cit - gnrs was supported by absorbance spectroscopy ( figure 1b and figure s1 , supporting
information ) , which produced a peak centered at 815 nm with
a full width at half - maximum ( fwhm ) of 138 nm ( 0.26 ev ) . hd size distribution
by nta produced values remarkably close to the gnr lengths determined
by tem . mode peaks accumulated over five separate runs ( ntrack = 24003200 each ) yielded an average dh of 43.4 nm ( standard error = 0.75 nm ) ; a gaussian
fit of the mode peak produced a dh of
43.8 nm with a standard deviation of 5.0 nm ( rsd 11.4% ) , well within
the error of tem measurement ( figure 1c ) . ( a ) tem
image of cit - gnrs ( 44.4 12.2 nm ; 8.8% rsd ) . ( b )
absorption spectrum of diluted cit - gnr dispersion ( lpr = 815 nm ) , prepared from pss - gnrs . ( c )
hd size analysis of cit - gnrs using nta ( black ; 43.4 nm ; 11.4% rsd )
versus dls ( red ; 51 nm ; 31% rsd ) . the nta size distribution is number - based ( ntrack = 1.44 10 ) , whereas the dls size
distribution is intensity - based ( n = 2.60
10 ) . the nta mode peaks are
much narrower than those produced by dls
using intensity - weighted size distributions ( the standard practice
for hd analysis ) . in a direct comparison , z - weighted
dls signals accumulated over 1 min ( n = 2.6
10 ) at 260 kcps yielded a mode dh value of 51 nm ; the rsd of the corresponding gaussian fit
was more than 30% . we note that ( i ) gaussian fits of dls mode peaks
ignore skewness and kurtosis within the data , but allow us to compare
the precision of each technique to the first approximation , and ( ii )
the comparison between nta and dls is not absolute , as the size distribution
for the latter is based on scattering intensity rather particle count .
nevertheless , the large differences in peak resolution are more than
sufficient to illustrate the advantages of nta over dls for hd size
analysis . nta is also a sensitive gauge of dispersion quality ,
much more
so than absorbance spectroscopy , a convenient but crude method that
relies on changes in the surface plasmon band . for example , cit - gnrs in 5 mm na3-cit ( ph 7.3 ) produced
a dh peak approaching normal distribution ,
corresponding with < 1% aggregation by peak area integration ( figure 2a ) , while the nta plot of pss - gnrs in 0.4 wt % na - pss
( ph 5 ) revealed a multimodal distribution , indicating partial aggregation
( figure 2b ) . in contrast , the absorbance spectra
for cit - gnrs and pss - gnrs are nearly identical ; while the latter has
lower transmission below 650 nm and a slightly larger fwhm at plasmon
resonance ( figure 1b ) , it hardly suggests the
presence of aggregates . we note that while the end - to - end assembly
of gnrs can produce large shifts in longitudinal plasmon resonance , the aggregation of gnrs in other orientations does not lead to pronounced
changes . earlier works have shown that side - by - side aggregation can
produce modest blue - shifts in transverse plasmon resonance (
520 nm ) , but the extent of such shifts depends strongly on
interparticle distances . overall , nta provides
the strongest evidence that cit - gnrs are fully dispersed and experience
minimum aggregation in the absence of other surfactants . nanoparticle
tracking analysis of ( a ) cit - gnrs in 5 mm na3-cit ( ph 7.3 )
and ( b ) pss - gnrs in 0.4 wt % na - pss ( ph 5 ) , at similar
particle concentrations ( ca the
latter shows a large number of aggregates in the 75200 nm
range , assumed to be a composite of polymer and gnrs ( pss background provided for comparison ) . it is worthwhile to present a
balanced discussion on the use of
nta for characterizing the hd size of anisotropic particles , which
are known to exhibit different motional behavior than spheres . strictly speaking , particle sizes
derived from the stokes einstein equation are based on a spherical
model with a single diffusion coefficient , which equates the dh of anisotropic particles to that of a sphere
with the same translational mobility . in fact , the brownian motion
of axially symmetric particles can be described using separate diffusion
coefficients for coaxial and transverse translation ( d and d ) as
well as rotation ( d ) . translational
and rotational diffusion are coupled in the fast ( autocorrelation )
regime but are essentially independent for displacements measured
over longer periods . the autocorrelation time of low - aspect gnrs in
water has been estimated to be on the order of 50 s , which is several orders of magnitude shorter
than the msd time steps recorded by nta , meaning that hd analysis
is unaffected by d. with
respect to the anisotropy of translational diffusion , the
ratio of d to d depends partly on aspect ratio but is also affected
by boundary conditions imposed on particle motion . single - particle
tracking studies of submicron ellipsoids have shown that diffusion
anisotropy increases for particles confined to two dimensions ( attributable
to friction anisotropy ) , but rodlike particles
with unrestricted mobility in three dimensions exhibit low anisotropy
( d/d < 2 ) , even with high aspect ratios . while nta measurements are quasi - two - dimensional ( bounded by the
thickness of the focal plane ) , particles
can freely move in all directions which favors isotropic diffusion . further evidence for isotropic brownian motion can also be obtained
by analyzing the tracking videos for vectored flow and used to determine
an acceptable threshold in aspect ratio . nta can thus be applied toward
the hd analysis of anisotropic nanoparticles with these considerations
in mind , and the dh values can be collated
with an independent sizing method such as tem analysis for a more
precise interpretation . citrate - stabilized
colloids have been used for decades in the preparation of imaging
contrast agents . it is therefore not surprising
that surface functionalization with cit - gnrs is facile , with fewer
problems in dispersion quality than ctab- or pss - stabilized gnrs ( for
more details see figure s2 , supporting information ) . we note that other stabilizing agents such as phosphatidylcholine , animomercaptotriazole , and mercaptocarboxylic acids have also
been examined as biocompatible surrogates in place of ctab ; nevertheless ,
citrate - stabilized colloids are among the most highly trusted substrates
for preparing surface - modified nanoparticles . the effects of
ligand adsorption on cit - gnrs after a single round of treatment were
again characterized by nta and absorbance spectroscopy ( figure 3 and figure s3 ; table 1 ) . small thiols such as mercaptoundecanoic acid
( mua ; mw 218 ) could stabilize gnr dispersions without a significant
change in the mode dh value , while larger
ligands such as mpeg thiol or dithiocarbamate ( mw = 1 or 5 kda ) increased dh by
57 nm . this supports the assumption that chemisorptive ligands
adsorb as monolayers on gnr surfaces ; however , hd size does not increase
monotonically with molecular weight . the experimental data suggests
that the 1 kda peg chains may adopt partially extended conformations ,
whereas the 5 kda mpeg chains are presumed to adopt mushroom - like
conformations , in accord with previous studies . we note that gnrs coated with 1 kda peg thiol also produce
a relatively broad nta peak , suggesting incomplete dispersion control . coated
gnr samples ( initial od 0.600.75 ) were diluted 2030-fold
( final od 0.020.05 ) prior to nta . intensities are normalized
to enable a comparison between mode peaks as a function of ligand
coating . obtained by nta ; sd from gaussian
fit of mode peak ( accumulated over 5 runs ) . measured in diluted pbs ( i = 1
mm ; ph 7.4 ) . measured in
diluted pbs ( i 8.2 mm ) treatment of cit - gnrs with
tween 20 ( 1.2 kda ; 5 mm ) increased the
mode dh by 9 nm , greater than that produced
by chemisorptive mpeg species . tween 20 has been reported to form
micelles of 79 nm , comparable
to the observed increase in hd size . nta also revealed minor populations
of submicron particles ( broad peaks centered at 100 and 175 nm ) that
can be attributed to aggregates containing two or more gnrs . this
shows that while nonionic surfactants may be useful as nanoparticle
dispersants , they do not provide full control over surface properties ;
indeed , the -potential of gnrs treated with tween 20 remains
moderately negative ( table 1 ) , indicating coadsorption
of residual citrate . lastly , exposing cit - gnrs to human serum albumin
( hsa , 67 kda ; 1 wt % ) increased dh by
15 nm , which is consistent with a monolayer of hsa in its native conformation , but thicker than that adsorbed on hydrophobic nanoparticles . we note that dls is often used to estimate the
thickness of biomacromolecular coatings on nanoparticles , but its precision is not as high
as nta as demonstrated earlier ( cf . figure 1c ) . to determine whether surfactant concentration
influenced monolayer
thickness or dispersion stability , cit - gnrs were treated with 5 kda
mpeg - thiol in variable amounts . stable dispersions were observed at
loadings down to 15 m ( figure 4a ) ; the dh mode peak did not change with mpeg concentration ,
ruling out the spontaneous formation of brush monolayers with extended
chains . cit - gnrs treated with mpeg - thiol
at or below 1.5 m exhibited signs of aggregation several hours
after treatment , based on the multimodal peak distribution in the
nta plots ( figure 4b ) . again , the absorbance
spectra of these gnr dispersions were nearly indistinguishable from
fully dispersed mpeg - gnrs ( figure s4 , supporting
information ) . concentration - dependent nta studies using
cit - gnrs and hsa in deionized
water produced similar results , with an onset in gnr aggregation at
1 mg / ml hsa ( figure 5a ) . the mode peak of the
coated gnrs did not shift with increasing amounts of hsa , in contrast
to a recent nta study of protein adsorption on spherical au nanoparticles ,
which indicated concentration - dependent increases in hd size . the low sensitivity to hsa concentration supports
the notion that protein adsorption takes place preferentially at the
gnr tips , in line with earlier studies on anisotropic functionalization . ( a )
dispersion stability of gnrs at different exposure levels of
5 kda mpeg - thiol . intensities are normalized for a comparison between
mode peaks as a function of preparation conditions . ( b ) mpeg - thiol concentrations
below 15 m ( 0.075 mg / ml ) were insufficient to produce fully
dispersed gnrs , based on nta . ( a ) gnrs exposed to different concentrations of hsa formed stable
dispersions in water ( dh = 5960
nm ) , down to 1 mg / ml . hsa - gnr samples ( od 1.92.0 ) were diluted
150-fold prior to nta ; intensities were normalized for a comparison
between mode peaks . ( b ) gnrs dispersed in pbs ( i
160 mm ) with 10 mg / ml hsa ( dh = 65 nm ) . hsa - gnrs ( initial od 0.4 ) were diluted 20-fold with pbs prior to nta . a background run containing 0.5 mg hsa / ml in pbs is shown for comparison ,
to address the formation of protein aggregates . similar results were observed for cit - gnrs treated with hsa
in
pbs , with the addition of a secondary peak centered at dh = 150 nm ( figure 5b ) . this particle
population can be attributed to the independent assembly of hsa nanoparticles
at or near physiological ionic strength ( i
160 mm ) , as observed in the control study of 0.5 mg hsa / ml in the
absence of cit - gnrs . it is worth mentioning that the hd size of hsa - coated
gnrs did not increase further in dense protein solutions ( up to 40
mg hsa / ml in pbs ) , indicating that hsa does not automatically form
a protein multilayer ( corona ) around these particles . however , corona
formation can be observed when cit - gnrs are exposed to serum proteins
under other conditions , a study in progress that will be discussed
elsewhere . nta is a valid method
for measuring the hydrodynamic size of gnrs
with low aspect ratios . the mode dh value
of citrate - stabilized gnrs matches closely with the mean length measured
by tem , indicating that translational diffusion is effectively isotropic
under our imaging conditions . the nta resolution of this study is
approximately 5 nm , which is sufficient to measure differences in
coating thickness based on hd size . in this respect , citrate - stabilized
gnrs are dependable substrates for surface functionalization and ligand
exchange , enabling a systematic analysis of gnr coatings as a function
of surfactant structure and concentration . | the
stability and hydrodynamic size of ligand - coated gold nanorods
( gnrs ; aspect ratio 3.6 ) have been characterized by nanoparticle tracking
analysis ( nta)a single - particle counting method that can measure
size distributions with low nanometer resolution .
stable aqueous suspensions
of citrate - stabilized gnrs ( cit - gnrs ) are amenable to surface functionalization
without loss of dispersion control .
cit - gnrs can be treated with chemisorptive
ligands ( thiols and dithiocarbamates ) , nonionic surfactants ( tween
20 ) , and proteins ( human serum albumin ) , all of which produce stable
suspensions at low surfactant concentrations .
the precision of nta
( relative standard deviation 1012% , standard error < 2% )
is sufficient to allow differences in the hydrodynamic size of coated
gnrs to be interpreted in terms of surfactant structure and conformation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in relation to all inguinal hernias , large irreducible scrotal hernias are quite rare , while such hernias containing colon tumors in the sac have so far been described in fewer than 30 cases . a 61-year - old patient was admitted for a planned surgery because of a large irreducible left - sided scrotal hernia . intraoperatively , a large tumor of the sigmoid colon was found in the hernial sac . in a histopathological examination a palliative operation was performed and he was referred to further systemic and palliative treatment ( because of numerous coexisting liver metastases ) . a 61-year - old patient was admitted to a surgery department because of a large left - sided irreducible scrotal hernia . except for a slight loss of weight over the past few months and periodically repeated left abdominal pains , he had had no other accompanying symptoms , including no symptoms of a bowel obstruction . in the physical examination , a large left - sided irreducible scrotal hernia , with a quite rigid consistency , together with the testis constituting an indivisible cell conglomerate ; otherwise , in the physical examination no abdomen abnormalities . the patient was anemic and had a leucocytosis . in a chest x - ray : lung fields , diaphragm and heart normal . the operation began in a classic way : a cut above the poupart 's ligament opened the left inguinal canal . separation of hernial sac from the spermatic cord was initiated , however , due to a very large infiltration , it turned out to be impossible ( fig . , there appeared a very much changed sigmoid with a tumor infiltrating beyond the hernial sac onto the left testis and spermatic cord , locally including inflammation with necrosis . , adenocarcinoma was diagnosed . for a proper evaluation of the entire peritoneal cavity , laparotomy was performed from a separate cutting . multiple nodular changes in the liver were found , most probably of a metastatic nature . transfer of the sigmoid tumor into the peritoneal cavity was impossible , so sigmoid was excised from the side of the inguinal canal , with manual anastomosis the release of the testis and spermatic cord from the infiltration was impossible to conduct , so it was necessary to excise both structures in one block ( fig . subsequently , the posterior wall of the inguinal canal was closed by halsted 's method . abdomen wall was closed in a conventional way and with the use of ventrofil stitches . the postoperative abdominal ultrasound examination revealed multiple nodules changes in the liver with suspicion of a central necrosis ( fig . stay , the patient received two units of prbcs , two units of ffp , fraxiparine 0.6 and antibiotic cover . the patient was discharged after a week , in a good general condition , for further systemic therapy and palliative care . in the received histopathological test : adenocarcinoma g2 , astler - coller stage b2 , ajcc stage 2 , histological type n , pt3nxm1 . the cancer infiltrates the entire thickness of the intestinal wall and crosses the serous membrane . he has interrupted the treatment and taken up physical work ; he has not reported for a check - up examination at the department of surgery . until now , about 30 cases of colon tumor in inguinal hernia sac have been reported . in the southern medical journal 1991 october , vol . , maj douglas and co. described 15 such cases . in three of them , the tumor was in the inguinal hernia sac on the right side , while in other cases on the left one . all the right - sided hernias contained cecum , while the left - sided ones had sigmoid . six patients demonstrated symptoms of obstruction , and all the patients were males , as in the case presented by us . just like in the case of our patient , all the cases described were diagnosed intraoperatively and laparotomy was performed from a separate cut for the purpose of resection of part of the colon and a full evaluation of the peritoneum cavity . describe the case of a 93-year old patient who was preoperatively diagnosed with sigmoid cancer . carr et al . described a patient who should have been operated because of the left - sided inguinal hernia . preoperative , the laboratory tests showed anemia ( as in our patient 's case ) . they conclude that in the cases of large hernias , especially those rapidly growing , colonoscopy should be a routine diagnostic procedure , applied to assess the colon and the possible detection of the tumor . it should be remembered that even the most obvious preoperative diagnosis may be verified intraoperatively . in some centers , ultrasound examination of each surgical patient is a routine preoperative action . to a large extent , the ultrasound evaluation allows to avoid such surprises during the operation . stephen king used to say : when you hear hoof beats , think horses , not zebras . however , as seen in our example and other ones , it sometimes happens that we do see the zebras . written informed consent was obtained from the patient for publication of this case report and case series and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . | introductionin relation to all inguinal hernias , large irreducible scrotal hernias are quite rare , while such hernias containing colon tumors in the sac have so far been described in fewer than 30 cases.presentation of casea 61-year - old patient was admitted for a planned surgery because of a large irreducible left - sided scrotal hernia .
intraoperatively , a large tumor of the sigmoid colon was found in the hernial sac . in a histopathological examination
it was diagnosed as adenocarcinoma .
a palliative operation was performed and he was referred to further systemic and palliative treatment ( because of numerous coexisting liver metastases).discussionuntil now , only about 30 cases of colon tumor in inguinal hernia sac have been reported.conclusionit should be remembered that even the most obvious preoperative diagnosis may be verified intraoperatively . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
thoracic outlet syndrome ( tos ) may cause several diverse clinical disorders of the upper limb , such as pain , paraesthesia and dysaesthesia . these symptoms result from compression of neuronal or vascular structures within the space delimited by the scalene muscles , the clavicle , and the first rib . compression of these neuronal and vascular structures may be secondary to anatomic bony anomalies such as cervical rib , tumour or callus formation after trauma . however , hypertrophy of the scalene muscles or the smaller pectoral muscle at the thoracic outlet can also be a causative factor for tos . different positional and compressive manoeuvres such as adson 's test , eden 's test , wright 's test , green - stone test or the elevated arm stress test ( east ) can reproduce the symptoms of tos . doppler sonography , x - ray , electromyographs and arteriography may also show pathological results in these patients . the diagnosis of tos remains difficult , as the different examinations are not specific for tos . patients who do not benefit from physiotherapy should undergo surgical treatment , whereby several procedures , such as transaxillary , supraclavicular , infraclavicular and transthoracic incision , have been described . since its introduction by roos , the transaxillary approach has become the most popular surgical procedure in patients with tos . from a recent review of the literature , very few reports analysing the different diagnostic options in patients with tos were to be found ; the purpose of this study was therefore to analyse the different clinical tests relative to their prediction of the clinical outcome subsequent to surgery . during a period of five years , 56 patients ( 36 female and 20 male who underwent a total of 64 operations ) were admitted to our vascular surgical unit and diagnosed with tos . afterwards , these patients were operated and followed up in a prospective manner for 55.6 45.5 months . the median age was 36.4 12.5 years ( range 17 - 70 years ) and the majority ( 64.3% ) were female . before being transferred to our outpatient clinic , these patients had been seen by an average of 3.2 1.1 different physicians . clinical examination included skin colour , swelling , weakness , sensibility of arm and hand . additional positional and compressive manoeuvres such as adson 's test , tinel 's test , eden 's test , wright 's test , greenstone test and the east test were performed . all patients were examined using the same protocol ( patients were placed in a standing position and had to perform the east test , blood pressure was measured directly after exercise on the dominant upper arm using a riva - rocci sphygmomanometer ; after a pause of ten minutes , the test was repeated on the contralateral arm ) . in some cases the following additional studies were performed : upper limb angiography , electromyography , doppler sonography and x - ray . diagnosis of tos was established on the basis of history , physical examination , angiography , electromyography and doppler findings . in 60.7% of the patients conservative treatment was attempted prior to surgery ( except in patients with acute vascular forms of tos ) , but proved unsuccessful in all patients . indications for surgery were persistent symptoms of tos after a minimum of 3 to 6 months of conservative therapy . patients with severe symptoms , emergencies and cervical ribs underwent surgery after a shorter period to prevent further damage of vessels or nerves , and of embolism in the arms . in the event of surgery , the median follow up was 55.6 45.5 months , clinical post - operative follow - up was available for all cases and included a clinical interview and examination by one of the three consultants . patients were questioned about their amount of pain , activity status and overall satisfaction for a minimum of three months post surgery . outcome was graded " good " when symptoms vanished and " fair " when symptoms decreased and the patients could return to their pre - illness activities . outcome was graded as " poor " when symptoms did not improve or worsened , and the patient could not return to their pre - illness activities . doppler sonography was performed post - operatively in all cases and electromyography was additionally performed in 36% ; these additional examinations , however , did not reveal any pathological findings . for statistical analyses of the data , chicago , il , usa ) . the chi - squared and mann - whitney u test was used to evaluate the operative outcome , anamnestic findings , clinical examinations , operative approach and complications . at presentation , history was taken and physical examination was performed by three experienced consultants . clinical examination included skin colour , swelling , weakness , sensibility of arm and hand . additional positional and compressive manoeuvres such as adson 's test , tinel 's test , eden 's test , wright 's test , greenstone test and the east test were performed . all patients were examined using the same protocol ( patients were placed in a standing position and had to perform the east test , blood pressure was measured directly after exercise on the dominant upper arm using a riva - rocci sphygmomanometer ; after a pause of ten minutes , the test was repeated on the contralateral arm ) . in some cases the following additional studies were performed : upper limb angiography , electromyography , doppler sonography and x - ray . diagnosis of tos was established on the basis of history , physical examination , angiography , electromyography and doppler findings . in 60.7% of the patients conservative treatment was attempted prior to surgery ( except in patients with acute vascular forms of tos ) , but proved unsuccessful in all patients . indications for surgery were persistent symptoms of tos after a minimum of 3 to 6 months of conservative therapy . patients with severe symptoms , emergencies and cervical ribs underwent surgery after a shorter period to prevent further damage of vessels or nerves , and of embolism in the arms . in the event of surgery , during surgery under general anaesthesia , two different procedures were performed - a transaxillary approach and a supraclavicular approach . the median follow up was 55.6 45.5 months , clinical post - operative follow - up was available for all cases and included a clinical interview and examination by one of the three consultants . patients were questioned about their amount of pain , activity status and overall satisfaction for a minimum of three months post surgery . outcome was graded " good " when symptoms vanished and " fair " when symptoms decreased and the patients could return to their pre - illness activities . outcome was graded as " poor " when symptoms did not improve or worsened , and the patient could not return to their pre - illness activities . doppler sonography was performed post - operatively in all cases and electromyography was additionally performed in 36% ; these additional examinations , however , did not reveal any pathological findings . for statistical analyses of the data , spss 11.0 was used ( spss inc . , chicago , il , usa ) . the chi - squared and mann - whitney u test was used to evaluate the operative outcome , anamnestic findings , clinical examinations , operative approach and complications . interviews and examination during follow - up showed a " good " outcome in 42.2% . 43.8% of our patients showed a " fair " outcome and the remaining 13.0% had a " poor " outcome . statistical analyses of different demographic data and anamnestic findings , such as sex , age , height , weight , hypertension , trauma , tobacco use , duration of symptoms and number of medical doctors involved , did not show any association with the outcome after operation ( p > 0.05 , data not shown ) . the majority of our patients had neurovascular tos ( 67.2% ) , followed by patients with arteriovenous ( 10.9% ) , arterial ( 7.8% ) , neurological ( 7.8% ) and venous tos ( 6.3% ) . the character of tos did not show any association with the outcome ( p > 0.05 ) . the east test showed the highest sensitivity with 98% , followed by the adson ( sensitivity : 92% ) and eden tests ( sensitivity : 92% ) . nevertheless , a positive east , eden , adson , green - stone or adson test was not associated with a poorer outcome ( p0.05 ) . mean systolic blood pressure of the afflicted side in the group of patients with good or fair outcome ( 85.9% of all patients ) showed an average systolic blood pressure of 123.1 12.5 mmhg before exercise and 108.9 12.8 mmhg after exercise ( average decrease : 16.2 9.6 mmhg ) . a decrease in blood pressure of more than 25 mmhg could not be found in this group . in the group of patients with a poor outcome , the systolic blood pressure before exercise was 140.6 24.6 mmhg and 106.7 21.8 mmhg after exercise ( average decrease : 35.0 14.1 mmhg ) . statistical analyses showed that a distinct decrease in blood pressure after exercises was associated with a poorer outcome ( p = 0.0027 ) . surgical approaches involved two different methods ( supraclavicular or transaxillary ) ; whereby the operative approach selected was not seen to be associated with a poorer outcome ( p 0.05 ) . intra - operatively , different abnormalities were observed , which are summarized in table 1 . statistic analyses showed no association of pathologies or peri - operative complications and a poor outcome . anatomic abnormalities of patients with tos , which could be find during operation complications after operation thoracic outlet syndrome is a clinical phenomenon resulting from compression of the neurovascular structures at the superior aperture of the thorax which presents with varying symptoms . these symptoms , which appear as a consequence of anatomic variations , were first described by coote in 1861 and the term tos was used in the literature for the first time by peet and rob in the late 1950ies . to date , the diagnosis of tos seems to be a challenge for a lot of physicians . in the current study , our patients were seen by an average of 3.2 1.1 physicians before the diagnosis was established ; a good explanation possibly being that patients with tos present a broad spectrum of symptoms . therefore , a lot of differential diagnoses are possible ; fortunately , the length of symptoms and the number of consulted physicians was not associated with a poorer outcome . it is necessary to distinguish between minor and major trauma ; minor trauma without bone or neurovascular lesions causes most cases of tos as a result of remodelling of muscle fibres during healing . therefore , it is not unexpected that anatomic abnormalities can frequently be found in patients with tos . these anomalies include cervical rib , first rib or soft tissue structures [ 12 - 14 ] . in our study , 26 patients presented compressive fibrous structures as reasons for tos . trauma of the clavicle or muscle hypertrophy could also be seen in some cases ( table 1 ) . however , the type of abnormality was not associated with a poorer outcome . different diagnostic tests ( e.g. adson , greenstone , east , wright or eden ) have been suggested as diagnostic tools in patients with tos . the sensitivity of these tests is acceptable , as shown in our study , although a disadvantage to these tests might be their specificity , which is considered to be poor . apart from wright 's test ( specificity : 90% ) , the specificity of these tests is less than 80% and the different tests failed to be a predictor for a poor outcome . measurement of the blood pressure is a simple clinical test , which is also cheap . as this study shows , a distinct decrease in systolic blood pressure of the affected side after exercises was a negative predictor for the outcome of patients with tos after surgery . a poorer outcome was not associated with the aetiology of tos , the operative technique , the length of the operation , a cervical rib or pathological findings during electrophysiological or neurological examination . especially pathological findings during electrophysiological or neurological examination were not associated with a distinct decrease in blood pressure on the affected side after exercises . an explanation of these findings could be that a distinct decrease of blood pressure could be an indirect sign of an excessive compression of vessels and neural structures . this compression might lead to a beginning damage or irritation of the neural structures , which is not detectable by electrophysiological or neurological examination . therefore , this easy practical test might also be useful as an indirect indicator for the grade of neural and vascular compression and as an indirect sign for beginning damage and irritation . in these patients , an earlier operative therapy ( instead of conservative therapy ) might be useful . however , conservative therapy should usually be attempted prior to surgery . in patients with persistent symptoms of tos for more than 6 months of conservative therapy there are different objectives of surgical treatment for neurogenic and vascular tos . for neurogenic tos , the objective is to diminish the symptoms , while in vascular tos the operative indication is the prevention of thrombosis or weakness of the arm during exercises . surgical decompression of the thoracic outlet usually leads to significant benefit in patients with tos . since its introduction by roos , the transaxillary approach has become the most popular surgical procedure in patients with tos . in general , the transaxillary approach provides a good exposure for the resection of cervical ribs , the first rib and excision of fibrous ligaments and the scalenus muscle associated with perfect cosmetic results . most of our patients were operated using a transaxillary approach because of the different advantages mentioned above . regarding a poor outcome , we could not find a disadvantage to any of the different surgical procedures . finally , our study has two limitations . a control group would be helpful to evaluate the specificity of the different clinical tests used in this study . however , there is one study that provides these data for some tests , which were used in our case . secondly , due to our surgical unit ( vascular centre ) therefore , the statements made in this study are mainly valid for patients with vascular tos . tos is a disease with a broad spectrum of symptoms , which leads to a delayed diagnosis . clinical tests for tos show a good sensitivity , but a poor specificity and can not be used as predictors for the outcome . measurement of the blood pressure is a simple clinical test and a distinct decrease in blood pressure of the affected side after exercises was associated with a poorer outcome . | objectivethoracic outlet syndrome ( tos ) is a clinical phenomenon resulting from compression of the neurovascular structures at the superior aperture of the thorax which presents with varying symptoms .
regarding to the varying symptoms , the diagnosis of tos seems to be a challenge and predictors for the outcome are rare .
the purpose of this study was therefore to analyze the different clinical examinations and tests relative to their prediction of the clinical outcome subsequent to surgery.methodsduring a period of five years , 56 patients were diagnosed with tos .
medical history , clinical tests , operative procedure and complications were recorded and analysed .
mean follow - up of the patients was 55.6 45.5 months , median age of the patients was 36.4 12.5 years.resultsdifferent clinical tests for tos showed an acceptable sensitivity overall , but a poor specificity .
a positive test was not associated with a poor outcome .
analyses of the systolic blood pressure before and after exercise showed , that a distinct decrease in blood pressure of the affected side after exercises was associated with a poor outcome ( p = 0.0027).conclusionsclinical tests for tos show a good sensitivity , but a poor specificity and can not be used as predictors for the outcome .
a distinct decrease in blood pressure of the affected side after exercises was associated with poor outcome and might be useful to predict the patients ' outcome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in pakistan , it is estimated that at least nine million people harbor hepatitis b virus , and over fourteen million are chronically infected with hepatitis c virus [ 1 , 2 , 11 , 19 , 2127 ] . the exact prevalence rate of hepatitis virus infections in pakistan is unknown , and most studies have been done in different small groups , e.g. blood recipients , paid blood donors , patients suffering from liver disorders , hemodialysis patients , health care workers and voluntary blood donors [ 24 , 25 , 28 , 29 ] . earlier studies done in pakistan have shown a prevalence rate of 4 - 10% for hbv and 4.814% for hcv [ 30 , 31 ] . recent data indicate the prevalence of hbv might be declining , probably because of increased awareness and wide acceptance of health care measures , including mass vaccination program undertaken by the government [ 4 , 5 , 6 ] . on the other hand , the burden of hcv - related chronic liver disease ( cld ) in pakistan has increased [ 7 , 8 , 1218 ] . earlier studies showed that of all patients presenting with cld , 16.6% were anti - hcv positive . furthermore , recent data show that 6070% of patients with cld tend to be positive for anti - hcv [ 31 , 33 , 34 , 35 ] . it has been demonstrated that nearly 50% of patients with hepatocellular carcinoma ( hcc ) in pakistan are anti - hcv positive . the main purpose of this study was to investigate the prevalence of hbv and hcv in young , apparently healthy women of childbearing age in a large city . women are expected to be the major victims of infections such as hbv , hcv and hiv because of greater exposure to syringes , blood and blood products , especially during pregnancy , delivery and ear piercing . another purpose was to make these women aware of those infections , which can be prevented easily by practicing simple precautionary measures such as regular health checkups and vaccination [ 9 , 10 , 20 , 53 ] . these young women can further educate their families and thereby indirectly play a role in reducing the burden of these kinds of diseases . informed signed consent was collected from all volunteers who participated in the study , after the purpose , nature and risks of the participation were fully explained to them verbally and in writing . the individual laboratory results were kept confidential and given to the participants at the completion of the project . also , they were provided with information on limiting the spread of these infections and referred to the nearest government medical facility for guidance . a total of 4000 healthy female students from two universities in karachi , aged 1830 years , participated in this study . to obtain enough volunteers , six screening camps were organized at the department of microbiology , university of karachi , and the department of microbiology , jinnah university for women , karachi , during march 2002 and october 2006 . every camp followed an awareness lecture on hepatitis infections , their consequences , and preventive measures after submitting their signed consents , volunteers were subjected to health checkups by a medical doctor . age 18 to 30 years ; weight : > 45 kg ; body temperature 96 to 98f ; hemoglobin > 10 g / dl , blood pressure : systolic 100180 mm , diastolic : 60100 mm ; pulse rate > 65/min . clinical history of volunteers was noted , especially jaundice , blood transfusion , exposure to syringes , surgical and dental procedures . apparently unhealthy or malnourished individuals were excluded . from every volunteer 15 ml of blood was taken . serum was separated by centrifugation and stored at 20c.hematologic screening ( hemoglobin , red cell count , total and differential white cell count , hematocrit , platelet count , mean cell volume , mean cell hemoglobin concentration ) was done using a sysmex - kx-21 hematology analyzer ( s. ejazuddin & company , pakistan).biochemical screening ( total bilirubin , direct bilirubin , alt , ast and alkaline phosphatase ) was done using a microlab 200 analyzer ( merck , germany).hbv and hcv screening : on the spot screening for hbs ag , anti hbs antibodies and hcv antibodies was done by using rapid immunochromatography kits ( ict , australia and abbott , usa ) . hematologic screening ( hemoglobin , red cell count , total and differential white cell count , hematocrit , platelet count , mean cell volume , mean cell hemoglobin concentration ) was done using a sysmex - kx-21 hematology analyzer ( s. ejazuddin & company , pakistan ) . biochemical screening ( total bilirubin , direct bilirubin , alt , ast and alkaline phosphatase ) was done using a microlab 200 analyzer ( merck , germany ) . hbv and hcv screening : on the spot screening for hbs ag , anti hbs antibodies and hcv antibodies was done by using rapid immunochromatography kits ( ict , australia and abbott , usa ) . confirmatory tests for hbs ag and hcv antibodies were done by using elisa ( imx , abbott , usa).hbv dna and hcv rna were extracted from 200 l of serum using purelink viral rna / dna mini kit ( invitrogen , usa ; for procedure refer to the manufacturer 's instructions).all positive cases were further confirmed by pcr using puretaq ready - to - go pcr beads ( amersham , uk/ usa ; for procedure refer to the manufacturer 's instructions ) . hbv dna and hcv rna were extracted from 200 l of serum using purelink viral rna / dna mini kit ( invitrogen , usa ; for procedure refer to the manufacturer 's instructions ) . all positive cases were further confirmed by pcr using puretaq ready - to - go pcr beads ( amersham , uk/ usa ; for procedure refer to the manufacturer 's instructions ) . informed signed consent was collected from all volunteers who participated in the study , after the purpose , nature and risks of the participation were fully explained to them verbally and in writing . the individual laboratory results were kept confidential and given to the participants at the completion of the project . also , they were provided with information on limiting the spread of these infections and referred to the nearest government medical facility for guidance . a total of 4000 healthy female students from two universities in karachi , aged 1830 years , participated in this study . to obtain enough volunteers , six screening camps were organized at the department of microbiology , university of karachi , and the department of microbiology , jinnah university for women , karachi , during march 2002 and october 2006 . every camp followed an awareness lecture on hepatitis infections , their consequences , and preventive measures , to create awareness about the importance of regular health checkups and hepatitis screening . after submitting their signed consents , age 18 to 30 years ; weight : > 45 kg ; body temperature 96 to 98f ; hemoglobin > 10 g / dl , blood pressure : systolic 100180 mm , diastolic : 60100 mm ; pulse rate > 65/min . clinical history of volunteers was noted , especially jaundice , blood transfusion , exposure to syringes , surgical and dental procedures . serum was separated by centrifugation and stored at 20c.hematologic screening ( hemoglobin , red cell count , total and differential white cell count , hematocrit , platelet count , mean cell volume , mean cell hemoglobin concentration ) was done using a sysmex - kx-21 hematology analyzer ( s. ejazuddin & company , pakistan).biochemical screening ( total bilirubin , direct bilirubin , alt , ast and alkaline phosphatase ) was done using a microlab 200 analyzer ( merck , germany).hbv and hcv screening : on the spot screening for hbs ag , anti hbs antibodies and hcv antibodies was done by using rapid immunochromatography kits ( ict , australia and abbott , usa ) .
hematologic screening ( hemoglobin , red cell count , total and differential white cell count , hematocrit , platelet count , mean cell volume , mean cell hemoglobin concentration ) was done using a sysmex - kx-21 hematology analyzer ( s. ejazuddin & company , pakistan ) . biochemical screening ( total bilirubin , direct bilirubin , alt , ast and alkaline phosphatase ) was done using a microlab 200 analyzer ( merck , germany ) . hbv and hcv screening : on the spot screening for hbs ag , anti hbs antibodies and hcv antibodies was done by using rapid immunochromatography kits ( ict , australia and abbott , usa ) . confirmatory tests for hbs ag and hcv antibodies were done by using elisa ( imx , abbott , usa).hbv dna and hcv rna were extracted from 200 l of serum using purelink viral rna / dna mini kit ( invitrogen , usa ; for procedure refer to the manufacturer 's instructions).all positive cases were further confirmed by pcr using puretaq ready - to - go pcr beads ( amersham , uk/ usa ; for procedure refer to the manufacturer 's instructions ) .
hbv dna and hcv rna were extracted from 200 l of serum using purelink viral rna / dna mini kit ( invitrogen , usa all positive cases were further confirmed by pcr using puretaq ready - to - go pcr beads ( amersham , uk/ usa ; for procedure refer to the manufacturer 's instructions ) . a total of 4000 healthy women were screened by immunochromatography for the presence of hbsag , anti hbs antibodies and hcv antibodies . we found 3820 ( 95.5% ) subjects negative by both immunochromatography and elisa , 181 ( 4.5% ) tested positive for hb surface antigen , 20 ( 0.5% ) were positive for anti - hb surface antibodies , and 208 ( 5.2% ) were positive for anti - hcv antibodies . only two volunteers ( 0.05% ) were infected with both hbv and hcv ( table 1 ) . prevalence of hbsag , and anti - hbs and anti - hcv antibodies in 4000 volunteers . wbc count , rbc count , hematocrit and platelet count in the 181 hbsag - positive individuals were within normal range , while mean hb was 9.81.6 g / dl . direct bilirubin , indirect bilirubin , alt , ast and alkaline phosphatase were within normal range in all tested individuals , except for the raised alt and ast levels in 10 participants with a previous history of jaundice who were positive hbsag . of 208 participants who scored positive for hcv antibodies , 13 showed elevated amino transferase activity ( ast ) and raised alt levels ( table 2 ) . values are given as meansem all samples that were positive for hbs antigen or hcv antibodies were later on confirmed by pcr . out of 181 hbs antigen positive samples , 151 ( 83.42% ) were genotype d , 28 ( 15.46% ) showed mixed infection with genotypes b and d , while one ( 0.025% ) showed mixed infection of genotypes c and d ( table 3 ) . out of 208 samples positive for hcv antibodies , 107 ( 51.44% ) were genotype 3a , 50 ( 24.03% ) were a mix of genotype 3a and 3b , 33 ( 15.86% ) were genotype 3b , 10 ( 4.80% ) were genotype 1b while , and 8 ( 3.84% ) samples could not be typed ( table 4 ) . genotypic distribution of hbv with respects to single & mixed infection ; the number of volunteers in each column is followed by the percentage within parentheses . genotypic distribution of hcv with respect to single & mixed infection ; the number of volunteers in each column is followed by the percentage within parentheses . confirmation of a diagnosis of hepatitis b and assessment of prognosis rely on examination of liver biopsy . most people who are chronic inactive carriers ( no symptoms , hbsag - positive , normal serum aminotransferase activity ) generally have little or no inflammation on biopsy . an important feature in such patients is the presence of ground glass cells in liver biopsy , i.e. liver cells producing large amounts of hbsag . individuals with chronic hepatitis b have various degrees of liver inflammation , and some have fibrosis or cirrhosis . substantial inflammation and the presence of fibrosis or cirrhosis a major problem estimating prognosis of patients with chronic hepatitis c is that it is difficult to predict who will have a relatively benign course and who will go on to develop cirrhosis or cancer . there is a wide variation in the prevalence of anti - hcv antibodies and hbsag worldwide . the prevalence of hcv is high in africa , especially in some egyptian cities where more than 15% of the population is infected . the carrier rate of hbs ag varies from 0.1% to 0.2% in britain and usa , more than 3% in greece and southern italy , and up to 15% in africa and the far east . studies are too limited to give a clear picture of the prevalence of hepatitis b and hepatitis c at the national level , especially among apparently healthy individuals . most previous studies targeted different small groups of individuals with some clinical indications , so they do not accurately reflect the overall prevalence in pakistan . for example , the prevalence of hbsag has been variously reported as 9.97% , 10% , 3.1% , 0.99% , 1.11% , 4% , 3% , 3.2% , 3% , 4.3% and 6.5% , respectively , in different groups of individuals [ 28 , 39 , 4149 ] . on the other hand , seroprevalence of hcv antibodies has been variously reported as 4% , 16.3% , 4.8% , 2.2% , 3.3% , 16% and 11.3% , respectively [ 46 , 47 , 49 , 5053 ] ( table 5 ) . available data indicates that hbv has been classified into eight genotypes ( a -h ) , according to the criterion of 8% differences in the complete nucleotide sequence of the viral genome [ 54 , 55 , 56 , 57 ] . in addition to the epidemiological importance , these genotypes may influence the disease pattern and response to treatment , and so it is important to identify the virus genotype . in our study we selected subjects who were apparently healthy and fit our basic inclusion criteria based on age , weight , body temperature , pulse rate , blood pressure and previous clinical history . for that reason , almost all participants had normal hematological biochemical values ( table 2 ) . noteworthy , however , is that 10 hbsag - positive volunteers had elevated levels of ast ( > 31 u / l ) , and 13 volunteers who were positive for hcv antibodies had elevated alkaline phosphatase level ( > 270 the prevalence rate of hbsag we observed among apparently healthy women ( 4.5% ) is close to previously reported rates [ 43 , 45 , 4766 ] . prevalence of hcv antibodies ( 5.2% ) is also similar to rates previously reported in healthy individuals [ 39 , 46 , 47 ] . genotyping results showed that all hbv - positive individuals had genotype d , either alone or in a mixed infection ( table 3 ) . in hcv - positive individuals , genotype 3a was the most common ( 51.44% ) , followed by 3b ( 15.87% ) ( table 4 ) . over 350 reports , papers and presentations estimate the combined prevalence of hepatitis b and c in various parts of pakistan at 8 - 10% . a substantial decline in hepatitis b has been observed due to mass scale immunization program started with government support against hbv infection . however , the prevalence of hepatitis c has risen due to improper screening of blood , unavailability of vaccine and other modes of transmission . due to the high cost of treatment of hepatitis b and c virus infection and the unavailability of a vaccine against hcv here comes the importance of identifying the genotype of the virus infecting a person , which is not a common practice in pakistan . mostly treatment is given without knowing the genotype , which may result in no response or emergence of mutant strains of the virus . in pakistan there is an urgent need to raise public awareness , which can be accomplished through programs in schools , colleges , and universities , and through information media about the value of immunization and preventive measures . infected women can spread infection among their family members , especially infections such as hbv and hcv . their health and education in health related issues could have a broad impact on the overall health status of the country . besides awareness programs and improved treatment strategies , we also need to evaluate the available hbv vaccines in the market for their proper storage , their efficacy , side effects and immunogenicity . genotype d was the predominant type of hbv ( 100% ) , and types 3a ( 51.44% ) and 3b ( 15.86% ) were the predominant types of hcv among the apparently healthy women participating in this study . attempts should be made to reduce the incidence of hcv and hbv and their unregulated spread . we also need to have similar studies at a national level to determine the overall prevalence and incidence of hepatitis infections in pakistan . | introductionalthough the prevalence of hepatitis virus infections in pakistan is still unknown , limited data indicate that the exposure rate to hbv is 35 - 38% with 4% being carriers and 32% having anti - hbv surface antibodies through natural conversion [ 1 , 2 , 3 ] . studies in pakistan have shown that the prevalence rate of hcv is 4.8 - 14% for , and that it is continuously increasing .
hence there is an urgent need to create awareness about the prevalence of both hepatitis b and c , and to develop preventive measures aimed at minimizing the prevalence of these diseases in the country.study designprospective , descriptive study .
the study took place from march 2002 till october 2006 at two university campuses in karachi.materials and methodsa total of 4000 healthy female students were screened for hbs ag , anti - hbs antibodies and anti - hcv antibodies by rapid immunochromatography , elisa and pcr.resultsa total of 3820 volunteers ( 95.5% ) were negative by all three methods , 181 ( 4.5% ) tested positive for hb surface antigen and 20 ( 0.5% ) were positive for anti hb surface antibodies ; 208 volunteers ( 5.2% ) were positive for hcv .
double infection with hbv and hcv was found in only one patient ( 0.025% ) .
out of 180 hbs antigen positive samples 151 ( 83.89% ) were genotype d , 28 ( 15.56% ) showed mixed infection with genotypes b and d , and one patient ( 0.56% ) showed mixed infection with genotypes c and d. out of 208 samples positive for hcv antibodies , 107 ( 51.44% ) were genotype 3a , 50 ( 24.04% ) were mix of genotype 3a and 3b , 33 ( 15.87% ) were genotype 3b , 10 ( 4.81% ) were genotype 1b while , 8 ( 3.84% ) samples could not be typed.conclusionalthough the presence of these pathogenic viruses was not very high in our young healthy female population , it is still a matter of concern to control the unregulated spread of these deadly infections by promoting increased awareness and regular immunization programs in the community .
local manufacturing of vaccines and related products may reduce these infections . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
two decades ago intensive care units ( icu 's ) were found only in a few large u.s today , almost every american hospital with more than 200 beds has an icu . in 1979 this nation 's 55,000 icu beds accounted for 5 percent of all acute care beds and 15 percent of all hospital expenditures ( knaus and thibault , 1981 ) . each year the number of icu beds continues to increase by 4 percent , with the largest growth taking place in community hospitals ( american hospital association , 1980 ) . to some observers icu 's are examples of physicians ' enthusiasm for new medical technology combined with an increased number of complex surgical procedures which depend on intense postoperative care . a similar view holds that the demand for icu 's stems from the increased age of our population and our progressively more aggressive approach to serve illness ( russell , 1979 ) . recently , attention has been directed toward the monitoring or close observation function of icu 's highlighted by the decline in the percentage of coronary care unit admissions who actually have heart attacks , and , for surgical icu 's the high percentage of postoperative monitoring ( thibault , mulley , et al . , 1980 ; knaus , wagner , et al . , 1981 ) . these tentative observations and the issues raised by them are important . as the number and cost of icu 's increase , state and local planning recent evidence suggests that restrictions on regular hospital beds by certificate of need regulations may have led to some of the increases in icu beds ( salkever and bice , 1976 ) . but icu beds are costly , with charges approximately three times the cost of regular hospital care and , under current reimbursement procedures , incentives exist to keep icu occupancy rates high . this case study describes the patient mix of two icu 's using a new severity of illness measurement technique . this new index would be useful in examining reimbursement issues and regional distribution of icu beds by providing a way to study use in existing units . intensive care refers to two distinct clinical activities : coronary care units ( ccu 's ) , and general medical - surgical or multi - disciplinary icu 's . the latter are commonly called micu 's ( medical intensive care units ) , sicu 's ( surgical intensive care units ) or simply icu 's . ccu 's contain a narrow range of diagnoses , mainly patients with suspected or actual heart attacks and those with related cardiac problems . ccu patients are generally not as critically ill as icu patients , although individual admissions can be similar . the therapeutic services provided within a ccu are fewer than those available in a multi - disciplinary icu , and these services emphasize diagnosis , particularly confirmation of acute myocardial infarction , which is not found in icu 's . most multi - disciplinary icu 's treat patients with a wide variety of diagnoses . in a medical icu there are patients recovering from acute drug overdoses , or suffering from respiratory failure , gastrointestinal bleeding or diabetic coma . a surgical icu treats patients recovering from open heart surgery , neurosurgery and other major operations . we collected information on 223 consecutive admissions to the medical and surgical icu 's of a community hospital and compared them with 613 consecutive icu admissions at the george washington university medical center reported in knaus , zimmerman , et al . the george washington university medical center ( the uh ) is a 500-bed medical school affiliated teaching hospital within a large metropolitan area . gw 's icu is a 16-bed medical - surgical unit admitting patients with a wide range of diagnoses , ( except acute myocardial infarctions and burns ) . usually this review is informal , becoming intense only during occasional periods of peak use . during the eight - month study period ( april - november 1979 ) only 23 admissions were denied or delayed , primarily because of a shortage of icu nurses . the community hospital ( ch ) used in this study is a 300 bed facility with a limited teaching service . it is located in a suburb of a large metropolitan area in a mid - atlantic state . it has a 10-bed medical icu and a 10-bed surgical icu , for a total of 20 medical - surgical icu beds . as with the uh , suspected or acute myocardial infarction patients are admitted to a separate ccu . both the ch micu and sicu have part - time directors , but they do not routinely review admissions . no patient whose admission had been requested by his attending physician was denied icu treatment during the ch study period ( april - july 1980 ) . with the exception of the full - time versus part - time directors , . both can do pulmonary artery or right heart catheterization ( swan - ganz ) at the bedside , both use ventilators to treat respiratory failure , and both have similar nurse - to - patient ratios which vary from 1:1 to 1:3 . in both hospitals information collected consisted of diagnosis , sex , age , race , and the specific indication for icu admission . in addition , we recorded the patient 's prior health status , a physiologic score measuring the severity of acute illness , and the type and amount of therapy received during the initial 24 hours of the patient 's icu stay . the therapeutic intervention scoring system ( tiss ) was used to measure therapeutic effort ( cullen , et al . , 1974 ) . the tiss system assigns a score of 1 to 4 to a listing of 75 therapeutic tasks routinely performed on icu patients . the higher the number of tiss points , the greater the nursing time and effort involved . although the inter - hospital reliability of tiss has never been formally tested , there is a good deal of experience with tiss in other hospital settings ( byrick , et al . , 1980 ) . though variations in tiss points have been associated with hospital outcome for some groups of icu patients , this association is not consistent , and tiss is not a direct measure of severity of illness because it reflects the physician 's therapeutic response only ( cullen , et al . , 1976 ) . because total tiss points reflect only the intensity rather than the actual type of service provided , we reclassified the 75 original tiss tasks into three distinct categories : those tasks which , in the clinical judgment of two authors , ( elizabeth draper , r.n . , and william a. knaus , m.d . ) reflect : 1 . ) active treatment ; 2 . ) active treatment refers to 33 tasks that involve direct therapy using techniques unique to or best performed in an icu , such as maintaining a patient on a ventilator or assisting his heart 's contraction with a balloon pump . icu monitoring includes eight tasks usually requiring either the facilities or personnel of a special care unit but which are observational , as opposed to therapeutic , in nature . the eight monitoring tasks consist of two labor - intensive services , hourly vital signs and neurologic checks , and six other activities requiring technology not normally available on hospital floors , such as ekg monitoring or pulmonary arterial lines . standard floor care refers to those remaining nursing services performed on icu patients but also commonly done in other hospital settings . in this study patients receiving one or more of the 33 active treatment tasks during the initial 24 hours of their icu stay are classified as active treatment patients . monitoring , since all admissions received at least one of the icu monitoring tasks . in a separate study this approach proved useful in identifying neurosurgical admissions who had a low risk of subsequently requiring active treatment during their icu stay ( knaus , draper , et al . , 1981 ) . the reason for an icu admission was designated as failure of , insufficiency of , or monitoring of one or more of the seven major vital organ systems : neurologic , cardiovascular , respiratory , gastrointestinal , renal , hematologic , and metabolic . these seven categories are a more concise description of icu patients because frequently diagnoses ( cancer , infection , trauma ) are not the primary reason for icu admission . it is rather the need for life support or monitoring of one of the seven organ systems that directly leads to icu admission . failure of one of these organ systems is also the major reason icu patients die ( cullen , et al . , 1976 ) . pre - admission health status designation was a system of four patient types or categories . ( see figure 1 ) . after reviewing a patient 's medical record within 24 hours of admission , these categories are designed to obtain a general assessment of the patient 's chronic health status six months prior to icu admission . the categories are directly related to hospital survival with approximately a four - fold increase in probability of death for class d patients when compared to class a patients ( knaus , zimmerman , et al . , 1981 ) . the most important descriptor of the icu case mix is the acute physiology score ( aps ) . it is designed to be a measure of the severity of illness of acutely ill hospitalized patients , regardless of diagnosis or disease state . the aps consists of a weighted sum of each of 34 potential physiologic measurements obtained from the patient 's clinical record within the first 24 to 32 hours of icu admission . a weight ranging from 0 to 4 is assigned for each recorded measurement to reflect how sick the patient is . for example , a heart rate ( pulse ) between 70 and 110 is assigned a weight of 0 , but a heart rate over 180 or under 40 is assigned a weight of 4 . the 34 potential measurements that determine the acute physiology score reflect the degree of derangement of one or more of the body 's seven major vital physiologic systems : neurologic , cardiovascular , respiratory , gastrointestinal , renal , metabolic and hematologic . we developed this list by reviewing the literature for measurements that had demonstrated promise in estimating severity of illness and that were generally tested and recorded in most icu 's . we presented an initial list to a panel of 7 experienced icu physicians from major medical centers around the country . this panel of experts also decided where to divide each physiologic parameter into ranges and what weight to assign to the ranges . we chose the 0 to 4 weighting system to convert the 34 physiologic measurements into a reproducible score that could easily be used in multiple institutions . another important advantage of a simple weighting system is that it closely duplicates the clinical evaluation of a critically ill patient . depending upon the patient 's medical history , the more abnormal each measurement becomes , the more concern or anxiety the clinician has , and by inference , the more severely ill the patient . the weights they assigned particular values reflect the level of anxiety they would feel for a particular patient because of the physiologic measurements . the panel sought internal agreement among individual weights and , as a result not every physiologic measurement has a range of weights from 0 to 4 . the scale does exhaust the sample space , with each possible value of each physiologic measurement represented . when multiple measurements are available , the assigned weight is determined by the value furthest removed from normal , that is , the lowest blood pressure for a patient in shock or the highest respiratory rate for a patient in respiratory distress . clinical judgment is used to insure that the lowest or highest reading is a legitimate value and not a measurement error or some other outlying number . in practice this decision is easily adhered to and minimizes the opportunity for recording error . unmeasured variables are assumed to be unnecessary for the patient 's care in the icu and are considered normal . we selected the initial 24 to 32 hours following icu admission as the time most likely to reflect the greatest degree of abnormality of all potential measurements . this time period also helps insure that all pertinent laboratory values will have been determined and returned to the patient 's record . in appendix a , we provide further information on the statistical validation of the aps . within the mid - range of the aps ( 15 - 20 ) there is approximately a 2 percent increase in the probability of hospital death with each one point increase in physiology score . they developed objective operational definitions of many of the data items on a pilot data set . table 1 compares the uh and ch populations in terms of general characteristics such as origin of admission . demographically , the two hospitals were similar except the uh icu admits more black patients . a greater percentage of ch patients are medicare beneficiaries over the age of 65 . the indications for admission ( table 2 ) , arranged according to organ system , show that the largest differences are in the surgical patients , with a greater percentage of neurologic and cardiovascular surgical patients at the uh . a larger portion of the ch surgical patients was admitted to the icu following gastrointestinal operations , an infrequent indication at the uh . the medical patients were quite similar in their distribution . in figure 1 the distributions of admissions ch admissions tended to be in poor or failing health more often than those in the uh , although the difference was small ( p<.07 ) . we next compared the two populations according to their acute severity of illness and the amount of therapy they received . we did this in three ways : first , we tabulated the average acute physiology and tiss scores across all major organ systems as well as for selected diagnostic groups ( tables 3 and 4 ) ; second , we determined the frequency distribution of physiology and tiss scores for both populations ( figure 2 ) ; and third , we classified the two populations according to whether or not they required active treatment or monitoring during their initial 24 hours of icu care . these results showed that for most indications for admission and for most of the narrower , diagnostic categories analyzed , acute physiology scores were generally two to three times higher at the uh ( figure 2 , tables 3 and 4 ) . analysis of the aps in the uh revealed a nonlinear relationship between the score and the probability of death ( appendix figure a-1 ) . applying this relationship to ch admissions implies that , on admission , uh icu admissions were almost two times as likely to die during their hospitalization as ch patients . the actual in - hospital death rate was 19 percent for uh patients and 11 percent for the ch . in addition to significant differences in severity of illness and projected and observed death rates , there were also differences in the therapy received . this was especially true with ch surgical admissions who received significantly fewer tiss points ( p<.001 ) . likewise , 86 percent of the ch surgical patients received only monitoring or routine floor care during their initial 24 hours in the icu , compared to 48 percent of the uh surgical patients . less difference in tiss scores occurred between medical admissions despite the fact the medical patients had significantly higher physiology scores at the uh . there was also little difference in the percentage of monitoring admissions of medical patients ( ch , 42 percent ; uh , 44 percent ) . for both medical and surgical admissions , however , we found that the ch patients more often received one of the two labor - intensive , as opposed to six technology - intensive , monitoring tasks . the ch icu admitted an equal percentage of post - operative patients , but they were more frequently admitted following routine surgical procedures , such as gastrointestinal operations , than were uh patients . for both medical and surgical patients , there were substantial differences in acute severity of illness . the aps 's were consistently higher in the uh across all classes of patients ( table 3 ) . even when categories were narrowed to more homogeneous diagnostic categories , we found that ch patients were less severely ill than uh patients ( table 4 ) . one might speculate that the difference in severity of illness between the two patient groups is due entirely to the larger number of patients in failing health at the ch . however , the aps is designed to capture both the chronically abnormal physiology reading in failing health patients who are frequently monitored for potential problems and the acute derangement in the chronically ill patients who require active treatment . furthermore , the increased number of ch admissions with serious chronic health problems is very small in comparison to the marked disparity in acute physiology scores between the two institutions . we infer from this difference in severity of illness that the threshold for icu admission , both medical and surgical , is lower in the ch than in the uh . this conclusion is supported when we examine the differences in treatment that the two icu 's provide . the overall difference in total tiss points and their distribution between the uh and ch is most prominent for surgical admission . one reason for this difference is that admission to both icu 's results in a minimum of 8 to 12 tiss points regardless of severity of illness . when we examine the type of treatment provided , however , we find that 86 percent of the ch surgical patients received only monitoring or routine floor care during their first 24 hours , compared to 48 percent of uh surgical admissions . these figures do not necessarily imply that the ch monitored patients should not have been admitted for monitoring ; more extensive analysis would be required to determine whether the risks and costs of icu treatment justify the expected benefits . furthermore , though severity of illness and therapy differed , the similarity between projected and actual death rates strongly suggests that the ch achieved quality of care comparable to that of the uh . it could be argued that these different icu populations simply reflect differences in the two hospitals ' primary roles . the uh is a tertiary center aimed at providing sophisticated surgical , diagnostic , and treatment services ; the other is a community facility oriented toward more routine hospital care . yet the icu 's in both institutions have similar diagnostic and treatment equipment , and they both have equivalent nurse - to - patient ratios . in fact , with the exception of three full - time physician directors at the uh ( as opposed to two part - time directors at the ch ) , the units ' technical and personnel capabilities were equivalent . at the ch , only one of the 223 ch patients used the pulmonary artery catheterization capabilities , compared to 25 percent of the uh population . only 12 percent of ch patients received ventilatory treatment , compared to 50 percent at the uh . this usage probably occurred because , of the 223 ch patients studied , we could identify only 11 patients ( 5 percent ) whose physiology score was within the range of what is clinically considered an unstable , critically ill patient ( physiology score > 20 ) . this figure compares to 135 uh admissions ( 22 percent ) ( figure 2 ) . these findings are compatible with recent surveys emphasizing the number of stable , noncritically ill patients admitted to a university icu ( thibault , et al . , 1980 ) . although the results of this survey are limited and can not be extrapolated nationwide , they support claims that the demand for more icu beds is due to many factors . within the uh , patients who had complicated surgery were frequent admissions ; and within both hospitals elderly patients , many with chronic medical problems , contributed to demand . the survey 's results also support the suggestion made by russell ( 1979 ) , however , that the primary factor behind icu growth may be that the medical staff is seeking the latest in monitoring and treatment technology . although the vast majority of icu admissions at the ch did not receive active treatment , there was a substantial investment in such equipment at the ch . these facts raise several questions , such as : is this the best use of health care funds ? since so few critically ill patients are treated at the ch , much of the equipment and personnel are under - used . moreover , in light of recent studies that have shown outcome from complex procedures varying directly with the number performed , ( luft , bunker and enthoven , 1979 ; luft , 1980 ) should an icu treat a minimum number of critically ill patients in order to maintain its competence ? these findings also raise questions about health planning . american hospital association statistics show that the number of icu beds nationwide continues to grow each year and that the largest growth is in community hospitals . are these new beds , as suggested by this case study , monitoring stable , older , chronically , but not critically , ill patients . if so , then efforts to restrict the growth of icu beds could proceed without fear that such moves would limit access for critically ill patients . perhaps , considering current nursing staffing patterns and third party payment for semi - private rooms , concentrating high - risk patients in an icu setting is the most efficient way of providing adequate nursing care . if this is true , however , future icu 's might be designed without the technological support that was largely unused in the ch . , it is estimated that it costs $ 44,000 to $ 75,000 to build or convert an icu bed ( u.s . also once a patient is in an icu his use of ancillary services increases ( griner , 1972 ) . the distribution of tiss points in this study suggests that almost all icu admissions receive a minimum amount of therapy which is higher than they would receive elsewhere , regardless of severity of illness . but , in order to improve icu use , we may need to measure severity of illness when we examine diagnostic case mix . in this comparison , we were able to consistently discover substantial differences between uh and ch admissions only because we could measure their underlying severity of illness . if we were to rely on more traditional descriptions such as age , sex , or h - icda ( international classification of diseases , adapted for hospitals ) diagnostic codes , utilization differences would not have been as apparent , particularly with the medical patients . likewise , an etreatment received , as measured by tiss points alone , would tion of overall not have disclosed the substantial variations in case - mix or their severity of illness . the difference in the type of operative procedures in the two hospitals suggested a greater intensity of services at the uh . the larger icu death rate at the uh could have been interpreted as a reflection of increased severity . neither of these descriptors , however , can be used in isolation . a variation in procedure codes does not necessarily imply any variation in severity of illness , and the lower death rate could have meant that treatment was better at the ch . only by quantifying the underlying severity of illness we believe collection of similar severity of illness data at a number of icu 's nationwide would provide valuable unique insights into how the growing number of icu beds are being used and how their use might be improved in the future . there are several reasons to be optimistic about the results of such an external validation using the aps . first , the measure is simple , being based on objective numbers which can be easily and reliably recorded . second , aps is relatively immune to manipulation . over - measurement of the physiologic variables will not lead to higher aps scores unless the patient has deranged physiologic values . under - measurement could lead to lower scores , but this is also likely to result in lower therapy and worse than expected outcome . third , the strength and stability of the aps coefficients in the estimated appendix equations are very promising . the explanatory power of the aps in these equations , while insufficient for clinical decision - making , is strong enough to yield relatively narrow predicted confidence bands for groups of patients . this use of the aps would make possible the analysis of such critical issues as quality of patient care and resource use . the initial question to ask about a new index number is how is it distributed ? the upper left panel of figure 2 tabulates the frequency distribution of the aps for 613 consecutive admissions to the uh icu . although a patient could theoretically score over 100 aps points , in practice the highest score was 54 . we tested the validity and sensitivity of the aps by examining how well it predicts two subsequent events in each admission 's hospital stay : 1 ) intensity of therapeutic effort in the icu , and 2 ) whether the patient was discharged alive or dead . while neither of these is a perfect test of validity , both do capture important consequences of acute illness . therapeutic intervention scoring system ( tiss ) points are the most widely used index of therapeutic effort in icu 's , and they are a reasonable measure of the resource cost of treating an icu patient . tiss points directly measure a substantial portion of the labor input in producing intensive care services and are a good proxy for other resources used in icus . hospital survival is a particularly appropriate outcome measure for icu 's because of the relatively high probability of death . future efforts will examine the relationship between the aps and chronic disability six months post - hospital discharge . table a-1 reports simple and multiple regression analyses of two different measures of tiss points . the first two equations ( first day tiss ) use the aps to explain concurrent therapeutic effort during the first 24 hours of icu care . the second two equations ( four day tiss ) explain variations in therapeutic effort accumulated over up to the first 4 days of icu care . for patients who were discharged before the 4 days elapsed , this method measured total therapy in the unit . we truncated the remaining 20 percent at 4 days because that length of time represents a reasonable amount of time to capture the therapeutic response to the severity of illness measured during the first icu day . examination of the first two columns ( first day tiss ) of table a-1 reveals that concurrent therapeutic effort has a highly significant relationship with the aps . the most important result from the second column is that the coefficient on aps is virtually unchanged by the introduction of 17 other independent variables into the equation , 9 of which are highly significant and raise the overall explanatory power from an r2 of .29 to .52 . the diagnostic groupings confirm that patients admitted to icu primarily for cardiovascular , respiratory or gastrointestinal reasons receive more therapeutic effort in their initial day than do neurologic patients , the reference group . the substantial intercept conforms with expectations , because standard operating procedures insure that an icu patient receives a minimum of 10 to 15 tiss points per day , or one - third of a nurse 's time . the second two equations in table a-1 replicate the first two , though , as one would expect , the explanatory power is decreased because of the longer time period of subsequent therapy captured by the dependent variable . the difference in magnitude between the first two columns and the second pair of columns reflects scale differences in the measurement of the dependent variable . again the strong significance and stability of the aps coefficient between the two equations is of particular importance . this stability implies that though patient age , chronic health status , surgical status , and diagnostic data influence subsequent therapeutic effort in an icu , they do not bias the influence of the aps . this nonlinear regression technique is chosen as an appropriate statistical technique because the dependent variable is dichotomous ( tobin , 1958 , pindyck and rubinfeld , 1976 ) . an alternate regression technique for dichotomous dependent variables , logistic regression , produces virtually identical results to those reported here . one important implication of using probit or logistic regression is that the functional form of the relationship between the independent and dependent variables is assumed to be bell - shaped , as opposed to the constant partial derivative assumed in ordinary least squares regression . the interesting and important results in table a-2 are that the regression coefficient on the aps is highly significant and quite stable in the two equations . the magnitude of the coefficients implies that in the vicinity of the sample mean , an extra point of the aps is associated with a 2 percent increase in the probability of death . a more detailed description of the nonlinear relationship between probability of death and the aps is plotted in figure a-1 . the solid line in figure a-1 represents the estimated relationship between the aps and the probability of in - hospital death , controlling for the impact of age , sex , smoking and drinking history , pre - admission health status , operative status , and principal reason for intensive care . the dotted line represents a simpler statistic , a moving average of the death rate for these icu admissions . the latter is an assumption - free relationship , but it does not control for the possible confounding influence of other variables . for both curves , the slope at any point represents the marginal probability of death per extra aps point . table a-3 summarizes the explanatory power of the second equation in table a-2 by comparing predicted outcomes with actual outcomes . another statistical test of the robustness of the aps as a severity of illness score relates to the sensitivity of the score to diagnostic case mix . we have not used principal discharge diagnosis as an independent variable , principally because this group of 613 admissions has 209 different principal diagnoses at the 3-digit level . within each of the seven indications for admission table a-4 reports probit multiple regression equations for 4 of these mutually exclusive but non - exhaustive subgroups of the uh admissions . the results document that the aps is significant within each of the indications for admission as well as across all admissions . in addition , the magnitude of the coefficients is reasonably similar in each of the four equations , particularly given the small sample sizes and small number of deaths in 3 of the 4 groups . one simple question would be what happens to the aps coefficient in the mortality equation when tiss is introduced as an independent variable ? elsewhere we have reported that the predictive power of the aps is essentially unchanged , but the predictive power of total tiss points is changed substantially ( scheffler , et al . , 1981 ) . a final question relates to the amount of time elapsing between the measurement of the aps and the death of a patient . it would be possible to obtain excellent predictive power in an equation merely by measuring physiological parameters shortly before death . however , the data analyzed here excludes values measured shortly before death and most deaths occurred substantially after the measurement of the aps . elsewhere we reported essentially identioal results on a subset of 582 of the 613 admissions reported here ( knaus , et al . , 1981 ) . the difference in samples is that the subset of 582 admissions excluded all patients who were discharged from the icu for any reason during their first two shifts in the unit . the exclusion of those 31 patients , about half of whom died , improved the explanatory power of both the tiss and death equations . we believe the improvement occurs because a few of the patients who were discharged quickly from the icu were not in the icu long enough to receive much therapy or have a reasonably full set of physiological parameters measured . in summary , this appendix demonstrates that the aps is a strong and consistent predictor of two subsequent events mortality and total therapeutic effort in the icu in 613 patients in one university hospital . the magnitude of the relationship appears to be insensitive to diagnostic mix , though more thorough testing of this phenomenon awaits a larger data base . before this index could be used for reimbursement , planning , or evaluation purposes it should be externally validated with a multi - institutional data base . this validation is necessary since any index related to outcome should not be the result of one institution 's experience but should be validated against a group of reference hospitals chosen because of their high quality of care . | we compared 223 consecutive intensive care unit ( icu ) admissions to a community hospital ( ch ) with 613 such admissions at a university hospital ( uh ) using a new clinical scale aimed at quantifying severity of illness.both icu 's had similar technical resources and treatment capabilities . at the ch , however ,
patients were more often admitted for monitoring rather than for treatment of uh admissions had a substantially greater acute severity of illness ( p<.001 ) than ch patients in most diagnostic categories.these findings suggest that use of the icu was substantially different in the two hospitals , with the ch admitting many more stable patients .
this study also suggests that evaluation of icu use is improved by quantitative measurement of severity of illness . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is the third leading cause of death in the world [ 1 - 3 ] . cancer can develop in almost any organ or tissue such as lung , colon , breast , skin , bone , or nerve tissue [ 4 - 7 ] . the annual prevalence of hodgkin 's lymphoma is about 1 in 25,000 people and the disease accounts for slightly less than 1% of all cancers worldwide . hodgkin 's lymphoma ( hl ) is characterized by a minority of abnormal b lymphocyte cells , the hodgkin and reed - sternberg cells ( hrs cells ) , and a general inflammatory background [ 9 , 10 ] . from ancient times , plants have been considered not only as sources of food , but also as treatments or remedies for many types of diseases . it has been pointed out in many different texts that there are unidentified properties in different parts of plants that can be used as treatments for certain diseases [ 11 - 13 ] . in the mint family , for instance , there is a branch which is called lavender ( of the genus lavandula officinalis ) which has clusters of small purplish flowers and yield soil used in perfumery . there are different species of lavenderas part of flowering plants around the world which belong to the lamiaceae family . this genus consists of annuals , herbaceous plants , sub - shrubs , and small shrubs [ 14 , 15 ] . in addition , lavender yields highly effective essential oil with very sweet overtones which can be used in balms , salves , perfume , cosmetics , and topical applications . in alternative medicine , lavender extraction is believed to be useful in easing or relieving the symptoms of stress , anxiety , exhaustion , irritability , headaches , migraines , insomnia , depression , colds , indigestion , flatulence , upset stomach , liver and gallbladder problems , nervousness and loss of appetite as well as being used as a breath freshener and mouthwash [ 14 - 21 ] . fragrance compounds and essential oils , such as lavender oil ( lavandula angustifolia ) , have a long - standing history as a medical remedy . there has been increasing interest in perillyl alcohol , a monoterpene found in trace amounts in l. angustifolia , owing to its chemo - preventative and chemotherapeutic properties [ 24 , 25 ] . many studies have shown the ability of chemo - preventive phytochemicals to increase the sensitivity of cancer cells to conventional anticancer drugs . it has been reported that antioxidant properties of lavender x intermedia are owing to the phenolic component such as rosmarinic acid ( ra ) of the plant . currently , perillyl alcohol , a component of the essential oil derived from lavender , is one of the most important metabolites of d - limonene . perillyl alcohol is considered a chemo - preventative and chemotherapeutic agent . in view of the fact that the antigrowth activity of aqueous extract of lavender angustifolia has not yet been evaluated on primary cells , the present study focuses on the anti - cytotoxicity properties of this aqueous extract on in vitro samples of hodgkin 's tumor which were collected from patients in comparison with two different cell lines . lavender extraction and preparation
lavandula angustifolia was provided by the herbarium of shahid beheshti university of medical sciences , tehran , iran . to prepare the extraction , 250 gr of lavender flowers were dried and then mixed with 1000 ml boiling water . in the next step , the plant specimen was determined by the pharmaceutics faculty of the university , where voucher specimens ( 1092 ) are kept . pelvic bone marrow samples were aspirated from patients in stage iii and iv of hodgkin 's lymphoma , the majority of which was provided for diagnostic tests by the bmt laboratory in taleghani hospital , tehran . samples were kept in heparin tubes ( anticoagulant ) and diluted with a ratio of 1 to 2 sterile phosphate buffered saline ( pbs ) , followed by ficoll with a ratio of 1 to 2 and with density gradient method peripheral blood mononuclear cells ( pbmc ) . cells were removed from the buffy coat and then transferred to a 15-cc tube and the same volume of sterile pbs was added and centrifuged at 4c and 1400 rpm for 10 minutes . finally , pellet was suspended in 0.5 cc rpmi1640 and then another 5 - 6 cc of rpmi1640 with fbs was added . sw742 and mkn45 carcinoma cells and lymphocytes of hodgkin 's lymphoma patients were cultured in rpmi 1640 supplemented with 10% fetal calf serum , 100u / ml penicillin , and 100 g / ml streptomycin . they were incubated at 37c in a humidified co2 incubator with 5% co2 and 95% air . an inverted microscope ( celti ) was used for comparing the cell morphology and pattern of cell spread in the presence of and in the absence of the extract . an inverted microscope ( celti ) was used to compare the cell morphology and pattern of cell distribution in various dosages of the extract . antioxidant activity of lavender aqueous extract : to evaluate the cytotoxic effects of lavender aqueous extract on cell lines and lymphocytes of hodgkin 's lymphoma patients , 3-(4 , 5-dimethyl-2-thiazolyl)-2 , 5-diphenyl-2h - tetrazolium bromide ( mtt ) colorimetric assay was applied . etoposide phosphate , an anti - cancer ( antineoplastic or cytotoxic ) chemotherapy drug , was used as a control sample . briefly , cells were seeded into 96-well culture plates with 10,000 cells in each well with 200 l medium . the medium was removed 48 hours after plating and fresh media containing different concentrations of lavender aqueous extract were added . after incubation for one hour , the medium was discarded , the cells were washed twice with phosphate - buffered saline and 50 g / ml mtt solution for 4 hours and formazan crystals dissolved by adding 100 g dimethyl sulfoxide ( dmso ) to each well . the absorptions were measured in triplicate at 570 nm , with a background correction at 630 nm , using a microplate reader . a solution without lavender aqueous the inhibition percentage was calculated as following : inhibition % = [ ( a0-a1)/ a0 ] 100 where a0 is the test sample or aqueous extract optical density ( od ) , and a1 is the absorption of the blank ( od ) at 570 nm .
flow cytometry analysis
for flow cytometry purposes , cell lines and lymphocytes of hodgkin 's lymphoma samples were cultured in 6-well plates at a density of 1106 cells both in the presence and in the absence of the cytotoxic agents for 48 hours . all suspended and adherent cells were harvested and centrifuged at 200 g for 10 minutes . cell pellet was washed with 1x phosphate buffer saline solution and centrifuged at 200 g for 10 minutes . the cell pellet was then re - suspended in 100 l of annexin v / fluos labeling solution ( predilute20 l annexin v / fluos labeling reagent in 1 ml incubation buffer and added 20 l propidium iodide solution ) , and incubated at 15 - 25c for 10 - 15 minutes . the samples were assayed by flow cytometer ( usa ) using 488 nm excitation and a 515 nm band pass filter for fluorescein detection and a filter > 600 nm for propidium iodide detection . mean difference among groups was calculated by one - way and two - way variance analyses and p < 0.001 was considered statistically significant . microscopic evaluations were used to determine morphological changes in hodgkin 's lymphoma cells ( figures 1 and 2 ) . a : this figure shows the modus of lymphocyte division . b : lymphocytes are seen cumulatively abnormal while dividing ( original magnification , 200 ) . reed - sternberg cells , which are specific to hodgkin s lymphoma disease , are clearly seen with two or three nuclei and are larger than normal lymphocyte cells . viability determination of different cell lines ( sw742 , mkn45 and hodgkin 's lymphoma patient 's sample ) in the presence of various dosages of lavender extract after 48 hours have been investigated by mtt assay ( figures 3 , 4 and 5 ) . living cells or annexin- v / fluos ( - ) /pi ( - ) ( ll ) are seen in the lower left quadrant . cells that are annexin v / fluos ( + ) /pi ( - ) ( lr ) are apoptotic ( lower right ) . the cell population with annexin v / fluos ( + ) /pi ( + ) ( ur ) has been described as necrotic or advanced apoptotic ( upper right ) and annexin v / fluos ( -)/pi ( + ) ( ul ) may be bare nuclei cells in late necrosis , or cellular debris ( upper left ) ( figure 6 ) . hodgkin 's lymphoma is one of the main life - threatening disorders throughout the world . since herbal remedies have been shown promising in cancer studies , lavender extract was used to determine the possible cytotoxic effects on hodgkin 's lymphoma . the microscopic technique was used for the evaluation of hodgkin 's lymphoma cell characterization and morphology ( figures 1 and 2 ) . as shown in figures 1 and 2 , hodgkin 's lymphoma cells contain two or more nuclei and exhibit abnormal cell growth and cell division . reed - sternberg cells are abnormal cells that are typical in hodgkin 's disease ; they exist in the cultured cells of the patients . this evidence indicates that the samples correspond to the diagnostic process referring to hodgkin 's lymphoma . as depicted in figure 2 , accumulative cells refer to hodgkin 's lymphoma , providing a real cell line of this disease which can be analyzed by the present study . a viability test is used for determining cytotoxic effects of the treatment on cells . since some studies suggest that a 200 g / ml of this extract can be effective as an alzheimer 's disease preventive remedy , evaluating other potential properties of the lavender aqueous extract is essential ; therefore , in this assessment a range of 30 to 100 g / ml of the extract was applied and tested on two different sources including : first , two cancerous cell lines ( mkn45 and sw742 ) and the second , a hodgkin 's lymphoma cell line derived from the patients ' blood samples . figures 3 and 4 show the viability of the two cell lines mkn45 and sw742 in the presence of various concentrations of lavender aqueous extract . the findings indicate that the sw742 cell line is sensitive to extract , so the viability in the presence of a 30 g / ml concentration of the extract and also higher concentrations is strongly inhibited in a steady trend . in all the applied dosages of the extract on the sw742 cell line viability were shown equally , the applied range of extract treatment in the mkn45 cell line viability test was altered to a lower degree . the viability study as illustrated in figure 4 for mkn45 cell line shows that the anti - cell proliferation properties of the extract began at a 1 g / ml dose . it should be mentioned that these findings ( data in figure 4 ) had been reported in a previously published study by our group . the cells from different sources have different growth and death rates when exposed to the extract . comparing figures 3 and 4 clearly indicates that very low dosages relative to the therapeutic dosage of extract show potent anticancer properties ; therefore , aqueous lavender extract can be considered as an effective antitumor drug . it was expected that the primary cell line study would confirm the in vitro assessment . in many cases , however , these two processes exhibited dissimilar results . here , the derived lymphoid cell line from hodgkin 's patients was a candidate for treatment by the extract ( figure 5 ) . the data in figure 5 clearly shows that cell resistance to the extract is remarkable at high dosage ; in fact , only 100 g / ml inhibits cell survival effectively . there are two interpretations for this occurrence ; firstly , the patient - derived cells are more complex and contain a compensative mechanism for response to cytotoxic effects of lavender . secondly , this cell line is primarily comparable to sw742 and mkn45 cell lines ; more passages in this cell line influence its ability and behavior . on the other hand , the effective concentration of lavender that decreases viability below lc50 value is 100g / ml , and this dosage is half the therapeutic dose . filtered and non - filtered forms of extract were applied in the present study as long as filtration could help to stimulate the dimension of the effective factors of extract . as is shown in figure 5 , however , therefore , the use of filtered forms of extract did little to influence its efficacy . flow cytometry is the technique used to study the mechanism of cell death during exposure to chemical agents . in this study flow cytometry was applied to confirm mtt assay results , and also for appraising the cell death mechanism in hodgkin 's lymphoma samples being treated with aqueous extract of lavender . the dosages of 100g / mland 50g / ml ( as a lower dosage ) of non - filtered extract were chosen for flow cytometry purposes . harvested cells were incubated with the extract for 48 hours and then stained with annexin v / fluos ( fl - i ) and propidium iodide ( pi , fl-2 ) , and finally analyzed by the flow cytometry method ( figure 6 ) . according to figure 6 it can be inferred that survival rate in concentration of 100 g / mlis lower than that in 50 g / ml , which verifies previous results obtained from mtt assays . on the other hand , a major portion of the cells that are annexin v / flous ( + ) /pi ( - ) [ lr ] are to be found in the lower right part of figure 6 . the calculated percentages of apoptotic and necrotic cells following treatment of hodgkin 's lymphoma cells with non - filtered extract indicate that most of the cells underwent apoptosis . in the presence of the 50 g / ml dosage of extract , apoptosis is the main mechanism , whereas in 100 g / mlof the concentration , 3.14% of the cell death population is related to a late apoptosis mechanism . in summary , flow cytometry findings reveal that apoptosis is the main mechanism by which the aqueous extract of lavender brings about hodgkin 's lymphoma cell death . it can be concluded that lavender aqueous extract ( lavandula angustifolia ) can be a potential candidate for more investigations in the field of cancer treatment . thus , in vivo studies are vital in order to identify and confirm the exact cytotoxic effect of this extract . moreover , identifying the effective agent of this extract is necessary for achieving the most successful results . it can be concluded that lavender aqueous extract ( lavandula angustifolia ) can be a potential candidate for more investigations in the field of cancer treatment . thus , in vivo studies are vital in order to identify and confirm the exact cytotoxic effect of this extract . moreover , identifying the effective agent of this extract is necessary for achieving the most successful results . | backgroundthere are several types of cancer , which cause millions of deaths worldwide every year .
many studies have confirmed that plants are adequate natural sources to be examined as anti - cancer drugs with fewer side effects than chemotherapy and radiotherapy . in this
study the anti - cancer properties of lavender aqueous extract on lymphocytes derived from patients with hodgkin 's lymphoma has been studied.methodsin order to determine the cytotoxic effects of the extract on lymphocytes of patients in stages iii and iv of hodgkin 's lymphoma and two different cell lines in the presence of different concentrations of aqueous extract of lavender , mtt colorimetric assay and flow cytometry analysis were used.resultsfindings indicated that lavender inhibited cell proliferation in both lymphocytes and cell lines with different effects .
the effective concentration of lavender that decreased viability of hodgkin 's lymphoma cells below lethal concentration 50 ( lc50 ) value was 100 g / ml and this was half of the therapeutic dose .
in addition , apoptosis was the main mechanism the hodgkin 's lymphoma cell encountered when exposed to the aqueous extract of lavender.conclusionthis experiment proposes that aqueous lavender extract can be regarded as a potential anti - cancer agent in future studies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the portability of a handheld dynamometer ( hhd ) is excellent , and its clinical application
for measurements is simple . the relative intra - class and inter - class reliabilities of an hhd
are 0.840.991 and 0.840.942 , respectively . conventionally , the sensor
unit of an hhd is fixed during the measurement of muscle strength . although hhds are usually
fixed by examiners using their hands , there are fixed limits for the strength values than
can be accurately measured3 , 4 . considering this , a
previous study reported 30 kgf as the fixed limit of shoulder horizontal adductor muscle
strength measurements using an hhd fixed with the examiner s hand ( hand - fixed hhd ;
hfhhd)10 . although the hfhhd method has
measurement limits , it is simple . therefore , measurements made by the same examiner in
accordance with the fixed limits of the sensor are considered clinically reliable . reported that in the measurement of lower limb muscle strength , the inter - class
reliability was higher when using a belt - fixed hhd ( bfhhd ) than when using the conventional
hfhhd method , even for muscle strength values less than the fixed limits of
measurements6 . however , there have been
no previous studies on the absolute reliability in measurements upper limb muscle strength . this study examined shoulder joint horizontal adduction muscle strength measured using an
hfhhd and bfhhd . the purpose of this study was to examine the absolute reliability of
measurements in the all subjects group as well as a group with less than a fixed limit of
muscle strength . a total of 33 healthy college students ( 20 males and 13 females ; age , 2122 years ; height ,
168.4 7.6 cm ; body weight , 62.4 9.6 kg ) were recruited in this study . the examiner , a
21-year - old college student ( male ; height , 174 cm ; body weight , 63 kg ) , received sufficient
training on measurement techniques before the experiment . measurements of the strength of
the shoulder joint horizontal adductor muscles were made using an hhd . a tas f-1 hhd ( anima corp . , tokyo , japan ) was used . the shoulder joint was abducted to 90 , with 0 internal
rotation and 0 external rotation , and the elbow joint was flexed to 90. the elbow on the
measurement side was positioned on the edge of the examination table . the subject was positioned such that the shoulder
joint position was aligned with the bedpost . for the bfhhd measurements , a belt was inserted
between the bedpost and the floor to fix the hhd . the sensor was placed on a thin rubber pad
on the distal upper arm . the examiner controlled his hand in such a way that he did not move
the sensor of the hhd and suppressed compensatory movements by placing his other hand on the
anterior aspect of the opposite shoulder joint . subjects were asked to perform isometric contractions in a manner similar to the make
test . maximum contractions were attained within 3 s and were maintained for 5 s. the
maximum values of the horizontal adduction muscle strength of the shoulder joint were
recorded . measurements were made
on the same day at intervals of 30 s. repetitions of hfhhd and bfhhd measurements were made
at intervals of 1 week . an assistant recorded the measured values , and the examiner was
blinded to these values . for obtaining representative values from the results obtained , the differences in the
values were measured , along with an analysis of absolute reliability in hfhhd and bfhhd
measurements for both all subjects and the < 30 kgf group . because the fixed limit of the
hfhhd for shoulder horizontal adduction muscle strength measurements was 30 kgf10 , we examined subjects with < 30 kgf
measurement values as a single group . baa was
performed using statistical software ( r2.8.1 ) between the 1st and 2nd measurements as well
as between the maximum value obtained during the 1st and 2nd measurements and the 3rd
measurement . a probability ( p ) value of < 0.05 was considered statistically
significant . the study protocol was approved by the ethics committee of ryotokuji university ( approval
number : 2528 ) and was in accordance with the declaration of helsinki . the mean and standard deviation of the measurements of the shoulder joint horizontal
adduction muscle strength are shown in table
1table 1.subject characteristics and shoulder joint horizontal adduction muscle
strengthall subjects<30 kgf group>30 kgf grouphfhhdbfhhdhfhhdbfhhdhfhhdbfhhdnumber of subjects ( male , female)33 ( 20,13)13 ( 1,12)20 ( 19,1)age ( years)21.8 8.421.5 0.521.9 0.3height ( cm)168.4 0.4161.2 4.3173.0 5.4body weight ( kg)62.4 9.653.8 3.768.0 3.71st ( kgf)21.0 6.232.0 15.214.8 3.716.7 4.925.0 3.741.9 10.62nd ( kgf)21.6 6.831.0 13.114.3 3.917.8 4.726.4 2.839.6 8.73rd ( kgf)20.6 6.830.3 12.313.9 4.217.9 5.424.9 4.138.4 7.8the maximum value obtained during the 1st and 2nd ( kgf)22.3 6.833.6 14.515.0 3.718.9 4.727.0 3.043.1 9.8meansd . hfhhd : conventional method of an examiner manipulating the hhd by hand
( hand - fixed hhd ) . the results of baa and the standard error of measurement ( sem ) are shown in
table 2table 2.bland-altman analysis of shoulder joint horizontal adduction muscle strength
measurementsfixed biasproportional biassem(kgf)loamdc95(kgf)95% cibias*slope of the regression linebias*<30 kgf group ( n=13)hfhhd ( the 1st and 2nd measurements)0.22 to 1.08n - ex0.055 n - ex0.8 0.6 to 1.42.1 hfhhd ( the maximum obtained during the 1st and 2nd measurements and
the 3rd measurrment ) 0.30 to 1.76 exist0.143 n - ex0.9 0.1 to 2.1 2.3 bfhhd ( the 1st and 2nd measurements)3.47 to 1.38n - ex0.051 n - ex2.8 4.7 to 2.67.8 bfhhd ( the maximum obtained during the 1st and 2nd measurements and
the 3rd measurement)0.10 to 2.08n - ex0.142n - ex1.30.7 to 2.63.5bfhhd and hfhhd ( the maximum obtained during the 1st and 2nd
measurements ) 1.83 to 6.10exist0.293 n - ex2.50.7 to 7.26.9all subjects ( n=33)bfhhd ( the 1st and the 2nd measurements)0.82 to 2.99n - ex0.158exist3.76.0 to 8.010.2bfhhd ( the maximum obtained during the 1st and 2nd measurements and
the 3rd measurement)1.62 to 4.87exist0.167exist3.22.9 to 9.49.0hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed
hhd ) ; bfhhd : hhd fixed with a belt ( belt - fixed hhd ) . * presence of bias : exist ,
present ; n - ex : not present . 95% ci : 95% confidence interval ; sem : standard error of
measurement ; loa : limits of agreement ; mdc95 : minimal detectable change in
the 95% confidence interval .. the < 30 kgf hfhhd group had no systematic bias between the 1st and 2nd
measurements , and the sem was 0.8 kgf . a fixed bias was observed between the maximum value
obtained during the 1st and 2nd measurements and the 3rd measurement . the 3rd measurement
was smaller than the maximum value obtained during the 1st and 2nd measurements . the < 30
kgf bfhhd group had no systematic bias between the 1st and 2nd measurements , and the sem was
2.8 kgf . in addition , no systematic bias between the maximum value obtained during the 1st
and 2nd measurements and the 3rd measurement was observed , and the sem was 1.3 kgf . in the
< 30 kgf group , a fixed bias existed between the maximum value obtained during 1st and 2nd
measurements with the hfhhd and bfhhd . in addition , the values measured using the bfhhd were
greater than those measured using the hfhhd . hfhhd : conventional method of an examiner manipulating the hhd by hand
( hand - fixed hhd ) . bfhhd : hhd fixed with a belt ( belt - fixed hhd ) hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed
hhd ) ; bfhhd : hhd fixed with a belt ( belt - fixed hhd ) . * presence of bias : exist ,
present ; n - ex : not present . 95% ci : 95% confidence interval ; sem : standard error of
measurement ; loa : limits of agreement ; mdc95 : minimal detectable change in
the 95% confidence interval . in the all subjects group , moreover , proportional and fixed biases between the maximum value obtained during
the 1st and 2nd measurements and the 3rd measurement were observed . the 3rd measurement was
smaller than the maximum value obtained during the 1st and 2nd measurements . in the present study , by using 30 kgf as the fixed limit for measurement of the shoulder
joint horizontal adduction muscle strength by hfhhd in accordance with previous research , we
verified the absolute reliability of the test - retest method in measurements less than the
fixed limit . in addition , we investigated the absolute reliability between the hfhhd and
bfhhd for measurements less than the fixed limit . flansbjer et al.12 reported good sensitivity of a test in the analysis of
reliability of the gait performance criteria , and the sem of measurement values was reported
to be 10% or less . therefore , in this study , no systematic bias for absolute reliability was
observed ; an sem of < 10% was regarded to be the bias allowed for clinical settings . the hfhhd results in the < 30 kgf group had no systematic bias , and the sem was < 10%
of the means of the 1st and 2nd measurements . in addition , the 3rd measurement was less than
the maximum value from the 1st and 2nd measurements . therefore , in the < 30 kgf hfhhd
group , a single measurement was considered to be reliable in the clinical setting . the bfhhd results in the < 30 kgf group had no systematic bias , and the sem was < 10%
of the mean of the 1st and 2nd measurements . in addition , the 3rd measurement value was less
than the maximum of the 1st and 2nd measurement values . therefore , the maximum value of two
measurements in the < 30 kgf bfhhd group was considered to be reliable . although 30 kgf is
within the manipulative fixed limit , a fixed bias was observed between the maximum value
obtained during the 1st and 2nd measurements using the hfhhd and bfhhd , and bfhhd values
were higher than hfhhd values . the magnitude of the bias was estimated to be 0.737.19 from
the limits of agreement . consequently , caution should be exercised when comparing
measurements made using an hfhhd and bfhhd because of the different measurement methods . in all subjects , a proportional bias between the 1st and 2nd measurements was observed , and
the sem was > 10% of the mean . fixed bias and proportional bias were observed between the
maximum value obtained during 1st and 2nd measurements and the 3rd measurement . the 3rd
measurement was smaller than the maximum value obtained during the 1st and 2nd measurements . therefore , the adopted value was considered to be the
maximum value of two measurements . according to the results of the present study , for measurement of the shoulder joint
horizontal adduction muscle strength using an hfhhd , however , hfhhd values may not accurately represent actual
strength , because they are smaller than bfhhd values ; thus , the measurement method should be
considered in the comparison of the measured values . for a bfhhd , the adopted values were
considered to be the maximum value of two measurements . in the present study , intra - class reliability was observed ; however , we were not able to
ensure face validity . therefore , future
research must consider inter - class reliability and the reliability of measurements in
elderly subjects and those with diseases . | [ purpose ] the aim of this study was to verify the absolute reliability of shoulder joint
horizontal adductor muscle strength measurements using a handheld dynamometer ( hhd ) .
[ subjects and methods ] the subjects were 33 healthy college students .
the measurements
were made three times with the hhd fixed using a belt ( bfhhd ) or with the examiner s hand
( conventional method ; hfhhd ) .
the absolute reliability of measurements was verified using
bland - altman analysis , both in the all subjects group and a group of subjects showing
measurements less than a fixed limit of 30 kgf .
[ results ] in the < 30 kgf group , a
systematic bias was not observed , and bfhhd values were greater than hfhhd values .
bfhhd
values in the all subjects group showed a systematic bias ; the 3rd measurement value was
less than the maximum value obtained during the 1st and 2nd measurements .
[ conclusion ] for
obtaining an acceptable value during clinical measurements of horizontal adductor muscle
strength , single measurements obtained using an hfhhd in the case of a < 30 kgf group
and the maximum value of two measurements obtained using a bfhhd are reliable . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
using scanning electron microscopic and light microscopic techniques , adriaens et al1 demonstrated bacteria invading the radicular cementum and the dentinal tubules of the radicular dentin of periodontally diseased , caries - free human teeth . it has been reported that periodontal diseases , periodontal treatment , such as root planing or surgery and over - vigorous tooth brushing can cause gingival recession.2,3 many authors claimed that such recession may account for the high prevalence of cervical dentin sensitivity ( cds ) in periodontal patients.3,4 furthermore , it is not known if hypersensitivity in the periodontal patients is true cds or due to some underlying pathological process such as bacterial penetration into the dentinal tubules during the disease process.5 periodontal treatment often results in the removal of the cementum and it has been claimed to be a factor in the occurrence of hypersensitive dentin and bacterial invasion to dentinal tubules.68 it has been suggested that bacteria and bacterial toxins , which are present in the diseased periodontium , can reach the pulp by way of lateral and/or accessory canals8,9 and dentinal tubules.10,11 it has been demonstrated that bacteria can invade open dentinal tubules and reach the pulp12 and that bacterial products , when applied to exposed dentin are capable of initiating inflammatory reactions in the underlying pulp.13 most of recently developed desensitizers are considered to contribute to better clinical results by reducing the rate of the cervical dentin sensitivity.14,15 however , little is known about their antibacterial effects.14 this study assessed the antibacterial activity of various desensitizers available on the market against some bacteria found in dental plaque by muller hinton agar well method . in this study , a benzalconium containing product ( micro prime ) , a triclosan containing product ( seal & protect ) , a dentin bonding primer ( all bond ) , a fluoride containing prophylaxis paste ( sultan desensitizer ) and two fluoride containing varnishes ( cavity shealth and ultra ez ) were used ( table 1 ) . the antibacterial efficacy of each material was evaluated against the following bacteria : streptococcus mutans ( nctc 10449 ) ; streptococcus salivarious ( rskk 606 ) ; staphylococcus aureus ( atcc 6538 ) ; streptococcus faecalis ( rskk 97008 ) ; and pseudomonas aeruginoza ( atcc 27853 ) . the agar was evenly distributed over the surface of 15 cm - in - diameter petri dishes to a thickness of 5 mm . standard wells with a diameter of 6.0 mm were punched into the agar with the blunt end of a pasteur pipette . approximately 0.5 ml suspensions of bacteria were swabbed over the surface of the agar plates . the concentrations of bacterial suspensions ( cfu ) were 210 s. mutans , 610 s. salivarious , 510 s. aureus , 210 s. faecalis , and 1.610 p. aeruginoza bacteria / ml , respectively . each material was inserted into the wells with its own sterile applicator under a laminar flow . the agar plates were incubated at 37c for 48 h. the diameters of the inhibition zones around the materials were measured in millimeter ( mm ) ( figure 1 ) . the results of 12 measurements were averaged and these values were subjected to kruskal wallis one way anova and mann whitney test at a significance level of p<.05 for the comparison of the products . the results of 12 measurements were averaged and these values were subjected to kruskal wallis one way anova and mann whitney test at a significance level of p<.05 for the comparison of the products . table 2 shows the mean values of the inhibition zones produced by each material tested . micro prime ( mp ) produced varying degrees of inhibitory effectiveness on the test bacteria . s. mutans and p. aeruginosa displayed a significantly lower resistance to mp than s. salivarious , s. faecalis and s. aureus respectively ( p<.05 ) . antibacterial effectiveness of sp against s. faecalis , s. mutans , and s. salivarious was not statistically different ( p>.05 ) . all bond primer showed its highest antibacterial effectiveness against s. faecalis and p. aeruginosa ( p<.05 ) . sultan demonstrated significant antibacterial effectiveness against all test bacteria with s. mutans being the least inhibited ( p<.05 ) . among the materials tested , no inhibition zones were noted for cavity sheld and ultraez ( p>.05 ) . antibacterial effectiveness shown by the dental materials in some studies was related to either their ph or their chemical composition . for example , current desensitizers include antibacterial components such as fluoride , triclosan , benzalkonium chloride , ethylene dianinetetraacetic acid , and glutaraldehyde . a dentin primer incorporating methacryloyloxydodecylpyridinium bromide was potentially able to kill any bacteria.16,17 the agar well technique test is an accepted method for initially differentiating antibacterial activity between materials . accordingly , even if the material contains less diffusive antibacterial components the substantive antibacterial activity is available . it is difficult to evaluate the antibacterial effects of desensitizer by a single test and more than one method needs to be used for screening the materials . furthermore , in order to speculate on clinical effects , in situ tests which simulate the clinical situation are indispensable . dental plaque is a host - associated biofilm . in this study , some microorganisms of dental plaque were used to determine antibacterial effectiveness of several desensitizers . these organisms have a strong affinity for hard surfaces , and do not usually appear in the mouth until after tooth eruption . s salivarious is only a minor component of dental plaque and not considered a significant opportunistic pathogen . however , s. salivarious and s. mutans have been found to produce root caries.18 s. fecalis have been recovered in low numbers from several oral sites . some strains can include dental caries in gnotobiotic rats while others have been isolated from infected root canals and from periodontal pockets.19 p. aeruginosa and s. aureus were colonized in pocket of the refractory chronic periodontitis patients.20 p. aeruginosa is resistant to tetracycline , penicillin g and erythromycin.19 antibacterial effectiveness of the desensitizers except for ultraez and cavity sheath used in this study was obtained against the bacteria above . in a study by emilson and bergenholtz,21 it was suggested that the antibacterial nature of the gluma and denthesive cleanser might be related to the high content of ethylene dianinetetraacetic acid ( edta ) in the materials . the results of the present study also indicate that chemical composition of the desensitizers play an active role their antibacterial properties . micro prime ( mp ) desensitizer is used for desensitizing under dental cements or temporary , provisional , or final restorative materials , abrasions , cervical erosions , and preps . the antibacterial activity of mp desensitizer may be related to the chemical composition , which is benzalkonium chloride in nature . mp desensitizer had significant inhibitory effect on not only s. mutans and p. aeruginosa but also on s. salivarious , s. faecalis . and s. aureus . this data supports the results of duran and sengun,14 who reported antibacterial effect of benzalkonium chloride containing heath - dent desensitizer . seal & protect desensitizer exhibited antibacterial zones that comparable in size with those of mp desensitizer . the zones of bacterial inhibition produced with all bond may be attributed to its ingredients . fluoride release is a factor in a materials antibacterial effect;22 however , in this category of materials , ultraez and cavity sheath had no inhibition effect when compared with sultan desensitizer in this study . in a study by ekenback et al,23 no statistically significant difference over time was found in s. mutans , lactobacilli or total streptococci after treatment with the fluoride varnishes or tymol varnish . on the basis of the findings of vermeersch et al,24 it was assumed that , in the set materials , fluoride ions might be firmly encapsulated by the resin matrix and that consequently its fluoride release rate into an aqueous environment might be small and slow . however , this finding does not necessarily indicate that these materials have no antibacterial effectiveness . moreover , release of fluoride from varnishes slowly in small amounts may be beneficial at the long term . thus , relationship between release of fluoride and antibacterial effectiveness of varnishes should be an issue of future studies . micro prime desensitizer containing benzalkonium chloride had the highest antibacterial effectiveness when compared with others in this study . in addition , seal & protect which contains triclosan and all bond which contains acidic components showed very high antibacterial efficacy . however , a fluoride component in a paste ( sultan desensitizer ) showed very high bactericidal efficacy . this study has demonstrated that currently marketed desensitizers have greatly in their ability to inhibit on growth of a variety of oral bacterial organisms in vitro . these experimental findings , however , only provide data that are useful for assessment of initial antibacterial effect . in vivo models that will account for many of the variables should be sought . | objectivesdesensitizers contribute to better clinical results by reducing the rate of cervical dentin sensitivity .
however , information on their antibacterial effect is limited .
this study examined the antibacterial activities of a triclosan containing ( seal & protect ) , a benzalconium containing desensitizer ( micro prime ) , a fluoride containing prophilaxy paste ( sultan desensitizer ) , two fluoride containing varnishes ( cavity shealth and ultra ez ) , and a dentin bonding primer ( all bond).methodsthe test materials were inserted in the wells of muller hinton agar plates inoculated with streptococcus mutans , streptococcus salivarious , staphylococcus aureus , streptococcus faecalis and pseudomonas aeruginosa .
the diameters of the inhibition zones produced around the materials were measured after 24 h of incubation .
the results were analyzed by the kruskal wallis one way anova and the mann - whitney tests at a significance level of p<.05.resultsmicro prime desensitizer containing benzalkonium chloride had the highest antibacterial effectiveness compared to other desensitizers used in this study . in addition , triclosan containing seal & protect and acidic components containing all bond showed very high antibacterial efficacy .
on the other hand , fluoride within both varnishes had little antibacterial effectiveness . however
a fluoride component in a paste ( sultan desensitizer ) showed very high bactericidal effect.conclusionsall desensitizers except fluoride varnishes showed various degrees of antibacterial effect against the bacteria tested in this study . if antibacterial effect is also required from the desensitizers clinicians should avoid use of varnishes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
oral implantology is an ever growing field that is reaching the practice of general dentist due to the simplification of technical procedures . titanium endosteal implants are widely used due to the advantages offered by their mechanical properties and excellent anchorage in the jawbone , known as osseointegration . this type of anchorage of the implant in bone is considered as essential criteria for a successful dental implant . nevertheless , it has , as every surgical procedure , several complications that can occur and that must be known in order to prevent or solve them . the failure of dental implants is due not only to biological factors , such as unsuccessful osseointegration or the development of periimplantitis , but it may also result from technical complications . these complications are relatively rare . in contrast , prosthetic complications are not uncommon . in general , these complications can be grouped into the following five categories :
veneering material fractureprosthetic screw looseningprosthetic screw fractureimplant fractureframework fracture . veneering material fracture prosthetic screw loosening prosthetic screw fracture failures of implant - supported restorations result from technical problems and can be divided into two groups : those relating to implant components , and those relating to the prosthesis . , 2004 reported that prosthetic screw fracture has an incidence rate of 3.9% and the rate for prosthetic screw loosening is 6.7% . fracture of prosthetic retaining screws is more common than implant fracture and it is normally due to a metal fatigue following an overload of materials . though several systems from different manufacturers are available , a simple and unique non - invasive technique to retrieve the broken abutment screw is described in this case report . a 36-year - old male presented for treatment , reporting the detachment of an implant - supported crown in the region of the lower left first molar . clinical examination of the patient revealed a missing tooth at the location of lower left first molar with no sign of an implant . radiographic examination of the area showed the presence of a root - form cylindrical implant , consistent in appearance with an 11.5 mm long , 4.2 mm diameter abutment with an internal hex . the implant appeared to be well - positioned in all three - dimensions ( mesiodistal , buccolingual and apico - coronal ) and the radiographic examination did not indicate any damage to the implant body . the apical part of the abutment screw remained threaded into the implant [ figure 1 ] , but had fractured below the level of the hexagonal lock . although the implant was osseointegrated , there were radiographic signs of periimplantitis with some crestal bone loss having occurred . broken abutment screw after anesthetizing the area , using the tissue punch , the implant was exposed . using a round bur in a high - speed hand piece , a 1 mm deep pit was made across the most occlusal portion of the broken screw fragment [ figure 2 ] . the hand piece is held with both hands to avoid having the bur inadvertently jump into the implant body . using ultrasonic scaler with no 3 tip placed in the pit prepared moving in anticlockwise direction slowly the broken abutment screw was retrieved [ figure 3 ] . using close tray transfer impression was made and the model with implant analog and the abutment was sent to the lab for prosthesis preparation . metal ceramic prosthesis was cemented to the abutment in position which was tightened to the implant body with screw which was torque to 35 n [ figure 4 ] . slot prepared on the fractured screw abutment screw retrieved cemented crown showing the broken screw part the abutment screw fracture presents a rare , but quite unpleasant failure and can be a serious problem as the fragment remaining inside the implant may prevent the implant from functioning efficiently as an anchor . the primary reason for screw fracture is undetected screw loosing which can be due to bruxism , an unfavorable superstructure , overloading or malfunction . fractures of the implant abutment or of the abutment screw have been observed as a consequence of screw loosening and undetected micro - movements of the abutment under functional loading and consequently , it is advised that the repeated loosening of an abutment screw should alert the clinician to possible significant contributing causes [ figure 5 ] . final prosthesis placed however , the behavior of the implant / abutment joint components with respect to critical bending force is still unclear . studies show that implant abutment failure occurs when lateral forces exceed 370 n for abutment with a joint depth of at least 2.1 mm and 530 n with a joint depth of at least 5.5 mm . the number , position , dimension and design of implants , as well as the design of the prosthesis are critical factors to be considered during the treatment planning phase . to withstand high bending stresses , implants should be as long and as wide as possible , used in adequate numbers , and be positioned such as to allow axial loading . implant components are known to fracture more frequently in the posterior region and in partially dentate patients compared to completely edentulous patients . retightening an abutment screw 10 min after the initial torque applications should be routinely performed , and increasing the torque value for abutment screws above 30 n can be beneficial for the abutment , implant stability and to decrease the possibility of the screw becoming loose . the methods employed to grasp the broken fragments or screw are determined according to the location of the fracture abutment - above or below the head of the implant . if an abutment screw fractures above the head of the implant , an explorer , a straight probe or hemostats might be successful . the tip of the instrument is moved carefully in a counter - clockwise direction over the surface of the screw segment until it loosens . if the screw fracture occurs below the head of the implant , other methods are required . there are several available implant repair kits :
iti dental implant system ( institut straumann ag , switzerland ) , consists of drills , two drill guides and six manual tapping instrumentsimz twinplus implant system1 ( dentsply friadent , germany)screw removal kit replace ( nobel biocare , yorba linda , california , usa)certain - screw removal kit ( biomet 3i , florida , usa ) . iti dental implant system ( institut straumann ag , switzerland ) , consists of drills , two drill guides and six manual tapping instruments imz twinplus implant system1 ( dentsply friadent , germany ) screw removal kit replace ( nobel biocare , yorba linda , california , usa ) certain - screw removal kit ( biomet 3i , florida , usa ) . prosthesis screw fracture was noted almost equally with fixed complete dentures ( 3% ) and fixed partial dentures ( 5% ) . abutment screw fracture , although uncommon , occurs in clinical practice . in most circumstances , however , sometimes the screw can not be removed conservatively . by using rotary instruments , internal threads of the screw hole may be damaged and the implant rendered useless . the use of osseointegrated implant - supported prostheses in the replacement of missing natural teeth has become an accepted clinical protocol in dentistry . success in this area is enhanced through correct diagnosis , treatment planning , and maintenance ; however , complications often occur , which may be significant and compromise the long - term success of the implant abutment and associated prosthesis . the management of such complications has given rise to several techniques to address failings , such as component fracture and bacterial contamination . | dental implants made of titanium for replacement of missing teeth are widely used because of ease of technical procedure and high success rate , but are not free of complications and may fail .
fracturing of the prosthetic screw continues to be a problem in restorative practice and great challenge to remove the fractured screw conservatively .
this case report describes and demonstrates the technique of using an ultrasonic scaler in the removal of the fracture screw fragment as a noninvasive method without damaging the hex of implants . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
non - small cell lung carcinoma ( nsclc ) accounts for 85% of all cases of lung cancer , which is increasingly a disease of older patients . more than two thirds of nsclc cases are diagnosed in persons of age 65 years or older and one in three patients is aged 75 years or older . data from the surveillance , epidemiology , and end results ( seer ) registry indicate that the median age at diagnosis of nsclc patients is 69 years . nsclc can therefore be regarded as a disease of the elderly and the proportion of the elderly among nsclc patients is expected to progressively increase due to the aging of the populations in many countries . aging is inextricably associated with physiological changes as they relate to functional status , organ function , and drug pharmacokinetics . aging is associated with decreases in marrow reserve , drug clearance and lean body mass . furthermore , concomitant co - morbidities that affect functional status , general health and tumor symptoms are frequently present in this patient population . age itself is not a negative predictive factor and nsclc treatment should not be omitted solely on the basis of chronological age . it is functional impairment and comorbidity , not chronological age , that effect treatment tolerance and effectiveness in nsclc cases . most elderly patients are diagnosed with an already advanced stage disease and the majority of those diagnosed with earlier stage disease will ultimately suffer disease progression . systemic chemotherapy has been a mainstay of therapy for patients with recurrent or advanced nsclc . several meta - analyses of randomized clinical trials have demonstrated that platinum - based combination chemotherapy induced a modest but significant survival advantage over best supportive care alone in patients with untreated , recurrent , or advanced nsclc . however , platinum - based doublets are often unsuitable for elderly patients due to the existence of deficits in patient functional status and organ function . oncologists have several treatment options for elderly patients with advanced nsclc , including best supportive care without chemotherapy , single agent chemotherapy with a third generation drug , non - platinum - based combination chemotherapy , platinum - based combination chemotherapy , and new biologic agents . elderly patients are excluded from participation in many clinical trials and often receive untested or inadequate treatment based on the long held , yet completely unsubstantiated , notion that cancer in the elderly is less aggressive and older patients are incapable of tolerating the exigencies of treatment . although the importance of more active treatment for elderly nsclc patients is increasingly being recognized , the interactions between age , performance status and comorbidity , remain uncertain . in this study , we analyzed the details of chemotherapy regimens and outcomes for nsclc patients older than 75 years of age , a demographic group known to account for more than 30% of newly diagnosed nsclc cases . in addition , we investigated performance status ( ps ) and comorbidity burden as a prognostic factor in those patients . we retrospectively reviewed the records of 48 advanced nsclc patients who were 75 years of age or older and who had been treated with systemic chemotherapy as a first line therapy at the korea university anam hospital ( seoul , korea ) between may 2002 and october 2008 . clinicopathological information including gender , age at diagnosis , smoking history , and the type of chemotherapy were retrieved from the patients ' electronic medical history records . the charlson index provided a weighted index of comorbidity based on relative risks of death associated with 19 clinical conditions . we set cutoffs of charlson index 0 to 1 as " mild , " charlson index 2 to 3 as " moderate , " and charlson index 4 or greater as " severe " comorbidities . this study was approved by the institutional review board at the korea university anam hospital . the chemotherapy regimen to be used was determined by the treating physician but the decision to administer first line chemotherapy depended , in all cases , on patient acceptance . after every 2 or 3 chemotherapy cycles , tumor measurements were prepared using chest computed tomography scan and other tests used to stage the tumor . responses were classified according to the response evaluation criteria in solid tumors ( recist ) 1.0 . toxicity was graded according to the national cancer institute common toxicity criteria ( nci - ctc ) version 3.0 . the severity of any toxicities not defined in nci - ctc were graded as 1=mild , 2=moderate , 3=severe or 4=very severe . treatment outcomes were estimated as response rate , disease control rate , overall survival ( os ) and progression free survival ( pfs ) . os was defined as the time between the date of recurrent or metastatic disease diagnosis and the date of death from any cause . pfs was defined as the time between the date of the recurrent or metastatic disease diagnosis to the date of disease progression or death from any cause . the kaplan - meier method was employed to estimate the probability of survival and survival difference was analyzed by the log - rank test . the two - sided significance level was set at p<0.05 . cox proportional hazards regression model was employed in univariate and multivariate analyses to identify the significant independent prognostic factors of various clinical parameters for survival . significant prognostic variables in the univariate analysis for os were included in the multivariate analysis . we retrospectively reviewed the records of 48 advanced nsclc patients who were 75 years of age or older and who had been treated with systemic chemotherapy as a first line therapy at the korea university anam hospital ( seoul , korea ) between may 2002 and october 2008 . clinicopathological information including gender , age at diagnosis , smoking history , and the type of chemotherapy were retrieved from the patients ' electronic medical history records . the charlson index provided a weighted index of comorbidity based on relative risks of death associated with 19 clinical conditions . we set cutoffs of charlson index 0 to 1 as " mild , " charlson index 2 to 3 as " moderate , " and charlson index 4 or greater as " severe " comorbidities . this study was approved by the institutional review board at the korea university anam hospital . the chemotherapy regimen to be used was determined by the treating physician but the decision to administer first line chemotherapy depended , in all cases , on patient acceptance . after every 2 or 3 chemotherapy cycles , tumor measurements were prepared using chest computed tomography scan and other tests used to stage the tumor . responses were classified according to the response evaluation criteria in solid tumors ( recist ) 1.0 . toxicity was graded according to the national cancer institute common toxicity criteria ( nci - ctc ) version 3.0 . the severity of any toxicities not defined in nci - ctc were graded as 1=mild , 2=moderate , 3=severe or 4=very severe . treatment outcomes were estimated as response rate , disease control rate , overall survival ( os ) and progression free survival ( pfs ) . os was defined as the time between the date of recurrent or metastatic disease diagnosis and the date of death from any cause . pfs was defined as the time between the date of the recurrent or metastatic disease diagnosis to the date of disease progression or death from any cause . the kaplan - meier method was employed to estimate the probability of survival and survival difference was analyzed by the log - rank test . cox proportional hazards regression model was employed in univariate and multivariate analyses to identify the significant independent prognostic factors of various clinical parameters for survival . significant prognostic variables in the univariate analysis for os were included in the multivariate analysis . of the 117 nsclc patients 75 years of age or older , 48 were advanced nsclc patients treated with systemic chemotherapy as a first line therapy . the median age of the patients was 76 years ( range , 75 to 87 years ) and the male / female ratio was 3.4/1.0 . the median eastern cooperative oncology group ( ecog ) ps was 1 ( range , 0 to 2 ) , and 11 patients ( 23% ) had never smoked . at the time of diagnosis with nsclc , 6 patients had diabetes the majority of patients had moderate comorbid disease with 2 patients having severe comorbid disease ( charlson index4 ) . twenty - nine of 48 patients ( 60.5% ) had the histologic subtype of lung adenocarcinoma and all patients had advanced metastatic or recurrent disease . as the first line of chemotherapy , 43 of 48 patients ( 90% ) received platinum - based combination chemotherapy . for platinum - based doublet , the relative dose intensity was 83.2% and the median number of treatment cycles was four ( range , 1 to 6 cycles ) . the chemotherapeutic agent added to platinum was gemcitabine in 28 patients , taxane in 10 patients , irinotecan in 4 patients and pemetrexed in 1 patient . front line single agent chemotherapy including vinorelbine , gemcitabine and docetaxel , was administered to 5 patients ( table 2 ) . of the 48 patients receiving first line chemotherapy , 1 complete response and 15 partial responses were observed ( overall response rate , 33.3% ) . stable disease was observed in 18 patients ( 37.5% ) and the disease control rate was 70.8% . of the 48 patients with first line chemotherapy , progressive disease was observed in 5 patients ( 10.4% ) , and 14 patients ( 29.2% ) received second line chemotherapy . the regimens used as second line therapy included epidermal growth factor receptor ( egfr)-tyrosine kinase inhibitors ( tkis ) in 6 patients , docetaxel in 4 patients , pemetrexed in 2 patients , and vinorelbine in 2 patients . there was no significant difference for os results associated with second line chemotherapy regimens ( p>0.005 ) . also , there was no significant difference in os results between patients with or without egfr - tki as second or more line of therapy ( p>0.005 ) . all 48 patients were included in the survival analysis on an intent - to - treat basis . median pfs for first line chemotherapy was 5.7 months ( 95% confidence interval [ ci ] , 4.93 to 6.47 months ) ( fig . 1 ) and the median os was 8.2 months ( 95% ci , 4.44 to 11.96 months ) ( fig . univariate analysis revealed that decreased os was significantly associated with male - gender , no - response for first line chemotherapy , and having not received a second line or more of chemotherapy ( table 3 ) . from the multivariate analysis results , male - gender ( hazard ratio [ hr ] , 0.338 ; 95% ci , 0.141 to 0.808% ; p=0.015 ) and not having received a second line or more of chemotherapy ( hr , 0.357 ; 95% ci , 0.171 to 0.745% ; p=0.006 ) were significantly associated with decreased os ( table 3 ) . age ( 75 - 80 years vs. 80 years ) , ecog ps ( 0 - 1 vs. 2 - 4 ) and charlson index ( mild comorbidity vs. moderate / severe comorbidity ) were not significant independent prognostic factors for survival . nci - ctc grade 3 or 4 hematologic toxicities included leukopenia in 26 patient , thrombocytopenia in 9 patients and anemia in 5 patients . grade 3 or 4 non - hematologic toxicities included diarrhea , mucositis , peripheral neuropathy and anaphylaxis . one patient died of a cardiovascular event and another due to the progression of an underlying usual interstitial pneumonia , instead of nsclc . of the 117 nsclc patients 75 years of age or older , 48 were advanced nsclc patients treated with systemic chemotherapy as a first line therapy . the median age of the patients was 76 years ( range , 75 to 87 years ) and the male / female ratio was 3.4/1.0 . the median eastern cooperative oncology group ( ecog ) ps was 1 ( range , 0 to 2 ) , and 11 patients ( 23% ) had never smoked . at the time of diagnosis with nsclc , 6 patients had diabetes the majority of patients had moderate comorbid disease with 2 patients having severe comorbid disease ( charlson index4 ) . twenty - nine of 48 patients ( 60.5% ) had the histologic subtype of lung adenocarcinoma and all patients had advanced metastatic or recurrent disease . as the first line of chemotherapy , 43 of 48 patients ( 90% ) received platinum - based combination chemotherapy . for platinum - based doublet , the relative dose intensity was 83.2% and the median number of treatment cycles was four ( range , 1 to 6 cycles ) . the chemotherapeutic agent added to platinum was gemcitabine in 28 patients , taxane in 10 patients , irinotecan in 4 patients and pemetrexed in 1 patient . front line single agent chemotherapy including vinorelbine , gemcitabine and docetaxel , was administered to 5 patients ( table 2 ) . of the 48 patients receiving first line chemotherapy , 1 complete response and 15 partial responses were observed ( overall response rate , 33.3% ) . stable disease was observed in 18 patients ( 37.5% ) and the disease control rate was 70.8% . of the 48 patients with first line chemotherapy , progressive disease was observed in 5 patients ( 10.4% ) , and 14 patients ( 29.2% ) received second line chemotherapy . the regimens used as second line therapy included epidermal growth factor receptor ( egfr)-tyrosine kinase inhibitors ( tkis ) in 6 patients , docetaxel in 4 patients , pemetrexed in 2 patients , and vinorelbine in 2 patients . there was no significant difference for os results associated with second line chemotherapy regimens ( p>0.005 ) . also , there was no significant difference in os results between patients with or without egfr - tki as second or more line of therapy ( p>0.005 ) . all 48 patients were included in the survival analysis on an intent - to - treat basis . the median follow up duration was 9.7 months . median pfs for first line chemotherapy was 5.7 months ( 95% confidence interval [ ci ] , 4.93 to 6.47 months ) ( fig . 1 ) and the median os was 8.2 months ( 95% ci , 4.44 to 11.96 months ) ( fig . univariate analysis revealed that decreased os was significantly associated with male - gender , no - response for first line chemotherapy , and having not received a second line or more of chemotherapy ( table 3 ) . from the multivariate analysis results , male - gender ( hazard ratio [ hr ] , 0.338 ; 95% ci , 0.141 to 0.808% ; p=0.015 ) and not having received a second line or more of chemotherapy ( hr , 0.357 ; 95% ci , 0.171 to 0.745% ; p=0.006 ) were significantly associated with decreased os ( table 3 ) . age ( 75 - 80 years vs. 80 years ) , ecog ps ( 0 - 1 vs. 2 - 4 ) and charlson index ( mild comorbidity vs. moderate / severe comorbidity ) were not significant independent prognostic factors for survival . nci - ctc grade 3 or 4 hematologic toxicities included leukopenia in 26 patient , thrombocytopenia in 9 patients and anemia in 5 patients . grade 3 or 4 non - hematologic toxicities included diarrhea , mucositis , peripheral neuropathy and anaphylaxis . one patient died of a cardiovascular event and another due to the progression of an underlying usual interstitial pneumonia , instead of nsclc . generally , the elderly are excluded from participation in clinical trials and are undertreated , or they receive therapies that have not been tested in relevant clinical trials . a systematic review of the recruitment barriers for elderly patients to clinical trials revealed exclusions related to trial design ( e.g. , protocol eligibility criteria with restrictions on age , comorbid conditions , or organ function requirements necessary to optimize treatment tolerability ) and individual physician skepticism ( e.g. , the perception that the patient would not be able to tolerate treatment due to comorbidities and advanced age ) . however , several age specific subgroup analyses of phase iii trials have failed to demonstrate differences in response rate , pfs and os between age groups . little information is available regarding the management of advanced nsclc in patients 75 years of age or older . in this study , median pfs for first line chemotherapy was 5.7 months ( 95% ci , 4.93 to 6.47 months ) with an overall response rate of 33.3% . the median os was 8.2 months ( 95% ci , 4.44 to 11.96 months ) . these outcomes were consistent with previous studies which were meta - analyses for first line chemotherapy in advanced or metastatic nsclc . studies included in the meta - analyses were intended for patients in their 50s and 60s . this finding implies that chronological age does not impact nsclc treatment effectiveness . in this study , only 29.2% of patients received a second line of chemotherapy and only 6 received egfr - tkis as a line of treatment , due to limitations of the korean medical insurance system . age is not a negative predictive factor and treatment should be not omitted on the basis of chronological age alone . oncologists increasingly recognize and accept the need for more aggressive treatment of elderly nsclc patients . two retrospective pooled analyses reported similar time to progression and os between older and younger patients , however , significantly higher toxic side - effects were reported for the older patients . nakamura et al . , also revealed no differences in the response or survival rates between age groups ( < 70 years vs. 70 years ) . the most frequent toxicity , neutropenia , tended to be more common in the older patients . in this study , grade 3 or greater neutropenia was observed in 54.2% of cases and febrile neutropenia in 12.5% , a frequency comparable to that of other studies that were meta - analyses of platinum - based chemotherapy used in first line treatment of advanced nsclc . however , in this study , 9 patients died of infectious causes during first line chemotherapy . these findings suggest that cisplatin - based chemotherapy may not be appropriate alone but could be used with platinum at doses attenuated to elderly nsclc patients . until now , the safety and efficacy of platinum - based combination chemotherapy in elderly patients with advanced nsclc has not been confirmed . although advanced age alone does not prelude combination therapies , given the increased likelihood of comorbidities , age should still be taken into consideration when selecting an appropriate regimen and dose in a clinical setting . however , there has been no data establishing appropriate chemotherapy regimens for elderly patients with advanced nsclc . a phase iii multicenter trial demonstrated that single agent vinorelbine improved quality of life and survival compared with supportive care alone . several trials showed that the platinum - doublet may be more beneficial for elderly nsclc patients than single agent chemotherapy . recently , davidoff et al . , reported that , in clinical practice , two thirds of nsclc patients with chemotherapy received a platinum - doublet first line regimen . in our results , 43 of 48 patients ( 90% ) received a platinum - doublet first - line chemotherapy . platinum - based chemotherapy is currently recommended as the standard approach for patients with advanced nsclc . however , to date , no prospective phase iii trial that has explored the reproducibility of this benefit in elderly patients has been published . due to association with significant organ toxicities , a rigorous risk versus benefit evaluation should be performed , particularly for elderly patients , before choosing cisplatin administration as an alternative to doublet . this study had limitations including a small number of patients all coming from a single institution , and a heterogeneous patient group . nevertheless , this study results suggest that advanced nsclc patients , 75 years of age or older , may receive clinical benefit from platinum - based doublet or single agent chemotherapy . however , oncologists must consider the safety aspect as well as the clinical benefit when managing this patient group . the two important lessons from our study are : first , platinum - doublet chemotherapy could be effective for elderly patients with advanced nsclc , and secondly , patient selection is important and a strategy should be explored to avoid fetal toxicity in this age group . further specifically designed randomized phase iii trials for elderly nsclc patients are needed to evaluate the standard treatment against the various options which include targeted agent , single agent , non - platinum - doublet and platinum - doublet . | purposeas the number of elderly patients diagnosed with non - small cell lung carcinoma ( nsclc ) increases , the number of these patients receiving chemotherapy also increases .
however , limited data exists regarding the use of chemotherapy in advanced nsclc patients who are 75 years of age or older.materials and methodsbetween may 2002 and october 2008 , data for 48 advanced nsclc patients who were 75 years of age or older who had been treated with chemotherapy were retrospectively analyzed.resultsthe median age of study participants at the time of first line chemotherapy was 76 years ( range , 75 to 87 years ) and their median charlson comorbidity index was 2 ( range , 1 to 4 ) . of the total 48 patients , 43 patients ( 90% ) were treated by platinum - based doublet as a first line chemotherapy regimen .
median progression free survival for first line chemotherapy was 5.7 months ( 95% confidence interval [ ci ] , 4.93 to 6.47 months ) with an overall response rate of 33.3% .
after first line chemotherapy , only 14 of the 48 patients ( 29.2% ) received second line chemotherapy .
the median overall survival ( os ) for these patients was 8.2 months ( 95% ci , 4.44 to 11.96 months ) .
multivariate analysis results indicated that female gender and having received second - line or more chemotherapy were independent prognostic factors for increased os for all 48 patients .
charlson index was not a significant independent prognostic factor for survival .
there were 9 treatment related deaths due to infectious causes ( 18.8%).conclusionpatients 75 years of age or older with advanced nsclc may obtain clinical benefit from the administration of platinum - based doublet or single agent chemotherapy .
however , oncologists must consider the aspect of safety in relation to the clinical benefits when managing this patient group . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
vascular calcification is an active process similar to the mineralization that occurs in bone [ 1 , 2 ] . vascular smooth muscle cells undergo phenotypic differentiation into osteoblast - like or chondroblast - like cells and they synthesize calcification regulating proteins and matrix components typically found in bone and in cartilage [ 3 , 4 ] . calcification of the arterial media , observed even in small vessels ( mnckeberg 's calcification ) , is common in uremic patients and seems to be less associated with inflammation as compared to intimal mineralization typical for atherosclerosis [ 5 , 6 ] . vascular mineralization advances with age and is intensified in diabetes , dyslipidemia , chronic kidney disease , and hypertension . in newly treated hemodialysis and peritoneal dialysis patients , diabetes , dialysis duration , and the previous presence of aortic arch calcification ( aac ) hyperinsulinemia and insulin resistance ( clinical signs of type 2 diabetes ) are positively correlated with the arterial calcification [ 8 , 9 ] . arterial medial calcifications often occur also in diabetic individuals as a component of the diabetic macroangiopathy . in the animal model , insulin resistance induced in rats by fructose feeding resulted in increased aortic calcium deposition , elevated calcium - phosphate index , and local hyperplastic changes in the aortic media . blood vessels obtained from end stage renal disease ( esrd ) patients were often studied by various histological techniques to assess vascular calcification . they were collected during renal transplantation ( epigastric or iliac arteries ) or by peripheral arterial biopsy ( radial artery ) [ 3 , 11 , 12 ] . in the present study we used small samples ( otherwise routinely discarded ) of radial arterial walls obtained during creation of arteriovenous fistula for hemodialysis access . the study was aimed at investigating the relationship between selected clinical and biochemical parameters , with special emphasis on diabetes markers , and the level of histologically assessed radial artery calcification in end stage renal disease patients . the study population consisted of 59 patients ( 38 males , 21 female ; mean age at the beginning of the study 61 16 yrs ) , including 36 on maintenance hemodialysis ( hd ) and 23 on predialysis ( stage 5 of ckd ) . the study was approved by the bioethics committee of the jagiellonian university and all patients signed an informed consent for their participation . the data on mortality was collected over a period of three years . during this period , the mortality data , including the causes of death , was based on the patients ' records . in all patients , selected biochemical parameters were assessed : serum concentrations of total cholesterol , hdl - cholesterol , ldl - cholesterol , triglycerides ( tg ) , serum creatinine , peripheral blood counts , albumin , glucose , intact parathyroid hormone ( ipth ) , total calcium ( ca ) and phosphate ( pi ) , high sensitive c - reactive protein ( hscrp ) , asymmetric dimethylarginine ( adma ) , osteopontin ( opn ) , osteoprotegerin ( opg ) , and osteocalcin ( oc ) . homeostasis model of assessment - insulin resistance ( homa - ir ) was calculated by application of the international formula : fasting insulin ( iu / ml ) fasting glucose ( mmol / l)/22.5 . routine biochemical tests were carried out using automatic biochemical analyzers : hitachi 917 ( hitachi , japan ) and modular p ( roche diagnostics , mannheim , germany ) . concentrations of hscrp were measured using immunonephelometric method on nephelometer bn ii ( siemens healthcare diagnostics , germany ) . opn , oc , opg , and adma were determined using elisa microplate immunoassays and elx808 automatic reader ( bio - tek instruments , inc . , the following kits of reagents were applied : opn ( r&d systems ) , oc ( metra , germany ) , opg ( quidel , biovendor , czech republic ) , and adma ( immundiagnostik , germany ) . the mean arterial pressure ( map ) was calculated according to the formula : map = dbp + 1/3(sbp - dbp ) , where sbp is systolic blood pressure and dbp is diastolic blood pressure . the intima - media thickness of the common carotid artery trunk ( cca - imt ) was assessed by ultrasonography ( b presentation , acuson 128 xp/10 apparatus equipped with a linear head at 5/7 mhz ) . the measurements were performed bilaterally at 0.5 cm and 2 cm below the division of the common carotid artery during diastolic phase of the heart cycle . the results were expressed as the arithmetic means of the values obtained for the left and right arteries . 5 2 mm in size , were collected during the first creation of arteriovenous fistula for hemodialysis access . the samples were immediately immersed in 10% phosphate - buffered formalin and fixed overnight and then rinsed in pbs and soaked in 30% sucrose . the material was snap - frozen and tissue blocks were positioned in a cryostat for cutting sections in a plane encompassing the entire thickness of the vascular wall . serial 10 m - thick cryosections were cut and thaw - mounted on poly - l - lysine coated slides . sections were stained routinely with mayer 's haematoxylin and eosin ( he ) , with von kossa method and with alizarin red . the stained sections were examined using an olympus bx-50 microscope ( olympus , tokyo , japan ) in brightfield mode and images were registered using olympus dp-71 digital ccd camera controlled by olympus analysis five software . the advancement of vascular calcification was semiquantitatively evaluated in von kossa and alizarin red - stained sections by two independent observers . the degree of mineralization was classified according to the following scale : 0 : no mineral content , 1 : a few small dispersed concretions , 2 : numerous small dispersed concretions , 3 : larger granular concretions , and 4 : large areas occupied by fused mineral deposits . the reproducibility of the morphological analysis was confirmed by bland - altman method and by calculating intraclass correlation coefficient ( icc ) which was 0.88 . the number of patients ( percentage of the group ) was reported for categorical variables and mean standard deviation or median ( lower - upper quartile ) for continuous variables , depending on distribution . student t - test or mann - whitney test was used for simple comparisons between the groups . multiple logistic regression models were constructed using the variables that differed significantly between the groups in simple comparisons and/or predefined sets of confounders , as pointed in the results . odds ratios ( or ) for 1 unit increase with 95% confidence intervals ( 95% ci ) being reported , unless otherwise stated . all tests were two - tailed and the results were considered statistically significant at p 0.05 . statistica 10 software ( statsoft , tulsa , ok , usa ) was used for computations . routine histology ( he ) showed general morphology of the radial artery , with intimal thickening in the vast majority of the examined specimens ( figure 1(a ) ) . basophilic deposits were visible in arterial wall in cases of very intense calcification ( figure 1(b ) ) . the preliminary comparison of two staining methods used for the assessment of the mineralization degree showed that von kossa method was less sensitive ; thus we employed alizarin red staining for further analysis and for correlation of the vascular calcification level with clinical and biochemical data . morphologically , mineral deposits were found in all layers of the arterial wall but they were most frequently localized in the media ( figures 1(b)1(d ) ) . in less advanced lesions , deposits were preferentially located close to the outer and inner elastic laminae ( figure 1(e ) ) . some deposits were fine and dispersed ( figure 1(f ) ) , while others occupied larger areas and in the most advanced cases even the entire thickness of the media ( figures 1(b)1(d ) ) . only very scanty mineral deposits were occasionally seen in the vascular intima . among 59 radial artery samples examined histologically , 34 showed positive alizarin red staining indicative of the calcification process . the proportion of samples with arterial wall mineralization ( table 1 ) as well as its advancement ( figure 2(a ) ) did not differ between hd and predialysis patients ( p = 0.6 ) . in further analysis , hd patients were studied together with predialysis patients ; nevertheless all multiple regression models were adjusted for hd status . table 1 summarizes differences in clinical and biochemical parameters between the groups with and without calcifications as assessed by alizarin red staining of radial artery . vascular calcification was associated with higher age of patients , higher glucose , and diabetes . map was slightly lower in patients with calcifications and the levels of adma and opg were higher in this group . clinical criteria of the metabolic syndrome [ 14 , 15 ] were compared between patients with and without vascular calcifications in radial artery ( table 2 ) . among patients with vascular calcifications , the number of individuals with fasting glucose level above 5.6 mmol / l , that is , patients with ifg ( prediabetes ) and diabetes , was significantly higher ( p = 0.0004 ) . moreover , vascular calcifications were more severe in the group of patients with ifg and diabetes ( figure 2(b ) ) . other criteria of the metabolic syndrome did not differ between the groups with or without calcifications . the association of radial artery calcifications with ifg and diabetes was further confirmed by multiple logistic regression ( table 3 ) . three models were constructed , containing age and fasting glucose > 5.6 mmol / l as independent variables : the first one was adjusted for gender , hd status , and ca pi product , and the second was additionally adjusted for dyslipidemia , hypertension , high bmi , and hscrp . the third model , adjusted as the first one , included other variables that were significantly associated with arterial calcification in simple comparisons , that is , map , adma , and opg . fasting glucose > 5.6 mmol / l was the only variable independently associated with the vascular calcifications in all three models . the results were similar when diabetes was substituted for increased fasting glucose level in the models : or = 17.2 ( 1.79166 ) ; p = 0.011 in model 1 ; or = 25.4 ( 1.74372 ) ; p = 0.015 in model 2 ; or = 24.6 ( 1.45419 ) ; p = 0.022 in model 3 . patients with calcifications in radial arteries presented higher cca - imt ( table 1 ) . the relation between cca - imt and histologically detected vascular calcification remained significant after adjustment for dialysis status , gender , ca pi , hscrp , and the presence of metabolic syndrome ( or for vascular calcification 2.31 per 0.1 mm increase in cca - imt ; 95% ci 1.184.52 ; p = 0.011 ) but not after adjustment for age . cca - imt was significantly higher in patients with ifg and diabetes ( 0.98 0.13 versus 0.88 0.15 mm ; p = 0.007 ) . sixteen patients with calcifications in the radial artery ( 47% ) died during 3 years of the followup , while in the group without calcifications the mortality was lower : 3 deaths ( 12% ) . vascular calcification was significantly associated with patients ' mortality in simple analysis ( p = 0.004 ) and after adjustment for hd status and age ( or for death 5.39 ; 95% ci 1.2024.1 ; p = 0.024 ) . this study presents a comprehensive comparison of biochemical and clinical data with the calcification status assessed histologically in the peripheral arteries of esrd patients . biopsies of radial artery collected during the creation of vascular access for hemodialysis were used previously by other authors to study calcification . however , in that study , the surgical anastomosis was performed in an end - to - end fashion ; thus a sample encompassing the entire circumference of the artery could be excised and used for further analysis , allowing for a more reliable assessment of the calcification extent in the arterial wall . in the study mentioned above , the authors found mineral deposits in 37% of the examined radial arteries . after adopting stringent morphological criteria to include even the finest calcifications and using more sensitive alizarin red staining for calcium detection we found arterial calcification in 57% of cases . intimal calcification occurs in advanced atherosclerotic lesions and is associated with lipid accumulation and infiltration of the inflammatory cells , such as macrophages and t cells . medial arterial calcification ( mac ) displays features very similar to those of physiological calcification in bone . mac develops independently of atherosclerosis and is a commonly observed pathology in diabetes , esrd , and ageing . the present study revealed a significant association of arterial medial calcifications with impaired fasting glucose ( ifg , prediabetes ) and diabetes but not with other criteria of the metabolic syndrome including overweight . our results are in accordance with the study of lim et al . demonstrating the relationship between anthropometric parameters , metabolic profiles , and coronary artery calcium scoring ( cacs ) . subjects with ifg or diabetes had higher cacs and more advanced coronary stenosis than normal subjects . moreover , several studies confirmed that fasting plasma glucose is a better independent determinant of the progression of coronary artery calcification than the other metabolic syndrome risk factors [ 2022 ] . the above mentioned papers presented a relationship between hyperglycemia and vascular calcification based on noninvasive imaging of blood vessels . in our study , this relationship was analyzed for the first time using histologically examined samples of peripheral arteries . our study showed that fasting hyperglycemia , mostly associated with type 2 diabetes , was the only significant predictor of vascular calcifications in esrd patients . recent evidence suggests that medial calcification in diabetes is an active , cell - mediated process , similar to that observed in patients with end stage renal disease [ 23 , 24 ] . vascular calcifications and atherosclerosis are frequent in patients with esrd and they are associated with increased cardiovascular morbidity . coronary artery calcification ( cac ) was found in 70.2% of dialysis patients and was significantly associated with cca - imt and the thickness of atherosclerotic plaques . these results indicate that both , medial calcification and atherosclerotic lesions , frequently coexist in patients with esrd and that cca - imt , increased in patients with calcifications examined in this study , may serve as a surrogate marker of vascular calcification . the mechanisms responsible for vascular calcification include inflammation and oxidative stress , as well as bone and mineral metabolism disturbances . in our study higher adma and opg levels were associated with vascular calcification . serum levels of adma in chronic kidney disease increase due to its defective inactivation and excretion . coen at al . postulated that adma may play a role in the pathogenesis of vascular calcification in dialysis patients . increased serum opg is associated with type 2 diabetes , chronic kidney disease , and the severity of vascular calcification and coronary artery disease [ 2931 ] . it could represent a compensatory mechanism for vascular damage , also showing a protective effect against vascular calcification [ 32 , 33 ] . arterial calcification was associated with higher mortality in esrd patients . according to our knowledge , the relationship between vascular calcification assessed histologically and the long - term mortality in chronic kidney disease patients has not yet been studied . ogawa et al . examined the effect of ct - assessed aortic arch calcification on mortality in the 401 hemodialysis patients during 4-year follow - up period and demonstrated that cardiovascular mortality was significantly higher in patients with calcification . in our study , employing a different assessment model ( radial artery and histology ) this effect of arterial calcification on mortality in esrd patients has been confirmed . small samples of radial artery obtained during creation of vascular access for hemodialysis may successfully serve as source of the material for histological assessment of vascular mineralization . in end stage renal disease patients , impaired fasting glucose ( prediabetes ) and diabetes predict vascular calcification which is significantly associated with higher mortality . these results indicate that combination of renal insufficiency and hyperglycemic conditions exerts a synergistic effect on vascular calcification and increases the risk of death . | objective .
the objective of the study was to assess the relationship between selected clinical and biochemical parameters of end stage renal disease ( esrd ) patients and arterial calcification .
materials and methods .
the study comprised 59 stage 5 chronic kidney disease patients ( 36 hemodialyzed and 23 predialysis ) .
the examined parameters included common carotid artery intima - media thickness ( cca - imt ) , bmi , incidence of diabetes and impaired fasting glucose ( ifg ) , dyslipidemia , hypertension , and 3-year mortality .
plasma levels asymmetric dimethylarginine ( adma ) , osteopontin ( opn ) , osteoprotegerin ( opg ) , and osteocalcin ( oc ) were also measured .
fragments of radial artery obtained during creation of hemodialysis access were stained for calcifications using von kossa method and alizarin red .
results .
calcification of radial artery was significantly associated with higher prevalence of ifg and diabetes ( p = 0.0004 ) and older age ( p = 0.003 ) , as well as higher opg ( p = 0.014 ) and adma concentrations ( p = 0.022 ) .
fasting glucose > 5.6 mmol /
l ( ifg and diabetes ) significantly predicted vascular calcification in multiple logistic regression .
the calcification was also associated with higher cca - imt ( p = 0.006 ) and mortality ( p = 0.004 ; or for death 5.39 [ 1.2024.1 ] after adjustment for dialysis status and age ) .
conclusion .
combination of renal insufficiency and hyperglycemic conditions exerts a synergistic effect on vascular calcification and increases the risk of death . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
traumatic posterior hip dislocation with ipsilateral intertrochanteric femur fracture is rare . to the best of our knowledge , this is the first case reporting the concomitant presence of posterior dislocation hip , ipsilateral intertrochanteric- and proximal tibia- fracture with popliteal artery injury . a handful of cases with similar polytrauma and a presentation similar to our case , sans the vascular injury have also been reported . the surgical management of patients presenting with ipsilateral multiple fractures is challenging and may lead to a poor outcome . we report our experience with successful management of this rare presentation with a relevant review of literature . a 25-year - old - male was transferred to emergency room at our level i trauma center shortly after a motor vehicle accident . at presentation , patient was conscious and verbal with stable vital signs and complained of severe pain- and decreased sensation- over left hip and left lower limb ( ll ) . the left ll was in slight but fixed hip flexion , abduction , and external rotation and shorter than the right . bilateral posterior tibial ( pt ) and dorsalis pedis ( dp ) pulses were palpable . skin overlying the right patella and volar aspect of left fore - arm had open wounds . hip radiographs and pelvic computed tomography ( ct ) scans revealed a posteriorly dislocated left femoral head and an ipsilateral intertrochanteric fracture with no acetabular or femoral head injury ( figure 1a and b ) . a complete oblique fracture of left proximal tibia ( figure 1c ) and a comminuted right patella fracture were also present . no additional skeletal , visceral or spinal injuries were noted on pertinent clinical examination , abdominal ultrasound and ct scans . the injury severity score was determined to be 17 patient was immediately brought to the operating room ( or ) . in the or , changes in exam findings on ll were noted in form of decrease in skin temperature and loss of palpable or dopplerable pt or dp pulses compared to right . secondary to this new - developed vascular compromise an intra - operative arteriogram was obtained which revealed a complete occlusion of popliteal artery at the level of the knee . through a posterior s shaped incision , an approximately 10 cm focal intimal tear involving the popliteal artery the meta - diaphyseal tibial fracture was reduced and stabilized using a knee - spanning multi - planar external fixator ( figure 1d ) . axial traction was applied carefully to achieve closed reduction of dislocated hip , but failed . the left hip was then approached through a lateral incision and the posterior dislocation was confirmed . wound was closed in layers leaving the distal 2/3 open due to presence of significant wound swelling and was packed with a wet - to - dry dressing . the left fore - arm and right patella wounds were similarly explored , thoroughly irrigated and packed . on the 4 post - operative day , patient was taken back to or for tension band wiring of the comminuted fracture right patella and repair of the left fore - arm flexor tendons . wounds were closed with vacuum dressings , which were changed periodically until 4 post - operative week when split thickness skin grafting was performed . concurrently , rehabilitation was initiated with crutch walking and weight bearing as tolerated on right ll but no weight bearing on left ll . at 14 week follow - up , ct scan of left tibia showed 30% fracture healing and patient was advanced to 25% partial weight bearing and to 50% weight bearing at 8 month follow - up . the tibial external fixator was removed at 15 week follow - up , uneventfully ( figure 2a ) . patient underwent knee and ankle range of motion exercises throughout the follow - up period . at the most recent examination at 15 months post - operative , there were no clinical or radiographic signs of osteonecrosis or post - traumatic arthritis ( figure 2b ) . the left knee achieved 100 flexion and full extension and right knee had 85 of flexion and 5 of extension . at this point , patient was evaluated for multi - ligamentous reconstruction of the left knee , however a follow - up ct scan showed proximal tibial non - union . following this , patient underwent a repair of left proximal tibial non - union with a right iliac crest bone harvest ( figure 3 ) . two weeks following the non - union repair , patient was taken back to the operating room for irrigation and debridement of a left knee hematoma . following this , patient s recovery has been uneventful and patient is full weight bearing on bilateral lower extremities at 16 months post - operative from the initial presentation . traumatic posterior hip dislocation resulting from high velocity trauma is not uncommon ; however , concomitant presence of ipsilateral femoral head- or intertrochanteric fracture is rarely reported . injuries in our patient included left proximal tibial fracture , left posterior hip dislocation with associated proximal femoral fracture , left popliteal artery injury , comminuted fracture of right patella and open laceration involving the left fore - arm . mechanistically , in a high velocity trauma , when a flexed knee strikes a stationary object ( e.g. , the dashboard ) ; the impact vector exits through the upper end of the intact femur . this may result in posterior dislocation of hip with posterior acetabular wall- and femoral head fracture . it has been reported that the dislocated head then gets jammed by the tight ilium . however , in our case the femoral head and acetabulum were not fractured ; it can be postulated that the longitudinal force did not dissipate through the femoral shaft and was concentrated at intertrochanteric region causing the intertrochanteric fracture . additionally , excessive adduction and external rotation force also resulted in the ipsilateral intertrochanteric fracture . the initial impact on the left knee resulted in a complete fracture of ipsilateral proximal tibia , which caused popliteal artery injury , similar to a popliteal artery injury following a posterior knee dislocation . the concept of damage control orthopedics ( dco ) involves primary temporary stabilization of long bone fractures using minimally invasive surgical techniques . studies have shown that external fixation has a role in initial as well as definitive stabilization of extremity fractures in multiply fractured patients with concomitant vascular injury . based on the dco concept , we triaged the injuries based on the severity and stabilized the left proximal tibia fracture with a knee - spanning external fixator first . notably our patient had no signs of vascular compromise at presentation , however , in the or , clinical exam deteriorated and the arteriogram detected the left popliteal artery damage . in patients with multiple fractures , definitive restoration of vascular continuity is recommended in a clinically stable patient with clean wound and adequate amount of viable soft tissue . similarly , in our case the left popliteal artery was bypass grafted with successful revascularization before fracture fixation . in contrast , in a similar case reported earlier , a through knee amputation could not be avoided despite of repairing the vascular injury after 8 hours of injury . in our patient , presence of multiple long bone fractures including a tibial fracture and presence of a vascular injury requiring a revascularization procedure increased the risk of development of compartment syndrome . in view of these findings , a prophylactic multiple compartment fasciotomy of left leg and thigh was performed which was eventually closed by split thickness skin grafting at 4 weeks post - operative . posterior hip dislocation with associated proximal femoral fracture is considered an orthopedic emergency with poor prognosis . the ideal time to reduce dislocated femoral head is within 6 hours and no later than 12 hours after dislocation . interestingly , presence of associated proximal femoral fracture and absence of posterior wall acetabular fracture is thought to be the reason for irreducibility , and closed reduction of such cases may lead to iatrogenic femoral neck fractures . if the concentric reduction is not achieved with 1 or 2 attempts ; open reduction internal fixation ( orif ) with removal of loose intra - artricular fracture debris should be considered without a delay . this case presented with intertrochanteric fracture without acetabular fracture and it was not possible to close reduce the dislocation . we approached the hip laterally and a large steinmann pin was inserted into the femoral neck through the fracture site and was used as a joystick to unlock and relocate the posteriorly dislocated head . the left intertrochanteric fracture was internally fixed using a variable - angle hip fixation system . hip replacement arthroplasty is also an option to manage such cases , however , especially in young patients , it is advisable to consider orif and postpone arthroplasty for future . notably , due to the concomitant vascular injury , patient was not positioned on the fracture table ; hence it was difficult to get the lateral radiographs . in such situations , a near 90 passive flexion of the contralateral hip may effectively scissor the lower extremities to obtain an optimum lateral view of operative lower extremity for confirmation of internal fixation . additionally , owing to the anatomic proximity of sciatic nerve to the posterior rim of acetabulum , up - to 10 - 28% patients with posterior hip dislocation present with sciatic nerve injury . we identified the sciatic nerve intra - operatively and secured it before any relocation attempts . however , during the follow - up , patient complained of severe pain in sciatic nerve distribution area which was managed with pregabalin and ultra - sound guided sciatic nerve block . rehabilitation protocol included gradual weight bearing as tolerated along - with manipulation of knee and ankle joints under anesthesia and range of motion exercises during the follow - up . at 15 months follow - up , patient regained near - full range of motion and there are no signs or symptoms of head collapse at last follow - up ( figure 2b ) , however , osteonecrosis of the femoral head may develop late and a periodic follow - up is necessary . patient was offered a ligamentous reconstruction of the left knee at this point , however due to presence of left proximal tibial non - union , patient underwent bone graft repair of the non - union at 15 months from the index presentation . at 16 months follow - up , patient has regained full range of motion of the left hip and knee and has returned to baseline functional level . traumatic posterior hip dislocation resulting from high velocity trauma is not uncommon ; however , concomitant presence of ipsilateral femoral head- or intertrochanteric fracture is rarely reported . injuries in our patient included left proximal tibial fracture , left posterior hip dislocation with associated proximal femoral fracture , left popliteal artery injury , comminuted fracture of right patella and open laceration involving the left fore - arm . mechanistically , in a high velocity trauma , when a flexed knee strikes a stationary object ( e.g. , the dashboard ) ; the impact vector exits through the upper end of the intact femur . this may result in posterior dislocation of hip with posterior acetabular wall- and femoral head fracture . it has been reported that the dislocated head then gets jammed by the tight ilium . however , in our case the femoral head and acetabulum were not fractured ; it can be postulated that the longitudinal force did not dissipate through the femoral shaft and was concentrated at intertrochanteric region causing the intertrochanteric fracture . additionally , excessive adduction and external rotation force also resulted in the ipsilateral intertrochanteric fracture . the initial impact on the left knee resulted in a complete fracture of ipsilateral proximal tibia , which caused popliteal artery injury , similar to a popliteal artery injury following a posterior knee dislocation . the concept of damage control orthopedics ( dco ) involves primary temporary stabilization of long bone fractures using minimally invasive surgical techniques . studies have shown that external fixation has a role in initial as well as definitive stabilization of extremity fractures in multiply fractured patients with concomitant vascular injury . based on the dco concept , we triaged the injuries based on the severity and stabilized the left proximal tibia fracture with a knee - spanning external fixator first . notably our patient had no signs of vascular compromise at presentation , however , in the or , clinical exam deteriorated and the arteriogram detected the left popliteal artery damage . in patients with multiple fractures , definitive restoration of vascular continuity is recommended in a clinically stable patient with clean wound and adequate amount of viable soft tissue . similarly , in our case the left popliteal artery was bypass grafted with successful revascularization before fracture fixation . in contrast , in a similar case reported earlier , a through knee amputation could not be avoided despite of repairing the vascular injury after 8 hours of injury . in our patient , presence of multiple long bone fractures including a tibial fracture and presence of a vascular injury requiring a revascularization procedure increased the risk of development of compartment syndrome . in view of these findings , a prophylactic multiple compartment fasciotomy of left leg and thigh was performed which was eventually closed by split thickness skin grafting at 4 weeks post - operative . posterior hip dislocation with associated proximal femoral fracture is considered an orthopedic emergency with poor prognosis . the ideal time to reduce dislocated femoral head is within 6 hours and no later than 12 hours after dislocation . interestingly , presence of associated proximal femoral fracture and absence of posterior wall acetabular fracture is thought to be the reason for irreducibility , and closed reduction of such cases may lead to iatrogenic femoral neck fractures . if the concentric reduction is not achieved with 1 or 2 attempts ; open reduction internal fixation ( orif ) with removal of loose intra - artricular fracture debris should be considered without a delay . this case presented with intertrochanteric fracture without acetabular fracture and it was not possible to close reduce the dislocation . we approached the hip laterally and a large steinmann pin was inserted into the femoral neck through the fracture site and was used as a joystick to unlock and relocate the posteriorly dislocated head . the left intertrochanteric fracture was internally fixed using a variable - angle hip fixation system . hip replacement arthroplasty is also an option to manage such cases , however , especially in young patients , it is advisable to consider orif and postpone arthroplasty for future . notably , due to the concomitant vascular injury , patient was not positioned on the fracture table ; hence it was difficult to get the lateral radiographs . in such situations , a near 90 passive flexion of the contralateral hip may effectively scissor the lower extremities to obtain an optimum lateral view of operative lower extremity for confirmation of internal fixation . additionally , owing to the anatomic proximity of sciatic nerve to the posterior rim of acetabulum , up - to 10 - 28% patients with posterior hip dislocation present with sciatic nerve injury . we identified the sciatic nerve intra - operatively and secured it before any relocation attempts . however , during the follow - up , patient complained of severe pain in sciatic nerve distribution area which was managed with pregabalin and ultra - sound guided sciatic nerve block . rehabilitation protocol included gradual weight bearing as tolerated along - with manipulation of knee and ankle joints under anesthesia and range of motion exercises during the follow - up . at 15 months follow - up , patient regained near - full range of motion and there are no signs or symptoms of head collapse at last follow - up ( figure 2b ) , however , osteonecrosis of the femoral head may develop late and a periodic follow - up is necessary . patient was offered a ligamentous reconstruction of the left knee at this point , however due to presence of left proximal tibial non - union , patient underwent bone graft repair of the non - union at 15 months from the index presentation . at 16 months follow - up , patient has regained full range of motion of the left hip and knee and has returned to baseline functional level . in summary , combination of ipsilateral traumatic posterior hip dislocation , intertrochanteric fracture and proximal tibia fracture with popliteal artery injury constitutes a rare and challenging case for orthopedic surgeons . this constellation of injuries can likely lead to poor clinical outcomes however , apt surgical management may result in favorable outcomes . the importance of continuous assessment of distal pulses should not be underestimated and vascular injuries should be addressed promptly . in the or , scissoring of lower extremities is recommended to obtain lateral radiographs for confirmation of internal fixation . trauma surgeons should be aware of this rare combination of injuries and should be prepared for utmost care of such patients . | constellation of ipsilateral posterior hip dislocation , intertrochanteric- and proximal tibial fracture with popliteal artery injury is rare .
management of this presentation is challenging . a motor vehicle accident victim presented with these injuries , but without any initial signs of vascular compromise .
popliteal artery injury was diagnosed intra - operatively and repaired .
this was followed by external fixation of tibial fracture , open reduction of dislocated hip and internal fixation of intertrochanteric fracture .
patient regained bilateral complete weight bearing and returned to pre - accident activity level .
apt surgical management including early repair of vascular injury in such a trauma mlange allows for a positive postoperative outcome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
p3ht ( 9194 % regioregular , rieke metals ) was dissolved in chlorobenzene ( vwr chemicals ) with a concentration of 0.15 mol l and spin - coated ( 7080 nm ) on znse / pt crystal and glass / ito ( 15 sq , xinyan ) , respectively . quinacridone ( tci ) was purified by repeated temperature gradient sublimation and vacuum - evaporated ( 90100 nm ) on both substrates mentioned before . subsequently , a thin layer ( 40 nm ) of pva ( 99 + % hydrolyzed , aldrich ) solution , 7 mg pva dissolved in 1 ml deionized water , was spin - coated ( 900 rpm ; 3 seconds ) onto the pigment and polymer , respectively , and finally dried under air . the thickness of the pva layer was measured by a dektak profilometer ( bruker ) . pt served as a counter electrode ( ce ) and a silver wire coated with agcl as a quasi - reference electrode ( qre ) , see ref . for fabrication details . a glass / ito electrode covered with a thin film of the studied material , which was deposited as described above , has been used as working electrode ( we ) . in the case of p3ht , we used a concentration of 0.3 mol l. a solution of 0.1 m tetrabutylammonium hexafluorophosphate ( tbapf6 , 99 % , fluka analytical ) in acetonitrile ( roth ) was used as an electrolyte solution . the midpoint potential of the ferrocene / ferrocenium redox couple was found to be + 353 mv vs. ag / agcl ( for a description of non - aqueous reference potential determination see for example , ref . ) . the cyclic voltammograms were recorded at a scan rate of 10 mv s by sweeping the potential between 0 mv and 650 mv for p3ht and between 0 mv and 1400 mv for quinacridone . all spectroscopic measurements have been performed with an ifs 66/s spectrometer ( bruker ) using the atr - ftir technique . for the spectroelectrochemical cell , shown schematically in figure 1 , we used znse / pt / studied material as a we , pt electrode as a ce and an ag / agcl electrode as a qre . znse was covered with a thin layer of pt ( 7 nm ) serving as ir - transparent electrode for contacting the we . we used the same electrolyte solution as mentioned above , which flows through the cell during the measurement . we changed the potential for p3ht between 0 mv and 600 mv in steps of 100 mv and for quinacridone from 0 mv to 1300 mv , also in steps of 100 mv . we plotted the spectra as log(tox / tref ) , where tref is the spectrum obtained at 0 mv for quinacridone and p3ht , respectively , and all other related spectra during oxidation are denoted as tox . p3ht ( 9194 % regioregular , rieke metals ) was dissolved in chlorobenzene ( vwr chemicals ) with a concentration of 0.15 mol l and spin - coated ( 7080 nm ) on znse / pt crystal and glass / ito ( 15 sq , xinyan ) , respectively . quinacridone ( tci ) was purified by repeated temperature gradient sublimation and vacuum - evaporated ( 90100 nm ) on both substrates mentioned before . subsequently , a thin layer ( 40 nm ) of pva ( 99 + % hydrolyzed , aldrich ) solution , 7 mg pva dissolved in 1 ml deionized water , was spin - coated ( 900 rpm ; 3 seconds ) onto the pigment and polymer , respectively , and finally dried under air . the thickness of the pva layer was measured by a dektak profilometer ( bruker ) . pt served as a counter electrode ( ce ) and a silver wire coated with agcl as a quasi - reference electrode ( qre ) , see ref . for fabrication details . a glass / ito electrode covered with a thin film of the studied material , which was deposited as described above , has been used as working electrode ( we ) . in the case of p3ht , we used a concentration of 0.3 mol l. a solution of 0.1 m tetrabutylammonium hexafluorophosphate ( tbapf6 , 99 % , fluka analytical ) in acetonitrile ( roth ) was used as an electrolyte solution . the midpoint potential of the ferrocene / ferrocenium redox couple was found to be + 353 mv vs. ag / agcl ( for a description of non - aqueous reference potential determination see for example , ref . ) . the cyclic voltammograms were recorded at a scan rate of 10 mv s by sweeping the potential between 0 mv and 650 mv for p3ht and between 0 mv and 1400 mv for quinacridone . all spectroscopic measurements have been performed with an ifs 66/s spectrometer ( bruker ) using the atr - ftir technique . for the spectroelectrochemical cell , shown schematically in figure 1 , we used znse / pt / studied material as a we , pt electrode as a ce and an ag / agcl electrode as a qre . znse was covered with a thin layer of pt ( 7 nm ) serving as ir - transparent electrode for contacting the we . we used the same electrolyte solution as mentioned above , which flows through the cell during the measurement . we changed the potential for p3ht between 0 mv and 600 mv in steps of 100 mv and for quinacridone from 0 mv to 1300 mv , also in steps of 100 mv . we plotted the spectra as log(tox / tref ) , where tref is the spectrum obtained at 0 mv for quinacridone and p3ht , respectively , and all other related spectra during oxidation are denoted as tox . as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors | spectroscopic measurements in the infrared range combined with electrochemistry are a powerful technique for investigation of organic semiconductors to track changes during oxidation and reduction ( p- and n - doping ) processes . for these measurements
it is important that the studied material , mostly deposited as a thin film on an internal reflection element , does not dissolve during this characterization . in this study
we introduce a technique that allows infrared spectroelectrochemical characterization of films of these materials for the first time . in many cases
so far this has been impossible , due to solubility in the oxidized and/or reduced form .
this novel technique is shown on thin films of quinacridone by adding a protection layer of poly(vinyl alcohol ) ( pva ) . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
congenital pouch colon ( cpc ) is a rare regional variant of anorectal malformation comprising 2%9% of cases . the most commonly accepted narasimharao 's classification divides this entity into four subtypes based on the length of normal colon proximal to the colonic pouch . recently , saxena and mathur classified cpc - based on the anatomic morphology of the pouch , adding a type v variant , i.e. , a double pouch colon with a short normal colonic segment interposition between the two pouches . we describe a similar case of type v cpc and recommend preservation of proximal pouch for a tabularizing coloplasty in such cases . a 6-month - old boy was transferred to our hospital as a case of cpc with a window colostomy in situ done at another hospital on day two of life . he was the first child born from a nonconsanguineous marriage by spontaneous vaginal delivery at full term . the ileum was opening directly into a hugely distended dumbbell shaped pouch with normal looking intervening colon of six centimeters . the distal pouch was excised as it was hugely dilated and the tubularizing coloplasty done using the proximal pouch was of acceptable length [ figure 1c and d ] . this tube was pulled through the abdominoperineal route and was placed within the muscle complex which was fairly well developed . the repair was protected by a diverting proximal ileostomy that was closed after 8 weeks . to begin with gradually , his condition improved and now at the age of 21 months , he has a stool frequency of three to four times a day . the stool consistency has also improved with decreased excoriations . ( a ) intraoperative photograph showing a double pouch colon with interposed normal colon , ( b ) window colostomy site and urinary fistula site , ( c and d ) tubularization of proximal colon first reported by chadha et al . and classified separately by saxena and mathur , only four cases of type v cpc have been described till date . the proximal pouch is akin to a segmental dilatation of colon ( sdc ) , while the distal pouch is a cpc . in all the reported cases , the ileum opens into the proximal pouch , with the interposing normal colonic segment length varying from 2 to 7 cm . in all , but one case report , there was an absence of appendix . the exact embryological cause for this defect is not known but has been attributed to vascular insult to the inferior mesenteric artery and ileocecal branch of the superior mesenteric artery with a normal middle colic branch of a superior mesenteric artery supplying the normal interposing segment . as per the vascular hypothesis of earlam , the fate of the developing bowel depends on the severity and duration of the vascular insult . atresia ( with or without a band ) , stenosis are the result of a severe prolonged injury whereas mild injuries result in an aganglionic bowel . however , one is not able to explain the simultaneous occurrence of sdc and cpc with an intervening normal segment on the basis of vascular theory alone . a defective organogenesis rather than a vascular insult may be responsible for this anomaly . in two cases , the distal pouch was excised due to massive dilatation and in one case due to gangrenous changes presumably secondary to dilatation . in our case also , the distal pouch was massively dilated . preservation of proximal pouch along with the interposing normal colon , a subsequent tapering coloplasty , and an abdominoperineal pull through with an ileostomy cover was done in two cases , whereas both the pouches were excised by one author . this may depend on which school of thought one belongs to as far as management of pouch in cpc is concerned . we excised the distal pouch since it was hugely dilated and an appropriate length ( including the normal interposing colon ) was available after the tapering coloplasty of proximal pouch . it seems prudent that in cases of type v pouch colon , the proximal pouch should always be preserved since there is always some length of interposing normal colon distal to this pouch . the proximal pouch , which is an sdc , has been reported to return to a normal caliber following ostomy of the normal interposing colon . moreover , segmental dilatation of near total colon has been managed by tubularizing coloplasty and postoperative barium enema done at 6 months showed normal caliber colon . in addition , there was no constipation at 1-year follow - up . in these cases if the total length obtained by the coloplasty of the proximal pouch plus the intervening normal colon is sufficient for pull through , the distal pouch can be excised . otherwise , the surgeon can use the distal pouch to gain length if he believes in pouch preservation . | type v is the rarest form of congenital pouch colon with only four cases reported till date .
we report this anomaly in a 6-month - old boy .
he was managed successfully with excision of distal pouch and coloplasty of proximal pouch along with abdominoperineal posterior sagittal anorectoplasty .
we recommend preservation of proximal pouch in such cases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in this work , a meoh - d4 solution of a and 1 was first exposed to 3 bar para - h2 ,
to form [ ir(h)2(imes)(mecn)3]cl , 2 . when this reaction was completed in a magnetic
field ( referred to as the polarization transfer field or ptf ) of 65
g , the resulting h nmr signal for free acetonitrile was
observed 3 s later with an intensity 8-fold larger than its normal ,
fully relaxed level . this is due to sabre and clearly confirms that 1 is able to catalyze the transfer of the spin order of para - h2 into a. however , when the
same sample was reexamined 5 min later , after the introduction of
fresh para - h2 , the enhancement seen for
the protons of a had fallen to 3-fold . while in both
these measurements 2 was seen , it is clearly not itself
an efficient sabre catalyst for a. the fact that stronger
sabre enhancement was seen during the conversion
of 1 into 2 , and hence before the reaction
reached completion , reveals that the introduction of para - h2 into 2 could be limiting . hence we added
phenylacetylene to the meoh - d4 solution
to see if it would increase the hyperpolarization level of a. this approach has been used successfully in related studies to
increase the detectability of metal dihydride complexes by forcing
h2 exchange . however , this
treatment proved unsuccessful here , although weak phip was observed
in the alkenic proton resonances of the product styrene which reflects
the relatively poor hydrogenation activity of 2 ( see supporting information ) . in the light of
this result , a small amount of pyridine was introduced
as a cosubstrate into the reaction system such that the acetonitrile
to pyridine ratio was 20:3 . now the methyl protons signal of a , seen in emission , was 9-fold enhanced and remained observable
at this intensity for over an hour when the polarization transfer
process was repeated . these investigations also revealed that 2 is converted into cis , cis-[ir(h)2(imes)(mecn)(py)2]cl , 3 ( scheme 2 ) . this reactivity matched that predicted
by density function theory ( dft ) calculations which revealed 3 to be more thermodynamically stable than 2 ( see supporting information ) . it also predicted that cis , cis-[ir(h)2(imes)(mecn)2(py)]cl is stable , although 3 is lower in energy .
we conclude based on these observations , and our dft data , that 3 is more efficient at hyperpolarizing a than 2 . the three h signals for free pyridine
were also observed
in this nmr spectrum in emission , with a collective 20-fold enhancement . in contrast , the protons of the axially
bound pyridine ligand of 3 failed to show any observable
hyperpolarization . this tells us that the transfer of polarization
in the plane trans to hydride is more efficient than
that in the plane at right angles to it . 3 yielded h nmr signals for its
two magnetically
inequivalent hydride ligands at 20.56 and
22.12 where the former is trans to acetonitrile
and the latter trans to pyridine ( see supporting information ) . both these hydride signals
show phip in these measurements and when exsy methods are used to
examine 3 , pyridine and a ligand exchange
processes were readily observed . the experimentally determined rate
constant for pyridine loss from 3 proved to be 1.72 and
0.33 s for the equatorial and axial ligands , respectively ,
at 298 k. in contrast , the experimentally determined rate constant
for the loss of a was 10.42 s and ,
therefore , six times larger than that of equatorially bound pyridine . the experimentally determined rate constant for hydride interchange
in 3 proved to be 5.80 s. no evidence
of hydride exchange into h2 was apparent in these measurements ,
even though phip is visible in the hydride signals of 3 . the lifetime of 3 under these sabre conditions was 0.096 s. consequently ,
if polarization transfer into a and pyridine were to
be equally efficient , then the hyperpolarization of a should dominate given its more rapid dissociation . experimentally ,
the reverse is true thus polarization transfer into pyridine must
be far more efficient than into acetonitrile . in the corresponding h these data concur with our
suggestion that 3 hyperpolarizes a and pyridine
by sabre through its j - coupling network . however , polarization transfer in 3 is complicated by the fact that its hydride ligands are both magnetically-
and chemically distinct from one another . this means that sabre transfer
in 3 could proceed not just in the equatorial plane but
also into the axial ligands as they also see different hydride couplings . however , the slower exchange of the axial ligand
allows us to critically demonstrate that it does not receive any direct
polarization transfer . the small cis - hydride coupling ,
therefore , precludes the observation of polarization transfer into
this ligand ( confirmed experimentally as noted above ) . in stark contrast ,
for 2 , transfer proceeds only into the ligands in the
equatorial plane which are trans to hydride . nonetheless , while 3 achieves the 9-fold signal enhancement
of a ( in a ptf of 65 g ) , these measurements were conducted using
a mixing chamber and flow probe apparatus and the results are illustrated in figure 1a . while the field - coil in the mixing chamber on a 0 g setting delivers
a zero field , the resultant field experienced by the sample is better
approximated by the earth s field . therefore , an experimental
setting of zero should be regarded as 0.5 g. this field value was
used in producing the theoretically derived spectra which we compare
to our experimental spectra . experimentally , an emission signal
is seen for the ch3 proton signal of a at
all of the probed ptf values ,
with the maximum signal intensity , corresponding to a 20-fold signal
enhancement , being seen at 80 g. note the convention which we use
here : the hyperpolarized signals appear in emission in contrast to
the thermal signals which appear in absorption . therefore , the enhancement
in the above case is 20-fold with a sign change which technically
could be stated as a 20-fold enhancement . this may appear
somewhat contradictory to some readers and so we have stated enhancements
as positive amounts throughout . likewise , in some of the spectra presented ,
we have inverted the signal phases from those actually observed for
ease of viewing . while 10% pyridine polarization has previously been reported , a 20-fold signal
enhancement still
far exceeds the signal gain achieved using a cryoprobe . here we did not seek to produce an optimized catalytic system ,
although we aimed to develop a strategy to aid in this development . in order to gain insight into the characteristics of hyperpolarization
transfer via sabre , theoretical calculations were performed using
the approach reported previously , the
results of which are shown in figure 1b . these
calculations explore the evolutions of the resulting spin systems
through a spin density operator treatment under the strong coupling
hamiltonian and were performed using mathematica . the theoretical predictions accord well with the observations
made in the experiment . ( a ) plot of the h nmr signal intensity
seen for free
ch3cn as a function of the ptf ( indicated ) ; data produced
by a cd3od solution containing 1 ( 10 mg ) ,
ch3cn ( 0.1 m ) and pyridine ( 0.02 m ) . the level of hyperpolarization observed for the
methyl protons
of acetonitrile can be further increased when the pyridine - h5 used as a cosubstrate is replaced by pyridine - d5 . this is a consequence of the fact that polarization
is not transferred effectively into the h - nuclei of the
deuterated ligands because of the greatly reduced hydride - h j - couplings compared to the hydride - h j - couplings and their frequency difference . instead it is transferred into the polarization transfer receptors of 3 that remain , the three protons of a and potentially
those in the imes ligand . in this case a 60-fold increase in signal
strength for a was observed when the ptf was 80 g rather
than the 20-fold enhancement described earlier . therefore , there is
a net 3-fold increase in acetonitrile signal polarization upon changing
from pyridine - h5 to pyridine - d5 . in order to test more comprehensively the potential
role of the
imes ligand in the polarization transfer process , the analogous complex
with a deuterated imes ligand was prepared . samples consisting of
either 1 or ir(imes - d22)(cod)cl in the presence of 20 equiv of pyridine and
4 equiv of a were then compared and found to give almost
identical enhancements for a after being shaken in either
a ptf of 0.5 or 80 g. a series of exsy measurements on cis , cis-[ir(h)2(imes - d22)(mecn)(py)2]cl revealed that pyridine and a loss occurred on the same time scale to those observed for 1 , within the limits of experimental uncertainty . furthermore ,
vibrational analysis of the co stretch in the two related ir(co)2(nhc)cl complexes revealed a 4 cm difference
in their frequencies and thus is indicative that both the protio and
deuterio nhcs have comparable electron - donating abilities ( confirmed
further by dft calculations ; see supporting information ) . the imes ligand in these complexes , therefore , plays a minimal
role as an acceptor of polarization , and deuteration of the coligand
pyridine clearly provides for the best route to increase sabre efficiency . we note , however , that upon the addition of 1.1 equiv of pcy3 ( cy = cyclohexyl ) to these samples , a significant difference
is observed . the pcy3 ligand binds by displacing the axial
pyridine and forms [ ir(imes)(mecn)(pcy3)(h)2(py ) ] ( 4 ) . thus , the pcy3 ligand
in 4 is placed trans to the imes ligand
and cis to both the hydride ligands . hence when pcy3 is located in the axial position different sabre behavior
is seen and now deuteration of the axial ligand acts to improve efficiency . these observations confirm that polarization transfer into the axial
groups leads to a reduction in sabre activity with some catalysts . as indicated earlier in this paper , our
theoretical calculations ,
in which we assumed a single mecn ligand coming into contact with
the metal center of the catalyst , reproduced the experimental behavior
well for both the h nmr spectra . these calculations show
that the key spin - system parameters in 3 are the 2-bond
hydride hydride coupling , the 5-bond trans hydride - a coupling , and the lifetime of the h these were determined experimentally ; the splitting jhh was measured at 7.6
hz , the transjhh at 2.1 hz , and the lifetime of 3 at 0.096 s.
the lifetime was obtained from the rate of exchange of a with the metal center of 3 determined under saturation
kinetics as necessary for a dissociative process . close agreement
between the theoretical and experimental spectrum resulted when the jhh value was set to 7.6
hz , jhh to 2.1 hz ,
and the complex lifetime set to 0.096 s ( see supporting
information for further details of the parameters used in the
theoretical calculations ) . furthermore , the sign of jhh controls the sign of the coefficient defining
the observed hyperpolarization amplitude , and hence the phase of the
signal , which in this case are both negative . the h nmr signals that were detected in these measurements
were encoded using a /2 pulse . the observed peaks reflect the
measurement of longitudinal magnetization as would be created in a
normal nmr measurement , albeit with much higher absolute amplitude . additionally , the formation of three two - spin order terms , such as
2i1zi2z , and
the three - spin order term , 4i1zi2zi3z , are predicted according to our theoretical modeling to be
formed under sabre in a. however , such two- and three - spin
order terms are not visible after a /2 measurement pulse ( or
indeed any pulse angle ) because the spins are completely magnetically
equivalent . normally , when at least one
nucleus is magnetically inequivalent , opsy ( only parahydrogen spectroscopy )
can be employed to view and differentiate these terms ( see supporting information for description ) . in the
case of a , this should not be possible because of the
magnetic equivalence of the methyl protons . however , a small residual
signal was observed for a in the h double - quantum
filtered opsy spectrum . similar signals were also observed for b and c where their magnitude relative to the
hydride peak at 22.12 was 0.050.1% , whereas
it was 6% for a. given the fact that we are dealing
with the creation of hyperpolarized states , low levels of residual
magnetization might be expected . as well as the h homonuclear longitudinal two - spin
order terms , corresponding polarized coupled states between protons
and the c nuclei are also predicted to be produced simultaneously
via sabre . this provides a route of polarization transfer to c. indeed , it has been reported that c nuclei
can be successfully polarized using sabre . when
a c nmr measurement was made on a sample of a , pyridine - d5 and 3 under
3 bar para - h2 , at the same concentrations
as those listed in figure 1 and following evolution
at a ptf of 0.5 g , a hyperpolarized signal for the quaternary c in natural abundance of free a at 116.7 ppm was observed with a s / n ratio of 11 in a single scan measurement . this appeared as an antiphase quartet with relative intensities 1:1:1:1
and a splitting of 9.2 hz . it is important to note that no signal
was observed for the methyl c resonance in this measurement
( see supporting information ) . in
order to probe polarization transfer to c more
effectively , the c labeled materials b and c shown in scheme 1 were employed together
with 1 and pyridine - d5 . first ,
for b , where the c label is located at the
methyl site , its h signal was observed to hyperpolarize
and yielded a 14-fold enhancement following polarization transfer
in an optimal ptf of 80 g. the drop in h hyperpolarization
level , relative to that seen for a , can be associated
with the extra c nuclear spin , in 100% abundance , which
causes a significant increase in the number of available magnetic
states that can be populated ( many of which are not directly observable ) .
transfer of hyperpolarization to the methyl c nucleus ,
albeit very weak , was also observed ( see figure 2a ) . this signal appeared as a 1:1:3:0.3 multiplet with a 136 hz splitting ,
simulated theoretically in figure 2b , instead
of the expected 1:3:3:1 profile . the difference in intensity between
the hyperpolarized and the thermal nmr spectra was actually very slight . the calculated relative contributions to the spectrum of the thermal
and polarized components are 3:1 . when we monitored the c spectra as a function of ptf we saw no change in the efficiency
of polarization transfer even when the ptf of our apparatus was set
to 0.5 g , in order to minimize the h as noted in the supporting information , this equipment setting does not achieve
a resultant zero field , and the actual field produced by the apparatus
was insufficiently low to produce an effectively enhanced signal . we note , however , that the methyl c resonance can also
be observed as a weakly hyperpolarized signal under inept transfer
from the ch3 protons . our theoretical calculations agreed
with this low level of polarization transfer and showed that a ptf
of 5 mg would be required to effect efficient polarization transfer
into the methyl c nucleus . c nmr spectra
of the methyl c of b obtained after hyperpolarization
in a ptf of 5 g obtained
using eight scans ( a ) and theoretical calculations ( b ) . in contrast , when c is studied , its
quaternary c signal at 116.7 becomes strongly
hyperpolarized
at a ptf of 0.5 g yielding a signal for a 0.1 m sample in a single
shot experiment with a s / n value
of 105 as shown in figure 3a . we obtained excellent
agreement between the experimental and theoretical spectra of free c recorded and calculated following evolution in a ptf of
0.5 g as seen in figure 3b . figure 3c shows , the corresponding ptf plot which reveals
enhancement maxima at 0.5 and 100 g are observed . the bound quaternary c signal for equatorial c of 3 is
also readily observed experimentally at 117.8 . again no significant
hyperpolarization of the methyl c signal was detected
( figure 3a ) . in the corresponding h nmr spectrum , the free methyl group signal enhancement for c was 12-fold at the optimum ptf of 90 g. over the ptf range
of 0140 g , these signals generally appear as antiphase doublets . they are observed with unequal line amplitudes resulting from varying
contributions of the theoretically predicted longitudinal magnetization
and longitudinal two - spin order terms . analysis of the experimental
spectra revealed that the longitudinal two - spin order terms were the
dominant terms at all fields except 90 and 140 g. ( a ) single scan c nmr spectrum of free c ( 116.7 , 15.5
l ) in the presence of 1 ( 10 mg ) and pyridine - d5 ( 3.75 l ) . hyperpolarization transfer was completed in a ptf of 0.5 g. the inset
trace shows the corresponding methyl c - region , magnified
128 times relative to the main trace . the antiphase multiplet at 117.8
ppm is due to the quaternary c signal of bound c in 3 . ( b ) experimental ( upper ) and theoretically
calculated ( lower ) c nmr spectra of the quaternary signal
of c after hyperpolarization in a ptf of 0.5 g ; ( c ) c field plot of c after hyperpolarization transfer
using 1 over the ptf range of 0.5 to 140 g at intervals
of 20 g collected experimentally ( left ) and theoretically calculated
( right ) . h ( a ) and c ( b ) nmr
spectra of a cd3od solution ( 0.6 ml ) consisting of 1 ( 2 mg ) , c ( 3.1 l ) , and pyridine - d5 ( 0.75 l ) obtained using a modified
opsy sequence in which
the double quantum coherence originating from the 2ikzsz starting state ( ik are h and s is c ) was
selected . in the experimental intensity
versus field profile for the quaternary c resonance shown
in figure 3(c ) ,
that is detected after a /2 pulse , a complex intensity variation
with increase in ptf is observed with a reversal of the signals sign
being seen between 120 and 140 g. however , the theoretical model of
these data only produced the signal reversal in this field range when
the rate of loss of c was set to 55 s , corresponding to a residence time of the ligand on the catalyst
of 0.018 s. the profile is also sensitive to small variations in the
hydride hydride jhh coupling . when the experimentally determined rate of exchange of c ( 10.42 s , corresponding to a residence
time of 0.096 s ) is employed in the calculation , the reversal occurs
at around 70 g. we are working to understand this difference . our theoretical calculations involving c confirmed
that sabre creates longitudinal two - spin order terms , 2ikzsz ( k = 1 , 2 , 3 ) , where the ik spins are proton nuclei of the three - spin
methyl group and s is the quaternary carbon . the
terms resulting from these states after a /2 pulse dominate
the spectra . no sz longitudinal
magnetization terms are produced with any meaningful amplitude at
ptf s other than pure ( theoretical ) 0 g. this is because of
the large h the initial magnetization
created after a /2(y ) rf pulse
to c is 2ikzsx and antiphase with
respect to a single jch coupling . further calculation of the evolution of 2ikzsx within
a four - spin system under a weak - coupling hamiltonian during the fid
acquisition obtained the following modulations of the real part of
the observable terms : 90 out - of - phase oscillations with respect
to i2 and i3 , in - phase oscillation with respect to i1 , and 90 out - of - phase oscillations with respect to the chemical
shift of s , all of which are 180 phase shifted
from original 2ikzsx term . the couplings between i1 , i2 , i3 , and s are all equal and this results
in a cos[j ] sin[j ] sin[ ] modulation . it is the combination of these effects that produces
the unusual [ 1:1:1:1 ] multiplet seen in these measurements
( figure 3a ) . three - spin order terms , 4ikzilzsz ,
( k = 1 , 2 ; m = 2 , 3 ; k m ) and four - spin order terms , 8ikzilzimzsz ( k = 1 ; l = 2 , m = 3 ) , are also produced
but with amplitudes an order of magnitude lower than the two - spin
order term . these do not appear to contribute significantly to the
experimentally produced quaternary c spectra . in addition
to their smaller amplitudes , the absence of their contributions could
also be attributable to their relatively fast relaxation ( t1 1 s ) . in fact , only the quaternary c resonance was observed
as an enhanced signal at a ptf of 0.5 g and upon proton decoupling
the expected singlet appeared with diminished intensity . refocusing
of the antiphase coupling did , however , improve the resulting signal
intensity ( see supporting information ) . the standard homonuclear opsy sequence was
modified to create a heteronuclear experiment by the application of
simultaneous /2 pulses to the h and c nuclei in conjunction with coherence selection gradients in the
ratio of 64:80 for h observation and 16:80 for c. this facilitated the selective detection of the theoretically
predicted 2ikzsz longitudinal two - spin order
term through either its ik or s nuclei . typical nmr spectra are shown in parts
a and b of figure 4 that illustrate these observables . it should be noted , that the addition of the c spin
allows the creation of the 4ikzilzsz , term which can also be detected using
the same heteronuclear opsy pulse sequence but with a gradient ratio
of 45.7:80 . however , the resulting h nmr signal had a
very small amplitude ( s / n ratio 19 ) compared with the h signal arising from the two - spin order term ( s / n ratio 995 ) as described and shown in figure 4a . this corresponds with the theoretical calculations
which show the amplitudes of these terms to be 75 smaller than
the two - spin terms . in the case of d , the absence
of any h h coupling between the substrate
and the hydride ligands of 3 results in no visible h or c - hyperpolarization
transfer within the experimental range of ptfs explored here . in this instance , not even the quaternary c could be observed
after 32 scans with repolarization between scans . our theoretical
calculations show no polarization transfer and agree completely with
this result . this situation does not change with time thereby confirming 1 is very inefficient at driving h h nmr spectrum of propionitrile ( 4.6 l ) ,
pyridine - d5 ( 0.75 l ) , and 1 ( 2
mg ) in meoh - d4 after being shaken in a
ptf of 65 g. we extended our experimental
investigations to longer chain molecules
containing cyano groups . in the supporting information , we detail experimental h and c data that
were collected when propionitrile , benzylnitrile , benzonitrile , and trans-3-hexenedinitrile were examined . we note that for
propionitrile , both the ch2 and ch3 protons
were enhanced by 10- and 4-fold , respectively , in the h nmr spectrum . the spectrum can be simplified by the use of pyridine - d5 instead of pyridine - h5 ; the resulting hyperpolarized h nmr spectrum
is shown in figure 5 . in the c
nmr spectrum , recorded after exposure to 3 bar para - h2 in a ptf of 0.5 g , an antiphase multiplet was detected
at 9.4 which is indicative of polarization transfer to the
methyl c nucleus . for benzylnitrile , enhancements of
2- and 18-fold were seen for the benzyl and ch2 proton
signals , respectively , after polarization transfer at a ptf of 65
g. conversely , benzonitrile displayed no enhancement upon exposure
to 3 bar para - h2 at a ptf of 65 g. these
important observations support the hypothesis that polarization transfer
must occur in the first instance via a suitable jhh coupling between the hydride and substrate protons . such a coupling is effectively zero for benzonitrile due to the remote
( six bonds ) location of the substrate proton nearest to the hydride
nucleus in this molecule . trans-3-hexenedinitrile
also proved to polarize via sabre and , interestingly , its alkene functionality
proved resistant to hydrogenation . the ch2 and alkenic
protons were enhanced by 4- and 10-fold , respectively . in this last
case , the preference for either the nitrile or alkene ligating to
the metal was probed using dft . structures were optimized using the
pbe0 functional from adamo and the basis sets from aldrich described
by the def2-svp label . these calculations showed that , in terms of
enthalpy , the dominant form of interaction with the iridium center
was via the nitrile group of trans-3-hexenedinitrile ,
by 105.9 kj mol compared to binding through the
alkenic component , hence reducing the propensity for alkene hydrogenation . it has been noted that in the absence of diisopropylethylamine ( dipea )
ir / phox catalysts are unable to hydrogenate the alkene bond of ,-unsaturated
nitriles due to coordination of two substrate molecules bound through
the nitrile group leading to deactivation of the catalyst . even in the presence of dipea , 50100
bar of h2 this
is despite ,-unsaturated nitriles being easier to hydrogenate
than ,-unsaturated nitriles due to activation by the
nitrile group and increased conjugation . it is , therefore , not surprising that trans-3-hexenedinitrile ,
a ,-unsaturated nitrile , does not hydrogenate under
the conditions we employ here . in summary , the small jhh couplings that exist between hydride
nuclei and the ch2/ch3 protons located directly
next to the cyano group
in a , propionitrile , benzylnitrile , and trans-3-hexenedinitrile are adequate to propagate polarization transfer . this contrasts to the jhh coupling
to the ortho proton in benzonitrile which results
in no detectable polarization transfer . in
this paper , we have proved that hyperpolarization transfer from
the hydride ligands of the polarization transfer catalyst into the
weakly coordinating acetonitrile ligand occurs in a homonuclear fashion
via their spin spin coupling network to the methyl protons
when the polarization transfer field is > 0.5 g. we have also demonstrated
that a range of aromatic and nonaromatic nitrile - containing substrates
can be polarized via sabre , provided that there is a suitable homonuclear
coupling pathway . this is a departure from the aromatic systems that
have been more commonly polarized by sabre . our theoretical
calculations details how the transfer of polarization
to the quaternary c nucleus occurs via the long - range
coupling to the methyl protons rather than directly from the former para - h2 derived hydride nuclei in the catalyst .
according to the theoretical study , it is the fact that this heteronuclear
coupling is of the same order of magnitude as the hydride hydride
coupling that facilitates this process in fields > 0.5 g. in sharp
contrast , the short - range coupling between the methyl
protons and the methyl c nucleus which is an order of
magnitude larger than the hydride the inefficiency of
transfer in this case was predicted in our calculations and observed
as a result experimentally . theoretically , the population of both
homonuclear and heteronuclear two spin order terms within a - c was predicted . a modified opsy sequence , was used
to detect the longitudinal two - spin order existing between h and c to confirm this experimentally . the complete
magnetic equivalence of the methyl protons precludes detection of
this homonuclear state . this situation lowers the efficiency of polarization
transfer into visible states by a theoretically predicted value of
20% at 70.5 g and increases to a maximum of 33% at 90.5 g. this
series of observations have significant implications on how
best to complete any c labeling if sabre is to be used in vivo . for such nitrile containing systems , placing the
label into a site that exhibits a long - range coupling to the sabre
polarized protons is suggested . the theoretical calculations provide
excellent agreement with the experimental observations of the h spectrum and the variations of the spectral amplitudes with
ptf . also the theoretical c spectrum of the methyl c nucleus and the quaternary c nucleus at low
field both provide excellent agreement with experiment . the only departure
from this otherwise excellent agreement is the quaternary c ptf plot profile . here the inversion of the phase of the spectrum
predicted by our models does not occur at the same ptf as the experiment
shows , when the experimentally measured parameters are used in the
model . we
have further demonstrated that the precise identity of the ligands
and their conformation within the complex determines the propagation
of polarization to ligands that are cis to the hydride
ligands . in the complex [ ir(h)2(imes)(mecn)(py)2 ] , no detectable polarization is transferred into the
imes ligand . crucially , the same ptf plot and enhancement levels are
observed regardless of whether or not the imes ligand is deuterated .
however , addition of pcy3 to this complex and subsequent
elimination of pyridine , forms ir(imes)(h)2(mecn)(py)(pcy3 ) , 4 , in which pcy3 is trans to imes and cis to the hydrides . the resulting
enhancement of the protons in a is half of that for the
former complex . in stark contrast , the use of imes - d22 instead of imes , resulted in the enhancement level
being maintained in the presence of pcy3 . it is , therefore ,
possible to control transfer into the axial site by ligand design . we believe that these methods illustrate a viable strategy to develop
sabre for weakly interacting , nonpyridine - based systems . we are currently
exploring alternative catalysts to improve further sabre s
polarization transfer efficiency and signal enhancement levels . such
increases in catalyst efficiency would improve the likelihood that
drug molecules possessing weakly interacting groups , such as nitriles ,
could be polarized by this method . once successfully hyperpolarized
such molecules could potentially feature as contrast agents , or reagents
that enable the study of reaction mechanisms and the detection of
reaction intermediates . an assessment of the steric bulk and ligand
exchange rates will have to be made before the polarization of an
unknown nitrile by sabre can be contemplated . | we report on a strategy for using
sabre ( signal amplification by
reversible exchange ) for polarizing 1h and 13c nuclei of weakly interacting ligands which possess biologically
relevant and nonaromatic motifs .
we first demonstrate this via the
polarization of acetonitrile , using ir(imes)(cod)cl as the catalyst
precursor , and confirm that the route to hyperpolarization transfer
is via the j - coupling network .
we extend this work
to the polarization of propionitrile , benzylnitrile , benzonitrile ,
and trans-3-hexenedinitrile in order to assess its
generality . in the 1h nmr spectrum ,
the signal for acetonitrile
is enhanced 8-fold over its thermal counterpart when [ ir(h)2(imes)(mecn)3]+ is the catalyst .
upon addition
of pyridine or pyridine - d5 , the active
catalyst changes to [ ir(h)2(imes)(py)2(mecn)]+ and the resulting acetonitrile 1h signal enhancement
increases to 20- and 60-fold , respectively . in 13c nmr
studies ,
polarization transfers optimally to the quaternary 13c nucleus of mecn while the methyl 13c is hardly polarized .
transfer to 13c is shown to occur first via the 1h1h coupling between the hydrides and the methyl
protons and then via either the 2j or 1j couplings to the respective 13cs , of which the 2j route is more efficient .
these experimental results are rationalized through a theoretical
treatment which shows excellent agreement with experiment . in the
case of mecn ,
longitudinal two - spin orders between pairs of 1h nuclei in the three - spin methyl group are created .
two - spin order
states , between the 1h and 13c nuclei , are also
created , and their existence is confirmed for me13cn in
both the 1h and 13c nmr spectra using the only
parahydrogen spectroscopy protocol . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
central bronchogenic carcinoma is usually accompanied with cancerous invasion of the main bronchus and pulmonary artery , and therefore the surgical operation to be performed requires bronchial anastomosis and pulmonary angioplasty , which are performed by traditional thoracotomy . video - assisted thoracoscopic surgery ( vats ) is an emerging technology in minimally invasive surgery , which provides painless surgery with a short recovery time . the worldwide experience with vats lobectomy is now sufficiently robust to enable a comparison of this procedure to be made with traditional thoracotomy . in all five lobes of the lung , the stage of the operation that has the greatest difficulty is vats sleeve left upper lobectomy for the special anatomical structure . in the present case report , and application of vats for the treatment of central lung cancer of the upper lobe with invasion of the main bronchus and pulmonary artery is presented . all procedures used in the present case study were approved by the clinical medical research ethics committee of the first affiliated hospital of anhui medical university ( hefei , china ) . a 68-year - old man whose smoking history was 1520 cigarettes per day for 40 years presented with a cough and hemoptysis . in november 2011 , the patient was found to have an abnormal shadow in the left pulmonary hilum , based on a chest x - ray ( fig . 1a ) , and so the patient was referred to our hospital ( the first affiliated hospital of anhui medical university , hefei , china ) for further examination and therapy . physical examination revealed that there were no palpable superficial lymph nodes . blood chemistry data were unremarkable , with the exception of a decreased level of total protein ( tpr ) of 56.1 g / l ) and a slightly increased level of total bilirubin to 19.0 mol / l ( normal range , 5.119.0 mol / l ) . the tumor markers for squamous cell carcinoma ( scc ) antigen ( normal range , 02 ng / ml ) , sialyl ssea-1 antigen ( slx ; normal range , 038 u / ml ) , and neuron - specific enolase ( nse ; normal range , 010 ng / ml ) were slightly increased to 2.6 ng / ml , 44.3 u / ml and 10.12 ng / ml , respectively . bronchoscopy revealed an occlusion in the distal portion of the left main bronchus by a cauliflower - like mass ( fig . an enhanced computed tomography ( ct ) scan ( siemens somatom definition as 64-slice computed tomography system ; siemens healthineers , erlangen , germany ) revealed a well - defined mass of soft tissue , with a coarse edge measuring 3.84.24.0 cm , in the upper lobe of the left lung close to the hilum , and enlarged mediastinal lymph nodes were also identified . the mass appeared to be located on the left upper lobe bronchus , and have pulmonary artery invasion ( fig . pulmonary function tests revealed a moderate obstructive ventilatory disorder and severe abnormality of small airway function . considering all the results collectively , the preoperative stage of the tumor was assessed to be ct2 , n2 , m0 , iiia , and the patient was proposed for a vats lobectomy . a 3.5 cm incision was made as the main operating hole in the third intercostal space of the anterior axillary line position . a thoracoscopic observation hole was made using a 12 cm trocar in the eighth intercostal space of the midaxillary line . in addition , a 3.5 cm incision was made as the operational assist hole , and a further 12 cm trocar was placed in the fifth intercostal space of the posterior axillary line position . the instruments were inserted to start the dissection of the pulmonary ligament and mediastinal pleura , and the superior pulmonary vein was exposed and resected using a 45 mm white linear stapler ( fig . amputation of the pulmonary fissure was performed using an endoscopic linear cutter scalpel ( endo - gia ; covidien llc , mansfield , ma , usa ) , and it was possible to observe that the carcinoma located on the left main bronchus had partly invaded the left pulmonary artery . after having cut and freed the left main bronchus , the left upper lobe was removed in a protective bag , and a systematic lymph node dissection was completed . the left pulmonary artery was repaired using a reciprocating continuous 40 prolene suture ( fig . the proximal occlusion clamp was opened , and subsequently the telecentric end occlusion clamp was opened to make the pulmonary perfusion . after the inferior pulmonary ligament had been divided to release the tension of airway anastomosis , end - to - end anastomosis was initiated . the midpoint of the offside wall of the bronchus was chosen as the starting point , then a 30 prolene continuous suture was used to close the membranous and bronchial cartilage from the posterior to the anterior end , dragging them tight simultaneously with the help of an endoscopic knot - pusher . following the completion of all the procedures , the pathological examination revealed a 2.61.72.7 cm solid carcinoma , which the resultant microscopic examination identified as scc ( fig . 3 ) with one hilar lymph node involvement ( a total of seven lymph nodes were studied ) , leading us to consider that the postoperative stage was pt2 , n1 , m0 , iib . thoracic drainage tubes were removed on the eighth postoperative day , and the patient was discharged from the hospital on the ninth postoperative day . it is now well established that , with the improvements in technique and instrumentation , vats has become a replacement method of choice for a number of procedures that were formerly carried out via thoracotomy ( 1 ) . the advantages of vats for lobectomy have been previously reported , including reduced perioperative pain , shorter hospital stays , a more rapid resumption of normal daily activities , less impairment of pulmonary and shoulder function , reduced rates of cytokine release , and an improved delivery of adjuvant chemotherapy ( 2 ) . central bronchogenic carcinoma often invades the bronchus and pulmonary artery , and sleeve lobectomy with pulmonary arterioplasty or bronchoplasty were traditionally performed with a posterolateral thoracotomy ( 3 ) . however , recently vats sleeve lobectomy was considered as the preferred minimally invasive method in view of its higher operation safety , lower complications , decreased pain and improved quality of life , particularly when the patients presented with long - term smoking , chronic obstructive pulmonary disease and poor pulmonary function , as previously described ( 4 ) . han et al ( 5,6 ) hypothesized that , compared with the open surgery , the vats procedure would generally be likely to be more technically challenging for the transmission from the direct view to a local two - dimensional screen , and from multi - angle , multi - direction operational field to one directional operation field . therefore , in comparative terms , a markedly clearer anatomical view of the travel , distribution and variation of the pulmonary vessels was required . in addition , others have argued that , in vats lobectomy , when all the five lobes are considered , the biggest difficulty of the operation resides with a vats left upper lobectomy due to the deep location , special operation angle and predominant vessel invasion of the tumor , particularly central - type pulmonary tumors ( 7 ) . however , as with all other procedures , vats sleeve lobectomy has had its own learning curve for surgeons . with the accumulation of experience , continuous suture has been able to be used to complete both membranous bronchus and cartilage anastomosis at one time through thoractomy . consequently , surgeons have been able to perform continuous suture to complete end - to - end anastomosis using vats , and to avoid tangling the untied ends . additionally , it was our opinion that the left pulmonary artery could more easily be prone to tumor invasion since the left pulmonary artery trunk is shorter , although it has more branches with more fissions and cross - sections . the left pulmonary artery is not shielded by other vessels lying ahead of it , but the right pulmonary artery is shielded by the superior vena cava . in comparison with the right pulmonary artery , the left pulmonary artery is more readily exposed to invasion by the central type pulmonary carcinoma in the left upper lobe . in order to reserve more pulmonary tissue , it was necessary to perform a pulmonary angioplasty . routinely , pulmonary arterioplasty comprises four operational modes , namely , direct suture , pericardial patch angioplasty , end - to - end anastomosis and pericardial tube replacement ( 8) . from the technical perspective however , the principle of a successful direct suture is to guarantee that there are no obstructions , and no stenosis for the distal section of the artery ; otherwise , pericardial patch angioplasty or end - to - end anastomosis ought to be performed instead ( 9 ) . however , it was our opinion that , courtesy of the improvements in operational proficiency and surgical instruments , the other three operational modes are also able to be completed using vats . the success of totally vats bronchial sleeve lobectomy and pulmonary angioplasty for the left upper lobe would offer more central type lung carcinoma patients the opportunity to accept the minimally invasive operation , and expand the operation indication of totally vats lobectomy . our hope is that total vats bronchial sleeve and pulmonary angioplasty lobectomy will obtain a more widespread application for the surgical treatment of central type lung carcinoma in the future . two major conclusions may be drawn from the present case report : i ) simultaneous end - to - end anastomosis of bronchus and pulmonary angioplasty may be completed using vats . this indicates that vats is applicable for the treatment of central bronchogenic carcinoma with invasion of the main bronchus and pulmonary artery ; and ii ) with the improvements in operational proficiency and surgical instruments , more complicated surgical procedures may also be completed using vats ; therefore , the surgical indications are that the applicability of vats lobectomy as a technique will be expanded in the future . | surgical treatment for central bronchogenic carcinoma with invasion of the main bronchus and pulmonary artery often include bronchial anastomosis and pulmonary angioplasty . as a technique ,
video - assisted thoracoscopic surgery ( vats ) lobectomy has proven to reduce the rate of occurrence of complications , and thereby obtain improved survival rates . in the present case study ,
its use in treating central bronchogenic carcinoma with invasion of the main bronchus and pulmonary artery is reported .
a case study of a 68-year - old man with a history of smoking 1520 cigarettes per day for 40 years is described , who presented with a cough and hemoptysis .
a bronchial sleeve left upper lobectomy and pulmonary angioplasty were performed with complete vats and routine lymph node dissection .
the preoperative diagnosis of squamous cell carcinoma ( scc ) of the lung ( ct2 , n2 , m0 , stage iiia ) was confirmed as scc through the postoperative pathological examination , leading to the tumor staging : pt2 , n1 , m0 , stage iib .
these results were obtained without sacrificing the oncological principles of thoracic surgery .
it has been demonstrated that vats may be applied for treating central bronchogenic carcinoma with invasion of the main bronchus and pulmonary artery . however , end - to - end bronchial anastomosis and continuous suture of the pulmonary artery were difficult to perform , and use of the vats procedure is on a learning curve , which will be informative for surgeons and their assistants . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
centers participating in bari 2d were invited to participate in this substudy , and nine clinical centers ( please see acknowledgments ) agreed . written informed consent for participation in the substudy was obtained from each participant , and the protocol was reviewed by the institutional review board of each participating clinical center . results were reviewed by the data and safety monitoring board of the parent bari 2d study . blood was obtained with the use of a two - syringe technique in which the first 3 ml blood was discarded . blood ( 1 ml ) to be analyzed for platelet reactivity was anticoagulated with 32 g / ml corn trypsin inhibitor ( cti ; enzyme research , south bend , in ) . cti is a specific inhibitor of factor xiia without effect on other coagulation factors ( 11 ) and was used as the anticoagulant because we have shown that the activation of platelets is altered by conventional anticoagulants such as citrate ( 12 ) . activation of platelets was identified with the use of flow cytometry by the binding to platelets of fluorescein isothiocyanate labeled fibrinogen ( that binds to the activated conformer of glycoprotein iib - iiia ) and phycoerythrin - labeled anti - cd62 that binds to p - selectin on the surface of activated platelets ( becton dickinson ) as previously described ( 5,13,14 ) . platelets were identified based on size and binding of a peridinin chlorophyll protein ( percp)-labeled anti - cd61 ( becton dickinson ) , which binds to glycoprotein iiia regardless of activation and does not interfere with the binding of fibrinogen . to quantify nonspecific association of proteins with platelets and to define a threshold above which activation - dependent association occurs , control samples containing phycoerythrin - conjugated nonimmune mouse igg and fluorescein isothiocyanate this measure of platelet activation correlates with subsequent cardiac risk ( 13 ) and with platelet activation reported as the mean fluorescence intensity ( 14 ) . blood to be analyzed for pt1.2 and fpa was added immediately to scat-1 tubes ( hematologic technologies , essex , vt ) . aliquots of plasma were stored at 80c until assay . concentrations of pt1.2 and fpa were determined with the use of commercial enzyme - linked immunosorbent assay ( elisa ) kits ( dade behring [ marburg , germany ] for pt1.2 and vitro chemie [ toernooiveld , the netherlands ] for fpa ) . concentrations of c - reactive protein ( crp ) were determined with the use of a high - sensitivity colorimetric competitive elisa as previously described ( 15 ) . concentrations of fibrinogen were determined by nephelometry ( siemens healthcare diagnostics , deerfield , il ) . fasting lipid profile and a1c assays were performed by the biochemistry core laboratory at the university of minnesota , minneapolis . for those patients for whom the core lab measures were unavailable , an estimate based on site - specific regression of the clinical site measure was used . this estimation was used for 2.5% of the triglycerides samples and 0.5% for a1c samples . we report results from patients in which at least 80% of significant baseline data points were available for analysis ( n = 201 ) . patients treated with either ticlopodine or clopidogrel were excluded from this analysis ( n = 8) because a primary measure was adp - induced activation of platelets . this study group ( n = 193 ) enabled us to identify for 1 sd change in the independent variable a regression coefficient of 0.20 for 1 sd change in a dependent variable with a power of 0.77 . because platelet reactivity results and those for markers of thrombosis were not normally distributed , spearman 's rank correlation estimates were used to evaluate relationships among the thrombosis markers and other variables of interest including bmi , a1c , lipids , and insulin . blood was obtained with the use of a two - syringe technique in which the first 3 ml blood was discarded . blood ( 1 ml ) to be analyzed for platelet reactivity was anticoagulated with 32 g / ml corn trypsin inhibitor ( cti ; enzyme research , south bend , in ) . cti is a specific inhibitor of factor xiia without effect on other coagulation factors ( 11 ) and was used as the anticoagulant because we have shown that the activation of platelets is altered by conventional anticoagulants such as citrate ( 12 ) . activation of platelets was identified with the use of flow cytometry by the binding to platelets of fluorescein isothiocyanate labeled fibrinogen ( that binds to the activated conformer of glycoprotein iib - iiia ) and phycoerythrin - labeled anti - cd62 that binds to p - selectin on the surface of activated platelets ( becton dickinson ) as previously described ( 5,13,14 ) . platelets were identified based on size and binding of a peridinin chlorophyll protein ( percp)-labeled anti - cd61 ( becton dickinson ) , which binds to glycoprotein iiia regardless of activation and does not interfere with the binding of fibrinogen . to quantify nonspecific association of proteins with platelets and to define a threshold above which activation - dependent association occurs , control samples containing phycoerythrin - conjugated nonimmune mouse igg and fluorescein isothiocyanate this measure of platelet activation correlates with subsequent cardiac risk ( 13 ) and with platelet activation reported as the mean fluorescence intensity ( 14 ) . blood to be analyzed for pt1.2 and fpa was added immediately to scat-1 tubes ( hematologic technologies , essex , vt ) . concentrations of pt1.2 and fpa were determined with the use of commercial enzyme - linked immunosorbent assay ( elisa ) kits ( dade behring [ marburg , germany ] for pt1.2 and vitro chemie [ toernooiveld , the netherlands ] for fpa ) . concentrations of c - reactive protein ( crp ) were determined with the use of a high - sensitivity colorimetric competitive elisa as previously described ( 15 ) . concentrations of fibrinogen were determined by nephelometry ( siemens healthcare diagnostics , deerfield , il ) . fasting lipid profile and a1c assays were performed by the biochemistry core laboratory at the university of minnesota , minneapolis . a1c concentrations were analyzed by high - performance liquid chromatography . for those patients for whom the core lab measures were unavailable , an estimate based on site - specific regression of the clinical site measure was used . this estimation was used for 2.5% of the triglycerides samples and 0.5% for a1c samples . we report results from patients in which at least 80% of significant baseline data points were available for analysis ( n = 201 ) . patients treated with either ticlopodine or clopidogrel were excluded from this analysis ( n = 8) because a primary measure was adp - induced activation of platelets . this study group ( n = 193 ) enabled us to identify for 1 sd change in the independent variable a regression coefficient of 0.20 for 1 sd change in a dependent variable with a power of 0.77 . because platelet reactivity results and those for markers of thrombosis were not normally distributed , spearman 's rank correlation estimates were used to evaluate relationships among the thrombosis markers and other variables of interest including bmi , a1c , lipids , and insulin . metabolic syndrome is defined by two of the following : large waist circumference , high triglycerides , low hdl cholesterol , or high blood pressure . pvd is defined as any of abi 0.9 , carotid stent , carotid disease , carotid surgery , intermittent claudication , and non - coronary vascular surgery . evidence of thrombin generation ( pt1.2 ) and thrombin activity ( fpa ) was limited in these patients with stable coronary artery disease ( table 2 ) . similarly , evidence of platelet activation in the absence of agonist was minimal , whether assessed by the percentage of platelets that bound fibrinogen ( reflecting activation of glycoprotein iib - iiia ) or the surface expression of p - selectin ( table 2 ) . the concentration of fibrinogen correlated positively with that of pt1.2 ( r = 0.17 , p = 0.034 ) but did not correlate with the concentration of fpa ( p = 0.24 ) . to assess the propensity of platelets to activate in response to a stimulus ( i.e. , platelet reactivity ) , platelets 1 ) . the activation of platelets identified by the surface expression of p - selectin in the absence of agonist and in the presence of 0.2 and 1 mol / l adp correlated positively ( the correlation coefficient between 0.2 and 1 mol / l adp was 0.85 , between no agonist and 0.2 mol / l was 0.58 , and between no agonist and 1 mol / l adp was 0.51 ; for each association , p < 0.0001 ) . correlations between the activation of glycoprotein iib - iiia seen with each concentration of adp were not as strong but were still positive . the correlation coefficient between the percentage of platelets that bound fibrinogen with no agonist and in response to 0.2 mol / l adp was 0.31 ; between 0.2 and 1 mol / l adp , it was 0.64 ( p < 0.0001 for both ) . the correlation coefficient between no agonist and 1 mol / l adp was 0.12 ( p = 0.12 ) . the activation of platelets induced by 0.2 mol / l adp and 1 mol / l adp was quantified with the use of flow cytometry based on the surface expression of p - selectin or the binding of fluorochrome - labeled fibrinogen . each box plot of the distribution of the percentage of platelets activated shows the median ( line ) , the 25th and 75th percentile ( box ) , and the 10th and 90th percentile ( error bars ) . greater bmi was associated with greater platelet reactivity as assessed by the surface expression of p - selectin ( fig . after adjustment for age , sex , a1c , use of insulin , and duration of diabetes in a linear model of platelet reactivity , the relationship between platelet reactivity and bmi remained significant ( table 3 ) . a similar magnitude of increase was seen in the small group ( n = 19 ) of subjects who were not taking aspirin at the time when blood was taken ( data not shown ) . identification of platelet activation based on the binding of fibrinogen ( activation of glycoprotein iib - iiia ) did not correlate with bmi . by contrast , the concentration of fibrinogen correlated with bmi ( r = 0.21 , p = 0.004 ) . correlation between the activation of platelets identified by the surface expression of p - selectin in response to 1 mol / l adp and bmi in patients with diabetes . because the activation of platelets was not normally distributed , the results were log transformed . pearson correlation coefficient and p value are shown . the inset is a box plot showing the distribution of platelet activation in patients with a lean bmi ( < 25 kg / m ) , overweight patients ( bmi 2530 kg / m ) , obese patients ( bmi 3035 kg / m ) , and morbidly obese patients ( > 35 kg / m ) . linear model of log ( platelet surface expression of p - selectin [ activation ] ) in response to 1 mol / l adp obesity has been associated with poor glycemic control , hypertriglyceridemia , inflammation ( reflected by an increased crp ) , and insulin resistance ( 16,17 ) . a1c correlated negatively with platelet reactivity in response to 1.0 mol / l adp ( s = 0.16 , p < 0.04 ) . the fasting concentration of insulin did not correlate with platelet reactivity ( rs = 0.14 , p = 0.07 ) . metabolic syndrome is defined by two of the following : large waist circumference , high triglycerides , low hdl cholesterol , or high blood pressure . pvd is defined as any of abi 0.9 , carotid stent , carotid disease , carotid surgery , intermittent claudication , and non - coronary vascular surgery . evidence of thrombin generation ( pt1.2 ) and thrombin activity ( fpa ) was limited in these patients with stable coronary artery disease ( table 2 ) . similarly , evidence of platelet activation in the absence of agonist was minimal , whether assessed by the percentage of platelets that bound fibrinogen ( reflecting activation of glycoprotein iib - iiia ) or the surface expression of p - selectin ( table 2 ) . the concentration of fibrinogen correlated positively with that of pt1.2 ( r = 0.17 , p = 0.034 ) but did not correlate with the concentration of fpa ( p = 0.24 ) . to assess the propensity of platelets to activate in response to a stimulus ( i.e. , platelet reactivity ) , platelets 1 ) . the activation of platelets identified by the surface expression of p - selectin in the absence of agonist and in the presence of 0.2 and 1 mol / l adp correlated positively ( the correlation coefficient between 0.2 and 1 mol / l adp was 0.85 , between no agonist and 0.2 mol / l was 0.58 , and between no agonist and 1 mol / l adp was 0.51 ; for each association , p < 0.0001 ) . correlations between the activation of glycoprotein iib - iiia seen with each concentration of adp were not as strong but were still positive . the correlation coefficient between the percentage of platelets that bound fibrinogen with no agonist and in response to 0.2 mol / l adp was 0.31 ; between 0.2 and 1 mol / l adp , it was 0.64 ( p < 0.0001 for both ) . the correlation coefficient between no agonist and 1 mol the activation of platelets induced by 0.2 mol / l adp and 1 mol / l adp was quantified with the use of flow cytometry based on the surface expression of p - selectin or the binding of fluorochrome - labeled fibrinogen . each box plot of the distribution of the percentage of platelets activated shows the median ( line ) , the 25th and 75th percentile ( box ) , and the 10th and 90th percentile ( error bars ) . greater bmi was associated with greater platelet reactivity as assessed by the surface expression of p - selectin ( fig . after adjustment for age , sex , a1c , use of insulin , and duration of diabetes in a linear model of platelet reactivity , the relationship between platelet reactivity and bmi remained significant ( table 3 ) . a similar magnitude of increase was seen in the small group ( n = 19 ) of subjects who were not taking aspirin at the time when blood was taken ( data not shown ) . identification of platelet activation based on the binding of fibrinogen ( activation of glycoprotein iib - iiia ) did not correlate with bmi . by contrast , the concentration of fibrinogen correlated with bmi ( r = 0.21 , p = 0.004 ) . correlation between the activation of platelets identified by the surface expression of p - selectin in response to 1 mol / l adp and bmi in patients with diabetes . because the activation of platelets was not normally distributed , the results were log transformed . pearson correlation coefficient and p value are shown . the inset is a box plot showing the distribution of platelet activation in patients with a lean bmi ( < 25 kg / m ) , overweight patients ( bmi 2530 kg / m ) , obese patients ( bmi 3035 kg / m ) , and morbidly obese patients ( > 35 kg / m ) . linear model of log ( platelet surface expression of p - selectin [ activation ] ) in response to 1 mol / l adp obesity has been associated with poor glycemic control , hypertriglyceridemia , inflammation ( reflected by an increased crp ) , and insulin resistance ( 16,17 ) . a1c correlated negatively with platelet reactivity in response to 1.0 mol / l adp ( s = 0.16 , p < 0.04 ) . the fasting concentration of insulin did not correlate with platelet reactivity ( rs = 0.14 , p = 0.07 ) . in this substudy of bari 2d , we assessed markers of thrombin generation and activity as well as platelet reactivity in blood from patients with type 2 diabetes and stable coronary artery disease . activity of the coagulation cascade was limited , as was evidence of platelet activation in the absence of agonist . we assessed platelet reactivity by determining the propensity of platelets to activate in response to an agonist ( 0.2 and 1 mol / l adp ) . we found that greater bmi was associated with progressively greater platelet reactivity when platelet activation was assessed by the surface expression of p - selectin induced by 1 mol / l adp . thus , our results suggest that obesity increases platelet p - selectin expression in patients with type 2 diabetes . increased platelet reactivity has been associated with a greater risk of subsequent cardiac events in apparently healthy subjects ( 18 ) , in patients with previous myocardial infarction ( 19 ) , and in patients undergoing percutaneous coronary intervention ( 13 ) . our results suggest that obesity may increase further the risk of subsequent cardiovascular events in patients with type 2 diabetes by increasing platelet reactivity . consistent with our results , previous studies have demonstrated increased activation of platelets in obese subjects . in one study , platelet activation was identified based on measurement of a thromboxane metabolite in urine and the concentration in blood of the cd40 ligand . both were increased in obese compared with lean women , and successful weight loss led to decreased concentrations of these markers ( 9 ) . a second study quantified the concentration in blood of platelet - derived microparticles that are released during the activation of platelets . similar to the previous study , the concentration of microparticles decreased after weight reduction ( 10 ) . our results are consistent with and extend these observations to patients with type 2 diabetes . aspirin was used in the majority ( 89% ) of the subjects we studied . the relationship between obesity and platelet reactivity was of similar magnitude in patients regardless of aspirin use or nonuse . these results are consistent with the limited efficacy of aspirin in patients with diabetes ( 20 ) . one mechanism that may contribute to limited efficacy of antiplatelet therapy in such patients is persistently increased platelet reactivity . our results suggest that obesity may be a cause of persistently increased platelet reactivity in patients with diabetes and thereby contribute to a lack of efficacy of aspirin . we did not identify an association between the concentration in blood of crp and platelet reactivity . by contrast , evidence of platelet activation has been associated with concentrations of crp in obese women without diabetes ( 21 ) . in our study , all patients had type 2 diabetes , and platelet reactivity was assessed ex vivo . the previous study compared markers of platelet activation in vivo in obese and nonobese women without diabetes . in addition , the consistent use of statins may have decreased crp and obscured a potential interaction ( 22 ) . thus , differences in the clinical characteristics of patients and the methods used to assess platelet reactivity may account for the lack of association in our study . although we did not specifically measure insulin sensitivity , obesity and increased concentrations of insulin in fasting blood have been associated with insulin resistance ( 16 ) . the strong positive association that we observed between obesity and platelet reactivity is consistent with our hypothesis that insulin sensitivity influences platelet reactivity when identified based on the surface expression of p - selectin and only in response to 1 mol / l adp . this correlation was not apparent when activation of platelets was identified based on the binding of fibrinogen . however , we have previously observed that platelet activation identified based on surface expression of p - selectin is altered by associated conditions or treatments ( 5,23 ) . one mechanism potentially contributing is that activation of glycoprotein iib - iiia occurs with a low concentration of agonist ( 13 ) . thus , the low threshold for activation of glycoprotein iib - iiia may limit sensitivity for detection of changes . as seen in fig . 1 , surface expression of p - selectin was limited in response to 0.2 mol / l adp . thus , the discrimination of inter - individual differences is reduced when the range of platelets activated is limited . accordingly , we postulate that the lack of statistical significance between bmi and surface expression of p - selectin in response to 0.2 mol / l adp reflected the limited discrimination between individuals because of the limited range of activation . our study does not identify the mechanism by which insulin resistance increases platelet reactivity . previous work has associated obesity with impaired synthesis and activity of cyclic nucleotides ( i.e. , cyclic adenosine monophosphate and cyclic guanosine monophosphate ) , which are key signaling molecules involved in the activation of platelets ( 24 ) . in summary , we found that obesity is associated with greater platelet reactivity in patients with type 2 diabetes and stable coronary artery disease . our results extend previous observations made in subjects without diabetes to subjects with diabetes and suggest that insulin resistance that is associated with obesity increases platelet reactivity that may in turn increase the risk of subsequent cardiac events in patients with type 2 diabetes . | objectiveto determine whether obesity increases platelet reactivity and thrombin activity in patients with type 2 diabetes plus stable coronary artery disease.research design and methodswe assessed platelet reactivity and markers of thrombin generation and activity in 193 patients from nine clinical sites of the bypass angioplasty revascularization investigation 2 diabetes ( bari 2d ) .
blood taken at the time of enrollment was used for assay of the concentration of prothrombin fragment 1.2 ( pt1.2 , released when prothrombin is activated ) and fibrinopeptide a ( fpa , released when fibrinogen is cleaved ) .
platelet activation was identified with the use of flow cytometry in response to 0 , 0.2 , and 1 mol / l adenosine diphosphate ( adp).resultsconcentrations of fpa , pt1.2 , and platelet activation in the absence of agonist were low .
greater bmi was associated with higher platelet reactivity in response to 1 m adp as assessed by surface expression of p - selectin ( r = 0.29 , p < 0.0001 ) but not reflected by the binding of fibrinogen to activated glycoprotein iib - iiia .
bmi was not associated with concentrations of fpa or pt1.2 .
platelet reactivity correlated negatively with a1c ( p < 0.04 ) , was not related to the concentration of triglycerides in blood , and did not correlate with the concentration of c - reactive peptide.conclusionsamong patients enrolled in this substudy of bari 2d , a greater bmi was associated with higher platelet reactivity at the time of enrollment .
our results suggest that obesity and insulin resistance that accompanies obesity may influence platelet reactivity in patients with type 2 diabetes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
isolates were obtained from 304 milk samples of 248 cows from 8 farms in portugal that were included in the study . detailed information regarding isolation methods and identification of field isolates by biochemical methods was described in a study of the subclinical mastitis associated pathogen s. uberis ( 4 ) . to confirm identification of s. dysgalactiae subsp . dysgalactiae , the 16s rrna gene was amplified by pcr and sequenced ( 5 ) . smai / cfr9i - digested dna banding patterns were obtained by pulsed - field gel electrophoresis for clone identification as described ( 4 ) . primers used and conditions for pcr were essentially as described elsewhere ( appendix table ) . samples without dna and strains lacking ( negative ) or carrying ( positive ) specific genes were used as controls in the pcr . sequencing of all virulence gene amplicons was performed with the same primers used for amplification ( stab - vida , lisbon , portugal ) . all sequences were compared with sequences in genbank by using the blast alignment tool ( www.ncbi.nlm.nih.gov/blast ) . antimicrobial drug resistance against macrolides ( erythromycin ) , lincosamides ( pirlimycin ) , and tetracycline was determined as described ( 10 ) . macrolide resistance phenotypes identified were m ( resistance to macrolides ) and mlsb ( resistance to macrolides , lincosamides and streptogramins b ) . we detected bacteriophage - associated virulence genes spem , spek , spec , spd1 , and spel . overall , spem was found in 10 ( 55.6% ) of 18 bovine gcs isolates , spek in 9 ( 50% ) , spec and spd1 in 6 ( 33% ) , and spel in 4 ( 22.2% ) . tn1207.3/10394.4 composite transposon left junction amplicon showed a size of 380 bp instead of 4536,807 bp as described for gas ( 9 ) . the emm gene encoding the antiphagocytic m surface protein was not amplified in any of the 18 bovine gcs isolates ; therefore , no emm types were obtained . subsets of isolates were erythromycin and pirlimycin resistant ( mlsb phenotype ) and contained erm(b ) or erm(a ) genes ( 22.2% ) or erythromycin susceptible and pirlimycin resistant and contained the linb gene ( 16.6% ) . all isolates were tetracycline resistant with a subset ( 66.7% ) carrying tet(m ) or tet(o ) tetracycline resistance determinants . distribution of bacteriophage - associated virulence genes and other characteristics of strains are shown in figure 1 . dendrogram and pulsed - field gel electrophoresis ( pfge ) profiles of group c streptococci ( streptococcus dysgalactiae subsp . pfge type - subtype , virulence genotype , antimicrobial drug resistance phenotypes , and genotypes of each isolate are indicated . the dendrogram was produced by using dice coefficients and unweighted pair group method using arithmetic averages . default clustering settings of 0.00% optimization ( i.e. , the relative distance an entire lane is allowed to shift in matching attempts ) and 1.5% band position tolerance were used . * all isolates were negative for spea , ssa , speh , spej , spei , and slaa genes and for tn1207.3/10394.4 element right junction tested by pcr ; * * all isolates were negative for mefa , tet(t ) , tet(w ) , tet(l ) , tet(q ) , tet(s ) and tet(k ) genes tested by pcr ; tet , resistance only to tetracycline ; mlsb - tet , resistance to macrolides , lincosamides , streptogramin b , and tet ; l - tet , susceptibility to macrolides and resistance to lincosamides ( l phenotype ) and tet ; tn1207.3 lj , tn1207.3/10394.4 element left junction . sequences of all virulence genes were compared by using the bioedit sequence alignment editor ( www.mbio.ncsu.edu/bioedit/bioedit.html ) . one different allele was found for each of the following gene sequences : spd1 ( among 6 strains ) , spec ( among 6 strains ) , and spel ( among 4 strains ) . two alleles were found for spek ( among 9 strains ) ( spek-1 and spek-2 ) , and 4 alleles were found for spem gene sequences ( among 10 strains ) ( spem-1 , spem-2 , spem-3 , and spem-4 ) . bovine alleles had sizes of 386 bp ( spd1 ) , 222 bp ( spec ) , 444 bp ( spel ) , 232 bp ( spek ) , and 357 bp ( spem ) . examples of alignments between bovine virulence gene alleles with sequences from genbank ( only most similar ones ) are shown in figure 2 . dysgalactiae ) alleles of virulence genes from 8 dairy herds , portugal , with sequences from the national center for biotechnology ( bethesda , md , usa ) database showing base differences between sequences . a ) spd1 ( 99% maximum identity ) ; b ) spek ( 99% maximum identity ) ; c ) spec ( 99% maximum identity ) ; d ) spel szem ( 99% maximum identity ) ; e ) spel ( 97% maximum identity ; f ) spem alleles 1 , 2 , and 3szel ( 98%99% maximum identity ) ; g ) spem allele 4 ( 98% maximum identity ) . s. equi . zoo . dysgalactiae strains ( 55.6% ) carried > 1 gas - specific bacteriophage virulence - associated genes ( spd1 , spec , spek , spel , and spem ) . this finding suggested that bacteriophages may also play a role in the genetic plasticity and virulence of animal gcs . the spel allele from bovine strains showed higher similarity with the szem allele ( 99% maximum identity ) from s. equi subsp . this organism causes mastitis in cows and mares and is most frequently found in horses ( 14 ) . we also observed that 3 of the spem alleles found among bovine strains ( spem-1 , spem-2 , and spem-3 ) also showed higher similarity with superantigen - encoding gene szel from s. equi subsp . another allele ( spem-4 ) showed higher similarity with the sdm gene from s. dysgalactiae subsp . the remaining alleles ( spd1 , spec , spek-1 , and spek-2 ) from the gcs s. dysgalactiae subsp . dysgalactiae bovine strains showed high similarity with s. pyogenes superantigen genes ( 98%99% maximum identity ) . this finding supports our hypothesis that gas prophages may play a role in the genetic plasticity of this pathogen . the spec and spd1 genes are known to be localized on the same gas prophage ( 15 ) , and both genes were detected in 6 bovine gcs s. dysgalactiae subsp . dysgalactiae bovine isolates in this study were typed by emm - typing because amplification products in the pcr specific for the m surface protein gene emm were not obtained . this result is consistent with those of a report that -hemolytic , but not -hemolytic , group c s. dysglacatiae subsp . amplification ( 380-bp product ) of the left junction of the composite transposon in bovine isolates suggests that this mobile element may be inserted in a similar location , the comec locus , as mapped in s. pyogenes and s. dysglactiae subsp . specific for any of the junctions of this element have been reported in other studies and attributed to possible lack of homology between the target and primers used ( 9 ) . detection of the linb gene carried by a large conjugative plasmid ( 13 ) in 3 of 18 bovine gcs s. dysgalactiae subsp . our findings indicate that -hemolytic bovine gcs isolates , which are known to be environmental or contagious pathogens and a cause of bovine mastitis , may be reservoirs of virulence genes encoded by prophages of human - specific gas . these genes encode exotoxins , superantigens , and streptodornases , which are responsible for gas virulence and pathogenesis , and may be transferred to other streptococci of human origin by horizontal genetic transfer . therefore , -hemolytic isolates should not be disregarded as putative infectious disease agents in humans . genes analyzed by pcr and primers used , for group c streptococci , from 8 dairy herds , portugal | phage - encoded virulence genes of group a streptococci were detected in 10 ( 55.6% ) of 18 isolates of group c streptococci that had caused bovine mastitis .
bovine isolates carried other genetic determinants , such as composite transposon tn1207.3/10394.4 ( 100% ) and antimicrobial drug resistance genes erm(b)/erm(a ) ( 22.2% ) , linb ( 16.6% ) , and tet(m)/tet(o ) ( 66.7% ) , located on mobile elements . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in recent years , a significant increase in the incidence of pulmonary tuberculosis ( ptb ) in prisons is reported both in the major industrialized countries and the developing countries ( 1 - 6 ) . epidemic of human immunodeficiency virus ( hiv ) infection among intravenous drug users ( idu ) in the prison is a major cause of this increase ( 7 - 11 ) . another important event in the recent years regarding ptb and prison is mdr - tb epidemic and increasing mortality from tuberculosis ( 12 - 16 ) . increase of tuberculosis in prisons in the other countries , including the developing countries , is also a notable event in the epidemiology of tuberculosis ( 3 , 5 , 17 ) . cohort studies showed a significant association between length of stay in prison and the risk of pulmonary tuberculosis ( 8) . in the developed countries , the important role of prisons in the tb epidemic is proven in many studies ( 2 , 4 , 6 , 18 ) . dna studies on mycobacterium tuberculosis isolated from ptb patients showed that over 40% of pulmonary tuberculosis cases were transmitted by person to person rout and not via reactivation of latent tb ( 19 ) . more than two third of ptb new cases are associated with hiv co - infection ( 19 ) . in addition to hiv infection , another reason for the increase in ptb among prisoners is that prisons are overcrowded . these facts suggest that the incidence of tb infection in prisons plays an important role in ptb epidemic in the society ( 1 , 17 , 19 ) . in our country the number of prisoners per year is low , compared to some neighboring countries and even the united states and some european countries , but in recent years the number of drug - related detainees has increased [ judicial official reports , maava newsletter ] . although the exact number of prisoners per year in the province is unclear , in regard to prison entrance rate of 280 per 100'000 population declared by the local law speaker [ maava , 2014 ] , it is estimated that between 12000 and 13000 peoples are imprisoned annually in the province . mycobacterium tuberculosis is spread through the unfavorable prison conditions such as the overcrowded population , improper ventilation , poor nutrition , inadequate health care , etc . prisons , as an important infection reservoir , pump the ptb into the community by the staff , visitors and improperly treated prisoners ( 17 ) . the prevalence of ptb in the patients with a history of imprisonment is not known in the region . regarding to the fact that a significant portion of those detained in the province are associated with injection drug use , and a majority of hiv cases in the region are injecting drug users , this study was carried out . the current study aimed to assess the prevalence and the risk factors of pulmonary tuberculosis in patients with a history of imprisonment . as part of a large retrospective study , medical files of patients with tuberculosis in the khuzestan health center ( khc ) , from 2005 to 2010 were reviewed . the tuberculosis cases were studied in khuzestan province ( excluding dezful and shush ) in the southwest of iran with a population of about 3.8 million people . patients with pulmonary tuberculosis were placed in two groups as : inmate prison ( ip ) group ( with a history of imprisonment ) and non - inmate prison ( nip ) group ( patients without a history of imprisonment ) data extracted from the patients ' records included demographic characteristics , clinical symptoms , microbiological findings and the control measures such as response to treatment , treatment failure , and mortality in both groups were compared . medical files of 363 tb patients in ip group and 4199 tb patients in nip group in khuzestan health center were reviewed . to compare data related to ptb , records of 291 patients in the ip group and 2640 patients in the nip group were analyzed . inclusion criteria were new documented ptb , and diagnosed based on national tuberculosis program ( ntp ) . exclusion criteria were old tb , treatment failure or relapsed tb and the patients under treatment of anti tb drugs . smear positive pulmonary tuberculosis ( sppt ) : cases with at least two sputum smear positive for acid fast bacillus ( ssp - afb ) , or a chest radiography suggestive of tuberculosis plus one ssp - afb , or sputum culture positive for m. tuberculosis and one ssp - afb were defined as smear positive pulmonary tuberculosis ( ptb+ ) . one to nine afb per 100 microscopic fields ( x100 ) were considered positive , 10 to 99 afb per 100 microscopic fields ( 100x ) were defined as 1 + , 1 - 10 afb per 1 microscopic fields ( 100x ) as 2 + , and more than 10 afb per microscopic field ( 100x ) as 3+.smear negative pulmonary tuberculosis ( snpt ) : cases with clinical findings suggestive of tb plus three sputum smear negative afb ( ssn - afb ) after two weeks of antibiotic therapy plus c - x - ray ( suggestive tb ) were defined as smear negative pulmonary tuberculosis ( ptb- ) . hiv infection was diagnosed on the basis of 2enzyme - linkedimmunosorbentassays ( elisa ) test and the confirmatory western blotting test . patients were considered as diabetic if they had baseline diagnosis of diabetes mellitus ( dm ) , self - reporting who were taking oral anti - dm drugs ( hypoglycemic ) , or fbs equal or more than 126 mg / dl or 200 mg / dl or more for random samples . spss software system , version 16 was used to derive descriptive statistics and the subsequent multivariable analyses . chi - square and fisher exact test were used to compare data in both groups . as part of a large retrospective study , medical files of patients with tuberculosis in the khuzestan health center ( khc ) , from 2005 to 2010 were reviewed . the tuberculosis cases were studied in khuzestan province ( excluding dezful and shush ) in the southwest of iran with a population of about 3.8 million people . patients with pulmonary tuberculosis were placed in two groups as : inmate prison ( ip ) group ( with a history of imprisonment ) and non - inmate prison ( nip ) group ( patients without a history of imprisonment ) data extracted from the patients ' records included demographic characteristics , clinical symptoms , microbiological findings and the control measures such as response to treatment , treatment failure , and mortality in both groups were compared . medical files of 363 tb patients in ip group and 4199 tb patients in nip group in khuzestan health center were reviewed . to compare data related to ptb , records of 291 patients in the ip group and 2640 patients in the nip group were analyzed . inclusion criteria were new documented ptb , and diagnosed based on national tuberculosis program ( ntp ) . exclusion criteria were old tb , treatment failure or relapsed tb and the patients under treatment of anti tb drugs . smear positive pulmonary tuberculosis ( sppt ) : cases with at least two sputum smear positive for acid fast bacillus ( ssp - afb ) , or a chest radiography suggestive of tuberculosis plus one ssp - afb , or sputum culture positive for m. tuberculosis and one ssp - afb were defined as smear positive pulmonary tuberculosis ( ptb+ ) . one to nine afb per 100 microscopic fields ( x100 ) were considered positive , 10 to 99 afb per 100 microscopic fields ( 100x ) were defined as 1 + , 1 - 10 afb per 1 microscopic fields ( 100x ) as 2 + , and more than 10 afb per microscopic field ( 100x ) as 3+.smear negative pulmonary tuberculosis ( snpt ) : cases with clinical findings suggestive of tb plus three sputum smear negative afb ( ssn - afb ) after two weeks of antibiotic therapy plus c - x - ray ( suggestive tb ) were defined as smear negative pulmonary tuberculosis ( ptb- ) . hiv infection was diagnosed on the basis of 2enzyme - linkedimmunosorbentassays ( elisa ) test and the confirmatory western blotting test . patients were considered as diabetic if they had baseline diagnosis of diabetes mellitus ( dm ) , self - reporting who were taking oral anti - dm drugs ( hypoglycemic ) , or fbs equal or more than 126 mg / dl or 200 mg / dl or more for random samples . spss software system , version 16 was used to derive descriptive statistics and the subsequent multivariable analyses . chi - square and fisher exact test were used to compare data in both groups . during the study period , from 2005 to 2010 , local tb units reported 4562 patients with tuberculosis to national tb surveillance system in khuzestan health center that 363 ( 7.9% ) of them were prison inmates at the time of tb diagnosis ( table 1 ) . the average number of persons with tb in each year was 61 cases and the annual tb case rate among the prison inmates was 403.3 per 100000 . the annual tb case rate in the general population during this period was 16.4 per 100'000 ; the figures indicated that the risk of tb in prisons was about 24 times more than the general population . from 2005 to 2010 the percentage of inmate tb cases decreased from 12.3% of total tb cases to 5.3 % showing the decline rate of 56.9% , while trend of tuberculosis in the general population through this period of time remained relatively constant ( table 1 ) . the rate of tb cases in the general population from 19.6 per 100'000 in 2005 reached 19.2 per 100'000 in 2010,while inmate tb case rate from 760 per 100000 in 2005 , significantly decreased to 328 per 100000 in 2010 ( table 2 ) . during these years , new cases of pulmonary tb ( ptb ) among inmate prison decreased from 656 per 100000 in 2005 to 240 per 100'000 in 2010 , a decline rate of 63.4 % whereas new ptb case rate in the general population was relatively unchanged , from 12.8 per 100'000 in 2005 to 11.1 per 100000 in 2010 , a decline rate of 13.2% ( table 2 ) . mean age of tb case among the inmates was 31.1 years and within the general population was 34.6 years . all patients with tuberculosis in the prisons were male while 80% of tb cases in the general population were male and 20% female . thirty nine subjects had a body weight of less than 45 kg , two patients in the ip group and 37 in the nip group . detection rate of smear positive pulmonary tuberculosis in prisons in 2005 was ( 58/82 ) 70% , which reached ( 26/30 ) 86.6% in 2010 , indicating the improved microscopic diagnosis and accuracy in the diagnosis of tuberculosis in the inmates ` prison of the region ( table 1 ) . among tb risk factors such as intravenous drug abuse ( idu ) , previous history of tb , chronic renal failure , immunosuppressed drug consumption , history of previous contact with tb patients , hiv infection status , diabetes mellitus , and malnutrition in prisoners with tb ; close contact in prison especially in the recent two years , idu , and hiv infection were more frequent among the prisoners than in the general population with tb ( tables 3 , 4).of the total tb patients who were in prison only 70 ( 19.6% ) were tested for hiv and nine were hiv positive . pulmonary tb among inmates was more prevalent than in non - inmates ( 372.8 per 100'000 , vs.12.03 per 100'000 ) . positive sputum results of afb for prisoner tb cases were higher than those of the non - prisoners ( 79.2 vs. 76.5% ) . extra - pulmonary tb among prisoners compared with non - prisoners was less frequent ( 1%vs . . abbreviation : tb , tuberculosis ; ptb , pulmonary tuberculosis ; ip , inmate prisoner ; sm+ , smear positive ; gp , general population . abbreviation : tb , tuberculosis ; ptb , pulmonary tuberculosis ; gp , general population ; ip , inmate prisoner ; no , number ; p , prevalence per 100000 population . total general population is calculated for people under coverage of ahvaz jundishapur university of medical sciences ( except for dezful university of medical sciences ) . abbreviation : tb , tuberculosis ; n , number ; hiv , human immunodeficiency virus ; idu , injecting drug use . close contact , household contact or at least six hours contact a day with a smear positive tb case . abbreviation : tb , tuberculosis ; n , number ; hiv , human immunodeficiency virus ; idu , injecting drug use ; ip , inmate patients ; nip , non - inmate patients ; ci , confidence interval . close contact , household contact or at least 6 hours contact a day with a smear positive tb case . epidemiology of tuberculosis in the province is affected by tuberculosis control in high - risk individuals , such as prisoners . improvement in the indicators of the national tuberculosis programs plays an important role in reducing tb cases in the province . the prevalence of tb in prisons is always more ( up to 50 times ) than the general population ( 1 , 19 ) . although , the trend of tuberculosis in the province from 2005 to 2010 was unchanged in the total tb cases , the risk of infection in prisons was downward . the incidence of tuberculosis in prisons decreased from 633.3 per 100'000 in 2005 to 273.3 per 100'000 in 2010 with a decline rate of 56.7 % . indeed , if the control of tuberculosis did not occur in prisons , increase of tb in the general population could be more pronounced . this finding was the same as the epidemiology of tb in prisons of industrialized countries where tb in prisons was reduced by tb control measures such as case finding by chest x - ray and sputum examination along with the improved nutrition and environment ( 1 - 5 , 9 , 13 ) . in the present study , tb prevalence rate of the inmate prison was approximately 24 times higher than that of the general population in khuzestan province at the time of study ( 403.3 per 100'000 vs. 16.4 per 100'000 ) . these individuals after their release from prison spread tb in the community . despite differences of methodology , study design , size of population , time of study and duration of the current study in comparison with the previous studies , the current study finding was similar to the results of several investigations in the other parts of the world ( 1 - 6 ) . prisoners , compared with the general population , are at higher risk for tb infection because of over crowdedness of the cells ( the large number of people living in cells with insufficient ventilation ) , poor nutrition , inadequate sanitation and health care services , and having little time outdoors ( 17 , 18 , 20 ) . also , inmate prison due to poor living conditions and their lifestyle , such as socioeconomic status , low education level , drug addiction , and hiv infection has a great chance to progress from infection to tb disease ( 17 - 20 ) . the current study found that close contact with active smear positive pulmonary tb in regional prisons is a major risk factor for tb . the risk of pulmonary tb among the subjects with relatively long duration of time in prison was 20 times more than the ones out of prison . these findings were consistent with most of the previous studies ( 17 , 21 , 22 ) . in the current study the average length of stay in prison for tuberculosis was 12 weeks whereas in most studies ; it has been for more than a year ( 8 , 19 ) . ? did screening with chest radiography and rapid detection of tb in early phase , reduce the time ? answering these questions is not consistent with the current study design and requires future prospective studies . the issue of tb patients with hiv co - infection is known . in the current study , hiv co - infection among tb patients was higher in prisoners compared to the general population ( 2.4% vs. 1.3%).hiv prevalence among tb patients in the current study ( 2.4% ) was less than the prevalence of hiv infection in tb patients in tanzania and spanish prisons , 17.9% and 26% , respectively ( 7 , 8 , 15 ) . the reasons for the difference are : the prevalence of hiv varies in different societies ; risky behaviors such as unprotected sex and injecting drug vary among prisoners in different countries . immunodeficiency due to hiv infection is an important factor for the spread of tb in prisons . since the outbreak of the hiv infection among detained ivd users in the study region was so much greater than that of the general population , the incidence of tb in prisoners was higher compared with the general population . although hiv infection is a risk factor for tb infection , hiv status is known in less than 20% of the prisoners , which means hiv screening is not done in prisons of the province . this situation occurs in most countries of the world ; for example , in a study by shafer et al . hiv status of about one third of the prisoners with tb were unknown ( 23 ) . most studies showed that both tb infection and progressing to active tb disease in hiv infected people occur more rapidly . therefore , screening for hiv infection at the time of admission in prison and rapid identification of tb infection and prevention of the disease play an important role in tuberculosis control ( 19 , 24 , 25 ) . negligence in the early diagnosis and delay in rapid treatment of tb patients in prisons is associated with a sad experience in the world . prisoners with tb in the current study had similar nutritional status with the tb cases in the population outside the prison , when the body weight of less than 45 kg in an adult subject was considered as malnutrition . the study found no clue for malnutrition as a risk factor for pulmonary tb in the regional prisons . the current study finding was not similar to those of the previous studies ( 19 , 21 ) . the current study result should be considered with caution because the authors ` definition of malnutrition was based on low body weigh not on body mass index ( bmi ) . . showed that intravenous drug use due to decreased cellular immunity acts as an independent variable to tuberculosis infection and disease progress ( 26 ) . in the current study study , the current study likewise the other studies showed that idu either alone or in combination with hiv infection were important risk factors for pulmonary tuberculosis among prisoners ( 2 , 11 , 15 , 18 , 19 , 22 , 27 ) . alavi et al . in another research in khuzestan concluded that idu subjects were significantly at the risk of both tb and hiv infection ( 28 ) . in conclusion , in the region under study , the prevalence of tb among prisoners was higher than that of the general population . the main risk factors for pulmonary tb in this population were close contact , idu , and hiv infection . this study had limitations such as retrospective design , and limited access to medical files of the reported tb cases . since all the tb cases in the prisons of the region were diagnosed , treated , followed up and supervised by khc , therefore , limited access to khc medical files could not result in significant bias . | background : high prevalence of tuberculosis ( tb ) among prisoners is reported as an alarming public health problem in the world , especially in the developing countries.objectives:since there is almost no information from tb in this population in khuzestan province , the current study aimed to assess the prevalence and identify risk factors of tb among the prisoners of this region.patients and methods : in a retrospective study , medical files of patients with tuberculosis in khuzestan health center ( khc ) , from 2005 to 2010 , were studied .
patients with pulmonary tb were placed in two groups as the inmate prison ( ip ) and non - inmate prison ( nip ) groups .
data extracted from the patients ' records in the two groups were compared by spss software system using chi square and fisher exact tests .
p - value was considered less than 0.05.results:from the reported 4562 patients with tuberculosis , 363 ( 7.9% ) were prison inmates at the time of tb diagnosis .
prevalence of tb cases among the prison inmates was 403.3 per 100'000.the annual tb case rate in the general population during this period was 16.4 per 100,000 . among the tb risk factors
close contact [ odds ratio ( or ) , 95% confidence interval ( ci ) , 19.4 , 8.9 - 41.8 , p < 001 ] especially in the recent 2 years , injection drug use ( idu ) [ or , 95% ci , 4.61 , 1.7 - 12.4 , p = 006 ] , and human immunodeficiency virus ( hiv ) infection [ or , 95% ci , 2.4 , 1.1 - 5.0 , p = 025 ] were more frequent in the prisoners than in the general population with tb.conclusions:in the region under study the prevalence of tb among the prisoners was higher than the general population .
the main risk factors for pulmonary tb in this population were close contact , idu and hiv infection . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
genetic disorders are rare conditions that are accorded a low public health priority in india , even though these account for significant suffering of patients and their family members12 . subsidized treatment services are of limited availability causing significant out of pocket ( oop ) expenditure for parents in india . genetic disorders are known to impact health services through repeated hospital admissions3 ( such as routine transfusion for patients with thalassaemia ) . sickle cell anaemia is prevalent in isolated , primarily inbreeding tribal groups in the country456789 . recent studies suggest a significant burden of thalassaemia in india1011 . for other genetic disorders ( such as haemophilia , cystic fibrosis , spinomuscular atrophy , myotonic dystrophy , fragile x syndrome ) , there are limited systematic epidemiological data . this evidence gap enhances the perception that genetic disorders other than the haemoglobinopathies are rare , self - limiting conditions , for which prevention programmes are not required on a priority basis1213 . due to its demographic characteristics , in absolute numbers india has the largest birth cohort globally , with 27 million new births in 201014 . the country has the second largest global population of 1.21 billion15 and a high birth rate of 21.816 . as genetic disorders arise in the population through spontaneous mutations and through affected births in families with known risk of a genetic disorder , in absolute numbers , the birth prevalence of genetic disorders is likely to be high in india . genetic counselling is the main tool for the prevention and control of genetic disorders , targeted at families with an affected birth or with a family history of the disorder . although genetic services are available through the private health sector , a public health programme is needed to ensure that prevention and control of genetic disorders can be implemented on a nation - wide basis . due to the methodological challenges of studying rare disorders , it is difficult to approach genetic disorders from a public health / epidemiology perspective and explore prevention , that is delivery of genetic counselling from a health systems standpoint . this review uses haemophilia , a rare bleeding disorder to determine the available information on the reported and estimated number of patients in india , the trends of the disorder in the country , the social costs of this disorder , in terms of morbidity , mortality and access to care , and the evidence on opportunities for prevention . it also discusses a framework for a national haemophilia programme , identifying the existing opportunities and challenges in delivering this programme . some states in india have started providing treatment for patients with haemophilia , and the government of india is piloting a haematology programme through the national rural health mission , maharashtra17 . bleeding disorders reportedly affect 1 in 1,000 men and women globally18 . haemophilia a and b192021 ( table i ) and von willebrand disease3233 , haemophilia a and b are single gene disorders , occurring due to a mutation in either the coagulation factor viii gene ( haemophilia a ) or the coagulation factor ix gene ( haemophilia b ) , resulting in deficient synthesis of coagulation factor viii and ix , presenting as haemorrhagic tendencies in the patient3536 . patients with haemophilia suffer from repeated haemorrhagic episodes in joints and soft tissues ( fig . 1 ) . the frequency of bleeding depends on the residual coagulation factor level and the genotype of the patient20 . patients are classified as having severe , moderately severe or mild haemophilia based on < 1 , 1 - 5 and 5 - 40 per cent of normal clotting factor levels2337 . patients with severe haemophilia a constitute nearly 70 per cent of patients with bleeding disorders . the haemorrhagic episodes of haemophilia are treated with replacement therapy , with either clotting factor viii for haemophilia a and clotting factor ix for haemophilia b , or with cryoprecipitate or fresh frozen plasma233738394041 . clotting factor concentrate is an orphan drug42 , and its high cost places the drug out of reach of the majority of indian patients . the lack of sufficient treatment product for pain relief , for life threatening haemorrhagic episodes and for the prevention of disability results in orthropaedic morbidity , premature mortality and extensive oop expenditure26 . clinico - epidemiological characteristics of haemophilia rare clotting factor deficiencies frequency and sites of bleeding in patients with severe and moderate haemophilia a. data from 480 patient weeks of follow up ( source : ref . the numbers indicate the total number of bleeding episodes at that site ( denominator ) and the number of haemmorrhagic episodes treated with clotting factor concentrate ( numerator ) . haemophilia a and b are sex - linked inherited disorders , with the conditions being typically transmitted through asymptomatic , heterozygous females to the male child ( fig . new cases appear in the population through birth of offspring with haemophilia to carrier females , and through new mutations . about 30 per cent of haemophilia a cases arise through spontaneous mutation , presenting as an affected male child in a family without a history of haemophilia27 . 2a ) followed by the option of medical termination of pregnancy is the method of prevention and control of the disorder . 2b ) is another method of prevention , as carrier detection empowers parents to make informed reproductive choices . ( a ) prenatal diagnosis is offered to women who are obligate carriers ( arrow ) , having one or more sons with haemophila , or whose father has haemophilia , or who has one or more relative with haemophilia . ( b ) carrier detection is offered to possible carriers ( arrow ) , who are daughters of carriers , mothers with one son with haemophilia but no other affected relative , or female relatives of carriers . ( i ) sources of data : data on the number of patients is of critical importance for any public health intervention . as standard epidemiological methods such as surveys are not cost - effective for measuring rare disorders , registries remain the best source of obtaining epidemiological data on these conditions45 . in india , a disease registry for haemophilia is available with the hemophilia federation of india ( hfi)31 . this non - governmental organization ( ngo ) collates data on the number of patients through 76 centers located across india . the organization is responsible for importation and distribution of treatment product , patient care , education and counselling and advocating for the rights of patients with bleeding disorders and their families . the availability of this registry makes haemophilia a model for the study of the epidemiology and for surveillance of trends of this condition in india . the quality of the registry data has been checked in a haemophilia surveillance study in maharashtra46 . of the 2,219 patients registered during the period 1989 to 2005 , the data had 8.3 per cent duplication , and lacked information on nearly 32 per cent patients ( 273 deceased patients and 882 relatives ) . thus this data set may have issues of accuracy , but still remains the best available source of data on this rare condition in the country . ( ii ) incidence : the most frequently cited incidence estimate for haemophilia is from haldane27 , who estimated an incidence of 1 per 5,000 male births . soucie et al47 estimated a similar incidence of 1 per 5,032 male births ( that is around 20 per 1,00,000 population ) from a haemophilia surveillance established in the united state of america ( usa ) . between 2009 and 2010 , 260 new patients were reported from india4849 , while there were 1,38,41,667 male births15 . this implies that the incidence of haemophilia in india in 2010 was around 2 per 1,00,000 male births , or around 277 new patients being registered each year in the country . if the incidence of 20 per 1,00,000 is used , the number of affected new births in india in 2010 would be 2,768 , that is approximately 0.01 per cent of total annual births in india . although apparently insignificant as compared to infectious disease burden , in the case of haemophilia , where patients survive to adulthood , patient accrual over time results in increasing population prevalence of a disorder whose management is extremely resource intensive . ( iii ) prevalence and global rank : the rarity of haemophilia challenges estimates of the disorder50 . the best available prevalence data are from a global survey on haemophilia and bleeding disorders , conducted by the world federation of haemophilia ( wfh ) , a global organization involved in promoting the care of people with haemophilia and bleeding disorders51 . this survey is conducted globally , and in 2011 included 108 countries and covered 90.6 per cent of the global population29 . the data showed that in 2011 , india reported 14,718 patients with bleeding disorders and 11,586 patients with haemophilia a29 . 3a and c show the distribution of patients with bleeding disorders and with haemophilia a in the five countries reporting the highest number of patients . india , the only developing country in this list , reports the third largest number of patients with bleeding disorders , and the second highest number of patients with haemophilia a. in terms of proportionate burden of patients , data indicated that india harbours 5 and 9 per cent of the global number of patients with bleeding disorders and with haemophilia a respectively ( fig . global distribution of total reported cases of bleeding disorders ( a ) and haemophilia a ( c ) in five countries reporting the highest number of patients . ( b ) and ( d ) show that nearly 5 and 9% of global patients with bleeding disorders and haemophilia a are from india . ( iv ) estimated number of patients : table iii shows the number of cases reported ( prevalence ) in five high burden countries29 . the usa and brazil report the highest prevalence of over 4 per 1,00,000 population . in comparison , the number of prevalent cases in india is 0.9 per 1,00,000 population , suggesting that underdiagnosis , mortality and incomplete case recording could be a reason for lower case reporting . the very high prevalence of 8.7 reported by the united kingdom is a phenomenon that has been observed in countries where the small population magnifies the prevalence estimates29 . china reports the third highest global number of haemophilia patients , but like india has a low prevalence of 0.7 per 1,00,000 population . as compared to the usa , which has an excellent haemophilia surveillance system52 , the current case detection in india is 4.7 times lower . adjusting the underdiagnosis of patients with haemophilia a in india to the prevalence rate of haemophilia a in the usa , the estimated number of patients in india would be around 54,454 . in case of haemophilia b , the prevalence rate of 0.1 per 1,00,000 population in india is 13 times lower to the prevalence rate of the usa ( 1.3 per 1,00,000 ) . adjusting for this difference in prevalence , there would be an estimated 21,931 patients with haemophilia b in the country ( unpublished observation ) . case detection rate ( prevalence ) of haemophilia a ( ha ) and haemophilia b ( hb ) in five countries reporting the highest global number of patients using the population data for 2011 from the census of india15 and a prevalence of haemophilia a of 4 per 1,00,000 , the estimated number of haemophilia patients in india would be around 48,407 . 4 shows the observed number of cases ( calculated at a prevalence of 0.9 per 1,00,000 population ) and estimated number of patients ( calculated at 4 per 1,00,000 population ) with haemophilia a in states / ut of the country . the large patient burden indicates the need for a public health intervention for prevention and care . observed ( calculated at 0.9 per 1,00,000 ) and estimated ( calculated at 4 per 1,00,000 population ) prevalence of haemophilia a for states and ut of india . ( v ) trends in case detection : for public health services , data on time trends of the disorder are needed for decision making on implementation of services . while studies predicting the trends of haemophilia in india are lacking , gross deductions are possible from the data available from the annual global surveys294849535455 . 5a shows the trends in the diagnosis of new patients in the four countries reporting the highest numbers of haemophilia patients . over the last five years , india ( 1,474 ) and brazil ( 1,952 ) have reported more newly diagnosed patients than the usa ( 1,376 ) or uk ( 713 ) , reiterating the need for a prevention programme . ( a ) numbers in parenthesis show the number of patients reported in the last five years by each country ( source : refs 29 , 48 , 49 , 53 - 55 . ( b ) per capita clotting factor viii consumption ( yaxis ) and number of haemophilia patients reported in 2011 for the four high burden countries ( source : ref . social costs of haemophilia : one of the major roles of public health agencies is to link people to needed services . the social costs of haemophilia occur as a consequence of lack of access to treatment and impact patients in terms of morbidity and mortality , schooling and employment . parents are financially affected due to the oop expenditure26 , and experience significant guilt and distress at being unable to offer appropriate treatment to the child . ( i ) orthopaedic complications and disability : the long - term consequences of repeated joint bleeds with sub - optimal treatment are the development of chronic and progressive joint damage and disability56 . studies in developed countries have primarily focused on the development of musculoskeletal scores which can be used for optimization of dose of clotting factor concentrate for maintaining joint health . in contrast , lack of treatment results in rampant disability in patients with haemophilia in india . only one study by kar et al57 has measured the prevalence of disability . this study , conducted at five centres across the country showed that of the 148 patients with severe haemophilia a , only nine were free of disability . of concern was that in the age group of 5 to 12 years , only 15 per cent of patients were disability - free57 . a significant association was found between the socio - economic status of the patient 's family and the severity of disability , suggesting that disability was most likely to be prevalent amongst the most vulnerable strata of society . increased orthopaedic vulnerability of patients was demonstrated in another study that reported that the incidence of osteoporosis ( t score : -2.5 or more ) and the incidence of fractures in adult life were significantly higher in patients with haemophilia as compared to controls58 . ( ii ) prevalence of transfusion transmitted infections ( tti ) : in the absence of access to treatment , there are anecdotal reports of use of whole blood by patients with haemophilia , especially in remote areas . there is , however , no data on the frequency of whole blood use by patients . patients with haemophilia , therefore , remain vulnerable to transfusion transmitted infections ( tti ) . data from the annual global report ( 2011 ) show that currently , 1.12 per cent ( 159/14,152 ) patients with haemophilia are reported infected with the human immunodeficiency virus ( hiv)29 . only one large study reported the prevalence of hiv , hepatitis b virus surface antigen ( hbsag ) and hepatitis c virus ( hcv ) infection amongst 323 severe and 77 moderately severe haemophilia patients . in the five year long study initiated in 1995 , the prevalence of hiv , hbsag and hcv positivity was found to be 3.8 , 6 and 23.9 per cent59 . one of the earliest studies conducted in 1991 had detected a 12 per cent hiv seropositivity ( n=124)60 . a retrospective review of hiv , hbsag , and hcv status of the 39,060 healthy donors identified the overall prevalence as 0.44 , 1.27 and 0.23 per cent , respectively61 . the risk of ttis in patients was also reflected in a study which reported that the prevalence of hepatitis c virus ( hcv ) infection was 7.1 per cent , ( 258 out of 3,589 ) when rt - pcr ( reverse transcriptase - polymerase chain reaction ) was used . of concern was that elisa ( enzyme - linked immunosorbent assay ) routinely used for the screening at blood banks detected only 6.1 per cent ( 221/3,589 ) of the hcv positive samples , suggesting that a substantial number of hcv infected samples in blood banks go undetected62 . ( iii ) prevalence of inhibitors : one of the complications of replacement therapy is the development of alloantibodies called inhibitors63 . these are high affinity igg molecules to factor viii which neutralize clotting factor concentrate , so that the patient becomes non - responsive to treatment . the latter treatment is however , expensive so that the most patients with inhibitors in india remain untreated . a systematic review reported the prevalence of patients with inhibitors between 5 to 7 per cent , with the risk of inhibitor development being higher in patients with severe rather than mild or moderate haemophilia a64 . studies conducted in india reported the prevalence of inhibitors ranging from 8.2 to 13 per cent6566 . these estimates are likely to be overestimates , as these studies have been conducted at tertiary care centers . ( iv ) access to treatment : in developed countries , use of clotting factor concentrate has resulted in increased longevity , so that the life expectancy of patients with haemophilia is now equal to that of the general population67 . although data on survival of haemophilia patients in india are lacking , access to treatment can be used as a surrogate indicator , as lack of access to treatment reduces longevity . haemophilia can be treated with replacement therapy on demand , or through prophylactic infusions of clotting factor concentrate68 . prophylaxis reduces the risk of joint damage69 , and possibly reduces the number of bleeding episodes and the risk of life threatening bleeds . in india , lack of access to treatment remains a major factor that severely compromises the quality of life of patients . dharmarajan et al30 measured the bleeding episodes experienced by 24 indian patients followed up over a 20 week period ( fig . nearly one - fifth of the injuries were caused by lifestyle - related factors ( such as travelling to school by public transportation ) whilst the remaining bleeding episodes were spontaneous in nature . the annualized bleeding episodes for patients with severe haemophilia a were 10.8 , implying that a patient with severe haemophilia a may bleed as frequently as 11 times in a year . the data reveal that india has one of the lowest usage of treatment product ( fig . the per capita use of clotting factor concentrate in india in 2011 was 0.032 , as compared to the us ( 5.157 ) or even thailand ( 0.074)29 . the extremely low per capita use of treatment product , despite having the second largest number of global patients with haemophilia a , illustrates the large treatment gap that exists in the country . ( v ) impact on schooling and employment : without access to treatment , patients with haemophilia experience frequent absenteeism from school and work , as physical activity is limited due to the extreme pain and discomfort associated with the haemorrhagic episode . a cross - sectional study reported that the proportion of school dropouts due to bleeding was 36.5 per cent ( n=148)57 , while a prospective study estimated that the annual number of school days lost due to haemorrhagic episodes was 19.2 ( range 0 - 50 days)30 . the consequence of chronic bleeding episodes and poor education was apparent in the overall proportion of unemployed patients aged above 18 years of age , which was 51 per cent57 . ( vi ) emotional costs of haemophilia : genetic disorders like haemophilia impact parents and families due to the chronic nature of the disorder , the progressive disability arising in the patient due to poor treatment , high treatment costs and the premature mortality25 . studies on quality of life ( qol ) need assessment and studies on the gender impact of a sex - linked recessive disorder in india have not been reported . apart from clinical reports , the largest thrust of indian haemophilia research is in the area of mutation analysis of the factor viii and factor ix genes , and on carrier detection and prenatal diagnosis . the factor viii gene is 186 kb long and mutations have been identified from the entire length of the gene22 . studies have estimated the prevalence of inversion 22 ( responsible for the aetiology of 50% of severe haemophilia ) and inversion 1 rearrangements in patients with severe haemophilia a7071 . studies have investigated allelic frequency of various intragenic or extragenic markers and their utility in carrier detection and prenatal diagnosis through linkage analysis757677 . one of the institutions offering prenatal diagnosis has reported that the quality and easy availability of medical support overwhelmingly determines the attitude and belief towards genetic testing79 . comparison of prevalence data from developed nations with established haemophilia surveillance shows the possible magnitude of cases in the country . using the prevalence data of the usa , we estimate that the number of patients with haemophilia could be over 70,000 in india . as more state governments initiate the provision of free treatment , the gap between the observed and estimated number of patients is likely to reduce , increasing the demand on public health services . the large patient load of haemophilia is not unexpected , as haemophilia prevalence is known to increase with improving medical services and increased survival of patients . like considering haemophilia a , and using an estimate of 20,000 iu of clotting factor viii requirement per patient per year7680 , india would need to acquire 23,17,20,000 iu of clotting factor concentrate for the currently reported number of patients ( 11,586 patients with haemophilia a ) . for the estimated number of patients ( 48,407 ) , an estimated 96,81,40,000 iu of clotting factor viii concentrate would be needed . this cost suggests that the development of indigenous capacity for the production of clotting factor concentrate may have to be considered in the near future . the large existing or anticipated burden of patients also suggests that a national programme for haemophilia needs to be initiated . an outline of the key components of a national haemophilia programme is shown in table iv . apart from issues of training and competency development of health service staff for the management of this disorder , issues of equity will have to be kept in mind , as patients from rural and remote areas are less likely to have access to the service as compared to patients from urban areas or from more socio - economically privileged groups . compulsory hepatitis b vaccination of all patients , and routine screening of patients for hiv could be an essential component of the programme directed towards prevention and screening for ttis . education of patients , and psychosocial support , especially after diagnosis ( which has a devastating impact on parents)25 have to be the major components of haemophilia services . components of a programme for the prevention and control of genetic disorders the prevention of haemophilia needs to be addressed on a priority basis . in contrast to the paucity of data on the epidemiology and social costs of haemophilia , there are numerous studies on the genetic basis of this condition , including reports of prenatal diagnosis being conducted routinely at premier institutions of the country . this wealth of information indicates the biotechnological competencies of the country , but this potential remains untranslated to communities , being limited to referred patients only . prenatal diagnostic services have to initiate with the identification of facilities for amniocentesis at the district level . genetic counselling services can be delivered through designated referral centres and national laboratories . unlike other developing countries , the technological competencies will not be the limiting factor for a haemophilia programme in india . rather , capacity building for launching genetic services , including building an understanding of genetics in public health will have to be initiated . critical to this will be the need to develop genetic counselling material which is contextual to the cultural milieu of patients . maintenance of the existing haemophilia registry is vital to providing surveillance data , that is information on the burden and trends of the disorder , data for estimating treatment needs and monitoring the impact of services . carefully selected variables can yield significant indicators for tracking the long term trends of haemophilia in the country8182 . the registry may be appropriately used by public health services for protecting the general population . for example , the haemophilia surveillance system in the usa , is used for monitoring the prevalence of ttis and for monitoring the emergence of new blood - borne infections52 . in conclusion , the complacency about the low prevalence of genetic disorders in india may have to be revisited . even at the current rates of case detection the high cost of providing treatment for patients is likely to overwhelm the public health services , suggesting the need for launching a national programme for haemophilia with components of prevention , care and support . | india lacks a national policy on the prevention and control of genetic disorders .
although the haemoglobinopathies have received some attention , there are scarce data on the epidemiology of other genetic disorders in india .
haemophilia , an inherited single gene disorder with an incidence of 1 per 10,000 births , manifests as spontaneous or trauma - induced haemorrhagic episodes in patients , progressing to chronic disability and premature mortality in untreated patients or patients with sub - optimal treatment .
although the genetic basis of this disorder has been well studied in india , data on the number of patients , trends of the disorder in india , social costs of the condition and opportunities and competencies for offering genetic counselling through a public health programme have not been reported .
this review article summarizes the available indian data , which show that the country harbours the second highest number of global patients with haemophilia a. the reported number of patients with haemophilia a is 11,586 while the estimated prevalence could be around 50,000 patients .
this review also identifies the need to immediately initiate a national programme for haemophilia , with components of prevention , care for patients , surveillance and education and support for families . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the impact of health on the quality of life has lately received increased attention in medicine and dentistry . different diseases affect life in different ways and in particular oral diseases seriously impair the quality of life in a large number of individuals and they may affect various aspects of life , including function , appearance , interpersonal relationships and even career opportunities . allison defined the quality of life as a dynamic construct that is the function of a number of variables such as stress , depression , appraisal and coping ; whereas , oral health - related quality of life is defined as a part of the quality of life that is affected particularly by the person s oral health . this term captures how oral health affects the person s ability to function ( e.g. in bite chew and speech ) , psychology states such as self esteem and satisfaction with one s appearance , social factors and pain or discomfort related to oral health . there are many variables affecting the quality of life out of which tooth loss is one of the premier factors . the loss of one or more teeth can have profound effects on an individual s oral health and quality of life . one concept that has received particular attention when setting health targets is that of a minimum threshold for the number of teeth below which oral function and health diminish rapidly . such concepts originally arose with the work of agerberg and carlson and kayser two decades ago . subsequent population - based oral health studies have frequently referred to the presence of a minimum of 20 teeth or sometimes a certain number of contacting posterior pairs of teeth as a simple way of defining satisfactory oral health . in some cases , besides , the foremost factor age and tooth loss both have their variable effects on different age groups affecting the quality of life . for example , in case of infants and small children , tooth loss hampers speech and sucking , while in teenagers aesthetics is of major concern and in older people chewing or mastication is a matter of concern which affects the quality of life while performing day to day tasks . in addition , along with the teeth , several other factors affect the oral health - related quality of life , the most important among which is personal habit which includes tobacco usage both in smoking and non - smoking forms and also alcohol consumption . the assessment of the quality of life has become an integral part in the evaluation of health programmes . a number of quality of life measures now exist in the field of dentistry such as the original 49-item ohip ( oral health impact profile ) which was developed by locker and slade and was based on locker s conceptual model of oral health including seven domains ; namely , functional limitation , physical pain , psychological discomfort , physical disability , psychological disability , social disability and handicapping . results can serve as an outcome measure ; they allow insight into how the patient s oral health affects this person s well - being and quality of life at a given point in time . to date thus , this study was performed to explain how age and tooth - loss relate to the impact of oral health on everyday life in two populations . a cross - sectional questionnaire - based survey was conducted among 1475 subjects collected from two major cities of gujarat and rajasthan . baroda and ahmadabad from gujarat ( a state in india known for trade and commerce ) and udaipur and jaipur were taken as center from rajasthan ( a state situated in the western part of india famous for historic battles and monuments ) . the subjects were randomly selected from dental clinics , hospitals and also from dental camps which were organized for the general population and people were encouraged for check up . so a total of 34 subjects who did not complete the questionnaire and were uncooperative were excluded from the study , yielding a final study sample of 1441 individuals , out of which 724 subjects were from gujarat and 717 were from rajasthan . the questionnaire approach was administered to people , using pretested english version ohip-14 questionnaire scale and on the same day oral examination was performed . the questionnaire included questions concerning the respondents sociodemographic background ( age , education , habits regarding dental visits and professional situation ) , their coping style and their ohrqol ( oral health related quality of life ) . ohrqol was measured using the 14-item short version of the ohip and items were scored on 5-point scales ranging from 1 - never to 5 - very often. thus , higher scores indicate worse ohrqol . the dimensions and the subjects of the questions were functional limitation , trouble pronouncing words , worsened taste ; physical pain , ache in the mouth , discomfort eating food ; psychological discomfort , feeling self - conscious or feeling tense ; physical disability , interrupted meals or poor diet ; psychological disability , difficulty in relaxing , embarrassment ; social disability , irritability , difficulty in doing usual jobs ; handicap , life less satisfying , inability to function . responses to the items were recorded in a five - point scale : 0 , never ; 1 , hardly ever ; 2 , occasionally ; 3 , fairly often ; 4 , very often . all 14 ordinary responses were summed to produce an overall ohip score that could range from 0 to 56 , with higher scores indicating poorer health - related quality of life . for a better approach and accuracy , clinical examination was conducted and subjects were examined using plane mouth mirror and cpi probe which were in accordance with who criteria for diagnosis of dental caries . all instruments were sterilized and examination was performed using a mouth mirror , probe under good illumination called type iii examination several tooth - sites were excluded from the examination : impacted teeth , retained roots , grossly broken down teeth , teeth which were too inaccessible to examine satisfactorily and those teeth in which the cemento - enamel junction ( cej ) was at an indeterminable attachment level . the patient s personal habits were also recorded including smoking , chewing tobacco and consumption of alcohol , their frequency and duration and also whether they visited a dental clinic for regular dental check - up was assessed . the data collected were entered into spreadsheets and were subjected to statistical analysis by spss ( statistical package social sciences ) , version 15.0 . means and standard deviations were assessed and one way anova was executed for comparing the means under various categories . step - wise multiple linear regression analysis was executed to estimate the linear relationship between dependent variables ohip and various independent variables ( age , gender , materials used for brushing and brushing frequency , dental visit and tobacco frequency ) . ethical clearance was obtained prior to the survey from the ethical committee of darshan dental college and hospital . table 1a illustrates the demographic data for the subjects in two different states . there were some differences between the states that reflect the underlying demography of the states and the sampling strategies . it shows that the maximum number of subjects who participated were from rajasthan and among them male individuals who participated were more ( 62.4% ) as compared to the participation of males from gujarat ( 53% ) . subjects who visited dental clinics within 12 months were higher in the state of gujarat ( 56.5% ) and subjects who never visited dental clinics were higher in the state of rajasthan ( 64.6% ) . table 1b shows that subjects from gujarat had the maximum number of remaining teeth ( 87.6% ) in comparison to rajasthan ( range , 2832% ) . higher scores indicate worse oral conditions and lower ohip scores show a better oral health - related quality of life . ohip scores were seen worse among rajasthan subjects compared to gujarat state subjects . regarding the independent variables including all the seven domains , low scores were found among rajasthan subjects affecting the quality of life ; while , better scores were seen among gujarat state subjects . in addition , with the increase of age , the quality of life deteriorates in both states ; however , less satisfactory quality of life was seen among subjects of rajasthan . among the 4554 years age group , ohip scores were 8.89 ( 13.94 ) and 11.21 ( 7.08 ) for gujarat and rajasthan subjects , respectively . subjects having 1822 remaining teeth showed the highest ohip score , 12.00 ( 5.16 ) and 17.11 ( 2.14 ) for states of gujarat and rajasthan , respectively . the minimum mean ohip score was detected in subjects having a remaining number of teeth ranged from 28 to 32 and the score was 6.69 ( 4.07 ) and 10.29 ( 6.28 ) for rajasthan and gujarat subjects , respectively . the subjects having dmft scores between 15 and 19 had a high mean ohip in both gujarat and rajasthan states ; 17.00 ( 0.01 ) and 17.11(2.14 ) , respectively indicating poor oral hygiene . whereas , scores between 0 and 4 show great variation . gujarat subjects had a score of 5.13 ( 4.24 ) indicating comparative good oral hygiene ; whereas , that of rajasthan was 10.36 ( 6.15 ) indicateing poor oral hygiene . table 3 shows the result of step - wise multiple regression analysis , in which ohip was the dependent variable ; whereas , sex , age , material frequency , brushing habit , tobacco chewing and smoking habits were independent health related variables . ohip shows the amount of variation 7.9% for place , similarly 6.4% , 2.6% and 2.1 % for tobacco users , and non tobacco users and a dental visit within 12 months and for materials used for brushing respectively ( p<0.0001 ) . this study is the first that has evaluated the relationship between age , tooth loss and the adverse impacts of oral conditions among adults of all ages in two different states of the country . as expected , the number of the remaining natural teeth played a central role as a determinant of subjective oral health . the quality of life is increasingly acknowledged as a valid , appropriate and significant indicator of service need and intervention outcome in contemporary public health research and practice . we have no reasons to believe that the associations between tooth loss and ohip scores in each state would be biased within these randomly selected subjects from both gujarat and rajasthan state and the analysis provides a valid contrast of association between gujarat state and rajasthan state . ohip has now been used in a number of age and cultural contexts to measure the oral health - related quality of life . the quality of life includes social , psychological as well as functional aspects . for this , the oral health impact profile ( ohip ) is one of the numbers of self - reported measurements of the adverse impacts of oral condition on daily life . the short form version ( ohip-14 ) consists of 14 items organized in seven sub - scales , which address aspects of oral health that may compromise someone s physical , psychological and social well - being . the ohip scale is concerned with the behavioral and psychosocial aspects of the impact and does not include measures of disease and impairment , which are depicted in the model on which it is based . their relationship with the other dimensions is retained in the empirical model , but it is not supported by empirical evidence . it is impossible to understand the impact of tooth loss without understanding the independent effect of age and vice versa . data from both states demonstrate that the impact of oral health problems on the quality of life reduces with the increase of age , which is independent from the effect of tooth loss . the current generations of older adults in both states had the lowest scores , but in the rapidly changing health environment , they may also have had the lowest expectations historically . the threshold of 2021 teeth has been widely used as a broad indicator of functional dentition for some years . although a threshold of 2021 teeth has been justified using clinical principles , there is also empirical evidence that this threshold is associated with functional and nutritional adequacy [ 2325 ] . further data from both states show that as the number of teeth decreases or tooth loss occurs , it is associated with a reduction in the oral health - related quality of life , independent from the effect of age . the data also show that the relationship between the increase of tooth loss and more severe impacts on oral health was not a simple one . instead , there appears to be a plateau in the trend and a point was reached where the least number of teeth remained . for example , in gujarat the mean ohip score was worst for those people with a remaining number of teeth ranged between 18 and 22 . in rajasthan , ohip scores were also worse for those people with a number of teeth ranged between 18 and 22 teeth , even worse than individuals of gujarat state . a positive state related to the quality of life was found in both states between group 2327 , but still qhrqol was worse among rajasthan state as compared to gujarat state . in addition , the most striking finding in both groups was that people who had more than 25 natural teeth had a significantly better oral health - related quality of life . compared with previous studies , the remaining number of teeth in the range of 2832 teeth for the uk and australian samples , the ohip mean score was 4.9 ( 0.12 ) and 6.7 ( 0.14 ) , respectively , while that among gujarat state and rajasthan state was 6.69 ( 4.07 ) and 10.29 ( 6.28 ) , respectively . the influence of cultural factors on ohip scores is apparent in the difference between gujarat state and rajasthan state , when the pattern of scores according to thenumber of teeth is analysed . the plateau of highest mean ohip scores is reached at the age group of 2327 teeth and where the number of teeth drops below 23 - 17 , and certainly below 18 , the chance of a person requiring partial denture in order to function increases dramatically . although the position of lost teeth is also a key factor , one of the possible reasons for the differences in the relationship between the number of teeth and ohip in the two samples may be the cultural variation . the overall ohip mean scores of gujarat and rajasthan state was 10.40 ( 6.42 ) and 7.05 ( 14.15 ) , respectively which indicates better ohrqol in gujarat state , which is in accordance with previous studies where ohip mean score for subjects of uk and australia were 5.1 ( 0.11 ) and 7.4 ( 0.13 ) , respectively where a better quality of life was seen among subjects of the uk . in addition , the present study indicates that mean ohip scores of subjects complaining about physical pain in gujarat and rajasthan was 1.35 ( 0.70 ) and 1.05 ( 0.61 ) , respectively which indicates higher ohip scores among all seven domains , which is in accordance with previous studies which stated that patients reporting higher ohip scores were more likely significant to report pain . previous studies showed that patients with a higher ohip-14 were also significantly more likely not to drink alcohol , which is in accordance with our study showing mean ohip scores for alcohol non users in gujarat and rajasthan states as 6.81 ( 4.27 ) and 9.84 ( 5.97 ) , respectively as compared to users of gujarat and rajasthan having scores 9.24 ( 1.80 ) and 12.65 ( 7.85 ) , respectively . even previous studies depicted that patients reporting higher ohip-14 scores ( i.e. inferior ohrqol ) at baseline were significantly more likely to have fewer than 25 teeth , have reported trouble with their teeth at their last dental visit , or only visited dental clinics when they had trouble and smokers , which is accordance with our present study . therefore , besides two factors of age and tooth loss , this illustrates how the perception of oral health - related quality of life may be influenced by cultural dimensions , different oral health habits such as smoking , consuming alcohol , regular dental visits , socioeconomic variation of two different states and different geographical locations . both age and tooth loss are associated with each other , but they have independent effects on the oral health - related quality of life . tooth loss , which is associated with the increase of age , is associated with more negative impacts , while the increase of age independently results in fewer . thus , in all populations and subpopulations studied , complete or almost complete natural dentition shows a good oral health - related quality of life . | objective : age and tooth loss are expected to have a complex relationship with oral health - related quality of life . so the purpose of this study was to explain the impact of age and tooth loss on oral health - related quality of life using the short form 14-item oral health impact profile ( ohip-14 ) among two population samples of gujarat and rajasthan.materials and methods : a cross - sectional questionnaire - based survey was conducted among 1441 subjects collected from two major cities of gujarat and rajasthan .
both questionnaire approaches using ohip-14 scale and clinical examination were conducted in accordance with who criteria using type iii procedure on the same day .
chi square test , anova and stepwise multiple regression analysis were applied using spss software version 15.0.results:with the increase of age , ohip mean score in both states increased , but that among rajasthan state was higher , depicting poor oral health . whereas , in the remaining 2327 number of teeth both states showed higher ohip mean , however again the score was much higher among rajasthan subjects showing worse oral hygiene .
hence , overall all mean ohip score for gujarat was lower indicating good oral health ; whereas , that among rajasthan was higher indicating poor oral health - related quality of life.conclusion:both age and tooth loss are associated with each other , but they have an independent effect on the oral health - related quality of life .
thus , all studied populations with complete natural dentition showed good oral health - related quality of life . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the preoperative diagnosis was intussusception of the colon with a benign tumor by ct - scan findings . laparoscopic reduction of intussusception due to a benign tumor is feasible and safe even in adults . mucinous cystadenoma is one of the causes of intussusception in adults and a good indication for the laparoscopic approach . this report describes an adult case of intussusception due to mucinous cystadenoma of the appendix treated laparoscopically . a 32-year - old female had intermittent abdominal pain and nonbloody diarrhea for 20 days . a barium enema showed a crab 's claw sign at the mid transverse colon ( figure 1 ) . a computed tomography ( ct ) scan showed a 3-cm , clear , low - density area in the transverse colon ( figure 2 ) . barium enema showed filling defect with crab 's claw sign at the mid transverse colon . enhanced computed tomography showed well - encapsulated , low - density area in the transverse colon . after adhesiolysis between the major omentum and the abdominal wall caused by the previous caesarean deliveries , the intussusception was confirmed at the middle of the transverse colon . next , gauze sponge sticks with these instruments were used to provide compression from the distal colon ( figures 4 and 5 ) . after laparoscopic mobilization of the right colon , the ileocecal portion was pulled out through a 5-cm longitudinal skin incision . ileocecal resection was accomplished , and end - to - end anastomosis was performed extracorporeally . the postoperative course was uneventful , and the patient was discharged on the ninth postoperative day . a 3-cm tumor was located in the appendix and invagination into the cecum was seen ( figure 6 ) . table 1 shows the causes of adult intussusception in 400 cases from japanese domestic reports . common causes in excess of 10% included cancer , lipoma , small bowel tumor , and lymphoma . however , the ct scan in this case revealed a well - encapsulated cystic lesion forming the lead point of the intussusception . it is possible to diagnose mucinous cystadenoma from its characteristic appearance as a well - defined , homogeneous low - density mass . complete resection of the tumor is sufficient treatment . in this process , we must avoid tumor rupture as some of these mucoceles could be mucinous cystadenocarcinoma , which can cause pseudomyxoma peritonei . if a tumor indicates the possibility of carcinoma , the mesenteric resection should encompass lymph node clearance . the laparoscopic approach to intussusception has been mostly reported in children . only one report exists of laparoscopic ileocolic resection for intussusception caused by mucinous cystadenoma of the appendix . in the textbook description , reduction is achieved by gently squeezing the mass from the distal side to reduce the intussusception rather than by pulling the ileum , which will cause tearing . we tried this maneuver laparoscopically by using a gauze sponge , which was atraumatic and proved very effective for the reduction of intussusception . in our opinion , laparoscopic reduction of intussusception is feasible even in adults ; however , it should be performed for benign disease . | objective : laparoscopic reduction of appendicocecal intussusception due to mucinous cystadenoma is herein described.methods:a 32-year - old female had intermittent abdominal pain and nonbloody diarrhea .
the preoperative diagnosis was intussusception of the colon with a benign tumor by ct - scan findings.results:laparoscopic reduction of intussusception and ileocecal resection were successfully performed .
gauze sponge sticks were used to provide compression from the distal colon .
this maneuver was very effective to reduce the intussusception.conclusion:laparoscopic reduction of intussusception due to a benign tumor is feasible and safe even in adults .
mucinous cystadenoma is one of the causes of intussusception in adults and a good indication for the laparoscopic approach . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 5-year - old boy presented to the emergency department with involuntary movements of the extremities , facial grimacing , fluttering eye movements , and slurred speech . the onset of symptoms was approximately 2 weeks prior to presentation , when he began to display unusual hyperactivity and clumsy movements that disappeared while sleeping . the last episode was reported to occur 2 months earlier ; at this time he received a 3-day course of azithromycin . the family history was unremarkable for rheumatic fever , social stress , psychiatric illness , and tic disorders . a normal vaginal delivery following an uneventful pregnancy was reported with a normal post - natal course . all vaccinations were received on schedule and the developmental milestones were appropriate for age . on clinical examination , the temperature was 36.6c , heart rate 100 per minute , blood pressure 101/58 mm and the respiratory rate 28 per minute . the neurological exam showed that he was alert and oriented to time , place , and persons . the cranial nerves , including extra ocular movements , were intact ; the sensation exam was normal . his deep tendon reflexes were normal and symmetrical throughout , and the toes were down going . special investigations revealed a normal complete blood count , as well as normal liver , and renal function . the acute phase reactants included the erythrocyte sedimentation rate , which was 16 mm / hour and the c reactive protein , which was negative . a throat culture was negative for group a streptococcus and the anti- streptolysin o titer was unremarkable sydenham chorea was considered as the most likely diagnosis , and long - term penicillin prophylaxis in the form of monthly penicillin g benzathine at a dose of 600,000u intra - muscularly was started . within a week of admission he improved with good control of motor activity , reduced involuntary movements of the extremities and facial grimacing . he continued to improve throughout his follow up visits and complete resolution of symptoms was observed 5 months from the onset of illness . recent hospital based studies have shown a dramatic decline in admissions for arf in saudi arabia.1,2 rheumatic fever ( rf ) has been considered a disease of the young ( commonly between 5 - 15 years of age).3,4 the disease is uncommon in children less than 5 years of age . published data estimates that arf occurs in 1 - 6.8% of children less than 5 years of age.4,5 arthritis and carditis are the most common clinical presentation in this age group.5,6 although reported in a boy at the age of 2 years and 8 months , sydenham chorea occurs most often in children before puberty with a female preponderance.7,8 the incidence of rheumatic chorea in young children varies from almost nonexistent in some series to 11% in another series.5,6 the patient described in this case report is a young saudi child diagnosed with sydenham chorea.9 the typical neurological signs together with the preceding history of pharyngitis , points towered the diagnosis of sydenham chorea . the absence of laboratory confirmation of group a streptococcal infection does not rule out the diagnosis of rheumatic chorea.10 although rare , the diagnosis of sydenham chorea should always be considered in young children with choreiform movements . a regimen of continuous penicillin prophylaxis against streptococcal infection reduces the risk of arf recurrence and the development of subsequent heart disease . | despite improvements in socio - economic status and the standard of health care services , rheumatic fever continuous to occur in saudi arabia , although with decreasing frequency .
the disease is most commonly observed in school - aged children , but can also occur in a younger age group .
carditis and arthritis are the major clinical symptoms on presentation of acute rheumatic fever in young children .
rheumatic chorea is infrequently reported in young children . here , a case of sydenham chorea , in a 5-year - old boy ,
is presented .
although rare , the diagnosis of sydenham chorea should always be considered in young children with choreiform movements . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cases evaluated in this study were selected from patients who underwent biopsies during a 12-month period . two hundred ninety three female patients with 314 lesions underwent us - guided biopsies at a single facility . the mean patient age was 39.9 years with a range of 17 - 81 years . the vast majority of the masses had diameters in the range of 0.4 - 2.6 cm . the diameters measured were 0.4 - 1 cm in 112 ( 36% ) cases , 1.1 - 1.5 cm in 101 ( 32% ) cases , and 1.6 - 2.6 cm in 101 ( 32% ) cases . the pre - biopsy final assessments were performed by a single radiologist with five years of experience in breast imaging . seven cases were category 2 , 104 cases were category 3 , 158 cases were category 4 , and 45 cases were category 5 . of the 314 lesions , 88 ( 28% ) were confirmed to be malignant by histology . of the malignant lesions , the most common diagnosis was invasive ductal carcinoma , which was found in 77 of the 88 cancer cases . other diagnoses included tubular carcinoma ( 3/88 ) , mucinous carcinoma ( 3/88 ) and ductal carcinoma in situ ( 5/88 ) . the remaining 226 ( 72% ) of the 314 total lesions were benign , including eight lesions associated with atypical ductal hyperplasia . follow - up ultrasonography was performed for 117 of the 226 benign cases and the mean duration time was 15 months ( range : 3 to 24 months ) . four cases in category 2 had a mean duration time of 11 months ( range : 6 - 17 months ) , 58 cases in category 3 had a mean duration time of 15 months ( range : 4 - 24 months ) , and 55 cases in category 4 had a mean duration time of 14 months ( range : 3 - 24 months ) . the lesions were stable in 65 cases ( 56% ) and decreased in size in 52 ( 54% ) cases . two radiologists at one facility performed a us - guided percutaneous biopsy or localization , and pre - biopsy static sonographic images of each breast lesion were acquired . all images were obtained with high - resolution us equipment ( hdi 5000 or hdi 3000 , advanced technology laboratories , bothell , wa ) using a 12 mhz linear transducer . four radiologists with experience in breast imaging ( 3 - 11 years ) and who work at outside hospitals reviewed the images . for each case , at least two static images including radial and antiradial images or transverse and longitudinal images with and without caliper measurements were provided . other us images including doppler , color doppler , and power doppler images were not provided . mammographic imaging and medical histories were also not provided to eliminate the possibility of introducing bias into the description and assessment of the us images . the bi - rads - us included the assessment of masses , calcification , special cases and the final assessment . however , we focused on us features of masses such as shape , orientation , margin , lesion boundary , echo pattern and posterior acoustic features in this study . each of the four radiologists independently evaluated all of the cases and selected the most suitable single term from each group of the lexicon , and then decided the final category of the lesion . to assess intraobserver variability , one of the four radiologists with experience in breast imaging for four years re - evaluated all cases one month after the initial evaluation . the sensitivity and specificity was calculated for each radiologist by means of a binary outcome ; categories 2 - 3 were grouped as negative , and categories 4 - 5 were grouped as positive . inter- and intraobserver variabilities in choosing sonographic descriptors and final assessment according to the bi - rads - us lexicon were determined using cohen 's kappa statistics ( 13 ) . cohen 's kappa statistics measures the proportion of decisions where observers agree while accounting for the possibility of agreements based on chance alone . perfect agreement results in a kappa value of 1.0 , and a kappa value of 0 indicates the level of agreement expected based on chance alone . although no definitive scale exists , prior reports have suggested a scale for kappa values and their level of agreement between observers : 0.2 indicates slight agreement , 0.21 - 0.40 fair agreement , 0.41 - 0.60 moderate agreement , 0.61 - 0.80 substantial agreement , and 0.81 - 1.00 indicates almost perfect agreement ( 14 ) . cases evaluated in this study were selected from patients who underwent biopsies during a 12-month period . two hundred ninety three female patients with 314 lesions underwent us - guided biopsies at a single facility . the mean patient age was 39.9 years with a range of 17 - 81 years . the vast majority of the masses had diameters in the range of 0.4 - 2.6 cm . the diameters measured were 0.4 - 1 cm in 112 ( 36% ) cases , 1.1 - 1.5 cm in 101 ( 32% ) cases , and 1.6 - 2.6 cm in 101 ( 32% ) cases . the pre - biopsy final assessments were performed by a single radiologist with five years of experience in breast imaging . seven cases were category 2 , 104 cases were category 3 , 158 cases were category 4 , and 45 cases were category 5 . of the 314 lesions , 88 ( 28% ) were confirmed to be malignant by histology . of the malignant lesions , the most common diagnosis was invasive ductal carcinoma , which was found in 77 of the 88 cancer cases . other diagnoses included tubular carcinoma ( 3/88 ) , mucinous carcinoma ( 3/88 ) and ductal carcinoma in situ ( 5/88 ) . the remaining 226 ( 72% ) of the 314 total lesions were benign , including eight lesions associated with atypical ductal hyperplasia . follow - up ultrasonography was performed for 117 of the 226 benign cases and the mean duration time was 15 months ( range : 3 to 24 months ) . four cases in category 2 had a mean duration time of 11 months ( range : 6 - 17 months ) , 58 cases in category 3 had a mean duration time of 15 months ( range : 4 - 24 months ) , and 55 cases in category 4 had a mean duration time of 14 months ( range : 3 - 24 months ) . the lesions were stable in 65 cases ( 56% ) and decreased in size in 52 ( 54% ) cases . two radiologists at one facility performed a us - guided percutaneous biopsy or localization , and pre - biopsy static sonographic images of each breast lesion were acquired . all images were obtained with high - resolution us equipment ( hdi 5000 or hdi 3000 , advanced technology laboratories , bothell , wa ) using a 12 mhz linear transducer . four radiologists with experience in breast imaging ( 3 - 11 years ) and who work at outside hospitals reviewed the images . evaluation and designations were made according to the bi - rads - us . for each case , at least two static images including radial and antiradial images or transverse and longitudinal images with and without caliper measurements were provided . other us images including doppler , color doppler , and power doppler images were not provided . mammographic imaging and medical histories were also not provided to eliminate the possibility of introducing bias into the description and assessment of the us images . the bi - rads - us included the assessment of masses , calcification , special cases and the final assessment . however , we focused on us features of masses such as shape , orientation , margin , lesion boundary , echo pattern and posterior acoustic features in this study . each of the four radiologists independently evaluated all of the cases and selected the most suitable single term from each group of the lexicon , and then decided the final category of the lesion . to assess intraobserver variability , one of the four radiologists with experience in breast imaging for four years re - evaluated all cases one month after the initial evaluation . the sensitivity and specificity was calculated for each radiologist by means of a binary outcome ; categories 2 - 3 were grouped as negative , and categories 4 - 5 were grouped as positive . inter- and intraobserver variabilities in choosing sonographic descriptors and final assessment according to the bi - rads - us lexicon were determined using cohen 's kappa statistics ( 13 ) . cohen 's kappa statistics measures the proportion of decisions where observers agree while accounting for the possibility of agreements based on chance alone . perfect agreement results in a kappa value of 1.0 , and a kappa value of 0 indicates the level of agreement expected based on chance alone . although no definitive scale exists , prior reports have suggested a scale for kappa values and their level of agreement between observers : 0.2 indicates slight agreement , 0.21 - 0.40 fair agreement , 0.41 - 0.60 moderate agreement , 0.61 - 0.80 substantial agreement , and 0.81 - 1.00 indicates almost perfect agreement ( 14 ) . the sensitivity and specificity of the us interpretations by the four radiologists are summarized in table 1 . the sensitivities of observers were high ( 96 - 100% ) , but the specificities were low and variable ( 8 - 43% ) . statistical analysis of agreement among observers when choosing lesion descriptions showed a range from fair to substantial concordance . the greatest reproducibility was found among observers determining the mass orientation ( k = 0.61 ) . however , only moderate levels of interobserver agreement were found for three of the six descriptive groups : mass shape , boundary and posterior feature ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) . the lowest levels of concordance occurred when observers determined the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) ( table 2 ) . figure 1 shows an image for which observers used variable terms to describe the margin but had good agreement for the final assessment . the reproducibility of the final assessment when assigning lesions as category 2 , 3 , 4 , or 5 was moderate ( k = 0.49 ) ( table 2 ) . when assigning lesions as category 2 , the greatest reproducibility was found ( k = 0.66 ) and moderate agreement degree was found for category 5 ( k = 0.54 ) . only fair reproducibility was found for determining category 3 ( k = 0.26 ) and for category 4 ( k = 0.30 ) . when choosing between a follow - up evaluation ( category 2 and 3 ) or recommending a biopsy ( category 4 and 5 ) , the level of agreement was lower ( k = 0.33 ) than when assigning lesions as category 2 , 3 , 4 , or 5 . figure 2 shows a lesion for which the observers disagreed on the final assessment and recommendation . substantial intraobserver agreement was found in selecting all of the morphologic features ( table 3 ) . substantial agreement was achieved for the final assessment category ( k = 0.74 ) with all final categories ( 2 , 3 , 4 and 5 ) . perfect agreement was found with lesions categorized as category 2 ( k = 1.0 ) . substantial agreement was obtained for categories 3 and 5 ( k = 0.61 and k = 0.68 , respectively ) . there was moderate agreement among observers for category 4 ( k = 0.59 ) . when choosing between follow - up care or recommending a biopsy , for all final categories the level of agreement was lower ( k = 0.62 ) than the assessment category ( k = 0.74 ) . the degrees of agreements for all descriptors except echo pattern were similar to the study of baker et al . ( 9 ) ; in the current study , the degree of agreement for the final assessment was higher . statistical analysis of agreement among observers when choosing lesion descriptions showed a range from fair to substantial concordance . the greatest reproducibility was found among observers determining the mass orientation ( k = 0.61 ) . however , only moderate levels of interobserver agreement were found for three of the six descriptive groups : mass shape , boundary and posterior feature ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) . the lowest levels of concordance occurred when observers determined the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) ( table 2 ) . figure 1 shows an image for which observers used variable terms to describe the margin but had good agreement for the final assessment . the reproducibility of the final assessment when assigning lesions as category 2 , 3 , 4 , or 5 was moderate ( k = 0.49 ) ( table 2 ) . when assigning lesions as category 2 , the greatest reproducibility was found ( k = 0.66 ) and moderate agreement degree was found for category 5 ( k = 0.54 ) . only fair reproducibility was found for determining category 3 ( k = 0.26 ) and for category 4 ( k = 0.30 ) . when choosing between a follow - up evaluation ( category 2 and 3 ) or recommending a biopsy ( category 4 and 5 ) , the level of agreement was lower ( k = 0.33 ) than when assigning lesions as category 2 , 3 , 4 , or 5 . figure 2 shows a lesion for which the observers disagreed on the final assessment and recommendation . substantial intraobserver agreement was found in selecting all of the morphologic features ( table 3 ) . substantial agreement was achieved for the final assessment category ( k = 0.74 ) with all final categories ( 2 , 3 , 4 and 5 ) . perfect agreement was found with lesions categorized as category 2 ( k = 1.0 ) . substantial agreement was obtained for categories 3 and 5 ( k = 0.61 and k = 0.68 , respectively ) . there was moderate agreement among observers for category 4 ( k = 0.59 ) . when choosing between follow - up care or recommending a biopsy , for all final categories the level of agreement was lower ( k = 0.62 ) than the assessment category ( k = 0.74 ) . the degrees of agreements for all descriptors except echo pattern were similar to the study of baker et al . ( 9 ) ; in the current study , the degree of agreement for the final assessment was higher . many studies have reported significant inter- and intraobserver variabilities in lesion description and assessment on mammography ( 4 - 8 ) . for us , baker et al . ( 9 ) reported a lack of uniformity among observers use of descriptive terms for breast masses using the lexicon described and further defined by stavros et al . a standardized lexicon similar to that of the bi - rads was proposed ( 9 ) . recently , a study by lazarus et al . examined observer variability using the new bi - rads lexicon ( 12 ) . in spite of using a standardized lexicon , these investigators showed a similar level of consistency using terminology and lower level of consistency for final assessment among observers compared to the baker et al . ( 12 ) , degrees of agreement for shape , margin and boundary were lower and higher for posterior features , echo pattern and final categories , and were similar for orientation ( table 2 ) . in the baker et al . study ( 9 ) , a greater reproducibility was obtained in determining the shape , margin , echo pattern , posterior feature and final category of a mass ( k = 0.8 , k = 0.43 , k = 0.4 , k = 0.55 and k = 0.51 , respectively ) than in the lazarus et al . ( 12 ) study and our study ( table 2 ) . in our study , the greatest consistency was found in determining the orientation of a mass ( k = 0.61 ) . in the lazarus et al . study ( 12 ) , good consistency was also seen ( k = 0.61 ) . the determination of parallel or not parallel orientation is generally easily measured , explaining the high degree of observer agreement . moderate agreement was obtained for shape , boundary , and posterior feature . for shape , some difficulties arose when trying to classify abnormalities containing five or six more gentle lobulations as oval or irregular , which may have contributed to the inter - observer variability ( fig . , questions arose among the observers when the lesion was elliptical - shaped with not - parallel orientation as to whether it could be deemed as having an " oval shape . " this situation is not trivial as the designation of an oval shape can influence a radiologist to conclude that the lesion is benign . when determining the posterior acoustic feature , we also had some difficulties because four observers evaluated only static images furthermore , the use of good us equipment can compensate for posterior acoustic features and posterior shadowing becomes less conspicuous . we could not find out why the agreement for cho pattern was so low , but it seems to have little effect on determining a final category . the greatest variation amongst observers was found when labeling a mass margin ( k = 0.32 ) . as mass margin is a critical feature for determining whether a lesion should be biopsied or not , this determination alone can have a substantial effect on the final assessment . the margins of a lesion may be heterogeneous , which may make it difficult to accurately label it using only one term . in this study when more than one type of margin existed in a lesion , we resolved this issue by choosing the term having the greatest positive predictive value , according to stavros and colleagues criteria ( 10 , 11 ) . the variability in the observers description of breast masses resulted in an inconsistent final assessment using bi - rads - us . only a moderate level of agreement ( k = 0.49 ) was found for the final assessment . when assigning lesions category 2 , negative for malignancy and category 5 , highly suggestive of malignancy , greater agreements were achieved ( k = 0.66 and k = 0.54 , respectively ) . this means that observers have similar conceptions for benign ( category 2 ) and malignant lesions ( category 5 ) and variable for probably benign ( category 3 , k = 0.26 ) and suspicious abnormalities ( category 4 , k = 0.3 ) . thus , the numbers of category 3 or 4 lesions will influence observer variability for each study . the level of agreement in determining a lesion as belonging to category 2 to 5 ( k = 0.40 ) was higher than when trying to determine whether close follow - up or a biopsy would be recommended ( k = 0.33 ) . this inconsistency is expected to have a negative effect on patient management . as expected , the agreement of evaluation within a single observer is better than that among multiple observers . we believe that radiologists have their own internally established standardization of lesion descriptions and criteria of the final categorization , but that the difference in choosing from a fixed set of lesion descriptors between observers may be the result of each individual having different cut - off points for determining whether one description or another is applicable . first , the number of category 2 or 3 lesions was small and the radiologists may have had a greater tendency to interpret a lesion as being worrisome as the cases of this study were selected from those performed for biopsy . second , observers did not perform and evaluate real time us , but interpreted only static images . thus the observers in this study did not have the opportunity to take advantage of certain real time us benefits such as manual compensation of the posterior feature . third , the radiologists studied bi - rads - us by themselves and made their own criteria . if they had had a more standardized education for bi - rads - us , we assume that interobserver reproducibility would be higher than reported . upon issuing bi - rads - us , the acr states that agreement on terminology and assessment categorization was reached by consensus of an expert working group and agreement among both experienced and novice breast imagers for most terms ( 1 ) . yet our study shows only moderate agreement for most descriptive terms and the final assessment , although the accuracies of observers were similar with one another . of special note , the level of agreement in determining the margin and echo patterns was commonly low in our study , as well as in studies by others . in conclusion , although the use of acr bi - rads - us as a unified descriptor system was made , observer agreements were only fair to substantial in the mass description and final assessment of breast abnormalities . the achievement of better agreement will ultimately require specialized education , as well as periodic performance assessments and self - auditing practice tests . | objectivethis study aims to evaluate the degree of inter- and intraobserver agreement when characterizing breast abnormalities using the breast imaging reporting and data system ( bi - rads)-ultrasound ( us ) lexicon , as defined by the american college of radiology ( acr).materials and methodstwo hundred ninety three female patients with 314 lesions underwent us - guided biopsies at one facility during a two - year period .
static sonographic images of each breast lesion were acquired and reviewed by four radiologists with expertise in breast imaging .
each radiologist independently evaluated all cases and described the mass according to bi - rads - us . to assess intraobserver variability , one of the four radiologists reassessed all of the cases one month after the initial evaluation .
inter- and intraobserver variabilities were determined using cohen 's kappa ( k ) statistics.resultsthe greatest degree of reliability for a descriptor was found for mass orientation ( k = 0.61 ) and the least concordance of fair was found for the mass margin ( k = 0.32 ) and echo pattern ( k = 0.36 ) .
others descriptive terms : shape , lesion boundary and posterior features ( k = 0.42 , k = 0.55 and k = 0.53 , respectively ) and the final assessment ( k = 0.51 ) demonstrated only moderate levels of agreement . a substantial degree of intraobserver agreement was found when classifying all morphologic features : shape , orientation , margin , lesion boundary , echo pattern and posterior feature ( k = 0.73 , k = 0.68 , k = 0.64 , 0.68 , k = 0.65 and k = 0.64 , respectively ) and rendering final assessments ( k = 0.65).conclusionalthough bi - rads - us was created to achieve a consensus among radiologists when describing breast abnormalities , our study shows substantial intraobserver agreement but only moderate interobserver agreement in the mass description and final assessment of breast abnormalities according to its use .
a better agreement will ultimately require specialized education , as well as self - auditing practice tests . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is the sixth most common cancer worldwide and the third cause of cancer - related death.1 in 2002 at least 600,000 new cases were registered and its incidence and prevalence in us and western europe have been increasing during the past decade . in 80% of cases hcc affects cirrhotic livers and it is now considered the first complication to occur and the major cause of liver - related death.2 principal risk factors for developing cirrhosis and then hcc are chronic liver diseases and in particular chronic b and c hepatitis / cirrhosis , alcoholic liver disease and nonalcoholic steatohepatitis - related cirrhosis.35 guidelines for hcc management recommend mortality risk estimates as a decision - making support.3 unfortunately , the ability of all the available prognostic scores to predict mortality is far from perfect and none of these systems provide sufficient confidence for the prediction of the outcome in the individual patient with hcc.3,68 in the absence of an optimum prognostic model , treatment algorithms for patients with hcc in europe and north america have been prepared on the basis of the barcelona clinic liver cancer ( bclc ) classification.3,9,10 the bclc staging classification for hcc classifies patients as having stages of disease from 0 to d ( figure 1 ) . stage 0 is very early disease , which is defined as a solitary liver cancer that measures 2 cm without tumor invasion into surrounding tissues . stage a is early disease , classified as patients who exhibit preserved liver function with a solitary hcc < 5 cm in size , or up to 3 tumors each of which is 3 cm in size . patients with stage 0 or stage a disease can be effectively treated with curative therapies , such as surgical resection , liver transplantation , or by percutaneous ablation methods , including percutaneous ethanol injection ( pei ) and radiofrequency ablation ( rfa ) . with these treatments it is possible to obtain complete responses with potential long - term cure , as reflected by a 5-year survival better than 50% to 70% . the bclc intermediate stage ( stage b ) consists of asymptomatic patients with well - preserved liver function , and multinodular or large tumor extension , without macrovascular invasion or extrahepatic spread ( es ) . patients with stage b ( intermediate ) disease treated with transarterial embolization ( tae ) or transarterial chemoembolization ( tace ) have demonstrated a significant increase in survival compared with best supportive care ( median survival , 20 months vs 16 months ) . patients with mild related symptoms and/or macrovascular invasion or es are classified as advanced stage ( bclc stage c ) . previously , no standard systemic therapy existed for the treatment of patients at this stage ; however , two randomized controlled trials ( rcts ) have now shown that sorafenib , an inhibitor of raf kinase and vascular endothelial growth factor receptor ( vegfr ) , improves the overall survival of patients with stage c disease . sorafenib is , therefore , now considered to be the standard treatment for advanced hcc.11,12 patients with cancer symptoms , related to progressed liver failure , tumor growth with vascular involvement , es , or physical impairment ( performance status > 2 ) are classified as stage d ( end stage ) disease ; they do not benefit from antitumor treatments and should receive only the best available supportive care . it should be noted that not all patients defined by each stage of bclc are ultimately candidates for the suggested treatment modality . for instance , tace can be performed at an early stage in patients for whom rfa or pei can not be performed because of tumor location ( proximity to a gallbladder , biliary tree , or blood vessel ) , or because of failed prior curative treatments or medical comorbidities . tace is also the first - line therapy for downstaging tumors that exceed the criteria for transplantation or in patients awaiting orthotopic liver transplantation ( olt ) . moreover , even if guidelines for the management of hcc provide indications for the use of various treatments as monotherapies , in clinical practice a multimodal approach that combines various techniques is used , either as first - line therapy or as a rescue ( second - line ) approach after the failure of a monotherapy ( table 1).13,14 hcc is an insidious disease , with no particular or specific signs and symptoms of manifestation and whose behavior is usually unpredictable . its natural history is also dependent on functional impairment of the underlying liver disease which often limits the application of therapeutic opportunities and influences survival . the spontaneous course of the unresectable disease has recently been evaluated in a meta - analysis which analyzed the survival rates of the placebo and untreated arms of several rcts on hcc patients , showing that the 1- and 2-year survival is extremely heterogeneous ( figure 2).15 moreover , when studies were separated according to the bclc stage , the 1-year survival was much higher in rcts including only bclc b or c patients ( 34% ) than in those also including bclc d patients ( 11%).15 for ethical reasons it is not possible to evaluate in rcts the natural history of early hcc . however a milestone paper published in 1989 showed that 1- and 2-year overall survival of asymptomatic patients with hcc and cirrhosis was 96% and 50% , respectively.16 despite the many treatment options , the prognosis of hcc remains dismal . a majority ( 70% to 85% ) of patients present with advanced or unresectable disease.17 since the stage of cancer dictates the therapeutic choice , early detection is a primary objective . the goal of cancer screening is to reduce mortality through a reduction in incidence of advanced disease . although the optimal methods of screening and the cost - effectiveness of surveillance ( the repeated application of screening tests ) for hcc remain to be established , systematic screening still offers the best hope for early diagnosis , treatment eligibility , and improved survival.10,18 recall policies are the policies instituted to deal with an abnormal screening test result . once a hepatic lesion is found during ultrasonographic surveillance , diagnosis of hcc is made through the application of some criteria that have been recently updated by bruix and sherman and have been endorsed by the american association for the study of liver diseases.10 according to these criteria , patients with nodules < 1 cm in diameter detected by ultrasonography are followed up every 3 to 6 months in order to observe any variation of aspect or dimensions . nodules > 1 cm in diameter should be investigated with at least one dynamic radiological study ( 4-phase multidetector ct scan or dynamic contrast enhanced mri ) . when typical contrast - enhancing behavior of hcc is observed ( ie , presence of a hypervascular pattern in arterial phase with a wash out of contrast during the venous and late phase ) the lesion should be treated as hcc . if imaging findings are atypical for hcc or uncertain , a second contrast - enhanced study with the other imaging modality should be performed or the lesion should be biopsied ( figure 3).10 several studies have evaluated the cost - effectiveness of the recall policies.1921 generally , hcc develops on a background of chronic liver disease or inflammation and cirrhosis in 70% to 90% of all cases . all risk factors for liver cirrhosis play a role in the hepatocellular carcinogenesis and liver cirrhosis per se is a precancerous condition.22 hcc is known to show a multistep progression from the hyperplastic nodule to early hcc and finally to moderately / poorly differentiated hcc ( figure 4 ) . throughout the course of this pathway , nodules acquire evident changes in vascular supply with development of newborn unpaired arteries that progressively replace portal vessels , giving the nodule the typical hypervascular appearance . the hepatocarcinogenetic process is mostly characterized by the appearance of dysplastic lesions ( dysplastic phase ) in the form of microscopic foci ( large and small cell changes ) and macroscopic dysplastic nodules ( low and high grade).23,24 this phase is very important because patients harboring these lesions are at increased risk of developing hcc , allowing early tumor detection and consequently improving survival . the possibility of de novo development of hcc without premalignant antecedents is rare , but can not be excluded . high - grade dysplastic nodules are the most advanced precursors of hcc and small and well - differentiated hccs with indistinct margins are the earliest and smallest recognizable forms of hcc ( usually < 2 cm ) . despite our growing comprehension of the different pathways altered in hepatocellular tumors , the molecular mechanisms that lead to malignant transformation of hepatocytes and give rise to a hcc are still poorly understood . several epigenetic and genetic alterations are involved in hepatocellular tumorigenesis , leading to mutations in genes that control cell cycle , proliferation , and apoptosis . different risk factors such as viral infections , oxidative stress , and cirrhotic inflammation induce the initiation of carcinogenesis and then the progressive occurrence of gene mutations contribute to the selection of cells that can proliferate and survive in an uncontrolled way . principal mutations observed in hcc carcinogenesis are deletions or gains of chromosome segments , point mutations , and epigenetic changes such as hypermethylation of gene promoters.25 during the past few years several possible key molecular pathways involved in hcc s pathogenesis have been discovered and they represent important potential targets for experimental therapies . the mitogen - activated protein kinase ( mapk ) pathway is a cascade of phosphorylation events mediated by four cellular kinases ( ras , raf , map and extracellular signal related kinase [ erk ] ) that influence cellular proliferation , differentiation , and apoptosis and are frequently involved in hcc pathogenesis . the phosphoinositide-3 kinase / protein kinase b / mammalian target of rapamycin ( pi3k / akt / mtor ) pathway includes a group of cellular kinases that promote regulation of cell cycle and apoptosis , and it is frequently upregulated in certain subgroups of hccs . moreover , several growth factors and their receptors are , interestingly , involved in hcc pathogenesis . in particular both egfr and vegfr are overexpressed in tumor tissue and possibly play a role in neoplastic cell growth and metastatization.26 as mentioned above , sorafenib is recommended as the first - line option in patients who can not benefit from resection , transplantation , ablation , or transarterial chemoembolization , and still have preserved liver function.10 the multicenter sharp trial randomly assigned 602 patients with inoperable hcc and child pugh a cirrhosis to sorafenib ( 400 mg twice daily ) or placebo.11 overall survival , the primary end - point , was significantly longer in the sorafenib - treated patients ( 10.7 vs 7.9 months ) , as was time to radiologic progression ( 5.5 vs 2.8 months ) . the magnitude of benefit was markedly less in the second trial12 than in the sharp trial . in fact , the treated group in the asian trial had a shorter survival duration than the control group in the sharp trial ( 6.5 vs 7.9 months ) , despite the fact that both trials used the same entry criteria . nevertheless , patients accrued to the asian study were more ill at the start of therapy than those in the sharp trial , with a generally worse performance status and more advanced stage of disease . sorafenib was generally well tolerated and the overall incidence of serious adverse events in the sorafenib and placebo groups was comparable ( 52% and 54% , respectively ) . drug - related adverse events ( diarrhea , hand foot skin syndrome [ hfsr ] , anorexia , weight loss , asthenia , alopecia , and voice changes ) , especially of grade 1 or 2 severity , were observed more frequently in the sorafenib group than in the placebo group ( 80% vs 52% ) . the two most common grade 3 adverse reactions with sorafenib were hfsr ( 8% ) and diarrhea ( 8% ) . there were no significant differences in discontinuation rates between the sorafenib and the placebo group ( 38% and 37% respectively ) because of adverse events . the safety profile of sorafenib was comparable to those of the subsequent asia pacific phase iii trial that enrolled patients of eastern countries with similar eligibility criteria . however , reports of its tolerability and efficacy in a real - life setting ( outside rcts ) are still scarce . a recent report , published as an abstract , showed that during treatment with sorafenib occurrence of adverse events of any grade is common ( 89% ) and often requires dose reduction or discontinuation . moreover , in this study , the overall 1-year survival rate was not significantly different between patients who received full dose and patients who received reduced dose . dose - ranging studies in order to assess the individual effective dose may be required.27 several new molecular targeted therapies are under clinical development for the treatment of advanced hcc including anti - egfr molecules such as erlotinib , monoclonal antibodies against vegf such as bevacizumab , and antiangiogenic agents such as sunitinib , brivanib , or linifanib ( table 2 ) . bevacizumab is a recombinant humanized monoclonal antibody against vegf - a . in a multicenter phase ii study , 46 patients with child pugh a class cirrhosis and unresectable hcc with no extrahepatic disease and vascular involvement were enrolled ; 6-month progression - free survival was achieved in 65% of these patients , with a 13% rate of partial response to treatment.28 bevacizumab has also been evaluated in combination with chemotherapy in several phase ii studies . in a phase ii study , 33 patients , even with metastatic disease , treated with bevacizumab , gemcitabine , and oxaliplatin achieved a 20% response rate with an overall median survival time of 9.6 months.29 a phase ii trial of bevacizumab and erlotinib showed a response rate of 25% with a median overall survival of 68 weeks.30 on the basis of these results , bevacizumab , alone or in combination , may have an antitumoral activity against hcc , but its efficacy and tolerability profile , in particular because of the increased risk of variceal bleeding and thromboembolic events , requires further evaluation . brivanib alanate is an inhibitor of vegfr and fibroblast growth factor receptor tyrosine kinases . at present a large randomized phase iii trial is studying brivanib as second - line therapy in hcc patients who have progressed on sorafenib.31 sunitinib is another oral multikinase inhibitor against vegfr1 , vegfr2 , platelet derived growth factor receptor ( pdgfr ) alfa and beta , c - kit , flt3 , and ret kinases . after two phase ii trials32,33 which analyzed efficacy and tolerability of sunitinib in advanced hcc , a phase iii trial comparing sunitinib and sorafenib was conducted . unfortunately it has been recently discontinued because of the high incidence of serious adverse effects in the sunitinib arm of study.31 erlotinib is an oral egfr inhibitor against its tyrosine kinase domain . two phase ii studies investigated efficacy of erlotinib in advanced hcc34,35 and a phase iii trial in combination with sorafenib is ongoing.31 a combination of erlotinib and bevacizumab versus sorafenib is now being studied in a multicenter phase ii trial.31 linifanib ( abt-869 ) is an oral agent that acts as a selective inhibitor of vegf and pdgf tyrosine kinase receptors that was recently evaluated in a phase ii trial conducted on child pugh a or b cirrhotic patients that reported a median time to progression and progression - free survival of 112 days with a median overall survival of 295 days.36 preliminary pharmacokinetics analysis in child pugh a and b patients showed that degree of hepatic impairment of tumor extent do not influence linifanib pharmacokinetics.37 its safety profile was acceptable and therefore a new phase iii study comparing linifanib with sorafenib in patients with advanced hcc is ongoing.31 despite the use of aggressive treatments such as resection , olt , pei , rfa , and tace , tumor recurrence and the development of extrahepatic metastases continue to have a marked effect on survival of patients with hcc . several steps are required to improve the effectiveness of hcc therapy , including the implementation of screening programs to increase the number of patients diagnosed in early stages of disease , and improving patients access to specialized , multidisciplinary treatments ( ie , pharmacological , interventional , radiological , and surgical ) . image - guided loco - regional therapies have long been used in the setting of combined treatment strategies to improve their efficacy and effectiveness . an accepted indication is the use of interventional treatment in patients awaiting transplantation to prevent tumor progression when the waiting time exceeds 6 months.38 a combination of tace followed by rfa or pei has been used to minimize heat loss due to perfusion - mediated tissue cooling and thus increase the therapeutic effect of rfa.13,14 combination treatment with rfa plus pei can improve survival compared with the use of rfa alone in selected patients.39 however , large rcts should be performed to confirm the efficacy of these combination therapies . the impact of sorafenib on advanced - stage hcc is a landmark finding in the treatment of liver cancer . moreover , the potential value of antiangiogenic and antiproliferative properties of sorafenib is currently under evaluation for early and intermediate stages in preventing recurrence . in fact , two studies31 that aim to evaluate the effect of sorafenib versus placebo after curative treatment ( adjuvant therapy ) , and the effect of sorafenib versus placebo in combination with tace ( combined therapy ) , have already been initiated . the sorafenib as adjuvant treatment in the prevention of recurrence of hepatocellular carcinoma ( storm ) rct is an international study that is evaluating effects of sorafenib versus placebo after resection or local ablation . the primary end - point of this rct is recurrence - free survival . the sorafenib or placebo in combination with tace in hepatocellular carcinoma ( space ) is investigating the combination of sorafenib and tace in patients with intermediate hcc with the aim of reducing risk of local relapse after this procedure . recently , although in the absence of solid evidence , panels of experts proposed shifting therapy to sorafenib in patients in intermediate stage if they showed poor tolerance or disease progression ( new lesions or growth lesions ) after first or second tace,40,41 and suggested continuing treatment with sorafenib even if patients previously treated with sorafenib showed disease progression during treatment42 ( figure 5 ) . however , well - conducted large studies are needed to evaluate these treatment approaches . several targeted agents are under investigation , which show encouraging results in phase ii studies . the combination of multiple , targeted agents may be the next logical step in the treatment of hcc due to the strong rationale of inhibiting signaling pathways in hepatocarcinogenesis . undoubtedly , the best way to prevent the development of hcc is the prevention of risk factors leading to chronic injury ( primary prevention ) . vaccination against hepatitis b ( hbv ) has decreased the incidence of hbv - related hcc . vaccination against hepatitis c ( hcv ) is not yet possible , and prevention of hcv infection relies on the implementation of adequate public health measures . a major challenge remains the early diagnosis of hcc in order to allow a potentially curative treatment approach ( secondary prevention ) . hcc surveillance by abdominal ultrasound should be performed on all patients at risk at 6-month intervals . diagnosis of hcc at an early stage provides the opportunity for therapy ( resection , olt , percutaneous ablation ) with the aim of complete response and potential long - term cure . tace is the recommended treatment modality for hcc at intermediate stage with well - preserved liver function . sorafenib is the standard treatment for intermediate or advanced stage hcc beyond the benefit of liver transplantation , surgery , and loco - regional therapies . trials comparing new agents with sorafenib and new agents in combination with sorafenib against sorafenib alone are a priority . in the absence of standard - of - care second - line therapy , randomized second - line trials should be placebo controlled . despite the availability of several treatment options , tumor recurrence and metastatic disease continue to have an important role on survival , and for this reason there is urgent need for effective neoadjuvant and adjuvant therapies in order to enhance benefits of these approaches . the advent of systemic therapies for hcc and in particular the success of antiangiogenic molecules such as sorafenib has opened a new window on promising clinical research that may potentially affect the future treatment of this disease . sorafenib has been shown to effectively prolong survival in patients with advanced hcc and preserved liver function but many other molecularly targeted agents , used alone or in combination , are in different stages of clinical development . combination of systemic therapies with local treatments in patients with hcc is still being evaluated but holds the promise of further improvements in patient outcomes . well - conducted , randomized controlled trials to examine the effectiveness of different multimodal approaches are urgently needed . given the complexity of the disease ( in particular for the presence of chronic liver disease ) and the large number of potentially useful therapies , it is not surprising that the expertise of many physicians is required to provide optimal care to patients with hcc . patients diagnosed with liver cancer should be referred to multidisciplinary teams including hepatologists , gastroenterologists , surgical oncologists , transplant surgeons , medical oncologists , radiation oncologists , diagnostic radiologists , interventional radiologists , primary care physicians , palliative care physicians , and allied health professionals , all of whom should play an active role in the care of these patients . treatment decisions should be discussed in multidisciplinary meetings , as no single treatment strategy can be applied to all patients , and treatment must be individualized . | hepatocellular carcinoma ( hcc ) is a major health problem .
it is currently the third cause of cancer - related death , it is highly prevalent in the asia pacific region and africa , and is increasing in western countries .
the natural history of hcc is very heterogeneous and prediction of survival in individual patients is not satisfactory because of the wide spectrum of the disease . during the past decade
, major advances have been achieved in prevention , through better surveillance of patients at risk , and in therapy through better surgical and ablative therapies and multimodal treatment approaches . moreover ,
the increasing knowledge of molecular hepatocarcinogenesis provides the opportunity for targeted therapies . in this setting , the impact of sorafenib on advanced - stage hcc is a landmark finding in the treatment of liver cancer .
the role of sorafenib administration as adjuvant therapy after curative treatment is being evaluated in clinical studies .
future research should lead to a molecular classification of the disease and a more personalized treatment approach . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
corrosive chemicals are used for many purposes in daily life , like cleaning agents , cosmetics , substances used for house , car , and upkeep of the garden . oral intake of these substances either by accident , or sometimes purposely , may cause life - threatening problems . inadvertant drinking of corrosive substances usually occurs in a group of patients at the pediatric age . recent data suggest that more than 200,000 exposures to household or industrial cleaning products occur annually in the united states and corrosive esophageal burns affect for about 5000 15000 people in the usa every year . although there are no epidemiological studies reported from our country , clinical experiences show that this rate is probably higher in turkey . ingested corrosive agents can produce oropharyngeal and gastrointestinal damages ranging from minor burns to full - thickness injuries , with severe necrosis , depending on the amount and concentration of the agent and duration of exposure . systemic symptoms due to gastrointestinal absorbtion of corrosive substances and sudden death in the following period is not very common . the most important reason of sudden death is the laryngeal burn , edema , and inflammation caused by chemical substances , and the resulting acute respiratory obstruction . however , in corrosive esophagitis patients , mortality is rather due to severe chemical burn in the thoracal and abdominal regions , presenting with the interruption of the integrity of the gastrointestinal tract , with necrosis , perforation , hemorrhages , and infections . the interventions made in the acute phase and the care given in the following period carry high mortality and morbidity risks and mandate a multidisciplinary approach and a close follow - up . the aim of this report is to state the fact that good outcomes are possible in severe burns caused by the oral intake of corrosive substances when fast , multidisciplinary , and appropriate management is provided on time . we report a case of massive hemorrhagic necrosis of the gastrointestinal organs , including the lower esophagus , stomach , small bowel , and pancreas , secondary to caustic ingestion of hydrochloric acid . herewith , we report the case of a 49-year - old male patient who had attempted suicide by drinking about 800 ml of 25% hydrochloric acid , and was in the ankara gven hospital , ankara , turkey , in 2009 . the patient was admitted to the emergency department within 30 minutes of ingestion of the corrosive liquid , with severe abdominal pain , agitation , and respiratory discomfort . the patient , with a history of no previous systemic disorder , was evaluated by gastroenterology , general surgery , and emergency department practitioners , as also the intensive care unit ( icu ) team . on admission to the icu , his consciousness was delirious in nature and he was confused . his blood pressure was 130/90 mmhg , heart rate 115/minute , oxygen saturation ( spo2 ) 90% , and respiratory rate 25 per minute . in the physical examination of the respiratory system , wheezing and prolonged expirium existed , together with fine rales . there were increased abdominal irritability and peritoneal irritation signs , but no pathological findings in the thoracoabdominal tomographic examination . his initial leucocyte count was 20.600 cell / ul , creatinine 1,68 mg / dl , aspartate aminotransferase 455 u / l , alanine aminotransferase 175 u / l , lactate dehydrogenase 701 u / l , gamaglutamyl transferase 110 u / l , sodium 152.1 meq / l , potassium 3.21 meq / l , ph 7.29 , po2 71 mmhg , pco2 43 mhg , hco3 17.4 mmol / l , and spo2 89% . intravenous hydration , meperidine , antibiotics , nonsteroidal anti - inflamatory agents , methylprednisolone , and proton pump inhibitors were given for his symptoms . after admission to the emergency department , the patient was moved to the icu and sedated with opioids and benzodiazepines , because of his agitative state . with nasal oxygen delivery nine hours after ingestion , due to gradually increasing metabolic ascidosis and respiratory deterioration , the patient was intubated and connected to the mechanical ventilator . arterial , central venous , and urinary catheterization were performed . his acute physiology and chronic health evaluation ii at the forty - eighth hour , because of extensive abdominal pain and serious respiratory discomfort , the thoracoabdominal computerized tomography ( ct ) was repeated [ figure 1 ] . an urgent surgical intervention was made because free abdominal fluid was detected on ct . during the operation , total gastrectomy , duodenal resection , partial jejunectomy , and partial pancreatectomy were performed . due to splenic hemorrhage , splenectomy was also applied [ figures 2 - 4 show pictures of the resected material ] . histopathological analysis of the surgical material revealed stage iiib necrosis , which was also called black necrosis. hemogram and electrolyte levels were closely followed up during the perioperative period . the blood components were given and fluid replacements were administered when needed . computed tomography scan of the abdomen at admission intraoperative perspective for severe intestinal burn totally resected material . note the widespread of the burn black necrosis of the stomach the patient was extubated eight days after the operation , without deterioration of oxygenation . however , he had abdominal infections and / or serious metabolic problems in common , such as , lactic ascidosis or low serum sodium bicarbonate levels , due to abdominal low perfusion andrenal insufficiency . after surgery , antibiotherapy , parenteral nutrition , and palliative care were applied to the patient for 140 days , 105 of which passed in the icu . nine complemantary or intra - abdominal debridement and clean - up surgeries were performed during this period . oral nutrition was started on the one hundred and twenty - fifth day of hospitalization . parenteral nutrition was gradually stopped and he was discharged with recommendations for psychiatry , gastroenterology , general surgery , and physical therapy departments on the one hundred and fortieth day . after six months , he came for a follow - up without any further complication . however , compared with the ingestion of corrosive substances in children , this problem tends to be more serious in adults , because its intent is often suicidal , rather than accidental . mortality rates are generally reported to be 10 20% , but they can be as high as 78% , if the intake is purposely for suicide . the degree and extent of damage depends on several factors like the type of substance , the morphological form of the agent , the quantity , and the intent , as well as the burn itself . these infectious situations may include ; stomatitis , gingivitis , mediastinitis , peritonitis , pneumonia , and the like . infections may develop secondary to perforation or surgery , because of impairment of epithelization and wound healing . severe mediastinitis and mediastinal abscess formation is reported in 1% of esophageal perforation cases . in our case , intra - abdominal infections had been one of the most important factors affecting the progression of the disease . he had undergone surgical interventions many times because of infections and had to receive long - term , wide - spectrum , antibiotherapy . as a result of utmost intensive care , intrathoracic or respiratory system infections did not occur in our patient , which frequently coexist and diminish morbidity and mortality in icu patients , as well as , corrosive burn patients . caustic and corrosive injury of the upper gastrointestinal tract can lead to significant morbidity and mortality , with the development of upper gastrointestinal stricture or perforation . medical and surgical treatments are controversial and include steroids , antibiotics , esophageal dilation , stenting , and surgical reconstruction , and are centered around saving esophageal integrity and preventing esophageal strictures . early diagnosis and prompt and aggressive treatment can improve the long - term outcomes in these patients . in the acute stage , perforation and necrosis x - rays of the abdomen and chest should be done initially to detect any evidence of perforation . endoscopy should be performed as soon as possible in all cases , to evaluate the extent and severity of damage , unless there was evidence of perforation . in this case we attempted an investigational endoscopy , but we could not complete the procedure , because the mucosa of esophagus looked pale and thin and there were widespread necrotic and hemorrhagic areas . continuing the procedure might have led to esophageal perforation and further complicated the medical status . in severe corrosive injuries of the upper respiratory tract , intubation and ventilation however , this does not reflect the severity of gastric or intestinal injury . on account of fast swallowing of the corrosive material , intraoral irritation may not occur , whereas , intestinal damage may be tremendous . choosing the best time for airway instrumentation is crucial , if the decision of intervention is prolonged , due to edema and tissue necrosis , the airway may not be provided . careful management of the acid base status , electrolytes , and blood counts are recommended . in our patient severe electrolyte , sodium bicarbonate , fresh frozen plasma , or erythrocyte suspension replacements were given according to the laboratory values . long - term complications include stricture formation in the oesophagus , antral stenosis , and the development of esophageal carcinoma . this patient was redirected to the associated branches for nutrition , swallowing therapy , and follow - up , after discharge from the hospital . if hemorrhages , erosions , necrosis , and pale - atrophic mucosa is detected , a close clinical follow - up should be made for a possible perforation . a multidisciplinary approach is crucial in a way that an adequate treatment can be administered , and short- and long - term complications can be avoided . this case report supports that even if the damage is very serious and proceeds to mortality , an aggressive multidisciplinary approach would help prevent complications and mortality rates may decrease in corrosive - intake patients . | inadvertantly or purposely , an oral intake of corrosive substances may cause life - threatening problems . early admission to the hospital , clinical and endoscopic evaluation , and early surgery when required , may reduce morbidity and mortality .
we report the case of a 49-year - old male patient , who had attempted suicide , by drinking about 800 ml of 25% hydrochloric acid , and who had severe intra - abdominal damage .
the aim of this report is to state the fact that a good outcome is possible in severe burns caused by oral intake of corrosive substances , when fast , multidisciplinary , and appropriate management is provided on time . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
oral health ( i.e. health of mouth and teeth ) of school children represents a significant social and economic value of the modern world . retrospective research data show that there is a difference in attitudes of examined children regarding the regular control of oral health , which is in correlation with social and educational structure of their families . the opinion that by practicing a regular preventive controls diseases of mouth and teeth can be prevented , obviously and unfortunately is not prevalent as life practice in many of primary school children 's families ( 1 , 2 ) even though the children are exposed to the oral health at the fairly young age and although the parents are increasingly aware of the importance of the oral health for the entire well - being of their children , in many instances the role of parents and children in maintaining health of mouth and teeth is not sufficient , so the necessity arises to seek the professional help . it is best to seek help of dental professionals preventively , even then when everything seems to be well with the health of mouth and teeth ( 3 , 4 ) . in 2005 , as an answer to the rather poor state of primary school children 's oral health in federation entity of bosnia and herzegovina ( f.b&h ) , within all of its ten cantons , a promotional - preventive activities have been carried out with the main objective to familiarize the matriculated first grade children with the importance of proper oral hygiene and its correct application . this ambitious program was carried out in cooperation with federal ministry of health , federal institute for public health , federal institute for insurance and re - insurance and primary health care institutions in f.b&h ( 5 ) . in the academic school year 2004/2005 this program included 99.5 percent of all primary schools in f.b&h ( i.e. 398 of central primary schools and majority of regional schools ) , while , at the same time education 89.2 percent of first grade children . in the academic school year 2006/2007 this program was additionally carried out to the first and second grade primary school pupils in federation of bosnia and herzegovina ( 6 , 7 ) . the progress of the infection process is exemplified by the penetration into the tissue around the tooth 's root and development of periodontitis . each hole in the tooth represents an additional place for keeping food , plaque formation and propagation of a large number of bacteria . the treatment actually consists in detecting caries damage and removing softened dentin , followed by the appropriate treatment and disinfection of the oral cavity and eventually sealing ( 8) . while there are many theories about the origin of caries none of them give a complete answer to all the questions that come to mind when it comes to the etiopathogenesis of dental caries . according to contemporary views , some factors have greater importance in its origination , namely : a ) the structure and roughness of enamel ; c ) properties of saliva ; and dental plaque is of great importance , both in the development of caries , as well as in the pathogenesis of parondotopathy . it consists of desquamated epithelium of the oral mucosa , microorganisms and mucin ( constituents of saliva ) ( 9 ) . the accumulation of plaque on the tooth surfaces on which the physiological self - cleaning and cleaning with a brush is rather inefficient , is preceded and followed by caries . a special attention should be paid to microorganisms that are found in plaque , especially cariogenic strains of streptococci ( streptococcus mutans and sangus ) . their biochemical activities carry out decomposition of carbohydrates to simple acids and synthesize different polysaccharides ( i.e. dextran , levan and amylopectin ) ( 10 ) . the survey instrument was used for the survey interview and clinical examination of the mouth and teeth to provide data on oral health of the examined children . the survey was conducted in all units of observation , in selected schools in the stage of choice within these departments - selected groups of students . this also meant that two phases stratified sample of compatible groups , where 804 students were surveyed in elementary schools and where 355 students were from urban and 449 from rural schools . creating questionnaires and publicity materials; working team members education; members were familiarized with the available data on oral hygiene habits and their impact on oral health , various techniques and tools for proper oral hygiene , and tools and techniques for the determination of ohi ( e.g. index hygiene oral). data were collected by conducting surveys in several classrooms ( i.e. one class from each age group selected among primary schools ) and filling out questionnaires with the assistance of members of the survey team , in order to help to determine the status and oral hygiene index. at the end , the data analysis and evaluation of the project was carried out . creating questionnaires and publicity materials ; working team members education ; members were familiarized with the available data on oral hygiene habits and their impact on oral health , various techniques and tools for proper oral hygiene , and tools and techniques for the determination of ohi ( e.g. index hygiene oral ) . data were collected by conducting surveys in several classrooms ( i.e. one class from each age group selected among primary schools ) and filling out questionnaires with the assistance of members of the survey team , in order to help to determine the status and oral hygiene index . at the end , the data analysis and evaluation of the project was carried out . below is presented the analysis of the data that we received after interviewing 804 students in elementary schools , where 355 students were from urban and 449 students from rural schools , the following results were obtained : assessment of the socioeconomic status in children from urban and rural areas was carried out on the basis of the group questions in the application form , which were related to employment and qualifications of father / mother , the place of residence , and on the basis of their financial status . the chi squared had the value of 22.814 , the level of significance of p = 0.0001 and contingency coefficient of 0.163 . the obtained responses from this group of questions are presented in the table 1 below : t - test according to the socioeconomic status in examinees residing in rural and urban areas . no statistical significance was observed at p < 0.05 , and therefore there is no statistically significant difference between urban and rural primary school children according to the socioeconomic status . from total amount of 72.37 percent of surveyed children listed that their father was employed , ( i.e. 44.00 percent in urban and 28.37 percent in rural areas ) , 25.75 listed that their father was unemployed ( i.e. 14.00 percent from urban and 11.37% from rural areas ) . situation with mothers employment status was quite different ; whereas 52.5 percent of surveyed children listed ( i.e. 22.25 percent in urban and 30.25 percent from rural areas ) listed that their mother was employed , while 66.62 percent ( i.e. 18.5 percent from urban and 48.125 percent from rural areas ) listed that their mother was unemployed . 86.5 percent of examinees listed to reside in their own house or apartment ( e.g. 34.37 percent in urban and 52.12 percent in rural areas ) . 40.50 percent of surveyed answered to have at disposal its own room , while 53.75 percent listed to share the room with brother or sister . by taking into consideration the answers regarding employment and socioeconomic status of examined children , where are clearly visible changed in rural and urban areas , we can ascertain that socioeconomic status ( as an independent variable ) was in causal relationship with the causation and development of dental caries and adverse changes in oral hygiene of examinees . poorer socioeconomic status seems to have caused the incidence of the increasing number of examinees from rural areas who have visited dentist(s ) more than four ( 4 ) times ; ( i.e. 19.75 percent ) in comparison to the examinees from the urban areas measured at 16.5 percent . at the same time there were not a single examinee residing in the urban areas who had reported to have visited a dentist more than ten times , while there were 1.5 percent of surveyed from the rural areas who visited a dentist more than ten times . graphical representation of prevalence of cap index ( includes the prevalence of : caries , filling and extractions ) when defining the socioeconomic status we can clearly see that the majority of respondents from rural and urban areas stated that their father was employed . in a small number of answers the unemployment was viewed as a direct impact on the socioeconomic status of respondents , as well as the position of the mother 's employment where it was clear that there was a difference between respondents in urban and rural , where a much larger number of respondents answered that the mother was not employed , which was not the case in the urban environment . accordingly , the city center had a much larger number of respondents who reported that their parents were employed compared to rural population ( 11 , 12 , 13 ) . most of the respondents in urban and rural areas stated to have their own house / apartment , while in the middle of both had the same number of responses for respondents who were living as tenants . the largest number of respondents shared his / her room with some brother / sister , while the rural areas had a higher number of respondents who had their own room . in the city , although the higher the number was higher than in the rural areas , statistically speaking there was some difference in favor of the respondents rural areas ( 14 , 15 ) . the second group of questions related to hygiene and diet and nutrition in relation to the hypotheses of this study gave some interesting answers . when asked how often they were having breakfast on weekends most of the respondents answered that they had breakfast on both days of the weekend , in both the city and rural areas ( 16 , 17 ) . most of the respondents stated that they were pleased with his / her weight and that there was no need or feeling the need to dedicate to a diet , and that a large number of respondents regularly consumed meals . a large number of respondents stated that they most commonly consumed fast food , and that having in mind its composition it was felt as a predictor for the occurrence of various diseases , including dental caries ( 18 ) . it is important to note that this factor had an impact on the status of oral hygiene in our patients , and that our sample consisted of a very large number of respondents who consumed sweets and snacks , each day and several times a day . encouraging responses were in the forms of answers where the fruits were consumed more than three times in the last three days , although it was directly linked with socioeconomic status of respondents ( 19 , 20 , 21 ) . the high prevalence of dental caries was caused by certain safe factors , so in this case we consider diet and place of residence ( e.g. rural and urban environment ) , where the respondents from urban areas were more susceptible to the influence of factors that lead to tooth decay , such as fast food and sugary treats , with 64.48% of the urban environment usually taking fast food during the big break at school , but also , a large number of children from rural areas at 80.95% , which meant that the predominant factors were no longer tied to regional geographical determination ( e.g. in rural and urban communities ) ( 22 ) . in our sample , 45.25% of respondents from urban areas have been consuming candy daily , while 68.5% of them from rural areas also consumed sweets every day , which indicated that the predominant factors were not specific geographical locality ( 23 ) . on the basis of this research the following conclusions can be drawn :
conditions of oral hygiene habits among school children was on a satisfactory level and no large differences were observed between respondents in urban and rural areas; the age group that comes to improving oral hygiene in the second half of elementary education , with a number of information , etc. factors that were predominant in relation to residence and caries were : eating poor quality food during the big break at school , and in urban areas more than in rural areas , one of the essential factors of consuming sweets and snacks was equally represented in all areas . regular brushing was the factor that had an impact on the formation of cavities , but it could not be correlated with the geographic distribution . taking diet that was supposed to improve tooth nutrition , such as drinking glasses of milk , gave no statistically significant results in both groups , but , rather favored the rural areas . conditions of oral hygiene habits among school children was on a satisfactory level and no large differences were observed between respondents in urban and rural areas ; the age group that comes to improving oral hygiene in the second half of elementary education , with a number of information , etc . factors that were predominant in relation to residence and caries were : eating poor quality food during the big break at school , and in urban areas more than in rural areas , one of the essential factors of consuming sweets and snacks was equally represented in all areas . regular brushing was the factor that had an impact on the formation of cavities , but it could not be correlated with the geographic distribution . taking diet that was supposed to improve tooth nutrition , such as drinking glasses of milk , gave no statistically significant results in both groups , but , , we can see that the socioeconomic status of patients was affected by the occurrence of dental caries and oral hygiene , in patients , in relation to their rural and urban residence areas , because we could observe that by the number of respondents and greater unemployment in both parents in rural areas than in the city , which caused a host of other factors that were directly and indirectly connected with the development of caries . according to the type of food consumed we could see that in urban and rural areas the responses were fairly balanced , with the city where the larger number of respondents ate foods that posed a risk factors for tooth decay and deterioration of an oral hygiene than in rural areas , while the answers to the sample size and the use of a healthy diet were conditioned with the geographical position , ( i.e. housing in rural areas where fruits and vegetables more available than in the city center ) . | aim : the main aim of this research was to determine the influence of socioeconomic status and residence / living conditions on the status of oral health ( e.g. health of mouth and teeth ) in primary school students residing in canton central bosnia.methods:the study was designed as a cross - sectional study . our research included two - phased stratified random sample of 804 participants .
the quantitative research method and newly designed survey instrument were utilized in order to provide data on the oral health of the examined children .
the alternate hypothesis foresaw that there were significant statistical differences between the levels of incidence of dental caries in comparison to the incidence in children of different socioeconomic status.results:the chi square ( ) of 22.814 , degree of freedom ( df ) = 8 , coefficient of contingency of 0.163 and t - test ( stat ) of0.18334 showed that there were no significant statistical differences at p < 0.05 level between the primary school children from urban and rural areas .
the obtained results showed that the caries indexes in elementary schools in central bosnia canton were fairly uniform .
research showed that there were a difference in the attitudes towards a regular dental visits , which correlated with social - educational structure of the children's families.conclusion:according to the results , we can see that the socioeconomic status of patients had an effect on the occurrence of dental caries and oral hygiene in patients in relation to the rural and urban areas , because we can see that by the number of respondents , the greater unemployment of parents in both , rural and urban areas , caused a host of other factors , which were , either , directly or indirectly connected with the development of caries . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
acquired drug resistance by microorganisms poses a grave threat to human and animal health and has enormous economic consequences . fungal pathogens , including the most common opportunistic fungal pathogen c. albicans , represent a particular challenge because they are eukaryotes and share many of the same mechanisms that support the growth and survival of the human host cells they infect . the number of drug classes that have unique targets in fungi is very limited , and the usefulness of current antifungal drugs is compromised by either dose - limiting host toxicity or the frequent emergence of high - grade resistance . azole compounds represent the most widely used class of antifungal drugs to treat candida infections [ 24 ] . azoles exert their action by inhibiting yeasts enzyme lanosterol 14-demethylase and interfere with the biosynthesis of cell membrane ergosterol which causes inhibition of cell growth and finally cell death . altered interactions with the target enzyme and altered efflux pump expression are common mechanisms of azole resistance in major candida species . resistance can be mediated by increased efflux of azoles resulting from the overexpression of multiple drug resistance genes such as atp - binding cassette transporters . however , little is known about the mechanisms by which azoles and particularly flc enter c. albicans . one reason for this is that the inaccessibility of the cytoplasmic face of the plasma membrane precludes direct examination of flc intracellular transport in intact cells . to circumvent this problem , several groups have studied the ability of c. albicans to pump fluorescent marker compounds out of the cell . these studies have provided important insights into the energetics and kinetics of these pumps , but the fluorescent compounds used in most of these studies are unrelated structurally or functionally to the azole antifungals [ 7 , 8 ] . the results suggest that [ h]flc enters the cell by energy - independent facilitated diffusion and import levels vary among resistant clinical isolates , suggesting that import is a conserved mechanism of resistance to azole drugs in c. albicans . thus , determination of flc intracellular concentration in c. albicans by sensitive and selective nonradioactive method is a prerequisite not only for understanding drug intracellular transport mechanisms but also for clinical monitoring of azole resistance of c. albicans and other medically important fungi . a literature survey reveals some hplc methods that are reported for the determination of flc in pharmaceutical dosage formulations as anticipated with the variation of mobile phase , column , and detector . different hplc methods [ 11 , 12 ] for individual assay are available for flc in official pharmacopoeia and several lc - ms / ms methods were used for determination of flc in human plasma [ 1315 ] . hence , an attempt has been made to develop a simple , efficient , and selective rp - hplc method for intracellular determination of flc concentration and its application to azole - resistant c. albicans . flc ( figure 1(a ) , usp rs , purity : 99.6% , batch : hh87 ) , tinidazole ( figure 1(b ) , usp rs , purity : 99.9% , batch : 0312-qcs-12 ) , ammonium acetate ( sigma - aldrich , hplc grade ) , sodium and potassium chloride and phosphate , millipore water , and methanol ( hplc grade , alpha chem germany , purity : 99.9% ) , acetonitrile ( hplc grade , alpha chem germany ; purity : 99.9% ) , and sodium hydroxide , dichloromethane ( panreac , spain , 99.9% ) were used in this study .
c. albicans nctc-885 - 653 and c. albicans atcc-10231 were purchased from the atcc ( lgc standards - atcc ) . five different c. albicans clinical isolates have been obtained from armenicum clinical centre ( cjsc armenicum , yerevan , armenia ) . the strains and clinical isolates were cultured in soya - bean casein digest ( sbd ) medium ( himedia laboratories ltd . , india ) or sabouraud dextrose ( sd ) agar ( carl roth , germany ) with aeration at 33. flc ( diflucan 2 mg / ml solution for infusion , pfizer inc . , usa ) , amphotericin b ( amb , amphocil 100 mg , 50 mg powder for injection , penn pharmaceuticals ltd . , uk ) , and voriconazole ( vrc ) substance ( liqvor pharmaceuticals , armenia ) were used in this study . 100 ml erlenmeyer flasks in triplicate containing 1 10 colony forming units ( cfu ) of each yeast strain cell in 100 ml sbd medium were incubated at 33 for 48 h and yeast growth in sd agar plates at 33c for 48 h was estimated for every 24 h by plating of 10 l and 100 l aliquots from the flasks . a total of 1 10 cfu for each yeast strain was harvested and then cells were washed three times in ice cold pbs solution ( 137 mmol / l nacl , 2.7 mmol / l kcl , 8 mmol / l na2hpo4 , and 1.46 mmol / l kh2po4 ) by centrifugation at 3000 rpm at 4c for 15 min . aliquots of 1000 l samples were stored at 80c and were brought to room temperature before use for method validation . equal amounts of c. albicans nctc-885 - 653 and atcc-10231 strains aliquots were mixed and used for blank in biological matrix preparation . quantity analysis was acquired by using high - performance liquid chromatography platin blue uplc system ( knauer , germany ) with diode array detector . nucleodur-100 - 3 c18 ( 250 2 mm , 3 m packing , machery - nagel , germany ) column and guard column nucleosil 120 - 5 c18 ( cc 8/4 ) were employed . gradient elution was employed using 0.01 mol / l ammonium acetate in water ( ph = 5 0.05 , mobile phase a ) and acetonitrile ( mobile phase b ) . the flow rate was set at 0.3 ml / min and injection volume was 10 l using a full loop mode for sample injection . the temperatures of column and autosampler were maintained at 30c and 4c , respectively . stock solutions of flc ( 1 mg / ml ) and tinidazole used as internal standard ( is , 1 mg / ml ) were prepared independently by accurately weighing the required amounts into volumetric flasks and dissolving in methanol . the working solutions of flc were obtained by diluting the stock solution successively with methanol . the stock solution of is was diluted with solvent using 80 : 20 ( v / v ) ( 0.01 mol / l ammonium acetate buffer : acetonitrile ) to make a working solution of 10 g / ml . all solutions were stored at 4c and were brought to room temperature before use . for preparation of standard samples for calibration curve , 50 l of the appropriate working solutions of flc was added to 1000 l of blank 1 10 cfu c. albicans to prepare concentrations of 100 , 200 , 500 , 1000 , 2000 , 5000 , and 10000 ng / ml for flc and 100 ng / ml for is . quality control ( qc ) samples at three concentration levels ( low , 250 ng / ml ; medium , 2500 ng / ml ; high , 8000 ng / ml ) were independently prepared in the same way . a simple liquid - liquid extraction method was applied to extract the analyte and is from c. albicans . aliquots of 1000 l 1 10 cfu c. albicans sample were transferred to a 10 ml polypropylene tube followed by the addition of 50 l is working standard solution and 25 l of 6 n naoh solution and vortex - mixed for 15 sec . 500 l of 0.01 mol / l sodium phosphate buffer ( ph = 6.0 ) was added and vortex - mixed for 15 sec . then , the mixture was extracted with 5 ml dichloromethane by vortex - mixing for 5 min . the supernatant was transferred to another tube after centrifugation at 3000 rpm at 20c for 10 min and evaporated to dryness at 45c under a gentle stream of nitrogen . finally , the residue was reconstituted in 100 l of the solvent followed by centrifugation at 3000 rpm at 20c for 5 min . an aliquot of 10 l of the supernatant was injected into the platin blue hplc system in the full loop mode . the method was validated for specificity , calibration curve , accuracy , precision , recovery , matrix effect , stability , and dilution effect in c. albicans according to the us food and drug administration guidelines ( us dhhs , 2001 ; european medicines agency , 2012 ) on bioanalytical method validation [ 16 , 17 ] . comparing the chromatograms of blank 1 10 cfu c. albicans , 1 10 cfu c. albicans sample spiked with flc and is , and 1 10 cfu c. albicans sample after long - term cultivation of yeast cells in the presence of 1/25 mic ( 20 g / ml ) of flc , no endogenous , medium components and metabolites of flc interfered in the assay of the analyte and is . the calibration curves were constructed by plotting the peak - area ratios of each analyte to is versus biological matrix concentrations using a 1/x
weighted least - squares linear regression model . the acceptance criterion for each back - calculated standard concentration was 15% deviation from the nominal value , except at the loq , which was within 20% . the intraday precision and accuracy were determined by analyzing qc samples at three concentration levels ( low , 250 ng / ml ; medium , 2500 ng / ml ; high , 8000 ng / ml ) in six replicates on the same day , while the interday precision and accuracy were evaluated by analyzing qc samples at three concentration levels on three continual validation days . the precision was expressed as relative standard deviation ( rsd , % ) and the accuracy as the relative error ( re , % ) . the extraction recoveries of flc at three qc levels with six replicates were measured by comparing the peak areas from extracted samples with those from postextracted blank c. albicans samples spiked with the analytes at the same concentration . the matrix effect was measured at three qc levels by comparing the peak area from the postextracted blank c. albicans spiked with flc working solutions with those of corresponding standard solutions . the stability of flc in c. albicans was conducted at the two qc concentration levels ( n = 5 ) in various storage conditions . postpreparative stability was evaluated by analyzing the processed qc samples kept in an autosampler at 18c for 48 h. short - term and long - term stability were studied by analyzing qc samples exposed at room temperature for 4 h and stored at 80c for 4 months , respectively . the freeze and thaw stability was tested by analyzing qc samples undergoing three freeze - thaw ( 80c to room temperature ) cycles on three consecutive days . dilution effect was investigated to ensure that samples could be diluted with blank matrix without affecting the final concentration . blank c. albicans samples spiked with flc ( 16000 ng / ml ) were diluted with pooled blank c. albicans at dilution factors of 2 in six replicates and analyzed . the carry - over was determined by injecting a blank c. albicans sample following the injection of an upper limit of quantification sample in three independent runs . carry - over was considered negligible if the measured peak area was < 20% of the lowest standard area . this validated method was applied to determine the intracellular flc concentration in c. albicans nctc-885 - 653 and atcc-10231 strains long - term serially cultivated in the presence of flc . 5 10 cfu / ml of cells in the sbd medium was incubated in separate tubes with total volume of 1.0 ml containing 1/25 of mic concentration of flc and incubated at 33 for 48 h for obtaining one generation . the fungal strains were propagated in the presence or absence of selecting antifungal drugs for a total of 20 generations and mic values for flc , vrc , and amb of every fifth generation of each strain were estimated . 100 ml erlenmeyer flasks in triplicate containing 1/25 of mic concentration of flc and 1 10 cfu / ml of each yeast strain ( nctc-885 - 653 and atcc-10231 ) cell at 20th generation in 100 ml sbd medium were incubated at 33 for 48 h and yeast growth in sd agar plates at 33c for 48 h was estimated for every 24 h by plating of 10 l and 100 l aliquots from the flasks . a total of 1 10 cfu yeast cells were harvested and biological matrix was prepared as described above . for determination of the flc intracellular concentration in c. albicans nctc-885 - 653 and atcc-10231 strains and 5 different c. albicans clinical isolates 1 10 cfu / ml of each yeast strain in 100 ml sbd medium were incubated at 33 for 30 min in triplicate containing 20 g / ml concentration of flc and a total of 1 10 cfu yeast cells were harvested for biological matrix preparation . one colony was inoculated in 5 ml of sbd medium and washed twice with 0.9% nacl and the fungal count was determined by spotting on sd agar . the initial concentration of the fungal suspension in the sbd medium was 5 10 cfu / ml . 0.5 ml of suspension was inoculated into separate tubes containing serial twofold dilutions of antifungal drugs . azole antifungal drugs ( flc and vrc ) dissolved in distilled water and tested in the range of 0.95 to 1000 g / ml and amb in the range of 0.0078 to 2 g / ml of serially diluted drugs were added to the tubes , yielding a total volume of 1 ml per tube . drug - free medium with fungi and a fungi - free medium were used as the positive and negative controls , respectively . after incubation at 33 for 48 h , the results were read visually , as recommended by the clinical and laboratory standards institute . the mic was considered to be the concentration that inhibited 100% of fungal growth . mic values were confirmed by plating of 10 l and 100 l aliquots from the tubes with visual lack of growth on sd agar . c. parapsilosis atcc-22019 were included in each susceptibility test for quality control and assessment of reproducibility testing . the aim of this study was to develop a simple , efficient , and selective rp - hplc method for intracellular determination of flc concentration in c. albicans . various attempts were made to separate both the analyte and is with different ph of the mobile phase buffer and composition of methanol in the mobile phase using c-18 and c-8 stationary phase columns . to ensure great resolution between known and unknown endogenous compounds , the c-18 stationary phase with an endcapping was used . tinidazole ( figure 1(b ) ) was selected as the is since its structure , chromatographic behavior , and extraction efficiency were similar to those of the analyte . hplc parameters , such as detection wavelength , ideal mobile phase , and their proportions and flow rate , were carefully studied . after trying different ratios of mixtures of acetonitrile and ammonium acetate buffer , both the analyte and is displayed the best intensity and peak shape in the mobile phase containing 80 : 20 ( v / v ) 0.01 m ammonium acetate ( solvent a ) and acetonitrile ( solvent b ) . at a flow rate of 0.3 ml / min and the detection wavelength 210 nm , the retention time was 6.8 0.02 min for flc and 5.6 0.01 min ( p < 0.0001 ) for is . the analytes peak areas were well defined and free from tailing under the described experimental conditions ( figure 2 ) . blank chromatograms with uv spectra of unidentified compounds from c. albicans biomass are represented in figure 3 . obviously , there were no significant interferences from endogenous substances and metabolites of flc at the retention time of flc and is . calibration curve showed a satisfactory linearity in the range of 10010000 ng / ml . a typical calibration curve equation was y = 0.022x + 3.542 , with correlation coefficient of 0.9999 , where y is the peak - area ratio of flc to is and x is the nominal concentration of flc . the deviations of the back - calculated concentrations from their nominal values of loq ranged from 1.75 to 2.07% and standards other than loq were within 2.02 to 3.84% . the intra- and interday precision and accuracy at corresponding qc levels are summarized in table 1 . the extraction recoveries of flc at the three qc levels were 79.3 , 78.6 , and 85.5% , respectively . the extract recovery of all analytes was constant , precise , and reproducible with average percentage extraction recoveries of flc 81 4% ( rsd% : 4.7 ) . the matrix effects of flc and is were in the range of 85.790.2% , which meant that there was no significant retention time suppression or enhancement for flc and is . diluted qc samples ( 16000 ng / ml ) with six replicates were determined after dilution to the concentration of 8000 ng / ml , and the results of the tested samples were within the acceptable criteria . no carry - over was observed in the analysis of a blank plasma sample after injection the analysis of the upper calibrator ( 10000 ng / ml ) , which indicated that the carry - over effect was negligible . this validated method was applied to determine the intracellular flc concentration in two different c. albicans strains ( nctc-885 - 653 and atcc-10231 ) long - term cultivated in the presence of flc . the initial susceptibility profile of the selected fungal strains was investigated by determination of mic values for antifungal drugs flc , vrc , and amb ( table 3 ) . the selected c. albicans nctc-885 - 653 strain displayed high - level azole resistance as shown by 100% fungal growth inhibition in the presence of 500 g / ml concentration of flc and 62.5 g / ml concentration of vrc , respectively . in contrast to this strain , c. albicans atcc-10231 displayed approximately 2-fold low - level azole resistance as mic values for flc and vrc were found to be 250 g / ml and 15.6 g / ml , respectively . however , initial susceptibility profile of the selected fungal strains to nonazole antifungal amb was found to be identical ( 0.25 g / ml , table 3 ) . resistance to azole drugs was experimentally induced in the selected fungal strains by long - term serial cultivation ( for a total of 20 generations ) of fungal cells in the presence of 1/25 of mic concentration of flc . the development of azole resistance was achieved for initial azole susceptible c. albicans atcc-10231 strain in approximately 20 days , and the strain at 20th generation was resistant to 750 g / ml concentration of flc and 500 g / ml concentration of vrc , respectively , and also displayed high resistance to amb ( table 3 ) . the susceptibility profile of the c. albicans nctc-885 - 653 strain at 20th generation also displayed high - level azole resistance ; however , mic values for flc and vrc were found to be 500 g / ml and 250 g / ml , respectively , and approximately 4-fold low - level amb resistance ( table 3 ) . the mean intracellular concentrations of flc for these two c. albicans strains long - term cultivated in the presence or absence of flc are shown in figure 4 . the results indicated that the intracellular concentration of flc for initially 2-fold low - level azole - resistant c. albicans atcc-10231 is statistically significantly higher comparing with the intracellular concentration of flc for initially high - level azole - resistant c. albicans nctc-885 - 653 ( 625 51 ng/10 cfu versus 445 24 ng/10 cfu , p < 0.003 , resp . ) . atcc-10231 at 20th generation displayed 1.5-fold high resistance to antifungal action of flc , which was found to be statistically significantly lower comparing with that of another high - level azole - resistant c. albicans nctc-885 - 653 with 1.5-fold lower mic value to flc at 20th generation ( 412 50 ng/10 cfu versus 790 74 ng/10 cfu , p < 0.005 , resp . ) . flc uptake calculation by yeast cell indicated that single cfu of high - level azole - resistant c. albicans accumulated 8.18.7 10 flc molecules while low - level azole - resistant c. albicans accumulated 12.315.5 10 flc molecules , which is highly correlated with the 1.52.0-fold differences between azole susceptibility profiles of the studied fungal strains . for future confirmation that the intracellular concentration of flc reverse - correlated with the azole - resistance profile of fungi , we compared the mic values and fungal flc concentration in azole - resistant nctc-885 - 653 and atcc-10231 strains at 20th generation with five different c. albicans clinical isolates . for this purpose , yeast cells were propagated in the presence of 20 g / ml concentration of flc for a total of 30 min incubation time ( during which no significant difference has been observed in yeast cells survival between different strains , data not shown ) and flc intracellular concentration was determined for each strain ( table 4 ) . the results indicated that the intracellular concentrations of flc in azole - resistant c. albicans atcc-10231 and nctc-885 - 653 strains ( mic values in the 500750 g / ml range ) are statistically significantly lower , comparing with that of azole - susceptible ( mic values in the 7.862.5 g / ml range ) c. albicans clinical isolates . the intracellular concentration of flc for high - level azole - susceptible c. albicans clinical isolate number 1 ( displayed 4-fold low resistance to flc , comparing with isolates numbers 25 ) was found to be statistically significantly higher comparing with the rest of the azole - susceptible clinical isolates , and flc uptake by 2-fold low resistance isolates number 2 and number 3 was statistically significantly higher , comparing with that of isolates number 4 and number 5 . thus , the obtained results clearly demonstrated that flc uptake by yeast cell is highly correlated with the azole susceptibility profile of the studied fungal strains . in the present study , a simple , sensitive , and selective rp - hplc method for intracellular determination of fluconazole concentration in c. albicans was developed for the first time . the method was successfully applied to the determination of flc intracellular concentration in different azole - resistant c. albicans strains for the first time and will be useful for further characterization of flc intracellular transport mechanisms and for monitoring of drug resistance of c. albicans and other medically important fungi . | candida albicans ( strains nctc-885 - 653 and atcc-10231 ) long - term cultivated in the presence of antifungal agent fluconazole ( flc ) and classical microbiological methods for determination of minimal inhibitory concentration ( mic ) were used in this study . a simple and sensitive method based on reverse - phase
high - performance liquid chromatography ( rp - hplc ) has been developed for the determination of flc intracellular concentration in c. albicans using tinidazole as an internal standard . following extraction with dichloromethane
, the chromatographic separation was achieved on a machery - nagel ec250/2 nucleodur-100 - 3 c18 column by gradient elution using the mobile phase consisting of ( a ) 0.01 m ammonium acetate buffer , ph = 5.00 , and ( b ) acetonitrile .
different analytical performance parameters such as linearity , precision , accuracy , limit of quantification ( loq ) , and robustness were determined according to us dhhs fda and emea guidelines .
the method was linear for flc ( r = 0.9999 ) ranging from 100 to 10000 ng / ml .
the intraday and interday precisions ( relative standard deviation ) were within 2.79 and 2.64% , respectively , and the accuracy ( relative error ) was less than 2.82% .
the extraction recovery ranged from 79.3 to 85.5% .
the reliable method was successfully applied to c. albicans azole - resistance study and it was shown that intracellular concentration of flc correlated with a yeast drug susceptibility profile and mic values . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 31-year - old male patient ( height 173 cm , weight 70 kg ) with no medical history of particular significance had been receiving treatment at a dermatology clinic for ten years for erythematous patches accompanied by non - painful itching in both nasal alar creases , both perioral areas , and both posterior auricular folds ( fig . 1 ) . a topical steroid treatment was chosen , as he had tested negative on the koh test . it was notable that even on the steroid treatment , skin lesions appeared when he consumed alcohol or was dehydrated . the patient was on the topical steroid treatment when he visited our hospital , and erythematous patches were visible in the nasal alar creases and perioral areas . as a previous study had reported a case of acne vulgaris treatment with sgb , and the mechanisms of acne vulgaris and seborrheic dermatitis the patient was positioned with the anterior spine extended , so that the transverse process of the c6 vertebra ( chassaignac 's tubercle ) could be easily detected . a needle was vertically inserted at the anterior tubercle and was placed on the transverse process . five ml of 1% mepivacaine were injected after fixing the needle in position and confirming that there were no abnormal sensations in the upper limb or blood aspiration . after administration of the injection on one side , ipsilateral ptosis and nasal obstruction occurred but faded about two hours later . the skin lesions disappeared within three days , after which the patient wished to stop the treatment for personal reasons . however , the patient revisited the hospital two months later due to a relapse . during the follow - up , the patient noted that there had been no symptoms up to one week before the revisit . we initiated the same treatment procedure and the patient 's skin lesions disappeared after five trials ( fig . fifty more trials were performed , and the patient has not seen a relapse of the symptoms or side effects since . although the fundamental cause of seborrheic dermatitis has not yet been identified , increased sebaceous gland secretions , the proliferation of malassezia spp , m. globose , and m. restricta and subsequent inflammation increase , as well as changes in the host immune function , are presumed to be some of the major causes . m. globosa and m. restricta break down the lipids in the sebum to form free fatty acids and triglycerides . the resulting unsaturated fatty acids can penetrate the skin and induce inflammation . moreover , increased amounts of natural killer cells ( nk1 + ) , cd16 + cells , and inflammatory interleukins , as well as the proliferation of complements which come as a result of changes in the host immune function are clearly visible in the skin lesions . in general , multiple topical therapies ( antifungal shampoo , corticosteroid cream , antifungal cream ) are used as a treatment to eliminate the cause and to improve the symptoms . stellate ganglion is also called cervicothoracic sympathetic ganglion ; it is located on the first anterior rib or the anterior tubercle of the c7 transverse process . the sympathetic fibers of the lower face , cervical , and upper limbs cross the stellate ganglion ; therefore , these fibers can be blocked with sgb . sgb is used in the differential diagnosis and treatment of autonomous nervous system disorders of the head , neck , and upper limbs . sgb increases the blood flow rate without altering the blood pressure , heart rate , and cardiac output , and stabilizes hypertonic conditions of the sympathetic nerves , thereby blocking the pain associated with visceral afferents . a skin biopsy performed on a seborrheic dermatitis patient 's lesion revealed increased counts of inflammatory mediators ( interleukin-1 , [ il-1 ] , il-2 , il-4 , il-6 , il-10 , il-12 , gamma interferon , tnf - a ) . liu et al . conducted a study on severe trauma patients and reported that the concentrations of il - b , il-6 , and tnf - a decreased 24 to 72 hours after a sgb . park et al . successfully treated an acne vulgaris patient with over 50 trials of sgb , and wajima et al . these results indicate that sgb is effective in reducing hyper inflammations caused by seborrheic dermatitis , and thus in mitigating the related symptoms . according to a previous study by wakusugi , sgb improves the blood flow in the brain and influences hormone secretions , effectively improving the symptoms of diseases responsive to steroids ; hence , sgb can also be applied to seborrheic dermatitis . furthermore , sgb affects the neural and immune systems . the sympathetic nervous system , which stems from the nucleus ceruleus of the brainstem , plays an important role in the neural and immune systems . the post - ganglionic sympathetic nerves , which travel along the paravertebral ganglia and prevertebral ganglia , release norepinephrine into various tissues . the concentrations of brain norepinephrine and serum cortisol are proportionately raised to maintain the reflex circuit of the hypothalamus - pituitary - adrenal and sympathetic nerve systems . under physiological conditions , the immune organs are innervated by the sympathetic nerves , and adrenergic receptors are expressed on the surface of most granulocytes . sgbs regulate the neuroendocrine - immune network and restore homeostasis within the body by blocking the sympathetic nervous system . this in turn is presumed to contribute to the restoration of unbalanced statuses , such as seborrheic dermatitis . from a different perspective , uchida et al . suggested that a chronic increase in sympathetic tone undermines the pinealocyte functions . subsequently , the plasma melatonin level is reduced , resulting in sleep deprivation , which in turn causes an increase in sympathetic tone . sgbs block this sympathetic cycle and restore a normal melatonin rhythm , ultimately helping patients to maintain a normal sympathetic tone . this restoration of a normal rhythm also contributes to the effective regulation of the neuroendocrine - immune network . in conclusion , seborrheic dermatitis patients are treated with antifungals and steroids . in cases in which the patients are unresponsive to these traditional treatment modalities sgbs can also be useful in the treatment of other cutaneous disorders with similar mechanisms . | seborrheic dermatitis is a chronic recurrent inflammatory disorder presumed to be caused by increased sebaceous gland secretion , metabolic changes in the cutaneous microflora , and changes in the host immune function .
stellate ganglion block ( sgb ) is known to increase the blood flow rate without altering the blood pressure , heart rate , or cardiac output , to stabilize hypertonic conditions of the sympathetic nerves , and to affect the endocrine and immune systems .
it is used in the differential diagnosis and treatment of autonomic nervous system disorders of the head , neck , and upper limbs .
the authors report the first case of successful treatment of a patient with seborrheic dermatitis through repeated sgb trials . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
background noise is pervasive in a wide range of our everyday environments including home , workplace , school , transportation , store , and recreational spaces . under noisy environments , some people may experience difficulties understanding speech in noise whereas some may have less problems . considering the large variability in individual susceptibility to noise , nabelek , et al . quantified the lowest signal to noise ratio that a person could accept while listening to speech . this noise level that an individual can tolerate or accept the anl test appears to be a quick , reliable , clinician - friendly procedure . unlike speech - in - noise recognition test , listener does not need to repeat the target speech they heard for anl measurement . rather , the anl is calculated by difference between the most comfortable level for speech and the maximum level of background noise that the listener is willing to accept while following the target story . although various types of sound soruces have been used as target sound such as reversed , unfamiliar discourses , and non - semantic sound sources , little research has focused the individual susceptibility to interference from background music . to our knowlege , only a few studies have reported anls to background music using different genres of music . in the previous study of nabelek , et al . , ' light music ' of waiting room was first used as source of background noise to examine listeners ' anls to music . in gordon - hickey and moore , music of rock genre was only used as background noise for anl measurement . comparing the results of young normal - hearing adults between two studies , nabelek and colleagues reported that ' light music ' was more demanding compared to multi - talker babble noise whereas gordon - hickey and moore found more acceptance of rock - genre music than babble noise . for the inconsistent finding , the authors speculated a substantial impact of musical attributes such as music tempo , genre , familiarity , and musical experience . since no studies have examined the influence of music tempo and genre on anls , the present study aimed to determine whether music tempo and genre would affect individual anls . in addition , this study investigated whether music familiarity and preference would influence the anls . to facilitate comparison with the previous finding of gordon - hickey and moore , this study grouped participants into low - anl group ( listeners with greater acceptance of noise ) and high - anl group ( listeners with lower acceptance of noise ) . this would allow us to investigate whether music preference or familiarity would affect anls differently between low - anl and high - anl groups . a total of forty - one ( 21 males , 20 females ) native korean listeners participated in this study . accoridng to the previous criteria , the participants consisted of 29 low - anl listeners ( 6 db ) and 12 high - anl listeners ( 14 db ) . the mean age of low - anl group ( n=29 ) was 47.2 years of age [ standard deviation ( sd ) : 23.4 ] , and the mean age of high - anl group ( n=12 ) was 47.1 years of age ( sd : 17.0 ) . the mean puretone threshold of two groups was less than 20 db hl from 250 to 2000 hz , and less than 30 db hl at 4000 and 6000 hz . analyses of independent t - test showed that the ages and the octave - scale puretone thresholds from 250 to 6000 hz did not significantly differ ( p>0.05 for all frequencies ) between low - anl and high - anl groups . additional analyses of pearson correlation verified no significant relations between anls and puretone threshold average and also between anls and ages of individuals , consistent with previous finding . before the experimental test , participants were informed of anticipated risk and benefit and all were agreed to participation in research before the experimental testing . for the anl measure , a recorded discourse of a male talker in korean was used as target story . as background noise , anls were tested in six different music categories consisting of three music genres ( korean - pop music : k - pop , popular music : pop , and classical music : classical ) and two types of music tempo ( fast and slow ) . each of the six categories included three music samples , resulting in 18 music samples as total , as displayed in table 1 . selecting as either fast or slow tempo first , as an objective standard , the number of beats per minute ( bpm ) was considered , as in the previous criteria . thus , 94 or more bpm was required to be fast tempo music whereas 72 or less bpm for the slow tempo music . especially for the classical music , the tempo was based on the quarter - notes per minute ( qpm ) such that adagio ( 60 - 80 qpm ) classical music was chosen as slow classical music and allegro ( 120 - 160 qpm ) was selected as fast classical music . second , as described in the previous studies which measured anls to background music , a single instrumental part was avoided such that vocal parts with lyrics were selected as music samples of k - pop and pop genres . in contrast , the instrumental part without lyrics was selected as music sample of classical genre . the average root mean square value of each wavefile was equated via adobe audition version 3.0 ( adobe systems incorporated , san jose , ca , usa ) with 16-bit resolution and a sampling rate of 44.1 khz . all the stimuli were delivered via clinical audiometer ( madsen obiter 922 , gn otometrics , taastrup , denmark ) connected to an external cd player ( dej017 , sony , tokyo , japan ) and a loudspeaker at 0 degrees azimuth to the subject . prior to the experimental test , a practice with verbal and written instructions in korean was given to ensure whether the participant understood task correctly . subjects ' anls were obtained based on the procedure of the previous study which first introduced anl . for the anl measure , each participant was required to adjust level of a target story in 2 db steps to find individual 's most comfortable level ( mcl ) . while listening to and following the target message at mcl , the listener was then required to adjust level of background music in 2 db steps to find the maximum level that the listener was willing to accept , called background noise level ( bnl ) . the anl was determined by subtracting bnl from mcl ( anl = mcl - bnl ) . after the anl test , participants were asked to judge the degree of familiarity and preference on each music sample using a 4-point scales , as used in the previous study on music familiarity . on this questionnaire , the greater numbers correspond to the higher levels of familiarity or preference . to complete all the task , first , a 2 ( group)2 ( tempo)3 ( genre ) three - way mixed - model analysis of variance ( anova ) was conducted on anls as dependent variable . group was a between - subjects variable ( low - anl and high - anl ) , and music tempo ( fast and slow ) and music genre ( k - pop , pop , and classical ) were used as two within - subjects variables . second , in order to examine any relationship of anls with subjective responses , non - parametric analyses of spearman 's rank - order correlation were conducted on music preference and music familiarity for low - anl and high - al groups , separately . for analyses with a lack of sphericity , the degrees of freedom and f values were adjusted with the greenhouse - geisser correction . if necessary , any post - hoc multiple comparisons were conducted . a total of forty - one ( 21 males , 20 females ) native korean listeners participated in this study . accoridng to the previous criteria , the participants consisted of 29 low - anl listeners ( 6 db ) and 12 high - anl listeners ( 14 db ) . the mean age of low - anl group ( n=29 ) was 47.2 years of age [ standard deviation ( sd ) : 23.4 ] , and the mean age of high - anl group ( n=12 ) was 47.1 years of age ( sd : 17.0 ) . the mean puretone threshold of two groups was less than 20 db hl from 250 to 2000 hz , and less than 30 db hl at 4000 and 6000 hz . analyses of independent t - test showed that the ages and the octave - scale puretone thresholds from 250 to 6000 hz did not significantly differ ( p>0.05 for all frequencies ) between low - anl and high - anl groups . additional analyses of pearson correlation verified no significant relations between anls and puretone threshold average and also between anls and ages of individuals , consistent with previous finding . before the experimental test , participants were informed of anticipated risk and benefit and all were agreed to participation in research before the experimental testing . for the anl measure , a recorded discourse of a male talker in korean was used as target story . as background noise , anls were tested in six different music categories consisting of three music genres ( korean - pop music : k - pop , popular music : pop , and classical music : classical ) and two types of music tempo ( fast and slow ) . each of the six categories included three music samples , resulting in 18 music samples as total , as displayed in table 1 . selecting as either fast or slow tempo first , as an objective standard , the number of beats per minute ( bpm ) was considered , as in the previous criteria . thus , 94 or more bpm was required to be fast tempo music whereas 72 or less bpm for the slow tempo music . especially for the classical music , the tempo was based on the quarter - notes per minute ( qpm ) such that adagio ( 60 - 80 qpm ) classical music was chosen as slow classical music and allegro ( 120 - 160 qpm ) was selected as fast classical music . second , as described in the previous studies which measured anls to background music , a single instrumental part was avoided such that vocal parts with lyrics were selected as music samples of k - pop and pop genres . in contrast , the instrumental part without lyrics was selected as music sample of classical genre . the average root mean square value of each wavefile was equated via adobe audition version 3.0 ( adobe systems incorporated , san jose , ca , usa ) with 16-bit resolution and a sampling rate of 44.1 khz . all the stimuli were delivered via clinical audiometer ( madsen obiter 922 , gn otometrics , taastrup , denmark ) connected to an external cd player ( dej017 , sony , tokyo , japan ) and a loudspeaker at 0 degrees azimuth to the subject . prior to the experimental test , a practice with verbal and written instructions in korean was given to ensure whether the participant understood task correctly . subjects ' anls were obtained based on the procedure of the previous study which first introduced anl . for the anl measure , each participant was required to adjust level of a target story in 2 db steps to find individual 's most comfortable level ( mcl ) . while listening to and following the target message at mcl , the listener was then required to adjust level of background music in 2 db steps to find the maximum level that the listener was willing to accept , called background noise level ( bnl ) . the anl was determined by subtracting bnl from mcl ( anl = mcl - bnl ) . after the anl test , participants were asked to judge the degree of familiarity and preference on each music sample using a 4-point scales , as used in the previous study on music familiarity . on this questionnaire , the greater numbers correspond to the higher levels of familiarity or preference . to complete all the task , all the statistical analyses were performed using spss version 20.0 ( ibm corp . , armonk first , a 2 ( group)2 ( tempo)3 ( genre ) three - way mixed - model analysis of variance ( anova ) was conducted on anls as dependent variable . group was a between - subjects variable ( low - anl and high - anl ) , and music tempo ( fast and slow ) and music genre ( k - pop , pop , and classical ) were used as two within - subjects variables . second , in order to examine any relationship of anls with subjective responses , non - parametric analyses of spearman 's rank - order correlation were conducted on music preference and music familiarity for low - anl and high - al groups , separately . for analyses with a lack of sphericity , the degrees of freedom and f values were adjusted with the greenhouse - geisser correction . if necessary , any post - hoc multiple comparisons were conducted . table 2 shows the mean anl and standard deviation for low - anl and high - anl groups when background music differed by music tempo and genre . when the background music of slow tempo was presented , the mean anls ranged from 2.2 to 2.5 db for low - anl listeners and ranged from 17.3 to 17.8 db for high - anl listeners across three music genres . when the fast - tempo music was presented , the mean anls of low - anl group were 4.1 , 3.0 , and 3.1 db and the mean anls of high - anl group were 17.5 , 16.1 , and 16.1 db for k - pop , pop , and classical music , respectively . a 223 three - way mixed - model anova was performed on anls and the results showed that the main effect of group was significant [ f(1 , 39)=281.5 ] . also , we found that music genre significantly influenced the anls [ f(1.73 , 67.64)=5.36 ] but music tempo did not significantly influence the anls . results from bonferroni - adjusted multiple paired - comparisons revealed that the anls to k - pop music were significantly greater than the anls to pop or classical music . a two - way interaction between tempo and group was significant [ f(1 , 39)=9.78 ] , showing higher anls with fast music for low - anl group yet in opposite for high - anl groups . other two - way interactions as well as a three - way interaction among tempo , genre , and group were not significiant . this indicates that the k - pop music which includes vocal part with korean lyrics yields the greatest amount of interference as background noise . this study investigated individual music familiarity and preference on each music sample in order to examine whether the anls would be related to individual 's familiarity and preference . the mean values of music familiarity was 2.5 ( sd : 0.6 ) and 2.4 ( sd : 0.8 ) for low - anl and high - anl groups , respectively . the mean values of music preference was 2.3 ( sd : 0.5 ) and 2.1 ( sd : 0.7 ) for low - anl and high - anl groups , respectively . the independent t - test showed that the subjective responses did not statistically differ between low - anl and high - anl goups on both music familiarity [ t(39)=0.37 ] and preference [ t(39)=1.01 ] . non - parametric analyses of spearman 's rank - order correlation were administered to determine any association between individual noise acceptance and their subjective preference or familiarity to music samples . in order to investigate this , we examined relationship between individual anls and subjective responses for low - anl and high - anl groups . table 3 shows the spearman 's coefficients rho for low - anl and high - anl groups . as displayed , for low - anl individuals , their acceptance of background music was relatively unaffected by music familiarity and preference , regardless of music genre . however , the results on correlated measures revealed a different tendency in high - anl group . for high - anl individuals , the anls were significantly and negatively related to subjective ratings of music familiarity and preference when the music samples were from k - pop ( -0.83<rs<-0.73 ) or pop genre ( -0.87<rs<-0.75 ) . that is , the subjective preference or familiarity of background noise would affect noise acceptance only for the high - anl listeners , rather than for all listeners . table 2 shows the mean anl and standard deviation for low - anl and high - anl groups when background music differed by music tempo and genre . when the background music of slow tempo was presented , the mean anls ranged from 2.2 to 2.5 db for low - anl listeners and ranged from 17.3 to 17.8 db for high - anl listeners across three music genres . when the fast - tempo music was presented , the mean anls of low - anl group were 4.1 , 3.0 , and 3.1 db and the mean anls of high - anl group were 17.5 , 16.1 , and 16.1 db for k - pop , pop , and classical music , respectively . a 223 three - way mixed - model anova was performed on anls and the results showed that the main effect of group was significant [ f(1 , 39)=281.5 ] . also , we found that music genre significantly influenced the anls [ f(1.73 , 67.64)=5.36 ] but music tempo did not significantly influence the anls . results from bonferroni - adjusted multiple paired - comparisons revealed that the anls to k - pop music were significantly greater than the anls to pop or classical music . a two - way interaction between tempo and group was significant [ f(1 , 39)=9.78 ] , showing higher anls with fast music for low - anl group yet in opposite for high - anl groups . other two - way interactions as well as a three - way interaction among tempo , genre , and group were not significiant . this indicates that the k - pop music which includes vocal part with korean lyrics yields the greatest amount of interference as background noise . this study investigated individual music familiarity and preference on each music sample in order to examine whether the anls would be related to individual 's familiarity and preference . the mean values of music familiarity was 2.5 ( sd : 0.6 ) and 2.4 ( sd : 0.8 ) for low - anl and high - anl groups , respectively . the mean values of music preference was 2.3 ( sd : 0.5 ) and 2.1 ( sd : 0.7 ) for low - anl and high - anl groups , respectively . the independent t - test showed that the subjective responses did not statistically differ between low - anl and high - anl goups on both music familiarity [ t(39)=0.37 ] and preference [ t(39)=1.01 ] . non - parametric analyses of spearman 's rank - order correlation were administered to determine any association between individual noise acceptance and their subjective preference or familiarity to music samples . in order to investigate this , we examined relationship between individual anls and subjective responses for low - anl and high - anl groups . table 3 shows the spearman 's coefficients rho for low - anl and high - anl groups . as displayed , for low - anl individuals , their acceptance of background music was relatively unaffected by music familiarity and preference , regardless of music genre . however , the results on correlated measures revealed a different tendency in high - anl group . for high - anl individuals , the anls were significantly and negatively related to subjective ratings of music familiarity and preference when the music samples were from k - pop ( -0.83<rs<-0.73 ) or pop genre ( -0.87<rs<-0.75 ) . that is , the subjective preference or familiarity of background noise would affect noise acceptance only for the high - anl listeners , rather than for all listeners . although various types of target stories and listening conditions have been used for anl measure , a source of background sound has been limited other than use of multitalker babble noise . despite a widespread and common use of music in everyday life , gordon - hickey and moore who used one genre of rock as music samples suggested a need of more research to explore individual susceptibility to background music with controlling musical attributes such as tempo , genre , and instrument composition . this has driven this study to investigate the effect of music tempo and genre on individual anls to music . results of this study showed that k - pop music was relatively less accepted as background noise , resulting in a relatively greater amont of noise distraction ( higher anl ) compared to pop or classical music . interestingly , the significant effect of genre on anls was similar in both low - anl and high - anl groups . as one of the possible reasons , the native korean participants could have been greatly annoyed by k - pop music due to meaningful content of k - pop songs . this seems consistent with previous anl measures which compared anls across five types of competing speech maskers ( e.g. , 1-male , 1-female , 2-talker , 4-talker , and 8-talker speech masker ) . considering the features of relatively reduced temporal fluctuations and unintelligible meaning in babble noise as background , researchers have examined individuals ' noise acceptance as a function of the number of the competing talkers . the findings were congruent such that acceptance of background noise was significantly poorer ( or higher anl ) when the background speech masker became more meaningful ( i.e. , 1- or 2-talker noise ) for young normal - hearing listeners , adult hearing aid users , and adults who use cochlear implant . thus , selecting a type of the noise source should be carefully considered for clinical measrues of anls and also when comparing data across anl studies who used different materials . although it was not the primary interest of this study , no relation was found between anls and individuals ' age or hearing threshold , consistent with previous findings . this supports the previous findings that anl might be an inherent characteristic of individual , which is unchangeable with age or acquired hearing loss of listeners . recent research revealed that the anls could be based on subjective loudness , self - control level , and personality . considering the substantial impact of subjective and inherent characteristics of the individuals on their anls , it seems important to investigate whether the greater annoyance from k - pop music would be associated with self - rating responses on music familiarity and preference . to clear this out , the present study explored any association between anls and individual familiarity or preference to music samples . the results revealed a different tendency on correlated measures between listeners with low - anl ( n=29 ) and high - anl ( n=12 ) . results showed that the anls of low - anl group were independent of their subjective responses of music familiarity and preference . this seems similar with previous finding who reported no significant correlation between anls and individual preference to background noise . gordon - hickey and moore also showed no association between anls and participants ' music preference . however , we found that the anls of high - anl group depended on music familiarity and preference . expected result to observe was that the listeners would accept more noise ( lower anl ) with less familiar and less preferred background music , meaning a positive association between anls and subjective responses ( music familiarity and preference ) . unexpectedly , negative correlations were observed between anls and subjective responses of high - anl group ( less acceptance of background music for less familiar or less preferred music ) . possibly , the relatively less familiar or less preferred music could introduce new conflicting cues , resulting in more distraction when following a target story . if a listener had a good strategy to suppress familiar music entirely , then the familiarity of music would be beneficial , as reported using word identification . however , a limitation of the study is the relatively small sample size especially for high - anl group ( n=12 ) such that more research is needed to determine whether subjective familiarity or preference on noise can affect a person 's capacity to accept background noise . the purpose of the current study was to evaluate the effects of music genre and tempo on the anls to background music . results showed that , overall , the anls did not significantly differ by music tempo . the anls depended on the genre of background music . since k - pop music with more meaningful lyrics was poorly accepted than pop or classical music for both low - anl and high - anl groups , the degree of informational masking would decrease acceptance of background noise . the subjective familiarity and preference of noise had a great impact on anls only for high - anl group . | background and objectivesacceptable noise level ( anl ) is a measure of the maximum background noise level ( bnl ) that a person is willing to tolerate while following a target story .
although researchers have used various sources of target sound in anl measures , a limited type of background noise has been used . extending the previous study of gordon - hickey & moore ( 2007 ) , the current study determined the effect of music genre and tempo on anls as possible factors affecting anls .
we also investigated the relationships between individual anls and the familiarity of music samples and between music anls and subjective preference.subjects and methodsforty - one participants were seperated into two groups according to their anls , 29 low - anl listeners and 12 high - anl listeners .
using korean anl material , the individual anls were measured based on the listeners ' most comfortable listening level and bnl .
the anls were measured in six conditions , with different music tempo ( fast , slow ) and genre ( k - pop , pop , classical ) in a counterbalanced order.resultsoverall , anls did not differ by the tempo of background music , but music genre significantly affected individual anls .
we observed relatively higher anls with k - pop music and relatively lower anls with classical music .
this tendency was similar in both low - anl and high - anl groups .
however , the subjective ratings of music familiarity and preference affected anls differently for low - anl and high - anl groups .
in contrast to the low - anl listeners , the anls of the high - anl listeners were significantly affected by music familiarity and preference.conclusionsthe genre of background music affected anls obtained using background music .
the degree of music familiarity and preference appears to be associated with individual susceptibility to background music only for listeners who are greatly annoyed by background noise ( high - anl listeners ) . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
gastric cancer remains one of the most common causes of death from cancer worldwide , especially in our part of the world . in kashmir , the incidence rates for gastric cancer have been estimated at 36.7/100000 per year in men and 9.9/100000 per annum in women , respectively . as the multidisciplinary management of gastrointestinal cancer has evolved over the last decade , an accurate extent of disease workup has become essential for treatment planning . even after a thorough radiological workup , many patients with stomach carcinoma are diagnosed as unresectable or metastatic on exploratory laparotomy . for the subgroup of patients who do not require palliation , exploration confers little benefit and may , on the contrary , be associated with significant morbidity and mortality . since the introduction of contrast enhanced computed tomography ( cect ) scan some 30 years back , the staging workup of gastric carcinoma has underwent a boom [ 35 ] . cect is used preoperatively primarily to determine the stage and extragastric spread of the carcinoma but has the propensity to underestimate the extent of disease , with small - volume metastatic disease being appreciated only at open surgical exploration . the aim of laparoscopic staging is to mimic staging at open exploration while minimizing morbidity , enhancing recovery , and thus allowing for quicker administration of adjuvant therapies if indicated [ 68 ] . this was a prospective study conducted on 50 patients of endoscopic and biopsy proven stomach carcinoma that were found to be operable on cect of abdomen / pelvis . the study was conducted over a period of two years in a tertiary care hospital of kashmir . all the patients were staged preoperatively by cect of abdomen / pelvis done on a 32-slice helical ct scanner ( fxi , ge medical systems ) . the patients were asked to take 500 ml , 250 ml , and 25 ml of water orally 120 , 60 , and 5 minutes , respectively , prior to their scan . five mm contiguous cuts were taken from the dome of diaphragm to the pubic rami . any area of gastric wall with thickness measuring more than 5 mm was considered abnormal . tumors confined to the gastric wall or intramural or transmural involvement with a smooth outer wall and clear fat plane around tumor were considered t1/t2 . transmural tumors with irregular or blurred outer border with or without perigastric fat stranding were considered as t3 . obliteration of fat plane between gastric tumor and adjacent organ or direct invasion of adjacent organ was taken as t4 . any enlarged lymph node seen in the 16 anatomic sites as per the japanese research society on gastric cancer classification was noted as nodal disease . regional lymph nodes were considered to represent local metastases if they were solitary or separate nodes 8 mm or greater in long - axis diameter with enhancement , which was defined as attenuation greater than 85 hounsfield units in the postcontrast portal venous phase . diagnostic laparoscopy was done in all these patients before proceeding with a formal exploratory laparotomy . this procedure was explained to the patients / attendants in detail and an informed consent was taken for the same . after a thorough inspection of all four quadrants of the peritoneal cavity was carried out , biopsies were taken from any suspicious tissue . a formal staging of the patient was done as per the 7th edition of the uicc / tnm classification , and a comparison between the staging obtained from cect and that from laparoscopy was made . statistical analysis was done by graphpad instat version 3.10 for windows ( graphpad softwares inc . , san diego , ca , usa ) fifty consecutive patients of stomach carcinoma , found to be resectable on cect , were enrolled . the mean age of presentation was 58.57 5.7 years in males and 56.67 6.3 years in females . the maximum incidence of stomach carcinoma in our study was found in the age group of 56 to 65 years . peritoneal metastases were seen in 5 patients either isolated ( 3 patients ) or in association with liver metastases ( 2 patients ) ( table 1 ) . as these peritoneal deposits were not picked up by the cect , comparison with diagnostic laparoscopy and histopathology was not possible , so these patients were excluded from the study and received palliative treatment . staging with preoperative cect was compared with the laparoscopic staging in the other 36 patients taking histopathological staging as the standard . the most common t stage on cect was t3 and t4 ( 44.44% each ) . overall accuracy of cect for t staging was 74% with a sensitivity of 65% and a specificity of 79% . overall accuracy of laparoscopy for t staging was 81% with a sensitivity of 76% and a specificity of 86% ( table 2 ) . overall accuracy of cect for n staging was 86% with a sensitivity of 50% and a specificity of 90% . the most common n stage on laparoscopy was n0 and n2 ( 42% each ) . overall accuracy of laparoscopy for n staging was 88% with a sensitivity of 53% and a specificity of 91% ( table 3 ) . in our study 50 patients underwent a diagnostic laparoscopy after a preoperative cect excluded any form of metastasis . at diagnostic laparoscopy , out of these 50 patients , 14 patients revealed metastasis ( 9 hepatic , 5 peritoneal ) , confirmed by frozen section . of note was one patient in whom multiple large metastases were detected on laparoscopy ( figure 1 ) . the magnification afforded by laparoscopy makes it possible to even pick up small peritoneal nodules which are otherwise missed on imaging modalities ( figure 2 ) . owing to their hypervascularity , most gastric cancers are seen as enhancing lesions . as regards the tumour ( t ) status , cect correctly staged 22 ( 61% ) patients . cect over - staged 7 ( 19.4% ) patients , and also under - staged the same number of patients . diagnostic laparoscopy correctly staged the t status in 26 ( 72% ) patients and it overstaged 4 ( 11.11% ) patients , and understaged 6 patients ( 16.7% ) . overall accuracy for t stage with laparoscopy was 81% as against 74% of cect with a sensitivity of 76% and a specificity of 86% ( p = 0.0324 ) . our results are similar to those of the study conducted by blackshaw et al . and d'ugo et al . [ 16 , 17 ] . as regards the nodal ( n ) status , cect correctly staged 26 ( 72% ) patients . it overstaged 4 ( 11.11% ) patients , and understaged 6 ( 16.7% ) patients . the relative insensitivity of cect for detecting nodal disease is due to its inability to detect micrometastasis in the nodes . laparoscopy correctly staged n status in 27 ( 75% ) patients , over - stage 5 ( 13.9% ) patients , and under - stage 4 ( 11.11% ) patients . the overall accuracy of laparoscopy for n staging was 88% as against 86% of cect scanning with a sensitivity of 53% and a specificity of 91% ( p = 0.4324 ) . reported an overall accuracy of laparoscopy for n staging as 58.4% with a sensitivity of 60% and a specificity of 90% . similar results were observed by a study conducted by muntean et al . in which the overall laparoscopic n staging accuracy was 64.3% with a sensitivity of 54.5% and a specificity of 100% . laparoscopic gastrojejunostomy has been established as a safe alternative to open approach for the palliation of symptoms due to gastric outlet obstruction in unresectable cancer stomach . additional benefits of the laparoscopic approach include decreased immune suppression , decreased postoperative pain , early ambulation , and other advantages of minimally invasive surgery . however , laparoscopic gastrojejunostomy was not offered to any of our patients , as we were not adequately experienced with this procedure . we acknowledge the fact that though the accuracy for nodal status was marginally better for laparoscopy and did not reach statistical significance , it does not preclude the use of diagnostic laparoscopy . the specific value of diagnostic laparoscopy is in detecting minimal metastatic disease that is otherwise undetectable by routine imaging modalities . laparoscopy is a valuable technique in staging stomach carcinoma and has an important role in the detection of occult extensive intra - abdominal or metastatic disease not detected by conventional radiological staging . the value of diagnostic laparoscopy is in the prevention of unnecessary surgical exploration and the resultant morbidity and mortality in patients with locally advanced or metastatic disease . | background . aim of this study was to compare the role of diagnostic laparoscopy and contrast enhanced computed tomography ( cect ) of abdomen in the staging of stomach carcinoma .
methods .
this was a prospective study conducted in a tertiary care hospital over a period of two years and included 50 patients of endoscopy and biopsy proven stomach carcinoma that were found to be operable on cect .
diagnostic laparoscopy was performed in all patients before proceeding to a formal laparotomy .
results .
metastasis was detected at diagnostic laparoscopy in 14 ( 28% ) patients .
cect correctly identified the t stage in 22 ( 61% ) patients .
overall accuracy of cect for t staging was 74% with a a sensitivity of 65% and a specificity of 79% .
laparoscopy correctly identified the t stage in 26 ( 72% ) patients .
overall accuracy of laparoscopy for t staging was 81% with a sensitivity of 76% and specificity of 86% .
the most common n stage on cect was n0 ( 50% ) .
cect correctly identified the n stage in 26 ( 72% ) patients .
overall accuracy of cect for n staging was 86% with a sensitivity of 50% and a specificity of 90% .
the most common n stage on laparoscopy was n0 and n2 ( 42% each ) .
laparoscopy correctly identified the n stage in 27 ( 75% ) patients .
overall accuracy of laparoscopy for n staging was 88% with a sensitivity of 53% and specificity of 91% .
conclusion .
laparoscopy is a valuable technique in staging of stomach carcinoma and has an important role in the detection of intra - abdominal metastasis missed by cect . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
diagnosis of phpt is usually delayed due to relative rarity and varying presentations . a good number of these patients developed major deformities resulting in loss of job and financial constraints . regional anesthesia was not an option in most of the patients due to the size of parathyroid lesion , frequent occurrence of adhesion to surrounding tissues , and coincident thyroid pathologies . the prevalence of renal dysfunction , gastrointestinal illnesses , diabetes mellitus , and hypertension was high among phpt patients . most of the patients belonged to the american society of anesthesiologists grading ii and iii and risk of anesthesia was high due to possible electrolyte changes and worsening of renal function . preoperative localization studies were routinely done to reduce the operating time and to avoid unnecessary dissection . our protocol included technetium 99 m methoxyisobutylisonitrate dual phase scan ( mibi scan ) and ultrasonography before operation . parathyroidectomy was done under general anesthesia and intraoperative parathyroid hormone monitoring ( iopth assay ) was done to ensure the completeness . the institutional financial audit showed that the localization studies and iopth assay accounted for 18.5% of the total cost of treatment . aim of the present study was to assess the use of iopth assay when concordant imaging was available . we hypothesized that cure rate of phpt is above 95% when concordant imaging was available and iopth assay might not positively influence the outcome . we included patients who were successfully operated for primary symptomatic hyperparathyroidism from january 2005 to december 2014 . patients who had phenotypic expressions of multiple endocrine neoplasia type 1 and 2 were excluded . fifteen to twenty mci of 99 m technetium - mibi was injected intravenously and high resolution images from anterior neck and mediastinum were acquired using dual head variable gamma camera . ultrasound ( us ) imaging using 7.510 mhz probe was done by surgeon and trained sinologist together when scintigraphy recorded mediastinal parathyroid lesion , magnetic resonance imaging ( mri ) was used as anatomical imaging . concordance in imaging was recorded when scintigraphy features were identical with anatomical imaging in site and number . focused parathyroidectomy with iopth monitoring was done for a single parathyroid lesion with concordant imaging . focused parathyroidectomy was attempted in patients with discordant imaging if scintigraphy or anatomical imaging showed a single suspicious lesion . iopth monitoring was also done with an intention to convert to total neck exploration ( tne ) if indicated . cervical exploration was done first when mediastinal lesion was suspected followed by median sternotomy if necessary . the postexcision blood sample was drawn from the peripheral vein 10 min after the excision of the lesion . more than 50% decline of postexcision pth value was considered positive for completeness of excision . rapid pth assay was done by chemiluminescent micro - particle immunoassay ( architect i system using abbott reagent ) . true decline - diagnostic pth decline in a patient free of hyperfunctioning parathyroid tissuefalse decline - diagnostic pth declines below cut - off with residual hyperfunctioning parathyroid tissue in situtrue failure to decline - failure to decline past cut - off with functioning residual parathyroid tissuefalse failure to decline - failure of pth to decline past cut - off in a patient free of hyperfunctioning parathyroid tissue . true decline - diagnostic pth decline in a patient free of hyperfunctioning parathyroid tissue false decline - diagnostic pth declines below cut - off with residual hyperfunctioning parathyroid tissue in situ true failure to decline - failure to decline past cut - off with functioning residual parathyroid tissue false failure to decline - failure of pth to decline past cut - off in a patient free of hyperfunctioning parathyroid tissue . patient is considered cured if serum corrected calcium levels remained < 10.2 mg / dl in the postoperative period and also 6 months after operation . serum pth estimation was done if serum calcium level was above 10 mg / dl . for the comparison of categorical variables among the different groups , chi - square test was used . for continuous / numerical variables with two groups , mann whitney u - test was applied , because the laboratory values did not follow the parametric assumption . we included patients who were successfully operated for primary symptomatic hyperparathyroidism from january 2005 to december 2014 . patients who had phenotypic expressions of multiple endocrine neoplasia type 1 and 2 were excluded . fifteen to twenty mci of 99 m technetium - mibi was injected intravenously and high resolution images from anterior neck and mediastinum were acquired using dual head variable gamma camera . ultrasound ( us ) imaging using 7.510 mhz probe was done by surgeon and trained sinologist together . when scintigraphy recorded mediastinal parathyroid lesion , magnetic resonance imaging ( mri ) was used as anatomical imaging . concordance in imaging was recorded when scintigraphy features were identical with anatomical imaging in site and number . focused parathyroidectomy with iopth monitoring was done for a single parathyroid lesion with concordant imaging . focused parathyroidectomy was attempted in patients with discordant imaging if scintigraphy or anatomical imaging showed a single suspicious lesion . iopth monitoring was also done with an intention to convert to total neck exploration ( tne ) if indicated . cervical exploration was done first when mediastinal lesion was suspected followed by median sternotomy if necessary . the postexcision blood sample was drawn from the peripheral vein 10 min after the excision of the lesion . more than 50% decline of postexcision pth value was considered positive for completeness of excision . rapid pth assay was done by chemiluminescent micro - particle immunoassay ( architect i system using abbott reagent ) . true decline - diagnostic pth decline in a patient free of hyperfunctioning parathyroid tissuefalse decline - diagnostic pth declines below cut - off with residual hyperfunctioning parathyroid tissue in situtrue failure to decline - failure to decline past cut - off with functioning residual parathyroid tissuefalse failure to decline - failure of pth to decline past cut - off in a patient free of hyperfunctioning parathyroid tissue .
true decline - diagnostic pth decline in a patient free of hyperfunctioning parathyroid tissue false decline - diagnostic pth declines below cut - off with residual hyperfunctioning parathyroid tissue in situ true failure to decline - failure to decline past cut - off with functioning residual parathyroid tissue false failure to decline - failure of pth to decline past cut - off in a patient free of hyperfunctioning parathyroid tissue . patient is considered cured if serum corrected calcium levels remained < 10.2 mg / dl in the postoperative period and also 6 months after operation . serum pth estimation was done if serum calcium level was above 10 mg / dl . for the comparison of categorical variables among the different groups , chi - square test was used . for continuous / numerical variables with two groups , mann whitney u - test was applied , because the laboratory values did not follow the parametric assumption . we analyzed data of 143 patients with a median age of 46 years ( 1180 ) and male and female sex ratio of 1:1.46 . of the group , 28 ( 20% ) patients were receiving treatment for hypertension and 15 ( 11% ) for diabetes mellitus before the diagnosis of phpt was made . all patients had normal renal function and mean estimated glomerular filtration rate was 79.54 ml / min/1.73 m ( standard deviation [ sd ] 39.54 ) . seventy two patients ( 50.7% ) had calcium elevated above 12 mg / dl and 88 ( 62% ) had serum pth elevated above 350 pg / ml . biochemical profile of the study group mibi scan showed positive imaging in 136 ( 95% ) patients and inconclusive in 7 ( 5% ) patients . the operation findings matched well in position and number with mibi findings in 134 ( 93.7% ) patients and this included 3 double adenoma and 13 ectopic lesions . the high serum pth level positively influenced mibi scan while coincident thyroid disease negatively affected it [ table 2 ] . on correlating with histology , mibi scan showed inconclusive results 8 adenomas and 1 carcinoma . mri scan did not identify the second lesion in a patient with mediastinal double adenoma . features influencing methoxyisobutylisonitrate scan us identified lesions in 121 ( 84.6% ) patients and was inconclusive in 22 ( 14.4% ) . us detection rate was not significantly influenced by co - existing thyroid diseases and size of parathyroid lesion . features influencing ultrasound mri was used as anatomical imaging for 8 patients with mediastinal parathyroid lesions located by mibi . surgical procedures included focused parathyroidectomy 106 ( 74% ) , parathyroidectomy with ipsilateral hemi - thyroidectomy 22 ( 15.5% ) , sternotomy and parathyroidectomy 6 ( 4% ) , tne 6 ( 4% ) , and parathyroidectomy with total thyroidectomy 5 ( 3.5% ) , respectively . indication for hemi - thyroidectomy was adherent parathyroid lesion in 14 and co - existing thyroid nodule of suspicious cytology in 8 . total thyroidectomy was done for patient with large volume goiters ( n : 3 ) and papillary thyroid cancer ( n : 2 ) . mean size of the lesion was 2.78 cm ( 18 ) and weight was 5.069 g ( 127 ) . the mean preincision serum pth values was 951.274 pg / ml ( sd : 849.255 ) and 10 min postexcision was 207.8 pg / ml ( sd : 367.031 ) . results of iopth assay showed true decline = 136 , false decline-1 true failure to decline-3 , and false failure to decline-3 , respectively . the mean of basal serum pth done initially ( 875.74 ; sd 777.87 ) was not statistically different from preincision values ( p = 0.478 ) . on review after 6 months , 139 ( 97.2% ) were normocalcemic and pth levels were within normal limits . final histology noted adenoma 126 ( 88.1% ) , hyperplasia 3 ( 2% ) , atypical adenoma 6 ( 4% ) and carcinoma in 10 ( 6.8% ) patients . case 1 : a 64-year - old lady showed concordant mibi / us imaging for left inferior parathyroid lesion . however , thyroid gland showed coarse heterogeneous echo texture and lobulated contour . case 2 : a 39-year - old male patient showed concordant mibi / us images corresponding to both inferior parathyroid glands . tne was done and removed 2 cm ( 3.5 g ) lesion from right side but failed to locate lesion on left side . case 3 : a 35-year - old lady had mediastinal parathyroid lesion on mibi and was concordant with mri . median sternotomy and excision of 3 cm ( 3.5 g ) lesion close to aortic arch was done . repeat mibi showed a second mediastinal lesion posterolateral to descending aorta and was removed by re - exploration after 6 months . case 4 : a 36-year - old lady had right inferior parathyroid lesion with concordant mibi / us images . histology showed parathyroid carcinoma invading thyroid lobe and soft tissue . computed tomography of chest showed multiple scattered lung nodules and lytic lesion of t12 vertebra . mibi scan showed positive imaging in 136 ( 95% ) patients and inconclusive in 7 ( 5% ) patients . the operation findings matched well in position and number with mibi findings in 134 ( 93.7% ) patients and this included 3 double adenoma and 13 ectopic lesions . the high serum pth level positively influenced mibi scan while coincident thyroid disease negatively affected it [ table 2 ] . on correlating with histology , mibi scan showed inconclusive results 8 adenomas and 1 carcinoma . mri scan did not identify the second lesion in a patient with mediastinal double adenoma . features influencing methoxyisobutylisonitrate scan us identified lesions in 121 ( 84.6% ) patients and was inconclusive in 22 ( 14.4% ) . us detection rate was not significantly influenced by co - existing thyroid diseases and size of parathyroid lesion . features influencing ultrasound mri was used as anatomical imaging for 8 patients with mediastinal parathyroid lesions located by mibi . surgical procedures included focused parathyroidectomy 106 ( 74% ) , parathyroidectomy with ipsilateral hemi - thyroidectomy 22 ( 15.5% ) , sternotomy and parathyroidectomy 6 ( 4% ) , tne 6 ( 4% ) , and parathyroidectomy with total thyroidectomy 5 ( 3.5% ) , respectively . indication for hemi - thyroidectomy was adherent parathyroid lesion in 14 and co - existing thyroid nodule of suspicious cytology in 8 . total thyroidectomy was done for patient with large volume goiters ( n : 3 ) and papillary thyroid cancer ( n : 2 ) . mean size of the lesion was 2.78 cm ( 18 ) and weight was 5.069 g ( 127 ) . the mean preincision serum pth values was 951.274 pg / ml ( sd : 849.255 ) and 10 min postexcision was 207.8 pg / ml ( sd : 367.031 ) . results of iopth assay showed true decline = 136 , false decline-1 true failure to decline-3 , and false failure to decline-3 , respectively . the mean of basal serum pth done initially ( 875.74 ; sd 777.87 ) was not statistically different from preincision values ( p = 0.478 ) . on review after 6 months , 139 ( 97.2% ) were normocalcemic and pth levels were within normal limits . final histology noted adenoma 126 ( 88.1% ) , hyperplasia 3 ( 2% ) , atypical adenoma 6 ( 4% ) and carcinoma in 10 ( 6.8% ) patients . case 1 : a 64-year - old lady showed concordant mibi / us imaging for left inferior parathyroid lesion . case 2 : a 39-year - old male patient showed concordant mibi / us images corresponding to both inferior parathyroid glands . tne was done and removed 2 cm ( 3.5 g ) lesion from right side but failed to locate lesion on left side . case 3 : a 35-year - old lady had mediastinal parathyroid lesion on mibi and was concordant with mri . median sternotomy and excision of 3 cm ( 3.5 g ) lesion close to aortic arch was done . repeat mibi showed a second mediastinal lesion posterolateral to descending aorta and was removed by re - exploration after 6 months . case 4 : a 36-year - old lady had right inferior parathyroid lesion with concordant mibi / us images . histology showed parathyroid carcinoma invading thyroid lobe and soft tissue . computed tomography of chest showed multiple scattered lung nodules and lytic lesion of t12 vertebra . patients with symptomatic phpt differ from those with asymptomatic variant in general health status and features related to parathyroid pathology . patients are younger with poor general health indices and have high incidences of vitamin d deficiency . the spectrum of parathyroid pathologies in phpt include single - gland adenomas ( 8085% ) , multi - gland hyperplasia ( 1015% ) , and carcinomas ( 1% ) . a systematic review of 20,225 phpt patients showed single adenoma ( 88.9% ) , multi - glandular nodular hyperplasia ( 5.74% ) , multi - glandular adenomas ( 4.14% ) , and carcinomas ( 0.74% ) . milas m et al . observed 13% incidence of double adenomas with a predilection for superior parathyroid glands . many published series from india observed 4% to 6% prevalence of carcinomas and < 6% prevalence of multi - glandular lesions among symptomatic phpt patients . we observed similar parathyroid pathologies in patients who had phenotype expressions of men type 1 . technetium 99 m mibi dual phase scan and ultrasonography are two common imaging techniques used for parathyroid localization . we used mibi scan and high resolution ultrasonography in sequential manor and recorded concordant results in 83.7% patients with cervical parathyroid lesions . dual phase protocol using technetium 99 m mibi is easy to perform and has efficacy to detect single - gland adenomas in 7488% of occasions . however , the rate of correct localization drops down to 1035% in multi - glandular lesions . two potential covets in dual phase mibi procedure are thyroid nodules and rapidly washing out variety of parathyroid adenomas . thyroid nodules may concentrate mibi and leads on to false - positive results . adding single - photon emission computed tomography in initial and delayed phase of mibi improves the accuracy but overall prevalence of thyroid nodules is in about 9.6% in many geographical regions of the country . thyroid nodules may concentrate the radiopharmaceutical and increase the chance of false positive mibi images . however , on the contrary , we observed false negative results in these patients and so they probably belonged to rapidly washing out variety . the mibi scan showed significantly high capability to identify correctly parathyroid lesions in our series even when they are related to superior pole of thyroid or placed ectopically . surgeon performed ultrasonography prior to operation helped to avoid unnecessary dissection and reduced operation time . persistent hypercalcemia occurred in 4 patients and iopth monitoring predicted true failure to decline in 3 patients . excluding one patient with disseminated metastases from parathyroid carcinoma only two patients could have been cured by re - exploration . however , further exploration could not locate an abnormal lesion in both cases and require higher imaging before further procedure . we feel that iopth monitoring does not add any additional advantage in patients with concordant imaging . in these situations there was no statistical difference between basal pth level and preincision level but showed a trend toward higher values at the latter occasion . since at the present protocol of two blood draws increases the cost of surgery by 7% ( institutional audit ) , we propose single postexcision blood draw , but preferably after 15 min to avoid false negativity . all patients with false failure to decline showed true decline of pth levels in the third blood draw after 30 min . we feel that the major drawback of the study is retrospective design and lack of control group . dual phase technetium 99 m mibi parathyroid scintigraphy has good accuracy in symptomatic phpt patients . there is relative low incidence of multi - gland pathology in symptomatic disease and successful parathyroidectomy is possible above 95% of patients with concordant images . iopth monitoring is very sensitive but unlikely to influence the outcome when concordant images are available . | introduction : symptomatic primary hyperparathyroidism ( phpt ) is still seen frequently in referral centers all over india .
these patients require parathyroidectomy and this study aimed to assess the roll of intraoperative parathyroid hormone ( pth ) assay when concordant results of two localization studies were available.study design : we analyzed the case records of patients who underwent parathyroidectomy for phpt from january 2005 to june 2015.results:of 143 patients included in the study , technetium 99 m methoxyisobutylisonitrate dual phase scintigraphy showed true positive images in 93.7% and high definition ultrasonography in 84.6% of patients .
concordance in localization studies was observed in 121 ( 84.6% ) patients , successful parathyroidectomy was done in 117 ( 96.7% ) patients with concordant localization studies .
intraoperative pth monitoring showed 97.84% sensitivity and 75% specificity and predicted failure in 2 patients with concordant imaging .
however , re - exploration was not successful in these patients.conclusion:when concordant result is available between parathyroid scintigraphy and anatomical imaging surgical cure rate is high in trained hands .
re - exploration is unlikely to be successful since these patients require higher imaging . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
bacteriocins are toxins produced by the bacteria to inhibit the growth of similar or closely related bacterial strain(s ) during stress conditions . they are structurally , functionally , and ecologically diverse , produced by almost all major lineages of eubacteria and archaebacteria . ribosomal encoded bacteriocins are generally secreted in the extracellular milieu by the producers where they recognize specific receptors on the surface of susceptible or target cells . they induce toxicity in the target cells by different mechanisms like enzymatic nuclease ( dnase or rnase ) or pore formation in cytoplasmic membrane . their structure comprises of three distinct domain organizations : ( i ) a domain involved in recognition of specific receptor r , ( ii ) a domain involved in translocation t , and ( iii ) a domain responsible for their toxic activity c. molecular mass of ribosomal encoded bacteriocins vary from ~25 to 80 kda and are broadly classified into two groups , group a and b , based on their cross - resistance . these proteins have received increasing attention due to their potential use as preservatives in the food industry or in the therapeutic applications for clinical usage . xenorhabdus nematophila is a motile gram - negative bacterium belonging to the family enterobacteriaceae , and forms a symbiotic association in the gut of soil nematode from the family steinernematidae [ 6 , 7 ] . free - living forms of the bacterium have not yet been isolated from soil or water sources , which suggests that the symbiotic association may be essential for the survival of the bacteria in the environment . juvenile ( ijs ) enters digestive tract of the insect larva and subsequently penetrates into hemocoel of the host insect . the nematode can also gain access to the hemocoel via the respiratory spiracles or by penetrating directly through insect cuticle . bacteria , in turn , are essential for effective killing of the insect host and are required by the nematode to complete its life cycle [ 8 , 9 ] . growth in vitro is probably supported by the rich nutrient supply of the laboratory growth media and lack of competition that normally exists in the soil environment . as the bacteria enter stationary phase of growth cycle , they secrete several extracellular products , which include lipase(s ) , phospholipase(s ) , and protease(s ) , and several broad spectrum antibiotics that can be assayed in the culture media [ 10 , 11 ] . these extracellular products are believed to be secreted in the insect hemolymph when the bacteria enter stationary phase . these degradative enzymes break the macromolecules from insect cadaver to provide the developing nematode with nutrient supply , while the antibiotics suppress contamination of the cadaver by other microorganisms . cytoplasmic inclusion bodies , composed of highly expressed crystalline proteins , are also produced by the bacterium during stationary - phase growth . in our earlier study recombinant xenocin - immunity protein complex is toxic to six bacterial genus like bacillus , enterobacter , enterococcus , citrobacter , serratia , and stenotrophomonas . xenocin - immunity protein complex has atypical features which include the following . ( 1 ) tol box which has been replaced by ton box from n terminal end of translocation domain of xenocin . ( 2 ) there is only 30% similarity of xenocin with other bacteriocins . ( 3 ) size of its cognate immunity protein is 42 kda , whereas 1016 kda have been reported in other prokaryotic systems . immunity protein of x. nematophila is a fusion of two different domains , immunity domain and hemolysin domain . ( 4 ) immunity protein has atpase activity , although walker motif is missing in its primary amino acid sequence . ( 5 ) xenocin - immunity protein complex is secretory in nature without any signal sequence . in this study we have cloned , expressed , and purified all the possible domains of xcina and ximb genes . exogenous toxicity assays were performed with purified recombinant xenocin - immunity domain protein complex and other domains . in silico study of the immunity protein showed its similarity with hemolysin and purine ntpase like protein ; therefore , hemolysis and atpase assays were performed . finally , secondary structural analysis of recombinant xenocin - immunity domain protein complex , catalytic - immunity domain protein complex , immunity protein , and its hemolysin domains were performed with circular dichroism . all the chemicals were purchased from sigma ( sigma - aldrich ) except where otherwise mentioned . vector pqe30 , ni - nta agarose resin and qia quick spin columns were from qiagen ( germany ) . e. coli strains dh5 ( bethesda research laboratories ) were used as the host for cloning . e. coli bl 21(de3 ) plyss strain from novagen and m 15 strain from qiagen were used in the expression studies . the plasmid vector pgem - t easy from promega ( madison , usa ) were used for pcr cloning . ampicillin , kanamycin , and chloramphenicol were used in the concentration of 100 , 35 , and 25 g ml , respectively . phylogenetic analysis of immunity protein was done by a method as described earlier . briefly , amino acids of all the protein sequences that matched with immunity protein were aligned by clustalw ( mac vector 7.0 ) , and a tree was constructed using neighbour - joining method , with the best tree mode in the mac vector version 7.0 ( oxford molecular , england ) program . all the constructs were amplified from the 4.3 kb genomic dna fragment of x. nematophila . the orf 1 encoding xcina gene and partial orf 2 encoding immunity domain of ximb gene were obtained by pcr amplification using primer 1 with a bamhi site at the 5 end and a reverse primer 6 with hindiii site at the 3 end . the amplified product ( 2 kb ) was ligated in pgem - t easy and pqe30 vector , producing pjc5 and pjc6 plasmids , respectively . the catalytic domain ( 318 bp ) of xcina gene was cloned with the immunity domain ( first 270 bp of ximb gene ) of ximb gene using primer pair 2 and 6 as described earlier . primer 1 with a bamhi site at the 5 end and a reverse primer transb with ncoi site at the 3 end were used to amplify the translocation domain of xcina gene . amplified product of 1 kb was ligated in pgem - t easy vector and pqe30 vector , producing pjc7 and pjc8 plasmids , respectively . primer 1 with a bamhi site at the 5 end and a reverse primer recb with hindiii site at the 3 end were used to amplify the translocation - receptor domain of xcina gene . the amplified product ( 1.5 kb ) was ligated in pgem - t easy vector and pqe30 vector producing pjc9 and pjc10 plasmids , respectively . primer 3 with bamhi site at the 5 end and a reverse primer 5 with hindiii site at the 3 end used for ximb cloning and forward primer 4 without any restriction site and backward primer 7 without any restriction site were used for cloning ximb hemolysin domain . the amplified products of 1 kb and 700 bp were ligated in pgem - t easy vector producing pjc11 and pjc12 plasmids . the 1 kb amplified product was further ligated in pqe30 and 700 bp amplified product was ligated in pqe31 expression vector producing pjc13 and pjc14 plasmids , respectively . a 2.330 kb dna fragment containing both xcina and immunity domain of ximb gene with native promoters was amplified using xenocinf1 ( 300 bp upstream of start codon of xcina locus ) and primer 6 and cloned in pgem - t easy vector producing pxim construct . the empty pgem - t easy vector designated as pgem was used as control . the plasmids pjc6 , pjc8 , pjc10 , pjc13 , and pjc14 were transformed in m15 cells where as pjc4 was transformed in e. coli bl 21(de3 ) plyss cells . the resulting strains jc4 , jc6 , jc8 , jc10 , jc13 , and jc14 were used for expression and purification of recombinant proteins under the control of iptg inducible t7 promoter as per the protocol described earlier . briefly , overnight grown cultures were diluted 100 fold in fresh 50 ml lb medium and grown till the od600 reached 0.5 . culture was induced by adding 1 mm final concentration of iptg and incubated at 30c for 6 hours . cells were harvested and washed with 40 ml of cold and 50 mm sodium phosphate buffer , ph 8 , containing 300 mm nacl and 50 mm benzamidine ( buffer a ) . the cell pellet was suspended in 25 ml of buffer a and cells were disrupted by sonication at 4c . the cell lysate was centrifuged at 12000 g for 30 min at 4c in a rc5 plus centrifuge , and the 6xhis - tagged recombinant proteins or protein complexes in the soluble fractions were purified as follows . the supernatant from the previous step was loaded on ni - nta agarose column preequilibrated with buffer a at 4c . the column was washed extensively with buffer a , containing 2550 mm imidazole , and the protein / protein complex was eluted with buffer a containing 300 mm imidazole . fractions containing pure protein or protein complex were concentrated using centricon ( millipore pm10 ) . recombinant protein or protein complexes were dialyzed overnight against 100 volumes of 50 mm sodium phosphate buffer , ph 8 , and the final preparations were stored at 20c in the presence of 15% glycerol . to study the neutralizing effect of the immunity domain protein , xcina gene was cloned with its native promoter along with immunity domain of ximb gene which gave rise to pxim . empty pgem - t easy vector was considered as control and transformed in e. coli dh5 to give rise to gem strain . overnight grown strains gem and xim were subcultured in fresh medium and incubated till the od600 reached 0.5 . the cultures were diluted in fresh medium 1 : 100 and induced with 0.3 g ml of mitomycin c ( an inducer of xenocin native promoter ) . the optical densities of the cultures were monitored at 600 nm during different intervals . the bacteriostatic activity of purified recombinant proteins / complexes were determined by the protocol as described earlier . briefly , lb agar plates without antibiotics were overlaid with 3 ml of soft nutrient agar containing indicator e. coli dh5 strain grown in m9 medium , and the protein complex was applied to sterile disks . the plates were incubated overnight at 37c , and the sizes of clearance zones were recorded . freshly isolated rabbit blood cells were washed thrice with phosphate buffer saline ( pbs ) by centrifuging at 1000 g , 4c for 10 minutes . washed erythrocytes were resuspended in pbs to make a final concentration of 4% . the same volume ( 100 l ) of protein ( 5 m ) sample dissolved in pbs and erythrocytes suspension were added into wells of 96-well plate . the plate was then incubated at 37c for 1 hr and centrifuged at 1000 g for 5 minutes . the resulting supernatant was transferred to new wells , and the absorbance was determined at 540 nm on a continuous spectrum microtitre plate reader . protein samples of different concentrations were incubated with 0.2 ci of [ -p ] labelled atp ( 6000 ci/ mmol , perkinelmer life sciences , usa ) in a buffer containing 20 mm tris - hcl ( ph 8.0 ) , 1 mm mgcl2 , 100 mm kcl , 8 mm dtt , and 80 g / ml of bsa in a total reaction volume of 10 l . samples were incubated at 37c for 30 minutes . at the end of the reaction , 1 l of the reaction mixture was spotted on a polyethyleneimine thin - layer chromatography ( tlc ) plate ( sigma - aldrich , usa ) and air - dried . chromatography was performed using 0.5 m licl and 1 m hcooh as the running solvent . the far - uv cd spectrum was recorded between 190 and 260 nm ( 500 l sample volume ) on a jasco j-810 spectropolarimeter equipped with a jasco peltier temperature controller at 25c using 1 mm optical path length quartz cells and the step size was 0.5 nm with 1 nm bandwidth at a scan speed of 20 nm minute . averages of 5 scans were obtained for blank and protein spectra , and the data was corrected for buffer contribution . the results were expressed as mean residue ellipticity in units of degree / cm / dmol . phylogenetic analysis of the xenocin and its immunity protein was done by preparing phylogenetic tree , using neighbour - joining method . results showed that immunity protein formed a separate cluster in the very beginning as shown figure 1(b ) . further , xcina gene was cloned along with n terminal immunity domain ( 10 kda ) of ximb gene . purification of recombinant xenocin - immunity domain ( 10 kda ) protein complex from jc6 strain was done by ni - nta chromatography under native conditions . one was at the position corresponding to 66 kda and another below 14 kda protein marker as shown in figure 2(a ) which corroborates with the size of xenocin and immunity domain of immunity protein , respectively . purification of recombinant catalytic - immunity domain protein complex with ni - nta chromatography under native conditions from jc4 strain also showed two bands corresponding to the size of catalytic domain of xcina and immunity domain of ximb as shown in figure 2(b ) . purification of recombinant translocation domain of xcina gene from jc8 strain with ni - nta chromatography showed multiple bands in sds - page as shown in figure 2(e ) . further , western blot was performed using purified fraction , probed with anti - his antibody , and the result showed single band at 38 kda which corresponds to the size of recombinant translocation domain protein as shown in figure 2(f ) . purification of recombinant translocation - receptor domain protein with ni - nta chromatography from jc10 strain showed two prominent bands in sds - page . upper band corresponded to ~52 kda whereas lower band corresponded to ~28 kda as shown in figure 2(g ) . western blot was performed using whole cell lysate and the purified fraction , probed with anti - his antibody , which showed a single band at 52 kda corresponding to a size of recombinant translocation - receptor domain protein as shown in figure 2(h ) . purification of recombinant full length immunity protein , as well as its hemolysin domain protein from jc13 and jc14 strains , showed less but stable expression as shown in figures 2(c ) and 2(d ) , respectively . neutralization of endogenous toxicity of xcina by immunity domain of ximb gene was determined by endogenous assay . endogenous assay with xim strain ( harboring pxim containing xcina with its native promoter and first 85 amino acid residues of ximb gene ) and gem strain ( harboring empty pgem t - easy vector ) in the presence of mitomycin c showed the same growth profile as shown in figure 3(a ) . exogenous toxicity assay was performed with purified recombinant xenocin - immunity domain ( 10 kda ) complex using e. coli dh5 as target cells . the zone of inhibition was observed as shown in figure 3(b ) ( i ) . purified catalytic - immunity domain protein complex was used to study for the bacteriostatic effect in the exogenous assays . the zone of inhibition was not observed in this case as shown in figure 3(b ) ( ii ) . similar results were observed when full length immunity protein ( 42 kda ) encoded by ximb gene or its hemolysin domain ( 32 kda ) was used for exogenous assay as shown in figure 3(b ) ( iii ) and ( iv ) , respectively . moreover , as expected zone of inhibition was not observed in buffer control experiment as shown in figure 3(b ) ( v ) . protein - protein blast results ( http://www.ncbi.nlm.nih.gov/blast/ ) of the immunity protein showed its similarity with hemolysin ( aaf42109 ) and purine ntpase like protein ( data not shown ) . hemolytic assay with fresh rabbit red blood cells was performed with purified full length immunity protein as well as its immunity and hemolysin domain . results showed that none of the protein had hemolytic activity ( data not shown ) . atpase assay was performed with purified recombinant full length immunity protein , its immunity domain , and hemolysin domain . atpase activity was not detected in recombinant immunity domain , hemolysin domain protein , and even in the purified bsa which was used as negative control as shown in figure 4(a ) lane 1 . however , full length recombinant immunity protein ( 42 kda ) showed atpase activity with increasing concentration of protein and was comparable to the atpase activity of purified groel protein of x. nematophila which was used as the positive control , as shown in figure 4(a ) lane 2 . the far uv spectra of purified recombinant xenocin - immunity domain ( 10 kda ) protein complex , catalytic - immunity domain protein complex , immunity , and its hemolysin domain were recorded at 25c as shown in figure 5 . recombinant xenocin - immunity domain protein complex was found to contain 41% -helical structure and 21% -sheet . catalytic - immunity domain protein complex was found to contain 51% -sheet and only 7% -helical structure . in case of full length immunity protein 30% of the secondary structure hemolysin domain of the immunity protein also had the same secondary conformation with 30% -helical and 11% -sheet content . recombinant xenocin-(66 kda- ) immunity ( 42 kda ) protein complex has a broad range bacteriostatic property , inhibiting the growth of six insect gut resident bacterial species . due to only 30 - 31% primary sequence similarity with other bacteriocins , xenocin from the x. nematophila forms a distinct cluster in phylogenetic tree . phylogenetic analysis of immunity protein showed similar results , in which immunity protein from x. nematophila forms a separate cluster in the very beginning . this could be due to variable length of immunity protein from x. nematophila . cognate immunity protein of xenocin consists of 368 amino acid residues and is a unique fusion of two different domains . its n terminal ( first 85 amino acid residues ) showed similarity with immunity protein from other prokaryotic systems , whereas the c terminal showed similarity with hemolysin ( n. meningitidis accession no . three - dimensional structure of xenocin has been recently deciphered by homology modelling in my lab . it is a multidomain protein which consists of 576 amino acid residues . from its n terminal 1327 amino acid residues form translocation domain ( t ) , 328476 amino acid residues form the middle receptor domain ( r ) , and amino acid residues from 477576 form the catalytic domain ( c ) at the c terminal . while cloning xcina gene alone in expression vector , not a single transformant was observed . one reason for this result could be the leaky expression of toxic xcina gene . to address this question , xcina gene was cloned along with n terminal immunity domain ( 10 kda ) of ximb gene . when the recombinant protein from jc6 strain was purified by ni - nta chromatography , xenocin was visible in sds - page at position corresponding to 66 kda whereas immunity domain of immunity protein was observed below 14 kda protein marker . this result showed that n terminal immunity domain ( 10 kda ) of immunity protein ( 42 kda ) encoded by ximb gene is enough to bind with and neutralize the in vivo toxic effect of xcina gene . to confirm this result and to map the minimum functional domain of immunity protein required to abolish the xcina gene toxicity in vivo , first 85 amino acids of immunity protein were cloned along with xcina gene under its native promoter . same growth profile of xim strain ( harboring pxim ) and gem strain ( harboring empty pgem t - easy vector ) in the presence of mitomycin c confirmed that first 85 amino acid residues of ximb gene were able to neutralize the toxic activity of xenocin in vivo . further , purification of recombinant catalytic - immunity domain protein complex with ni - nta chromatography under native conditions from jc4 strain confirmed the minimal domains of xcina and ximb genes that could be expressed and purified . as we were unable to express xcina gene alone which is composed of translocation , receptor , and catalytic domain an attempt had been made to clone , express , and purify the translocation domain alone or along with receptor domain of xcina gene . in native conformation , translocation domain of bacteriocin like colicin e3 interacts with catalytic domain of e3 and immunity protein via receptor domain , and this interaction further provides stability to the translocation domain . however , in recombinant translocation domain of xcina , receptor and catalytic domains as well as immunity protein were missing which may be probably made it to attain an open conformation and be susceptible to proteases from the host cells . hence , during the purification of translocation domain from pjc8 , multiple bands were observed in sds - page . however , western blot with purified fraction when probed with anti - his antibody showed a single band corresponding to the size of translocation domain which confirmed the expression of translocation domain alone . further , purification of recombinant translocation - receptor domain protein with ni - nta chromatography from jc10 strain , showed two prominent bands in sds - page rather than multiple bands . upper band corresponded to ~52 kda whereas lower band corresponded to ~28 kda . western blot using whole cells and purified fraction when probed with anti - his antibody showed a single band at 52 kda which is corresponding to a size of recombinant translocation - receptor domain protein . therefore , we inferred that recombinant translocation domain along with receptor domain of the xcina gene was more stable as compared to the recombinant translocation domain alone , but due to the absence of catalytic domain and immunity protein it was still prone to proteases of the host cell . endogenous toxicity assays with xim and gem strains were performed to identify the minimum domain required to neutralize the xcina toxicity . results showed that first 85 amino acids of the immunity protein were able to neutralize xenocin endogenous toxicity as both strains had the same growth profile . moreover , from this experiment we inferred that expression of cognate immunity protein domain and its binding to the catalytic domain of xenocin occurs in the host cell simultaneously . receptor domain in bacteriocin plays a major role in the exogenous toxic effect , as it is the first domain which binds to ligand present on the surface of its target cells . binding is followed by import of bacteriocin into the cells with the assistance of either ton proteins ( exbb , exbd , and tonb ) or tol proteins ( tola , -b , -q , and -r ) of periplasm and facilitate the translocation of the catalytic domain of bacteriocins into the periplasmic space of the target cell for further processing [ 5 , 1618 ] . interaction of bacteriocins either with ton or tol proteins of periplasm occurs via ton or tol box present at their n terminal end of the translocation domain . interestingly , although xenocin has rnase activity , tol box in its translocation domain has been replaced by ton box . this could be due to the domain swapping which generally occurs during the horizontal gene transfer in prokaryotes . in the colicin e3-immunity complex , binding of the receptor domain of e3 to the surface protein on target cells leads to the conformational changes which assisted the immunity protein to dissociate from the protein complex [ 4 , 18 ] . the immunity protein from x. nematophila is a unique fusion of immunity domain ( 10 kda ) and hemolysin domain ( 32 kda ) protein , and endogenous assay confirmed that immunity domain of ximb gene is enough to neutralize the detrimental effect of xcina gene . therefore , exogenous assay was performed with purified recombinant xenocin - immunity domain ( 10 kda ) complex using e. coli dh5 as target cells to determine translocational ability of xenocin - immunity domain ( 10 kda ) complex into the cytoplasm of target cells . clear zone of inhibition was observed in the exogenous toxicity assay due to the detrimental effect of xenocin - immunity domain ( 10 kda ) protein complex . this result confirmed the functionality of translocation as well as receptor domain of xenocin and their individual roles in internalization of xenocin into the cytoplasm of target cells . moreover , it also confirmed that hemolysin domain ( 32 kda ) of ximb gene has no role in the internalization of xenocin as well as in exogenous toxicity . catalytic domain of xcina gene along with immunity domain of ximb gene was the minimum domain which could be expressed and purified . therefore , purified catalytic - immunity domain protein complex was studied for the bacteriostatic effect in the exogenous assays . results showed that zone of inhibition was not observed , which again confirmed the role of translocation as well as receptor domain of xcina gene for its internalization into the cytoplasm on the target cells . similar results were observed when full length immunity protein ( 42 kda ) encoded by ximb gene or its hemolysin domain ( 32 kda ) was used for exogenous assay . moreover , as expected zone of inhibition was not observed in the experiment in which buffer was used as a negative control . to neutralize the detrimental effect of bacteriocins , the molecular weight of the immunity protein in other prokaryotic systems is between 10 and 16 kda ; however , immunity protein encoded by ximb gene corresponds to 42 kda . protein - protein blast using blastp ( http://www.ncbi.nlm.nih.gov/blast/ ) of the immunity protein showed similarity with hemolysin ( aaf42109 ) and purine ntpase like protein . hemolytic assay with fresh rabbit red blood cells was performed with purified full length immunity protein as well as its immunity and hemolysin domains . due to the partial primary amino acid sequence similarity with hemolysin protein , none of the protein / protein domains showed hemolytic activity . as immunity protein also showed similarity with protein like purine ntpase 's atpase assay was performed with purified recombinant full length immunity protein , its immunity domain , and hemolysin domain . although full length immunity protein showed atpase activity , in silico analysis did not show walker motif in its primary amino acid sequence , which is generally present in the proteins having atpase activity . possibility of atpase activity in immunity protein towards the secretion of recombinant xenocin - immunity protein complex can not be ruled out at this stage as none of the proteins have any signal sequence at their either ends . secondary structure analysis of purified recombinant xenocin - immunity domain ( 10 kda ) protein complex , catalytic - immunity domain protein complex , immunity , and its hemolysin domain was done with far uv spectra . high percentage of -helical structure of xenocin - immunity complex is attributed due to the helix turn helix structure of receptor domain of xenocin which corroborates with its recently deciphered three - dimensional structure . catalytic - immunity domain protein complex was found to contain 51% -sheet and only 7% -helical structure . this open conformation with high -sheet might be beneficial to bind with its substrate ( rna ) and act upon it [ 20 , 21 ] . in case of full length immunity protein 30% of hemolysin domain of the immunity protein also had the same secondary conformation with 30% -helical and 11% -sheet content . since immunity protein is a novel fusion of two different domains the role of its secondary is not deciphered yet . | xenorhabdus nematophila , a gram - negative bacterium belonging to the family enterobacteriaceae is a natural symbiont of a soil nematode from the family steinernematidae . in this study cloning ,
expression , and purification of broad range iron regulated multidomain bacteriocin called xenocin from x. nematophila ( 66 kda , encoded by xcina gene ) and its multidomain immunity protein ( 42 kda , encoded by ximb gene ) have been done .
xcina - ximb ( n terminal 270 bp ) , translocation , and translocation - receptor domain of xcina , ximb , and its hemolysin domain were cloned , expressed , and purified by single step ni - nta chromatography under native conditions . in the functional characterization ,
neutralization of xcina toxicity by immunity domain of ximb gene was determined by endogenous assay .
exogenous toxic assays results showed that only the purified recombinant xenocin - immunity domain ( 10 kda ) protein complex had toxic activity .
atypical cognate immunity protein ( 42 kda ) of xenocin was fusion of immunity domain ( 10 kda ) and hemolysin domain ( 32 kda ) . in silico analysis of immunity protein revealed its similarity with hemolysin and purine ntpase like proteins .
hemolytic activity was not observed in immunity protein or in its various domains ; however , full - length immunity protein lacking walker motif showed atpase activity . finally , using circular dichroism performed secondary structural analyses of all the recombinant proteins / protein complexes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the autoimmune and inflammatory processes that characterize celiac disease are triggered by gluten in genetically predisposed individuals , in the presence of environmental aggression that interferes with the integrity of the small intestine.1 among the known genetic markers , the hla genes have the greatest impact on the development of the disease.2 the presence of genes coding for dq2 and dq8 molecules of the hla complex class ii explains up to 40% of the occurrence of celiac disease in european populations.3 the association between the genotype dq2 and celiac is explained by the high affinity of the dq2 molecule of hla in cells presenting this antigen in the intestinal mucosa , towards peptides derived from gluten.4 in a multicenter study carried out in europe , it was observed that the hla genotype dq2 is present in around 86 to 93% of celiac disease patients , while around 3 to 8% of these patients have dq8 without dq2.5 these markers are also carried by many individuals without celiac disease : 40 to 65% of first - degree relatives of celiac disease patients and 18 to 30% of the general population.6 - 8 however , in non - european populations , different frequencies are observed . in the united states , a greater proportion of hla dq8 and a smaller proportion of dq2 than in europe have been reported . 9 hla dq2 and dq8 frequencies similar to those observed in the usa have been described in asian10 , cuban11 and chilean12 populations . some authors have suggested that the hla genotypes dq2 and dq8 not only are indicators of genetic vulnerability but also may be used for diagnosing celiac disease in situations that remain undefined even after biopsy.13 - 14 among first - degree relatives , just like among other groups at risk , active searching for new cases using serological tests is indicated . these groups present the highest concentration of cases with undefined diagnoses and would be the greatest candidates for genotyping . 7,15 however , the frequency of the hla genotypes dq2 and dq8 among family members is greater than among the general population and it also varies between different regions of the world . the hla system is extremely polymorphic and reflects the process of formation of each population . 16 the brazilian population is intensely miscegenated , with marked differences between the regions . in the northeastern region of brazil , the genetic markers for this disease have not been studied yet . recent studies have demonstrated that the frequencies of celiac disease in the americas and in brazil are similar to what has been described in europe.17 - 19 this knowledge has increased the number of new diagnoses of celiac disease in brazil , especially among high - risk groups . the diversity of celiac disease among these groups shows the need for greater knowledge about celiac disease in this population . in the present study , we aimed to evaluate the frequencies of alleles coding for the hla molecules dq2 and dq8 among individuals with celiac disease and their first - degree relatives in northeastern brazil . this study was conducted in pediatric gastroenterology outpatient clinics in the city of recife , state of pernambuco , northeastern brazil , between august 2007 and may 2008 . children and adolescents with a diagnosis of celiac disease ( index cases ) , together with the first - degree members of their families ( fathers , mothers and siblings ) were invited to participate in this study . a free and informed consent statement was obtained from all of the participants in the study . the study had previously been approved by the ethics committee for research on human beings of the fernando figueira integrated medicine institute ( instituto de medicina integral fernando figueira , imip ) , under the number 893 , on november 10 , 2006 , and the work was performed in accordance with the principles of the 1983 declaration of helsinki . the study had a cross - sectional design , in order to compare frequencies between cases and family controls . all the first - degree relatives who agreed to participate in the study underwent the human tissue transglutaminase ( ttg ) serological test , and those with positive findings were invited to undergo an intestinal biopsy . cases were taken to be celiac disease patients with a diagnosis in accordance with the criteria of espghan 199020 ( index cases ) and family members with positive ttg and signs of villous atrophy on intestinal biopsy . the control group was formed by first - degree relatives of patients with negative results from ttg serological tests . one hundred and eighty - two first - degree relatives of 66 patients were identified during the study period and 161 ( 88.4% ) first - degree relatives were included in the study . seven first - degree relatives whose serological tests were positive and biopsies presented villous atrophy were included in the case group , while 126 first - degree relatives with non - reactive serological tests for ttg antibodies made up the control group . after blood sample collection , the blood was centrifuged and the serum thus obtained was stored in eppendorf tubes at -18c . the serum ttg concentration was investigated by using quantitative elisa with a commercially available kit ( immulisa , immco diagnostics , inc , buffalo , ny , usa ) . values lower than 20 eu / ml were considered negative , as suggested by the manufacturer . genomic dna was extracted from 2 ml of whole blood by using the genome wizard dna kit ( promega ) , following standard protocols . the genotyping was performed by using the eu - dq kit from eurospital ( trieste , italy ) . pcr products were detected by means of electrophoresis , which was run on 2% agarose gel and viewed under uv light . hla haplotypes were double - checked by using the pcr - ssp kit allset ( dynal , biotech a.s.a , oslo , norway ) . the frequency of hla dq2 and dq8 were based in the frequency of the alleles - a1 * 05 , dqb1 * 02 , a1 * 0201 and b1 * 0302 in genotyping . we consider carrier genotype dq2 individuals who had the alleles a1 * 05 and dqb1 * 02 in genotyping and the genotype dq8 those who had the allele b1 * 0302 in pcr screening . the frequencies of hla genotypes and alleles were described as percentages with their respective confidence intervals . the frequencies of the groups were compared by using the chi - squared test ( ) . this study was conducted in pediatric gastroenterology outpatient clinics in the city of recife , state of pernambuco , northeastern brazil , between august 2007 and may 2008 . children and adolescents with a diagnosis of celiac disease ( index cases ) , together with the first - degree members of their families ( fathers , mothers and siblings ) were invited to participate in this study . a free and informed consent statement was obtained from all of the participants in the study . the study had previously been approved by the ethics committee for research on human beings of the fernando figueira integrated medicine institute ( instituto de medicina integral fernando figueira , imip ) , under the number 893 , on november 10 , 2006 , and the work was performed in accordance with the principles of the 1983 declaration of helsinki . the study had a cross - sectional design , in order to compare frequencies between cases and family controls . all the first - degree relatives who agreed to participate in the study underwent the human tissue transglutaminase ( ttg ) serological test , and those with positive findings were invited to undergo an intestinal biopsy . cases were taken to be celiac disease patients with a diagnosis in accordance with the criteria of espghan 199020 ( index cases ) and family members with positive ttg and signs of villous atrophy on intestinal biopsy . the control group was formed by first - degree relatives of patients with negative results from ttg serological tests . one hundred and eighty - two first - degree relatives of 66 patients were identified during the study period and 161 ( 88.4% ) first - degree relatives were included in the study . seven first - degree relatives whose serological tests were positive and biopsies presented villous atrophy were included in the case group , while 126 first - degree relatives with non - reactive serological tests for ttg antibodies made up the control group . after blood sample collection , the blood was centrifuged and the serum thus obtained was stored in eppendorf tubes at -18c . the serum ttg concentration was investigated by using quantitative elisa with a commercially available kit ( immulisa , immco diagnostics , inc , buffalo , ny , usa ) . values lower than 20 eu / ml were considered negative , as suggested by the manufacturer . genomic dna was extracted from 2 ml of whole blood by using the genome wizard dna kit ( promega ) , following standard protocols . the genotyping was performed by using the eu - dq kit from eurospital ( trieste , italy ) . pcr products were detected by means of electrophoresis , which was run on 2% agarose gel and viewed under uv light . hla haplotypes were double - checked by using the pcr - ssp kit allset ( dynal , biotech a.s.a , oslo , norway ) . the frequency of hla dq2 and dq8 were based in the frequency of the alleles - a1 * 05 , dqb1 * 02 , a1 * 0201 and b1 * 0302 in genotyping . we consider carrier genotype dq2 individuals who had the alleles a1 * 05 and dqb1 * 02 in genotyping and the genotype dq8 those who had the allele b1 * 0302 in pcr screening . the frequencies of hla genotypes and alleles were described as percentages with their respective confidence intervals . the frequencies of the groups were compared by using the chi - squared test ( ) . the characteristics of the 73 cases are described in table 1 . among the 126 controls , 68 ( 54% ) were women and 58 were men ; 33 ( 26.2% ) were fathers , 45 ( 35.7% ) were mothers and 48 ( 38.1% ) were siblings . the parents ages ranged from 23 to 56 years , with a median of 38 years ( p25/75 : 33/43 years ) , and the siblings ages ranged from 20 months to 27 years , with a median of 13 years ( p25/ p75 : 8/16 years ) . the hla genotypes dq2 or dq8 were present in 68 of the 73 celiac individuals ( 93.1% ; 95% ci : 84 97% ) and 99 of the 126 controls ( 78.6% ; 95% ci : 70 85% ) . the hla genotypes dq2 and dq8 frequencies distribution in the two groups are described in table 2 . among the five patients who did not present hla dq2 or dq8 , four had the allele b1 * 02 without a1 * 05 and one did not have any of the alleles investigated with the eu - dq kit . the frequencies of the alleles a1 * 0201 , a1 * 05 , b1 * 02 and b1 * 0302 in celiac patient and controls are described in table 4 . b1 * 02 was the most frequent allele in both groups and was found in 93% of the patients and 88 % of the control . no differences in the distribution of each allele alone were observed between the two groups . the genotypes dq2 and dq8 were present in 93.2% of patients with celiac disease in the northeast of brazil . the hla dq2 was present in 75.6% and dq8 in 17.8% of these patients and these proportions differ from those described in european populations.21 in celiac patients of european population the frequency of the hla dq2 is up of 90% e the hla dq8 is between five and 10% , like was described in recent study performed in 2308 cases from dutch , uk and irish . 22 differences in the frequencies of the hla genotypes dq2 and dq8 in non - european populations have already been described . butterworth et al , in england , demonstrated that patients of indian origin had lower frequency of hla dq2 than those of british origin.10 lower frequencies of hla dq2 and higher frequency of hla dq8 than european have also been described among celiac disease patients in the united states ( 82% dq2 and 16% dq8 only ) and in cuba ( 86% dq2 ) 11,17 in south america , araya et al studied chilean celiac patients of amerindian origin and found that genotype dq8 predominate among this group . these results can possibly be explained by the origins of the chilean population , formed by miscegenation of the mapuche people with spaniards.12 in brazil , the miscegenation is so great that it is erroneous to identify genetic ancestry through physical characteristics.23,24 thus , in our population , it is impossible to determine the composition of the group in terms of caucasian , amerindian or black african origin . another finding from this group is that 79% of the unaffected control families carried genotype dq2 and/or dq8 , which is one of the highest frequencies so far described among first - degree relatives . just like the genotypes dq2 and dq8 , a1 * 0201 , a1 * 05 , b1 * 02 and b1 * 0302 alleles were very frequently found among the first - degree relatives of the patients . we raise the possibility that these data were overestimated because of characteristics peculiar to this group of controls . we believe that one of the biggest limitations to this study is that , among the family controls , there might be some patients . this would occur both because of the characteristic that celiac disease may be manifested at any time during life , which would put limits on evaluations made at a single time , and because of the possibility of false negative ttg findings . however , most studies on hla among first - degree relatives used designs similar to ours , and found that no more than 59.5% of first - degree relatives in europe presented hla dq2 and dq8.7,15 at present , there is no data on the distribution of hla dq among the general population of recife . nevertheless , since the frequencies of genetic markers among populations of first - degree relatives reflect and amplify those among the general population of which they form part , this allows us to speculate that in our region , a large proportion of the general population may carry these markers . one of the theories that explain the differences in hla between different populations relates to negative selection of these molecules that has occurred during human evolution.16 this selection has been affected by the different antigen stimuli to which each population has been exposed.25 in the case of celiac disease , it depends primarily on gluten exposure , and possibly also on other environmental factors.26 recife is located in northeastern brazil , a region that was first peopled by amerindian tribes , like the remainder of the americas . these tribes came from places where there was no wheat - growing culture ( peoples who came from asia , arriving here via the bering strait).27 furthermore , differing from europe and the middle east ( the region around the fertile crescent ) , where gluten has been consumed for more than 10,000 years , this food only came to the americas with the european colonizers 500 years ago.26,28 consequently , in our region , there has been less time for negative selection of these genes , thereby leaving their frequencies relatively high in this population . another finding from the present study was that five out ( 6,8% ) of the 73 celiac patients presented neither dq2 nor dq8 , although four of them had at least the allele b1 * 02 . among these patients , only one did not have the classic form of celiac disease , but this patient presented considerable gastrointestinal symptoms . these findings are concordant with several previous studies in which it was demonstrated that just one of the alleles a1 * 05 or b1 * 02 , coding for half of the dq2 heterodimer molecule would confer a predisposition towards triggering celiac disease.2,5,21 in our study , we found the a1 * 0201 allele in nine patients : one of them was negative for dq2 and dq8 but had the allele b1 * 02 . these findings are concordant with european data . in a multicenter study conducted in europe in 2002 , 61 out of the 1008 celiac patients studied did not present dq2 and dq8 genotypes . thirty - four out of the 61 patients presented the gene a1 * 0201 in association with b1 * 02 , only four were characterized non - dq2 and/or dq8 haplotypes.21 it has been hypothesized that the genotype a1 * 0201-b1 * 0201 is capable of coding for a molecule of dq2 with lower affinity for gliadin . the patient who did not present any of the alleles investigated was diagnosed in accordance with the criteria of espghan , with classic symptoms , positive serological tests and signs of villous atrophy from the biopsy . this patient underwent hla genotyping repeated three times in blind with the dynal all set ssp kit and resulted hla dqa1 * 01 . we hypothesize that in the subjects analyzed in our study the genotypes dq2 and dq8 conferred vulnerability towards the development of celiac disease . however , the distribution of the frequencies of the genotypes dq2 and dq8 were different from distributions found in european populations . the distribution was closer to what has been found in other studies conducted in the americas . the high frequencies of the hla genotypes dq2 and dq8 found in first - degree relatives would make it difficult to use these hla genotypes for routinely diagnosing celiac disease in this specific group . in the future , it will be necessary to investigate the hla genotypes dq2 and dq8 in the general population of recife , in order to achieve better understanding of these markers in our region . although the genotypes dq2 and dq8 were presents in the main of the celiac patients in recife , northeastern brazil , the distribution of these genotypes was different from what had been found in european population . the quite high frequencies of the hla genotypes dq2 and dq8 found in first - degree relatives would make it difficult to use these hla genotypes for routinely diagnosing celiac disease in this group . this study was funded by the brazilian national counsel of technological and scientific development ( cnpq ) ( case no . | aims : the aim of this study was to evaluate the frequencies of the hla genotypes dq2 and dq8 and the alleles a1 * 05 , a1 * 0201 , b1 * 0201 and b1 * 0302 in individuals with celiac disease in recife , northeastern brazil.methods:hla dq2 and dq8 genotyping was performed for 73 individuals with celiac disease and 126 first - degree relatives with negative transglutaminase serology .
the alleles dqa1 * 05 , dqa1 * 0201 , dqb1 * 02 and dqb1 * 0302 were identified by sequencing using specific primers and the eu - dq kit from the eurospital laboratory , trieste , italy and double - checked by the all set spp kit ( dynal).results : among the 73 cases , 50 ( 68.5% ) had the genotype dq2 , 13 ( 17.8% ) had dq8 , 5 ( 6.8% ) had dq2 and dq8 , and 5 did not have any of these genotypes . among the 5 negative individuals , four had the b1 * 02 allele and one did not have any of the alleles studied .
b1 * 02 was the most frequent allele in both groups ( 94% in the patients and 89% in the control relatives).conclusions : in this study , celiac disease was associated with the genotypes dq2 and dq8 .
dq2 predominated , but the distribution of the frequencies was different from what has been found in european populations and was closer to what has been found in the americas .
the high frequencies of the hla genotypes dq2 and dq8 that were found in first - degree relatives would make it difficult to use these hla genotypes for routine diagnosis of celiac disease in this group . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a severe outbreak of respiratory disease occurred in a cattle herd in calabria region , southern italy , during december 2009february 2010 . the animals were not screened for pestiviruses before their introduction into the herd but were vaccinated regularly for bvdv . clinical signs appeared in 26 calves , 67 months old , and consisted of fever ( 39.440.1c ) , cough , accelerated pulse and breath , seromucoid nasal discharge , and leukopenia . two calves died , and necropsy indicated severe tracheitis and bronchopneumonia involving the apical lung lobes . the nasal discharge of 6 ill calves and the apical lobes of the dead calves were subjected to traditional or molecular assays to detect the main respiratory pathogens of cattle ( 6 ) . all samples tested positive by a taqman assay specific for atypical pestiviruses ( 7 ) and contained rna copy numbers ranging from 2.57 10 to 5.48 10 copies/l of template . the pestivirus strains ( italy-1/10 - 1 and italy-1/10 - 2 ) detected in the lung samples of 2 calves were successfully isolated on mdbk cells as shown by the positive results of an immunofluorescence assay by using an anti - ns3 monoclonal antibody pool ( 3a3 , 3h4 , if2 ) . other viral pathogens of cattle , as well as bacteria and parasites , were not detected in the examined samples , with the exception of the lungs of the dead calves , from which streptococcus bovis and vibrio spp . were isolated . the near full - length genome ( 12,104 nt ) of strain italy-1/101 , representative of the pestiviruses circulating in the herd , was determined through pcr amplifications and subsequent sequencing of overlapping fragments ( 8) . the nucleotide sequence ( genbank accession no . hq231763 ) obtained was analyzed by using ncbi ( www.ncbi.nlm.nih.gov ) and embl ( www.ebi.ac.uk ) tools . by sequence comparison with reference sequences , strain italy-1/101 had the same genomic organization of other members of the genus pestivirus , consisting of a unique open reading frame of 11,700 nt flanked by 2 untranslated regions ( utrs ) . by sequence analysis of the near full - length genome , strain italy-1/101 displayed the closest relatedness to atypical pestivirus th/04_khonkaen , whereas the nucleotide identities to bvdv-1 and bvdv-2 reference strains were much lower ( table ) . percentage identities were similar between the hobi - like strain from italy and bdv and csfv reference isolates . when the informative genomic regions were analyzed , strain italy-1/10 - 1 displayed the closest relatedness to strains d32/00_hobi and ch - kaho / cont that had been detected in south america . phylogeny was inferred from the full - length genome by using the neighbor - joining method of mega4.1 software ( 9 ) . the analyzed pestiviruses clustered into 6 monophyletic clades , with strain italy-1/1001 forming a unique cluster with strain th/04_khonkaen , which was clearly separated from the other pestivirus species ( figure , panel a ) . a similar cluster was observed in the trees constructed on the e2 , 5 utr and n sequences , where the hobi - like strain from europe formed a tight subcluster with south america viruses ( figure , panels b d ) . neighbor - joining unrooted trees based on the full - length genome ( a ) , e2 ( b ) , 5 untranslated region ( c ) , and n ( d ) sequences of members of the genus pestivirus . for phylogenetic tree construction , pestivirus sequences listed in the table were used . csfv , classical swine fever virus ; bvdv-1 , bovine viral diarrhea virus type 1 ; bvdv-2 , bovine viral diarrhea virus type 2 ; bdv , border disease virus . we evaluated the pathogenic potential of strain italy-1/101 in 2 seronegative 6-month - old calves ; an additional calf served as control . the 2 challenged calves showed only mild clinical signs consisting of mucoserous nasal discharge , hyperthermia , and moderate leukopenia . the successful infection was confirmed by viremia and viral shedding through the nasal and fecal routes ( data not shown ) . seroconversion was demonstrated by using the bvdv - ab svanovir elisa ( svanova biotech ab , uppsala , sweden ) and virus neutralization ( 5 ) , with mean optical density value and virus neutralizing titer of 0.398 ( cutoff 0.200 ) and 512 , respectively . traditionally , 4 different species have belonged to the genus pestivirus , but in the past few years , new putative members have been described worldwide . in 2004 , an atypical pestivirus , d32/00_hobi , distantly related to bvdv-1 and bvdv-2 was isolated from a batch of fetal calf serum collected in brazil ( 3 ) . strictly related viruses were later identified in the blood of a buffalo in brazil and in contaminated cell cultures in south america ( 4 ) . more recently , another atypical pestivirus , th/04_khonkaen , was isolated from a bovine serum sample during an epidemiologic survey in thailand ( 5 ) . based on the genetic and antigenic divergence from known bvdv-1 and bvdv-2 strains , all these viruses were proposed as members of a new species of the genus pestivirus ( 5,8,10 ) . the results of our study show that atypical pestiviruses also are circulating on the european continent . although experimental infection of seronegative calves induced only mild disease , koch s postulates were fullfilled , as demonstrated by some clinical signs , viremia , viral shedding , and seroconversion . at the genetic level , the hobi - like strain from italy was more strictly related to the viruses from brazil than to the isolate from thailand . considering that the virus has been repeatedly detected in batches of fetal calf serum ( 3,11 ) , a possible introduction of the virus to the european continent through vaccines or other products prepared with contaminated bovine serum should be taken into account . accordingly , previous reports suggest that bvdv may spread ( and cause severe disease ) through vaccination with contaminated products ( 1214 ) . by phylogenetic analysis of the full - length genome and e2 and n regions , atypical pestiviruses formed a monophyletic cluster that was approximately equidistant from bvdv-1/bvdv-2 and bdv / csfv , whereas the dendrogram obtained from 5 utr showed a closer relatedness to bvdvs . thus , phylogeny may not support naming hobi - like strains as bvdv-3 because the proposed nomenclature ( 8,10 ) does not reflect the genetic relationship among different pestivirus species . antigenic differences have been found between hobi - like strains and bvdv-1/bvdv-2 through cross - neutralization assays ( 3,5 ) . this difference also was evident in this study in that experimentally infected calves displayed high antibody titers by virus neutralization with the homologous virus , whereas only titers slightly above the cutoff were obtained by a commercial bvdv-1based elisa . the genetic and antigenic differences between hobi - like strains and bvdv-1/bvdv-2 pose intriguing questions about the efficacy of commercially available bvdv vaccines and the need to develop specific vaccines against this new virus . in addition , bvdv surveillance programs may be affected by the poor sensitivity of commonly used pcrs with respect to atypical pestiviruses because of their genetic distance from bvdvs . continuous epidemiologic surveillance will help assess the extent to which hobi - like pestivirus strains are widespread in cattle populations worldwide and their impact on animal health and production , thus requiring specific immunization plans . | in 2010 , a hobi - like pestivirus was isolated from clinically affected calves in italy .
this european virus reproduced a milder form of disease under experimental conditions and was genetically related to previously reported hobi - like strains .
isolation of this novel virus from a clinical outbreak may have implications for cattle health and prophylactic programs . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
matrix metalloproteinases ( mmps ) are zn - dependent endopeptidases that are implicated in numerous physiological processes such as reproduction , wound repair , development , and immune function as well as pathological conditions such as cancer , inflammation , neurodegenerative disorders , and autoimmune diseases [ 14 ] . the expression of many mmp family members is enhanced in endotoxemia [ 57 ] and cecal ligation and puncture ( clp ) [ 810 ] , two mouse models of sepsis , a highly mortal infectious disease , which still lacks an efficient therapeutic treatment . additionally , studies using mmp inhibitors and mmp knockout mice indicate that mmps play a detrimental role in sepsis [ 9 , 1113 ] . moreover , several human data have directly correlated higher levels of active mmp with lower rates of survival in sepsis patients and some mmps are considered as valuable biomarkers in sepsis [ 8 , 9 , 14 , 15 ] . their detrimental role in several inflammatory diseases justifies the development of specific mmp inhibitors , which have been intensely sought after for over two decades but with poor success [ 4 , 16 ] . most mmp inhibitors ( mmpi ) consist of two distinct features : a peptidomimetic backbone that interacts noncovalently with specific subsites of the catalytic domain that govern substrate interaction and a zn - chelating moiety or zinc - binding group ( zbg ) that binds to the hydrolytic zn - ion via coordinate - covalent bonds , rendering the enzyme inactive [ 16 , 17 ] . the majority of mmpi were initially synthesized containing hydroxamic acid as zbg which , although very potent , resulted in poor specificity , oral availability , or biocompatibility . to circumvent these problems , pyrone - based inhibitors emerged as superior mmpi with known biocompatibility , good aqueous solubility , and synthetic versatility [ 19 , 20 ] . based on this strategy , a specific mmp-3 pyrone - based inhibitor ( am-6 ) was developed . however , the specificity of am-6 was only characterized for mmp-1 , mmp-2 , and mmp-3 and therefore , in this study , we synthesized the same compound and screened it against a broader range of mmps to firmly ascertain mmp selectivity . surprisingly , the compound displayed specificity and potency towards mmp-12 . to accommodate these findings , we show that the inhibitor protects against inflammation - induced disruption of the blood - cerebrospinal fluid barrier both in vitro and in vivo . the target compound was synthesized according to the literature with some modifications ( scheme 1 ) . the omission of an aqueous recrystallization step leads to near - quantitative yields of the hydrolytically unstable chlorokojic acid ( 1 ) without sacrificing purity . furthermore , 4-iodobenzylamine could be replaced with 4-bromobenzylamine ( g ) , which is less costly and not sensitive towards light and air . the hcl / acetic acid protocol as written in the original publication did not provide us with the final inhibitor in good yield ( some 39% crude yield ) . reductive debenzylation ( step i ) did prove to be a very reliable method to obtain the deprotected molecule . proton nmr spectra were recorded using a bruker avance 300 ( 300 mhz ) device using tetramethylsilane as internal standard for cdcl3 and dmso - d6 . c - nmr spectra were recorded using a bruker avance 300 ( 75 mhz ) device , using the deuterated solvent as an internal standard . reagents were purchased from various companies , most notably tci , sigma - aldrich , and acros . kojic acid ( tci , 15 g , 0.105 mol ) is placed in a round bottom flask equipped with a magnetic stirring bar . the flask is cooled in an ice bath and thionyl chloride ( 60 ml ) is slowly added after which the ice bath is removed and the mixture is placed under an argon atmosphere . after stirring for 1.5 h a yellow mass is filtered off and washed extensively with petroleum ether . the product was an off - white solid ( 16.6 g , 98% ) : h - nmr ( dmso - d6 ) 4.6 ( s , 2h , cl - ch2 - 6 ) , 6.6 ( s , 1h , 5-h ) , and 8.1 ( s , 1h , 2-h- ) in agreement with the literature . chlorokojic acid 1 ( 2.5 g , 0.0156 mol , 1 eq ) is dissolved in water ( 8 ml ) and heated to 50c under an argon atmosphere in a flask equipped with a magnetic stirring bar . zinc dust ( 2.1 g , 0.031 mol , 2 eq ) is added . an aqueous solution of hcl ( 4.7 ml , 0.055 mol , 3.5 eq ) is slowly added to the reaction mixture under vigorous stirring , during which the temperature is increased to 70c . after 4 h the excess zinc dust is filtered off while being hot , and the resultant liquid is extracted with dichloromethane ( 320 ml ) . the combined organic phase is dried over magnesium sulfate and the solvent is removed by evaporation under reduced pressure . the crude material is purified via recrystallization from isopropanol to obtain an off - white solid ( 1.2 g ; 52% ) : h - nmr ( cdcl3 ) 2.3 ( s , 3h ) , 6.2 ( s , 1h ) , and 7.8 ( s , 1h ) in agreement with the literature . sodium hydroxide ( 0.696 g , 0.017 mol , 1.1 eq ) is dissolved in water ( 16 ml ) . to this solution 2 ( 2 g , 0.016 mol , 1 eq ) a magnetic stirring bar is added . a 35% aqueous formaldehyde solution ( 0.36 ml , 0.017 mol , 1.1 eq ) is added and the mixture is allowed to stir overnight . after acidification to ph 1 with 35% aqueous hydrochloric acid the mixture is cooled to 2c and allowed to stand overnight . the crystalline mass is filtered off , washed with 5 ml of water , and dried via lyophilisation . an off - white solid is obtained ( 1.71 g , 71% ) : h - nmr ( dmso - d6 ) 2.26 ( s , 3h ) , 4.38 ( s , 2h ) , 5.36 ( b , s , 1h ) , 6.21 ( s , 1h ) , and 8.86 ( b , s , 1h ) in agreement with the literature . sodium hydroxide ( 0.56 g , 8.93 mmol , 1.1 eq ) is dissolved in water ( 2.4 ml ) and added to a solution of 3 ( 2 g , 8.12 mmol , 1 eq ) in methanol ( 1.2 ml ) in a two - necked flask under argon equipped with a reflux condenser , a septum , and a magnetic stirring bar . benzyl bromide ( 1.7 ml , 8.93 mmol , 1.1 eq ) is slowly added and the mixture is allowed to stir overnight . the mixture is concentrated in vacuo and taken up in dichloromethane ( approximately 20 ml ) . is then extracted with 5% aqueous sodium hydroxide ( 220 ml ) and brine ( 120 ml ) . the organic phase is dried with anhydrous sodium sulfate after which the solvent is removed under reduced pressure . the solid is dissolved in as little dichloromethane as possible after which heptane ( or petroleum ether ) is added until no more precipitation occurs . the precipitate is filtered off and dried to yield a white to off - white powdery solid ( 2.3 g , 73% ) : h - nmr ( cdcl3 ) 2.25 ( s , 3 ) , 2.284.30 ( d , 2h , 6.8 hz ) , 5.18 ( s , 2h ) , 6.19 ( s , 1h ) , and 7.37 ( s , 5h ) in agreement with the literature . compound 4 ( 2 g , 1 eq , 8.18 mmol ) is dissolved in 37.8 ml chloroform and 10.2 ml dmso . to this mixture triethylamine ( 7 ml , 0.050 mol , 6 eq ) and pyridine ( 0.1 ml ) are added . the mixture is stirred in an ice bath under argon using a magnetic stirring bar until a temperature of 35c is reached . sulfur trioxide - pyridine complex ( 6.48 g , 0.040 mol , 5 eq ) is subsequently added and the mixture is allowed to stir overnight . it is then extracted ( 220 ml water , 120 ml brine ) and dried over anhydrous sodium sulfate . the solvent is removed under reduced pressure using a rotavapor equipped with a cold trap ( dry ice / isopropanol ) to obtain the crude product as orange oil . this is diluted with 10 ml diethyl ether and transferred onto a flash column packed with silica / diethyl ether . after eluting with diethyl ether the solvent is removed under reduced pressure using a rotavapor equipped with a cold trap . a white to yellow crystalline solid is obtained ( 1.38 g , 69% ) : h - nmr ( cdcl3 ) 2.32 ( s , 3h ) , 5.49 ( s , 2h ) , 6.31 ( s , 1h ) , 7.35 ( s , 5h ) , and 9.85 ( s , 1h ) in agreement with the literature ; ft - ir 1690.33 cm ( c = o aldehyde ) , 1641.24 cm ( c = o pyrone ) , 1613.12 cm , and 1583.88 cm ( c = c pyrone ) . ( 6 ) preparation of compound
6
( 3-(benzyloxy)-6-methyl-4-oxo-4h - pyran-2-carboxylic acid ) . compound 5 ( 1.57 g , 6.4 mmol , 1 eq ) is dissolved in acetone / water ( 20 ml/20 ml ) with a magnetic stirring bar . sulfamic acid ( 0.86 g , 8.9 mmol , 1.4 eq ) and sodium chlorite ( 80% , 0.76 g , 6.7 mmol , 1.05 eq ) are added and the mixture is allowed to stir for 1 h in an open vessel . the mixture is subsequently evaporated under reduced pressure to remove the acetone after which the crude product is filtered off and washed with a small amount of ethanol . the product is then dried in vacuo to obtain a stark white powder ( 1.3 g , 78% ) : h - nmr ( dmso - d6 ) 2.29 ( s , 3h ) , 5.10 ( s , 2h ) , 6.40 ( s , 1h ) , and 7.327.45 ( m , 5h ) in agreement with the literature ; ft - ir 1720.37 cm ( c = o acid ) , 1625.50 cm ( c = o pyrone ) , 1554.48 cm and 1496.36 cm ( c = c pyrone ) , and mp ( precipitated from water / acetone ) 180c . compound 6 ( 0.1 g , 0.38 mmol , 1 eq ) is dissolved in dry tetrahydrofuran ( 4.16 ml ) in a flame - dried round bottom flask equipped with a magnetic stirring bar under an argon atmosphere . n - hydroxysuccinimide ( 0.045 g , 0.39 mmol , 1.02 eq ) is added and the mixture stirred for 30 min . dicyclohexylcarbodiimide ( 0.079 g , 0.38 mmol , 1 eq ) is added as a solid and the mixture is stirred for an additional 3 h at rt under an argon atmosphere . dicyclohexylurea is filtered off and the precipitate is washed with tetrahydrofuran ( 2 ml ) . 4-bromobenzylamine ( 0.05 ml , 0.385 mmol , 1.01 eq ) is added to the filtrate in a dried round bottom flask equipped with a magnetic stirring bar and a reflux condenser under an argon atmosphere . this solution is transferred to a chromatography column ( silica , eluent chloroform / methanol 1% ) . after chromatography , the product is obtained as an off - white solid ( 0.15 g , 91% ) : h - nmr ( cdcl3 ) 2.37 ( s , 3h ) , 4.34.38 ( d , 2h , j = 5.6 ) , 5.33 ( s , 2h ) , 6.28 ( s , 1h ) , 6.97.5 ( m , 9h ) , and 8.06 ( b , s , 1h ) ; ft - ir 3363.82 cm ( (nh ) ) , 1677.31 cm ( (c = o ) pyrone ) , 1643.58 cm ( amide i band ) , 1621.41 cm ( (c = c ) pyrone ) , 1584.93 cm ( (c = c ) pyrone ) , 1536.21 cm ( amide ii band ) , and mp ( recrystallized from methanol ) 118c .
( 8) preparation of compound
8
( n-([1,1:4,1-terphenyl]-4-ylmethyl)-3-(benzyloxy)-6-methyl-4-oxo-4h - pyran-2-carboxamide ) . compound 7 ( 90 mg , 0.21 mmol , 1 eq ) is dissolved in toluene in a round bottom flask equipped with a reflux condenser , magnetic stirring bar , and an argon atmosphere . to this mixture are added aqueous potassium carbonate ( 2 m solution , 10 ml ) , triphenylphosphine ( 5.5 mg , 0.021 mmol , 0.1 eq ) , [ 1,1-biphenyl]-4-ylboronic acid ( 41.5 mg , 0.21 mmol , 1 eq ) , and palladium acetate ( 4.6 mg , 0.02 mmol , 0.1 eq ) after which the mixture is heated to 135c with vigorous stirring . the mixture is allowed to stir for 24 h before being extracted with toluene ( 320 ml ) and dried over sodium sulfate and the solvent is removed under reduced pressure . the crude product is purified via column chromatography ( silica , chloroform/1 - 2% methanol ) : h - nmr ( cdcl3 ) 2.37 ( s , 3h ) , 4.444.5 ( d , 2h , j = 5.7 hz ) , 5.34 ( s , 2h ) , 6.29 ( s , 1h ) , 7.107.75 ( m , 18h ) , and 8.12 ( b , 1h ) . compound 8 ( 186.5 mg ) is dissolved in dichloromethane / methanol ( 70/30 , 35 ml ) in a thick - walled glass vessel . after flushing with argon , the vessel is placed in a shaker - type hydrogenation apparatus and placed under 40 psi hydrogen gas for 20 h after flushing with hydrogen gas to remove traces of oxygen . the catalyst is filtered off and the filtrate washed with 10 ml dichloromethane / methanol ( 50/50 ) . the combined organic phase is evaporated in vacuo to yield an orange solid ( 138.5 mg , 90% ) : h - nmr ( cdcl3 ) 2.24 ( s , 3h ) , 4.6 ( s , 2h ) , 6.16 ( s , 1h ) , and 77.8 ( m , 13h ) ; ft - ir 2339.5 cm ( oh ) , 1633.1 cm ( amide i ) , 1591.8 cm ( c = o pyrone ) , 1537.5 cm ( amide ii ) , 1483.9 cm ( c = c pyrone ) , and mp ( recrystallized from toluene ) 253270c . the specificity of the synthesized inhibitor was determined in vitro against a panel of ten human recombinant mmp catalytic domains using a fluorescent assay kit ( bml - ak016 , enzo life sciences ) . briefly , the compound was dissolved in dimethyl sulfoxide ( dmso ) and further diluted in assay buffer ( 50 mm hepes , 10 mm cacl2 , 0.05% brij-35 , and ph 7.5 ) . ten mmps ( mmp-1 , mmp-2 , mmp-3 , mmp-7 , mmp-8 , mmp-9 , mmp-10 , mmp-12 , mmp-13 , and mmp-14 ) were individually incubated with varying concentrations of inhibitor for one hour at 37c , followed by addition of a quenched fluorogenic substrate ( omnimmp fluorogenic substrate mca - pro - leu - gly - leu - dpa - ala - arg - nh2 [ mca is ( 7-methoxycoumarin-4-yl)-acetyl ; dpa is n-3-(2,4-dinitrophenyl)-l---diaminopropionyl ] , 4 m in assay ) . the assays were performed in black , clear bottom , nbs greiner 96-well plates ( 655906 , greiner bio - one ) and fluorescence ( ex = 325 nm , em = 405 nm ) was measured at 60 sec intervals for 30 min with a flexstation ii microplate reader running softmax pro 5.3 ( molecular devices ) . after each fluorescent measurement the well plates were shaken for 2 sec to agitate the reagents . in each experiment we included a blank , a substrate control ( substrate only in assay buffer ) , a positive control ( nngh , 1.3 m final concentration ) , and negative control ( only substrate and inhibitor in assay buffer ) . the latter was implemented to exclude possible interference of the inhibitor with the substrate . to confirm the potency against mmp-3 and mmp-12 , separate assays were performed using human recombinant mmp-3 ( 72006 , anaspec ) and mmp-12 catalytic domains ( 55525 - 1 , anaspec ) and quenched fluorescent substrate qxl 520-pro - leu - ala - tyr - trp - ala - arg - lys(5- fam)-nh2 ( ex = 485 nm , em = 538 nm , 60577 - 01 , anaspec ) . the ic50 values were determined in a single experimental run in duplicate . data analysis and curve fitting for determination of ic50 values were performed in graphpad prism 6 . female c57bl/6j ( 810 weeks old ) mice were purchased from janvier labs ( france ) and mmp-12 knockout mice ( mmp-12 ) ( in c57bl/6j background together with littermate mmp-12 controls ) were obtained from dr . c57bl/6 and mmp-12 mice were housed with 46 mice / cage with ad libitum access to food and water and with a 14-hour light/10-hour dark cycle in a specific pathogen - free animal facility and conventional facility , respectively . all experiments were approved by the ethics committee of the faculty of sciences of ghent university . injection of lipopolysaccharide ( lps ) from salmonella enterica serotype abortus equi ( sigma ) dissolved in pbs . the dose was 200 g/20 g body weight ( the ld100 dose for c57bl/6 mice ) . 100 g mmp-12i ( 1 g/l ) or vehicle control was administered intraperitoneally at different time points : 15 min before and 3 and 6 hours after lps administration . for isolation of total rna from in vivo choroid plexus samples , mice were anesthetized with ketamine / xylazine and perfused with pbs supplemented with bromophenol blue . brains were dissected from the skull and choroid plexus from the third and fourth ventricles were dissected under a dissection microscope . total rna was isolated at different time points after lps injection with the rneasy kit ( qiagen ) . rna concentration and purity were determined spectrophotometrically using the nanodrop nd-1000 ( nanodrop technologies ) . cdna was made by using iscript cdna synthesis kit ( bio - rad ) with 500 ng starting material and qpcr was done using the sensifast sybr no - rox kit ( bioline ) on the light cycler 480 system ( roche ) . expression levels of mmp-12 were normalized to the expression of the two most stable housekeeping genes , ubc and gapdh , which were determined using the genorm housekeeping gene ( hkg ) selection software . one hour before csf isolation , mice were injected i.v . with 75 mg / kg body weight of fitc - labeled dextran ( 4 kda , sigma ) . csf was obtained using the cisterna magna puncture method as described previously . in brief , borosilicate glass capillary tubes ( b100 - 75 - 15 , sutter instruments ) were used to pull needles on the sutter p-87 flaming micropipette puller ( pressure 330 pa , heat index 300 ) . before sampling csf , mice were sedated with ketamine / xylazine . the incision site was sterilized with 70% ethanol , and cisterna magna was exposed by cutting skin and muscle tissue on the posterior side of the skull . the head of the mouse was placed at an angle of 135 degrees and csf was collected by inserting the trimmed needle into the fourth ventricle by piercing the cisterna magna . a csf sample of 2 l was diluted 25-fold in sterile pbs and leakage into this brain compartment was determined by measurement of fluorescence with ex/em = 488/520 nm . culturing primary mouse choroid plexus epithelial cells was done as described . in brief , 29-day - old pups were decapitated and brains were isolated . the cells were dissociated enzymatically by incubating them for 57 min with pronase ( isolated from streptomyces griseus , sigma ) . digestion was stopped by adding an excess of hbss buffer and the cells were washed twice with hbss . the cell pellet was resuspended in dmem - f12 culture medium and plated on laminin - coated plates . two days later , they were shifted to dmem - f12 containing cytosine arabinoside ( ara - c ) to eliminate growth of fibroblasts . purity of the cultures was confirmed by checking the levels of transthyretin ( ttr ) both by qpcr and by immunostaining . primary cpe cells retained the epithelial and the barrier properties which were confirmed by staining for e - cadherin , zo-1 , and occludin . the electric cell - substrate impedance ( ecis ) technique ( applied biophysics ) was used to monitor barrier properties as described before . 250.000 cells per well were seeded onto laminin - coated 8w10e array plates ( applied biophysics ) and the array holder was placed in a standard cell culture incubator ( 37c , 100% humidity , and 5% co2 ) . after ~16 hours , a stable impedance at low and high frequency was obtained and cells were incubated with vehicle or 1 m mmp-12i , followed 1 hour later by vehicle or lps ( 1000 ng / ml ) . compound 9 ( figure 1(a ) ) was assessed for its inhibitory properties towards an array of ten different mmps using a fluorescent in vitro assay . for all tested mmps , the compound is poorly potent against mmp-1 , mmp-3 , mmp-7 , mmp-9 , mmp-10 , and mmp-13 , reflecting ic50 values higher than 50 m ( figure 1(b ) ) . the compound displays slightly better inhibitory activity towards mmp-2 , mmp-8 , and mmp-14 as the apparent ic50 values are situated between 2 m and 50 m . the initial screen revealed an apparent ic50 value for mmp-12 below 2 m and when performing a detailed dose - response experiment using a more specific substrate for mmp-12 ( substrate xiii , anaspec ) a nonlinear regression analysis indicated that at higher inhibitor concentrations an inhibitory plateau ( 72 1.75% ) is reached with a relative ic50 of 177 nm ( figure 1(c ) ) . although the use of a different substrate can potentially influence the kinetic readout , a comparison between the fluorescent in vitro assay kit and the use of substrate xiii resulted in similar inhibitor potencies ( data not shown ) , which justifies the use of the more specific substrate for mmp-12 . taken together , these data indicate that the synthesized compound is a potent and fairly specific inhibitor of mmp-12 and therefore from section 3.2 onwards it will be referred to as mmp-12i . the discrepancy between puerta et al . and this study regarding the inhibitory selectivity towards mmp-12 over mmp-3 could in part be explained by the strong ph - dependence of inhibitor potency for human mmp-3 . both mmp-3 and mmp-12 have a deep pocket s1 subsite in which the terphenyl can reside . however , mmp-3 is uniquely characterized by a sharp optimum at ph 6 for efficient catalysis and inhibition and this is drastically reduced at neutral ph by structural changes in the s1 pocket and ionization of inhibitor residues . in contrast to the study of puerta and colleagues , the compound was tested in physiologically relevant ph 7.5 to accommodate a large array of mmps . importantly , the ph - dependence of inhibitor - mmp-3 interactions typically gives rise to a change in ic50 values not larger than one order of magnitude as opposed to the three orders of magnitude we established here , so other factors might be at play . because of this and the observed potency towards mmp-12 we further validated the biological relevance of the compound in the context of mmp-12 . endotoxemia , that is , systemic administration of lipopolysaccharide ( lps ) , induces systemic inflammation and eventually lethality in mice . we have previously shown that mice can be protected from lps - induced lethality by administration of a broad spectrum mmp inhibitor bb-94 and several mmps appeared to play a role in the lps - induced lethality [ 8 , 1113 ] . here , we studied the effect of mmp-12 deficiency on the lps sensitivity by using mmp-12 mice . as shown in figure 2(a ) , mmp-12 mice display a partial protection to an ld100 dose of lps , indicating that mmp-12 plays a detrimental role in the lps - induced lethality . to verify this , we treated wild type mice with the mmp-12i and challenged them with lps ( figure 2(b ) ) . mmp-12i treatment resulted in a significant reduction in lps - induced lethality compared with vehicle treated mice , which again demonstrates that the compound most likely targets mmp-12 . systemic inflammation is known to be associated with loss of blood - brain barrier integrity and this has been correlated with lethality . next to the most studied endothelial blood - brain barrier ( bbb ) , we have previously shown that the blood - cerebrospinal fluid barrier ( bcsfb ) which is formed by the choroid plexus epithelium ( cpe ) is also affected in response to systemic lps administration . mrna expression analysis of choroid plexus tissue revealed 500-fold upregulation of mmp-12 upon systemic lps administration ( figure 2(c ) ) , associated with an increase in bcsfb permeability ( figure 2(d ) ) . interestingly , the loss of bcsfb permeability was significantly reduced when endotoxic mice were treated with our mmp-12i ( figure 2(d ) ) . therefore , primary cpe cells were isolated and plated onto electrical cell impedance sensing ( ecis ) arrays containing gold electrodes . ecis is a real - time , label - free , impedance - based method used to study the barrier properties of cells grown in culture . after reaching confluency , cells were incubated with lps or lps supplemented with mmp-12i and compared to untreated cells . lps resulted in a drop in normalized resistance compared to control and this was significantly reduced in the presence of mmp-12i ( figure 2(e ) ) . these data clearly show that mmp-12 plays a role in the observed lps - induced loss of bcsfb integrity . in summary , we report the synthesis and biological evaluation of a hydroxypyrone - based mmpi with excellent potency and specificity towards mmp-12 . both in vivo and in vitro studies on the effects of the target compound on endotoxemia and bcsfb integrity clearly indicate a role for mmp-12 in these inflammatory processes and establish the use of this compound in a biological context . | a hydroxypyrone - based matrix metalloproteinase ( mmp ) inhibitor was synthesized and assayed for its inhibitory capacity towards a panel of ten different mmps .
the compound exhibited selective inhibition towards mmp-12 .
the effects of inhibition of mmp-12 on endotoxemia and inflammation - induced blood - cerebrospinal fluid barrier ( bcsfb ) disruption were assessed both in vitro and in vivo .
similar to mmp-12 deficient mice , inhibitor - treated mice displayed significantly lower lipopolysaccharide- ( lps- ) induced lethality compared to vehicle treated controls .
following lps injection mmp-12 mrna expression was massively upregulated in choroid plexus tissue and a concomitant increase in bcsfb permeability was observed , which was restricted in inhibitor - treated mice .
moreover , an lps - induced decrease in tight junction permeability of primary choroid plexus epithelial cells was attenuated by inhibitor application in vitro . taken together ,
this hydroxypyrone - based inhibitor is selective towards mmp-12 and displays anti - inflammatory activity in vitro and in vivo . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
brucellosis remains one of the world s most significant zoonotic diseases still widely distributed globally in both animals and humans , with effective control and/or eradication achieved in only some of the most developed countries ( 1 ) . while over 500,000 new human cases a year are reported globally ( 2 ) , the nonspecific clinical picture of brucellosis , as well as low disease awareness and poor diagnostic capabilities in many parts of the world , means that this figure is likely a gross underestimate . ten species of brucella are now recognized as members of a largely genetically highly conserved group ( 3 ) , but the most economically significant are brucella abortus ( responsible for bovine brucellosis ) , brucella melitensis ( brucellosis of small ruminants ) , and brucella suis ( swine brucellosis ) . all of these three species are also highly pathogenic for humans , with b. melitensis thought to be responsible for the largest human disease burden . human infection usually occurs as a result of occupational exposure ( abattoir workers , farmers , hunters , and veterinarians ) or as a result of consumption of unpasteurized dairy products , reflecting excretion of the organism in the milk of domesticated animals . brucellosis in animals is associated with abortion , retained placenta , orchitis , or epididymitis , and abortion causes a massive release of the organism into the environment . in humans , initial symptoms are nonspecific and can include an undulant fever , tiredness , night sweats , appetite and weight loss , and headaches , all of which , without treatment , can become severe and debilitating . left untreated , the infection can become chronic in such cases osteoarticular manifestations , such as arthritis , sacroiliitis , or spondylitis , are frequent forms of localized disease . osteomyelitis caused by brucellosis most frequently affects the lumbar and lower thoracic vertebrae , and an important differential diagnosis in cases of osteomyelitis or septic arthritis is tuberculosis ( 4 ) . being an insidious and often nonspecific disease that debilitates , rather than kills , there are no dramatic epidemics in historical records , unlike for diseases such as plague . writers have tried to link outbreaks of disease reported in ancient literature and historical records , such as in ancient greece ( 5th century bc ) , with brucellosis based on the descriptions ( 5 ) , and it has been suggested that brucellosis was endemic in roman society ( 6 ) . more - direct evidence has come from a number of paleoanthropological studies that have identified vertebral lesions consistent with brucellosis from early bronze age samples in the middle east , from skeletons of adults fleeing the eruption of vesuvius in ad 79 , and from later european samples ( 6 ) . further , it has recently been hypothesized that the macroscopic , microscopic , and radiological appearance of lytic lesions in lumbar vertebrae of an australopith ( australopithecus africanus stw 431 ) from the late pliocene site of sterkfontein in south africa is consistent with skeletal pathognomonic characteristics of brucellosis ( 7 ) . this observation raises the possibility of the presence of brucellosis in hominids 2.3 to 2.5 million years ago . the above - described studies all rely on potentially challenging differentiations of lesions characteristic of brucellosis from those of other infectious diseases , such as tuberculosis or staphylococcal spondylitis , which can cause superficially similar , though less discriminate , lesions . the earliest laboratory - confirmed cases , thought to date from between the 10th and 13th centuries , have been described from the ancient albanian city of butrint ( 8) . here , lesions on thoracic and lumbar vertebrae of skeletal remains of two adolescent males were identified . while pathologies suggested brucellosis or tuberculosis , genetic screening of skeletal samples for tuberculosis was repeatedly negative . however , two brucella - specific dna markers , is711 and bscp31 , could be amplified by pcr from the affected vertebrae but not from unaffected individuals or control samples . subsequent sequencing confirmed the presence of is711 and provides strong direct evidence that brucellosis has been endemic in this area , which still reports some of the highest incidences in europe today , since at least the middle ages . the study described above is typical of those undertaking molecular examination of ancient - pathogen dna until recently ( 9 ) . since the emergence of the use of genetics in paleomicrobiology some 20 years ago , studies have relied largely on pcr amplification of small fragments of dna from historical material . while much has been gleaned from such studies , they are limited in many respects , particularly by concerns about cross - contamination with modern material , either in the laboratory or environmentally , and by the limitation that the small fragments of dna obtained restrict the ability to place ancient dna in context with modern bacterial strains of the same group . however , paleomicrobiology , at least for some microorganisms , now promises to be revolutionized by the emerging field of ancient - pathogen genomics driven by the astronomical pace of advancement in next - generation sequencing technologies . the field has been driven largely by application to three organisms , yersinia pestis , mycobacterium leprae , and mycobacterium tuberculosis , for which pertinent samples are more easily identifiable through historical records or pathological markers ; in addition , the biological properties of these organisms mean that genetic material may be better preserved . given the historical impact of the black death , caused by y. pestis , application of paleomicrobiology to provide concrete evidence of the causative agent and to understand the evolution of the organism has been of substantial interest . in 2011 , the genome of y. pestis was reconstructed at 30-fold coverage from the teeth of black death victims from a london graveyard dated to the mid-14th century ( 10 ) . phylogenetic analysis at the time showed the strain to be close to the ancestral node of all strains that cause human disease , suggesting that contemporary y. pestis epidemics originated in the medieval period . compared against modern genomes , no unique derived positions were detected in the medieval genomes , indicating that the perceived increase in virulence associated with the black death may not reflect bacterial genotype but other factors , such as environmental or social changes , the impact of concurrent infectious disease , vector dynamics , or changes in host susceptibility . however , an alternative explanation that can not be excluded is that the virulence of the organisms may be affected by areas of the genome other than those currently recognized ( 9 ) . this reflects the fact that this study , as well as a further recent study confirming that the y. pestis associated with the plague of justinian in ad 541 to 543 is an independent emergence into humans from rodents that may now be extinct ( 11 ) , utilizes capture techniques in which modern sequences are used to drive hybridization and enrich for dna of interest . thus , inherent weaknesses of these approaches are that one finds only what one is looking for and that they may fail to detect sequences present in ancient strains but absent in contemporary ones . shotgun metagenomics addresses the above issue by allowing an unbiased sequencing en masse of dna extracted from a sample without target - specific amplification or capture . in 2013 , what was believed to be the first full de novo assembly of a genome via shotgun sequencing alone representing an ancient pathogen from skeletal material held at ambient temperature was reported ( 12 ) . from one sample , the tooth of a woman who died in a leper colony in denmark in the 1300s , the finding that an astonishing 40% of sequence reads mapped to m. leprae allowed the de novo assembly of an m. leprae genome with 100-fold coverage and with 169 contigs separated by gaps corresponding to repetitive regions . this genome , along with four others obtained following enrichment by traditional capture approaches , was compared with modern m. leprae strains , revealing remarkable conservation over a millennium . these data suggested that the decline in leprosy in 16th - century europe likely did not reflect a loss of virulence of the pathogen ; they also suggested a european origin for leprosy in the americas and showed that strains currently circulating in the middle east likely originated in medieval europe . the authors concluded that the study implied the real prospect that the prehistoric origins of m. leprae might be traced by de novo genome assembly . at around the same time , a shotgun metagenomics study applied to mummified lung tissue from an individual who died in hungary in 1797 allowed genomic reconstruction of another mycobacterium species , mycobacterium tuberculosis , and suggested infection with two genotypes ( 13 ) . turning back to brucellosis , kay et al . ( 14 ) applied shotgun metagenomics to calcified nodules from the skeleton of a 14th - century male excavated from the medieval sardinian settlement of geridu . although the authors had initially once again suspected tuberculosis , they instead were able to recover a b. melitensis genome . while coverage ( 6.5-fold ) was somewhat low , the use of single nucleotide polymorphism ( snp ) data in comparison with draft genomes emerging from an ongoing international brucella whole - genome sequencing project sampling the global diversity of the genus ( https://olive.broadinstitute.org/projects/brucella_ii , last accessed 18 july 2014 ) allowed phylogenetic placement of the genome . the genome was placed within a clade that includes the well - studied b. melitensis biovar 3 reference strain ether , originally isolated from an italian goat in 1961 , two other more contemporary italian isolates , and two additional isolates , one from egypt and one of unknown origin . this placement was also confirmed by further analysis of deletions and is711 insertions , which were found to be confined to geridu and the five other strains in the clade in a comparison with all other b. melitensis genomes available . in support of the work truly reflecting recovery of an ancient brucella genome , sequence reads showed signatures typical of ancient dna , and it was confirmed that work was performed in a laboratory with no history of work with brucella cultures or dna . it has been suggested that the initial success of shotgun metagenomic approaches applied to mycobacterium might reflect the unique properties of the cell walls of these organisms in the form of a robust hydrophobic layer of mycolic acids that may protect mycobacterial dna from damage ( 15 ) . a particularly important aspect of this study is therefore the evidence that , under the right conditions , whole - genome sequences can be derived from organisms with more fragile cell envelopes at least hundreds of years postmortem . although these approaches are not without controversy ( 16 ) , shotgun metagenomics applied to ancient material represents a powerful new tool with the potential to shed light on the emergence , evolution , and spread of microbial pathogens , both contemporaneously and stretching back into history and perhaps even prehistory . the technique has the potential to add new perspectives to our understanding of historical events where the causative agent may be unclear ; in addition , it will be invaluable for understanding relationships between pathogens today and those in the past , providing clues to the causes of increases or decreases in virulence over time and possibly enabling calibration of the rate of evolutionary change . specifically with regard to brucella , if even older genomes could be recovered in the future from human and animal remains , these might add to our understanding of how brucella evolved into the ecotypes seen today and shed light on the historical and prehistoric associations between animal and human brucellosis . | abstractthe potentially debilitating zoonotic disease brucellosis is thought to have been a scourge of mankind throughout history
. new work by kay et al .
[ mbio 5(4):e01337 - 14 , 2014 ] adds to evidence for this by exploiting the huge advances in next - generation sequencing technology and applying shotgun metagenomics to a calcified nodule obtained from a 14th - century skeleton from sardinia . while not the first dna - based confirmation of brucella in medieval dna samples , kay et al.s study goes much further than previous reports based on single gene fragments in that it allows a full - genome reconstruction and thus facilitates meaningful comparative analysis of relationships with extant brucella strains .
these analyses confirm the close relationship of the genome to contemporary isolates from the western mediterranean , illustrating the continuity of this lineage in the region over centuries .
the study , along with recent studies characterizing other ancient - pathogen genomes , confirms that shotgun metagenomics offers us a powerful tool to fully characterize pathogens from ancient samples .
such studies promise to revolutionize our understanding of the nature of infectious disease in these materials and of the wider picture of the emergence , evolution , and spread of bacterial pathogens over history . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
anogenital warts are an infectious , proliferating disorder of the anogenital lesion caused by one or more human papilloma viruses ( hpvs ) . in the united states , anogenital warts are treated with patient - applied chemical treatment of imiquimod and podofilox , physician - applied chemical treatment of podophyllin resin and trichloroacetic acid , and ablative treatment of cryotherapy with liquid nitrogen and laser therapy . recently , treatment with topical vitamin d3 derivatives has been reported to be effective for hpv - infected verruca . here , we report an infant case with an anogenital wart on the anus , which was successfully treated with calcipotriene ointment , a vitamin d3 derivative . a 1-year- and 1-month - old male presented with an anogenital wart on the anus without suspicious episodes of infection ( fig . the wart did not invade into the rectum and colon . after obtaining informed consent from the parents , we treated the wart with a topical vitamin d3 derivative of calcipotriene ointment with simple application to the affected lesion twice a day . 2 ) . the anogenital wart did not recur for 6 months after complete regression . anogenital warts in children have been reported to be associated with both mucosotropic ( hpv6 and 11 ) and cutaneotropic types ( hpv2 ) of the virus . recent investigation of hpv typing in nonabused preschool children showed that 3 ( 1.8% ) of 211 children had clinically detectable anogenital warts and that 7 samples from 5 children were hpv - positive ( hpv6 and/or 16 ) , detected by polymerase chain reaction . as our patient had anogenital wart only on the mucocutaneous lesion , we surmise that our case was a nonabuse case of anogenital wart caused by mucosotropic hpv . verruca is usually treated with freezing with liquid nitrogen , laser therapy or application of imiquimod . we medicated the patient with a therapy for the anogenital wart with a topical vitamin d3 derivative . our case was successfully treated with simple application of calcipotriene ointment to the lesion . using diapers for the infant patient may bring the occlusive condition . previously , the effect of vitamin d3 derivatives on verruca was speculated to be derived from its potential to regulate epidermal cell proliferation and differentiation and to modulate cytokine production [ 2 , 3 ] . an important observation was reported which suggested that toll - like receptor ( tlr ) activation of human macrophages upregulated expression of vitamin d receptor and vitamin d-1-hydroxylase genes , leading to induction of the antimicrobial peptide . treatment with imiquimod for anogenital warts in an infant was shown to be highly effective . imiquimod induces the secretion of proinflammatory cytokines and the reaction of antitumor and antiviral cellular innate immunity through tlr 7- and 8-signaling cascade . we surmised that imiquimod and vitamin d3 derivatives , to some extent , share the same antiviral efficacy . previously , egawa reported the effectiveness of a topical vitamin d3 derivative for condylomata acuminata on the corona and glans in a 74-year - old man with simple application twice a day for 4 months . the infected duration of anogenital warts in adults varies from a few weeks to many years . it took 4 months for the treatment of the anogenital wart in our infant patient . we reported an infant having anogenital wart successfully treated with a vitamin d3 derivative without developing pain , scar or dysfunction . we propose that topical application of a vitamin d3 derivative may be an alternative therapy for anogenital warts in infants . | anogenital warts are an infectious disorder of the anogenital lesion caused by one or more human papilloma viruses .
verruca is commonly treated with freezing with liquid nitrogen , laser therapy or application of imiquimod .
such ablative treatment may cause pain and scars on the anogenital lesion .
we herein report an infant case of anogenital wart which was successfully treated with a topical vitamin d3 derivative .
topical application of a vitamin d3 derivative may be an alternative therapy for anogenital warts in infants . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
improved characterisation of a number of possible environmental risk factors would advance accurate identification of not only those at risk of ddh , but also differentiation between infants with hip instability that is like to resolve and those in which it may persist . the establishment of a large clinical inception cohort study would provide a valuable data set , from which hypothesis generation for further focussed studies may subsequently be developed . developmental dysplasia of the hip ( ddh ) is common and remains a leading cause of hip osteoarthritis in young adults . predating ortolani s well - recognised work in the 1900s , the first published report of clinical hip instability is believed to have been in 1879 . that ddh continues to be regarded as the term ddh encompasses a spectrum of anatomical abnormalities of the hip , which may be either congenital or develop during infancy and/or childhood . these include being first born , female gender , high birth weight , oligohydramnios , talipes ( calcaneo valgus or equino varus ) , a family history and breech presentation . of these , only the latter two are recommended in national screening programme guidelines to identify at - risk babies for secondary screening . neonatal clinical screening programmes for ddh have been in practice since the 1950s , accompanied by considerable debate as to their effectiveness and impact on functional outcome . the importance of early diagnosis , however , is universally acknowledged : the earlier the detection , the simpler and more effective the treatment . an increasing burden on secondary ultrasound screening services at a rate of 5 % year on year furthermore , the significance of these risk factors in differentiating cases of resolution versus those that persist remains unknown . review of the current understanding of the aetiology and pathophysiology of ddh reveals evidence for both genetic and environmental contributions to ddh . hypothesised environmental risk factors may be broadly categorised as epidemiological , nutritional , hormonal and connective tissue composition ( table 1).table 1summary of categorised possible ddh risk factors requiring further elucidationmaternalinfant1 . nutritionalweight , height ( bmi)birthweightuse of dietary supplementsgrowth ( height , weight)alcohol historybreast / bottle milksmoking historyage of weaning serumvitamin cvitamin cvitamin dvitamin dcalciumcalcium3 . . connective tissuebeighton score / similar joint laxity assessmentumbilical cord collagen ( content , ratio)pelvic joint syndrome summary of categorised possible ddh risk factors requiring further elucidation there is recognised variation in the incidence rate of ddh worldwide ranging from 0.1 to > 10 % . highest incidence populations can be found in finland , croatia and canada ( 5195 per 1,000 ) , with very low incidences amongst populations in sub - saharan africa and hong kong ( 00.1 per 1,000 ) . geographical and cultural factors regarding climate differences and the practice of swaddling respectively may in part explain this variation [ 8 , 9 ] . although the trend has been most commonly observed with an inclination towards the winter months , the converse is reported in finland with a peak in the months of june and july . . recommended , more robust analytical approaches such as time - series analyses are required . progress is underway : the first study to mathematically model the birth month of children with ddh was published earlier this year , demonstrating seasonal variation across all groups ( both hemispheres ) , with peak incidences most frequently observed in mid - march and mid - october . as acknowledged by the study s authors , to make sense of these patterns of seasonal variation , we must understand their role in the context of a wider complex interplay of extrinsic physical , intrinsic physical , metabolic and genetic factors . nutrition plays a major role in the development of canine ddh . in genetically predisposed dogs , a number of dietary excesses are believed to increase the frequency and severity of hip dysplasia . this is believed to increase the frequency and severity of ddh in genetically susceptible dogs , most markedly if in the first 6 months of life . the two main aetiological categories in canine hip dysplasia ( cdh ) have been proposed as abnormal progression of endochondral ossification and hip joint laxity causing instability . relating these principles to diet , young dogs lack a protective mechanism against excess dietary calcium . excess vitamin d , by increasing intestinal absorption and renal resorption of calcium , is believed to be similarly harmful in dogs genetically predisposed to ddh . regarding the interaction between diet and hip joint laxity , the importance of vitamin c for healthy collagen synthesis is well understood and was previously believed to be protective against canine ddh . the administration of high dose dietary vitamin c in the controlled clinical setting has however failed to support this theory . in addition , some studies show that excess vitamin c causes hypercalcaemia and delayed bone remodelling as described above . unlike young dogs , neonates exhibit protective parathyroid , renal and skeletal regulatory mechanisms to control calcium and vitamin d levels . to the best of our knowledge , no data have been published regarding maternal and neonatal levels of calcium , or vitamins d or c , and risk of ddh . relaxin is a 6-kda polypeptide pregnancy hormone that increases the secretion of collagenase and plasminogen activator two important enzymes for collagenolysis . the first describes its direct effect on foetal ligament laxity by influencing connective tissue metabolism alongside oestrogens and progesterone . higher and more prolonged levels of relaxin have been reported in canine serum of animals with hip dysplasia and in the cord blood serum of babies with hip dysplasia compared to those without hip pathology ( 28.7 vs. 19.8 pg / ml ) . this however did not reach statistical significance ( p = 0.086 ) in a cohort size of 24 babies , and subsequent investigation has failed to show an association between umbilical vein blood relaxin levels and neonatal hip instability . a contradicting hypothesis exists to explain a higher incidence of ddh with lower relaxin concentrations . one of the main assumed functions of relaxin is relaxation of the mother s pelvic ligaments to prepare the birth canal for parturition . a study has shown lower relaxin concentrations in the cord blood of newborns with clinical symptoms of hip instability compared to newborns with inconspicuous hip findings . hence , an association between lower relaxin levels and poorer preparation of the pelvis has been suggested to cause higher pressures to be exerted on the foetus perinatally . this indirect influence of relaxin fits with a longstanding theory that intrauterine pressure or that developed during delivery may contribute to hip instability [ 25 , 26 ] . the direct effects of oestrogen and progesterone on the collagen and elastin content of the joint capsule have been investigated in animal models . these show an increased rate of hip dislocation with administration of progesterone versus a protective effect with administration of oestrogen . urine analysis has thus far shown no significant differences in oestrogen output between newborns with ddh and matched controls . however a positive correlation between serum progresterone and serum relaxin concentration has been reported , with attenuation of serum relaxin concentration associated with use of hormonal contraception . the ubiquity of relaxin and a lack of clear definition for its many actions make for an obvious focus of further studies . a greater understanding of relaxin receptor expression of the developing foetal hip and hence the possibility of varying susceptibilities to this hormone is required . connective tissue disorders include a spectrum of cartilage , collagen , fibrillin and matrix protein abnormalities . in 1978 , ponseti described his theory of acetabular cartilage dysplasia following histological analysis of six infants with ddh . the pathological changes documented include a loss of proteoglycans and an increase in collagen deposition in the lateral acetabular roof , manifesting as a ridge of degenerating acetabular cartilage detected clinically as a positive ortolani sign . systemically , recognition of associated joint hypermobility and of inguinal hernias in children with ddh has directed the focus of a number of studies to identify differences in collagen content , distribution and metabolism of the joint capsule and ligaments [ 3134 ] . the specific appearance of hernias abnormally early in life favours the hypothesised role of relaxin exerting its effects on collagenase in these infants . prolidase is a cytosolic exopeptidase that plays a crucial role in collagen degradation and in the recycling of proline . increased serum prolidase activity in patients with ddh suggests increased collagen turnover , with a positive correlation reported between prolidase level and disease severity . soran et al . compared 36 ddh patients to 33 controls , all between the ages of 9 and 18 months . larger population studies , to also include a wider age range , are required to show consistency and add power to these findings . it is as yet unclear whether and how prolidase activity may be a useful marker in differentiating between cases of ddh likely to resolve or persist . there is recognised variation in the incidence rate of ddh worldwide ranging from 0.1 to > 10 % . highest incidence populations can be found in finland , croatia and canada ( 5195 per 1,000 ) , with very low incidences amongst populations in sub - saharan africa and hong kong ( 00.1 per 1,000 ) . geographical and cultural factors regarding climate differences and the practice of swaddling respectively may in part explain this variation [ 8 , 9 ] . although the trend has been most commonly observed with an inclination towards the winter months , the converse is reported in finland with a peak in the months of june and july . . recommended , more robust analytical approaches such as time - series analyses are required . progress is underway : the first study to mathematically model the birth month of children with ddh was published earlier this year , demonstrating seasonal variation across all groups ( both hemispheres ) , with peak incidences most frequently observed in mid - march and mid - october . as acknowledged by the study s authors , to make sense of these patterns of seasonal variation , we must understand their role in the context of a wider complex interplay of extrinsic physical , intrinsic physical , metabolic and genetic factors . nutrition plays a major role in the development of canine ddh . in genetically predisposed dogs , a number of dietary excesses are believed to increase the frequency and severity of hip dysplasia . this is believed to increase the frequency and severity of ddh in genetically susceptible dogs , most markedly if in the first 6 months of life . the two main aetiological categories in canine hip dysplasia ( cdh ) have been proposed as abnormal progression of endochondral ossification and hip joint laxity causing instability . relating these principles to diet , young dogs lack a protective mechanism against excess dietary calcium . excess vitamin d , by increasing intestinal absorption and renal resorption of calcium , is believed to be similarly harmful in dogs genetically predisposed to ddh . regarding the interaction between diet and hip joint laxity , the importance of vitamin c for healthy collagen synthesis is well understood and was previously believed to be protective against canine ddh . the administration of high dose dietary vitamin c in the controlled clinical setting has however failed to support this theory . in addition , some studies show that excess vitamin c causes hypercalcaemia and delayed bone remodelling as described above . unlike young dogs , neonates exhibit protective parathyroid , renal and skeletal regulatory mechanisms to control calcium and vitamin d levels . to the best of our knowledge , no data have been published regarding maternal and neonatal levels of calcium , or vitamins d or c , and risk of ddh . relaxin is a 6-kda polypeptide pregnancy hormone that increases the secretion of collagenase and plasminogen activator two important enzymes for collagenolysis . the first describes its direct effect on foetal ligament laxity by influencing connective tissue metabolism alongside oestrogens and progesterone . higher and more prolonged levels of relaxin have been reported in canine serum of animals with hip dysplasia and in the cord blood serum of babies with hip dysplasia compared to those without hip pathology ( 28.7 vs. 19.8 pg / ml ) . this however did not reach statistical significance ( p = 0.086 ) in a cohort size of 24 babies , and subsequent investigation has failed to show an association between umbilical vein blood relaxin levels and neonatal hip instability . a contradicting hypothesis exists to explain a higher incidence of ddh with lower relaxin concentrations . one of the main assumed functions of relaxin is relaxation of the mother s pelvic ligaments to prepare the birth canal for parturition . a study has shown lower relaxin concentrations in the cord blood of newborns with clinical symptoms of hip instability compared to newborns with inconspicuous hip findings . hence , an association between lower relaxin levels and poorer preparation of the pelvis has been suggested to cause higher pressures to be exerted on the foetus perinatally . this indirect influence of relaxin fits with a longstanding theory that intrauterine pressure or that developed during delivery may contribute to hip instability [ 25 , 26 ] . the direct effects of oestrogen and progesterone on the collagen and elastin content of the joint capsule have been investigated in animal models . these show an increased rate of hip dislocation with administration of progesterone versus a protective effect with administration of oestrogen . urine analysis has thus far shown no significant differences in oestrogen output between newborns with ddh and matched controls . however a positive correlation between serum progresterone and serum relaxin concentration has been reported , with attenuation of serum relaxin concentration associated with use of hormonal contraception . the ubiquity of relaxin and a lack of clear definition for its many actions make for an obvious focus of further studies . a greater understanding of relaxin receptor expression of the developing foetal hip and hence the possibility of varying susceptibilities to this hormone is required . connective tissue disorders include a spectrum of cartilage , collagen , fibrillin and matrix protein abnormalities . in 1978 , ponseti described his theory of acetabular cartilage dysplasia following histological analysis of six infants with ddh . the pathological changes documented include a loss of proteoglycans and an increase in collagen deposition in the lateral acetabular roof , manifesting as a ridge of degenerating acetabular cartilage detected clinically as a positive ortolani sign . systemically , recognition of associated joint hypermobility and of inguinal hernias in children with ddh has directed the focus of a number of studies to identify differences in collagen content , distribution and metabolism of the joint capsule and ligaments [ 3134 ] . the specific appearance of hernias abnormally early in life favours the hypothesised role of relaxin exerting its effects on collagenase in these infants . prolidase is a cytosolic exopeptidase that plays a crucial role in collagen degradation and in the recycling of proline . increased serum prolidase activity in patients with ddh suggests increased collagen turnover , with a positive correlation reported between prolidase level and disease severity . soran et al . compared 36 ddh patients to 33 controls , all between the ages of 9 and 18 months . larger population studies , to also include a wider age range , are required to show consistency and add power to these findings . it is as yet unclear whether and how prolidase activity may be a useful marker in differentiating between cases of ddh likely to resolve or persist . our review of the most up - to - date evidence highlights the need for better characterisation of the natural history of human ddh . efforts to improve detection of ddh have been based on identification of infants at increased risk . neither the prenatal and postnatal factors that predispose to hip instability nor the determinants of its resolution or persistence are well understood . a number of epidemiological , nutritional , hormonal and connective tissue influences on ligament laxity have been hypothesised . evidence for these potential risk factors is however provided largely by canine studies , with a paucity of consistent or strong evidence in humans . specifically , we lack large prospective studies that capture the breadth of the environmental risk factors hypothesised . such studies would provide data to aid the design of further focussed , high - quality human studies of specific , potentially modifiable maternal , pre- and antenatal risk factors for ddh . in turn , we may progress towards a clearer understanding of the origins of early degenerative hip disease , using robust evidence to best direct screening and surgical resources in the future . | purposedevelopmental dysplasia of the hip ( ddh ) is common , and the term encompasses a spectrum of anatomical abnormalities of the hip in which the femoral head displaces from the acetabulum .
these abnormalities may be congenital or develop during infancy and/or childhood . neither the prenatal and postnatal factors that predispose to hip instability nor the determinants of its resolution or persistence are well characterised . a multifactorial pathogenesis of ddh is commonly accepted and identified risk factors include a family history , being first born , breech presentation , female gender , high birth weight and oligohydramnios 1 .
further to genetic factors , a number of nutritional , hormonal and mechanical influences on ligament laxity have been hypothesised.methodsa comprehensive search was conducted using nice healthcare databases advanced search and google scholar engines , and the terms nutrition , environmental , risk factors , cdh and ddh . wherever possible , evidence from randomised controlled trials , systematic reviews and expert review articles published in the medical and veterinary literature was considered.resultsthe relationship between a number of hormones and biochemical markers of nutritional status and the development of ddh has been repeatedly hypothesised upon in the last 45 years .
of those most frequently cited are calcium , vitamins c and d , and relaxin hormone .
the evidence for these potential risk factors is provided mainly by canine studies , with a paucity of consistent or strong evidence in humans.conclusionsddh is common and remains a leading cause of hip osteoarthritis in young adults .
neonatal clinical screening programmes for this condition have been in practice since the 1950s , albeit with varying levels of sensitivity .
this review summarises current understanding of some of the most frequently cited nongenetic hypothesised risk factors , the significance of which remain to be determined . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatocellular carcinoma ( hcc ) ranks the fifth in incidence globally in men and the ninth in women according to the 2012 report by the american cancer society . it has become the fastest growing cause of cancer - related deaths in the united states and is the second leading cause of death in china . the currently recommended treatments include surgical resection , radiofrequency ablation , and liver transplantation . however , in the most advanced stage cases , liver reserve deficiency or the combinations of other liver diseases and complications render these patients unsuitable for surgery . even after surgical excision , the postoperative recurrence rate within 5 years is more than 50% , and the 5-year survival rate is less than 20% . the 5-year survival rate of patients undergoing liver transplantation has increased in recent years , but the overall prognosis remains unfavorable , indicating that the current treatment options are unsatisfactory . poor survival of hcc patients is strongly associated with tumor size [ 4 , 5 ] , tumor stage , vascular invasion , and micrometastasis , which are reliable and important indicators of tumor growth and invasion . vascular involvement by hcc cells , causing hematogenous dissemination , may lead to a high rate of recurrence and metastasis and poor prognosis [ 9 , 10 ] . for earlier therapeutic intervention , better early diagnostic techniques are urgently required . at present , imaging examinations such as b - mode ultrasonography , computed tomography ( ct ) , and magnetic resonance imaging ( mri ) and serum alpha - fetoprotein ( afp ) levels are mainly used to diagnose hcc . however , accurate diagnosis is difficult in approximately one third of hcc patients with low afp levels if the imaging findings are atypical . in recent years , great progress has been made in screening tumor - specific antigens , which has led to the identification of a variety of candidate proteins and genes . simpson et al . first reported cancer - testis antigens in melanoma patients , which belong to the largest group of identified specific tumor antigens . cancer - testis antigens , including the melanoma antigen ( mage ) family , ssx family , lage , gage , ctp11 , and ny - eso - l , are generally not expressed in normal tissues except in the testis but are expressed to some degree in hcc , malignant melanoma , lung cancer , sarcoma , and bladder cancer , among other tumor types . these antigens were found to be the most promising class of antigens for immune therapy . since 1998 , our group has studied cancer - testis antigens and hcc , and we have found that mage-1 , mage-3 , mage-4 , mage-10 , mage - b1 , mage - b2 , mage - c1 , mage - c2 , ny - eso-1 or other ct antigens were highly expressed in the tumor tissue of chinese hcc patients [ 1315 ] . mage-3 is not only highly expressed in hcc but also has strong immunogenicity with multiple hla - restricted epitopes , as identified with tetramer technology . for example , mage-3 can be detected in the peripheral blood of patients with gastrointestinal cancer , melanoma , or lung cancer as a specific cellular immune response [ 12 , 1619 ] . thus , we postulated that pentamer technology could be applied as a diagnostic method for hcc alongside routine examination . mage - a3-specific cytotoxic t lymphocyte ( ctl ) antigens were detectable in the peripheral blood of hcc patients . combined with serum afp , we hypothesized that this parameter may provide a more reliable diagnosis for afp - negative hcc patients . in this study , we performed pentamer staining and flow cytometry to detect the frequency of hla - a2/mage - a3112 - 120 epitope - specific ctls in the peripheral blood of hla - a2-positive hcc patients , liver cirrhosis patients , and healthy volunteers . the frequency of ctls in patients with liver cirrhosis was significantly lower than that of hcc patients ( p < 0.05 ) , while healthy controls had few cd8/mage - a3 double - positive cells . therefore , this approach may help to distinguish between benign and malignant liver disease and could be combined with serum afp measurement to form a new diagnostic method for hcc . we retrospectively analyzed the clinicopathologic data of 175 hcc patients who underwent surgery at our hospital between june 2007 and december 2012 . they included 117 males and 58 females with a mean age of 53.3 6.8 ( range 28 to 84 ) years . sixty patients were infected with hepatitis b virus ( hbv ) and two patients were infected with hepatitis c virus ( hcv ) . additionally , 80 cancer - free liver cirrhosis patients were included as controls . hcc tissue and adjacent normal tissue specimens were excised during surgery and were snap frozen in liquid nitrogen and were subsequently classified by pathological examination . diagnosis of hcc was based on preoperative investigations , which included serum afp concentration , liver ultrasonography , ct , and hepatic angiography in selected cases . histopathological examination of the tissue specimens was conducted by two pathologists to confirm the diagnosis of hcc . tumor stages were based on the american joint committee on cancer ( ajcc ) staging system ( 2010 ) . diagnosis of cirrhosis was based on liver histology as well as laboratory and imaging evidence of hepatic decompensation or portal hypertension . furthermore , 105 healthy volunteers were included in the study , all of whom were negative for the markers of hepatitis viruses a , b , c , d , and e and hiv antibodies , and had no liver , gallbladder , or kidney disease . the study protocol was approved by the local institutional review boards at the authors ' affiliated institutions and patient consent was not required because of the retrospective nature of this study . two ml peripheral venous blood was collected from each subject and hla phenotyping was performed using hla - a2 fluorescein isothiocyanate ( fitc ) conjugated mouse anti - human monoclonal antibody ( bb7.2 atcc ; becton dickinson , franklin lakes , nj ) with a facs calibur flow cytometer ( becton dickinson ) . the data was analyzed using the cellquest software . totally , 10,000 nucleated cells were obtained and if more than 80% of the cells were labeled , the sample was considered positive . hla - a2-positive hcc patients were denoted as the hcc group and hla - a2-positive patients with liver cirrhosis and healthy volunteers as the non - hcc control group . total rna was extracted from the tissue specimens using an rnaeasy extraction kit ( qiagen , hilden , germany ) , and cdna was synthesized with oligonucleotide primers using a superscript ii reverse transcriptase kit ( promega , madison , wi ) in accordance with the manufacturer 's instructions . the mage - a3 gene primers and probes were designed using abi prism primer express 3 ( applied biosystems , foster city , ca ) . fluorescent dye , fam , was used as a reporter signal and gapdh was used as an internal control . mage - a3 : forward primer : 5-ggagcactgaaggagaagatctg-3 , reverse primer : 5-tgactctggtcagggcaaca-3 , probe : 5-fam - tgggtctccattgcccagctcc - tamra-3 ; gapdh : forward primer : 5-gaaggtgaaggtcggagtc-3 , reverse primer : 5-gaagatggtgatgggatttc-3 , probe : 5-fam - caagcttcccgttctcagcc - tamra-3. the pcr was run at 50c for 2 min and 95c for 10 min followed by 40 cycles of 92c for 15 sec and 60c for 1 min . the pcr products were resolved by agarose gel electrophoresis and analyzed using the abi prism7000 detection system ( applied biosystems ) . ten ml peripheral venous blood was obtained from the study subjects who were hla - a2-positive . after heparin anticoagulation , peripheral blood mononuclear cells ( pbmcs ) were isolated by density gradient centrifugation and 1 10 pbmcs were incubated with anti - cd8 microbeads ( miltenyibiotec , bergischgladbach , germany ) at 4c for 30 min . approximately 1 10 cd8 t lymphocytes were isolated using ms columns ( miltenyibiotec ) . the five mhc - dimer ( pentamer ) mage - a3 epitope ( p112120 , kvaelvhfl ) complexes containing polypeptide were marked with phycoerythrin ( pe ) , thus enabling recognition and binding to t cell receptors of cd8 t cells against the antigen peptide . facscalibur flow cytometry was used for detection , and data were acquired and analyzed using the cellquest software . the lymphocyte gate was set to count 20,000 cd8 t cells and 20,000 double - positive cd8-fitcpentamer - pe cells ( mage - a3-specific cd8 t cells ) and frequency was expressed by the percentage of double - positive cells . serum afp levels were detected by electrochemiluminescence using roche e170 instruments and commercial kits ( roche , basel , switzerland ) . the follow - up was carried out once every 3 or 4 months for the first 3 years and then 6 months afterwards and consisted of physical examination , routine blood chemistry , serum afp , chest x - ray , and abdominal ultrasound . in cases with suspicious lesions upon ultrasound or elevated afp , further examinations ( contrast - enhanced ultrasound , ct or mri ) were conducted to confirm or to rule out recurrence . survival was defined as the time between the date of surgery to death of any cause . all data were expressed as mean standard deviation ( sd ) and analyzed using the spss 19.0 ( spss inc . , correlation between the frequency of mage - a3 peptide - specific ctls and mage - a3 mrna expression in hla - a2-positive hcc patients was examined by nonparametric pearson correlation analysis . differences in the frequency of mage - a3-specific cd8 t cells in peripheral blood among the three groups were compared by one - way analysis of variance . student 's t - test was used to analyze differences between the hcc group and non - hcc group . the receiver operating characteristic ( roc ) curve and area under the curve ( auc ) were used to delineate serum afp or mage - a3-specific ctls frequency as the efficiency index of diagnosis of hcc . the best possible cut off points were defined at the highest youden index ( j = sen + spe 1 ) . for combined detection of mage - a3-specific ctl frequency and serum afp , logistic regression analysis was carried out before roc curve analysis . to study the influence of mage - a3-specific ctl prevalence on prognosis our hla - a2 antigen phenotyping analysis by flow cytometry revealed 85 ( 48.6% ) hla - a2-positive cases from 175 hcc patients , 38 cases ( 47.5% ) from 80 liver cirrhosis patients , and 50 cases ( 47.6% ) from 105 healthy volunteers . we examined the frequency of cd8-specific ctls binding to mage - a3 epitopes by pentamer staining and flow cytometry . we found that the frequency of mage - a3 binding ctls in the peripheral blood of 85 hla - a2-positive hcc cases was 0.71 0.25% , which was significantly higher than that of cirrhotic patients ( 0.27 0.14% , p < 0.001 ) ( figure 1(a ) ) . few or no cd8/mage - a3 double - positive cells were detected in the healthy subjects ( 0.20 0.10% ) . furthermore , there was a marked difference in the frequency of cd8-specific ctls binding to mage - a3 epitopes between the hcc group and the non - hcc group ( p = 0.0021 ) ( figure 1(b ) ) . we found that 54.6% ( 24/44 ) of the hla - a2-positive tumor tissue specimens expressed mage - a3 mrna , which , however , was not detectable in adjacent normal tissues ( figure 1(c ) ) . pearson correlation analysis revealed no correlation between mage - a3 mrna expression in hcc tissues and the frequency of mage - a3-positive ctls in hcc patients ( pearson correlation coefficient = 0.131 , p > 0.05 ) . at a cutoff value of 200 ng / ml for afp , 27 ( 31.8% , 27/85 ) cases were diagnosed with hcc . at a cutoff value of 0.67% for the frequencies of mage - a3-epitope - specific ctls , 63.5% ( 54/85 ) of the hla - a2-positive hcc patients were diagnosed with hcc ( table 2 ) . when the two parameters were combined , 76.5% ( 65/85 ) of the patients were diagnosed with hcc . for early stage hcc patients ( tnm i and ii ) , 83.1% ( 54/65 ) were diagnosed by the combined use of the two parameters whereas only 29.2% ( 19/65 ) early stage patients were diagnosed using afp alone and 72.3% ( 47/65 ) early stage patients were diagnosed using the frequencies of mage - a3-epitope - specific ctls alone . roc curve analysis showed that the auc of serum afp was 0.613 ( figure 2(a ) ) . at a cutoff value of 200 ng / ml , the sensitivity of serum afp for diagnosing hcc was 31.8% , and the specificity was 98.9% with the youden index at 0.307 . for the frequency of mage - a3-positive ctls , the auc was 0.873 ( figure 2(b ) ) . at a cutoff value of 0.67% , 63.5% ( 54/85 ) of hcc patients exhibited a specific mage - a3 ctl response to hla - a2-restricted epitopes . in contrast , 38 ( 100% ) patients with liver cirrhosis and 50 ( 100% ) healthy volunteers were negative for this response . the diagnostic sensitivity of the frequency of mage - a3-positive ctls at 0.67% was 68.6% and the specificity was 100% with the youden index at 0.686 . while serum afp did not correlate with the frequency of mage - a3-specific ctls ( pearson correlation coefficient = 0.093 , p = 0.154 ) , the two indicators were complementary . we analyzed the combination of the two indicators according to the decision boundary in hcc diagnosis . at a cutoff value of 200 ng / ml for afp and at a cutoff of 0.67% for mage - a3-specific ctls , the roc curve of the auc for combined afp and mage - a3-specific ctls was 0.916 with a sensitivity of 72.9% and a specificity of 100% ( figure 2(c ) ) . the findings indicate markedly improved diagnostic performance of combined afp and mage - a3-specific ctls for diagnosing hla - a2-positive hcc . we next analyzed the correlations between the frequency of mage - a3-specific ctls and patient clinicopathologic parameters such as age , sex , preoperative afp level ( 20 ng / ml and 200 ng / ml ) , tumor size , tumor number , hbsag expression , child - pugh class , tnm staging , and differentiation ( table 1 ) . the frequency of mage - a3-specific ctls exhibited no statistically significant association with any of these parameters ( p > 0.05 ) . all 85 hcc patients were followed up for a mean duration of 34 ( range , 4 to 68 ) months after surgery . twenty - four patients died and 54 patients were alive at the time of the last follow - up . the median survival was 37 5.4 months ; the 1-year , 3-year , and 5-year survival rates were 80.8% , 41.3% , and 27.5% , respectively . the group with mage - a3 specific ctl frequency above 0.67% had a median survival of 37 6.0 months . furthermore , the 1-year , 3-year , and 5-year survival rates were 91.3% , 43.0% , and 21.5% , respectively . in the other group with mage - a3 specific ctl frequency below 0.67% , the median survival was 19 7.7 months , and the 1-year , 3-year , and 5-year survival rates were 63.8% , 45.7% , and 38.1% , respectively ( table 3 ) . the kaplan - meier survival curves showed that patients with low cell frequency of mage - a3 ( < 0.67% ) did not have a significant survival difference compared to patients with elevated cell frequency of mage - a3 ( 0.67% ) ( p = 0.099 ) ( figure 3(b ) ) . in china , serum afp level is used as one of the conventional indexes of primary hcc diagnosis . however , highly and poorly differentiated hcc cells usually produce little afp in contrast to the high levels synthesized by moderately differentiated hcc cells . therefore , the positive rate of afp in the diagnosis of hcc is generally only 6070% . in addition , serum afp levels in patients with liver cirrhosis can be very high , suggesting that afp gives false positives in the diagnosis of primary hcc . in this study , we used pentamer staining and flow cytometry to detect the frequency of ctls specific for hla - a2/mage - a3112 - 120 epitope in the peripheral blood of hcc patients . when the cutoff value of mage - a3-positive ctls was set at 0.67% , 63.5% ( 54/85 ) patients with hcc exhibited positive results . however , a corresponding ctl response was not detected in 38 patients with liver cirrhosis and 50 healthy volunteers . thus , the pentamer technique may be sensitive enough to detect spontaneous ctl response to a mage - a3 specific epitope , and it may be used as an important auxiliary method to improve the diagnosis rates of hcc . we adopted the roc curve method to evaluate the efficiency of serum afp measurement in the diagnosis of hcc . according to the commonly used decision boundary applied in the clinical diagnosis of hcc , when the afp - positive cutoff value was 200 ng / ml , the sensitivity and specificity of afp were 42.86% and 98.9% , respectively , and the auc was 0.613 . combined detection of serum afp levels and mage - a3-specific ctls with a cutoff of 0.67% resulted in an roc curve with an auc of 0.916 , which apparently improved the diagnostic sensitivity for hcc , reaching 72.9% . our results showed that using the hla - a2/mage - a3 polypeptide pentamer technology , specific spontaneous ctl response to tumor - specific antigens can be quantitatively identified in the peripheral blood of patients with hcc . the mage - a3-specific ctl frequency and its diagnostic significance in a large cohort have not been previously investigated . in addition , we found that in the 44 hla - a2-positive hcc cases expressing the mage - a3 gene , there was no correlation between mage - a3 mrna expression and mage - a3-specific ctl response . another study showed that many ct genes , including mage - a3 , exhibited the phenomenon of clustering expression . various ct antigens are spontaneously expressed in tumors but in some cases , no ct antigen is expressed . therefore , while antigen expression is not always detectable in solid tumors , ctl response to antigens may be detected in peripheral blood . for reliable assessment of specific ctl detection , qpcr data can be used as an important reference . in the future , if the diagnosis index of hcc is applied , these flexible inspection methods should be considered . this study found that parameters including patient 's gender , age , preoperative afp level ( 20 ng / ml and 200 ng / ml ) , tumor size , tumor number , tnm staging , and differentiation had no significant correlation with the frequency of mage - a3 ctls ( p > 0.05 ) . in addition , no significant correlations were observed in other studies [ 25 , 26 ] . in addition , since the expression frequency of hla - a2 antigen reached 51.9% in chinese hans patients , we chose hla - a2-positive patients and an hla - a2 type pentamer . since we only chose the hla - a2 type pentamer , we could not cover all hcc patients in our assessment . with the progression of technology and the gradual accumulation of data , we will eventually have a variety of hla - type pentamers at our disposal and will be able to choose antigens with stronger immunogenicity that encompass more patients . in this study , by applying classical immunology theory and advancing technology , we analyzed the response of ctls against a specific tumor antigen and attempted to find a diagnostic hcc this study showed that , with the relatively mature and sensitive pentamer technology , the combined detection of the frequency of ctl response to a tumor - specific antigen peptide with serum afp levels was of value in the diagnosis of hcc , especially in cases of serum afp - negative hcc . this novel auxiliary diagnostic mode may be established to enhance the sensitivity and specificity of classic hcc screening and improve the diagnosis rates of hcc . moreover , mage - a3-specific tcrs are identified and made ready for immune therapy [ 29 , 30 ] . further research on mage - a3 will enable us to apply this tumor - specific antigen ctl marker in the diagnosis of hcc . | we investigated the feasibility of the combined detection of hla - a2/mage - a3 epitope - specific cytotoxic t lymphocytes ( ctls ) and serum alpha - fetoprotein ( afp ) for specific diagnosis of hepatocellular carcinoma ( hcc ) .
we detected the frequency of mage - a3 epitopes ( p112120 , kvaelvhfl ) in spontaneous ctls in the peripheral blood of hcc patients , liver cirrhosis patients , and healthy subjects with hla - a2/polypeptide complex ( pentamer ) detection technology .
eighty - five hcc cases , 38 liver cirrhosis cases , and 50 healthy cases who were hla - a2-positive were selected from 175 hcc patients , 80 patients with liver cirrhosis , and 105 healthy volunteers , respectively .
the frequency of hla - a2-specific mage - a3 + ctls in the hcc group was significantly higher than that in the other groups .
combined detection of mage - a3 + ctl frequency and serum afp value had a higher specificity than either of the two indicators alone .
the pentamer technique is helpful in distinguishing benign lesions and malignant lesions in the liver .
combined with serum afp , it can improve the diagnosis performance for hcc , especially for afp - negative cancer . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
low back pain ( lbp ) is often concurrent with pain from other body sites . individuals with localized lbp report better perceived health , less pain severity , shorter pain duration and shorter time with pain the previous year compared with individuals with lbp accompanied by widespread pain ( natvig et al . , 2001 ) . this group also reports their sleep to be better than those with lbp and widespread pain , defined as lbp and , in addition , pain from four or more sites of the body ( natvig et al . , 2001 ) . the number of painful locations has been shown to be more strongly associated with health - related functioning than chronicity or location of the pain ( saastamoinen et al . , 2006 ) . multi - site pain is associated with an increased risk of sickness absence ( haukka et al . , 2013 ) , disability pension ( kamaleri et al . , 2009b ) and poor self - rated work ability ( miranda et al . , 2010 ) . sleep problems is a factor associated with both pain ( smith and haythornthwaite , 2004 ; fishbain et al . , 2010 ; alsaadi et al . , 2011 ) and sickness absence ( sivertsen et al . , 2006 , 2009 ; akerstedt et al . , 2007 ; 2010 ) . in a review from 2010 , investigating the relationship between chronic pain and sleep disorder , the presence of a bidirectional relationship between sleep and pain could not be excluded ( fishbain et al . , 2010 ) . insufficient sleep or short sleep duration has shown to be associated with subsequently increased self - reported pain intensity ( edwards et al . , 2008 ; haack et al . , 2012 ) and inadequate pain inhibition ( edwards et al . , 2009 ; campbell et al . , 2011 ; haack et al . , there are , however , few longitudinal studies that have investigated the effect of disturbed sleep on pain . a 28-year follow - up study showed that disturbed sleep at baseline was a significant predictive factor for hospitalization due to back pain , even after excluding participants with back pain at baseline ( kaila - kangas et al . , 2006 ) . gupta and colleagues found , after controlling for pain at baseline , that self - reported sleep problems , somatic symptoms and illness behaviour all predicted the onset of chronic widespread pain ( cwp ) , defined as pain present from two contralateral quadrants of the body , above and below the waist , and in the axial skeleton ( gupta et al . , 2007 ) . it is of clinical value to know more about predictive factors for multi - site pain . previously having been in pain is a strong predictor of multi - site pain ( kamaleri et al . self - reported problems with sleep have shown to be predictive of the onset of cwp ( gupta et al . , 2007 ) and restorative to the best of our knowledge , there is no prospective study that has investigated disturbed sleep as a predictor of the onset and resolution of multi - site musculoskeletal pain in which the cohort has been stratified by the number of pain sites . we hypothesize that disturbed sleep ( including the dimensions , difficulties falling asleep , repeated awakenings , premature final awakening , not feeling well - rested at awakening and disturbed / restless sleep ) predicts the onset of multi - site ( musculoskeletal ) pain 5 years later among individuals free from pain at baseline , and that good sleep predicts the resolution of multi - site pain 5 years later . the present study is based upon data from the music ( musculoskeletal intervention centre ) norrtlje study , a study initiated in order to identify and quantify risk and protective factors for lbp and nsp , and to investigate pain prognoses . in the music - norrtlje study , the study was designed as a prospective case - referent study with one 5-year follow - up of all cases and referents that participated in the baseline study . approximately 17,000 men and women , 2059 years of age , who were living and working in the rural municipality of norrtlje in sweden , comprised the study population . the cases were recruited when participants sought care for lbp or nsp from 1 of approximately 70 caregivers in the area , including physicians , physiotherapists and alternative caregivers , such as chiropractors , osteopaths and homeopaths . referents , matched by age and gender , were chosen at random via the population register . the inclusion criteria for the music - norrtlje study were to be working , and to not have sought care for , or been treated for lbp or nsp , for at least 6 months prior to baseline assessment . individual and demographic data , information on lbp and nsp , sleep disturbance and other medical conditions , and also on work - related exposures were assessed through self - administered questionnaires and interviews among both cases and referents ( grooten et al . census data on sickness absence ( > 14 consecutive days ) were taken from the national social insurance board and linked to each of the 2329 subjects who participated in both the baseline study and at follow - up . the music - norrtlje study was approved by the ethics committee of karolinska institutet ( dnr 03 - 139 ; dnr 93 - 255 ) . the present study is designed as a 5-year prospective cohort study , which considers all participants with data from baseline and follow - up regardless of whether they were cases or referents in the original music - norrtlje study . an exclusion criterion based upon some diseases associated with chronic pain was however added . in the baseline questionnaire , the participants were asked to state whether they had ( 1 ) vascular pain from legs ; ( 2 ) disease from nerves ( brain , spinal cord , peripheral nerves ) ; ( 3 ) joint reconstruction ( arthroplasty ) in hip , knee or other joint ; ( 4 ) any congenital defect in joints , muscles or back ; ( 5 ) been diagnosed with rheumatoid arthritis ; and ( 6 ) been diagnosed with ankylosing spondylitis ( bechterew 's disease ) . if the answer was yes for any one of these items , the individual was excluded from the study ( resulting in exclusion of 10% of the cohort ) . the exclusion criterion was based upon the assumption that having any one of these conditions would make it more likely for individuals to have chronic multi - site pain where sleep might well influence their general health , but would be less likely to have an impact on the onset or resolution of pain . the cohort included all subjects with valid data from baseline and follow - up , not reporting any of the above medical conditions . sleep disturbance was assessed through a modified version of the karolinska sleep questionnaire , using a 5-item likert scale ( akerstedt et al . , 2002a , 2008 ) . to obtain a value for sleep disturbance , a sleep disturbance index ( akerstedt et al . , 2002b , 2008 ) with the following five questions was used : during the last 6 months have you had ( 1 ) difficulties falling asleep ? ; ( 2 ) repeated awakenings with difficulties going back to sleep ? ; ( 3 ) the feeling of not being well - rested when waking up ? ; ( 4 ) premature ( final ) awakening ? ; ( 5 ) disturbed / restless sleep ? the respondents could select between 1 never ; 2 seldom / a few times per year ; 3 sometimes / several times per month ; 4 most of the time / several times per week ; 5 always , every day . the distribution of sleep scores ( including all 2329 individuals with baseline data ) enabled us to divide sleep into tertiles with the following cut - offs : < 10 ( sleep a ) , 1113 ( sleep b ) and > 14 ( sleep c ) . sleep a represents the tertile with best sleep and sleep c represents the tertile with worst sleep . multi - site pain was defined using items from a modified version of the standard nordic questionnaire ( kuorinka et al . , 1987 ) : have you had discomfort ( pain , ache , discomfort ) at any time during the last 6 months from ( 1 ) neck ; ( 2 ) shoulder / shoulders ; ( 3 ) elbow / elbows ; ( 4 ) hand / hands / wrist / wrists ; ( 5 ) upper back ( thoracic ) ; ( 6 ) lower back ; ( 7 ) hip / hips ; ( 8) knee / knees ; and ( 9 ) foot / feet ? we made no distinction between unilateral and bilateral pain , entailing , e.g. , that if pain was reported from both elbows , the two elbows were treated as just one pain location . the same items for assessment of pain sites were used at both baseline and follow - up . in both questionnaires , the questions were supplemented with an illustration of the body parts in question . the expression 2010 ) but with different specifications of how many sites should , in general , form a cut - off . the cut - off used in the present study ( 3 sites ) is based upon the results in a study by kamaleri and colleagues , using the same questionnaire . in that study , individuals with three or more pain sites were found to show an increased risk for work disability ( kamaleri et al . , 2009b ) . to establish whether the same cut - off was reasonable for the present study , a binary logistic regression analysis of sickness absence ( for > 14 consecutive days at any time during the 5-year study period ) was made with the numbers of pain sites as independent factors adjusted for age and gender . the analysis showed an or of 1.9 ( p = 0.001 ) at the level of three pain sites ( for two pain sites or = 1.4 ; p = 0.04 and for four pain sites or = 3.0 ; p = 0.000 ) . high physical ( biomechanical ) ( haukka et al . , 2012 ) and psychosocial ( haukka et al . , 2011 ) workload have been shown to predict the onset of multi - site pain . apart from the already - mentioned risk factors , commonly used covariates in research investigating pain are age , gender , physical activity , smoking , body mass index ( bmi ) and psychosocial circumstances . in the present study , age ( continuous ) , gender , inclusion as case or referent in music - norrtlje , bmi ( dichotomized into < 25 and 25 kg / m ) smoking , physical activity , psychosocial exposures at work and biomechanical exposures at work were considered as potential confounders and assessed in questionnaires and interviews at baseline . smoking was categorized into ( 1 ) non - smoker ; ( 2 ) smoking sometimes , e.g. , at parties ; and ( 3 ) smoker . physical activity comprised two variables , medium - intensity exercise and high - intensity exercise , and was assessed by the questions : ( 1 ) to what extent do you at the present perform regular medium intensity exercise ( e.g. , jogging , riding , gymnastics , dancing ) ? ( 2 ) to what extent do you at the present perform regular high intensity exercise ( e.g. , running , football , squash ) ? the variables were allocated to five categories according to their frequency : ( 1 ) 5 days or more per week ; ( 2 ) 24 days / week ; ( 3 ) 1 day / week ; ( 4 ) 13 days / month ; ( 5 ) almost never / never . biomechanical exposures at work were treated in four variables : working with hands above shoulder level ; prolonged sitting ( 75% of the working time ) ; manual handling ( 50n 60 min / day ) ; and working with vibrating tools ( 60 min / day ) . psychosocial exposures at work were considered in eight variables : ( 1 ) few opportunities to learn and develop at work ; ( 2 ) high mental demands ; ( 3 ) low decision latitude ; ( 4 ) job strain ( a combination of high mental demands and low decision latitude ) ; ( 5 ) poor general support at work ; ( 6 ) low meaningfulness ; ( 7 ) high time pressure ; and ( 8) hindrances at work ( including poor work task clarity , poor material or personnel resources , and/or poor work task support affecting the quality of work or leading to regular overtime working or neglecting safety rules to accomplish the work ) . each of the psychosocial and biomechanical exposures was dichotomized into exposed or non - exposed . the construction of the psychosocial and biomechanical exposures , and of the variables and cut - offs for dichotomization , is described in detail in previous music - norrtlje studies ( tornqvist et al . , 2001 ; grooten et al . , 2004a ) . the distribution of former cases and referents are presented in the study as a baseline characteristic since cases and referents might have different pain characteristics . to be included as a case or referent in the study has been treated as a confounder in the analysis of the two strata including individuals reporting pain at baseline . pain at baseline is considered a strong predictive factor for an increase in the number of pain sites ( kamaleri et al . , 2009a ) . three pain strata were thus formed : no pain , pain from 12 sites and multi - site pain . the stratification was used both at baseline and for the outcomes at follow - up . the study is designed to study individuals migrating from one stratum at baseline to a different one at follow - up . the effect of sleep disturbance in the three pain strata was analysed for the three outcomes ( no pain , 12 pain sites and 3 pain sites ) in multinomial logistic regression analyses . the potential confounders were tested one by one in a stratified multinomial logistic regression analysis , and included in the modelling if , after adjustment for age and gender , they were significantly associated with outcome at a 0.05 level and altered the beta coefficient by more than 10% . the present study is based upon data from the music ( musculoskeletal intervention centre ) norrtlje study , a study initiated in order to identify and quantify risk and protective factors for lbp and nsp , and to investigate pain prognoses . in the music - norrtlje study , the study was designed as a prospective case - referent study with one 5-year follow - up of all cases and referents that participated in the baseline study . approximately 17,000 men and women , 2059 years of age , who were living and working in the rural municipality of norrtlje in sweden , comprised the study population . the cases were recruited when participants sought care for lbp or nsp from 1 of approximately 70 caregivers in the area , including physicians , physiotherapists and alternative caregivers , such as chiropractors , osteopaths and homeopaths . referents , matched by age and gender , were chosen at random via the population register . the inclusion criteria for the music - norrtlje study were to be working , and to not have sought care for , or been treated for lbp or nsp , for at least 6 months prior to baseline assessment . individual and demographic data , information on lbp and nsp , sleep disturbance and other medical conditions , and also on work - related exposures were assessed through self - administered questionnaires and interviews among both cases and referents ( grooten et al . census data on sickness absence ( > 14 consecutive days ) were taken from the national social insurance board and linked to each of the 2329 subjects who participated in both the baseline study and at follow - up . the music - norrtlje study was approved by the ethics committee of karolinska institutet ( dnr 03 - 139 ; dnr 93 - 255 ) . the present study is designed as a 5-year prospective cohort study , which considers all participants with data from baseline and follow - up regardless of whether they were cases or referents in the original music - norrtlje study . an exclusion criterion based upon some diseases associated with chronic pain was however added . in the baseline questionnaire , the participants were asked to state whether they had ( 1 ) vascular pain from legs ; ( 2 ) disease from nerves ( brain , spinal cord , peripheral nerves ) ; ( 3 ) joint reconstruction ( arthroplasty ) in hip , knee or other joint ; ( 4 ) any congenital defect in joints , muscles or back ; ( 5 ) been diagnosed with rheumatoid arthritis ; and ( 6 ) been diagnosed with ankylosing spondylitis ( bechterew 's disease ) . if the answer was yes for any one of these items , the individual was excluded from the study ( resulting in exclusion of 10% of the cohort ) . the exclusion criterion was based upon the assumption that having any one of these conditions would make it more likely for individuals to have chronic multi - site pain where sleep might well influence their general health , but would be less likely to have an impact on the onset or resolution of pain . the cohort included all subjects with valid data from baseline and follow - up , not reporting any of the above medical conditions . sleep disturbance was assessed through a modified version of the karolinska sleep questionnaire , using a 5-item likert scale ( akerstedt et al . , 2002a , 2008 ) . to obtain a value for sleep disturbance , a sleep disturbance index ( akerstedt et al . , 2002b , 2008 ) with the following five questions was used : during the last 6 months have you had ( 1 ) difficulties falling asleep ? ; ( 2 ) repeated awakenings with difficulties going back to sleep ? ; ( 3 ) the feeling of not being well - rested when waking up ? ; ( 4 ) premature ( final ) awakening ? ; ( 5 ) disturbed / restless sleep ? the respondents could select between 1 never ; 2 seldom / a few times per year ; 3 sometimes / several times per month ; 4 most of the time / several times per week ; 5 always , every day . the distribution of sleep scores ( including all 2329 individuals with baseline data ) enabled us to divide sleep into tertiles with the following cut - offs : < 10 ( sleep a ) , 1113 ( sleep b ) and > 14 ( sleep c ) . sleep a represents the tertile with best sleep and sleep c represents the tertile with worst sleep . multi - site pain was defined using items from a modified version of the standard nordic questionnaire ( kuorinka et al . , 1987 ) : have you had discomfort ( pain , ache , discomfort ) at any time during the last 6 months from ( 1 ) neck ; ( 2 ) shoulder / shoulders ; ( 3 ) elbow / elbows ; ( 4 ) hand / hands / wrist / wrists ; ( 5 ) upper back ( thoracic ) ; ( 6 ) lower back ; ( 7 ) hip / hips ; ( 8) knee / knees ; and ( 9 ) foot / feet ? we made no distinction between unilateral and bilateral pain , entailing , e.g. , that if pain was reported from both elbows , the two elbows were treated as just one pain location . the same items for assessment of pain sites were used at both baseline and follow - up . in both questionnaires , the questions were supplemented with an illustration of the body parts in question . the expression 2010 ) but with different specifications of how many sites should , in general , form a cut - off . the cut - off used in the present study ( 3 sites ) is based upon the results in a study by kamaleri and colleagues , using the same questionnaire . in that study , individuals with three or more pain sites were found to show an increased risk for work disability ( kamaleri et al . , 2009b ) . to establish whether the same cut - off was reasonable for the present study , a binary logistic regression analysis of sickness absence ( for > 14 consecutive days at any time during the 5-year study period ) was made with the numbers of pain sites as independent factors adjusted for age and gender . the analysis showed an or of 1.9 ( p = 0.001 ) at the level of three pain sites ( for two pain sites or = 1.4 ; p = 0.04 and for four pain sites or = 3.0 ; p = 0.000 ) . high physical ( biomechanical ) ( haukka et al . , 2012 ) and psychosocial ( haukka et al . , 2011 ) workload have been shown to predict the onset of multi - site pain . apart from the already - mentioned risk factors , commonly used covariates in research investigating pain are age , gender , physical activity , smoking , body mass index ( bmi ) and psychosocial circumstances . in the present study , age ( continuous ) , gender , inclusion as case or referent in music - norrtlje , bmi ( dichotomized into < 25 and 25 kg / m ) smoking , physical activity , psychosocial exposures at work and biomechanical exposures at work were considered as potential confounders and assessed in questionnaires and interviews at baseline . smoking was categorized into ( 1 ) non - smoker ; ( 2 ) smoking sometimes , e.g. , at parties ; and ( 3 ) smoker . physical activity comprised two variables , medium - intensity exercise and high - intensity exercise , and was assessed by the questions : ( 1 ) to what extent do you at the present perform regular medium intensity exercise ( e.g. , jogging , riding , gymnastics , dancing ) ? ( 2 ) to what extent do you at the present perform regular high intensity exercise ( e.g. , running , football , squash ) ? the variables were allocated to five categories according to their frequency : ( 1 ) 5 days or more per week ; ( 2 ) 24 days / week ; ( 3 ) 1 day / week ; ( 4 ) 13 days / month ; ( 5 ) almost never / never . biomechanical exposures at work were treated in four variables : working with hands above shoulder level ; prolonged sitting ( 75% of the working time ) ; manual handling ( 50n 60 min / day ) ; and working with vibrating tools ( 60 min / day ) . psychosocial exposures at work were considered in eight variables : ( 1 ) few opportunities to learn and develop at work ; ( 2 ) high mental demands ; ( 3 ) low decision latitude ; ( 4 ) job strain ( a combination of high mental demands and low decision latitude ) ; ( 5 ) poor general support at work ; ( 6 ) low meaningfulness ; ( 7 ) high time pressure ; and ( 8) hindrances at work ( including poor work task clarity , poor material or personnel resources , and/or poor work task support affecting the quality of work or leading to regular overtime working or neglecting safety rules to accomplish the work ) . each of the psychosocial and biomechanical exposures was dichotomized into exposed or non - exposed . the construction of the psychosocial and biomechanical exposures , and of the variables and cut - offs for dichotomization , is described in detail in previous music - norrtlje studies ( tornqvist et al . , 2001 ; grooten et al . , 2004a ) . the distribution of former cases and referents are presented in the study as a baseline characteristic since cases and referents might have different pain characteristics . to be included as a case or referent in the study has been treated as a confounder in the analysis of the two strata including individuals reporting pain at baseline . pain at baseline is considered a strong predictive factor for an increase in the number of pain sites ( kamaleri et al . , 2009a ) . three pain strata were thus formed : no pain , pain from 12 sites and multi - site pain . the stratification was used both at baseline and for the outcomes at follow - up . the design of the stratification and research questions are described in fig . 1 . the study is designed to study individuals migrating from one stratum at baseline to a different one at follow - up . the effect of sleep disturbance in the three pain strata was analysed for the three outcomes ( no pain , 12 pain sites and 3 pain sites ) in multinomial logistic regression analyses . the potential confounders were tested one by one in a stratified multinomial logistic regression analysis , and included in the modelling if , after adjustment for age and gender , they were significantly associated with outcome at a 0.05 level and altered the beta coefficient by more than 10% . in all , 1777 participants had valid data on all the parameters included ( baseline and follow - up ) . of these , 1599 fulfilled the added inclusion criterion ( not having any of the identified medical conditions associated with increased musculoskeletal pain ) . there were more women ( 60% ) than men in the group included in the study , and 58% were under 45 years of age at baseline . among the participants included in the study , 622 ( 39% ) had best sleep ( sleep a ) , 481 ( 30% ) had medium sleep ( sleep b ) and 496 ( 31% ) had worst sleep ( sleep c ) . further , 881 participants reported multi - site pain at baseline , whereas 188 reported no pain ( table 1 ) . women were more common in the multi - site pain stratum than in the other two strata . among the individuals who reported multi - site pain at baseline , more also reported the worst sleep ( sleep c ) than in the other two pain strata . background characteristics showing the number of individuals ( n ) and percentage of individuals ( % ) within each pain stratum among individuals with no pain at baseline ( n = 188 ) , 51% were women and 55% were under 45 years of age . among the 11% ( n = 21 ) who reported no pain at baseline and multi - site pain at follow - up , the most frequently reported pain sites at follow - up were shoulder / shoulders ( 86% ) , neck ( 76% ) , lower back ( 71% ) and thoracic spine ( 43% ) . these 21 participants were rather evenly distributed across the three sleep categories ( sleep a 33% ; sleep b 29% ; sleep c 38% ) ( table 2 ) . pain locations reported by participants with no pain at baseline , but reporting multi - site pain at follow - up , number of individuals ( n ) , percentage within each sleep group ( % ) bmi fulfilled the criteria for confounding and was therefore included in the full model . bmi 25 kg / m showed a negative association with multi - site pain at follow - up , but no association with 12 pain sites at follow - up ( data not shown ) . in the multinomial logistic regression analysis , the worst sleep tertile ( sleep c ) showed a significantly higher odds ratio ( or 4.55 ; 95% ci 1.2816.12 in the full model ) for reporting multi - site pain ( pain from 3 sites ) in the no - pain - at - baseline stratum . the medium sleep tertile ( sleep b ) also showed a higher odds ratio for reporting multi - site pain at follow - up , but the increase was non - significant ( or 2.31 ; 95% ci 0.668.09 in the full model ) . the same trend for sleep a sleep c was not seen for the pain - from-1 - 2-sites outcome at follow - up ( table 3 ) . multinomial regression analysis presenting odds ratios for reporting 12 pain sites or 3 pain sites at follow - up , stratified by no pain or 12 pain sites at baseline ci , confidence interval ; or , odds ratio . significant result at the 0.05 level . adjusted for age and gender . adjusted for age , gender and body mass index . adjusted for age , gender and inclusion as case or referent . among the individuals with multi - site pain at baseline ( n = 881 ) , 68% were women and 57% were under 45 of age . a majority of those who reported multi - site pain at baseline also reported multi - site pain at follow - up ( 69% ) , and very few ( 6% ) reported no pain at follow - up . the most frequently reported pain sites among the participants with multi - site pain at baseline were lower back ( 82% ) , shoulder / shoulders ( 79% ) and neck ( 78% ) . pain in the lower back and neck were reported by 62% of the participants included in the stratum . among the 6% ( n = 53 ) who reported multi - site pain at baseline but no pain at follow - up , the most common pain sites in this group were neck ( 74% ) , lower back ( 74% ) , shoulder / shoulders ( 68% ) and knees ( 38% ) ( table 4 ) . pain locations reported by participants with multi - site pain at baseline , but reporting no pain at follow - up , number of individuals ( n ) , percentage of each sleep group and of total ( % ) . prevalence is presented for the three tertiles of sleep disturbance and in total manual handling ( 50n 60 min / day ) and prolonged sitting ( 75% of working time ) both fulfilled the criteria for confounding factors and were therefore included in the full model for the multinomial logistic regression analysis ( data not shown ) . sleep a and sleep b showed higher odds ratios for no pain at follow - up compared with more disturbed sleep ( sleep c ) ( or 3.48 ; 95% ci 1.617.53 for sleep a , and or 2.44 ; 95% ci 1.115.36 for sleep b ) after adjusting for age and gender . in the full model , the or and the confidence interval increased for both sleep a ( or 3.96 ) and sleep b ( or 2.40 ) , and remained significant for sleep a at a 0.05 level ( table 5 ) . multinomial regression analysis showing the odds ratios for reporting fewer pain sites at follow - up ( 12 pain sites or no pain ) among individuals with multi - site pain at baseline ci , confidence interval ; or , odds ratio . adjusted for age , gender and inclusion as case or referent . adjusted for age , gender , among individuals with no pain at baseline ( n = 188 ) , 51% were women and 55% were under 45 years of age . among the 11% ( n = 21 ) who reported no pain at baseline and multi - site pain at follow - up , the most frequently reported pain sites at follow - up were shoulder / shoulders ( 86% ) , neck ( 76% ) , lower back ( 71% ) and thoracic spine ( 43% ) . these 21 participants were rather evenly distributed across the three sleep categories ( sleep a 33% ; sleep b 29% ; sleep c 38% ) ( table 2 ) . pain locations reported by participants with no pain at baseline , but reporting multi - site pain at follow - up , number of individuals ( n ) , percentage within each sleep group ( % ) bmi fulfilled the criteria for confounding and was therefore included in the full model . bmi 25 kg / m showed a negative association with multi - site pain at follow - up , but no association with 12 pain sites at follow - up ( data not shown ) . in the multinomial logistic regression analysis , the worst sleep tertile ( sleep c ) showed a significantly higher odds ratio ( or 4.55 ; 95% ci 1.2816.12 in the full model ) for reporting multi - site pain ( pain from 3 sites ) in the no - pain - at - baseline stratum . the medium sleep tertile ( sleep b ) also showed a higher odds ratio for reporting multi - site pain at follow - up , but the increase was non - significant ( or 2.31 ; 95% ci 0.668.09 in the full model ) . the same trend for sleep a sleep c was not seen for the pain - from-1 - 2-sites outcome at follow - up ( table 3 ) . multinomial regression analysis presenting odds ratios for reporting 12 pain sites or 3 pain sites at follow - up , stratified by no pain or 12 pain sites at baseline ci , confidence interval ; or , odds ratio . significant result at the 0.05 level . adjusted for age and gender . adjusted for age , gender and body mass index . adjusted for age , gender and inclusion as case or referent . among the individuals with multi - site pain at baseline ( n = 881 ) , 68% were women and 57% were under 45 of age . a majority of those who reported multi - site pain at baseline also reported multi - site pain at follow - up ( 69% ) , and very few ( 6% ) reported no pain at follow - up . the most frequently reported pain sites among the participants with multi - site pain at baseline were lower back ( 82% ) , shoulder / shoulders ( 79% ) and neck ( 78% ) . pain in the lower back and neck were reported by 62% of the participants included in the stratum . among the 6% ( n = 53 ) who reported multi - site pain at baseline but no pain at follow - up , the most common pain sites in this group were neck ( 74% ) , lower back ( 74% ) , shoulder / shoulders ( 68% ) and knees ( 38% ) ( table 4 ) . pain locations reported by participants with multi - site pain at baseline , but reporting no pain at follow - up , number of individuals ( n ) , percentage of each sleep group and of total ( % ) . prevalence is presented for the three tertiles of sleep disturbance and in total manual handling ( 50n 60 min / day ) and prolonged sitting ( 75% of working time ) both fulfilled the criteria for confounding factors and were therefore included in the full model for the multinomial logistic regression analysis ( data not shown ) . sleep a and sleep b showed higher odds ratios for no pain at follow - up compared with more disturbed sleep ( sleep c ) ( or 3.48 ; 95% ci 1.617.53 for sleep a , and or 2.44 ; 95% ci 1.115.36 for sleep b ) after adjusting for age and gender . in the full model , the or and the confidence interval increased for both sleep a ( or 3.96 ) and sleep b ( or 2.40 ) , and remained significant for sleep a at a 0.05 level ( table 5 ) . multinomial regression analysis showing the odds ratios for reporting fewer pain sites at follow - up ( 12 pain sites or no pain ) among individuals with multi - site pain at baseline ci , confidence interval ; or , adjusted for age , gender and inclusion as case or referent . adjusted for age , gender , both hypotheses in this study , ( 1 ) that disturbed sleep predicts ( musculoskeletal ) multi - site pain 5 years later among individuals free from pain at baseline and ( 2 ) that good sleep predicts resolution of ( musculoskeletal ) multi - site pain 5 years later , are supported by the results . that sleep is a predictor of multi - site pain is in line with previous research ( kamaleri et al . , 2009a ) , and the present study implies that the association is also significant for initially pain - free individuals . the results indicate that reporting better sleep ( or having less disturbed sleep ) is one factor relevant to predicting the resolution of multi - site pain . to the best of our knowledge , no study has specifically looked at this relationship before , although restorative sleep has previously been shown to be a predictive factor in the resolution of cwp ( davies et al . , 2008 ) . high physical workload ( haukka et al . , 2012 ) , psychosocial work exposures ( haukka et al . , 2011 ) and obesity(haukka et al . , 2012 ; magnusson et al . , 2014 ) have , in previous research , been shown to be associated with the onset of multi - site pain . for the present study , sleep disturbance was categorized into tertiles to study sleep disturbance in a general sense , including several dimensions of sleep problems . the stratification by pain and the cut - off used for multi - site pain were , as in previous studies in this field , somewhat arbitrary . there are no clear definitions of multi - site pain , and one common way of establishing a cut - off is to divide the cohort into percentiles . since the cohort in the original music - norrtlje study comprised both cases and referents , a division of this kind would not have been interpretable . our cut - off , with 3 pain sites , is based upon the results in previous research ( kamaleri et al . , 2009b ) where an increased risk for work disability was seen if the number of pain sites was 3 ( when adjusting for age and gender ) . furthermore , we chose to establish the relevance of the chosen cut - off for multi - site pain in our study group by calculating the odds ratios for sickness absence when individuals were exposed to various numbers of pain sites . in a supplementary analysis ( data not shown ) , we included a variable for number of pain sites in a model alongside sleep ( for the multi - site pain - at - baseline stratum ) . this influenced the results to some extent , but did not change their trend or significance . to stratify , rather than to include a number of pain sites in the modeling , was an approach adopted in order to make the results easier to interpret even in clinical settings . to stratify into more than three strata we wanted the three strata to reflect three different pain characteristics , with one pain - free stratum and one multi - site pain stratum , similar to previous research ( kamaleri et al . we found that , with our multi - site pain cut - off , 55% reported multi - site pain . since the original study included both cases ( recruited when seeking care for lbp or nsp ) and referents , it is likely that the ratio reporting multi - site pain is higher in the present study than it is in a general population . the definition of multi - site pain is vague and primarily refers to concurrent musculoskeletal pain ( sometimes including also headache ) from several body sites . we were able to exclude individuals with medical conditions associated with pain ( e.g. , rheumatoid arthritis , claudication intermittence , nervous disorder or stroke ) , which gave us better control over the nature of the included participants pain complaints . we found it relevant to investigate the locations of the pain reported by the individuals with multi - site pain at baseline , but no pain at follow - up . our presumption was that pain from the extremities might not be of the same kind as lbp or neck pain ( np ) . there was a somewhat lower prevalence of np , shoulder pain and pain from the thoracic spine among the individuals who slept well than among those who slept medium well or worst . due to a paucity of research on multi - site pain , we have referred to research on cwp in this paper . multi - site pain is clinically different from cwp , not only due to chronicity , but also because cwp traditionally shares diagnostic criteria with fibromyalgia , i.e. , pain present from two contralateral quadrants of the body , above and below the waist , and in the axial skeleton ( gupta et al . even though our study indicates a clear trend , some caution has to be observed in interpreting the results . generally , the odds ratios had wide confidence intervals , which indicate limited statistical power and uncertainty in risk estimation . when stratifying the cohort into three strata , the size of the group entering each analysis became small . when investigating migration from one extreme ( e.g. , no pain at baseline ) to another ( e.g. , multi - site pain at follow - up ) , the number of events was few . the trends are however consistent , which strengthens the presumption that there is an association . the high prevalence of multi - site pain in our study might have resulted in overestimated odds ratios ( zhang and yu , 1998 ) , which is another reason for caution in interpreting the results . it is possible that there are other confounders that should have been included in the analysis . due to stratification by pain site , statistical power was lost , and , accordingly , we chose to be very careful in including confounders , so as not to lose more power than necessary . we had no information on the psychosocial factors ( except for work - related ones ) that might have been worth testing in the model , which is a limitation of the study . also , it would have been relevant to investigate the variables in terms of pain severity ( pain intensity and disability ) , so as to exclude the possibility that the participants who slept well were actually the ones who had less severe pain or lower pain intensity . we used a modified version of the standard nordic questionnaire , which did not include any items on pain intensity or disability , and could therefore not exclude the possibility of an effect of pain severity on sleep and the resolution of multi - site pain . in a previous study of the cohort ( submitted for publication ) , however , we saw that the differences in pain intensity in the lower back and neck / shoulder(s ) for the three sleep categories were small . the two questionnaires used for assessments of sleep disturbance and pain sites were both referring to respective symptom occurrences during the last 6 months . with regard to pain , this could have overestimated the events classified as multi - site pain . in previous studies on multi - site pain , questionnaires including items on pain during the last 12 months ( kamaleri et al . , 2011 , 2012 ) or 1 month ( haukka et al . , 2013 ) have been used . the music - norrtlje study was , in its design , a case - referent study , where cases were recruited when participants sought care for lbp or nsp . thus , our data are limited in terms of generalizability in the sense that , there in our cohort , was a larger proportion of individuals with pain who had also sought care for their pain than there is in a general population . cote and colleagues found that only one quarter of individuals with lbp or np sought care , and that individuals seeking care had worse pain , more disabling pain , worse physical - role - functioning , and an over - all poorer health status ( cote et al . , it is also possible that there is a difference between the cases and referent with regard to coping strategies . in the present study , the distribution of cases and referents in the different sleep tertiles was fairly even and the effect of sleep remained after adjusting for inclusion as case or referent. disturbed sleep has been associated with many disorders , among of which pain is just one . nevertheless , sleep is rarely discussed as a factor to consider in the evaluation of intervention programmes , e.g. , in multimodal rehabilitation programmes for chronic pain patients . in clinical settings in sweden , there are recommendations to take psychosocial factors into account when meeting patients with pain , but sleep is not yet a factor mentioned in these recommendations ( socialstyrelsen [ english : national board of health and welfare , 2007 ) . we believe that sleep should be investigated further as a factor in research on individuals with pain in order to investigate whether supplementation of the clinical recommendations is warranted . in this study , we did not focus on the different possible causes of disturbed sleep , but rather on disturbed sleep in general as a predictive factor for the onset or resolution of pain . data were assessed at two time points with 5 years in between . in order to better understand the relationship between disturbed sleep and pain , there are some truly interesting research yet to be performed in order to inquire into possible mechanisms underlying the risk factors for the severance and maintenance of pain . intervention studies may investigate the clinical value of also addressing disturbed sleep in rehabilitation programmes for individuals with pain the results show that sleep disturbance could be a relevant factor to consider when predicting multi - site pain and that non - disturbed ( or less disturbed ) sleep might be relevant when predicting the resolution of multi - site pain . further research on larger study populations is needed to better understand the impact of sleep on the onset and resolution of multi - site pain . sleep disturbance should be considered when evaluating rehabilitation programmes for patients with multi - site pain so as further to investigate its significance in clinical settings . the results show that sleep disturbance could be a relevant factor to consider when predicting multi - site pain and that non - disturbed ( or less disturbed ) sleep might be relevant when predicting the resolution of multi - site pain . further research on larger study populations is needed to better understand the impact of sleep on the onset and resolution of multi - site pain . sleep disturbance should be considered when evaluating rehabilitation programmes for patients with multi - site pain so as further to investigate its significance in clinical settings . socialstyrelsen [ english : national board of health and welfare ] , ( 2007 ) . sjukskrivning vid risk fr lngvarig icke - malign smrta i rrelseapparaten , inklusive fibromyalgi som rr rrelseapparaten [ swedish ] . | backgrounddisturbed sleep and pain often co - exist and the relationship between the two conditions is complex and likely reciprocal .
this 5-year prospective study examines whether disturbed sleep can predict the onset of multi - site pain , and whether non - disturbed sleep can predict the resolution of multi - site pain.methodsthe cohort ( n = 1599 ) was stratified by the number of self - reported pain sites : no pain , pain from 12 sites and multi - site pain ( 3 pain sites ) .
sleep was categorized by self - reported sleep disturbance : sleep a ( best sleep ) , sleep b and sleep c ( worst sleep ) . in the no - pain and pain - from-12 sites strata , the association between sleep ( a , b and c ) and multi - site pain 5 years later was analysed .
further , the prognostic value of sleep for the resolution of multi - site pain at follow - up was calculated for the stratum with multi - site pain at baseline . in the analyses , gender , age , body mass index , smoking , physical activity and work - related exposures were treated as potential confounders.resultsfor individuals with no pain at baseline , a significantly higher odds ratio for multi - site pain 5 years later was seen for the tertile reporting worst sleep [ odds ratio ( or ) 4.55 ; 95% confidence interval ( ci ) 1.2816.12 ] .
non - disturbed ( or less disturbed ) sleep had a significant effect when predicting the resolution of multi - site pain ( to no pain ) ( or 3.96 ; 95% ci 1.699.31).conclusionin conclusion , sleep could be relevant for predicting both the onset and the resolution of multi - site pain .
it seems to be a significant factor to include in research on multi - site pain and when conducting or evaluating intervention programmes for pain . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
about 235 million people across the world suffer from asthma , with no fewer than 50 million nigerians suffering from this disease . asthma is defined as a chronic inflammatory condition characterized by airway hyperresponsiveness to multiplicity of stimuli with wheezing , dyspnea , and cough as the major clinical presentations . achieving and maintaining asthma control requires four major components including assessment and monitoring , education of patients for a partnership in care , control of environmental factors , and comorbid conditions that affect asthma and pharmacotherapy . pharmacotherapy is targeted at two main strategies , namely blocking the release of chemical mediators of bronchoconstriction and then , reversal of bronchoconstriction and other pathologic features of the disease . at present , many drugs including adrenergic stimulants , phosphodiesterase inhibitors , anticholinergic drugs , and corticosteroids are effective in the pharmacotherapy of the disease . these drugs are present in different dosage forms for different routes of administrations and could be used for oral , inhalational , or parenteral routes of administrations . inhalational is the preferred route of delivery for drugs used in the treatment of asthma due to the advantage of direct and localized delivery of a high concentration of the agents to the bronchioles with minimal side effects . a variety of inhaler devices is available including metered dose inhalers ( mdis ) which are the most commonly prescribed and used dosage form . these inhalers deliver an aerosol of drug dissolved or suspended in a propellant directly to the lungs for their local actions . according to the national asthma council , australia , incorrect technique when taking inhaled medications studies also show that patients are unlikely to use inhalers correctly unless they receive clear instructions with physical demonstrations repeated over time . the use of correct inhaler technique has been shown to improve asthma control and asthma - related quality of life . according to ali et al . in line with the national asthma education and prevention program ( naepp ) guidelines , the correct use of mdi involves eleven steps . these steps include :
shake the contents wellremove caphold the inhaler uprighttilt the head back slightlybreathe out slowlyopen mouth with inhaler 12 inches away in the mouth with the lips tightly sealed around itbegin breathing in slowly and deeply through the mouth and actuate the canister oncehold breath for 1020 sexhale and wait one minute before the second doseshake again before the second doseafter use , replace the mouthpiece cover . shake the contents well hold the inhaler upright tilt the head back slightly open mouth with inhaler 12 inches away in the mouth with the lips tightly sealed around it begin breathing in slowly and deeply through the mouth and actuate the canister once hold breath for 1020 s exhale and wait one minute before the second dose shake again before the second dose after use , replace the mouthpiece cover . steps number 1 , 5 , 6 , 7 , and 8 were identified as the critical steps and must be properly applied to maximize benefits . improvement in inhaler technique could be enhanced by methodical education with proper demonstrations from health - care professionals who must have basic knowledge and skills needed to correctly educate their patients . the community pharmacist as the most accessible health - care professional with the key roles of ensuring the safe , appropriate , and effective use of medicines is therefore indispensable in providing this education and training to their patients . therefore , there is a necessity to evaluate the community pharmacists knowledge of the appropriate use of mdis . this was a cross - sectional study carried out in two major cities , namely awka and onitsha in the state of anambra , nigeria . according to the office of the director of pharmaceutical services in the state , about 56 pharmacists were duly registered in both cities ( awka and onitsha ) at the time of carrying out this study . a total of forty - one registered pharmacists were randomly selected for the study using simulated patient approach . two adequately trained undergraduate students from the fourth and fifth year of the faculty of pharmaceutical sciences , nnamdi azikiwe university , awka , anambra state , nigeria , were used . the students were trained using the 11-step guidelines on the appropriate use of mdis for the management of asthma as adapted from the naepp by ali et al . without prior briefing or notice to the pharmacists , one of the students accompanied with the other as a friend presented to the pharmacists as newly diagnosed asthma patient requesting for assistance on how to use his mdi with other asthma medications . as the pharmacists demonstrated the use of the mdi to the mock newly diagnosed asthma patient , the friend noted down the steps as correctly or not correctly demonstrated into a coded form which was later used for further analyses . the data collected were analyzed using statistical package for social sciences program software version 18.0 ( spss inc . frequency analysis was conducted for the demographics , and the average scores on the demonstrations for the pharmacists were computed . one - way anova was used to determine if gender , age , and years of experience had any effects on pharmacists ability to demonstrate the correct use of mdi . ethical approval for the study was obtained from the ethics committee of the nnamdi azikiwe university teaching hospital , nnewi , anambra state , nigeria . the data collected were analyzed using statistical package for social sciences program software version 18.0 ( spss inc . , version 18.0 , chicago , il , usa ) . frequency analysis was conducted for the demographics , and the average scores on the demonstrations for the pharmacists were computed . one - way anova was used to determine if gender , age , and years of experience had any effects on pharmacists ability to demonstrate the correct use of mdi . ethical approval for the study was obtained from the ethics committee of the nnamdi azikiwe university teaching hospital , nnewi , anambra state , nigeria . more than two - thirds of the pharmacists were male ( 73.2% ) and 26.8% were female with a mean age of 45 years 3.25 . while all the pharmacists had bachelor of pharmacy as their first degrees , 2.4% had d. pharm and 19.51% had masters in pharmacy degree [ table 1 ] . sociodemographic characteristics of the community pharmacists the pharmacists demonstration ability mean score was 45.45% . as presented in table 2 , only step 2 , 6 , 7 , and 8 were demonstrated by 50% of the pharmacists . step 7 , which involved breathing in slowly and deeply through the mouth and then depressing the canister once was demonstrated mostly by the practicing pharmacists ( 90.2% ) . other steps that were satisfactorily demonstrated by the pharmacists were step 6 ( 75.6% ) and step 2 ( 63.4% ) . on the other hand , more than half of the practicing pharmacists failed to demonstrate all other steps correctly . demonstration of steps for using metered dose inhalers by the community pharmacists among the five critical steps identified in the 11-step guidelines used , only steps 6 , 7 , and 8 where demonstrated by more than half of the surveyed pharmacists while a very small number of pharmacists correctly demonstrated steps 1 and 5 . further analysis showed that gender , age , and years of practice did not significantly influence the demonstrations ability of the community pharmacists in the study . on the average , the community pharmacists demonstration of the appropriate use of mdi was poor . the introduction of mdis is a major innovation in the therapeutic management of asthma because of the direct delivery of its medications to the respiratory system thus reducing the first pass effect while minimizing the systemic side effects . according to al - hassan , the treatment outcomes for asthmatic patients on mdis are widely dependent on the appropriate use of the inhalers . the understanding of the appropriate use of these inhalers is dependent on the health - care professionals who must educate and counsel these patients . hence , the need to ascertain the knowledge of these health - care professionals on these devices use . the pharmacists as the first point of call for most patients and as the member of the health - care team primarily charged with the responsibility of drug dispensing and counseling have greater responsibility in this education and demonstration of correct medication / device use . like in other countries , poor asthma device use techniques , especially the inhalational agent devices has been identified to be one of the major contributors to poor asthma control in nigeria with a resultant increase in asthma symptoms , lifestyle restrictions , and increased emergency care visits . this poor device use techniques have been blamed on the inadequate education of the patients by the health - care providers . the poor demonstration observed in this study is similar to findings from other countries that reported a high proportion of health - care professionals showing incorrect inhaler use technique . begin breathing slowly and deeply through the mouth and to depress the canister once while step 4 which involves tilting of head back slightly was the least . further analysis of the results showed that there was no influence of gender on the ability of the community pharmacists to demonstrate the step , similar to the findings of chafin et al . similarly , qualification and years of experience had no impact on the outcome of the scores of the respondents . however , the reports of odili and okoribe observed that pharmacists with d. pharm showed a better performance . the poor inhaler use technique observed among the practicing pharmacists in this region may be due to lack of training and retraining of the practicing pharmacists . it has been shown by most researchers that routine training and retraining of health - care providers through continued professional development could improve the mdi use skills of both the health - care providers and the patients . hence , there is a need to commence training and retraining of practicing pharmacists in this region on current activities in asthma management . this could form a part of the annual mandatory continuing professional development organized by the pharmacists council of nigeria which is designed to update the knowledge and skills of pharmacists in current trends and global best practices in pharmacy . one limitation of this study is that the presentation of the simulator may have influenced the pharmacists demonstration which may have affected the entire result . second , not purchasing the inhaler from the premise may have led to the loss of the pharmacists interest leading to the shabby demonstration . recording of the demonstrations which were not carried out would have led to more reliable scoring since it was only one scorer that was used . this study showed that community pharmacists in the region lack the proper knowledge and skills to demonstrate the use of mdis to their patients . hence , implementing training programs focusing on the use of these devices will enable practicing pharmacists to educate and impart knowledge on the effective use of mdi to their patients . | rationale : the pharmacist charged with the responsibility of drug administration and counseling should have the basic knowledge and skills necessary to demonstrate the use of metered dose inhalers ( mdis ) to asthma patients for the maximization of treatment outcomes.objective:this study was designed to evaluate the community pharmacists knowledge of the appropriate use of mdis in anambra state , nigeria.methods:the study was carried out in two major cities in anambra state , nigeria , using 41 registered community pharmacists . a simulated patient approach utilizing two adequately trained pharmacy students
were used .
obtained data were analyzed using independent t - test and one - way anova through spss version 18.results:the pharmacists had a mean demonstration score of 45.45% .
step number seven of the correct use of mdi , which involves breathing in and depressing the canister was the most demonstrated step ( 90.2% ) while step 4 which involves tilting the head back slightly was the least demonstrated ( 14.6% ) by the pharmacists . among five
identified critical steps in asthma guideline used , two were well demonstrated ( 75.6% and 90.2% ) : one averagely demonstrated ( 51.2% ) and two poorly demonstrated ( 39% and 31.7% ) .
sociodemographic characteristics did not influence the demonstration ability of the pharmacists in this study.conclusion:the study indicated that community pharmacists lacked the adequate knowledge of appropriate use of mdi .
training programs for pharmacists focusing on the use of such devices will enable them to educate patients on the effective use of mdis in patients with asthma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
t cells are a minor population of lymphocytes expressing and t cell receptor ( tcr ) chains , which are often considered to bridge innate and adaptive immune responses . recent studies have shown that t cells can comprise up to 50% of the t cells within epithelium or mucosa - rich tissues and less than 10% in peripheral blood . the specific localization and abundance of these cells suggest that they might be markedly implicated in epithelial / mucosal immunity [ 2 , 3 ] . in contrast to recognition of antigens by t cells , t cells recognize antigens directly without any requirement for antigen processing and presentation or major histocompatibility complex ( mhc ) molecules . it has been indicated that t cells may play crucial roles in the development and perpetuation of allergic inflammation as effector and immunoregulatory cells , via production of t helper ( th)1- , th2- , and th17-associated cytokines , which not only induce the synthesis of ige but also recruit effector cells like eosinophils and basophils into the site of allergic inflammation . besides , different subsets of t cells can show different functions , depending on what tissue they are found in and which specific tcrs they bear . even though there is a growing consensus about the importance of these cells in allergic immune responses , the present review focuses on the latest knowledge on characteristics and role of t cells in allergic diseases . as research continues , it has been realized that t cells are not a homogeneous population of cells with a single physiological role , and their subset complexity is being characterized , both in mice and humans . tcr v- and v-encoded chain pairs may interact with distinct ligands in different tissues and be expanded on that basis . defined by the usage of either v1 or v2 tcr ( v3 and v5 making up minor populations ) , human t cells fall into two major subsets : v2 t cells account for the majority ( 5095% ) of circulating t cells , whereas v1 t cells are rare in the blood but appear at increased frequencies in mucosal tissues and in the skin [ 710 ] . the v9v2 ( also termed v2v2 , collectively designated v2 ) t cells in the peripheral blood can sometimes identify over 50% of leucocytes after certain bacterial or parasitic infections and rapidly get activated ; therefore , such tcr - dependent activation of v9v2 t cells enables them to respond to a diverse range of pathogens . according to the surface expression of cd45ra and cd27 , markers more commonly used to identify the naive , effector , or memory status of conventional t cells , human v9v2 t cells , are often subdivided into four subsets : naive ( tnaive ) cd45racd27 cells ; central memory ( tcm ) cd45racd27 cells ; effector memory ( tem ) cd45racd27 cells ; cd45ra effector memory tnaive and tcm cells express lymph node homing receptors , abound in lymph nodes , and lack immediate effector functions . conversely , tem and temra cells , which express receptors for homing to inflamed tissues , are poorly represented in the lymph nodes while abounding in sites of inflammation and display immediate effector functions . it indicates a lineage differentiation pattern for human v2 t cells that generates naive cells circulating in lymph nodes , effector / memory cells patrolling the blood , and terminally differentiated effector cells residing in inflamed tissues . in contrast to v2 , the tcr- chain usage by the tissue - associated v1 t cells varies at distinct anatomic locations . v1 t cells in the periphery express a naive phenotype and may migrate preferentially to localized sites when they are activated . for instance , v2 , v3 , v5 , v6 , and v7 are used predominantly by t cells in peripheral lymphoid organs , skin , small intestine , tongue , and reproductive system , respectively [ 14 , 15 ] . in contrast , v1 and v4 are preferentially expressed in the respiratory system like nasal mucosa and lung [ 1618 ] . recent studies have indicated that these tissue - associated v1 t cells may play an important function not only in maintaining immune homeostasis in the local microenvironment but also in wound healing , removing distressed or transformed epithelial cells and subduing excessive inflammation , in both mice and humans [ 2022 ] . besides , the role of these mucosa predominantly expressed t cells in allergic diseases has also been noticed . our preliminary studies found that the infiltration of t cells significantly increases in the nasal mucosa of patients with perennial allergic rhinitis ( ar ) ( data not shown ) . moreover , pawankar et al . proved that the increased population of t cells in the perennial ar patients ' nasal mucosa mainly comprises of v1v1 subsets . in mice sensitized and challenged with ova , cook et al . observed that v1 t cells spontaneously enhance airway hyperresponsiveness ( ahr ) , whereas v4 t cells , after being induced by allergen sensitization and challenge , suppress ahr . these data suggest that t cells of distinct phenotypes may play different , sometimes opposed , functions in airway allergic inflammation . however , it is still premature to speculate whether the v4 subsets of t cells may exert an important role in maintaining immune homeostasis in local microenvironment of healthy humans ; on the other hand , the v1 subsets may take an essential part in the development and perpetuation of allergic inflammation as effectors in atopy patients . besides , our another recent study showed that different subsets of t cells in peripheral blood of perennial ar patients before and after specific immunotherapy ( sit ) appear with distinct expression patterns . but whether t cells in peripheral blood and in mucosa function separately or synergistically remains an unsolved problem . with age , there comes the change from having fairly diverse pairs of t cells ( of which v1 subsets serve as the majority in cord blood at birth ) to increasingly restricted pairings ( with v9v2 t cells becoming the major subsets with very limited receptor diversity by adulthood ) . from birth to about 10 years of age , the absolute number of t cells in the periphery increases , with the v9v2 t cell subsets expanding from a minor population at birth to usually more than 75% of circulating t cells [ 13 , 26 ] . v9v2 t cells are known to respond to many different phosphoantigens , so it is likely that the exposure to a variety of pathogens results in the selection of these cells in early life . this clonal expansion has been seen as evidence of the vital role these t cells play in responding to environmental challenges in early life . however , it has not been demonstrated whether this phenomenon is in fact primary in response to environmental challenges but not , at least in part , endogenous stimuli , as an extension of the adaptive changes taking place within the newborn . previous longitudinal cohort studies have shown that most childhood asthma begins in infancy , and between 40% and 75% of children with asthma will have complete resolution of symptoms by adolescence or adulthood . respiratory syncytial virus ( rsv ) infection in lower respiratory tract in early childhood is a risk factor for the subsequent development of allergic sensitization such as wheezing up to age of 11 years . aoyagi et al . reported that compared to age - matched controls , infants affected by rsv - bronchiolitis have lower frequencies of ifn--producing t cells in peripheral blood . moreover , they noticed normalization of this frequency during the convalescent phase , suggesting that the defective ifn- production by these cells may play an important role in the development of asthma . however , it is too early to conclude whether the expansion of v2v9 t cells with age is associated with childhood asthma spontaneous remission by adolescence . in adulthood , studies have also found the possible great impact of age and gender on the t cell repertoires : in contrast to childhood , the absolute number of t cells decreases , as the result of reduction of v2 , but not v1 t cells . besides , the number of total t cells and v2 t cells are both significantly higher in males than in females [ 31 , 32 ] . it indicates that age- and gender - matched controls are essential for clinical studies of t cell repertoires in patients . refers to the natural history of atopic manifestations , which is characterized by a typical sequence of ige antibody responses and clinical symptoms that appear early in life , persist over years or decades , and often remit spontaneously with age . new allergy can occur throughout life ; generally , allergy prevalence and severity tend to decrease after young adult life , and th2-type responses may weaken with age . found that immunization dose , sex , and age are highly influential on allergy outcomes in murine models . nevertheless , further researches are required to make certain whether the change of t cell subsets is associated with the age and gender related allergic march . selective allergen recognition by tcr that binds specific regions of the antigen molecules is the priming and initiation of antigen - specific t cell immune responses . so far , more than 4000 substances in the environment , the vast majority of which are proteins , mostly enzymes , have been identified as allergens that elicit an ige - mediated immune response in a genetically predisposed individual . different from mhc - restricted recognition of bound peptides by tcrs , the antigen specificity of t cells involves the immunoglobulin - like structure of the tcr with the recognition of unprocessed peptides , small organic phosphate molecules , or alkylamines derived from microbes and edible plants . studies have shown that the epithelial - associated t cells can recognize stress - induced self - antigens , which enables them to monitor multiple insults to the epithelium . however , data from humans and mice seem to indicate the relevance of mucosa - associated t cells in allergen recognition and airway inflammation , perhaps mediated by interaction of foreign antigens with cd1 dendritic cells ( dcs ) . the study by russano et al . showed that cd1 immature dcs expand in the respiratory mucosa of allergic subjects and are able to process both proteins and lipids , and cd1-restricted phospholipids ( pl)-specific t cells represent the key mucosal regulatory subsets for the control of early host reactivity against tree pollens . these cd1-restricted t cells can respond promptly to lipid - antigen recognition by secreting a wide array of cytokines , including high amounts of il-4 , and expand at mucosal allergic inflammation sites . in addition , t cells derived from nasal mucosa in allergic subjects could also recognize pollen derived pe in a cd1d - restricted fashion . therefore , it may be speculated from above that the early allergic response initiates with primary mucosal recognition of allergen by cd1 dcs and cd1-restricted t cells , which ensure rapid handling of the foreign inhaled grain . it is proposed that t cells may act as an extended arm of t cells , by providing a rapid but weaker response before the t - cell response has fully developed . substantial evidence has been accumulated to indicate that t cells have the potential to produce th17-type cytokines ( like il-17 ) and th2-type cytokines ( il-4 , -5 , and -13 ) and thus enhance airway allergic inflammation and ahr . in contrast , th1-type cytokines ( il-12 and ifn- ) produced by t cells might be induced after special immunotherapy and inhibition of these allergic diseases [ 42 , 43 ] . the study by ribot et al . showed that in the spleen and lymph nodes and in the peripheral tissues of mice , the presence or absence of the cytokine cd27 distinguishes two t cell subsets : the cd27 cells produce ifn- , whereas the cd27 cells ( 50% of v4 and 11% of v1 ) produce primarily il-17 . it suggests the existence of a differential requirement for optimum activation of these distinct t cell subsets in the peripheral immune compartment . in humans , 80% of circulating v9v2 t cells are ifn- producers , while less than 1% produce il-17 . observed that ifn- v9v2 t cells have a predominant tem and at a lower extent temra phenotype , while il-17 v9v2 t cells exhibit a temra phenotype . however , il-17 v9v2 t cells significantly increase and secrete abundant il-17 at sites of inflammation ( perhaps primarily at epithelial surfaces ) , which may directly shape the inflammatory infiltrate , for example , by attracting neutrophils during bacterial infection . . also found that the ifn-/il-17 ratio in t cells significantly decreases in patients with allergic asthma compared with healthy controls . what is more , several t cells are indicated to be a chief source of il-17 in peripheral tissues such as lung , which share certain common features with th17 cells [ 4850 ] . with regard to humans v9/v2 segments have an ifn--producing phenotype and might thus have a partial ability to modulate allergen - specific th2-skewed immunity . in a word , after quick antigen recognition and full activation , diverse subsets of t cells in the circulating blood and various lymphoid compartments subsequently produce an array of different cytokines , performing proinflammation as well as pleiotropic immunoregulatory functions , as it will be further discussed . lately , kalyan and kabelitz provided a biographical sketch of t cells : in a continuum , innate natural killer ( nk ) cells and adaptive t cells respond to the missing self and the dangerous nonself , respectively , while t cells respond to the safe nonself and deal with the inevitable distressed self . what is more , nk cells could contribute to responding to the distressed self , whereas t cells have some regulatory training to temper the response to the safe nonself ( figure 1 ) . this sketch supports the viewpoint that t cells serve as the bridge between innate and adaptive immunity . allergy is primarily considered as a classic th2-driven immune response against allergens ( safe nonself ) , with important contributions to pathology by th2-type cytokines il-4 , -5 , and -13 , which not only induce the synthesis of ige but also recruit effector cells like eosinophils and basophils into the site of allergic inflammation . however , inflammatory responses in allergic diseases are more complex than simple overexpression of th2 cytokines . a recent hypothesis has been put forward to rely on the genetically determined barrier deficiency and disruption by environmental and endogenous proteases in the epithelial barrier ( distressed self ) , which might result in the allergen uptake as a primary defect in the pathogenesis of allergic reactions . it seems that allergy is both an epithelial disease and a disease of the immune system . using an adoptive cell transfer approach , jin et al . found that nk and t cells ( only v1v5 subsets ) are necessary for the acute stages of ahr in mice but not for the later airway eosinophilic inflammation . another study on ahr demonstrated that nk cells secreted il-4 and -13 to produce their effector function , but t cells did not have this effect . in addition , t cells , similar to nk cells , express the nkg2d receptor that may contribute to effective stress - responses as well as immune surveillance , which may be relevant in the induction of food allergy . these data suggest that the interaction of innate and adaptive immune cells and the impact of the inflammatory responses on this collaboration seem to be important and worthy of further research . the respiratory mucosa such as nasal mucosa , bronchial mucosa , and lung contain t cells as well . this may be of importance in the remarkable resistance of the airway against environmental stimuli . substantial evidence has been accumulated to indicate that t cells take part in th2 immune responses . t cells themselves can not only take the function of follicular th cells in certain responses but also can support responses that are dependent on classical help provided by t cells . an increase in t cells expressing th2-type cytokines has been reported in bronchoalveolar lavage ( bal ) fluids of allergen challenged asthmatic patients . in addition to proinflammatory function , the t cells also engage as regulators of th2 immunity , in particular regulating the ige antibodies [ 3 , 38 , 40 ] . svensson et al . showed that t cell - deficient mice exhibited a diminished allergen specific ige response compared with wild - type ( wt ) mice , indicating that t cells contribute to b cell secretion of allergen - specific ige , either by promoting ig class switch to ige or by providing activation signals to differentiated ige - producing cells . reported a low antigen specific ige and il-5 release and a decrease in t cell infiltration in the same mouse models . they further found that the response could be restored when il-4 was administered , suggesting that t cells contribute to type 2-mediated airway inflammation by inducing il-4 dependent ige and igg1 responses . in contrast , lahn et al . showed that t cells exert a suppressive role in the th2 response to allergen challenge . therefore , it is clear that t cells might have various , possibly opposing roles for cd4 t cells . studies have demonstrated that , in the airway , distinct subsets of t cells , defined by their expression of tcr- , seem to exhibit differential and sometimes opposed th - like reactivities in allergen - induced allergic inflammation [ 7 , 47 ] . in mouse models of allergic diseases , it has been shown that the v1 subsets can enhance ahr as well as levels of th2 cytokines in the airways and eosinophilic infiltrates in the lungs [ 61 , 62 ] , and , in contrast , the v4 subset can be induced to inhibit ahr [ 63 , 64 ] . selectively depleted either subset in the lungs ( using aerosolized , inhaled anti - tcr abs ) following airway challenge and observed that ahr is altered in the predicted fashion ; that is , depletion of v1 cells decreases and depletion of v4 cells increases ahr . after transferring few purified v1 cells into ova / alum immunized tcr- mice , huang et al . observed the increase of the ova - specific ige responses , suggesting that individual enhancer cells are quite potent . however , the relative importance of t cells in human asthma remains to be determined . it has been shown for some time that murine t cells become functionally competent in the thymus , particularly regarding the production of proinflammatory cytokines ifn- and il-17 . . found that t cells regulate ige responsiveness to inhaled antigens by high production of ifn-. by using mice immunized with recombinant vaccine virus expressing rsv f protein and challenged with live rsv , dodd et al . reported that v4 subsets are recruited into the lungs and produce ifn- in a time - dependent manner . these studies suggest that antigen - specific t cells are able to suppress the pathogenic th2 response in allergic asthma , whereas a recent study by chen et al . found that the serum levels of il-4 and il-13 in peripheral blood of children with ar and asthma markedly decrease while ifn- increases after receiving sit , suggesting that ifn- t cells might exert their th2 immunosuppression under certain conditions like sit . our recent study showed that the serum levels of il-17 and il-23 in the ar patients were significantly higher than those in the healthy subjects , and positive correlations exist between the il-17 and the il-23 levels , as well as the il-17 level and t frequencies . accordingly , we conjecture that the il-23r il-17 t cells may promote t cell - mediated traditional th2 inflammation via producing abundant il-17 . in addition , il-17-producing t cells could directly promote the development of other il-17-producing t cells , and these innate il-17-producing t cells are involved in sensing stress , injury , or pathogens and serve an immunoregulatory role at epithelial sites . gonalves - sousa et al . reported that murine cd4cd25foxp3 regulatory t cells ( treg ) abolish key effector functions and proliferation of t cells both in vitro and in vivo . they further showed that the suppression is dependent on cellular contact between treg and t cells and is partially mediated by glucocorticoid - induced tnf receptor - related proteins . it reveals a novel mechanism , by which t - cell function is regulated , and suggests that endogenous treg may prevent the desired effects of t cell - based immunotherapies . it has also been shown by hahn et al . that t cells affect the level of il-10 in the airways and block their function resulting in an increase of treg in the lung , which suggests that t cells might inhibit treg function . while these data highlight the importance of understanding how the proinflammatory and immunoregulatory functions of t cells are regulated , the detailed processes remain poorly understood . t cells stimulated with bisphosphonate compounds , which are clinically well tolerated and used for t cell expanders in vitro and in vivo , have been considered to be good candidates for cancer immunotherapy , because of their ifn- production and cytotoxic effect . therefore , the adoptive transfer of autologous t cells expanded in vitro might also be an effective strategy for il-4-mediated allergy . it has been shown that oral tolerance , which refers to the active state of nonresponsiveness to food and food protein intake , is a unique feature of the ( gut - associated ) mucosal immune system . and most intestinal epithelial lymphocytes ( iels ) in the mouse consist of t cells , which are localized in the paracellular space between intestinal epithelial cells at the luminal site of the basement membrane . mengel et al . showed that treating mice with a tcr--specific antibody results in impaired oral tolerance induction and that oral tolerance could be transferred by means of t cells . it suggests that targeting intestinal t cells may provide preventing and therapeutic strategies for food allergy . however , currently iels are among the least studied cells in the process of allergic sensitization . studies have shown that many phosphoantigens and fungal immunomodulators play an important role in t cell - mediated immunotherapy . for example , ( e)-4-hydroxy-3-methyl - but-2-enyl pyrophosphate is characterized as a very potent agonist of v9v2 responses and could strengthen the principle of t cell based immunotherapy . in contrast , gonalves - sousa et al . described that treg could negatively modulate the t cell activities and stressed the importance of combining treg inhibition with t cell activation for future immunotherapeutic strategies . in animal models , chronic allergen challenge induces suppression of the th2 response and reduces ahr and airway inflammation [ 77 , 78 ] . reductions of late - phase asthmatic responses to allergen after long - term allergen challenge have also been reported in clinical studies [ 79 , 80 ] . . indicated that the v4 subsets appear to mediate such suppressive effect of long - term allergen challenge on ahr . in addition , t cells could also suppress th2-dependent ige responses without affecting parallel igg responses to inhaled antigens . taken together , t cells may have the potential to help alter the th2-skewed immunity in patients with allergic diseases . further accumulated studies to clarify the ability of t cells as an allergic immunotherapy candidate are thus called for . recent studies in humans and mice suggest that they can both drive and regulate allergic immune responses through different mechanisms . however , many aspects of the characteristics and role of t cells in allergy remain to be fully elucidated in near future , for instance , the exact effects of various t cell subsets on allergic inflammation ; the underlying relations between blood- and mucosa - associated t cells ; how age and gender influence the population , distribution , and function of t cells in allergic diseases ; the specific regulatory mechanisms of t cells in allergy ; how t cells could be applied to prevent and treat allergic diseases , and so on . | the predominant distribution of t cells in the mucosal and epithelial tissues makes these unconventional lymphocytes the guards to contact external environment ( like allergens ) and to contribute to immune surveillance , as well as
vanguards to participate in initiating mucosal inflammation . therefore
, t cells have been considered to bridge the innate and adaptive immunity .
the role these cells play in allergy seems to be complicated and meaningful , so it makes sense to review the characteristics and role of t cells in allergic diseases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this randomized , double blind , placebo - controlled , 2-period , 2-treatment crossover trial evaluated the safety and efficacy of 21 days of twice daily ( bid ) treatment with tv-45070 ointment in phn patients . the study was conducted between august , 2010 and march , 2011 at 24 sites in the united states . the study included 2 , 1-week patient - blind placebo run - in periods ( before each treatment period ) , and 2 , 3-week double - blind treatment periods ( fig . 1 ) . a 1-week washout separated treatment period 1 ( tp1 ) and the second placebo run - in period , effectively separating each randomized treatment period by 2 weeks . the first single - blind , placebo run - in period was 1 week in duration ( day-7 to day-1 ) . at randomization ( visit 3 ) , patients were randomized in a crossover design to 1 of 2 treatment sequences : tv-45070/placebo or placebo / tv-45070 . the 1-week between - treatment washout period ( between visits 6 and 7 ) , study medication was not applied , but patients continued to record pain scores using the interactive voice response system . the second single - blind , placebo run - in period was 1 week in duration ( day-29 to day-35 ) . in tp2 , patients received the medication that was not received during tp1 . one week after the end of tp2 , patients returned for a follow - up visit ( visit 12 ) . patients with mean daily pain scores of 4 ( using an 11-point numerical rating scale ) for at least 4 days during the initial placebo 7 day run - in period were randomized in a 1:1 ratio through an interactive voice response system to 1 of 2 treatment sequences ( tv-45070/placebo or placebo / tv-45070 ) . throughout the study ( including washout ) , patients recorded pain scores 4 times each day ( upon waking , 12 noon1 h , 4 pm1 h , and 8 pm1 h ) using an 11-point numerical rating scale , and reported them through telephone to the interactive voice response system . after treatment period 1 ( tp1 ) and the 1-week washout , patients entered a second patient - blinded , placebo run - in period . unlike tp1 , patients were not required to report a minimum mean daily pain score before entering treatment period 2 . all patients applied 7.5 l of ointment per cm of affected skin , covering the entire painful area ( up to a maximum of 400 cm ) . the actual dose applied varied according to the size of the treatment area ( determined by the investigator ) . patients were given 1 of 4 area - specific dosing cards , indicating the amount of ointment to be applied ( 60 , 120 , 180 , or 240 mg of tv-45070 bid , table 1 ) . patients were allowed to rescue with acetaminophen ( up to 4000 mg / d ) and recorded any use in a diary . doses administered by size of treatment area a central independent review board approved the study protocol and amendments . all participants provided written informed consent . the study was performed in accordance with the declaration of helsinki and international conference on harmonization guideline on good clinical practice and is registered with clinicaltrials.gov ( nct01195636 ) . males and females of nonchildbearing potential , aged 18 to 80 years , with a clinical diagnosis of phn , persistent pain for > 6 months from the appearance of herpes zoster rash and intact skin over the treatment area were eligible for inclusion . exclusion criteria were patients with systemic disease that would have put them at an additional risk or limited their ability to participate , phn on the face or in proximity to mucous membranes , creatinine clearance < 30 ml / min , history of serious mental or psychiatric illness , known sensitivity to topical products , active herpes zoster lesions or dermatitis , other severe or chronic pain conditions , or patients who had participated in > 1 topical pain study and/or > 3 phn studies . patients were also excluded if they had received a local anesthetic in 2 weeks before randomization , nerve blocks within 30 days of randomization , qutenza or other capsaicin preparations in the 90 days before screening , or if they used opioids , local prescription or nonprescription therapy ( lidocaine patch , transcutaneous electrical nerve stimulation , etc . ) and were unable to washout for the study . patients were permitted to remain on stable doses of up to 2 of the following : gabapentin , pregabalin , duloxetine , or amitriptyline . stable doses were defined as remaining unchanged for the 4 weeks before the start of the first placebo run - in period , with no planned doses changes during the study . safety assessments included adverse event reporting , laboratory measurements ( serum chemistry , hematology , and urinalysis ) , 12-lead electrocardiograms , vital signs , and physical examinations ( including assessments for local irritation and numbness were performed at regular clinic visits . pharmacokinetic plasma samples were collected at each weekly visit to determine the extent of systemic exposure of tv-45070 using a validated bioanalytical method . efficacy assessments included patient reported pain intensity ( 4 times per day ) and daily sleep interference scores ( dsis , an 11-point numerical rating scale where 0=pain does not interfere with sleep and 10=completely interferes ) . the 4 daily pain intensity scores were combined to generate a mean daily pain score . the neuropathic pain symptom inventory ( npsi , a 12-point questionnaire to evaluate different neuropathic pain symptoms ) and patient global impression of change ( pgic ) were also assessed at clinic visits . as an exploratory endpoint , for patients who consented to genetic testing , a dna sample was collected and genotyped for nav1.7 r1150w carrier status . the sample size was estimated to provide 80% power to detect a 1.0-point difference in mean pain intensity . the calculation assumed a significance level of 0.05 and a within - patient sd of 2.25 . the treatment effect and sd were selected based on review of other similar phn studies.1214 an interim analysis was performed after 21 patients completed the study to determine if the estimated sd was appropriate and if the sample size required adjustment . as a result , the significance level for the final analysis of the primary variable was adjusted to =0.049 . safety variables including pharmacokinetic exposure measures were summarized using descriptive statistics for continuous variables and frequency and percentage for categorical variables . the primary efficacy endpoint was the difference in mean change from baseline in mean daily pain score between the last week ( week 3 ) of tv-45070 treatment and the last week of placebo treatment . baseline for each treatment period was the average of the 7 mean daily pain measurements in the preceding patient - blind placebo run - in period . the mean daily pain scores for weeks 1 , 2 , and 3 of each treatment period were similarly defined . if the third week in a treatment period had < 4 days of recordings , the last observation carried forward ( locf ) algorithm was used ( ie , the average of the last 4 d with at least 1 pain score ) . the hypothesis that the mean change in mean daily pain scores from baseline would differ between tv-45070 and placebo was tested using a mixed effects analysis of covariance model , with period and sequence as fixed effects , patient within treatment sequence as a random effect , and the baseline pain score as a covariate . secondary efficacy analyses included : number of patients with 30% and 50% improvement in mean pain score from baseline . changes in mean daily pain scores from baseline to each week of treatment and over the entire treatment period . number of patients with a mean improvement from baseline of 1 , 2 , and 3 or more points for each week of treatment and overall . changes in dsis , npsi , and pgic scores from baseline to the end of treatment . for categorical variables the numbers and percentages of patients in each treatment group in each category were summarized . exploratory analyses included examining response to treatment in the subgroup of patients who were carriers of the nav1.7 r1150w polymorphism . this randomized , double blind , placebo - controlled , 2-period , 2-treatment crossover trial evaluated the safety and efficacy of 21 days of twice daily ( bid ) treatment with tv-45070 ointment in phn patients . the study was conducted between august , 2010 and march , 2011 at 24 sites in the united states . the study included 2 , 1-week patient - blind placebo run - in periods ( before each treatment period ) , and 2 , 3-week double - blind treatment periods ( fig . 1 ) . a 1-week washout separated treatment period 1 ( tp1 ) and the second placebo run - in period , effectively separating each randomized treatment period by 2 weeks . the first single - blind , placebo run - in period was 1 week in duration ( day-7 to day-1 ) . at randomization ( visit 3 ) , patients were randomized in a crossover design to 1 of 2 treatment sequences : tv-45070/placebo or placebo / tv-45070 . the 1-week between - treatment washout period ( between visits 6 and 7 ) , study medication was not applied , but patients continued to record pain scores using the interactive voice response system . the second single - blind , placebo run - in period was 1 week in duration ( day-29 to day-35 ) . in tp2 , patients received the medication that was not received during tp1 . one week after the end of tp2 , patients returned for a follow - up visit ( visit 12 ) . patients with mean daily pain scores of 4 ( using an 11-point numerical rating scale ) for at least 4 days during the initial placebo 7 day run - in period were randomized in a 1:1 ratio through an interactive voice response system to 1 of 2 treatment sequences ( tv-45070/placebo or placebo / tv-45070 ) . throughout the study ( including washout ) , patients recorded pain scores 4 times each day ( upon waking , 12 noon1 h , 4 pm1 h , and 8 pm1 h ) using an 11-point numerical rating scale , and reported them through telephone to the interactive voice response system . after treatment period 1 ( tp1 ) and the 1-week washout , patients entered a second patient - blinded , placebo run - in period . unlike tp1 , patients were not required to report a minimum mean daily pain score before entering treatment period 2 . all patients applied 7.5 l of ointment per cm of affected skin , covering the entire painful area ( up to a maximum of 400 cm ) . the actual dose applied varied according to the size of the treatment area ( determined by the investigator ) . patients were given 1 of 4 area - specific dosing cards , indicating the amount of ointment to be applied ( 60 , 120 , 180 , or 240 mg of tv-45070 bid , table 1 ) . patients were allowed to rescue with acetaminophen ( up to 4000 mg / d ) and recorded any use in a diary . a central independent review board approved the study protocol and amendments . all participants provided written informed consent the study was performed in accordance with the declaration of helsinki and international conference on harmonization guideline on good clinical practice and is registered with clinicaltrials.gov ( nct01195636 ) . males and females of nonchildbearing potential , aged 18 to 80 years , with a clinical diagnosis of phn , persistent pain for > 6 months from the appearance of herpes zoster rash and intact skin over the treatment area were eligible for inclusion . exclusion criteria were patients with systemic disease that would have put them at an additional risk or limited their ability to participate , phn on the face or in proximity to mucous membranes , creatinine clearance < 30 ml / min , history of serious mental or psychiatric illness , known sensitivity to topical products , active herpes zoster lesions or dermatitis , other severe or chronic pain conditions , or patients who had participated in > 1 topical pain study and/or > 3 phn studies . patients were also excluded if they had received a local anesthetic in 2 weeks before randomization , nerve blocks within 30 days of randomization , qutenza or other capsaicin preparations in the 90 days before screening , or if they used opioids , local prescription or nonprescription therapy ( lidocaine patch , transcutaneous electrical nerve stimulation , etc . ) and were unable to washout for the study . patients were permitted to remain on stable doses of up to 2 of the following : gabapentin , pregabalin , duloxetine , or amitriptyline . stable doses were defined as remaining unchanged for the 4 weeks before the start of the first placebo run - in period , with no planned doses changes during the study . safety assessments included adverse event reporting , laboratory measurements ( serum chemistry , hematology , and urinalysis ) , 12-lead electrocardiograms , vital signs , and physical examinations ( including assessments for local irritation and numbness were performed at regular clinic visits . pharmacokinetic plasma samples were collected at each weekly visit to determine the extent of systemic exposure of tv-45070 using a validated bioanalytical method . efficacy assessments included patient reported pain intensity ( 4 times per day ) and daily sleep interference scores ( dsis , an 11-point numerical rating scale where 0=pain does not interfere with sleep and 10=completely interferes ) . the 4 daily pain intensity scores were combined to generate a mean daily pain score . the neuropathic pain symptom inventory ( npsi , a 12-point questionnaire to evaluate different neuropathic pain symptoms ) and patient global impression of change ( pgic ) were also assessed at clinic visits . as an exploratory endpoint , for patients who consented to genetic testing , the sample size was estimated to provide 80% power to detect a 1.0-point difference in mean pain intensity . the calculation assumed a significance level of 0.05 and a within - patient sd of 2.25 . the treatment effect and sd were selected based on review of other similar phn studies.1214 an interim analysis was performed after 21 patients completed the study to determine if the estimated sd was appropriate and if the sample size required adjustment . as a result , the significance level for the final analysis of the primary variable was adjusted to =0.049 . safety variables including pharmacokinetic exposure measures were summarized using descriptive statistics for continuous variables and frequency and percentage for categorical variables . the primary efficacy endpoint was the difference in mean change from baseline in mean daily pain score between the last week ( week 3 ) of tv-45070 treatment and the last week of placebo treatment . baseline for each treatment period was the average of the 7 mean daily pain measurements in the preceding patient - blind placebo run - in period . the mean daily pain scores for weeks 1 , 2 , and 3 of each treatment period were similarly defined . if the third week in a treatment period had < 4 days of recordings , the last observation carried forward ( locf ) algorithm was used ( ie , the average of the last 4 d with at least 1 pain score ) . the hypothesis that the mean change in mean daily pain scores from baseline would differ between tv-45070 and placebo was tested using a mixed effects analysis of covariance model , with period and sequence as fixed effects , patient within treatment sequence as a random effect , and the baseline pain score as a covariate . secondary efficacy analyses included : number of patients with 30% and 50% improvement in mean pain score from baseline . changes in mean daily pain scores from baseline to each week of treatment and over the entire treatment period . number of patients with a mean improvement from baseline of 1 , 2 , and 3 or more points for each week of treatment and overall . changes in dsis , npsi , and pgic scores from baseline to the end of treatment . continuous variables were summarized using similar methods as for the primary efficacy variable . for categorical variables the numbers and percentages of patients in each treatment group in each category were summarized . exploratory analyses included examining response to treatment in the subgroup of patients who were carriers of the nav1.7 r1150w polymorphism . in total , 129 patients were screened and 109 ( 84.5% ) entered the first placebo run - in period , 70 patients were randomized : 35 ( 50.0% ) to each treatment sequence . fifty - four ( 77.1% ) patients completed the study and 16 ( 22.9% ) discontinued ( fig . reasons for discontinuation included adverse event ( 8 [ 11.4% ] patients ) , withdrawal of consent ( 6 [ 8.6% ] patients ) , protocol violation ( 1 [ 1.4% ] patient ) , and lost to follow - up ( 1 [ 1.4% ] patient ) . the tv-45070/placebo sequence had a slightly lower mean age than the placebo / tv-45070 sequence ( 58.3 vs. 63.1 y ) . overall , the mean number of months since herpes zoster rash healing was 77.1 months ( range , 3.6 to 558.1 mo ) . patients were relatively evenly distributed between the 4 categories of treatment area ; 61.4% of patients were allocated to the 2 smaller areas of application ( ie , < 201 cm ) . seventeen ( 24.3% ) patients remained on one or more of the permitted phn medications during the study , ( 15 [ 21.4% ] patients remained on gabapentin and 2 [ 2.9% ] on pregabalin ) . patient demographics and disease characteristics by treatment sequence for all randomized patients the safety population ( n=68 ) comprised patients who received at least 1 application of study medication . there were 2 serious adverse events ( saes ) , neither considered related to study medication : an sae of tooth abscess occurred during placebo treatment , and an sae of worsening of coronary artery disease ( cad ) occurred on the first day of tv-45070 treatment . this cardiac event occurred in a patient with well - documented cad ( including angina and a prior myocardial infarction ) . angiography performed at the time of the sae revealed coronary artery occlusion that was managed with angioplasty and stent placement to the left anterior descending coronary artery . there were no clinically meaningful changes in blood chemistry , hemodynamic parameters , electrocardiograms , vital signs , or in physical examination findings . the incidence of teaes was similar between tv-45070 and placebo ( 53.2% and 50.8% , respectively ) . however , study medication - related teaes were more frequent on placebo than tv-45070 ( 30.2% vs. 17.7% ) . generally , application site related teaes were more common on placebo treatment , for example , application site pain and pruritus ( table 3 ) . in addition , a very low incidence of dizziness was reported and no somnolence was observed ( table 3 ) . summary and incidence of the most frequently reported treatment emergent adverse events safety population eight patients discontinued because of a teae . for 7 of these 8 patients , the events leading to discontinuation were local skin reactions ( 5 during placebo and 2 during tv-45070 ; table 4 ) and the other discontinuation was the patient with the worsening cad . adverse events leading to discontinuation overall , systemic exposure was low , ranging from < 0.1 ng / ml ( lower limit of quantitation ) to 13.7 ng / ml . the mean maximum plasma concentration ( cmax ) was comparable between treatment sequences : the mean cmax for the tv-45070/placebo sequence was 2.1 ng / ml and the mean cmax for the placebo / tv-45070 treatment sequence was 2.2 ng / ml . similar findings of low plasma levels have been observed with application of topical tv-45070 in a prior human phase 1 study ( unpublished ) which also showed high skin concentration ( mean concentration 12,000 ng / g ) . the efficacy evaluable population ( n=57 ) comprised all patients with baseline and postbaseline efficacy data in both treatment periods . the least squares ( ls ) mean change in mean daily pain score from baseline to week 3 with locf was 0.97 with placebo and 0.94 with tv-45070 ( difference in change from baseline ls means between treatments=0.03 , 95% confidence interval , 0.38 , 0.43 ; p=0.8885 ) . analysis of the change in mean daily pain scores by each week of treatment did not result in significant differences between tv-45070 and placebo and there were no significant differences in the numbers or percentages of patients with a mean improvement from baseline of 1 , 2 , and 3 points for each week of treatment . more patients achieved 50% improvement with tv-45070 ( n=15 , 26.8% ) than with placebo ( n=6 , 10.7% ) at week 3 with locf ( p=0.0039 ) . a similar trend was observed in the proportion of patients achieving 30% improvement at week 3 with locf , with 22 ( 39.3% ) patients achieving 30% improvement on tv-45070 versus 13 ( 23.2% ) patients on placebo ( p=0.0784 ) . over the entire 3-week treatment period , the difference between treatments in the proportion of patients achieving 30% improvement was statistically significant ( p=0.0213 ) , with 19 ( 33.9% ) patients achieving 30% improvement on tv-45070 versus 9 ( 16.1% ) patients on placebo ( table 5 ) . the separation between treatments increased over time a week - to - week improvement in the percentage of responders on tv-45070 versus placebo was observed ( table 5 ) . proportion of patients achieving at least 30% or 50% pain improvements efficacy evaluable population cumulative percentage of patients versus percent change in mean daily pain score at week 3/locf . the figure displays the cumulative percentage of patients versus percent change in mean daily pain score at week 3 with locf for the efficacy evaluable population . there is a noticeable separation between the 2 curves , indicating that more patients experienced a 10% to 80% reduction in mean daily pain scores at the end of tv-45070 treatment compared with placebo treatment . for example , approximately 40% of patients reported a 30% or greater reduction in pain when on tv-45070 treatment , compared with just 24% of patients during placebo treatment . overall , the mean total number of rescue medication pills taken was slightly lower with tv-45070 treatment compared with placebo treatment ( 24.8 vs. 29.2 pills , not statistically significant ) . analyses of dsis , npsi , and pgic did not demonstrate any significant differences between treatments . the ls mean change in dsis score from baseline to week 3 with locf was 0.84 on placebo and 0.81 on tv-45070 . however , a statistically significant increase , favoring tv-45070 , in the proportion of patients with 30% and 50% improvement in sleep interference scores in week 3 was observed ( p<0.05 ) . the mean change in npsi score from baseline was 6.1 on placebo and 6.7 on tv-45070 . for pgic , patients reported their overall status during each treatment period as follows : very much improved ( 5.4% tv-45070 : 1.8% placebo ) , or very much worse ( 0% tv-45070 : 0% placebo ) . one randomized patient discontinued due to lack of efficacy ( in treatment period 2 while on placebo treatment due to worsening of pain at the site of phn ) . forty - five of these patients were included in the efficacy evaluable population and contributed data to the exploratory r1150w subgroup analyses . thirty - seven patients did not have the r1140w genotype , whereas 8 were heterozygous carriers of the nav1.7 r1150w polymorphism . given the small number of patients contributing data , no inferential analyses were performed and results were summarized . sixty - three percent of r1150w carriers achieved 30% reduction in pain scores on tv-45070 treatment compared with 35% of wild - type patients , and 38% of r1150w carriers achieved 50% reduction in pain scores compared with 24% of wild - type patients ( table 6 ) . in addition , the r1150w carriers showed a greater reduction in mean pain after 3 weeks of tv-45070 treatment compared with their response to placebo treatment ( mean treatment difference=0.78 points ) . in total , 129 patients were screened and 109 ( 84.5% ) entered the first placebo run - in period , 70 patients were randomized : 35 ( 50.0% ) to each treatment sequence . fifty - four ( 77.1% ) patients completed the study and 16 ( 22.9% ) discontinued ( fig . reasons for discontinuation included adverse event ( 8 [ 11.4% ] patients ) , withdrawal of consent ( 6 [ 8.6% ] patients ) , protocol violation ( 1 [ 1.4% ] patient ) , and lost to follow - up ( 1 [ 1.4% ] patient ) . the tv-45070/placebo sequence had a slightly lower mean age than the placebo / tv-45070 sequence ( 58.3 vs. 63.1 y ) . overall , the mean number of months since herpes zoster rash healing was 77.1 months ( range , 3.6 to 558.1 mo ) . patients were relatively evenly distributed between the 4 categories of treatment area ; 61.4% of patients were allocated to the 2 smaller areas of application ( ie , < 201 cm ) . seventeen ( 24.3% ) patients remained on one or more of the permitted phn medications during the study , ( 15 [ 21.4% ] patients remained on gabapentin and 2 [ 2.9% ] on pregabalin ) . the safety population ( n=68 ) comprised patients who received at least 1 application of study medication . there were 2 serious adverse events ( saes ) , neither considered related to study medication : an sae of tooth abscess occurred during placebo treatment , and an sae of worsening of coronary artery disease ( cad ) occurred on the first day of tv-45070 treatment . this cardiac event occurred in a patient with well - documented cad ( including angina and a prior myocardial infarction ) . angiography performed at the time of the sae revealed coronary artery occlusion that was managed with angioplasty and stent placement to the left anterior descending coronary artery . there were no clinically meaningful changes in blood chemistry , hemodynamic parameters , electrocardiograms , vital signs , or in physical examination findings . the incidence of teaes was similar between tv-45070 and placebo ( 53.2% and 50.8% , respectively ) . however , study medication - related teaes were more frequent on placebo than tv-45070 ( 30.2% vs. 17.7% ) . generally , application site related teaes were more common on placebo treatment , for example , application site pain and pruritus ( table 3 ) . in addition , a very low incidence of dizziness was reported and no somnolence was observed ( table 3 ) . summary and incidence of the most frequently reported treatment emergent adverse events safety population eight patients discontinued because of a teae . for 7 of these 8 patients , the events leading to discontinuation were local skin reactions ( 5 during placebo and 2 during tv-45070 ; table 4 ) and the other discontinuation was the patient with the worsening cad . overall , systemic exposure was low , ranging from < 0.1 ng / ml ( lower limit of quantitation ) to 13.7 ng / ml . the mean maximum plasma concentration ( cmax ) was comparable between treatment sequences : the mean cmax for the tv-45070/placebo sequence was 2.1 ng / ml and the mean cmax for the placebo / tv-45070 treatment sequence was 2.2 ng / ml . similar findings of low plasma levels have been observed with application of topical tv-45070 in a prior human phase 1 study ( unpublished ) which also showed high skin concentration ( mean concentration 12,000 ng / g ) . the efficacy evaluable population ( n=57 ) comprised all patients with baseline and postbaseline efficacy data in both treatment periods . the least squares ( ls ) mean change in mean daily pain score from baseline to week 3 with locf was 0.97 with placebo and 0.94 with tv-45070 ( difference in change from baseline ls means between treatments=0.03 , 95% confidence interval , 0.38 , 0.43 ; p=0.8885 ) . analysis of the change in mean daily pain scores by each week of treatment did not result in significant differences between tv-45070 and placebo and there were no significant differences in the numbers or percentages of patients with a mean improvement from baseline of 1 , 2 , and 3 points for each week of treatment . more patients achieved 50% improvement with tv-45070 ( n=15 , 26.8% ) than with placebo ( n=6 , 10.7% ) at week 3 with locf ( p=0.0039 ) . a similar trend was observed in the proportion of patients achieving 30% improvement at week 3 with locf , with 22 ( 39.3% ) patients achieving 30% improvement on tv-45070 versus 13 ( 23.2% ) patients on placebo ( p=0.0784 ) . over the entire 3-week treatment period , the difference between treatments in the proportion of patients achieving 30% improvement was statistically significant ( p=0.0213 ) , with 19 ( 33.9% ) patients achieving 30% improvement on tv-45070 versus 9 ( 16.1% ) patients on placebo ( table 5 ) . the separation between treatments increased over time a week - to - week improvement in the percentage of responders on tv-45070 versus placebo was observed ( table 5 ) . proportion of patients achieving at least 30% or 50% pain improvements efficacy evaluable population cumulative percentage of patients versus percent change in mean daily pain score at week 3/locf . the figure displays the cumulative percentage of patients versus percent change in mean daily pain score at week 3 with locf for the efficacy evaluable population . there is a noticeable separation between the 2 curves , indicating that more patients experienced a 10% to 80% reduction in mean daily pain scores at the end of tv-45070 treatment compared with placebo treatment . for example , approximately 40% of patients reported a 30% or greater reduction in pain when on tv-45070 treatment , compared with just 24% of patients during placebo treatment . overall , the mean total number of rescue medication pills taken was slightly lower with tv-45070 treatment compared with placebo treatment ( 24.8 vs. 29.2 pills , not statistically significant ) . analyses of dsis , npsi , and pgic did not demonstrate any significant differences between treatments . the ls mean change in dsis score from baseline to week 3 with locf was 0.84 on placebo and 0.81 on tv-45070 . however , a statistically significant increase , favoring tv-45070 , in the proportion of patients with 30% and 50% improvement in sleep interference scores in week 3 was observed ( p<0.05 ) . the mean change in npsi score from baseline was 6.1 on placebo and 6.7 on tv-45070 . for pgic , patients reported their overall status during each treatment period as follows : very much improved ( 28.6% tv-45070 : 28.6% placebo ) , minimally improved ( 17.9% tv-45070 : 33.9% placebo ) , no change ( 25.0% tv-45070 : 21.4% placebo ) , minimally worse ( 5.4% tv-45070 : 1.8% placebo ) , or very much worse ( 0% tv-45070 : 0% placebo ) . one randomized patient discontinued due to lack of efficacy ( in treatment period 2 while on placebo treatment due to worsening of pain at the site of phn ) . forty - five of these patients were included in the efficacy evaluable population and contributed data to the exploratory r1150w subgroup analyses . thirty - seven patients did not have the r1140w genotype , whereas 8 were heterozygous carriers of the nav1.7 r1150w polymorphism . given the small number of patients contributing data , no inferential analyses were performed and results were summarized . sixty - three percent of r1150w carriers achieved 30% reduction in pain scores on tv-45070 treatment compared with 35% of wild - type patients , and 38% of r1150w carriers achieved 50% reduction in pain scores compared with 24% of wild - type patients ( table 6 ) . in addition , the r1150w carriers showed a greater reduction in mean pain after 3 weeks of tv-45070 treatment compared with their response to placebo treatment ( mean treatment difference=0.78 points ) . we conducted a proof - of - concept trial in 70 patients with phn using tv-45070 , a topical novel potent inhibitor of nav1.7 and additional navs.10 overall , tv-45070 was safe and well tolerated and unlike many commonly used orally active medications used to treat neuropathic pain , topically applied tv-45070 demonstrated an absence of drug - related central nervous system ( cns ) teaes . this was an expected property of the product due to the low plasma concentrations ( mean cmax was 2.1 ng / ml with a maximal individual cmax of 14 ng / ml ) relative to plasma levels previously shown to mediate cns effects ( data not shown ) . the most common adverse events were local skin reactions where application site pain and pruritus were observed more frequently on placebo than tv-45070 treatment , suggesting that the tv-45070 api itself does not primarily cause dermal irritation . the local skin reactions were mostly mild ( 66% ) , with occasional moderate events ( 28% ) . these resolved spontaneously without intervention . eight patients terminated because of an adverse event ( 5 during placebo treatment and 3 during tv-45070 treatment ) . neither of the 2 saes reported in this trial were considered related to study treatment . the phn population studied was consistent with the typical demographic profile for other reported phn trials with one major exception ; the mean duration since diagnosis was substantially higher ( 76.6 mo ) than reported in other phn studies ( 30 mo).12,13,15 although some studies have been able to demonstrate efficacy in phn patients who have failed prior therapies , in this study the longer duration of disease suggests a more refractory population that may have compromised the ability to demonstrate an overall treatment difference in this study . nevertheless , despite a potentially more refractory study population , while the primary efficacy analysis did not show differences between the treatment arms , statistical significance was observed for responder rate analyses . a statistically higher percentage of patients had a 50% improvement in pain during tv-45070 treatment compared with placebo and a trend to 30% improvement in pain during tv-45070 treatment compared with placebo was observed . this positive responder rate observation suggests that a subpopulation of phn patients exists that is more likely to have an analgesic effect and , further suggests the possibility exists that this response to topical tv-45070 could be mechanism based . although the sample size is very small and definitive conclusions can not be drawn , phn patients who were carriers of the common gain - of - function r1150w polymorphism appeared more likely to experience a more robust response to tv-45070 . an increase in the proportion of responders for both 30% and 50% improvement in pain was observed for heterozygous carriers compared with wild type . interestingly , the placebo response was reduced in the r1150w carriers , further widening the effect size seen in this carrier subpopulation . although the nav1.7 r1150w polymorphism has been associated with an increase in pain perception for a variety of painful disorders including both nociceptive and neuropathic pain as well as experimentally induced heat pain ( mean increase in visual analog scale of 2.0 for carriers vs. wild type),9 these data have not yet been replicated.16 using in vitro electrophysiological testing in transfected dorsal root ganglion cells , the r1150w variant channel has previously been shown to demonstrate gain - of - function and hyperactivity.17 we postulate that enhanced pain perception mediated through an increased activity of the r1150w polymorphism may render patients more susceptible to pharmacological intervention by nav1.7 inhibitors such as tv-45070 compared with their wild - type counterparts . these preliminary findings reported herein , when combined with the previously reported efficacy of the active ingredient of tv-45070 in iem patients where the mutations in the scn9a gene are known to cause a gain - of - function of nav1.7 channel , support the continued evaluation of the r1150w polymorphism in larger clinical studies in common disorders of pain . human genetics has uncovered the vital importance of nav1.7 in pain perception illuminating a critical mechanism for analgesic development.3,4,18 here , we show that topically applied tv-45070 , which has potent nav1.7 inhibition and is currently in clinical development , was safe , well tolerated , and devoid of drug - related cns or cardiac toxicity . although a mean difference between treatment groups was not detected , significant improvements were demonstrated with tv-45070 in a subset of phn patients . furthermore , based on a small analysis subpopulation , heterozygous carriers of the r1150w polymorphism appeared more likely to report a clinically meaningful response than their wild - type counterparts . these results support the potential clinical utility of pharmacological inhibition of nav1.7 for the treatment of peripheral neuropathic pain . given the favorable safety profile coupled with demonstrated efficacy in this phn study , these data warrant further development of topical tv-45070 in larger , longer , parallel - design studies of patients with phn or other peripheral neuropathic pain conditions . | objective : the objective was to evaluate the safety and efficacy of tv-45070 ointment , as a treatment for postherpetic neuralgia , and to explore the response in patients with the nav1.7 r1150w gain - of - function polymorphism.materials and methods : this was a randomized , placebo - controlled , 2-period , 2-treatment crossover trial .
patients with postherpetic neuralgia with moderate or greater pain received tv-45070 and placebo ointments , each applied twice daily for 3 weeks .
the primary efficacy measure was the difference in change in mean daily pain score from baseline compared with the last week of placebo and active treatment .
secondary endpoints included responder rate analyses and a further exploratory analysis of response in carriers of the nav1.7 r1150w polymorphism was conducted.results:seventy patients were enrolled and 54 completed the study .
tv-45070 was safe and well tolerated .
no statistical difference was observed between treatments for the primary endpoint .
however , the proportion of patients with 50% reduction in mean pain scores at week 3 was greater on tv-45070 than on placebo ( 26.8% vs. 10.7% , p=0.0039 ) .
similarly , a greater proportion of patients on tv-45070 had a 30% reduction in mean pain scores at week 3 ( 39.3% on tv-45070 vs. 23.2% on placebo , p=0.0784 ) .
of note , 63% of patients with the r1150w polymorphism versus 35% of wild - type carriers had a 30% reduction in mean pain score on tv-45070 at week 3 ( no inferential analysis performed).conclusions : the 50% responder analysis suggests a subpopulation may exist with a more marked analgesic response to tv-45070.the trend toward a larger proportion of responders within nav1.7 r1150w carriers warrants further investigation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
clinically , the disease manifests as patchy alopecia , diffuse alopecia , reticulate alopecia , ophiasis , ophiasis inversus , alopecia totalis or alopecia universalis . nail changes ( diffuse fine nail pitting , longitudinal ridging , thin and brittle finger and toe nails , and trachyonychia ) may be seen in 3 - 30% of the patients . in general , clinical diagnosis of aa is made based on the typical pattern of hair loss , which can be supported by the presence of characteristic exclamation mark hair on light microscopy . however , in some cases , the clinical diagnosis may not be straightforward where invasive techniques ( biopsy ) may be more appropriate but are frequently not well accepted by patients ; especially children . recently , dermoscopy has established itself as a useful aid in the diagnosis of aa . the correlation of dermoscopic features with severity of disease has not been looked into in previous studies on aa . elucidation of dermoscopic features that are highly correlated with severe disease could help in developing dermoscopic predictors of severe disease or poor prognosis . the objective of our study was to document the dermoscopic features of aa in indian patients and to analyze the correlation of dermoscopic features with severity of disease . all consecutive patients diagnosed with aa between august 2010 and august 2012 were included in the study after taking written informed consent . the patients with co - existent androgenetic alopecia or history of any treatment during the past 2 months were excluded from the study . the diagnosis was established by clinical examination in most of the cases and biopsy in ten patients . localized patchy alopecia was defined as 1 - 3 patches of alopecia and multiple patchy hair losses as more than three patches of alopecia . the activity of aa was classified as progressive or nonprogressive according to the change in hair loss over the past month . this classification was used as the aim of our study was to correlate dermoscopic features with severity and prognosis of the disease . the various patterns of aa were noted as patchy , diffuse , ophiasis , totalis , and universalis . the severity of aa was graded as s1 to s5 according to the guidelines of the national aa foundation . dry dermoscopy was done with a heine delta 20 dermoscope ( heine optotechnik , herrsching , germany ) which was followed by wet dermoscopy . the dermoscopic features that were looked for were yellow dots ( yds ) , black dots , exclamation mark hair , short vellus hair , circle hair and coudablity hair . the differentiation of yds and white dots was done by consensus among two independent dermatologists . the number of yds in a field of vision ( yd / fov ) was counted for each patient from the most active margin of the alopecic patch . statistical analysis was performed using spss13 software ( spss , chicago , il , usa ) . categorical variables were assessed using the chi - square test and fisher 's exact test and continuous variables were assessed using spearman rank correlation . sensitivity and specificity of the various dermoscopic findings in comparison to skin biopsy were estimated . the mean age of the patients with aa was 25.3 19.7 years ( ranging from 1 to 55 years and a median of 25 years ) . one hundred and ten patients had fitzpatrick type v and 6 had type iv skin . the various types of aa seen in our study were patchy localized ( 76 , 65.5% ) , patchy multiple ( 26 , 22.41% ) , ophiasis ( 5 , 4.31% ) , totalis ( 3 , 2.58% ) , universalis ( 3 , 2.58% ) and diffuse ( n = 3 , 2.58% ) . regarding the extent of hair loss ; 84 had s1 , 12 had s2 , 5 had s3 , 12 had s4 and 03 had s5 grade of aa . nine ( 7.7% ) patients had a family history of aa ( 8 had patchy aa and 1 had alopecia universalis ) . yds ( 104 , 89.6% ) , short vellus hair ( 91 , 78.4% ) , black dots ( 36 , 31.0% ) , exclamation mark hair ( 23 , 19.8% ) , broken hair ( 15 , 12.9% ) and circle hairs [ figures 14 ] ( 8) were seen by dermoscopy in the present study . it was seen that ninety - four patients had a coudability score of 0 , 6 had a score of 1 , 9 had a score of 2 and 7 had a score of 3 . there was no specific dermoscopic pattern noted in the various types of aa [ table 1 ] . larger yellow dots and smaller white dots seen on dermoscopy coudability hairs and exclamation mark hairs black dots and short vellus hairs circle hairs seen on dermoscopy dermoscopic features seen in all types of aa yellow dots were found to be sensitive ( 89.6% ) and specific ( 88.6% ) dermoscopic markers for the diagnosis of aa . diagnostic sensitivity increased to 97.4% when short vellus hair was included with yds in dermoscopic evaluation . it was even seen in children less than 10 years of age . in view of the high number of yds , dermoscopy was also done in other causes of alopecia to check if yds were more common in this demographic population . however , only 10.1% of patients with other diseases showed yds in comparison to 89.6% of patients with aa ( p < 0.00001 ) . distribution of yd among the different age groups the mean number of yd / fov was 7.53 12.31 . the mean yd / fov was highest in alopecia universalis ( 50.3 53.6 ) , followed by ophiasis ( 22.2 13.1 ) . the number of yd / fov did not differ significantly in progressive or nonprogressive alopecia ( p = 0.5351 ) . it was observed that the number of yd / fov correlated significantly with the severity of alopecia ( p < 0.0001 ) . mean yd / fov according to the type of aa the individual dermoscopic findings did not correlate with the activity or extent of aa . even the coudability score did not correlate with the disease activity ( p = 0.72 ) or extent ( p = 0.58 ) . yds ( 104 , 89.6% ) , short vellus hair ( 91 , 78.4% ) , black dots ( 36 , 31.0% ) , exclamation mark hair ( 23 , 19.8% ) , broken hair ( 15 , 12.9% ) and circle hairs [ figures 14 ] ( 8) were seen by dermoscopy in the present study . it was seen that ninety - four patients had a coudability score of 0 , 6 had a score of 1 , 9 had a score of 2 and 7 had a score of 3 . there was no specific dermoscopic pattern noted in the various types of aa [ table 1 ] . larger yellow dots and smaller white dots seen on dermoscopy coudability hairs and exclamation mark hairs black dots and short vellus hairs circle hairs seen on dermoscopy dermoscopic features seen in all types of aa yellow dots were found to be sensitive ( 89.6% ) and specific ( 88.6% ) dermoscopic markers for the diagnosis of aa . diagnostic sensitivity increased to 97.4% when short vellus hair was included with yds in dermoscopic evaluation . it was even seen in children less than 10 years of age . in view of the high number of yds , dermoscopy was also done in other causes of alopecia to check if yds were more common in this demographic population . however , only 10.1% of patients with other diseases showed yds in comparison to 89.6% of patients with aa ( p < 0.00001 ) . distribution of yd among the different age groups the mean number of yd / fov was 7.53 12.31 . the mean yd / fov was highest in alopecia universalis ( 50.3 53.6 ) , followed by ophiasis ( 22.2 13.1 ) . the number of yd / fov did not differ significantly in progressive or nonprogressive alopecia ( p = 0.5351 ) . it was observed that the number of yd / fov correlated significantly with the severity of alopecia ( p < 0.0001 ) . mean yd / fov according to the type of aa the individual dermoscopic findings did not correlate with the activity or extent of aa . even the coudability score did not correlate with the disease activity ( p = 0.72 ) or extent ( p = 0.58 ) . common dermoscopic findings of aa reported in the literature are yds , black dots , short vellus hairs , exclamation mark hair and broken hair . peter et al . in their study of aa patients from a tertiary care center in south india , reported that the commonest dermoscopic finding was black dots ( 75% ) , followed by broken hairs ( 67% ) and yds ( 42% ) . in our study , yds and short vellus hairs , were more commonly seen when compared to other dermoscopic findings . inui et al . , in their dermoscopic study of 300 japanese patients with aa , reported 72.7% frequency of short vellus hair , 63.7% of yds , 45.7% of broken hair , 44.3% of black dots and 31.7% of tapering hair . yellow dots were found to be 89.6% sensitive for the diagnosis of aa , according to our study . de moura et al . reported the presence of yds in 95% of aa patients in all stages of the disease and stated that yds were a specific finding for slopecia areata . , on the other hand , did a study on the same demographic population as ours and reported similar results with regard to yds . we propose that this could be explained by the south indian practice of oiling hair . yellow dots represent distension of affected follicular infundibulum with keratinous material and sebum . because of underdeveloped sebaceous glands in prepubertal children , yds are sparsely seen in children with aa . however , in the present study , 82.35% of patients ' up to 15 years of age showed yds on dermoscopy . the higher prevalence of yds in the present study could perhaps be explained by the local practice of oiling hair that could resemble a yd on scalp dermoscopy . our results showed that yds together with short vellus hairs were seen in 97.4% patients , suggesting that this combination enhances the sensitivity of diagnosis of aa . the fact that a combination of dermoscopic findings can increase the diagnostic sensitivity of aa was also noted in several other studies . this combination of findings could be very useful in the pediatric population to avoid skin biopsies for diagnosis . miteva and tosti described circle hairs on dermoscopy in aa , which are nothing but short vellus hairs , which have a tendency to become coiled . in our study , these circle hairs were seen in eight patients with aa . we substantiate the usefulness of this finding in the diagnosis of aa even in darker population . reported black dots , yds and short vellus hairs to be useful severity markers of aa . lacarrubba et al . in their dermoscopic study of aa reported that exclamation mark hairs , broken / cadaverized hairs were found most commonly in acute aa and their presence indicated progressive disease activity . on the other hand , short vellus hairs indicated hair regrowth and disease remission . in the present study , black dots , exclamation mark hairs , broken hairs , yds and short vellus hair showed no correlation with the disease activity or severity of aa . described coudable hair to be a useful marker for disease activity in aa and a substitute for the hair pull test . this however was in contrast to the findings of the present study . in the present study dermoscopic assessment for the number of yd / fov could be included in the evaluation of aa as it could serve as a guide to subclassify aa based on the severity and extent of involvement , and also to serve as a prognostic indicator . the high frequency of yds in our study and the study by mane et al . however , yds were seen in only 10.1% ( 22/218 ) of south indian patients with other alopecias and hair disorders . the increased frequency of yds could be explained by the practice of oiling hair ; however , they are still sensitive in the diagnosis of aa . a limitation of this study is that the dermoscopy was not done in healthy controls to look at the normal dermoscopic patterns in indian patients . the most common dermoscopic features of aa in indian patients are yds and short vellus hairs . this study also highlights the potential influence of hair care practices in the interpretation of scalp dermoscopic findings . further studies are required to confirm the usefulness of yd / fov , as well as to establish the normal dermoscopic patterns of scalp in the general population . | background : several dermoscopic findings in alopecia areata ( aa ) are characteristic and aid in the diagnosis of this disease .
studies evaluating the clinical significance of these findings in aa in dark - skinned individuals are sparse .
there is no literature of correlation of dermoscopic findings to severity of disease.aims:the aim was to determine the dermoscopic findings of aa in dark skinned individuals and to assess whether certain dermoscopic findings correlate with disease activity and severity.materials and methods : totally 116 patients with aa were included in the study . after a thorough clinical history and examination to note type , severity and activity of the disease
, dermoscopy was performed using a heine delta 20 dermoscope ( heine optotechnik , herrsching , germany ) and the results were noted in a proforma .
statistical analysis was performed using spss13 software using appropriate statistical tools.results:dermoscopic findings were nearly similar to that described in western literature .
yellow dots ( yds ) were found to be highly sensitive for diagnosis , increased frequency being seen in indian prepubertal patients when compared with western literature .
yds / field of vision ( fov ) were found more frequently in severe types of aa .
there was no correlation of dermoscopic findings to severity of disease.conclusion:dermoscopic features are similar to that described in the literature .
however , yds are seen in higher frequency .
yds / fov could serve as dermoscopic criteria to grade severity of aa . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hydatid cyst is a significant health problem in underdeveloped and developing countries , particularly among sheep breeders . although cardiac involvement is seen only in 0.2% to 3% of the cases , early diagnosis and treatment are important . a 13-year - old boy with dyspnea and atypical pericardial type chest pain for three months was referred to us . chest x - ray revealed linear calcification in the left side of the heart . computed tomography demonstrated a cyst with peripheral calcification and without internal septation in the lateral left ventricle ( lv ) myocardium . no other cyst was seen in the other organs such as the lungs and liver . by midline sternotomy on pump , an incision was made 2-cm lateral to the left ascending artery through the lv myocardium and without entering any cardiac chamber . after injecting hypertonic ( 5% ) saline , the cyst was punctured and its fluid contents were aspirated , the cyst was enucleated , and the cavity marsupialization was done for protection of the myocardium . lv ejection fraction before operation was 40% but after operation and repairing lv myocardium , ejection fraction increased to 50% in . in myocardial hydatid cysts , we recommend a direct approach without entering the cardiac chambers to avoid dissemination of the infection . we recommend excision of the germinative membrane without capitonnage to avoid impairment of myocardial contraction . hydatid cyst is a significant health problem in underdeveloped and developing countries , particularly among sheep breeders ( 1 ) . hydatidosis is a parasitic infection caused by the larval stage of echinococcus granulosus ( 1 ) . the liver ( 70% ) and lungs ( 25% ) are the most affected organs ( 2 ) . although cardiac involvement is seen only in 0.2% to 3% of cases , early diagnosis and treatment are important ( 1 ) . hydatid infection of the heart may occur via coronary circulation or from intravascular pulmonary cyst rupture ( 2 ) . the clinical signs and symptoms of cardiac hydatid cyst are nonspecific and highly varied ; therefore , this disease may be difficult to diagnose . although echinococcosis is a serious health issue in some geographical regions of the world , cardiac involvement is rare ( 3 ) . the mostly affected sites of the heart are the left ventricle ( lv ) ( 75% ) , right ventricle ( rv ) ( 18% ) , and the interventricular septum , whereas the pericardium as well as left and right atria are least affected . in primary cardiac hydatidosis , a 13-year - old boy who had no remarkable medical history was admitted to baqiyatallah hospital , tehran , iran , on december 2012 because of dyspnea and atypical pericardial type chest pain . three months before admission , he was referred to us without fever , angina - like chest pain , or palpitation . cardiac examination and laboratory data ( including blood chemistries , cardiac enzymes ) yielded normal findings . his erythrocyte sedimentation rate was 22 mm / h and complete blood count showed no significant eosinophilia . chest x - ray revealed increased cardiothoracic ratio with linear sharp calcification in left heart border ( table 1 ) ( figure 1 ) . abdominal and thoracic computed tomography ( ct ) scans ruled out involvement of other locations ( figure 2 ) . transthoracic and trans esophageal echocardiography revealed a large ( 73 mm 53 mm ) encapsulated , intramural , heterogeneous well - define mass with multiple small echolucency , outer wall calcification ( 77 mm 53 mm ) in the anterolateral part of the lv at middle and apical segments with protrusion to lv cavity , and severely decreased lv volume and diameter . there was mild central mitral regurgitation and mild to moderate pericardial effusion with systolic rv inversion without diastolic rv collapse . thoracic ct revealed a cystic formation of 8-cm 6-cm dimensions in the same location as shown by chest x - ray and echocardiography . cardiac mri ( dynamic study with gadolinium ) showed a large ( 75 mm 54 mm ) , well - demarcated intramyocardial mass with cystic or necrotic center in the anterolateral wall of lv with severe protrusion to lv cavity ; post - gadolinium enhancement at the peripheral aspect of the mass showed capsular enhancement ( we used ruler with cm measurement cyst and use cts criteria for measure ) . prior to surgery for cyst excision , the patient received albendazole for two weeks in order to decrease the number of living parasites . via midline sternotomy on pump , a 5-cm incision was made on lv myocardium , lateral to lad and without entering cardiac chambers , to excise the cyst . after injecting hypertonic ( 5% ) saline , removal of the cyst improved myocardial compliance and myocardial perfusion , corrected the cardiac deformity , and strengthened myocardial contraction ( figure 5 ) . after two years , follow - up transthoracic echocardiography showed ef of 50% with no evidence of recurrence and decreased mitral regurgitation . chest x - ray revealed increased cardiothoracic ratio with linear sharp calcification in left heart border . in deciding upon an operative technique , the location of the cyst is of great importance . most cysts are in the ventricular myocardium . in this reported case , we excised the germinative membrane through the myocardium without entering the cardiac chambers . postoperative echocardiographic findings indicated improved myocardium function and an ejection fraction of 40% with mild increase in mitral regurgitation . cardiac involvement can occur from the systemic or pulmonary circulation of parasite or direct extension from adjacent involved structures . it can occur in any part of the heart and the manifestations depend on the size , location , and integrity of the cyst . the lv is the most common site ( 75% ) , followed by the rv ( 15% ) , interventricular septum ( 5%-9% ) , left atrium ( 8% ) , pericardium ( 8% ) , pulmonary artery ( 7% ) , and right atrium ( 3%-4% ) ( 3 ) . in a study , 15 patients with cardiac hydatid cyst were followed up from ten months to 22 years . there were four recurrences of myocardial cysts after 12 months ( 3 ) . in this report , calcification of the cystic lesion in chest x - ray was the main key to diagnosis . although the symptoms associated with echinococcosis are nonspecific , it may be indicated by an abnormal cardiac silhouette on a chest radiograph , or by echocardiographic findings of cardiac chamber deformation . few serious consequences were encountered from obstruction of the cardiac valves by a cyst , or from compression of the conduction system or great veins . major surgical complications from rupture of cyst were seen including systemic or pulmonary embolization , pericardial dissemination , purulent inflammation , and sepsis . these complications of surgical treatment account for a greater mortality rate than anaphylaxis and heart failure do ( 3 ) . most patients with cardiac echinococcosis have no symptoms and the disease is often latent because of slow growth of hydatid cyst in the heart . unless a cyst is located in a critical anatomic site , the disease is usually diagnosed late . signs and symptoms of cardiac hydatid cysts are extremely variable and are directly related to the location and the size of the cysts . approximately 10% of patients , especially those with large hydatid cysts , have clinical manifestations . precordial pain is the most common symptom and is most often vague and does not resemble angina pectoris . precordial pain also can be of the pericardial type , especially in patients with a pericardial hydatid cyst and a pericardial reaction such as in our patient . sudden rupture of intracardiac cysts is a frightful complication and can cause acute pericarditis or tamponed , acute pulmonary hypertension by embolization of several scolices , systemic arterial embolization , and severe anaphylactic shock . a variety of intracardiac tumors and a congenital pericardial cyst must be considered in the differential diagnosis ; the cysts may be single or multiple , uniloculated or multiloculated , and thin - or thick - walled . more specific signs include calcification of the cyst wall ( figure 1 ) , presence of daughter cysts , and membrane detachment . the mass becomes solid and can be difficult to differentiate from heart tumors ( 4 ) . although anthelminthic drugs have been used in the preoperative and postoperative periods since 1977 , excision of the lesion under cardiopulmonary bypass is recommended ( 4 ) . precordial pain and dyspnea are frequent revealing symptoms , but patients sometimes present with life - threatening conditions such as congestive heart failure , pericardial tamponade , pulmonary embolism , syncopal attacks , or superior vena cava syndrome . the combination of imaging and serology ( enzyme - linked immunosorbent assay ) usually provides an effective diagnosis , although sensitivity is quite low . because recurrence may appear much later , such a monitoring should be pursued for at least three years ( 5 ) . albendazole is active against the germinal membrane of the cyst wall but its concentrations in cyst fluid may be suboptimal . in contrast , praziquantel reaches adequate levels in cyst fluid but is not active against the germinal membrane at usual dosages . some evidence suggests preoperative combination chemotherapy with both agents to be more effective than albendazole alone . however , because of its activity against the germinal membrane , albendazole may cause cysts to leak or rupture . therefore , in this case we did not pretreat patient with albendazole for a prolonged period ( 6 ) . perhaps , weak point of this report is reporting only one case but it was a very large cyst in lateral wall of lv and close to coronary vessel without rupture and involvement of heart chamber , which would be a strong and specific point of this research . in conclusion , the reported case was of particular interest because it enabled a rare preliminary diagnosis of cardiac echinococcosis by chest x - ray . in addition , technique of excision has been never reported before in connection with this entity . in myocardial hydatid cysts , we recommend a direct approach without entering the cardiac chambers in order to avoid dissemination of infection and cyst materials . we also recommend excision of the germinative membrane without capitonnage to avoid impairment of myocardial contraction . | introduction : hydatid cyst is a significant health problem in underdeveloped and developing countries , particularly among sheep breeders . although cardiac involvement is seen only in 0.2% to 3% of the cases , early diagnosis and treatment are important.case presentation : a 13-year - old boy with dyspnea and atypical pericardial type chest pain for three months was referred to us .
chest x - ray revealed linear calcification in the left side of the heart . computed tomography demonstrated a cyst with peripheral calcification and without internal septation in the lateral left ventricle ( lv ) myocardium .
serologic igg test was positive for echinococcosis .
no other cyst was seen in the other organs such as the lungs and liver . by midline sternotomy on pump ,
an incision was made 2-cm lateral to the left ascending artery through the lv myocardium and without entering any cardiac chamber . after injecting hypertonic ( 5% ) saline ,
the cyst was punctured and its fluid contents were aspirated , the cyst was enucleated , and the cavity marsupialization was done for protection of the myocardium .
lv ejection fraction before operation was 40% but after operation and repairing lv myocardium , ejection fraction increased to 50% in .
histopathologic examination confirmed a hydatid cyst.conclusions:in myocardial hydatid cysts , we recommend a direct approach without entering the cardiac chambers to avoid dissemination of the infection .
we recommend excision of the germinative membrane without capitonnage to avoid impairment of myocardial contraction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cerebral palsy ( cp ) refers to permanent , mutable motor development disorders stemming from
a primary brain lesion , leading to secondary musculoskeletal alterations , and limitation of
activities of daily living1 . motor
impairment is the main manifestation in children with cp , and it has consequent effects on
the biomechanics of the body2 . children
with cp exhibit impaired muscle coordination , difficulties in organization of sensory
information and functional limitations3 . postural control is fundamental to efficient , effective functional performance in all
activities of daily living4 . this complex
process depends on the interaction of the visual , vestibular and peripheral systems ,
commands of the central nervous system and neuromuscular responses5 . deficits in postural control due to motor impairment have
been identified as one of the main limitations in the development of children with cp6 . abnormal movements and posture of children
with cp are the consequences of limitations stemming from the disease , which directly affect
overall neuromuscular development and the postural control mechanism7 . a number of studies in the scientific literature propose combining the pediatric evaluation
of disability inventory ( pedi ) and the gross motor function classification system
( gmfcs)2 for the classification of cp
with regard to function8 . the pedi allows the
assessment of skills and functional performance in typical tasks and activities of daily
living9 , and it is administered in the
form of a structured interview with one of the child s caregivers . the first part of the
questionnaire evaluates the skills in the child s repertoire grouped into three functional
categories : self - care , mobility and social function . in the present study , only the
self - care and mobility dimensions were considered to determine the importance of functional
balance in the performance of activities of daily living . due to the lack of specific scales , assessment tools for the clinical evaluation of
postural control in elderly individuals the berg balance scale was developed for the analysis of balance
of elderly individuals12 , 13 and was translated into portuguese by miyamoto et al14 . this scale has been widely used for the
assessment of balance of adult and child populations . however , a pilot study involving
children found that the berg balance scale demonstrated contestable reliability in a child
population15 . thus , changes were made
to the 14 items of the scale to adapt it to the pediatric population and a specific scale
was developed the pediatric balance scale ( pbs ) . the pbs was developed in the united states and has 14 items that assess daily functional
activities of children aged 5 to 15 years with mild to moderate motor impairment . the pbs was used to detect successive changes in the functional
balance of six children with cp with mild to moderate impairment in evaluations performed at
four - month intervals over a three - year period16 . the adaptation of the scale consisted of changes to the order of
the application of the tests , the time for maintaining static positions , the instructions
and the equipment used . ries et al.17
published a study in which the pbs was adapted and validated for use with brazilian
pediatric populations . the cross - cultural adaptation process involved four translators and
33 healthcare professionals . intra - examiner reliability was demonstrated through the
administration of the scale for five volunteers with cp on three different occasions . the
pbs has demonstrated reliability for use with brazilian children with a diagnosis of cp
classified as levels i and ii on the gmfcs . as the pbs and pedi are important tools for the evaluation of function of children , the
primary aim of the present study was to determine whether there was a correlation between
functional balance ( pbs ) and functional performance ( pedi ) in a sample of children with cp
at a physical therapy teaching clinic . the secondary aim was to determine differences in
functional balance and functional performance ( self - care and mobility dimensions ) in
children classified as levels i , ii and iii on the gmfcs . the hypothesis to be tested was
that different results would be found among children classified on different gmfcs
levels . the present study complied with the principles of the declaration of helsinki and the
regulating norms and guidelines for research involving human subjects formulated by the
brazilian national health council , ministry of health , established in october 1996 . the
study received approval from the ethics committee of the universidade nove de julho ( sao
paulo , brazil ) under protocol number 409972\2011 . all parents / guardians agreed to the
participation of the children by signing a statement of informed consent . an observational , cross - sectional study was carried out involving 30 male and female
children aged four to 10 years with a diagnosis of spastic cp . the participants were
recruited from the physical therapy clinics of nove de julho university in so paulo ,
brazil . convenience sampling was performed and the initial sample was made up of 53 children
with a diagnosis of cp , 30 of whom were selected based on the following eligibility
criteria : a diagnosis of spastic cp ; a functional classification of levels i , ii or iii on
the gmfcs2 an age between 4 and 12 years ;
and agreement from a parent / guardian to the child s participation received through a signed
statement of informed consent . the exclusion criteria were a ) incompatible degree of
comprehension and cooperation for performance of the activities proposed , and b ) orthopedic
deformities with indication for surgery . the sample was divided into three groups based on the gmfcs : group 1 children
classified as level i ; group 2 children classified as level ii ; and group 3 children
classified as level iii . the participants were evaluated using the following functional test
and scale . pediatric balance scale ( pbs ) : functional balance was assessed using the pbs , which
consists of 14 tasks similar to activities of daily living . the items are scored on a
five - point scale ( 0 , 1 , 2 , 3 or 4 ) , with zero denoting an inability to perform the activity
without assistance and four denoting the ability to perform the task with complete
independence . the score is based on the time for which a position can be maintained , the
distance to which the upper limb is capable of reaching in front of the body , and the time
needed to complete the task . the test is performed with the
child clothed and making use of his / her habitual brace and/or gait - assistance device4 , 13 . pediatric evaluation disability inventory : the pedi quantitatively measures functional
performance . this questionnaire was administered in interview form to one of the child s
caregivers who was knowledgeable about the performance of the child in typical activities
and tasks of daily routine . this assesses
skills in the child s repertoire grouped into three functional categories : self - care ( 73
items ) , mobility ( 59 items ) and social function ( 65 items ) . an item is scored 0 ( zero ) when
the child is unable to perform the activity or 1 ( one ) when the activity is part of the
child s repertoire of skills . each participant was evaluated on two non - consecutive days by previously trained
physiotherapists blinded to the objectives of the study . anthropometric characteristics ( height , body mass and body mass index ) were then
determined . the order of the administration of the assessment tools was determined randomly
by lots . during all evaluations , the children were clothed and made use of their habitual
ankle - foot orthoses , walkers or crutches , since the aim of the study was to obtain results
similar to normal daily performance . the children could interrupt the evaluation at any time due to
fatigue or discomfort . the kolmogorov - smirnov test was used to determine whether the data adhered to the gaussian
curve . a normal distribution was demonstrated , the data were expressed as mean and standard
deviation . pearson s correlation coefficient ( r ) was used to determine correlations between
the pbs and pedi . one - way anova was used for the comparison of means of the results among
the different groups . the data
were organized and tabulated using the statistical package for the social sciences ( spss
v.19.0 ) . group 1 was made up of two children with diparesis and eight with
hemiparesis . group 2 was made up of nine children with diparesis and one with hemiparesis . group 3 was entirely made up of ten children with diparesis who used forearm crutches as a
gait - assistance device . anthropometric data of the sample ( mean sd)group 1 gmfcs igroup 2 gmfcs iigroup 3 gmfcs iiiage ( years)8.5 0.78.4 0.77.9 1.4body mass ( kg)27.4 2.526.5 2.925.8 3.2height ( cm)127.3 5.8124.1 6.9122.4 4.2body mass index ( kg / m)16.5 0.617.0 0.315.9 0.9 displays the anthropometric data for the sample . a strong correlation was found between the pbs and both the self - care ( r = 0.73 ; p <
0.001 ) and mobility ( r = 0.82 ; p < 0.001 ) dimensions of the pedi . a strong positive
correlation was also found between the self - care and mobility dimensions of the pedi ( r =
0.72 ; p < 0.001 ) . in the analysis of the different gmfcs levels , a moderate correlation was found between the
pbs and self - care dimension of the pedi ( r = 0.51 ; p = 0.12 ) , and a strong correlation was
found between the pbs and the mobility dimension of the pedi ( r = 0.82 ; p < 0.001 ) in
group 1 ( gmfcs level i ) . moderate correlations were found between the pbs and both the
self - care dimension ( r = 0.57 ; p = 0.10 ) and mobility dimension ( r = 0.41 ; p = 0.23 ) of the
pedi in group 2 ( gmfcs level ii ) . the pbs was weakly correlated with the self - care dimension
( r = 0.11 ; p = 0.77 ) and moderately correlated with the mobility dimension ( r = 0.55 ; p =
0.12 ) in group 3 ( gmfcs level iii ) . the results of anova ( table 2table 2 . results ( mean and sd ) of the functional test and pedi scale in the different
groupsgroup 1 ( n=10)group 2 ( n=10)group 3 ( n=10)pbs51.0 ( 2.7)46.6 ( 4.7)34.8 ( 4.9 ) * # pedi- mobility51.1 ( 3.3)50.6 ( 3.0)34.5 ( 6.9 ) * # pedi- self - care62.0 ( 7.6)63.5 ( 7.0)41.7 ( 6.2 ) * # * anova i x iii ( p<0.05 ) ; # anova ii x iii ( p<0.05 ) ) revealed statistically significant differences in the self - care dimension of
the pedi between groups 1 and 3 ( p < 0.001 ) as well as between groups 2 and 3 ( p <
0.001 ) , whereas no significant difference was found between groups 1 and 2 ( p = 1.0 ) . statistically significant differences were also found in the mobility dimension of the pedi
between groups 1 and 3 ( p < 0.001 ) as well as between groups 2 and 3 ( p < 0.001 ) ,
whereas no significant difference was found between groups 1 and 2 ( p = 1.0 ) . likewise ,
statistically significant differences were found in the pbs between groups 1 and 3 ( p <
0.001 ) as well as between groups 2 and 3 ( p < 0.001 ) , whereas no significant difference
was found between groups 1 and 2 ( p = 0.08 ) . * anova i x iii ( p<0.05 ) ; # anova ii x iii ( p<0.05 ) falls constitutes one of the most frequent complaints of children with cp who have the
ability to walk independently21 . the aim of the present study was to analyze correlations
between the results of the pediatric balance scale and the functional test , the pediatric
evaluation disability inventory ( self - care and mobility dimensions ) , for children classified
as levels i to iii on the gmfcs . the current preference in the literature is to classify children with cp based on the
gmfcs , which measures functional independence with regard to gross motor skills . a number of
studies report that this classification , which takes the child s age into account , maintains
a certain stability over the years22 , 23 . children classified on levels i and ii
have a good prognosis regarding gait and do not require gait - assistance devices . auxiliary
resources , such as orthoses , conventionally improve the positioning of the ankle . in
contrast , walkers and forearm crutches are indicated to compensate for deficient balance and
are fundamental for children classified as level iii . the present findings revealed
significant differences between the children classified as levels i and ii and those
classified as level iii regarding self - care , mobility and the pbs ; there were no significant
differences between the children classified as levels i and ii . despite the lack of significant differences between the children classified using the gmfcs
as groups 1 and 2 , the results of the correlations analyzed were not equal . the only
significant correlation for group 1 participants was between the pbs and the mobility
dimension of the pedi . a strong correlation was found between functional balance and the
mobility dimension of the pedi in group 1 and moderate correlations were found in groups 2
and 3 . the mobility dimension of the pedi evaluates performance during locomotion as well as
overall mobility , including transfers . the pbs involves items such as changing from a
sitting to a standing position , transfers and picking up objects from the floor , which is
similar to the assessments performed with the mobility dimension of the pedi . many of the
items of these two instruments are similar , and the results demonstrate the clinical status
of children with cp regarding muscle tone and impaired postural control , both of which
affect functional balance6 , 24 , 25 . with the current interest in the analysis of functional balance , there is a need for
detailed evaluations of assessment tools designed for such an analysis . in study carried out
by ries et al.17 , the pbs was shown to be
a simple , valid , reliable assessment tool for individuals with cp . the administration of the
pbs requires a maximum of 15 minutes and uses materials that are easy to obtain ( stopwatch ,
ruler / tape measure , chair , stool , adhesive tape , foot support ) . , postural control is inversely proportional to the classification level of the gmfcs , as
a higher level denotes worse postural control . balance and postural control in the standing
position are fundamental components of movement , involving the ability to anticipate and
recover from instabilities as well as to take action to avoid instability26 . as poor balance hampers the performance
of functional activities of daily living5 ,
we expected the pbs would be significantly correlated with all dimensions of evaluation
employed in the present study , which did not prove to be true . thus , the pbs can not be
considered a predictor of performance of global functions in children with cp , especially
children classified as level iii , since a strong correlation was only found for the mobility
dimension of the pedi for level i subjects , and only moderate correlations were found for
levels ii and iii . regarding the self - care dimension , moderate correlations were found among
all levels , which may be explained by the fact that this dimension does not involve a change
in position and only evaluates activities performed while sitting ( eating , brushing one s
teeth , brushing one s hair ) . the pbs demonstrated a positive correlation with the mobility
dimension of the pedi , regardless of the degree of motor impairment ( gmfcs level ) . thus , the
results of the scale can help to determine the degree of independence in activities related
to functional mobility in children with cp , such as the ability to walk , demonstrating that
balance is a prerequisite for independent gait performance . in the present study , no significant differences were found between groups 1 and 2 , which
is likely due to the similarity in these two functional levels . reliable measures of
functional balance for children with cp are important in clinical practice for the
determination of the proper therapy protocol and the assessment of the results obtained . based on the present findings , the pbs may be considered a good auxiliary tool for the
assessment of functional performance with regard to mobility , but can not be used in an
isolated fashion as a predictor of performance of other functions . thus , a complete analysis
is necessary for the functional classification of children with cp . the study population
was composed of a convenience sample ( children with cp registered at the physical therapy
clinics of the universidade nove de julho , brazil ) and therefore no sample size calculation
was performed . future studies with a
larger number of participants should stratify the sample based on functional level ( gmfcs
levels i / ii and level iii ) . | [ purpose ] to investigate the correlation of functional balance with the functional
performance of children with cerebral palsy .
[ subjects and methods ] this was a
cross - sectional study of children with cerebral palsy with mild to moderate impairment .
the children were divided into 3 groups based on motor impairment .
the evaluation
consisted of the administration of the pediatric balance scale ( pbs ) and the pediatric
evaluation disability inventory . correlations between the instruments were determined by
calculating pearson s correlation coefficients . [ results ] in group 1 ,
a strong positive
correlation was found between the pbs and the mobility dimension of the pediatric
evaluation disability inventory ( r=0.82 ) , and a moderate correlation was found between the
pbs and self - care dimension of the pediatric evaluation disability inventory ( r=0.51 ) . in
group 2 , moderate correlations were found between the pbs and both the self - care dimension
( r=0.57 ) and mobility dimension ( r=0.41 ) of the pediatric evaluation disability inventory .
in group 3 ,
the pbs was weakly correlated with the self - care dimension ( r=0.11 ) and
moderately correlated with the mobility dimension ( r=0.55 ) .
[ conclusion ] the pbs proved to
be a good auxiliary tool for the evaluation of functional performance with regard to
mobility , but can not be considered a predictor of function in children with cerebral
palsy . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.