text
stringlengths 69
652k
| id
stringlengths 36
47
| dump
stringclasses 105
values | url
stringlengths 25
1.53k
| date
stringlengths 19
25
| file_path
stringlengths 125
155
| offset
int64 36.4k
1.68B
| token_count
int64 15
198k
| language
stringclasses 1
value | page_average_lid
stringclasses 19
values | page_average_lid_score
float64 0.4
1
| full_doc_lid
stringclasses 42
values | full_doc_lid_score
float64 0.08
1
| per_page_languages
listlengths 1
435
| is_truncated
bool 2
classes | extractor
stringclasses 2
values | page_ends
listlengths 1
435
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
wwoods2 on DSK1DXX6B1PROD with RULES_PART 1
57862
Cross-Reference: Assistance to certain disabled veterans in acquiring specially adapted housing. See §§ 36.4400 through 36.4410 of this chapter. [FR Doc. 2010–23629 Filed 9–22–10; 8:45 am] BILLING CODE 8320–01–P
ENVIRONMENTAL PROTECTION AGENCY
40 CFR Part 52
[EPA–R09–OAR–2009–0958; FRL–9204–3]
Revisions to the California State Implementation Plan, San Joaquin Valley Unified Air Pollution Control District location (e.g., copyrighted material), and some may not be publicly available in either location (e.g., CBI). To inspect the hard copy materials, please schedule an appointment during normal business hours with the contact listed in the FOR FURTHER INFORMATION CONTACT section.
FOR FURTHER INFORMATION CONTACT: Joanne Wells, EPA Region IX, (415) 947–4118, [email protected].
SUPPLEMENTARY INFORMATION:
Throughout this document, ''we,'' ''us'' and ''our'' refer to EPA.
Unified Air Pollution Control District (SJVUAPCD) portion of the California State Implementation Plan (SIP). These revisions were proposed in the Federal Register on March 26, 2010 and concern volatile organic compound (VOC) emissions from refinery vacuum producing systems and process unit turnaround. We are approving local rules that regulate these emission sources under the Clean Air Act as amended in 1990 (CAA or the Act).
DATES: Effective Date: This rule is effective on October 25, 2010.
ADDRESSES: EPA has established docket number EPA–R09–OAR–2009–0958 for this action. The index to the docket is available electronically at http:// www.regulations.gov and in hard copy at EPA Region IX, 75 Hawthorne Street, San Francisco, California. While all documents in the docket are listed in the index, some information may be publicly available only at the hard copy
Table of Contents
I. Proposed Action
II. Public Comments and EPA Responses
III. EPA Action
AGENCY
: Environmental Protection
Agency (EPA).
ACTION
: Final rule.
SUMMARY: EPA is finalizing approval of
revisions to the San Joaquin Valley
IV. Statutory and Executive Order Reviews
I. Proposed Action
On March 26, 2010 (75 FR 14545), EPA proposed to approve the following rules into the California SIP.
We proposed to approve these rules because we determined that they complied with the relevant CAA requirements. Our proposed action contains more information on the rules and our evaluation.
imposed by State law. For that reason, this action:
be inconsistent with the Clean Air Act; and
II. Public Comments and EPA Responses
EPA's proposed action provided a 30day public comment period. During this period, we received no comments.
III. EPA Action
No comments were submitted that change our assessment that the submitted rules comply with the relevant CAA requirements. Therefore, as authorized in section 110(k)(3) of the Act, EPA is fully approving these rules into the California SIP.
IV. Statutory and Executive Order Reviews
Under the Clean Air Act, the Administrator is required to approve a SIP submission that complies with the provisions of the Act and applicable Federal regulations. 42 U.S.C. 7410(k); 40 CFR 52.02(a). Thus, in reviewing SIP submissions, EPA's role is to approve State choices, provided that they meet the criteria of the Clean Air Act. Accordingly, this action merely approves State law as meeting Federal requirements and does not impose additional requirements beyond those
* Is not a ''significant regulatory action'' subject to review by the Office of Management and Budget under Executive Order 12866 (58 FR 51735, October 4, 1993);
* Does not impose an information collection burden under the provisions of the Paperwork Reduction Act (44 U.S.C. 3501 et seq.);
* Is certified as not having a significant economic impact on a substantial number of small entities under the Regulatory Flexibility Act (5 U.S.C. 601 et seq.);
* Does not contain any unfunded mandate or significantly or uniquely affect small governments, as described in the Unfunded Mandates Reform Act of 1995 (Pub. L. 104–4);
* Does not have Federalism implications as specified in Executive Order 13132 (64 FR 43255, August 10, 1999);
* Is not an economically significant regulatory action based on health or safety risks subject to Executive Order 13045 (62 FR 19885, April 23, 1997);
* Is not a significant regulatory action subject to Executive Order 13211 (66 FR 28355, May 22, 2001);
* Is not subject to requirements of Section 12(d) of the National Technology Transfer and Advancement Act of 1995 (15 U.S.C. 272 note) because application of those requirements would
VerDate Mar<15>2010
14:54 Sep 22, 2010
Jkt 220001
PO 00000
* Does not provide EPA with the discretionary authority to address, as appropriate, disproportionate human health or environmental effects, using practicable and legally permissible methods, under Executive Order 12898 (59 FR 7629, February 16, 1994).
In addition, this rule does not have tribal implications as specified by Executive Order 13175 (65 FR 67249, November 9, 2000), because the SIP is not approved to apply in Indian country located in the State, and EPA notes that it will not impose substantial direct costs on tribal governments or preempt tribal law.
The Congressional Review Act, 5 U.S.C. 801 et seq., as added by the Small Business Regulatory Enforcement Fairness Act of 1996, generally provides that before a rule may take effect, the agency promulgating the rule must submit a rule report, which includes a copy of the rule, to each House of the Congress and to the Comptroller General of the United States. EPA will submit a report containing this action and other required information to the U.S. Senate, the U.S. House of Representatives, and the Comptroller General of the United States prior to publication of the rule in the Federal Register. A major rule cannot take effect until 60 days after it is published in the Federal Register.
Frm 00022
Fmt 4700
Sfmt 4700
E:\FR\FM\23SER1.SGM
23SER1
wwoods2 on DSK1DXX6B1PROD with RULES_PART 1
This action is not a ''major rule'' as defined by 5 U.S.C. 804(2).
Under section 307(b)(1) of the Clean Air Act, petitions for judicial review of this action must be filed in the United States Court of Appeals for the appropriate circuit by November 22, 2010. Filing a petition for reconsideration by the Administrator of this final rule does not affect the finality of this action for the purposes of judicial review nor does it extend the time within which a petition for judicial review may be filed, and shall not postpone the effectiveness of such rule or action. This action may not be challenged later in proceedings to enforce its requirements (see section 307(b)(2)).
List of Subjects in 40 CFR Part 52
Environmental protection, Air pollution control, Incorporation by reference, Intergovernmental relations, Ozone, Reporting and recordkeeping requirements, Volatile organic compounds.
Dated: July 7, 2010.
Keith Takata,
Acting Regional Administrator, Region IX.
■ Part 52, chapter I, title 40 of the Code of Federal Regulations is amended as follows:
PART 52—[AMENDED]
■ 1. The authority citation for Part 52 continues to read as follows:
Authority:
42 U.S.C. 7401
et seq.
■ 2. Section 52.220 is amended by adding paragraphs (c)(52)(i)(D), (c)(52)(iv)(G) and (c)(52)(vii)(D), by revising paragraph (c)(71)(i)(A) and adding paragraph (c)(71)(i)(B), and by adding paragraphs (c)(75)(iv) and (c)(351)(i)(C)(3) and (4) to read as follows:
§ 52.220 Identification of plan.
*
*
*
*
*
(c) * * *
(52) * * *
(i) * * *
(D) Previously approved on August 21, 1981 in paragraph (c)(52)(i)(A) of this section and now deleted without replacement within the San Joaquin Valley Unified Air Pollution Control District area, Rule 414.2.
*
*
*
*
*
(iv) * * *
(G) Previously approved on May 7, 1982 in paragraph (c)(52)(iv)(A) of this section and now deleted without replacement: Rule 414.2.
*
*
*
*
*
(vii) * * *
(D) Previously approved on May 7, 1982 in paragraph (c)(52)(vii)(A) of this
VerDate Mar<15>2010
14:54 Sep 22, 2010
Jkt 220001
PO 00000
section and now deleted without replacement: Rules 413.2 and 413.3.
*
*
*
*
*
(71) * * *
(i) * * *
(A) New or amended Rules 411 and 414.3.
(B) Previously approved on May 7, 1982 in paragraph (c)(71)(i)(A) of this section and now deleted without replacement: Rule 414.3.
*
*
*
*
*
(75) * * *
(iv) Previously approved on August 21, 1981 in paragraph (c)(75)(i) of this section and now deleted without replacement within the San Joaquin Valley Unified Air Pollution Control District area, Rule 414.3.
*
*
*
*
*
(351) * * *
(i) * * *
(C) * * *
(3) Rule 4453, ''Refinery Vacuum Producing Devices or Systems,'' adopted on May 21, 1992 and amended on December 17, 1992.
(4) Rule 4454, ''Refinery Process Unit Turnaround,'' adopted on May 21, 1992 and amended on December 17, 1992.
*
*
*
*
*
[FR Doc. 2010–23808 Filed 9–22–10; 8:45 am] BILLING CODE 6560–50–P
Frm 00023
Fmt 4700
Sfmt 9990
E:\FR\FM\23SER1.SGM
23SER1
|
<urn:uuid:837db8a8-3584-4e62-bf89-f9eaba603408>
|
CC-MAIN-2019-39
|
https://www.govinfo.gov/content/pkg/FR-2010-09-23/pdf/2010-23808.pdf
|
2019-09-21T11:30:39Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514574409.16/warc/CC-MAIN-20190921104758-20190921130758-00524.warc.gz
| 885,354,199 | 2,315 |
eng_Latn
|
eng_Latn
| 0.870916 |
eng_Latn
| 0.928077 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
5999,
9067
] |
40 YEARS as the leader in nonprofit lending
18.3
BILLION
Dollars in SBA Real
Estate Financed
105.8 MILLION Dollars in Working Capital Loans
165 MILLION Dollars to women, veterans + minorities
203 THOUSAND Jobs Created and Preserved
ANNA MARIE CRUZ
LOAN OFFICER
Penina Goodman Senior Vice President, Brand Marketing 619-243-8667 | [email protected]
As a steadfast follower of the design-thinking philosophy, Penina Goodman has long believed in putting customers and their needs first. When you accomplish this crucial step as a company, your messaging and outreach resonnates with your audience and drives results that meet your business objectives — from increasing brand awareness to driving growth.
Goodman leads with this customer-centric approach. The brand marketing strategy involves leveraging careful listening, empathy and innovation to meet the evident and unspoken needs of the audiences we serve, from the hardworking business owner to our trusted referral audiences. Essentially, we tell stories about how our business loans empower the individual borrowers and the communities in which they live and work. This is how we stand out in the sea of financial services competing for the attention and trust of the small business community.
Goodman's design and marketing portfolio and leadership record spans more than 20 years. Before joining CDC, Goodman worked with a slate of clients including Michael Jordan, W Hotel, Cymer Inc., Geppetto's Toys and Independent Financial Group. She has led and inspired collaborative teams through hundreds of branding and marketing initiatives — from concept through execution. Working in multiple industries has transformed Goodman into a stronger marketer, as it leads her to always consider many perspectives when creating a strategy.
Goodman is a proud native Michigander though began her career in Chicago, where she launched her first design studio. In 2003, she moved to San Diego and hasn't looked back, especially during the fall and winter months. Offline, you'll often find her cheering at Michigan football game watches, traveling to new places near and far, immersing in a good book, or hiking with her beloved rescue dog, Torrey.
Education:
* Bachelor's degree in psychology from University of Michigan
* Master's degree in graphic design from the Portfolio Center
* IDEO U certifications in design thinking
Current community involvement:
* American Marketing Association member
* Board of Governors of the University of Michigan Alumni Club of San Diego
|
<urn:uuid:865e77e7-b6a5-437b-96e0-4b5f76880d08>
|
CC-MAIN-2019-35
|
https://cdcloans.com/download/bio-penina-goodman/
|
2019-08-22T22:34:23Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027317516.88/warc/CC-MAIN-20190822215308-20190823001308-00251.warc.gz
| 399,160,870 | 501 |
eng_Latn
|
eng_Latn
| 0.996688 |
eng_Latn
| 0.996688 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2541
] |
St. John Parish
126 Hickory Street Strawn, TX 76475 Saturday Vigil Mass: 4:00 p.m. (English), Reconciliation: Before Mass
St. Rita Parish
St. Francis Xavier Parish
1109 Blackwell Road Ranger, TX 76470 Sunday Mass: 8:00 a.m. (English) Reconciliation: Half Hour before Mass
++Feast Day of the Week++
Halbryan and Foch Street
Eastland, TX 76448 Sunday Mass: 9:45 a.m. (Spanish) Reconciliation: Half Hour before Mass http://stfranciseastland.org/
Parochial Administrator: Father Reehan Antony
Parish Office Telephone: 254-647-3163.
If you need a priest (Fr. Reehan) in an emergency (hospital, etc.), please call 682-207-8557
Weekday Events in Your Parish/Eventos Durante la Semana de su Parroquia
St. Francis, Eastland Monday – Rosario (Rosary in Spanish), 7 p.m.
Tuesday – Estudio Biblico (Bible Study in Spanish), 7:30 p.m.
Friday – Oracion (Evening Prayer), 7 p.m.
Holy Rosary, Cisco Wednesday – Rosary 9 a.m., then coffee & donuts
1
st
Wednesday – Adoration of the Blessed Sacrament after Rosary
Sunday – Bible Study on the Gospel of Matthew, 5 p.m.
Calendar of Events/Calendario de Eventos
May 7
May 22
Holy Rosary parish pastoral and finance council meeting at 5pm St. Rita's Church Feast Day Mass at 6pm
Prayer Intentions for April 2017
Council Meeting
Pope's Prayer Intention -Young People: That young people may respond generously to their vocations and seriously consider offering themselves to God in the priesthood or consecrated life.
Urgent Intention - Landslide Victims: Victims of the landslide in Colombia and peace in the Democratic Republic of Congo, Venezuela, and Paraguay.
MASSES THIS WEEK
Monday - St. Rita -8am Wednesday-St. Boniface -5pm Thursday - St. Francis Xavier -7pm Friday- Holy Rosary- 9am
Parish pastoral and finance council meeting on 5/7/2017, 5pm at Holy Rosary church Hall
Fr. Reehan's vacation
Father Reehan will go to India to visit his parents from May 23 to June 23. Anything needing his attention, needing any sacraments, in those days please meet him as soon as possible
HOUSE BLESSING
IF YOU WOULD LIKE TO HAVE YOUR HOUSE BLESSED PLEASE CALL THE OFFICE.
Blessed Rose was born at Viterbo in 1656, the daughter of Godfrey Venerini, a physician. Upon the death of a young man who had been paying court to her, she entered a convent, but after a few months had to return home to look after her widowed mother. Rose use to gather the women and girls of the neighborhood to say the rosary together in the evenings, and when she found how ignorant many of them were of their religion, she began to instruct them. She was directed by Father Ignatius Martinelli, a Jesuit, who convinced her that her vocation was as a teacher "in the world" rather than as a contemplative in a convent; whereupon in 1685, with two helpers, Rose opened a preschool for girls in Viterbo: it soon became a success. Blessed Rose had the gift of ready and persuasive speech, and a real ability to teach and to teach others to teach, and was not daunted by any difficulty when the service of God was in question. Her reputation spread, and in 1692, she was invited by Cardinal Barbarigo to advise and help in the training of teachers and organizing of schools in his diocese of Montefiascone. Here she was the mentor and friend of Lucy Filippini, who
became foundress of an institute of maestre pie and was canonized in 1930. Rose organized a number of
schools in
various places, sometimes in the face of opposition that resorted to force in unbelievable fashion - the teachers
were shot at with bows and their house fired. Her patience and trust overcame all obstacles, and in 1713 she made a
foundation in
Rome that received the praise of Pope
Clement XI himself. It was in
Rome that she died, on May
7, 1728; her reputation of holiness
was confirmed by miracles and in 1952, she was beatified. It was not until
sometime after her death that Blessed Rose's lay school teachers were organized as a religious congregation: they
are found in
America as well as in Italy, for the Venerini
Sisters have worked among Italian immigrants since early in the twentieth century. Her
feast day is May 7
Save the date
St. Rita's Church feast day mass is on May 22 at 6pm.
Our Lady of the Holy Rosary Parish
1108 Avenue F Cisco, TX 76437 Sunday Mass: 11:30 a.m. (English) Reconciliation: After Mass www.ciscoholyrosary.com
STEWARDSHIP April 29-30, 2017
St. John.
$317.00
Holy Rosary. $925.00
St. Rita.
$654.75
St. Francis. $408.25
May God bless you for your generosity.
Mass Intentions
Holy Rosary-Sunday- For the repose of the Soul of: Helen Gaeta. Requested by: Gaeta Children.
St. Francis Xavier-Sunday- For the repose of the Soul of: Tommy Brock. Requested by: Pauline Scheuren.
St. Rita-Sunday- For the repose of the Soul of: Larry Jessup. Requested by: Pauline Scheuren.
St. John-Saturday- For the repose of the Soul of: Claude Wachsmann. Requested by: Pauline Scheuren
Holy Rosary Friday- For the repose of the Soul of: Helen Gaeta. Requested by: Holy Rosary Altar Society.
St Rita –Monday- For the repose of the Soul of: Gerald Wachsmann. Requested by: Pauline Scheuren.
St John -Wednesday - For the repose of the Soul of: Larry Jessup. Requested by: Pauline Scheuren.
St Francis –Thursday- For the repose of the Soul of: Ron Scheuren. Requested by: Pauline Scheuren.
|
<urn:uuid:e93beace-a163-465a-998c-83dbb489cd67>
|
CC-MAIN-2019-47
|
https://d2y1pz2y630308.cloudfront.net/5016/bulletins/20170507.pdf
|
2019-11-17T08:09:52
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2019-47/subset=warc/part-00229-47abed28-4fa2-4f4a-b4d3-db11c85b2f3a.c000.gz.parquet
| 369,509,517 | 1,410 |
eng_Latn
|
eng_Latn
| 0.993822 |
eng_Latn
| 0.993822 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
5346
] |
Maintaining Resilience in Teaching: Navigating Common Core and More Site-based Participant Syllabus
Course Description
This course is designed to help K-12 teachers navigate the ever-growing complexities of the education profession while simultaneously helping them to balance their lives and careers. Teachers will learn the tenets of Positive Psychology (Seligman) and related theories and strategies. These in turn, will provide the foundation for increasing personal and professional resilience, maintaining flexibility, and tending to physical and mental health as a basis to improve classroom experiences for all.
Course Prerequisites
This course is recommended for all K-12 educators. Participants must hold a baccalaureate degree. No prerequisites are required for this course.
Textbooks/Supplemental Reading
Selected research articles, research summaries, Web resources, and topical articles drawn from educational literature are integrated into the course. No textbook is required for this course.
Global Course Outcomes
Upon completion of this course, the learner will be able to:
1. To understand the impact of teacher disposition and well-being as a major contributing factor within the classroom
2. To develop a personal mission statement and foundation for teaching to improve resiliency and continued growth within the teaching profession
3. To examine current over-arching trends in education and evaluate how they dove-tail within the field and impact the classroom
4. To learn skills for the ongoing development of resiliency, foundation for classroom leadership, and teacher mission
5. To comprehend the significance of personal reflection and communities of practice in the ever-changing field of education
Instructional Objectives
By the conclusion of the course, each participant should be able to do the following:
1. Analyze current personal state of well-being, and through awareness and training develop a plan for improvement.
1.1 Define resiliency and how it relates personally and professionally.
1.2 Develop and maintain a wellness journal as a means of awareness of current state.
1.3 Explore current research and personal insights with the aim of improving personal well-being.
1.4 Create a plan for ongoing maintenance and continued improvement of well-being.
2. Develop a personal mission statement and foundation for teaching.
2.1 Define personal beliefs and values for holistic living.
2.2 Define a personal philosophy of teaching and learning.
2.3 Assess the integration of the personal mission statement and foundation for teaching.
3. Examine current major trends in education and evaluate how they integrate into the field and classroom.
3.1 Examine current national standards and supplementary standardsbased groups.
3.2 Examine current trends and philosophies in special education.
3.3 Examine teacher professionalism and current teacher evaluation models and practices.
3.4 Examine 21 st century student skills and the dynamic impact these skills have in the classroom.
4. Explore skills for ongoing development of resiliency as a means for enhanced growth within the field and improved classroom environment and instruction.
4.1 Understand self-leadership as the platform for classroom leadership.
4.2 Evaluate specific strategies designed to improve resiliency and wellbeing in general, and specifically within the field of education.
4.3 Define goals for personal growth and professional development.
5. Maximize personal reflection and communities of practice in support of personal and professional growth.
5.2 Explore the enlistment of a mentor or several mentors as a mode for continued resilience.
5.1 Enhance developing practices of holistic and professional well-being to sustain habits of reflection and participation in communities of practice.
5.3 Evaluate ways to maintain balance and see the larger picture within the educational field and personal life.
Teaching Methodology and Delivery Model
Teaching methodologies of this course are designed to support intensive, graduate-level course work in an interactive setting. Instructional plans support the content of this course, which focuses on the improvement of professional teaching expertise in any or all of the following categories: assessment, collaboration, communication, diverse learners, educational reform, instructional strategies, planning instruction, productivity, reflection of practice, student learning, subject matter, and/or technology.
* Methodologies include instructor presentations, specific skill practice, discussions, audio-visual presentations, self-evaluation, project development, course readings, research/inquiry exercises, and the synthesis of new knowledge and skills with previously acquired skills/expertise in relation to transition knowledge and content.
* The course is taught with instructor-participant and participant-participant feedback. Course content, activities, and assessments are organized into 8 modules totaling 45 seat hours. Assessments are due two-weeks following the end of the course.
* Research-based content, presentations, educator resources in print and on the Internet, notes from instructor presentations, class activity work pages, references, and assessments are supported by content designed specifically for educators.
* Daily activities include a variety of research-based instructional approaches appropriate for adult learners. Class participants actively construct their own learning and make it personally relevant by acquiring and applying course knowledge/skills during hands-on practice and problem-solving activities, personal reflection, in-class presentations, whole-class and small group discussions and activities, assigned readings, research/inquiry, projects, and collaborative work in various group formats. All are designed to make it possible for educators and other school-related personnel to learn the same basic content and skills with an emphasis on application to their own specific content area or grade level.
Topics Agenda
Milestone One: Teacher Resiliency
Reasons for teacher attrition rates; teacher resiliency defined; managing the ups and downs of teaching; recognizing and managing stress; obvious and subtle signs of stress; holistic wellness including protective factors, exercise, diet, hobbies, communities of support, and time for personal reflection; foundation for increasing personal and professional resilience, maintaining flexibility, and tending to physical and mental health as a basis to improve classroom experiences for all.
Milestone Two: Foundations for Classroom Leadership and Career Success Self-leadership as a platform for classroom leadership; teacher strength as a foundation for classroom leadership and career success; maintaining a positive attitude and the tenets of Positive Psychology (Martin Seligman); success strategies; risk taking and overcoming fears; teaching styles overview; staying organized; utilizing resources;
leading from within; finding a mentor or career coach; working with parents; preventing burnout; leadership as responsibility, service, and loyalty; cultivating flexibility; working in community; habits of effectiveness.
Milestone Three: The Teacher's Mission
Development of a personal mission statement that can help with motivation; climbing the career ladder…or not; the significance of reflection; creating career passion; determining strengths and passions as a teacher; the heart of a teacher; beyond surviving and moving towards thriving; managing individual working conditions; a mentor; success breeds success.
Milestone Four: Navigating the Standards
This milestone will provide an overview of all current and relevant standards including Common Core State Standards, other standards groups, and National Board Certification; how teaching standards impact the teacher and the classroom; observing questioning techniques as a key to unlocking the standards; ongoing development of resiliency, foundation for classroom leadership, and teacher's mission.
Milestone Five: Special Education
This milestone will provide an overview of all current and relevant initiatives within special education; Response to Interventions (RtI); tiers of support; RtI for content area teachers; managing differentiation; talented and gifted students; considering and valuing all stakeholders; special education meetings; working with parents; collaborative teaching and support from paraprofessionals; ongoing development of resiliency, foundation for classroom leadership, and teacher's mission.
Milestone Six: Teacher Professionalism and Evaluation
This milestone will provide an overview of all current and relevant practices for teacher evaluation; the Danielson framework for teaching; purpose of an e-portfolio; developing and maintaining a professional e-portfolio; personal observation logs; reflective observations; foundations for teaching (personal philosophy of teaching and learning); organizing the portfolio; using evaluations for continued growth; ongoing development of resiliency, foundation for classroom leadership, and teacher's mission.
Milestone Seven: The 21 st Century Classroom
This milestone will provide an overview of all current and relevant skills students need for the 21 st century; survey of computer software and applications; coping with changing landscapes in technology; what to do when technology does not work or availability is limited; the Flipped Class model; ongoing development of resiliency, foundation for classroom leadership, and teacher's mission.
Milestone Eight: Putting it All Together and Looking Ahead
Putting it all together and keeping it all together in an ever-changing field; staying invigorated and committed; moving forward in changing times; understanding and
respecting school culture; working with colleagues and administrators; professional development opportunities; maintaining balance; seeing the big picture; ongoing development of resiliency, foundation for classroom leadership, and teacher's mission.
Final Projects
Assignments/ assessments should reflect that each participant is accountable for a high degree of learning appropriate for graduate level credit. Therefore, instructors will assign 3 formative assignments which can be completed throughout the course. These assignments will correlate to the instructional learning objectives. All courses will also include a final summative project which requires critical thinking, analysis, synthesis, evaluation or application. Assessment of the assignments should not be limited to the quantity of work submitted but should carefully consider the quality and intellectual value of the work.
Final projects are due within two weeks of the end of class. Projects submitted during the third week "grace period" will have their grade reduced one full letter grade. No papers will be accepted past the grace period, and participants will, consequently, forfeit credit for the course. Papers are expected to be properly formatted and submitted to the instructor either in person or via mail or an email attachment.
Participants taking professional development unit (not-for-credit) courses must attend all scheduled class sessions and complete all formative assignments. However, they will be exempt from completing the final summative project unless otherwise noted. Proof of seat hours will be presented to the participants after completing course reflection via the student portal and all hours are met.
Grading
Throughout the course, participants will engage in both formal and informal formative and summative assessments. Points are assigned based on a rubric specifically delineated for each assessment that can be further defined as follows:
Distinguished: The assessment is highly imaginative; demonstrates critical thought; is unique; shows substantial application to one's own teaching or professional position; goes above and beyond requirements; is creative; demonstrates both breadth and depth of knowledge of transition-related subject matter; shows individual's personality; is professional in presentation and appearance; and demonstrates considerable effort. The assessment is exceptionally completed and demonstrates clear understanding of the tasks, gives explanations, and shows how the assessment applies to a teaching/learning situation. The assessment meets the specific criteria delineated in "Distinguished" on the course rubric.
Proficient: The assessment is well-organized and complete; is effectively and clearly presented; demonstrates clear understandings; applies what has been learned to the author's own classroom situation; clearly shows connections; is detailed; and is
thoughtful and supported with ideas. A thoroughly completed assessment demonstrates that the participant shows awareness of the tasks, gives explanations, and shows how the assessment applies to a teaching/learning situation. The assessment meets the specific criteria delineated in "Proficient" on the course rubric.
Basic: This is the lowest passing grade. The assessment meets minimum requirements; includes general information but lacks descriptive detail; shows limited application to teaching/learning; and lacks originality. This denotes work that does not meet all aspects of standards for academic performance in a graduate-level course. The assessment meets the specific criteria delineated in "Basic" on the course rubric.
Unsatisfactory: The assessment is missing evidence or information; is sloppy and poorly organized; demonstrates only surface understandings; shows no evidence of application to the author's own teaching situation; is poorly written; and does not meet minimum standards for academic performance in a graduate-level course. The assessment meets the specific criteria delineated in "Unsatisfactory" on the course rubric.
The assessments for this course are weighted as follows:
30%
Participation and Reflection
Formative Assessments
30%
Summative Assessments
40%
Final projects are due within two weeks of the end of class. Projects submitted during the third week "grace period" will have their grade reduced one full letter grade. No papers will be accepted past the grace period, and participants will, consequently, forfeit credit for the course. Papers are expected to be properly formatted and submitted to the instructor either in person or via mail or an email attachment.
Participants taking professional development unit (not-for-credit) courses must attend all scheduled class sessions and complete all formative assignments. However, they will be exempt from completing the final summative project unless otherwise noted. Proof of seat hours will be presented to the participants after completing course reflection via the student portal and all hours are met.
Academic Honesty and Integrity
All participants are expected to maintain academic honesty and integrity by doing their own work to the best of their ability. Academic dishonesty (cheating, fabrication, plagiarism, etc.) will result in the participant receiving a zero for that assessment or paper.
Americans with Disabilities Act Compliance
In compliance with Section 504 of the Rehabilitation Act and The Americans with Disabilities Act, participants who have any condition, either permanent or temporary, which might affect their ability to perform in this class, are encouraged to inform the instructor at the beginning of the first session. Reasonable academic accommodations, aids, and adjustments may be made as needed to provide for equitable participation.
Attendance
Participants are required to attend all classes and to fully participate in class discussions, small group activities, and projects. Absence from any part of the class will require that you withdraw from the class. You will need to contact The Connecting Link at (888) 550-5465 in the event this occurs.
Emergency Statement
In the event of an emergency declared by the college or by The Connecting Link (TCL), we reserve the right to alter course plans and the attendance policy. In the event of an emergency, TCL will contact the instructor/participants with alternative educational plans for the course.
Late Work and Make-Up Policy
Participants are expected to keep pace with all assessments assigned both in and out of the classroom. If a situation arises in which an assessment cannot be completed, the participant is expected to make arrangements with the instructor for the timely submission of such work. All work is due no later than two weeks after the course ends. Failure to complete all work in this time frame will result in an incomplete or a grade of F for the work, depending on the reason for the delay.
University Compliance
Course content and instruction are bound by policies associated with the university granting academic credit for the course. Such polices include, but are not limited to: academic integrity and honor codes, institutional objectives, and grade grievance procedures. These policies are located within the official academic catalogs which can be accessed through the university's official website.
|
<urn:uuid:1e1a8bec-1aba-4618-8d21-0e9d552217a4>
|
CC-MAIN-2019-26
|
https://www.connectinglink.com/pdf/MRT_SB_Participant_Syllabus_revised180925_SB.pdf
|
2019-06-24T19:50:27Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560627999709.4/warc/CC-MAIN-20190624191239-20190624213239-00273.warc.gz
| 690,405,490 | 3,054 |
eng_Latn
|
eng_Latn
| 0.993695 |
eng_Latn
| 0.994925 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1849,
3925,
6984,
9809,
12722,
15183,
17167
] |
ROUSSELY REPORT: SAVING FRENCH NUCLEAR INDUSTRY WITH OUTRAGEOUS MEASURES
After France's failure to win the contract for four nuclear power plants in the United Arab Emirates, president Sarkozy ordered a report on the French nuclear industry. The outline of the Roussely report (named after Francois Roussely, a former EDF-president), dated June 16, was made public –in French- by the Elysée Palace on 27 July 2010
(715.6078) Sortir du nucleaire - In the report, author Francois Roussely recognizes the scale of problems facing the French nuclear industry: lack of export competitiveness, falling domestic load factor, delays and cost overruns in EPR construction projects.
French nuclear industry: disastrous economic and industrial results
the claims made by Areva, the merchant of nuclear plants. Roussely points out the inadequate performance of the French nuclear reactors: "whereas global average nuclear plant availability has significantly increased during the last 15 years, nuclear plant availability in France has seen a marked decrease in the last few years."
The Roussely report recognizes the scale of the setbacks experienced by Areva and EDF at the EPR reactor construction sites in France and Finland: "the credibility of both the EPR model and the French nuclear industry's ability to build new reactors has been severely eroded by the difficulties encountered at the Finnish construction site of Olkiluoto and at the site of the third tranche of the Flamanville plant." At fault is the "complexity of the EPR" which "without doubt hinders its construction and consequently impacts on its cost."
By stating that "the nuclear industry must become sufficiently competitive to attract private investment", Roussely admits that the nuclear industry has so far never been competitive nor economically efficient, in contrast with
The failure of the EPR is such, according to Roussely, that "it is the credibility, and therefore the very existence" of the French nuclear industry which is at stake. In the face of this, Roussely uses all available means to recommend various equally outrageous "emergency measures".
Passing the cost onto the consumer and misuse of public funding
Roussely recommends "a moderate but regular increase of electricity tariffs, opening the way towards financing the renewal of nuclear installations". Is nuclear power too costly? That's no problem, the consumer can pay. By becoming "regular", the tariff increase is unlikely to remain "moderate" for any length of time...
SEPTEMBER 3, 2010 | No. 715
Roussely proposes the diversion of some of the funding available for renewable energy to benefit the nuclear industry.
The uranium used in nuclear plants is a finite mineral resource and is nonrenewable: nuclear power is a fossil energy as much as oil and coal. Yet Roussely suggests "taking firm political action to ensure that all multilateral funds for renewable energy should also be available to the nuclear industry".
Savings at the expense of safety
The Roussely report confirms a dangerous trend: the reduction of safety and security requirements in the face of economic constraints: "Continually increasing safety requirements cannot be the only rational way forward". Roussely calls for the optimal realignment between safety requirements and economic constraints. This politically correct jargon means that safety requirements are governed by the industry's criteria of profitability and profit. "Safety indeed, but only if we can afford it!"
Chernobyl cost, in euros and in human lives?
Given the economic constraints, Roussely gives little thought to the appalling working conditions of the 20,000 external workforce employed by 600 subcontracting firms. Last May, eight temporary workers were forced to go on strike at the CEA site at Carradache: they were not being paid and had to buy their own radioactive protection gear! Yet Roussely only proposes a working conditions "charter", i.e. a non-binding list of commitments left to the goodwill of companies...
Gagging a cautious French Safety Authority
Nuclear energy is not "attractive enough for private investment", so the construction of new reactors is not a foregone conclusion. Roussely recommends an increase in the lifespan of French nuclear power stations to 60 years, when they were designed to operate for 30! The oldest French reactors have already experienced incidents far more numerous than the average across nuclear installations as a whole. To pretend they can operate for another 30 years is therefore a highrisk strategy, totally irresponsible. Several hundred million euros would be needed to repair each reactor, which would still be cheaper than the 5 billion required to (maybe) build an EPR. And how much would a major accident like
Roussely calls for a reduction in the scope of the Autorité de Sûreté Nucléaire (ASN) in favor of the government: "the government must define a balanced modus vivendi with the ASN, it must re-establish a sovereignty which it shouldn't relinquish to an independent authority." This is clearly a way to reduce the small margin of autonomy available to the official organization controlling the nuclear industry.
Although very muted, criticisms from the ASN remain an embarrassment for Areva and EDF: "events with very limited effects [i.e. incidents and design errors documented by the ASN] should not result in undeserved suspicion of [nuclear] technology as a whole."
The Roussely report confirms the fact that the government sees the ASN as a useful alibi, a tool to "reassure" the population. Does the French Safety Authority only have authority in name?
Making nuclear waste acceptable to the public
Roussely admits that "public acceptance [...] is an essential condition for developing the civilian nuclear industry". Roussely points out that "[nuclear waste] is the most convincing argument against nuclear power for 60 to 70% of French people".
Yet there is no solution to the serious problem of nuclear waste, some of which remains dangerous for hundreds of thousands of years. Roussely lets slip a telling confession: "a list of realistic specifications" is yet to be drawn up for the nuclear waste burial site at Bure, due to become operational in 2015. So Roussely admits in veiled terms that all the fine words uttered for years by the French National Radioactive Waste Management Agency ANDRA are not "realistic".
Thus, one shall not be surprised that Roussely is panicking to such an extent that he addresses all the industry's players: "It is now essential that ANDRA determines as a matter of urgency the detailed operational plans being set up for 2015 in relation to the deep disposal centre. To achieve this, it is proposed that ANDRA urgently involves EDF, AREVA and the CEA (French Atomic Energy and Alternative Energies Commission) in defining the best possible specifications for the deep disposal center and its completion."
An English translation of the published summary of the Roussely report is available at: http://www.psr.org/nuclearbailout/resources/roussely-reportfrance-nuclear-epr.pdf
Source and contact: Sortir du nucleaire, 9, rue Dumenge, 69317 Lyon Cedex 04, France.
Email: [email protected]
Web: www.sortirdunucleaire.org
OLKILUOTO BLOCKADE
Saturday August 28 was the day of the first publicly announced blockade of a nuclear site in Finland ever. More than 100 activists from Finland and other countries did several blockades on the roads to the nuclear power plant. While a bigger blockade with picnics, sit-ins and other activities closed the entry to the main access road to the NPP blockading also several times the highway passing this place, smaller action groups showed up at many points on the roads to the power station.
2
Nuclear Monitor 715
(715.6079) Olkiluoto blockade - The police could not prevent most of the actions, although they closed a huge area of public roads for everyone who was not a resident or a nuclear power plant worker. Even media had no access to that region. However, activists used the forests to reach the forbidden area and successfully blockaded many roads for up to nine hours.
While smaller action groups had spread over the region closed for public by the police for that day and did several blockades with sit-ins and lock-ons, a bigger group of more than 50 activists blockaded the access from the highway E8 to the main road to the nuclear power plant (NPP) Olkiluoto for some 9 hours. In the time between they several times also blockaded the highway for a couple of minutes.
area around Olkiluoto is owned by the atomic industry the prohibited area is small and public is allowed to use the forests very close to the power station.
only besides the streets. Rumors said that (para-)military and special riot police forces were stationed at the plant and in the forests close to the power station. There have been also police on the water around the peninsula on which the plant is located, some people reported. Actually, most blockaders just saw a few police units at the main access road junction to the highway and at important junctions of smaller access roads to the plant, where they had street barricades to stop public from reaching this public area.
In Finland's countryside "everyone's right" is ruling - private property owners of land can't prohibit anyone to go to the forests, camp there, have camp fire etc. Only a small circle of a couple of meters around houses are protected against trespassing. Anyway, there are exceptions for capitalist companies (of course), and the nuclear power plant has a security area because of risks of terrorist attacks and whatever. But even they are limited and although a huge
People made music, had talks with local people, showed banners to the cars on the highway next to the blockade, discussed about nuclear power and chances to fight against it and had picnics, coffee and cakes. Cars leaving the nuclear area were usually allowed to pass the blockade as well as ambulances or other emergency cars. In the beginning the police forced people to let a few trucks pass, too. But later, when the blockade had been completely established and the smaller blockades of other roads were also closing streets, traffic had been stopped here totally.
The police arrested 30 activists.
The police had announced a few days before to follow the wishes of TVO (operator of the nuclear power plant) to keep the roads open and allow protest
Source: Indymedia Germany, 29 August
2010
Contact: [email protected]
Uranium: A blessing or a curse? Pan-African trainingsweek in Tanzania, in November
Africa is the next frontier to meet energy needs. Oil and gas are being exploited as never before, exacerbating conflict in many African nations. At the same time, renewed demand for uranium is being explored on the continent more than at any other time in history. Yet the continent's huge potential for truly renewable energy is not fully being realized.
In the past years WISE has been approached by many civil society groups in different African nations to help develop networks, materials and (ways to develop) strategic campaigning plans and, in general, start helping the ngo's in their efforts to counter the pro-mining agenda. After several successful meetings and trainings in different countries and with different audiences and groups involved, we now have the opportunity to organize a truly Pan-African week for real in-depth trainings and networking/capacity development.
The training will take place in Tanzania, very close to the capital, at the coast. In seven days (November 20 – 27) a group of 30 representatives from 12 different African countries will learn, exchange and practice. Presentations will be given by different experts from Europe, Asia, Africa and the USA, all with a clear aim to educate and learn. The week of training is free for the invited participants from the 12 African countries but is in principal also open for interested activists and campaigners from non-African countries. The costs are 700 euros (plus of course your ticket to Tanzania)
Would you be interested to take part in this unique week, to learn, exchange and get to know the African struggle for environmental justice; contact WISE for more details on the program.
Nuclear Monitor 715
HAUNTED BY HISTORY: NUCLEAR NEW BUILD IN BRITAIN
Part 2 The Force of 'Legacy'.
In January 2008, Gordon Brown's cabinet formally decided to permit private businesses to build new nuclear power stations in England and Wales. Politically, there was nothing surprising about the news. Key decisions had been made well before 2008. Tony Blair, as Prime Minster, had declared for new nuclear as early as July 2004.
(715.6080) East Midlands Campaign for Nuclear Disarmament – (This is the second and last part on the history of new build in Britain. Part 1 was printed in Nuclear Monitor 714, 20 August 2010)a government.
New Nuclear and Coalition
The May 2010 election in Britain changed the prospects of building new nuclear power stations significantly. Labour under Blair and Brown favored new nuclear from around 2004-5. This was not shared by the parties that came to form the coalition. The Conservatives changed to conditional support for nuclear only in December 2007. The Liberal Democrats opposed both the replacement of the Trident nuclear weapon system and nuclear new build and went to the electorate on this basis:
the deficit and is cutting and privatizing public services. It hopes that the private and the voluntary sectors will fill the gaps in employment and in vital social functions (Cameron's 'Big Society'). This has implications too for financing nuclear revival. The coalition's neoliberal consensus bars open subsidies, it seems, but the underlying instability of the financial system remains and the banks are reluctant to lend.
'More nuclear power will soak up subsidy, centralize energy production and hinder development of Britain's vast renewable resources. Nuclear has a dirty legacy and increases global security risks. We oppose construction of further nuclear power stations'.
As a result the coalition's statement on nuclear power seems ambiguous – in a country where coalitions are unfamiliar. The parties' positions are recapitulated, the Conservative position being described as 'allowing the replacement of existing power stations provided they are subject to the normal planning process for major projects … and also provided they receive no public subsidy'. Liberal Democrats agree to allow the government to put a new 'National Planning Statement' to Parliament, where one Liberal Democrat MP may speak against, but the rest must abstain from voting. The issue is not 'a matter of confidence' that can threaten the coalition and its
4
Nuclear Monitor 715
Liberal Democratic opposition is absorbed in a solution similar to Labour's. The joint program insists on 'no public subsidy' without defining what a subsidy is. It promises to modify Labour's changes in the planning process, increasing ministerial powers, abolishing Labour's new quango - the Infrastructure Planning Commission and strengthening Parliamentary oversight. It implies only the 'replacement' of existing power stations, a retreat from Labour's embrace of whatever 'the market' allows.
The Minister with the new powers is the Secretary of State for Energy and Climate Change, a post now held by Christopher Huhne, a Liberal-Democrat, who was previously an opponent of nuclear power. In the latest Commons debate he reaffirmed coalition policy, insisting that as an economist, I am skeptical about the economics of nuclear power, but I recognize that it is entirely up to investors to make that decision. If there is no public subsidy and if investors think that it is worth taking the risk, as they increasingly do, looking forward to rising oil and gas prices and a rising carbon price, then they will take those decisions.
Asked to explain why Labour's loan to the Sheffield Forgemasters (to produce large metal vessels for reactors) had been cancelled, he replied that this was a subsidy. Subsidy, he declared, is now impossible for, to quote the Chancellor of the Exchequer, 'there is no money left'. Generally, the Coalition adopts an anti-Keynesian approach to the crisis in state finance caused by rescuing the banking system. It blames Labour for
The companies, however, have been reassured that the government welcomes nuclear power in its energy strategy, although they must submit definite financial and technical programs for the subsequent decommissioning. A new Nuclear National Plan will be submitted 'in the autumn', followed by more 'consultation', and a proposal to Parliament in Spring 2011. It is to be expected that the industry is already lobbying hard, without enjoying perhaps Labour's preferential access. According the KPMG, one of the Big Four auditors, all that is currently on offer is to fix the carbon floor price and this is insufficient security for investors. RWE, hoping to build in Britain, argues that nuclear should get the same level of public subsidy as renewables, a position also pushed by the CBI, the national employers' organization. This demand comes on top of more hidden subsidies that include fixing the carbon price, indemnity for accident and government finance for legacies of waste and decommissioning. Government is therefore faced with dilemmas. Can it depend on a renewables sector, grossly under-supported in the past and lagging by European standards? Can it make an explicit break from 'no subsidy'? Will nuclear split the coalition? Can government make a secret deal with the industry or can subsidies be further fudged? Will the public stand a hike in energy prices to accommodate nuclear?
The government's difficulties are increased by the revival of anti-nuclear campaigning after a period of relative quiet, broken mainly by Greenpeace and the Shut Down Sizewell campaign in Suffolk. The need for carbon reduction, and the (usually exaggerated) claims for nuclear on this score, complicated issues for some green activists, while anti-nuclear movements, especially the Campaign for Nuclear Disarmament (CND) has focused on weapons. Latterly, however, issues have been clarified and new local movements have sprung up. These are centred on nuclear waste dumping (e.g. Kings Cliffe Waste Watchers Northants; Radioactive Landfill No Thanks! - Keekle Head, Cumbria) and new power station sites (e.g. Stop Hinkley; Shut Down Sizewell; BANNG – Bradwell, Essex; Heysham Anti-Nuclear Alliance; Stop Wylfa – Anglesey and a number of movements in Cumbria (Cumbrians Opposed to A Radioactive Environment, Radiation Free Lakeland, Save Kirksanton, Toxic Coast). CND, locally and nationally, increasingly stresses the overlaps between the global proliferation of uranium and plutonium weapons and the civil nuclear cycle and has joined other NGOs in an umbrella group opposing nuclear power. The local movements are also networking through meetings and campaigning and educational websites (e.g. No New Nukes; Energy Fair; Stop Nuclear Power; NuclearSpin). A substantial body of independent expert opinion opposes nuclear new build for health and economic reasons. There are plausible projections of how to meet (reduced) energy needs without nuclear power and convincing arguments for the superior employment impacts of green investment compared with the nuclear industries and the arms trade.
If the new waste dumps and power stations are finally approved they will face non-violent direct action as well as the citizen strategies already being used. Because opportunities for intervening in formal planning processes have been reduced, local non-violent direct action may grow.
Legacy Lesson I: Subsidy
As we have seen, pro-nuclear governments and industry seek to split the awkward past of civil nuclear power off from its future promise and prospects, repeating an older story about the 'good' and 'bad' atom. The new stations, it is said, will produce less waste and be safer. This splitting of old from new is discursive, with the 'Nuclear Renaissance' presumably contrasting with the Nuclear Dark Ages, but it is also institutional and a matter of balance sheets. The creation of a new public body, the Nuclear Decommissioning Agency (NDA) in April 2005, was a crucial institutional move because it allocated 'legacy waste' and decommissioning to a public balance sheet. Moreover the NDA wields a complicated system of sponsorship, 'parent bodies' and subcontracting that will obscure further subsidies.
Actually the past history of civil nuclear power has effects in the present both as lessons from the past and as material legacies or burdens – as very material ghosts in fact.
The major lesson from the past is that nuclear electricity generation means public subsidy. This arises from the high capital costs of construction and the uncertainty that investors can recoup large loans. The object lesson in the British case was the near insolvency of the monopolistic nuclear energy company British Energy in 2002. This required a major government bail out and led to the creation of the NDA, siphoning off some industry obligations.
The high capital costs arise in large part from the dangers to life on earth from ionizing radiation. Epidemiological research shows that these dangers arise not only from accidents, which can be catastrophic, but also from the routine operation of nuclear installations. For example, the repeated finding of higher rates of childhood leukemia near nuclear installations has been confirmed by the important German KIKK study, large-scale 'hard science' in terms of the discipline. (see Nuclear Monitor 703, 29 January 2010). Regulatory agencies argue that radiation from emissions is 'too low' to affect health, but developments in cellular biology and genetics show that risk levels need to be revised. The science is complex and contested and needs fuller treatment, but, in sum, policy needs to take due account of the effects of 'internal emitters'– particles of radionuclides found inside the body, spread to the environment from nuclear installations or contained in waste. Omnibus categories like 'low level radiation' or 'low level waste' are unsafe. The way is now open for more adequate explanations of childhood leukemia and other contested findings.
In economic terms, the intense radioactivity of reactor cores demands fortress-like containment and shielding, complex accident prevention measures, close monitoring and protection of workers, rigorous management, welltrained staff and tight regulative surveillance and policing. It is arguable that there should be regular epidemiological checks on surrounding populations. Should accidents or attacks with evil intent occur, damage could be massive, costly, and in many ways irreparable. All this adds to economic risk and pressure on costs. Moreover, especially with privatization, the narrow margin of profitability sets up a dangerous dynamic, a balancing of safety with profit, with companies under pressure to cut costs by reducing safeguards and to campaign for looser safety codes and inspection. Lower tenders may be accepted from less competent subcontractors, with a lowering of knowledge and skill at a time of skill shortages. There is already evidence, in the case of low-level waste, that companies will try to dump on the cheap without adequate engineering. If the new power stations really are safer, they are likely to cost more.
In building power stations, delays, rising costs and reduced ambitions have been commonplace. In the UK this has meant eleven Magnox stations instead of twenty, reduced and slow building of the AGR fleet, one PWR reactor instead of four, one failed fast-breeder reactor only. The last power station built in Britain was the one and only PWR Sizewell B. Costs rose from a budget of £1.69 billion to the eventual cost of £2.5 billion (US$3.8 bn or 3 bn euro); the design was approved in 1987, generation started in 1995. Areva and Siemens' EPR power station at Olkiluoto, Finland was already more than three years over schedule and 55% over budget in August 2009. In May 2009 the Finnish government's Radiation and Nuclear Safety Authority
Nuclear Monitor 715
threatened to halt construction, because of faulty safety systems, lack of expertise in design and construction and 'evident errors' in building. Costs are high or unpredictable where designs are new or when a design approved in one country encounters a new regulatory regime. Public opposition may also cause delays as at Sizewell. Construction in England and Wales of the AP1000 and the EPR risks these delays and neither design has yet been passed by the Nuclear Installations Inspectorate.
Critics of nuclear power have listed the many forms of indirect subsidy. In Britain, subsidy has also been direct, most clearly since the industry was privatised. From 1990, for example, a nuclear levy was introduced to cover the difference between nuclear and coal-fired generation adding 11% to electricity bills. Intended for a decommissioning fund, the levy was diverted to pay for Sizewell B.
More Ghosts in the Material World: Legacy Waste and Decommissioning
Similar problems arise in waste storage, reprocessing and decommissioning. Since 2005, one public institution, the NDA has inherited these problems. They are also concentrated spatially in a nuclear House of Horrors, the Sellafield site on the Cumbrian coast, home to many ghosts that haunt the nuclear industry today. These include Calder Hall, the first power station built primarily to provide fissile material for nuclear weapons; a plutonium pile at 'Windscale' which caused the most serious nuclear accident in Britain in October 1957; the Magnox plant built to reprocess spent fuel for first generation reactors; the Thorp Reprocessing plant closed because of serious incidents for much of its history; the troubled vitrification plants which prepare highlevel waste for long-term storage; the Actinide Removal Plant, source of the radioactive pollution of the Irish Sea; the MOX plant which was supposed to use excess plutonium and natural uranium to create reactor fuel; and a large number of radioactive waste stores. The Drigg low-level waste depository is 6km away.
Sellafield's and the NDA's problems figure in concerned official reports from
6
Nuclear Monitor 715
1992 to late 2008. The NDA was in a state of administrative disarray by 2008, the critical year for accepting consortia bids for decommissioning and waste management. By July 2008 42% of budget of the department responsible (then called Business, Environment and Regulative Reform) was going to the NDA, £15 million (US$23 million or 18.1 million euro) of it switched from funding for renewables and some even from the wartime military budget. Subcontracting companies like AMEC complained of 'turbulence', with key NDA executives leaving and staff sent for retraining. Decommissioning started then stopped on key projects, including removing old reactors from sites where new are planned. Several waste projects were also curtailed. Overall, the cost of decommissioning the 19 nuclear plants within NDA's remit has risen steadily from £61 billion to £73bn (January 2008) to £83bn (July 2008) (US$127.3 bn or 100.4 bn euro), far outstripping any possible earnings.
Apart from military applications, the hope of making money from waste from civil nuclear activity has been disappointed. Vitrification, long-term storage and Thorp's reprocessing have been dogged by breakdowns, broken contracts and financial losses. There is a long history of expert anxiety about safety at Sellafield, about Magnox 'swarf' (which contains plutonium), the 23 separate intermediate-level waste streams, and about contaminated buildings. The storage of large amounts of very radioactive material in liquid form is vulnerable to leakage, earthquakes and sabotage. Clean-up costs at Sellafield are estimated at just over £45.5bn (US$70 bn or 55 bn euro). The new private managing consortium will surely be back with urgent safetybacked requests for additional public funds.
Meanwhile long-term waste storage is in crisis. Material from decommissioning generations of old plant must go somewhere. For low-level waste, with Drigg almost full, waste disposal companies are looking to 'go nuclear' and use their ordinary hazardous waste landfills. Apart from offers from Cumbria County Council to host waste storage at the cost of £75 million (US$ 115m or 90.7m euro) compensation from public funds, little progress is being made with vitrification and the building of deep level storage. Generally public opposition to the dumping of waste is growing.
Pro-nuclear advocates argue that the threat of climate chaos and increases of oil and gas price favour nuclear as part of 'the energy mix'. An economic nationalist case for 'energy security' is also argued, yet, in UK today, nuclear means dependence on French, German, American and Spanish companies who can take capital and skills elsewhere. New nuclear will add further accumulations of radioactive plant and waste. Given the geological time-spans involved, nuclear 'clean up' and waste storage maybe problems beyond human capacity to solve. Certainly the technical knowledges, institutional frameworks and longer-term political wisdom do not yet exist. Neoliberal doctrine disallows firm correctives to the short-term competitive interest that rules under capitalist conditions. If new nuclear goes forward, it will add weighty burdens to over-stressed world, while safer green alternatives will be stifled, as nuclear enterprise gobbles up public resources. In the end, the best approach to nuclear electricity generators (or nuclear weapons of course) is simply not to have them.
Sources (in addition to those cited in Part 1 in NM 714): Health and Safety Commission, Advisory Committee on the Safety of Nuclear Installations (HMSO 1992); National Audit Office Press Release 30th Jan 2008 (on Decommissioning and the NDA) http:// www.nao.org.uk/pn/07-08/0708238.htm Internal BERR audit of NDA reported Guardian 24 July 2008; Liberal Democrat Policy Briefing - Climate Change and Energy, May 2010; The Coalition: Our Programme for Government, May 2010; Sunday Telegraph 17 July 2010, reported in NM 714.
Contact: Richard Johnson, Chair East Midlandss Campaign for Nuclear Disarmament.
3, Westhill Road, Leicester, LE3 6GB, UK.
Email: richard.johnson61@btinternet. com
NUCLEAR ENERGY DECREASES WORLD STABILITY AND INCREASES INEQUALITY
Jordanians are wondering why the United States is opposing efforts from Jordan to establish a uranium enrichment program. The Nuclear Non-Proliferation Treaty (NPT) and other international accords "guarantee the right of all nations to develop nuclear energy meant for peaceful purposes", which includes uranium enrichment.
(715.6081) WISE Amsterdam - Jordan has huge uranium reserves. The International Atomic Energy Agency (IAEA) has estimated that the country has uranium deposits of nearly 112,000 tons, ranking 11th on the global chart. It has licensed French energy company Areva to extract 2,000 tons of uranium ore annually from its central and southern deserts. A British-Australian company and a Chinese firm are also exploring other regions for deposits.
Jordan Atomic Energy Commission Chairman Khaled Toukan says the country's nuclear project, including uranium enrichment "is not a choice but a national necessity that will guarantee the nation's future."
A Jordanian view:
But the US is opposing uranium enrichment in Jordan. According to the US proposal, Jordan must exchange its uranium for enriched uranium produced in foreign countries, a move that would impose a burdensome expenditure on Jordan. The US is not just trying to impose this restriction on Jordan. In fact, Washington wants to deprive all Arab states of their national and international right to enrich uranium.
Jordan and the US signed a memorandum of understanding on nuclear cooperation in 2008 that guaranteed Jordan's right to enrich uranium. In the same year, Jordan also entered into talks with two US companies for the construction of its first nuclear power plant, and without consultation with any other Arab country, waived its right to enrichment. Saudi Arabia and Egypt will probably also be forced to accept the same fate. However, the main difference is that those two countries both sit atop vast oil reserves.
Jordan signed a peace treaty with Israel in 1994 and has remained one of Washington's main unwavering allies in the Middle East. It is referred to as a NATO partner. All these concessions should allow the country to demand its right to enrich uranium, as enumerated in international agreements.
policy is to ban foreign enrichment and nuclear fuel production. According to this policy, nuclear programs from the Nile to the Euphrates would be required to be dependent on nuclear fuel exporting countries. In the Middle East, only Israel is allowed to enjoy access to the complete nuclear fuel cycle, and the US is opposed to any efforts that could break this monopoly.
What was that again on nuclear power and independence?
At the moment, Jordan needs to import 95% of its oil and gas needs. In 2007, the nation of 7 million people spent US$3.2 billion to buy oil. This figure swelled to US$3.9 billion in 2008, which is about 20% of Jordan's gross domestic product. Imagine the possibilities of solar and what that would mean for dependency and the gross domestic product! Because there are (too) many examples that nuclear power does not decrease dependency on oil.
Press.tv, 14 August 2010
Source:
One Jordanian official says the real US
MORE PLUTONIUM DESTINED FOR WIPP?
The Department of Energy (DOE) Savannah River Site in South Carolina is proposing to ship up to six metric tons of surplus plutonium from nuclear bombs to the Waste Isolation Pilot Plant (WIPP) in southeastern New Mexico.
(715.6082) CNCS – Before making the decision to ship surplus plutonium to the WIPP, DOE must provide detailed information about the proposal and consider reasonable alternatives in an environmental impact statement. Public meetings will be held in Carlsbad and Santa Fe late August. The draft statement might be published in 2011 and released for public review, comment and hearings.
neither of them proposed that any of the surplus plutonium would be destined for WIPP. They proposed a two-track solution where the plutonium would be immobilized or made into nuclear reactor fuel.
seven metric tons, including through immobilization.
In the 1990s, DOE completed two environmental impact statements, but
DOE now plans to supplement those statements in order to reconsider what to do with 13 metric tons of surplus plutonium. DOE is proposing that approximately six metric tons could be prepared for disposal at WIPP and is considering how to handle the other
Activists agree that the scope of the new statement must address whether the plutonium will fit into WIPP, which has a capacity for about seven metric tons. Further, it must address why the plutonium should be transported again. Much of the six metric tons was already shipped from the DOE sites at Hanford, Livermore, and Los Alamos to the Savannah River Site. DOE claims that the waste is similar to that at WIPP.
Nuclear Monitor 715
Activists question why the plutonium was not shipped directly to WIPP in the first place.
cycle, it is expected to receive about 37,000 shipments.
fuel and instead vigorously pursue the immobilization option of mixing it back into the high-level waste from which it came."
The Waste Isolation Pilot Plant (WIPP), managed by the Carlsbad Field Office of the U.S. Department of Energy (DOE), is an underground repository for transuranic radioactive waste, or TRU waste, left over from the production of nuclear weapons. WIPP began operations on March 26, 1999 and is located in the remote Chihuahuan Desert of southeastern New Mexico, about 26 miles southeast of Carlsbad. TRU waste is currently stored at 23 locations nationwide. Over WIPP's life
Tom Clements, with Friends of the Earth, based in South Carolina, said that they support immobilization. One option in the current statement is to fill small cans with plutonium that is mixed with molten glass and high-level waste. When the small cans are cooled, they are then placed inside a much larger canister that is then filled with the molten high-level waste mixture. He said "For safety, security, nonproliferation and cost reasons, DOE should abandon the option of making surplus plutonium into nuclear reactor
Sources: Factsheet WIPP at www. spdsupplementaleis.com/ WIPPFactsheet.pdf / CCNS news update 20 August 2010
Contact: Concerned Citizens for
Nuclear Safety, 107 Cienega
Street,Santa Fe, NM 87501, USA.
Tel: +1 505 986-1973
Email: [email protected]
Web: www.nuclearactive.org
PROLONGING NUCLEAR POWER WILL HINDER RENEWABLES
A new report has outlined why ending the use of nuclear energy matters for the development of renewable energy infrastructure. Electricity needs can entirely be met through renewable energy sources by 2050. The report states the last nuclear power plant can be removed from the grid in 2023 and the last coal-fired power plant in 2046. Extending the lifespans of nuclear power plants would damage vital investment interests and set back the switch to renewable energy by decades.
(715.6083) WISE Amsterdam - The study, "2050. Die Zukunft der Energie" (2050. The future of Energy, only available in German), concludes that nuclear is incompatible with renewable energy sources (RES) and that nuclear power plant lifetime-extension will seriously hamper RES-development. With a quick phase-out of nuclear and coal, Germany's electricity consumption could be covered 100 percent by RES by 2030. If coal and nuclear is phased out slowly, it will take until 2050.
austerity measures for the coming years. The nuclear tax plan is tied to an ongoing debate about extending the operating lives of nuclear reactors. Above that Merkel said she is in favor of the plant operators making further financial contributions in return for longer reactor operating lives to promote RES.
that nuclear and coal power would continue until supplies could be met entirely by clean energy. But that, many say, is a false argument: What is needed is more competition in the field of energy and that will happen if nuclear is phased out and allow investors to install new production capacity.
The author of the study, Professor Dr. Olav Hohmeyer, is member of the German Expert Council for the Environment (SRU), who advises the German Government, and also vicechairman of IPCCs working group on climate change mitigation. SRU has recently published an analysis, in which it concludes that the potential of renewable energy outweighs the current and future need for electricity in Europe many times.
In the midst of the ongoing debate over whether to extend the lifespan of Germany's 17 nuclear power plants, German Chancellor Angela Merkel's center-right coalition has said it will raise 2.3 billion euro annually from the fuel-rod tax from 2011 as part of its
8
Nuclear Monitor 715
Germany's nuclear reactor operators -E.ON, RWE, EnBW AG and Vattenfall Europe AG- have warned that the government's plan to tax the fuel could make reactors unprofitable and they were forced to close he power plants (proponents of nuclear power thought that was a stupid threat).
During 2009 four of the 17 nuclear power plants in Germany were out of commission for more than 10 months, and that at times as many as eight of them were out of commission.
On August 30, Angela Merkel, coming off a recent tour of energy facilities around Germany, said in an interview with public broadcaster ARD that "on technical grounds, [an additional] 10 to 15 years is reasonable."
In a statement two days earlier, Merkel said renewable energies should supply
half of all energy needs by 2050 and
Electricity in Germany isn't particularly cheap. In theory, the German power market has been liberalized since 1998, but there is little true competition. The four large nuclear energy firms produce around 80 percent of Germany's power. This market dominance keeps consumers from profiting from economically produced nuclear power. If the lifespan of reactors is extended, it will merely cement this dominance – likely leading to higher prices. On the other hand, systematically taking nuclear power plants off the grid would provide openings for potential competitors. Many municipal utilities have already prepared for the nuclear phase-out by investing in renewable energy. Keeping reactors running longer will snuff out their chances before they even get started.
A rapid conversion to renewable energy would have the added benefit of hindering a market-dominating concentration of power production. In the future, electricity creation will be more decentralized and there will be a greater number of providers. Proper competition ensures lower prices and hinders companies from developing a market monopoly.
The '2050. Future of Energy' report claims extending operational life of nuclear power stations will not be as profitable as expected after all, because energy from renewable sources enjoys legal priority over nuclear and coal power. It is fed into the grid before electricity from non-renewable sources.
"Renewable energies are feeding into the system in a flexible way, depending on weather conditions for example," Bjoern Klusmann, director of Germany's Renewable Energy Association told Deutsche Welle. "Because of the priority given to renewables in the German grid, the conventional power stations, so coal and nuclear and other fossil power stations, have to react in a flexible way to the production from renewables. Nuclear energy is not as flexible as is needed for this future concept of renewable energy being the dominant part in our grid."
As the capacity of electricity from wind or solar sources increases, conventional electricity sources will only be needed to fill in gaps when there is a lack of wind or sun. But it takes about 50 hours to restart a nuclear power plant that has been completely shut down, meaning it would be necessary to keep the plant running at 50 or 60 percent capacity. Gas powered turbines, however, can be turned on within 20 minutes and can also be run on biogas. Other possibilities to bridge fluctuations in renewable electricity output include the decentralized approach of using micropower stations or accessing the batteries of electric cars.
It was calculated that if the lifespan of the power plants were increased by 28 years, energy companies will have to come to terms with turning the reactors off some 15,800 times between 2020 and the date when the last plant is shut down. That would cost the operators between 21 and 80 billion euros (US$26.7 billion to US$101.7 billion).
So it is clear that the nuclear operators will try very hard lobby vehemently to reverse the law giving electricity from RES priority on the grid. And that would be very bad consequence of lifetime extension and hinder the development of RES enormously. That is one of the reasons for the fact that with a quick phase-out of nuclear and coal, Germany's electricity consumption could be covered 100 percent by RES by 2030. If coal and nuclear is phased out slowly, it will take until 2050.
The debate over extending the running time of Germany's nuclear plants has sparked a deep debate in the German parliament. Merkel said any extension would come in a form that circumvents Germany's upper house of parliament, the Bundesrat.
However, doubts have been raised by the interior and justice ministries that an extension of more than 10 years could be illegal if it were not approved by the Bundesrat, which is made up of the governments of Germany's 16 states. And the Bundesrat has a SPD/Green Party majority after the May election in North Rhine-Westphalia.
The government now faces resistance to its plans to postpone the phase-out schedule with nine out of 16 German states opposed to them, including Hamburg, Thuringia and Saarland which are led by Merkel's own Christian Democrats. Ministers from both North Rhine-Westphalia and RhinelandPalatinate have said that they will press for a judicial review in Germany's Constitutional Court, if the government goes ahead without Bundesrat approval. A decision on the policy is expected late September.
Sources: FOX Business, 26 August / Deutsche Welle, 26, 28 & 30 August 2010 / Die Zeit, 27 August 2010 / '2050. Die Energie der Zukunft', University of Flensburg, August 2010, available at www.lichtblick.de/uf/ LichtBlick-Zusammenfassung_2050_ Die%20Zukunft%20der%20Energie.pdf
IN BRIEF
Doctors against uranium. The International Physicians for the Prevention of Nuclear War (IPPNW) on September 1 adopted a resolution at its International Council meeting in Basel, Switzerland, calling for a ban on uranium mining and the production of yellowcake (uranium oxide). The resolution described both processes as "irresponsible" and "a grave threat to health and to the environment".
The resolution also describes uranium mining and yellowcake production as a "violation of human rights". The right to life, liberty and security, to physical integrity, self-determination, the protection of human dignity, the right to clean water are just some of the rights that are afflicted by uranium mining and its processes, say the doctors. IPPNW calls for appropriate measures to ban uranium mining worldwide
Although many national branches of the IPPNW network have been campaigning against uranium mining and nuclear energy for many years already it is seen as a major breakthrough that now the international federation has taken a firm position and has committed itself to support campaigns against uranium mining.
IPPNW, Anne Tritschler, Tel.: +49 (0) 30-698074-14
Source and contact:
[email protected]
Iran: Busher reactor finished after 36 years! On August 21, Russia started loading fuel into the reactor at Iran's first nuclear power station Bushehr. The Bushehr plant is on the Gulf coast of southwest Iran. It is Iran's first nuclear power plant. Construction of two pressurized water nuclear reactors began in 1974 with the help of German contractor Siemens and French scientists. The Bushehr I reactor was 85 percent complete and the Bushehr II reactor was partially complete prior to the 1979 Iranian Revolution and the fall of the Shah. The project was halted and the site was then damaged during the 1980-88 Iran-Iraq war, and equipment was looted.
The project was later revived with Russian help but construction ran into repeated delays blamed by Russia on problems with receiving payment from Iran. Current plans are for one reactor to be launched. Bushehr will have an operating capacity of 1,000 MW.
Nuclear Monitor 715
Reuters, 21 August 2010
Sudan: 4 reactors in 2030. Well, if you think you read it all…. Sudan plans to build a four-reactor nuclear power plant to "fill a gap in the energy needs" of Africa's largest country by 2030, Mohamed Ahmed Hassan el-Tayeb, head of Sudan's atomic energy agency, said on August 24. He also said that the International Atomic Energy Agency (IAEA) would help to build a research reactor and power plant for Sudan by providing expert training for staff, fellowships and feasibility studies.
He said Sudan was hoping for "a medium size four-unit power plant with each reactor producing between 300-600 MW per year". El-Tayeb said bidding for equipment and technology could begin in five years time and a further 10 years for construction of the plant, so it could be completed by 2030, costing between US$3-6 billion.
Currently 20% of the population has access to electricity.
Reuters, 24 August 2010
No Nukes Asia Forum in Taiwan
Activist from Indonesia, Malaysia, Vietnam, Taiwan, Japan, Korea, the Philippines, Thailand and India wil hold their (almost) annual meeting in Taipei, from September 18- 22.
NNAF began in 1993 and unites Asian based antinuclear organizations. The forum always combines education and exchange with direct action and media outreach. This year the international delegation will travel to Taiwan's nuclear power station no. 1 and 2 at the northeast coast and nuclear power plant no. 3 at the southeast coast. At the University of the capital Taipei a two-day program will discuss the danger of nuclear power plants in earthquake prone areas, the debate on climate change and the role of nuclear power and the situation in the different countries. Contact and more information: [email protected]
Nuclear power: Goal or means? Vice President Boediono of Indonesia said on August 20, that a proposal to build a nuclear power plant in Indonesia was still on the table although he could not say when or where it may be built. "We will continue trying. Someday, somewhere we will build the nuclear power plant."
More often than not it seems that nuclear power is rather a goal than a means to boil water (because that's all there is to it, or not…?).
Jakarta Post, 20 August 2010
Radioactive boars on the rise in Germany. Almost a quarter century after the 1986 Chernobyl nuclear meltdown in Ukraine, its fallout is still a hot topic in some German regions, where thousands of boars shot by hunters still turn up with excessive levels of radioactivity and considered potentially dangerous for consumption. In fact, the numbers are higher than ever before. The total compensation the German government paid last year for the discarded contaminated meat shot up to a record sum of 425,000 euro (US$558,000), from only about 25,000 euro ten years ago, according to the Federal Environment Ministry in Berlin. "The reason is that there are more and more boars in Germany, and more are being shot and hunted, that is why more contaminated meat turns up," spokesman Thomas Hagbeck told The Associated Press. Boars are among the species most susceptible to longterm consequences of the nuclear catastrophe 24 years ago. Unlike other wild game, boars often feed on mushrooms and truffles which tend to store radioactivity and they plow through the contaminated soil with their snouts, experts say. However, boars are actually the beneficiaries of another ecological crisis — climate change. Central Europe is turning into a land of plenty for the animals, as warmer weather causes beech and oak trees to overproduce seeds and farmers to grow more crops the boars like to feast on such as corn or rape, said Torsten Reinwald of the German Hunting Federation. "The impact of the Chernobyl fallout in Germany, in general, has decreased," said Florian Emrich, spokesman of the Federal Office for Radiation Protection. For example, radiation has ceased to be a problem on fields cultivated with commercial crops, he said. But forest soil in specific regions that were hit hardest after Chernobyl — parts of Bavaria and Baden-Wuerttemberg in southern Germany — still harbors high amounts of radioactive Cesium-137 which has a half life of roughly 30 years, Emrich said. In fact, the Cesium from the Chernobyl fallout is moving further into the ground and has now reached exactly the layer where the boars' favorite truffles grow. Therefore, the season for such truffles — a variety not eaten by humans — usually means a rising number of radioactive boars.
AP, 18 August 2010
Russian reactor too expensive for Belarus? Alyaksandr Lukashenko said that Belarus might abandon plans to have its nuclear power plant project built by Russia and financed with a Russian loan, according to BelaPAN. The Belarusian leader said that the signing of an interstate agreement on the project had been postponed once again, and that the government did not reject the possibility of the plant being built by a contractor other than Russia s Atomstroiexport. Belarus chose Russia on the basis of "what they promised to us," Mr. Lukashenko noted. "They urgently demanded from us that they build this plant and then they started putting pressure on us for, I believe, purely subjective reasons. You know what the reasons are," he said.
Russia wanted Belarus to pay "in fact a double price," but Minsk refused, saying that there had been an agreement that the price would be "the same as in Russia," he said, adding that Belarus had agreed to pay the price at which the last nuclear power plant was built in Russia.
www.naviny.by, 16 August 2010
10
Nuclear Monitor 715
WISE/NIRS NUCLEAR MONITOR
The Nuclear Information & Resource Service was founded in 1978 and is based in Washington, US. The World Information Service on Energy was set up in the same year and houses in Amsterdam, Netherlands. NIRS and WISE Amsterdam joined forces in 2000, creating a worldwide network of information and resource centers for citizens and environmental organizations concerned about nuclear power, radioactive waste, radiation, and sustainable energy issues.
The WISE/NIRS Nuclear Monitor publishes international information in English 20 times a year. A Spanish translation of this newsletter is available on the WISE Amsterdam website (www.antenna.nl/wise/esp). A Russian version is published by WISE Russia and a Ukrainian version is published by WISE Ukraine. The WISE/NIRS Nuclear Monitor can be obtained both on paper and in an email version (pdf format). Old issues are (after two months) available through the WISE Amsterdam homepage: www.antenna.nl/wise.
Receiving the WISE/NIRS Nuclear Monitor
US and Canada based readers should contact NIRS for details of how to receive the Nuclear Monitor (address see page 11). Others receive the Nuclear Monitor through WISE Amsterdam.
For individuals and NGOs we ask a minimum annual donation of 100 Euros (50 Euros for the email version). Institutions and industry should contact us for details of subscription prices.
WISE/NIRS offices and relays
WISE Amsterdam
Email: [email protected]
P.O. Box 59636 1040 LC Amsterdam The Netherlands
Tel: +31 20 612 6368
Fax: +31 20 689 2179
Email: [email protected]
Web: www.antenna.nl/wise
NIRS
6930 Carroll Avenue, Suite 340 Takoma Park, MD 20912 Tel: +1 301-270-NIRS (+1 301-270-6477)
Fax: +1 301-270-4291
Email: [email protected]
Web: www.nirs.org
NIRS Southeast
P.O. Box 7586 Asheville, NC 28802 USA
Tel: +1 828 675 1792
Email: [email protected]
WISE Argentina
c/o Taller Ecologista CC 441 2000 Rosario
Argentina
Email: [email protected]
Web: www.taller.org.ar
WISE Austria
c/o Plattform gegen Atomgefahr Roland Egger Landstrasse 31 4020 Linz
Austria
Tel: +43 732 774275; +43 664 2416806
Fax: +43 732 785602
Web: www.atomstopp.com
WISE Czech Republic
c/o Jan Beranek Chytalky 24 594 55 Dolni Loucky Czech Republic
Tel: +420 604 207305
Email: [email protected]
Web: www.wisebrno.cz
WISE India
42/27 Esankai Mani Veethy
Prakkai Road Jn.
Nagercoil 629 002, Tamil Nadu
India
Email: [email protected];
WISE Japan
P.O. Box 1, Konan Post Office
Hiroshima City 739-1491
Japan
WISE Russia
P.O. Box 1477 236000 Kaliningrad Russia
Tel/fax: +7 95 2784642
Email: [email protected]
Web: www.antiatom.ru
WISE Slovakia
c/o SZOPK Sirius Katarina Bartovicova Godrova 3/b 811 06 Bratislava Slovak Republic
Tel: +421 905 935353
Email: [email protected]
Web: www.wise.sk
WISE AMSTERDAM/NIRS
ISSN: 1570-4629
Reproduction of this material is encouraged. Please give credit when reprinting.
Editorial team: Dirk Bannink and Peer de Rijk
With contributions from: WISE Amsterdam, CNCS, East Midlands CND, Sortir du Nucleaire and Laka Foundation.
Next issue of the Nuclear Monitor (#716) will be mailed out on September 24, 2010
The "Elfi Gmachl Foundation for a Nuclear-free Future" / PLAGE-Salzburg supports the Nuclear Monitor financially.
See: http://www.plage.cc (not available in
English (yet))
.
WISE South Africa
c/o Earthlife Africa Cape Town Maya Aberman po Box 176 Observatory 7935 Cape Town South Africa
Tel: + 27 21 447 4912
Fax: + 27 21 447 4912
Email: [email protected]
Web: www.earthlife-ct.org.za
WISE Sweden
c/o FMKK
Tegelviksgatan 40
116 41 Stockholm
Sweden
Tel: +46 8 84 1490
Fax: +46 8 84 5181
Email: [email protected]
Web: www.folkkampanjen.se
WISE Ukraine
P.O. Box 73 Rivne-33023 Ukraine
Tel/fax: +380 362 237024
Email: [email protected]
Web: www.atominfo.org.ua
WISE Uranium Peter Diehl Am Schwedenteich 4 01477 Arnsdorf Germany
Tel: +49 35200 20737
Email: [email protected]
Web: www.wise-uranium.org
Nuclear Monitor 715
11
WISE/NIRS NUCLEAR
PRINTED MATTER
MATIERE IMPRIME
MONITOR
c/o WISE Amsterdam PO Box 59636 1040 LC Amsterdam Netherlands
|
<urn:uuid:98aa0352-316a-4dcc-964a-ab81b461a672>
|
CC-MAIN-2021-17
|
https://wiseinternational.org/sites/default/files/NM715.pdf
|
2021-04-14T01:38:23+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00004-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet
| 700,719,848 | 12,152 |
eng_Latn
|
eng_Latn
| 0.87786 |
eng_Latn
| 0.998698 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"mlt_Latn"
] | false |
rolmOCR
|
[
2550,
7800,
12348,
17823,
24348,
30605,
35497,
41274,
47106,
52705,
56762,
56885
] |
Baseline Concussion Testing Program Consent
Dear Parents and Athletes,
Our school is participating in a sports concussion testing program through our association with the Marshall Sports Medicine Institute. Your son's/daughter's participation is highly encouraged, but voluntary. These baseline tests are provided at no cost, compliments of the Marshall Sports Medicine Institute.
We will be conducting Neurocognitive Baseline Concussion Testing, which refers to testing under normal conditions before injury, usually conducted in the pre-season. This is neither intelligence nor achievement testing. The baseline test gives us a snapshot of how one's brain functions in normal, everyday circumstances by evaluating memory, brain processing speed, attention, concentration, reaction time and post-concussion symptoms. This baseline information is then stored on a secure, HIPAA-compliant server for accessing later if an athlete is concussed and needs post-injury testing.
In the event an athlete sustains a concussion, the athlete is tested again "post-injury" by physicians at the Marshall Sports Medicine Institute or an outside physician of your choice. Usual office visit charges will likely apply for postinjury testing, as with any doctor visit or clinical test. It is fairly common, however, for most insurance companies to consider the post-test a covered medical service. Please check with your insurance provider as needed.
Post-injury testing scores are then compared to the baseline scores acquired earlier and assessed for deficiencies or abnormalities. The physician will objectively base their decision for return to play on post-test comparisons, depending on when post-test scores return to baseline (normal), among other clinical considerations.
If you should have additional questions about participation in this program, please contact the Marshall Sports Medicine Institute's concussion services coordinator, Tom Belmaggio, MS, ATC, CSCS, at 304-691-1880 or your school's administration.
I hereby give my consent and approval for my son/daughter to participate in my school's Baseline Concussion Testing Program.
Athlete name:
School:
Parent/guardian signature:
Date:
|
<urn:uuid:04375ec8-74e3-4481-a930-ae25dd531f34>
|
CC-MAIN-2023-50
|
https://www.marshallhealth.org/img/new_patient/MSMI%20baseline%20concussion%20testing%20consent.pdf
|
2023-12-11T12:01:58+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00099-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet
| 940,620,266 | 406 |
eng_Latn
|
eng_Latn
| 0.994108 |
eng_Latn
| 0.994108 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2200
] |
Foot Controlled Continuously Variable Preference Circuit for Musical Instruments
Inventors: Bradley J. Plunkett, Lester L. Kushner
Warren T. Jessup
ATTY
Fig. 1
Fig. 2
Fig. 3
FOOT CONTROLLED CONTINUOUSLY VARIABLE PREFERENCE CIRCUIT FOR MUSICAL INSTRUMENTS
Fig. 4
Fig. 5
INVENTOR:
BRADLEY J. PLUNKETT
BY LESTER L. KUSHNER
Warren T. Jessup
ATTY
FOOT CONTROLLED CONTINUOUSLY VARIABLE PREFERENCE CIRCUIT FOR MUSICAL INSTRUMENTS
Bradley J. Plunkett, Van Nuys, and Lester L. Kushner, North Hollywood, Calif., assignors to Warwick Electronics Inc., Chicago, Ill., a corporation of Delaware
Filed Feb. 24, 1967, Ser. No. 618,359
Int. Cl. G10h 1/02
U.S. Cl. 84—1.11
7 Claims
ABSTRACT OF THE DISCLOSURE
In a musical instrument a resonant circuit is connected in the circuit between the tone generators and the loudspeaker. The tone generators deliver tone signals rich in harmonics covering a wide frequency spectrum. Within this spectrum a given frequency (or a narrow band of frequencies) is given preference in the delivery path of the tones from the tone generators to the loudspeaker. The position on the frequency scale of this preferred frequency or resonant peak is continuously variable, from low frequency to high frequency over the wide frequency spectrum. This variability is under the ready control of the instrument player, as for example by being connected to a foot pedal. Thus, during playing of the instrument, the player can continuously move the resonant peak back and forth across the frequency spectrum and create a rhythmic musical sound. The musical effect may be described as a wow-wow and is closely akin to that produced by the warbling of a trumpet mute across the bell of a trumpet.
BACKGROUND OF THE INVENTION
Electronic musical instruments are becoming more and more popular among musical groups. In some cases, for example, in an electronic organ, the tone itself is generated electronically and treated in its electric signal state in numerous ways, finally emerging, for the first time as a vibration or acoustic signal, from the loudspeaker of the system. In other musical instruments the tone is generated mechanically, as for example by vibrating a guitar string or blowing into a wind instrument. The mechanical or acoustic vibration is then picked up and translated into an electric signal. The electric signal is then acted upon in a variety of ways by numerous electronic circuits, and then emerges once more to acoustic form in the loudspeaker of the system.
In years past, for example in dance bands, certain trumpet players have produced a unique effect which may be described as a wow-wow. This is done by holding a mute over the bell of the trumpet and moving the mute so as to in effect rhythmically open and close the bell passage. When done skillfully the effect can almost simulate the human voice. A rudimentary practice of the effect, as noted hereinbefore, produces a sound closely akin to a person's singing wow-wow-wow. Heretofore, this effect has been largely confined to horns, such as trumpets, and has required skillful manipulation of a mute over the bell of the horn by sophisticated horn players.
SUMMARY
The present invention consists of an electronic circuit by means of which the artist or player of any electronic musical instrument has at his control a lever, such as a foot pedal, through which he can closely simulate the wow-wow sound previously limited to the trumpet, as noted hereinbefore. The invention may be applied to any musical instrument in which electric tone signals are produced, whether such signals are initially produced electronically or whether they are produced acoustically, and then translated into electric tone signals by means of pickup devices. It is particularly adaptable to hand-held instruments, such as wind instruments, guitars and other string instruments and the like. The present invention consists of a resonant circuit which favors or discriminates in favor of a particular frequency, or narrow band of frequencies, in the translation path between the tone generators and the loudspeaker. By continuously moving this favored frequency back and forth across the frequency spectrum rhythmically, as with a foot pedal, the player can simulate the wow-wow sounds previously done acoustically by sophisticated trumpet players.
In a preferred form of the invention the frequency tuning is accomplished by means of an amplifier circuit having negative feedback and so connected that the apparent input reactance of the total amplifier circuit may be varied in accordance with the gain of the amplifier. This reactance, for example a capacitive reactance, is coupled with a complementary reactance, e.g., an inductor, to form a variable frequency resonant circuit, the frequency position of which depends on the gain of the amplifier at that particular moment. The amplifier is so designed that the gain may be controlled by a controllable member, such as a potentiometer, which is readily placed under the manual or pedal control of the instrument player or performer.
BRIEF DESCRIPTION OF THE DRAWING
In the drawing, FIG. 1 is a block diagram of the musical circuit, FIG. 2 is a circuit diagram illustrating the variable frequency circuit of the present invention, FIG. 3 is a graph illustrating the effect of the variable frequency circuit on the output of the musical system. FIG. 4 is a side view of a pedal designed to inject the wow-wow effect into the circuit, FIG. 5 is an end view of the pedal.
DESCRIPTION OF THE PREFERRED EMBODIMENT
Referring to FIG. 1 there is shown an amplifier 13 having an input 11 and an output 12. To the input 11 there is designed to be applied an electric tone signal and especially an electric tone signal rich in harmonics. This signal may be generated electronically, e.g., in an electronic organ, or may be generated acoustically, e.g., by vibrating the strings of a guitar 9, or in the mouthpiece of a wind instrument, and then translated into an electric signal by any form of known pick-up device.
The output 12 is adapted to be connected ultimately to some form of speaker means or electro-acoustic transducer 10. Interposed between the output 12 and speaker may if desired be any form of amplifier, formant circuit, tone control circuit, or other musical instrument circuitry, exemplified generally at 15.
Referring to FIG. 2 the amplifier 13 interposed between the input 11 and the output 12 consists of two stages, the first stage including the transistor 14, and the second stage, the transistor 16.
The input 11 consists of a jack having a B—terminal 17, a ground terminal 18, and a hot or signal terminal 19. When the plug from the tone signal generator 9 is plugged into the jack 11, signal voltage is applied between the terminals 17 and 19, and simultaneously the terminal 17 is connected with terminal 18. The plug thus serves the double function of injecting signal into the system and also energizing the circuit by connecting the negative side of the energizing battery 21 to ground 18.
Tone signals are applied from the input terminal 19, through a coupling capacitor 22 and resistor 23, to the base 24 of the transistor 14. Amplified output is taken from the collector 26 through the coupling capacitor 27 and applied to a variable resistance means in the form of a potentiometer 28. The slider 29 of the potentiometer 28 is connected through a coupling capacitor 31 to the base 32 of the second stage transistor 16. The transistor 16 is connected as a low output-impedance amplifier of approximately unity gain, i.e., as an emitter follower.
Output from the second stage 16 is taken from the emitter 33 through a feedback impedance, in the form of a feedback capacitor 34, to the input to the amplifier, i.e., to the base 24, through a resistor 36.
The first stage 14 amplifies and inverts the applied tone signal. Because of the amplification of the signal applied across the feedback capacitor 34, the apparent reactance, seen by the input signal looking into the capacitor 34, is much lower than the actual reactance. The input impedance into the transistor 14 on the other hand is relatively high. Thus, so far as current flow is concerned, as a practical matter, the signal looks primarily into the reactance 34, the apparent magnitude of which, as noted, depends on the gain of the signal in passing through the amplifier. This gain is determined by the position of the slider 29 of the potentiometer 28. When the slider is farthest to the right in FIG. 2, the gain is minimum; the current flow through the feedback capacitor 34 is minimum; and, hence, the apparent reactance is maximum, i.e., the apparent capacitance approaches the true capacitance, viz, a relatively small value. When the slider 29 is in its left-hand position in FIG. 1, the gain is maximum; the current through the capacitor 34 is maximum; the apparent reactance 34 is minimum; and, hence, the apparent capacitance of 34 is a maximum.
There is thus presented to the input signal appearing at the junction point 37, a relatively pure capacitive reactance, the magnitude of which is dependent upon the gain in the amplifier, i.e., upon the position of the slider 29. There then remains only the matter of connecting a complementary reactance, in this case an inductor 38, in circuit with the capacitor 34, to produce a resonant circuit, the tuning of which may be adjusted by tuning the apparent magnitude of the capacitor 34.
The output from the amplifier is taken from the junction point 39, between the capacitor 27 and potentiometer 28, and applied through a double-throw switch 41 to the output jack 12.
The operating characteristics of FIG. 2 will be readily understood by reference to FIG. 3, wherein the ordinate represents output signal appearing at the output jack 12 and the abscissa represents frequency of the tone components in the harmonic-rich tone applied to the input 11. When the slider 29 is moved to the left the net gain in the amplifier is high and the apparent capacitance of 34 is likewise high, so that the resonance frequency of the LC circuit 34/38 is relatively low. Hence the circuit in this condition gives decided preference to the low frequency, exemplified at peak 41 in FIG. 3. Conversely when the slider 29 is moved to the right, the amplifier gain is low, the apparent capacitance of 34 is likewise low, and the circuit peaks at 42. The peak can be positioned anywhere in between simply by positioning the slider 29 between its extreme positions.
The aggregate Q of the circuit is quite high, thereby giving decided preference to the selected frequency (or narrow frequency band). This is seen in FIG. 3, where the peak output at 41 is many times, e.g. 10 times, the output at the other frequencies, represented by the relatively flat line at 43. The innate Q of the circuit, in fact, is so high that it was found desirable to insert the resistor 36 in order to admit some of the non-favored (off-peak) frequencies into the amplifier, so that they could pass to the output. Without the resistor 36, virtually the only frequency appearing at the base 24 would be the selected frequency, because of the high Q of the circuit. The presence of resistor 36 allows all frequencies to be developed to a certain extent thereacross, and hence to be passed to the amplifier.
The function of the other components in FIG. 2 will now be described. Resistor 44 constitutes the DC load for the collector 26 of the transistor 14. Resistors 46 and 47 form a voltage divider for determining the bias applied to the base 24 through the inductor 38 and resistor 36.
The bias for the second stage, transistor 16, is obtained from the collector 26 of the first stage 14, through the resistor 48. The emitter follower 16 has some slight tendency to oscillate. The inclusion of resistor 49 in its collector circuit suppresses any parasitic oscillations.
Resistor 52 is a DC return resistor for the emitter follower 16. Resistor 53 is a DC return for the emitter of transistor 14. Capacitor 54 constitutes an AC return path for the tuned circuit 38/34, and also serves as a bypass for AC around the bias network resistor 47.
It will be noted that the output, being taken from the point 39, is unaffected by the position of the potentiometer slider 29. Therefore the position of the slider 29 does not change the overall amplification of the circuit, at the output 12. Its only effect is to move the resonant frequency peak back and forth along the frequency scale, shown in FIG. 3.
When the wow-wow effect is not desired, the double throw switch 41 is thrown to the upper position, which bypasses the amplifier and sends the signal directly from the input terminal 19 to the output jack 12. It will be noted that even in this position of switch 41, the input to the amplifier is still attached to the circuit, through the permanently attached coupling capacitor 22. This produces a slight hump at the frequency to which the amplifier is set, but the effect is so slight as not to be audible to the ear. That is, at the peak frequency the amplifier presents to the bypass conductor 51 an impedance which is approximately the sum of resistor 23 (68 kilohms) plus the parallel impedance of the resonant circuit 38/34, which is about 15 kilohms. This totals approximately 83 kilohms. At off peak frequencies, the impedance is essentially the 68 kilohms of resistance 23, plus the resistance of resistor 36, about 1.5 kilohms. This difference in loading placed on the bypass circuit 51, as noted, does produce a slight hump at the resonant frequency, but it is not enough to be discernible by the ear.
As noted hereinbefore, the slider 29 is attached to some form of lever or operating member which is readily controllable by the instrument player. In the case where the tone generator which produces and delivers the basic musical tone to the input 11, is an instrument such as a guitar 9 held by both hands of the player, this operating lever may conveniently take the form of a foot pedal, which is rocked back and forth to produce the wow-wow sound discussed hereinbefore. Alternatively, the lever may be a rocker arm attached to the face of the guitar, for example, a bridge member which may span the guitar strings and be rocked back and forth, somewhat in the way that a mute control is moved to apply a muting pad to the strings of the guitar.
In place of the potentiometer 28 having the movable slider 29, there may be light dependent resistor (LDR) which constitutes one segment of a voltage divider. The output to the second stage 16 is taken from the junction point between a fixed resistor and the LDR. In this case the voltage division is continually dependent upon the magnitude of the LDR, and, hence, upon the amount of
light falling on it. By giving the instrument player or performer control over the amount of light falling on the LDR, he can be given control of the gain of the amplifier and, hence, control of the position of the frequency peak 41 (FIG. 3).
A satisfactory circuit has been constructed as shown in FIG. 2 having the following parameters.
Transistor 14—2N3900A
Transistor 16—2N2924
Resistor 23—68 kilohms
Resistor 36—1.5 kilohms
Resistor 47—100 kilohms
Resistor 46—470 kilohms
Resistor 53—470 ohms
Resistor 44—22 kilohms
Resistor 48—740 kilohms
Potentiometer 28—100 kilohms
Resistor 49—1 kilohm
Resistor 52—10 kilohms
Capacitor 22—0.01 microfarad
Capacitor 54—4 microfarads
Capacitor 27—0.22 microfarad
Capacitor 34—0.01 microfarad
Capacitor 31—0.22 microfarad
Inductor 38—500 millihenrys
Battery 21—9 volts
Another feature of the invention is the construction of the foot pedal which operates the slider 29 of the potentiometer 28. This foot pedal is so constructed as to conveniently gang the slider 29 and the double-pole switch 41, in such a manner that the instrument player may conveniently operate both the slider 29 and the double-throw switch 41 by appropriate manipulation of a single pedal.
This configuration is shown in FIG. 4, wherein 61 represents a base to which a foot pedal 62 is hinged at 63. The pedal 62 is so mounted that by downward movement of the toe the pedal may be rocked down toward the base 61, while by pressing back with the heel against the rear of the pedal 62, the toe end of the pedal may be raised from the base 61. By means of a rack 64 and pinion 65, the rocking of the pedal 62 is coupled to a shaft, shown figuratively at 29 in FIG. 4, which in turn actuates the slider 29 back and forth across the potentiometer resistance 28.
The double-throw switch 41 is mounted on top of the base 61, just under the toe of the pedal 62. Switch 41 is a conventional type of switch, characterized by an operating member or element, in this case a reciprocable plunger 66, which is biased upwardly and which returns to its starting or upward position after each actuation. The plunger 66 thus always moves through a given cycle of movement, up and down, with each actuation. Each cycle of movement, i.e., pushing down and releasing on the plunger 66, causes the double-throw switch 41 to move from either position to the other. Thus, assuming the arm 72 of switch 41 is in the lower or wow-wow position (FIG. 2) and the underside of the pedal 62 is brought against the plunger 66 and pressed down, the arm 72 will be thrown to the upper or by-pass position. The pedal 62 is then returned to a "normal" position, out of contact with the switch plunger 66. The next identical operation of the foot switch 62 on the plunger 66 will cause the plunger to go through exactly the same reciprocating cycle, but this time the arm 72 of switch 41 will be thrown back to the lower or wow-wow position.
The lower (counterclockwise, FIG. 4) position of the pedal 62 is, of course, at one extreme of the slider 29 in its passage across the resistor 28. For example, this may be the right-hand end of resistor 28 in FIG. 2, i.e., where the circuit represented by 38/34 is tuned to its highest frequency.
Thus, to switch the wow-wow circuit in or out, the instrument player need only move the pedal 62 to its extreme downward position. The terminal operation serves to actuate the plunger 66 and thus switch the double-throw switch 41 to its other position. In this way the wow-wow circuit may be conveniently placed in or out of the instrument circuit without requiring any special operation by the player, since his foot is already on the pedal 62 ready to operate the wow-wow effect (potentiometer 28/29) whenever the arm 72 of switch 41 is in its down position (FIG. 2).
In practice it is preferred to construct the potentiometer 28 so that at the switch operating end, there is no variation in resistance. Thus, during that portion of the movement of pedal 62, where the switch 41 is being operated, no change in the resonant frequency of the circuit occurs.
In order that the switch 41 be not accidentally operated there are provided a pair of rubber bumpers 67 projecting downward from the underside of the pedal 62 on each side of the switch 41. These bumpers engage the base 61 about the time the pedal 62 comes into contact with the switch operating plunger 66. Thus, the instrument player must increase the force on the pedal 62 greatly in order to overcome the resistance of the bumpers 67, thereby compressing them and forcing the pedal down against the plunger 66 far enough to actuate the switch 41. Upon release of this extra pressure, the rubber bumpers aid in returning the pedal 62 to a position clear of the actuating plunger 66.
The slider 29 and switch 41 are thus to a certain extent ganged together by the foot pedal 62. This ganging is represented schematically by the dotted line 71 in FIG. 2.
While the present invention has been shown and described herein in what is conceived to be the most practical and preferred embodiment, it is recognized that departures may be made therefrom within the scope of the invention which is, therefore, not to be limited to the details disclosed herein, but is to be afforded the full scope of the claims.
What is claimed is:
1. A circuit means adapted to be inserted between a musical instrument and a speaker means, said instrument including tone generating means for delivering electric tone signals corresponding to musical sounds, and said speaker means serving to transduce said tone signals into musical tones; said circuit means being adapted to have applied thereto from said instrument, electric tone signals in a predetermined frequency range lying within the range of said electric tone signals delivered by said tone generating means for passing said electric tone signals delivered by said tone generating means for passing said electric tone signals from said tone generating means to said speaker, and said circuit means including:
network means for favoring the delivery of certain signal frequencies in a narrow frequency band within said predetermined frequency range from said tone generating means to said speaker means, and
foot-operated control means physically separated from said instrument and readily controllable by the foot of the instrument player for continuously varying said narrow frequency band back and forth over said predetermined frequency range.
2. The combination defined in claim 1, in which said network means comprises a resonant network having a high Q relative to said circuit means to exhibit a sharp peak amplitude/frequency response characteristic superimposed on the aforesaid substantially uniform response characteristic, and extending to an amplitude representing a substantial multiple of the corresponding amplitude of said uniform response characteristic, the position of said narrow frequency band in said frequency range being established by the resonant frequency of said resonant network, and said foot-operated control means serving to vary said resonant frequency so as to move said narrow frequency band back and forth over said predetermined frequency range.
3. The circuit means defined in claim 2, wherein said foot-operated control means comprises a potentiometer, the position of which determines the apparent magnitude
of a resonant frequency-determining reactance element forming a portion of said resonant network.
4. The circuit means defined in claim 2, wherein said resonant network comprises: a variable gain amplifier having feedback means for creating an apparent resonant frequency-determining reactive input impedance to said amplifier, the magnitude of which depends upon the gain of the amplifier, and wherein said foot-operated control means comprises means for varying the gain of said amplifier.
5. The circuit means defined in claim 4, in which said amplifier comprises: a first stage of amplification, variable resistance means in the output of said first stage, a second stage of amplification having its input taken from said variable resistance means, a feedback impedance connected from the output of said second stage to the input of said first stage, whereby variation of said variable resistance means varies the resonant frequency-determining apparent reactive input impedance of the amplifier.
6. The circuit means defined in claim 5, in which said variable resistance means comprises a potentiometer.
7. The circuit means defined in claim 5, in which said second stage of amplification is a low impedance amplifier of approximately unity gain.
References Cited
UNITED STATES PATENTS
| Patent Number | Date | Inventor | Classification |
|---------------|------------|--------------|----------------|
| 3,316,341 | 4/1967 | Peterson | 84—1.24 |
| 3,288,909 | 11/1966 | Volodin | 84—1.26 |
| 3,255,296 | 6/1966 | Peterson | 84—1.24 |
| 2,070,344 | 2/1937 | Waters | 84—1 |
OTHER REFERENCES
Kerchner-Corcoran: Alternating-Current Circuits, 3d ed. 1958, pp. 121–123.
WARREN E. RAY, Primary Examiner
U.S. Cl. X.R.
84—1.19, 1.24; 330—12
|
<urn:uuid:63b012ca-4826-4455-9d38-bd8d78fb3d16>
|
CC-MAIN-2022-33
|
https://www.dpma.de/docs/dpma/veroeffentlichungen/us000003530224a_wahwah.pdf
|
2022-08-15T02:48:36+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-33/subset=warc/part-00069-d466b69e-be2b-4525-ac34-1b10d57329da.c000.gz.parquet
| 640,204,392 | 5,337 |
eng_Latn
|
eng_Latn
| 0.757044 |
eng_Latn
| 0.997229 |
[
"eng_Latn",
"dan_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
178,
350,
6564,
14811,
22194,
24036
] |
CHAPTER 561—S. F. No. 1116
An act defining the duties, providing for the bond, filling of vacancies and fixing the fees of county abstract clerks in all counties of the State of Minnesota having a population of not less than 250,000 nor more than 350,000 inhabitants, providing penalties for destroying or defacing records, and repealing Minnesota Statutes 1941, Section 386.38, and all other acts or parts of acts inconsistent herewith.
Be it enacted by the Legislature of the State of Minnesota:
Section 1. County abstract clerks in certain counties; penalty for defacing records. In all counties of the State of Minnesota having a population of not less than 250,000 nor more than 350,000 inhabitants:
(a) The records and indices in the office of County Abstract Clerk are hereby designated and defined as public records, open to inspection, but only to the extent in this section provided.
(b) Every record, index, abstract copy, plat, bookkeeping record, or paper of any type whatsoever, prepared in such office, shall be the property of the County for the use of the County Abstract Clerk and his successors in office, and shall, at the expiration of the term of any such Abstract Clerk be turned over to his successor in office.
(c) The County Abstract Clerk shall permit, without fee and within such reasonable business hours as not to interfere with the conduct of the work of the office, and under such supervision as shall assure the safety of the records, inspection of the Tract Index as hereinafter defined, by any party interested in the ownership of any particular parcel of land, or his agent or attorney. There shall be no right on the part of anyone to make general or indiscriminate searches of the records or to copy any part thereof for the purpose of making abstracts of title or abstract books or in any manner to deprive the Abstract Clerk of the fees provided by law for his official duties.
(d) Any person who destroys, attempts to destroy, deface or alter any record in the office of the County Abstract Clerk shall be guilty of a gross misdemeanor and upon conviction thereof shall be subject to punishment according to law.
Sec. 2. Duties of clerk. (a) It shall be the duty of the County Abstract Clerk to maintain, current as of eight o'clock A. M. of every business day, abstract indices to all the lands
of such county, including a tract and miscellaneous system of indices, correctly indexing every instrument filed of record in the office of the Register of Deeds in such county which in any manner affects the title to real property within the county. He shall maintain currently correct as of each day, indices to all judgments in any court which are a lien on real property within the county and all Federal tax liens. He shall maintain such other and further abstract records and indices as the Board of County Commissioners of such county may direct.
(b) It shall be the duty of the County Abstract Clerk to furnish, within ten days, upon demand of anyone and proffer of his fees, a complete true and perfect Abstract of Title to any parcel of land in such county.
(c) The County Abstract Clerk shall, without fee and within such reasonable hours as not to interfere with the conduct of his office and under such reasonable supervision as to assure the safety of the public records, permit the use of any records in such office by duly authorized representatives of other State, County, Municipal or Federal governmental agencies for public purposes.
(d) It shall be the duty of the County Abstract Clerk to furnish to anyone within 48 hours of demand, and without fee, an oral report of the apparent ownership and apparent unsatisfied encumbrance as to any parcel of land within such county, but he shall not be responsible under the bond herein required, for the correctness of any report furnished without fee.
(e) The County Abstract Clerk shall not be required, without demand and proffer of fees as herein set forth, to furnish any report of personal judgments in any court against any person, firm or corporation. He shall not be required or permitted, except as incident to the issuance of or with reference to Abstract of Title, to report any Old Age Assistance Lien against any person.
(f) The County Abstract Clerk and his deputies and employees shall not be permitted to practice law, or demand or receive any fee for any opinion as to the condition of the title to any parcel of real estate, save as to reports of the apparent record ownership as hereinbefore provided nor to prepare or execute any papers incident to the transfer of title to real property or in any manner act as advisor or counsellor at law or as agent for the sale of real property or in any manner assume the function of lawyer, real estate broker or advisor.
(g) The County Abstract Clerk may appoint a Deputy County Abstract Clerk to act in his stead and behalf, and for whose acts the County Abstract Clerk shall be responsible.
Sec. 3. Annual inspection and appraisal of clerk's office. It shall be the duty of the Board of County Commissioners in any such county, to appoint each year a committee to inspect the records and the conduct of the office of the County Abstract Clerk, such committee to consist of an accountant representing the office of the County Auditor, a representative of the County Attorney's office and one member of the said Board, all of whom shall serve without further compensation than now provided by law for their respective positions. It shall be the duty of the said committee to inspect at least once each year all the records of the office of County Abstract Clerk and report to the Board of County Commissioners on the fees collected, the public service rendered, the condition of the public records therein contained and the general conduct of the office. The County Abstract Clerk shall permit inspection of all records of whatsoever nature having to do with his conduct of the office, upon demand at any time by said committee.
Sec. 4. Compensation; fees allowable. The County Abstract Clerk shall be permitted to collect and retain for his own use, fees for his services as follows: In the preparation and issuance of each Abstract of Title or Registered Property Report, 35 cents for each pertinent and proper entry thereon of a transfer or other instrument affecting title to the premises; but if the proper presentation of the instrument necessitates an entry of more than 200 words, he shall be permitted to charge 20 cents additional for each additional folio thereof; for abstractors certificate, $1.00; for report as to taxes or assessments, 50 cents for each abstract or continuation thereof; for each name searched for Judgments $1.00 which shall include both State and Federal Courts; for each name searched for Bankruptcies, 25 cents; for each name searched for Old Age Assistance Liens, 25 cents; for each name searched for Federal Tax Liens, 25 cents; for every plat or drawing furnished on request with any Abstract, such reasonable fee as may seem fit and proper. Provided, however, that the maximum fee permitted to be charged for any Abstract of Title or continuation as to any one description shall be $50.00.
Sec. 5. Provide office space. The Board of County Commissioners of any such County shall provide the necessary office and vault space for the County Abstract Clerk in the Court House of such county, with suitable furniture therefor, and shall provide heating, lighting and maintenance of
such offices. The said Board shall furnish the said Abstract Clerk with all books, stationery, letterheads, envelopes, telephone service, office equipment and supplies necessary for the discharge of his duties.
Sec. 6. Bonds. The County Abstract Clerk shall before entering upon his duties, give bond to the County at County expense in the penal sum of $5,000.00, to be approved by the County Board, conditioned that he will faithfully discharge the duties of his office, and shall give bond to the public, in the penal sum of $10,000.00, at his own expense, to be approved by the County Board, conditioned that he shall pay all damages suffered by anyone through any error or deficiency in any Abstract of Title or Registered Property Report issued by his office.
Sec. 7. Vacancies; appointment. Vacancies in the office of County Abstract Clerk, for whatever cause, shall be filled by appointment by the Board of County Commissioners of any such county. The person so appointed shall give the bond and take the oath required by law, and shall hold for the remainder of the unexpired term, and until his successor qualifies.
Sec. 8. Severable. If any provision of this act is held invalid, such invalidity shall not affect other provisions of the act which can be given effect without the invalid provision, and to this end the provisions of this act are declared to be severable.
Sec. 9. Repeal. Minnesota States 1941, Section 386.38 and any and all acts or parts of acts inconsistent herewith are hereby repealed.
Approved April 23, 1945.
CHAPTER 562—S. F. No. 1117
An act relating to the salary of probate judge in certain counties.
Be it enacted by the Legislature of the State of Minnesota:
Section 1. Salary of probate judge in certain counties. In all counties of this state now or hereafter containing not less than nineteen nor more than twenty-one organized town-
|
<urn:uuid:c7c2ee10-1bc9-47b7-88f4-e1877e53e951>
|
CC-MAIN-2020-50
|
https://www.revisor.mn.gov/laws/1945/0/Session+Law/Chapter/561/pdf/
|
2020-11-30T17:29:52+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-50/subset=warc/part-00286-8431e8c9-c763-4c27-b286-ba1dd7e2631e.c000.gz.parquet
| 826,485,049 | 1,913 |
eng_Latn
|
eng_Latn
| 0.996459 |
eng_Latn
| 0.996794 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
2344,
4797,
7498,
9382
] |
Total support for food plants and distribution centers
Our support system uses the GALILEI GROUP network to offer design, construction, and maintenance services
We provide a wide range of support according to customer needs through the engineering capabilities of the GALILEI GROUP.
FUKUSHIMA GALILEI CO.LTD.
We will listen to the future visions, current issues, and requests that our customers think, and we will create the optimal environment from the same perspective as our customers. These proposals have been cultivated through proposal activities for the showcase business and refrigerator business, which are our main businesses.
By applying and developing the know-how and technology of a wide variety of product groups, we will realize engineering links that are possible only from manufacturers.
FUKUSHIMA GALILEI'S engineering business aims to be an engineering link that is useful to our customers and contributes to society.
TAKAHASHI GALILEI CO.LTD.
In 1961, we developed, designed and manufactured the world's first continuous quick-cooling, quick-freezing system. In this system, the tunnel's inlet and outlet can be kept open without cool air leaking. Over 60 years since then, the Tunnel Freezer® has been renovated and redesigned for marketing around the world. Challenging all the time for safety and security, the GALILEI people have been keeping customers close to our heart, with Tunnel Freezer® first in mind.
GALILEI PANEL CREATE CO. LTD.
Due to the rise in awareness of the customer’s environment, safety, and security, the needs required by sanitation management and temperature control are becoming more and more advanced. Using the panel technologies and system engineering cultivated over many years, we contribute to society by meeting customer needs with “environmental creation” technologies that provide high-quality “freezer and refrigeration spaces” and “clean work spaces.”
SHOKEN GALILEI CO. LTD.
Always since its foundation, SHOKEN GALILEI Co. Ltd. has been researching and developing production line machinery and equipment with labor and energy saving in mind. In today’s whirlwind of changes, the SHOKEN GALILEI engineers have been coming up with unheard-of technology and creative ideas in response to production system innovations. For delivering superior products, they are doing tireless activities. The SHOKEN GALILEI people are committed to delivering factory automation systems to meet customers’ needs today and tomorrow.
The FE Clean Water is a mildly alkaline aqueous solution that mainly consists of sodium hypochlorite evolved electrolytically from saline solution. It can be employed to sterilize foodstuff and kitchen utensils.
Easy installation type (generation capacity 8.0 ℓ/min · 40ppm~), optimal aquarizer for food factories Maximum production amount 258 tons/day (at 30ppm setting), etc.
We will design it according to the maximum amount of water required.
It has evolved into an ultra-compact with the rapid freezing/cooling system unchanged. It is a new tunnel freezer that allows you to freely layout multiple units.
It can be used not only as a single unit, but also in a variety of arrangements such as connecting multiple units and using a L-shaped connection module.
An alcohol freezer is recommended for customers related to meat and fisheries. Immerse in an alcohol brine at -35°C and freeze about 20 times faster than air blasting.
Minimize ice crystals, resulting in high quality freezing with high reconstitution during thawing.
It is a batch type and can handle a wide variety of small quantities, and can be installed with limited space even by customers.
The product is loaded into the freezer while it is still mounted on the trolley, and it is cooled and frozen. It is also possible to create a dedicated trolley or use a weight according to the front and rear process of the freezer.
The structure is assembled with a heat insulation panel in which urethane foam is sandwiched by steel plates. High-precision heat insulation panel required for Tunnel Freezer®.
Avoids food product deterioration, seals in the good taste.
**Blast Chiller / Shock Freezer**
Blast chiller is a device for rough heat removal, rapid cooling, and quick freezing. As it can contain freshly heated food, it will hold the moisture, scent, and color that you missed along with the steam, making it juicy without losing the flavor of the ingredients.
The blast chiller with an automatic cleaning function can reduce the cleaning work time by automatically performing rinsing and drying.
Control indoor air cleanliness
**Clean room**
It manages room temperature, humidity, room pressure, air flow, etc. according to the required conditions. For example, the pressure difference between the rooms is adjusted by the differential pressure sensor and the differential pressure damper so that the pressure of inside the room is always maintained at a constant positive pressure. By pressurizing the room, it prevents entering the dust from the outside. In addition, a HEPA filter is installed in the part that takes in the outside air, and invisible dust can be removed. We ensure air cleanliness by observing the four principles; not bringing in, not generating, not accumulating, and eliminating foreign matter.
Automate your casing processes
**Casing Line System**
This mechanical casing system integrates into production lines and features a suction system for automated casing processes. The system is ideal for businesses looking to free themselves from manual casing work and those who are wary of adopting a robotic system. Integrate this system into your processes and reduce labor in your casing facilities.
Sweet potatoes: proper curing improves quality, shelf life
**Sweet potatoes:Curing room**
The curing process is to heal any abrasions or bruises of the sweet potatoes sustain during harvesting. As the sweet potatoes cures, a corky layer of cells develops just below the surface of the abrasions, which serves as a barrier against disease-carrying organisms. Sweet potatoes stored in cool, constant conditions have a shelf life for a long term.
Thaw a large amount
**Prefabricated defroster**
By uniformly applying a large amount of high-humidity air, even large volumes can be thawed without unevenness. Achieved high quality thawing with less drip by suppressing the drying and discoloration of food ingredients. Since the temperature can be set in the range of -15°C to 30°C, it is possible to set the optimum temperature according to the food. Compared to thawing in a refrigerator, it can be thawed in a shorter time and does not require draining after thawing with running water.
The program can be started from the frozen storage state, and after the crimping process, it will be refrigerated storage operation until it is taken out. It can also be used as a refrigerator because it can be operated independently in each process.
Freezing and refrigerating with one unit
**Wide temperature range commercial refrigerator**
One unit can handle a wide range of temperatures. This is a commercial refrigerator/freezer that can be used according to the season and menu. It is possible to switch between freezing (-25°C to -15°C) and refrigeration (-5°C to 10°C) with a single switch. Freezing and refrigeration can be switched in both the right and left chambers with independent control. It can be used in 4 patterns.
Unique panel structure with excellent heat insulation improves economic efficiency
**Non-Freon Insulation Panel econea**
Since December 2019, all thermal insulation panels and non-combustible thermal insulation panels produced at the Hikone, Shiga plant have switched to "non-fluorocarbon panels" using a new "HFO (hydrofluoroolefin)". Foaming agent in anticipation of next-generation global environmental protections, we began researching products which do not use alternative fluorocarbon five years ago and realized the development of the high-performance "econea" series. We will meet the needs of non-combustible products, from food processing rooms to freezers and refrigerators.
For product development that ensures safety and security
**Voluntary inspection of food**
Food safety cannot be said without scientific verification. It is important to scientifically verify and record the quality of each process and feed back the results to the site in a timely manner. Conventional bacteria testing is a difficult task. However, in recent years, kits that can easily test bacteria have evolved and are becoming easier to use. For daily monitoring, it is recommended that you conduct your own food microbiological inspection and regularly inspect at an external inspection agency. We will propose an inspection plan according to your request.
Ceiling panel with line lighting for interior
The joint of the heat insulation panel has a T-bar structure, and LED line lighting is embedded and integrated with the panel ceiling. There is a high degree of freedom in the layout of the ceiling surface, and flexible support is possible. Since the process and construction are simple, the construction period can be shortened. Furthermore, the space above the ceiling can be walked for inspection and work. It is also safe in terms of maintenance.
Innovative freshness control
"F's eye" management system for food plants and low temperature warehouses
F’s eye provides start/stop control and status monitoring of all machinery within a facility to help achieve stable equipment operation. Moreover, it can significantly reduce the time and effort spent by equipment managers through centralized management of temperature and equipment data on a PC.
Secure food safety management with IoT
HACCP ExAround
HACCP temperature management system that automatically monitors and records the temperature of the refrigerator for 24 hours. The key to HACCP is to keep a record. However, it takes time and labor to check and manage the records. In addition to temperature recording and monitoring, central monitoring, automatic recording, and automatic notification when an abnormality occurs, help HACCP management.
Refrigeration and freezer equipment operating status and error 24/7 remote monitoring maintenance contract
Snet24
Advantages of implementing S Net 24 is signing a maintenance contract can limit the occurrence of sudden repair costs. Verifies and optimizes the configuration, operating status, and energy usage of each piece of equipment. Enables the optimization of each store according to its environment and characteristics. Support can also be provided for reduction plans corresponding to revised Energy Conservation Act together with maintenance.
CO2 refrigerant is a next-generation, natural refrigerant with the highest level of safety.
CO2 refrigerant is an extremely environmentally friendly refrigerant that has almost no effect on global warming.
It has a high energy-saving effect and contributes to a 10-15% reduction in power consumption compared with conventional refrigerants.
|
9a6dfa2b-95f5-499d-97c1-08b59de2d39a
|
CC-MAIN-2022-21
|
https://www.galilei.co.jp/galileibase/pdf/GALILEIBASE.pdf
|
2022-05-21T06:01:50+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00234-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet
| 929,592,858 | 2,151 |
eng_Latn
|
eng_Latn
| 0.996961 |
eng_Latn
| 0.997753 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
1442,
2484,
4063,
6144,
8780,
10697,
11041
] |
CREDIT CARD MARKET MONITOR
May 2016
Credit Conditions Through the Eyes of Consumers
The U.S. economy expanded at a subpar rate of 1.4 percent in Q4 2015, significantly slower than the 2.0 percent growth rate achieved Q3. At the same time, the credit card market showed steady year-over-year gains driven by healthy consumer spending and continued labor market strength.
Overview
1) Monthly purchase volumes slipped in Q4 for subprime and prime accounts, but rose to a new high for super-prime accounts. On a year-over-year basis, however, purchase volumes rose across the board (5.9 percent for subprime, 3.0 percent for prime, and 3.1 percent for super-prime).
2) Dormant accounts fell 0.7 percentage points in Q4, while Revolvers and Transactors increased by 0.4 and 0.3 percentage points, respectively. Meanwhile, the effective finance charge yield increased to 11.18 percent, but remains near post-recession lows.
Monthly Purchase Volume, by Risk Type
Effective Finance Charge Yield
Monthly purchase volumes dipped for subprime and prime accounts in Q4, but rose for super-prime accounts. On a year-over-year basis, however, purchase volumes are up across all three risk groups.
Source: Argus Information & Advisory Services LLC.
Credit Card Credit Outstanding as a Share of Disposable Income
As a share of disposable income, credit card credit outstanding increased to 5.38 percent in Q4 2015, but is still in line with historic lows.
Source: Federal Reserve Bank of New York, Bureau of Economic Analysis.
The effective finance charge yield for all accounts rose 9 basis points in Q4 2015, but remains near post-recession lows.
Source: Argus Information & Advisory Services LLC.
Distribution of Accounts by Behavior Type
Dormant accounts declined 0.7 percentage points to 28.1 percent in Q4, while Revolvers and Transactors increased 0.4 and 0.3 points, respectively.
Source: Argus Information & Advisory Services LLC.
American Bankers Association | 1120 Connecticut Avenue NW | Washington DC 20036 | 1-800-Bankers | www.aba.com
Page 1
CREDIT CARD MARKET MONITOR
May 2016
Broader Credit Market Conditions
The credit card market continues to follow recent trends, as account volumes expanded across risk tiers and credit lines increased — particularly for lower-risk borrowers.
Overview
1) New accounts jumped to 80.3 million in Q4, driven by a 26 percent year-over-year increase in new subprime accounts. However, at 23 million, new subprime account openings remain well below pre-recession levels (e.g., 35 million new subprime accounts were created in Q1 2008).
2) Credit lines ticked up for new subprime accounts (+0.4 points) and jumped for new prime (+1.6 points) and super-prime accounts (+2.4 points).
Average Credit Line (New Accounts*)
Number of New Accounts* (Millions)
In Q4 2015, average credit lines among new accounts increased across risk tiers. In particular, credit lines for new super-prime accounts grew 2.4 percent, reaching a new post-recession high.
Source: Argus Information & Advisory Services LLC.
Average Credit Line (All Accounts)
Average credit lines for all accounts fell among subprime accounts, but rose for both prime and super-prime accounts.
Super Prime
*
New account volume grew 16.3 percent in 2015 Q4 compared to year-ago levels, with double-digit percentage growth occurring in all three risk tiers.
Number of All Accounts (Millions)
The number of open credit card accounts increased 5.8 percent year-over-year, reaching a new post-recession high of 323 million accounts.
New Accounts include accounts vintage less than 24 months.
American Bankers Association | 1120 Connecticut Avenue NW | Washington DC 20036 | 1-800-Bankers | www.aba.com
Page 2
Frequently Asked Questions: ABA Credit Card Industry Monitor
Q: What is the Credit Car Market Monitor?
The American Bankers Association ("ABA") Credit Card Market Monitor ("Monitor") provides key statistics on industry trends and relevant economic factors affecting the industry. The purpose of the report is for ABA to provide a clear, concise, and fact-driven assessment of credit card market conditions and to place current trends in both a historical and macroeconomic context. Additionally, the Monitor will occasionally be accompanied by a supplemental "Special Report" on a specific key issue in the credit card industry.
Q: How often and when is it released?
The Monitor is published quarterly, with the first report released in September 2013.
Q: Who publishes the report?
The report is published by the American Bankers Association. Data is provided by Argus Information and Advisory Services, which serves as the leading provider of information services for U.S. financial institutions. Analytical support is provided by Keybridge LLC, a boutique economic and public policy consulting firm with a diverse clientele of companies, associations, and other institutions that operate at the intersection of economics and public policy.
Q: Where do the data come from?
The data used in the report originate from proprietary industry databases and publicly available government sources. Specifically, the credit card data are taken from a nationally representative sample provided by Argus. Credit card data are presented as national averages for all accounts based on actual credit card account information. No individual account holder's information or specific financial institution's data can be identified from the data set. Other data used in the report are taken from various public and private sources, including the Department of Commerce's Bureau of Economic Analysis and the Federal Reserve.
Q: How current are the data?
In all cases, the Monitor uses the latest available quarterly data, which are typically published several weeks after the end of each quarter. As a result, there is a time lag between the period of the latest available data and the Monitor's publication date. Among the figures used in the Monitor, data typically lag by 1–2 quarters.
Q: What are the data elements included in the Monitor, and how are they defined?
Page 1 of the Monitor shows credit conditions through the eyes of consumers, while Page 2 depicts broader credit market conditions. Each page consists of four charts and includes an overview section followed by brief textual descriptions that accompany each chart. In some cases, charts are broken down by risk category (sub-prime, prime, and super-prime). These risk categories are defined by Argus according to the following risk scores: (1) sub-prime <680, (2) prime 680-759, and (3) super-prime >759.
Page 1 Charts
- Monthly Purchase Volume, by Risk Type: The average amount of purchases paid for with credit cards per cardholder per month, for each risk category.
- Credit Card Debt Outstanding as a Share of Disposable Income: Credit Card Debt-to-Income is a commonly used ratio to indicate cardholders' ability to repay their credit card balances. Outstanding Credit Card Debt measures the aggregate amount of outstanding credit card loans held by U.S. households as reported by the Federal Reserve. Disposable Income is the aggregate amount of money available to individuals after saving and income taxes as reported by the Federal Reserve.
- Effective Finance Charge Yield: This credit card rate, sourced from Argus, represents the average effective finance charge yield on all accounts. The effective finance charge yield is the annualized interest income generated by a portfolio expressed as a percentage of a portfolio's assets.
- Distribution of Accounts by Behavior Type: The share of credit card accounts by three behavior categories: (1) "Transactors," or accounts that have purchases, fees, and/or a balance during the quarter but have no finance charges (net of reversals) in any month of a quarter; (2) "Revolvers," or accounts for which some percentage of the monthly balance is rolled over to the next month at least once during a quarter; and (3) "Dormants," or accounts that show no activity over the course of the quarter.
Page 2 Charts
- Average Credit Line (New Accounts): The average line of credit on accounts opened in the last 24 months, by risk category.
- Average Credit Line (All Accounts): The average line of credit on open accounts, by risk category.
- Number of New Accounts: The number of accounts opened within the past 24 months of a given quarter, by risk category.
- Number of All Accounts: The total number of open accounts in a given quarter, by risk category.
Q: Where can I find past editions of the report, and who is the point of contact?
Past editions of the Monitor are available at ABA's website (www.aba.com). For inquiries related to the Monitor, please contact Jeff Sigmund, ABA VP for Public Relations, at 202-663-5439.
LAST UPDATED April 27, 2016
|
<urn:uuid:949d8711-6f31-4977-88e9-16e36f304293>
|
CC-MAIN-2017-26
|
http://www.aba.com/Press/Documents/ABA2016Q2CreditCardMonitor.pdf
|
2017-06-29T01:57:37Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128323842.29/warc/CC-MAIN-20170629015021-20170629035021-00120.warc.gz
| 432,038,962 | 1,878 |
eng_Latn
|
eng_Latn
| 0.990907 |
eng_Latn
| 0.993135 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2060,
3730,
6611,
8818
] |
Volunteers Registration Form
We need your help!
The Goulburn Show is one of the largest community events held on the 1 st full weekend in March annual in the Goulburn/Mulwaree area. It is a volunteer run, non-profit organisation, promoting low-cost family fun and something for everyone. We would really appreciate your support!
If you are interested in becoming a volunteer or assisting in a particular area of the show, please indicate which area and a committee member will be in contact with you.
Your area of interest: ……………………………………………………………………………………………………………………………..
(entries, pavilion, stewarding, catering, office work, social media, raffle selling, setting up and pull down, livestock, maintenance, etc, the list is endless)
When would you be available to help? …………………………………………………………………………………………………
Show time only, week prior, month prior, during the year if required
Your skills and experience: …………………………………………………………………………………………………………….………
.................................................................................................................................................................
Do you have any medical conditions which the show society should be aware of?...................................
.................................................................................................................................................................
Contact Name: .........................................................................................................................................
Postal Address: ........................................................................................................................................
Email Address: .........................................................................................................................................
Phone: .................................................................. Date of birth: .............................................................
Working with children check number (WWCC): ........................................................................................
Name and signature of parent or guardian if volunteer is under 18 years:
.................................................................................................................................................................
Date:
................................................................................................................................................................
Goulburn Show respects the privacy rights of our members and volunteers and any data recorded on this form will be used for show society purposes ONLY.
Thank you for your support!
|
<urn:uuid:de057b40-bbfd-4ece-a9b8-4f0ee4986434>
|
CC-MAIN-2023-50
|
https://goulburnshow.com.au/assets/Volunteer-Register-form.pdf
|
2023-12-04T13:51:17+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00171-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet
| 334,981,520 | 326 |
eng_Latn
|
eng_Latn
| 0.602159 |
eng_Latn
| 0.602159 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2734
] |
New Storage Architectures
Replacing LNET routers with IB routers
#OFSUserGroup
Lustre Basics
• Lustre is a clustered file-system for supercomputing
• Architecture consists of clients and three types of servers
• Basic configuration connects servers and clients with a single network.
LNET Routers
- Separate storage and compute IB fabrics
- Different subnet managers, different topologies, fault isolation
- Limited to LNET traffic
Typical LNET Router
• Basic Compute Node
• Xeon Processor(s), lots of Memory, one or two HCAs
• Runs Linux and the LNET kernel stack
• Software involvement in packet routing
The First Crossbow Device
Crossbow R400-6
40G 6-port 4X QDR IB router
LAN or mixed LAN / WAN environments
R400
- Six port IB router
- Shared memory hardware switching architecture
- ~30 watts operating
- ~350ns port to port latency
- Wire speed
- Stripe with multipath many R400s for capacity
Demo Configuration
- Ran for 3 days on the show floor during SC14
Demo Configuration
- Full bandwidth while deliberately faulting equipment
Replacing LNET Routers
- Each Crossbow R400 replaces three LNET router nodes
- Automatic Path Migration is supported at the IB layer
- Routed IB can be natively extended over distance using Longbow
Replacing LNET Routers
• Cross connect multiple subnets
Storage
Subnet 2006::/64
R400
Subnet 2001::/64
Subnet 2002::/64
Subnet 2003::/64
Subnet 2004::/64
Subnet 2005::/64
Replacing LNET Routers
- Parallel connect two subnets for bandwidth
Storage
Subnet 2006::/64
R400
Subnet 2001::/64
BGFC Clustered SM
• New multi-subnet, router enabled SM
• Clustered per subnet, and clustered globally
• Sophisticated multi-subnet routing engine allows complex multi-subnet topologies
• Provably safe loss-less cross subnet routing
• Full support for multipathing
• Cross subnet path record queries, with multipathing and Alternate Path Migration
File Copy over WAN
• Extend clustered file system data beyond a Campus
• Obsidian's dsync+ tool gives high performance file copy over RDMA
• Supports Longbow and Crossbow devices
• Very tolerant to latency
DSYNC+
• APAN results: 300ms RTT, 26000 Km.
NCI AU to SG data transfer speed
Average Time
- DSYNC NCI to A*Star RSE path: 4h 7m
- DSYNC NCI to A*Star 10Gb PoB: 3h
- DSYNC 16Gb IB path: 1h 21m
- DSYNC 10Gb IB path (-26,000Km): 8m
381Gb data set
nci.org.au
Thank You
OpenFabrics Software User Group Workshop
#OFSUserGroup
|
5c8a5854-748f-4245-bf97-6388f7d030a5
|
CC-MAIN-2022-49
|
https://www.openfabrics.org/images/eventpresos/workshops2015/UGWorkshop/Thursday/thursday_07.pdf
|
2022-11-30T21:35:44+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-49/subset=warc/part-00296-a0906200-461b-4808-9b94-6c53daf73f61.c000.gz.parquet
| 972,862,386 | 653 |
eng_Latn
|
eng_Latn
| 0.68726 |
eng_Latn
| 0.905219 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"dan_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"deu_Latn"
] | true |
docling
|
[
79,
286,
436,
612,
720,
909,
977,
1053,
1253,
1429,
1549,
1899,
2107,
2369,
2437
] |
CASREF,CLOSED,HBG,SPADFORM
United States District Court Middle District of Pennsylvania (Harrisburg) CIVIL DOCKET FOR CASE #: 1:14−cv−02148−CCC−MCC
Jamal et al v. Kane et al
Date Filed: 11/10/2014
Jury Demand: Plaintiff
Date Terminated: 04/30/2015
Nature of Suit: 440 Civil Rights: Other
Jurisdiction: Federal Question
represented by Ashley K Henderson Amistad Law Project
Assigned to: Chief Judge Christopher C. Conner
Referred to: Magistrate Judge Martin C. Carlson
Related Case: 1:15−cv−00045−CCC−MCC
Cause: 42:1983 Civil Rights Act
Plaintiff
Mumia Abu Jamal
PO Box 9148
Philadelphia, PA 19139
267−225−5884
Email: [email protected]
LEAD ATTORNEY
ATTORNEY TO BE NOTICED
Bret D. Grote
Abolitionist Law Center
PO Box 8654
Pittsburgh, PA 15221
412−654−9070
Email: [email protected]
LEAD ATTORNEY
ATTORNEY TO BE NOTICED
David Shapiro
375 E. Chicago Ave
Northwestern Univ School of Law
Chicago, IL 60611
LEAD ATTORNEY
312−503−0711
PRO HAC VICE
ATTORNEY TO BE NOTICED
Deneekie Grant
PO Box 9148
Amistad Law Project
Philadelphia, PA 19139
Email: [email protected]
267−225−5884
LEAD ATTORNEY
ATTORNEY TO BE NOTICED
Dustin McDaniel
PO Box 8654
Abolitionist Law Center
Pittsburgh, PA 15221
Email: [email protected]
412−651−7485
LEAD ATTORNEY
ATTORNEY TO BE NOTICED
Jules L Lobel
Abolitionsit Law Center PO Box 8654 Pittsburgh, PA 15260 412−648−1375 Email: [email protected]
Plaintiff
Robert L. Holbrook
Plaintiff
Kerry Shakaboona
TERMINATED: 12/01/2014
represented by
LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro
Roderick and Solange MacArthur Justice Center Northwestern University School of Law 375 East Chicago Avenue 8th Floor Chicago, IL 60611 312−503−0711 Email: [email protected] ATTORNEY TO BE NOTICED
represented by Ashley K Henderson
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Bret D. Grote
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David Shapiro
(See above for address) LEAD ATTORNEY PRO HAC VICE ATTORNEY TO BE NOTICED
Deneekie Grant
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Dustin McDaniel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Jules L Lobel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
Ashley K Henderson (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Bret D. Grote (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David Shapiro (See above for address) LEAD ATTORNEY
Plaintiff
Marshall Prison Radio TERMINATED: 12/01/2014
Plaintiff
Human Rights Coalition represented by
PRO HAC VICE ATTORNEY TO BE NOTICED
Deneekie Grant
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Dustin McDaniel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Jules L Lobel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
represented by Ashley K Henderson
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Bret D. Grote
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David Shapiro
(See above for address) LEAD ATTORNEY PRO HAC VICE ATTORNEY TO BE NOTICED
Deneekie Grant
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Dustin McDaniel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Jules L Lobel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
Ashley K Henderson
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Plaintiff
Educators for Mumia Abu−Jamal represented by
Bret D. Grote (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David Shapiro (See above for address) LEAD ATTORNEY PRO HAC VICE ATTORNEY TO BE NOTICED
Deneekie Grant
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Dustin McDaniel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Jules L Lobel (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
Ashley K Henderson
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Bret D. Grote (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David Shapiro (See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Deneekie Grant
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Dustin McDaniel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
Jules L Lobel
(See above for address) LEAD ATTORNEY ATTORNEY TO BE NOTICED
David M Shapiro (See above for address) ATTORNEY TO BE NOTICED
Plaintiff
Donnell Palmer
Plaintiff
Anthony Chance
Plaintiff
Kerry Shakaboona Marshall
Plaintiff
Prison Radio
V.
Defendant
Kathleen Kane
Attorney General of Pennsylvania represented by
Bret D. Grote
(See above for address) ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
represented byBret D. Grote
(See above for address) ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
represented by represented by
Bret D. Grote
(See above for address) ATTORNEY TO BE NOTICED
David M Shapiro
ATTORNEY TO BE NOTICED
(See above for address)
Bret D. Grote
(See above for address) ATTORNEY TO BE NOTICED
David M Shapiro
(See above for address) ATTORNEY TO BE NOTICED
represented byKenneth L. Joel
Office of General Counsel
333 Market Street
17th Floor
Harrisburg, PA 17101
717−787−9348
Fax: 717−787−1788
Email: [email protected]
ATTORNEY TO BE NOTICED
M. Abbegael Giunta
PA Governor's Office of General Counsel 333 Market Street 17th Floor Harrisburg, PA 17101 717−7879350 Email: [email protected] ATTORNEY TO BE NOTICED
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 6 of 11
R. Seth Williams
District Attorney of Philadelphia County TERMINATED: 03/06/2015
Bryan C. Hughes
Email: [email protected]
TERMINATED: 02/23/2015
PA Office of Attorney General 1600 Arch Street Third Floor Philadelphia, PA 19103 267−940−6713
ATTORNEY TO BE NOTICED
Michael R Scalera
Email: [email protected]
ATTORNEY TO BE NOTICED
Philadelphia District Attorney's Office Civil Litigation, 13th Floor Three South Penn Square Philadelphia, PA 19107 215−686−5688
| Date Filed | # |
|---|---|
| 11/10/2014 | 1 |
| 11/10/2014 | 2 |
| 11/10/2014 | 3 |
| 11/12/2014 | |
| 11/13/2014 | 4 |
| 11/13/2014 | 5 |
| 11/13/2014 | |
| 11/14/2014 | |
| 11/17/2014 | 6 |
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 7 of 11
11/17/2014)
11/17/2014 8 Supplement by Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights
| 11/18/2014 | | DOCKET ANNOTATION: Petitioning attorney's bar status verified. (aaa) (Entered: 11/18/2014) |
|---|---|---|
| 11/19/2014 | 9 | ORDER granting Ashley Henderson, Esquire's application 4 for pro hac vice admission. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 11/19/14. (ki) (Entered: 11/19/2014) |
| 11/19/2014 | 10 | ORDER granting Deneekie Grant, Esquire's application 5 for pro hac vice admission. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 11/19/14. (ki) (Entered: 11/19/2014) |
| 11/19/2014 | 11 | ORDER granting David M. Shapiro, Esquire's application 6 for pro hac vice admission. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 11/19/14. (ki) (Entered: 11/19/2014) |
| 12/01/2014 | 12 | AMENDED COMPLAINT against All Defendants, filed by Educators for Mumia Abu−Jamal, Kerry Shakaboona, Robert L. Holbrook, Marshall Prison Radio, Mumia Abu Jamal, Human Rights Coalition. (Attachments: # 1 Exhibit(s))(Grote, Bret) (Entered: 12/01/2014) |
| 12/15/2014 | 13 | DELETED − MOTION to Appear Pro Hac Vice − Attorney Jules Lobel is seeking special admission. Filing fee $ 50, receipt number 0314−3304183. by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Grote, Bret) (Entered: 12/15/2014) |
| 12/16/2014 | | DOCKET ANNOTATION: Counsel is advised to refile 13 Motion for Admission Pro Hac Vice of Jules Lobel. The sponsor's statement is moving for the admission of the wrong party. The local rule referenced is incorrect. (pw) (Entered: 12/16/2014) |
| 12/29/2014 | 14 | MOTION to Amend/Correct 13 MOTION to Appear Pro Hac Vice − Attorney Jules Lobel is seeking special admission. Filing fee $ 50, receipt number 0314−3304183. by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Grote, Bret) (Entered: 12/29/2014) |
| 12/30/2014 | 15 | ORDER granting application of Jules Lobel, Esquire 14 to appear pro hac vice. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 12/29/14. (ki) (Entered: 12/30/2014) |
| 01/07/2015 | 16 | NOTICE of Appearance by M. Abbegael Giunta on behalf of Kathleen Kane (Giunta, M.) (Entered: 01/07/2015) |
| 01/07/2015 | 17 | Unopposed MOTION for Extension of Time to of Time to File Response to Amended Complaint by Kathleen Kane. (Attachments: # 1 Proposed Order Extending Response Deadline for All Defendants By Two Weeks, until January 23, 2015)(Giunta, M.) (Entered: 01/07/2015) |
| 01/08/2015 | 18 | MOTION for Preliminary Injunction by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Grote, Bret) (Entered: 01/08/2015) |
Coalition, Mumia Abu Jamal, Marshall Prison Radio, Kerry Shakaboona. to 5
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 8 of 11
01/08/2015)
01/08/2015 20 ORDER: Dfts shall file and serve any papers in response to pltfs mtn for Preliminary
| 01/09/2015 | 21 | ORDER granting deft's motion 17 to extend ddl for response to amended complaint until 1/23/15. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 1/9/15. (ki) (Entered: 01/09/2015) |
|---|---|---|
| 01/13/2015 | 23 | SCHEDULING ORDER directing parties to meet & confer re: br'ing schedule for motions for PI & any addt'l anticipated filings & to submit jt prop schedule to ct by 1/16/15..., & setting Oral Argument re: both motions for 2/26/2015 @ 10:00 AM in Harrisburg − Courtroom 2 before Chief Judge Christopher C. Conner. (See order for complete details.)Signed by Chief Judge Christopher C. Conner on 1/13/15. (ki) (Entered: 01/13/2015) |
| 01/13/2015 | 24 | MOTION to Appear Pro Hac Vice − Attorney Bryan Hughes is seeking special admission. Filing fee $ 50, receipt number 0314−3325757. by R. Seth Williams.(Hughes, Bryan) (Entered: 01/13/2015) |
| 01/14/2015 | | DOCKET ANNOTATION: Counsel is advised that Doc. 24 filed 1/13/15 is required to have the CODE OF PROFESSIONAL CONDUCT attached. The Code may be filed separately as a "Document Filed." (gls) (Entered: 01/14/2015) |
| 01/14/2015 | 25 | Code of Professional Conduct form by R. Seth Williams. 24 MOTION to Appear Pro Hac Vice − Attorney Bryan Hughes is seeking special admission. Filing fee $ 50, receipt number 0314−3325757. . (Hughes, Bryan) (Entered: 01/14/2015) |
| 01/14/2015 | 26 | ORDER granting motion to appear pro hac vice 24 by Bryan C. Hughes, Esquire (SPAD approved). (Original: SCR Registry) Signed by Chief Judge Christopher C. Conner on 1/14/15. (ki) (Entered: 01/14/2015) |
| 01/14/2015 | 27 | APPROVED (per 1/15/15 order 29 of court) − STIPULATION re 23 Scheduling Order, Jointly By All Parties by Kathleen Kane. (Giunta, M.) Modified on 1/15/2015 (ki). (Entered: 01/14/2015) |
| 01/15/2015 | 28 | NOTICE of Appearance by Kenneth L. Joel on behalf of Kathleen Kane (Joel, Kenneth) (Entered: 01/15/2015) |
| 01/15/2015 | 29 | ORDER approving stipulated proposed schedule 27 , inc. deft Kane & Williams' MTDs due 1/23/15, brs in supp of MTDs & brs in opp of motions for prelim inj due 2/6/15, pltfs' combined br in opp to MTDs & reply in supp of mots for prelim inj due 2/17/15 & defts' reply brs in supp of MTDs due 2/23/15. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 1/15/15. (ki) (Entered: 01/15/2015) |
| 01/23/2015 | 30 | MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM by R. Seth Williams. (Attachments: # 1 Proposed Order)(Hughes, Bryan) (Entered: 01/23/2015) |
| 01/23/2015 | 31 | MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM by Kathleen Kane. (Attachments: # 1 Proposed Order Granting Defendant Kane's Motion to Dismiss the Claims Against Her)(Giunta, M.) (Entered: 01/23/2015) |
| 02/04/2015 | 32 | MOTION to Exceed Page Limitation by Kathleen Kane. (Attachments: # 1 Proposed Order Granting Defendant Kane Leave to File a Brief up to 35 Pages in Length)(Giunta, M.) (Entered: 02/04/2015) |
| 02/05/2015 | 33 | MOTION to Appear Pro Hac Vice − Attorney Michael Scalera is seeking special admission. Filing fee $ 50, receipt number 0314−3346928. by R. Seth Williams. (Attachments: # 1 Certificate of Service)(Scalera, Michael) (Entered: 02/05/2015) |
| 02/05/2015 | 34 | ORDER granting dft Kane's MOTION to Exceed Page Limitation 32 . Dft Kane may file a combined brsup of the mtns to dismiss and in opposition to the mtns for PI not to exceed 35 pages.Signed by Chief Judge Christopher C. Conner on 02/05/15. (ma) (Entered: 02/05/2015) |
Injunction 18 by 1/20/2015Signed by Chief Judge Christopher C. Conner on 01/08/15.
02/06/2015
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 9 of 11
Chief Judge Christopher C. Conner on 02/06/15. (ma) (Entered: 02/06/2015)
36 BRIEF IN SUPPORT
Combined Brief in Opposition re 31 MOTION TO DISMISS
| 02/06/2015 | 37 | BRIEF IN SUPPORT re 30 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM filed by R. Seth Williams.(Scalera, Michael) (Entered: 02/06/2015) |
|---|---|---|
| 02/12/2015 | 38 | Unopposed MOTION for Leave to File Brief Up to 25 Pages by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona. (Attachments: # 1 Proposed Order)(Shapiro, David) (Entered: 02/12/2015) |
| 02/13/2015 | 39 | ORDER granting pltfs' unopposed motion 38 for leave to file combined brief in opp to defts' MTD & in supp of pltfs' motion for prelim inj up to 25 pp in length. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 2/13/15. (ki) (Entered: 02/13/2015) |
| 02/17/2015 | 40 | BRIEF IN OPPOSITION re 30 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM , 31 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM and REPLY BRIEF IN SUPPORT OF MOTION FOR PRELIMINARY INJUNCTION filed by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Shapiro, David) (Entered: 02/17/2015) |
| 02/20/2015 | 41 | MOTION to Withdraw as Attorney by R. Seth Williams. (Attachments: # 1 Proposed Order)(Hughes, Bryan) (Entered: 02/20/2015) |
| 02/23/2015 | 42 | ORDER granting Assistant District Attorney Bryan C. Hughes' motion 41 for leave to w/draw as cnsl for deft R. Seth Williams. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 2/23/15. (ki) (Entered: 02/23/2015) |
| 02/23/2015 | 43 | REPLY BRIEF re 31 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM filed by Kathleen Kane.(Giunta, M.) (Entered: 02/23/2015) |
| 02/23/2015 | 44 | REPLY BRIEF re 30 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM filed by R. Seth Williams.(Scalera, Michael) (Entered: 02/23/2015) |
| 02/26/2015 | 45 | COURT REPORTER NOTES OF PROCEEDINGS, filed by Wesley J. Armstrong, of oral argument hearing held before Chief Judge Conner on 26 February 2015. In accordance with 28 U.S.C., Section 753(b), I certify that these original notes are a true and correct record of proceedings in the United States District Court for the Middle District of PA before Chief Judge Conner on 26 February 2015. By: s/ Wesley J. Armstrong, RMR. (Court Reporter Notes are viewable by court staff only.) (Entered: 02/26/2015) |
| 03/06/2015 | 47 | MEMORANDUM (Order to follow as separate docket entry) re: 30 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM filed by R. Seth Williams & 31 MOTION TO DISMISS FOR FAILURE TO STATE A CLAIM filed by Kathleen Kane. (See memo for complete details.) Signed by Chief Judge Christopher C. Conner on 3/6/15. (ki) (Entered: 03/06/2015) |
| 03/06/2015 | 48 | ORDER (Memorandum 47 filed previously as separate docket entry) GRANTING MTD by Williams 30 & dismissing all claims vs same, DENYING MTD by Kane 31 , setting trial on merits for 3/30/15 @ 10:00 a.m. in Ctrm #2 and attaching all cnsl, directing parties to meet & confer to develop jt stip of facts necessary for resolution of pltfs' constitutional challenges, etc., & to file same by 3/23/15, & if parties unable to agree on stip of facts by 3/23/15 they shall separately notify ct of same by letter on docket. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 3/6/15. (ki) (Entered: 03/06/2015) |
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 10 of 11
03/23/2015 49 STIPULATIONOF FACTSby Anthony Chance, Educators for Mumia Abu−Jamal,
Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.
Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona
(Attachments: # 1 Exhibits)(Shapiro, David) (Entered: 03/23/2015)
| 03/27/2015 | 50 | DVD referenced in Joint Stipulation of Facts filed and forwarded to Chambers. (pjr) (Entered: 03/27/2015) |
|---|---|---|
| 03/30/2015 | 51 | COURT REPORTER NOTES OF PROCEEDINGS, filed by Wesley J. Armstrong, of bench trial on merits, held before Chief Judge Conner on 30 March 2015. In accordance with 28 U.S.C., Section 753(b), I certify that these original notes are a true and correct record of proceedings in the United States District Court for the Middle District of PA before Chief Judge Conner on 20 March 2015. By: s/ Wesley J. Armstrong, RMR. (Court Reporter Notes are viewable by court staff only.) (Entered: 03/30/2015) |
| 03/31/2015 | 53 | EXHIBIT 17 (CORRECTED) by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Donnell Palmer, Prison Radio. (Shapiro, David) (Entered: 03/31/2015) |
| 04/28/2015 | 54 | MEMORANDUM (Order to follow as separate docket entry) re: 18 MOTION for Preliminary Injunction filed by Prison Radio, Educators for Mumia Abu−Jamal, Donnell Palmer, Mumia Abu Jamal, Marshall Prison Radio, Robert L. Holbrook, Kerry Shakaboona, Human Rights Coalition, Kerry Shakaboona Marshall, Anthony Chance. (See memo for complete details.) Signed by Chief Judge Christopher C. Conner on 4/28/15. (ki) (Entered: 04/28/2015) |
| 04/28/2015 | 55 | ORDER (Memorandum 54 filed previously as separate docket entry) − It is ORDERED that plfts' motions 18 are CONSTRUED as MSJs & permanent injunctive relief & are GRANTED as so construed.. FURTHER ORDERED & DECLARED that Commonwealth's Revictimization Act... is unconstitutional in violation of 1st & 5th Amends to US Constitution & enforcement thereof hereby & permanently ENJOINED. Clrk of Ct shall enter declaratory jdgmt in favor of pltfs & against deft & thereafter close case. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 4/28/15. (ki) (Entered: 04/28/2015) |
| 04/30/2015 | 56 | DECLARATORY JUDGMENT ENTERED in favor of plaintiffs Mumia Abu Jamal, et al., & against defendants Kathleen Kane, et al., as follows; It is ORDERED & DECLARED that the Commonwealth's Revictimization Relief Act, 18 PA. CONS. STAT. Section 11.1304 is unconstitutional in violation of the 1st & 5th Amends to the US Constitution, & the enforcement thereof is hereby & permanently ENJOINED, in acc w/ this court's order 55 dated 4/28/15. (See jdgmt for complete details.) Signed by Deputy Clerk on 4/30/15. (ki) (Entered: 04/30/2015) |
| 05/07/2015 | 57 | Unopposed MOTION for Extension of Time to Move for an Award of Attorneys' Fees by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Shapiro, David) (Entered: 05/07/2015) |
| 05/11/2015 | 58 | ORDER granting pltfs' motion to postpone ddl 57 for moving for award of atty's fees until 30 days after any appeal by deft Kane is resolved or 30 days after ddl of deft Kane to file appeal has passed if she does not appeal. (See order for complete details.)Signed by Chief Judge Christopher C. Conner on 5/11/15. (ki) (Entered: 05/11/2015) |
| 06/29/2015 | 59 | MOTION for Extension of Time to to file Motion for Fees and Costs by Anthony Chance, Educators for Mumia Abu−Jamal, Robert L. Holbrook, Human Rights Coalition, Mumia Abu Jamal, Kerry Shakaboona Marshall, Marshall Prison Radio, Donnell Palmer, Prison Radio, Kerry Shakaboona.(Shapiro, David) (Entered: 06/29/2015) |
| 06/30/2015 | 60 | ORDER granting pltfs' motion 59 to postpone deadline for moving for award of atty's fees until 8/17/15. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 6/30/15. (ki) (Entered: 06/30/2015) |
Case: 1:14-cv-2148 As of: 11/04/2018 04:33 PM EST 11 of 11
REFERRING matter to the Honorable Martin C. Carlson for the purpose of mediation of appropriate attorneys' fees. (See order for complete details.) Signed by Chief Judge Christopher C. Conner on 7/22/15. (ki) (Entered: 07/22/2015)
|
<urn:uuid:b1df5a73-19bb-472a-b4a8-f9e5a8165eb1>
|
CC-MAIN-2021-17
|
https://www.clearinghouse.net/chDocs/public/PC-PA-0037-9000.pdf
|
2021-04-20T07:19:02+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00012-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet
| 812,020,869 | 6,964 |
eng_Latn
|
eng_Latn
| 0.610731 |
eng_Latn
| 0.64884 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1440,
2583,
3671,
4723,
5838,
6586,
9910,
13692,
17435,
21626,
21921
] |
RATING REPORT
Dubai Islamic Bank Pakistan Limited
REPORT DATE:
June 27, 2024
RATING ANALYSTS:
Basel Ali Assad [email protected]
APPLICABLE METHODOLOGY
Rating Methodology – Financial Institution
Rating The Issue https://docs.vis.com.pk/Methodologies%202024/Financial-Institution-v2.pdf
https://docs.vis.com.pk/docs/Rating-the-Issue-Aug-2023.pdf https://docs.vis.com.pk/docs/VISRatingScales.pdf
VIS Rating Scale
VIS
Dubai Islamic Bank Pakistan Limited
OVERVIEW OF THE INSTITUTION
RATING RATIONALE
Incorporated in Pakistan as an unlisted public limited bank, Dubai Islamic Bank Pakistan Limited (DIBPL) operates as an Islamic commercial bank in accordance with Shari'a principles.
Profile of Chairman
Mohamed Saeed Ahmed Abdulla Al Sharif serves as Chairperson of the Board. Currently, Mr. Sharif serves as Chief of International Business and Real Estate at DIB, UAE; his experience spans over 30 years.
Profile of CEO
Junaid Ahmed has over thirty years' experience in the areas of General Banking, Foreign Exchange, Treasury, Corporate and Investment Banking with leading banks in Pakistan and in the Middle East. He is a seasoned banker, who joined Dubai Islamic Bank Pakistan Limited as President and Chief Executive Officer in August 2010. He has also served as Director on the Board of MESC - Jordan Dubai Islamic Bank, Bank of Khartoum- Sudan and Bosna Bank International – Bosnia Herzegovina.
Dubai Islamic Bank Pakistan Limited ('DIBPL' or 'the Bank') is a subsidiary of Dubai Islamic Bank PJSC, operating independently since 2005 within the regulatory framework and banking laws of Pakistan. DIBPL provides a range of retail, wholesale, treasury & investment banking, and capital markets products and services to individual, corporate and institutional customers. The Bank operates 235 branches across Pakistan.
Banking sector
The banking sector in Pakistan has been navigating a challenging macroeconomic landscape. Despite facing headwinds such as high inflation, elevated interest rates, and geopolitical uncertainties, the sector has demonstrated resilience and adaptability in supporting economic stability.
One of the important factors contributing to the sector's resilience has been its strong capitalization and liquidity. Banks in Pakistan remain well-capitalized, with an industry-wide CAR of 19.7%. This ensures that banks are equipped to absorb potential shocks and maintain financial stability. Moreover, profitability metrics remain healthy, with a return on equity (ROE) of 27.1% based on CY-23 results, underscoring the sector's ability to generate sustained returns amidst challenging operating conditions.
The government's successful negotiation of the IMF's Stand-By Arrangement (SBA) program, culminating in a Staff-Level Agreement and disbursement of funds, has provided additional support to market confidence and exchange rate stability, with positive implications for the banking sector. In terms of monetary policy dynamics, the State Bank of Pakistan (SBP) has maintained a cautious stance, balancing the imperative of containing inflationary pressures while supporting economic growth. As the headline inflation has moderated from peak levels, though remains elevated, prompting the SBP to decrease the policy rate by 150bps to 20.5% in its latest monetary policy statement. The central bank remains commitment to anchoring inflation expectations and safeguarding macroeconomic stability.
Looking ahead, the banking sector faces both challenges and opportunities. Continued vigilance in managing credit quality and liquidity risks will be vital, especially amidst evolving macroeconomic dynamics and policy uncertainties. Moreover, the sector's role in supporting the government's reform agenda, particularly in areas such as taxation, energy, and privatization of state-owned enterprises, will be critical in fostering sustainable economic growth and financial stability.
Key rating drivers
Strong sponsor profile
Ratings assigned to Dubai Islamic Bank Pakistan Limited (DIBPL) take into account the strong franchise of the institution given its association with Dubai Islamic Bank PJSC (DIB), the largest Islamic bank operating in United Arab Emirates. Parent support has been witnessed over time both in the form of financial support and technical knowledge transfer. Ratings also draw strength from the standalone financial profile of DIB, rated A+/A1 (Single A Plus / A One) on
2
international scale ratings and AA (ae)/A1+(ae) on national scale by the Islamic International Rating Agency (IIRA).
No major movement in the gross financing portfolio over the rating review period owing to challenging macroeconomic environment
DIBL's gross advances remained relatively stable in absolute terms at end-March'24 compared to end-Dec'22 despite marginal industry growth of 0.4%; the same is a reflection of the challenging macroeconomic environment and drop in overall credit demand over the rating review period. Nonetheless, market share remained stable at 2.2% (CY23: 2.1%, CY22: 2.1%). Moreover, gross advances to deposits ratio (ADR) stood higher at 71.1% (CY23: 70.4%, CY22: 64.6%) at end1QCY24 in conjunction with lower deposit base; the same continues to be higher compared to medium-sized banking peers in line with historical trends. Going forward, the Bank does not envisage any major increase in the overall portfolio and aims to remain focused on established corporate entities in order to manage the associated risk.
Increase in gross infection while adequate provisioning coverage led to improvement in some asset quality indicators
The Bank's infected portfolio increased significantly over the rating review period in conjunction with deterioration in macroeconomic conditions, resulting in higher gross infection of 6.3% (CY23: 6.1%, CY22: 3.8%) at end-1QCY24. However, sizeable increase in specific provisions led to low net infection and Net NPLs to Tier-1 equity ratios of 0.4% and 2%, respectively (CY23: 0.2%, 1.2%; CY22: 0.6%, 4.1%) vis-à-vis CY22; the same compare favorably to mediumsized banking peers. Hence credit risk related to the advances portfolio is presently considered low.
Going forward, the management envisages some improvement in asset quality indicators on the back of the Bank's cautious lending strategy, anticipated decline in interest rates and expected recoveries against NPLs. The ratings remain sensitive to improvement in asset quality to ensure a healthy loan book.
Investment portfolio remained tilted towards government securities
The investment portfolio augmented over the rating review period as liquid resources were directed largely toward short-term GoP Ijarah Sukuks and foreign debt securities to capitalize on the high discount rate environment. The overall credit risk profile is considered manageable given that government securities comprise majority of the investment portfolio. While foreign securities consist of investment-grade and government debt instruments, providing comfort in terms of credit risk.
Exposure to Mark-to-Market (MTM) losses is also prevalent given that the entirety of the portfolio is categorized as securities at fair value through other comprehensive income (FVOCI); nonetheless, the associated risks are moderated given that the majority of investments constitute floating-rate instruments and have a duration of less than a year, as per management. Going forward, the Bank aims to continue focusing on short-term instruments.
Meanwhile, as the majority of foreign securities are fixed rate instruments and the PKR may to remain volatile, inherent market and foreign currency risks are present. Nonetheless, as per management, these instruments are funded by foreign deposits which help mitigate the
3
VIS
aforementioned foreign currency risk. Moreover, the management intends to hold the securities till maturity, thus potential losses are unlikely to be realized.
Decreasing trend in deposit base while liquidity remained adequate
DIBL's deposits decreased by 6.1% to Rs. 324.9b (CY22: Rs. 345.8b) at end-CY23 while the industry exhibited a growth of 23.9%; the relevant market share therefore decreased to 1.2% (CY22: 1.5%) by end-CY23. This was largely due to decline in corporate saving deposits and shedding of high-cost term deposits to in order to improve spreads. Meanwhile, current account deposits increased by 7.3% to Rs. 92.3b (CY22: Rs. 86.1b). Given higher current account deposits offsetting decline in savings deposits, the proportion of Current Account Saving Account (CASA) remained relatively stable. The concentration of top depositors in the total deposit base remained on the higher side. During 1QCY24, the Bank's deposit base decreased further largely on account of lower fixed and other deposits. Consequently, CASA portion increased slightly.
While LCR improved and liquidity metrics were adequate, the same lagged medium-sized peers, indicating room for improvement. Going forward, the management plans to expand its network from the current 235 branches to 500 locations over the next four years, pending approval from the Board. The network expansion is expected help in mobilizing low cost deposits, going forward.
Enhanced profitability indicators mainly on the back improving spreads
The SBP's monetary tightening policy over the rating review period led to benchmark rates increasing by 600bps during CY23 compared to SPLY, translating in appreciable improvement in industry-wide profitability of banks. Consequently, DIBL's net markup income increased significantly by 56.5% on the back of higher net spreads and expansion of the investment portfolio. The non-markup income also increased slightly due to higher fee & commission and foreign exchange income. The operating expenses increased emanating largely from higher salary compensation and IT related expenses in line with inflationary pressure. Nonetheless, the efficiency ratio improved to 36.2% (CY22: 44.1%) on account of significantly higher recurring income. Net provisions and write-offs stood higher at Rs. 7.4b (CY22: Rs. 4.6b). Nevertheless, a healthy bottom-line was recorded, amounting to Rs. 6.7b (CY22: Rs. 3.9b), with RoAA increasing to 1.5% (CY22: 1%) in CY23. Improvement in profitability continued in 1QCY24.
Going forward, profitability metrics may depict downward movement owing to anticipated policy rate cuts coupled with strategic shift toward corporate lending which typically operate on relatively lower spreads. Moreover, the planned network expansion may also adversely impact operational efficiency. However, the Bank's focus on low-cost deposits may alleviate pressure on spread to some extent. Meanwhile, profitability indicators will remain sensitive to improvement in asset quality.
Improvement in capitalization on a timeline basis
The Bank's Capital Adequacy Ratio (CAR) increased to 18% (CY22: 15.6%) by end-Dec'23 that is comfortably above regulatory requirement. The same is attributable to uptick in Tier-1 Capital owing to enhanced profit retention coupled lower Risk-Weighted Assets (RWA) in line with lower credit risk assets. CAR remained at 18.2% at end-Mar'24. Going forward, maintenance of
4
an adequate cushion above minimum CAR requirement would remain an important rating parameter.
5
Dubai Islamic Bank Limited
Appendix I
*Annualized
VIS
VIS Credit Rating Company Limited
|
<urn:uuid:b5143303-f9a8-406c-b3bc-ccf4122a01b0>
|
CC-MAIN-2024-33
|
https://docs.vis.com.pk/RatingReports/OP_00532501025_0005325.pdf
|
2024-08-11T12:06:29+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-33/subset=warc/part-00176-4f628544-3cdf-4526-86aa-bdfa0b33cdc9.c000.gz.parquet
| 164,733,878 | 2,336 |
eng_Latn
|
eng_Latn
| 0.818713 |
eng_Latn
| 0.992091 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"unknown",
"unknown"
] | false |
rolmOCR
|
[
422,
4450,
7771,
11208,
11306,
11359,
11364,
11399
] |
Textbook Processes & Orders
Bookstore / Financial Aid / Finance
Information for Faculty
Textbook Affordability Committee
BLUE RIDGE COMMUNITY AND TECHNICAL COLLEGE
# TABLE OF CONTENTS
## FOR FACULTY:
**Administrative Procedure for Bookstores and Textbooks** ................................................................. 2
West Virginia Code §§18B-1B-4; 18B-10-14 133, Procedural Rule, West Virginia Higher Education Policy Commission, Series 51, Bookstores and Textbooks; Public Law 110-315, Higher Education Opportunity Act, August 2008
Section 1. Purpose ........................................................................................................................................... 2
Section 2. Scope and Applicability .................................................................................................................. 2
Section 3. Procedure ....................................................................................................................................... 2
Section 4. Background or Exclusions ............................................................................................................. 3
Section 5. General Provisions ......................................................................................................................... 5
Section 6. Responsibilities and Procedures .................................................................................................... 7
Section 7. Review ............................................................................................................................................. 8
Appendix A – Series 51 New Textbook Selection Form .............................................................................. 9
Additional Materials Selection with Book List Form .................................................................................. 10
Textbook Selection/Adoption Timelines ....................................................................................................... 11
## FOR STUDENTS:
Finance & Financial Aid – Bookstore Ordering ......................................................................................... 12
Textbook Online Selection and Purchase – Student BRIDGE Account .................................................. 13
Textbook Online Selection and Purchase – Blue Ridge CTC Website .................................................... 17
REFERENCES: West Virginia Code §§18B-1B-4; 18B-10-14
133, Procedural Rule, West Virginia Higher Education Policy Commission,
Series 51, Bookstores and Textbooks
Public Law 110-315, Higher Education Opportunity Act, August 2008
SECTION 1. PURPOSE
1.1 The purpose of this document is to establish and communicate the administrative procedure of Blue Ridge Community and Technical College regarding the selection, adoption, use and sale of textbooks and other course materials for all credit-based College courses and programs in compliance with state and federal requirements.
SECTION 2. SCOPE AND APPLICABILITY
2.1 This procedure applies to the selection, adoption, use of textbooks and other course materials by faculty in all academic units, departments, programs and/or courses, and addresses the sale of the adopted textbooks and materials by bookstores operated and/or contracted by Blue Ridge Community and Technical College.
2.2 Institutional procedures established in respect to the selection, adoption and use of textbooks and other course materials for all academic credit-based courses offered by the College are defined and outlined in the College’s Bookstores and Textbooks manuscript approved by the President’s executive staff. Sections of the Bookstores and Textbooks manuscript are referenced where appropriate in this document to illustrate the mechanisms established by the College in compliance with the mandates referenced above.
SECTION 3. PROCEDURE
3.1 It is the procedure of Blue Ridge Community and Technical College to comply with the mandates of Series 51 of the Rules and Administrative procedures of the West Virginia Council for Community and Technical College Education (Council) and the requirements of the Higher Education Opportunity Act (HEOA) regarding the selection, adoption, use and sale of textbooks and other course materials as well as the regulations pertaining to the operation of bookstores.
3.2 Employees of the College will comply with the above cited mandates and the institutional procedures established in respect to the selection, adoption and use of textbooks and other course materials for all academic credit-based courses offered by the College at all campuses, instructional sites and course locations.
3.3 Employees of the College, or those employed by contractors for purposes of operating College bookstores, shall comply with the above cited mandates and the institutional procedures established in respect to the sale of textbooks and other course materials.
SECTION 4. BACKGROUND OR EXCLUSIONS
4.1 Series 51 requires the Board of Governors to promulgate a rule that fully and adequately addresses the mandates in West Virginia Code §18B-10-14 regarding the actions of employees of the institution in the selection and adoption of textbooks and course materials (See Bookstores and Textbooks, Section 2). These mandates include:
4.1.1 Faculty must commit, to the maximum percent practicable, to a selection procedure that will ensure certain basic textbooks will be utilized for a reasonable number of consecutive years without new editions being adopted unless earlier editions are not easily utilized in the courses (See Bookstores and Textbooks, Appendix A).
4.1.2 Faculty or any employee are prohibited from receiving any payment, loan, subscription, advance, deposit, or money, service, benefit or thing of value, present or promised, as an inducement for requiring students to purchase a specific textbook or supplemental course material.
4.1.3 Faculty or any employee may receive royalties or other compensation from such sales that include the faculty member or other employee's own writing or work.
4.1.4 Faculty or any employee may receive free sample copies, instructor’s copies, and instructional materials for review, but shall not resell those items and retain the proceeds.
4.1.5 Faculty or any other employee are prohibited from requiring for any course a textbook that includes his or her own writing or workbook if the textbook or workbook incorporates either detachable worksheets or workbook-style pages
4.2 In addition, Series 51 requires the institutional rule to address the mandates of West Virginia Code §18B-10-14 related to the actions of employees and bookstores operated or contracted by the College regarding the sale of textbooks and course materials (See Bookstores and Textbooks, Sections 4 and 5). These mandates require that the institution:
4.2.1 Provide specific mechanisms to minimize the costs to students for textbooks and course materials.
4.2.2 Commit to, the maximum percent practicable, the number of used books the bookstore will repurchase from students at the end of each semester.
4.2.3 Commit to, the maximum percent practicable, a range of percentage of repurchase prices based on the new textbook price.
4.3 Series 51 also requires that institutional procedure comply with the mandates of Public Law 110-315, the Higher Education Opportunity Act enacted on August 14, 2008 in the selection, adoption, and use of textbooks and course materials (See Bookstores and Textbooks, Appendix A, located on the N drive/Forms/Registrar/Bookorders). This law requires that:
4.3.1 Prior to considering a specific textbook for selection, adoption, and/or use, faculty may require that textbook publishers provide, in writing:
18.104.22.168 The price of the textbook and/or supplemental course materials to be considered;
22.214.171.124 The copyright dates of the three previous editions, if any;
126.96.36.199 A description of substantial content revisions from previous editions;
188.8.131.52 Whether the textbook is available in other lower cost formats and, if so, the price to the institution and the general public;
184.108.40.206 The price of textbooks unbundled from supplemental materials; and
220.127.116.11 The same information, to the extent practicable, for custom textbooks.
4.3.2 No employee shall select or assign a textbook or supplemental course material if the publisher has not supplied the required information in Section 5.3.1, if requested, in writing.
SECTION 5. GENERAL PROVISIONS
5.1 Institutional procedures for the selection, adoption and use of textbooks and/or supplemental course materials shall be developed through an inclusive process under the direction of the President’s designee (See Bookstores and Textbooks, Sections 1 and 2). Such procedures shall include the following:
5.1.1 Firm deadlines for faculty to be assigned to courses;
5.1.2 Firm deadlines for the selection, adoption and placement of orders with the College bookstore for textbooks and supplemental course materials to be used in each course;
5.1.3 For deadlines not met, to the maximum extent practicable, there shall be a mechanism in place reasonably calculated to ensure that used textbooks, if available, can be located and purchased by the time of enrollment each semester. This mechanism should include, but is not limited to, such measures as default selection of certain textbooks, continuing to use the previous textbook, or having the Department Chair or Division Dean select the textbook. Any such textbook default selection must be strictly enforced and faculty not be allowed to change the selection.
5.1.4 Guidelines to be used by faculty in the selection, adoption and use of textbooks and supplementary course materials include the following:
18.104.22.168 Faculty must consider more than one textbook publisher;
22.214.171.124 Faculty must compare prices for textbooks and supplemental course materials in their consideration for selection and adoption;
126.96.36.199 A simple form stating that the required information as stated in section 5.3.1 was or was not provided by the publisher must be submitted to the Division Dean in support of the adoption of any textbook or supplemental course material (See Bookstores and Textbooks, Appendix A); and,
188.8.131.52 Procedures for textbook selection and adoption must include a requirement that a textbook be used for a minimum of three academic years before any change is considered, to the extent practicable.
184.108.40.206 Textbooks and supplemental course materials from publishers who refuse to submit the required, written information by established deadlines shall not be considered for future selection, adoption, and/or use for a minimum of three academic years from the date of such failure.
220.127.116.11 Discourage the selection and adoption of textbooks in which less than 50 percent of the content will be used in the course unless the same textbook will be used in subsequent courses;
18.104.22.168 Encourage the use of textbooks that have low cost alternative editions available;
22.214.171.124 Encourage the selection of textbooks it is believed will not be revised by the publisher within the next 3 years;
126.96.36.199 Encourage the use of consortia which make available open source textbooks or course materials to faculty and students free or at low cost; and,
188.8.131.52 Encourage the use of various technology innovations for the provision of textbooks and course materials such as electronic textbooks, on-line textbooks, print-on-demand services, open source materials, and institutionally produced materials.
5.2 Institutional procedures for sharing of information with currently admitted and potential students regarding all required and/or recommended textbooks and supplemental course
materials shall be developed through an inclusive process under the direction of the President’s designee. Such procedures shall include the following:
5.2.1 Information on all required or recommended textbooks and supplemental materials shall be prominently posted in a central location on each campus, in every campus bookstore, and on the institution’s website prior to the designated registration period for each semester.
5.2.2 The information provided shall include the International Standard Book Number (ISBN) and retail price.
5.2.3 If the ISBN is not available, then the author, title, publisher and copyright date shall be provided.
5.2.4 If the required information cited in 5.2.2 and 5.2.3 to be disclosed is not available, then the designation “To be Determined” shall be used.
5.3 The College shall include a link on its institutional website for any provisions for rental of textbooks, purchase of used textbooks, textbook repurchase or buyback and any alternative content delivery programs available.
SECTION 6. RESPONSIBILITIES AND PROCEDURES
6.1 A designee of the President, through a collaborative and inclusive process, shall be responsible for developing procedures and assigning responsibilities for the implementation of all sections of this document applicable to faculty and other employees.
6.2 In addition to the requirements set forth in previous sections of this document, the President’s designee shall:
6.2.1 Include training for all faculty, at the time of hire and periodically thereafter, on textbook selection and strategies that guarantee high quality course materials at the most affordable cost;
6.2.2 Establish designees to serve as liaisons with textbook publishers and to be responsible for dissemination of relevant information to their respective division
faculty on textbook strategies and education and training opportunities regarding textbook selection; and,
6.2.3 Enforce the policies of the Board of Governors concerning textbook selection, adoption, and use.
6.3 In addition to the requirements set forth in previous sections of this document, a designee of the President shall:
6.3.1 Develop procedures and assign responsibilities for the implementation of the sections of this document applicable to the bookstore;
6.3.2 Direct an examination of the feasibility of operating a textbook rental program;
6.3.3 Establish a permanent Textbook Affordability Committee consisting of a representative from the faculty, students, administration and bookstore. The Textbook Affordability Committee shall:
184.108.40.206 Meet periodically, but at least annually;
220.127.116.11 Advise the Faculty Council, Student Government Association, Administration, and Board of Governors on affordability issues and initiatives, textbook selection guidelines and procedures, and educational opportunities;
18.104.22.168 Meet annually with the Board of Governors to make recommendations and provide reports it may have generated with copies to be forwarded to the Chancellor.
SECTION 7. REVIEW
7.1 This document shall be reviewed on a regular basis to comply with any future federal mandates with a time frame for review to be determined by the President or the President’s designee.
New Textbook Selection Provisions
Pursuant to Title 135 Procedural Rule for West Virginia Community and Technical College Education Series 51 Bookstores and Textbooks, all new textbook selections (including new editions of the same textbook) must be accompanied by this form, indicating whether or not the following information required of the textbook publisher, if requested, was provided in writing:
| ITEM | REQUESTED? | RECEIVED | NOT RECEIVED |
|----------------------------------------------------------------------|------------|----------|--------------|
| The price of the textbook and supplemental course materials | | | |
| The copyright dates of the three previous editions, if any | | | |
| A description of substantial content revisions from the previous | | | |
| additions | | | |
| Whether the book is available in lower cost formats and, if so, | | | |
| the price to the institution and the general public | | | |
| The price of textbooks unbundled from separate material | | | |
| The same information, to the extent practicable, for custom | | | |
| textbooks | | | |
Faculty Name _______________________________________________________
Course ___________________________________________________________
Textbook Information:
Title ____________________________________________________________
Author(s) _________________________________________________________
ISBN-10 _________________________________________________________
Edition __________________________________________________________
Publisher _________________________________________________________
Faculty Signature ________________________________________________ Date ______
Vice President / Designee Signature _________________________________ Date ______
Please keep the following timelines in mind to submit textbook selections/adoptions to the Bookstore.
For summer semesters.............in March (exact date to be determined) prior to the start of the summer semester
- Schedule given to Bookstore for textbook orders February prior to summer semester
For fall semesters.........................in April (exact date to be determined) prior to the start of the fall semester
- Schedule given to Bookstore for textbook orders February prior to fall semester
For spring semesters.......................in October (exact date to be determined) prior to the start of the spring semester
- Schedule given to Bookstore for textbook orders September prior to spring semester
Financial Aid may be used by students to purchase textbooks if the amount of financial aid exceeds or is greater than the amount of tuition and fees they owe the college.
Currently, students have a limit of $1,250.00 for book and electronic purchases when using financial aid credits.
Only one electronic purchase per student is allowed using student financial aid credits.
If a student’s textbooks or items, and no more than one electronic, exceed $1,250.00, a student may make a request to increase the limit, to the Finance Office. The Finance Office will check prior purchases and financial aid availability before approving an increase in the spending limit. Please allow up to 24 hours for this limit to be increased.
The Finance Division receives updated information daily from Financial Aid on available credit for each student for textbook purchases through Financial Aid. The Finance Division uploads this information once daily to the Blue Ridge CTC Bookstore for available credit. Due to timing issues between Financial Aid, Finance, and the Blue Ridge CTC Bookstore, it could take up to 24 hours for this information to be processed.
For dates in which textbooks can be purchased and returned each semester, please refer to the Blue Ridge CTC Bookstore:
- HQ (Headquarters) Bookstore at (304) 260-4380, extension 2270; and
- Tech (Technology) Center Bookstore at (304) 260-4380, extensions 2272 and 2273.
I. Once logged in to your Student Bridge account, click on the “Student Services” tab.
2. **Click on the “Registration” tab.**
3. **Click on the “Shop Textbook Options” link.**
4. THE DROPDOWN BOX WILL LIST THE CURRENT AND FUTURE TERMS FOR WHICH YOU ARE REGISTERED.
5. SELECT THE APPROPRIATE TERM FROM THE DROPDOWN BOX AND CLICK ON THE “SUBMIT” BUTTON.
6. YOU WILL BE DIRECTED TO “PURCHASE BOOKS” BY CLICKING ON THE “GO TO BLUE RIDGE BOOKSTORE” LINK.
7. **Textbooks and course materials based on your registration and courses will appear on the next screen.**
1. Click on the “Current Students” tab.
2. Click on the “Bookstore” tab on the left hand side of the webpage.
3. Click on the “Shop Online” link in the center of the webpage.
4. Click on the “Books” link and then the “Textbooks & Course Materials” link.
5. Select various options, including “Program” and “Term” under the “Shop by Course” category, to select your textbooks based on your course schedule.
6. **OTHER OPTIONS INCLUDING “DEPARTMENT,” “COURSE,” AND “SECTION” WILL APPEAR TO SELECT YOUR APPROPRIATE TEXTBOOKS.**
|
<urn:uuid:583ed539-8bc5-45b1-be86-a3fc81548ae2>
|
CC-MAIN-2019-43
|
http://www.blueridgectc.edu/wp-content/uploads/2018/10/Textbook-Processes-UPDATE-July-2018.pdf
|
2019-10-23T16:29:16Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570987834649.58/warc/CC-MAIN-20191023150047-20191023173547-00050.warc.gz
| 230,626,007 | 3,845 |
eng_Latn
|
eng_Latn
| 0.807443 |
eng_Latn
| 0.982592 |
[
"por_Latn",
"por_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
166,
2441,
4385,
6542,
8237,
10000,
11774,
13585,
14991,
17282,
18004,
19429,
19517,
19609,
19886,
19996,
20037,
20174,
20406,
20526
] |
Month
PERCUSSION SCHEDULE 18-19
Date
Event
Dec
Day
t
Start
5:45 PM
End
9:00 PM
| | th | 6 | Rehearsal | 5:45 PM | 9:00 PM |
|---|---|---|---|---|---|
| | s | 8 | Rehearsal (Music only) | 8:45 AM | 12:15 PM |
| | t | 11 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 13 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 15 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 18 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 20 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 22 | Rehearsal | 8:45 AM | 12:15 PM |
| | th | 27 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 29 | Rehearsal | 8:45 AM | 12:15 PM |
| Jan | t | 1 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 3 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 5 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 8 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 10 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 12 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 15 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 17 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 19 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 22 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 24 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 26 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 29 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 31 | Rehearsal | 5:45 PM | 9:00 PM |
| Feb | s | 2 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 5 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 7 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 9 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 12 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 14 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 16 | Rehearsal | 8:45 AM | 12:15 PM |
| | t | 19 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 21 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 23 | Dartmouth Show | 8:00 AM | 11:30 PM |
| | t | 26 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 28 | Rehearsal | 5:45 PM | 9:00 PM |
| Mar | s | 2 | Rehearsal | 8:45 AM | 12:15 PM |
| | su | 3 | Weymouth Show | 8:00 AM | 11:30 PM |
| | t | 5 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 7 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 9 | Rehearsal | 8:45 AM | 12:15 PM |
4 Rehearsal
PERCUSSION SCHEDULE 18-19
| | th | 14 | Rehearsal | 5:45 PM | 9:00 PM |
|---|---|---|---|---|---|
| | s | 16 | Rehearsal | 8:45 AM | 12:15 PM |
| | su | 17 | Somerset Show | 8:00 AM | 11:30 PM |
| | t | 19 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 21 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 23 | Triton Show | 8:00 AM | 10:00 PM |
| | t | 26 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 28 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 30 | Rehearsal | 8:45 AM | 12:15 PM |
| | s | 30 | Guard Finals | 10:00 AM | 9:00 PM |
| Apr | t | 2 | Rehearsal | 5:45 PM | 9:00 PM |
| | th | 4 | Rehearsal | 5:45 PM | 9:00 PM |
| | s | 6 | Percussion Finals | 8:00 AM | 11:30 PM |
|
<urn:uuid:ff775115-1089-49c3-8c0e-28aff467daeb>
|
CC-MAIN-2018-51
|
http://www.tritonarts.net/uploads/5/1/3/5/5135989/percussion_schedule_2018-19.pdf
|
2018-12-11T13:14:44Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823621.10/warc/CC-MAIN-20181211125831-20181211151331-00052.warc.gz
| 491,291,723 | 1,443 |
eng_Latn
|
eng_Latn
| 0.617779 |
eng_Latn
| 0.459471 |
[
"eng_Latn",
"unknown"
] | false |
rolmOCR
|
[
2060,
2740
] |
MICHAEL BOND, ESQ.
111 J
OHN
S
TREET
, S
UITE
800, N
EW
Y
ORK
, N
EW
Y
ORK
10038
Tel: 646-378-4400 | Fax: 646-390-6763 | Email: [email protected] | Web: michaelbondlaw.com
Choosing a Guardian for Your Minor Children
by Michael Bond, Esq.
or many parents, choosing who will raise their minor children if both parents die is not only disturbing to think about, but is often the most difficult decision they have to make when planning their estate. However, it is also one of the most important. Failing to make and document the decision can lead to outcomes the parents never would have wanted for their children. F
This article first discusses the factors you should consider when making the guardianship decision, and then outlines how a well-considered estate plan can help ensure that your children are raised by the people you want to raise them, that their needs while still minors are provided for, and that your assets pass to your children in a responsible way once they reach adulthood.
Considerations When Naming a Guardian
hen a parent dies and leaves behind a minor child, the surviving parent usually automatically becomes the child's guardian (although there are special considerations for same-sex and unmarried couples, discussed below). The issue of guardianship primarily arises when both parents die or become incapacitated. Admittedly, it is a difficult thing to contemplate, but it can happen, and if it does happen what can be more important than making sure your children are raised well and loved by someone you trust to provide for them? W
Some of the questions you should ask yourself when choosing a guardian are:
1. Whose parenting style and values most closely match your own? The importance of this consideration will vary from parent to parent, but it is important to decide to what extent a prospective guardian should share your values, including religious beliefs.
2. Who is most able to take on the responsibility of a caring for a child — emotionally, financially, physically, etc.? Oftentimes, parents of a minor child assume one set of the child's grandparents will be ready, willing, and able to assume the role of guardian. However, it is important to discuss these factors in advance with the prospective guardians—whoever they are—to make sure raising a child is a responsibility they want to take on, and one they can handle. Additionally, will you be able to provide enough assets for the guardians to raise your child? If not, do the prospective guardians have the means to do so on their own? Are they mature enough to raise a child? Do they have the physical stamina you know from experience is important to safely raising a healthy and happy child?
3. Does the child feel comfortable with the prospective guardian already? Would your child need to move far away? These considerations go hand in hand because losing both parents is
already a traumatic event for a child. Further trauma can be minimized if the child's new guardian is someone the child is already comfortable around, and if the child won't have to change schools and make new friends in a strange place.
Once you have made a choice, or narrowed down your options, you should discuss it with the prospective guardians to find out if they are interested in raising your child if you are not able to. You should be candid about your wishes for your child and the responsibilities involved, and also make it clear that you want them to be candid with you, too, and that you won't be offended if they do not want to assume the role.
Another thing to consider is alternate guardians, and under what conditions, if any, the alternate guardian would be preferred over the first guardian you designate. Obviously, the death or incapacity of the first guardian would trigger the appointment of the alternate guardian. But what if you named your parents as initial guardians and one of the parents dies or becomes incapacitated? Or, perhaps you named your sibling and his or her spouse as initial guardians. What if they divorce? Would you still want them to be coguardians? Would you want a sibling-in-law raising your child if your sibling died? You should think through these issues, and your estate planning attorney can help you do it.
How Will My Estate Plan Provide for My Minor Children?
comprehensive, well-designed estate plan will look at several factors, including who will serve as guardian upon the death of both parents, who will serve as guardian should both parents be alive but become temporarily or permanently incapacitated, A
and who will look after the deceased parents' estate so that it is available first to provide for the child's upbringing and then, upon reaching adulthood, that it passes to the child in responsible, age-appropriate way.
One thing your estate planning attorney should do is prepare a Designation of Guardian document to name a guardian in the event of your incapacity. A Will is not adequate in this instance because it only takes effect upon your death. For any circumstance short of death, the Designation of Guardian document is needed.
Next, your attorney should make sure your Will names, as an added safeguard, the surviving spouse or co-parent as guardian, with any subsequent guardians to assume the role only upon the death of both parents. If you or your attorney feel a court might take issue with your designated guardians, you can write a letter of explanation to keep with your Will that states the reasons for your choice. Because a judge must always rule in the best interests of the child—a subjective standard indeed—a letter of explanation can be helpful to the judge in reaching a decision. Such a letter can be especially important in situations where a same-sex couple coparents a child, even when one of the partners is still alive. In such situations there are also other steps you and an estate planning attorney sensitive to and knowledgeable about same-sex considerations can and should take to help ensure your relationship—and guardianship decision—are recognized and respected by a court.
Because a minor cannot inherit outright before reaching adulthood, your Will should direct that a trust be created upon your death to hold and administer your estate until your child is of suitable age to receive your estate outright. In recognition of the
expenses associated with raising a child, the trust will also direct that funds be dispersed generously to aid your child's guardian in providing for your child's well-being, education, etc. The trustee of this trust can, but need not be, the same person who serves as guardian. Some people designate a different person (or entity, such as a financial institution) to serve as trustee, because the guardian—while well-suited to raise the child—might not be the best money manager; sometimes a separate trustee is named as a kind of check on the guardian—with one person being in charge of raising the child, and the other being in charge of making sure the child is provided for financially in a fiscally responsible way. An estate planning attorney can help you think through the different options.
Once your child reaches adulthood, he or she can inherit. However, while 18 might be the age of majority, in most cases it is not the age of maturity. How your child receives his or her inheritance is your decision, but one route to consider is establishing a trust that will allow the trustee to distribute funds to your child at the trustee's discretion—for education or other reasonable, responsible purposes—from age 18 to 30, while paying out a certain percentage of the trust's principal at various set intervals, such as every two years beginning at age 22, with the entirety being paid out by age 30. You and your estate planning attorney can discuss an appropriate payout schedule depending on various factors such as your child's sense of responsibility, financial obligations, health, or other special needs. In the case of multiple children, you might wish for one child to receive trust assets on one schedule, with another child receiving assets on a different schedule.
his article has highlighted some of the basic considerations involved in a relatively straightforward situation. As mentioned above, additional measures should be taken by same-sex and unmarried couples to provide for guardianship of their children. Even for a heterosexual married couple with children, various complexities might emerge. To name a new examples: What if you don't think your family will like your choice of guardian? What if you don't like your choice's spouse? What if you have children from previous marriages? These and other circumstances can be met head on with the help of an estate planning attorney who is interested in learning about the particulars of your family and financial situation, and who knows how to create a plan for the guardianship of your children that reflects your wishes and is constructed with the mechanisms necessary to carry out those wishes. Although the unpleasant nature of the decision might make it difficult to get the process started, the peace of mind you'll have once your plan is in place will give you invaluable peace of mind. T
This article has been provided by the Law Office of Michael Bond for general educational purposes and does not constitute legal advice or create an attorney-client relationship. For more information about the contents of this article, or if you have any other estate planning questions, please contact Michael Bond at 646-378-4400 x127 or [email protected].
|
<urn:uuid:e00077d6-764b-47b1-a989-0ba7eb90a3ad>
|
CC-MAIN-2018-51
|
http://www.michaelbondlaw.com/uploads/5/0/2/0/5020691/choosing_a_guardian_for_your_minor_children_042011.pdf
|
2018-12-17T07:26:42Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376828448.76/warc/CC-MAIN-20181217065106-20181217091106-00435.warc.gz
| 434,501,532 | 1,899 |
eng_Latn
|
eng_Latn
| 0.998204 |
eng_Latn
| 0.998336 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2914,
6369,
9612
] |
TOWN OF LIMON
Regular Meeting
BOARD OF TRUSTEES
November 2, 2000
7:30 P.M.
ROLL
Town Clerk Chris Snyder called roll. Members of the Board present: Mayor Bandy, Trustees: Beattie, Hendricks, Kudlock, Lohmeier, Templeman and Younger.
STAFF
Staff present: Town Administrator Kiely, Public Works Director Stone, Attorney Kimble, Chief of Police Yowell and Town Clerk Snyder.
GUESTS
Guests present: Dale Kanack, Josette Gallegos, Gary Watkins, and Frank Lucero.
APPROVAL OF MINUTES
Trustee Hendricks made a motion to approve the minutes for the October 5, 2000 regular meeting; seconded by Trustee Kudlock. Voting Aye: Mayor Bandy, Trustees: Beattie, Hendricks, Kudlock, Lohmeier, and Younger. Abstain: Trustee Templeman. Motion carried.
TEN MINUTE CITIZEN INPUT
Trustee Kudlock introduced Gary Watkins who is the new warden at the Limon Correctional Facility.
USES FOR BUILDING LOCATED AT 590 E AVENUE
Frank Lucero, Josette Gallegos, and Dale Kanack requested the board consider allowing the East Central Education Center, an alternative school program to be located at 590 E Avenue, which is owned by the Town of Limon.
Trustee Lohmeier moved to have staff apply for a conditional use permit and prepare a contract with either BOCES or the Limon School; seconded by Trustee Templeman. Motion carried unanimously.
RESOLUTION NO. 11-00-16; SIDEWALK, CURB AND GUTTER REPLACEMENT OR REPAIR
Public Works Director Stone introduced and there was read the following proposed resolution and the entire text of said proposed resolution was submitted in writing to each member of the Board of Trustees and the Mayor:
Resolution No. 11-00-16; A Resolution Establishing a Sidewalk, Curb and Gutter Replacement or Repair Policy for the Town of Limon, Colorado.
Regular Meeting /November 3, 2000
Page 1
Trustee Templeman moved to approve Resolution No. 11-00-16; seconded by Trustee Kudlock. Motion carried unanimously.
RESOLUTION NO. 11-00-17; GRAVEL STREET UPGRADE POLICY
Public Works Director Stone introduced and there was read in full the title of the following proposed resolution and the entire text of said proposed resolution was submitted in writing to each member of the Board of Trustees and the Mayor:
Resolution No. 11-00-17; A Resolution Establishing a Gravel Street Upgrade Policy for the Town of Limon.
Trustee Younger moved to approve Resolution No. 11-00-17; seconded by Trustee Hendricks. Motion carried unanimously.
RESOLUTION NO. 11-00-18; RIGHT-OF-WAY AND EASEMENT WITH HI-PLAINS BAPTIST CHURCH
Town Administrator Kiely introduced and there was read in full the title of the following proposed resolution and the entire text of said proposed resolution was submitted in writing to each member of the Board of Trustees and the Mayor:
Resolution No. 11-00-18; A Resolution Approving an Agreement for the Grant of Right-of –Way and Easement with Hi-Plains Baptist Church and Authorizing the Execution of Said Agreement.
Trustee Kudlock moved to approve Resolution No. 11-00-18, with change; seconded by Trustee Templeman. Motion carried unanimously.
PAY REQUEST #9 FROM GMS FOR WATER TREATMENT PLANT
Trustee Kudlock moved to approve Pay Request #9 in the amount of $27,720; seconded by Trustee Hendricks. Motion carried unanimously.
ORDINANCE NO. 458; REAL ESTATE CONTRACT WITH ROBERT J. SAFRANEK AND ELLEN E. SAFRANEK
Town Attorney Kimble introduced and there was read in full the title of the following proposed ordinance and the entire text of said proposed ordinance was submitted in writing to each member of the Board of Trustees and the Mayor:
Ordinance No. 458; An Ordinance Approving A Contract to Buy and Sell Real Estate With Robert J. Safranek and Ellen E. Safranek, Authorizing the Execution of Said Contract and Authorizing the Execution of a Quit Claim Deed for Said Property.
Trustee Templeman moved to approve Ordinance No.458; seconded by Trustee Hendricks. Motion carried unanimously.
ATTORNEY'S REPORT
Attorney Kimble reported that a speeding ticket case that went to trial and was found guilty will be appealed.
Tom McClernan, GMS, will be coming out to do an inspection at the Lake Creek Dam. Linda Olsen will be present and continues to be part of the process.
Regular Meeting /November 3, 2000
Page 2
Kimble updated the board about possible litigation concerning Sexually Oriented Businesses and that the attorney chosen by CIRSA is in contact with the attorney representing Video Xpress.
ADMINISTRATION REPORTS
Public Works Director Stone and Attorney Kimble have researched how to handle the remaining items at the feedlot that have not been picked up.
The Christopher 2 Redrill permit has been approved and will be started soon.
Sewer plans for the Water Treatment Plant, 6 th Street and V Avenue have arrived and are being reviewed by staff. The bid closing is November 30 th .
The South Limon containment pond plans are done.
We have advertised in several newspapers the 1977 Dodge pick up we want to sell but did not receive any bids. After discussion, it was decided to take the pick up to Anderson Motors and try to sell it that way.
Town Administrator Kiely reported that the airport advisory board had met and discussed the noise complaints and have recommended that additional signage be posted.
The Discretionary Grant that the town applied for has been approved in the amount of $105,000, with at $35,000 match to do joint and crack sealing on the runway and apron at the airport.
Kiely has asked Rural Development to put in writing the reasons we cannot allow water taps to be installed in the flood plain.
Department of Local Affairs has asked Joe to be a managerial representative on a committee that looks at water managerial capacities.
Kiely presented a draft letter to the Transportation Commission thanking them for their efforts in fixing the S-curve at the south end of the Highway 24 Realignment Project and asked for board approval to have the mayor sign the letter. Trustee Beattie moved to authorize the mayor to sign the letter; seconded by Trustee Younger. Motion carried unanimously.
A budget hearing is scheduled for Thursday, November 16 at 5:30 p.m.
MAYORS REPORT
Mayor Bandy asked if anyone from the board is interested in running for the Council of Governments Board.
Mayor Bandy asked for volunteers to be on the staff evaluation committee with him. Trustees Lohmeier and Templeman will serve with the mayor.
TRUSTEES REPORT
Trustee Kudlock mentioned he felt the board retreat was worthwhile to attend. He also invited the board to attend the change of command ceremony at the prison for the new warden on December 7 th .
Regular Meeting /November 3, 2000
Page 3
Trustee Lohmeier also mentioned she felt the retreat was excellent and well worth the time spent attending.
Trustee Younger asked how the Chamber presentation went and that the program is good for the citizens to see.
APPROVAL OF BILLS
Trustee Younger moved to approve the bills that were submitted for the month of October; seconded by Trustee Lohmeier. Motion carried unanimously.
ADJOURNMENT
At 9:25 p.m. Trustee Templeman moved to adjourn; seconded by Trustee Kudlock. Motion carried unanimously.
TOWN CLERK____________________ MAYOR________________________
Regular Meeting /November 3, 2000
Page 4
|
<urn:uuid:ecb5dff5-7390-4630-a966-5e6c65dfde24>
|
CC-MAIN-2024-38
|
https://www.townoflimon.com/index.php/component/easyfolderlistingpro/?view=preview&format=raw&data=eNpFT9EOgjAM_Je9EzaJivVjlikFmrBBtqImxn-3uBGf2t71LncOjIF3ghOofp46jOqawLSgyLsBU710fe0prIzpxxhQa8KYfwVcItAFHlZM_Pc4g7L2h21Xm2XBedxODWobp4xSt_uIKOK0OB43-giqPmiti0FPE-4GjXA8P4O9zS521iMyhcGWpNaYSjdVVjag8MVlkzolHL4WivhvIJEcs7uPHoN838AIehFFxAfhM5eSwMExPSTD5wuZzGPh
|
2024-09-16T11:52:49+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-38/subset=warc/part-00094-781f89b0-54ef-4e32-b51d-e5860e733e3a.c000.gz.parquet
| 947,229,351 | 1,713 |
eng_Latn
|
eng_Latn
| 0.988535 |
eng_Latn
| 0.995861 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1812,
4279,
6703,
7318
] |
© The Bônau Cabbage Patch
A Miscellany of Local Newspaper Reports for Llanelly and the surrounding areas.
Spanning the period 1810 – 1819
Compiled by Peter Kent
An Intriguing and fascinating insight into the lives of our ancestors.
1810 – 1819
1810
DEATH
At Llanelly, on Sunday last, in the 39th year of his age,. Mr. Will. Maurice, Comptroller of his Majesty's Customs.
(North Wales Gazette 7 th June 1810)
NOTICE
is hereby given,
That all DEBTS due to us, as Trustees of the Estates of
Mr. ALEXANDER RABY, of Llanelly, in the County of Carmarthen,
are only to be received by Mr. STEPHEN JONES, of Swansea; and not by Mr. Alexander Raby, or Mr. Henry Wright, our late Agent at Llanelly.
Signed by:
JOHN HAMMET, - Trustee WM. THOMPSON, - Trustee London 24 th Sept. 1810
(The Carmarthen Journal and South Wales Weekly Advertiser 6 th October 1810)
PEMBREY SANDS
On Saturday last, the Union, Capt.
Roberts, with a cargo of copper ore, bound to Spitty, fell in with the American ship Francis of Philadelphia, Conner, master, laden with cotton and staves, bound from Philadelphia to Liverpool, between the island of Caldy and the Burry Holmes, and conducted her over the bar of Burry into the harbour in safety. Had she not been so fortunate as to meet the Union, she would have been inevitably lost, as she was not many hours sail from Pembrey sands, and the Captain had compleatly lost his reckoning. On Monday the 22d inst. in a tremendous gale of wind the ship Queen of London, from Quebec to Deptford, laden with timber, spars and staves, went ashore on Pembrey sands about two o'clock P. M. The owner and six men, part of her crew, perished : The protected master and five men, the remainder of the crew, were saved by remaining on board the ship. The owner and the other six men let down the boat, and had not been many minutes on board her before she overset. The owner had hold of a rope, and made three efforts to regain the ship but was at length washed off, and floated for a few minutes and
then totally disappeared. He was a very fine-looking man, upwards of six feet in height, and beloved by the whole crew. He was a widower, and left two daughters and a mother to lament his loss ; he being the only person on whom they depended for support. The Collector of the Customs, and his Officers, at Llanelly, have exerted themselves to the utmost for the preservation of the ship and cargo.
(The Carmarthen Journal and South Wales Weekly Advertiser 27 th October 1810)
BRIG 'UNION OF LONDON' LOST
The brig, "Union of London," Elisha Worrall master, from Cadiz to London, with wool, copper in bars and pigs, logwood, cochineal, indigo, capers, horse hides, and skins in mats, struck on Cefen Shidan sands and is totally lost, and all on board perished. The ship's papers have been found, and bills of exchange to the amount of £3336 have been picked up and lodged in the hands of Henry Eaton, Esq., Customs at Llanelli, and Stephen Jones Esq., Consul. These gentlemen are using every means in their power to preserve as much cargo as possible.
(The Carmarthen Journal and South Wales Weekly Advertiser 27 th October 1810)
CORPSE FOUND ON PEMBREY SANDS
A corpse was picked up on Pembrey Sands last week, supposed to have been a military officer, passenger on board the 'Union,' whose melancholy fate we mentioned in our last paper. He was a fine looking young man about 25 years of age, had a ring on his finger with two hands united engraved on it, and a silk handkerchief about his waist, but in every other respect was in a state of nudity his hair and whiskers were trimmed in the military fashion. Every respect was shown to the body, which was interred in Pembrey Churchyard with becoming decency, and the funeral was attended by I John Rees, Esq., of Kilymaenllwyd; Henry Eaton, Esq., Collector of Customs; Stephen Jones, Esq., Consul; and Lieut Henry Shewen, R. N.
(The Cambrian 2 nd November 1810)
1811
LLANELLY WORKS.
IN consequence of an arrangement about to take place between Mr. Alexander Raby, of Llanelly, in the county of Carmarthen, and his Trustees, for the Sale of Llanelly Works, Colliery, and Property—Notice is hereby given, to those who may have any Claims against the said concerns to send me in a statement of their demands, in order that the same may be investigated; and those who stand Indebted to the said concerns, are requested to pay me the same within one month from this date.
STEPHEN JONES, For the Trustees of Mr. Raby. Llanelly, May 2,1811 (The Cambrian 11 th May 1811)
CARMARTHENSHIRE,
AT a MEETING, convened by public advertisement, of PERSONS interested in the IMPROVEMENT of the HARBOUR of KIDWELLY, and making proper communications therewith from the several Collieries in the neighbourhood by a Canal or Rail-Roads, held at the Pelican-inn, Kidwelly, on Monday, the 24th of June,1811,
LORD CAWDOR, Chairman,
Messrs. Martin and Davies having produced at this Meeting a plan of a proposed Canal and TramRoad from the Great Mountain to Pwllilygoed, near Spuddersbridge, and from thence round Pembrey Mountain to the Flats at Llanelly, and of the rivers Gwendraethfawr and Gwendraeth-fach, with part of Cefnsidan Sands and Carmarthen River;
It was Bevolved,
That Lord Cawdor, Lord Dynevor, Sir Wm. Paxton, Dr. Morgan, Mr. Brogden, Mr. Rees, Mr. Thomas, Mr. Saunders, Mr. Parker, Mr. Tatlow, Mr. Raby, Mr. Pemberton, Mr. Pemberton, of Llanelly, Mr. Nevill, Mr. Child, Mr. Cox, Mr. Bowzer, Mr. Wedge,. Mr. Humphries, and Mr. Richard Williams, be appointed a Committee to take such Plan into their consideration, and report thereon at the next meeting to be held at the Pelican-inn, Kidwelly, on Tuesday, the 16th day of July next, at eleven o'clock in the forenoon, and that five of such Committee be a Quorum.
That Mr. Lewis, of Llandilo, be appointed Secretary and Solicitor.
That these Resolutions be inserted in the Cambrian and Carmarthen papers,
CAWDOR, Chairman.
That the Thanks of this Meeting be given to Lord Cawdor for his conduct in the Chair.
(The Cambrian 29 th June 1811)
ALEXANDER RABY IMPROVEMENTS
Among the various improvements introduced by Alexander Raby, Esq. of Llanelly, in the iron trade, his new wheel for rail or tramroads, proves of the first import, by a reduction of friction; a saving of near 50 per cent. in oil and additional correctness to those used in the ordinary way.
(The Carmarthen Journal and South Wales Advertiser 13 th July 1811)
MARRIED
At the parish church of Llanelly., on Friday, John David, aged 77, to Mary Thomas, aged 17, both of that place.
(North Wales Gazette 1 st August 1811)
LEGAL NOTICE
NOTICE is hereby given that
Application is intended to be made to Parliament in the next Session, for an Act for making a Navigable Canal, or a Rail-way or Tram-way, or partly a canal and partly a Rail-way or Tram-road, from or near a certain place called the Dock, at or near the town of Llanelly, in the parish of Llanelly, in the county of Carmarthen, into the parish of Kidwelly, to join a certain Canal there, now and already made, called Mrs Kymer's Canal, as or near a certain bridge called Spudder's Bridge, in the said county of Carmarthen; and for making and maintaining a Navigable Canal, or Rail-way or Tram-road, or partly a Rail-way or Tram-road, to begin at the east or upper end of Mrs Kymer's Canal, at or near a certain place called Pwll-Llygod, in the parish of Pembrey, and county of Carmarthen, and to extend into the parish of Llanarthney, in the said county of Carmarthen, to a Common called the Great Mountain, at or near a certain tenement there called Cwm-Gloe; and also for making and maintaining or powers for making and maintaining the following Collateral Branches of Canal,
Rail-ways, or
Tram-roads, to
communicate with and join such
Canal, main Rail-way and Tramroad, or Canal and Rail-way, or Tram-road; that is to say, a Branch to or from the several tenements following; that is to say, a tenement of land called Trimsarran, occupied by James Brogden, Esq., another called Coed-Evan-Ddu, occupied by John Hugh, another called Syddin, occupied by Thomas William, and another called Brynhwthan, occupied by Nary David, widow, another called Bryndyas, occupied by George Bowser, Esq. another called Llettyrhychen-fach, occupied by Robert Jenkin, and also to or from a certain Common called Craig-y-Cappel, and also a Bto or from a Common, called Pembrey Mountain, all situated in the aforesaid parish of Pembrey; and also a Branch to or from several tenements following, that is to say, a tenement called Caerway otherwise Caerwed, occupied by David Thomas, another called Gellygelynog, occupied by David James, both situated in the parish of Llangendeirne and Pembrey, in the said county of Carmarthen ; and also a Branch to of from the several tenements of land following, that is to say, a tenement
called
Hirwainole, occupied by Evan Howell, another
called Blaen-Hirwain, occupied by Thomas Jones, another called Llech-y-rodin, occupied by David Thomas, and another called Llech-y-fedach, occupied by John Edwards, all situated in the parish of Llanon, in the said county of Carmarthen ; also a Branch to or from a certain garden, adjoining a cottage called Ty Newydd, occupied by Jenkin Lewis, in the parish of Llanddarog, in the said county of Carmarthen ; and also for altering, inproving, enlarging, and repairing the said Canal, called Mrs Kymer's Canal, and all its bridges, towing-paths, drams, feeders, wastes, and appurtenances, &c., situated in the parish of St Mary, in the borough of Kidwelly, in the said county of Carmarthen; and also for making and maintaining a Branch of Canal from the same at or near the shipping-place belonging to Mrs Kymmer, in a direction towards the bridge at Kidwelly ; and also from a Branch to or from a certain limestone quarry, on a certain common called Mynydd-y-Garreg, to the said Mrs Kymmer's Canal, at or near a bridge there called Pont-MorrisCross ; and also another Branch to or from certain Tin Mills, called Kidwelly Tin Mills, to the said Mrs Kymmer's Canal, at or near the aforesaid bridge called Pont-Morris-Cross, all situated in the parish of St Mary, in the borough of Kidwelly aforesaid ; and also powers for restoring, improving, and maintaining the Harbour of Kidwelly, and for the erection of Shipping-places, Wharfs, and all Conveniences whatsoever, for the purpose of loading and unloading goods to and from the said Canal ; and also the making and maintaining several Wharfs, Shipping-places, Drains , and other Conveniences at or near the Docks at Llanelly ;and that such Canal, or Rail-way or Tram-road, or Canal and Railway or Tram-road, and such Collateral Branches of Canal, Rail-way or Tram-road, Wharfs, Shipping-places, Drains and other Conveniences are intended to be made into, or pass through, the several parishes of Llanelli, Pembrey, Kidwelly, St Mary in the borough of Kidwelly, Llangendeirne, Llanon, Llanddarog, and Llanarthney, all in the county of Carmarthen.
THOS.LEWIS, Solicitor Dated the 10 th Sept 1811
(The Cambrian 14 th September 1811)
ROYAL CHARLOTTE
On Friday last a vessel was lost on Pembrey Sands, and, melancholy to relate, the crew, consisting of three men and a boy, all perished.—A boat belonging to the unfortunate vessel was picked up the same day on the north side of Burry bar, marked on the outside, "Royal Charlotte, of Bridgewater," and on the inside "John Rees." A l,arge quantity of cheese , and a bowsprit, came on shore at the same place.
(The Cambrian 9 th November 1811)
INQUEST
On Monday last an Inquest was held by Dr. J. C. Collins on the body of Wm. Temberleak, master of the Bridgwater vessel lost about a month since on Pembrey Sands. The body had been driven by the tide up the Burry river nearly to Llandilo Taly-bont church, where it was thrown ashore, and in one of the pockets were found the ship's register, various other papers, and a small sum in money, which, to the credit of the country people, were all delivered to the Coroner.
(The Cambrian 7 th December 1811)
1812
CORONER INQUEST
Last week, a Coroners's Inquest was held at Llanelly on the body of Walter Thomas, who slipped from the chain in coming up from one of the coal-pits of Messrs. A. and A. T. Raby. Verdict— Accidental Death.
(The Carmarthen Journal and South Wales Weekly Advertisers 4 th January 1812
DIED
At Carmarthen, aged 62, loved, honoured, and deeply lamented, after a long and painful illness, which she endured with the resignation of a true and pious Christian, the Lady Dowager Mansel, relict of the late Sir Wm. Mansel, Bart., of Iscoed. She was an excellent mother, a sincere friend and a kind protector of the poor ; to whom she dispensed frequent and liberal charities, and who will long have cause to lament so irreparable a loss.
(The Cambrian 4 th January 1812)
Advertisement:
THE CELEBRATED MAGNETIC RAZOR TABLET,
patronised by his Royal Highness, the Prince of Wales, having become so high in reputation as to be considered the only invention in the world, capable of forming a most scientific and acute edge to a razor without the use of oil or grease, JOHN THOMAS RIGGE, the proprietor and Inventor, feels it is his duty to caution the Public that none are genuine but such as are signed in red ink, with his signature, and numbered, price 7s. 6d.
Sold at this Warehouse in London, 53, Park-street, Grosvenor-square, and 65, Cheapside; also by T. Jenkins, Printer of this Paper, and Morgan, Swansea; Daniel, and Harris, Carmarthen; and Griffiths, Haverfordwest.
(The Cambrian 11 th April 1812)
BIRTH.
On Saturday last, on board the Jason, at sea, Mrs. Andrews, wife of Capt. Andrews, of Kidwelly, of a daughter.
(The Carmarthen Journal and South Wales Weekly Advertiser 11 th April 1812)
FALCON-INN, LLANELLY, Sept, 1. 1812
AT a MEETING of the GENTLEMEN interested in the Trade of the Port of LLANELLY and the Rivers BURRY and LLOUGHOR, held this day pursuant to public advertisement,
Resolved,
That Mr. Richard Rees be appointed Solicitor for the purpose of giving the necessary Notices previous to an application to Parliament for leave to bring in a Bill for improving the above Navigation.
That the Notice now read be approved of,
That this Meeting stand adjourned to Thursday, the 1st day of October next, at the Falcon-Inn, at twelve o'clock in the forenoon, for the purpose of reading over and discussing the clauses of the intended Bill. That these Resolutions be inserted in the Cambrian Paper and Carmarthen Journal.
RICHARD REES, Solicitor
(The Carmarthen Journal and South Wales Weekly Advertiser 12 th September 1812)
Advertisement:
TO BE SOLD
A TREVETHIC STEAM ENGINE, about five horsepower ; has been used to wind coal and pump water ; but being found to be of inadequate power, will be sold reasonable, and put on board a vessel free of expense.
For inspection and particulars apply on the premises.
Llangennech-Park, Jan. 31, 1812.
(The Cambrian 8 th February 1812)
Kidwelly District Turnpike Trust
NOTICE is hereby given, That a TOLL BAR or CHAIN, is intended to be SET UP, at or near a Field called Caeffynnon; and also another, at or near a place called Brinmaen and Croseheol, upon the Turnpike Road, in the parish of Llanon, in the said district.
By Order of the Trustees Carmarthen, March 28, 1812 JOHN STACEY, Clerk
(Carmarthen Journal and South Wales Weekly Advertiser 11 th April 1812)
1813
Advertisement:
LOST GELDING
LOST, from Llanelly, a BAY GELDING, about 14 hands high, with black legs, and hogged mane. Whoever will bring him to Mr A Raby, Llanelly, shall be handsomely rewarded for their trouble.
(The Cambrian 25 th September 1813)
CARMARTHENSHIRE.
To the Proprietors of Lands in the vicinity of Llanelly, and to the Burgesses of the Borough of Llanelly.
WHEREAS it is intended to apply to Parliament in order to obtain an Act for the Making a Canal from the Copper House Dock, in the parish of Llanelly, to Gwilly Bridge, in the parish of Llangennech, in the county of Carmarthen ; and as few of you, whose interests are so deeply involved in this measure, have been consulted upon it; and as by the estimate of its expanse, and by the Book of Reference, there appear to be no collateral branches provided for, save those calculated for the benefit a few individuals, it is, therefore requested, that the persons to whom this is addressed, will meet at the Falcon-Inn, in the town of Llanelly, on Thursday, the 4th of November, 1813, at the hour of eleven in the forenoon of the same day, to take into consideration the propriety of opposing the measure under its present form.
(The Cambrian 30 th October 1813)
Advertisement:
UNION-INN, LLANELLY MARY BALL
Respectfully informs her Friends and the Public, that she has fitted up the above Inn replete with every comfort and accommodation, and hopes by attention to merit their favours. Gentlemen Travellers are respectfully informed that, in addition to the comfort of the house, there is good Stabling, Hay, Corn &c.
(The Cambrian 2 nd January 1813)
FAMILY NOTICES
DIED - On Saturday, aged 60, Charles Nevill, Esq. of Llanelly', formerly of Swansea.
(North Wales Gazette 2 nd December 1813)
1814
DIED
At Pen-y-fai, near Llanelly, Miss Mary Davies, formerly of Goodig, aged 70 years, much lamented by all who had the pleasure of her acquaintance.
(The Cambrian 28 th May 1814)
SLOOP LOST
Last week the sloop, Friends Good Will, of Laugharne, Edward Hancock, Master, on her passage from Kidwelly to that place, laden with coals, sunk off St. Ishmael's church the master and a man in his employ escaped in a small boat belonging to the sloop.
(North Wales Gazette 4 th August 1814)
INQUEST
Yesterday morning an inquest was held at Portinon, Glamorganshire, by Dr J. C. Collins, on the body of Thomas Cox, a labouring man, who, while on his passage from Appledore to the above place, with three others, on their way to Kidwelly, where they were engaged to work on the new canal, be- came sea-sick, and lying down on the deck, was supposed to have fallen asleep, but was
found lifeless. -verdict, Died by the visitation of God (The Cambrian 27 th August 1814)
KIDWELLY HARBOUR
The long-projected improvement of Kidwelly Harbour and its vicinity being now begun, under the able auspices of Messrs. Bower and Pinkertons, has attracted the attention of a great influx of fashionables during the last few weeks, among-whom we have noticed the arrival of The Right Hon. Earl of Ashburnham, Lords Dynevor, Cawdor, and St. Asaph, Sir Wm. Paxton, Cols. Colby, Mansel, and Brigstocke, Major Bevan, Mr. Brogden, M. P, Messrs. Gwynne, Morris, Lewis, Tatlow, Wedge, Williams, Hopkins, Davies, Gilbert, Murphy, Chapman, Tippin, Bishop, Allen, and the Misses Bowers, who have expressed much delight with the spirit in which it is carried 0n.
We should not omit mentioning that Messrs. Hopkins, Engineers, of Swansea, have recovered a considerable quantity of copper which had been sunk in the sands in Carmarthen Bay, and considered as irretrievably lost.
(The Cambrian 17 th September 1814)
Advertisement:
Valuable Colliery in South Wales,
By HUGHES and
OUTHWAITE,
At the Auction Mart.
HUGHES and OUTHWAITE respectfully inform the Public they will in a short time put up to Public Auction, extensive and productive COAL MINES, in Carmarthenshire, containing in an extent of nearly 50 Acres, a continuation of strata of Pit and Culm Coal of the most marketable qualities.
Printed particulars in a few days. 23, St Paul's Church-yard, London.
(The Cambrian 9 th April 1814)
UNIVERSAL PEACE.
The close of 1814, and a more eventful year the annals of the world scarcely record, has been marked, by the conclusion of a Treaty of Peace between-England and America, and the last firebrand of desolating War is at length extinguished. Let us hope that the period of tranquil repose may be very long protracted and that the wounds inflicted by the late extended, chequered, but finally successful contest, may be speedily healed. We may now confidently look forward to a diminution of our most oppressive burthens— to the enlargement of our spheres of commercial rivalry --and finally, we trust, to the consolidation of our national greatness, by a steady adherence to those principles of moral action which have rescued Europe from degrading subjugation, and rendered this country an object of gratitude and admiration, as well as a memorable example; to the other kingdoms of the world.
(The Cambrian 31 st December 1814)
Advertisement:
This day published, price £1 11s. 6d.
The PRACTICE of the COURT of GREAT SESSIONS on the CARMARTHENSHIRE CIRCUIT;
Also, the MODE of LEVYING a FINE, and , and a SUFFERING a RECOVERY, with the Precedents of Practical Forms &c.
By W.R.OLDNALL Esq. Of Lincoln's Inn, Barrister at Law.
Sold only by J. Daniel, Bookseller and Stationer, in Lower Market-street, Carmarthen.
1815
Advertisment
TO BE SOLD BY AUCTION, BY ORDER OF THE HIGH COURT OF ADMIRALTY,
On TUESDAY, the 11th day of APRIL, 1815, between the hours of one and three of the clock in the afternoon, at the Dwelling-house of JOHN HARRIS, known by the sign of the BLUE ANCHOR, in the Borough of LLOUGHOR, in the County of GLAMORGAN,
THE BRIGANTINE SALLY, of LLANELLY,
Burthen per Register 77 Tons, or thereabout.
As she now lies near the Glass-house, at Lloughor in the River Burry, within the Port of Swansea.
For particulars apply to Mr. GEORGE LLEWHELLING, Shipbuilder, Swansea.
(Seren Gomer March 22, 1815)
CARMARTHENSHIRE.
TO BE SOLD BY AUCTION
At the Ivy-Bush-inn, in the town of Carmarthen, on Saturday; the 30th. of September instant, between the hours of three and five o'clock in the afternoon, subject to such conditions of Sale as shall be then produced unless disposed of in the mean time by Private Contract, of which timely notice will be given,
ALL that capital LEASEHOLD ESTATE, consisting of a Mansion-house, Farm-house, Lands, and Premises, called PEN LAN, situate in the parish of, Saint Mary, in the borough of Kidwelly, in the said county, held for three lives, all insured, containing 320 Acres Of good Arable, Water Meadow, and Pasture Land, with an unlimited Right of Common over 1200 Acres of Down and Salt Marsh.
The House, at a small expense, would accommodate a large family, and is most delightfully situated, commanding a fine view of the Bristol Channel, Carmarthen Bay, and the seaport, market, and post town of Kidwelly, with the, extensive ruins of its ancient castle, from which it is distant half a mile.
A gentleman fond of agriculture and the sports of the field would find this Estate a most desirable residence.
The country abounds with game, and a trout-stream runs near it; lime and coals are very plentiful and cheap, and within two miles; fish moderate and capital sands for bathing; nine miles from Carmarthen, 20 from Swansea, and the same distance from Tenby.
Apply, by letter, post-paid, to Thomas Brookman, Esq. Penlanhouse, near Kidwelly; to R. L. Appleyard, Esq. Lincolns-inn, London; Messrs Gwynne and Howell, Solicitors, Carmarthen; or to J. Beynon, Solicitor, Newcastle Emlyn, Carmarthenshire.
N B. lf the Lease will not be sold, the Farm will be let the same day.
(The Cambrian 23 rd September 1815)
WRECK
Last week the schooner Dora, Patrick Donoghue, master, from Roscarberry, in Ireland, bound to Cardiff, in ballast, was totally wrecked on Pembrey Sands. Crew and passengers fortunately saved in the boat; which had not quitted the vessel ten minutes before she sank.
(The Cambrian 25 th November 1815)
Advertisement:
THE GENERAL PICTON NEW POST-COACH,
Carrying Four Insides, will also leave SWANSEA on the 11th of April., and continue to run every Tuesday, Thursday and Saturday, at eight o'clock in the morning, through Llanelly and Kidwelly to Carmarthen, conveying all Passengers and Parcels that arrive by Bristol Coach on the preceding evenings; and will return from Carmarthen the following days (Monday, Wednesday and Friday). – Passengers will be booked from Carmarthen, Kidwelly, and Llanelly, to Bristol, by the Cambrian Coach on the following mornings at four o'clock.
(The Cambrian 8 th April 1815)
1816
Advertisement:
A MEETING of the TRUSTEES for the borough of LLANELLY, in the county of Carmarthen, appointed by an Act made in the 47th year of the reign of King George the Third, will be held at the house of Mr. Joseph Williams, called the Falconinn, in the town of Llanelly, in the said borough, on Tuesday, the 20th day of this month, at twelve o'clock in the forenoon.
Dated 6th August, 1816. (The Cambrian August 10 th 1816)
DIED.
At Llanelly, on Monday the 28th inst. after a lingering illness of one year and eight months, Mrs Williams, wife of the Rev. Howell Williams, Dissenting Minister at that place, in the 29 th year of her age, daughter of Me Evan Evans, ironmonger.
On Tuesday the 29th inst. at Penyfan, near Llanelly, Mrs. Griffiths, relict, of the late Evan Griffiths, Esq. of the same place, in the 83d year of her age, much regretted by her relatives and friends.
(The Cambrian 2 th November 1816)
SHIPWRECKS
We have, since our last publication, experienced two nights of must tempestuous weather. While thousands, or perhaps, tens of thousands were enjoying the pleasures of Christmas festivity, many of our mariners were struggling with death. We understand that two, if not three vessels, have been this week lost on the Pembrey sands, Carmarthenshire; one a Bristol West-Indiaman; another, a ship from St. Ives to Newport; a third at present unknown. It has been reported to us, that one boy alone has been saved from the three but we hope this will prove an exaggeration.
(The Cambrian 28 th December 1816)
Advertisement:
To Small Farmer or Others in Wales WANTED, for a middle-aged Man, BOARD and LODGING, in a plain family. – Address letters post paid, Mr Morris, No 106, Wood-street, Cheapside, London.
1817
HARVEST
The barley harvest has commenced in the neighbourhood of Llanelly, and if the present fine weather continues, will become general very shortly. Abundance and reduced prices are every where anticipated.
(The Cambrian 9 th August 1817)
THE MAGISTRATES COURT
On Thursday last, J. E. Saunders and D. Parry, Esqs. and Morgan Jones, Clerk, Magistrates for the county of Carmarthen, held their monthly meeting at the Falconinn, Llanelly, when three boys were brought before them for robbing the orchard and garden of Henry Eaton, Esq. Collector of the Customs at Llanelly, two of whom were publicly whipped through the town, and the other (a native of Cardiganshire) was committed to the House of Correction for a short period, and to be forwarded from thence to his parish. One of the constables was committed for passing too quickly with the boys through the streets, but was afterwards released, being his first offence.
(The Cambrian 16 th August 1817)
SLOOP 'WILLIAM AND MARY'
The sloop William and Mary of Swansea, William Howell, master, bound from Llanelly to Carmarthen with coals, was on Tuesday evening wrecked on Laugharne sands, when one of the men belonging to her, and a passenger, were unfortunately drowned. The master, with great difficulty escaped, by clinging to the mast until assistance was afforded him.
(The Cambrian 23 rd August 1817)
STAG'S HORN
About three weeks ago as some workmen were employed in deepening the river Daven in Llanelli Great March, they found a stag's horn thirteen feet below the surface, supposed to have lain there ever since the general deluge : it is in a high state of preservation.
(The Cambrian 27 th December 1817)
1818
THE LATE GALES.
Since the violent storm of Wednesday se'nnight, the wind has become much more moderate, although some severe gales have blown at intervals. The tempest of the 4th appears to have felt throughout the whole island and considerable damage has every where been done. From almost every part of South Wales we have received accounts of the destructive effects of the hurricane, and scarcely a single place has been exempted from more or less injury. It has, however been wholly confined, as far as we can collect, to the total or partial destruction of roofs of houses and other buildings, chimnies, thatched ricks, the glass of hot and greenhouses, &c.
(The Cambrian 14 th March 1818)
BOROUGH OF LLANELLY.
IN pursuance of an Act of Parliament, made in the 47th year of his present Majesty, entitled "An Act for Inclosing Lands in
Llanelly, in the county of Carmarthen, and for Leasing part of the said Lands, and applying the Rents thereof in improving the Town and Port of Llanelly, in the said county;— Notice is hereby given, that a MEETING of the TRUSTEES for the BURGESSES of the BOROUGH of LLANELLY will be held at the Falcon-inn, in the town of Llanelly, on Friday, the 2d day of October, 1818, at eleven o'clock in the forenoon, when they will proceed to Let by AUCTION, in several lots, the LA NDS belonging to the said Trustees, for a term such as shall be then and there produced.
(The Cambrian 19 th September 1818)
NOTICE
Whereas a Quantity of PIGS' HAIR. Brought from Ireland by the Hebe, Capt. Garder, has been lying in the Warehouse of Messrs. Grove, in Swansea, for a long time past :Notice is therefore hereby given, that unless the Owner takes away the same, and pays all Expences incurred thereon, iut will be SOLD by AUCTION, on MONDAY, OCTOBER 19, 1818, to defray the Charges thereon.
The Cambrian 17 th October 1818
1819
Advertisement:
NEW HARBOUR, BURRY RIVER.
PEMBREY HARBOUR is now OPEN for the reception of the largest class of COASTING VESSELS, and all suitable conveniences are provided for the accommodation of a large Trade, and Two excellent RUN COAL COLLIERIES are in full work.
Sailing Directions for Pembrey Harbour.
This Harbour is situate on the north side of the Burry River, about 400 yards below the spot marked Edwig on the Chart (to which. I refer for a general description of the navigation). It is well sheltered by a strong Breakwater, extending from the main toward low water in a southerly direction, about 400 yards in length : within the Pierhead there is a depth of from 11 to 12 feet of water at full sea neap tides, and from 20 to 21 feet on ordinary spring tides.
It is peculiarly well circumstanced for an extensive trade, being capable of immense enlargement, and by being situated where there is sufficient water over the shoals to the south and west of it
(except when there is a heavy ground sea running) whenever there is water into the Harbour : with a fair wind it may be entered or quitted by night nearly as safe and easy as by day. There is a Flag always flying at the Pierhead when there is 10 feet of water within it.
Directions for Vessels bound to this Part when there is not sufficient Water over the Shoals.
In the North Channel leading to it Two Red Buoys have been laid down. This is a fine commodious channel, no where less, and in a great part of it more, than half a mile in breadth, and from the outer Buoy (which is placed at the entrance of it) to an extent of nearly two miles above the Harbour a depth at low water spring tides of from two to three fathoms, and in no part less than eight feet.
From the Holmes, giving it a birth of from half to threequarters of a mile, to Buoy No. 1, riding in about eight feet at low water spring tides, the course is N. E. ½ N ,-pass close to the southward of this Buoy. From Buoy No I to No. 2, riding in about two fathoms at low water spring tides, the course is N. E. a little northerly — pass close to the southward of this Buoy.
There is good Anchorage in from two to three fathoms at low water spring tides all the way from No. 2 to the foot of Pembrey Harbour.
The Pier-head bears from this Buoy (No. 2) E. by N.— pass close to the southward of the Barrel Post placed at a small distance from the Pier-head, and run in close along the east side of the Breakwater.
The north side of the Burry River is bold to an extent of nearly two miles above the Pembrey Harbour, and was formerly well known by the name of the North Pool. There is excellent Anchorage in this pool in about three fathoms at low water spring tides. It was formerly the station in which ships of 300 tons burden had their cargoes taken off to them from Barnaby Pill, by small sloops, for want of a Harbour at Pembrey.
Many Pilot Boats are always (when the weather permits) cruising outside the Burry Bar, on the look out for Vessels bound in there. Goodig. May 19, 1819. JOHN WEDGE
TO BE NEXT DOOR
As it were to a Capital Prize, has often been the fate of most Adventurers; and it has frequently been suggested by Country Correspondents, that if a Scheme could be formed so as to give the Number on each side of a Capital Prize something like Neighbour's Fare it would meet universal approbation. The Contractor with Government for this NEW LOTTERY, although limited to 6,050 Tickets, feels pleasure in announcing that the Scheme is grounded on the above principle, in which
INCREASED CHANCES & NOVELTY
ARE COMBINED, AND
Every Ticket and Share HAS THE CHANCE OF
Three Distinct Numbers AND CAN
Actually Gain Three Prizes
-------
THE SCHEME CONTAINS
….. Prizes OF …..
TWO
£20,000
TWO ….. Prizes OF ….. £2,000
TWO ….. Prizes OF ….. £1,000
TWO
….. Prizes OF …..
£500
&c. &c. &c.
ALL STERLING MONEY
ONLY 6050 TICKETS
------
ALL IN ONE DAY,
22 nd JULY
------
The Number in numerical order after the Numbers drawn either of the Prizes of £20,000, will receive £2,000. – The Number in numerical order before the Number drawn either of the Prizes of £20,000 will receive £1,000, &c. for the other Capitals, as are fully explained in the Schemes at
All the Lottery Offices in Town and Country; where Tickets and Shares are now on Sale.
(The Cambrian 3 rd July 1819)
|
<urn:uuid:8beef6c4-bf68-43e2-8e8a-0b3526fc38b7>
|
CC-MAIN-2024-33
|
http://pwllmag.co.uk/history/newspdf/1810-1819.pdf
|
2024-08-06T23:27:01+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-33/subset=warc/part-00026-4f628544-3cdf-4526-86aa-bdfa0b33cdc9.c000.gz.parquet
| 20,900,483 | 8,706 |
eng_Latn
|
eng_Latn
| 0.9958 |
eng_Latn
| 0.99775 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
863,
4868,
8878,
12881,
16672,
20539,
23600,
26934,
30534,
33906
] |
ISSN:2348-2079
International Journal of Intellectual Advancements and Research in Engineering Computations
An intelligent and highly secured walking stick for disabled people
A.MohammedJafferAli 1 ., U.Mylon 2 , V.MariMuthu 3 and L.Ranjith Kumar 4 ,P.Prem Kumar 5 UG Scholars 1,2,3,4 ,Assistant professor 5 , Nandha Engineering College
MAIL ID:[email protected]
Abstract: The Blindness is frequently used to describe severe visual impairments with or without residual vision. The application of ultrasonic ranging scheme for producing electronic walking stick for the blind is a technological advancement. There is a great dependency for any type of movement or walking within area or out of the particular area, they use only their natural senses such as touch or sound for identification or walking .To overcome all these problems of blind people, need to develop a project by using simple available technologies. This walking stick for blind people which have multiple sensors, with the help of sensors it has possible to enhance more features to the walking stick. The features are to detect the obstacle for collision avoidance, it detects the object in directions up, down and front. The other sensor placed near bottom tip of the walking cane to find the pits on the ground. Integrate these sensors to the voice record and play chip. Voice record in the different tracks; respond for different sensors to give the audio message to the blind person by the speaker to alert. In this project, sensors plays key role to detect the objects in all directions to make free to walk for the blind people. A dedicated switch is to get the position of the device and send it others through global system for mobile communication (GSM).
The proposed work includes a wearable equipment consists of light weight blind stick and sensor based obstacle detection circuit is developed to help the blind person to navigate alone safely
Keywords: Blind walking stick; Distance measuring sensor; Microcontroller; Global positioning system.
I. INTRODUCTION
lindness is a state of lacking the visual perception due to physiological or neurological factors. The partial blindness represents the lack of integration in the growth of the optic nerve or visual centre of the eye, and total blindness is the full absence of the visual light perception. In this work, a simple, cheap, friendly user, smart blind guidance system is designed and implemented to improve the mobility of both blind and visually impaired people in a specific area. B
and to avoid any obstacles that may be encountered, whether fixed or mobile, to prevent any possible accident. The main component of this system is the infrared sensor which is used to scan a predetermined area around blind by emitting reflecting waves. The reflected signals received from the barrier objects are used as inputs to microcontroller. The microcontroller is then used to determine the direction and distance of the objects around the blind. The main objective of this project is to develop an application for blind people to detect the objects in various directions, detecting pits and manholes on the ground to make free to walk. This system presents a concept to provide a smart electronic aid for blind people. The system is intended to provide overall measures artificial vision and object detection, real time assistance via global positioning system (GPS). The aim of the overall system is to provide a low cost and efficient navigation aid for blind which gives a sense of artificial vision by providing information about the environmental scenario of objects around them. In this system embedded system plays a major role. In this system we are using the Ultrasonic sensor, temperature sensor, humidity sensor, GPS receiver, Vibrator, Voice synthesizer, speaker or headphone, microcontroller and Battery.
II. RELATED WORK
Basically an embedded system integrating the following components: pair of infrared sensor, the horizontal one to detect obstacles in front of the blind in the range of 200 cm, the inclined infrared sensor to detect obstacles on floor, upward and downward stairs. Both infrared sensors collect real time data and send it to 16F877A microcontroller to process this data. When the infrared signal is received at the microcontroller, it begins to compare between transmitted and received signals to identify obstacles standing in the way of
the blind. If the microcontroller finds a difference in the form and amplitude of transmitted and received signals, it invokes the appropriate speech warning message stored in ISD 1932 through an earphone.
ROM, as well as a typically small volume of RAM.
Microcontrollers are designed for embedded applications.
PIC 16F877A is made by Microchip technology as it's a family of modified Harvard architecture microcontrollers, derived from the PIC1650.PICs are widely used due to the following reasons:
* Low cost.
* Wide availability.
* Can be programmed by free tools.
* Can be re-programming with flash memory capability.
One of the PIC 16F877A main advantages is that each pin shares more than one function. It also contains a 40 pin out and many internal peripherals. The 40 pins can be used as multifunction if more than one external device is attached to MC.
As shown in Fig.2. When the MCU starts by generating the pulse that will drive the infrared emitters. After receiving the reflected wave, the A/D converter of MCU will read and convert the received analog wave from each infrared receiver into a digital signal.
If the received signal comes from the horizontal sensor, MCU will calculate the distance between the stick and obstacle.
If the inclined sensor received the signal, MCU will calculate average of the signal shape and its amplitude to detect the presence of stairs and direction of stairs (upward or downward).
After calculating the required information, MCU invokes the appropriate speech warning message through an earphone.
III. METHODOLOGY
BLOCK DIAGRAM
WORKING DESCRIPTION
An intelligent and highly secured blind user walking with an electronic stick. An ultrasonic sensor is mounted on the stick having range from 20-350cms (set to different ranges). Two Infrared sensors are also implemented on the lower side of stick for avoiding small obstacles ranging from2-10cms. A switch that can be operated with the thumb (in worst condition) that allows the blind user to send a general message (I am in trouble, help me) on a saved mobile no. for help. The box contain combination of GSM300/900 module and microcontroller circuitry. The co-operation between the Ultrasonic and IR sensors are utilized to create a complementary system that is able to give reliable distance measurement. The humidity sensor is used to detect the environment (moisture, water and heat), when it reach specified range it gives input to the controller. The LED strip used as a light source where the environment is dark through a dedicated switch.
The GPS unit is preferably coupled to an emergency communication and navigation system similar to those used With the ONSTARTM system to permit the user to receive the text message(I need a help) an information but also to transmit information about the position latitude and longitude in the event of an emergency.. The present invention provides a very convenient to visually impaired or sightless people. By incorporating a global communication device With a GPS unit, an electronic eye and a Wireless earpiece, the user can feel more secure that he or she has all that they need in order to go about their day with safety. The device provides the user with environment information permitting the user to know in, what are the obstacles.
The proposed device uses ISD1932 circuit that contains a multiple-message recording- and playback device. This circuit can record up to 64 seconds per message. It includes microphone inputs and speaker outputs. In the proposed system, eight different speech warning messages are recorded as listed to alert the user. To decrease recording duration to 21.2sec per message, a capacitor of 4.7 μF and an external resistor of 100K are added. The eight channel Audio playback and record device is used to eight different sounds, which will produce the output based on the input to the processor. If there is any obstacles on the way, it is detect through an ultrasonic sensor. And it is one of the input to the processor and the output will be an audio (It may be an object). In stair case detection, the IR sensor measure distance of first step (D1), then measuring the distance of second step (D2). Comparing the first and second distance, if the first distance is higher than the second distance the signal given to the processor and produce the voice channel output (Upstairs). If the first distance is lesser than the second distance is the signal to the processor and produce the third voice channel as an audio (Downstairs).
ULTRA SONIC SENSOR:
Ultrasonic transducers are transducers that convert ultrasound waves to electrical signals or vice versa. Those that both transmit and receive may also be called ultrasound transceivers; many ultrasound sensors besides being sensors are indeed transceivers because they can both sense and transmit. These devices work on a principle similar to that of transducers used in radar and sonar systems, which evaluate attributes of a target by interpreting the echoes from radio or sound waves, respectively. Active ultrasonic sensors generate high-frequency sound waves and evaluate the echo which is received back by the sensor, measuring the time interval between the sending signals and receiving signal, the echo to determine the distance to an object. Passive ultrasonic sensors are basically mobile phones that detect ultrasonic noise that is present under certain conditions, convert it to an electrical signal and report it to computer.
HUMIDITY SENSOR:
The humidity sensor is comprised of an integrated circuit (IC) with a stable polymer element and platinum RTD that is used for temperature compensation .contaminant and chemicals, and is protected by a sintered stainless steel filter which resists condensation. A humidity sensor senses relative humidity. This means that it measures both air Temperature and moisture. Relative humidity, expressed as a percent, is the ratio of actual moisture in the air to the highest amount of moisture air at that temperature can hold. The warmer the air is, the more moisture it can hold, so relative humidity changes with fluctuations in temperature.
VOICE RECORD AND PLAY BACK DEVICE:
This circuit offers true single-chip voice recording, nonvolatile storage and Playback capability for 40 to 60 seconds. It supports both random and sequential access of multiple messages. It can be used in three different modes. The device is ideal for use in portable voice recorders.
Digital recording annd reproduction converts the analog sound signal picked up by the microphone to a digital form by the process of digitization. This lets the audio data be stored and transmitted by a wider variety of media. Digital recording stores audio as a series of binary numbers (zeros and ones) representing samples of the amplitude of the audio signal at equal time intervals, at a sample rate high enough to convey all sounds capable of being heard. Digital recordings are considered higher quality than analog recordings not necessarily because they have higher fidelity (wider frequency response or dynamic range), but because the digital format can prevent much loss of quality found in analog recording due to noise and electromagnetic interference in playback and mechanical deterioration or damage to the storage medium.
GPS/GSM MODULE
The circuit is made simple by the adoption of a mobile phone module of Simcom and the SIMCom. The USB connection is implemented with the aid of a converter TTL /
USB type FT782M. Our modem is ideal to perform data links without access to the GPRS network or in any case to the Internet and allows, for example, the use in point-to-point mode, locators GPS / GSM or GSM only so as to obtain instantly data positioning and follow moves on live. In short, it allows direct data connection with another modem or mobile phone provider of a modem, but without going through the web: connections are made directly to the GSM data channel.
UART, I2C, CAN, and even USB. Low-power and high speed variations exist for many types.
PROCESSOR
The ATmega328 is a single-chip microcontroller created by Atmel in the mega AVR family. The Atmel 8-bit AVR RISC-based microcontroller combines 32 kB ISP flash memory with read-while-write capabilities, 1 kB EEPROM, 2 kB SRAM, 23 general purpose I/O lines, 32 general purpose working registers, three flexible timer/counters with compare modes, internal and external interrupts, serial programmable USART, a byteoriented 2-wire serial interface, SPI serial port, 6-channel 10bit A/D converter (8-Channels in TQFP and QFP/MLF packages), programming watchdog timer with internal oscillator, five software selectable power saving modes. The device operates between 1.8-5.5 volt. The device achieved throughput approach 1 MIPS in Mhz.
IV. SUMMARY
The Smart Stick acts as a basic platform for the coming Generation of more aiding devices to help the visually impaired to be safer. It is effective and afford. It leads to good results in detecting the obstacles lying ahead of the user in a range of four meters, detecting stairs and water pits. This system offers a low-cost, reliable, portable, low power consumption and robust solution for navigation with obvious short response time. Though the system is hardwired with sensors and other components, it's light in weight. Further aspects of this system can be improved via wireless connectivity between the system components, thus, increasing the range of the ultrasonic sensor and implementing a technology for determining the speed of approaching obstacles. While developing such an empowering solution, visually impaired and blind people in all developing countries were on top of our priorities.
V. REFERENCES
[1] Sung Jae Kang, Young Ho, Kim, In Hyuk Moon, "Development Of An Intelligent Guide-Stick For The Blind", IEEE International Conference on Robotics & Automation Seoul, Korea, May 21-26, 2012.
[2] Alessio Carullo and Marco Parvis, "An Ultrasonic Sensor For Distance Measurement In Automotive
Applications" , IEEE Sensors Journal, Vol.1, No.2, August 2009.
[3] D. Dakopoulos and N. G. Bourbakis, "Wearable obstacle avoidance electronic travel aids for blind: a survey," IEEE Transactions on Systems, Man and Cybernetics C, vol. 40, no. 1, pp. 25–35, 2010.
[4] Samleo L. Joseph, Jizhong Xiao," Being Aware of theWorld: Toward Using Social Media to Support the Blind With Navigation ", IEEE transactions on human-machine systems, vol. 45, no. 3,june 2015.
[5] B. Ando, S. Baglio, S. La Malfa, and V. Marietta, "A mobility aid for the visually impaired," IEEE Sensors J., vol. I I, no. 3, pp. 634-640,Mar. 2011.
[6] D. Dakopoulos and N.Bourbakis.."Wearable obstacle avoidance electronic travel aids for blind" A survey. IEEE Trans. Syst., Man, Cybern. C, Appl. Rev. [Online}. 40(1), pp. 25-35.Jan 2010
[7] S. L. Joseph, X. Zhang, 1. Dryanovski, J. Xiao, C. Vi, and Y. Tian, "Semantic indoor navigation with a blind-user oriented augmented reality," in Proc. IEEE Int. Can! Syst., Man, Cybern., Oct. 2013, pp. 3585-3591.
[8] R. Velazquez, E. Pissaloux, J.-C.Guinot, and F. Maingreaud, "Walking using touch: Design and preliminary prototype of a non-invasive ETA for the visually impaired," in Proc. IEEE 27th Annu. Int. Conf Eng. Med. Bioi. Soc., Jan. 2005, pp. 68216824.
[9] D. Dakopoulos and N. G. Bourbakis, "Wearable obstacle avoidance electronic travel aids for blind: a survey," IEEE Transactions on Systems, Man and Cybernetics C, vol. 40, no. 1, pp. 25–35, 2015
[10] Harsha Gawari and Prof. Meeta Bakuli, "Voice and GPS Based Navigation System For Visually Impaired", International Journal of Engineering Research and Applications", Vol. 4, No. 4, pp. 4851, April,2014.
[11] ] D. Dakopoulos, and N. G. Bourbakis. "Wearable obstacle avoidance electronic travel aids for blind: a survey." Systems, Man, and Cybernetics, Part C: Applications and Reviews, IEEE Transactions on 40, no. 1 (2010): pp. 25-35.
[12] S.L. Joseph, X. Zhang, D. Ivan, J. Xiao, C. Yi, Y. Tian, "Semantic Indoor Navigation with a BlindUser Oriented Augmented Reality," Systems, Man, and Cybernetics (SMC), 2013 IEEE International Conference on, 13-16 Oct. 2013, pp.3585-3591.
[13] S.L. Joseph, C. Yi, J. Xiao, Y. Tian, F. Yan, "Visual semantic parameterization - To enhance blind user perception for indoor navigation," Multimedia and Expo Workshops (ICMEW), 2013 IEEE International Conference on, 15-19 July 2013, pp.16.
[14] ] J. Xiao, S.L. Joseph, X. Zhang, B. Li, X. Li, J. Zhang, "An Assistive Navigation Framework for the Visually Impaired," Human-Machine Systems, IEEE Transactions on , vol.PP, no.99, pp.1,6
[15] Ilias Apostolopoulos, Navid Fallah, Eelke Folmer, and Kostas E. Bekris, "Integrated online localization and navigation for people with visual impairments using smart phones," in International Conference on Robotics and Automation (ICRA), 2012.
[16] Brett R. Fajen, William H. Warren, Selim Temizer, and Leslie Pack Kaelbling, "A dynamical model of visuallyguided steering, obstacle avoidance, and route selection," International Journal of Computer Vision, vol. 54, no. 1- 3, 2009.
|
<urn:uuid:bea25e93-1b69-4899-bd8c-ac5822b6e02c>
|
CC-MAIN-2018-43
|
http://ijiarec.com/sites/default/files/articles/IJIAREC-17-148_344-347.pdf
|
2018-10-24T05:51:32Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583519859.77/warc/CC-MAIN-20181024042701-20181024064201-00488.warc.gz
| 177,692,743 | 3,807 |
eng_Latn
|
eng_Latn
| 0.913664 |
eng_Latn
| 0.994517 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
4421,
8979,
14463,
17547
] |
ALCONOX CERTIFICATE OF ANALYSIS
Manufactured by: Alconox Inc.
Sub lot No: 11-06-23-12
Date Of Manufacture: 11/6/2023
Sub lot numbers of Master lot No: A4A2
Manuf. Cat. no.: 1101, 1103, 1104, 1104-1, 1112, 1112-1, 1125, 1150
Storage Conditions: Closed upright and in a cool dry place (should be 15 - 30 deg C or 60 - 90 deg F).
Expires end of: 11/25
Laura Falla, QA
Alconox, Inc.
Contains no class 1, class 2, class 3, or class 4 residual solvent ingredients as defined by ICH Q3C guidelines.
Alconox Inc.
Critical Cleaning Experts
30 Glenn St., Suite 309, White Plains, NY 10603 USA
Tel.914.948.4040 ● Fax.914.948.4088
www.alconox.com ● [email protected]
..
Date COA Created: 11/13/2023
|
<urn:uuid:72114174-2082-4583-997e-89bc0ef0530f>
|
CC-MAIN-2024-22
|
https://www.alconox.com/wp-content/uploads/2023/11/11-06-23-12.pdf
|
2024-05-23T03:48:00+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-22/subset=warc/part-00107-4dd72944-e9c0-41a1-9026-dfd2d0615bf2.c000.gz.parquet
| 549,235,980 | 260 |
eng_Latn
|
eng_Latn
| 0.448315 |
eng_Latn
| 0.448315 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
714
] |
SNAPlink RS-232 Serial Cable Replacement Devices
Model SL232-010 is FCC and IC certified for use in North America
Model SL232-020 is CE certified for use in Europe
WARNING AND CAUTIONS:
* To reduce risk of damage, disconnect power from the SNAPlink and from the connected device before making your serial connection.
* To be installed and/or used in accordance with appropriate electrical codes and regulations.
* Terminal block connections should use wire between 26 and 14 AWG.
* Torque terminal block connections to between 0.35 and 0.40 Nm (3.1 to 3.5 inch pounds).
* Mounting: It is critical that the antennas of all SNAPlink devices be oriented in the same direction.
* If you are unsure about any part of these instructions, consult an electrician.
QUICK START GUIDE
DESCRIPTION
POWERING THE DEVICES
The Synapse SL232-xxx is a cable-replacement solution for connecting devices that would normally use an RS-232 DE-9 cable.
SNAPlink devices allow for one-to-one communications, or communications between a single master and multiple slaves. They support many serial baud rates and configurations, and multiple independent pairings or networks can coexist without conflict in a single working environment.
PROVISIONING
SNAPlink devices are configured for 9600 baud 8N1 serial communications with flow control disabled by default. These settings can be adjusted using the EasySet software available from Synapse Wireless, or you can select common baud rates and configure flow control using DIP switches inside the case.
To begin provisioning:
Remove the screw from the end of the SNAPlink device and lift the cover off. There will be a bank of eight DIP switches. labeled 1 through 8.
DIP switch 1 controls flow control, and the On position indicates that flow control is enabled.
DIP switches 2, 3, and 4 control the serial baud rate, as follows:
| Baud Rate | Switch 2 | Switch 3 | Switch 4 |
|---|---|---|---|
| 300 | On | Off | On |
| 1,200 | Off | On | On |
| 2,400 | On | On | On |
| 9,600 | Off | Off | Off |
| 19,200 | On | Off | Off |
| 38,400 | Off | On | Off |
| 57,600 | On | On | Off |
DIP switches 5 through 8 affect the SNAP radio channel used for over-the-air communications and typically need no adjustment. Refer to the SNAPlink User Guide for more information. (Note: Devices must use the same channel to communicate with each other. Do not set all four switches to On as this selects channel 15, which is unavailable for the SL232-020 and SL485-020 devices.)
After setting the DIP switches, reassemble each device.
You can power your SNAPlink devices either through the micro-B USB connection (5V DC, 500 mA), or using the power terminal blocks providing 6-30 volts DC.
PAIRING DEVICES
To pair two devices for one-to-one communication, power both devices in their defaulted state. Select a device and hold the Mode button for at least 5 seconds until LED A turns red, then release the button. Repeat this process for the second device and it should find the first SNAPlink device looking for a partner and then switch to a solid LED color indicating radio link quality (green for strong, amber for weak, red for unable to communicate). Your devices are now paired and ready to communicate.
If you need to establish a master/slave configuration for a one-to-many installation, first select a device to be the master. With the device powered and in its default state, press the Mode button four times within 3 seconds to put it into multipoint mode. (LED A will blink amber when the device is in multipoint mode.) When LED A is blinking amber, press the Mode button four more times within 3 seconds to indicate the device is a master. LED A will begin to slowly blink between amber and green.
With the master device still powered, on each (powered) slave device press the Mode button four times within 3 seconds to put the device into multipoint mode. LED A may briefly flash amber, but then should go to a solid color indicating radio link quality with the master (green for strong, amber for weak, red for unable to communicate).
Once your devices are paired (either one-to-one or in a master/slave configuration) you may remove their power. They will retain their pairing information in non-volatile memory and you can now install them in their final environments.
MOUNTING
For best transmission, orient all antennas in the same direction. Typically it will be easiest if the antenna points straight up. However if one device is physically located directly above another one, adjust all antennas to be parallel to each other and horizontal.
SERIAL CONNECTIONS
SNAPlink SL232-xxx devices are configured as DCE (Data Communications Equipment) devices, ready to be connected to DTE (Data Terminal Equipment) devices. If you need to connect your SNAPlink device to a DCE device, you will need a crossover cable or null modem adapter. Please consult the SNAPlink User Guide for more information.
ADDITIONAL INFORMATION
For additional information on configuring your SNAPlink devices and how to fine-tune settings for your application and environment, please see the SNAPlink User Guide, available at http://www.synapse-wireless.com/resources/support-documents/
|
<urn:uuid:4a562be7-90eb-4770-a012-b28bbf74e216>
|
CC-MAIN-2024-51
|
https://downloads.synapse-wireless.com/snaplink/SL232-003-QIG.pdf
|
2024-12-07T14:18:53+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00147-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet
| 192,667,249 | 1,160 |
eng_Latn
|
eng_Latn
| 0.99518 |
eng_Latn
| 0.99518 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
5211
] |
FULL SPECS AND FEATURES
BASIC FEATURES – UNIT 1 BEDROOMS: 4
BATHROOMS: 2 1 STOREY
UNIT 2
BEDROOMS: 4 BATHROOMS: 2
1 STOREY
DIMENSIONS
DEPTH: 16.73m
WIDTH: 27.41m
AREA
UNIT 1
UNIT 2
RESIDENCE: 146.4m2
RESIDENCE: 146.4m2
GARAGE: 35.4m2 GARAGE: 35.4m2
ALFRESCO: 9m2
ALFRESCO: 9m2
PORCH: 1.7m2
PORCH: 1.7m2
TOTAL: 192.5m2
TOTAL: 192.5m2
TOTAL: 385m2
ROOF
STYLE: Hip
TYPE: Colorbond
BEDROOM FEATURES
Built in wardrobes to bedrooms 2, 3 and 4 in each duplex Private ensuite and walk in robe to each master bedroom
KITCHEN FEATURES
Lots of bench space Good sized corner pantry
ADDITIONAL ROOM FEATURES
Open plan kitchen, living and dining Second living room/kids retreat
|
<urn:uuid:64535f01-875b-484e-a48a-72c10184dc4e>
|
CC-MAIN-2021-10
|
https://www.abbottbuild.com.au/wp-content/uploads/2019/01/CHARLIE-D4004.pdf
|
2021-02-27T00:39:37+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-10/subset=warc/part-00202-dbb5a216-bcb2-4bff-b117-e812a7981d21.c000.gz.parquet
| 665,078,616 | 273 |
eng_Latn
|
eng_Latn
| 0.568728 |
eng_Latn
| 0.568728 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
698
] |
OPEN ACCESS
International Journal of Environmental Research and Public Health ISSN 1660-4601 www.mdpi.com/journal/ijerph
Article
Performance Evaluation of Public Non-Profit Hospitals Using a BP Artificial Neural Network: The Case of Hubei Province in China
Chunhui Li 1 and Chuanhua Yu 1,2, *
1 School of Public Health, Wuhan University, 115 Donghu Road, Wuhan 430071, China; E-Mail: [email protected]
2 Global Health Institute, Wuhan University, 115 Donghu Road, Wuhan 430071, China
* Author to whom correspondence should be addressed; E-Mails: [email protected] or [email protected]; Tel./Fax: +86-27-6875-9299.
Received: 5 June 2013; in revised form: 1 August 2013 / Accepted: 5 August 2013 / Published: 15 August 2013
Abstract: To provide a reference for evaluating public non-profit hospitals in the new environment of medical reform, we established a performance evaluation system for public non-profit hospitals. The new "input-output" performance model for public non-profit hospitals is based on four primary indexes (input, process, output and effect) that include 11 sub-indexes and 41 items. The indicator weights were determined using the analytic hierarchy process (AHP) and entropy weight method. The BP neural network was applied to evaluate the performance of 14 level-3 public non-profit hospitals located in Hubei Province. The most stable BP neural network was produced by comparing different numbers of neurons in the hidden layer and using the "Leave-one-out" Cross Validation method. The performance evaluation system we established for public non-profit hospitals could reflect the basic goal of the new medical health system reform in China. Compared with PLSR, the result indicated that the BP neural network could be used effectively for evaluating the performance public non-profit hospitals.
Keywords: public non-profit hospitals; health care reform; indicator system; performance evaluation; BP neural network; cross validation
1. Introduction
Since 2009, new health reforms have entered the implementation stage in China. Changes to public non-profit hospitals are an important part of the health reform process. In the past three years, reform has had positive effects, but it has also encountered some problems.
The only way to evaluate the effects of public non-profit hospital reform and to solve the problems accurately is to establish a performance evaluation system. An evaluation system could help managers make decisions and determine how to improve hospital-performance [1–3]. A performance evaluation system for public non-profit hospitals will not only establish a better system for supervising performance but also facilitate evidence-based health policymaking and the regulation of public nonprofit hospitals.
In recent years, as public non-profit hospital reform has been implemented, many studies have comprehensively evaluated the operations of domestic public non-profit hospitals. However, the research on the performance of public non-profit hospitals is currently limited to the quality of medical services, service efficiency, service ability and management ability, which are not sufficient to fully evaluate the performance for public non-profit hospitals. Tang et al. [4] have used the balanced score card to establish the performance evaluation system for public non-profit hospitals. In Cui et al. [5], the evaluation system included investment assets, service quality, financial management and external evaluation. Wang et al. [6] have selected several key performance indicators by key success factor. They ignored the embodiment of commonweal in their studies. In addition, the present evaluation system lacks a satisfaction indicator for evaluating medical performance, such as patient satisfaction and medical safety. Thus, the evaluation results will not support the sustainable development of public non-profit hospitals, and they cannot accurately measure the effectiveness of public non-profit hospital reform.
The most important feature of an ideal performance evaluation system is the accuracy of the evaluation results. Thus, it is important to choose reasonable indicators that reflect the purpose of the performance evaluation and to use the proper methods to evaluate performance.
Recently, the literature on performance evaluations of medical services has dramatically increased in China. Key Performance Indicators (KPIs) have been used widely; the most common indicators are medical costs and medical quality [7]. Subsequently, many methods (including the "Balanced Score Card" (BSC)) have been introduced into the performance evaluations of hospitals [8,9]. Furthermore, fuzzy comprehensive evaluations, fuzzy gray relational analyses and TOPSIS have been applied for evaluating hospitals or making predictions.
However, there are some disadvantages to conducting of fuzzy comprehensive evaluations and fuzzy gray relational analyses. In fuzzy comprehensive evaluations, the weights of the factors are subjective and the membership function is hard to define [10,11]. In addition, because of the narrow theoretical basis of the grey correlation quantitative model, the positive correlation result is contradictory to the actual relationship between the factors [12–14]. Considering the questions above, we chose artificial neural networks (ANNs). The neural network more closely represents human thinking. Based on the expert evaluations of the given sample and the knowledge gained from experience, the neural network can be used to compute complex nonlinear relationships, just like human brain [15,16]. Thus, both qualitative analysis and quantitative analysis can be used, and the
objectivity of the evaluation results will be ensured. In recent years, artificial neural networks have emerged as tools for clinical decision-making [17], and they may be more successful than traditional statistical models in predicting clinical outcomes [18,19]. ANNs can acquire experiential knowledge expressed through internal connections in a manner similar to the way natural neurons function in the brain, and this knowledge can be made available for use [20]. ANNs, which demonstrate excellent performance in modeling nonlinear relationships that involve a multitude of variables, can potentially be useful tools to alleviate nonlinear problems. However, applications of ANNs in public health monitoring and evaluation are uncommon.
The present evaluation mainly depends on the experience and knowledge of experts, and this information is difficult to express in mathematical formulas. In addition, it is more difficult to accumulate experiences. Artificial neural networks can capture self-study and self-evaluation, and they have high overall collateral and a high capacity for nonlinear relationships. These models can use hidden knowledge expression to integrate knowledge into the interlinked concepts and the linked weights in the network, making it easier to realize the relationship between experience and knowledge [21]. An ANN model with an input layer, an output layer and one or more hidden layers could be an adequate universal approximate of any nonlinear function [22,23]. The input layer comprises the data available for the analysis, and the output layer comprises the outcome (e.g., a prediction, prognosis or evaluation).
Based on the current situation in China and the aim of the performance evaluation, this study used an input-output model to establish proper evaluation indicators. The weighted TOPSIS method and BP artificial neural networks were used to conduct a comprehensive evaluation. We chose 14 level-3 public non-profit hospitals located in Hubei Province for a performance evaluation.
2. Methods
2.1. Data Collection
Hubei Province lies in central China, and it was one of the first provinces to implement health reform. This evaluation was conducted at large public non-profit hospitals (14 hospitals) in Hubei Province. At the beginning of 2009, the Hubei Health Ministry (HHM) conducted a program to facilitate reforms of public non-profit hospitals. All of the public non-profit hospitals were required to report service and management data to the Hubei Medical Service Information Quality Control Center (HMSIQCC) via Hubei Public Hospital Information Software. The Information Software involves 117 variables, including general information (the number of doctors, beds, etc.), hospital management (including training times and infectious disease control), medical service quantity (including information on all services performed in the hospital), medical service quality (including hospitalization outcomes, e.g., diagnosis rates, positive rates, etc.), nursing quality control, laboratory quality control, economic efficiency (including income, expenditures, etc.), medical safety (including medical negligence and compensation information) and patient satisfaction. The standardized reporting system was developed by HHM, and the doctors and administrators from all of the public non-profit hospitals in Hubei were trained to report the data in a standard format. After the data had been uploaded to the software, the experts in HMSIQCC could exclude abnormal data and check the accuracy of the data, which could then be downloaded for our study. The data used in our study came
from the HMSIQCC in the first half of 2012. The integrity and the accuracy of the data were checked by HMSIQCC.
2.2. Establishing the Evaluation System
2.2.1. Indicator Selection
Given our understanding of performance, the input-output model was used as the framework for evaluating public non-profit hospitals. The efficiency and the quality of services hospitals are key concerns for consumers and managers and are widely used in performance evaluations [24–26]. Therefore, this study began from these starting points to establish the evaluation indicators.
First, we used experts' suggestions and the criteria from the literature to select the evaluation indicators. Experts and grassroots workers were invited to complete a questionnaire based on four scientific principles (orientation, comparability, operability and representativeness). After several rounds of expert scoring, we reached a final selection of reasonable, high sensitive, typical indicators that could meet the performance evaluation needs of government managers and public non-profit hospitals.
2.2.2. Tendency Treatment
If a higher value of an indicator indicates better performance, the normalized value can be calculated by Equation (1):
If a smaller value indicates better performance, the normalized value can be calculated by Equation (2):
If a value in a fixed interval indicates better performance, the normalized value can be calculated by Equation (3):
where xij is the value of indicator j for the evaluation subject i. min[ ] ij i x is the minimum value of indicator j for all of the evaluation subjects, and max[ ] ij i x is the maximum value of indicator j for all of the evaluation subjects. If the best standard value was not provided, we used X S as the best value (e.g., the daily number of clinic patients for each doctor).
2.2.3. Weight Definition
First, according to the importance of each indicator, we invited the experts to score the indicators, and we then determined level l and 2 index weights using an analytic hierarchy process (AHP). The AHP is a decision-making tool developed by Satty to handle complex, unstructured and multi-factor problems [27]. The AHP involves ranking a set of indices with respect to an overall goal, which is broken down into a set of criteria and indices [28]. The weights of indicators were calculated by conducting pairwise comparisons between the relative importance of the lower evaluation indicator and the relative importance of the upper indicator.
The entropy weight method was used to determine the weights of the level 3 indicators. The weight of indicator j can be calculated by Equation (4):
where entropy j h as 1 1 ln , 1,2, , . ln n j ij ij i h p p j m n In addition, ln ij ij p p is defined as 0 if.
The comprehensive indicator weights were calculated by determining the product of the weights of the level 1, 2 and 3 evaluation indicators.
2.3. Artificial Neural Networks
Artificial neural networks can be defined as a parallel distributed processing method with a large number of processing elements and neurons connected to one another with different connection strengths. The strength of a connection between neurons is the weight. In the beginning of the neural development process, these weights are initially random. They are adjusted in a model calibration phase (called "training") to minimize the MSE between the calculated outputs and the corresponding target output values for the particular training data set. The testing subset is used to check the performance of the developed network. Various types of ANNs are used for different applications [29].
BP (back propagation) artificial neural networks (BP-ANN) are typically used for amending errors. BP-ANNs set each quantifiable indicator as the network's input (X) and the result as the output (Y). After training enough samples and repeatedly amending the connection weight values (W, V) and the threshold values among the neurons, the final weight values and threshold values were obtained to indicate correct knowledge (Figure 1).
In the three-layer BP-ANN in our study, the indicators for the performance evaluation system for public non-profit hospitals were used as input variables, and each public non-profit hospital's performance score as the output. According to the evaluation index system, there were 41 third-level evaluation indicators. The outcome was the performance evaluation; thus, the output layer included only one variable. Therefore, the numbers of neurons in the input and output layers were 41 and 1, respectively. The number of hidden layer neurons can be calculated by Equation (5). The number of neurons in the hidden layer ranged from 8–17.
(5)
where n is the number of neurons in the input layer, m is the number of neurons in the output layer, a is the constant, and 1 < a < 10.
When BP neural networks are used for public hospital performance evaluation, the data should be normalized before they are trained. In this paper, the MATLAB software normalization function "mapminmax" was adopted, and the normalization interval was 0–1.
The mean squared error (MSE) can be used to determine how well the network output fits the desired output. MSE is defined as follows:
where yi is the observed value, ˆ i y is the network output value, and smaller values indicate better performance.
To avoid the effects of using fewer samples for training and to influence the generalization ability of network, the Leave-one-out Cross Validation (LOOCV) method was used to train and test the BP neural network in our study. In LOOCV, if the raw data set has N samples, the model is trained and tested N times. Each time, one sample is selected as the validation sample, and the remaining samples are used as training samples. The cross-validation estimate of the overall accuracy is simply calculated as the average of the N individual accuracy measures. With this method, we attempted to derive reliable results and increase the generalization ability of network [30,31].
The performance of the model can be evaluated using certain statistical indicators, including the coefficient of determination (R 2 ), the root mean squared error (RMSE) and the mean absolute percentage error (MAPE). These indicators are mathematically defined as follows:
where yi is the observed value and ˆ i y is the network output value.
According to Table 1, the most suitable neural network was model with 10 neurons in the hidden layer.
Table 1. Statistical indicators for various numbers of neurons in the hidden layer.
Thus, a 41-10-1 BP neural network was obtained. The learning speed, the maximum numbers of epochs, the target error goal MSE and the minimum performance gradient were set at 0.05, 3,000, 10 −5 , and 10 −5 , respectively. The Levenberg-Marquardt (LM) algorithm was chosen to avoid the time-consuming one-dimension searching [21]. Training stopped when any of these conditions occurred. All of the calculations were performed using MATLAB software (MathWorks, Inc., Natick, MA, USA).
To explain the good performance of BP neural network, we compared BP neural network with partial least-squares regression (PLSR). PLSR is a new multivariate statistical analysis method. The advantages of PLSR are exhibited in dealing with the problems: low sample, more independent variables and multi-correlation [32]. The coefficient of determination (R 2 ) was used to evaluate the performance of the model [33].
Table 2. Public non-profit hospitals performance evaluation system.
Table 2. Cont.
a Analytic hierarchy process (AHP) was used to determine the weights of level 1and 2 indicators; b The entropy weight method was used to determine the weights of level 3 indicators; The reference values were from Hospital management evaluation guidelines; +: Higher indicator values indicate better performance, -: Smaller indicator values indicate better performance, 0: values in one interval indicate better performance.
3. Results
The input-output model was used as the framework for establishing the performance evaluation system for public non-profit hospitals. Experts' suggestion and criteria from the literature were used to select indicators. The weights of the indicators were determined by AHP and the entropy weight method (as shown in Table 2).
Based on the public non-profit hospitals performance evaluation system, the TOPSIS evaluation method was adopted to calculate the relative scores for the evaluation standards, as shown in Table 3.
Table 3. The weighted TOPSIS results for 14 level 3 hospitals in the first half of 2012.
Ci is relative approach degree in the TOPSIS method; The higher the value of Ci, the better the rank.
The 14 public non-profit hospitals we chose are almost the same level (level 3, class A) and scale. The value of Ci (relative approach degree) indicated the performance of the hospital. The higher the value of Ci, the better the performance was. Thus, Ci was the output variable for training and testing BP neural network.
Because the sample was small (14 hospitals), LOOCV was used to train and test the BP neural network to derive reliable results and increase the generation ability. The simulation of the training error is shown in Figure 2. The MSE value decreased as the number of iterative steps increased. Beginning with the 441th iterative step, the MSE was 9.95e−6, which was smaller than target error goal MSE (10 −5 ). Consequently, the training was finished. The MATLAB software function "cputime" was adopted to record the computational cost of the model training, and the cpu time used to run the program is 60.35 s.
The statistical indicators of network performance are shown in Table 4. The network was trained by using LOOCV, and after 14 experiments, the average RMSE was 0.0392. The coefficient of determination (R 2 ) was 0.9903. The closer that the value of R 2 is to 1, the better the network performance is [34].
Table 4. The statistical indicators of net performance.
The error analyses of partial least-squares regression are shown in Table 5. The coefficient of determination (R 2 ) of PLSR model was 0.7731. Obviously, the value of R 2 is smaller than BP neural network model. Thus, BP neural network provided the better results in performance evaluation for public non-profit hospital.
Table 5. The error analyses of partial least-squares regression.
Table 5. Cont.
4. Conclusions
The performance evaluation system for public non-profit hospitals covers almost all aspects of quality for public non-profit hospitals. The system could reflect the guidance of public non-profit hospitals reform. The indicator weights were scientific and reasonable, based on both the objective and the subjective points of view. Developing the indicator weights using both the subjective (experts scoring and AHP) and objective (entropy method) methods ensured that both experience and objectivity were considered.
The integrity and the accuracy of the data were also important and, may have influenced the results. A small mistake could potentially lead to inaccurate estimates of the hospital's performance. HMSIQCC has a special quality control measure for the integrity and accuracy of the management data for public non-profit hospitals. All of the data used in this study were verified.
A relatively stable BP neural network model was obtained using the Leave-one-out Cross-Validation method and adjusting the network parameters. According to the results, the structure of the BP neural network was 41-10-1, R 2 was 0.9903 and RMSE was 0.0392. Compared with PLSR model, the value of R 2 (R 2 = 0.9903) for BP neural network is larger than PLSR model (R 2 = 0.7731). Thus, the proposed model could be used for public non-profit hospital performance evaluations.
The new health reform policies in our country state that three key problems should be considered: accessibility, equity and price. Accessibility refers to basic medical institutions. Equity refers to the efforts to narrow the gap between urban and rural areas and between regions, and the price is a consideration so that people can afford to consult a doctor or purchase medicines when they get sick. Thus, a performance evaluation system for public non-profit hospitals should have certain characteristics (i.e., the weights of the social benefit index in the evaluation system should be increased). Consequently, the commonweal goal of public non-profit hospitals can be reflected fully.
One of the purposes of this evaluation is to help the government understand the performance of public non-profit hospitals and to aid in decisions related to the development and reform of public non-profit hospitals; another goal is to help hospitals improve their performance. Whether or not performance evaluation improves performance depends on whether and how the evaluation results are applied [35]. First, the evaluation results should be used appropriately. Each public non-profit hospital
will find the problems or weak links that may influence the evaluation results. Then, they may resolve or improve them, but they may accomplish these results falsifying data or accepting only low-risk patients. Second, the evaluation system and methodology should be same, so that the performance evaluation results from different hospitals will be comparable. Third, the performance of hospitals at different levels and in different categories should be evaluated individually.
Acknowledgments
This work was funded by the Ministry of Health of the People's Republic of China, National Natural Science Foundation of China (No. 30371254). The authors would like to thank Jingchen Hu at the Hubei Medical Service Information Quality Control Center (HMSIQCC) for the data preparation.
Conflict of Interest
The authors declare no conflicts of interest.
References
1. Li, L.X.; Benton, W.C. Performance measurement criteria in health care organizations: Review and future research directions. Eur. J. Oper. Res. 1996, 93, 449–468.
2. Elizabeth, A.M.; Steven, M.A. Developing a clinical performance measure. Am. J. Prev. Med. 1998, 14, 14–21.
3. Maria, G.; Russell, M.; Peter, C.S. Assessing the performance of NHS hospital trusts: The role of "hard" and "soft" information. Health Policy 1999, 48, 119–134.
4. Tang, Y.H.; Xue, X.; Chen, J.C.; Jian, D.S.; Pan, L.J.; Qiu, F.; Cao, M.Q.; Wang, P.; Jiang, X.M.; Wang, J.J.; et al. The performance appraisal indicator system of public general hospitals based on balanced scorecard. Chin. Hosp. Manag. 2008, 28, 56–59.
5. Cui, S.; Yang, J.L.; Li, Z.S.; Li, C.R. The study on performance evaluation of public hospital: The evaluation methods and indicator system. Chin. Health Econ. 2008, 27, 57–61.
6. Wang, H.; Lin, Q.Y.; Xie, G. Discussion on establishment of key performance evaluation system for public hospital. Mod. Hosp. Manag. 2009, 5, 13–15.
7. Wang, X.J. Theory and practice of KPI utility for hospital performance evaluation. Chin. J. Hosp. Adm. 2006, 6, 421–422.
8. Zhao, J.S.; Li, L.; Zhu, Q. Study of using BSC for hospital management in China. Chin. Hosp. Manag. 2007, 27, 79–81.
9. Ren, R. Theory and practice of hospital performance evaluation. Chin. Hosp. Manag. 2005, 25 15–17.
,
10. Wang, Y.L.; Zheng, J.G.; Wang, X. The summary of the domestic study on assessing knowledge management performance. J. Intell. 2010, 29, 93–97.
11. Liang, J.; Jiang, W.; Li, X.H. An improvement on fuzzy comprehensive evaluation method and its use in urban traffic planning. J. Traffic Transp. Eng. 2002, 2, 68–72.
12. Cao, M.X. Research on Grey Incidence Analysis Model and its Application. Master Thesis, Nanjing University of Aeronautics and Astronautics, Nanjing, China, January 2007.
13. Wang, J.L.; Liu, S.F.; Qiu, G.H. Formation and application of a new grey incidence degree based on information aggregation. Syst. Eng. Electron. 2010, 32, 77–81.
14. Wang, Z.X.; Dang, Y.G.; Cao, M.X. Weighted degree of grey incidence based on optimized entropy. Syst. Eng. Electron. 2010, 32, 774–783.
15. Kuo, Y.M.; Liu, C.W.; Lin, K.H. Evaluation of the ability of an artificial neural network model to assess the variation of groundwater quality in an area of blackfoot disease in Taiwan. Water Res. 2004, 38, 148–158.
16. Patterson, D.W. Artificial Neural Networks; Prentice Hall: New York, NY, USA, 1996; pp. 10–25.
17. Dayhoff, J.E.; Deleo, J.M. Artificial neural network: Opening the black box. Cancer 2001, 91 1615–1635.
,
18. Green, M.; Bjork, J.; Forberg, J.; Ekelund, U.; Edenbrandt, L.; Ohlsson, M. Comparison between neural networks and multiple logistic regression to predict acute coronary syndrome in the emergency room. Artif. Intell. Med. 2006, 38, 305–318.
19. Abbod, M.F.; Catto, J.W.; Linkens, D.A.; Hamdy, F.C. Application of artificial intelligence to the management of urological cancer. J. Urol. 2007, 178, 1150–1156.
20. Cross, S.S.; Harrison, R.F.; Kennedy, R.L. Introduction to neural networks. Lancet 1995, 346 1075–1079.
,
21. Hagan, M.T.; Demuth, H.B.; Beale, M. Neural Network Design, 1st ed.; PWS Publishing Co: Boston, MA, USA, 1996; pp. 134–157.
22. Raoufy, M.R.; Vahdani, P.; Alavian, S.M.; Fekri, S.; Eftekhari, P.; Gharibzadeh, S. A novel method for diagnosing cirrhosis in patients with chronic hepatitis B: Artificial neural network approach. J. Med. Syst. 2011, 35, 121–126.
23. Dariani, S.; Keshavarz, M.; Parviz, M.; Raoufy, M.R.; Gharibzadeh, S. Modeling force-velocity relation in skeletal muscle isotonic contraction using an artificial neural network. Biosystems 2007, 90, 529–534.
24. Susan, M.G.; Peter, T.W.; Keong, L.; Timothy, W.B. The effect of location, strategy, and operations technology on hospital performance. J. Oper. Manag. 2002, 20, 63–75.
25. Anke, N.; Josiane, H.; Jean-Roger, L.G.; Eric, L. Measuring performance in health care: Case-mix adjustment by boosted decision trees. Artif. Intell. Med. 2004, 32, 97–113.
26. Berg, M.; Meijerink, Y.; Gras, M. Feasibility first: Developing public performance indicators on patient safety and clinical effectiveness for Dutch hospitals. Health Policy 2005, 75, 59–73.
27. Kovacst, J.M.; Malczewski, J.; Flores-Verdugo, F. Examining local ecological knowledge of hurricane impacts in a mangrove forest using an analytical hierarchy process (AHP) approach. J. Coast. Res. 2004, 20, 792–800.
28. Zhang, R.Q.; Zhang, X.D.; Yang, J.Y.; Yuan, H. Wetland ecosystem stability evaluation by using Analytical Hierarchy Process (AHP) approach in Yinchuan Plain, China. Math. Comput. Model. 2013, 57, 366–374.
29. Mirvakili, S.M.; Faghihi, F.; Khalafi, H. Developing a computational tool for predicting physical parameters of a typical VVER-1000 core based on artificial neural network. Ann. Nuclear Energy 2012, 50, 82–93.
30. Zhe, W.; Fei, W.; Shi, S. Solar irradiance short-term prediction model based on BP neural network. Energy Procedia 2011, 12, 488–494.
31. Li, Z.; Luo, J.H.; Yang, S.Y. Forecasting box office revenue of movies with BP neural network. Expert Syst. Appl. 2009, 36, 6580–6587.
32. Wang, H.W. Partial Least-Squares Regression-Method and Applications; National Defence Industry Press: Beijing, China, 1999.
33. Emilio, M.; Marco, B.; Elisa, R.; Marcello, L. Hydroxyl and acid number prediction in polyester resins by near infrared spectroscopy and artificial neural networks. Anal. Chim. Acta 2004, 511, 313–322.
34. Shi, F.; Wang, H.; Yu, L.; Hu, F. MATLAB Intelligence Algorithm: The 30 Cases, 1st ed.; Beijing University of Aeronautics and Astronautics Press: Beijing, China, 2011; pp. 237–245.
35. Richard, L.; Mohammed, A.M.; David, S.; Richard, T. Use and misuse of process and outcome data in managing performance of acute medical care: Avoiding institutional stigma. Lancet 2004, 363, 1147–1154.
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
|
<urn:uuid:7ea2b287-4de5-4e06-a569-f6231825ee7c>
|
CC-MAIN-2014-23
|
http://www.mdpi.com/1660-4601/10/8/3619/pdf
|
2014-07-22T22:06:47Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1405997865523.12/warc/CC-MAIN-20140722025745-00239-ip-10-33-131-23.ec2.internal.warc.gz
| 904,430,581 | 6,449 |
eng_Latn
|
eng_Latn
| 0.915959 |
eng_Latn
| 0.985227 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1965,
5676,
9313,
11140,
14018,
15617,
16776,
16845,
17286,
18948,
19700,
22293,
25032,
28197,
29293
] |
CLASS: M.Sc. BIOCHEMISTRY
15A/ 220
St. JOSEPH'S COLLEGE (AUTONOMOUS) TIRUCHIRAPPALLI – 620 002
SEMESTER EXAMINATIONS – APRIL 2015
TIME: 3 Hrs.
MAXIMUM MARKS: 100
| SEM | SET | PAPER CODE |
|---|---|---|
| IV | 2013 | 12PBI4113 |
SECTION – A
Answer all the questions:
20 x 1 = 20
Choose the correct answer:
1. The phenolic compound secreted by injured cells of dicot plants is ________.
a) Taxol
b) Quinol
c) Acetosyringone
d) None of the above
2. Tin polymerase used in PCR is obtained from _______.
a) Thermus aquaticus
b) Thermus indicus
c) Both
d) None of the above
3. Any excised part of plants to be used in tissue culture is called _______.
a) Explants
b) Cybrids
c) Hybrids
d) None of the above
4. Golden rice is rich source of _______.
a) Vitamin E
b) Vitamin C
c) Vitamin A
d) None of the above
5. Which of the following can be used as the platform for DNA microarray.
a) Poly lysine
b) Poly glutamate
c) Poly vinyl pyrolidine
d) None of the above
Fill in the blanks:
6. Restriction enzymes from different sources acting on the same sequences are termed _______.
7. Protein biding sequences on DNA can be determined using _______ analysis.
8. The phenotopic variation of cultured plants is termed _______.
9. Expand: ICSI.
10. DNA spot on a micro array is termed _______.
State True or False:
11. Agrobacterium infects monocot plants.
12. Duration of a granted patent is 5 years.
13. SCID mice is a knock out mice.
14. Bacillus anthracis was used as biological weapon.
15. Microarray analysis can be useful for monitoring co regulated genes.
Answer in one or two sentences:
16. List out the antibiotic resistance genes contained in PBR 322 .
17. Comment on plant breeder's right.
18. What are biological weapons?
19. What are cybrids?
20. Comment on stem cell niche.
Answer all the questions:
5 x 4 = 20
21. a. Give a brief account on restriction enzymes.
OR
b. Describe the gene transfer mechanism mediated by Agrobacterium.
22. a. Explain the mechanism of GURT.
OR
b. Explain the principle involved in PCR.
23. a. Comment on bioleaching.
OR
b. Give a brief account on biopesticides.
24. a. Explain the principles of 'Eugenics'.
OR
b. List out any four agricultural applications of biotechnology.
25. a. List out the features of stem cells.
OR
b. List out the applications of microarray.
SECTION – C
Answer any FOUR questions:
26. Write an essay on cloning vehicles.
27. Describe the methods of recombinant selection.
28. Write an essay on gene transfer methods.
29. Give a detailed account on the strategies of gene therapy.
30. Explain the features of embryonic stem cells.
**************
4 x 15 = 60
|
<urn:uuid:c4c3ca11-9359-4b51-867f-862686045d0b>
|
CC-MAIN-2017-22
|
http://mail.sjctni.edu:8085/moodle/pluginfile.php/137/mod_folder/content/0/PG/Biochemistry/220-b.pdf?forcedownload=1
|
2017-05-27T17:39:35Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608984.81/warc/CC-MAIN-20170527171852-20170527191852-00031.warc.gz
| 285,466,248 | 742 |
eng_Latn
|
eng_Latn
| 0.901036 |
eng_Latn
| 0.967068 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
992,
1821,
2356,
2676
] |
CANADA’S FISH AND SEAFOOD TRADE WITH THE UNITED STATES OF AMERICA, 2019
Economics, Statistics and Data Governance Directorate
Strategic Policy Sector
Fisheries and Oceans Canada
© Her Majesty the Queen in Right of Canada, 2021.
Please refer to http://www.dfo-mpo.gc.ca/notices-avis-eng.htm
Cat. Fs1-91E-PDF ISSN 2562-8070
Published by: Economics, Statistics, and Data Governance Directorate,
Strategic Policy Sector, Fisheries and Oceans Canada, Ottawa, Ontario, K1A 0E6
Correct Citation for this publication:
Fisheries and Oceans Canada. 2021. Canada’s Fish and Seafood Trade with the United States of America, 2019. Ottawa: DFO. ii + 15 p.
Value of Canada’s fish and seafood exports to the US (Canada’s largest export destination by value) was $4.56B\(^1\) in 2019, accounting for 61 per cent of total Canadian fish and seafood exports by value.
Canadian fish and seafood export value to the US increased 7 per cent (+$286M) between 2018 and 2019.
Quantity of exports was 299 thousand tonnes and remained almost the same as in 2018, with less than a 1 per cent increase. Fish and seafood export prices to the US increased 6 per cent during the same period.
### Canada’s Top 3 Fish and Seafood Exports to the US, 2019
| Species | Value of Exports ($B) | Change\(^2\) of Values (%) | Change of Volumes (%) | Change of Prices (%) | Share\(^3\) of Exports (%) | CAGR\(^4\) of Value (%) |
|-----------|-----------------------|-----------------------------|-----------------------|----------------------|---------------------------|-------------------------|
| Lobster | 1.64 | 8.0 | -3.3 | 11.7 | 63.2 | 1.6 |
| Crab | 1.02 | 22.6 | 22.6 | 0.0 | 69.6 | 12.0 |
| Salmon | 0.96 | -5.6 | -1.5 | -4.1 | 91.2 | 5.8 |
| Other | 0.94 | 3.7 | -3.0 | 6.9 | 40.2 | 1.0 |
| **Total** | **4.56** | **6.7** | **0.4** | **6.3** | **61.2** | **4.3** |
Top species exported were lobster\(^5\) ($1.64B), crab\(^6\) ($1.02B) and salmon ($0.96B), accounting for 79 per cent of total Canadian fish and seafood export value to the US.
Main other species exported were halibut ($138M), scallop ($107M) and mussel ($51M).
Top exporting provinces were New Brunswick ($1.45B), Nova Scotia ($1.02B) and British Columbia ($0.85B).
Canada continued to be a net exporter of fish and seafood products to the US, with imports from the US worth $1.43B. With 33 per cent of Canada’s total fish and seafood imports by value, the US was Canada’s largest supplier of fish and seafood products. The main imported species were lobster ($417M), salmon ($409M) and crab ($84M).
---
\(^1\) Trade statistics are sourced from Statistics Canada, and were accessed through: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed: February 17, 2020. No endorsement of this product by Statistics Canada is implied.
\(^2\) The term “change” indicates yearly change from the previous year, unless otherwise specified.
\(^3\) Share of Canada’s total exports for the given species/total.
\(^4\) Compound annual growth rate from 2015 to 2019.
\(^5\) Lobster refers to the *Homarus* species.
\(^6\) Canadian exports of crab refer to snow crab, Dungeness crab and unspecified crab species. Based on exporting provinces and Canadian crab species landings data, Canadian exports of crab consist principally of snow crab.
Acronyms and Notes
CAGR Compound annual growth rate
CUSMA Canada-United States-Mexico Agreement
DFO Department of Fisheries and Oceans Canada
EU European Union
MMPA Marine Mammal Protection Act
NAFTA North American Free Trade Agreement
US United States of America
1) Unless otherwise indicated, trade statistics are sourced from Statistics Canada, and were accessed through: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed: February 17, 2020. No endorsement of this product by Statistics Canada is implied.
2) When sources other than Statistics Canada are indicated, note that export statistics reported by one territory are often not the same as the import statistics reported by its trade partner. Import statistics often include additional shipping costs, and territories may apply different rules in the accounting of international trade.
3) Values are nominal not accounting for inflation.
4) Throughout this report’s tables, the term “change” indicates yearly change from the previous year, unless otherwise specified.
5) Compound annual growth rate (CAGR) is used to take into account variances in growth during interim years.
6) Unless otherwise specified, lobster refers to the *Homarus* species.
7) Canadian exports of crab refer to snow crab, Dungeness crab and unspecified crab species, unless otherwise specified. Based on exporting provinces and Canadian crab species landings data, total Canadian exports of crab consist principally of snow crab.
# Table of Contents
Acronyms and Notes .................................................................................................................. i
Canada’s Fish and Seafood Exports ......................................................................................... 1
Canada’s Fish and Seafood Exports to the US ........................................................................ 2
Canada’s Fish and Seafood Exports to the US by Species ..................................................... 4
- Lobster (largest export) ........................................................................................................... 5
- Crab (2nd largest export) ....................................................................................................... 7
- Salmon (3rd largest export) .................................................................................................... 8
- Other Species .......................................................................................................................... 10
Canada’s Fish and Seafood Exports to the US by Province and Territory ......................... 12
Canada’s Fish and Seafood Imports from the US .................................................................. 13
## List of Tables
Table 1. Canada’s Fish and Seafood Exports to the US, 2015-2019 ........................................ 3
Table 2. Canada’s Top 10 Fish and Seafood Exports to the US, 2019 ...................................... 11
Table 3. Canada’s Fish and Seafood Exports to the US by Province and Territory, 2019 .... 12
Table 4. Canada’s Fish and Seafood Imports from the US, 2015-2019 .................................. 13
Table 5. Canada’s Top 10 Fish and Seafood Imports from the US, 2019 .............................. 14
## List of Figures
Figure 1. Canada’s Fish and Seafood Exports by Destination, 2019 ($M) ............................ 1
Figure 2. Canada’s Fish and Seafood Exports to the US, 2015-2019 .................................... 2
Figure 3. Canada’s Top 10 Fish and Seafood Exports to the US, 2019 ($M) ......................... 4
Figure 4. Canada’s Lobster Exports by Destination, 2019 ($M) ........................................... 5
Figure 5. Canada’s Lobster Exports to the US, 2015-2019 .................................................. 6
Figure 6. Canada’s Crab Exports by Destination, 2019 ($M) ............................................... 7
Figure 7. Canada’s Crab Exports to the US, 2015-2019 ...................................................... 8
Figure 8. Canada’s Salmon Exports by Destination, 2019 ($M) .......................................... 8
Figure 9. Canada’s Salmon Exports to the US, 2015-2019 .................................................. 9
Canada’s Fish and Seafood Exports
In 2019, Canada’s total fish and seafood exports were valued at $7.44B with an increase of 7 per cent from the previous year. The top five destinations for Canadian fish and seafood exports in rank order of value were:
| Destination | Value |
|----------------------|---------|
| United States (US) | $4.56B |
| China | $1.31B |
| European Union (EU) | $0.51B |
| Japan | $0.29B |
| Hong Kong | $0.24B |
Together, these destinations accounted for 93 per cent of Canada’s fish and seafood total export value in 2019.
Figure 1. Canada’s Fish and Seafood Exports by Destination, 2019 ($M)
Source: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed February 17, 2020. Adapted from Statistics Canada, International Trade Data. This does not constitute an endorsement by Statistics Canada of this product.
Canada’s Fish and Seafood Exports to the US
In 2019, Canada’s fish and seafood exports to the US were valued at $4.56B, accounting for 61 per cent of total Canadian fish and seafood exports by value. The US remained by far Canada’s largest fish and seafood export destination.
Canadian fish and seafood export value to the US increased 7 per cent (+$286M) between 2018 and 2019. Quantity of exports was 299 thousand tonnes and remained almost the same as in 2018, with less than a 1 per cent increase. Fish and seafood export prices to the US increased 6 per cent during the same period.
Since 2015, Canada’s exports of fish and seafood to the US grew in value by 4 per cent per year on average driven by price increases, as fish and seafood export prices grew by 7 per cent annually (on average) and quantity exported decreased 2 per cent per year.
The US is an important fish and seafood importer and Canada’s most valuable trading partner. In 2019, the US ($31.2B) was the second largest importer of fish and seafood worldwide after the EU ($40.5B) and followed by China ($24.6B) and Japan ($20.6B)\(^7\). According to the US Bureau of Census, Canada was the top supplier of fish and seafood to the US by value, representing 15 per cent of the US import market share in 2019. Canada was followed by India (11 per cent), Chile (10 per cent), China (9 per cent) and Indonesia (8 per cent).\(^8\)
Because of its geographical proximity and close trading relationship, the US remains an important opportunity for Canada’s fish and seafood exports. However, the concentration of Canadian fish and seafood exports to the US market could leave Canada vulnerable to fluctuations in the US economy, as was highlighted by the effects of the 2008 global recession, changing consumer demands, changes in US fisheries policies or non-tariff barriers to trade.
For instance, the challenging negotiation of a successor to the North American Free Trade Agreement (NAFTA), the Canada-US-Mexico Agreement (CUSMA), highlighted the risks that come along with the benefits of having convenient access to a single large trade partner. CUSMA will preserve NAFTA’s virtually tariff-free market access for Canadian exports, while addressing modern trade challenges, and making it easier for Canadian exporters to claim preferential tariff treatment\(^9\). On July 1, 2020, the new Canada-United States-Mexico Agreement (CUSMA) entered into force.
---
\(^7\) Retrieved March 9, 2020 via the Global Trade Tracker.
\(^8\) Retrieved March 9, 2020 via the Global Trade Tracker, seafood trade statistics collected by the US Department of Commerce: Bureau of Census. Import data reported by one country may differ from the reported exports of its trade partners.
\(^9\) Global Affairs Canada, The Canada-United States-Mexico Agreement (https://www.international.gc.ca/trade-commerce/assets/pdfs/agreements-accords/cusma-aceum/CUSMA-impact-repercussion-en.pdf, accessed March 10 2020)
From a market access perspective, it is also worth noting that the US will require fish and seafood imports to comply with the Marine Mammal Protection Act (MMPA) Import Provisions, beginning January 1, 2022. To maintain U.S. market access under the MMPA, exporting nations, including Canada, will have to meet US standards to mitigate harm to marine mammals. Canada is working to meet the requirements of the US MMPA Import Provisions in close collaboration with Canadian harvesters and other stakeholders.
**Canada’s Fish and Seafood Exports to the US by Species**
In 2019, Canada’s top fish and seafood exports by value to the US were lobster ($1.64B), crab ($1.02B) and salmon ($957M). Together, these three species accounted for 79 per cent of total Canadian fish and seafood exports by value to the US.
*Figure 3. Canada’s Top 10 Fish and Seafood Exports to the US, 2019 ($M)*
| Species | Value ($M) |
|-----------|------------|
| Lobster | 1,637 |
| Crab | 1,021 |
| Salmon | 957 |
| Halibut | 138 |
| Scallop | 107 |
| Mussel | 51 |
| Herring | 42 |
| Cod | 40 |
| Oyster | 37 |
| Clam | 36 |
| Other | 491 |
Source: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed February 17, 2020. Adapted from Statistics Canada, *International Trade Data*. This does not constitute an endorsement by Statistics Canada of this product.
Lobster (largest export)
In 2019, Canada’s lobster exports to the US were valued at $1.64B. Although its share of total lobster export value dropped from 75 per cent in 2015 to 63 per cent in 2019, the US remained, by far, Canada’s largest export destination for lobster.
By value, Canada’s lobster exports to the US mostly consisted of frozen (67 per cent in 2019) and live (32 per cent) lobster.
In 2019, New Brunswick ($841M) and Nova Scotia ($469M) continued to be the main provinces exporting lobster to the US with respectively 51 and 29 per cent of total lobster exports share by value. They were followed by Prince Edward Island ($171M), Quebec ($100M) and Newfoundland and Labrador ($56M), sharing respectively 10, 6 and 3 per cent of Canada’s lobster export value to the US in 2019.
Canada’s lobster export value to the US increased 8 per cent (+$121M) between 2018 and 2019, while quantities exported declined by 3 per cent and export prices increased 12 per cent. Prior to 2019, the value of lobster exports to the US remained relatively flat, even as quantities declined, supported by good prices.
The overall trend in value of Canada’s lobster exports to the US over recent years has been characterized by an annualized growth rate of 2 per cent since 2015. During the
same period, quantity of lobster exported to the US decreased 4 per cent annually, while export prices increased 6 per cent per annum.
**Figure 5. Canada’s Lobster Exports to the US, 2015-2019**
Note that Canada, mainly the province of New Brunswick, also imports large amounts of live lobster from the US for processing which is then destined for export back to the US market. *Homarus americanus* comprises practically all the global supply of *Homarus* lobster and is caught almost entirely in Canada and the US. Small amounts of another *Homarus* species, the European lobster (*Homarus gammarus*), are also caught in the EU. Unlike the rock or spiny lobsters\(^{10}\), which have no large edible claws, the *Homarus* species of lobster is clawed and the meat in its claws, body, and tail is commercialized. In contrast, the rock or spiny lobster only has marketable meat in its tail. Another clawed lobster species, the Norway lobster\(^{11}\), also forms an important global catch, but the species is much smaller and is sold separately on markets, mainly within the EU.
---
\(^{10}\) of the *Palinuridae* family
\(^{11}\) *Nephrops norvegicus*
Crab (2nd largest export)
In 2019, the US remained the largest export destination for Canadian crab, accounting for 70 per cent, or $1.02B, of Canada’s total crab export value. By value, 82 per cent of Canadian crab exported to the US was frozen snow crab\(^{12}\).
**Figure 6. Canada’s Crab Exports by Destination, 2019 ($M)**
| Destination | Value |
|-------------|---------|
| US | 1,021 |
| China | 266 |
| Japan | 66 |
| Viet Nam | 43 |
| Indonesia | 42 |
| Hong Kong | 12 |
| Singapore | 6 |
| EU | 6 |
| Taiwan | 1 |
| Thailand | 1 |
| Other | 2 |
*Source: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed February 17, 2020.*
*Adapted from Statistics Canada, International Trade Data. This does not constitute an endorsement by Statistics Canada of this product.*
Newfoundland and Labrador ($320M), New Brunswick ($238M), Quebec ($221M), and Nova Scotia ($186M) shared essentially all (94 per cent by value) of Canadian crab exports to the US.
In 2019, Canada’s value of crab exports to the US increased 23 per cent (+$188M) from the previous year, returning to the longer term trend after a decline in 2018 (-11%) that was coincident with a sharp drop in Canadian landings. Export prices of Canadian crab to the US remained stable from 2018 to 2019, after several years of strong increases.
The value of Canadian exports of crab to the US has grown at an annualized rate of 12 per cent since 2015. Crab export prices have increased 14 per cent annually, while quantity exported decreased by 2 per cent per annum during the same period.
---
\(^{12}\) In 2019, 11 per cent ($117M) of Canada’s crab exports to the US was labelled as unspecified frozen crab, which, based on exporting provinces and Canadian crab species landings data, would mostly be snow crab.
Salmon (3rd largest export)
In 2019, Canada’s salmon exports to the US were valued at $957M, representing 91 per cent of Canada’s total salmon export value. By value, 87 per cent of Canada’s exports of salmon to the US was Atlantic salmon.
Figure 8. Canada’s Salmon Exports by Destination, 2019 ($M)
| Destination | Value ($M) |
|-------------|-----------|
| US | 957 |
| Japan | 26 |
| EU | 23 |
| Taiwan | 10 |
| China | 10 |
| Israel | 9 |
| Viet Nam | 4 |
| Hong Kong | 2 |
| Thailand | 1 |
| Australia | 1 |
| Other | 5 |
Source: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed February 17, 2020. Adapted from Statistics Canada, International Trade Data. This does not constitute an endorsement by Statistics Canada of this product.
In 2019, British Columbia ($636M) and New Brunswick ($290M) were practically the only exporting provinces of salmon products to the US with respectively 66 per cent and 30 per cent of the share of total salmon exports to the US by value.
In 2019, the value of Canada’s salmon exports to the US experienced a 6 per cent decrease (-$57M) from the previous year. This decrease was mostly attributable to a decline in salmon export prices (-4 per cent) as quantity of Canadian salmon exported to the US decreased by 1 per cent during the same period.
Salmon exports to the US increased substantially between 2015 and 2016 due to strong growth in Canadian production of farmed Atlantic salmon\(^{13}\) combined with high prices globally.\(^{14}\) Exports have remained relatively flat since 2016. On an annualized basis, salmon exports to the US grew at a rate of 6 per cent per year in value since 2015. Salmon export prices have increased 7 per cent annually, while quantity exported decreased by 1 per cent per annum during the same period.
**Figure 9. Canada’s Salmon Exports to the US, 2015-2019**
![Graph showing salmon exports to the US from 2015 to 2019]
*Source: Fisheries and Oceans Canada (2020), EXIM [database], Ottawa. Accessed February 17, 2020.*
---
\(^{13}\) Statistics Canada. [Table 32-10-0107-01 Aquaculture, production and value](http://www.statcan.gc.ca/tables-tableaux/sum-som/l01/cst01/aqua01a-eng.htm).
\(^{14}\) FAO. “Severely elevated prices in 2016 has salmon sector searching for solutions.” [http://www.fao.org/in-action/globefish/market-reports/resource-detail/en/c/902748/](http://www.fao.org/in-action/globefish/market-reports/resource-detail/en/c/902748/)
Other Species
In 2019, Canadian exports of species other than lobster, salmon and crab to the US were valued at $941M, representing 21 per cent of Canada’s total fish and seafood export value to the US. The main other species exported to the US in 2019 were halibut ($138M), scallop ($107M) and mussel ($51M).
In 2019, Canada’s exports of halibut to the US were valued at $138M, representing 73 per cent of Canada’s total halibut export value. By value, 68 per cent of Canada’s exports of halibut to the US consisted of fresh Atlantic halibut, 26 per cent of fresh Pacific halibut and 6 per cent of frozen unspecified halibut. Nova Scotia ($73M), British Columbia ($35M) and Newfoundland and Labrador ($19M) were the main provinces exporting halibut products to the US in 2019.
Canada’s exports of scallop to the US were valued at $107M in 2019, representing 57 per cent of Canada’s total scallop export value. Mostly Nova Scotia ($92M), but also New Brunswick ($13M) were the main exporting provinces of scallop products to the US with respectively 86 and 12 per cent of total share of scallop exports to the US by value.
The US also represented Canada’s main market for a number of other species. For example, in 2019, more than 90 per cent of the value of Canadian exports of mussel (91 per cent), haddock (95 per cent), pickerel (100 per cent) or perch (98 per cent) was destined to the US. This proportion was also noteworthy for cod (66 per cent), oysters (86 per cent) and tuna (74 per cent).
Table 2. Canada’s Top 10 Fish and Seafood Exports to the US, 2019
| Species | Value of Exports ($M) | Change of Values (%) | Change of Volumes (%) | Change of Prices (%) | Share of Exports (%) |
|---------|----------------------|----------------------|-----------------------|----------------------|---------------------|
| Lobster | 1,637 | 8.0 | -3.3 | 11.7 | 63.2 |
| Crab | 1,021 | 22.6 | 22.6 | 0.0 | 69.6 |
| Salmon | 957 | -5.6 | -1.5 | -4.1 | 91.2 |
| Halibut | 138 | 7.1 | 6.6 | 0.5 | 72.7 |
| Scallop | 107 | 6.2 | 4.7 | 1.4 | 57.4 |
| Mussel | 51 | 4.1 | 1.7 | 2.3 | 91.1 |
| Herring | 42 | -1.9 | -2.8 | 1.0 | 30.9 |
| Cod | 40 | -15.9 | -14.8 | -1.3 | 65.5 |
| Oyster | 37 | 23.4 | 7.4 | 14.9 | 85.8 |
| Clam | 36 | 2.8 | 1.5 | 1.3 | 26.9 |
| Other | 491 | 3.6 | -4.8 | 8.8 | 31.9 |
| **Total** | **4,556** | **6.7** | **0.4** | **6.3** | **61.2** |
In 2019, New Brunswick was the top fish and seafood exporting province to the US by value. The province exported $1.45B worth of fish and seafood products to the US, with lobster ($841M), salmon ($290M) and crab ($238M) as the main species exported by value. The other top exporting provinces in 2019 were Nova Scotia ($1.02B), British Columbia ($847M) and Newfoundland and Labrador ($477M).
Table 3. Canada’s Fish and Seafood Exports to the US by Province and Territory, 2019
| Province and Territory | Value ($M) | Quantity (thousand tonnes) | Main species | Share* % |
|------------------------|------------|----------------------------|--------------|---------|
| New Brunswick | 1,453 | 74 | Lobster | 57.9 |
| | | | Salmon | 19.9 |
| | | | Crab | 16.4 |
| Nova Scotia | 1,020 | 60 | Lobster | 46.0 |
| | | | Crab | 18.2 |
| | | | Scallop | 9.0 |
| British Columbia | 847 | 84 | Salmon | 75.0 |
| | | | Crab | 4.8 |
| | | | Halibut | 4.2 |
| Newfoundland and Labrador | 477 | 33 | Crab | 67.0 |
| | | | Lobster | 11.7 |
| | | | Halibut | 4.0 |
| Quebec | 357 | 14 | Crab | 61.9 |
| | | | Lobster | 28.0 |
| | | | Shrimp | 2.6 |
| Prince Edward Island | 252 | 19 | Lobster | 67.6 |
| | | | Mussel | 17.0 |
| | | | Crab | 5.7 |
| Other | 150 | 14 | Pickerel | 10.7 |
| | | | Perch | 9.9 |
| | | | Whitefish | 9.5 |
* of province’s fish and seafood exports to the US
Canada’s Fish and Seafood Imports from the US
In 2019, Canada continued to be a net exporter of fish and seafood products to the US, with imports from the US worth $1.43B. With 33 per cent of Canada’s total fish and seafood imports by value, the US was Canada’s largest supplier of fish and seafood products, followed by China (15 per cent), Thailand (8 per cent) and Vietnam (7 per cent).
In 2019, Canada’s fish and seafood import value from the US increased 5 per cent (+$67M) relative to 2018. Quantity of imports was 172 thousand tonnes with a 5 per cent decline since 2018, while fish and seafood import prices from the US increased 10 per cent during the same period.
Table 4. Canada’s Fish and Seafood Imports from the US, 2015-2019
| Year | Value of Imports ($B) | Change of Values (%) | Change of Volumes (%) | Change of Prices (%) |
|------|-----------------------|----------------------|-----------------------|----------------------|
| 2015 | 1.29 | 12.5 | -3.1 | 16.1 |
| 2016 | 1.46 | 13.3 | 2.0 | 11.1 |
| 2017 | 1.32 | -9.3 | -2.3 | -7.2 |
| 2018 | 1.37 | 3.3 | -0.7 | 4.1 |
| 2019 | 1.43 | 4.9 | -5.0 | 10.5 |
| Average | 1.37 | CAGR 2.7 | CAGR -1.5 | CAGR 4.3 |
In 2019, the top species imported from the US were lobster ($417M), salmon ($409M) and crab ($84M). Together, these three species accounted for 64 per cent of total Canadian fish and seafood imports by value from the US.
With 99 per cent of total lobster import value, the US is considered the sole provider of lobster to Canada. Most lobster imports from the US consist of live lobster that is destined for processing to be then exported back to the US market.
In 2019, the US was Canada’s top supplier of salmon (55 per cent) followed by Chile (22 per cent), with import values of $409M and $163M respectively. By value, 38 per cent of salmon imports from the US were sockeye salmon, either canned ($64M) or whole frozen ($64M) or fresh ($29M).
### Table 5. Canada’s Top 10 Fish and Seafood Imports from the US, 2019
| Species | Value of Imports ($M) | Change of Values (%) | Change of Volumes (%) | Change of Prices (%) | Share of Imports (%) |
|---------|-----------------------|----------------------|-----------------------|----------------------|---------------------|
| Lobster | 417 | 7.9 | -12.6 | 23.4 | 99.1 |
| Salmon | 409 | 15.0 | 15.2 | -0.2 | 55.1 |
| Crab | 84 | -9.8 | -23.9 | 18.6 | 50.8 |
| Scallop | 53 | 1.4 | -0.4 | 1.8 | 58.9 |
| Halibut | 38 | 14.2 | 18.0 | -3.2 | 66.5 |
| Cod | 25 | -4.1 | 1.6 | -5.6 | 21.9 |
| Tuna | 17 | -34.1 | -31.2 | -4.2 | 6.2 |
| Shrimp | 16 | -3.9 | 10.0 | -12.6 | 2.3 |
| Oyster | 14 | -13.2 | -12.4 | -0.9 | 53.4 |
| Trout | 11 | 16.8 | 7.3 | 8.9 | 12.9 |
| Other | 349 | -0.5 | -7.4 | 7.4 | 21.5 |
| **Total** | **1,433** | **4.9** | **-5.0** | **10.5** | **33.5** |
**Note:** In preparing this document, the authors have taken care to provide information that is timely and accurate at the time of publication. Since trade market conditions are dynamic, some information presented here may have changed since this document was published. Information contained in this document does not necessarily reflect official policies of Fisheries and Oceans Canada.
Prepared by:
Economics, Statistics and Data Governance Directorate
Fisheries and Oceans Canada, Ottawa
For more information: Please email InfoECON (DFO/MPO):
[email protected]
© Her Majesty the Queen in Right of Canada, 2021
Information contained in this publication or product may be reproduced, in part or in whole, and by any means, for personal or public non-commercial purposes, without charge or further permission, unless otherwise specified.
|
0176ce05-98f0-4821-99b8-92691e65063a
|
CC-MAIN-2024-18
|
https://waves-vagues.dfo-mpo.gc.ca/library-bibliotheque/40966410.pdf
|
2024-04-25T05:17:23+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-18/subset=warc/part-00188-29538f81-5664-4df2-acb6-7d8ba3d2a1aa.c000.gz.parquet
| 549,535,553 | 7,444 |
eng_Latn
|
eng_Latn
| 0.890553 |
eng_Latn
| 0.978317 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"pol_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
178,
648,
3867,
5367,
8167,
9086,
9940,
12051,
13526,
14815,
15972,
17882,
18785,
20479,
21984,
23832,
26525,
28845,
31570
] |
TREGUA OLIMPICA: E' NECESSARIO IL DIALOGO FRA I PAESI
07/07/2005 - 18:33
Braghero, presidente di "Peace Weaves":"Le future Olimpiadi siano ponte di pace"
L'associazione onlus "PeaceWaves" (www.treguaolimpica.peacewaves.org/lignano2005), presente a Lignano in questi giorni di Gare olimpiche della Gioventù europea per promuovere il progetto "Tregua Olimpica: una sfida per lo sport, un'opportunità per la pace", da cinque anni lavora sul territorio italiano per una migliore acquisizione dello spirito olimpico e per la sua trasformazione in concrete azioni di cessazione dei conflitti. PeaceWaves opera attraverso mirate campagne di sensibilizzazione e azioni di apertura rivolte ai giovani e alla cittadinanza intera affinché, mediante la discussione pubblica, la Tregua Olimpica venga diffusa e si sostengano concretamente i diritti umani e le pari opportunità all'interno di una visione interculturale. "Ora più che mai c'è bisogno di fermarsi a riflettere – dichiara Braghero, poco dopo aver appreso le tragiche notizie che hanno insanguinato Londra - sul significato più profondo della Tregua. Questa si deve intendere come azione che parta dal basso, dalle realtà che operano nei territori della città, realizzando progetti a livello locale, nazionale ed internazionale.
I fatti di oggi – continua - sono tragici e sarebbe facile lasciarsi trascinare dall'emotività e rispondere chiudendosi in se stessi e al dialogo con gli altri. Ma sono solo lo scambio di opinioni e il confronto le modalità attraverso cui si deve procedere per conquistare la pace".
Braghero ha voluto commentare nello specifico i fatti di oggi: " Non credo siano riconducibili – ha spiegato – alla vittoria di Londra come capitale delle Olimpiadi del 2012. Forse, se una relazione ci deve essere, bisognerebbe cercarla nel G8 in Scozia. In ogni caso, al di là di ogni connessione che potrebbe essere del tutto casuale o errata, credo che gli attentati di oggi, proprio in quanto così disastrosi e fatali a molti innocenti, siano stati preparati da lungo tempo". Il presidente di PeaceWaves ha poi voluto fare il punto sulle possibili strategie da adottare per arrivare ad una cessazione dei conflitti e alla conquista della pace. "Londra, e più in generale l'Europa, – ha commentato - deve procedere verso i Giochi di Torino e di Pechino cogliendo l'occasione per riflettere su temi importanti quali il valore educativo e l'importanza della diffusione della Tregua, che deve essere intesa e "messa in moto" mediante campagne di sensibilizzazione, dibattiti, incontri di tutti i Paesi Solo mediante i fatti si può procedere a risolvere i conflitti". "Il nostro obiettivo – ha concluso il presidente di PeaceWaves - deve essere quello di sfruttare tutti i canali possibili per dialogare fra Paesi e per isolare così il terrorismo. Solo così si sconfiggeranno i terroristi e gli attentati non avranno modo di insanguinare il pianeta".
VC
www.lignano2005.it
OLYMPIC TRUCE: DIALOGUE BETWEEN COUNTRIES IS NECESSARY
07/07/2005 - 18:33
Braghero, president of "Peace Weaves": "The future Olympic Games as bridge to peace"
The no
profit organization
"PeaceWaves"
(www.treguaolimpica.peacewaves.org/lignano2005), is present in Lignano at the European Youth Olympic Festival to promote the project "Olympic Truce: a challenge for sport, an opportunity for peace" and it has been working for five years in Italy to improve the Olympic spirit and to use it to stop the conflicts. PeaceWaves works by means of awareness and open-mindedness campaigns for the young and the citizens, to spread the Olympic Truce and to concretely support the human rights and the equal opportunities in an intercultural view. "Now more than ever we need to stop and think –said Borghiero after the tragic news that steeped London in blood- about the deepest meaning of the Truce that needs to start from the local levels by means of local, national and international projects. Today's events -he added- are tragic and it could be easy to get influenced by emotions and to become withdrawn, but we need discussions and comparison to gain peace". Braghere wanted to talk especially about today's events: "I don't think they depend on the victory of London to host the 2012 Olympic Games -he added- Maybe they could depend on the G8 in Scotland. Anyway, since they were disastrous and fatal for many innocent victims, I think they have been planned since long time". PeaceWaves' president talked also about the possible strategies to stop the conflicts and gain peace.
"London, and more precisely Europe –he said- needs to think about the Games of Turin and Beijing and about important values as education and the Truce diffusion that need to be understood and based on awareness campaigns, discussions, meetings of all countries. Only this could help to resolve conflicts". "Our purpose -concluded PeaceWaves' president- is to use every possible communication channel for the dialogue between countries in order to isolate terrorism. That is the only way to defeat terrorism and attacks".
|
<urn:uuid:6b59a8f5-147e-434a-9763-4b1eb45486f5>
|
CC-MAIN-2018-51
|
http://www.peacewaves.org/multimedia/rassegna_stampa/art0082.pdf
|
2018-12-10T05:08:29Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823303.28/warc/CC-MAIN-20181210034333-20181210055833-00108.warc.gz
| 478,729,194 | 1,300 |
eng_Latn
|
eng_Latn
| 0.499588 |
ita_Latn
| 0.934733 |
[
"ita_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2925,
5052
] |
Preregistration is required for all Presentations/Seminars.
All presentations are FREE and take place at the Joslyn Center, Lounge.
MEDICARE & VITALITY CENTER – INTER VALLEY HEALTH PLAN The Vitality Series is open to those 55 and over. Learn how to keep your vitality and be healthy! Join in on free screenings, informative presentations,
Doc talks and refreshments!
DAY & TIME:
Tuesdays, 9 am-12 pm
PRESENTATIONS:
Please call (626) 384-5380 to reserve your place at the following seminars.
- JANUARY 21 – DRIVE WELL
Discussion on when it's time to give up the keys. Behind the wheel safety and driving options will also be discussed.
- FEBRUARY 4 – MEDICARE 101
Great presentation for those who are new to Medicare or turning 65 in 2014.
-
FEBRUARY 11 – CHOCOLATE BINGO
Join us for a new twist on the old game of Bingo. Great for chocolate lovers!
1 / 1
|
<urn:uuid:104f402d-037f-46bd-b417-9600e9950cb4>
|
CC-MAIN-2014-35
|
http://covinaca.gov/city-departments/parks-a-recreation/seniors/422-senior-presentations-and-seminars?format=pdf
|
2014-09-02T14:03:38Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2014-35/segments/1409535922087.15/warc/CC-MAIN-20140909042018-00058-ip-10-180-136-8.ec2.internal.warc.gz
| 113,955,876 | 222 |
eng_Latn
|
eng_Latn
| 0.989497 |
eng_Latn
| 0.989497 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
871
] |
Chairman: Cary Simpson Address: 1 The Crescent Dullingham, Newmarket CB8 9UY
Tel: 01638 508572
Email: [email protected]
Email: [email protected]
Members of the Council are summoned to and General Meeting of Dullingham Parish Council to take place on
Thursday 2 nd February 2023 at Taylor Hall at 6pm
MINUTES
Present: Councillor Simpson (CS), Algar (RA), Mardon (SM), Owen (KO), Cameron (MC), Parkin (GP) arrived 18.44, Councillor Alan Sharp (AS) and three members of the public
020223/1 TO RECORD APOLOGIES FOR ABSENCE
Councillor Robertson (MR) – holiday. Apologies accepted
020223/2 TO RECEIVE ANY DECLARATIONS OF INTEREST:
1. Declaration of any disclosable pecuniary interest in any item of business
2. Declaration of any personal and/or prejudicial interest in any items on the agenda
3. Written requests for dispensations for disclosable pecuniary interests
4.
Grants to any requests for dispensation
There were no declarations made.
020223/3 TO SIGN AND APPROVE MINUTES OF MEETINGS OF: 5 th January 2023
CS proposed, SM seconded to approve the Full Parish Council Minutes of 5 th January 2023 as a true and accurate record of the meeting. Motion carried.
020223/4 OPEN FORUM FOR PUBLIC PARTICIPATION
At the close of this item, members of the public will no longer be permitted to address the Council unless invited to do so by the Chairman
No members of the public wished to make and comment.
020223/5 MATTERS ARISING:
1. To discuss and approve Pavilion/ Cricket Usage and terms
CS invited Newmarket Cricket Club to introduce the team and provide a brief history of the club. CS advised the club had been in discussions with Parish Council in the hope of re locating to Dullingham Sports Field for the 2023 season. A contract had been mutually collated and circulated to all prior to the meeting. CS proposed, RA seconded that the Parish Council sign and agree terms. Motions carried. Everyone at Dullingham Parish Council welcomed the Club to Dullingham.
2. To discuss and approve pavilion works
RA provided a brief recap on works needed; new ceiling and electrics. The council agreed to allocate a maximum overall spend council spend of £9000 for these works and using any remaining CIL income not allocated along with any S106 funds as match funding for the project.
CS proposed, RA seconded to apply to East Cambridgeshire District Council for assistance with the works in form of the Facilities Improvement Grant and S106 Funding should there be any available. Motion carried.
In addition the council agreed to apply to other funding sources for additional works when required.
CS advised that the Cricket Club sponsors are expected to donate flooring and materials to assist with works.
3. To discuss donation request from Dullingham Charities
Dullingham Parish Council
www.dullingham.org.uk
Clerk: Karen Peck 19 High Street Aldreth, Cambs CB6 3PQ
Dullingham Parish Council
www.dullingham.org.uk
Chairman: Cary Simpson Address: 1 The Crescent Dullingham, Newmarket CB8 9UY
Tel: 01638 508572
Email: [email protected]
Clerk: Karen Peck 19 High Street Aldreth, Cambs CB6 3PQ
Email: [email protected]
The council had received the accounts up until Dec 2021 but felt they would like to see accounts up until Dec 2022 and also request a representative from the charity provide an document outlining historic and current charity activities.
4. Request for an additional dog waste bin
East Cambridgeshire District Council has received a request for a dog waste bin to be sited at Dullingham Ley. The council discussed the request and it was agreed unanimously not to progress the request
5. Parish Elections May 2023 - The Combined District Council and Town and Parish Council Elections will be held on 4 May 2023. Nomination Forms for Prospective Candidates and further information can be found at https://www.eastcambs.gov.uk/electionsvoting/elections-may-2023
020223/6 PLANNING
(Any plans the PC are aware of after posting of the agenda will be discussed at the next meeting. The application numbers and brief details will be posted via the notice board prior to said meeting.)
Applications to discuss:
22/01489/FUL Land North of Kings Head Public House, Dullingham
Erection of single, two storey dwelling – Amendment received 16 th January which includes changes to the access to address highways comments
Responses sent and Application Status:
22/01489/FUL Land North of Kings Head Public House, Dullingham
Erection of single, two storey dwelling
Dullingham Parish Council did object to a previous application in the adjoining plot due to the dangerous exit onto the main road. Despite that, the development was approved .Whereas we still think that this is not a suitable place for dwelling entrances and are not supportive of the application, if it is approved, the footpath should be extended to serve this property – Pending Consideration
22/01478/FUL Fairways, 14 Cross Green, Dullingham
Construction of a detached, 2 bay, single storey, oak framed cart lodge and associated works The Parish Council had no objection to the application – Pending Consideration
22/01251/FUL 56 Brinkley Road, Dullingham
New cartlodge with room above
The Parish Council had no objection to the application – Pending consideration
22/01385/FUL the Bungalow, Marwell Park, Brinkley Road, Burrough Green
Replacement 2 bedroom 1.5 storey detached dwelling and double garage with hobbies room and associated works
If the current building has an occupation restriction, then this should remain to protect the equine industry. – Pending consideration
22/01063/FUL Hare House, 5 Elm Close, Dullingham
Demolition of existing garage and single storey extension, removal of two storey roof structure. Construction of new roof structure, loft conversation, new single storey extension and double garage
The Parish Council have no objection to the application - Pending Consideration
22/00039/RMM Site East of Clare House Stables, Stetchworth Road, Dullingham
Amendments to proposed foul and surface water drainage system, layout and design of proposed roads, addition of visibility splay and vehicle tracking information, amendments to proposed landscaping
The Council unanimously voted to respond with reiteration of previous objection and MR to look at getting professional input with a budget set for £500 or less. Dullingham Parish
020223/9
Dullingham Parish Council
www.dullingham.org.uk
Chairman: Cary Simpson Address: 1 The Crescent Dullingham, Newmarket CB8 9UY
Tel: 01638 508572
Email: [email protected]
Clerk: Karen Peck 19 High Street Aldreth, Cambs CB6 3PQ
Email: [email protected]
Councils full and detailed reply can be found on East Cambridgeshire planning portal – Pending consideration
Decisions made:
22/01327/VAR Tilbrook Farm House 63 Station Road, Dullingham
To remove condition 21 (sprinkler system) of previously approved18 /01384/FUL New dwelling with access and associated works
The Parish Council have no objection to the application - Refused
020223/7 PLAY AREA
MC circulated a full inspection report to the council prior to the meeting. The only point to note was the basket swing but felt cosmetic only.
chippings had arrived and await return of MR.
MC noted the fence needs work and quotes would be sought.
020223/8 COUNTY AND DISTRICT COUNCILLOR REPORTS
AS gave the council a brief summary, outlining the key points:
- Congestion charge is likely to be voted on after the Elections. Everyone is invited to visit the Great Cambridgeshire website for further details
- Police and Crime Panel propose a 5% increase and this is mainly to accommodate the increase in officers
- Combined Authority proposed increase of a band e property to £12
- Cambridgeshire County Council meet 7 th February and it is likely to recommend a 4.99% increase
- Potholes throughout the county as an major issue
ENVIRONMENT AND FOOTPATHS
SM noted that quotations had been sought for the required pond works and presented to council for consideration. The council unanimously approved quotation B from Glenn Conway for the sum of £1750.
020223/10 ASSETS
RA updated that NCC are planning to have a clear up day on February 12th and another painting day a few weeks after that. They are also offering to re-floor the whole building at their own cost.
A quote to improve the track up to the sports field and make the grass area at the bottom more accessible for parking had been sought.
020223/11 FINACIAL MATTERS
a)Bank Reconciliation for Signature up until 31 st January 2023 and approval of payments and income to date
Payments:
010.2
Income
Dullingham Parish Council
www.dullingham.org.uk
Chairman: Cary Simpson Address: 1 The Crescent Dullingham, Newmarket CB8 9UY
Tel: 01638 508572
Email: [email protected]
Clerk: Karen Peck 19 High Street Aldreth, Cambs CB6 3PQ
Email: [email protected]
CS proposed, RA seconded to approve all payment, income and reconciliations up until 31 st January 2023.
020223/12 COUNCILLORS FORUM
KO noted the poor condition of road.
GP noted that condition of Flint Walls is becoming an issue. Clerk to provide Building Control details to GP to progress
RA noted that the Parish Council had been approached by Stetchworth Parish Council to provide a joint celebration for the Kings Coronation. Article to be put in newsletter for working party volunteers and advise Stecthworth we are keen to work together.
CS wished to raise concern over the pavement on the old Station Road, report to me made to CCC
020223/13 DIARY DATES –2 nd March 2023 @ 6pm
Meeting closed at 19.45
..........................................................
K Peck Karen Peck Clerk and RFO Dullingham Parish Council
.................................................
C Simpson
Cary Simpson Chair Dullingham Parish Council
|
<urn:uuid:73406035-e7d0-4c9f-b20a-307ae3a4b69f>
|
CC-MAIN-2024-10
|
http://www.dullinghamvillage.org.uk/wp-content/uploads/2023/04/Dullingham-Parish-Council-Draft-Minutes-Feb-2023.pdf
|
2024-02-27T17:50:17+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-10/subset=warc/part-00261-d9675c6d-5c8d-45bb-9c98-c56e42022a4d.c000.gz.parquet
| 55,688,361 | 2,324 |
eng_Latn
|
eng_Latn
| 0.991579 |
eng_Latn
| 0.995211 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2925,
6447,
8719,
9958
] |
WEST VIRGINIA NEEDLESTICK INJURY PREVENTION PROGRAM
350 Capitol Street, Room 125, Charleston, West Virginia 25301-3715
(304) 558-2195 fax (304) 957-0185
[email protected] https://oeps.wv.gov/needlestick/
ANNUAL NEEDLESTICK AND SHARP OBJECT INJURY REPORT
Hospitals, nursing homes, home health agencies, and local health departments are required to report needlestick and sharp object injuries to the Director of the Division of Health under West Virginia Code 16-36 and Legislative Rule 64CSR82. §64-82-5.3.b states that "The facility shall prepare an annual report of needlestick injuries within the facility, to be reported to the Director, including a quality improvement report based on the data from the quarterly reports. The quality improvement report shall include a summary of trends in needlestick injuries and suggestions as to whether or how protective mechanisms or work practice control could be used to prevent these injuries."
The annual report should be submitted to the West Virginia Needlestick Injury Prevention Program (WVNIPP) by January 30 for the previous calendar year. This form can be used as a cover page when submitting the report that satisfies the requirement above. If this form is not included with the annual report, the information below must be included on the cover page of the report.
Total Annual Injuries Reported:
WVNIPP 4-Digit Facility Code:
Report is for Calendar Year:
Facility Name:
Report Content – If your facility had zero injuries during the calendar year specified above, only this form must be submitted. If one or more injuries occurred, please analyze all of the needlestick and sharp object injuries reported and discuss the following in your annual report:
1. Are you able to summarize your data to identify any trends in needlestick injuries in your facility? Examples might include seeing a higher percentage of injuries in a specific job category; identifying specific devices or brands involved in the injuries; or identifying common uses of a device when injuries occur.
2. Can you offer any suggestions as to whether or how protective mechanisms or work practice control could be used to prevent needlestick and sharp object injuries in your facility? Will these suggestions be implemented in your facility?
Report Format – The report may be in any style, format, and length chosen by each facility, as long as the issues above are addressed.
Report Submitted By: ____________________________________________ Date:
Form Revision Date: 10/30/2023
|
<urn:uuid:b43d5d38-adab-4774-80e6-028be9cc1ceb>
|
CC-MAIN-2024-10
|
https://oeps.wv.gov/needlestick/Documents/report/needlestick_report_annual.pdf
|
2024-02-23T16:55:09+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-10/subset=warc/part-00000-d9675c6d-5c8d-45bb-9c98-c56e42022a4d.c000.gz.parquet
| 428,204,581 | 519 |
eng_Latn
|
eng_Latn
| 0.997158 |
eng_Latn
| 0.997158 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2531
] |
BYLAWS
CANADIAN UNION OF PUBLIC EMPLOYEES
LOCAL 737
(Employees of BRANDON SCHOOL DIVISION)
Approved by membership: September 13, 2017
Approved by National: December 6, 2017
TABLE OF CONTENTS
BYLAWS CUPE LOCAL 737
PREAMBLE
In order to improve the social and economic welfare of its members of Local 737 without regard to sex, colour, race or creed, to promote efficiency, morale and relations with other CUPE Locals and to manifest its belief in the value of the unity of organized labour. This Local 737 of the Canadian Union of Public Employees (hereinafter referred to as CUPE) has been formed.
The following bylaws are adopted by the Local 737 to supplement Appendix 'A' and 'B' of the CUPE Constitution, to safeguard the rights and procedures of the Local, and to involve as many members as possible through the sharing of duties and responsibilities.
SECTION 1 – NAME
The name of the Local shall be the Canadian Union of Public Employees, Local 737 Certificate No.'s M.L.B. 3113, 2904, 3683 and 4628.
SECTION 2 – OBJECTIVES
a) To govern the proceedings of CUPE Local 737.
b) Secure adequate remuneration for work performed and generally advance the economic and social welfare of its members and of all workers.
c) Support CUPE in reaching the goals set out in Article II of the CUPE Constitution.
d) Providing an opportunity for its members to influence and shape their future through free democratic trade unionism.
e) Encourage the settlement by negotiations and mediation of all disputes between the members and their employers.
f) Eliminate sexual and racial harassment or harassment based on sexual orientation, and all other forms of harassment wherever it exists.
SECTION 3 – INTERPRETATION & DEFINITIONS
a) When article numbers are at the end of sections or sub-sections, refer to the relevant articles or the CUPE Constitution, which should be read in conjunction with these bylaws.
SECTION 4 – INTERPRETATION – ADDITIONAL OR CHANGES IN BYLAWS
a) No bylaws of the CUPE Local 737 will or shall conflict with the CUPE Constitution as stated in Article 13.3, Appendix A, B, C and D. Proposed changes to CUPE Local 737 bylaws must be in accordance with Appendix B.5.1.
Any changes or additions in the bylaws of Local 737 must first get a majority vote of the members present and be subject to the approval of the National President before they govern the Local's activities.
When making changes to the bylaws, members will receive at least seven (7) days notice at a previous meeting or at least sixty (60) days written notice.
b) When the bylaws are approved by the National President, they shall then become the laws of Local 737.
c) The Local 737 President shall have the authority to interpret these bylaws subject to the approval of the Executive.
d) CUPE Local 737 bylaws be reviewed every two (2) years (every even year). A new committee of no less than five (5) members to be struck from as wide a spectrum of the membership as possible, with the executive available to answer questions.
e) A copy of the amended bylaws shall be made available, upon request, to any member of Local 737.
f) Masculine pronouns shall be understood to include the feminine gender.
SECTION 5 – MEMBERSHIP MEETINGS (REGULAR AND SPECIAL)
a) Regular membership meetings shall be held each month on the second Wednesday of the month. If a statutory holiday intervenes, the Executive shall give a week's notice of any change in the date of the regular meeting. There will be no regular meetings in the months of January, July and August except as authorized in these bylaws.
b) Child care will be provided for family members at our general monthly membership meetings if requested by a member a minimum of forty-eight (48) hours in advance. Caregivers will be paid the student rate as reflected of our Collective Agreement.
c) Special Meeting – Special meetings may be called by order of any three (3) of the Executive or by written request of twelve (12) members, provided however, that no business shall be transacted at such special meetings other than for which the special meeting has been called. Notice shall be sent to every CUPE Local 737 work site at least five (5) working days prior to the meeting stating the purpose of the Special Meeting.
In the event of a Special Meeting dealing with strike-related matters, at least twenty-four (24) hours' notice shall be given prior to the meeting stating the purpose of the Special Meeting.
d) Quorum – A quorum for the transaction of business at any regular or special meeting shall be twelve (12) members including at least three (3) members of the Executive.
e) During the months where no meetings are held, the Executive shall be empowered to conduct the business of the Local and such Union business shall be reported at the next regular meeting.
f) The Executive will conduct all business of the Local Union deemed necessary between general membership meetings including the spending of funds for expenses and bills with a full report being made at the next membership meeting for ratification.
SECTION 6 – ORDER OF BUSINESS
1. Call to Order
2. Read Equality Statement
3. Roll Call of Officers
4. Voting on new members and initiation
5. Reading of the Minutes
6.
Matters arising
7. Treasurer's Report
8. Communications and Bills
9. Executive Report
10. Reports of Committees and delegates
11. Nominations, Elections or Installations
12. Unfinished Business
13. New Business
14. Good of the Union
15. Adjournment
SECTION 7 – OFFICERS
a) The Executive Officers of the Union shall consist of a President, Vice-President, Recording Secretary, Treasurer and three (3) Trustees, all of whom shall be elected by the membership at a regular membership meeting in December. The Executive shall be bonded through the master bond held by National Office; any Officer who cannot qualify for the bond shall be disqualified from office.
b) Should any Executive member fail to answer the roll for three (3) consecutive meetings without having submitted good reason for these failures, the office shall be declared vacant and shall be filled by an election at the following membership meeting.
c) Three (3) Trustees shall be elected for one (1), two (2) and three (3) year terms. The terms of office for Trustees shall be so that one (1) serves for a period of three (3) years, one (1) for two (2) years, and one (1) for one (1) year, as laid down in Article B.2.4 of the National Constitution. Each year thereafter, the Local Union shall elect one (1) Trustee for a three (3) year period. No member who has been a signing Officer for the Local Union is eligible to run for Trustee, until at least one (1) full term of office has elapsed.
SECTION 8 – EXECUTIVE
a) The Executive shall comprise of all officers except the Trustees.
b) The Executive shall meet at least once every month (Article B 3.14).
c) A majority of the Executive constitutes a quorum.
d) The Executive shall do the work delegated to it by the Local and shall be held responsible for the proper and effective functioning of all committees.
e) All charges against members or officers must be made in writing and dealt with in accordance with provisions of the CUPE Constitution (Article B 11.1 to B 11.5).
f) The Executive will prepare and present a budget for the year at the February meeting for the membership to approve.
SECTION 9 – PRESIDENT
The President shall:
a) preside at all meetings;
b) preserve order and enforce the Constitution and bylaws;
c) ensure that all officers perform their respective duties;
d) appoint all committees not otherwise provided for;
e) be ex-officio member on all committees;
f) decide all questions or order, subject to an appeal by a member of the Local, but shall not vote on such appeal;
g) announce the results of all votes
h) sign as signing officer for all expense statements;
i) be one of the signing officers for all cheques drawn on the Local's account, except the cheque to self where an alternate signature is required;
j) surrender all property of the Local at time of termination of office;
k) have the same right as other members of vote on any question. In case of a tie vote, the President shall cast the deciding vote;
l) have first preference as a delegate to the CUPE National Convention
m) will have union cell phone, if preferred.
n) The President shall be booked off two (2) days per week from September to June to maintain the function and responsibilities of the Local, and administration of the office.
SECTION 10 – VICE-PRESIDENT
The Vice-President shall:
a) if the President is absent or incapacitated, perform all the duties of the President;
b) if the office of the President falls vacant, be Acting President until a new President is elected (Refer to Section 16 c);
c) render assistance to any member of the Executive as directed by the Executive;
d) be designated as the alternate signing officer;
e) maintain the membership information files;
f) receive the job postings and file in the appropriate manner;
g) surrender all property of the Local at time of termination of office;
h) be ex-officio member of each standing committee;
i) remove outdated files, keep past files for seven (7) years, and file previous year in our office in January.
SECTION 11 – TREASURER
The Treasurer shall:
a)
receive all revenue, initiation fees, dues, and assessments, keeping a record of each member's payments and deposit promptly all money with a bank or credit union
b) prepare all CUPE National per capita tax forms and remit all funds owing to the National Secretary-Treasurer by the last day of the following month
c) record all financial transactions in a manner acceptable to the Executive and in accordance with good accounting practices
d) regularly make a full financial report to meetings of the Local's Executive, as well as a written financial report to each regular membership meeting, detailing all income and expenditures for the period;
e) make all books available for inspection by the Trustees on reasonable notice, and have the books audited annually and within a reasonable time, respond in writing to any recommendations and concerns raised by the Trustees;
f) provide the trustees with any information they may need to complete the audit report forms supplied by CUPE;
g) sign all cheques and ensure that the local Union's funds are used only as authorized or directed by the CUPE Constitution, Local Union bylaws, or vote of the membership. In consultation with the Executive board, designate a signing officer during prolonged absences.
h) arrange a trustee audit prior to a newly elected treasurer receiving the books. Books will be audited every second year, by an independent auditor, after the election of the Treasurer;
i) surrender all property of the Local at time of termination of office;
j) maintain an inventory of the furniture and equipment owned by Local 737;
k) out-of-pocket allowances shall be issued three (3) business days prior to attending conventions, conferences and schools;
l) be responsible for maintaining, organizing, safeguarding and keeping on file all supporting documents, authorizations, invoices and/or expense claims for every disbursement made, receipts for all money sent to CUPE National, as well as records and supporting documents for all income received by the Local Union.
SECTION 12 – RECORDING SECRETARY
The Recording Secretary shall:
a) keep full, accurate, and impartial account of the proceedings of all regular or special membership and Executive Board meetings. These records must also include a copy of the full financial report (Executive Board meetings) and the written report (membership meetings) presented by the Secretary Treasurer. The record will also include the Trustees' reports.
b) record all alterations in the bylaws;
c) answer correspondence and fulfil other secretarial duties as directed by the Executive;
d) file a copy of all letters sent out and keep on file all communications;
e) prepare and distribute all circulars and notices to members;
f) have all records ready on reasonable notice for auditors and Trustees;
g) surrender all property of the Local at time of termination of office;
h) preside over membership and board meetings in the absence of both the President and the Vice- President;
i) be one of the signing officers for all cheques drawn on the Local's account;
j) remove outdated files, keep past files for seven (7) years, and file previous year in our office in January.
SECTION 13 – TRUSTEES
The Trustees
shall:
a) act as auditing committee on behalf of the members, auditing the books and accounts of the Treasurer, the Secretary, and the Standing Committees annually;
b) provide a written report of their findings to the Local, including details of any expenditures made for the purposes other than those approved by the Executive or general membership, at the first regular meeting of each annual period;
c) submit in writing to the President and Treasurer any recommendations and/or concerns they feel should be reviewed in order to ensure that the Local's funds, records, and accounts are being maintained by the Treasurer in an organized, correct and proper manner;
d) ensure that proper financial reports are made to the membership;
e) audit the record of attendance
f) provide the National Secretary-Treasurer with a full annual report on their audit on the forms provided by the National Secretary-Treasurer as outlined in the National Constitution (Appendix B.3.10 to B.3.12);
- 10 -
g) any stocks, bonds, securities, office furniture and equipment, titles or deeds to property that may at any time be owned by the Local shall be inspected once yearly by the Trustees within thirty (30) days of elections and a report of findings submitted to the Local.
SECTION 14 – CHIEF SHOP STEWARD
The Chief Shop Steward shall:
a) have general knowledge of the Collective Agreement;
b) with the assistance of the Executive, investigate all alleged violations of the Collective Agreement;
c) under directive of the Executive, contact the CUPE National Representative;
d) make a report to every regular local meeting, if necessary, or have one of the Shop Stewards make the report;
e) preside over any Shop Steward meeting and conduct the meeting in an orderly manner;
f) maintain contact with the shop stewards to provide ongoing union awareness and education;
g) is expected to attend regular monthly meetings to be aware of current issues.
SECTION 15 – SHOP STEWARDS
All classifications in Local 737 shall be represented by Shop Stewards.
The Shop Steward shall:
a) have general knowledge of the Collective Agreement;
b) assist in the preparation and presentation of grievances at the initial level as prescribed in the Collective Agreement;
c) make a report to the Chief Shop Stewards, if necessary.
SECTION 16 – ELECTIONS AND INSTALLATION OF OFFICERS
a) Nominations and Elections
(1) Nominations and elections to office shall be held at the general meeting in December of
each year. No nomination shall be accepted unless the member is in attendance at the nomination meeting or his consent in writing to run for office is presented and duly witnessed by another member. Any member running for an executive or Chief Shop Steward position must have attended five (5) meetings in the immediately preceding twelve (12) month period (this includes the month in which the election is being held) to run for office.
i) The election of the President and Treasurer shall be conducted in even years and these terms of office shall be for two (2) years.
ii) Vice-President and Recording Secretary shall be elected in odd years and this term shall also be for two (2) years.
iii) Trustees shall be elected so that one shall serve for a period of three (3) years, one (1) for two (2) years and one (1) for one (1) year. Each year thereafter, the Local Union shall elect one (1) Trustee for a three (3) year period.
iv) The Chief Shop Steward shall be elected at the December meeting for a two (2) year term, elected on odd years. If a vacancy occurs, a new Chief Shop Steward will be elected to fill the position at the next regular local meeting.
v) The Shop Stewards shall be elected at the December meeting for a one (1) year term. If a vacancy occurs, a new Shop Steward will be elected to fill the position at the next regular local meeting.
(2) Members shall not be entitled to hold more than one (1) elected position, i.e., Vice-President and Chief Shop Steward, or President and Shop Steward.
b) (1) The Executive will ensure that sufficient quantities of paper ballots are made available for elections.
(2) When two (2) or more nominees are to be elected to any office by ballot, each member voting shall be required to vote for the full number of candidates to be elected or the member's ballot will be declared spoiled.
(3) Voting to fill one office shall be conducted and completed, and recounts dealt with, before balloting may begin to fill another office.
(4) A majority of votes cast shall be required before any candidate can be declared elected, and second and subsequent ballots shall be taken, if necessary, to obtain a majority. On the second and subsequent ballots the candidate receiving the lowest number of votes in the previous ballot shall be dropped. In case of a final tie vote, the presiding officer may cast the deciding vote.
(5) Each candidate may appoint a scrutineer for the purpose of vote counting.
(6) No proxy vote shall be allowed.
(7) All duly elected officers shall be installed at regular meeting in which the election occurred.
c) By-Election
(1) Should an office fall vacant pursuant to Section 7 (b) of these Bylaws or for any other reason, the resulting by-election should be conducted as closely as possible in conformity with this Section.
(2) When vacancies occur between the annual elections or when there are insufficient nominees for the various elected positions, the following procedure will take place:
i) The Vice-President shall be Acting President until the next meeting where elections for a new President will take place.
ii) If a vacancy occurs on the Executive, the Executive shall be empowered to appoint members to fill the vacancy until the next meeting where elections will take place with seven (7) days' notice to all members before meeting.
SECTION 17 – FEE, DUES, AND ASSESSMENTS
a) The monthly union dues shall be 1.5%.
b) An Initiation Fee or Re-Admittance Fee of one dollar ($1.00) will be charged by the Local for admittance and confirmation of the desire to become a member of CUPE. (Article B.4.1 and B.8.2)
c) Changes in the levels of the Initiation Fee, the Re-admittance Fee, and Monthly Dues can be effected only by following the procedure for amendment of these bylaws with the additional provision that the vote must be by secret ballot. (Article B.4.3)
d)
Special assessments may be levied in accordance with Article B.4.2. of the CUPE Constitution.
e) The amounts herein established will automatically increase by the amount of any increases in the National Union's per capita.
f) Affiliations to MFL, CUPE Manitoba, School Division Sector.
SECTION 18 – DELEGATES TO CONVENTIONS, CONFERENCES AND SCHOOLS
a) The Executive shall have first preference as delegates to conventions where voting takes place.
b) Except for the Executive all delegates to attend conventions, conferences, or schools shall be chosen by election at a membership meeting. When deemed necessary or relevant, the Executive shall have the right to select an appropriate committee member to the relevant conference, convention, or school, and the reasons for such shall be given to the membership. Where notification time did not allow for the proper voting to be done, the Executive shall be allowed to send the most appropriate person to the conference.
c) (1) All delegates or other official representation shall be elected by the membership.
(2) Representation at seminars shall be on a voluntary basis, with the approval of the Executive.
(3) Per Diem rates will be paid as follows:
$25.00
Travel Day:
Six (6) hours or less
Over six (6) hours
$65.00
Meeting or event (no overnight)
$25.00
Meeting or event (overnight required):
Six (6) hours or less
$25.00
Over six (6) hours
$65.00
Hotel and parking expenses for attending any convention, conference, seminars and schools held outside of the City of Brandon as authorized by the Local will be reimbursed on top of any per diem paid.
All delegates to conventions, conferences, seminars and schools shall be paid transportation expenses at the current CUPE Manitoba rate per kilometre up to a maximum of two (2) vehicles, four (4) members per vehicle. Any more than two (2) vehicles will be at the Executive's discretion.
Meeting or event (out of province)
$75.00 per day
When a meal is being provided and advanced notice is given the following will be deducted from the per diem:
Breakfast
$15.00
Out-of-pocket allowances shall be issued a minimum of three (3) business days prior to attending convention, conferences and schools.
(4) When conventions, conferences, seminars or schools are cost inclusive outside the city of Brandon, and out-of-pocket allowance of twenty-five dollars ($25.00) per day will be paid to the delegates attending.
(5) All delegates to conventions, conferences, seminars and schools shall be paid transportation expenses at the current CUPE Manitoba rates per kilometre up to a maximum of two (2) vehicles. Any more than two vehicles will be at the Executive's discretion.
(6) All authorized representatives to the School sector meetings outside the City of Brandon
shall be paid transportation expenses at the current CUPE Manitoba rates per kilometre up to a maximum of two (2) vehicles. Any more than two (2) vehicles will be at the Executive's discretion.
(7) When a member is sitting on a committee that mileage is not covered by the committee, the member will be paid mileage. The Local Union will pay per diem as per these Bylaws, with the understanding that their Expense Statement to CUPE Manitoba will request reimbursement to the Local Union.
(8) For conventions, conference, seminars and schools held in Brandon, there will be no allowance for travel; the daily expense allowance shall be twenty-five dollars ($25.00).
(9) The Union shall reimburse the Employer for all authorized union leaves.
(10) As many members as possible, especially those on committees, executive and shop stewards, shall be encouraged to attend any courses made available.
(11) All delegates and observers shall attend all sessions at conventions, conferences, or schools or show just cause for not attending. Any delegate or observer found not to have just cause for not attending shall reimburse the Local in full all expenses afforded them through these Bylaws.
(12) Due to inclement weather, delegates to conventions, conferences, seminars and schools held outside the City of Brandon shall have the right to obtain accommodation if unable to return and shall be paid hotel and parking expenses, plus an out-of-pocket allowance as per c(3)ii.
(13) Adequate Union leave will be provided to allow for sufficient travel time, subject to Executive approval.
(14) CUPE Local 737 will not sponsor any school, seminar, workshop or conference that is not Union related.
(15) Any member attending may be required to give a written/verbal report to the next membership meeting. Such reports are at the discretion of the Executive.
SECTION 19 – STANDING/AD HOC COMMITTEES
a) Members will submit names to the Executive for the committees they are interested in being on. The executive will appoint the members to each committee.
b) At the time of a change in committee members, all records and information will be turned over to the new committee.
c) Standing committees shall be Social, Grievance, Health and Safety, and Scholarship Committee.
Ad Hoc committees shall be formed as deemed necessary. At the conclusion of the committee's assignment, the committee shall be disbanded.
d) The Executive shall be held responsible for the proper and effective functioning of the Standing Committee.
e) The Executive shall be held responsible for the proper and effective functioning of the Standing Committees.
(1) GRIEVANCE COMMITTEE
i) The Grievance Committee shall comprise of the President or Vice-President, Chief Shop Steward, and an Area Shop Steward.
ii) The Chief Shop Steward shall be Chairperson of the Grievance Committee.
iii) This Committee shall process all grievances not settled at the initial stage and its reports shall be submitted first to the Executive, with a copy to the CUPE Representative, and then to a membership meeting. Grievances must be in writing on the forms provided by the National Office and be signed by the complainant or complainants, as provided for in the Collective Agreement. The Committee shall review each grievance thoroughly. In the investigation and processing of grievances, up to and including the decision whether or not to refer a matter to arbitration, the Committee shall not deal in an arbitrary, discriminatory or bad-faith manner.
iv) Any appeals of the decision of the committee will be referred to the Executive.
(2) HEALTH AND SAFETY COMMITTEE
This committee will:
i) work to educate members on the importance of workplace health and safety.
ii) prepare and present reports to the regular membership meetings.
iii) inform the members of details of April 28 th Day of Mourning ceremony each year.
iv) participate on the Joint Worksite Health and Safety Committees (JWH&SC).
v) promote safe work procedures and environments so as to prevent illness and injury as a result of workplace factors.
vi) immediately bring to the attention of the employer any workplace hazard that has the potential to cause members' illness or injury.
vii) work to eliminate all workplace hazards, be they physical, environmental, or social.
The committee shall comprise of two (2) members, one of which shall be a member of the Executive. The committee members will be appointed and revisited every two (2) years of the beginning of the school year along with schools voting on the safety reps at each school's buildings or locations which reflects the Collective Agreement and the Health & Safety Act.
(3) SOCIAL COMMITTEE
i) The Committee shall submit reports and proposals to the Executive or to the membership as required.
ii) It is the function of this Committee to arrange and conduct all social and recreational activities of the Local subject to the approval of the membership, including but not limited to the food (could be appetizers etc.) provided at the June general membership meeting, the Long Service evening (event) and the Thank You Evening (event).
iii) Members and their guest will be responsible for purchasing their alcohol at events where alcohol is available for purchase.
iv) A ceiling for the Committee's net expenditures shall be fixed annually by the membership but other than that all social and recreational events and activities shall be self-supporting.
v) The Executive shall be held responsible for the proper and effective functioning of this Committee.
vi) The Committee shall comprise of at least two (2) members.
(4) SCHOLARSHIP COMMITTEE
i) The committee shall consist of two (2) members plus the Vice-President as ex-officio.
ii) The Committee shall review applications and determine successful candidate(s) as per Appendix 'B'.
iii) The Committee will report to the Executive the winner, upon decision.
(5) NEGOTIATION COMMITTEE
This shall be a member committee elected by the membership at the local meeting and shall consist of:
- Secretary of the Local will be there to take notes as an ex-officio
- Three (3) Executive officers (President being one (1))
- Four (4) elected members – one from each group below:
o Group 1 – Education Assistant, Home School Liaison, Food Service, Crossing Guard
o Group 2 – Clerical, Library Tech
o Group 3 – Transportation, Bus Assistant
o Group 4 – Maintenance, Custodian, Custodian Assistant, Mechanic
The function of the committee is to prepare collective bargaining proposals and to negotiate a Collective Agreement. The CUPE National Representative shall be a non-voting member of the Committee and shall be consulted at all stages from formulating proposals, through negotiations, to contract ratification by the membership. Automatic disbanding.
(6) EDUCATION COMMITTEE
The Committee will comprise of a least two (2) Executive: Recording Secretary and Treasurer. Members wanting to register for a school need to send an email to the Executive saying they want to attend the school.
SECTION 20 – VOTING OF FUNDS
a) Except for ordinary expenses and bills as approved at membership meetings, no sum over three hundred dollars ($300.00) shall be voted for the purpose of a grant or contribution to a member.
SECTION 21 – GRANTS AND/OR CONTRIBUTIONS
a) Grants or contributions outside of CUPE over two hundred dollars ($200.00) a notice of motion must be made at a regular membership meeting before the grant or contribution can be paid out.
SECTION 22 – OUT OF POCKET EXPENSES
a) TABLE OFFICERS:
President
$150.00 per month
Vice-President
$100.00 per month
Secretary
$125.00 per month
Treasurer
$125.00 per month
Chief Shop Steward $ 30.00 per month
This amount is to be split in half and paid twice yearly, once at the regular meeting in June and once at the regular meeting in November.
If a member of the executive misses more than three (3) regular, special or executive meetings in a twelve (12) month period without just cause, the office may be penalized by reduction of out-of-pocket expenses or be declared vacant as per Section 7(b).
b) NEGOTIATING COMMITTEE:
Each Negotiating Committee member shall receive twenty-five dollars ($25.00) per full day of meetings (a full day is six (6) hours or more). For any meeting running over four (4) hours and over the lunch hour (12:00 p.m. – 1:00 p.m.) and the supper hour (5:00 p.m. – 6:00 p.m.) a meal will be provided at a reasonable cost.
c) TRUSTEES:
Committee members shall receive out-of-pocket expenses at the rate of twenty-five dollars ($25.00) per evening audit. Supper will be provided at a reasonable cost.
SECTION 23 – LONG SERVICE RECOGNITION FOR CUPE MEMBERS LEAVING LOCAL 737
a) Based on number of years of service noted on the seniority list at the date of leaving less days missed, a member with fifteen (15) years of service and greater will receive a gift valued up to one hundred dollars ($100.00) plus engraving costs. The committee members will inform members of the gift choices.
b) Executive will host an event in honour of long service members and retirees leaving CUPE Local 737 as of June 30 th of the current year and their guest.
SECTION 24 – HONORARY LIFE MEMBERS
a) Members reaching retirement age or becoming incapacitated, and providing they are in good standing, can make application to the Treasurer of the Local for Honorary life membership. The application shall be voted on at a regular membership meeting.
b) Honorary life members shall be entitled to attend all general meetings with voice but no vote. An honorary life member may speak at the privilege of the chair.
SECTION 25 – RULES OF ORDER
a) All meetings of the Local shall be conducted in accordance with the basic principles of Canadian Parliamentary procedure.
b) The Rules of Order to ensure free and fair debate are appended to these bylaws as Appendix 'A'.
c) These rules shall be considered as an integral part of the bylaws and may be amended only by the same procedure used to amend the bylaws.
d) In situations not covered by Appendix 'A' the CUPE Constitution may provide guidance, but if the situation is not dealt with there, Bourinot's Rules of Order shall be consulted and applied.
APPENDIX 'A' TO THE BYLAWS OF LOCAL 737 CUPE
RULES OF ORDER
a) The President or in his/her absence, the Vice-President, shall take the chair at all membership meetings.
b) No member, except the Chairperson of a Committee making a report or the mover of a resolution, shall speak more than five (5) minutes, or more than once on the same question without the consent of the meeting or until all who wish to speak have had an opportunity. Chairpersons and movers of a resolution shall be limited to fifteen (15) minutes, except with the consent of the meeting.
c) The President shall state every question coming before the Local, and before allowing debate thereon, and again immediately before putting it to a vote, shall ask: "Is the Local ready for the question?" Should no member rise to speak, the question shall then be put.
d) A motion to be entertained by the presiding officer must be moved and seconded; both mover and seconder must rise and be recognized by the chair.
e) A motion to amend, or to amend an amendment, shall be in order, but no motion to amend an amendment to an amendment shall be permitted. No amendment or amendment to an amendment, which is a direct negative of the resolution shall be in order.
f) On motion, the regular order of business may be suspended, by a two-thirds vote of those present, to deal with any urgent business.
g) All resolutions and motions other than those named in Rule (q), or those to accept or adopt the report of a committee, shall, if requested by the presiding officer, be presented in writing before being put to the Local.
h) At the request of any member, and upon a majority of those present, a question may be divided when the sense will admit to it.
i) Any member having made a motion can withdraw it with the consent of the seconder, except that any motion, once debated, cannot be withdrawn except by a majority vote of those present.
j) When a member wishes to speak on a question or to make a motion, he/she shall rise in his/her place and respectfully address the presiding officer, but, except to state that he/she rises to a point of order or on a question of privilege, he/she shall not proceed further until recognized by the chair.
k) When two (2) or more members rise to speak at the same time, the presiding officer shall decide which one is entitled to the floor.
l) Every member, while speaking, shall adhere to the question under debate and avoid all personal, indecorous, or offensive language, as well as any poor reflection on the Local or member thereof.
m) If a member, while speaking, is called to order, he/she shall cease speaking until the point is determined; if it is decided he/she is in order, he/she may again proceed.
n) No religious discussion shall be permitted.
o) The President shall take no part in debate while presiding, but may yield the chair to the Vice-President in order to speak on any question before the Local, or to introduce a new question.
p) The presiding officer shall have the same rights as other members to vote on any question. In case of a tie, he/she may in addition give a casting vote, or, if he/she chooses, refrain from breaking the tie, in which case the motion is lost.
q) When a motion is before the Local, no other motion shall be in order except (1) to adjourn, (2) to put the previous question, (3) to lay on the table, (4) to postpone for a definite time, (5) to refer, (6) to divide or amend, which motions shall have precedence in the order named. The first three (3) of these shall be decided without debate.
r) A motion for the previous question, when regularly moved and seconded, shall be put in this form: "Shall the main question be not put?" If it is adopted, the President shall proceed to take the vote on the resolution and amendments thereto, (if any) according to their priority. If an amendment or an amendment to any amendment is adopted, the original resolution, as amended, shall be put to the Local.
s) A motion to adjourn is in order except (1) when a member has the floor, and (2) when members are voting.
t) A motion to adjourn, having been put and lost, shall not be in order again, if there is further business before the Local, until fifteen (15) minutes have elapsed.
u) After the presiding officer declares the vote on a question, and before the Local proceeds to another order of business, any member may ask for a division. A standing vote shall be taken and the Secretary shall count same.
v) If any member wishes to challenge (appeal) a decision of the chair, he/she must do so at the time the decision is made. If the challenge is seconded, the member shall be asked to state briefly the basis for his/her challenge. The chairperson may then state briefly the basis for his/her decision. Following which the chairperson shall immediately and without debate put the question: "Shall the decision of the chair be sustained?" A majority vote shall decide except that in the event of a tie the chair is sustained.
w) After a question has been decided, any two (2) members who have voted in the majority may, at the same meeting, move reconsideration thereof.
x) No member shall enter or leave a meeting during the reading of the minutes, the initiation of new members, the installation of officers, or the taking of a vote, and no member shall be allowed to leave without the permission of the President.
y) The Local's business, and proceedings of meetings, are not to be divulged to any persons outside the Local or the Canadian Union of Public Employees.
/pnf/cope 491
APPENDIX 'B'
CUPE LOCAL 737 SCHOLARSHIP
APPLICATION FORM
The CUPE Local 737 Scholarship has been established and is available to any child, grandchild, or legal ward of a CUPE Local 737 member currently employed by the Brandon School Division.
Two scholarships, in the amount of $500 each, may be awarded annually to:
One high school student who is graduating from a Technical Education Program and has applied for post-secondary education (with a minimum of two credit courses in/towards a program);
and
one high school student who is graduating from an Academic Program and has applied for post-secondary education (with a minimum of two credit courses in/towards a program).
NOTE: A graduating student must have completed a minimum of EIGHT credits from ONE vocational area to qualify as a technical graduate.
All applications will be forwarded to the Scholarship Committee of CUPE Local 737.
In selecting the successful applicants, candidates must have demonstrated both school and community involvement.
The successful applicants shall be identified during the month of June and notice of the Scholarship shall be made during the annual awards program in the applicant's home school.
The successful applicant's may present their essay (if available), to the members of CUPE Local 737 at the Regular September meeting.
Payment of the scholarships will be made upon confirmation of the recipient's attendance at a post-secondary educational institution, i.e. receipt for tuition, books or materials, or a letter from the Registrar. Please submit receipts or Registrar's letter to Treasurer, CUPE Local 737.
APPLICATION FOR THE CUPE LOCAL 737 SCHOLARSHIP
Deadline for submission is May 31 of current school year.
I am applying for the:
ACADEMIC SCHOLARSHIP
TECHNICAL SCHOLARSHIP
Name of Applicant:
Address:
Telephone:
Name of CUPE Local 737 member:
Relationship to CUPE employee:
Name of Applicant's High School:
Address:
Name of Post-Secondary Institution to which Student has applied:
Please attach current copy of your transcript.
The applicant is requested to complete an essay including all of the following:
1. Give a description of unions. (Some suggestions of what might be included are: What are unions? How do unions help? What have unions done in the past? What are unions presently doing?)
2. Explain why you feel deserving of this Scholarship. (Include any details that you feel would be of interest to the Committee, e.g. committees/groups you are a member of, sports teams, jobs, etc.)
3. What are your aspirations?
Upon completion, return the essay with this signed application to the CUPE Local 737 Scholarship Committee. Please be sure the envelope is clearly marked CUPE Scholarship Committee to:
CUPE Scholarship Committee c/o CUPE L. 737 1911 Park Avenue Brandon MB R7B 4A7
Applicant's Signature
CUPE LOCAL 737 SCHOLARSHIP
Deadline for submission is May 31 of current school year.
Please provide this form to one of the teachers under whom you have studied in your School Division during your high school years.
TO:
Name of Teacher
RE:
Student's Name
The above named student has applied to CUPE Local 737 for the CUPE Local 737 Scholarship in the amount of $500 for entry into post-secondary education. In selecting the successful applicants, candidates must have demonstrated both school and community involvement. Your comments regarding the suitability of this individual as an applicant for this Scholarship would be appreciated. Upon completion, place your letter in a sealed envelope and give it to the student to be included with their application.
____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________ ____________________________________________________________________________
________________________________________
Teacher's Signature
Criteria for CUPE Local 737 Scholarship
1. Applicant is to verify he/she is the child, grandchild, stepchild, or legal ward of a member in good standing of CUPE Local 737 who is currently employed by Brandon School Division.
2. Applicant must be graduating from high school and have applied to attend a post-secondary institution in the year the scholarship is awarded. Please provide proof of application.
3. Applicant must submit a current transcript.
4. Application must be received on or before May 31 st of the current year.
5. Effort shown on the completion of the essay, as outlined on the application form, will be a determining factor in the selection process.
|
<urn:uuid:4127a9e5-a667-44c5-8cea-89c4055120d1>
|
CC-MAIN-2023-14
|
https://737.cupe.ca/files/2018/01/Bylaws_Local_737_2017_12_06.pdf
|
2023-03-24T05:43:45+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-14/subset=warc/part-00146-39c03058-7d78-443d-9984-102329513e3d.c000.gz.parquet
| 106,446,388 | 9,054 |
eng_Latn
|
eng_Latn
| 0.95596 |
eng_Latn
| 0.996951 |
[
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
180,
199,
1917,
4274,
6164,
8015,
9480,
11785,
13526,
15024,
17485,
19346,
21335,
23538,
25482,
27422,
29189,
30883,
31923,
34268,
37056,
37471,
39096,
40230,
40334,
41939,
42612
] |
Schedule of Masses
Weekdays: 7:00 & 9:00 am
Saturday:
8:00 am, 5:00 pm English Vigil 7:00 pm Spanish Vigil
Sunday:
7:00 am, 8:45 am, 10:45 am, 12:30 pm (Spanish), 6:00 pm
Sacrament of Reconciliation: Saturdays: 8:30 - 9:30 am
Infant Baptism:
Three months notice & pre-baptismal instruction required
Marriages:
Minimum six months preparation required
Respect Life
Representatives:
Odile Draa & Jim Thompson
Look for other ministries In our parish on our website:
www.st-anthonys.org
Parish Pastoral Council
St. Anthony of Padua Catholic Church
Iglesia Católica San Antonio de Padua
August 14, 2016
Twentieth Sunday in Ordinary Time
Church
505 E. North St.
Manteca, CA 95336
Office: 209-823-7197
Fax: 209-823-5238
School
323 N. Fremont Ave. Manteca, CA 95336 209-823-4513
~~~~~~~~~~~~~~~
General e-mail: [email protected] St. Anthony's website address is: www.st-anthonys.org
~~~~~~~~~~~~~~
Mission Statement
We covenant to give ourselves to Christ as He gives Himself to us in the Eucharist, so every person might be a full, active, & conscious participant in His Church, empowered to share & live the Gospel.
Celso Doria, Mel Picanco, Felicia Anaro, Martin Espinoza, Anna Mello, Debbie Rivas Allan Rodriguez, Alice Correia, Melissa Manalastas & Sylvia Ranjel
Parish Staff
Rev. Chad Wahl, Pastoral Administrator
Rev. Dante Dammay, Parochial Vicar
Rev. Jairo Ramirez, Parochial Vicar
Rev. Mr. Jeff Vierra, Deacon
Mrs. Susie Dickert, School Principal
Sr. Ann Venita Britto, F.C., Pastoral Care & Senior Ministry
Dave Corder, Faith Formation Director
Angelique Gutierrez, Coordinator of Religious Formation
Diane Lehman,
Coordinator of Youth
Activities
Emelie Diaz Director of Liturgical Music
Mary Ferreira, Office Manager
Richard Sepulveda, Facilities Manager
We Participate in God's Mercy and Love
Have you ever tried to have a conversation with someone who doesn't participate? (I know my wife has). They're physically in the room, maybe even looking at you, then, when you ask a question they seemed surprised to be in a conversation. You don't storm off or stop loving the person (Thank you Nelia). No you keep in the relationship until they respond and participate in the conversation. I bring this up because we're at a point in the Mass when we are called to respond to the love and mercy of God.
The priest is preparing to begin the consecration of the Eucharist. This is the high point of the Mass. He faces us and asks, "Pray brethren that my sacrifice and yours, may be acceptable to God, the almighty Father." After which we stand and respond, "May the Lord accept the sacrifice at your hands…"
I'm hoping to make two main points. The first point is that we are not called to passively receive the love and mercy of God. God doesn't force his love on us, we must receive his love. The second point is this. We don't respond to the call so that God will love us. We respond because God already loves us. Our Mass is a conversation that we participate in...and the conversation was started by God.
Dave Corder
Attention Families Faith Formation Registrations
Registration for the upcoming 2016-17 year for Youth Faith Formation will begin on Monday, August 8 th - August 31st at the parish office.
The program registration requirements are as follows:
- Be a registered member of St. Anthony's parish
- If your child is registering for the first time, a copy of their baptismal certificate
- Registration fee of $75 for the first child, $20 for each additional child (no balance owed from previous years)
- Completion of all registration forms
The ONLY hours for registrations are as follows Mondays 11am-8pm
Tuesdays, Wednesdays, and Thursdays 9am-4pm
No registrations accepted on Fridays or on weekends Registrations will not be accepted through mail or over the phone.
Bishop's Awards Dinner
We are celebrating parish ministry leaders at the 2016 Bishop's Awards Dinner on Saturday, October 29, 2016 at St. Bernard's Parish—Holy Family Center in Tracy. Bishop Blaire would like to celebrate his retirement by honoring outstanding parish ministry leaders in our Diocese at the 2016 Bishop's Awards Dinner.
Proceeds from the event benefit SEEDS: which provides tuition assistance to students who otherwise could not afford a Catholic education and Catholic Charities which supports families, reduces poverty and builds strong communities.
To purchase tickets and for sponsorship opportunities, call the Development Office at (209) 4660-0636 or visit: http://stocktondiocese.org/bishops-awards.
Twentieth Sunday in Ordinary Time August 14, 2016
First Communion Process for the 2016-17 year begins in the second grade, and is now a TWO YEAR process. Confirmation preparation begins in the 7 th grade (through high school) and is a TWO YEAR process. Sessions are once a week on any of the following dates of choice:
Sundays 9am-10:15am Sundays, Spanish 10:45am-12pm Tuesdays, 4:30pm-5:45pm Wednesdays, 4:30pm-5:45pm or
Wednesdays, 6:15pm-7:30pm For more details, please visit the parish website at www.st-anthonys.org and click "Youth Faith Formation"
[Jesus] endured the cross, despising its shame, and has taken his seat at the right of the throne of God. — Hebrews 12:2
Collection Totals:
August 7, 2016: $22,989
Parish Goal: $18,612
Next Week's Goal: $18,252
EL COSTO DE SER DISCÍPULO
El Salmo responsorial de hoy, Salmo 40 (39), nos es muy familiar por el refrán "Señor, date prisa en socorrerme". La historia de Jeremías hoy y el refrán "¡Señor, date prisa en socorrerme!" nos recuerda que siempre hay dos caminos para seguir el llamado de Dios. El autor de la Carta a los Hebreos también lo sabía. Él recordaba a sus lectores que aunque nos agobien desgracias y pecados, podemos todavía perseverar si mantenemos nuestros ojos fijos en Jesús, quien también conoció la vergüenza y el dolor de la cruz, pero vio más allá del sufrimiento, el gozo de sentarse a la derecha del trono de Dios.
Jesús mismo dio a sus discípulos una "idea" de un bautismo que no sería tan maravilloso como el del Jordán que inauguró su ministerio, sino de fuego y angustia. Las palabras de la Sagrada Escritura hoy pueden no ser terriblemente apaciguadoras, pero en su honestidad y fortaleza podemos reconocer las dificultades que el discípulo enfrenta a diario, y consolarnos por la seguridad de nuestra salvación en Cristo. Copyright © J. S. Paluch Co.
Lecturas De La Semana
Atención Familias Registraciones para Educación Religiosa (Catecismo)
Inscripciones para el próximo año 2016-17 para Formación de Fe (Catecismo) comenzaran el lunes, 8 de agosto al 31 de agosto en la oficina de la parroquia. Los requisitos de registro son los siguientes:
-Ser un feligrés registrado en la Parroquia de San Antonio de Padua.
-Si su niño/a esta siendo registrado por primera vez, una copia de su Acta de Bautizo.
-La cuota de registro (o/costo) es de $75 por el primer niño/a, $20 por cada niño/a adicional en la familia (el saldo del año anterior necesita haber sido liquidado).
-Formas de registro completadas
Las UNICAS horas y días de registración son las siguientes:
-Martes, miércoles y jueves de 9 a.m. a 4 p.m.
-Lunes de 11 a.m. a 8 p.m.
-No se aceptaran registraciones los viernes o el fin de semana.
-Registraciones por teléfono o por correo no estarán disponibles.
El proceso para la Primera Comunión para todo niño/a que curse el segundo año escolar 2016–2017. La preparación toma solo DOS AÑOS.
El proceso para la Confirmación para todo joven que curse el grado 7mo escolar en adelante (hasta la High School). Este es un proceso de DOS AÑOS.
Las clases son una vez por semana con las opciones de los siguientes días y horarios:
Domingo de 9 am a 10:15 am Domingo en español de 10:45 am a 12 pm Martes de 4:30 pm a 5:45 pm
Lunes:
Vigilia: 1 Cr 15:3-4, 15-16; 16:1-2; Sal 132 (131):6-7, 9-10, 13-14; 1 Cor 15:54b-57; Lc 11:27-28 Día: Ap 11:19a; 12:1-6a, 10ab; Sal 45 (44):10-12, 16; 1 Cor 15:20-27; Lc 1:39-56
Martes:
Ez 28:1-10; Dt 32:26-28, 30, 35cd-36ab; Mt 19:23-30
Miércoles: Ez 34:1-11; Sal 23 (22):1-6; Mt 20:1-16
Jueves: Ez 36:23-28; Sal 51 (50):12-15, 18-19;
Mt 22:1-14
Viernes: Ez 37:1-14; Sal 107 (106):2-9; Mt 22:34-40
Sábado: Ez 43:1-7a; Sal 85 (84):9ab, 10-14; Mt 23:1-12
Domingo: Is 66:18-21; Sal 117 (116):1, 2;
Heb 12:5-7, 11-13; Lc 13:22-30
TRADICIONES DE NUESTRA FE
El otro día leí un artículo escrito por un pastor bautista sobre la necesidad de tener un altar en casa para educar a nuestros hijos en la fe y la oración. Lo leí con interés ya que el uso del altarcito tiene una larga historia en la Iglesia católica. En casa de mis abuelos paternos, en México, había un bello altarcito en forma de pirámide que contenía flores, velas y figuras de Jesús, María y algunos santos. Además de esto estaban también algunos instrumentos de oración como el rosario, la Biblia y algún otro libro de oración. También en casa de mi abuela materna, en Texas, había un rinconcito sagrado. Muchos latinos tenemos altarcitos familiares. Algunos son verdaderos altares como el de mi abuela, Mamá Lilia. Otros son rincones especiales como el de Mamá María, con alguna imagen y libro de oración y fotografías de nuestros parientes. A fin de cuentas no importa ni su tamaño ni su forma. Importa su existencia y sobre todo su uso para recordarnos de la presencia e importancia de Dios en nuestros hogares y familias.
—Fray Gilberto Cavazos-Glz, OFM, Copyright © J. S. Paluch Co.
Respect Life
"Protecting Human Life is the Cornerstone of Catholic social Teaching."
"The abortion conflict has never simply been about repealing Roe v. Wade. And the many pro-lifers I know live a much deeper kind of discipleship than "single issue" politics. But they do understand that the cornerstone of Catholic social teaching is protecting human life from conception to natural death. They do understand that every other human right depends on the right to life. They did not and do not and will not give up – and they won't be lied to."
Archbishop Charles J. Chaput O.F.M
Santo Nino Novena Prayers Home Visitation
Santo Nino Ministry would like to invite you to welcome Santo Nino and the Blessed Mother into your homes for one week. Please contact Cora Doria (209) 679-3748 or Grace Bautista at (209) 740-6875 for more details.
Sister Ann's Corner
Grief Support Workshop
The death of a loved one is unlike any other loss. Whether or not the death was sudden and tragic, or one with warnings and preparation, the reality of death leaves most of us in a state of shock, confusion, and sadness. Grieving people need time and space to honor their grief. Join us for a six week workshop and let us help you to begin the healing process.
Dates and times:
Fridays from 7:00 pm – 8:30 pm August 12 th , August 19 th , August 26 th , September 2 nd and September 9 th Location: St. Anthony Parish Conference Room 505 E. North St. Manteca, CA 95336
THIS WORKSHOP IS OPEN TO ALL REGARDLESS OF RELIGIOUS AFFILIATION.
Please contact Carol Delmanoswski at 823-7555 to register by phone or to obtain additional information.
Registration is required!
Please pray for those who need the support of this community of faith:
Kevin Wise Ramona Baker Maria N. Dias Delia Soria Eva Segura Jacob Sanchez Michelle Vicente Steve Gannon Steve Hernandez Debbie Kapina Elizabeth Cantu Patricia Lorraine Navarro
Shelley Cultrera Freitas Raquel Selinas Omar Gonzalez Galvan Jeannie Andres Marcelino J. Loza Edna Romero Dennis Duncan- Christopher Houser Beatrice Rios Alonzo Family
June Torres Barbara Donnelly Lolita Rilcopiro Ricardo Dominguez Jaedyn Hendryx Gerri Arriaga Martin Landeros Ruben Bright Michael Kautzer Pat Moretti Brian Donnelly Esther Yoo
Tim Barth Joseph Kusy Daniel Portillo Cynthia Juarez Warren Rogers George Bettencourt Nicholas Bush Jenevieve Mario Leah Carroll Jose Rios
Prayer Shawl Ministry
If someone would like to request a shawl (for ladies) or lap robe (for men), please contact Kathleen Gomes at [email protected]. Shawls and lap robes are not just for those who are ill; they are also given out to celebrate a special occasion such as an anniversary. A message of love and caring comes with each shawl or lap robe and the giving of the shawl or lap robe enriches the giver as well as the recipient.
St. Anthony's Safety Patrol Ministry
St. Anthony's parish is creating the Safety Patrol Ministry and we are looking for volunteers. The ministry will offer a warm welcome to all people before Sunday Mass but also provide observation of the entire Church area for any unusual activity or concern. These volunteers will be trained for their ministry by competent professionals. The ministry will require a minimal degree of physical stamina for walking around the grounds. A personal cell phone for communication will be necessary. If you are interested in being party of the Safety Patrol, please contact the parish office.
St. Anthony C.Y.O. Sports News
C.Y.O. will start collecting registrations for Co-ed Cross Country Running for Grades 4th thru 8th. Fees are $60 per child.
C.Y.O. will start collecting registrations for Girls Basketball for grades 3rd thru 8th. Fees are of $100 for the 1st child and $75 for each additional sibling. Applications and medical release forms are available on St. Anthony's School website or at the parish office. The cut off date for both sports is mid August.
Manteca Pregnancy Help Center Brats & Brews
The Pregnancy Help Center of Manteca will be holding a Brats and Brews fundraising dinner on Friday, August 19 at the Manteca Transit Center. Doors open at 5:30pm and dinner is at 6:30 pm. Tickets are $25.00 if purchased in advance or $30.00 at the door. Buy online: http;//mantecabratsandbrews.simpletix.com/ or www.phcheroes.org
Save the Date
Join us for this years Harvest Festival on September 17th & 18th! There will be lots of fun, food and games at this family friendly event.
Free Parenting Workshop Nurturing Parenting Philosophy and Practices
Catholic Charities is offering workshops in our area to help parents to learn about the philosophy and practices of nurturing parenting. For more information please call Nancy at (209) 444-5927.
.
St. Anthony's Weekly Events Monday, August 15
Tuesday, August 16
10:00 am Bible Study, Conf. Room
6:00 pm
Misa & Hora Santa, Church
8:00 pm
Music Ministry, Church
Thursday, August 18
Friday, August 19
6:00 pm
Coro Angeles de Dios, Rm. 4
7:00 pm
Grief Support Workshop, Conf. Room
7:00 pm
Cursillos de Cristiandad, Cafeteria
Sunday, August 21
9:00 am
Coffee & Donuts, Cafeteria
7:00 pm
J.A.M., Rec. Hall
TREASURES FROM OUR TRADITION
Long ago, a signet ring was an essential part of the wardrobe of influential people. A letter or document would be sealed with hot wax, and a signet ring pressed into the wax would affirm the origin of the document. In the case of the pope, at least from the thirteenth century, the ring was used to seal public documents with hot lead, saving the red wax for private letters. The public documents were called bullae after the Latin name for the lead stamp, and we still call them "papal bulls."
It is not surprising, therefore, that a signet ring has long been bestowed as part of the inauguration of a pope. The ring is called the Pescatorio, or "Ring of the Fisherman." It reminds the wearer of his link with Peter, and his responsibility to continue the apostolic ministry of "fishing for human beings." Until 1842 it actually functioned as a signet ring. Now, each pope receives a new gold ring at the beginning of his ministry. It goes on the fourth finger of his right hand and bears some fisherman design, usually St. Peter casting nets from a boat, as well as the pope's name in Latin. A custom that endures for the pope, but not so much for bishops, is for people being introduced to him to kiss the Pescatorio as a sign of respect for his teaching authority. Another enduring custom is for the ring to be smashed and defaced at the pope's death, originally a way of preventing counterfeit deathbed documents.
—Rev. James Field, Copyright © J. S. Paluch Co.
Perpetual Adoration
Spend an hour with Jesus in the Most Blessed Sacrament.
Vacant Hours:
Monday
5 pm to 6 pm
Tuesday 10 am to 11 am
Tuesday 12 am (midnight) to Wednesday 1 am
Wednesday 12 am (midnight) to Thursday 1 am
Saturday 12 pm (noon) to 1 pm
Saturday 12 am (midnight) to Sunday 1 am
Adoration partner hours needed:
There are a number of available hours. Please contact
Mark Lilly for information on available hours.
If you would like to sign up for a Holy Hour, please email
Mark Lilly at
[email protected] or call 239-5732.
"English Cursillo Retreat Weekends"
Greetings CURSILLISTAS, is there someone close to your heart that is ready to live a weekend? If so, the Diocese of Stockton English Cursillo Movement will be hosting this years Retreats on the following dates:
Men's Cursillo Retreat 3-day weekend October 6 - 9 th , 2016
Women's Cursillo Retreat 3-day weekend October 20 - 23 rd , 2016
Cursillistas should be familiar with the group method to teach candidates and candidates must be able to receive the body and blood of Christ. For more information on being a sponsor and applications contact Gilbert Somera (209) 401-7143.
THE COSTS OF DISCIPLESHIP
Today's responsorial psalm, Psalm 40, is more familiar to us with the refrain "Here am I, Lord." This "Here am I" is Jeremiah's great prophetic response to God's call. But today's story of Jeremiah and the refrain "Lord, come to my aid!" remind us that there are always two sides to following the call of God. The author of the Letter to the Hebrews knew this, too. He reminded his readers that even weighted down with burdens and sins, we can still persevere by keeping our eyes fixed on Jesus, who himself knew the shame and pain of the cross, but saw beyond it to the joy of sitting at the right of the throne of God.
Jesus himself gave the disciples a "sneak preview" of a baptism that would not be as wondrous as the one in the Jordan that inaugurated his ministry, but would be one of fire and anguish. Today's words from scripture may not be terribly soothing, but in their honesty and strength we can acknowledge the difficulties of daily discipleship, and take comfort in the assurance of our own salvation in Christ.
Copyright © J. S. Paluch Co.
Mass Schedule
```
MONDAY, AUGUST 15 7:00 am – Fr. Jairo †Salvador R. Inventado (Voltaire Inventado) 9:00 am – Fr. Chad †Frank Ruggirello (Ruggirello Family) TUESDAY, AUGUST 16 7:00 am – Fr. Jairo †John Vargas (Judie Cahill) 9:00 am – Fr. Dante †Sadie Cabral (Cabral Family) WEDNESDAY, AUGUST 17 7:00 am – Fr. Jairo †Fred Golisano (Knights of Columbus Council) 9:00 am – Fr. Chad †Anton Marty (Y.L.I.) †Mary & Robert Davidson (Denis Davidson) THURSDAY, AUGUST 18 7:00 am – Fr. Dante Special Intention Guilherme Lima (Guilherme Lima) 9:00 am – Fr. Chad Special Intention Art Perry & Family (Frank Ramalho) FRIDAY, AUGUST 19 7:00 am – Fr. Dante †Josephine Garcia (Modesta Taylor) 9:00 am – Fr. Jairo †Maria Luisa Mendoza (Melva Luna) SATURDAY, AUGUST 20 8:00 am – Fr. Dante †Jose & Dionicia Rocero (Tessie Quintal) 5:00 pm – Fr. David †Joey Cattolica (Holland Family) †Victoria Resuello (Resuello Family) 7:00 pm – Fr. Jairo †Maria Verduzco SUNDAY, AUGUST 21 7:00 am – Fr. Dante †Pat Hose (Nanci & Richard Gruber) †Victoria Resuello (Resuello Family) 8:45 am – Fr. Dante †Luis Da Rocha (Florentino & Adelaide Santos) 10:45 am – Fr. Chad For the People of the Parish 12:30 pm – Fr. Jairo †Victor Murillo 6:00 pm – Fr. Chad †Alvaro Rossete (Ariel Rossete) †Filomena Marcelino (Al Medeiros)
```
GIVING BACK
The Virgin received salvation so that she may give it back to the centuries.
—Peter Chrysologus
Readings & Special Observances
Today's Readings
First Reading
— They took Jeremiah and threw him into the cistern (Jeremiah 38:4-6, 8-10).
Psalm — Lord, come to my aid! (Psalm 40).
Second Reading — Let us keep our eyes fixed on Jesus, the leader and perfecter of faith (Hebrews 12:1-4).
Gospel— I have come to set the earth on fire, and how I
wish it were already blazing (Luke 12:49-53).
The English translation of the Psalm Responses fromLectionary for Mass
© 1969, 1981, 1997, Interna- tional Commission on English in the Liturgy Corporation. All rights reserved.
Saints & Special Observances
Sunday: Twentieth Sunday in Ordinary Time
Monday: The Assumption of the Blessed Virgin
Mary
Tuesday: St. Stephen of Hungary
Friday: St. John Eudes
Saturday: St. Bernard
Readings for the Week
Monday: Vigil: 1 Chr 15:3-4, 15-16; 16:1-2;
Ps 132:6-7, 9-10, 13-14; 1 Cor 15:54b-57;
Lk 11:27-28
Day: Rv 11:19a; 12:1-6a, 10ab;
Ps 45:10-12, 16; 1 Cor 15:20-27;
Lk 1:39-56
Tuesday: Ez 28:1-10; Dt 32:26-28, 30, 35cd-36ab;
Mt 19:23-30
Wednesday: Ez 34:1-11; Ps 23:1-6; Mt 20:1-16
Thursday: Ez 36:23-28; Ps 51:12-15, 18-19;
Mt 22:1-14
Friday: Ez 37:1-14; Ps 107:2-9; Mt 22:34-40
Saturday: Ez 43:1-7a; Ps 85:9ab, 10-14; Mt 23:1-12
Sunday: Is 66:18-21; Ps 117:1, 2;
Heb 12:5-7, 11-13; Lk 13:22-30
.Marriage Encounter
Do you know that more than 1,500,000 couples in over 92 countries have experienced a Worldwide Marriage Encounter Weekend? They found something worth passing on. The next Marriage Encounter Weekend is Sept. 30-Oct. 2 in Turlock. For more information visit our website at: https://www.stocktonwwme.org or contact John & Angelica at (209) 691-0603 at [email protected].
Year of Mercy
Holy Doors, Pilgrimages, and Indulgences
St. Stanislaus Church, 1200 Maze Blvd., Modesto, California is designated as a pilgrimage site for the Jubilee Year of Mercy. The Holy Door is located on the north side of the church and is open Monday-Friday 10:00 am to 7 pm, and Saturday and Sunday 8:00 am to 8:00 pm through November 20, 2016.
|
<urn:uuid:c3e9ca26-c3b2-43e8-beb9-b8e2e0004009>
|
CC-MAIN-2017-43
|
http://st-anthonys.org/bulletins/20160814.pdf
|
2017-10-23T15:29:24Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187826114.69/warc/CC-MAIN-20171023145244-20171023165244-00849.warc.gz
| 329,523,971 | 6,103 |
eng_Latn
|
eng_Latn
| 0.702482 |
eng_Latn
| 0.917352 |
[
"eng_Latn",
"eng_Latn",
"spa_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1816,
5366,
9496,
14251,
18443,
21925
] |
Ladies Auxiliary of the Father Joseph O'Connell Council #3481 Knights of Columbus 2985 Kenneth Place, Oceanside, NY 11572
PHONE: 516-678-1237 OPTION #2 THEN OPTION #9
WEBSITE: ladiesauxiliary3481.com
EMAIL: [email protected]
Lisa James President 516-305-1110
Fr. Bret J.
Moderator
Celebrating 68 Years of Charity
Stockdale
SEPTEMBER 2020 NEWSLETTER
PRESIDENT'S MESSAGE: Dear Ladies: As you know, unfortunately, our auxiliary year pretty much ended in March due to the Global Pandemic – COVID-19. The Fashion Show was canceled; Our Lady of the Year was celebrated with a masked drive by – hardly an appropriate tribute; the Installation of Officers was conducted on a Zoom video conference. All things considered, I am personally grateful for the health and well-being of my loved ones and hope that you are all safe and healthy. But as we know, time stops for no one and although our daily lives may look different, we persevere. This year will be different. These unprecedented times are pushing us to be creative, particularly with our fundraising efforts. So, we ask for your patience, understanding and generosity. We will do what we do best – work together in the spirit of unity and sisterhood. We will take every precaution to be safe while still having fun, faith and fellowship. Feel free to reach out to me anytime at 516-305-1110. I look forward to seeing you all soon. May God bless our church, family, community and country. ~Lisa James, President
2020/2021 BUDGET: In accordance with Article VII Sec. 3 of our bylaws, this is to notify you that copies of the proposed budget will be available and voted upon at our September meeting.
CHANGE IN NEWSLETTER: Keeping in line with the Knights, we are now going digital. The newsletter will be emailed each month to you along with flyers and other pertinent information. If you, or another member you know, do not have access to email, please contact Tricia Daley. Please be sure that you submit any changes to your contact information directly to Tricia Daley, Recording/Corresponding Secretary at [email protected] or 516-398-6132.
MEMBERSHIP MEETING: Our first meeting is scheduled for September 1, 2020. Upon entering the Council, you will be guided by our trustees, Vanessa Ambrosecchia PP, Lisa Kahl PP, and Kim Marchetti, PP. Please enter through the lounge. Your temperature will be taken when you arrive. Masks must be worn throughout the duration of the evening except when seated. Attendance is taken at every meeting. Please be prepared with your membership card as it will be checked by Noreen McCabe, Sergeant at Arms. Immediately following the meeting, we will head to the lounge for hospitality and some "icebreaker" fun.
2020 CHARITABLE DONATIONS: Charitable donations from the Ladies Auxiliary efforts during the 2019/2020 year were sent to: St. Anthony's Church, 3481 Catering, Passetti Catering, Vineyard Church Food Pantry, Oceanside Community Service Center, Oceanside Sr. High School Best Buddies, Oceanside Fire Dept. Kenny Marino, South Nassau SIBS, and Heart of American Homes Foundation.
WAYS & MEANS: Autumn Paint Night Fundraiser. Friday, October 9, 2020. Limited seating – First come, first serve. $35 pp - Doors open at 6:45 pm at St. Anthony's Cafeteria. Join us to create a painting from start to finish of the "Harvest Moon on an Autumn Night" – no experience necessary! Light refreshments will be served. BYOB! RSVP by 9/28 to Rosemarie Prendergast, VP at 516-996-5191.
MEMBERSHIP DUES: Please submit your annual $15.00 membership dues for the 2020/2021 Auxiliary year to Amy Bermudez, Financial Secretary at our next membership meeting or mail to Ladies Auxiliary Attn: Amy Bermudez, PP Financial Secretary, 2985 Kenneth Place, Oceanside, NY 11572. If you wish to have your card mailed back, be sure to include a self-addressed STAMPED envelope. Membership dues are to be paid by December 1, 2020. If we did not receive payment of your dues for the 2019/2020 year you are in jeopardy of having your name removed from our roster and mailing list (see By-Laws IX-Dues). Any questions, call Amy Bermudez, PP at 516-384-9566.
LIFETIME MEMBER: If you are 80 years old by September 1, 2020 you will be considered a "Lifetime Member" and your dues will be waived. You must provide proof to Financial Secretary, Amy Bermudez, PP 516-384-9566.
Instagram:
@ladies3481 Twitter: @3481ladies
Ladies Auxiliary of the Father Joseph O'Connell Council #3481 Knights of Columbus 2985 Kenneth Place, Oceanside, NY 11572
PHONE: 516-678-1237 OPTION #2 THEN OPTION #9
WEBSITE: ladiesauxiliary3481.com
EMAIL: [email protected]
Lisa James President 516-305-1110
Fr. Bret J.
Moderator
Celebrating 68 Years of Charity
Stockdale
SEPTEMBER 2020 NEWSLETTER
FRATERNAL ASSISTANCE: If there is a Sister in need of Financial Assistance through our Fraternal Assistance Program, all proposals must be submitted in writing. For more information, please contact Financial Secretary, Amy Bermudez, PP 516-384-9566
SUNSHINE, SICK & VIGIL: If you know of a member who is sick or has had a recent death in the family, please notify Lisa Kahl, PP at 516-633-1376.
2020/2021 CALENDAR
All meetings are held on the First Tuesday of every month and will begin at 7:00pm (unless otherwise notified)
| September 1, 2020 | Membership Meeting | February 2, 2021 |
|---|---|---|
| October 6, 2020 | 2020/2021 Installation | March 2, 2021 |
| October 9, 2020 | Paint Night Fundraiser | April 6, 2021 |
| November 17, 2020 | 2020 Lady of the Year | April 18, 2021 |
| December 8, 2020 | Ladies Christmas Dinner Party | May 4, 2021 |
| January 5, 2021 | Membership Meeting | May 31, 2021 |
KNIGHTS CORNER
**Please note all events are subject to change and have limited spacing**RESERVATIONS ARE A MUST**
KNIGHT OWL LOUNGE: The lounge is now serving food Tuesday – Saturday, 2pm - 7pm. Stop by and check out the menu.
K OF C CHARITABLE & BENEVOLENT PROGRAM: Grand Prize $25,000/Second Prize $10,000/Third Prize $5,000/10 Prizes @ $1,000 Each book is $12.00 with 6 chances to win. For books and more information contact DGK Paul Kahl @ 516-860-8858 or SK Frank Modica @ 631-513-8277. Final drawing will be on 12/5/2020 - tickets needs to be in by 12/1/2020.
KNIGHT OF THE YEAR BRUNCH: Sunday, August 30. Mass @ 9:30am St. Anthony's Chapel. Immediately following is the award presentation and brunch in church cafeteria. $10 per person. LIMITED SEATING - reservations are a must. Contact DGK Paul Kahl @ 516-860-8858
GRAND KNIGHT TESTIMONIAL: Sunday, September 13. 12pm-4pm. Contact PGK Darab Lawyer @ 516-242-0036
ITALIAN NIGHT: Friday, September 18. 7pm-11pm. Location to be determined. $35 per person includes Italian style dinner and DJ. Bring your own beverage. 50/50 Contact PGK Gene Peluso @ 516-404-0616
FIRST ANNUAL CIGARS AND STEAKS FUNDRAISER: Saturday, September 19 12pm-4pm Knight Owl Lounge. $100 per person includes steak lunch, open bar, 3 Line of Duty Cigars, stainless steel cutter & lighter. Baskets and 50/50 will be available. Contact Chancellor Donald Morgan @ 917-371-3291.
Respectfully submitted, Tricia Daley, Corresponding/Recording Secretary
Facebook: Ladies Auxiliary of the Father Joseph O’Connell Council #3481
Instagram:
@ladies3481 Twitter: @3481ladies
|
<urn:uuid:233d8206-ef53-43cf-b3dd-657960422e60>
|
CC-MAIN-2020-40
|
http://ladiesauxiliary3481.com/pdf/LA_Sept2020_Newsletter.pdf
|
2020-09-25T22:21:16+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-40/subset=warc/part-00024-50bb8e61-7c5b-4d2c-bd34-dad6ca92b697.c000.gz.parquet
| 66,922,386 | 1,962 |
eng_Latn
|
eng_Latn
| 0.978718 |
eng_Latn
| 0.988958 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
4426,
7329
] |
FAS
Suggestions about Japan's Nuclear Fuel Recycling Policy Based on U.S. Concerns
A special report published by the Federation of American Scientists
Yusei Nagata March 2016
About FAS
Founded in November 1945 by many of the scientists who built the first atomic bombs, the Federation of American Scientists (FAS) is devoted to the belief that scientists, engineers, and other technically trained people have the ethical obligation to ensure that the technological fruits of their intellect and labor are applied to the benefit of humankind. The founding mission was to prevent nuclear war. While nuclear security remains a major objective of FAS today, the organization has expanded its critical work to address urgent issues at the intersection of science and security. FAS publications are produced to increase the understanding of policymakers, the public, and the press about urgent issues in science and security policy. Individual authors who may be FAS staff or acknowledged experts from outside the institution write these reports. Thus, these reports do not represent an FAS institutional position on policy issues. All statements of fact and expressions of opinion contained in this and other FAS Reports are the sole responsibility of the author or authors.
Acknowledgements
I specially thank all of the experts who kindly gave me their opinions about the topic of the report. I am very grateful for the mentoring from FAS President Charles D. Ferguson. Moreover, I am very appreciative of the advice on the report by Pia Ulrich of FAS and the report's editing and formatting by Allison Feldman, Communications and Community Outreach Officer at FAS.
© 2016 by the Federation of American Scientists. All rights reserved.
For more information about FAS or publications and reports, please call 202-546-3300, e-mail [email protected], or visit www.fas.org.
Design, layout, and edits by Allison Feldman.
Cover Photo: ©f11photo, Shutterstock.
Table of Contents
Introduction
To date, Japan's peaceful nuclear energy use has taken the form of a nuclear fuel recycling policy that reprocesses spent fuel and effectively utilizes the plutonium retrieved in light water reactors (LWRs) and fast reactors (FRs). With the aim to complete recycling domestically, Japan has introduced key technology from abroad and has further developed its own technology and industry.
After India's nuclear test in 1974, the United States, a leader in the field of nuclear energy use, enforced a policy of nonproliferation, influencing other countries' policies. However, in 1988 after discussions on Japan's nuclear energy use, the United States and Japan signed a nuclear cooperation agreement, in which the U.S. government permitted Japan's promotion of recycling activities. [1] Through efforts to obtain the understanding of the international community regarding peaceful nuclear energy use such as its aggressive acceptance of IAEA safeguards, Japan has become the only non-nuclear weapon state with full recycling technology and facilities. [2]
However, Japan presently seems to have issues regarding its recycling policy and plutonium management. All of the spent fuel in Japan has been stored as future energy resources. Some spent fuel has been reprocessed at commercial reprocessing plants in Europe and a testing plant in Japan. Consequently, 7.3 tons of separated fissile plutonium (Puf) in Japan and 24.5 tons of Puf in Europe have been accumulated as of the end of 2014. [3] In addition, a commercial reprocessing plant in Japan is under construction and is expected to start operating in 2018. [4]
All of the separated plutonium retrieved by reprocessing is planned to be consumed in nuclear reactors. But, because of the Fukushima nuclear accident in 2011, all of Japan's nuclear reactors have been stopped. After the Fukushima nuclear accident, the Nuclear Regulation Authority (NRA) was established in 2012 and new regulations were introduced requiring safer and more secure operations of nuclear reactors. Since then, although Japanese electric power companies have made efforts to restart nuclear reactors as soon as possible, only two nuclear reactors have restarted as of 2015, with the approval of the NRA and the consent of local governments. Because restarts of nuclear reactors are difficult, slow, and unforeseeable, it is unclear how Japan's plutonium consumption will be affected in the future.
Because of recent increasing risks of terrorism and nuclear proliferation in the world, the international community seeks much more secure use of nuclear energy. All of the countries that store plutonium (which can be used for making nuclear weapons) must make the best efforts possible to decrease it. Taking this into account, concerns about Japan's problem of plutonium management have been growing in the international community and Japan's accountability for its recycling policy is essential.
In this paper, I analyze U.S. experts' opinions and concerns about Japan's problem and consider what Japan can (and should) do to solve it.
U.S. Experts' Opinions about Japan's Nuclear Energy Policy
In order to know what the United States is concerned about regarding Japan's nuclear energy policy including its recycling policy, I collected opinions of about a dozen U.S. experts from industry, academia, think tanks, and government-related organizations, mainly through interviews.
Opinions about Japan's nuclear energy policy after Fukushima nuclear accident
1. Japan should restart nuclear reactors as soon as possible to solve the problem of climate change. Many U.S. experts believe nuclear energy is a major energy resource that can help to solve the issue of climate change, so Japan needs to continue producing nuclear energy.
2. Japan should be very careful about nuclear energy use. Rather, it should develop renewable energy use. Some experts, who are anxious about nuclear energy safety and security, are adverse to nuclear energy use and instead advocate the development of much safer and cleaner energy resources.
Opinions about Japan's recycling policy
1. Recycling has no value in the economic sense today.
2. Recycling causes nuclear proliferation and security risks. Most of U.S. experts insist that the idea of recycling was built on an (incorrect) assumption of scarce uranium resources. They insist that because today's and foreseeable prices of uranium are cheaper than the price to use plutonium, recycling has no economic value or advantage. [5] In addition, they claim that recycling has inherent risks related to proliferation, such as plutonium (the material used to create a nuclear weapon) theft. Although no U.S. experts whom I have talked to are concerned about the risk that Japan is currently making nuclear weapons with its stored plutonium, some of them point out that the mere capability of making nuclear weapons creates stress with other countries in Asia.
3. The value of recycling can be different from country to country. There might be a value in Japan due to its dense population in such a small region, therefore making spent fuel disposal in Japan more difficult than in the U.S.
4. Although recycling has value, we don't yet have enough technology to use plutonium or other trans-uranic materials fully today. Some U.S. experts think that recycling has significance under certain conditions, such as high difficulty of nuclear waste disposal or achievement of strong technological basis.
5. Japan should stop its recycling policy.Some experts in the nonproliferation community, especially those who are strongly concerned about the risks of plutonium, insist that Japan should stop its recycling policy because recycling has no economic merits and causes nuclear proliferation and security risks.
6. If Japan continues its recycling policy, Japan should solve the problems below:
a. Japan should balance plutonium production and consumption.
b. Japan should decrease the amount of plutonium as much as it can.
c. Japan should operate the commercial reprocessing plant in Rokkasho after solving these problems.
Most of U.S. experts are eager to reduce the amount of Japan's plutonium. Based on the fact that restarts of nuclear reactors in Japan are slow and that Rokkasho Reprocessing Plant (RRP) is planned to start in 2018, they are concerned about the possibility that the amount of Japan's plutonium may continue to increase without a credible plan of consumption for the future.
7. Japan should have a more transparent recycling policy plan. Some experts suggest that Japan should not only declare that it will not have any excess plutonium, but that it will also show a detailed plan about plutonium management.
8. Japan should explore all possibilities, especially spent fuel disposal options. Some experts suggest that it is important for Japan to maintain its "once-through" option of spent fuel disposal, even while it continues its recycling policy, because Japan may not have enough reactors to burn all of the plutonium in the future.
Opinions about Japan's R&D approaches towards the future
1. Japan should seek alternatives to mixed oxide (MOX) fuel for plutonium disposal. Experts who are opposed to Japan's recycling policy insist that Japan should seek to dispose plutonium without burning it as MOX fuel. They are also concerned about the U.S. plan to dispose excess plutonium from dismantled nuclear weapons by making and burning MOX fuel. They suggest that the U.S. and Japanese governments should cooperate on this issue.
2. As long as Japan continues its recycling policy, it should be involved with the development of FR technology. Japan can promote development of much more secure technology of reprocessing. Japan aims to achieve two things by recycling. The first is to gain fissile plutonium as an energy resource by transmuting non fissile uranium. The second is to decrease the volume and toxicity of nuclear wastes by burning long half-life material. LWR is not as efficient for these purposes, so FR is preferable. That is why some experts suggest that there should be a strong connection between recycling policy and FR, and why Japan has promoted R&D on FR technology. Some experts also suggest that it is adequate to do R&D to look for the much safer and more secure reprocessing technology that doesn't separate pure plutonium if Japan continues its recycling policy.
3. Japan should enhance its storage capacity of spent fuel, particularly with the use of dry cask storage technology. Some experts point out that an urgent risk of the lack of spent fuel storage ability is a driving force to the early operation of a commercial reprocessing plant. In order to avoid this risk, they suggest that Japan should increase its capacity of interim spent fuel storage, using a dry cask storage system, which is very safe and cheap.
4. Japan should promote R&D on advanced nuclear reactors. Some experts vow that the world is moving towards much safer and cheaper nuclear reactors. This worldwide trend is related to their construction by many countries that have essentially no experience of operating nuclear reactors, necessitating the creation of a new type of reactor with inherent safety features that can be stopped safely and automatically without well experienced operators in case of accidents. Advanced reactors are expected to satisfy both safety and lower cost concerns.
5. Japan should promote R&D on renewable energy technology. Because Japan is completely certain that the achievement of cheap, safe, and clean renewable energy resources is ideal, it needs to promote R&D in this field.
What Can (and Should) Japan Do To Solve Its Problematic Recycling Policy?
One of the goals of this article is to consider what Japan's options are in regards to its challenging recycling policy. This section will focus on U.S. experts' opinions on recycling, and I will consider potential routes that Japan can take based on them.
What can (and should) Japan do based on the opinion that Japan should end its recycling policy?
1. It is not realistic for Japan to stop its recycling policy at present. After the Fukushima nuclear accident in 2011, Japan discontinued all of its nuclear reactors and considered its future policy on nuclear energy use. After discussion, the Japanese government decided on the continuation of nuclear energy use and recycling, formulated in its Strategic Energy Plan of 2014.
We can understand how Japan thinks about recycling from the Strategic Energy Plan. First, although it is said that recycling has no economic value today, Japan has discovered that it has significance in other ways. In its Strategic Energy Plan, it is described that the basic policy of Japan is to promote a nuclear fuel cycle "from the viewpoint of effective utilization of resources and reduction of the volume and harmfulness of high-level radioactive waste." [6]
Second, Japan has a longstanding history of cooperation among all parties in the promotion of recycling and solving the issue of spent fuel management, which is regarded as a significant mid to long-term topic of concern. Over time, the central government has formulated national policy and developed fundamental technology, while industry has constructed and operated recycling facilities. The local government of Aomori, a prefecture in the northern part of Japan's main island of Honshu, has accepted these facilities and the interim storage of spent fuel and nuclear wastes as a result of reprocessing. In the Strategic Energy Plan, it is described that the Japanese government will steadily promote reprocessing and plutonium use "while taking into consideration the past history and seeking the understanding of the relevant municipalities," and that "problems related to the nuclear fuel cycle cannot be solved in a short period but require a mid to long-term approach." [6]
The Fukushima nuclear accident certainly brought to light a significant problem of spent fuel management that nuclear reactors stopped and the plutonium consumption plan became unclear. However, does it lead directly to the idea that Japan stops its recycling policy?
When considering the history of Japan, it is more realistic and natural for Japan to make best efforts to solve these new problems and continue its recycling policy.
Because only a few years have passed since Japan established its post-Fukushima nuclear accident policy in 2014, it should be carefully watched and monitored.
2. Japan should explore other options regarding spent fuel management so that it can change its policy if necessary in the future. Some U.S. experts point out that one of the reasons why Japan doesn't discontinue its recycling policy is because of the complicated relationship between the central and local governments.
If the Japanese government stops its recycling, all of the spent fuel and nuclear wastes that have accumulated must be moved out of Aomori prefecture because the continuation of recycling policy is the condition for all of cooperation of Aomori prefecture. But who is ready (and willing) to accept the spent fuel and nuclear waste buildup? The Japanese government has no realistic answer. The U.S. experts point out that this situation makes it difficult for the Japanese government to stop its recycling policy. Another U.S. expert insists that just to be able to continue its present policy is one of the reasons why the Japanese government doesn't stop its recycling policy.
These opinions reveal a negative aspect of Japan's policy. Because Japan concentrated solely on the promotion of a recycling policy for so long, it appears to have no other realistic policy options about spent fuel management now.
Looking towards the future, Japan should improve this problem. And some activities have been beginning after Fukushima nuclear accident.
In the Strategic Energy Plan, it is described that the Japanese government will "secure reversibility and retrievability so that the future generation will be able to select the best disposal method when a better solution will be found in the future," and that it is "necessary to expand the capacity for storing the spent fuels and is urgently important to broaden the range of choices for managing the spent fuels while ensuring safety," and "it will make flexibility of policies and response, and contribute to medium-term energy security." [6] After the Fukushima nuclear accident, Japan began R&D on the spent fuel direct disposal method and began to strengthen its efforts for facilitating the construction and utilization of new interim storage facilities and dry cask storage facilities. [7] [8]
These activities are examples of how Japan is exploring additional options should a policy change occur in the future. Japan should promote such innovation and advancement in the field of nuclear energy.
3. Japan should continue to intensify its efforts for the peaceful use of nuclear energy. Moreover, in order to promote its recycling policy, Japan needs to overcome nuclear proliferation and security risks related to reprocessing. Japan has already taken several positive steps in the direction of peaceful nuclear energy use, such as its aggressive acceptance of IAEA safeguards over the years. Japan must continue these activities.
Yet the Fukushima nuclear accident highlights a new problem about recycling and Japan must take accountability to solve this problem. This will be discussed in the coming sections.
What can (and should) Japan do based on the opinion that Japan should balance its production and consumption of plutonium?
Japan should develop a new mechanism to take the appropriate balance of plutonium production and consumption before RRP starts to operate. Most of the U.S. experts who emphasize proliferation and security risks caused by recycling are concerned about the possibility that Japan will produce more plutonium at RRP than it can consume in nuclear reactors.
RRP is planned to begin operations during the first period of the Japanese fiscal year 2018 (between April and September of 2018). [4] From there, it will gradually pump up its operations and, when it reaches full scale, approximately 4.5 tons of Puf can be produced per year. Yet because the process of restarting nuclear reactors has been delayed and the restart times are difficult to foresee, the expected amount of plutonium consumption is also unclear. In order to restart nuclear reactors, approval of the NRA and the consent of local governments are necessary. This strict process stems from anxiety about nuclear reactor safety after the Fukushima nuclear accident. A report estimates the probable amount of plutonium consumption as of 2023 and it insists that it is impossible for Japan to consume 4.5 tons of Puf per year under current evaluations. [9] This leads to the need for an adjustment of the throughput of RRP in order to balance the amount of plutonium emitted.
However, because RRP is a commercial plant operated by a private company, operations should be carried out on a business basis. Adjusting the throughput can lead to a fall in profits, so it is not necessarily easy to adjust the throughput of RRP in today's systems; this creates a tricky dynamic between nonproliferation and business.
In order to resolve this difficult situation, the Japanese government working together with industry should consider building a new mechanism to satisfy both nonproliferation concerns and commercial objectives, while also fulfilling the issue of plutonium balance. Although it is described in the Strategic Energy Plan of 2014 that the Japanese government will "conduct an appropriate management and utilization of plutonium while paying due consideration to an appropriate balance between separation and utilization of plutonium," a more concrete and transparent mechanism must be determined. [6]
This mechanism can be achieved through various approaches, including the establishment of an organization, regulation standards, a budget, and so on. This mechanism may be enforced by the Japanese government, industry, or a combination of the two. In order to increase the credibility and transparency of this mechanism, the Japanese government must commit to it regardless of where it's made.
In addition, this mechanism should be grounded on the idea that the production amount should be determined based on the estimated amount of consumption, while also taking into account the mechanism should be realistic and flexible enough to truly work. Although the amount of plutonium produced can be adjusted technically by changing the operation level of RRP, the estimated amount of consumption is more difficult to quantify because of the complicated and unforeseeable process of reactors' restarts. So, the amount of production can only be determined based on the consumption amount estimated at a certain level of accuracy. Although the criteria of "a certain level of accuracy" are difficult to establish, a significant benchmark may be securing the approval of the NRA and the consent of local governments about restarting reactors that are planning to use MOX fuel.
Moreover, even though the amount of consumption is approximated carefully, the estimated amount does not always match with how much plutonium is actually consumed. There is a time lag between the timings of estimation and consumption because some processes, such as MOX fuel fabrication, are necessary. During this time lag, the plutonium consumption plan of each reactor can be changed based on varying circumstances encountered during operations. For example, there may be a case when a reactor stops because of an unplanned shutdown and it can't consume as much plutonium as it planned to consume. To solve this issue, it is important
not to aim to take the plutonium balance every year tightly but take it in a certain time period. In the case above, the plutonium production amount of next some years should be adjusted to take the appropriate balance at the end of the time period. It is not a simple and easy task to take the plutonium balance. Japan should consider a new mechanism that is realistic and flexible enough to work.
What can (and should) Japan do based on the opinion that Japan should decrease its overall amount of plutonium as much as it can?
If Japan doesn't currently have a serious need or plan to use its own plutonium that is stored in the United Kingdom and France, taking its ownership to both countries is a possible good idea. Japan should begin discussions with both countries in regards to the feasibility of this idea.
In 2014, on the occasion of the third Nuclear Security Summit in The Hague, Netherlands, Prime Minister Abe and President Obama pledged to remove and dispose of all of the plutonium and highly-enriched uranium from Fast Critical Assembly, a testing facility in Japan. These nuclear materials are set to be securely transferred to the United States and then fully converted into less sensitive forms. [10] These efforts to decrease nuclear material of both countries are highly evaluated.
Japan has a large quantity of plutonium stockpiled not only in Japan, but also in the United Kingdom and France. By learning from the achievement at the third Nuclear Security Summit, it seems to be effective for Japan to take ownership of Japan's plutonium to both countries if Japan doesn't have strong needs or plans to use it today. Japan should start to discuss this idea with both countries.
One of the biggest concerns about Japan's current plutonium storage situation is the anxiety over the excess of plutonium that can't be consumed or disposed of. However, this same anxiety exists in the United Kingdom and France as well because the plutonium management plans of both countries are not clear or uncertain. [11] When considering solely the Japanese situation, this idea of taking ownership of excess plutonium to the UK and France definitely alleviates these concerns, yet it may increase European unease when considering the whole world.
Of course, because taking ownership of plutonium diminishes the risk caused by transportation of plutonium from Europe to Japan, this idea should remain on the table. So I believe that Japan should try to carry out this idea, but that it should recognize that other countries have similar issues, and that any decision by any country can have widespread impacts and consequences.
What can (and should) Japan do based on the opinion that Japan should explore all possibilities, especially about spent fuel disposal, and opinions about Japan's R&D approach towards the future?
In order to explore and maintain many policy options, Japan should promote broad R&D. As mentioned previously, when considering the policy about spent fuel management, I think Japan should explore other policy options while it continues its recycling policy. For this purpose, I believe it is important and effective to promote R&D.
In nature, R&D is an effective tool, not only because it furthers existing national policies, but also because it contributes to the building of technical standards and the exploring of the possibility of new national policies. This importance of R&D is true of not only of spent fuel management but also of other issues. Japan began to promote R&D on the direct disposal method of spent fuel after the Fukushima nuclear accident. Japan has also promoted R&D on advanced nuclear reactors and renewable energy use, in which U.S. experts have vested interests (as shown above). Japan should continue and intensify these types of R&D activities in order to explore and maintain several policy routes in the future. Moreover, in order to promote R&D effectively and economically, it is important to cooperate with other countries which have aligned problems and interests.
In addition to robust technical R&D, policy research is also vital. By considering what policy may be desirable in the future and how it can be achieved, Japan can advocate for candidates of its policy and R&D. In general, because policy research isn't as expensive compared to technical R&D, the Japanese government should fund policy research in order to gather useful ideas from professionals and experts in the field. In particular, participation and collaboration of experts internationally will be effective should Japan's policy be considered in a global context.
Conclusion
In this paper, I showed U.S. experts' opinions about Japan's nuclear energy policy, especially concerns about its recycling policy, and considered five suggestions for Japan's future.
1. Although it is not realistic for Japan to stop its recycling policy now, Japan should explore other options about spent fuel management so that it can change its policy if necessary in the future.
2. Japan should continue its efforts for the peaceful use of nuclear energy, including its plutonium management.
3. Japan should develop a new mechanism to take the appropriate balance of plutonium production and consumption before RRP starts to operate.
4. In order to decrease the amount of Japan's plutonium, taking ownership of Japan's plutonium stored in the United Kingdom and France to both countries is a possible good idea. Japan should start to discuss this idea with them.
5. In order to explore and maintain many policy options, including those about spent fuel management, Japan should promote broad R&D.
Through these kinds of activities, Japan should continue and intensify its peaceful nuclear energy use, while also promoting its accountability and transparency to the international community.
Besides, Japan should contribute to the whole world. Japan is a unique country in that it has one of the most developed nuclear energy use programs and it is the only non-nuclear weapon state that has full recycling technology capabilities and facilities, all while being the only country that has suffered from nuclear weapons at war. Because of its distinctive status, Japan's policy can affect all countries which use or will use nuclear energy. Improvement of its stored plutonium management can contribute to other countries that have the same problems and Japan's experiences and advanced technology about peaceful nuclear energy use, such as safeguards, can contribute to the development of countries emerging in the nuclear energy field.
It is important for Japan to recognize its position in the international regime and to make its best effort to improve both domestic and international peaceful nuclear energy use.
Endnotes
[1] Agreement for Cooperation Between the Government of the United States of America and the Government of Japan Concerning Peaceful Uses of Nuclear Energy. [Online]. Available: http://nnsa.energy.gov/sites/default/files/nnsa/05-13-multiplefiles/2013-0502%20Japan_123.pdf.
[3] Secretariat of the Atomic Energy Commission. "The Status of Plutonium Management in Japan." 21 July 2015. [Online]. Available: http://www.aec.go.jp/jicst/NC/iinkai/teirei/siryo2015/siryo28/siryo3.pdf (in Japanese), http://www.aec.go.jp/jicst/NC/iinkai/teirei/siryo2015/siryo28/siryo3_e.pdf (in English).
[2] Kazuko Goto. Japan's Role as Leader for Nuclear Nonproliferation. 2012.
[4] Japan Nuclear Fuel Limited. "Schedule Change of Completion of Rokkasho Reprocessing Plant and MOX Fuel Fabrication Plant." 16 November 2015. [Online]. Available: http://www.jnfl.co.jp/english/topics/151116-1.html.
[5] Matthew Bunn, Steve Fetter, John P. Holdren and Bob van der Zwaan. "The Economics of Reprocessing vs. Direct Disposal of Spent Nuclear Fuel." Nuclear Technology, vol. 150, no. 3, 2005.
[6] Strategic Energy Plan. April 2014. [Online]. Available:
http://www.meti.go.jp/press/2014/04/20140411001/20140411001-1.pdf (in Japanese), http://www.enecho.meti.go.jp/en/category/others/basic_plan/pdf/4th_strategic_energy_pla n.pdf (in English).
[7] Chisou Shobun Kiban Kenkyuu Kaihatsu Chousei Kaigi, Chisou Shobun Kiban Kenkyuu Kaihatsu ni kansuru Zentai Keikaku (Heisei 25 nendo - Heisei 29 nendo). March 2013. [Online]. Available: http://www.enecho.meti.go.jp/category/electricity_and_gas/nuclear/rw/docs/library/rprt3/ rprt06.pdf.
[8] Saishuu Shobun Kankei Kakuryou Kaigi, Shiyouzumi Nenryou Taisaku ni kansuru Action Plan. 6 October 2015. [Online]. Available: http://www.cas.go.jp/jp/seisaku/saisyu_syobun_kaigi/pdf/1006siryou1.pdf.
[10] "Joint Statement by the Leaders of Japan and the United States on Contributions to Global Minimization of Nuclear Material." 24 March 2014. [Online]. Available: http://www.mofa.go.jp/dns/n_s_ne/page18e_000059.html.
[9] James M. Acton. Wagging the Plutonium Dog: Japanese Domestic Politics and Its International Security Implications. 2015.
[11] Frank von Hippel and Gordon MacKerron. Alternatives to MOX. Direct-disposal options for stockpiles of separated plutonium. The International Panel on Fissile Material, 2015.
|
<urn:uuid:3c7e03d9-985c-4abc-b31e-f7704753525e>
|
CC-MAIN-2019-47
|
https://fas.org/wp-content/uploads/2016/03/japannukefuelrecyling_final.pdf
|
2019-11-17T07:09:43
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2019-47/subset=warc/part-00250-47abed28-4fa2-4f4a-b4d3-db11c85b2f3a.c000.gz.parquet
| 402,320,403 | 6,101 |
eng_Latn
|
eng_Latn
| 0.956709 |
eng_Latn
| 0.997964 |
[
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
177,
1954,
1973,
5060,
7853,
10840,
11611,
14789,
17945,
21775,
24948,
26390,
28528,
30869
] |
Operational Policy
COLAC OTWAY WEED MANAGEMENT POLICY
PURPOSE
<<Insert a brief description of why the policy exists and what it is expected to achieve.>>
Weeds, or invasive plants, pose a serious threat to natural, social and amenity assets across Australia and have a profoundly detrimental impact on biodiversity, public amenity and primary production. Weed management in Colac Otway Shire is therefore critical to the protection and enhancement of these assets, and Council has legislated responsibility to respond to threats posed by declared weeds on land it manages, in particular under the Catchment and Land Protection Act 1994 (CaLP Act), which sets state-wide strategic policy for invasive species.
Health, safety, biodiversity conservation and amenity can be seriously affected by weeds. Weeds can threaten wildlife and habitat, rare or threatened species, native vegetation communities and ecosystems. They are visible to the community and in some cases reduce amenity and contribute to reduction in the safe access or use of public spaces.
Weed management in Colac Otway is critical for the protection and enhancement of biodiversity and the protection and encouragement of indigenous flora and fauna and is critical in the maintenance of a range of public spaces including street landscapes, parks and sports fields.
The purpose of this policy is to outline the key principles that guide Colac Otway Shire Council's weed management programs to ensure Council is able to implement effective and accountable weed control and chemical/herbicide application that also minimises environmental and human impacts.
SCOPE
<<Describe the coverage of the policy, that is who or what it applies to and the extent of activities that it covers.>>
This policy applies to all weed treatment programs auspiced, undertaken or contributed to by Colac Otway Shire Council, and it is binding upon Councillors, Council Officers, contractors and consultants, while engaged by Council, and any volunteers involved with works associated with these programs.
This policy applies to:
- Amenity and asset maintenance, public open space management and road maintenance; and
- Environmental weed management for biodiversity protection and enhancement.
DEFINITIONS
<<Provide a list and brief description of key terms used in the policy.>>
NB. For consistency across all of Council's weed management documentation, this list contains phrases that pertain to both this policy and its related procedures.
REFERENCES
This policy is governed by the following Legislation and Statutory Regulations:
- Catchment and Land Protection Act 1994 (CaLP Act)
- Agricultural and Veterinary Chemicals (Control of Use) Act 1992
- Agricultural and Veterinary Chemicals (Control of Use) Regulations 2007
- Occupational Health and Safety Act 2004
- Occupational Health and Safety Regulations 2007
- Public Health and Wellbeing Act 2008
- Public Health and Wellbeing Regulation 2009
- Safety Data Sheets (SDS) – All chemicals used by Council are bound by the product specific SDS from a legislative perspective. The SDS highlights how a chemical is to be used and stored, and safety requirements for the public and those applying it.
STATEMENT OF POLICY
<<This section is to contain the policy statement and body of the policy. A policy is a statement of position or principles to be adopted. Please do not include the procedure necessary for carrying out this policy, a separate procedure should be prepared for this purpose.>>
1. STATEMENT
Council is committed to the effective management of declared weeds on land it manages and seeks to adopt best practice principles, policies and procedures to support its weed management objectives.
Colac Otway Shire Council's objectives in weed management are to:
- significantly reduce the cover of declared noxious weeds and other environmental weeds that are a threat to the health and quality of Council-owned/managed land of significant environmental value and community amenity;
- treat target weed species using appropriate techniques and registered herbicides, at the optimum control time for each target species (i.e. before seed-set);
- undertake works in a fashion that ensures no damage to off-target native or other vegetation, and ensures no spray drift or other chemical contamination of any land, ground water or waterway, including organic farms or other sensitive areas;
- create a safe environment for all staff and the community in relation to chemical application within the municipality;
- ensure risks associated with the use of herbicides and pesticides are safely controlled and managed;
- capture information to help inform future management and continuous improvement of Council's programs;
- continue to investigate new and alternative weed control options that seek to balance a range of important considerations, including environmental and human health impacts, and cost-effectiveness; and
- where possible, seek to reduce the use of chemically based herbicides and pesticides as weed control and landscape management measures.
2. KEY PRINCIPLES
2.1 PRESCRIBED MEASURES FOR WEED CONTROL
Appropriate methods for control and eradication of declared weeds in Victoria are prescribed under the Catchment and Land Protection Act 1994 Regulations 2002. All of Council's weed management operations follow these prescribed measures. The chosen measure applied is determined based on the target weed species and management context.
Herbicide application is among the measures applied by Council for the management of public open space, environmental reserves, revegetation sites and road reserves. All of Council's operations that involve the use of selective herbicide application – which most frequently involves techniques of targeted spraying and cutting-andpainting – are in strict compliance with Victorian legislation controlling the use of registered herbicides and adhere to all requirements and dosage recommendations of product labels. All herbicides used are approved by the Australian Pesticides and Veterinary Medicines Authority (APVMA) for weed control and are applied in accordance with their product label and Safety Data Sheet (SDS) by appropriately trained and supervised staff and contractors.
In environmentally sensitive sites and certain high-amenity public open spaces, such as playgrounds, the range of weed control techniques may also involve mechanical, hand weeding and weed steaming. Ecological burns are also undertaken on some sites, including significant remnant grasslands.
Safe work and risk mitigation procedures, as well as record-keeping systems, are also integral to the effective undertaking of all of Council's weed management operations.
2.2 STRATEGIC ASSET PROTECTION
Given the limited resources available to Council to perform its weed control responsibilities – and the number of assets over a wide area for which it is responsible – Council takes a strategic asset-protection based approach to weed control both in terms of target sites and in terms of noxious weed species. This approach is determined in consultation with Council's Weeds Consultative Committee and according to the requirements of funding providers for programs that are auspiced by other levels of government.
2.3 ACCOUNTABILITY AND TRANSPARENCY
Council Otway Shire Council's Weed Management Policy establishes a clear framework of principles to guide its weed management operations and ensure these maintain high levels of accountability and transparency.
Public notification is an important component of ensuring that Council's weed management operations remain accountable and transparent. Council is committed to notifying communities within Colac Otway Shire of upcoming spraying works by publishing this information in the form of a public notice on Council's website, to be updated at minimum twice per year. Attention is drawn to newly published information via a media release and/or social media. Information included as part of the public notice is:
1. location of spraying;
2. the active chemical constituent(s) of the herbicide(s) being applied; and
3. an indicative timetable of spraying.
Additional public notification methods where herbicides are applied may include signage and the use of marker dyes, so that treated weeds can be easily identified in the period between application and die-off.
Council also maintains a Community Weed Treatment Exemption Register that allows landholders within the municipality to opt out of Council's weed treatment programs adjacent to their properties by request.
2.4 CONTINUOUS IMPROVEMENT
Colac Otway Shire Council is committed to continuous improvement of its natural resource, public open space and community amenity management, including seeking to increase efficacy, efficiency and safety of its weed treatment operations.
Council captures detailed information and undertakes monitoring of its programs to help inform future management and continuous improvement objectives. It also undertakes ongoing investigation and trialling of new and alternative weed control options and methods that seek to balance a range of important considerations, including environmental and human health impacts, and cost-effectiveness. As part of these investigations Council acknowledges that, while herbicide application is on some occasions the most appropriate management technique, long-term reliance on chemical herbicide/pesticide can present other potential concerns including the development of weed-specific herbicide resistance and potential health impacts on people, wildlife and the environment.
Council's commitment to continuous improvement of its weed management programs also includes ongoing consideration of the principles of 'Value for money' and 'Fair and Honest Dealing', as outlined in Council's Procurement Policy.
2.5 ROLES AND RESPONSIBILITIES
RELATED DOCUMENTS
<<List documents that relate to the policy and where they are located, eg website, intranet, CM reference.>>
-
Colac Otway Shire Environment Strategy
o
Document location: D13/44380
- Environmental Sustainability Policy 2012
- Procurement Policy 2019
o Document location:
D15/89691
o Document location: D19/171470
- Public Notification of Weed Treatment Procedure
o Document location:
D20/96867
- Weed Treatment Exemption Procedure
o Document location: D20/96845
- Weed Treatment Exemption Register
Document title: Properties to notify before treatment commences and or where no treatment may occur Previously called No Spray register
o Document location:
D18/83848
DOCUMENT CONTROL
| Policy owner | <<State position title, not person’s name>> | Division |
|---|---|---|
| Adopted by executive | | Policy Number |
|
<urn:uuid:f3d5f97f-bdac-4ee6-91c7-dde405460763>
|
CC-MAIN-2021-39
|
https://www.colacotway.vic.gov.au/files/assets/public/trimfiles/council-and-the-shire/website-updates-2019-2020/20200624-cos-operational-weed-management-policy-2020.pdf
|
2021-09-24T18:20:34+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-39/subset=warc/part-00086-f465d820-0362-4c4c-a396-c69f5fd24cc4.c000.gz.parquet
| 746,437,419 | 2,030 |
eng_Latn
|
eng_Latn
| 0.853486 |
eng_Latn
| 0.988379 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2247,
2711,
5089,
8143,
9901,
10752
] |
Design Manual
Student: Sean O'Connor – C00224424
Supervisor: Richard Butler
Cybercrime & I.T. Security – CW_KCCYB_B
Institute of Technology Carlow
Contents
Introduction
In this document we will be going through the design specification for the function tabs for the extensions we will be creating. We will go through each of the functions and their sequences. After this we will then go through a brief description of the layouts of the function tabs along with a simple wireframe mock-up of the layout.
Sequence Diagrams
Ping Function
Ping Sweep Function
Threaded Port scan
Subdomain Crawler
HTML Scraper
User Interface Examples
GUI Code
For the actual GUI creation, the code was the same the whole way through. It firstly consisted of creating the actual tabs and sub tabs for the input and result boxes to sit on. This was done using a mix of Burps callbacks feature and using java swing to create JPanels and JTabbedPanes. (See Fig. 1)
For the input and output boxes, I used JPanels and Boxes to create the necessary input and output boxes. For all the input and output boxes the code repeated itself except for box sizes and labels. (See Fig. 2
The Final step in the GUI creation was to make the buttons, using JPanels and JButtons to create and link these buttons to the function. After this the buttons were added to the appropriate tab. (See Fig. 3)
Fig. 1
Fig. 3
Fig. 2
Ping and Ping Sweep
Below is a screenshot of the Ping and ping sweep functions. Instead of having a separate tab for each function, it made more sense to have them on the same tab.
The tab consists of two rows, the input row being on top, and the button/results row on the bottom. Users can enter in a target IP on the leftmost input field, press the "Ping" Button directly below and get their results in the text box to the right of the button.
For the sweep, there is an input field, for the first three segments of the target IP, then two smaller fields for the start range and end range. Below this is another button marked "Sweep" and a results box.
Threaded Port Scan
Below is a screenshot of the Threaded Port Scanner tab. The tab consists of an input text box, the button used to execute the script, the results box and another text box for the time taken for the file to execute.
Subdomain Crawler
Below is a screenshot of the Subdomain Crawler function tab. The tab consists of a input field for the target domain, another input field on the top right for file selection, a button in the middle for execution of code, a result box on the bottom left, another box in the middle for the time taken, and finally a button on the left for clearing the results box.
HTML Scraper
Below is a screenshot for the HTML Scraper function tab. The tab consists of a input box for the target to be scraped, with instructions, the button which will execute the code and finally the result box where our output will be displayed.
|
<urn:uuid:f0b543a2-fb3c-4e04-985a-4f21f8647759>
|
CC-MAIN-2023-23
|
https://showcase.itcarlow.ie/C00224424/Design%20Manual.pdf
|
2023-05-29T01:45:32+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-23/subset=warc/part-00234-ffa3bf93-6ba1-4a27-adea-b0baae3b4389.c000.gz.parquet
| 589,435,226 | 656 |
eng_Latn
|
eng_Latn
| 0.907231 |
eng_Latn
| 0.997334 |
[
"eng_Latn",
"unknown",
"eng_Latn",
"unknown",
"unknown",
"unknown",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
150,
160,
544,
565,
585,
604,
618,
1399,
2058,
2294,
2677,
2932
] |
STATE OF NEW YORK
________________________________________________________________________
6392
2021-2022 Regular Sessions
IN ASSEMBLY
March 17, 2021 ___________
Introduced by M. of A. PEOPLES-STOKES, GOTTFRIED -- read once and referred to the Committee on Health
AN ACT to amend the public health law, in relation to allowing donate life registration on electronic application forms administered by the office of temporary disability assistance, the higher education services corporation, and on mandatory electronic tax filings
The People of the State of New York, represented in Senate and Assembly, do enact as follows:
1 Section 1. Paragraph (a) of subdivision 5 of section 4310 of the 2 public health law, as amended by chapter 149 of the laws of 2020, is 3 amended to read as follows:
5 anatomical gift can be made through: (i) indication made on the applica-
4 (a) Such organ, eye and tissue registration of consent to make an
6 tion or renewal form of a driver's license, (ii) indication made on a
8 cation made on a voter registration form pursuant to subdivision five of
7 non-driver identification card application or renewal form, (iii) indi-
9 section 5-210 of the election law, (iv) indication made on the applica-
11 health benefit exchange, (v) enrollment through the donate life registry
10 tion for health care coverage offered through the state , or renewal of
12 website, (vi) paper enrollment submitted to the donate life registry,
14 fishing or trapping license issued pursuant to title seven of article
13 (vii) indication made on the application or renewal form of a hunting,
15 eleven of the environmental conservation law, [ ] (viii) or indication
17 assistance through the mybenefits.ny.gov website, or any such successor
16 made on transactions administered by the office of temporary disability
18 website; (ix) indication made on applications, renewals or related tran-
20
19 sactions for college financial aid, grants, or scholarships offered or
21 services corporation; (x) indication made on any tax document that is
administered through any website maintained by the higher education
22 subject to mandatory electronic filing in accordance with the provisions
23
through any other method of section twenty-nine of the tax law; or (xi)
EXPLANATION--Matter in (underscored) is new; matter in brackets italics [ ] is old law to be omitted.
LBD09389-02-1
A. 6392 2
```
1 identified by the commissioner. The department shall establish a means 2 by which to register the consent given by individuals who are sixteen or 3 seventeen years of age in the donate life registry, and shall make 4 registration available by any of the methods provided in subparagraphs 5 (i), (ii), (iii), (iv), (v), (vi) (vii) [ ] of , and , (viii), (ix) and (x) 6 this paragraph. 7 § 2. Subparagraph (i) of paragraph (b) of subdivision 5 of section 8 4310 of the public health law, as amended by chapter 40 of the laws of 9 2016, is amended to read as follows: 10 (i) Where required by law for [ ] registration forms transactions 11 described in subparagraphs (i), (ii) [ ] (iv) and , , (vii), (viii), (ix), 12 of paragraph (a) of this subdivision, the commissioner (x) and (xi) 13 shall ensure, in consultation with the head of any agency required to 14 that space is provided on any [ ] implement such transaction, registration 15 form so that the applicant shall register or decline registra- required 16 tion in the donate life registry for organ, eye and tissue donations 17 under this section and that the following is stated on the form in clear 18 and conspicuous type: 19 "You must fill out the following section: Would you like to be added 20 to the Donate Life Registry? Check box for 'yes' or 'skip this ques21 tion'." 22 § 3. This act shall take effect on the one hundred eightieth day after 23 it shall have become a law; provided, however, that if chapter 149 of 24 the laws of 2020 shall not have taken effect on or before such date then 25 this act shall take effect on the same date and in the same manner as 26 such chapter of the laws of 2020, takes effect.
```
|
<urn:uuid:347932be-a002-4472-816b-a513ab00769f>
|
CC-MAIN-2023-40
|
https://legislation.nysenate.gov/pdf/bills/2021/a6392
|
2023-09-28T20:23:48+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-40/subset=warc/part-00293-7aa0a1e5-33a6-434b-89a2-950f294b40c1.c000.gz.parquet
| 400,351,021 | 1,122 |
eng_Latn
|
eng_Latn
| 0.979256 |
eng_Latn
| 0.982013 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2484,
4295
] |
NOTES
Specifications for Tactile Walking Surface Indicators
City of Mississauga Detail Sheets
2240.033 - Signalized Intersection Configurations of Pedestrian Crossings
2240.034 - Controlled Non Signalized Intersection Configurations of Pedestrian Crossings
2240.035 - Tactile Walking Surface Indicator and Depressed Curb Detail
2240.036 - Tactile Walking Surface Indicator and Curb Ramp Detail
2240.037 - Location of Dropped Curbs at Controlled Intersections
Canadian Standards Association
CSA B651-2012 Accessible Design for the Built Environment
American Society of Testing and Materials
ASTM A 48 Standard Specification for Grey Iron Castings
ASTM C 1028 Standard Test Method for Determining the Static Coefficient of Friction of Ceramic Tile and Other like Surfaces by the Horizontal Dynamometer Pull-Meter Method
ASTM C 501-84 Standard Test Method for Relative Resistance to Wear of Unglazed Ceramic Tile by the Taber Abraser
Ontario Provincial Legislation
O.Reg. 191/11 Accessibility for Ontarians with Disabilities Act, 2005
MATERIALS
Tactile Walking Surface Indicators
Tactile walking surface indicators shall be according to drawing 2240.036 and Standard number TBD and be made of cast iron, according to CSA B651-2012 with the following amendment: minimum 92.59 millimeter centre to centre spacing of domes and follows Ontario Regulation 191/11, and meets the following requirements:
| Standard | Property | Minimum Result |
|----------------|------------------------|--------------------|
| ASTM A 8 | Tensile Strength | Class 30 B |
| ASTM C 1028 | Slip Resistance | Dry 0.8 min, Wet 0.8 min |
| ASTM C 501-84 | Wear Resistance | Wear Index: > 15 |
The truncated domes shall be of uniform size and shape. Units shall be uniform in texture, be free from pouring faults, sponginess, cracks, blowholes, and other defects, and have clean-cut and well-defined edges. All surfaces shall be bare, without any coating, and be uniform and free of flaking rust or mounts of rust or debris.
CONSTRUCTION
Ramps
Sidewalk accessibility ramps shall be in according to 2240.033, 2240.034, 2240.035, 2240.036, and 2240.037 with tactile walking surface indicators and shall be incorporated at every location with a pedestrian crossing or as specified on the Contract Drawings.
Installation of Tactile Walking Indicators
Tactile walking surface indicators shall be set and pressed into wet concrete to final elevation according to manufacturer’s recommendations. Remove any wet concrete that may spill onto tactile walking surface indicator surface. Radius plates to be used as required to follow curb radius. Straight Plates will be allowed on Radii upon approval by the City of Mississauga representative.
|
<urn:uuid:4891ce7f-2eed-4b41-b5a3-7f0b48c73edf>
|
CC-MAIN-2022-27
|
https://www.mississauga.ca/wp-content/uploads/2020/08/12144658/Standard-Drawing-2240038.pdf
|
2022-07-01T21:05:03+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-27/subset=warc/part-00021-48f675b2-7fd4-43af-adb3-2a4ea7f82193.c000.gz.parquet
| 975,239,759 | 623 |
eng_Latn
|
eng_Latn
| 0.875116 |
eng_Latn
| 0.875116 |
[
"eng_Latn"
] | false |
docling
|
[
2781
] |
Licensing Sub-Committee 3
Tuesday, 1st November, 2016 at 10.00am
in the Council Chamber at the Council House, Priory Road, Dudley
Agenda - Public Session
(Meeting open to the public and press)
1. Apologies for absence.
2. To report the appointment of any substitute Members for this meeting of the Sub-Committee.
3. To receive any declarations of interest under the Members’ Code of Conduct.
4. To confirm and sign the minutes of the meeting held on 23rd August, 2016 as a correct record
5. Application for the Renewal and Variation of Consent to Engage in Street Trading LSD Promotions Ltd – Food/Craft Market in Stourbridge (Pages 1 – 5)
6. Application for Grant of Consent to Engage in Street Trading – Mr Richard Lee Anthony Palethorpe – Halesowen Town Centre (Pages 6 – 7)
Chief Executive
Dated: 19th October, 2016
Distribution:
Councillor M Evans (Chair); Councillor K Finch and G Simms
Please note the following important information concerning meetings at Dudley Council House:
- In the event of the alarms sounding, please leave the building by the nearest exit. There are Officers who will assist you in the event of this happening, please follow their instructions.
- There is no smoking on the premises in line with national legislation. It is an offence to smoke in or on these premises.
- Public WiFi is available in the Council House. The use of mobile devices or electronic facilities is permitted for the purposes of recording/reporting during the public session of the meeting. The use of any such devices must not disrupt the meeting – Please turn off any ringtones or set your devices to silent.
- If you (or anyone you know) is attending the meeting and requires assistance to access the venue and/or its facilities, please contact us in advance and we will do our best to help you.
- Information about the Council and our meetings can be viewed on the website www.dudley.gov.uk
- Elected Members can submit apologies by contacting Democratic Services. The appointment of any Substitute Member(s) should be notified to Democratic Services at least one hour before the meeting starts.
- You can contact Democratic Services by Telephone 01384 815238 or E-mail [email protected]
Present:-
Councillor M Evans (Chair)
Councillors C Perks and G Simms
Officers:-
R Clark – Principal Solicitor – Chief Executive’s Directorate, S Smith – Interim Licensing Manager – Place Directorate and K Buckle, Democratic Services Officer – Chief Executive’s Directorate.
13. **Apology for Absence**
An apology for absence from the meeting was received on behalf of Councillor J Cowell.
14. **Appointment of Substitute Member**
It was reported that Councillor C Perks had been appointed as a substitute Member for Councillor J Cowell for this meeting of the Sub-Committee only.
15. **Declarations of Interest**
No Member made a declaration of interest in accordance with the Members’ Code of Conduct.
16. **Minutes**
Resolved
That the minutes of the meeting of the Sub-Committee held on 19th July, 2016, be approved as a correct record and signed.
17. **Application for a Licensed Premises Gaming Machine Permit**
A report of the Strategic Director Place was submitted on an application for a Licensed Premises Gaming Machine Permit for three Category C machines and one Category D machine, in respect of the premises known as The Lutley Oak, 327 Stourbridge Road, Halesowen.
The Licensing Clerk referred to the report submitted and the supporting documentation that had been forwarded to Members only for their consideration.
As the applicant was not in attendance at the meeting the Sub-Committee agreed to hear the matter in their absence.
**Resolved**
That, following consideration of the information contained in the report submitted, the grant of a Licensed Premises Gaming Machine Permit for three Category C machines and one Category D machine, in respect of the premises known as The Lutley Oak, 327 Stourbridge Road, Halesowen, be approved.
18. **Application for a Licensed Premises Gaming Machine Permit**
A report of the Strategic Director Place was submitted on an application for a Licensed Premises Gaming Machine Permit for five Category C machines and one Category D machine, in respect of the premises known as The Corn Exchange, Amblecote Road, Brierley Hill.
The Licensing Clerk referred to the report submitted and the supporting documentation that had been forwarded to Members only for their consideration and clarified that no objections had been received to the application.
**Resolved**
That, following consideration of the information contained in the report submitted, the grant of a Licensed Premises Gaming Machine Permit for five Category C machines and one Category D machine, in respect of the premises known as The Corn Exchange, Amblecote Road, Brierley Hill, be approved.
19. **Application for a Licensed Premises Gaming Machine Permit**
A report of the Strategic Director Place was submitted on an application for a Licensed Premises Gaming Machine Permit for four Category C
machines, in respect of the premises known as The Lawnswood, Lawnswood Road, Wordsley, Stourbridge.
The following persons attended the meeting in respect of the application:-
Mr J Baldaro – Area Manager – Stonegate Pub Company Limited
Mr O Lowther – General Manager – The Lawnswood.
Following introductions Mr Baldaro responded to queries from Members and in doing so confirmed that the purpose of the application was to promote growth investment and that staff received online training in relation to monitoring and awareness of those using the machines. Mr Baldaro also confirmed the location of the machines which were within the view of members of staff.
The parties then withdrew from the meeting to enable the Sub-Committee to determine the application.
The Sub-Committee having made their decision invited the parties to return and the Chair then outlined the decision.
**Resolved**
That, following consideration of the information contained in the report submitted, the grant of a Licensed Premises Gaming Machine Permit for four Category C machines, in respect of the premises known as The Lawnswood, Lawnswood Road, Wordsley, Stourbridge, be approved.
20. **Application for a Licensed Premises Gaming Machine Permit.**
A report of the Strategic Director Place was submitted on an application for a Licensed Premises Gaming Machine Permit for four Category C machines and one Category D machine, in respect of the premises known as The Stag & Three Horseshoes, Halsowen Road, Halesowen.
Mr D Taylor – Designated Premises Supervisor was in attendance at the meeting.
Following introductions, Mr Taylor responded to questions from Members and in doing so advised that there were Gambling Awareness Policies in place with camera footage of current machines being viewed from the bar area at the premises.
The parties then withdrew from the meeting to enable the Sub-Committee to determine the application.
The Sub Committee having made their decision invited the parties to return and the Chair then outlined the decision.
**Resolved**
That, following consideration of the information contained in the report submitted, the grant of a Licensed Premises Gaming Machine Permit for four Category C machines and one Category D machine, in respect of the premises known as The Stag & Three Horseshoes, Halesowen Road, Halesowen, be approved.
---
21. **Application for a Licensed Premises Gaming Machine Permit**
A report of the Strategic Director Place was submitted on an application for a Licensed Premises Gaming Machine Permit for three Category C machines, in respect of the premises known as The Crabmill, Hagley Road, Stourbridge.
As the applicant was not in attendance at the meeting the Sub-Committee agreed to hear the matter in their absence.
**Resolved**
That, following consideration of the information contained in the report submitted, the grant of a Licensed Premises Gaming Machine Permit for three Category C machines, in respect of the premises known as The Crabmill, Hagley Road, Stourbridge, be approved.
The meeting ended at 10.50am
CHAIR
LSBC3/9
Licensing Sub-Committee 3 – 1st November 2016
Report of the Strategic Director Place
Application for the Renewal and Variation of Consent to Engage in Street Trading
LSD Promotions Ltd - Food/Craft Market
Purpose of Report
1. To consider the application on behalf of Mr. Dermot McGillicuddy of LSD Promotions, for the renewal and variation of the consent to engage in street trading at a site in Stourbridge.
Background
2. On the 14th March, 2014, LSD Promotions made application for the grant of a consent to engage in street trading for a Food/Craft Market on the 1st & 3rd Saturday of each month from 9.00 a.m. until 4.00 p.m. at a site in Ryemarket, (High Street to a point 30 metres from High Street), Stourbridge, to replace the previous Farmers and Craft Market, which ceased trading in Stourbridge on the 4th March, 2014.
3. A copy of the application together with the proposed site plan of the stall layout was forwarded to Committee Members, various agencies and interested parties. Details of the application were also posted on the Licensing Web Page. No objections were received in respect of the application.
4. This matter was considered by the Licensing Sub-Committee on the 28th May 2014, the Committee resolved that the application be approved.
5. On the 8th June 2015, Mr McGillicuddy made application for the renewal of the consent to engage in street trading.
6. On the 1st June 2015, (Prior to the application for renewal of consent to engage in street trading) a letter of objection was received from a local trader.
7. This application was considered by the Licensing Sub-Committee on the 15th September 2015, the Committee resolved that the application for renewal of the Street Trading Consent be approved.
8. On the 26th July 2016, Mr McGillicuddy made a further application for the renewal and variation of the Street Trading Consent. The application for variation is to include every Saturday to trade from Lower High Street, Coventry Street and the
area around the Clock. A site plan/stall plan is attached to this report as Appendix 1.
9. A copy of that application has been forwarded to Committee Members and Interested Parties and details of the application have been posted on the licensing web pages.
10. Representations have been received from the Communications Department, Street and Green Care Department, Traffic Highways and Transportation Department, Dudley Market Traders and the Stourbridge Chamber of Trade. Copies of which have been forwarded to Committee Members and the Applicant prior to the hearing.
11. This report has a direct link to the Council’s priority for safety as the principal reason for submission is safeguarding the public.
**Finance**
12. There are no financial implications.
**Law**
13. The grant of consents to engage in street trading is governed by Part III of Schedule IV to the Local Government (Miscellaneous Provisions) Act 1982. High Street/Coventry Street Stourbridge is a consent street designated by a resolution of the Council. To trade without such a consent is an offence.
14. Paragraph 7(2) of Schedule IV of the 1982 Act, states that the Council may grant a consent if it thinks fit and, when granting or renewing a consent, the Council may attach such conditions as it considers necessary.
15. Paragraph 10 of Schedule IV of the 1982 Act, states that a street trading consent may be granted for one period not exceeding 12 months but may be revoked at any time.
16. Where the consent allows the holder to trade from cart, barrow, or other vehicle, then the consent must specify the location from which the trader may trade and the times between which or periods for which he may trade.
17. There is no right of appeal against the Council’s decision to vary a condition upon which consent is issued, or refusals to grant or renew a street trader’s consent.
**Equality Impact**
18. This report takes into account the Council’s policy on equal opportunities.
19. There has been no consultation or involvement of children and young people in developing these proposals.
Recommendation
20. That the Committee consider the application for the renewal and variation of the street trading consent issued to LSD Promotions.
Strategic Director Place.
Contact Officer: Mr S Smith
Telephone: 01384 814631
Email: [email protected]
List of Background Papers
APPENDIX 1
DANE STREET
CONVENTRY STREET
THE OLD BATH
Een House
15 491
7 8 9
NORTH STREET
Crown Centre
Town Hall and Library
5
Licensing Sub-Committee 3 – 1st November 2016
Report of the Strategic Director Place
Application for Grant of Consent to Engage in Street Trading
Mr Richard Lee Anthony Palethorpe – Halesowen Town Centre.
Purpose of Report
1. To consider the application made by Mr Richard Palethorpe for the grant of a consent to engage in street trading at a site in HighStreet /Hagley Street, Halesowen.
Background
2. On the 23rd June 2016, Mr Palethorpe made application for the grant of a Street Trader’s Consent to sell Jacket Potatoes Speciality Tea and Coffee and in the winter months additional Soups, between the hours of 10.30 and 15.00 Monday to Friday inclusive, in High Street Dudley.
3. On the 23rd June 2016, representations were received from the Communication and Public Affairs Office, Visitor Economy and Culture Department, Street and Green Care (Highways) and Building Control (Planning).
4. Due to the redevelopment of the Market and the limited space available Mr Palethorpe was asked to look at alternative sites within the Borough.
5. On the 7th September 2016, Mr Palethorpe submitted a further site plan for an alternative site in High Street/Hagley Street, Halesowen a copy of that site plan has been forwarded to all interested parties and details of the application posted on the licensing web page.
6. On the 7th September 2016, representations were received from the Halesowen Chamber of Trade and on the 16th September 2016, representations were also received from the Street and Green Care (Highways) Department.
7. A copy of the application form with supporting documentation and site plans along with all representations have been forwarded to Committee Members prior to the hearing.
8. This application falls within the Council’s responsibility for licensing which has a direct link to the Council’s key corporate priority that safety matters.
Finance
9. There are no financial implications.
Law
10. The grant of consents to engage in street trading is governed by Part III of Schedule IV to the Local Government (Miscellaneous Provisions) Act 1982. High Street/Hagley Street Halesowen is a consent street designated as such by a resolution of the Council. To trade without such consent is an offence.
11. Paragraph 7(2) of Schedule IV of the 1982 Act, states that the Council may grant a consent if it thinks fit and, when granting or renewing a consent, the Council may attach such conditions as it considers necessary.
12. Paragraph 10 of Schedule IV of the 1982 Act, states that a street trading consent may be granted for one period not exceeding 12 months but may be revoked at any time.
13. Where the consent allows the holder to trade from a cart, barrow, or other vehicle, then the consent must specify the location from which the trade/may trade and the times between which or periods for which he may trade.
14. There is no right of appeal against the Council’s decision to vary a condition upon which consent is issued, or refusal to grant or renew a street trader’s consent.
Equality Impact
15. This report takes into account the Council’s policy on equal opportunities.
16. There has been no consultation or involvement of children and young people in developing these proposals.
Recommendation
17. That the Committee consider Mr Palethorpe’s application for the grant of a street trading consent in High Street/ Hagley Street, Halesowen.
______________________________
STRATEGIC DIRECTOR PLACE
Contact Officer: Mr S Smith
Telephone: 01384 814631
Email:[email protected]
List of Background Papers
|
50095b37-9770-4370-8f69-9f7c4fcaa3e2
|
CC-MAIN-2023-50
|
https://dudley.cmis.uk.com/Document.ashx?czJKcaeAi5tUFL1DTL2UE4zNRBcoShgo=dVTn8fVjdlmmHpC813A%2FqnEVWXs%2FmHNmcalD90CwJozQ08AI0ITN0Q%3D%3D&rUzwRPf%2BZ3zd4E7Ikn8Lyw%3D%3D=pwRE6AGJFLDNlh225F5QMaQWCtPHwdhUfCZ%2FLUQzgA2uL5jNRG4jdQ%3D%3D&mCTIbCubSFfXsDGW9IXnlg%3D%3D=hFflUdN3100%3D&kCx1AnS9%2FpWZQ40DXFvdEw%3D%3D=hFflUdN3100%3D&uJovDxwdjMPoYv%2BAJvYtyA%3D%3D=ctNJFf55vVA%3D&FgPlIEJYlotS%2BYGoBi5olA%3D%3D=NHdURQburHA%3D&d9Qjj0ag1Pd993jsyOJqFvmyB7X0CSQK=ctNJFf55vVA%3D&WGewmoAfeNR9xqBux0r1Q8Za60lavYmz=ctNJFf55vVA%3D&WGewmoAfeNQ16B2MHuCpMRKZMwaG1PaO=ctNJFf55vVA%3D
|
2023-12-02T21:55:51+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00151-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet
| 254,619,407 | 3,479 |
eng_Latn
|
eng_Latn
| 0.939015 |
eng_Latn
| 0.993801 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
903,
2231,
3094,
5072,
6895,
8167,
10160,
12245,
12535,
12547,
12672,
14551,
16243
] |
SHARED SERVICES CANADA
Amendment No. 002 to the
Request for Information
For the Procurement Process for Smart Card/Token Requirement, Public Key Infrastructure
| Request for Information No. | | RAS 17-58040 /A | Date | |
|---|---|---|---|---|
| | GCDocs File No. | N/A | | GETS Reference No. |
This Amendment revises the RFI's previously amended closing date, released by SSC on September 29, 2017, and addresses the first set of Suppliers' Q&As . Except as expressly amended by this document, the RFI remains unchanged.
| Issuing Office | | |
|---|---|---|
| Contracting Authority (The Contracting Authority is SSC’s representative for all questions and comments about this document.) | | Name |
| | | Telephone No. |
| | | Email Address |
| | | Postal Address |
| | Closing Date and Time | |
| | Time Zone | |
| | Destination of Goods/Services | |
| | Email Address for Submitting your | |
| | Response by the Closing Date | |
QUESTION 1
Would a non-Java card smartcard be acceptable to DND?
ANSWER 1
The solution requirements focus entirely on security, performance and interoperability with existing solution components (Card Management System, Entrust CA etc.). So long at the card meets these requirements, DND would accept the card.
QUESTION 2
Does the government plan on keeping the Entrust smart card solution? Is this opportunity just a "token" purchase? My company, XTec, currently issues PIV smart cards to the US Government's Dept. of Homeland Security, Dept. of State, others. We can offer the same secure technology and standards based solution that would ensure security, and interoperability with various logical access and physical access systems, as well as interoperability with US government solutions. Our solution allows for and manages derived credentials for use on mobile devices (phones, tablets, etc.) and other tokens (USB, etc.).
ANSWER 2
DND will maintain the Entrust CA solution and Entrust IdentityGuard solution. There is a need provide tokens for the expanding user base and replace or lost/damaged tokens, without completely replacing the Entrust tokens (smart cards) currently in circulation.
The intent is to develop a solicitation for tokens.
DND maintains two environments, one which utilizes smart cards, and the other Personal Identify Verification (PIV).
Yes, DND is considering other form factors, although other form factors will have more limited usage/distribution. DND already has a derived credential solution for use on mobile devices. Therefore, this is not within the scope of this RFI nor expected to be within the scope of a subsequent solicitation.
|
<urn:uuid:adc284c8-9b04-4f71-af6e-558f9c6cd8ae>
|
CC-MAIN-2024-38
|
https://canadabuys.canada.ca/documents/pub/att/2017/10/10/186559f4afe85b69b648dcad76bfb26f/en_rfi_amendment_002_final.pdf
|
2024-09-20T11:11:28+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-38/subset=warc/part-00205-781f89b0-54ef-4e32-b51d-e5860e733e3a.c000.gz.parquet
| 120,833,157 | 622 |
eng_Latn
|
eng_Latn
| 0.984879 |
eng_Latn
| 0.992996 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
957,
2649
] |
Privacy
Purpose:
Caledon Community Services (CCS) strives to ensure that the privacy of all CCS clients, staff, volunteers, program/student placements, donors and other stakeholders is respected and protected.
Policy:
CCS is committed to developing, implementing and maintaining systems and procedures in order to protect the personal information of all of its stakeholders in accordance with provincial privacy legislation. All CCS staff, volunteers, and program/student placements shall be expected to strictly adhere to CCS privacy policies and procedures. CCS privacy policies and procedures shall serve to protect the privacy of personal information belonging to the following parties:
- Clients
- Volunteers
- Staff
- Student/Program Placements
- Donors
- CCS website users
Clients:
CCS collects personal health information about the client directly from the client, or from the person acting on behalf of the client in compliance with the Personal Health Information Protection Act (PHIPA). The personal health information that CCS may collect includes:
Client's name
Date of birth
Address
Phone number
E-mail address
Health history
Records of visits and other interactions with CCS
Emergency Contact Information
If required, CCS collects personal health information about the client from other sources where we have obtained the client's consent to do so or where the law permits.
Policies and Procedures Manual
CCS uses and discloses clients' personal and/or personal health information to:
- Provide services for the client such as personal care giving, transportation; counseling and care coordination, employment assistance for individuals needing accommodations due to a disability, etc;
- Plan, administer and manage our internal operations;
- Ask clients for feedback about the services they have already received as part of our quality assurance commitment;
- Conduct risk management and quality improvement activities;
- Compile statistics;
- Fulfill other purposes permitted or required by law;
- Comply with legal and regulatory requirements;
Client Rights:
Under Ontario law clients have every right to:
- Know how CCS collects, uses, discloses and stores their personal health information;
- Expect that any personal health information held by CCS remains accurate, confidential and secure;
- Expect that their personal health information remains private. CCS will not share personal information with others without client consent unless we are permitted or required to by law;
- Look at or receive a copy of their personal health information and ask CCS to correct their personal health information record. Kindly make these requests in writing to Caledon Community Services;
- Ask questions or make a complaint to our Privacy Officer about our privacy practices;
- Withdraw their consent (if the law allows) for some of the above uses and disclosures by contacting CCS in writing;
Staff/Volunteers/Student/Program Placements:
CCS will inform its staff (or applicants for employment), volunteers, student and program placements of why and how we collect, use and disclose their personal information, obtain their consent where required, and only handle their personal information in a manner that a reasonable person would consider appropriate in the circumstances.
Unless the purposes for collecting personal information are obvious and the applicant, staff, volunteer, student or program placement voluntarily provides their personal information for those purposes, CCS will communicate the purposes for which personal information is being collected, either orally or in writing, before or at the time of collection. We will only collect applicant/staff/volunteer/student/program placement information that is necessary to fulfill the following purposes:
- To assess suitability for employment or volunteer/student/program placement;
- To verify credentials;
- To verify identity;
- To check for relevant criminal records;
- To send out information;
- To meet regulatory requirements (i.e. Canada Revenue Agency (CRA) requirements) (for paid staff/program placements);
- To process payroll and/or benefits (for paid staff/program placements);
- To substantiate and/or arrange for accommodations in accordance with the Ontario Human Rights Code (OHRC);
- To assess eligibility for benefits (for paid staff);
In order for Caledon Community Services to employ (or continue to employ) staff members and to look after their well-being and to provide quality services, CCS collects and uses certain Staff Personal Information, that may include:
- Home address and telephone number;
- Date of Birth;
- Gender;
- Marital status;
- Social Insurance Number (for Canada Revenue Agency requirements)
- Photograph (for I.D. badges);
- Earnings
- Bank account number (for direct deposit of pay);
- Driving record history (abstract);
- Criminal Records Check (Vulnerable Sector);
- Driver's license copy/number;
- Functional Abilities Information (for sick leave/ STD/LTD/WSIB claims or
accommodation for a disability);
- Limited information about spouses/partners/dependants for benefits or RRSP;
- Personal and professional references;
- Performance summaries and ratings;
- Attendance records;
- Career goals and objectives;
Donors:
The privacy and security of donors' personal information is important to Caledon Community Services. Caledon Community Services (CCS) respects its donors' right to privacy and is committed to protecting the personal information that donors provide to the agency.
The information collected is used:
- To facilitate donation collection and processing
- To communicate relevant news and updates
- To provide tax receipts
CCS does not trade, license, rent or sell our donors' personal information in any manner.
CCS website users:
Individuals can browse our website without disclosing their personal data. Any personal information that site visitors voluntarily choose to provide in order to complete any of our online application forms, set up a profile with our Jobs Caledon on-line job board, make donations or request information, etc IS NOT shared with third parties unless stated otherwise. CCS will ensure all personal information is secured and remains confidential.
CCS's Use of Cookies: A cookie is a small text file containing a unique identification number that is transferred from a website to the hard drive of your computer so that the website may identify separate visitors to the site and track users' activities on the website. A cookie will not let a website know any personally identifiable information about website visitors, such as their real name and address. CCS uses cookies only to keep track of how many people visited the website and how frequently each page is visited. Each individual movement of any user cannot be tracked while on CCS's site. Cookies are only used to track page popularity for statistical purposes and to improve the quality of the site and meet website user needs.
Links on our Website: CCS wants our website users' experience to be informational and resourceful; therefore our website also provides a number of links to third party sites. CCS assumes no responsibility for the information practices of sites that our users are able to access through our site. We encourage our website users to review each site's privacy policy before disclosing any personally identifiable information.
Safeguards
CCS employs a number of safeguards to protect your personal information against loss or theft, as well as unauthorized access, disclosure, copying, use, or modification. Such safeguards include physical measures, for example locked filing cabinets, restricted access to offices, and limiting access on a "need to know" basis, and use of passwords and encryption.
Exceptions
Caledon Community Services does not disclose any private information regarding individuals without informed consent, unless it is required or permitted by law.
Raising Concerns or Complaints about Compliance to this Policy
If, for any reason, you are concerned about our compliance with our Privacy Policy, you may contact our Privacy Officer in writing, by mail or by email. CCS has policies and procedures to receive, investigate and respond to individuals' complaints and questions. If you are not satisfied with the way CCS has responded to a complaint, you can contact the Privacy Commissioner of Canada. This Privacy Policy may be updated from time to time and will be posted on our website.
Contact Information for the CCS' Privacy Officer:
Nancy Kopriva, Manager, Human Resources Privacy Officer 18 King Street East, Bolton, ON L7E 1E8
E-mail: [email protected]
References:
CCS Policies and Forms:
Complaint/Satisfaction Form Privacy and Confidentiality Agreement Incident Investigation Report Personnel Records Policy – Staff and Program Placements Personnel Records Policy – Volunteers and Student Placements CCS Donor Bill of Rights Privacy Complaint Investigation Procedure
Legislation:
Employment Standards Act of Ontario PIPEDA – Personal Information and Electronic Documents Act PHIPA – Personal Health Information Protection Act PIPA – Personal Information Protection Act FIPPA- Freedom of Information and Protection of Privacy Act Health Services Operational Policies –Personal Health Information Privacy
Date Developed: February 26, 2016
Date Approved: March 2016
|
<urn:uuid:3ef10672-ae95-41a3-8ed8-0817d43eecff>
|
CC-MAIN-2017-13
|
http://ccs4u.org/wp-content/uploads/2017/01/AGENCY-Privacy-Policy.pdf
|
2017-03-27T10:41:26Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189471.55/warc/CC-MAIN-20170322212949-00227-ip-10-233-31-227.ec2.internal.warc.gz
| 60,887,064 | 1,746 |
eng_Latn
|
eng_Latn
| 0.892793 |
eng_Latn
| 0.988701 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1436,
3972,
5786,
8654,
9401
] |
Estimation of Black Carbon Concentrations Levels in High Concentration Region Using Machine Learning Models
Pratima Gupta
CAS, IITD, India
Author list (excluding presenting author)
Pau Ferrer-Cid, Jose M. Barcelo-Ordinas, Jorge Garcia-Vidal, Mira L. Pohlker, Ajit Ahlawat, Mar Viana
Abstract
Black carbon (BC) is emitted into the atmosphere during combustion processes, often in conjunction with emissions such as NOx and O3, which are also by-products of combustion. In highly polluted regions, combustion processes are one of the main sources of aerosols and particulate matter (PM) concentrations, which affect the radiative budget. In this study we use machine learning approaches to estimate BC from NOx, O3, PM2.5, relative humidity (RH), and solar radiation (SR). We assess the effectiveness of various machine learning models, such as random forest (RF), support vector regression (SVR), and multilayer perceptron (MLP) artificial neural network, for predicting black carbon (BC) mass concentrations in areas with high BC levels such as Northern Indian cities (Delhi and Agra), across different seasons. This study evaluates the performance of models in Delhi using data from 2018-19, including NOx, O3, PM2.5, relative humidity (RH), and solar radiation as input variables and Agra. The results demonstrate comparable effectiveness among the models, with the multilayer perceptron (MLP) showing the most promising results. In Delhi, the MLP shows high correlations between measured and modelled concentrations during winter (R 2 : 0.85) and post-monsoon (R 2 : 0.83) seasons, and notable metrics in the pre-monsoon (R 2 : 0.72). The results from Agra are consistent with those from Delhi, highlighting the consistency of the neural network's performance. These results highlight the usefulness of machine learning, particularly MLP, as a valuable tool for predicting BC concentrations. This approach provides critical new opportunities for urban air quality management and mitigation strategies and may be especially valuable for megacities in medium- and low-income regions.
Early Career Scientist
YES, I am an early career scientist.
IGAC Activities
ACAM: Atmospheric Chemistry and the Asian Monsoon, GEIA: Global Emissions Initiative
|
<urn:uuid:37cedcbf-4c3e-4e07-9202-b20f66630e9e>
|
CC-MAIN-2025-08
|
https://icacgp-igac2024.com/wp-content/uploads/2024/08/B39.-Pratima-Gupta.pdf
|
2025-02-09T05:57:43+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-08/subset=warc/part-00274-b184e832-acd1-425a-bab7-895830f2748a.c000.gz.parquet
| 281,941,168 | 493 |
eng_Latn
|
eng_Latn
| 0.960607 |
eng_Latn
| 0.960607 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2255
] |
How to Change Planned Working Time
For employees who have schedules that are not five 8 hour days per week, you must change their Planned Working Time in SAP to allow for accurate leave entries. This is only for alternate full time schedules, such as four 10 hour days. This should not be used for someone who is working less than 100% FTE.
1. Go to PA30.
2. Enter the Person ID or use the search option to find the employee by their name.
3. Navigate to the UK Time Data tab by clicking on the folder icon shown below. Then click on UK Time Data from the drop down list.
4. Click on the gray square beside Planned Working Time. Then, click on the double paper icon to copy the current record.
5. Change the Start field to the date when the new schedule will begin. You can also include an end date, if there is one. Otherwise, you can leave the end date as 12/31/9999.
6. Click on the field for Work schedule rule to view the drop down for available options.
7. Choose the appropriate option from the drop down menu by double clicking.
a. You will want to choose an option with C at the end to indicate Campus.
b. 8 h/d 40 h/w M-F means that they can enter up to 8 hours of nonproductive time (vacation, TDL, holiday) on weekdays only.
c. 8 h/d 40 h/w S-S means that they can enter up to 8 hours of nonproductive time (vacation, TDL, holiday) on any day of the week.
d. 10 h/d 40 h/w S-S means that they can enter up to 10 hours of nonproductive time (vacation, TDL, holiday) on any day of the week.
e. 12 h/d 40 h/w S-S means they can enter up to 10 hours of nonproductive time (vacation, TDL, holiday) on any day of the week.
f. 24x7 flex means they can enter leave up to 24 hours per day any day of the week. I do NOT recommend using this option. Students default to this option, but they are not eligible for leave, so it doesn’t create any issues.
g. Do NOT use No time eval.
8. DO NOT use this process to change the Employment percent.
9. Click the Save icon at the top of the screen.
10. If you get a yellow message at the bottom of the screen, continue to press Enter until you get the green check Record created message.
|
<urn:uuid:7beed95b-8db0-4de4-936e-600408403a51>
|
CC-MAIN-2023-50
|
https://www.research.uky.edu/uploads/pa30-planned-working-time
|
2023-12-10T14:36:10+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00078-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet
| 1,044,874,139 | 537 |
eng_Latn
|
eng_Latn
| 0.994851 |
eng_Latn
| 0.998734 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
574,
965,
1895,
2007,
2147
] |
THRESHER/MILL
For rice, bean, corn, wheat, sorghum, millet etc.
pandatractor.com
Wheat/rice grain thresher
Capacity: 800-1200 Kg/h rice, wheat. Millet, sorghum, and other grains; Soybean 400-600 kg/h
Power: 7.5kw electric motor/12-15hp diesel engine
breaking rate ≤ 0.5
Total loss rate ≤ 1.0
Overall dimension Length width Height (including tire and pull frame): 310*170*140cm
Cleaning type: Vibrating screen + blowing fan
Corn thresher
Peel threshing yield: 2-3 ton/hour (4-6 ton/hour)
Power: 12-18 diesel engine or electric motor
Thresher rate: 99%
pandatractor.com
| Product name | Capacity (kg/h) | Power | Weight (kg) | Dimension (mm) |
|---------------------------|-----------------|--------------------------------------------|-------------|-------------------------|
| Rice milling machine MS-10D | 500~1200 | 11kw motor or 15hp diesel engine | 230 | 760x730x1735 |
| Rice milling machine MS-30 | 1100~1500 | 15kw motor or 20~40hp diesel engine | 300 | 1070x760x1760 |
| Rice milling machine MS-50 | 1800~2300 | 22kw motor or ≥30hp diesel engine | 560 | 2400x1080x2080 |
pandatractor.com
SERVICES
Spare parts:
A complete range of original spare parts, guaranteed directly.
Warranty:
A precise certainty for the customer’s satisfaction: 2-year warranty.
Assistance:
A team of specialists, well prepared and available to assure an efficient and resolving service. Agricultural machinery industry information and customer marketing assistance.
www.pandatractor.com
[email protected]
0086 15933376293
|
d032d18f-d3ee-4a49-a0cb-506a3364fcce
|
CC-MAIN-2022-40
|
http://pandatractor.com/wp-content/uploads/2022/05/multifunction-thresher.pdf
|
2022-09-30T10:44:13+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-40/subset=warc/part-00156-26160df0-1827-4787-a515-95ecaa2c9688.c000.gz.parquet
| 36,313,550 | 442 |
eng_Latn
|
eng_Latn
| 0.841897 |
eng_Latn
| 0.888134 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"unknown",
"eng_Latn"
] | true |
docling
|
[
82,
430,
560,
578,
1267,
1687
] |
International Law Commission
Seventy-third session (second part)
Provisional summary record of the 3587th meeting
Held at the Palais des Nations, Geneva, on Monday, 4 July 2022, at 3 p.m.
Contents
General principles of law (continued
GE.22-10553 (E) 180722 050822
)
A
/CN.4/SR.3587
Provisional
For participants only
5 August 2022
Original: English
2
Present:
Chair:
Mr. Tladi
Members:
Mr. Argüello Gómez
Mr. Cissé
Ms. Escobar Hernández
Mr. Forteau
Ms. Galvão Teles
Mr. Grossman Guiloff
Mr. Hassouna
Mr. Hmoud
Mr. Huang
Mr. Jalloh
Mr. Laraba
Ms. Lehto
Mr. Murase
Mr. Murphy
Mr. Nguyen
Ms. Oral
Mr. Ouazzani Chahdi
Mr. Park
Mr. Petrič
Mr. Rajput
Mr. Reinisch
Mr. Ruda Santolaria
Mr. Saboia
Mr. Šturma
Mr. Valencia-Ospina
Mr. Vázquez-Bermúdez
Mr. Wako
Sir Michael Wood
Secretariat:
Mr. Llewellyn
Secretary to the Commission
GE.22-10553
GE.22-10553
The meeting was called to order at 3.20 p.m.
General principles of law (agenda item 6) (A/CN.4/753)
Mr. Vázquez-Bermúdez (Special Rapporteur), introducing his third report on general principles of law (A/CN.4/753), said that the report dealt with the functions of general principles of law within the meaning of Article 38 (1) (c) of the Statute of the International Court of Justice and the relationship between those principles and the other two sources of international law listed in Article 38 – treaties and international custom. The report also revisited certain aspects relating to the identification of general principles in the light of the debates in the Commission and in the Sixth Committee in 2021.
Paragraph 4 of the report summarized the positions taken by States speaking in the Sixth Committee at the seventy-sixth session of the General Assembly. Various delegations had agreed with the use of the term "community of nations" instead of "civilized nations". Many delegations had also agreed with the two-step analysis methodology for the identification of general principles of law derived from national legal systems, as reflected in draft conclusion 4 as provisionally adopted by the Commission. Some States had agreed with the existence of general principles of law formed within the international legal system and had called upon the Commission to clarify how such principles could be identified. Other States had expressed openness regarding the existence of such general principles and had stated that the matter should be further studied and that a clear distinction must be made between such general principles and international custom. Lastly, some delegations had expressed the view that general principles of law within the meaning of Article 38 (1) (c) of the Statute could only originate in national legal systems.
Part one of the third report dealt with the issue of the transposition of the first category of general principles to the international legal system, taking into consideration the debates at the Commission's seventh-second session and in the Sixth Committee. The objective of that part of the report was to respond to the doubts raised by some members of the Commission and delegations in the Sixth Committee concerning draft conclusion 6. Among the main issues raised was the idea that draft conclusion 6 was overly complex and that a provision stating simply that a principle common to the various legal systems of the world must be transposable to the international legal system would suffice. It had also been argued that the issue of transposition did not appear in Article 38 (1) (c), and that recognition within the meaning of that provision might not therefore play a role in the analysis of the transposition of a principle common to the various legal systems of the world. Others had questioned whether or not a formal act of transposition was required for the transposition of a general principle to the international legal system. As for compatibility, the term "fundamental principles of international law" had been questioned by some who considered it ambiguous. The same concern had been expressed in relation to the phrase "adequate application" in paragraph (b) of draft conclusion 6.
Paragraphs 13 to 17 of the report addressed those concerns. He agreed that draft conclusion 6 could be simplified so as to avoid being overly prescriptive. As for recognition within the meaning of Article 38 (1) (c), his position was that recognition at the national level did not suffice and that recognition that a principle was also applicable to the international legal system was also necessary. As to how recognition in the context of transposition could be ascertained, no formal act of transposition was necessary, as was evident from judicial and State practice; recognition was thus implicit. The specific criteria for ascertaining transposition could be discussed in more detail in the Drafting Committee, but it was necessary at least to ascertain the compatibility of the principle in foro domestico with the international legal framework in which it was to operate. Bearing in mind the comments and proposals made, he would present a revised version of draft conclusion 6 to the Drafting Committee.
Part two of the report summarized the divergent views expressed in relation to the second category of general principles of law, namely those formed within the international legal system. His own view remained that there was sufficient practice and literature to support a draft conclusion on that category of general principles. Various members and States had expressed their support for such a provision. In addition, nothing in Article 38 of the Statute of the International Court of Justice indicated that the provision was limited to general
3
4
principles of law derived from national legal systems. Of course, the Commission must handle the issue with caution, taking into account in particular the concern raised by various States and members of the Commission that a clear distinction should be made between the second category and customary international law.
The main challenge facing the Commission was to clearly and precisely formulate the methodology for the identification of general principles formed within the international legal system. He would submit to the Drafting Committee a revised version of draft conclusion 7 and would also welcome other suggestions.
Part three of the report dealt with the functions of general principles of law and their relationship with other sources of international law, in particular treaties and international custom, and included five proposed draft conclusions. In chapter I of part three, he addressed the role of general principles of law in filling gaps in treaty and customary law. That gapfilling role was well established in practice and in the literature, as illustrated in paragraphs 39 to 68 and recognized by various members of the Commission and States in the Sixth Committee. As noted in paragraph 41 of the report, that gap-filling function essentially meant that a general principle of law could be resorted to when a legal issue was not regulated, or not clearly regulated, in treaties or customary law. As noted in paragraph 71, not all lacunae in the law could necessarily be remedied by a general principle of law. A general principle of law could only perform a gap-filling role to the extent that its existence could be identified.
In paragraph 70, it was clarified that the gap-filling function was not necessarily unique to general principles of law. Indeed, in some cases, a treaty rule or a customary rule could perform that function. However, practice seemed to suggest that the essential gapfulling function was inherent in general principles of law. By its nature, a general principle could be applied in cases where other rules of international law either did not exist or were ambiguous. The gap-filling function indicated a relationship between general principles of law and other sources of international law. It was not a hierarchical relationship, rather one governed by the principle of lex specialis.
Paragraph 72 briefly addressed the concept of non liquet, which had been raised by various Commission members and delegations in the Sixth Committee in previous debates. He did not consider it necessary for the Commission to enter into a discussion of the capacity of general principles of law to prevent situations of non liquet, for two reasons. First, the analysis of the gap-filling function of general principles of law already sufficiently addressed that question. Second, the concept of non liquet applied only in a judicial context, where a court or tribunal could not decide on a case due to a lacuna in the law. As he had previously stated, however, general principles of law should not be regarded in a purely court-centric manner; on the contrary, like rules of international law, general principles applied generally to relations between States and other subjects of international law.
Chapter II of part three of the report addressed the relationship between general principles of law and the other sources of international law, namely treaties and international custom. As noted in paragraph 75, that relationship was a complex matter, and it was not necessary for the Commission to pay attention to all aspects of it. He therefore identified in the report three specific issues to be addressed: the absence of hierarchy between the different sources of international law; the possible parallel existence of general principles of law and other rules of international law with identical or similar content; and the operation of the principle of lex specialis in the context of general principles of law.
The absence of hierarchy between the sources of international law was generally accepted in international law. As explained in paragraph 81 of the report, such a hierarchy was also absent in the compatibility test for the purposes of transposition of general principles common to the legal systems of the world to the international legal system. As noted in paragraph 82, the essential gap-filling function of general principles of law did not create a hierarchical relationship between those principles and other rules of international law.
Paragraphs 83 to 94 addressed the possible parallel existence of general principles of law and other rules of international law. An analysis of practice showed that general principles of law could indeed exist alongside identical or similar conventional and customary rules and that coexistence did not affect the applicability and specificity of those principles.
GE.22-10553
GE.22-10553
Paragraphs 95 to 107 addressed the operation of the lex specialis principle in the context of general principles of law, with special reference to the work of the Study Group on fragmentation of international law. The main conclusion reached in the report was that general principles of law were normally considered to be the "general law" in relation to other rules of international law due to the way in which they emerged. However, as the general law, general principles of law could continue to play an interpretative or complementary role with regard to the rules from other sources.
Chapter III of part three of the report dealt with certain specific functions of general principles of law. As stated in paragraph 109, those functions were not necessarily unique to general principles of law, but pertained in principle to all sources of international law. In the case of general principles, however, they should be understood in the light of their gap-filling role. The report addressed three particular functions. First, it was demonstrated that general principles of law could be an independent basis for rights and obligations. As noted in paragraph 121, however, general principles of law had been invoked or applied in that manner in relatively few cases; more commonly, they had served as a basis for procedural or secondary rules. They could also be used as a means to interpret or complement other rules of international law, as evidenced in practice. In addition, they could serve as a means to ensure the coherence of the international legal system.
Mr. Murase said that, regrettably, as on previous occasions, he had found much to be critical of in the Special Rapporteur's third report. He hoped that his remarks on the topic would be taken as constructive criticism.
The main argument of the third report, as set out in part three, seemed to be that there was no hierarchy between the three sources of international law listed in Article 38 (1) of the Statute of the International Court of Justice, that the parallel existence of those sources was recognized and that general principles of law were thus part of the international legal system.
Unfortunately, that argument was based on a false assumption and a groundless assertion. First, Article 38 (1) did not specify the sources of international law; it referred only to the applicable law of the International Court of Justice. The order of subparagraphs (a), (b) and (c) was generally understood to be the order of priority for how the law was to be applied. The Court was normally expected to try to apply international conventions first. Customary international law was to be applied if no appropriate international convention could be found. And, lastly, the Court could apply general principles of law as appropriate. Although the Special Rapporteur seemed to employ the word "hierarchy" to mean "legal status or validity", there was absolutely no suggestion in Article 38 of a hierarchy, in the sense of higher or lower forms of law. In any case, the Special Rapporteur's discussion of "hierarchy" was irrelevant, since Article 38 was not concerned with that issue.
The Special Rapporteur asserted that, in the absence of a hierarchy, the parallel existence of general principles of law and conventions and customs was possible. However, the Commission was not engaged in a general discussion on the sources of international law. The question was whether the parallel or overlapping existence of the three forms of law was possible when it came to interpreting Article 38 of the Statute. The Special Rapporteur had only given an example of the parallel existence of conventions and customs but not of the parallel existence of general principles of law and the other two applicable forms of law. There was an obvious gap in the logic of his argument.
Consequently, the Special Rapporteur's assertion that general principles of law were formed within the international legal system was inaccurate. As he had previously stated, the Special Rapporteur's interpretation of Article 38 (1) was contrary to the established rule of treaty interpretation. The effect and meaning of each provision of that article must be interpreted in such a way as not to overlap with the other provisions: there should be no overlaps between subparagraphs (a), (b) and (c). In other words, general principles of law must not be interpreted in such a way as to make them overlap with international conventions or custom. Consequently, the general principles of law referred to in Article 38 (1) (c) must be domestic law principles.
The fundamental flaw in the current project lay in the unfounded premise that general principles of law were a source of international law, as stated in draft conclusion 1. Although he had repeatedly asked what was meant by the word "source", he had not yet received a
5
6
satisfactory answer. At the seventy-second session of the Commission, the Special Rapporteur had proposed a clarification that referred to "formal sources" and "material sources". However, in the face of strong criticism from Commission members, he had withdrawn that proposal and instead provided the ambiguous and, to his mind, nonsensical explanation: "The term 'source of international law' refers to the legal process and form through which a general principle of law comes into existence." When the topic had first been proposed, Sir Michael Wood had suggested that the title should be "General principles of law as a source of international law". He had opposed that suggestion and the Special Rapporteur had agreed with him at the time. He hoped that the Special Rapporteur would return to his original position and that the misleading phrase "as a source of international law" would be deleted on second reading.
Another question was whether the topic concerned only the general principles of law referred to in Article 38 (1) (c) of the Statute of the International Court of Justice, or whether it also concerned general principles of law applicable to other courts and tribunals. In paragraph 2 (a) of his third report, the Special Rapporteur stated that Article 38 (1) (c) was the point of departure for the work of the Commission, but he did not indicate what destination he was hoping to reach. For most of the report, the Special Rapporteur discussed general principles of law in relation to the Statute of the International Court of Justice. However, the statute of each court or tribunal had its own provisions on applicable law, which could not be extended to other courts or tribunals or made generally applicable.
Some inter-State arbitral agreements, as well as some investment agreements, identified general principles of law as a source of applicable law and stated that such general principles were the same as those referred to in Article 38 (1) (c). If the statute of a court or tribunal included such a clause on applicable law, then it was possible that it had assimilated the general principles of law referred to in Article 38 (1) (c). Unfortunately, the Special Rapporteur did not indicate which arbitral tribunals had such provisions in their statutes.
The Rome Statute of the International Criminal Court and the statutes of other criminal tribunals contained provisions on applicable law that were entirely different from those of the Statute of the International Court of Justice. However, in paragraphs 49 to 62 of the third report, the Special Rapporteur treated such provisions as though they referred to the same general principles of law as the Statute. It was difficult to accept such a far-fetched conclusion.
Perhaps the Special Rapporteur overestimated the role played by general principles of law in filling gaps. General principles of law did not have a monopoly on the function of gapfilling; treaties and custom played a similar role. For example, article 31 (3) (c) of the Vienna Convention on the Law of Treaties, on the systemic and harmonious interpretation of relevant rules, performed a gap-filling function. Customary international law also performed such a function, because of its general and ambiguous character.
The Commission should reconsider the scope of the current topic and determine how best to approach it. The crucial question was whether it should deal with general principles of law from the perspective of the sources of international law in general, or whether it should address the question specifically in terms of the interpretation of Article 38 (1) (c) of the Statute of the International Court of Justice. He suggested that a working group should be established to resolve that basic problem.
Mr. Murphy said that the Special Rapporteur's third report contained a very interesting and useful discussion of three issues, namely transposition, the question of whether general principles of law were formed within the international legal system, and the functions of general principles of law and their relation to other sources of international law. He would address each issue in turn.
The Special Rapporteur's analysis, in part one of the report, of the transposition of general principles of law to the international legal system was very helpful and thoughtful. In particular, he agreed with the Special Rapporteur's conclusion, in paragraph 13, that the requirement of recognition was pertinent both to the principle's existence across national legal systems and to the principle's transposition.
GE.22-10553
GE.22-10553
He also agreed with the Special Rapporteur's suggestion, in paragraph 12 of the report, that the Drafting Committee should simplify draft conclusion 6 to maintain a degree of flexibility in the identification of general principles of law derived from national legal systems. Draft conclusion 6 could simply state that: "A principle common to the principal legal systems of the world is transposed to the international legal system if it is recognized as compatible with that system." The commentary could then explain what was meant by such compatibility, and explain that such recognition was not a formal or express act, but arose implicitly and in context. If the Commission did more with draft conclusion 6, it would run the risk of establishing a test that made the identification of such principles unduly difficult.
He also supported the Special Rapporteur's conclusions on the process of recognition of a general principle, which were discussed in paragraphs 13 and 14 of the third report. While recognition by States that a principle common to national legal systems was transposable did not occur by a formal or express act, there must nevertheless be some implicit agreement by the community of nations that the principle should apply in the international sphere. Paragraphs 15 to 17 of the third report discussed the precise criteria for ascertaining transposition. In that regard, the simplification of draft conclusion 6 would allow the Commission to avoid the difficulties inherent in developing precise criteria.
With respect to part two of the report, he supported the Special Rapporteur's conclusion that general principles of law could emanate from within the international legal system. However, that category of general principles was a relatively narrow one, and the Commission should be very cautious in indicating the circumstances in which such principles arose. The practice discussed by the Special Rapporteur in support of such a category was relatively limited, and it was not always clear that a general principle of law within the meaning of Article 38 (1) (c) of the Statute of the International Court of Justice was present in each example of practice put forward. The International Court of Justice itself had never cited Article 38 (1) (c) of its Statute in relation to the identification of principles of law formed within the international legal system. Hence, the existence of such a second category had been denied by a number of scholars, who often took the view that principles of law existed within the international legal system but that they were not "general principles of law" within the meaning of Article 38 (1) (c).
To address such concerns, the Special Rapporteur suggested, in paragraph 29 of the third report, that the methodology for the identification of such principles should be clearly explained. However, the Special Rapporteur did not set forth a clear methodology in paragraphs 30 to 32. As far as he could tell, the "methodology" consisted of, firstly, determining that no customary rule existed; secondly, engaging in vague acts of inductive and deductive reasoning; and, thirdly, ascertaining whether the principle in question was recognized as independent of any particular treaty regime or customary rule. Such a methodology was not likely to resolve existing concerns about the second category, and ran the risk of encouraging decision-makers to identify miscellaneous principles as general principles of law that overwhelmed the other sources of international law, as well as the risk of dissipating the requirement for State consent to international obligations – perhaps even at the risk of unravelling the system of international law.
He therefore generally supported the Special Rapporteur's suggestion that the Drafting Committee should simplify draft conclusion 7. However, in doing so, it should craft the text narrowly, anchoring general principles formed within the international legal system to the requirement that they should be inherent in that system. Perhaps draft conclusion 7 could simply read: "To determine the existence and content of a general principle of law formed within the international legal system, it is necessary to ascertain that the community of nations has recognized the principle as intrinsic to that system." The evidence that should be relied upon when making such a determination – such as, for example, acceptance by all Member States of the United Nations of the principle of non-intervention as set forth in the Charter of the United Nations – could be explained in the commentary, as part of a carefully delineated methodology for identifying such principles.
The main thrust of the third report was in part three, which concerned the functions of general principles of law and their relation to other sources of international law. Draft conclusion 10 indicated that there was no hierarchy between treaties, customary international
7
8
law and general principles of law as sources of international law. As a formal matter, he agreed with that position, which was well supported by State practice and scholarly writings. There was, however, tension between draft conclusion 10 and draft conclusion 13, which indicated that the essential function of general principles of law was to "fill gaps". The Special Rapporteur appeared to be suggesting that, generally speaking, when an issue arose that concerned international law, one should look first to treaties and custom to address the matter, and only afterwards turn to general principles of law as a residual source of law; and, likewise, that if there was a conflict between a treaty or customary rule and a general principle of law, the treaty or customary rule would prevail. Such a position implied a hierarchical relationship, with treaties and custom as the primary sources and general principles operating only as needed to fill any gaps.
Similarly, as a practical matter, if there was an available treaty or customary law rule that resolved the legal question at hand, a judge or other legal practitioner was likely to apply that rule rather than consider whether a relevant general principle of law also existed. Again, such a position suggested a hierarchical relationship. On the other hand, if the general principle of law was jus cogens, a possibility that the Commission had recognized in its project on that topic, then that principle would be hierarchically superior to any conflicting rule of treaty or custom. The Commission should bear such points in mind when discussing draft conclusion 10 and its commentary.
As a formal matter, he agreed with draft conclusion 11 regarding the parallel existence of identical or analogous general principles and treaty or customary rules. However, he was not sure whether the draft conclusion was really needed or helpful. It would make sense to merge the concept laid out in draft conclusion 11 into draft conclusion 10, such that it was indicated in a single conclusion, or in its commentary, that the three sources operated in parallel and without any formal hierarchy.
Draft conclusion 12 highlighted one particular method for resolving conflict between the three main sources of international law, stating that the lex specialis principle applied to the relationship between general principles of law and rules drawn from the other sources of international law that addressed the same subject matter. However, there was no explanation in the third report as to why that particular method was proposed; it could equally be explained, for example, that the later-in-time rule applied, or that a peremptory norm (jus cogens) superseded a general principle of law. Moreover, it was problematic to view the three main sources as having the same quality of law. General principles of law were not just another source of law; they advanced more abstract legal concepts than were generally found in treaties or custom. Given their abstract and fundamental nature, general principles of law were arguably lex generalis. The Commission's 2006 report on the fragmentation of international law (A/CN.4/L.682) referred to lex specialis as a principle used to resolve a conflict between two different treaties, or between a treaty and a custom; however, in no instance did it refer to a general principle of law as being lex specialis in relation to a rule of treaty or custom. To the contrary, the report indicated that it could perhaps be assumed that customary international law had primacy over general principles of law as a natural aspect of legal reasoning.
Draft conclusions 13 and 14 identified "essential" and "specific" functions of general principles of law. While he had enjoyed reading the report's discussion of how general principles of international law had arisen, he was unsure as to whether it was helpful to attempt to identify the functions that they served. First, it was not obvious that the functions mentioned were the only functions or even the most important functions that such principles performed. For instance, providing procedural canons for international courts and tribunals was a specific and important function that they served. Second, the purpose of contrasting "essential" functions with "specific" functions was unclear; the term "general", for example, might be more appropriate than "essential". In any event, if those ideas were retained, draft conclusions 13 and 14 should be combined into a single draft conclusion that addressed "functions".
Draft conclusion 13 suggested that general principles of law essentially served as gapfillers. As he had previously noted, such a proposal was at odds with the idea that there was no hierarchy among the main sources of international law. Moreover, the function of being a gap-filler might suggest that there could be, or should be, no lacunae, or non liquet, in
GE.22-10553
GE.22-10553
international law, notwithstanding the recognition in paragraph 71 of the third report that lacunae might exist. Finally, the terms "gap-filling" and "fill gaps" were unwieldy and thus unhelpful; if what was meant was that the essential function of general principles of law was to provide a source of law, if possible, where no relevant treaty or customary rule existed, then it should be clearly stated as such.
With regard to draft conclusion 14, in addition to his concerns about the three "specific functions" listed, he was also somewhat sceptical about the emphasis placed on general principles as an "independent basis for rights and obligations", as stated in subparagraph (a). Even if operating independently of treaty or custom, general principles of law often did not establish an independent right or obligation. To give an example, the International Court of Justice had held in multiple cases that the general principle of good faith did not give rise to new obligations, and that good faith only related to the fulfilment of obligations that already existed. While he was not taking the position that general principles of law could never serve as an independent source of rights and obligations, he believed that the Commission should avoid unduly emphasizing such a function, in part because it was not common, and in part because the Commission's work should not encourage attempts to turn to general principles of law to find rights and obligations that did not appear in treaties or arise from customary international law.
He was in favour of sending draft conclusions 10 to 14 to the Drafting Committee for further development in the light of the current debate.
The meeting rose at 4.20 p.m.
9
|
<urn:uuid:51ef21d9-ba6c-4ec9-ae75-15192bca702c>
|
CC-MAIN-2023-23
|
https://legal.un.org/ilc/documentation/english/summary_records/a_cn4_sr3587.pdf
|
2023-06-03T17:22:12+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-23/subset=warc/part-00144-ffa3bf93-6ba1-4a27-adea-b0baae3b4389.c000.gz.parquet
| 406,303,676 | 6,210 |
eng_Latn
|
eng_Latn
| 0.862851 |
eng_Latn
| 0.996768 |
[
"eng_Latn",
"zsm_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
367,
889,
5720,
10611,
15493,
20095,
25059,
29993,
31728
] |
The image shows a group of men in formal attire, likely at a professional or official event. One man is holding a document and appears to be presenting it to another man who is gesturing with his hand, possibly explaining something. The setting includes a microphone, suggesting that this could be a press conference or a formal announcement. The background features curtains, indicating an indoor venue.
|
80958681-fbe6-4910-a611-b579dc8fee0c
|
CC-MAIN-2023-14
|
https://exploreuk.uky.edu/catalog/xt7msb3wtd0h_116_1/download?type=pdf
|
2023-03-25T10:57:50+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-14/subset=warc/part-00245-39c03058-7d78-443d-9984-102329513e3d.c000.gz.parquet
| 292,411,673 | 75 |
eng_Latn
|
eng_Latn
| 0.999046 |
eng_Latn
| 0.999046 |
[
"eng_Latn"
] | true |
docling
|
[
404
] |
Kenan
Kenan, the great-grandson of Adam, the grandson of Seth and the son of Enosh, appears on genealogical lists of the antediluvian heroes (Gen 5:9–14; 1 Chr 1:2). Kenan was born when Enosh was ninety years old. Kenan begot Mahalel at the age of seventy. Kenan lived for 910 years.
Kenan is often paralleled to Cain for the following reasons: the names are etymologically related, both figures are linked to fathers with nearly identical names meaning “man, humanity” (Adam and Enosh), and the genealogy of Cain and Kenan contains similar names, but in a slightly altered sequence (Gen 4:17–22 vs. Gen 5:9–14).
The etymology of Kenan and Cain is disputed. Whereas Gen 4:1 derives Cain explicitly from the
stem \( q-n-y \) (“to acquire”), both names probably originate from a stem \( q-y-n \) (“to form, shape, forge.” The suffix \(-ān\) is mostly interpreted as a diminutive ending. Therefore, Kenan might be a “little Cain.” Maybe Kenan is a short form of a nominal sentence, namely the predicate with omission of the theophoric element: “Smith is (X).” However, Kenan could also be linked to Arabic \( qiin \) “servant.” In that respect it could be a short form with the hypocoristic ending “servant (of X)” like the Safatenic full form \( qn'l \) (“servant of El”). A similar short form of the same name might be Safatenic \( qnn \). Jerome translates \( Cainan \) with “lament or their possession” relating \( Cainan \) to the Hebrew noun \( qinā \) or the root \( q-n-y \) (Jerome, *Nom. hebr.* 4.2–3).
Furthermore, Kenan (\( Qaynān \)) is the name of a deity attested in Sabaean inscriptions. \( Qaynān \) might have been a patron deity for metalworkers worshipped mainly by the \( Ḥasa' um \) tribe, though the texts do not provide an indication for a proper interpretation. This deity is often simply called “God of the \( Ḥasa' um \) (tribe).”
Kenan appears twice in the NT as Cainan (Gk. \( Kaivánū \)) in Luke’s genealogy of Jesus: as the son of Enosh (Luke 3:37–38) and as the son of Arphaxad (Luke 3:36). The second Kenan is part of the genealogy of Shem according to the LXX version of Gen 10:24; 11:12. This postdiluvian Kenan lived in the time between Noah and Abraham.
The book of *Jubilees* adds the name of both the mother (Noam, sister of Enosh) and the wife of the antediluvian Kenan (Mualeleth, sister of Kenan; *Jub.* 4:13–15). The postdiluvian Kenan married Melka, daughter of Madai, and became father of Shelah. He has found an inscription with the secrets of astronomy and astrology (*Jub.* 8:1–5).
**Bibliography:** ■ Becking, B., “Kenan,” *DDD* (Leiden 1995) 902. ■ Hess, R. S., “Kenan (Person),” *ABD* 4 (New York 1992) 16. ■ Hess, R. S., *Studies in the Personal Names of Genesis* 1–11 (AOAT 234; Kevelaer 1993). ■ Höfner, M., “Die vorislamischen Religionen Arabiens,” in *Die Religionen Altsyriens, Altarabiens und der Mandaer* (ed. H. Gese et al.; Stuttgart 1970) 233–402. ■ Jacobus, H. R., “The Curse of Cainan (*Jub.* 8.1–5): Genealogies in Genesis 5 and Genesis 11 and a Mathematical Pattern,” *JSP* 18.3 (2009) 207–32. ■ Rechenmacher, H., *Althebräische Personennamen* (LOS 2/1; Münster 2012). ■ Ryckmans, G., *Les noms propres sud-sémitiques* (Le Muséon 2/1; Leuven 1934).
*Erasmus Gaß*
|
<urn:uuid:eec8c3c1-e9d3-4e57-bb35-7f3c6e80c790>
|
CC-MAIN-2024-10
|
https://opus.bibliothek.uni-augsburg.de/opus4/frontdoor/deliver/index/docId/94860/file/94860.pdf
|
2024-02-27T07:37:24+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-10/subset=warc/part-00189-d9675c6d-5c8d-45bb-9c98-c56e42022a4d.c000.gz.parquet
| 443,619,651 | 1,002 |
eng_Latn
|
eng_Latn
| 0.950267 |
eng_Latn
| 0.952632 |
[
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
709,
3234
] |
CROWDSOURCING AND EVALUATING TEXT-BASED AUDIO RETRIEVAL RELEVANCES
Huang Xie, Khazar Khorrami, Okko Räsänen, Tuomas Virtanen
Unit of Computing Sciences, Tampere University, Finland
ABSTRACT
This paper explores grading text-based audio retrieval relevances with crowdsourcing assessments. Given a free-form text (e.g., a caption) as a query, crowdworkers are asked to grade audio clips using numeric scores (between 0 and 100) to indicate their judgements of how much the sound content of an audio clip matches the text, where 0 indicates no content match at all and 100 indicates perfect content match. We integrate the crowdsourced relevances into training and evaluating text-based audio retrieval systems, and evaluate the effect of using them together with binary relevances arise from audio captioning. Conventionally, these binary relevances are defined by captioning-based audio-caption pairs, where being positive indicates that the caption describes the paired audio, and being negative applies to all other pairs. Experimental results indicate that there is no clear benefit from incorporating crowdsourced relevances alongside binary relevances when the crowdsourced relevances are binarized for contrastive learning. Conversely, the results suggest that using only binary relevances defined by captioning-based audio-caption pairs is sufficient for contrastive learning.
Index Terms— Text-based audio retrieval, non-binary relevance, crowdsourcing assessment
1. INTRODUCTION
Text-based audio retrieval, or text-to-audio retrieval, refers to searching for audio clips with free text queries, which has great potential in real-world applications, such as search engines and multimedia databases. Early works [1, 2] have mainly focused on methods of retrieving audio with carefully curated phrases (e.g., audio tags, onomatopoeic words). With the availability of large audio-caption datasets (e.g., Clotho [3] and AudioCaps [4]) in recent years, increasing attention has been drawn to developing methods for audio retrieval using free-form text [5].
Most of the literature tackles text-to-audio retrieval with cross-modal learning methods. Oncescu et al. [6] first established benchmarks in this topic with an adapted text-to-video retrieval model. With the recent success of large-scale pretrained audio models (e.g., PANNs [7]) and language models (e.g., BERT [8]), pretrained models are widely used for text-to-audio retrieval and fine-tuned on task-specific data to learn joint representations of audio and text [5]. Besides, several works [9, 10] explored training strategies for text-to-audio retrieval models. For example, Mei et al. [9] evaluated several cross-modal learning objectives (e.g., InfoNCE loss [11]) in the context of text-to-audio retrieval.
In aforementioned works [6, 9, 10], relevances of audio to be retrieved are usually assumed to be binary, i.e., either relevant or irrelevant, given a text query. For example, an audio clip is relevant to a caption if and only if the caption thoroughly describes its sound content (i.e., their content matches perfectly). Practically, due to the lack of annotated non-binary relevances in existing datasets, binary relevances defined by captioning-based audio-caption pairs are adopted for system training and evaluation. Binary relevances are positive for audio-caption pairs where the caption describes the paired audio, and negative for all other pairs. This allows producing large quantities of positive and negative examples for contrastive learning in state-of-the-art systems [5].
As a caption might partially describe the sound content of an audio clip, we explore grading audio-text relevances with non-binary numerical scores. Specifically, we crowdsource audio-text relevances graded on a scale of 0 to 100, where 0 indicates completely irrelevant (i.e., no content match at all) and 100 indicates completely relevant (i.e., perfect content match). The main contributions of this work are: 1) we crowdsource non-binary audio-text relevances for environmental audio and its existing captions; 2) we integrate the crowdsourced relevances into training and evaluating text-to-audio retrieval systems, and evaluate the effect of using them alongside binary relevances defined by captioning-based audio-caption pairs; 3) we release all the data and the crowdsourcing instructions to the research community to allow others to explore non-binary relevances [12].
2. CROWDSOURCING ASSESSMENTS
This section presents the proposed method for crowdsourcing audio-text relevances.
2.1. Crowdsourcing Pipeline
We crowdsource audio-text relevances on Amazon Mechanical Turk (MTurk). Here we first introduce the terms used in this work. A human intelligence task (HIT) represents a single task that a crowdworker can work on. An assignment is a copy of a HIT that is assigned to a crowdworker. A worker answer is the submitted task result when a crowdworker completes an assignment.
Fig. 1 presents an overview of the crowdsourcing pipeline. Audio clips and captions for relevance assessments are combined to form HITs, each of which consists of five audio clips and one caption. Every HIT is assigned to multiple MTurk workers. Raw answers containing graded audio-text relevances are collected and aggregated after workers complete their assignments.
2.2. Audio and Caption Data
We select a subset of captions and audio clips from each split in Clotho [3], with each subset containing 200 captions and 17 audio clips for each caption. Clotho crowdsources captions for each audio clip, and captions scored high by other workers results to the final captions [3]. The audio clips selected for each caption consists of one true positive clip (TP, being completely relevant to the caption), one true negative clip (TN, being completely irrelevant to the caption), and 15 relevance-unknown candidates (C15). Specifically, we select audio clips corresponding to the captions in Clotho as TPs and obtain TNs using low audio-caption similarity scores estimated by the baseline system in DCASE 2023 Challenge Task 6B\(^1\) followed by human verification. For C15s, we choose the top five clips with high audio-caption similarity scores, together with another 10 randomly selected clips to include audio clips having diverse relevances. Table 1 summarizes the captions and audio clips for crowdsourcing relevance assessments.
2.3. Crowdsourcing Task Setting
For each caption, five HITs are created, each of which is assigned to several crowdworkers. Each HIT contains five audio clips, which are provided for crowdworkers to assess their individual relevance to the caption. The C15s of a caption are split into five batches of three C15s, with one batch per HIT. The TP and TN clips are used for quality check after crowdsourcing.
In each assignment, crowdworkers are asked to assign numeric scores (between 0 and 100) to indicate their judgements of how much the sound content in each audio clip matches the given caption in that assignment. Inspired by [13], we grade audio-text relevances on a scale of 0 to 100, where 0 indicates completely irrelevant (i.e., no content match at all) and 100 indicates completely relevant (i.e., perfect content match). An initial value of 0 is set as the default relevance score for each audio clip. Crowdworkers are required to listen to each audio clip entirely.
2.4. Quality Check
To collect high-quality answers, a quality check is conducted before and after crowdsourcing. Worker requirements are set up for selecting workers with high-quality work on MTurk (e.g., workers with a HIT approve rate greater than 98%). Besides, crowdworkers should pass a predefined qualification test by correctly answering questions about identifying the audio clip described by a given caption from three candidates before they can accept our HITs (i.e., receiving assignments).
With the fact that TPs are clearly more relevant than TNs within the same assignment, the former should receive higher scores than the latter. Let \( s_{tp} \) be the graded relevance of a TP, and \( s_{tn} \) be the one of the TN within the same assignment. Consistency verification on \( s_{tp} \) and \( s_{tn} \) is applied to check and select worker answers at the worker level.
Let \( D = \{ S_i \mid 1 \leq i \leq N \} \) denote the set of \( N \) answers submitted by a worker, where \( S_i = \{ s_{tp}^i, s_{tn}^i, s_{c1}^i, s_{c2}^i, s_{c3}^i \} \) represents the \( i \)-th answer from the worker, and \( s_{c1}, s_{c2}, s_{c3} \) are the scores of the three C15 clips within the same assignment. As mentioned above, a C15 can be either completely relevant or irrelevant, or even partially relevant to a given caption. For every \( S_i \in D \), we measure two random variables for the worker: \( X \), which represents the difference of \( s_{tp} \) and \( s_{tn} \), and \( Y \), which denotes the difference of every pair of \( s_{c1}, s_{c2}, s_{c3} \). Intuitively, \( s_{tp} \) should be higher than \( s_{tn} \) by more than what is expected by chance when sampling from \( Y \). For consistency verification on \( s_{tp} \) and \( s_{tn} \), we therefore require that \( X \) and \( Y \) should satisfy:
\[
E(X) = E(s_{tp} - s_{tn}) \geq E(Y) + \sigma(Y),
\]
where \( E \) represents the expected value and \( \sigma \) represents the standard deviation across \( D \) (i.e., all answers from the worker). If the inequality is not satisfied, \( D \) will be discarded completely.
3. AUDIO-TEXT RELEVANCE SCORES
This section analyzes the crowdsourced relevances.
### 3.1. Crowdsourced Raw Scores
Table 2 summarizes information about the crowdsourced data after filtering the data based on the quality check. For each HIT, answers were collected from at least five distinct crowdworkers. In total, 18204 answers were crowdsourced from 340 MTurk workers.
Fig. 2 presents the distribution of raw relevance scores of TP, TN, and C15 clips. For TPs, approximately 60% of relevance scores have a value of 100. For TNs, about 90% of relevance scores are zeros, and over 98% of these scores are less than 20. It indicates that most crowdworkers can appropriately assess the relevances of TPs and TNs to a given caption. For C15s, over 10% of relevance scores have a value of 100, which indicates that some C15s are highly relevant to a given caption. We notice that around 20% of relevance scores of TPs are zeros, which shows the necessity of further processing on the crowdsourced raw scores.
### 3.2. Aggregated Scores
The raw scores from different workers regarding the relevance of an audio clip to a text query are aggregated by discarding a maximum and a minimum score and then averaging the remaining to produce a statistic that is robust to outliers. Fig. 3 presents the distribution of aggregated relevance scores of TP, TN, and C15 clips. After aggregating, the distribution of relevance scores becomes more balanced, with fewer instances of extreme or polarized judgements (e.g., scores of 0 and 100). Particularly, TPs exhibit a broader spectrum of relevances (e.g., having scores spanning from 30 to 100) compared to other clips. Over 99% of TPs have a score above 10, while about 99% of TNs have a score below 10. Around 30% of C15s have a score above 10, and roughly 10% have a score above the mean score of TPs (i.e., $s > 72$).
### 4. EXPERIMENTS
This section reports experimental results of using the crowdsourced relevances for text-to-audio retrieval. Due to the lack of established methods for using non-binary relevances for training and evaluation, we binarize the crowdsourced relevances.
#### 4.1. Audio-Caption Pairs
Similar to previous studies [5], we tackle text-to-audio retrieval with contrastive learning. To obtain positive and negative examples for contrastive learning, we binarize the crowdsourced relevances (see 3.2) using the mean score of TPs as an arbitrary threshold. Specifically, we obtain positive audio-caption pairs by combining: 1) a caption with its high-graded C15 clips, which have a score above the threshold; 2) the TP clip of a caption with the captions corresponding to its high-graded C15 clips in Clotho; 3) the siblings (i.e., captions describing the same TP clip in Clotho) of a caption with its high-graded C15 clips. All other audio-caption combinations are treated as negative pairs. The resulting positive and negative pairs are referred to as content-matching pairs with “Binarized Crowdsourced Relevances” (BiCrRel).
As a baseline, we created a subset of Clotho by selecting those audio-caption pairs of which the audio or the caption were part of BiCrRel, i.e., using the captioning-based clip-specific audio-caption pairs from Clotho [3]. The selected pairs are referred to as captioning-based pairs with “Binary Relevances” (BiRel), which include the same audio clips and captions as in BiCrRel. Table 3 summarizes information about BiCrRel, BiRel, and their combination (“BiCrRel+BiRel”). The development / validation / evaluation splits are used for training / validation / evaluation, respectively.
#### 4.2. Retrieval System
We experiment with the retrieval system proposed as the baseline in DCASE 2023 Challenge Task 6B\(^2\), where a pre-trained CNN14 [7] is employed as the audio encoder and the Sentence-BERT (i.e., “all-mpnet-base-v2”) [14] is used as the text encoder. This system is trained by optimizing the InfoNCE loss [11] such that embeddings of the paired audio and text are pulled together while those of the unpaired are pushed far away.
**Audio Encoder.** The CNN14 [7], which is pretrained on AudioSet [15], is employed as the audio encoder, with its last linear layer discarded. An extra linear layer is added on the top to generate 300-dimensional audio embeddings. The audio encoder is fine-tuned during training.
**Text Encoder.** The Sentence-BERT [14], which is derived from BERT [8] for the purpose of generating robust sentence embeddings, is used as the text encoder. An extra linear layer is also added on the top to generate 300-dimensional text embeddings. The Sentence-BERT is frozen during training.
**InfoNCE Loss.** The InfoNCE loss [11] is a symmetric cross-entropy loss, taking the form of
$$L = - \frac{1}{M} \sum_{i=1}^{M} [\log \frac{\exp(z_{ii}/\tau)}{\sum_{j=1}^{M} \exp(z_{ij}/\tau)} + \log \frac{\exp(z_{ii}/\tau)}{\sum_{j=1}^{M} \exp(z_{ji}/\tau)}],$$
(2)
---
\(^2\)https://dcase.community/challenge2023/task-language-based-audio-retrieval.
where $\tau$ represents the temperature hyper-parameter, $M$ denotes the number of audio-text pairs, and $z_{ij}$ represents the cosine similarity of the $i$-th audio embedding and the $j$-th text embedding. It has been widely used to train cross-modal retrieval systems [5].
**Training Setup.** The retrieval system is trained with mini-batches consisting of 32 audio-text pairs from a development split. An Adam optimizer with an initial learning rate of 0.001 is adopted to optimize training. Learning rate is reduced by a factor of ten once the validation loss does not improve for five epochs. Training is terminated by early stopping with a patience of ten epochs.
### 4.3. Evaluation Metrics
Retrieval performance is measured with recall at 10 (R@10) on different evaluation splits. The R@10 is defined as the proportion of relevant items among the top 10 results to all the relevant items contained in the data and is averaged over queries [5]. The more relevant items are within top 10 results, the higher R@10 it is.
### 4.4. Results
Table 4 shows that training the system on BiRel leads to high R@10 (e.g., 0.566 on BiRel), whereas training the system on BiCrRel yields low R@10 (e.g., 0.478 on BiRel) and on BiCrRel+BiRel results in intermediate R@10 (e.g., 0.509 on BiRel). We conclude that the crowdsourced relevances do not improve the performance from captioning-based audio-caption pairs when they are reduced to binary relevances. A possible explanation is that captions in Clotho are crowdsourced specifically to describe an exact audio clip, while the crowdsourced relevances are graded based on their matching content with a given caption (i.e., different underlying purposes and criteria for generating captions and assessing relevances). Besides, with the fact that each caption in BiRel is annotated with one relevant audio clip while a caption in BiCrRel can have several relevant audio clips, it makes text-to-audio retrieval on BiCrRel more difficult and leads to a decrease in R@10.
### 5. CONCLUSIONS
We explore grading audio-text relevance for text-based audio retrieval via crowdsourcing assessments. We crowdsource audio-text relevances graded on a scale of 0 to 100, where 0 indicates completely irrelevant and 100 indicates completely relevant. We integrate crowdsourced relevances into training and evaluating text-to-audio retrieval systems, and evaluate the effect of using them alongside binary relevances defined by captioning-based audio-caption pairs. Experimental results show that the crowdsourced relevances do not positively contribute to the performance when they are reduced to binary relevances, and using only binary relevances defined by captioning-based audio-caption pairs is sufficient for contrastive learning.
### 6. ACKNOWLEDGMENT
The research leading to these results has received funding from Emil Aaltonen foundation funded project “Using language to interpret unstructured data” and Academy of Finland grant no. 314602.
7. REFERENCES
[1] M. Slaney, “Semantic-audio retrieval,” in *Proc. Int. Conf. Acoustic., Speech and Signal Process. (ICASSP)*, 2002, pp. IV–4108–IV–4111.
[2] S. Ikawa and K. Kashino, “Acoustic event search with an onomatopoeic query: Measuring distance between onomatopoeic words and sounds,” in *Proc. Detect. Classif. Acoust. Scenes Events Work. (DCASE)*, 2018, pp. 59–63.
[3] K. Drossos, S. Lipping, and T. Virtanen, “Clotho: an audio captioning dataset,” in *Proc. Int. Conf. Acoustic., Speech and Signal Process. (ICASSP)*, 2020, pp. 736–740.
[4] C. Kim, B. Kim, H. Lee, and G. Kim, “Audiocaps: Generating captions for audios in the wild,” in *Proc. Conf. North Am. Chapter Assoc. Comput. Linguist. Hum. Lang. Technol. (HLT-NAACL)*, 2019, pp. 119–132.
[5] H. Xie, S. Lipping, and T. Virtanen, “Language-based audio retrieval task in dcase 2022 challenge,” in *Proc. Detect. Classif. Acoust. Scenes Events Work. (DCASE)*, 2022, pp. 216–220.
[6] A. Oncescu, A. Koepke, J. Henriques, Z. Akata, and S. Albanie, “Audio retrieval with natural language queries,” in *Proc. Annu. Conf. Int. Speech Commun. Assoc. (INTERSPEECH)*, 2021, pp. 2411–2415.
[7] Q. Kong, Y. Cao, T. Iqbal, Y. Wang, W. Wang, and M. Plumbley, “Panns: Large-scale pretrained audio neural networks for audio pattern recognition,” *IEEE/ACM Trans. Audio Speech Lang. Process.*, pp. 2880–2894, 2020.
[8] J. Devlin, M. Chang, K. Lee, and K. Toutanova, “Bert: Pre-training of deep bidirectional transformers for language understanding,” in *Proc. Conf. North Am. Chapter Assoc. Comput. Linguist. Hum. Lang. Technol. (NAACL-HLT)*, 2019, pp. 4171–4186.
[9] X. Mei, X. Liu, J. Sun, M. Plumbley, and W. Wang, “On metric learning for audio-text cross-modal retrieval,” in *Proc. Annu. Conf. Int. Speech Commun. Assoc. (INTERSPEECH)*, 2022, pp. 4142–4146.
[10] H. Xie, O. Räsänen, and T. Virtanen, “On negative sampling for contrastive audio-text retrieval,” in *Proc. Int. Conf. Acoustic., Speech and Signal Process. (ICASSP)*, 2023, pp. 1–5.
[11] A. Van den Oord, Y. Li, and O. Vinyals, “Representation learning with contrastive predictive coding,” 2018. [Online]. Available: https://arxiv.org/abs/1807.03748
[12] TAU Audio-Text Graded Relevances 2023 Dataset, https://github.com/xieh97/retrieval-relevance-crowdsourcing.
[13] K. Roitero, E. Maddalena, S. Mizzaro, and F. Scholer, “On the effect of relevance scales in crowdsourcing relevance assessments for information retrieval evaluation,” *Inf. Process. Manag.*, p. 102688, 2021.
[14] N. Reimers and I. Gurevych, “Sentence-BERT: Sentence embeddings using Siamese BERT-networks,” in *Proc. Empirical Methods Nat. Lang. Process. (EMNLP)*, 2019, pp. 3982–3992.
[15] J. F. Gemmeke, D. P. W. Ellis, D. Freedman, A. Jansen, W. Lawrence, R. C. Moore, M. Plakal, and M. Ritter, “Audio set: An ontology and human-labeled dataset for audio events,” in *Proc. IEEE Int. Conf. Acoustic., Speech and Signal Process. (ICASSP)*, 2017, pp. 776–780.
|
<urn:uuid:061a0700-2103-4ff5-a651-c311142d0842>
|
CC-MAIN-2023-50
|
https://dcase.community/documents/workshop2023/proceedings/DCASE2023Workshop_Xie_35.pdf
|
2023-12-04T19:34:32+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00017-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet
| 227,330,026 | 4,967 |
eng_Latn
|
eng_Latn
| 0.858824 |
eng_Latn
| 0.984049 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"dag_Latn"
] | false |
docling
|
[
5329,
9568,
14473,
17463,
20427
] |
International Law Studies—Volume 51
Situation, Documents, and Commentary on Recent Developments in the International Law of the Sea
Brunson MacChesney
The thoughts and opinions expressed are those of the authors and not necessarily of the U.S. Government, the U.S. Department of the Navy or the Naval War College.
SECTION III
TESTING AREAS FOR MODERN WEAPONS SYSTEMS
UNITED STATES GUIDED MISSILE RANGE
Figure 6.
SECTION III
TESTING AREAS FOR MODERN WEAPONS SYSTEMS
A. Long Range Proving Ground for Guided Missiles
1. Note. In the process of developing the inter-continental ballistic missile, as with the atomic and hydrogen bombs, the United States has sought the use of extensive areas necessary for the testing of these weapons. The first nuclear tests outside the continental United States were conducted at Bikini in the Pacific in July 1946. This and the subsequent larger nuclear testing areas in the Marshall Islands were designated as warning zones or danger areas by the United States during the various testing periods. See Danger Areas for Nuclear Weapons Tests, infra. With the long range guided missile, however, the difference in the type of weapon and tests involved necessitated the establishment of a flight range area, range sites and tracking stations within the territory of other countries in the Atlantic and over an area even greater than that covered by the Pacific nuclear experiments.
The first agreement creating a long range proving ground for guided missiles was concluded between the United Kingdom and the United States on 21 July 1950. This agreement established a flight testing area, referred to as "The Bahamas Long Range Proving Ground," extending approximately 675 miles from the launching site located at Cape Canaveral, Florida, to a point north of the Caicos Islands. TIAS 2099; 1 UST 545; 97 UNTS 261; Cmd. 8109. On 26 November 1951, arrangements were made with the Dominican Republic whereby proving ground sites and stations were set up on the northeast coast of the island. TIAS 2425; 3 UST 2569; 150 UNTS 227. Similar sites and posts were established in Puerto Rico at about the same time. By a second agreement between the United Kingdom and the United States on 15 January 1952 the Bahamas Long Range Proving Ground was extended to the Turks and Caicos Islands. TIAS 2426; 3 UST 2594; 127 UNTS 3; Cmd. 8485. In 1952, a treaty with Haiti provided for the temporary establishment of a Short-Range-Aid-to-Navigation (SHORAN) Ground Station for the tracking of guided missiles on Haitian territory. TIAS 2701; 3 UST 5105. As of 31 October 1956, the Treaty is no longer in force. Treaties in Force, Publication 6427, page 68. With a view toward developing countermeasures against guided missiles, a High Altitude Interceptor Range was created in certain areas north and south of Grand Bahamas Island by an agreement with the United Kingdom in 1953. TIAS 2789; 4 UST 429; Cmd. 8881. Recently two separate agreements between the United Kingdom and the United States have further extended the Long Range Proving Ground out into the Atlantic to Saint Lucia in the Windward Islands (TIAS 3595) and to Ascension Island (TIAS 3603). These agreements entered into force on 25 June 1956, and increased the guided missile range from 1000 miles to 5000 miles. By an Exchange of Notes, effective 21 January 1957, Brazil agreed to
the establishment of a guided missile station on the Brazilian Island of Fernando de Noronha (TIAS 3744). Effective 1 April 1957, the United Kingdom agreed to extend the Flight Testing Range to include an additional area to the southeast, as shown on map annexed to the Agreement (TIAS 3808).
So far as could be determined, there have been no objections or protests made by other nations against the establishment or operation of the long range proving ground, and there have been no reported incidents involving foreign vessels or aircraft. Although the long range proving ground extends over areas that include some of the air and shipping routes in the Caribbean and Atlantic, it is believed that the missile flights are at such high altitudes that they do not interfere with air or sea navigation. Moreover, every effort is made by the authorities responsible for testing to make sure that the range area is clear before any missiles are launched. In addition, the testing areas are announced in the United States Radio Facilities Charts, Notices to Airmen and Notices to Mariners well in advance of any tests.
The 1950 agreement establishing the Bahamas Long Range Proving Ground, reproduced below, is similar to the numerous succeeding agreements and extensions of the proving grounds which have been entered into by the United States. Paragraph 3 of Article XI of this original agreement was amended by an exchange of notes in 1955. TIAS 3379; Cmd. 9565. The Amendment provided that “certain facilities at the Sites at Governor’s Harbour (Eleuthera), Mayaguana, and San Salvador shall be open for regular use by civil aircraft” in accordance with certain provisions and regulations. A similar Amendment, providing for extension of civil air services to the Turks and Caicos Islands and Jamaica, became effective 4 January 1957 (TIAS 3727).
2. Agreement Between the Government of the United States of America and the Government of the United Kingdom of Great Britain and Northern Ireland Concerning a Long Range Proving Ground for Guided Missiles to be Known as “The Bahamas Long Range Proving Ground” (1950)
The Government of the United States of America and the Government of the United Kingdom of Great Britain and Northern Ireland, with the concurrence of the Government of the Bahama Islands,
Considering that it is the intention of the Government of the United States of America to establish a Long Range Proving Ground consisting of a Main Base and Launching Area which shall be in the vicinity of Cape Canaveral, Florida, United States of America, and of a Flight Testing Range, as defined in this Agreement, which shall extend to the south-east from the Launching Area through the Bahama Islands and the waters adjacent thereto,
Having decided that the said Proving Ground should be used by the Government of the United States of America and the Government of the United Kingdom of Great Britain and Northern Ireland for testing the flight of guided missiles and associated
equipment and for training with such missiles and equipment, and
Desiring that this Agreement shall be fulfilled in a spirit of good
neighborliness between the Governments concerned, and that de-
tails of its practical application shall be arranged by friendly
cooperation,
Have agreed as follows:
ARTICLE I
DEFINITIONS
For the purposes of this Agreement:
(1) "Range Area" means that part of the Flight Testing Range
which lies within the territory of the Bahama Islands (including
the territorial waters thereof).
(2) "United States authorities" means the authority or au-
thorities from time to time authorized or designated, by the Gov-
ernment of the United States of America, for the purpose of
exercising the powers in relation to which the expression is used.
(3) "United States Forces" means the armed forces of the
United States of America, and "member of the United States
Forces" means a member of those forces who is entitled to wear
the uniform thereof.
(4) "Flight Testing Range" means the area within the red and
hatched line drawn on the attached map. [Map not reprinted.]
(5) "National of the United States" means a citizen of the
United States or a person who, though not a citizen of the United
States, owes allegiance to the United States.
(6) "British national" means any British subject or Common-
wealth person or any British protected person, but shall not
include a person who is both a British national and a member
of the United States Forces.
(7) "Local alien" means a person, not being a British national,
a member of the United States Forces or a national of the United
States, who is ordinarily resident in the Bahama Islands.
(8) "Sites" means the sites provided under Article IV of this
Agreement so long as they are so provided.
ARTICLE II
GENERAL DESCRIPTION OF RIGHTS
(1) Subject to the provisions of this Article, the Government
of the United States of America shall have the right in the Range
Area:
(a) to launch, fly and land guided missiles;
(b) to establish, maintain and use an instrumentation and a
communications system including radar, radio, land lines and submarine cables for operational purposes in connection with the Flight Testing Range;
(c) to operate such vessels and aircraft as may be necessary for purposes connected directly with the operation of the Flight Testing Range.
(2) No wireless station, submarine cable, land line or other installation shall be established within the Range Area except at such place or places as may be agreed between the Contracting Governments, provided that such agreement shall not be required in respect of any wireless station, submarine cable, land line or other installation to be established within a Site.
(3) No wireless station shall be established or used in the Range Area otherwise than for the purpose of operating the Flight Testing Range.
(4) When submarine cables established in accordance with paragraph (1) of this Article are no longer required for the purposes of this Agreement, their disposal or further use shall be subject to consultation between the Contracting Governments and, in the absence of agreement, they shall be removed by and at the expense of the Government of the United States of America.
(5) The use of radio frequencies, powers and band widths, for radio services (including radar), under any of the provisions of this Agreement, shall be subject to the prior concurrence of the Senior Member of the British Armed Forces posted to the Bahamas Long Range Proving Ground.
(6) The Contracting Governments shall, in consultation with the Government of the Bahama Islands, take all reasonable precautions against possible danger and damage resulting from operations under this Agreement in the Flight Testing Range.
(7) The rights granted to the Government of the United States of America by this Article shall not be exercised unreasonably or so as to interfere with or to prejudice the safety of navigation, aviation or communication within the Flight Testing Range and the rights so granted shall be exercised in the spirit of the last paragraph of the Preamble.
**ARTICLE III**
**RIGHTS OF WAY**
The Government of the United Kingdom of Great Britain and Northern Ireland shall, after consultation with the Government of the Bahama Islands, provide to the Government of the United States of America such rights of way as may be agreed to be necessary for the operation of the Flight Testing Range.
ARTICLE IV
PROVISION OF SITES
(1) The Government of the United Kingdom shall, after consultation with the Government of the Bahama Islands, provide so long as this Agreement remains in force such Sites for the purpose of the operation of the Flight Testing Range as may be agreed between the Contracting Governments to be necessary for that purpose. When it is agreed between the Contracting Governments that any Site provided under this Article is no longer necessary for the purpose of the operation of the Flight Testing Range, the Government of the United Kingdom shall be entitled to cease to provide the Site for that purpose.
(2) Access to the Sites shall not be permitted to persons not officially connected with the Bahamas Long Range Proving Ground except with the consent of the Senior Member of the British Armed Forces posted to the Bahamas Long Range Proving Ground and the Senior Member of the United States Armed Forces detailed to the said Proving Ground.
ARTICLE V
JURISDICTION
(1) The Government of the United States of America shall have the right to exercise the following jurisdiction over offenses committed in the Bahama Islands:
(a) Where the accused is a member of the United States Forces,
(i) if a state of war exists, exclusive jurisdiction over all offenses wherever committed;
(ii) if a state of war does not exist, exclusive jurisdiction over security offenses wherever committed and United States interest offenses committed inside the Sites; concurrent jurisdiction over all other offenses wherever committed.
(b) Where the accused is a British national or a local alien and a civil court of the United States is sitting in the Bahama Islands, exclusive jurisdiction over security offenses committed inside the Sites.
(c) Where the accused is not a member of the United States Forces, a British national or a local alien, but is a person subject to United States military or naval law,
(i) if a state of war exists, exclusive jurisdiction over security offenses committed inside the Sites and United States interest offenses committed inside the Sites; concurrent jurisdiction over all other offenses wherever committed;
(ii) if a state of war does not exist and there is no civil
court of the United States sitting in the Bahama Islands, exclusive jurisdiction over security offenses which are not punishable under the law of the Bahama Islands; concurrent jurisdiction over all other offenses committed inside the Sites;
(iii) if a state of war does not exist and a civil court of the United States is sitting in the Bahama Islands, exclusive jurisdiction over security offenses committed inside the Sites; concurrent jurisdiction over all other offenses wherever committed.
(d) Where the accused is not a member of the United States Forces, a British national or a local alien, and is not a person subject to United States military or naval law, and a civil court of the United States is sitting in the Bahama Islands, exclusive jurisdiction over security offenses committed inside the Sites; concurrent jurisdiction over all other offenses committed inside the Sites and, if a state of war exists, over security offenses committed outside the Sites.
(2) Wherever, under paragraph (1) of this Article, the Government of the United States of America has the right to exercise exclusive jurisdiction over security offenses committed inside the Sites, such right shall extend to security offenses committed outside the Sites which are not punishable under the law of the Bahama Islands.
(3) In every case in which under this Article the Government of the United States of America has the right to exercise jurisdiction and the accused is a British national, a local alien or, being neither a British national nor a local alien, is not a person subject to United States military or naval law, such jurisdiction shall be exercisable only by a civil court of the United States sitting in the Bahama Islands.
(4) In every case in which under this Article the Government of the United States of America has the right to exercise exclusive jurisdiction, the following provisions shall have effect:
(a) The United States authorities shall inform the Government of the Bahama Islands as soon as is practicable whether or not they elect to exercise such jurisdiction over any alleged offenses which may be brought to their attention by the competent authorities of the Bahama Islands or in any other case in which the United States authorities are requested by the competent authorities of the Bahama Islands to furnish such information.
(b) If the United States authorities elect to exercise such jurisdiction, the accused shall be brought to trial accordingly, and the courts of the Bahama Islands shall not exercise jurisdiction except in aid of a court or authority of the United States, as required or permitted by the law of the Bahama Islands.
(c) If the United States authorities elect not to exercise such jurisdiction, and if it shall be agreed between the Government of the Bahama Islands and the United States authorities that the alleged offender shall be brought to trial, nothing in this Article shall affect the exercise of jurisdiction by the courts of the Bahama Islands in the case.
(5) In every case in which under this Article the Government of the United States of America has the right to exercise concurrent jurisdiction, the following provisions shall have effect:
(a) The case shall be tried by such court as may be arranged between the Government of the Bahama Islands and the United States authorities.
(b) Where an offense is within the jurisdiction of a civil court of the Bahama Islands and of a United States military or naval court, conviction or acquittal of the accused by one such court shall not exclude subsequent trial by the other, but in the event of such subsequent trial the court in awarding punishment shall have regard to any punishment awarded in the previous proceedings.
(c) Where the offense is within the jurisdiction of a civil court of the Bahama Islands and of a civil court of the United States, trial by one shall exclude trial by the other.
(6) Notwithstanding anything contained elsewhere in this Article, when a state of war exists in which the Government of the United Kingdom is, and the Government of the United States of America is not, engaged, then in any case in which the Government of the United States of America would, but for this paragraph, have exclusive jurisdiction, that jurisdiction shall be concurrent in respect of any of the following offenses against any part of His Majesty’s dominions committed outside the Sites or, if not punishable by the Government of the United States of America in the Bahama Islands, inside the Sites:
(a) treason;
(b) any offense of the nature of sabotage or espionage or against any law relating to official secrets;
(c) any other offense relating to operations in the Bahama Islands of the Government of any part of His Majesty’s dominions, or to the safety of His Majesty’s naval, military or air bases or establishments or any part thereof or of any equipment or other property of any such Government in the Bahama Islands.
(7) Nothing in this Article shall give the Government of the United States of America the right to exercise jurisdiction over a member of a United Kingdom, Dominion or Colonial armed force, except that, if a civil court of the United States is sitting in the
Bahama Islands and a state of war does not exist, or a state of war exists in which the Government of the United States of America is, and the Government of the United Kingdom is not, engaged, the Government of the United States of America shall have the right, where the accused is a member of any such force, to exercise concurrent jurisdiction over security offenses committed inside the Sites.
(8) Nothing in this Article shall affect the jurisdiction of a civil court of the Bahama Islands except as expressly provided in this Article.
(9) In this Article the following expressions shall have the meanings hereby assigned to them:
(a) "Security offense" means any of the following offenses against the Government of the United States of America and punishable under the law of the United States of America:
(i) treason;
(ii) any offense of the nature of sabotage or espionage or against any law relating to official secrets;
(iii) any other offense relating to operations, in the Bahama Islands, of the Government of the United States of America, or to the safety of any equipment or other property of the Government of the United States of America in the Bahama Islands.
(b) "State of war" means a state of actual hostilities in which either the Government of the United States of America or the Government of the United Kingdom is engaged and which has not been formally terminated, as by surrender.
(c) "United States interest offense" means an offense which (excluding the general interest of the Government of the Bahama Islands in the maintenance of law and order therein) is solely against the interests of the Government of the United States of America or against any person (not being a British national or local alien) or property (not being property of a British national or local alien) present in the Bahama Islands by reason only of service or employment in connection with the construction, maintenance, operation or defense of the Flight Testing Range.
ARTICLE VI
SECURITY LEGISLATION
The Government of the Bahama Islands will take such steps as may from time to time be agreed to be necessary with a view to the enactment of legislation to ensure the adequate security and protection of the Sites and United States equipment and other property, and the operations of the United States under this Agreement and the punishment of persons who may contravene any laws
or regulations made for that purpose. The Government of the Bahama Islands will also from time to time consult with the United States authorities in order that the laws and regulations of the United States of America and of the Bahama Islands in relation to such matters may, so far as circumstances permit, be similar in character.
**Article VII**
**Arrest and Service of Process**
(1) No arrest of a person who is a member of the United States Forces or who is a national of the United States subject to United States military law shall be made and no process, civil or criminal, shall be served on any such person within any Site except with the permission of the Commanding Officer in charge of the United States Forces in such Site; but should the Commanding Officer refuse to grant such permission he shall (except where, under Article V, jurisdiction is to be exercised by the United States or is not exercisable by the courts of the Bahama Islands) forthwith take the necessary steps to arrest the person charged and surrender him to the appropriate authority of the Bahama Islands or to serve such process, as the case may be, and to provide for the attendance of the server of such process before the appropriate court of the Bahama Islands or procure such server to make the necessary affidavit or declaration to prove such service.
(2) In cases where the courts of the United States have jurisdiction under Article V, the Government of the Bahama Islands will on request give reciprocal facilities as regards the service of process and the arrest and surrender of persons charged.
(3) In this Article the expression "process" includes any process by way of summons, subpoena, warrant, writ or other judicial document for securing the attendance of a witness, or for the production of any documents or exhibits, required in any proceedings, civil or criminal.
**Article VIII**
**Right of Audience for United States Counsel**
In cases in which a member of the United States Forces shall be a party to civil or criminal proceedings in any court of the Bahama Islands by reason of some alleged act or omission arising out of or in the course of his official duty, United States counsel (authorized to practice before the courts of the United States) shall have the right of audience, provided that such counsel is in the service of the Government of the United States of America
and appointed for that purpose either generally or specially by the appropriate authority.
**ARTICLE IX**
**SURRENDER OF PERSONS CHARGED**
Where a person charged with an offense which falls to be dealt with by the courts of the Bahama Islands is in a Site, or a person charged with an offense which falls under Article V to be dealt with by courts of the United States is in the Bahama Islands but outside the Sites, such person shall be surrendered to the Government of the Bahama Islands, or to the United States authorities, as the case may be, in accordance with special arrangements made between the Government and those authorities.
**ARTICLE X**
**PUBLIC SERVICES**
The Government of the United States of America shall have the right to employ and use all utilities, services and facilities, harbours, roads, highways, bridges, viaducts, canals and similar channels of transportation belonging to or controlled or regulated by the Government of the Bahama Islands or the Government of the United Kingdom on such conditions as shall be agreed between the Contracting Governments.
**ARTICLE XI**
**SHIPPING AND AVIATION**
(1) The Government of the United States of America may place or establish in the Sites and the territorial waters adjacent thereto, or in the vicinity thereof, lights and other aids to navigation of vessels and aircraft necessary for the operation of the Flight Testing Range. Such lights and other aids shall conform to the system in use in the Bahama Islands. The position, characteristics and any alterations thereof shall be determined in consultation with the appropriate authority in the Bahama Islands and the Senior Member of the British Armed Forces posted to the Bahamas Long Range Proving Ground.
(2) United States public vessels operated by the Army, Navy, Air Force, Coast Guard or the Coast and Geodetic Survey bound to or departing from a Site shall not be subject to compulsory pilotage in the Bahama Islands. If a pilot is taken pilotage shall be paid for at appropriate rates. Such United States public vessels shall have such exemption from light and harbor dues in the Bahama Islands as shall be agreed between the Contracting Governments.
(3) Commercial aircraft shall not be authorized to operate from any of the Sites (save in case of emergency or for strictly military purposes under supervision of the Army, Navy or Air Force Departments) except by agreement between the Government of the United States of America and the Government of the United Kingdom.
**ARTICLE XII**
**IMMIGRATION**
(1) The immigration laws of the Bahama Islands shall not operate or apply so as to prevent admission into the Bahama Islands, for the purposes of this Agreement, of any member of the United States Forces posted to a Site or any person (not being a national of a Power at war with His Majesty The King) employed by, or under a contract with, the Government of the United States of America in connection with the establishment, maintenance, or use of the Flight Testing Range; but suitable arrangements shall be made by the United States to enable such persons to be readily identified and their status to be established.
(2) If the status of any person within the Bahama Islands and admitted thereto under the foregoing paragraph shall be altered so that he would no longer be entitled to such admission, the United States authorities shall notify the Government of the Bahama Islands and shall, if such person be required to leave the Bahama Islands by that Government, be responsible for providing him with a passage from the Bahama Islands within a reasonable time, and shall in the meantime prevent his becoming a public responsibility of the Bahama Islands.
**ARTICLE XIII**
**MOTOR VEHICLE TAXES**
No tax or fee shall be payable in respect of registration or licensing for use in the Bahama Islands of motor vehicles belonging to the Government of the United States of America and used for purposes connected directly with the establishment, maintenance or use of the Flight Testing Range.
**ARTICLE XIV**
**CUSTOMS DUTIES AND OTHER TAXES ON GOODS**
(1) No import, excise, consumption or other tax, duty or impost shall be charged on:
(a) material, equipment, supplies or goods for use in the establishment, maintenance, or use of the Flight Testing Range
consigned to, or destined for, the United States authorities or a contractor;
(b) goods for use or consumption aboard United States public vessels or aircraft of the Army, Navy, Air Force, Coast Guard or Coast and Geodetic Survey;
(c) goods consigned to the United States authorities for the use of institutions under Government control known as Post Exchanges, Ships' Service Stores, Commissary Stores or Service Clubs, or for sale thereat to members of the United States Forces, or civilian employees of the United States being nationals of the United States and employed in connection with the Flight Testing Range, or members of their families resident with them and not engaged in any business or occupation in the Bahama Islands;
(d) the personal belongings or household effects of persons referred to in sub-paragraph (c) of this Article and of contractors and their employees being nationals of the United States employed in the establishment, maintenance, or use of the Flight Testing Range and present in the Bahama Islands by reason only of such employment.
(2) No export tax shall be charged on the material equipment, supplies or goods mentioned in paragraph (1) in the event of re-shipment from the Bahama Islands.
(3) This Article shall apply notwithstanding that the material, equipment, supplies or goods pass through other parts of the Bahama Islands enroute to or from a Site.
(4) Administrative measures shall be taken by the United States authorities to prevent the resale of goods which are sold under paragraph (1) (c), or imported under paragraph (1) (d) of this Article, to persons not entitled to buy goods at such Post Exchanges, Ships' Service Stores, Commissary Stores or Service Clubs, or not entitled to free importation under the said paragraph (1) (d); and generally to prevent abuse of the customs privileges granted under this Article. There shall be cooperation between such authorities and the Government of the Bahama Islands to this end.
(5) The understanding with respect to paragraph (1) (d) of Article XIV of the Agreement for the Use and Operation of Certain Bases, signed March 27, 1941\(^1\) embodied in the notes exchanged by the Contracting Governments at Washington on January 18, 1946 and February 21, 1946, the texts of which are annexed hereto,\(^2\) is hereby made applicable to this Article.
---
\(^1\) Executive Agreement Series 235; 55 Stat. 1560. [Not reprinted herein.]
\(^2\) Post, p. 17; printed also as Treaties and Other International Acts Series 1592; 61 Stat., Pt. 3, p. 2637. [Not reprinted herein.]
ARTICLE XV
TAXATION
(1) No member of the United States Forces or national of the United States, serving or employed in the Bahama Islands in connection with the establishment, maintenance or use of the Flight Testing Range, and residing in the Bahama Islands by reason only of such employment, or his wife or minor children, shall be liable to pay income tax in the Bahama Islands except in respect of income derived from the Bahama Islands.
(2) No such person shall be liable to pay in the Bahama Islands any poll tax or similar tax on his person, or any tax on ownership or use of property which is within a Site, or situated outside the Bahama Islands.
(3) No person ordinarily resident in the United States shall be liable to pay income tax in the Bahama Islands in respect of any profits derived under a contract made in the United States with the Government of the United States of America in connection with the establishment, maintenance or use of the Flight Testing Range, or any tax in the nature of a license in respect of any service or work for the Government of the United States of America in connection with the establishment, maintenance or use of the Flight Testing Range.
ARTICLE XVI
POSTAL FACILITIES
The Government of the United States of America shall have the right to establish United States Military Post Offices in the Sites for the exclusive use of the United States Forces, and civilian personnel (including contractors and their employees) who are nationals of the United States and employed in connection with the establishment, maintenance or use of the Flight Testing Range and the families of such persons, for domestic use between United States Military Post Offices in the Sites and between such Post Offices and other United States Post Offices and Post Offices in the Panama Canal Zone and the Philippine Islands.
ARTICLE XVII
HEALTH MEASURES IN THE VICINITY OF THE SITES
The Government of the United States of America shall have the right, in collaboration with the Government of the Bahama Islands, and, where necessary, with the local authority concerned, to exercise, without other consideration than adequate and effective compensation to be paid by the Government of the United
States of America to private owners or occupiers, if any, such powers as such Government and local authority may possess of entering upon any property in the vicinity of the Sites for the purpose of inspection, and of taking any necessary measures to improve sanitation and protect health.
**ARTICLE XVIII**
**REMOVAL OF PROPERTY**
(1) The title to any property placed on the Sites (including property affixed to the realty) and provided by the Government of the United States of America for the purposes of this Agreement, shall remain in the Government of the United States of America.
(2) At any time before the termination of this Agreement or within a reasonable time thereafter, such property may, at the discretion of the Government of the United States of America be
(a) relocated within the Sites, or
(b) removed therefrom, or
(c) disposed of while on a Site on the condition (unless otherwise agreed between the Government of the Bahama Islands and the United States authorities) that it shall forthwith be removed therefrom.
(3) Any ground from which such property is so removed, shall be restored, as far as possible, to its present condition by the Government of the United States of America.
(4) The Government of the United States of America will not, in the Bahama Islands, dispose of any such property
(a) without the consent of the Government of the Bahama Islands, or
(b) without offering the property for sale to that Government, if such offer is consistent with laws of the United States of America then in effect, or
(c) before the expiration of such period, not being less than 120 days after the date of such offer, as may be reasonable in the circumstances.
(5) Such property may be exported by the United States authorities free from any license, export tax, duty, or impost.
(6) Any such property not removed or disposed of as aforesaid within a reasonable time after the termination of this Agreement, shall become the property of the Government of the Bahama Islands.
**ARTICLE XIX**
**RIGHTS TO BE RESTRICTED TO THE PURPOSES OF THE AGREEMENT**
The Government of the United States of America shall not
exercise any rights granted by this Agreement, or permit the exercise thereof, except for the purposes specified in this Agreement.
**ARTICLE XX**
**RIGHTS NOT TO BE ASSIGNED**
The Government of the United States of America shall not assign or part with any of the rights granted by this Agreement.
**ARTICLE XXI**
**LIAISON**
The Senior Member of the British Armed Forces posted to the Bahamas Long Range Proving Ground and the Senior Member of the United States Armed Forces detailed to the said Proving Ground shall jointly decide the details of the execution of this Agreement in its application to specific situations, in the best interests of all concerned. The said Senior Member of the British Armed Forces shall be responsible for undertaking negotiations with the Government of the Bahama Islands in this connection.
**ARTICLE XXII**
**CLAIMS FOR COMPENSATION**
(1) The Government of the United States of America undertakes to pay adequate and effective compensation, which shall not be less than the sum payable under the laws of the Bahama Islands, and to indemnify the Governments of the United Kingdom and of the Bahama Islands and all other authorities, corporations and persons in respect of valid claims arising out of:
(a) the death or injury of any person, except persons employed by the Government of the United Kingdom in connection with the Bahamas Long Range Proving Ground, resulting from the establishment, maintenance or use by the Government of the United States of America of the Flight Testing Range;
(b) damage to property resulting from any action of the Government of the United States of America in connection with the establishment, maintenance or use of the Flight Testing Range;
(c) the acquisition of private property, or of rights affecting private property, to enable the Sites, or any rights of the Government of the United States of America under this Agreement, to be provided.
(2) Compensation payable under sub-paragraph (1)(c) of this Article shall be assessed in accordance with the laws of the Bahama Islands.
(3) For the purposes of this Article the laws of the Bahama Islands shall be the laws in force at the time of the signature of this Agreement, provided that any subsequent alteration of the said laws shall have effect if the Contracting Governments so agree.
**ARTICLE XXIII**
**FREEDOM FROM RENTS AND CHARGES**
Except as provided in Articles XVII and XXII the Sites shall be provided, and the rights of the Government of the United States of America under this Agreement shall be made available, free from all rent and charges to the Government of the United States of America.
**ARTICLE XXIV**
**MODIFICATION OF THE AGREEMENT**
Modification of this Agreement shall be considered by the Contracting Governments in the light of any modification of the Agreement between the Governments of the United States of America and the United Kingdom relating to the Bases leased to the United States of America dated the 27th March, 1941, which may be made under Article XXVIII of that Agreement.
**ARTICLE XXV**
**IMPLEMENTATION OF THE AGREEMENT**
(1) The Government of the United States of America and the Government of the Bahama Islands respectively will do all in their power to assist each other in giving full effect to the provisions of this Agreement according to its tenor and will take all appropriate steps to that end.
(2) During the period for which this Agreement remains in force, no laws of the Bahama Islands which would derogate from or prejudice any of the rights conferred on the Government of the United States of America by this Agreement shall be applicable within the Range Area, save with the concurrence of the Government of the United States.
**ARTICLE XXVI**
**FINAL PROVISIONS**
This Agreement shall come into force on the date of signature and shall continue in force for a period of twenty-five years and thereafter until one year from the day on which either Contracting Government shall give notice to the other of its intention to terminate the Agreement.
IN WITNESS WHEREOF the undersigned, being duty authorized thereto by their respective Governments, have signed this Agreement.
DONE in duplicate at Washington this 21st day of July, 1950.
[Signatures omitted.]
[Annex and attached map not reproduced.]
B. Danger Areas for Nuclear Weapons Tests
1. NOTE. Since 1946, several nuclear bomb test series have been conducted in the Pacific by the United States. The legal problems involved in establishing danger areas, which extend over large portions of the high seas, for these experiments, have caused considerable comment among some writers in the field of international law. McDougal and Schlei have argued persuasively that the tests are lawful and reasonable measures for national security in an article, "The Hydrogen Bomb Tests in Perspective: Lawful Measures for Security," 64 Yale Law Journal (1955), pp. 648–710. A condensed version by McDougal will be found in 49 AJIL 356 (1955). For an opposing view, see Margolis, "The Hydrogen Bomb Experiments and International Law," 64 Yale Law Journal (1955), pp. 629–647.
The nuclear testing areas in question have been established as danger areas, warning all vessels and aircraft to stay clear, but not prohibiting them from entering the hazard area. The danger areas have been promulgated internationally by the Notices to Mariners, which are published by the U.S. Navy Hydrographic Office under the authority of the Secretary of the Navy in accordance with Title 5 of the United States Code, Section 457.
The announcements as published in Notices to Mariners concerning all the tests in the Pacific have been essentially the same, except for the size of the area included in the danger zone. The excerpts reprinted below are taken from the Notices to Mariners, and relate to the latest hydrogen bomb test series conducted in the Pacific in May 1956.
2. Closed Areas Effective January 7, 1956
(29) NORTH PACIFIC OCEAN—Marshall Islands—Eniwetok and Bikini Atolls—Closed areas.—The following are closed areas and all vessels and aircraft are prohibited from entrance without specific clearance:
(a) The area of Eniwetok Atoll including the land areas of the atoll and the water areas of the lagoon within three (3) miles to the seaward side of the periphery of the land areas.
(b) The area of Bikini Atoll including the land areas of the atoll, the water areas of the lagoon and adjacent ocean waters within three (3) miles to the seaward side of the periphery of the land areas.
(N.M. 1, Jan. 7, 1956)
3. Danger Area Effective April 20, 1956.
*(1298) NORTH PACIFIC OCEAN—Marshall Islands—Eniwetok and Bikini Atolls—Danger Area—Information.—Effective April 20, 1956, a danger area, dangerous to all ships, aircraft and personnel entering its limits, is established. The danger area is bounded by a line joining the following positions:
(a) $18^\circ 30' \text{ N.}, 158^\circ 00' \text{ E.}$
(b) $18^\circ 30' \text{ N.}, 172^\circ 00' \text{ E.}$
(c) $11^\circ 30' \text{ N.}, 172^\circ 00' \text{ E.}$
(d) $11^\circ 30' \text{ N.}, 166^\circ 16' \text{ E.}$
(e) $10^\circ 15' \text{ N.}, 166^\circ 16' \text{ E.}$
(f) $10^\circ 15' \text{ N.}, 158^\circ 00' \text{ E.}$
Grave hazards, as a consequence of tests of military weapons, will exist in the area and all mariners and airmen are cautioned to keep clear.
All possible precautions will be taken to insure against the incidence of injuries to human life or to property within the area. It is not anticipated that there will be any such hazards outside the area. In the unlikely event that these test activities create such hazards outside the area, appropriate warning will be given.
(N.M. 11, Mar. 17, 1956)
(H.O. Doc. A5, Mar. 5, 1956)
H.O. Charts 5413, 5415, 5203, 0528, 5950, 5800, 5799, 5590.
H.O. Pub. 165A, 1952, page 247.
This same notice is repeated in Notices to Mariners Nos. 12–15 of 1956.
4. Discontinuance, August 25, 1956, of Danger Area
(4070) NORTH PACIFIC OCEAN—Marshall Islands—Eniwetok and Bikini Atolls—Danger area discontinued—Closed areas remain in effect.—1. The danger area, bounded by a line joining the following positions, has been discontinued:
(a) $18^\circ 30' \text{ N.}, 158^\circ 00' \text{ E.}$
(b) $18^\circ 30' \text{ N.}, 172^\circ 00' \text{ E.}$
(c) $11^\circ 30' \text{ N.}, 172^\circ 00' \text{ E.}$
(d) $11^\circ 30' \text{ N.}, 166^\circ 16' \text{ E.}$
(e) $10^\circ 15' \text{ N.}, 166^\circ 16' \text{ E.}$
(f) $10^\circ 15' \text{ N.}, 158^\circ 00' \text{ E.}$
(Supersedes N.M. 12 (1416) and 11 (1298) of 1956.)
* Indicates Notice to Mariners based on original information.
2. The closed areas around Eniwetok and Bikini Atolls remain in effect.
(See N.M. 1 (29) of 1956.)
(N.M. 34, Aug. 25, 1956.)
(Hydrolant 1252.)
H.O. Charts 5413, 5415, 5203, 0528, 5950, 5800, 5799, 5590.
H.O. Pub. 165A, 1952, page 247.
☆ U. S. GOVERNMENT PRINTING OFFICE: 1957—427712
|
<urn:uuid:e8ec53f3-4ed3-4aa0-99d6-af2a865d0562>
|
CC-MAIN-2019-35
|
https://digital-commons.usnwc.edu/cgi/viewcontent.cgi?article=2037&context=ils
|
2019-08-25T11:54:43Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027323328.16/warc/CC-MAIN-20190825105643-20190825131643-00137.warc.gz
| 433,039,531 | 9,147 |
eng_Latn
|
eng_Latn
| 0.933929 |
eng_Latn
| 0.988796 |
[
"eng_Latn",
"unknown",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"zsm_Latn"
] | true |
docling
|
[
316,
371,
418,
3372,
6368,
8426,
10821,
13050,
15719,
18273,
20671,
23067,
25265,
27391,
29966,
32198,
34347,
36418,
38414,
40928,
43018,
43306
] |
Steeple Barton Chase
Meeting Point (There will be signs from the main road.)
Barton Abbey Cricket Ground Steeple Barton OX25 4QS
From the main Oxford to Banbury road, A4260: Turn west at the traffic lights at Hopcroft's Holt onto the B4030, then take the first left (Pack Lane) signed to "St Mary's Church". Take the first driveway on the left, to the cricket ground & Barton Abbey. There is ample parking on site.
|
<urn:uuid:486d8aeb-2cc1-4c27-84e9-816e11ef8795>
|
CC-MAIN-2022-05
|
https://8ce45792-d316-46e5-87bc-82deb95632b6.filesusr.com/ugd/776924_4ed5ef58cf5a418eadb7004d7874f571.pdf?index=true
|
2022-01-16T09:42:29+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-05/subset=warc/part-00281-1e2959d8-5649-433a-b76e-f1b876a6479d.c000.gz.parquet
| 144,339,912 | 104 |
eng_Latn
|
eng_Latn
| 0.996843 |
eng_Latn
| 0.996843 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
417
] |
Powered by TCPDF (www.tcpdf.org)
Sealmaster BEARING LTD
Boston Gear 16P80D 5/8 Conveyor Roll End Bearings
Bearing No. 16P80D 5/8
Page 1/1
|
<urn:uuid:94b21fcc-0c63-419e-b9b6-07c8954ea251>
|
CC-MAIN-2021-04
|
https://world-artist.org/pdf/65041151-boston-gear-16p80d-5-8-conveyor-roll-end-bearings.pdf
|
2021-01-25T07:37:45+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00011-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet
| 633,195,797 | 52 |
eng_Latn
|
eng_Latn
| 0.452224 |
eng_Latn
| 0.452224 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
141
] |
Unlock strategic value
Through education
Introducing Sustainability Unlocked
The world’s first sustainability education platform, ready to be deployed at scale
- **Expert-led**
Delivered by >100 world-leading policy makers, climate scientists and sustainability leaders
- **Scalable solution**
On-demand platform delivery, integratable into your existing learning architecture with bite sized content
- **Accredited, endorsed and comprehensive**
More than 1,000 learning opportunities. Continuously updated
- **Consultative content planning and curation**
Experts on hand to curate learning journeys. Content creation that is responsive to customer needs
Trusted by AIRBUS, LLOYDS BANK, Sage, ABN AMRO
Play demo video
Mixed Modalities of Learning
Built to meet the needs of time-pressed professionals
Video modules
Expert-delivered bite-sized videos on individual topics. 10-minutes on average
Pathways
Curated video courses, led by one or more industry experts covering fundamental concepts. Tested and certified, 1 hour on average
Certificate programs
Longer format learning providing in-depth knowledge around a subject area aligned to industry and role profiles. 20 hours on average
Insights
Industry-related news, key learning and concepts
## Comprehensive covering sustainability topics for all staff
**Constantly reviewed, updated and expanded**
| Climate & Biodiversity | Corporate Governance | ESG Financial Markets | Net Zero Innovation | Sector Transition | Social Responsibility | Sustainable Workplace | Targets & Disclosure |
|------------------------|----------------------|----------------------|--------------------|------------------|----------------------|-----------------------|---------------------|
| Carbon Tax and Regulation | Assessing Culture and Behaviours in an Organisation | Finance ESG in the CLO Context | Introduction to Energy Storage Technology | Limitations of ESG Integration | Mitigating UK Regional Inequality | Sustainably Managing Remote Working Teams I | Demystifying Sustainability Labels |
| Central Bank Climate Stress Tests | Organisation Conduct and Culture Framework | ESG Loans | Introduction to Solar Energy | Value of ESG Integration | Social Impact Investment & Social Lending | The FEAST Framework I | ESG Investment Data |
| Central Banks and Climate Risk Management | Control the Controllables | Green Bond Markets | Introduction to Wind Energy | Wholesale Banking and the Green Economy | The Foundations of Active Listening | The FEAST Framework II | EU’s Path to a Standardised Sustainability Definition |
| Climate Policy Intervention | Culture Change Tools and Techniques I | Green Bonds | Introduction to Renewable Energy | Achieving the Net Zero Pledge | UK Regional Inequality | The Four Phases of a Human Cycle | Global Sustainable Finance Initiatives I |
| Integrated Assessment Models I | Defining the Firm’s Purpose for Culture | Green Covered Bonds | The Drivers of Widespread Renewable Energy Adoption | Application of GEOVOL and RISK to Climate Policy | Combating Wealth Inequality | The Importance of Listening in Leadership and Sales | Real Life Examples of Greenwashing |
| Introduction to Climate Change | Derivative Risks | Green Finance Introduction | The Historic Underestimation of Renewable Generation | Assessing Environmental Investment Risks and Opportunities | Executing Change in the Hospitality Sector | What is Behavioural Science? | Sustainability Supply Chain Data |
| 1.5°C vs 2°C Global Warming | Enhancing ESG for Strategic Success | Incremental Value of Social Bonds | Implementation Demand-Side Energy Solutions | Assessing Governance Investment Risks and Opportunities | Global Initiatives to Enhance Supply Chain Sustainability | What is Listening? | The Need for One Standardised Sustainability Definition |
| 5 Ways We Can Reduce Our Carbon Footprint | Error Management II | Measuring Social Bond Impact | Introduction to Demand-side Energy Solutions | Hospitality Case Study | Introduction to Sustainable Supply Chains (Danale) | Why Stress is the Enemy of Productivity? | The Role of Stakeholders to Minimise Greenwashing |
| A Closer Look at Climate Modes | Establishing a Risk Appetite Framework for Corporate Governance | Second-Party ESG Debt Opinions | Introduction to Green Buildings | Impact of Wealth Inequality on Sustainability | Introduction to Sustainable Supply Chains (Danale) | Working Remotely in a Sustainable Way I | What is Greenwashing? |
| A Closer Look at Scope 3 Emissions | Social Bond Principles | Social Bonds History & Market Today | Introduction to Hydrogen as an Energy Source | Introduction to Sustainable Supply Chains | Measuring Social Impact and a Social Impact Fund Case Study | Working Remotely in a Sustainable Way II | Asia Sustainable Finance Update Dec 2021 |
| Assessing Climate Crisis Solutions | Social Bond Principles | Bank Climate Risk Management I | Introduction to Solar Thermal Energy | Building Trust With an Authentic Voice | Overconsumption and Environmental Footprints | 10 Simple Ways to Live More Sustainably | Being a b Corp |
| Assessing Net Zero Targets | Bank Climate Risk Management II | Bank Climate Risk Management I | Introduction to Wave | Common Life Cycle of Glass Bottles | Social Inequalities Caused by the COVID-19 | A framework for clear communication | Benefits of an Ecosocile Law |
| Blue Financing and Ocean-based Solutions | Bankability of a Renewable Energy Project | Bringing the Gaps in Climate Policy Essentials | | | | Navigating EU Disclosure & Reporting Initiatives | Navigating UN Disclosure & Reporting Initiatives |
| Carbon Markets and Markets Jargon Buster | | | | | | | |
|
9565fa69-27b3-4014-89c6-a23f18a305ca
|
CC-MAIN-2024-30
|
https://cdn.asp.events/CLIENT_Innovati_94A26F7C_B3C0_752F_CC179EFAFD17992A/sites/Innovation-Zero-2023/media/libraries/exhibitor-brochures/9104-Sustainability-Unlocked_-3-pages-Apr24-.pdf
|
2024-07-12T19:55:44+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-30/subset=warc/part-00138-65338ae2-db7f-48fa-a620-71777c40d854.c000.gz.parquet
| 125,038,867 | 1,102 |
eng_Latn
|
eng_Latn
| 0.988403 |
eng_Latn
| 0.987896 |
[
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
41,
734,
1267,
5684
] |
OnlineOpenAthensRegistration
NICE have redevelopedtheir online registration form and self‐administration site. The registration form has been designedto be intuitive and to guide users through the registration process, it is notanticipatedthat new users registering for theNHS OpenAthensservice will require assistance or guides over and above those provided on the registration site.
This is the registration formhomepage. All the data capture steps are now on the same page.
Users are presented with a message up front that they should use a work email address and register from their place of work to ensure their registration is automatically approved, otherwise their registration will require approval by an OpenAthens administration.
Users are given instructions in how to use the type ahead function, and prompted at the bottom of the type ahead list to refine their search if they don't find what they are looking for (the maximum number of type ahead suggestions is 10).
In the event a user selects a temporary position a new box will be displayed to capture their contract expiry date.
Student accounts will automatically be set to expire after 6 months.
Should a user complete the registration form and the organisation they input is not recognised, they will be returned to the organisation box where an explanatory text is displayed asking them to select the county their organisation is based in (this field was not previously displayed)
If the user attempts to submit a registration and they have not completed all the fields then they will be presented with a message indicating how many issues need addressing and any boxes that require data will be highlighted in red.
Users must accept the terms and conditions.
After submitting the form, users are taken to this page which tells them what to do next, summarises their account details, and provides the name of their administrator. Ineligible users will see a slightly different message shown next:
If the details entered do not meet the eligibility criteria then the user will be shown this screen.
10.
When they click the link in the activation email, users are taken back to the form to enter their chosen password and activate their account.
|
<urn:uuid:e5dccc10-ce99-458b-8e86-f1647f6a900d>
|
CC-MAIN-2021-43
|
https://www.iow.nhs.uk/Downloads/Education%20Centre/Library/Information%20sheets/New%20online-registration%20-%202015.pdf
|
2021-10-23T20:46:18+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-43/subset=warc/part-00059-16202947-a809-4711-8221-79ab0a79d5b1.c000.gz.parquet
| 974,001,207 | 719 |
eng_Latn
|
eng_Latn
| 0.998125 |
eng_Latn
| 0.998868 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
385,
478,
743,
984,
1171,
1459,
1695,
1740,
1978,
2080,
2228
] |
Agenda items:
1. COVID-19 Safety Measures – same as fall 2020
a. COVID-19 – player tested positive, team was shut down for a week.
b. Coaches must wear masks on the sidelines like last year
c. If you have a players or team sitting out for COVID 19, notify the LCSL board immediately, especially if you have played a game and another community or Ref could be involved.
d. If a coach or player comes in contact with a positive COVID-19, must wait 10 day and be symptom free before returning
i.
If the positive COVID case did play with the team, the whole team will need to sit out for 10 days
e. Sideline Benches – Okay to use
f. When possible and field location allows, each team/community on opposite sides of the field – Keep players/coach on one half of their sideline and spectators on the other half. Can go around the corner but not next to or behind the goal.
i. When there is only one side of the field, see home coach for determination of how to handle.
ii. Lagrange – Suggested using signed at the fields, "HOME TEAM" and "GUEST TEAM" to identify. Coaches carry them and they put them in the ground when they have games to identify.
g. Spectators should be 10 feet from the sideline or as far back as field location allows.
h. Coaches cannot go on the field during the game unless a player is hurt and the ref allows you onto the field.
2. Classic –
a. Location – Bryan had conversation with Oberlin, waiting on the city's okay. No final word yet.
i. Midview and Amherst has offered to host as a back up
b. Fee - $5.00 per player, that shows up and plays at the classic
c. Trophies – Paul will order sooner than later
3. Debbie is stepping down at the end of spring season. If you are interested let Paul know. This is not a paid position.
4. U7 – 4 ten minutes quarters, U8 – 2 twenty minutes halves
5. In October or November we can modify the by laws – Update to identify we are a Saturday league
6. Schedule changes submitted after 6PM on April 18 th , $25.00 late fee will apply. Must be done 5 days prior to the originally scheduled game day. This allows time for the board and Joe to make the changes necessary.
a. School functions, death in family, COVID related cancellation will be $0 fee
b. COVID related cancellations can be day of.
7. Elyria – Field's address - 1200 Foster Avenue Elyria, OH 44035
8. Remind coaches, players and spectators not to argue or yell at referees.
Updates:
President – Paul
o Once team commitments are made and schedule is posted. The goal is to allow 4/4/21-4/18/21 for game changes without a fee.
Vice President – Bryan
o Spoke with the city of Oberlin regarding permission to have spring classic. Waiting on the city's determination
Treasurer – Debbie Radar (not in attendance)
o Team Commitments – pay asap if you have not
o Will be stepping down after Spring 2021 season – Anyone interested please let Paul, Bryan, Debbie or Rachel know.
o Coach/Player fee - $11 per player and $11 per coach, pay now. DO NOT wait for an invoice
o Amherst requests an itemization
o Amherst owes for Fall 2020 and Spring 2021
o Fees/Money owed can be mailed to:
**Team commitment fees (calculated at the bottom of the spreadsheet), per player, per coach fee should be paid immediately, if you have not done so already.**
Debbie Radar 437 Olivet Drive Elyria, OH 44035
Registrar – Heidi
o Tuesday the 20 th by noon for players to be active for first games on April 24 th
o Last day to add players / coaches Wednesday, May 12, 2021.
o Demosphere – New system. Possible option to stay with affinity/sports connect.
o Reminder - *Only 2 club players per team*
o Bernie is the contact at Ohio Soccer
o Pictures and Birth Certs required for ALL county players
o In the fall 2021 – Will be considered rec soccer, our per player fee will go down and have no coaches fee
Scheduler – Paul
o Many double coaches, even some with 3 teams!
o 111 teams!!
o U7 and U8 start early
o Games should be completed by 5 pm on Saturdays
o Manually completed U11, U12, and U13
o Game changes during the season (after the 18 th ), $25.00 each game change unless it is a COVID, weather or school related issues.
Secretary – Rachel
o Each community should check their contact page and send an email to the above address if there is any information that needs updated or added.
Next meeting Wednesday May 4, 2021 8pm at zoom
Motion to adjourn Jackie,. Second by Laura.
|
<urn:uuid:56b85215-8739-4d41-a64f-af1b9b10aa97>
|
CC-MAIN-2021-21
|
https://www.quickscores.com/downloads/loraincountysoccer_LCSL_April_2021_Meeting_Minutes.pdf
|
2021-05-18T23:49:16+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-21/subset=warc/part-00147-2bb1ba05-1421-4b90-a3f4-bbc46b4a29a5.c000.gz.parquet
| 1,018,654,987 | 1,085 |
eng_Latn
|
eng_Latn
| 0.98359 |
eng_Latn
| 0.995654 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2214,
4398
] |
Research Assistant Position in Isotope Geochemistry
The Isotope Geochemistry Group, University of Tübingen, Germany, seeks motivated applicants for a post-doctoral research assistant position (100%) in Isotope Geochemistry for 3 years with a possible extension for another 3 years upon positive evaluation.
The potential candidate should hold a PhD degree in Geosciences or a related field and be experienced with non-traditional stable isotope systematics (e.g. Cr, Fe, Zn, Se, Mo etc.) either for low- or high-temperature applications. Experience with quadrupole ICP-MS (solution and/or laser ablation) or TIMS is regarded beneficial, but not conditional. Fluency in both written and spoken English is a prerequisite and experience with writing and publishing scientific results in internationally recognized peer-reviewed journals is requested.
We seek a motivated scientist who wants to establish a strong and competitive research profile within the isotope geochemical community. The candidate will be given every support to pursue his/her own scientific projects. This position enables application of own research funding with the German Research Council (Deutsche Forschungsgemeinschaft - DFG) and supervision of PhD students. Partaking in the diverse scientific projects of the Isotope Geochemistry Group in Tübingen, ranging from the evolution of oxygen in Earth's early atmosphere and oceans to investigating the formation of PGE ores in layered intrusions, is welcome.
The Isotope Geochemistry Group chaired by Prof. Ronny Schoenberg hosts new state-of-the-art clean laboratories and analytical instruments including a quadrupole ICP-MS, a Resonetics Resolution M-50 excimer laser system and a Thermo Scientific NeptunePlus MC-ICPMS mainly used for non-traditional stable isotope analyses. The Isotope Geochemistry Group also maintains gas-IR-mass spectrometers for H-C-O-S stable isotope analyses and a newly upgraded solid source thermal ionization mass spectrometer for radiogenic Sr and Nd isotope analyses and an X-ray fluorescence spectrometer for major element determinations. Instrument maintenance is mainly organized by technical personnel. The Department of Geosciences further houses a JEOL 8900 electron microprobe, Raman and IR spectroscopy, and XRD instruments for sample characterization.
The position commences earliest on September 1 st 2018 and is initially filled for 3 years with a possible extension for another 3 years upon successful performance evaluation. Salary and benefits are commensurate with the German employee scale TV-L E13-100% (see link http://oeffentlicherdienst.info/tv-l/west/). As the University of Tübingen intends to increase the proportion of female employees in science, women are particularly encouraged to apply. In case of equal qualification and experience physically challenged applicants are given preference.
Interested candidates should send a detailed CV with a list of publications, copies of certificates, statement of research interests and contact details of 2 potential referees as well as a motivation letter for this position including research goals for the next 5 years to the E-Mail address given below. Application reviewing starts on April 10 th 2018 and continues until the position is filled.
Prof. Dr. R. Schönberg Chair of Isotope Geochemistry University of Tübingen Wilhelmstraße 56 D-72074 Tuebingen
Phone: +49 7071 29-78903
E-mail: [email protected]
|
<urn:uuid:f2332567-2d80-4e6c-bd0f-02ec643d96ce>
|
CC-MAIN-2018-26
|
http://www.eag.eu.com/jobs/d29148240952a8a7151a0a253f989266.pdf
|
2018-06-20T05:08:55Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267863463.3/warc/CC-MAIN-20180620050428-20180620070428-00494.warc.gz
| 396,970,838 | 712 |
eng_Latn
|
eng_Latn
| 0.988342 |
eng_Latn
| 0.988342 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
3456
] |
Statement in support of SB 330
Bill Stevenson
4792 N. Amherst St.
Portland OR 97203
Mr. Chairman and members of the committee. My wife and I own a small apartment in north Portland and have been providing affordable housing long before that term became the major issue that it is today. We have never evicted anyone and understand the need during this pandemic for eviction moratoriums. However, they do represent a taking by government. As such the government has a responsibility and obligation to pay for the losses it has caused as a result.
The landlord compensation fund, hereafter referred to as the LCF, enacted during the recent special session, is inadequate to its stated purpose. It is insufficiently funded, and continues to allow a 20% taking—and more by excluding utility costs—without compensation. It is a complicated system to navigate for many small operators who are not tech savvy and provides no alternative way for such individuals to apply.
SB 330 is a superior vehicle to address the issue. It solves a tenant’s problem and provides a means to compensate landlords for the losses caused by the government’s actions. However, it does appear to need either amendment or clarification on two points.
First, the “emergency period” is referred to as from April1, 2020 to December 31, 2020. The means to compensate landlords appears limited to that time period. As I understand it, the moratorium extends to July 1, 2021. What about the six month period from January 1, 2021 to July 1, 2021? How will landlords be compensated for that time period? The bill needs to include this time span as well.
Second, it seems advisable to not have a termination date for the legislation be at the end of the fifth year in case any given taxpayer based on the tax amount they owe in a given year or years was unable to fully recover their loss. This would perhaps best apply particularly to small operators.
As a former member of both the House and Senate, serving in the positions now held by Speaker Kotek and Senator Frederick respectively, and as a former Oregon Labor Commissioner, I understand your roles in making best public policy judgments among often competing interests. SB 330 is a measure that will allow you to do that. I urge its support and passage. Thank you.
|
<urn:uuid:bd054ce6-b4e9-4c86-9ecb-88bc796e81d5>
|
CC-MAIN-2024-22
|
https://olis.oregonlegislature.gov/liz/2021R1/Downloads/PublicTestimonyDocument/9158
|
2024-05-23T17:51:24+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-22/subset=warc/part-00293-4dd72944-e9c0-41a1-9026-dfd2d0615bf2.c000.gz.parquet
| 386,661,260 | 477 |
eng_Latn
|
eng_Latn
| 0.999217 |
eng_Latn
| 0.999217 |
[
"eng_Latn"
] | false |
docling
|
[
2291
] |
WORCESTER TOWNSHIP
BOARD OF SUPERVISORS
MONTGOMERY COUNTY, COMMONWEALTH OF PENNSYLVANIA
RESOLUTION NO. 2013-17
TCC Delegate Appointment Resolution
Background. Act 32 § 505 (b) requires the governing bodies of school districts, townships, boroughs, and cities that impose an earned income tax to appoint one voting delegate and one or more alternate delegates to be their Tax Collection Committee (TCC) representatives. The purpose of this resolution is to appoint the required delegates. The appointed individuals have consented to appointment.
RESOLVED, by the Board of Supervisors of Worcester Township, Montgomery County, Pennsylvania that the following individual is/are appointed as TCC delegates for Worcester Township, Montgomery County, Pennsylvania.
1. Delegate: Stuart Whiteleather
2. First Alternate Voting Delegate: F. Lee Mangan
3. Second Alternate Voting Delegate: Eunice C. Kriebel
If the primary voting delegate cannot be present for a TCC meeting, the first alternate voting delegate shall be the representative at the TCC meeting. If both the primary voting delegate and the first alternate voting delegate cannot be present for a TCC meeting, the second alternate voting delegate shall be the representative at the TCC meeting.
These appointments are effective immediately and shall continue until successors are appointed. Delegates shall be appointed each year in November or December or as soon thereafter as possible. All delegates shall serve at the pleasure of this governing body and may be removed at any time.
Certification of adoption. The undersigned certifies that the above Resolution was adopted at a public meeting on this date.
Be It Resolved This 20th Day of February, 2013.
WORCESTER TOWNSHIP
By: ____________________________
Arthur C. Bustard, Chairman,
Board of Supervisors
Attest: ____________________________
F. Lee Mangan, Secretary
|
<urn:uuid:807bb692-aafe-4634-92a6-205a510d5388>
|
CC-MAIN-2018-09
|
http://worcestertwp.com/images/PDF/resolutions/2013/Resolutions-2013-17.pdf
|
2018-02-21T11:31:31Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891813608.70/warc/CC-MAIN-20180221103712-20180221123712-00022.warc.gz
| 385,269,125 | 399 |
eng_Latn
|
eng_Latn
| 0.995477 |
eng_Latn
| 0.995477 |
[
"eng_Latn"
] | false |
docling
|
[
1888
] |
Characterization of a *Pseudomonas aeruginosa* Fatty Acid Biosynthetic Gene Cluster: Purification of Acyl Carrier Protein (ACP) and Malonyl-Coenzyme A:ACP Transacylase (FabD)
ALECKSANDR J. KUTCHMA,† TUNG T. HOANG, AND HERBERT P. SCHWEIZER*
Department of Microbiology, Colorado State University, Fort Collins, Colorado 80523
Received 8 April 1999/Accepted 14 June 1999
A DNA fragment containing the *Pseudomonas aeruginosa* fabD (encoding malonyl-coenzyme A [CoA]:acyl carrier protein [ACP] transacylase), fabG (encoding β-ketoacyl-ACP reductase), acpP (encoding ACP), and fabF (encoding β-ketoacyl-ACP synthase II) genes was cloned and sequenced. This fab gene cluster is delimited by the plsX (encoding a poorly understood enzyme of phospholipid metabolism) and pabC (encoding 4-amino-4-deoxychorismate lyase) genes; the fabF and pabC genes seem to be translationally coupled. The fabH gene (encoding β-ketoacyl-ACP synthase III), which in most gram-negative bacteria is located between plsX and fabD, is absent from this gene cluster. A chromosomal temperature-sensitive fabD mutant was obtained by site-directed mutagenesis that resulted in a W258Q change. A chromosomal fabF insertion mutant was generated, and the resulting mutant strain contained substantially reduced levels of cis-vaccenic acid. Multiple attempts aimed at disruption of the chromosomal fabG gene were unsuccessful. We purified FabD as a hexahistidine fusion protein (H₆-FabD) and ACP in its native form via an ACP-intein-chitin binding domain fusion protein, using a novel expression and purification scheme that should be applicable to ACP from other bacteria. Matrix-assisted laser desorption–ionization spectroscopy, native polyacrylamide electrophoresis, and amino-terminal sequencing revealed that (i) most of the purified ACP was properly modified with its 4'-phosphopantetheine functional group, (ii) it was not acylated, and (iii) the amino-terminal methionine was removed. In an *in vitro* system, purified ACP functioned as acyl acceptor and H₆-FabD exhibited malonyl-CoA:ACP transacylase activity.
Fatty acid biosynthesis in eukaryotes is catalyzed by a multienzyme complex encoded by a single gene and known as the type I system. In contrast, eubacteria contain a type II or dissociated Fab (fatty acid biosynthesis) system, where the reactions are carried out by proteins encoded by multiple genes (for a review, see reference 6). Bacterial fatty acid biosynthesis necessitates a three-carbon precursor, malonyl-coenzyme A (CoA), which is derived from acetyl-CoA by the action of acetyl-CoA carboxylase. The malonyl-CoA is transferred to the acyl carrier protein (ACP) by malonyl-CoA:ACP acyltransferase (FabD). Fatty acid elongation involves four reactions: (i) a condensation reaction catalyzed by one of three β-ketoacyl-ACP synthases, FabB, FabF, or FabH; (ii) a reduction involving a NADPH-dependent β-ketoacyl-ACP reductase (FabG); (iii) a dehydration reaction catalyzed by either FabA or FabZ, both of which are β-hydroxyacyl-ACP dehydratases with broad, overlapping chain length specificities (15); and (iv) a second reduction reaction catalyzed by NADH-dependent enoyl-ACP reductase (FabI).
In *Escherichia coli* (28) and other bacteria (9, 25, 38), the genes acpP, fabD, fabF, fabG, and fabH, encoding ACP, FabD, FabF, FabG, and FabH, respectively, are contained in a fab gene cluster. In *Bacillus subtilis*, fabH is not part of the major fab gene cluster (25).
Besides the role of ACP in phospholipid (6) and rhamnolipid (3, 27) synthesis, ACPs play central roles in a broad range of other biosynthetic pathways that depend on acyl transfer reactions, including polyketide (35), nonribosomal peptide (1), and depsipeptide biosynthesis (31), as well as in the transacylation of oligosaccharides (8, 11) and proteins (22). More recently, acyl-ACPs derived from the Fab pathway have been proposed to be the acyl donors for synthesis of acylated homoserine lactones (AHLs) (26, 32, 40). The AHLs (or autoinducers) have received considerable attention in recent years since they are required for a regulatory phenomenon termed quorum sensing (10). Characterization of the two known AHL-producing systems of *Pseudomonas aeruginosa*, *rhl* and *las*, has shown that the respective autoinducers, N-butyryl homoserine lactone (C₄-HSL) and N-(3-oxo)-dodecanoyl homoserine lactone (3-oxo-C₁₂-HSL), are required for expression of a multitude of virulence factors and secondary metabolites (41).
We recently began characterization of the unique aspects of the *P. aeruginosa* Fab system (20), and in this report we describe the characterization of the *P. aeruginosa* fabD-fabG-acpP-fabF gene cluster, as well as the purification and characterization of FabD and ACP.
**Cloning and characterization of the acpP-containing region.** When we initiated these experiments, the sequence of only a fragmented acpP-containing region was available from the *P. aeruginosa* genome database, and it contained no intact acpP gene. This acpP-containing gene cluster was cloned into M13,
### TABLE 1. Strains, plasmids, and primers used in this study
| Strain, plasmid, or primer | Relevant properties or sequence<sup>a</sup> | Reference or origin |
|---------------------------|---------------------------------------------|---------------------|
| **E. coli** | | |
| BL21(DE3) | *E. coli* B; F<sup>−</sup> ompT r<sub>B</sub><sup>−</sup> m<sub>B</sub><sup>−</sup> (λDE3) | 37 |
| SA1503(DE3) | lon-100 his-87 ompT::Km<sup>r</sup> relA1 rpsL781 spoT1 thi-1 (λDE3) | 19a |
| **P. aeruginosa** | | |
| PAO1 | Prototroph | B. H. Holloway |
| PAO198 | PAO1 with fabF::Gm<sup>r</sup> | This study |
| PAO204 | PAO1 with fabD(Ts) | This study |
| **Plasmids** | | |
| pEX100T | Ap<sup>r</sup> sacB<sup>−</sup>; gene replacement vector | 34 |
| pUCGM | Ap<sup>r</sup> Gm<sup>r</sup>; source of Gm<sup>r</sup> cassette | 33 |
| pWSK29 and pWKS30 | Ap<sup>r</sup>; low-copy-number cloning and T7 expression vectors | 44 |
| pCYB1 | Ap<sup>r</sup>; intein-chitin binding domain expression vector | New England Biolabs |
| pET-15b | Ap<sup>r</sup>; hexahistidine fusion and expression vector | Novagen |
| pGEM-T | Ap<sup>r</sup>; TA-cloning vector | Promega |
| pNam | Ap<sup>r</sup>; low-copy-number intein-chitin binding domain expression vector | 19a |
| pT7-7 | Ap<sup>r</sup>; T7 promoter expression vector | 39 |
| pPS671 | Ap<sup>r</sup> fabB<sup>+</sup> pabC<sup>+</sup> (ligation of chromosomal 4-kb EcoRI-HindIII fragment between the same sites of pWSK29) | This study |
| pPS681 | Ap<sup>r</sup> fabB<sup>+</sup> fabG<sup>+</sup> acpP<sup>+</sup> fabF<sup>+</sup> pabC<sup>+</sup> (ligation of 3.4-kb BamHI-EcoRV fragment from pPS840 between the BamHI and XbaI [blunt-ended] sites of pPS671) | This study |
| pPS831 | Ap<sup>r</sup>; PCR-amplified 147-bp genomic segment from PAO1 cloned into pGEM-T | This study |
| pPS840 | Ap<sup>r</sup> fabB<sup>+</sup> fabG<sup>+</sup> acpP<sup>+</sup> (3.7-kb chromosomal EcoRV-BamHI fragment cloned between the same sites of pWSK29) | This study |
| pPS966 | Ap<sup>r</sup>; ligation of 1.8-kb NdeI-PstI fragment from pPS981 between the same sites of pT7-7 | This study |
| pPS981 | Ap<sup>r</sup> acpP<sup>−</sup>; ligation of NdeI-SapI-digested PCR fragment between the same sites of pCYB1 | This study |
| pPS1096 | Ap<sup>r</sup> acpP<sup>+</sup> (ligation of 735-bp HindIII-XbaI fragment from pPS966 between the same sites of pNam) | This study |
| **Primers** | | |
| ACP1 | ATCGAGGGAGCG(A/C/T/G)GT(G/C)AAGAAAGAT(A/C)AT | |
| ACP2 | GTCGAACTCCCTC(G/C)TC(A/C/T/G)AG(G/C)GCAT | |
| FabD1 | TGGATGTCTCTCCACCGCGGACCCGGGGCTGT | |
| ACP-Nde | NdeI-TGAAAAACAACATagAGCACCATCGAAGAACCGCGTT | |
| ACP-Sap | SapI-ATCCGGCTCTTCCCCTGCAattgCTGGGGAGC | |
| FabD-Nde | NdeI-GGGACCTATcatATGTCTGCATCCCTCCGCAATTTCGTC | |
| FabD-Bam | BamHI-CCCCGAtCCCCAGTTCCAGCGCAATCGCC | |
<sup>a</sup> Primer sequences are printed 5′ to 3′; lowercase letters indicate nonmatching oligonucleotides used to either form the indicated motif as underlined or introduce other nonmotif changes indicated in lowercase letters.
which led to expression of toxic levels of apo-ACP. Previous attempts to clone intact *acpP* from *E. coli* (42), as well from a number of other bacteria (25, 36), into multicopy plasmids were hampered by the toxic effects of overexpressed apo-ACP (23). We therefore chose to reclone the chromosomal *acpP*-containing region into the low copy-number pWSK vectors (typically exhibiting only five to eight copies per cell [44]). A 147-bp sequence containing a partial *acpP* coding sequence was PCR amplified from *P. aeruginosa* chromosomal DNA by using the two primers ACP1 and ACP2 (Table 1). These partially degenerate primers were modeled after conserved amino acid sequence regions found in the *E. coli*, *Haemophilus influenzae* and *Vibrio harveyi* ACP homologs. PCR was performed on a PTC-100 PCR system thermocycler (MJ Research, Watertown, Mass.), using *Taq* polymerase from Qiagen (Santa Clarita, Calif.) and previously described conditions (19). The PCR fragment was cloned into pGEM-T (Promega, Madison, Wis.) to form pPS831. Nucleotide sequence analysis revealed the presence of a partial *acpP* gene on the PCR fragment. This fragment was used as a probe to generate a partial restriction map of the PAO1 chromosomal *acpP* region, which revealed a 3.4-kb EcoRV-BamHI fragment which was cloned into the low-copy-number cloning vector pWKS30 by using previously described strategies (17, 20), yielding pPS840 (Fig. 1A).
The entire nucleotide sequence of both strands of a 3,433-bp chromosomal EcoRV-BamHI fragment was determined (relevant segments of the sequence are shown in Fig. 1B). BLAST searches revealed the presence of the 3′ end of *plsX*, complete sequences of *fabD*, *fabG*, and *acpP*, and the 5′ end of *fabF* (Fig. 1A). To obtain the 3′ end of *fabF*, a 1.1-kb BamHI-EcoRI fragment from pPS840 was used as a probe to identify a ~4-kb EcoRI-HindIII fragment, which was cloned into pWSK29 to generate pPS671 (Fig. 1A).
Sequence analyses of pPS671 and several subclones derived from it established the entire sequence of both strands from the BamHI site within *fabF* to the SalI site immediately downstream of *fabF* (Fig. 1A). The *fab* gene cluster contains *fabF*, *acpP*, *fabG*, and *fabD* but not *fabH*. Many bacteria, i.e., *B. subtilis* (25), *V. harveyi* (36), *H. influenzae* (9), and *Streptomyces glaucescens* (38), contain similarly organized *fab* gene clusters, but *P. aeruginosa* provides the first example of a gram-negative bacterium where the *fabH* gene is absent from the
FIG. 1. The *P. aeruginosa* *acpP* region. (A) Maps of plasmids containing a *fab* gene cluster and flanking genes. The chromosomal inserts of pPS840 and pPS671 were cloned individually, and fusion of these two clones at the common *Bam*HI site yielded pPS681, containing a continuous sequence of this region. Abbreviations: Ba, *Bam*HI; Ec, *Eco*RI; Ev, *Eco*RV; Hd, *Hind*III; Ps, *Pst*I; Sa, *Sal*I; Xb, *Xba*I; Xh, *Xho*I. The following genes and their products were identified by nucleotide sequencing: *plsX*, encoding a poorly understood protein involved in phospholipid biosynthesis; *fabD*, malonyl-CoA:ACP transacylase; *fabG*, β-ketoacyl-ACP reductase; *acpP*, ACP; *fabF*, β-ketoacyl-ACP synthase II; *pabC*, 4-amino-deoxychorismate lyase; *tmk*, thymidylate kinase. (B) Partial nucleotide sequences of the *P. aeruginosa* *plsX*, *fabD*, *fabG*, *acpP*, *fabF*, and *pabC* genes. Most of the sequences within the structural genes are omitted, as indicated by dashes. The deduced amino acid sequences are given in one-letter code below the nucleotide sequence. Putative ribosome binding sites (RBS) are labeled. Numbers above the sequence mark the first nucleotides of the initiation and last codons, and stop codons are marked with asterisks. The TG-to-CA nucleotide changes in *fabD* that were introduced by site-directed mutagenesis and resulted in a W258Q change and a FabD(Ts) phenotype are indicated above the nucleotide sequence.
*acpP*-containing cluster; the only other known example is *B. subtilis* (25).
The *fab* cluster is delimited by *pabC* and *plsX* homologs, encoding 4-amino-deoxychorismate lyase and a protein of unknown function in phospholipid synthesis, respectively. We recently confirmed that *pabC* encodes *P. aeruginosa* aminodeoxychorismate lyase (13), which is required for *p*-aminobenzoic acid (PABA) synthesis, since *pabC* mutants are PABA auxoUnlike *E. coli*, the ATG start codon of the *P. aeruginosa* *pabC* gene overlaps the TGA stop codon of *fabF*. Although the two genes are translationally coupled, it is unclear whether both genes are cotranscribed from a single promoter upstream of *fabF*. The *fabF* mutant PAO198 (Table 1), containing a nonpolar gentamicin resistance (Gm\(^r\)) cassette in a transcriptional orientation opposite *fabF* and *pabC*, was not a PABA auxotroph, and we have not yet isolated mutants containing polar *fabF* mutations.
After our studies were completed, a contig appeared in the *Pseudomonas* genome project database; albeit not annotated, this entry confirmed our results and the gene order *phsX-fabD-fabG-acpP-fabF-pabC*, as well as the absence of *fabH* from this cluster. Searches of this database revealed several possible *fabH* homologs, which are located elsewhere in the chromosome, and we are in the process of characterizing the most likely *fabH* homolog.
The deduced amino acid sequences of the *fabD*, *fabG*, *acpP*, and *fabF* genes were analyzed, and, in general, found to be most similar to the respective *E. coli* homologs. The identities were 66% for FabF, 65% for FabG, and 56% for FabD. However, other bacterial Fab proteins also exhibited considerable similarities to the deduced *P. aeruginosa* protein sequences.
The high degree of primary amino acid sequence conservation was especially evident with ACP. *P. aeruginosa* ACP was 90% identical to *E. coli* ACP, 83% identical to *H. influenzae* ACP, and 80% identical to *V. harveyi* ACP. All ACPs consisted of between 76 to 78 amino acids, and they contained (i) the consensus sequence, DSLD, for attachment of the 4'-phosphopantetheine and (ii) a large proportion of acidic amino acids. The calculated isoelectric point of PAO1 ACP (pH 3.8) confirmed the acidic nature this protein.
**Characteristics of fab genes and their products.** Several lines of evidence indicated that the *fabF*, *fabD*, and *fabG* genes cloned in this work encode β-ketoacyl-ACP synthase II (FabF), malonyl-CoA:ACP transacylase (FabD), and β-ketoacyl-ACP reductase (FabG), respectively.
The evidence for FabF includes the following: (i) there is a high degree of similarity or identity to the well-characterized homologs from *E. coli*; (ii) translation of both *E. coli* and *P. aeruginosa* FabF coding sequences is apparently initiated at a GTG because the first Met codon found in the *P. aeruginosa* FabF protein is not preceded by a suitable Shine-Dalgarno sequence and the first 10 NH\(_2\)-terminal amino acids of the *P. aeruginosa* FabF protein (MSRRRVVITG) are 80% identical to those of the *E. coli* FabF protein (MSKRRVVVTG), which has a GTG start (GenBank accession no. AE000210); and (iii) a *P. aeruginosa* *fabF* mutant was constructed by deletion of a 597-bp *NcoI* fragment from within the *fabF* gene and replacing it with a 830-bp blunt-ended Gm\(^r\) encoding cassette from plasmid pUCGM (33). The mutated *fabF* sequence was returned to the PAO1 chromosome via the gene replacement vector pEX100T (34). Gas chromatography-mass spectrometric (12) analysis of the fatty acid content in cell extracts of the *fabF* knockout mutant PAO198 (*fabF::Gm\(^r\*) demonstrated eightfold lower levels of *cis*-vaccenic acid compared to wild-type PAO1 (data not shown). This compares favorably with a 10-fold reduction of *cis*-vaccenic acid levels seen in an *E. coli* *fabF* mutant (12).
The following evidence suggests that the *fabD* gene encodes malonyl-CoA:ACP transacylase (FabD). (i) FabD not only is 56% identical (78% similar) to its counterpart from *E. coli* but also contains the critical catalytic domain, the conserved pentapeptide GHSLG, which is the GXSXG signature motif of serine-dependent acylhydrolases (2). Characterization of an *E. coli* *fabD*(Ts) mutant showed that the temperature-sensitive (Ts) phenotype resulted from a mutation that led to a W257Q substitution (43). We changed a conserved Trp\(^{258}\) to a Gln residue in the *P. aeruginosa* FabD protein by mutating two nucleotides (Fig. 1B) by site-specific mutagenesis using the Altered Sites mutagenesis system (Promega). Primer FabD1 (Table 1) introduced a double TG-to-CA mismatch that resulted in a W258Q change in the FabD amino acid sequence, which was confirmed by nucleotide sequence analysis. Return of the *fabD*(Ts) allele to the PAO1 chromosome was achieved by using a previously described strategy (20). FabD(Ts) mutants, including PAO204, were obtained at a frequency of 23%, demonstrating the essentiality of FabD in *P. aeruginosa*. (iii) A hexahistidine (H\(_6\)-)tagged FabD protein was overexpressed and purified (Fig. 2A). Its observed molecular mass of ~33 kDa matches closely that for FabD (32,442 Da) plus the H\(_6\)-containing NH\(_2\)-terminal extension (2,181 Da). (iv) The purified FabD protein exhibits malonyl-CoA:ACP transacylase activity (see below).
Besides the high homology to other bacterial FabG proteins and the presence of the amino acids of the NADPH binding signature AX\(_2\)GXGX\(_2\)AX\(_6\)G near the NH\(_2\) terminus, other evidence suggests its essential role in the cycles of fatty acid elongation in *P. aeruginosa*. First, despite repeated attempts, we were unable to isolate a *fabG* knockout mutation, indicating the gene's essential nature. Second, the purified FabG protein is essential for fatty acid elongation on a reconstituted in vitro Fab synthesis system (21). A separate NADPH-dependent β-ketoacyl-ACP reductase, RhlG, that is specifically involved in rhamnolipid synthesis has recently been described (3), although no biochemical data supporting its presumed function were presented.
**Expression and purification of ACP.** The ACP was overexpressed and purified by using the intein-chitin binding domain (CBD) system. An ACP-intein-CBD fusion protein was constructed according the basic protocol provided by New England Biolabs (Beverly, Mass.). Two PCR primers, ACP-Nde and ACP-Sap, were designed to introduce an *NdeI* site at the ACP initiation codon and a *SapI* site immediately downstream of the last codon of *acpP*. These primers were used to amplify a ~270-bp fragment by using pPS681 (Table 1) DNA as the template and standard PCR conditions (18). The PCR fragment was cloned into pCYB1 DNA. This procedure yielded pPS981. Using pPS981, various *E. coli* host strains, and different induction conditions, we detected no expression of ACP-intein-CBD unless the *lac* promoter was replaced with the more powerful T7 promoter from pT7-7 (39), a step that yielded pPS966. Optimization of the expression conditions by using *E. coli* BL21(DE3)/pPS966 revealed that an overnight induction and growth at room temperature (RT) in Luria-Bertani (LB) medium (Gibco-BRL, Gaithersburg, Md.) led to substantial overproduction of the ~66,000-\(M_r\) ACP-intein-CBD fusion protein.
For purification of ACP-intein-CBD from a high-copy-number expression vector, 4-liter LB-ampicillin (100 \(\mu g/ml\)) cultures of BL21(DE3)/pPS966 were grown at 37°C to log phase (\(A_{600}\) of ~1.0), and gene expression was induced by addition of 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG). The cells were shaken at RT and harvested after a 9-h induction period. The cells were resuspended in 4 liters of fresh LB medium without IPTG and further incubated for 1.5 h at 37°C before they were harvested. During this recovery period, most of the apo-ACP was converted to holo-ACP by ligation of the 4'-phosphopantetheine. When this period was omitted and the cells were harvested after a 13-h incubation at RT in the presence of IPTG, ~90 to 95% of the ACP preparation was apo-ACP which did not serve as a FabD substrate. The cell
pellet was suspended in 50 ml of column buffer (20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 0.1 mM EDTA, 0.1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride) and disrupted by French press treatment (19,000 lb/in\(^2\)). All subsequent steps were performed at 4°C. Cell debris was removed by ultracentrifugation for 1 h at 260,000 \(\times\) g. The cell extract was applied to a 10-ml bed volume of chitin beads (New England Biolabs) in a 30-ml column and washed with 15 volumes of column buffer. The column buffer was exchanged with cleavage buffer (20 mM Tris-HCl [pH 8.0], 50 mM NaCl, 0.1 mM EDTA, 30 mM dithiothreitol [DTT]), and cleavage of the fusion protein on the column was achieved by overnight incubation. The cleaved ACP was eluted with 30 ml of cleavage buffer without DTT, and fractions were collected. The ACP content of the fractions was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (24), and protein concentrations were determined by using the Bradford dye binding assay (Bio-Rad Laboratories) and bovine serum albumin as the standard.
For purification of ACP from *E. coli* cells containing the low-copy-number expression vector pPS1096, 250-ml LB-ampicillin cultures of *E. coli* SA1503(DE3)/pPS1096 were grown at 37°C to log phase (\(A_{600}\) of \(\sim\)1.0) and gene expression was induced by addition of 0.5 mM IPTG. The cells were shaken at RT for 12 h, and ACP was purified as described above. The low-copy-number expression vector allowed for a simpler induction scheme and yielded an ACP preparation with a holo-ACP content of \(\sim\)95%. This amount could not be boosted by growing the cells in the presence of pantothenic acid. In contrast to expression experiments using the high-copy-number expression construct, the low-copy-number expression vector did not lead to an observable cessation of cell growth.
SDS-PAGE analysis revealed that ACP had been purified to near homogeneity (Fig. 2A). On this gel, ACP migrated at the position of a 22.5-kDa protein, significantly larger than its calculated molecular mass of 8.7 kDa. The anomalous migration of PAO1 ACP on SDS-PAGE is consistent with observations for ACPs from other bacteria (25, 28, 35) and has been attributed to the protein’s high charge-to-mass ratio (with ACP being highly acidic; calculated pI 3.8) as well as its low hydrophobic amino acid content, two factors that have a considerable influence on SDS binding (30). When the same ACP preparation was analyzed on a 0.1% SDS–13% polyacrylamide gel containing 5 M urea, we observed a single protein band of \(\sim\)9 kDa (data not shown), a value that closely matches its calculated mass of 8.7 kDa.
**Characterization of ACP.** Matrix-assisted laser desorption-ionization mass spectrometric analysis (4) (performed at the Colorado State University Macromolecular Resource Facility) of the purified ACP fraction revealed three species with molecular masses of 8,583 Da (minor peak), 8,934 Da (major peak), and 17,844 Da (minor peak) (data not shown). These values correspond to the three ACP species commonly found in ACP preparations, apo-ACP (without 4’-phosphopantetheine), holo-ACP (with 4’-phosphopantetheine), and the ACP dimer. ACP dimerization was an artifact of the precipitation step used in matrix-assisted laser desorption-ionization sample preparation, as no dimers were present in our ACP preparation, as judged by native PAGE (data not shown). The data confirm that the majority of our recombinant ACP (the major peak at 8,934 Da) contains the 4’-phosphopantetheine group required for its activity, presumably attached to Ser\(^{36}\), and that the NH\(_2\)-terminal methionine of ACP is posttranslationally removed by an aminopeptidase (16), as has been observed with other ACPs (25, 28, 35). The latter was verified by NH\(_2\)-terminal amino acid sequence analysis of purified *P. aeruginosa* ACP (performed at the Peptide Sequencing Facility at the University of Victoria, Victoria, British Columbia, Canada), which revealed the sequence STIEE, corresponding to amino acids 2 to 6 deduced from the nucleotide sequence (Fig. 1B).
Native PAGE is a powerful means for characterization of modified and unmodified ACP (29). It can be used to assess ACP dimer content and the ratio of apo-ACP to holo-ACP-SH. Since acylation alters the Stokes radius of ACP, it can also be used to assess the fraction of acyl-ACP in ACP preparations (29). Using native PAGE, we showed that our ACP preparation (i) contained \(\sim\)95% holo-ACP and \(\sim\)5% apo-ACP and (ii) contained no detectable acyl-ACPs (Fig. 2B). We do not know whether nonacylated ACP is due to masking of the 4’-phosphopantetheine prosthetic group in the ACP-intein-CBD fusion protein or due to efficient removal of acyl groups by the DTT used for cleavage of the fusion protein.
The identity of the holo-ACP was confirmed in a malonyl-CoA:ACP transferase assay by incubation of our ACP preparation with malonyl-CoA and purified FabD. For purification of FabD, a H\(_6\)-FabD expression vector was constructed. The *fabD* coding sequence was PCR amplified from PAO1 genomic DNA with primers FabD-Nde, creating a *Nde*I site at the *fabD* ATG initiation codon, and FabD-Bam, which creates a *BamHI* site immediately downstream of *fabD*. The PCR fragment was cloned into pET-15b (Novagen, Madison, Wis.) to form pPS979, which was then transformed into *E. coli* BL21(DE3). Expression of H\(_6\)-FabD, cell lysis, and purification of the soluble fusion protein on a Ni\(^{2+}\)-agarose column (Qiagen) were performed as previously described (14) except that the cells...
were grown in LB-ampicillin medium. Purified FabD was used in acylation reaction mixtures (20 μl) that contained 2 μg of ACP, 0.25 μg of FabD, and 0.1 mM malonyl-CoA in 20 mM Tris-HCl (pH 7.2)–100 mM NaCl–10% glycerol–1 mM DTT–2 mM EDTA–25 mM MgSO₄–0.1 mM FeSO₄. The mixtures were incubated at RT for 5 min, and products were analyzed by electrophoresis on 20% native polyacrylamide gels and followed by staining with Coomassie blue R-250 as previously described (29). In this assay, at least 50% of the holo-ACP was converted to malonyl-ACP by FabD (Fig. 2B, lane 1); conversion was not complete since the reaction catalyzed by FabD is reversible. This reaction required FabD and malonyl-CoA since neither FabD alone (lane 2) nor malonyl-CoA alone (lane 1) led to formation of malonyl-ACP after a 5-min incubation period. Longer incubation times and higher malonyl-CoA concentrations resulted in some spontaneous acylation of ACP by malonyl-CoA alone. As shown in Fig. 2C, apo-ACP did not serve as a FabD substrate. Although of the ~10% holo-ACP present about half was converted to malonyl-ACP, the ACP preparation contained ~90% apo-ACP which did not serve as a FabD substrate. Similar results were obtained with ACP purified from a strain carrying a low-copy-number ACP overproducer (Fig. 2D).
**Conclusions.** The ACP purification procedure described herein has several distinct advantages over other purification methods (7, 8). (i) It is rapid, and yields are comparable to those obtained by other methods (15, 25, 29). We routinely isolate in excess of 5 mg of ACP from 4 liter of induced culture, containing either low- or high-copy-number expression vectors, using a single 5- to 10-ml chitin-agarose affinity column on which all washing steps and the cleavage step are performed. We only know of one other method that yields more ACP when expressed from an overproducer, but it is much more involved with respect to both labor and instrumentation requirements (15). (ii) Our purification procedure yields >95% holo-ACP, whereas other procedures relying on expression constructs yield mostly apo-ACP and little to almost no holo-ACP (7, 8). Although apo-ACP can efficiently be converted into holo-ACP by purified holo-ACP synthase (8), this step contaminates the ACP preparation, and thus additional steps are required to purify the holo-ACP before further use. (iii) ACP purified by our procedure is not acylated and therefore does not require the deacylation steps prior to its use as holo-ACP in the synthesis of defined acyl-ACP substrates, compared to ACP obtained with more traditional purification procedures (5). (iv) Our purification method is inexpensive and can be performed in laboratories that have neither the expertise nor the equipment necessary for traditional protein purification schemes.
We have successfully used the *P. aeruginosa* ACP prepared in this manner for the synthesis of defined acyl-ACP substrates (19); together with purified H₆-FabD and H₆-FabG, it functions in a reconstituted enzyme system leading to synthesis of biologically active 3-oxo-C₁₂-HSL from simple metabolic precursors (21).
**Nucleotide sequence accession number.** The complete sequence of the 3,811-bp EcoRV-SalI fragment (Fig. 1A) was deposited in GenBank and assigned accession no. U91631.
This work was supported by Public Health Service grant GM56685 from the National Institutes of Health and by a grant from the CSU College of Veterinary Medicine and Biomedical Sciences. A.J.K. was supported by a graduate teaching assistantship from the Department of Microbiology.
A.J.K. and T.T.H. contributed equally to this work.
**REFERENCES**
1. Baldwin, J. E., J. W. Bird, R. A. Field, N. M. O’Callaghan, C. J. Schofield, and A. C. Willis. 1991. Isolation and partial characterization of ACV synthetase from *Cephalosporium acremonium* and *Streptomyces clavigerus*. Evidence for the presence of phosphopantothenate in ACV synthase. *J. Antibiot.* **44**:241–248.
2. Brenner, S. 1988. The molecular evolution of genes and proteins: a tale of two serines. *Nature* **334**:528–530.
3. Campos-Garcia, J., A. D. Caro, R. Najera, R. M. Miller-Maier, R. A. Al-Tahhan, and G. Soberon-Chavez. 1998. The *Pseudomonas aeruginosa* rhlG gene encodes an NADPH-dependent β-ketoacyl reductase which is specifically involved in rhamnolipid synthesis. *J. Bacteriol.* **180**:4442–4451.
4. Cottrill, J. S., and C. W. Sutton. 1998. The identification of electrophoretically separated proteins by peptide mass fingerprinting, p. 1–16. In J. M. Walker (ed.), Protein protocols on CD-ROM. Humana Press, Totowa, N.J.
5. Cronan, J. E., and A. L. Klages. 1981. Chemical synthesis of acyl thioesters of an acyl carrier protein with native structure. *Proc. Natl. Acad. Sci. USA* **78**:5440–5444.
6. Cronan, J. E., and C. O. Rock. 1996. Biosynthesis of membrane lipids, p. 612–636. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), *Escherichia coli and Salmonella*: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
7. Crosby, J., D. H. Sherman, M. J. Bibb, W. P. Revill, D. A. Hopwood, and T. J. Simpson. 1995. Polyketide synthase acyl carrier proteins from *Streptomyces*: expression in *Escherichia coli*, purification and partial characterization. *Biochim. Biophys. Acta* **1251**:32–42.
8. Epple, G., K. M. G. M. Van der Drift, J. E. Thomas-Oates, and O. Geiger. 1998. Characterization of a novel acyl carrier protein, RkP, encoded by an operon involved in capsular polysaccharide biosynthesis in *Sinorhizobium meliloti*. *J. Bacteriol.* **180**:4950–4954.
9. Fleischmann, R. D., O. Adams, O. White, R. A. Clayton, E. F. Kirkness, A. R. Kerlavage, J. J. Bult, L.-F. Tomb, B. A. Dougherty, J. M. Merrick, K. McLeod, C. Sutton, W. FitzHugh, C. Fields, J. D. Gocayne, J. Scott, R. Shirley, L.-L Liu, A. Glodek, J. M. Kelley, J. F. Weidman, C. A. Phillips, T. Spriggs, E. Heidelberg, M. D. Cotton, T. R. Utterback, M. C. Hanna, D. T. Nguyen, D. M. Saudeck, R. C. Brandt, L. D. Fine, J. L. Frithman, J. L. Fuhrmann, N. S. M. Geoghegan, C. L. Gnehm, L. A. McDonald, K. V. Small, C. M. Fraser, H. O. Smith, and J. C. Venter. 1995. Whole-genome random sequencing and assembly of *Haemophilus influenzae* Rd. *Science* **269**:496–512.
10. Fuqua, W., C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. *Annu. Rev. Microbiol.* **50**:727–751.
11. Geiger, O., H. P. Spaink, and E. P. Kennedy. 1991. Isolation of the *Rhizobium leguminosarum* NodF nodulation protein: NodF carries a 4'-phosphopantetheine prosthetic group. *J. Bacteriol.* **173**:2872–2878.
12. Gelman, E. P., and J. E. Cronan. 1992. Mutants of *Escherichia coli* deficient in the synthesis of cis-unsaturated fatty acids. *J. Bacteriol.* **174**:381–387.
13. Green, J. M., W. K. Merzel, and B. P. Nichols. 1992. Characterization and sequence of *Escherichia coli* pubA, the gene encoding aminoexodioximohydrolase, a pyridoxal phosphate-containing enzyme. *J. Bacteriol.* **174**:5317–5323.
14. Heath, R. J., and C. O. Rock. 1996. Roles of the FabA and FabZ β-hydroxyacyl-acyl carrier protein dehydratases in *Escherichia coli* fatty acid biosynthesis. *J. Biol. Chem.* **271**:2795–27801.
15. Hill, R. B., K. R. MacKenzie, J. M. Flanagan, J. E. Cronan, and J. H. Prestegard. 1995. Overexpression, purification and characterization of *Escherichia coli* acyl carrier protein and two mutant proteins. *Protein Expression Purif.* **6**:394–400.
16. Hired, P. H., J. M. Schmitter, P. Dessen, K. Fayat, and T. S. Banque. 1989. Extent of N-terminal methionine excision from *Escherichia coli* proteins is governed by the side-chain length of the penultimate amino acid. *Proc. Natl. Acad. Sci. USA* **86**:8274–8251.
17. Hoang, T., S. Williams, and H. P. Schweizer. 1997. Molecular genetic analysis of the region containing the essential *Pseudomonas aeruginosa* ada gene encoding aspartate-β-semialdehyde dehydrogenase. *Microbiology* **143**:899–907.
18. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchera, and H. P. Schweizer. 1998. A broad-host-range Flip-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked *Pseudomonas aeruginosa* mutants. *Gene* **212**:77–86.
19. Hoang, T. T., and H. P. Schweizer. 1999. Characterization of *Pseudomonas aeruginosa* enoyl-acyl carrier protein reductase; a target for the antimicrobial triclosan and its role in acylated homoserine lactone synthesis. *J. Bacteriol.* **181**:5489–5497.
19a. Hoang, T. T., Y. Ma, R. J. Stern, M. R. McNeil, and H. P. Schweizer. Construction and use of low-copy number T7 expression vectors for purification of problem proteins: purification of *Mycobacterium tuberculosis* RmlD and *Pseudomonas aeruginosa* LasI and RhlI, and functional analysis of purified RhlI. *Gene*, in press.
20. Hoang, T. T., and H. P. Schweizer. 1997. Fatty acid biosynthesis in *Pseudomonas aeruginosa*: cloning and characterization of the fabAB operon encoding β-hydroxyacyl-acyl carrier protein dehydratase (fabA) and β-ketoacyl-acyl carrier protein synthase I (fabB). J. Bacteriol. 179:5326–5332.
21. Hoang, T. T., and H. P. Schweizer. 1999. Synthesis of the *Pseudomonas aeruginosa* autoinducer N-[3-oxo-dodecanoyl]-l-homoserine lactone from metabolic precursors in a reconstituted enzyme system, abstr. B/D309, p. 90. In Abstracts of the 99th General Meeting of the American Society for Microbiology, 1999. American Society for Microbiology, Washington, D.C.
22. Issartel, J. P., V. Koronakis, and C. Hughes. 1991. Activation of *Escherichia coli* prohaemolysin to the mature toxin by acyl carrier protein-dependent fatty acylation. Nature 351:759–761.
23. Keating, D. H., M. R. Carey, and J. E. Cronan. 1995. The unmodified (apo) form of *Escherichia coli* acyl carrier protein is a potent inhibitor of cell growth. J. Biol. Chem. 270:22229–22235.
24. Makowski, G. S., and M. L. Ramsby. 1993. pH modification to enhance the molecular sieving properties of sodium dodecyl sulfate-10% polyacrylamide gel. Anal. Biochem. 212:283–285.
25. Morbidoni, H. R., D. De Mendoza, and J. E. Cronan. 1996. *Bacillus subtilis* acyl carrier protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol. 178:4794–4800.
26. Moré, M. I., D. Finger, J. L. Stryker, C. Fuqua, A. Eberhard, and S. C. Winans. 1996. Enzymatic synthesis of a quorum-sensing autoinducer through use of defined substrates. Science 272:1655–1658.
27. Ochsner, U. A., A. Fiechter, and J. Reiser. 1994. Isolation, characterization, and expression in *Escherichia coli* of the *Pseudomonas aeruginosa* rhlAB genes encoding a rhamnosyltransferase involved in rhamnolipid biosurfactant synthesis. J. Biol. Chem. 269:19787–19795.
28. Rawlings, M., and J. E. Cronan. 1992. The gene encoding *Escherichia coli* acyl carrier protein lies within a cluster of fatty acid biosynthetic genes. J. Biol. Chem. 267:5754–5754.
29. Rock, C. O., and J. E. Cronan. 1981. Acyl carrier protein from *Escherichia coli*. Methods Enzymol. 71:341–351.
30. Rock, C. O., and J. E. Cronan. 1979. Re-evaluation of the solution structure of acyl carrier protein. J. Biol. Chem. 254:9778–9785.
31. Rusnak, F., M. Sakaitani, D. Drueckhammer, J. Reichert, and C. T. Walsh. 1991. Biosynthesis of the *Escherichia coli* siderophore enterobactin: sequence of the entF gene, expression and purification of EntF, and analysis of covalent phosphopantetheine. Biochemistry 30:2916–2927.
32. Schaefer, A. L., D. L. Val, B. L. Hanzelka, J. E. Cronan, and E. P. Greenberg. 1996. Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified *Vibrio fischeri* LuxI protein. Proc. Natl. Acad. Sci. USA 93:9505–9509.
33. Schweizer, H. P. 1993. Small broad-host-range gentamycin resistance cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15:831–833.
34. Schweizer, H. P., and T. Hoang. 1995. An improved system for gene replacement and xylE fusion analysis in *Pseudomonas aeruginosa*. Gene 158:15–22.
35. Shen, B., R. G. Summers, H. Gramajo, M. J. Bibb, and C. R. Hutchinson. 1992. Purification and characterization of the acyl carrier protein of the *Streptomyces glaucescens* tetracenomycin C polyketide synthase. J. Bacteriol. 174:3818–3821.
36. Shen, Z., and D. M. Byers. 1996. Isolation of *Vibrio harveyi* acyl carrier protein and the fabG, acpP, and fabF genes involved in fatty acid biosynthesis. J. Bacteriol. 178:571–573.
37. Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60–89.
38. Summers, R. G., A. Ali, B. Shen, W. A. Wessel, and C. R. Hutchinson. 1995. Malonyl-coenzyme A:acyl carrier protein acyltransferase of *Streptomyces glaucescens*: a possible link between fatty acid and polyketide biosynthesis. Biochemistry 34:9389–9402.
39. Tabor, S. 1995. Expression using the T7 RNA polymerase/promoter system, p. 16.2–16.9. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Short protocols in molecular biology, 3 ed. John Wiley & Sons, New York, N.Y.
40. Val, D. L., and J. E. Cronan. 1998. In vivo evidence that S-adenosylmethionine and fatty acid intermediates are the substrates for the LuxF family of acyl carrier protein synthases. J. Bacteriol. 180:2661–2663.
41. Van Delden, C., and B. H. Iglesias. 1998. Cell-to-cell signaling and *Pseudomonas aeruginosa* infections. Emerg. Infect. Dis. 4:551–560.
42. Van Den Boom, T., and J. E. Cronan. 1989. Genetics and regulation of bacterial lipid metabolism. Annu. Rev. Microbiol. 43:317–343.
43. Verwoert, I. G. S., E. F. Verhagen, K. H. van der Linden, H. Verbree, J. J. Nijkamp, and A. R. Stuitje. 1994. Molecular characterization of an *Escherichia coli* mutant with a temperature-sensitive malonyl coenzyme A:acyl carrier protein transacylase. FEBS Lett. 348:311–316.
44. Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in *Escherichia coli*. Gene 100:195–199.
|
<urn:uuid:93888bb9-2503-44dc-bb28-f1da605f1438>
|
CC-MAIN-2019-43
|
https://jb.asm.org/content/jb/181/17/5498.full.pdf
|
2019-10-17T23:31:17Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986677230.18/warc/CC-MAIN-20191017222820-20191018010320-00172.warc.gz
| 547,048,473 | 11,979 |
eng_Latn
|
eng_Latn
| 0.89007 |
eng_Latn
| 0.950775 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
5071,
11919,
13815,
21549,
27174,
36394,
41542
] |
WHITE HOUSE ACADEMY DETERMINED ADMISSION POLICY 2020-2021
INTRODUCTION
White House Academy ("the Academy") is a primary academy located within East Sussex and is part of STEP Academy Trust, a multi academy trust ("the Trust"). The Trust is the "admission authority" for the Academy and therefore responsible for determining and implementing the admission arrangements for the Academy each year in accordance with the School Admissions Code 2014 ("the Code") and other legislation.
PARENT
A "parent" is defined in this policy as a natural or adoptive parent of the child, or a person who is not the natural or adoptive parent of the child, but who has parental responsibility for the child, or who is deemed to be a person who has care of the child instead of their natural or adoptive parent(s).
EQUALITY AND INCLUSION
The Academy is fully inclusive and welcomes applications for the admission of children of all abilities and needs, including those with special educational needs and disabilities. The Academy fully complies with its responsibilities under the Equality Act 2010.
CHILDREN WITH AN EDUCATION HEALTH AND CARE PLAN
There are separate statutory procedures in place which govern the admission of children with special educational needs ("SEN") for whom an education health and care plan ("EHC plan") has been issued by their Local Authority. This means that the parents of children who have an EHC plan, or are being assessed for an EHC plan, should not apply for admission of their child to the Academy under this Admission Policy. If parents have a preference for the Academy to be named as the provider in their child's EHC plan, the Local Authority needs to be made aware of this so that they can consider whether the Academy is suitable in consultation with the child's parents and the Academy.
Where a child's EHC plan names the Academy as the provider, the child will be admitted to the Academy even if this will result in the published admission number ("PAN") for that year group, or the statutory maximum infant class size, being exceeded. Where admission is to Reception Year in September (i.e. in the normal admission round), the number of places available within the PAN for other children will be reduced.
AGE ON ADMISSION TO RECEPTION YEAR
All children are entitled to a full-time place in Reception Year at a primary school from the September following their fourth birthday. Children do not, however, reach compulsory school age until the first of three prescribed dates after their fifth birthday. These prescribed dates are 31 December, 31 March and 31 August.
For example, a child who will reach the age of five years on 18 November will not reach compulsory school age until the following 1 January, a child who will reach the age of five years on 22 March will not reach compulsory school age until the following 1 April and a child who will reach the age of five years on 3 June will not reach compulsory school age until the following 31 August.
DEFERRED ENTRY AND PART-TIME ATTENDANCE
Parents who have achieved a place for their child in Reception Year at the Academy can choose to defer their child's start date until they have reached compulsory school age (i.e. on one of the three prescribed dates stated above) and still retain their child's place in Reception Year at the Academy.
However, the start date for a child born between 1 April and 31 August who will not reach compulsory school age until 31 August (known as a "summer born child") cannot be deferred later than the first day of the last term (usually when the Academy reopens after Easter) without losing the place achieved, which will then be allocated to another child. Parents of "summer born children" can, however, choose to delay their child starting school for a whole school year (see below).
Parents may also choose to send their child to school part-time until they reach compulsory school age (i.e. on one of the three prescribed dates stated above). Unlike the right to defer entry, this right can be exercised during the last term in the case of "summer born children", and can also be exercised in combination with the right to defer the child's start date until later in the school year, as set out above.
For example, a child born on 18 November could start school part-time from 1 September and then full-time from 1 January, and a child born on 22 March could start school part-time from either 1 September or 1 January and then full-time from 1 April.
DELAYED ENTRY FOR "SUMMER BORN CHILDREN"
Parents of children born between 1 April and 31 August (known as "summer born children") have the following options in relation to their child:
1. To start school full-time in Reception Year in the September following their fourth birthday in the usual way; or
2. To retain the place they have achieved for their child in Reception Year and decide that their child will start school later in the school year (i.e. deferred entry) and/or attend part-time, as set out above; or
3. To lose any place achieved for their child in Reception Year and delay (rather than defer) their child starting school for one whole school year (i.e. following September).
Parents choosing to exercise the third option will need to decide whether they want their child to be admitted to Year 1 in the following September with their usual age group (subject to their being an available place in Year 1, as no place will be have been reserved for the child) or be admitted to Reception Year in the following September with children below their normal age group. The second of these options will require parents to submit a separate Application for Admission Outside Normal Age Group to the Governing Body of the Academy (see below).
APPLICATIONS FOR ADMISSION OUTSIDE NORMAL AGE GROUP
All parents have a right to apply for their child to be admitted to a year group above or below their child's normal year group, however it is for the admission authority for each school to decide whether to agree to this or not. Parents do not have an absolute right to decide that their child will be educated outside their normal age group.
Children will not, under any circumstances, be admitted to reception class earlier than the academic year in which their fifth birthday falls.
In order to apply, parents must complete a separate application form (called an Application for Admission Outside Normal Age Group form, which is available for download via the Academy's website or in hard copy from the Academy's office) and submit it to the Governing Body with any supporting documentation. Applications should be submitted as early as possible so that all options are kept open before deadlines pass, as a formal application for admission will also have to be made.
On receipt of a completed application form and any supporting documentation, the Governing Body will need to decide whether to agree or refuse the application. This decision will be made on the basis of the circumstances of each case and in the best interests of the child concerned. The factors that will be considered include the following:
* The parent's views;
* Information about the child's academic, social and emotional development;
* The Headteacher's views;
* Where relevant, the child's medical history and the views of their medical professionals;
* Whether the child may naturally have fallen into a lower age group if not for being born prematurely.
* Whether the child has previously been educated or attended a nursery outside their normal age group;
Where the application is refused, the Governing Body will write to the parents confirming the refusal, clearly setting out their reasons for their decision. Parents do not have a statutory right of appeal against a decision to refuse an application for a child to be admitted outside their normal age group, however a complaint can be submitted under the STEP Complaints Policy if the child's parents believe that the Governing Body did not deal with the application properly.
Where the application is agreed in principle, the Governing Body will write to the parents confirming the agreement in principle. Parents should note that an agreement in principle is not the same as an offer of a place in the desired year group - it is simply an indication that the Governing Body will accept an application for admission of the child to the desired year group. Once an application for admission to the desired year group has been submitted, it will be processed with all other applications for that year group, with the oversubscription criteria being applied where more applications are received than there are places available. The application for admission must be accompanied by the letter confirming the Governing Body's agreement in principle.
For the avoidance of doubt, this means that even where the Governing Body has agreed in principle to a child being admitted outside their normal age group, there is no guarantee that a place in the desired year group will be achieved for the child. This is particularly relevant in the case of "summer born children" for whom a place in Reception Year is being sought one year later than usual, as they could be left without a place in Reception Year at the Academy, and the child's parents will then need to decide whether to submit an application for admission outside normal age group to another school with a place available in Reception Year, or to seek a place in Year 1 at the Academy subject to their being any places available.
PUBLISHED ADMISSION NUMBER ("PAN")
The published admission number ("PAN") for Reception Year at the Academy is 30.
This means that the Academy will admit up to that number of children in the September of the school year to which this policy applies.
OVERSUBSCRIPTION CRITERIA
Where more applications are received than there are places available, the available places will be allocated in the following order of priority:
1. Looked After and Previously Looked After Children
A "looked after child" is a child in public care at the date on which the application is made. A "previously looked after child" is a child who was in public care, but ceased to be so because they were adopted or became subject to a residence order or special guardianship order immediately after being in public care. To be included in this category, the application for admission must be supported by the relevant Local Authority's Children's Services Department. In the case of a previously looked after child, a copy of the adoption or special guardianship order must also accompany the application for admission.
2. Children with a Medical Need to Attend White House Academy Only
Children for whom White House Academy is the only suitable and appropriate school for the child to attend will be allocated places in this category by reference to the proximity of the child's home address (as defined by this policy) to the Academy, with those living nearer receiving higher priority.
To be included within this category, there must be compelling reasons why White House Academy is the only school which is suitable and appropriate for the child to attend because of a medical need of the child or their parent which prevents them from attending any other school. For the avoidance of doubt, social reasons and inconvenience for parents will not be regarding as a compelling reason for the child to be included within this category.
In addition to the Common Application Form, parents must complete a Category 2 (Children with a Medical Need) Form, which is available for download on the Academy's website or in hard copy form from the Academy's office. Part A of the Category 2 (Children with a Medical Need) Form must be completed by the parent before being provided to the child or parent's G.P. or hospital consultant who must then complete Part B, sign, stamp and date the form. Parents must not complete Part B of the Category 2 (Children with a Medical Need) Form.
The G.P. or hospital consultant must expressly confirm not only the nature of the medical condition of the child or parent, but also the reason why in their professional opinion only White House Academy is suitable and appropriate for the child to attend, why no other school is suitable and appropriate, and the medical reasons why this is the case.
The completed, signed and stamped Category 2 (Children with a Medical Need) Form must be received on or before the application deadline. Failure to do so will result in the child being placed into the next category that applies.
The Trust's Admissions Panel will make the decision as to whether the child meets the criteria for inclusion within this category, and will do so fairly and consistently in all cases. Where the Admissions Panel is not satisfied that the criteria are met, the child will be placed into the next category that applies.
3. Children with a Sibling at White House Academy at the Date of Admission
Children with a sibling at White House Academy at the date of their admission will be allocated places in this category by reference to the proximity of the child's home address (as defined by this policy) to the Academy, with those living nearer receiving higher priority.
A "sibling" will include a full, half, step, adopted or foster brother or sister, as well as a child of their parent's partner with whom they have been cohabiting for a period of at least one year at the application deadline, provided that in all cases the sibling and the applicant child live at the child's home address (as defined by this policy) and are being brought up as siblings as part of a core family unit. For the avoidance of doubt, a child of a friend or extended family member (for example, a cousin) living at the same address will not be a sibling for the purpose of this policy.
Parents must ensure that they have included full details of the sibling in the Common Application Form to be included in this category. Failure to do so will result in the child being placed into the next category that applies.
4. All Other Children
Children not falling into any of the above categories will be allocated places in this category by reference to the proximity of the child's home address (as defined by this policy) to the Academy, with those living nearer receiving higher priority.
ORDER OF ALLOCATION
School places will be allocated on the basis of our determined admissions arrangements. The order in which places will be allocated in the categories above will be by reference to the distance the child lives from the School in accordance with our below 'Distance Measuring' section, with those living closest to the School receiving highest priority.
CHILD'S HOME ADDRESS
The child's home address will be the address at which they live and sleep with their parent (as defined above) for more than 50% of their time from Monday to Friday during term time at the application deadline. It will usually be the address at which Child Benefit is claimed or, if ineligible, the address at which the child is registered with their G.P. and dentist.
Where there is an issue over whether the home address stated in the Common Application Form is the child's main home address as defined by this policy, parents may be required to provide documentary evidence to resolve the issue. This may include providing details of the times that the child has spent at the stated home address in the three month period immediately preceding the application deadline. Please refer to Annex A of this policy for further information.
DISTANCE MEASURING
The distance between the child's home address (as defined by this policy) and the Academy will be measured in a straight line from the geographical reference point at the child's main home address to the Academy's designated entrance using the Local Authority's geographical distance measuring software.
In the case of multi-dwelling buildings (for example, an apartment block), the distance will be measured from same geographical reference point in the building regardless of the actual location within the building of the child's home address, with the tie breaker being applied if more than one application is received for children living in the building (see below).
TIE BREAKER
Where two applications cannot otherwise be separated because the distance between the child's home address (as defined by this policy) to the Academy is the same, the order in which places will be allocated will be determined by random lottery in the presence of a person who is independent of the Academy.
STATUTORY MAXIMUM INFANT CLASS SIZE
The maximum number of pupils legally permitted to be in a class in Reception Year, Year 1 or Year 2 class is 30 pupils.
There are specified circumstances in which some categories of children will not be counted towards the class size, allowing for these children to be admitted to a class containing 30 or more pupils without breaching the
5 |
Page statutory maximum infant class size. These children are known as "excepted pupils" until the class size falls back to 30 pupils. Parents are referred to Paragraph 2.15 of the Code (which is accessible on the Department for Education's website) for further details in this respect.
TWINS AND CHILDREN OF A MULTIPLE BIRTH
Where a child who is a twin or a child of a multiple birth achieves a place but their twin or siblings of a multiple birth fail to do so, the twin or siblings of a multiple birth will be admitted to the Academy above the PAN. These children be "excepted pupils" until the class size falls back to 30 pupils (see above).
CHILDREN OF UK SERVICE PERSONNEL AND CROWN SERVANTS
The Academy will accept applications for the admission of the children of UK Armed Forces Personnel with a confirmed posting in the area of the Academy, or the children of Crown Servants returning from overseas to live in the area of the Academy, in advance of them arriving. These children do not have to be living at the stated home address at the application deadline, as all other children do.
The application for admission must be supported by an official letter declaring the relocation date and a Unit postal address or quartering area address, which will be used as the child's home address for the purpose of applying this Admission Policy.
APPLICATIONS FOR ADMISSION
Applications for admission to Reception Year in September (known as admission "in the normal admission round") must be made to the Home Local Authority.
Parents must ensure that they complete all necessary information (for example, details of siblings) before the application is submitted. Where relevant, a completed Category 2 (Children with a Medical Need) Form must also be submitted. Failure to do so by the application deadline will result in the child being placed into the next category that applies.
ADMISSION TIMETABLE
The deadline for applications for admission to Reception Year in the normal admission round is on or about 15 January 2020. Late applications will be accepted but will not be considered until all applications received on or before the application deadline have been processed, which will reduce the chance of achieving a place for the child.
National Offer Day for places in Reception Year in the normal admission round is on or about 16 April 2020. On that date, parents will be notified whether their application for admission has been successful or not. Where an application is unsuccessful, the reason for this will be confirmed in the notification letter.
ADMISSION APPEALS
Parents have a statutory right of appeal against the refusal of a place which will be heard before an independent panel. Full details about the statutory right of appeal, including how and when the request for an appeal must be lodged, will be confirmed in the notification letter sent to parents on National Offer Day.
A request for an admission appeal must be accompanied by the grounds for making the appeal (for example, why the parents believe that this Admission Policy is not compliant with admission law; in what way the Admission Policy was incorrectly or partially applied to the application for admission, or why it was unreasonable to refuse the application for admission). Before setting out the grounds of appeal, parents are advised to consider the reason for the refusal stated within the notification letter.
The Academy is required to publish an admission appeal timetable on its website on or before 28 February before National Offer Day.
WAITING LISTS
The names of all children who are unsuccessful in achieving a place in Reception Year will be automatically added to the waiting list for Reception Year for the duration of the first term until 31 December. After that date, all names will be removed unless the child's parents notify the academy that they would like their child's name to be kept on the waiting list going forwards.
Looked after children, previously looked after children and those allocated a place at the academy in accordance with a Fair Access Protocol take precedence over those on a waiting list.
IN-YEAR ADMISSIONS
The Academy participates in the Local Authority's coordinated scheme for in-year admission and admission to year groups other than Reception Year. These applications must also be made to the Home Local Authority, rather than the Academy.
Where an application for in-year admission or admission to a year group other than Reception Year is unsuccessful, parents will be asked if they would like their child's name to be added to a waiting list for that year group and, if so, for how long. Waiting lists are not routinely kept for other year groups unless parents specifically ask for their child's name to be included on one.
The child's position on a waiting list will be ranked solely in accordance with the order of priority set out in this policy, and not in accordance with the date that the child's name was added to the waiting list. This means that the child's name may go up or down the waiting list, as the names of other children are added or removed.
FAIR ACCESS PROTOCOL
The School is committed to taking a fair and reasonable proportion of children who are vulnerable and/or hard to place, as identified in the locally agreed Fair Access Protocol.
WITHDRAWALS
Please refer to Annex A of this policy for further information.
PRE-APPLICATION VISITS
The Academy is happy for parents and children to visit the Academy before an application for admission is made, and will try to be as flexible as possible in arranging a mutually convenient appointment to facilitate this. Parents who want to visit should telephone the Academy's office and speak to a member of the Academy's Admissions Team. If possible, a member of the Academy's Senior Leadership Team will be available to answer any questions that parents may have during the visit.
ADMISSION PROSPECTUS
In addition to this Admission Policy, the Academy has an Admission Prospectus which is available for viewing or downloading on the Academy's website or available in hard copy from the Academy's office.
FURTHER INFORMATION
For further information about admission to the Academy, please contact the Academy Office:
[email protected]
Academy Email Address:
STEP Admissions
[email protected]
Annex A
The child's address
The child's address should be that of the child's permanent place of residence at which they live and sleep with their parent (as defined above) for more than 50% of their time from Monday to Friday during term time at the application deadline.
The address used as the child's permanent place of residence must be where both the parent/s and child concerned are registered (and living) at the time of application, subject to any exemptions in the Admission Code as detailed in our Admission Policy.
Proof of address will be required and must be in the same name and address as those provided on the application. The proofs of address that may be requested to confirm the permanent place of residence could include for example: council tax reference number; current driving license; household Insurance; confirming of benefit entitlement; motor policy insurance; utility bill (dated within the last three months); child benefit notice – showing child's details; tax Credit Award notice – showing child's details (if applicable/available); and/or doctors registration confirmation.
Your address may be thoroughly investigated to ensure there is a permanent commitment to the address i.e. an address is not a temporary arrangement to access a preferred school. Examples of documents that may be requested in relation to a new residence may include: a letter from a solicitor confirming the date of completion (not exchange of contract) for the new place of residence or a copy of the new tenancy agreement stating the commencement date, together with evidence of residence, for example as detailed above; a utility bill, doctors registration confirmation and child tax documents.
A business address, work place address, a childminder's address will not be accepted as a permanent place of residence, and a relative or carer's address can only be considered as a permanent place of residence if they have legal custody/parental responsibility of the child. In these circumstances, evidence of legal custody/parental responsibility must be supplied.
Where parents are separated and share custody, if there is a genuine equal share custody arrangement between two parents, the address that will be used will be the address of the parent who is claiming Child Benefit for the child.
Temporary address
A temporary address may not be accepted if parents/guardians still own a property that was previously used as a home address, or a temporary address which the Admissions Authority consider to be solely or mainly used to obtain a school place.
If families own more than one property the Admissions Authority may only consider the given address if families have lived there for a year prior to the closing date of application (including rented, bought or living with a family member or friend).
The admissions committee may also review the application of any family that decides to move after taking up the school place, up to a year following the closing date.
Parents/guardians will be asked to provide additional information to explain why they are not using their permanent address, or another address identified as a result of screening, or as a result of information obtained from the public. This may include utility bills, benefit claims and copies of mortgage or rent agreement. The school may also check relevant local authority records to clarify whether or not families receive services or benefits at another address.
Withdrawal
The Academy will not withdraw an offer unless it has been offered in error, a parent has not responded within intentionally misleading application.
a reasonable period of time, or it is established that the offer was obtained through a fraudulent or
Where the parent has not responded to the offer, a further and final opportunity to respond will be provided prior to withdrawal.
Where an offer is withdrawn on the basis of misleading information, the application will be considered afresh, and a right of appeal offered if an offer is refused (please refer back to the admissions policy for further information relating to appeals).
If the child has started at the school, in deciding whether to withdraw a place, the length of time that the child has been at the school will be taken into account.
We take very seriously any attempt to gain an advantage in the admissions process by giving false information. Your address will be checked by reference to your documentation and recorded information, and, if necessary, by a member of school staff visiting your address.
|
<urn:uuid:e209c723-4760-46ed-96bb-acb4722ddcf0>
|
CC-MAIN-2019-13
|
https://www.stepacademytrust.org/wp-content/uploads/2019/02/Determined-White-House-Academy-Admission-Policy-2020-2021.pdf
|
2019-03-18T21:33:38Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912201707.53/warc/CC-MAIN-20190318211849-20190318233849-00328.warc.gz
| 932,937,258 | 5,467 |
eng_Latn
|
eng_Latn
| 0.998484 |
eng_Latn
| 0.998681 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
3000,
6299,
9972,
13864,
17293,
20569,
23381,
26845,
27934
] |
2019 UCF Women's Basketball Camps
Check Appropriate Camp
___
Elite Camp;
June 14th
(11:30am‐6pm)
$80.00
(Lunch, insurance, camp shirt)
*This camp is designed specifically for players entering 8th‐12th grade. This is a high intensity camp for players that have the desire to play at the next level. Coach ABE and her women's basketball staff will work with players on a variety of individual and team skills to prepare the prospective student-athlete for the pace at the next level.
___ Team Play Days; June 15 th & 16 th (8:30am‐8:00pm) $220/Team/Day
*Concessions will be available for purchase*
Check: JV ___Varsity ___AAU Level of Play: ____Low _____Mid _____High
_______ June 15 th ($220) ______ June 16
th
($220) ______ Both Days ($440)
Team Name:
# of players: _______
*This camp is designed for JV & Varsity High School Teams & AAU Teams. Guaranteed a minimum of 3 games per day in your level of play. One demonstration and/or lecture per day will be provided by UCF Women's Basketball Coaches.
——————————————————————————————
*Register online or fill out the following information and mail to:
UCF Women's Basketball c/o Stephanie Follett 4000 Central Florida Blvd. Orlando, FL 32816
Elite Campers
Name Age DOB Grade Fall 2019 T‐shirt Size Ht. Position Email Cell Home Address City State Zip Parent/Guardian_________________ Cell_ ___________________________ Email __________ High School _____________________________ HS Coach Email Cell
TEAM PLAY DAYS
High School/AAU Team Name: _____________________________________________
Head Coach: ___________________________________________
Head Coach Email: _____________________________________________________________________________
Head Coach Cell: _________________________
Register Online:
www.abeswinningways.com
CHECKS MADE OUT TO
ABE's Winning Ways
Contact Steph Follett with Questions: [email protected]
334‐707-9250
*Camp fees
are non‐refundable within
14
days prior to
the camp.
*All UCF camps are open to any and all entrants, limited only by number, age, grade level, and/or gender*
|
<urn:uuid:cf350127-e6a8-4c9b-9723-0d2f49a8fa8b>
|
CC-MAIN-2019-22
|
http://ucfknights.com/attachments1/files/34100/641433.pdf?ATCLID=211769773&SPSID=1115497&SPID=181629&DB_LANG=C&DB_OEM_ID=34100
|
2019-05-23T01:18:10Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232256997.79/warc/CC-MAIN-20190523003453-20190523025453-00297.warc.gz
| 215,366,264 | 504 |
eng_Latn
|
eng_Latn
| 0.98936 |
eng_Latn
| 0.98936 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
2112
] |
U.S. District Court
District of Hawaii
Notice of Electronic Filing
The following transaction was entered on 3/19/2017 at 9:49 AM HST and filed on 3/19/2017
Case Name:
State of Hawaii v. Trump
Case Number: 1:17-cv-00050-DKW-KSC
Filer:
Document Number:
229(No document attached)
Docket Text:
EO: The Court is in receipt of the Federal Defendants' Motion for Clarification of TRO. Dkt. No. 227. That Motion essentially asks whether the Court's March 15, 2017 Temporary Restraining Order was intended to apply to Sections 2 and 6 of the Executive Order. The Motion, in other words, asks the Court to make a distinction that the Federal Defendants' previous briefs and arguments never did. As important, there is nothing unclear about the scope of the Court's order. See Dkt. No. 219 (TRO) at 42 ("Defendants... are hereby enjoined from enforcing or implementing Sections 2 and 6 of the Executive Order across the Nation."). The Federal Defendants' Motion is DENIED. (JUDGE DERRICK K. WATSON)(watson1)
|
<urn:uuid:7a2c0d6e-ae66-45c3-9a8b-ea94c73c399e>
|
CC-MAIN-2021-49
|
https://www.hoganlovells.com/-/media/hogan-lovells/pdf/hawaii-district-court-denied-motion.ashx
|
2021-12-01T15:31:13+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00049-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet
| 838,587,904 | 263 |
eng_Latn
|
eng_Latn
| 0.983155 |
eng_Latn
| 0.983155 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
1007
] |
INTERNATIONAL PROTECTION PROCEDURE – HOW IT WORKS
An international protection procedure starts when you submit your application to the police or Ministry of Interior. The application is followed by an interview. There can be more than one interview. During the procedure you should be especially aware that:
* you have the right to have an interpreter for a language you are able to easily communicate in
* if you do not understand anything, do not hesitate to ask for an explanation
* if you assume that an interpreter is not interpreting your words correctly, don't be scared to inform a person conducting the interview
* during the procedure, do not provide any statements that are not true or do not precisely correspond with your situation
* do not sign anything that you do not understand and that was not translated to you
During interviews it is important to provide true reasons for leaving your country of origin and not provide false personal data. Do not repeat stories that you heard from other people that do not correspond with your personal experience and have no connection with real reasons why you left your country. If you have documents or other evidence proving your story, provide these to the ministry. If you do not have such documents with you but you can get them soon, tell the workers of the Ministry. You have a right to inspect your file at the Ministry during the whole procedure and to add documents proving your story. All information that you provide to the Ministry of Interior as well as the fact that you applied for an international protection in the Czech Republic is confidential, and cannot be disclosed to the authorities in your country of origin.
A procedure at the Ministry of Interior before the decision is issued is the most important part of the whole international protection process. Therefore, it is important that you are active and come for interviews upon the invitation of the Ministry. You can follow the situation in your country of origin for example, via the internet, and add relevant documents to the file. These documents do not have to be translated into Czech.
ASYLUM – REFUGEE STATUS
SUBSIDIARY PROTECTION
APPLICATION DECLINED (1. NEGATIVE)
A person who proves that he/she was persecuted in his/ her country of origin will be recognized as a refugee and will get refugee status.
Reasons for granting refugee status are as follows: Persecution for pursuing political rights and freedoms and/or a person who has a well founded fear of being persecuted for reasons of race, gender, religion, nationality, membership of a particular social group or for holding certain political opinions in the country of his/her origin, or in the case of a stateless person, in the country of his/her former permanent residence.
If the ministry does not find out grounds for granting refugee status, such an applicant can be granted subsidiary protection if the ministry finds that the person would face any of these conditions upon return to the country of origin: danger of imposition of capital punishment or enforcement of capital punishment, torture or inhuman or degrading treatment or punishment, serious threat to life or human dignity by reason of indiscriminate violence in situations of international or internal armed conflict, or if the alien's leaving the country would be contrary to international obligations of the Czech Republic.
Another reason for granting refugee status is for the reunification of family members (spouse, minor or parent), for whom the status was already granted.
The final reason is for so called humanitarian grounds. There is no legal right to gain humanitarian asylum. It is up to the ministry to recognize that there are substantial humanitarian grounds.
Your application for granting international protection is declined and you are given a so called "negative".
DEPARTURE FROM CZ (repatriation)
APPEAL
It is possible to appeal a negative decision (or part of the decision in case of granted subsidiary protection and denied asylum) to the regional court. The appeal has to be sent to the court according to your official address.
NGO lawyers can help you to write an appeal as well as represent you during the procedure at the ministry or regional court. NGO lawyers, after studying your case, will provide you with appropriate advice and help.
The appeal has to be filed within 15 days of the date that the decision of the ministry was given to you. If you obtained the decision in an administrative detention, reception center at the airport, or your application was denied as unfounded, you have to appeal the decision within 7 days.
It is necessary to explain where the ministry made mistakes in the decision and which statements you do not agree with in the appeal. The statements written in the appeal are crucial for the procedure at the court.
Subsidiary protection can also be granted for the reunification of family members (spouse, minor or parent), for whom the status was already granted.
Subsidiary protection is granted for a limited time period and after expiration, the situation is reexamined to see if there are still reasons for subsidiary protection. If the ministry finds out that there is still danger in the country of origin, the subsidiary protection is prolonged. It is necessary to apply for the extension within 30 days prior to the expiration of the period for which the subsidiary protection is granted.
It is possible to appeal the decision by which you were granted subsidiary protection and not granted asylum. You may appeal the part of the decision concerning not being granted asylum. Subsidiary protection, which was granted to you, is not revoked but you are once again in the process of granting international protection.
If you do not appeal against that part of the decision by which you were not granted asylum, you are becoming an alien to whom subsidiary protection was granted.
REVERSED DECISION OF MINISTRY OF INTERIOR (POSITIVE)
The Court revokes the decision and returns the case to the Ministry of interior for further proceedings. This takes you back to the initial level of the procedure. However, it does not mean that the Ministry has to grant you asylum or subsidiary protection. Therefore, it is necessary for you to actively participate in the procedure.
APPEAL DISMISSED (2.NEGATIVE)
The Court dismisses appeal. In such a case, you can file a cassation complaint to the Highest Administrative Court in Brno within two weeks of the date when you received the judgment.
CASSATION COMPLAINT
You have to be represented by a lawyer (attorney) who is a member of the Bar association at the hearing of the Highest Administrative Court. If you do not have enough money, you have to file the cassation complaint and ask the court to assign you a pro bono attorney. The Court will send you a questionnaire concerning your financial situation and based on this information, decides about your request. The court sends you the address of the attorney. You should contact the attorney and supplement the cassation complaint.
DEPARTURE FROM CZ (repatriation)
ATTENTION: The Highest Administrative Court contacts only your attorney during the procedure. When your attorney obtains a judgment, your toleration stay visa expires even though the date of expiration on your visa is later! Therefore it is important to be in touch with your attorney and if you change your address, inform him/her about it. You have to be sure that your attorney will inform you about judgment and send you the copy of the judgment.
DISMISSAL (REFUSAL) OF A CASSATION COMPLAINT (3.NEGATIVE)
REVERSED JUDGMENT OF A REGIONAL COURT (POSITIVE)
The court dismisses or refuses your cassation complaint. It is the final decision in your international protection procedure and it is the end of your toleration stay visa.
DEPARTURE FROM CZ (repatriation)
The court acknowledges your cassation complaint, revokes the judgment of a regional court, and returns your case back to a regional court. Your toleration stay visa expires, you have to visit the department on asylum and migration policy (OAMP), and the international protection procedure continues.
DO YOU WANT TO APPLY FOR INTERNATIONAL PROTECTION?
www.migrace.com
Everybody who faces persecution in their country of origin can, after arrival to the Czech Republic, apply for international protection, international protection can be granted in the form of asylum or subsidiary protection . During an international protection procedure, the Ministry of Interior examines if an international protection seeker was persecuted in his/her country of origin for reasons stated in the Asylum Act (see page two – the scheme).
If you would like legal representation during the procedure, you can choose from several possibilities:
Legal representation is not compulsory during the procedure at the Ministry of Interior and at the Regional Court.
1) Representation by NGO lawyer. This help is free of charge and it is up to the NGO to what extent it is provided.
2) You can be represented by an attorney, for whose services you can either:
a) pay on your own a majority of attorneys do not have any experience with international protection procedure. Therefore, consider
. In case you are represented by a lawyer or attorney, it will be necessary
(see page two – the scheme) the Court will send you a notice asking you if you want to ring the procedure at the Regional Court
b)
means
It is important to note that
The Highest Administrative carefully when hiring an attorney for whose services you have to pay
to cooperation closely with him/her.
documents have to be translated into the Czech language.
For the procedure at the Regional Court be present at the hearing. If you do not respond within 15 days, the Court makes a decision without a public hearing. The court decision will not
depend on your presence at the hearing. However, if you do respond within 15 days, it is reasonable to come to the court especially if:
* you have a lawyer
*
For the procedure at the Highest Administrative Court, legal representation by an attorney is compulsory.
Court does not order a hearing and decides without presence of parties. You can pay your attorney's services either:
a) you have a lawyer mob: (+420) 605 253 994
The Association for Integration and Migration
Baranova 33
130 00 Prague 3
tel: (+420) 224 224 379
fax: (+420) 224 239 455
mob: (+420) 603 547 450
PROCEDURE IN THE CZECH REPUBLIC
INTERNATIONAL PROTECTION
LEGAL HELP
, not the courts. Courts can only cancel the decision of previous a subsidiary protection
or
Only the Ministry of Interior can grant you an asylum
bodies, and return your case back for further proceedings.
STAY IN THE TERRITORY DURING THE PROCEEDINGS FOR GRANTING INTERNATIONAL PROTECTION Once the declaration of intent to apply for international protection has been made, you can stay in the territory of the Czech Republic until the decision on your application is made. In the event of the decision being negative, you can file a lawsuit against such a decision. The legal action against the decision of Ministry of Interior as well as cassation complaint generally have suspensive effect, that means that in the meantime of the decision being made you can stay in the Czech Republic. If they do not have a suspensive effect, you can ask the court to grant suspensive effect of the lawsuit. Until the court decides on the suspensive effect appeal, you can stay in the territory. The Ministry of Interior should make a decision on your application within 6 months from its submission. In some cases the length of the proceedings may be extended from 18 to 21 months from the submission date of the application. The length of the proceedings of the Ministry of Interior and the courts depends on several things (individual assessment of the case, number of asylum seekers, overloading of individual courts, the scope of the case file), and therefore the length of your asylum proceedings cannot be predicted in advance.
SERVICES ARE PROVIDED AT
ADDRESS
WITHDRAWAL OF AN APPLICATION FOR INTERNATIONAL PROTECTION/ APPEAL / CASSATION COMPLAINT
The Association for Integration and Migration
Baranova 33
130 00 Prague 3
CONTACT US
counselling via phone: (+420) 224 224 379
Mon - Thu: 10:00 – 17:00
THE ASSOCIATION FOR INTEGRATION AND MIGRATION (AIM)
e-mail: [email protected]
In case you want to close your asylum procedure, you can do that by writing "a stop asylum request". According to what stage of asylum procedure you are at, you will write this request to the Ministry of Interior, Regional Court or Highest Administrative Court. If you are writing to the Regional Court or the Highest Administrative Court, you should also inform the Ministry about your intention to stop the procedure. In case you have an attorney, it should be him/her who writes the request for stopping the your procedure. After sending your request, you need to wait until you receive the decision of the Ministry or a Court at the address you have written on your request. After receiving this decision you are obliged to go to OAMP (in case your procedure was closed at the stage of proceedings at the Ministry or Regional Court), where you return your asylum seeker's card Your passport is returned to you by the Ministry and the Foreign police issues you a departure visa (also in case of stopping the procedure at
Highest Administrative Court).
In some cases, you can ask the Ministry of Interior to cover the costs associated with a voluntary return to your country of origin or another state, or if you are a stateless person, to the country of last permanent residence. Since this opportunity is associated with a very short deadline (starting from the end of your proceedings on international protection) you should seek legal advice in case you are interested in repatriation. In relation to medical services, accommodation, food, and other necessary services, you will be viewed as an applicant for international protection, up to the moment of departure or until the moment the Ministry notifies you that it won't pay the costs associated with the voluntary return.
www.migrace.com
The Association for Integration and migration is diverse support to foreigners in the Czech Republic and to those individuals who have applied for theinternational protection in the Czech Republic.We provide legal, social and psychological counselling to asylum seekers in the territory of the Czech Republic. Counselling is provided free of
(END OF ASYLUM PROCEDURE)
REPATRIATION / VOLUNTARY RETURN
|
<urn:uuid:5be31ba6-e29e-4bb0-a003-02a1273bba60>
|
CC-MAIN-2022-49
|
https://www.migrace.com/docs/160901_mo_aj.pdf
|
2022-11-26T18:51:18+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-49/subset=warc/part-00262-a0906200-461b-4808-9b94-6c53daf73f61.c000.gz.parquet
| 988,505,725 | 2,920 |
eng_Latn
|
eng_Latn
| 0.996745 |
eng_Latn
| 0.997211 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
8195,
14648
] |
BOARD MEETING MINUTES
PLACE AND DATE: SBMCS CAMPUS Tues. February 16, 2018 continued Tues. February 20, 2018
0.0 Call to Order. 5:30 pm on February 16th and continued at 5:30pm on February 20th)
1.0 Roll Call. Mr. Luis Parra, Ms. Margot Luque, Ms. Vanessa Havel, Mr. Martin Saenz, Ms. Elaine Padron and Ms. Elizabeth Behrentz.
2.0 Moment of Reflection.
3.0 Former Minutes for Approval.
A. Board Meeting Minutes from January 5, 2018 were reviewed and approved.
B. Board Meeting Minutes from December 14, 2017 have been approved and uploaded in Charter Tools.
4.0 Reports.
A. Financial Statements for Oct. 2017 through Jan. 2018 are pending approval and will be reviewed for approval at the next Board Meeting on February 27th.
B. The Board discussed the financial statements with Ms. Behrentz (bookkeeper), as well as a preliminary budget for the upcoming school year.
C. The Board discussed continuing with the same accountant.
5.0 Business for Reviewing.
A. The Board discussed the upcoming Teachers' Meeting to be held Feb. 22nd and topics to be addressed.
B. The Board discussed the status of the Application for Charter Contract Renewal.
C. The Board discussed fundraising strategies. Mr. Parra spoke regarding the Florida Consortium which has been recommended by an attorney. Mr. Saenz and Ms. Havel offered to speak with the attorney to follow up.
D. The Board discussed Charter Tools, the upcoming due dates, and improvements for correct information to be uploaded on a timely basis.
E. The Board discussed Governor Scott's letter of recognition for students' gains in Reading. Ms. Padron shared the letter with the teachers. The Board also wants to give recognition to the teachers for the students' gains in Reading, as well as future gains in Math, and will thank them at the Teacher's Meeting on Feb. 22nd.
F. Board discussed Charter Tools and access to all concerned is being processed.
6.0 Other Business.
A. The Board reviewed a proposed plan of action contained in a memorandum prepared by Mr. Saenz.
B. The Board agreed to hold the Board Meetings on a weekly basis, every Tuesday at 5:00pm.
7.0 Public Comments.
No public was present in this meeting.
8.0 Adjournment
Motion to Adjourn by: Luis Parra. All yes. Feb. 16th at 8:00 pm and Feb. 20th at 7:00pm.
The Board of South Broward Montessori Charter School
Luis Parra
Martin Saenz
Margot Luque
Vanessa Havel
|
<urn:uuid:dc92d570-9df7-4131-9356-a7dc30aabc3e>
|
CC-MAIN-2019-22
|
http://sbmontessoricharter.com/wp-content/uploads/2018/07/Minutes-2.16.18-and-2.20.18-signed-VH.ML_.pdf
|
2019-05-23T06:08:00Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257100.22/warc/CC-MAIN-20190523043611-20190523065611-00271.warc.gz
| 175,468,423 | 592 |
eng_Latn
|
eng_Latn
| 0.996993 |
eng_Latn
| 0.996993 |
[
"eng_Latn"
] | false |
docling
|
[
2393
] |
JOYFUL LIVING SERVICES
MAILING ADDRESS:
TELEPHONES: 530-878-1119 or 800-704-9800, FAX
Joyful Living Services' News
E-MAIL: [email protected]
WEB SITE: http://www.joyfullivingservices.com
P.O. Box 485 Weimar, CA 95736-0485
: 530-878-1119
SEPTEMBER 2007
From The Author
WOW! That's what I have to say about how fast this summer has gone! Amazing isn't it – it's September already and what that means to us is "Back to School" both for my kids and for
JLS students. Josephine is going into 1 st grade. Amazing! A lot of you have been with us for years and were around before Josephine so it's amazing to me to realize that's she's 6 years old. Joshua seems like he was just born and now he's 4 and next year he will be going to kindergarten. Once again, WOW! It's amazing how "fast" time flies. I was reading a newsletter that was talking about our "perception" of time and how our lives have become faster and faster. Isn't it true? Seems just about everyone I speak to these days is spinning like a top and they don't seem to know which end is up. Not only do our days fly by but we have all the tools to help us move even faster including super fast computers, fast lanes on the highways, cell phones, e-mail, and a whole load of other technologies created to help make our lives easier living at the fast pace that we live at. Luckily for me I still have a little bit of slowness around me since I live in the foothills surrounded by oak and pine trees and I still can see the milky way at night and the big dipper. At least I have a little bit of "country" to see out my window while I'm busy working on these newsletters! Moving so fast has become second nature to most of us. Even retired people are saying that they are going all the time and they're busier than they were when they were working when they were younger? Even the earth is supposedly turning faster. Where does all this "fastness" lead us? Does this mean we are a more efficient society? Or is this something we are all in denial about? I do know that people are "burning the candle at both ends" and burning out their adrenals. I see it every time I look into someone's iris in the adrenal areas and the pupils. Because of this Starbucks is making billions while people drive up to their window hoping for a way to wake up in the morning before their day begins. There has to be a better way don't you think? How about Kneipp baths? Those will certainly stimulate the circulation and wake you up in the morning without the added caffeine. How about a liquid vitamin, an adrenal supporting supplement, and even Ginseng or Spirulina. How about some daily meditation to help us center and relax or even a calming bath with some catnip tea. There are so many ways to calm down and unwind. Soft music, a good book, or a good movie can do the trick. Finding a way to wind down after a crazy day is a must. Spending time with plants that don't talk to me and listening to the chickens talk while they eat is my soothing comfort. I hope you find your soothing comfort. Brenda
1
VOL. 16, NO. 2
Shop Online
We are continuously updating our online shopping cart. You can order all our products online using PayPal. PayPal is a secure system that requires your e-mail address. It's free to use and was created by Ebay. To find out about PayPal go to http://www.paypal.com. To access our online shopping cart, go to http://www.joyfullivingservices.com/products.html. We look forward to doing online business with you!
VitaWave Liquid Vitamin/Mineral (Helping Your Body Stay Healthy)
Not only do I notice issues with the adrenals when I look into
the irises of our clients, but I also find very low vitamin and mineral counts through muscle testing. VitaWave has been the only product I've found so far that seems to reverse these issues. When following up with clients I see their counts come up pretty rapidly once they begin the VitaWave. Liquid vitamins and minerals are absorbed very quickly whereas tablets and capsules take time.
Benefits:
*Provides vital nutritional support.
*Tastes great with natural black raspberry flavor.
*Convenient, in an easy-to-take liquid form.
*Contains minerals that support the body at a cellular level.
A number of people today do not get optimal levels of essential vitamins and minerals. NSP VitaWave provides 100 percent or more of the Daily Value of 17 important vitamins and minerals. It is flavored with natural black raspberry, which also offers strong antioxidant protection.
The 17 essential vitamins and minerals are found in a base of healthful herbs, an amino acid blend, plant-derived trace minerals and a body-supporting blend of healthful nutrients like lutein and lycopene, two proven antioxidants.
The Herbal Blend contains 320 mg Asian ginseng root, damiana leaf, oat straw aerial parts, stevia leaves, saw palmetto fruit, stinging nettle leaf, green tea leaf extract, bilberry fruit extract and grape seed extract.
The Amino Acid Blend contains 220 mg taurine, alanine, arginine, aspartic acid, cysteine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, and valine.
The Body Support Blend contains 95 mg Vitamin C (ascorbic acid), alpha-lipoic acid, citrus bioflavonoids, inositol, paminobenzoic acid, choline bitartrate, lutein, lycopene (from tomato powder), vitamin D3 (cholecalciferol) and folic acid; plus Dead Sea salt, plant-derived trace minerals (10 mg) and boron (from boric acid) (2 mg).
Other ingredients include purified water, natural fruit flavoring (blackberry, raspberry, orange and mango), citric acid, potassium benzoate and potassium sorbate as preservatives, xanthan gum and natural coloring.
Adults: Take 2 tablespoons (1 oz.) daily with a meal.
Children: Take 1 tablespoon (1/2 oz.) daily with a meal.
Each serving of VitaWave contains:
If you think this product may help you with energy and rebuilding and maintaining your health, contact us at 800-7049800 or 530-878-1119. The Stock Number = 3332-3.
2
Vagus Nerve
Either of the tenth and longest of the cranial nerves, passing through the neck and thorax into the abdomen and supplying sensation to part of the ear, the tongue, the larynx, and the pharynx, motor impulses to the vocal cords, and motor and secretory impulses to the abdominal and thoracic viscera. Also called pneumogastric nerve.
'Vagus' means 'wanderer' — and that is indeed what these nerves are. Attached to the brain stem, and emerging through the base of the skull into the neck, the right and left vagus nerves innervate through their branches a widespread range of body parts, from the head down to the abdominal organs.
These nerves contain fibres that are both incoming to the central nervous system (the majority) and outgoing from it. Sensory information comes from the external ear and its canal, and from the back of the throat (pharynx) and upper part of the larynx. Longer fibres travel in the branches of the vagi from the organs in the chest and in the abdomen: from the lungs and the heart, and from the alimentary tract, including the oesophagus and right down to half way along the colon. The incoming signals lead to many reflex responses, mediated at cell stations in the brain stem, and entailing either autonomic or somatic motor responses. For example: irritants in the airways stimulate vagal sensory nerve endings and lead to a cough reflex; information on the state of inflation of the lungs causes modification of the breathing pattern; distension of the stomach leads to reflex relaxation of its wall.
The outgoing, motor fibres in the vagus nerves represent most of the cranial component of the parasympathetic division of the autonomic nervous system. Vagal stimulation slows the heart beat, and excessive stimulation can stop it entirely. When Otto Loewi first showed, in 1921, that stimulation of the vagus nerve to a frog heart caused something to be released that could slow down another heart that was linked to the first only by fluid perfusion, he called the unknown factor Vagusstoff. We know now that vagal nerve endings act on the heart's pacemaker by the release of the transmitter acetylcholine; this modulation of the heart rate is continuous, counterbalancing the action of the sympathetic nerves at the same site. The vagus nerves also provide a pathway for reflex reduction of the cardiac output if the blood pressure tends to rise. In the lungs, they stimulate the smooth muscle in the wall of the bronchial tree, tending to increase the resistance to airflow (by causing bronchoconstriction), again counterbalancing the sympathetic effect which tends towards relaxation. In the alimentary tract they stimulate smooth muscle in the walls of the stomach and of the intestines, acting through the nerve networks between the layers of smooth muscle, but they have the opposite action on the smooth muscle sphincter that tends to prevent the stomach contents from moving on. They stimulate glandular secretions of stomach acid and of the digestive enzymes that are released into the stomach and intestine, and the ejection of bile from the gall bladder. They also influence the release from the pancreas of the hormones that promote the storage of absorbed nutrients. All these effects add up to support of activity in the alimentary system during and after eating, when the parasympathetic effects predominate over the opposite quietening effects of the sympathetic nerve supply.
The term 'vaso-vagal' attack refers to fainting, when — from a variety of causes ranging from emotional shock to the pain of injury — there is a strong parasympathetic outflow in the vagus nerves, causing slowing of the heart that leads to a fall in blood pressure sufficient to cause unconsciousness.
Cellular Energy
Cellular Energy [Vital Nutrition, Glandular] contains vitamins, minerals, amino acids and other co-factors involved in vital processes that are important for normal energy production and cellular metabolism.
In addition to their nutritional value, the ingredients in Cellular Energy exert reasonable antioxidant effects that may help address some of the metabolic issues that affect energy production.
The B vitamins in Cellular Energy perform important biochemical functions in cellular energy metabolism.
Manganese and magnesium support muscular and skeletal systems, while zinc universally supports all body systems either as an integral part or as a component of enzymes and hormones.
People who experience fatigue, reduced stamina, feelings of weakness or who need an energy boost for prolonged physical activity could benefit from supplementing their diets with Cellular Energy.
It provides highly absorbable forms of the vitamins and minerals needed to boost cellular metabolism.
Cellular Energy contains generous amounts of:
Vitamin B1
Vitamin B2
Vitamin E
Niacin
Pantothenic Acid
Zinc
Manganese
Ferulic Acid
Alpha Lipoic Acid
Alpha-ketoglutaric Acid
L-carnitine
Coenzyme Q10
Dimethyl glycine
Adults: Take 1 capsule twice daily with a meal.
If you think this product may help you with energy and rebuilding and maintaining your health, contact us at 800-7049800 or 530-878-1119. The Stock Number = 1879-6.
Anatomy & Physiology
This month we are starting an anatomy & physiology section in our newsletter. We plan to write something about anatomy and physiology in each newsletter. This month is about the nervous system to go right along with the busy lives we all seem to lead. The following is taken from our anatomy & physiology course.
The nervous system is the major controlling, regulatory, and communicating system in the body. It is the center of all mental
activity including thought, learning, and memory. Together with the endocrine system, the nervous system is responsible for regulating and maintaining homeostasis.
Through its receptors, the nervous system keeps us in touch with our environment, both external and internal.
3
Like other systems in the body, the nervous system is composed of organs, principally the brain, spinal cord, nerves, and ganglia. These, in turn, consist of various tissues, including nerve, blood, and connective tissue. Together these carry out the complex activities of the nervous system.
The various activities of the nervous system can be grouped together as three general, overlapping functions:
1. Sensory
2. Integrative
3. Motor
Millions of sensory receptors detect changes, called stimuli, which occur inside and outside the body. They monitor such things as temperature, light, and sound from the external environment. Inside the body, the internal environment, receptors detect variations in pressure, pH, carbon dioxide concentration, and the levels of various electrolytes. All of this gathered information is called sensory input.
Sensory input is converted into electrical signals called nerve impulses that are transmitted to the brain. There the signals are brought together to create sensations, to produce thoughts, or
to add to memory; Decisions are made each moment based on the sensory input. This is integration.
Based on the sensory input and integration, the nervous system responds by sending signals to muscles, causing them to contract, or to glands, causing them to produce secretions. Muscles and glands are called effectors because they cause an effect in response to directions from the nervous system. This is the motor output or motor function.
Nerve Tissue
Although the nervous system is very complex, there are only two main types of cells in nerve tissue. The actual nerve cell is the neuron. It is the "conducting" cell that transmits impulses and the structural unit of the nervous system. The other type of cell is neuroglia, or glial, cell. The word "neuroglia" means "nerve glue." These cells are nonconductive and provide a support system for the neurons. They are a special type of "connective tissue" for the nervous system.
Neurons
Neurons, or nerve cells, carry out the functions of the nervous system by conducting nerve impulses. They are highly specialized and amitotic. This means that if a neuron is destroyed, it cannot be replaced because neurons do not go through mitosis. The image below illustrates the structure of a typical neuron.
Each neuron has three basic parts: cell body (soma), one or more dendrites, and a single axon.
Cell Body
In many ways, the cell body is similar to other types of cells. It has a nucleus with at least one nucleolus and contains many of the typical cytoplasmic organelles. It lacks centrioles, however. Because centrioles function in cell division, the fact that neurons lack these organelles is consistent with the amitotic nature of the cell.
Dendrites
Dendrites and axons are cytoplasmic extensions, or processes, that project from the cell body. They are sometimes referred to as fibers. Dendrites are usually, but not always, short and branching, which increases their surface area to receive signals from other neurons. The number of dendrites on a neuron varies. They are called afferent processes because they transmit impulses to the neuron cell body. There is only one axon that projects from each cell body. It is usually elongated and because it carries impulses away from the cell body, it is called an efferent process.
Neuroglia
Neuroglia cells do not conduct nerve impulses, but instead, they support, nourish, and protect the neurons. They are far more numerous than neurons and, unlike neurons, are capable of mitosis.
Axon
An axon may have infrequent branches called axon collaterals. Axons and axon collaterals terminate in many short branches or telodendria. The distal ends of the telodendria are slightly enlarged to form synaptic bulbs. Many axons are surrounded by a segmented, white, fatty substance called myelin or the myelin sheath. Myelinated fibers make up the white matter in the CNS, while cell bodies and unmyelinated fibers make the gray matter. The unmyelinated regions between the myelin segments are called the nodes of Ranvier.
Tumors
In the peripheral nervous system, the myelin is produced by Schwann cells. The cytoplasm, nucleus, and outer cell membrane of the Schwann cell form a tight covering around the myelin and around the axon itself at the nodes of Ranvier. This covering is the neurilemma, which plays an important role in the regeneration of nerve fibers. In the CNS, oligodendrocytes produce myelin, but there is no neurilemma, which is why fibers within the CNS do not regenerate.
Functionally, neurons are classified as afferent, efferent, or interneurons (association neurons) according to the direction in which they transmit impulses relative to the central nervous system. Afferent, or sensory, neurons carry impulses from peripheral sense receptors to the CNS. They usually have long dendrites and relatively short axons. Efferent, or motor, neurons transmit impulses from the CNS to effector organs such as muscles and glands. Efferent neurons usually have short dendrites and long axons. Interneurons, or association neurons, are located entirely within the CNS in which they form the connecting link between the afferent and efferent neurons. They have short dendrites and may have either a short or long axon.
4
Schwannomas are benign tumors of the peripheral nervous system which commonly occur in their sporadic, solitary form in otherwise normal individuals. Rarely, individuals develop multiple schwannomas arising from one or many elements of the peripheral nervous system. Commonly called a Morton's Neuroma, this problem is fairly common benign nerve growth and begins when the outer coating of a nerve in your foot thickens. This thickening is caused by irritation of branches of the medial and lateral plantar nerves that results when two bones repeatedly rub together.
Organization of the Nervous System
Although terminology seems to indicate otherwise, there is really only one nervous system in the body. Although each subdivision of the system is also called a "nervous system," all of these smaller systems belong to the single, highly integrated nervous system. Each subdivision has structural and functional characteristics that distinguish it from the others. The nervous system as a whole is divided into two subdivisions: the central nervous system (CNS) and the peripheral nervous system.
The Central Nervous System
The brain and spinal cord are the organs of the central nervous system. Because they are so vitally important, the brain and spinal cord, located in the dorsal body cavity, are encased in bone for protection. The brain is in the cranial vault, and the spinal cord is in the vertebral canal of the vertebral column. Although considered to be two separate organs, the brain and spinal cord are continuous at the foramen magnum. Click here to learn more about the CNS.
The Peripheral Nervous System
The organs of the peripheral nervous system are the nerves and ganglia. Nerves are bundles of nerve fibers, much like muscles are bundles of muscle fibers. Cranial nerves and spinal nerves extend from the CNS to peripheral organs such as muscles and glands. Ganglia are collections, or small knots, of nerve cell bodies outside the CNS.
The peripheral nervous system is further subdivided into an afferent (sensory) division and an efferent (motor) division. The afferent or sensory division transmits impulses from peripheral organs to the CNS. The efferent or motor division transmits impulses from the CNS out to the peripheral organs to cause an effect or action. Click here to learn more about PNS.
Finally, the efferent or motor division is again subdivided into the somatic nervous system and the autonomic nervous system. The somatic nervous system, also called the somatomotor or somatic efferent nervous system, supplies motor impulses to the skeletal muscles. Because these nerves permit conscious control of the skeletal muscles, it is sometimes called the voluntary nervous system. The autonomic nervous system, also called the visceral efferent nervous system, supplies motor impulses to cardiac muscle, to smooth muscle, and to glandular epithelium. It is further subdivided into sympathetic and parasympathetic divisions. Because the autonomic nervous system regulates involuntary or automatic functions, it is called the involuntary nervous system.
Please let us know if you are interested in our anatomy and physiology course. It costs $300 and can be taken online or on CD-ROM. Contact us with questions and/or to place an order.
The Study of Iridology
We make it a point to put some type of iridology information in each of our newsletters. This month we are discussing the various constitutions. Please let us know if you have any questions about these items.
Constitution is important because it gives an indication of the overall "strength" of the body. Persons with poorer constitutions have a greater amount and degree of inherent weakness in their body. Generally speaking, they need to care for themselves more than others do with stronger constitutions in order to stay well. They find that they cannot abuse themselves and get away with it. They have to pay more attention to what they eat, perhaps what they wear, the climate in which they work and live, etc. Usually, the poorer the constitution, the more difficult it is to get well and stay well.
5
People with a very strong constitution often grow up abusing themselves physically because they find they can get away with it and suffer no ill consequences. They don't think about their health very much because they aren't forced to do so by feeling badly. When they do become ill, they usually have little patience with their problem and they tend to recover rapidly. Sometimes they are not always too considerate of the health problems of others with weaker constitutions who perhaps are ill more frequently or take longer to recover.
Persons with the weaker constitutions are frequently more sensitive. They know what it is like to be ill and not to recover so quickly and thus tend to have a greater sympathy with others who are not well. They are often the people found in jobs where they care for the ill. Both those with strong and those with weaker constitutions can be well and stay well. A person with a weaker constitution just needs to take a little extra care. Most people, of course, have a constitution which falls somewhere in between these extremes.
To find out more about iridology and/or to take our courses, please contact us. Courses are $200 each (beginning, intermediate, and advanced) or $450 if all 3 are ordered together.
Important Notice - The information contained in the Joyful Living Services' newsletter is for educational purposes only and should not be used to diagnose or treat diseases. If you have a disease, the author suggests that you contact a health practitioner, and do not treat the disease yourself.
|
<urn:uuid:45ec95cb-1581-4ccc-ae0b-7a316855bc68>
|
CC-MAIN-2019-04
|
http://www.joyfullivingservices.com/uploads/1/3/7/9/13798116/september2007newsletter.pdf
|
2019-01-20T07:48:50Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583700734.43/warc/CC-MAIN-20190120062400-20190120084400-00399.warc.gz
| 305,782,422 | 4,989 |
eng_Latn
|
eng_Latn
| 0.997914 |
eng_Latn
| 0.998419 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
5231,
9849,
14798,
18935,
23023
] |
Instruction Manual
For generic HA-1 15 class Sewing Machines
-1-
Your HA-1 Sewing Machine
This is a generic instruction manual for straight stitch sewing machines that are commonly known as HA-1s. The HA-1 machine is mechanically a clone of the very old Singer 15 class, such as the 15-30 or 15-87. Many later 15 class Singers, such as the 15-91, used a different shuttle/bobbin case arrangement which was mostly reversed from this style. However, this early style became so prevalent that Singer eventually switched back to the earlier arrangement.
HA-1 machines have been sold with hundreds of different nameplates, but are all essentially the same. Most of the HA-1 machines have been built in the far eastern countries since the end of WW2. There have been numerous modifications, but the basic machine has remained so similar that this instruction book will cover the important points for many machines.
The bobbins are the common 15 class, and the needles are known as 15X1 (US), 705 (H or B, European), or HAX1 (Japanese or other far eastern), followed by the # that designates the size. A US size 16 = a European size 100, size 14 = size 90, size 12 = size 80. The European # tells the actual size of the needle, such as the 100 is 1mm in dia., the 80 is .8mm in dia., etc.
Prepared by:
Bill Holman Madison, WI
TO REPLACE THE NEEDLE
To replace the needle, raise the needle bar to its highest point by turning the hand wheel (Fig. 3) TOWARD YOU by hand. Loosen the needle clamp screw (A) on the right hand side, and the needle clamp will open, allowing the old needle to slip out.
Remove the old needle and slide the new needle up, (FLAT SIDE TO THE RIGHT) as far as it will go. When the needle hits the stop, it is positioned correctly. Tighten the needle clamp screw securely. For best results change needle frequently.
NEEDLES AND THREAD
Never use a bent needle, nor one with a blunt point, since this causes imperfect stitches and may cause the needle to break. Unless the needle is in all the way, flat side to the right, the machine will not function correctly, and you will not get good results.
The size of the needle should conform to the size of the thread, and both should be suitable for the material being sewn. In most applications, use the same thread top and bottom, and always use good quality thread and needles.
THE BOBBIN CASE
Important
In the following operations, the needle must always be above the surface of the machine. In raising the needle, always turn the hand wheel toward you.
REMOVING THE BOBBIN CASE
Slide or lift the access plate. (Fig. 4) With left thumb and forefinger, open the hinged latch (A-Fig. 2) on the bobbin case, and hold securely as you withdraw it from the post. (D-Fig. 2) *Note the position of your fingers on the latch, because it is important to grip it the same way when reinserting it into the machine.
INSERTING THE BOBBIN CASE
After installing the bobbin in the case, grip the latch with your fingers in the same position* as when you removed it. (Note: If you grip it with your fingers pointed directly toward the case, it will be difficult to install it in the machine.) Guide the bobbin case back onto the post with the finger (B-Fig. 2) into the notch (C-Fig. 2). This should be an easy operation requiring no force. When you release the latch, it will snap onto the groove on the post, and the three or four inches of thread hanging free from the bobbin case will be brought up through the needle plate as shown on page 8.
WINDING THE BOBBIN
Note: This machine uses standard 15 class bobbins. The bobbin can also be wound while the machine is in operation by not releasing the stop motion knob as described below, in which case, machine and bobbin winder will operate at the same time.
While holding the hand wheel with the left hand, turn the stop motion knob toward you. This will permit the hand wheel to turn freely while the needle bar remains still. Place a spool of thread on spool pin (A). Pass the thread through the tension disk (B) at right corner of the base of the machine. Attach the thread to an empty bobbin by winding it around numerous times or inserting it inside out through one of the holes. Place the bobbin on spindle (C). Push the bobbin winder (D) down until the snaps against the hand wheel, and finger (E) drops between the sides of the bobbin. Operate the motor until the bobbin is full or the finger (E) snaps up and disengages the bobbin winder. Do not over fill the bobbin. Cut the thread, and tighten the stop motion screw while holding the hand wheel. Your bobbin is now ready to be inserted in the bobbin case (pg. 6) and installed in the machine (pg. 4).
TO THREAD THE BOBBIN CASE
Hold the bobbin case between the left thumb and forefinger with the slot up. With 4 or 5 inches of thread trailing in the direction shown…
...insert the bobbin into the bobbin case and pull the trailing thread back into the slot, down and to the left, until it snaps into the "delivery eye" under the tension spring. When you pull on the thread, looking at the bobbin in the open side of the bobbin case, the bobbin should rotate clockwise.
There should be a slight but consistent tension (drag) on the thread as it is pulled through the "delivery eye." The tension can be increased by turning the tension screw clockwise decreased by turning it counter-clockwise.
UPPER THREADING
1– Place a spool of thread on spool pin (A).
2– Bring the thread from the back of the spool, (so that the notch in the spool is up) and lead it through thread guide (B).
3- Run the thread down, between, and under the tension disks (C) from back to front.
4– Bring the thread over the guide bar (D) and through the check spring (E).
5- With the take up lever (F) in its uppermost position, bring the thread through it from back to front.
6– Run the thread through guides (G) & (H).
7– Thread the needle from left to right, drawing it through about 4-5 inches.
TO PREPARE FOR SEWING
Thread machine as per pages 6 & 7.
Pick up the bobbin thread by holding the loose end of the needle thread with your left hand while turning the hand wheel toward you until the needle moves down and up and the thread take up lever has reached its highest position.
Pull gently on the needle thread where it is looped down through the needle plate, and the bobbin thread will come up through the needle hole. (If the bobbin thread does not come up, recheck your threading, and be sure that there is 4-5 inches of thread trailing from the bobbin case.)
Finally, place both thread ends toward the rear of the machine, with the needle thread going between the two presser foot toes (A).
TO START SEWING
With the needle raised and the threads drawn back at least 4 inches through the toes of the presser foot, place the material to be sewn beneath the presser foot and lower the presser foot lift lever. Turn the hand wheel toward you until the needle enters the material. Regulate the desired stitch length (Fig. 12) and start sewing.
Do not try to help the feeding of the material by pulling by hand, as this may bend or break the needle. Gently guide the material as it feeds in the direction you want to sew.
TO REMOVE THE WORK
Stop the machine by releasing the pressure on the foot or knee control and stopping the hand wheel with your right hand. If you are stopping to turn a corner, stop with the needle just entering the material. If you are going to remove the material, stop with the needle and take up lever at their highest positions. Then, raise the presser foot lift lever, draw the material to the back about 6-8 inches, and cut the thread.
OTHER FEATURES
Fabric Selector: The height of the feed dog may be regulated according to the thickness or other characteristics of the material being sewn, by proper setting of the drop feed knob.
1– When sewing normal to thick materials, turn the knob to the "NORM" position.
2– When sewing thin materials, such as silk, which require a gentler feeding motion, turn the knob to "SILK."
3– When a situation arises when you want to move the material by hand, such as in darning or embroidery, turn the knob to the "DARN" or "EMBR" position.
PRESSURE CONTROL
The pressure control (Fig. 4, pg. 5) controls the amount of pressure that the presser foot applies to the material. Different HA-1s use two versions of the pressure control, but you can regulate it by screwing it up and down or using the snap release, to find the pressure that provides the best feeding action.
PRESSER FEET & ATTACHMENTS
Your HA-1 is equipped with a standard low shank mounting system. With this arrangement, it is easy to find almost any type of presser foot or attachment for your sewing needs.
STITCH LENGTH REGULATION
Regulating the length of the stitch: The machine can be adjusted to from six to thirty stitches per inch, as indicated by the numbers on the stitch indicator plate. Changing the length of the stitch is accomplished as follows:
Loosen the stitch length stop control (B, Fig. 12) and move it to the bottom of the slot. Move the stitch length lever (A, Fig. 12) to the desired stitch length. Now, move the stop control up until the control plate (visible in the stitch length slot) touches the bottom of the stitch length lever. Tighten the thumb screw (B) with finger pressure only. At this point, the stitch length is "marked," and you can move the lever up to sew in reverse at approximately the same stitch length, and then return it to your desired forward length.
TENSIONS
For ideal stitching, the tension on the upper and lower threads should be equal, and just sufficiently strong to lock both threads in the center of the work. (Fig. 13)
If the upper tension is too tight or the lower too loose, the needle thread will lay straight on the upper surface. (Fig. 14)
If the lower tension is too tight or the upper too loose, the bobbin thread will lay straight on the underside of the material. (Fig. 15)
Note: Most minor imperfections in the stitch can be corrected by adjusting the needle tension only.
To increase the upper tension, turn the tension knob clockwise. To decrease it,
turn counterclockwise. All adjustments should be made gradually, no more than one number at a time. When the presser foot is in the raised position, the upper tension is released, so if you pull on the thread to feel the amount of tension, the foot must be down.
If it becomes necessary to adjust the bobbin tension, this is explained on pg. 6, Fig. 7.
OILING THE MACHINE
Your HA-1 sewing machine never needs grease. All moving parts which come in contact with others must be covered with a thin film of oil, and should not be allowed to become dry. Oil, when necessary, should be applied at the points indicated by the arrows in Fig. 17, a single drop of oil is usually sufficient if applied in the right place. Oil all spots of contact on the underside of the machine. These spots can be identified by rotating the hand wheel and watching where parts move against one another. The shuttle race should be kept oiled, and frequently, it is wise to snap open the clamps that hold the shuttle retainer, and remove the shuttle to clean the race and apply oil. Once the machine has been oiled, it is wise to run it to distribute the oil, and sew some stitches on a test cloth until oil no longer appears on the thread.
Note: Use sewing machine oil only. Multi purpose oils will often dry leaving a sticky residue behind.
SEWING HINTS
See that the presser foot screw is securely tightened. It is dangerous for the foot to vibrate loose while you are operating the machine.
Skipped stitches may be caused by a bent or blunt needle, by incorrect positioning of the needle, the wrong size of needle, or by thread that is too heavy for the selected needle.
Breaking needles are usually caused by the operator pulling on the fabric in an effort to help the machine feed. This action will pull the needle out of line and it will strike the presser foot or needle plate.
Breaking the upper thread may be caused by:
1– Incorrect threading
2– Not bringing up the bobbin thread correctly
3– Upper tension too tight
4– Bad needle, or clamped incorrectly
5– Needle rubbing against attachments or presser foot
6– Needle eye too small for thread
7– Starting the machine at full speed
8– Starting machine without take up lever at highest point
Breaking the lower thread may be caused by:
1– Incorrect threading of bobbin case
2– Too tight a tension
3– Bobbin wound too full to revolve freely
4– Not bringing up bobbin thread correctly
5– Hole in the needle plate damaged by needle strikes
Uneven stitches may be caused by:
1– Presser foot not resting evenly on material
2– Feed dogs not high enough
3– Too short a stitch
4– Pulling the cloth
5– Incorrect needle for the thread, or poor quality thread
|
<urn:uuid:a03dcec1-7be5-482e-bbc2-d4696110740a>
|
CC-MAIN-2023-06
|
https://ismacs.net/singer_sewing_machine_company/manuals/ha-1-ib-wgh-instruction-manual.pdf
|
2023-01-28T17:09:04+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-06/subset=warc/part-00149-b5ddf469-bf28-43c4-9c36-5b5ccc3b2bf1.c000.gz.parquet
| 341,299,354 | 2,963 |
eng_Latn
|
eng_Latn
| 0.994679 |
eng_Latn
| 0.997547 |
[
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
66,
1326,
2351,
3511,
4683,
5379,
5956,
6666,
7640,
8722,
9517,
10499,
11466,
12840
] |
June 29, 2018 FOR IMMEDIATE RELEASE CONTACT: Kevin Spirlet, Associate Director of Media Relations 774.357.3361 [email protected]
BRISTOL COMMUNITY COLLEGE, MASSACHUSETTS MARITIME ACADEMY AND UMASS DARTMOUTH SIGN "CONNECT4WIND" AGREEMENT
Today, three of the region's top institutions for higher education signed a Memorandum of Understanding (MOU), called Connect4Wind, celebrating their long-term commitment to sharing resources and collaborating on the development of curriculum and programs centered on the offshore wind energy sector. It is the first time the three institutions have entered into a cross-collaborative agreement of this kind.
Bristol Community College President Laura L. Douglas, Massachusetts Maritime Academy Rear Admiral Francis X. McDonald and University of Massachusetts Dartmouth Interim Dean and Professor, College of Engineering Ramprasad Balasubramanian signed the Connect4Wind agreement, a shared commitment with the goal of creating a vibrant and sustainable offshore wind industry that compliments the existing and historic fishing and industrial uses of the port. It also develops a better understanding of the workforce requirements of existing models of offshore wind and deepens the understanding of offshore wind as a new industry sector with an appropriate supply chain model.
The academic partners will bring their unique expertise to the table with the commitment to share research, academic faculty and educational training facilities to encourage efficiency, and the fiscally responsible utilization of resources. The agreement further underscores the institutions shared commitment to the advancement of the regions offshore wind energy sector and Blue Economy.
"Today, we celebrate a long-term shared commitment in the development of our region's workforce," said Bristol Community College President Laura L. Douglas. "For Bristol Community College, this is one of several partnerships that further solidifies our commitment to offshore wind training and the creation of jobs. It also ensures that the region's higher education institutions will be able to support the regions offshore wind industry with highly-skilled workers, innovative training programs, and the shared-use of specialized facilities, well into the future."
"The opportunity to connect the Academy's expertise in energy and the maritime industries with Bristol Community College and the University of Massachusetts Dartmouth's expertise in workforce training and research, stands to propel Massachusetts into a leadership role in offshore wind nationwide" said Admiral Francis X. McDonald, President, Massachusetts Maritime Academy.
"UMass Dartmouth looks forward to building this partnership with Bristol Community College and Massachusetts Maritime Academy to accelerate the development of the offshore wind industry through innovation," UMass Dartmouth Interim Dean and Professor, College of Engineering Ramprasad Balasubramanian said. "Offshore wind will be a cornerstone of a regional blue economy corridor that expands opportunity for people and communities across the region."
The Connect4Wind creates a framework for cooperative efforts, and specifically includes:
* Student Participation: Inclusion in degree or non-degree granting offshore wind academic programs at each partner institution.
* Research Collaborations: Each institution will encourage research collaborations in areas of mutual interest.
* Visit of Faculty Members: An institution's faculty members will submit teaching or research proposals for establishing visiting lectures, presentations and services at partner institutions.
* Shared Facility Utilization: Parties will identify specific teaching and research facilities to be made available for the utilization at their respective institutions.
The US Department of Energy estimates 43,000 new jobs will be created in the offshore wind market by 2030. The Massachusetts Clean Energy Center recently published an assessment of the jobs and economic impacts associated with development of 1,600 megawatts in Massachusetts. That study estimated that over the next decade, offshore wind farms will create nearly 3,000 jobs and generate economic impacts between $1.2B and $2.1B in the region.
In 2016, Massachusetts enacted legislation requiring Eversource and National Grid to purchase 1,600 megawatts of electricity generated from offshore wind farms located in the Atlantic Ocean south of Martha's Vineyard. Three major offshore wind companies currently have leases in the Massachusetts wind energy area and another lease is scheduled for the late summer. All three leaseholders submitted competitive bids in December and the Commonwealth will announce the successful bids on May 23.
About Bristol Community College
Bristol Community College is currently offering an Engineering Technology/Offshore Wind Power Technology concentration of its Associate in Science in Engineering Technology (Offshore Wind Power Technology), as well as a Certificate of Recognition in Offshore Wind Power Technician. Both programs prepare students to work as technicians for the offshore wind power industry. Students learn aspects of engineering technology such as electrical machinery, fluid systems, materials science and strength of materials, and gain hands-on experience with assembly, installation, operation and maintenance of wind power systems.
Bristol Community College is a leading resource for education and workforce development in Southeastern Massachusetts. BCC has locations in Fall River, Attleboro, New Bedford, and Taunton, along with flexible online offerings that lead to an associate degree, a career-ready certificate, or the ability to seamlessly transfer to baccalaureate colleges throughout the state and country. The College's Center for Workforce and Community Education provides customized training for businesses and the community including healthcare, workforce and sustainable initiatives, and corporate services. The BCC Foundation, a non-profit organization utilizing community donations and partnerships, supports the College's mission to meet the lifelong educational needs of the community. For more information, visit http://www.bristolcc.edu/aboutbcc/.
About Massachusetts Maritime Academy
Massachusetts Maritime is your college for - Emergency Management, Energy Systems Engineering, Facilities Engineering, International Maritime Business, Marine Engineering, Marine Transportation, and Marine Safety and Environmental Protection.
We also offer graduate programs in Emergency Management and Facilities Management.
About University of Massachusetts Dartmouth
UMass Dartmouth is a Tier 1 national research university that provides a private college educational experience and a public university value. The university is dedicated to engaged learning and innovative research resulting in lifelong student success.
Located on 710 acres on the SouthCoast of Massachusetts, UMass Dartmouth is 15 minutes from the ocean. It is home to a $27 million research enterprise and is the only Massachusetts research university located south of Boston. The university's civic engagement initiatives generate more than 250,000 hours of student community service each year and places the university in the top 3 percent nationwide on the President's National Community Service Honor Roll. UMass Dartmouth offers students high-quality academic programs through 50 majors and 40 professional and doctoral programs, including the UMass School of Law, the state's only public law school.
|
<urn:uuid:11576962-c740-4710-a44c-4c48ee412bb9>
|
CC-MAIN-2018-30
|
http://bristolcc.edu/media/bcc-website/2017buildimages/documents/PR,Connect4Wind.pdf
|
2018-07-21T19:37:28Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676592654.99/warc/CC-MAIN-20180721184238-20180721204238-00273.warc.gz
| 53,308,138 | 1,335 |
eng_Latn
|
eng_Latn
| 0.991859 |
eng_Latn
| 0.993965 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1718,
4747,
7563
] |
Reconciling Instructors’ and Students’ Course Overlap Perspectives via Linked Data Visualization
Fouad Zablith and Bijan Azad
Abstract—Research on the use of modeling and mapping tools in curriculum management is thriving, often focusing on the perspectives of the faculty alone. However, scholarly works that also incorporate the students’ curriculum concerns are rare. A recurring theme in students’ curriculum concerns is the perceived overlap among courses, which is expressed at the level of course concepts across courses. This common “concept” overlap imposes a challenge for modelers, who often focus on the course level comparisons because they usually lack tools with sub-course (concept) level granularity. This paper investigates how to model and represent curriculum information to help in reconciling the gap between instructors’ and students’ views of cross-course overlap. The proposed approach involves the design and development of a digital environment to 1) model a curriculum via linked data through an ontology representing concept-level granularity; 2) offer instructors aid in populating the curriculum; and 3) facilitate the visualization and manipulation of data. The visualization tools are designed to offer functions for perceived common concept overlap identification and rectification. This digital environment was deployed and evaluated in the context of a curriculum review process, in which 25 course instructors employed the visualization tools to address a perceived course overlap problem. The preliminary results demonstrate, first, the usefulness of the approach in reconciling the views of instructors and students regarding perceived course overlap. Second, the results highlight that the approach contributes to transforming course overlap from a fuzzy notion to a more concrete and actionable construct defined as either repetition or reinforcement.
Index Terms—Course overlap, curriculum mapping, knowledge graphs, linked data, ontologies, semantic web, visualization.
I. INTRODUCTION
In the last two decades, the influence of accrediting bodies as well as competition among programs and schools have forced universities to institute more systematic approaches to whole curriculum design, management, and transformation (e.g., [1]). Simultaneously, the traditional curriculum management approach of focusing on syllabi, course catalogs, and the list of course sequences/prerequisites has increasingly given way to curriculum mapping and modeling studies (e.g., [2]). More specifically, a problem area that is starting to attract the deployment of visualization tools in combination with curriculum mapping and modeling involves ensuring that university degree plans contain the least amount of ‘overlap’ possible across courses to increase efficiency (e.g., [3]). However, capturing potentially different stakeholder perspectives on course overlap—e.g., those of instructors and students—has remained secondary within this research.
As such, designing, deploying, and evaluating a novel integrated configuration of modeling, mapping, and visualization components under one roof in order to analyze course overlap from the perspectives of instructors and students can both help advance our understanding of the overlap problem and provide us with a repertoire of curriculum modeling tools. Students often focus on perceived overlap among courses, stating, for example, “but we studied five forces of strategy in marketing too!” or “five forces were covered in management!” Perceived overlap requires zeroing in on common phrases (e.g., concepts) as basic elements of commonality among courses. However, instructors often rely on course-level representations to navigate and explore the substance of overlap because traditionally there is a dearth of curriculum management tools and models at the (sub-course) level of concepts. This creates a gap between what students consider as overlap, and the curriculum administrators’ ability to respond to such feedback. Furthermore, as one starts to focus on the notion of ‘overlap’ among courses, a host of definitional, granularity, and ontological as well as practical issues take on urgency. For example, one might ask such questions as, “How should the difference between perceived and substantial overlap be incorporated in modeling environments?” “How should the overlap be represented?” “How should it be displayed?” “What should be done to enable finding it,” and “What should be done once the overlaps are found?” Our paper aims to contribute to this literature. Therefore, we propose to investigate the following research question: How should we model, represent, and visualize curriculum information to enable us to reconcile perceived versus substantial overlap, so that we can detect and rectify the latter?
In this exploratory study, the objective is to investigate how linked data, coupled with appropriate visualization tools, can help in identifying course overlap and reconciling the perception of overlap versus its substantial existence. To operationalize this objective, we design and develop a digital integrated framework to 1) model curriculum-linked data following an ontology to represent curriculum courses, topics, and relations down to the level of concepts; 2) populate data to capture, store, and publish curriculum-linked data; and 3) manipulate and visualize the data through a set of four different visualizations that provide a variety of features to represent overlap at the sub-course granularity levels. We then perform a preliminary evaluation of the proposed approach via an international accreditation-based initiative, in which 25 faculty members participate in the overlap detection and rectification task as part of the curriculum review of an AACSB-accredited business school. The initial results highlight the utility of the proposed curriculum model design as well as the associated digital environment in supporting the process of course overlap detection and rectification. We believe there are many lessons to be learned from our attempt at reconciling the instructor and student perspectives.
Our study contributes to the extant research on curriculum modeling, mapping, and visualization in two ways. First, we propose a modeling environment that can capture and integrate instructor and student perspectives on course overlap more comprehensively, efficiently, and effectively. Second, our empirical analysis led us to construct a general scheme whereby course overlap can be either classified as knowledge repetition or as knowledge reinforcement.
The remaining parts of the paper are structured as follows. Section II presents the background and related work in the field. Section III discusses the research methodology, followed by the evaluation of the approach presented in Section IV. Section V concludes the paper with a discussion of the contributions, research limitations, and future research directions.
II. BACKGROUND AND RELATED WORK
A. Managing Curricula via Course Modeling and Mapping
The analysis of educational programs often involves exploring alternatives and pinpointing observations, and subsequently introducing a curricular change or reform [4]. When curricula are subject to change, educational organizations too often face the significant challenges of the so-called “needle in a haystack syndrome” [5]. Many factors contribute to this problem, including for instance 1) the fact that curricula knowledge are often black-boxed and spread across various sources in the organization (e.g., course syllabi and catalogs); and 2) the lack of appropriate tools to capture and represent sub-course curriculum content, for example at the level of concepts, to enable more granular information for decisions fit for the task at hand. Tackling such challenges can be a boon to educational organizations’ efforts to provide students with a better learning environment. In fact, the effective and efficient management of perceived course overlap is seen as a core strategy of universities to improve students’ education experience [6].
Indeed, we are witnessing increased research interest in supporting solutions for a variety of problems in curriculum analysis. For example, Gluga et al. [2] focus on modeling university curricula by mapping courses’ learning objectives. They propose a “lightweight” curriculum mapping approach to align the learning goals supported by multiple internal and external accreditation bodies. Their method involves an ontology that maps the different curriculum elements concerning learning goals, which are used to develop a digital platform to analyze courses with respect to the related learning objectives. Other efforts have focused on investigating techniques for visualizing curriculum content [3], [7]. Siirtola et al. [3] investigate an approach for visualizing curriculum content and the associated overlap. They propose a visual tool that can support the identification of overlap instances across degree programs among faculties. However, they highlight the labor-intensive nature of the work required to bring lecturers together for mapping the overlapping topics in the curriculum. One of the challenges they face is how to align the different instructors’ approaches in mapping curriculum topics at the appropriate and relevant abstraction and granularity levels. We see an opportunity to extend these lines of work by providing an integrated web-based environment to model, collaboratively create, and visualize curriculum data to afford the appropriate level of granularity.
B. Linked Data in the Education Domain
The web is increasingly seen as a platform to deliver personalized tools and applications that are adaptive and accommodate evolving user needs [8]. Numerous applications have been studied in different contexts including education, leading to the development of adaptive educational hypermedia in online learning environments [9]–[11]. Since the inception of the Semantic Web vision [12] and linked data [13], content published on the web has increasingly incorporated entities with explicit and machine-processable semantics. Linked data relies on using ontologies and common vocabularies to make it possible to establish links at the data level—rather than at the document level—on the scale of the World Wide Web. Such semantically rich and linked data are opening up opportunities to create web-based applications that are an order of magnitude smarter and more sophisticated. Anderson and Whitelock [14] concur with this view and propose a vision of an “Educational Semantic Web.” Indeed, the Semantic Web and linked data have increasingly played a more significant role in supporting learning technologies [15]–[17]. Certain challenges, however, constrain the expansion of the latter. For example, agreement on using unified ontologies to represent the educational domain is lacking [18]. Furthermore, it is argued that for such technologies to reach greater maturity and take-up, a deeper understanding is required of how specific user types (e.g., instructors in the educational domain) put such technologies into practice [19]. Specifically, understanding the potential of semantic technologies and the mechanics of their applications in assisting educational administration tasks (e.g., curriculum review and management focused on reconciling instructors’ and students’ views) remains an under-explored area of research.
It is important to acknowledge the progress made so far in the domain of education. For example, common standards and vocabularies are proposed to better connect educational platforms [18]. However, research has also highlighted the heterogeneity that exists in published educational datasets [20], [21], to the extent that high-level services are needed to keep track of existing and newly emerging datasets and to increase the possibility of interlinking and reusing published data [22]. Furthermore, the major rise in the availability of
online courses and Massive Open Online Courses (MOOCs) on various platforms is increasingly seen to benefit from the use of linked data [23]. Indeed, there are several examples of successful educational applications in which videos and online materials [21], [24]–[26], research publications [27], [28], books, and scholarly articles [29] generated or adopted by various educational organizations have been successfully connected and linked.
Interestingly, the growing pool of datasets, as well as the associated linkages and tools, indicate that the lion’s share of existing linked data approaches in educational contexts are focused on interlinking high-level resources and data. The available vocabularies reflect this fact, as indicated by the major vocabulary catalogs (e.g., Linked Open Vocabularies (LOV) [22] and Linked Education [30]). Examples in this context include the Academic Institution Internal Structure Ontology (AIISO) [31] and the Courseware ontology [32]. These vocabularies largely represent university-level curricula and at best may go down as far as course-level representations. Therefore, we observe that linkages represented by these vocabularies do not capture information deeper than the subject and high-level content coverage of the courses. This situation constrains the types of tasks that can be performed, especially curriculum management tasks that may require more granular curriculum information that students can relate to (e.g., concepts in the context of cross-course overlap).
Others, for example Poore [33], have identified several teaching and learning tasks that can be supported by Semantic Web technologies—e.g., seeking out educational content, planning courses, and deciding upon curricula. However, so far there appear to be few scholarly works that attempt to put such technologies in the service of practical curriculum review and analysis—e.g., tackling students’ views of course overlap, which requires the ability to capture data at a more granular level than the existing Semantic Web and linked data vocabularies. Our work aims to address this literature gap in two ways. First, we propose a distinctive curriculum model that involves designing an ontology that builds on the available existing ontologies described above to model and map curriculum-linked data at the sub-course level of granularity. Second, we have designed, developed, and evaluated a digital environment that integrates the modeled linked data with visualization tools, supporting administrators and instructors in overlap detection and rectification tasks while incorporating students’ views of course overlap.
III. RESEARCH METHODOLOGY
A. Conceptualizing Course Overlap
Our research objective is to design, develop, deploy, and study a digitally enabled environment that allows administrators and instructors to examine issues of concern within a university faculty curriculum management context. The focal issue is to study and reflect on how designing and using such an environment could help in reconciling different instructor and student perspectives about overlap among courses within an undergraduate business curriculum. The inception of this project is traced back to a town hall meeting related to the reaccreditation of the Business School when some students complained about the repetition and redundancy in the curriculum. There were subsequent discussions with faculty members who are engaged in curriculum review and design matters in the Business School. These discussions eventually led to a formal initiative that focused on how the perceived course overlaps reported by students can be rectified.
These discussions revealed a repetitive process in the way faculty tackled the overlap issue. First, faculty largely relied on their syllabus, started browsing the topics mentioned in it, and drilled down in their books to see what is covered in certain topics. Then they looked up other courses’ content through course catalogs. Second, faculty started analyzing whether certain perceived overlaps were valuable to have, or perhaps with clarifications for to students about the presence and desirability of these overlaps. In some discussions, though, we saw faculty defending the students’ position and supporting their complaints. In other words, the faculty appeared to be equally open to classifying overlaps according to their own understanding or students’ views. Third, faculty appeared to move toward exploring concrete means of resolving the overlap in their courses. In summary, the alignment of the students’ perceived view of overlaps with the instructors’ substantial view of overlaps emerged as a three-step process: identify the perceived overlap, classify the perceived overlap, and rectify the perceived overlap.
It is important to underscore that the existing course representations via syllabi, catalogs, and textbooks provided little consistency across the curriculum. On the one hand, during our discussions, faculty emphasized that overlap can be thought of at the level of course subjects, for example between an “information systems” course and a “management” course, given that they both cover the topic of “organizational strategy.” On the other hand, an overlap between these two courses can occur, for example, at the conceptual level of “five forces of strategy,” which refers to notions at the sub-strategy level. The latter view of overlap is closer to the students’ conception, that is, it is close to perceived overlap. Hence, we converged on a relational conceptualization of perceived overlap as understood by students, as the occurrence of commonly labeled concepts across courses.
To summarize, our discussions with the faculty as well as our own analysis of the information base needed for solving the course overlap problem culminated in recognizing two key shortcomings that needed to be addressed. First, the content of courses lacked a unified and hierarchical schema, or any central repository, which made it extremely difficult to detect potential overlap across several courses. Second, without properly designed tools with the appropriate level of sub-course granularity, there is inadequate visibility of overlap manifestations for faculty members to detect, classify, and rectify overlap as perceived by students. Next, we turn our attention to describing the development of models and tools to tackle these gaps.
B. Developing a Course Overlap Analysis Information Base
To enable instructors to analyze the course overlap situation, it would be helpful to develop a modeling environment
that provides sub-course level information features to detect, classify, and rectify perceived overlap. Toward that end, we propose an integrated environment that provides the following components and associated functions as depicted in Fig. 1: 1) a component that provides curriculum linked data modeling functionalities through an ontology that can represent common information among courses, topics, and corresponding concepts—the whole representing perceived overlap; 2) a component that offers capabilities to collaboratively populate the curriculum model with relevant data via capturing, storing, and publishing course content data using a Semantic MediaWiki; and 3) a component that provides visualization and manipulation features for curriculum content to enable perceived overlap detection and rectification at relevant granularity levels—namely, common concepts and related topics across courses.
1) Modeling curriculum-linked data using an ontology: We discuss in this part how our proposed ontology can help model and represent curriculum entities and relations that are a core requirement for linking courses with common concepts. The ontology enables user control over the creation of the linked data entities. Also, because the ontology follows a well-defined structure, it facilitates the reuse and streamlined processing of curriculum data. Every node defined in the ontology will have an explicit type (e.g., course) with semantic relations to other entities (e.g., a course related to a certain topic). Consistent with the state-of-the-art principles of linked data [13], we employ existing ontologies to enable an easier exchange of data with external entities. Based on relevance and fit for our application, we reuse, combine, and extend entities from existing ontologies, namely Courseware [32] and AIISO [31]. These were identified via the main vocabulary catalog providers [22] and online aggregators of linked data in the educational contexts (e.g., the Linked Education website [30]).
Fig. 2 presents the proposed ontology and its associated context with the reused ontologies. A “course” entity (reused from AIISO) has a “code” (also reused from AIISO), and a certain “number of credits” (reused from Courseware). It is “taught at” (reused from Courseware) a certain “organization” (reused from AIISO), “has prerequisite” (defined by our ontology using our wiki namespace), “has subject” (defined by our ontology using our wiki namespace), and “covers topic” (defined by our ontology using our wiki namespace). The topic entities “include” “learning concepts” (defined by our ontology using our wiki namespace). For example, a course on the “foundations of information systems” can be part of the “information systems” subject, and covers different topics such as “database processing,” “business intelligence,” and others. Each topic usually covers more granular “concepts” such as “structured query languages” that are part of the “database processing” topic.
The nodes that are directly connected to the “course” entity in the core of the model are identified from the courses’ syllabus structure that is traditionally used to describe courses at the Business School. For example, “topic”, “credit hours,” and “subject” are explicitly defined in syllabus documents and can be easily combined to perform high-level course comparison and analysis. In addition, a key objective of this research is to offer the ability to identify and analyze perceived overlap among courses within the curriculum at different granularity levels that are consistent with students’ views of overlap. This will allow perceived course overlap to be assessed and rectified by instructors. Such analysis would require fine-grain information that goes beyond syllabus information (e.g., what is taught within each topic), and is thus more complex. Capturing sub-course information via concepts is a key ontology design feature, which can enable us to implicitly and indirectly model overlap through the common concepts in courses.
Another added value of such ontology is the ability to standardize the connections among courses in the curriculum in a coherent way at the sub-course level. Furthermore, the ontology helps in de-black-boxing the common cross-course connections that were formerly latent. For example, it is possible now to perform information comparison across courses quickly and to consider analyzing concepts covered according to their topics within a course, or according to their course within a subject, or according to their subject within a faculty (i.e., organization). Our ontology allows for enhanced customization and ease of use in tackling a complex hierarchy of courses, topics, and concepts.
2) Populating curriculum data: capturing, storing, and publishing linked data using a Semantic MediaWiki: We deployed a Semantic MediaWiki to collaboratively capture, store, and publish the curriculum-linked data. We involved faculty and teaching assistants to capture the data using the MediaWiki. The wiki is part of a larger project that aims to link university data. The platform is accessible online and is available for anyone to access and to contribute to [34]. One of the features of the Semantic MediaWiki that played a major role in deciding to use this wiki is the presence of “forms.” Such forms serve as a control mechanism to populate and extend the curriculum data following the proposed ontology. We hardwired our ontology with the wiki forms, which we designed to populate and interlink the various elements, such as courses, topics, learning goals, teaching materials, and concepts. The linking is performed by controlling the input boxes and by explicitly specifying the type of entity expected to be entered following the ontology (e.g., course, concept, and others). Subsequently, the interface would automatically provide relevant entities that are already present in the wiki, so that the user could reuse such entities and create the links. The latter step rendered perceived overlap manipulable and visible to instructors. Another important feature was the presence of unique resource identifiers (URIs). These URIs are one of the fundamental features of linked data and were crucial in enabling the creation of semantic linkages among entities in the curriculum—this was a core prerequisite for enabling the representation of overlap as common concepts across the course level.
The curriculum entities were generated based on a two-step process. First, principal investigators and teaching assistants (TAs) manually examined all the course syllabi and created a high-level representation of courses including the covered topics, course description, prerequisites, etc. In the second step, additional information on concepts was identified
from textbook materials. Following a “knowledge factory” process [35], we trained course TAs, who identified, extracted, and encoded concepts from the books. Concepts were defined as self-contained “labels” that are covered in textbooks within the topics defined in syllabi. For example, in a marketing course syllabus, the pricing strategies topic is related to the fixed and variable costs concepts in the textbook. Lecture presentations and handouts were also used as a guide to highlight the existence of common concepts among courses. TAs were instructed to identify and select the key concepts within the topics and enter them into our system via the wiki interface. TAs were also guided to reuse concepts that are automatically “proposed” to them through the wiki interface if they semantically match with the concepts of the course in the information base.
The consistency of identified and selected concepts among the different TAs was managed as follows. Initially, TAs entered the course concepts, aided by the automatic matching feature in the wiki. Subsequently, the principal investigators of the project and certain instructors did a quality assurance / quality control check of these data for consistency, and if needed, introduced any corrections, which were minimal.
In addition to capturing curriculum-linked data, the wiki was used as a platform for storing the modeled data. Given that the high performance and complex query features of full-fledged SPARQL were a low priority in our context, we relied on the wiki as the main repository for storing the linked data. In the future, if more features and querying capabilities are required, the data can be easily extracted and stored in native graph-based triple-stores to improve query performance.
Going beyond the storage of linked data, the wiki was used to publish the data for reuse in external application development. We relied on the wiki’s semantic search features to access and extract the stored data (in JavaScript Object Notation (JSON) format) following the designed ontology [36].
3) Visualizing and manipulating curriculum data: Having captured the curriculum entities and relations as linked data, our next objective was to devise a means for faculty to explore the data to detect and rectify perceived overlaps. For this purpose, we leveraged the collected linked data to create visualizations that we refer to as linked data visualizations. The linked data triples (viz., subject–predicate–object) with the explicit semantics that follow the designed ontology offered flexibility to traverse the data and selectively visualize specific data elements. We accessed the linked data following the JSON format to generate different visualization tools. The proposed visualizations were designed to provide improved visibility of the curriculum-linked data to help in depicting perceived overlap via common concepts across courses.
Based on the feedback from the School’s curriculum committee members who are involved in curriculum review and design tasks, a consensus emerged that faculty would have different expectations of the curriculum visualization tools. While some preferred more sophisticated visualization features, others opted for simple capabilities. Another requirement emerged from the discussions with the members. That is, to have a successful curriculum review and redesign, they wanted features that helped not only in exploring and identifying overlap occurrences but also in deciding what to do with such occurrences. Subsequently, we evaluated the existing online visualization packages as falling short of the needed requirements, since they provided inadequate support for visualizing the common concepts across courses in the curriculum. Eventually, based on a detailed review of “linked data visualization” [37] as well as “data visualization” (e.g. [38]) capabilities, we identified three key functionalities that needed to be provided via custom-designed curriculum mapping tools. First, the tools need to represent curriculum entities using diagrammatic features (e.g., using colors to draw the user’s attention to important elements of the curriculum). Second, the tools should be able to depict complex curriculum connections via different concept linkage features (e.g., common concepts and links among courses should be made visible).
Third, the tools need to provide users with some degree of *customizability* to perform tasks with minimum effort (e.g., changing the selection of courses to display on the curriculum map).
One of the challenges we faced was how the custom-designed tools can cater to these different requirements “under one roof.” We started by developing a visualization that rendered visible on one screen all concepts and courses and their corresponding “links.” When we shared this visualization that we dubbed Forced-Node with some committee members, some members were pleased with it, while others found it overwhelming, as it did not display a clear hierarchy of courses and concepts among the data levels. Some described it as a constantly moving “jellyfish” that is hard to follow and difficult to make sense of. Subsequently, we created an additional visualization that we called Sankey, to enable instructors to select and focus on a certain course, render it visible on the screen, and gradually unfold the concepts related to this course. Upon sharing the Sankey visualization with the committee members, again some welcomed it, while others expressed some concern about the complexity of tracing the links on the screen in a meaningful manner. Certain members asked us to display the content in a traditional tabular format that can be used as a “simple map.” Therefore, we developed a third visualization that we called a Mapping Table, which shows where each concept occurred in the corresponding topics and courses. This visualization displays all courses, topics, and concepts in one table. Then, further feedback from the committee members highlighted the need for a course-level view of how the different subjects within the curriculum compare. This motivated us to create a Treemap view of the curriculum. Via the Treemap view, users can navigate the curriculum at three different levels, starting by comparing the number of concepts covered at the subject level, and proceeding down to the course level and then the topic level.
After sharing these four visualizations with the committee members and asking them to choose the appropriate one for the course overlap analysis, they could not agree on a single tool. After some intense debate, we decided to keep all four visualizations as part of this study to avoid straitjacketing members into using one tool, as this could negatively impact the use of visualizations. The full list of visualizations that we created as part of the project for dealing with overlap and other curriculum review tasks can be tracked on the curriculum data visualization page [39]. Table I provides an overview of the features provided by our four visualization tools. We describe each of the four visualizations in more detail next.
**Forced-Node graph visualization.** The Forced-Node graph shown in Fig. 3, is a visualization that displays concepts and courses as nodes with links. At a diagrammatic level, the concepts in this visualization are connected to their courses in a node–link–node visual form. The links between the concepts and courses are created by inference through the topics—i.e., concept–topic–course relations. Colors are employed to highlight the selected nodes and provide a visual reference for the user (e.g., in Fig. 3 on the left, three nodes turned red after being selected by the user). Furthermore, the greater size of nodes reveals the higher importance of an entity in the curriculum based on its larger number of connections (commonality). Concerning linkages among concepts, this visualization gives an overview of the whole curriculum with explicit linkages. There is also the possibility of selecting specific courses for a focused exploration (e.g., Fig. 3 focuses on visualizing the perceived overlap in common concepts between a pair of accounting and finance courses). Fig. 3 on the right shows specific nodes selected from the larger graphic on the left, highlighting for example that “dividends” appears as a common concept (perceived overlap) between the accounting and finance courses. The visualization provides additional customization features, such as the ability to focus on specific nodes’ connections by clicking on them. The Forced-Node visualization is built using the D3 visualization toolkit [40]. Our choice of this JavaScript-based toolkit stems from its high degree of customizability and interactive features. This enabled us to accommodate the “whole” curriculum data on one screen, combined with the possibility to adapt to users’ distinctive need to drill down and narrow in on specific concepts.
**Sankey visualization.** The Sankey visualization, shown in Fig. 4, highlights the concepts a selected course has in common with the other courses in the curriculum. Sankey-style visuals are typically employed in industrial contexts [41]. We saw a potential value in adapting the Sankey to our context as a means of revealing perceived overlap—i.e., the existence of common concepts and topics across various courses in the curriculum. At a diagrammatic level, like the Forced-Node visualization, the Sankey visualization provides explicit linkages among the courses, topics, and concepts that are represented as nodes. In this visualization, the thicker the line connecting courses to other entities, the higher the number of common concepts. Fig. 4 is an the example in which a marketing course (the left part of Fig. 4) connects to 11 other courses in the curriculum (right part of Fig. 4). The nodes in the middle of Fig. 4 reflect the concepts that connect with the topics to their left and right. The “height” of a colored “vertical node” reflects high common concepts that involve linkages passing through this node. For example, Fig. 4 highlights the fact that the topic “managing marketing information to gain customer insights” covered in the marketing course has a large
| Features | Forced Node | Sankey | Treemap | Mapping Table |
|-------------------|-------------|--------|---------|---------------|
| **Diagrammatic** | | | | |
| Explicit Connections | ✓ | ✓ | | ✓ |
| Color Coding | ✓ | ✓ | | ✓ |
| Size Coding | ✓ | ✓ | | ✓ |
| **Concept Linkages** | | | | |
| Curriculum Overview | | | | ✓ |
| Shared Concepts | ✓ | ✓ | | ✓ |
| Path Navigation | ✓ | ✓ | | ✓ |
| **Customizability** | | | | |
| Focused View | ✓ | ✓ | | ✓ |
| Adaptive Screen | ✓ | ✓ | | ✓ |
| Filtering | ✓ | ✓ | | ✓ |
number of concepts (e.g., secondary and primary data) in common with other business courses in the curriculum. Entities with different colors are used to show the contrasts between the courses and concepts, as well as the links connecting them. The Sankey visualization displays common concepts and associated topics across courses as links. Such linkages can help with highlighting course, topic, and concept sequences and interdependence among courses in the curriculum. The interface provides users with the functionality to select a specific course in part (a) of Fig. 4. The technical process of using the Sankey is as follows. After clicking on the “submit” button, the tool first provides text-based information in part (b) of the screen, which reveals the total number of concepts covered in the course with the number of concepts it has in common with other courses in the curriculum (part (b) of Fig. 4). Then the related entities of the selected course are extracted and visualized via the Google Charts API [42]. The selected course is visualized in part (c) of Fig. 4, followed by its topics in part (d) that cover the shared common concepts in part (e) with the other courses in the curriculum. The user can trace if these common concepts exist among other topics in part (f), and finally, the other related courses are shown in part (g). The user is also able to “hover” on the links to get further information on the source and destination of a connecting link among entities.
Treemap visualization. The Treemap visualization, shown in Fig. 5, enables an incremental exploration of information covered in the curriculum. At a diagrammatic level, the Treemap visualizes the subjects, courses, and topics as nodes. The links are vertically traversed from the root of the tree (i.e., subjects), down to the tree leaves (i.e., topics). In this visualization, the size and color of the nodes are rendered based on the number of concepts that exist at each level. The concept linkages and subjects (e.g., accounting, marketing, etc.) are first displayed at the macro level. Once a subject is selected, the courses belonging to the corresponding subject are revealed. Then, when a course is selected, its associated topics are displayed. Subsequently, the number of concepts can be displayed by hovering on a topic. Furthermore, the user has the ability to drill down to the source page wiki of a specific topic. Via this visualization, curriculum links can be traversed through hierarchical connections between the nodes, with the ability to ascertain the source of concepts (i.e., back to the wiki). While traversing the tree, the categories are displayed in gray (e.g. the “business” subject and related courses in Fig. 5), and the related nodes are displayed below each category. The screen interface of the Treemap is adaptive and can automatically adjust to the content selected by the user (e.g., the node colors and sizes that are generated based on the curriculum data associated with the nodes). This visualization is also developed using the Google Charts API.
Mapping Table. The Mapping Table, part of which is shown in Fig. 6, visualizes in a tabular format the list of courses, their corresponding topics, and the covered concepts. Diagrammatically, the cells in the first row and the column headings represent the nodes, while the links in this tabular representation are denoted by an “X” mark. Colors are used to differentiate the different node types; for example, courses (depicted in the top row of Fig. 6) are colored in gray, topics are in yellow, and cells that contain common concepts are colored in red. Also, similar cases are depicted through multiple occurrences of “Xs” in the corresponding cell to show the number of times a concept is common among two topics (e.g., Fig. 6 shows that the “cash budget” concept is covered under two topics in two different accounting courses). Also, the origin of the concepts can be traced by looking up concept descriptions contained in the Semantic MediaWiki. Effectively, the Mapping Table provides a macro view of the courses as a whole within the curriculum, and at the same time, it affords the ability to zoom in at the level of course concepts. This visualization provides distinctive user customization features. For example, animated pop-up windows appear when users hover over the cells with common concepts. This would be an indication of the presence of perceived overlap. The Mapping Table is created by enclosing and importing the related course data in an HTML table and jQuery [43] elements.
IV. EVALUATION AND RESULTS
In order to assess the potential impact of our approach, we collected the feedback of faculty members at the School
of Business of one of the leading universities in the Eastern Mediterranean. As part of its accreditation process, the School formally reviews its curriculum periodically. We took advantage of one of the School’s once-every-five-years curriculum review exercises to evaluate the instructors’ use of the curriculum visualization and manipulation digital environment.
One key objective of the curriculum review of the Business School was to reduce overlap among courses in the curriculum. The motivation for this goal emanated from several students’ expressed concerns about similarities among different courses in the Business School curriculum. In line with our research objective, and in close cooperation with the School’s Curriculum Committee, an initiative was formulated for the instructors to investigate the potential overlap between their own courses and other courses in the curriculum. Twenty-five full-time faculty members who teach core courses volunteered to employ the visualization tools to detect and potentially rectify perceived course overlap. Most of the faculty members have more than seven years of experience in teaching.
Instructors were given the opportunity to explore perceived course overlap, using the tools we provided to analyze the content of their courses. They were encouraged to think aloud during the session and be as explicit as possible when using the tools. At the end of each session, we interviewed the participants and asked them a set of open-ended questions to assess their views on the four visualizations. We used the following semi-structured, open-ended questions to elicit the participants’ detailed views on several aspects of the
curriculum review process enabled by the digital environment:
- Which visualization did you find the most (and least) useful? Why did you find it the most (least) useful? Can you elaborate on the how/process?
- What kinds of things did you come across or discover that you had not expected (new discoveries/things you were not aware of in your course/curriculum)? Can you elaborate on the how/process?
- Do you have any suggestions for improving the visualizations?
- Do you have any suggestions for thinking and doing the curriculum review process as a result of today’s work with the visualizations?
- Would you like to add any further comments?
With the Institutional Review Board’s approval and the participants’ consent, the sessions during which the participants worked on the task using the curriculum mapping tools were recorded and transcribed for further analysis. In this section, we summarize 1) the data generated from the curriculum mapping step; 2) a use case on how the tools were employed in the course overlap identification and rectification process; and 3) the initial reflections and outcome of handling perceived course overlap.
A. Data Generated from the Business School Curriculum Mapping Effort
As mentioned earlier, we used in this study a Semantic MediaWiki, which is based on the linked data graph model, to capture the concepts and their connections in the School of Business curriculum. Project investigators, faculty, and teaching assistants collaboratively worked on creating and populating the curriculum data. We captured in the digital environment 20 courses in seven subjects, which cover 170 topics, aggregating more than 2500 concepts—effective and efficient handling of these concepts is a key feature of our designed environment. The number of concepts mapped in each of the seven subjects is shown in Fig. 7.
Performing an initial review of the common concept–topic links in the data reveals that approximately 20% of concepts (i.e., 500 out of 2500 concepts) are common to more than one topic in the curriculum. Thus, we may surmise that, as a preliminary estimate, the total proportion of potential cases of perceived course overlap is approximately 20%. However, determining whether these instances of perceived overlap actually constitute cases of substantial course overlap necessitates an exploratory analysis via the visualizations by the instructors. The process through which the instructors employed the digital environment to explore the existence and resolution of substantial course overlap is described next.
B. Use Case for Enabling Course Overlap Handling via Linked Data Visualization Tools
1) Course overlap handling process: identifying-classifying-rectifying: The use case was designed to dovetail with the high-level scheme described earlier. Each participant was given a task related to one of the courses she/he is teaching. The objective of the task is to investigate perceived overlap and determine whether there is a substantial course overlap to be rectified. Although users had equal access to course syllabi, textbooks, and digital visualization tools, most of the participants relied more heavily on the latter to address the task on hand. An implicit conclusion could be drawn that the digital visual tools enabled them to better interact with the curriculum content—however, testing this finding formally was beyond the scope of our research. The participants appeared more or less to follow a three-step process as described earlier: identifying a perceived overlap, classifying the overlap, and rectifying the overlap.
Identifying a perceived overlap. After listening to the problem statement related to students’ concern with perceived overlap, instructors started investigating the potential existence of a substantial overlap between their courses and others. First, most of them started exploring the different available tools. They compared the different visualizations’ features. Second, they often spent a short period of time on each of the four tools to individually manipulate the features provided. They zoomed in on the content of their course and contrasted it with the content of the other courses. They were going from a course-level view to a topic comparison, zooming into and then back out from certain concepts. During this activity, most users took notes and verbalized what they were experiencing while working with the tools. Each session lasted on average around one hour. During this time, some focused on the manipulation of the features provided by the more complex visual tools (e.g., Sankey), while others gravitated toward working with simple visual tools (e.g., Mapping Table). Third, while working with the tools, participants often pointed to perceived overlap instances that they detected. In this context, we offer a preliminary qualitative observation: the visual tools appeared to have aided users in more confidently identifying perceived overlap cases at the sub-course levels, compared to using textbooks and syllabi that were too cumbersome and labor-intensive for them to tackle otherwise.
Classifying overlap. Once users managed to identify a perceived overlap, they often paused and reflected on it. First, they started analyzing the source of this overlap. The exploratory power of the visual tools equipped the users with the ability to go beyond the boundary of their own course content and contrast it with other courses they were unfamiliar with. This provided them with relevant contextual information that enabled them to decide whether this was a case of substantial overlap. Second, we observed patterns in the users’ views on the perceived overlap. We saw instances in which instructors agreed with the students’ view that a perceived overlap was occurring in their course and should not have been the case—i.e., negative overlap. But other instructors decided that it was acceptable for sister courses to cover similar and common concepts, and challenged the students’ concerns over this, arguing that this is even beneficial for students—i.e., positive overlap.
Rectifying overlap. After identifying an overlap and classifying it, participants proceeded further to analyze the impact of the overlap on the curriculum. The look-up capabilities of the visual features enabled faculty to act on the problem. First, some argued that overlap can be reduced, as certain concepts should be covered only in specific courses. Others suggested the need for better coordination with other instructors to agree on who should teach what. Second, instructors who pointed to “positive” overlap instances often mentioned the need to keep such overlap and even extend it to other parts of the curriculum. One can make a reasonable observation that the visualizations provided not only a means of identifying perceived overlap, but also helped users rectify it by making more informed decisions. The visualizations achieved this by turning overlap from an abstract concept to a tangible one.
2) Visualization support for the overlap identification-classification-rectification process: We present in this part a detailed use case of how a specific visualization, the Sankey tool, was employed during the process of overlap identification, classification, and rectification.
Using Sankey for perceived overlap identification. Fig. 8 shows a potential sequence of steps to be followed using Sankey to identify perceived overlap. The list of courses in part (a) of Fig. 8 is extracted from the linked data source using a semantic search query. The user selects the course to explore in part (b). Then Sankey provides text-based information in part (c) about the total number of concepts covered in the course, along with the number of concepts shared with other courses in the curriculum. For example, in Fig. 8, the user can see that the principles of marketing course covers 343 concepts and has 50 concepts shared with 11 other courses in the curriculum. This textual information provides an initial indication of the presence of perceived overlap, via the number of concepts held in common with other courses. After absorbing this indicative information, the user can start visually exploring the conceptual links across the selected course by using the list of common concepts that may constitute substantial overlap among courses. The list of related courses is visualized on the right of the visualization. The explicit links that visually connect entities enable the participants to trace common concepts (often by pointing their fingers at the links on the computer screen). Referring back to Fig. 4, a few participants identified...
potential perceived overlap at the level of the “SWOT analysis” and “customer relationship management (CRM)” concepts that had thicker nodes than the others in the visualization (shown in parts (h) and (i) of Fig. 4). The size of the nodes at the course level in part (g) of Fig. 4 also highlights the degree of overlap at the course level—i.e., the number of common concepts. Thus, one can see the utility of the combined tools’ textual and visual features helping identify the existence of perceived overlap, with an appropriate amount of granularity that allows one to drill down to the level of course topics and concepts.
Using Sankey for overlap classification. Once a perceived overlap is identified, users can start drilling further down to investigate the reasons behind such overlap. By hovering the pointer over a link, the Sankey visualization lets the user dynamically “highlight” the source and target of this link (see part (d) of Fig. 8). By hovering the pointer over a node, Sankey highlights the topics connected to this node by making them bolder (see part (e) of Fig. 8). In part (h) of Fig. 4, the visualization indicates that SWOT analysis is covered in the “company and marketing strategy: partnering to build customer relationships” topic of the “principles of marketing” course. At the same time, SWOT analysis is covered in: 1) the “optimization techniques” topic of the “managerial economics” course; 2) the “introduction to operations” topic of the “operations management” course; 3) the “strategic management” topic of the “fundamentals of management and organizational behavior” course; and 4) the “internal analysis” topic of the “strategic management” course. These examples were regarded by some faculty members as instances of unnecessary overlapping concepts in the curriculum. This made them think that covering this same concept in four courses in the curriculum was a mistake that should be rectified. In another example, some information systems instructors were interested in what the Sankey visualization showed. One instructor was not aware that the CRM concept that he covers in the “organizations and information systems” topic of his “foundations of information systems” course is also covered in two topics of the “principles of marketing” course: “managing marketing information to gain customer insights” and “creating and capturing customer value” (see part (i) of Fig. 4). Even though he had already heard students stress their familiarity with the CRM concept, now it was tangibly visible to him which other courses this concept was covered in, and from which topical perspective. He mentioned to us that he regarded positively the fact that the CRM concept that he covers from a technical perspective in his course is also addressed in a sister marketing context from a business perspective.
Using Sankey for overlap rectification. A few instructors who saw the perceived overlap manifested at the level of the “SWOT analysis” concept started questioning why such a concept is covered in both Marketing and Management, especially since most students take these courses in parallel during the same semester. Some instructors suggested that this concept probably should not be given during the same semester in two courses in parallel, especially if the content is identical. Instructors thought students are unlikely to regard perceived overlap among courses as building on each other when they are given in parallel. That is, in cases where students are exposed to the same concept, without an explicit discussion (or explicit contextualization by different instructors) as to how and why they build on each other, the students are likely to complain about perceived course overlap. Instructors proposed to eliminate such cases of perceived overlap. This shows how the deployment of digital visualization tools apparently helped instructors gain a deeper understanding of students’ concerns over overlap, especially in cases where there appeared to be a substantial problem behind the perceived overlap. In certain other cases, instructors questioned the concern students expressed about the perceived overlap. In such cases, perhaps instructors should articulate explicitly to students why they are covering the same concept from a different perspective. The students are seeing any and all perceived overlaps as problematic, while from the instructors’ point of view, many student-perceived overlaps were useful to keep in the curriculum. For example, the CRM concept that appears to students as a case of perceived overlap should be contextualized so that they can see the benefits of reemphasizing this concept from different perspectives. In other words, substantively speaking, this is not a “bad overlap.”
C. Reflections on the process and outcome of handling perceived overlap
To draw lessons from the whole initiative and reflect on what general remedies we could recommend for the perceived overlap problem, we analyzed the think-aloud data from instructor interactions with the visualization tools. We employed qualitative data analysis techniques to code and extract recurring themes from these data [44]. After three rounds of coding, our analysis efforts converged on classifying the proposed rectification remedies for “perceived overlap” into two general categories: reducing repetition and extending reinforcement. That is, according to our analysis, after drilling down to better understand the substance of the overlap at the concept level, the instructors thought there was overlap among certain courses that they regarded as avoidable and negative. They used various terms, but these were largely synonymous, and we captured them under the umbrella term *repetition*. However, in other cases, the data analysis showed that instructors considered certain perceived overlap cases as positive, which helped students form a better and deeper cumulative understanding of concepts across courses. They labeled these with different but equivalent rubrics that we refer to in aggregate as *reinforcement*.
Interestingly, the instructors appeared to use an exploratory search process that allowed them to drill down, drill up, and then keep going back and forth when arriving at this classification of perceived overlap. Perhaps in retrospect, it may not be surprising that the instructors stumbled upon a dual classification system in which they deemed some instances of overlap as unnecessary repetition that could be eliminated, while judging that other cases of overlap amounted to necessary reinforcement for students. Nevertheless, we postulate that it was the deployment of the linked data visualizations that
Fig. 8. Process of using the Sankey visualization to drill down and explore potential perceived overlap.
contributed to greater visibility of these instances of overlap, and thus led to the reconciliation of and closer alignment between instructor and student views of perceived course overlaps. That is, the visual mapping tools helped transform the perceived course overlap from an abstract concept into a tangible notion that could then be properly responded to and resolved via instructor actions.
Here we provide a glimpse of our analysis, including an overall count of how many instances of perceived overlap were tackled. First, we identified the statements in the text of the interviews in which the participants mentioned the two types of overlap that emerged from the data (i.e., repetition versus reinforcement). Second, we identified the statements referencing the four linked data visualizations. The processed interview data resulted in a total of 531 “overlap” related statements by the 25 participants. In total, the tools aided the participants in the identification of 318 instances of overlap as repetition, and 213 instances of overlap as reinforcement. The breakdown is as follows: 123 cases of overlap identified by the Treemap visualization, 126 by Forced-Node, 127 by Sankey, and 155 cases by the Mapping Table.
V. DISCUSSION AND CONCLUSIONS
With increasing competition and accreditation requirements, educational institutions are under pressure to maintain well-designed curricula, while also trying to meet the demands of their students. One particular challenge faced by curriculum administrators is the difficulty in handling students’ complaints about perceived course overlap issues. One of the reasons for this problem is that students’ perceptions of overlap often arise from the granular level of concepts (sub-course), while the course representations that instructors commonly adopt (e.g., course syllabi and catalogs) do not offer this level of granularity. This makes it hard for instructors and curriculum administrators to analyze perceived overlap as reported by students, since the former lack the ability to manage and explore concepts that exist in common among courses, and evaluate whether there is in fact substantial overlap and what to do about it.
To address this issue, we designed and developed in this paper an integrated digital environment that potentially enhances the productivity and scalability of earlier curriculum management tools (e.g., [2]). Specifically, the design of the underlying environment aims to provide the enhanced level of granularity that is required for effective detection and rectification of perceived overlap at the sub-course level, across the courses in the curriculum. The design further incorporates an ontology that allowed us to model curriculum content by semantically de-black-boxing the course entities, their topics, and the corresponding concepts as linked data. This ontology played a key role in defining and relating the concepts at the sub-course level, a prerequisite for representing perceived course overlap from the students’ perspective. The management of curriculum linked data content was handled through a Semantic MediaWiki. The wiki was structured in line with the proposed ontology schema and assisted us in collaboratively capturing and storing linked data for 20 core courses, their 170 topics, and more than 2500 corresponding concepts. This would have been a daunting if not practically impossible task in the absence of digital tools. This wiki platform was further deployed to publish the curriculum content through semantic queries. The published linked data were then employed to develop four visualizations to provide a means for manipulating the curriculum through various diagrammatic, concept linkages, and user-customizable features. These visualization tools incorporated functionalities along a spectrum from simple visual features (e.g., rendering the curriculum connections in a tabular form using the Mapping Table tool), to more sophisticated and complex ones (e.g., a highly interactive network of curriculum concepts with their explicit connections depicted using the Forced-Node tool). The various features in the four tools were designed to give instructors and curriculum administrators the flexibility to employ the one they regarded as most appropriate for the task of detecting and rectifying overlap. This avoided straitjacketing them into using a single tool, which could have negatively affected their use of the digital environment.
The linked data visualizations were evaluated by observing and interviewing 25 instructors involved in the accreditation-mandated review of a business school curriculum. Our preliminary and exploratory analysis shows that the four visualizations were useful for detecting and rectifying perceived course overlap. The visualizations enabled instructors to detect the perceived “negative” overlap between common concepts, or what we refer to as repetition. These instances were candidates for potential elimination. In addition, the tools helped highlight the existence of “positive” perceived overlap that the instructors thought was useful, which we refer to as concept reinforcement. During the interviews, the participants were positively inclined toward the majority of the visual features designed and developed in this study. Some indicated that they were able to gain a deeper understanding of what a perceived overlap is. In other words, the abstract notion of perceived overlap appeared to have become more tangible and thus easier for the faculty to handle. They could visually track and see the overlapping concepts at a granular level, which was necessary for them to systematically identify the potential presence of perceived overlap as reported by students, and subsequently classify whether each case was a reinforcement type of overlap to be preserved or a repetition type to be eliminated. While the perceived overlap issue in the curriculum was a widespread student complaint looming over most courses in the curriculum, our study highlights the fact that the visualizations provided the means for a differentiated and more precise understanding of students’ concerns about perceived overlap, going beyond course-level formulations. Therefore, we suggest that the proposed ontology and visualizations contributed to transforming overlap among courses from an abstract and fuzzy notion, to a more concrete, tangible, and precise construct.
It is important to be aware of some limitations of this research. First, while the study proposes an integrated framework, the evaluation focuses mainly on the four visualization tools. Further work is required to evaluate the different components of the proposed framework, including, for example,
the usability of the wiki, and the completeness of the ontology scope and structure. Second, the study relies on feedback from course instructors. While instructors’ views are important, we believe that capturing students’ perspectives more directly can provide further insights into the impact of the visual tools on their perceptions of overlap. A third limitation of this study is that the data is collected from one business school. Conducting similar evaluations in other faculties could uncover faculty-dependent views of the notion of overlap that might potentially differ among university faculties.
Moving forward, this research can be extended in different directions. First, further studies can be conducted to understand the significance of variations in the visualization tools’ support of positive versus negative overlap detection. For example, research could focus on asking: is the ability to detect negative overlap using the Forced-Node visualization significantly greater than the ability to detect negative overlap using the Treemap? Furthermore, do the visual features adopted to represent overlap (e.g., network-based versus text-based representation) have an impact on instructors’ views of positive versus negative overlap? Additional research would be needed to answer such questions. Second, another research opportunity is to study other types of relations between courses (e.g., prerequisites) to explore their impact on the perceived overlap detection and rectification task. Third, this work can be extended to investigate the possibility of automating the overlap detection process and sending notifications for the faculty to respond to. Fourth, it may be worth investigating how the current tools proposed in this study compare to other approaches, such as topic and concept maps. Finally, it may be valuable to investigate the possibility of using the tools for solving curriculum-related issues beyond overlap. We foresee that the novel curriculum data visualizations will open new exploratory avenues that can make the process of performing university curriculum reviews more effective and efficient. We also believe that performing further studies of the impact of such tools on a variety of curriculum analyses and change processes is a promising future research direction.
Our work contributes to the curriculum modeling, mapping, and visualization literature in two ways. First, we contribute by developing a fairly generic approach to modeling curriculum linked data, coupled with four visualization tools. This approach allows instructors to explore course overlap at the granular level as perceived by students, and to resolve the identified cases of substantial course overlap. Second, we contribute by showing that perceived course overlap, when analyzed via the linked data visualizations in terms of its substance and classified either as repetition or as reinforcement, renders the fuzzy notion of overlap a concrete, tangible, and therefore resolvable problem.
REFERENCES
[1] C. L. Wang, “Mapping or tracing? Rethinking curriculum mapping in higher education,” *Stud. Higher Educ.*, vol. 40, no. 9, pp. 1550–1559, Oct. 2015, doi: 10.1080/03075079.2014.899343.
[2] R. Ghosh and K. Kay, “A Level-Set approach for modeling university curricula in term of multiple learning goal sets,” *IEEE Trans. Learn. Technol.*, vol. 6, no. 1, pp. 25–37, Aug. 2012, doi: 10.1109/TLT.2012.17.
[3] H. Siirtola, K. J. Raiha, and V. Surakka, “Interactive curriculum visualization,” in *Proc. 17th Int. Conf. Information Visualisation*. London, U.K.: IEEE Comput. Soc. Press, Jul. 2013, pp. 108–117, doi: 10.1109/IV.2013.10.
[4] A. Van Barneveld, K. E. Arnold, and J. P. Campbell, “Analytics in higher education: Establishing a common language,” *EDUCAUSE Learn. Initiative*, vol. 1, no. 1, pp. I–II, Jan. 2012.
[5] D. Bridges, “Back to the Future: The higher education curriculum in the 21st century,” *Cambridge J. Educ.*, vol. 30, no. 1, pp. 37–55, Mar. 2000, doi: 10.1080/03057640010825767.
[6] S. G. Archambault and J. Maasunga, “Curriculum mapping as a strategic planning tool,” *J. Library Admin.*, vol. 55, no. 6, pp. 503–519, Aug. 2015, doi: 10.1080/19308286.2015.1054770.
[7] R. Rollande, J. Grundspenkis, and A. Miseivics, “Suitability analysis of graph visualization algorithms for personalized study planning,” in *Proc. 2nd Int. Conf. System Theory, Control and Computing (IC-STCC’16)*, Sinaia, Romania, Oct. 2016, pp. 441–448, doi: 10.1109/IC-STCC.2016.7790705.
[8] P. Brusilovsky, A. Kobsa, and W. Nejdl, Eds., *The Adaptive Web: Methods and Strategies of Web Personalization*. Berlin, Germany: Springer-Verlag, 2007, doi: 10.1007/978-3-540-72079-9_22.
[9] E. Meils, E. Andres, J. Binderbauer, A. Frischauß, G. Goguadze, P. Libbrecht, M. Pollet, and C. Ullrich, “ActiveMath: A generic and adaptive web-based learning environment,” *Int. J. Artif. Intel. Educ.*, vol. 12, no. 4, pp. 385–407, 2001.
[10] P. De Bra, A. Aerts, B. Berden, B. De Lange, B. Rousseau, T. Santie, and S. Stappers, “Stable Paths: The adaptive hypermedia architecture,” in *Proc. 14th ACM Conf. Hypertext & Hypermedia (HYPERTEXT’03)*, Nottingham U.K.: ACM, Aug. 2003, pp. 81–84, doi: 10.1145/900051.900068.
[11] P. Brusilovsky and N. Henze, “Open corpus adaptive educational hypermedia,” in *The Adaptive Web: Methods and Strategies of Web Personalization*. Berlin, Germany: Springer-Verlag, 2007, pp. 671–696, doi: 10.1007/978-3-540-72079-9_22.
[12] T. Berners-Lee, J. Hendler, and O. Lassila, “The semantic web,” *Scientific Amer.*, vol. 284, no. 5, pp. 28–37, May 2001, doi: 10.1038/scientificamerican0501-34.
[13] T. Heath and C. Bizer, *Linked Data: Evolving the Web into a Global Data Space*. San Rafael, CA, USA: Morgan & Claypool, 2011, doi: 10.2200/S00334ED1V01Y201102WEB001.
[14] T. Anderson and D. Whitehite, “The educational semantic web: Visioning and practicing the future of education,” *J. Interactive Media Educ.*, vol. 2004, no. 1, May 2004, doi: 10.5334/jime.10.
[15] S. N. Sahoo, S. Banerjee, M. Khare, and N. Bajpai, “Added values of linked data in education: a survey and roadmap,” *Computers*, vol. 7, no. 3, p. 45, Sep. 2018, doi: 10.3390/computers7030045.
[16] C. K. Pereira, S. Siqueira, B. P. Nunes, and S. Dietze, “Linked data in education: a survey and a synthesis of actual research and future challenges,” *IEEE Trans. Learn. Technol.*, Dec. 2018, doi: 10.1109/TLT.2017.2732610.
[17] J. Jensen, “A systematic literature review of the use of semantic web technologies in formal education,” *Brit. J. Educ. Technol.*, vol. 50, no. 2, pp. 505–517, Aug. 2019, doi: 10.1111/bjet.12570.
[18] S. Dietze, S. Sanchez-Alonso, H. Ebner, H. Q. Yu, D. Giordano, and M. Maier, and B. P. Nunes, “Interlinking educational resources and the web of data,” *J. Educ. Technol.*, vol. 47, no. 1, pp. 60–91, Feb. 2013, doi: 10.1108/00313021311296312.
[19] P. Carmichael and K. Jordan, “Semantic web technologies for education – time for a ‘turn to practice’?” *Technol. Pedagogy Educ.*, vol. 21, no. 2, pp. 153–169, Jul. 2012, doi: 10.1080/1475939X.2012.696788.
[20] M. d’Aquin, A. Adamou, and S. Dietze, “Accessing the educational semantic web landscape,” in *Proc. 5th Annu. ACM Web Sci. Tech. Conf. (WebSci’13)*, Paris, France: ACM, May 2013, pp. 43–46, doi: 10.1145/2464464.2464487.
[21] D. Tabii, S. Chawla, S. Dietze, I. Mareni, and B. Fetahu, “Exploring TED talks as linked data for education,” *Brit. J. Educ. Technol.*, vol. 46, no. 5, pp. 1024–1036, Sep. 2015, doi: 10.1111/bjet.12281.
[22] P. Carretero, M. Schenke, G. A. Arcezmao, M. Poveda-Villalón, and B. Vatani, “Linked Open Vocabularies (LOV): a gateway to reusable semantic vocabularies on the Web,” *Sem. Web*, vol. 8, no. 3, pp. 437–452, Dec. 2017, doi: 10.3233/SW-160213.
[23] D. Mouroumtsev, A. Romanov, D. Volchek, and F. Kozlov, “Metadata extraction from open edx online courses using dynamic mapping of NoSQL databases,” in *Proc. 25th Int. Conf. Companion on WWW*. Montréal, Canada: ACM, Apr. 2016, pp. 501–506, doi: 10.1145/2827518.2890462.
[24] H. Q. Yu, C. Pedrinaci, S. Dietze, and J. Domingue, “Using linked data to align and search educational video resources for supporting distance learning,” *IEEE Trans. Learn. Technol.*, vol. 5, no. 2, pp. 130–140, Mar. 2012, doi: 10.1109/TLT.2012.16.
[25] F. Zablith, “Towards a linked and reusable conceptual layer around higher education programs,” in *Open Data for Education*. Cham, Switzerland: Springer, 2016, pp. 86–102, doi: 10.1007/978-3-319-30493-9_9.
[26] F. Zablith, M. d’Aquin, S. Brown, and L. Green-Hughes, “Consuming linked data within a large educational organization,” in *Proc. 2nd Int. Workshop Consuming Linked Data (COLD) at the Int. Semantic Web Conf. (ISWC)*, Bonn, Germany, Oct. 2011.
[27] S. Peroni and D. Shotton, “FaBiO and CITO: Ontologies for describing bibliographic resources and citations,” *Web Semantics*, vol. 17, pp. 33–43, Dec. 2012, doi: 10.1016/j.websem.2012.08.001.
[28] R. S. Xia, O. Hassanzadeh, C. Fritz, S. Sobrabi, and R. J. Miller, “Publishing bibliographic data on the Semantic Web using BibBase,” *Semantic Web*, vol. 4, no. 1, pp. 15–22, 2013, doi: 10.3233/SW-2012-0062.
[29] T. Pecht, R. Singer, N. Shahir, C. Clarke, and J. Leavescy, “Assembling and applying an education graph based on learning resources in universities,” in *Proc. Linked Learning Workshop (LILE’12)*, Lyon, France, Apr. 2012.
[30] “Linked education - schemas & vocabularies,” Apr. 2011. [Online]. Available: https://linkededucation.wordpress.com/data-models/schemas/ (accessed Aug. 14, 2021).
[31] R. Styles and N. Shahir, “Academic Institution Internal Structure Ontology,” 2008. [Online]. Available: http://vocab.org/aioo/schema (accessed Aug. 14, 2021).
[32] H. Gilbert, A. Mardur, T. Anderson, and B. Randell, “Resist project deliverable d14 Prototype knowledge base,” University of Southampton, Tech. Rep. D10, 2006.
[33] M. Poore, “The Next G Web. Discernment, meaning-making, and the implications of Web 3.0 for education,” *Technol. Pedagogy and Educ.*, vol. 23, no. 2, pp. 167–180, Apr. 2014, doi: 10.1080/1475939X.2013.870010.
[34] “LinkedAUB - MediaWiki.” [Online]. Available: https://linked.aub.edu.lb/collab/ (accessed Aug. 14, 2021).
[35] V. K. Chaudhri, N. Dimiex, J. Pacheco, G. Ng, P. E. Clark, A. Goldenkranz, P. Seyed, and N. Sharma, “Preliminary steps towards a knowledge discovery process,” in *Proc. 6th Int. Conf. Knowledge Capture*, Banff, Canada: ACM, Jun. 2011, pp. 179–180, doi: 10.1145/1999767.1999714.
[36] “LinkedAUB - semantic search page feature.” [Online]. Available: https://linked.aub.edu.lb/collab/index.php?Special:Ask/ (accessed Aug. 14, 2021).
[37] A. Dazdze and E. Pietriga, “Visualisation of linked data – reprise,” *Semantic Web*, vol. 8, no. 1, pp. 1–21, Jan. 2017, doi: 10.3233/SW-160249.
[38] C. Kostelnick, “The visual rhetoric of data displays: The conundrum of clarity,” *IEEE Trans. Professional Commun.*, vol. 50, no. 1, pp. 280–294, Dec. 2007, doi: 10.1109/TPC.2007.908725.
[39] “LinkedAUB - index of categories of the business curriculum linked data.” [Online]. Available: https://linked.aub.edu.lb/collab/index.php/Business_Curriculum_Analytics (accessed Aug. 14, 2021).
[40] M. Bostock, V. Ogievetsky, and J. Heer, “D3 data-driven documents,” *IEEE Trans. Visualization and Computer Graphics*, vol. 17, no. 12, pp. 2301–2309, Dec. 2011, doi: 10.1109/TVCG.2011.187.
[41] M. Schmidt, “The sankey diagram in energy and material flow management,” *J. Ind. Ecology*, vol. 12, no. 1, pp. 82–94, Feb. 2008, doi: 10.1111/j.1530-9290.2008.00004.x.
[42] “Charts - Google developers.” [Online]. Available: https://developers.google.com/chart (accessed Aug. 14, 2021).
[43] “jQuery JavaScript library.” [Online]. Available: https://jquery.com/ (accessed Aug. 14, 2021).
[44] J. Corbin and A. Strauss, *Basics of Qualitative Research*. London: Sage, 2008, doi: 10.4135/9781442230153.
|
e8e916ef-d750-4759-973e-75a5209f42c2
|
CC-MAIN-2021-43
|
https://fouad.zablith.org/docs/IEEETranLearningTech2021.pdf
|
2021-10-26T12:59:19+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-43/subset=warc/part-00166-16202947-a809-4711-8221-79ab0a79d5b1.c000.gz.parquet
| 359,406,634 | 15,715 |
eng_Latn
|
eng_Latn
| 0.945424 |
eng_Latn
| 0.996266 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
5423,
12003,
18599,
25402,
29761,
36651,
41381,
43066,
45636,
51731,
58418,
58524,
65253,
73324,
77196
] |
The Treaty Of Versailles
1919
Muhammad Najm Akbar
Gent 14
[email protected]
Interwar Period
During the last unit, I had lumped the Great War and the Treaty of Versailles in one session which is a huge historical injustice to both. In this unit, we will not return to the Great War directly but refer to it in all four lectures beginning today with the Treaty of Versailles and going on to the Birth of the Modern Middle East, Tensions after WWI and the Great Depression, and finally the Road to WWII.
Wilson’ War
• The President had asked the Congress for a Declaration of War on April 2, 1917, following growing German submarine attacks on American shipping including on *Lusitania* (1915) which took 128 American lives, and the deciphered Zimmerman telegram to the Mexican government (January 1917) offering collaboration to regain the territories lost in the 1848 Treaty of Guadalupe Hidalgo.
• Peace, however, always dominated Wilson’s thought. In his speech, he said, “The world must be made safe for democracy. Its peace must be planted upon the tested foundations of political liberty. We have no selfish ends to serve. We desire no conquest, no dominion. We seek no indemnities for ourselves, no material compensation for the sacrifices we shall freely make. We are but one of the champions of the rights of mankind. We shall be satisfied when those rights have been made as secure as the faith and the freedom of nations can make them…”
Wilson’s Fourteen Points January 8, 1918
The President enunciated his peace plan in his speech to Congress on January 8, 1918.
“The program of the world's peace, therefore, is our program; and that program, the only possible program, as we see it, is this:
I. Open covenants of peace, openly arrived at, after which there shall be no private international understandings of any kind, but diplomacy shall proceed always frankly and in the public view.
II. Absolute freedom of navigation upon the seas, outside territorial waters, alike in peace and in war, except as the seas may be closed in whole or in part by international action for the enforcement of international covenants.
III. The removal, so far as possible, of all economic barriers and the establishment of an equality of trade conditions among all the nations consenting to the peace and associating themselves for its maintenance.
IV. Adequate guarantees given and taken that national armaments will be reduced to the lowest point consistent with domestic safety.”
V. A free, open-minded, and absolutely impartial adjustment of all colonial claims, based upon a strict observance of the principle that in determining all such questions of sovereignty the interests of the populations concerned must have equal weight with the equitable claims of the government whose title is to be determined.
VI. The evacuation of all Russian territory and such a settlement of all questions affecting Russia as will secure the best and freest cooperation of the other nations of the world in obtaining for her an unhampered and unembarrassed opportunity for the independent determination of her own political development and national policy and assure her of a sincere welcome into the society of free nations under institutions of her own choosing; and, more than a welcome, assistance also of every kind that she may need and may herself desire. The treatment accorded Russia by her sister nations in the months to come will be the acid test of their goodwill, of their comprehension of her needs as distinguished from their own interests, and of their intelligent and unselfish sympathy.
VII. Belgium, the whole world will agree, must be evacuated and restored, without any attempt to limit the sovereignty which she enjoys in common with all other free nations. No other single act will serve as this will serve to restore confidence among the nations in the laws which they have themselves set and determined for the government of their relations with one another. Without this healing act the whole structure and validity of international law is forever impaired.
Wilson’s Fourteen Points January 8, 1918
VIII. All French territory should be freed and the invaded portions restored, and the wrong done to France by Prussia in 1871 in the matter of Alsace-Lorraine, which has unsettled the peace of the world for nearly fifty years, should be righted, in order that peace may once more be made secure in the interest of all.
IX. A readjustment of the frontiers of Italy should be effected along clearly recognizable lines of nationality.
X. The peoples of Austria-Hungary, whose place among the nations we wish to see safeguarded and assured, should be accorded the freest opportunity of autonomous development.
XI. Rumania, Serbia, and Montenegro should be evacuated; occupied territories restored; Serbia accorded free and secure access to the sea; and the relations of the several Balkan states to one another determined by friendly counsel along historically established lines of allegiance and nationality; and international guarantees of the political and economic independence and territorial integrity of the several Balkan states should be entered into.
Wilson’s Fourteen Points January 8, 1918
XII. The Turkish portions of the present Ottoman Empire should be assured a secure sovereignty, but the other nationalities which are now under Turkish rule should be assured an undoubted security of life and an absolutely unmolested opportunity of autonomous development and the Dardanelles should be permanently opened as a free passage to the ships and commerce of all nations under international guarantees.
XIII. An independent Polish state should be erected which should include the territories inhabited by indisputably Polish populations, which should be assured a free and secure access to the sea, and whose political and economic independence and territorial integrity should be guaranteed by international covenant.
XIV. A general association of nations must be formed under specific covenants for the purpose of affording mutual guarantees of political independence and territorial integrity to great and small states alike.
In regard to these essential rectifications of wrong and assertions of right, we feel ourselves to be intimate partners of all the governments and peoples associated together against the Imperialists. We cannot be separated in interest or divided in purpose. We stand together until the end. For such arrangements and covenants, we are willing to fight and to continue to fight until they are achieved; but only because we wish the right to prevail and desire a just and stable peace such as can be secured only by removing the chief provocations to war, which this program does remove.”
Wilson’s Fourteen Points January 8, 1918
• Historian Walter LaFeber says that an American journalist based in Paris by the name of Walter Lippmann had helped the President draft these points. The President had ordered a group of advisors called The Inquiry to elaborate his peace plan. When it did produce specific proposals, the President often ignored them and made his own choices. The Allies and the U.S. Senate had reservations about them from the beginning.
• The fourteen points, however, made the President exceptionally popular. Millions of people greeted him when he arrived in Europe in December 1918.
The American Expeditionary Force (AEF) parades through Paris, France, on November 12, 1918, after the end of World War I.
The Paris Peace Conference, also known as the Versailles Peace Conference, was a meeting held in 1919 to discuss the peace terms for the defeated Central Powers at the end of World War I. The conference was held in the Palace of Versailles, near Paris, France, and was attended by representatives from 32 countries. The main goal of the conference was to establish a just and lasting peace that would prevent future wars.
The conference was chaired by U.S. President Woodrow Wilson, who proposed a series of principles known as the Fourteen Points. These points included the establishment of a League of Nations, the right of self-determination for all peoples, and the disarmament of Germany. However, the other major powers, such as Britain and France, were more concerned with punishing Germany and ensuring their own interests.
The most significant outcome of the conference was the Treaty of Versailles, which was signed on June 28, 1919. The treaty imposed harsh penalties on Germany, including the loss of territory, the payment of reparations, and the disarmament of its armed forces. It also established the League of Nations, which was intended to promote international cooperation and prevent future conflicts.
The Paris Peace Conference was a complex and contentious event, with many different interests and agendas at play. Despite its flaws, it remains an important part of history and has been the subject of much debate and analysis.
The Paris Peace Conference January 19, 1919
• This is how the Daily Guardian described the participants seated around the horseshoe table at Quai d’Orsay:
The great conference was formally opened at the Quai d’Orsay, yesterday on the 48th anniversary of that scene, so calamitous to Europe, when the German Empire was proclaimed at Versailles on the eve of the capitulation of Paris....
On the right hand of M. Poincaré sat the United States delegates, on the left the British. Next to the United States representatives, round the corner of the table on the outside, came in order the French, Italian, and Belgian representatives. On either side of that end of the horseshoe were seated the Brazilian delegates, and on the inside, from the end up to the canter, came the delegates from Cuba, Greece, Haiti, Peru, Portugal, Serbia, Czecho-Slovakia, and Uruguay. On the other side of the horseshoe, to the left of M. Poincaré, next to the British delegation, sat the delegates from Canada, Australia, South Africa, New Zealand, and India; and lastly the Japanese representatives. On the inner side of the table facing them, starting from the bottom, sat the delegates from Bolivia, Ecuador, Guatemala, the King of the Hedjaz, Liberia, Panama, Poland, Rumania and Siam.
The Hall of Mirrors at Versailles, France.
The Big Four at the Paris Peace Conference, 1919: (from left to right) David Lloyd George, Prime Minister of Great Britain; Vittorio Orlando, Prime Minister of Italy; Georges Clemenceau, Prime Minister of France; and Woodrow Wilson, President of the United States.
The Petitioners
• The Peace Conference invoked high hopes in the disadvantaged communities who hoped to seek justice. They included petitioners for a restored Poland, a free Belgium, a Jewish state; an Arab republic free from British and French control; a free Ukraine, a Kurdish state, and a free Armenia. Petitions arrived in favor of rights for women and blacks; a Japanese proposal for a racial equality clause; and a state for the south Slavs (or “Yugoslavs”). Queen Marie of Romania came in person to argue for Romanian land claims and a Parisian immigrant worker lodged a proposal for the freedom of his people, the Vietnamese, from French imperial rule. History would later know him as Ho Chi Minh.
M. Poincaré tells us that justice must rule the deliberations of the peace conference. It is fine saying, and the Allied statesmen must be true to it in spirit and in word. They are under every sort of temptation to be false to it. They are the heirs of a bad tradition – the tradition of secrecy, the tradition of power, the tradition of barter. Again, there is nobody to resist them. The whole world is spread before them; they have but to stretch out their hands and take. To fortify them in resisting these temptations they have the moral spectacle of the destruction of three empires which acted as though force were the highest law. If the passionate desire of the peoples of the world for peace and justice should fail to convert the Allied statesmen, there is the powerful argument of Germany, Austria, and Russia that the way of violence and rapacious appetite does not prosper.
Allies and the Fourteen Points
• The two victors of the war, Lord George and George Clemenceau were not very enthusiastic about the fourteen points. They also knew that the Republicans were in control of the Senate and Wilson's archenemy, Henry Cabot Lodge chaired the Senate Foreign Relations Committee. In LaFeber’s view, the President failed to placate the Senate leaders. He named a Peace Commission which he headed but it included not a single senator or the republican leader. The allied leaders had strong domestic support.
• The British refused to accept the second point on freedom of the Seas.
• About number 6, the evacuation of Russia and the self-determination of its future, Wilson intervened and maintained U.S. forces in Russia.
Allies and the Fourteen Points
• Clemenceau was determined to ensure French security by crippling Germany. The European leaders focused more on the losses of the war that had taken the lives of eight million soldiers and sailors. Over one million French soldiers perished. Approximately 20 million civilians died during the war and its immediate aftermath. The French had seen 4000 towns wiped off their map. Great Britain had suffered 900,000 troops killed and two million wounded.
• While Wilson sought agreement with his principles for an open, democratic world, Clemenceau was driven by centuries of French history. Walter LaFeber quoted the President as saying, “If I didn't feel that I was the personal instrument of God, I couldn't carry on.” Lloyd George, again according to LaFeber remarked, “I think I did as well as it might be expected, seated as I was between Jesus Christ and Napoleon Bonaparte.”
Allies and the Fourteen Points
• The Allies also perceived the Bolshevik revolution as another threat on the European horizon. Walter LaFeber writes that Wilson and Lloyd George rejected Clemenceau’s proposal to take decisive military action against Lenin. They agreed instead that a Western delegation would meet Lenin at the island of Prinkipo (Büyükada, in the Sea of Marmara, near Istanbul), but the Russian White Russian army succeeded in killing the Prinkipo talks. Finally, in April 1919, Wilson sent one of his advisors William Bullitt to meet Lenin in Moscow but never considered his report. In 1920, the President decided that the United States would not officially recognize the Soviet government.
• When the participants met in Paris, Wilson defined himself as an associated nation with the Allies. Twenty-seven of them deliberated the issues but the major decisions were made by the Big Four. Finally, the Big Three because Italy left the group over a dispute with Wilson.
Allies and the Fourteen Points
• On the point about the colonized people, the mandate of principle was a compromise against the secret Treaty of London 1915 where the allies had planned to take direct control of the territories conquered from the losers, especially the German colonies. They insisted that the US must share the mandates. Wilson was not ready for it but accepted a mandate over Armenia and Constantinople, but the Senate rejected the responsibility.
• Wilson prevailed when it came to the organization of work. Instead of beginning with the treaty on Germany, the conference started with considering the covenant for the league. According to LaFeber, Wilson wrote the Covenant in ten days. After writing it, the President left Paris on February 14, 1919, for a month of business in Washington. That's where the Monroe Doctrine was included in the Covenant.
The Covenant of the League of Nations
• The Republicans, however, conveyed to the President that they would accept the peace treaty but not the Covenant. Senator Henry Cabot Lodge circulated to the Republicans a round robin which proved that 39 senators opposed the Covenant.
• On his return to Paris in March 1919, the President made more compromises. He allowed Japan to remain in Shantung despite 30 million Chinese living there. The Japanese, however, failed to convince the European leaders to include a clause in the Covenant that would uphold racial equality.
• Finally, the treaty begins with the Covenant. Here is what it says:
The Covenant of the League of Nations
Preamble:
- THE HIGH CONTRACTING PARTIES, In order to promote international co-operation and to achieve international peace and security by the acceptance of obligations not to resort to war by the prescription of open, just and honourable relations between nations by the firm establishment of the understandings of international law as the actual rule of conduct among Governments, and by the maintenance of justice and a scrupulous respect for all treaty obligations in the dealings of organised peoples with one another Agree to this Covenant of the League of Nations.
• The last major peace conference was the Congress of Vienna 1815, which we discussed in an earlier unit. Wilson showed how the state and human thinking about interstate relations in the twentieth century had evolved. The Congress of Vienna Final Document, however, had a longer life than the League.
The Covenant of the League of Nations
• Article 1 stipulates the conditions for members who could join it later provided two-thirds of the membership agreed.
• Article 2 established its two organs, an assembly, and a Council.
• Article 3 details the membership of the Assembly and grants each of them one vote.
• Article 4 names the Principal Allied and Associated Powers as five permanent members of the Council (The United States, the British Empire, France Italy, and Japan). The composition of the council included four additional members that the Assembly was to elect. For the first session, the conference named them. They were Belgium, Brazil, Greece, and Spain.
The Covenant of the League of Nations
• Article 5 stipulates the decision-making in the Assembly and the Council which is in an idealistic vein because the decisions at any meeting of the Assembly or the Council shall require the agreement of all the members of the league represented at the meeting. On procedural matters, the requirement was less rigorous. The United States had the privilege under Article 5.3 to summon the first meetings of the Assembly and the Council.
• Article 6 dealt with the Permanent Secretariat, the stuff that they would need, and how the members would fund it.
• Article 7 headquartered it in Geneva and declared its buildings in the host country or wherever it would decide to meet as an inviolable.
• Article 8 focuses on disarmament. Here is what it says:
Disarmament
• **ARTICLE 8.**
• The Members of the League recognise that the maintenance of peace requires the reduction of national armaments to the lowest point consistent with national safety and the enforcement by common action of international obligations. The Council, taking account of the geographical situation and circumstances of each State, shall formulate plans for such reduction for the consideration and action of the several Governments. Such plans shall be subject to reconsideration and revision at least every ten years. After these plans shall have been adopted by the several Governments, the limits of armaments therein fixed shall not be exceeded without the concurrence of the Council. The Members of the League agree that the manufacture by private enterprise of munitions and implements of war is open to grave objections. The Council shall advise how the evil effects attendant upon such manufacture can be prevented, due regard being had to the necessities of those Members of the League which are not able to manufacture the munitions and implements of war necessary for their safety. The Members of the League undertake to interchange full and frank information as to the scale of their armaments, their military, naval, and air programmes and the condition of such of their industries as are adaptable to war-like purposes.
The Covenant of the League of Nations
• Article 9 established a Commission to ensure the execution of the provisions of Articles One and Eight.
• Article 10 deliberates on the security issues. It forbids external aggression against the territorial integrity and political independence of the member states and mandates the Council to offer advice about how the respect for these principles being an obligation shall be fulfilled. (Senate objected to it).
• Article 11 declares that any war or threat of war should be of concern to the whole League. If there is any such issue, it had to be considered by an emergency session of the council.
• Article 12 requires members to seek arbitration if they couldn't resolve a dispute or request the Council to investigate it and agree “in no case to resort to war until three months after the award by the arbitrators or the report by the Council.”
The Covenant of the League of Nations
• Article 13 concerns the details of arbitration particularly if they're about the interpretation of a treaty or any question of international law and to respect the award of the Court of Arbitration. It emphasizes that War should not be an option and that the members “will not resort to war against a member of the League which complies with the award.”
• Article 14 established the Permanent Court of International Justice which has outlived the League and is now part of the United Nations system.
• Article 15 outlines the steps the Council takes to investigate a dispute and if the statement of facts that it approves is disregarded by a member, other members will not go to war with any party to the dispute which complies with the recommendation of the report. If there is no consensus, then the members of the League reserved the right to take such action as they shall consider necessary for the maintenance of right and justice.
ARTICLE 16.
Should any Member of the League resort to war in disregard of its covenants under Articles 12, 13, or 15, it shall ipso facto be deemed to have committed an act of war against all other Members of the League, which hereby undertake immediately to subject it to the severance of all trade or financial relations, the prohibition of all intercourse between their nations and the nationals of the covenant-breaking State, and the prevention of all financial, commercial, or personal intercourse between the nationals of the covenant-breaking State and the nationals of any other State, whether a Member of the League or not. It shall be the duty of the Council in such case to recommend to the several Governments concerned what effective military, naval, or air force the Members of the League shall severally contribute to the armed forces to be used to protect the covenants of the League. The Members of the League agree, further, that they will mutually support one another in the financial and economic measures which are taken under this Article, in order to minimise the loss and inconvenience resulting from the above measures, and that they will mutually support one another in resisting any special measures aimed at one of their number by the covenant-breaking State, and that they will take the necessary steps to afford passage through their territory to the forces of any of the Members of the League which are co-operating to protect the covenants of the League. Any Member of the League which has violated any covenant of the League may be declared to be no longer a Member of the League by a vote of the Council concurred in by the Representatives of all the other Members of the League represented thereon.
The Covenant of the League of Nations
• Article 16 constitutes the common defense. It means a delinquent state would be deemed to have committed an act of war against all other members of the league. They will then take various steps including sanctions on trade, finances, commerce, and people-to-people contacts against the violator. The Council could recommend effective military or naval force that members of the League shall contribute to the armed forces to be used to protect the Covenants of the League.
• Article 17 defines what happens when a member has a disagreement or dispute with a non-member of the League. Essentially, the non-member will have to respect the Covenant articles that might apply.
The Covenant of the League of Nations
- Article 18 creates a central registry for all treaties and agreements signed between the members. They will have to submit a copy to the Permanent Secretariat. This is another tradition that has survived as part of the UN system.
- Article 19 talks about the management of those treaties that might no longer be valid.
- Article 20 upholds the supremacy of the Covenant and abrogates all obligations or understandings which would be inconsistent with its terms.
- Article 21 excludes the Monroe Doctrine from the ambit of the Covenant. It was a concession to the U.S. Senate.
- Article 22 laid down the mandate system. We'll talk about it in detail when we will discuss the Middle East.
The Covenant of the League of Nations
• Article 23 is about the rights of Labor including men, women, and children, in their home countries or as immigrants. It requires member states to secure just treatment of the native inhabitants of territories under their control. It acts against the traffic of women and children and the traffic of opium and other dangerous drugs. It puts the League in charge of traffic in arms and ammunition with the countries that the Council might name. It also deals with international commerce which should enjoy the freedom of communications and transit and equal treatment for all members of the League. It also endeavors to prevent and control diseases.
• Article 24 makes the League a supreme organization over and above and responsible for all the existing international bureaus and commissions or the ones that might be created and determines how additional expenses will be shared.
• Article 25 protects the work of the Red Cross.
The Covenant of the League of Nations
• Article 26 is about the amendments that members might like to introduce which must be ratified by the Council and then a majority of the League.
• It includes a list of the original members, and appoints Sir James Eric Drummond, a British diplomat, as the secretary general of the League.
Beyond the Covenant
• The other parts of the treaty are about the restoration of sovereignty where it had been lost and the creation of Poland and Czechoslovak states. The bulk of it is codified hostility toward Germany.
• Part II opens with the boundaries of Germany.
• Part III, Articles 3 and 32 restore guaranteed, full sovereignty to Belgium.
• Article 40 does the same for Luxembourg.
• Article 42 defines the French role in Rhineland and Article 45 ceded Saar Basin to them. Section V restored Alsace-Lorrain to France reversing the German annexation of 1871.
• Article 80 guaranteed Austrian independence.
Poland
- Congress of Vienna Article I
- ARTICLE I. The duchy of Warsaw .... is united to the Russian empire, to which it shall be irrevocably attached by its constitution, and be possessed by his majesty the Emperor of all the Russias, his heirs and successors in perpetuity. His Imperial Majesty reserves to himself to give to this State, enjoying a distinct Administration, the interior improvement which he shall judge proper...
- The Poles, who are respective subjects of Russia, Austria, and Prussia, shall obtain a representation, and national institutions, regulated according to the degree of political consideration, that each of the governments to which they belong shall judge expedient and proper to grant them.
- Section VIII of the Paris Treaty created Poland.
Beyond the Covenant
• Article 118 disposed of the German colonies, some of which became mandates under the victors.
• Article 156 grants German Shantung to Japan.
• Part V limits German armed forces. Article 163 permits them only 100,000 soldiers.
• Article 199 arraigned the Kaiser as a war criminal.
• Article 231, Part VIII, Germany recognizes its war guilt.
Beyond the Covenant
• Article 232 imposes compensation for all damages and in the subsequent sections, the Treaty goes into minute details about them, including the establishment of a Reparation Commission to calculate the sums due.
• Article 292 abrogates all German intrusions into Russia.
• On June 28, 1919, the participants signed the treaty at Versailles.
The Give and Take
• ART. XXVI. His Majesty the King of the United Kingdom of Great Britain and Ireland, having substituted to his ancient title of Elector of the Holy Roman Empire, that of King of Hanover, and this title having seen acknowledged by all the Powers of Europe, and by the Princes and free towns of Germany, the countries which have till now composed the Electorate of Brunswick Luneburg, according as their limits have been recognized and fixed for the future, by the following Articles, shall henceforth form the kingdom of Hanover.
• ART. XXVII. His Majesty the King of Prussia cedes to his Majesty the King of the United Kingdom of Great Britain and Ireland, King of Hanover, to be possessed by his Majesty and his successors, in full property and sovereignty;...
The Treaty
• President Wilson opposed the French extreme positions on Germany to the extent that according to LaFeber, Clemenceau accused him of being a pro-German. At one point, he says, Wilson threatened to board the George Washington and return home. Clemenceau gave up his demand for French annexation of much of the German Rhineland and control of the remainder. In return, Wilson and Lloyd George agreed that French armies could occupy the Rhineland for 15 years.
• Wilson also signed a security treaty with France that guaranteed its border with Germany. He thought that this would enable Germany to stay in German hands.
The Treaty
• The French won the war guilt clause (Article 231 of the Treaty) and reparations that a Commission calculated at $33 billion, far more than Germany was able to pay.
• The Allies also discovered that if the Eastern European nations exercised the right to self-determination, the results could be unmanageable, so they reached a compromise.
• Section VIII created the Polish state. Poland also received special access to the Baltic Sea through Danzig, which was declared a freeport although it was fully German.
• Several million Germans of Sudetenland were included in the Czechoslovak borders.
Congress of Vienna to the League of Nations
• This link offers details of all the changes made to the European map.
The old empires... became new countries.
Independent Republic of Turkey
French Mandate of Syria
British Mandate of Mesopotamia (Iraq)
British Mandate of Palestine
Lebanon
Independent Iran
Back Home
• Back home the Senate did not budge from its position. Two groups of opponents to the Treaty emerged.
• Known as Irreconcilables, Republican Senators Hiram Johnson and William Borah rejected the Covenant, especially Article 10.
• The second group was led by Senator Henry Cabot Lodge. It was known as the reservationists who essentially opposed the League and proposed several unacceptable amendments to it. Senator Lodge substituted China everywhere Wilson had put Japan in dealing with former German colonies in China. And then of course the reservationists also apprehended that Article 10 locked the United States into having to act with the weakening European colonial powers. It also threatened Congress's power to declare war. Senator Lodge invented his fourteen points to modify Wilson's Covenant to remove any automatic commitment to the League’s principles.
Back Home
• On September 19, 1919, the President began a cross-country speaking tour to whip up support for the League. His health had frail since his stay in Paris, but he delivered 36 speeches in 23 days. During this ordeal, on September 26 in Pueblo, Colorado, he suffered a paralytic stroke which forced him to end his tour and return to Washington. His health issues failed to move the Senate. On November 19, 1919, the Senate defeated the treaty containing the Lodge’s reservations, 39 to 55. Wilson's loyal Democrats joined the Irreconcilables to vote down the measure.
Raymond Blaine Fosdick, an American official to be seconded to the League apprehended the outcome in a personal letter on Jan 19, 1920, “I confess, however, that I have not much hope about the result because the proceedings in the Senate are dragging unconscionably, and if any result is achieved, I am very, very fearful that it will be one which will not be acceptable to the president.... Altogether, it is a sorry, agonizing mess, and as an American, I hang my head in shame. My only satisfaction in resigning is that it releases me from the burden of silence. I can now speak my faith before the world. I shall do it in as loud and eloquent tones as I can.”
Letters on the League of Nations: From the Files of Raymond B. Fosdick. Supplementary Volume to The Papers of Woodrow Wilson, 1966
Back Home
• On March 19, 1920, the Senate voted again with Lodge’s reservations, but the number fell short of necessary to two-thirds, with 49 to 35.
• In 1920 republican Warren G. Harding of Ohio won the Presidential election by 7 million votes.
• In 1921, the United States officially ended its role in the war by signing separate treaties with Germany and Austria.
Conclusion
• The United States did not join but Wilson’s League began to grapple with the complexities of the international system with a reduced and yet considerable incorporation of his idealism. The question was if the inter-state system, after the experience of a devastating Great War, was ready for idealism. The League survived until 1946. Its successor organization, the United Nations since 1945, has confronted similar challenges in eight decades of its existence.
• For the international system, however, the League marked a giant step forward from the Final Document of Congress of Vienna 1815 which distributed Europe and its people between royal houses, and the Congress of Berlin 1884-85 which fixed the rules for the scramble for Africa.
• National interests drive the behavior of states. They defend and advance them in terms of their understanding of existing realities. In the process, they collide with others or any bits of idealism if they determine that their crucial interests are at stake.
• Beginning next week, we will see how far the members of the League respected or not Wilson’s idealism beyond the Hall of Mirrors of Chateau de Versailles where they signed his Covenant.
|
c213c7a9-103e-43c3-a034-2a28079c5977
|
CC-MAIN-2024-46
|
https://www.gentrain.org/wp-content/uploads/The-Treaty-of-Versailles-032823.pdf
|
2024-11-05T15:25:08+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-46/subset=warc/part-00199-65a16d46-7179-4f3c-849a-3216b203b23b.c000.gz.parquet
| 736,857,679 | 7,023 |
eng_Latn
|
eng_Latn
| 0.961209 |
eng_Latn
| 0.997383 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
73,
500,
1448,
2481,
4075,
5178,
6750,
7366,
7489,
8943,
10214,
10258,
10524,
11233,
12122,
12871,
13785,
14774,
15650,
16291,
17207,
17883,
18678,
20035,
20931,
21913,
23650,
24366,
25099,
26073,
26405,
27026,
27808,
28176,
28542,
29326,
29958,
30569,
30687,
30729,
30882,
31765,
32344,
33140,
33512,
34720
] |
CQ
(EXHIBIT B)
Parent/Guardian Authorization to Communicate with Student by Text Messaging
Clear Creek ISD only allows an employee or contracted worker who has a cocurricular or extracurricular duty to use text messaging with students as part of an approved activity in accordance with CQ(REGULATION).
By signing this authorization, you are granting permission to [name of staff member with cocurricular or extracurricular duty] to call or text important information to your student at the number you provide on this form. Concerns about any inappropriate communication by any employee or contracted worker should be reported to the campus principal immediately. [See Board Policy DH(LOCAL) and CQ(REGULATION)]
I, ______________________________________________, agree that the authorized employee
(Parent/Guardian Name)
________________________________________________ may text my student by cell phone
(Employee Name)
to communicate important class, team, group and/or practice information on an "as needed" basis.
Student Name:
Cell phone number for student communication:
Student Cell Phone Number
Parent/Guardian Cell Phone Number
Parent/Guardian Signature
Date
Student Signature
Date
Date Issued: 08-26-19
|
<urn:uuid:38ac82fd-bb30-412f-96c3-b4fcb4802ef2>
|
CC-MAIN-2021-39
|
https://www.clearfallswrestling.net/uploads/8/6/5/2/86525168/ccisd_parent_guardian_authorization_to_communicate_with_student_by_text_messaging.pdf
|
2021-09-23T12:53:25+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-39/subset=warc/part-00080-f465d820-0362-4c4c-a396-c69f5fd24cc4.c000.gz.parquet
| 743,391,422 | 242 |
eng_Latn
|
eng_Latn
| 0.994509 |
eng_Latn
| 0.994509 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
1228
] |
Profile of Shri B. N. Shukla
Shri B. N. Shukla (DIN 05131449), graduated in 1982 from I.T. BHU and did M. Tech in Opencast Mining from Indian School of Mines, Dhanbad in 1989. He is silver medalist at B. Tech and M. Tech level and was popular students' leader.
He joined SECL in 1982, where he was instrumental in deploying SDL and Chain Conveyor for depillaring in 1983. He experimented cast blasting in Jamuna Opencast mines and brought back Amalai opencast mines into production which was stopped by DGMS for last six months due to vertical faces merged with OB benches. He joined Churcha East underground mine in 1999, where he experimented Hydrofracturing for hard roof management and constructed strata bunkers which reduced the breakdowns of belt conveyors and saving of power.
He joined as Sub-area Manager of Behraband U/G mine having modified continuous miner with LHD and the mine was adjudged the overall best mine in group 'A' of SECL alongwith 36% growth in production. He was posted as Project Officer, Balram OCP to sort out the R&R problem and poor geometry. The mine bagged 1st prize in overall annual safety week for successive two years. He was posted as General Manager, Bharatpur area in 2007, where he could sort out R&R problem and brought the mine into desired shape with sufficient land possession in hand. Then he was posted in most difficult area of MCL, i.e. Hingula area where the daily production was 21000 tpd, when he left the area, the daily production was 62000 tpd.
Considering his vision, knowledge, strategy he was posted as General Manager, Corporate Planning and Projects at MCL HQ, where he was instrumental in diversification of MCL into pit head Super critical thermal power projects (2 x 800 MW) for which MBPL company was formed and he was appointed Director w.e.f. 9.04.2012 to Sept.2015, other diversification were into solar, port and power transmission business.
He was key person in translating Jharsugda Barapalli rail link on paper to ground fighting tooth and nail to complete it by 2016 June, which is life line for growth of MCL. He got projects approved with total capacity of 322 MT (peak) from a level of 122 MT. He planned and monitored various infrastructural activities like road network, rail network, CHP, silo and was actively involved in meetings with MoC, state Govt. to sort out forest, R&R and law & order problems.
He was Director (Technical)/Coal Resource Development), CMPDIL w.e.f. 1.10.2015 to 16.08.2016. During his tenure departmental drilling saw highest ever growth in volume of about 52000m. He was instrumental in getting CMPDIL notified under section 4(1) of MMDR 1957 for prospecting any mineral which is a landmark in the history of CMPDIL.
He visited China and presented many technical papers in seminars. He attended world mining congress at Rio-de-janerio in 2016. He was a very good sportsman and was captain of IT Boating club, BHU. He performed journey on cycle from BHU to Kathmandu, Nepal in 1981.
He was transferred to ECL as director (Technical) for 1 year w.e.f. 17.08.16 to 16.08.17. During his tenure, underground production increased to 10,89% & dispatch by 11.52% compared to last year. Now he has joined CMPDIL w.e.f. 17.08.17.
|
<urn:uuid:4287d58f-34a0-4a93-bcd9-0cebd3f1dcba>
|
CC-MAIN-2019-18
|
https://www.cmpdi.co.in/profiles/ProfileofShriBNShukla.pdf
|
2019-04-21T16:44:06Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578531994.14/warc/CC-MAIN-20190421160020-20190421182020-00297.warc.gz
| 666,980,751 | 807 |
eng_Latn
|
eng_Latn
| 0.997456 |
eng_Latn
| 0.997974 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2390,
3235
] |
TERRANEA
JUNIOR GOLF LEAGUE
DIVISIONS
*All levels of Terranea players welcome
GOLD DIVISION
(9 hole matches - For players with prior competitive experience) Format modeled after the PGA JR. league (2 player teams – scramble format)
SILVER DIVISION
(6 hole matches - For less skilled players/introduction to competitive play) Format modeled after the PGA JR. league (2 player teams – scramble format)
BRONZE DIVISION
(3 hole matches - For younger players and those newer to the game) Format will be 2-4 player scramble and far more introductory in nature. This division is ideal for younger kids (7-9 years old) with less on course experience
REQUIREMENTS
Available for junior golfers 14 years of age and younger
COSTS
$299 per player includes:
6 League matches, team shirt and two practice sessions
LEAGUE MATCH SCHEDULE
| DATE | TEE TIME START | LOCATION |
|------------|----------------|----------|
| MARCH 12 | 3:00PM | TERRANEA |
| MARCH 19 | 3:00PM | TERRANEA |
| MARCH 26 | 3:00PM | TERRANEA |
| APRIL 15 | 3:00PM | TERRANEA |
| APRIL 23 | 3:00PM | TERRANEA |
| APRIL 30 | 3:00PM | TERRANEA |
*All players in all divisions will show up 1 hour prior to their posted tee times (all tee times will be emailed in advance). Players in all divisions will run through a practice short-game training program developing skills prior to play on the course. While competitive in nature, it is the greater mission of this league that kids have fun, play their best and learn more about our great game along the way.
CONTACT THE GOLF HOUSE TO RESERVE YOUR SPOT AT 310.265.2752
100 TERRANEA WAY, RANCHO PALOS VERDES, CA 90275 | 310.265.2752 | TERRANEA.COM/GOLF
|
<urn:uuid:57595237-078a-4d81-bc43-4e4f29ef2923>
|
CC-MAIN-2017-17
|
http://www.terranea.com/assets/pdfs/Terranea-Junior-League-2017-Flyer.pdf
|
2017-04-29T21:25:38Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123590.89/warc/CC-MAIN-20170423031203-00291-ip-10-145-167-34.ec2.internal.warc.gz
| 702,953,361 | 474 |
eng_Latn
|
eng_Latn
| 0.992376 |
eng_Latn
| 0.992376 |
[
"eng_Latn"
] | false |
docling
|
[
1732
] |
GREAT NORTHERN RAILWAY
MONTANA DIVISION.
TIME TABLE No. 71
TO TAKE EFFECT AT TWELVE-ONE (12:01) O'CLOCK A.M.
MOUNTAIN TIME.
SUNDAY, OCT. 22, 1911.
Superseding Time Table No. 70 and all Supplements thereto.
THIS TIME TABLE IS FOR THE USE OF EMPLOYEES ONLY.
F. D. KELSEY, Superintendent.
J. H. TAYLOR, General Superintendent.
W. C. WATROUS, General Supt. of Transportation.
G. H. EMERSON, Asst. General Manager.
J. M. GRUBER, General Manager.
### WEST BOUND.
#### THIRD DISTRICT - HAVRE TO CUT BANK.
| Time Table No. 71. | In Effect Oct. 22, 1911. |
|--------------------|--------------------------|
| **STATIONS.** | |
| | HAVRE |
| | IV |
| | PACIFIC JUNCTION |
| | 5.1 |
| | BURRUM |
| | 8.3 |
| | FRESCO |
| | 14.6 |
| | KREMLEN |
| | KN |
| | XENIA |
| | 8.0 |
| | GILFORD |
| | GR |
| | HINGHAM |
| | HG |
| | RUDYARD |
| | 4.3 |
| | WATER TANK |
| | RN |
| | INVERNESS |
| | 4.0 |
| | JOPLIN |
| | JO |
| | BISHOP |
| | 5.0 |
| | CHESTER |
| | CH |
| | THIBB |
| | 4.0 |
| | LOTHAIR |
| | HA |
| | GALATA |
| | GA |
| | CONCORD |
| | CD |
| | LAVINGTON |
| | 4.0 |
| | DUNKIRK |
| | DK |
| | FAIRBELL |
| | 5.3 |
| | SHELLEY |
| | SJ |
| | VIRGEN |
| | VR |
| | SOILA |
| | 3.6 |
| | ETRIDGE |
| | EG |
| | BORU |
| | 3.6 |
| | BALTI |
| | 12.6 |
| | CUT BANK |
| | CT |
#### Special Rules.
West bound trains are superior to east bound trains of the same class.
No. 27 is superior to all other trains. Opposing first class trains will clear No. 27 five (5) minutes, other opposing trains will clear No. 27 ten (10) minutes. All west bound trains must be clear at the time No. 27 is due to leave the next station in the rear where time is shown.
No. 1, 2, 27 and 28 will register by card at Shelby and Virgen. No. 3 and 4 will register by card at Virgen.
No. 2 will stop at any station to let off passengers from East of Davitt Lake.
No. 3 will stop at any station to pick up passengers for South of Shelby.
No. 4 will stop at any station to let off passengers from West of Virgen.
No. 27 will stop at any station to let off passengers from South of Shelby.
No. 28 will stop at any station to pick up passengers for South of Shelby.
### Time Table No. 71.
In Effect Oct. 22, 1911.
| STATIONS. | Signs (See Rule 5, Page 8) | 236 | 28 | 44 | 232 | 4 | 240 | 2 | 402 |
|-----------|-----------------------------|-----|----|----|-----|---|-----|---|-----|
| | | | | | | | | | |
| HAVRE | R@DN WC TO | 125.7 | 2:50m | 5:05m | 7:00m | 8:45m | 3:05m | 5:40m |
| PACIFIC JUNCTION | P V | 124.6 | 2:40m | 7:54 | 6:50 | 8:38 | 9:57 | 4:01 | 5:20 |
| BURKHAM | P W | 118.0 | 7:44 | 6:57 | 8:25 | 9:48 | 4:30 |
| FRESNO | P | 114.1 | 7:97 | 6:20 | 8:17 | 9:41 | 8:50 |
| KREMLIN | N P | 109.6 | 7:28 | 6:15 | 8:10 | 2:32 | 9:30 |
| XENIA | P | 103.5 | 7:18 | 6:09 | 8:00 | 2:20 | 2:41 |
| GILDFORD | DN PW | 99.5 | 7:10 | 5:50 | 7:54 | 2:12 | 2:12 |
| BINGHAM | P | 93.4 | 7:08 | 5:55 | 7:45 | 9:03 | 1:30 |
| RUDYARD | P | 87.6 | 6:58 | 5:22 | 7:36 | 1:10 | 1:10 |
| WATER TANK | W | 82.4 | 6:48 | 5:05 | 7:36 | 1:40 | 12:45 |
| INVERNESS | DP | 81.1 | 6:36 | 4:58 | 7:19 | 1:56 | 12:29m |
| JOPLIN | D P | 77.7 | 6:26 | 4:40 | 7:10 | 1:58 | 11:55 |
| BIGON | P | 73.2 | 6:17 | 4:25 | 6:58 | 1:18 | 11:00 |
| CHESTER | DN WC | 67.5 | 6:07 | 4:10 | 6:45 | 1:08 | 10:30 |
| TIBER | P | 61.5 | 5:56 | 3:54 | 6:35 | 12:38 | 10:10 |
| LOTHRAIR | P | 55.5 | 5:45 | 3:45 | 6:25 | 12:48 | 9:15 |
| GALLA | DP V | 49.2 | 5:30 | 3:37 | 6:15 | 4:41 | 8:50 |
| CONCORD | DP W | 43.2 | 5:30 | 3:35 | 6:15 | 12:40 | 8:50 |
| LAVINGTON | P | 37.6 | 5:24 | 3:15 | 6:07 | 19:54 | 8:50 |
| DUNKIRK | DP W | 33.5 | 5:18 | 3:06 | 6:00 | 19:59 | 8:10 |
| FARRELL | P | 27.8 | 5:09 | 3:55 | 5:51 | 19:30 | 7:30 |
| SHELBY | R@DN | 24.3 | 4:59 | 2:45 | 5:40 | 2:50m | 13:18 | 6:35 |
| VIRDEN | RDP WY | 21.8 | 4:48 | 2:30m | 2:50m | 2:20m | 13:07m | 6:40 |
| SIHLA | P | 16.4 | 4:40 | 6:09 | 5:22 | 11:59 | 5:59 |
| ETRIDGE | NP W | 11.0 | 4:28 | 6:02 | 1:40 | 11:59 | 5:14 |
| BORU | P W | 7.4 | 4:27 | 5:57 | 5:03 | 11:47 | 4:20 |
| BALTIIC | P | 4.21 | 5:50 | 4:57 | 11:42 | 4:00 |
| CUT BANK | R@DN WCTY | 4:10m | 5:30m | 4:40m | 11:30m | 3:25m |
| | Leave Daily | Leave Daily | Leave Daily | Leave Daily | Leave Daily | Leave Daily | Leave Daily |
**Time Over District:** 10 2:55 10 4:30 4:50 7:2 35:9 14:10
**Average Speed per Hour:** 34 27:8 36:1 35:1 35:2 35:9 34:0
### Special Rules.
West bound trains are superior to east bound trains of the same class.
Between Havre and Pacific Junction all trains will be operated under the train staff system. The staff in possession of the Engineer is authority for a movement through the block.
Maximum rate of speed for passenger trains (except No. 27) between Havre and Cut Bank fifty (50) miles per hour.
Maximum rate of speed for freight trains between Havre and Cut Bank thirty (30) miles per hour.
### INITIAL STATIONS.
Havre for trains Nos. 1, 3, 27, 231, 232, 401, 411, 433, 443, 699, 675.
Cut Bank for trains Nos. 1, 3, 27, 43, 401, 411, 435, 443, 669.
### TERMINAL STATIONS.
Pacific Junction = No. 236
Havre = No. 236
Shelby = No. 43, 239, 435
Cut Bank = No. 43, 239, 44, 402.
Pacific Junction = No. 231, 233, 675.
Havre = No. 2, 4, 28, 231, 236, 402.
## Time Table No. 71
### In Effect Oct. 22, 1911
| STATIONS | Telephone Calls | Signs (See Rule 8, Page 8) |
|----------------|-----------------|----------------------------|
| BAINVILLE | 53 44 | R D Y |
| MONTGOMERY | 62 80 | 4.10 |
| FRODID | 24 10 | 3.40 |
| HOMESTEAD | 27 79 | 3.15 |
| MEDICINE LAKE | 21 78 | 9.05 |
| RESERVE | 14 30 | 2.80 |
| ANTELOPE | 8.04 | 9.10 |
| PLENTYWOOD | 0.0 | R D Y C |
**Special Rules**
West bound trains are superior to east bound trains of the same class.
Branch Line trains will not occupy main line at Bainville without fully protecting themselves.
Maximum rate of speed for all trains between Bainville and Plentywood is 25 miles per hour.
**INITIAL STATIONS**
- Bainville for Train No. 357
- Plentywood for Train No. 358
**TERMINAL STATIONS**
- Bainville for Train No. 358
- Plentywood for Train No. 357
### CAPACITY OF ENGINES IN ADDITION TO WEIGHT OF ENGINES, TENDERS AND CABOOSES.
| STATIONS | Ruling Grade | Class L1 1900-1921 | Class L2 1800-1844 | Class F4-1085-1090 | Class J1-1500-1550 | Class F7-730-731 | Class F7-732-733 | Class D6-450-476 | Class D4-600-626 |
|---------------------------|--------------|--------------------|--------------------|--------------------|--------------------|----------------|----------------|----------------|----------------|
| | | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 | 1 2 3 4 |
| Williamston to Glasgow | .4 | | | | | | | | |
| Glasgow to Williamston | .4 | | | | | | | | |
| Glasgow to Havre | .4 | | | | | | | | |
| Havre to Glasgow | .4 | | | | | | | | |
| Havre to Cut Bank | 1.0 | 1650 1485 1320 1155| 1450 1305 1160 1015| 1290 1080 960 840 | 1100 990 880 770 | 900 810 720 630| 725 650 580 510| 700 630 560 490| 650 575 510 445| 550 490 435 380|
| Cut Bank to Havre | .8 | 1900 1730 1560 1380| 1800 1620 1440 1260| 1425 1355 1140 1060| 1350 1215 1060 945 | 1250 1125 1000| 875 960 865 770| 670 940 855 770| 750 700 615 580| 870 785 680 595|
| Bainville to Plainview | .7 | | | | | | | | |
| Plainview to Bainville | .7 | | | | | | | | |
---
**WEATHER RATING**
1—When temperature is 20 degrees above zero or over.
2—Very frosty or wet; 5 to 10 above zero.
3—Five degrees above to 10 below zero.
4—Ten below zero and colder.
The following will govern when handling empty cars: With 10 or less empty cars in train no allowance will be made for wheel friction; with more than 10 empty cars in a train add 6 tons per car for wheel friction.
**Weight of Empty Cars and Dead Engines and Tenders will be estimated as follows when not marked.**
| Type | Weight (Tons) | Description |
|-----------------------------|---------------|--------------------------------------------------|
| Box Cars, 28 to 30 feet | 11 | Engines numbered below 200 series. |
| Box Cars, 32 feet | 12 | Engines numbered in 200 series. |
| Box Cars, 34 feet | 13 | Engines numbered in 200 series. |
| Box Cars, 36 feet | 14 | Engines numbered in 400 series. |
| Box Cars, 38 feet | 15 | Engines numbered in 400 series. |
| Box Cars, 40 feet | 16 | Engines numbered in 400 series. |
| Refrigerator Cars | 17 | Engines numbered in 600 series. |
| Flat Cars, 32 to 40 feet | 18 | Engines numbered in 600 series. |
| Furniture, 40 to 50 feet | 19 | Engines numbered in 800 series. |
| Caboose, 4 wheel | 20 | Engines numbered in 800 series (except 992 to 997).|
| Caboose, 4 wheel | 21 | Engines numbered 992 to 997. |
| Flat Cars, 33 and 34 foot | 22 | Engines numbered 1000 to 1007. |
| Flat Cars, 40 feet | 23 | Engines numbered 1000 to 1007. |
| Coal Cars | 24 | Engines numbered 1070 to 1085. |
| Grandola Cars | 25 | Engines numbered 1200 to 1300 series. |
| Ore Cars, Wood | 26 | Engines numbered in 1300 series. |
| Ore Cars, Steel | 27 | Engines numbered 1400 to 1425. |
| Oil Cars | 28 | Engines numbered in 1500 and 1600 series. |
| Ballast Cars | 29 | Engines numbered 1500 to 1600 series. |
| Steam Wreckers | 30 | Engines numbered 1500 to 1600 series. |
| Baggage Cars (Empty) | 31 | Engines numbered 1800 series. |
| Mail Cars | 32 | Engines numbered 1900 series. |
| Baggage Cars | 33 | Engines numbered 1900 series. |
| Coaches, 4 wheel | 34 | Engines numbered 1900 series. |
| Coaches, 6 wheel | 35 | Engines numbered 1900 series. |
| Dining Cars and Tourist Cars| 36 | Engines numbered 1900 series. |
| Sleeping Cars, Parlor Cars and Observation Cars | 37 | Engines numbered 1900 series. |
---
**Speed Table.**
50 miles per hour is equivalent to one mile in 1 minute and 12 seconds.
45 miles per hour is equivalent to one mile in 1 minute and 20 seconds.
40 miles per hour is equivalent to one mile in 1 minute and 30 seconds.
35 miles per hour is equivalent to one mile in 1 minute and 43 seconds.
30 miles per hour is equivalent to one mile in 2 minutes and 12 seconds.
25 miles per hour is equivalent to one mile in 2 minutes and 24 seconds.
20 miles per hour is equivalent to one mile in 3 minutes and 0 seconds.
15 miles per hour is equivalent to one mile in 4 minutes and 0 seconds.
|
<urn:uuid:798f5591-3f77-43ed-9191-de8736779b90>
|
CC-MAIN-2025-05
|
https://www.gn-npjointarchive.org/GN%20Timetable%20Scans/GN%2019111022%20ETT%20071%20MONTANA%20Div.pdf
|
2025-01-25T13:31:53+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-05/subset=warc/part-00259-88b30a59-3c73-48ba-a167-077611bfd245.c000.gz.parquet
| 807,946,773 | 4,279 |
eng_Latn
|
eng_Latn
| 0.821669 |
eng_Latn
| 0.990334 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
446,
4326,
7539,
8697,
14958
] |
September is official National Yoga Month
Join the Yoga Month celebration: YogaHealthFoundation.org
One Week Free Yoga
Get the Yoga Month Card for ONE WEEK FREE YOGA at a local yoga studio for FREE and experience the proven health benefits of yoga. Get ONE WEEK FREE YOGA now.
Yoga Month Events
Hundreds of community events are organized each year in celebration of National Yoga Month every September. Find yoga events near you!
A Time for Yoga
Yoga Month’s celebration culminates with The Time for Yoga, a global community yoga practice. Join us for yoga on September 30!
September is Whole Grains Month
Whole grains include grains like wheat, corn, rice, oats, barley, quinoa, sorghum, spelt, rye. Whole grains even include popcorn!
ANTIOXIDANTS, VITAMINS AND MINERAL – Whole grains have valuable antioxidants not found in fruits and vegetables, as well as B vitamins, vitamin E, magnesium, iron and fiber.
HEALTH BENEFITS OF WHOLE GRAINS – The medical evidence is clear that whole grains reduce risks of heart disease, stroke, cancer, diabetes and obesity. People who eat whole grains regularly have a lower risk of obesity and lower cholesterol levels. Specifically those who eat three daily servings have been shown to reduce their risk of heart disease by 25-36%, stroke by 37%, Type II diabetes by 21-27%, digestive system cancers by 21-43%, and hormone-related cancers by 10-40%.
Move of the Month: Walking … Your Way to Good Health!
ArthritisToday.org
Why walk?
● Live longer – an average of 1.3 years longer than your couch-potato peers.
● Increase your mobility – Those who started with 10 min a day, and worked up to 40 min a day within three months increased their physical functioning by 25%.
● Better mood – Stimulates brain chemicals like serotonin & endorphins.
● Reduce your risk of diabetes – Researches think that walking improves the way that our body processes insulin. It can also reduce belly fat which can decrease odds of developing diabetes.
● Reduces memory loss & boosts brainpower – walk 40 min three times a week and help prevent a decline in brain function associated with aging.
Recipe of the Month
Whole Grain Crackers
Ingredients
4 c. Whole grain flour (your choice)
1 cup Rolled oats, or 1 cup popped amaranth, or half and half
1/2 c Shortening, or butter
2 cups Buttermilk, yogurt, cream or sweet milk
1 tsp Salt
1 tsp Baking soda
Choose one or more of the following: Kosher salt, Onion powder, Cheese powder, Bacon bits, Herbs or spices & BBQ sauce
Preparation
Place all ingredients into a large bowl and mix until it forms a ball. Divide dough into small portions and roll out on a lightly floured surface as thin as you can. The thinner it is rolled out, the better it will taste. Cut out as desired and bake at 275 on a greased sheet pan or parchment paper until the edges start to brown lightly. Store in an airtight container; they will stay fresh as long as they are kept dry. Compliments of: MealsMatter.org
|
<urn:uuid:fb016116-b8c1-41d7-be40-da8ce3c3ef0f>
|
CC-MAIN-2019-39
|
http://qa.healthyeating.org/Portals/0/Documents/Health%20Wellness/Wellness%20Newsletters/September_Wellness_Newsletter_2012.pdf?ver=2012-11-27-100448-000
|
2019-09-15T08:03:31Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514570830.42/warc/CC-MAIN-20190915072355-20190915094355-00330.warc.gz
| 163,512,135 | 677 |
eng_Latn
|
eng_Latn
| 0.995919 |
eng_Latn
| 0.995919 |
[
"eng_Latn"
] | false |
docling
|
[
2964
] |
March 2000
To Whom It May Concern:
I contracted with Kevin Graham, of Lookout Management Inc., to produce a satisfaction survey of our recent alumni. At that time, we were really only interested in doing an alumni survey, largely to test our new marketing message which states, "Cranbrook: the most challenging and comprehensive college preparation possible." We were hoping to validate this message and gather useful data that could support this statement. When Kevin presented us the results of the survey, we immediately realized that the process, and specifically Kevin's fine analysis afforded us so much more. The entire administrative team at Cranbrook was stunned at the incredible information that was garnered from this survey, and exceptionally impressed with the analysis of the data. As a result of the tremendous work by Kevin on the alumni survey, we have contracted with him to do a faculty survey this spring and plan to do parent and student satisfaction surveys in the fall. We are so excited about this process now, that we are also discussing doing these surveys every year, or every other year, to gather data longitudinally.
What stands out about Kevin is the depth and quality of the analysis of the data that he provides. While there are many companies that will create effective survey instruments, I doubt there are any which will create as many different cross-tabulations or analyze the data as thoroughly as Kevin. But, he does not stop by just cross tabbing the data, Kevin puts forth probable explanations for the data, suggesting causation where appropriate...and equally important giving the data a context to supply meaning to the results.
In putting together the alumni survey there was a large number of people at Cranbrook who needed to be involved in the process. Kevin was so professional, thorough, approachable and knowledgeable that he made the process, even with many different players involved, utterly painless. I have worked with a number of different consultants over the years and Kevin is certainly the most thorough and conscientious I have worked with. He seems to take enormous personal ownership of each project.
I would highly recommend Kevin Graham and Lookout Management Inc., to any school or organization trying to gather performance feedback. Kevin far surpassed our expectations and his work is worth far more than we paid for it. Given the volume and quality of the data gathered about our alumni the investment of hiring Kevin has already paid for itself many times over.
Sincerely,
D. Scott Looney
Director of Admission & Financial Aid
|
<urn:uuid:f9b6e8e1-5cb9-4f22-8c23-e783b565f541>
|
CC-MAIN-2017-26
|
http://lookoutmanagement.com/pdf/CranbrookSchools1.pdf
|
2017-06-27T19:04:32Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128321536.20/warc/CC-MAIN-20170627185115-20170627205115-00573.warc.gz
| 242,744,190 | 492 |
eng_Latn
|
eng_Latn
| 0.998997 |
eng_Latn
| 0.998997 |
[
"eng_Latn"
] | false |
docling
|
[
2606
] |
FINANCIAL STATEMENTS
YEAR ENDED DECEMBER 31, 2018
(With Independent Auditors' Report)
TABLE OF CONTENTS
DECEMBER 31, 2018
INDEPENDENT AUDITORS' REPORT
Board of Directors Africa Development Promise Denver, CO
We have audited the accompanying financial statements of Africa Development Promise, which comprise the statement of financial position as of December 31, 2018, and the related statements of activities, functional expenses, and cash flows for the year then ended, and the related notes to the financial statements.
Management's Responsibility for the Financial Statements
Management is responsible for the preparation and fair presentation of these financial statements in accordance with accounting principles generally accepted in the United States of America; this includes the design, implementation, and maintenance of internal control relevant to the preparation and fair presentation of financial statements that are free from material misstatement, whether due to fraud or error.
Auditor's Responsibility
Our responsibility is to express an opinion on these financial statements based on our audit. We conducted our audit in accordance with auditing standards generally accepted in the United States of America. Those standards require that we plan and perform the audit to obtain reasonable assurance about whether the financial statements are free from material misstatement.
An audit involves performing procedures to obtain audit evidence about the amounts and disclosures in the financial statements. The procedures selected depend on the auditor's judgment, including the assessment of the risks of material misstatement of the financial statements, whether due to fraud or error. In making those risk assessments, the auditor considers internal control relevant to the organization's preparation and fair presentation of the financial statements in order to design audit procedures that are appropriate in the circumstances, but not for the purpose of expressing an opinion on the effectiveness of the organization's internal control. Accordingly, we express no such opinion. An audit also includes evaluating the appropriateness of accounting policies used and the reasonableness of significant accounting estimates made by management, as well as evaluating the overall presentation of the financial statements.
We believe that the audit evidence we have obtained is sufficient and appropriate to provide a basis for our audit opinion.
Opinion
In our opinion, the financial statements referred to above present fairly, in all material respects, the financial position of Africa Development Promise as of December 31, 2018, and the changes in its net assets and its cash flows for the year then ended in accordance with accounting principles generally accepted in the United States of America.
ICL, LLC Chicago, IL
April 29, 2019
STATEMENT OF FINANCIAL POSITION
DECEMBER 31, 2018
ASSETS
STATEMENT OF ACTIVITIES
YEAR ENDED DECEMBER 31, 2018
STATEMENT OF FUNCTIONAL EXPENSES
YEAR ENDED DECEMBER 31, 2018
See accompanying notes to the financial statements.
STATEMENT OF CASH FLOWS
YEAR ENDED DECEMBER 31, 2018
Cash Flows From Operating Activities:
NOTES TO FINANCIAL STATEMENTS
YEAR ENDED DECEMBER 31, 2018
NOTE 1 – NATURE OF ORGANIZATION
Africa Development Promise (the "Organization") is Colorado nonprofit corporation that was formed in 2013. The Organization works to build thriving rural African communities where everyone has the opportunity to realize their full potential through sustained economic development. Africa Development Promise works to stimulate economic activity by building strong, well-managed, and profitable agricultural cooperatives that strengthen local economies to achieve long-term positive outcomes. We are committed to the cooperative-enterprise model that is democratically owned and controlled and provides benefit to its members and the greater community.
Within the countries of Rwanda and Uganda, the Organization operates the following programs:
Cooperative Governance and Management Training – The Organization believes that education is the foundation of effective cooperative governance. Members are best served when cooperative leaders understand the basic democratic principles of running a co-op; their functions and responsibilities and those of members; the importance of financial management and record keeping; and strategic planning to name a few. Working with local Business Development Services we train the cooperative on the following topics:
* Introduction to cooperative principles and democratic governance process
*
* Business managing/planning with short-term and long-term actions
Basic record keeping system
* Internal controls
* Financial management and accounting system
* Marketing and communications
* Leaders acquire "soft skills" —problem solving, critical thinking, negotiating, prioritizing, consensus building, conflict management, and partnership building
Agricultural Technical Assistance – In order for the cooperative to be competitive, the Organization offers specialized, hands-on technical training that addresses topics such as soil fertility and water resource management strategies, climate adaptation, use of reduced-toxicity pesticides, as well as techniques for successful harvests and post-harvest storage. In this case we will hire a local agronomy consultant who specializes in mushroom cultivation to build member capacity to increase their production to take advantage of the available market for their product.
NOTES TO FINANCIAL STATEMENTS (Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 1 – NATURE OF ORGANIZATION - Continued
Building Networks and Coordinating Efforts – The Organization encourages the cooperative to see themselves as part of a larger network or eco-system that includes other businesses, cooperatives, government agencies, etc. As such, the Organization works with them to build their networks allowing them to work together to share market information; supplier, demand and distribution channels; and storage facilities. The Organization also link them microfinance institutions.
This bundle of services will translate into increased benefit for all members in form of increased productivity, maximize land use, guaranteed market, more competitive process and some modules are designed to benefit them in their personal life.
NOTE 2 – SUMMARY OF SIGNIFICANT ACCOUNTING POLICIES
A summary of the significant accounting policies applied in the preparation of the accompanying financial statements follows:
Basis of Accounting
The financial statements of the Organization have been prepared on the accrual basis of accounting in accordance with U.S. generally accepted accounting principles.
Financial Statement Presentation
The Organization presents financial information pursuant to FASB Accounting Standards Codification (ASC) 958-205, Not-for-Profit Entities: Presentation of Financial Statements, which establishes standards for external financial reporting by not-for-profit organizations and requires that resources be classified into distinct net asset categories according to externally (donor) imposed restrictions. In addition, the Organization is required to present a statement of cash flows.
Net Assets Without Donor Restrictions – Net assets that are not subject to donorimposed restrictions are net assets without donor restrictions. These assets include the revenues and expenses of the primary operations of the Organization. Donor restricted contributions and grants whose restrictions are met in the same reporting period are reported as net assets without donor restrictions.
NOTES TO FINANCIAL STATEMENTS
(Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 2 – SUMMARY OF SIGNIFICANT ACCOUNTING POLICIES - Continued
Financial Statement Presentation
Net Assets With Donor Restrictions – Net assets subject to donor or grant-imposed stipulations that may or will be met either by actions of the Organization and/or the passage of time are classified as net assets with donor restrictions. When a restriction expires, net assets with donor restrictions are reclassified to net assets without donor restrictions and reported in the statement of activities as net assets released from restrictions.
Cash and Cash Equivalents
The Organization considers short-term, highly liquid instruments that are both readily convertible to cash on demand without penalty, and having maturities of three months or less, when purchased, to be cash equivalents.
Cash and cash equivalents held in the United States are insured according to FDIC regulations. Cash amounts maintained overseas are largely unsecured. Cash and cash equivalents held in the United States as of December 31, 2018 was $28,565. Cash and cash equivalents held outside of the United States as of December 31, 2018 was $28,648.
Accounts and Pledges Receivable
Accounts and pledges receivable represents unconditional commitments made by donors. Receivables that are expected to be collected in less than one year are reported at net realizable value. Receivable that are expected to be collected in more than one year are recorded at fair value at the date of promise. That fair value is computed using a present value technique applied to anticipated cash flows. Amortization of the resulting discount is recognized as additional contribution revenue. Management determines a reserve for doubtful contributions receivable based on estimates of collectability with certain donors with past experience as well as a general reserve for the remaining amount. There were no such receivable balances outstanding as of December 31, 2018.
Revenue Recognition
All contributions are considered to be available for unrestricted use unless specified by the donor. Contributions are recognized as revenues when the contributions or pledges are received.
NOTES TO FINANCIAL STATEMENTS
(Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 2 – SUMMARY OF SIGNIFICANT ACCOUNTING POLICIES - Continued
Property and Equipment
Property and equipment are recorded at cost. Additions and improvements to existing property and equipment and leasehold improvements over $5,000 during the year are capitalized, while general maintenance and repairs are charged to expense. Depreciation and amortization is computed using the straight-line method over the estimated useful lives of the related assets. These lives range up to 3 years for computers and equipment.
Fair Value of Financial Instruments
The carrying amounts of cash and cash equivalents, prepaid expenses, accounts receivable, pledges receivable and accounts payable and accrued expenses approximate fair value because of the short term maturity of these financial instruments.
Use of Estimates
The preparation of financial statements in conformity with U.S. generally accepted accounting principles requires management to make estimates and assumptions that affect the reported amounts of assets and liabilities and disclosures of contingent assets and liabilities at the date of the financial statements, as well as the reported amounts of revenue and expenses during the reporting period. Actual results could differ from those estimates.
Functional Allocation of Expenses
The Organization classifies its expenses into their functional categories. Expenses directly identified with a functional area are charged to that area and, where expenses affect more than one area, they are allocated to the respective areas based on estimates made by management.
Subsequent Events
The Organization has evaluated subsequent events for potential recognition and/or disclosures through April 29, 2019, the date the financial statements were available to be issued.
NOTES TO FINANCIAL STATEMENTS
(Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 2 – SUMMARY OF SIGNIFICANT ACCOUNTING POLICIES - Continued
Tax-Exempt Status
The Organization is a tax-exempt organization under Section 501(c) (3) of the Internal Revenue Code and the related State of Colorado statutes, respectively.
NOTE 3 – CONCENTRATION OF CREDIT RISK
The Organization maintains bank cash balances, which at times could exceed the $250,000 insurance coverage provided by the Federal Deposit Insurance Corporation. The Organization has not experienced any losses in such accounts and believes that it is not exposed to any significant risk on cash and cash equivalents.
NOTE 4 – PROPERTY AND EQUIPMENT
Property and equipment at December 31, 2018, consists of the following:
Depreciation expense in 2018 was $2,247 as included in the statement of functional expenses.
NOTE 5 – LEASE COMMITMENTS
The Organization is currently operating on a month to month lease arrangement for office space at a rate of $248 per month. Rent expense was approximately $2,978, which is included in occupancy costs in the statement of functional expenses for the year ended December 31, 2018.
NOTE 6 – IN-KIND CONTRIBUTIONS
In-kind contributions for the year ended December 31, 2018 consisted of $2,600 of professional services and $2,850 for a solar water pump.
NOTES TO FINANCIAL STATEMENTS (Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 7 – LIQUIDITY AND AVAILABILITY
The Organization has $57,213 of financial assets available within one year of the statement of financial position date consisting of cash and cash equivalents. Financial assets subject to donor restrictions consist of donated funds ($51,000) that is scheduled for expenditure for programmatic purposes in 2019.
NOTE 8 – NET ASSETS WITH DONOR RESTRICTIONS
Net assets with donor restrictions were expended for the following purposes in 2018:
Net assets with donor restrictions are available for the following purposes in 2019:
NOTE 9 – NEW ACCOUNTING PRONOUNCEMENTS
On January 1, 2018, the Organization adopted ASU 2016-14, Presentation of Financial Statements of Not-for-Profit Entities, ASU 2016-14 represents phase 1 of FASB's Notfor-Profit financial reporting project and results in reducing the number of net asset classes, requires presentation by functional and natural classification, requires quantitative and qualitative information on liquidity, retains the option to present the cash flow statement on a direct or indirect method as well as includes various other additional disclosure requirements.
In February 2016, the FASB issued ASU No. 2016-02, Leases (Topic 842). This standard requires increased transparency and comparability among organizations by requiring them to recognize lease assets and lease liabilities on the balance sheet and disclosing key information about leasing arrangements. The provisions of this standard are effective for fiscal years beginning after December 15, 2019 and early adoption is permitted. Management is currently evaluating the impact of adopting this standard.
NOTES TO FINANCIAL STATEMENTS
(Continued)
YEAR ENDED DECEMBER 31, 2018
NOTE 9 – NEW ACCOUNTING PRONOUNCEMENTS - Continued
In November 2016, the FASB issued ASU No. 2016-18, Statement of Cash Flows (Topic 230) - Restricted Cash. This standard requires that a statement of cash flows explain the change during the period in the total of cash, cash equivalents, and amounts generally described as restricted cash or restricted cash equivalents. Therefore, amounts generally described as restricted cash and restricted cash equivalents should be included with cash and cash equivalents when reconciling the beginning-of-period and end-of-period total amounts shown on the statement of cash flows. The provisions of this standard are effective for fiscal years beginning after December 15, 2017 for public business entities and December 31, 2018 for all other entities and early adoption is permitted. Management is currently evaluating the impact of adopting this standard.
In June 2018, FASB issued ASU 2018-08, Not-for-Profit Entities (Topic 958): Clarifying the Scope and the Accounting Guidance for Contributions Received and Contributions Made, ASU 2018-08 clarified the guidance in ASC 958 on how entities determine whether to account for a transfer of assets as an exchange transaction under other guidance (e.g., ASC 606) or a contribution. The FASB also clarified that a contribution is conditional if the agreement includes both a barrier (or barriers) that must be overcome for the recipient to be entitled to the assets transferred and a right of return for the transferred assets or a right of release of the promisor's obligation to transfer assets. ASU 2018-08 is effective for transactions in which the entity serves as the resource recipient in annual periods beginning after December 15, 2018, and interim periods within annual periods beginning after December 15, 2019. Early adoption of ASU 201808 is permitted. The requirements of this statement are effective for the Organization for the year ending December 31, 2019. Management is currently evaluating the impact of adopting this standard.
|
<urn:uuid:816fb120-fdcf-4840-88cb-2ddc7e714602>
|
CC-MAIN-2019-26
|
http://africadevelopmentpromise.org/wp-content/uploads/2019/06/ADP_Audit_Report_2018_FINAL.pdf
|
2019-06-27T08:40:47Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560628001014.85/warc/CC-MAIN-20190627075525-20190627101525-00524.warc.gz
| 4,746,604 | 3,253 |
eng_Latn
|
eng_Latn
| 0.876013 |
eng_Latn
| 0.990318 |
[
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"unknown",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
87,
125,
2472,
2869,
2929,
2984,
3101,
3195,
5554,
7669,
9893,
11750,
13103,
14834,
16950
] |
Forklift Types
Counterbalance forklifts
These forklifts have cargo handling equipments such as a mast and a fork, and have a weight attached at the rear for counterbalancing the load.
Internal combustion engines fueled by petroleum, liquefied petroleum gas or diesel, or batteries power them.
Load capacity is 0.5t to 42t.
They are used in many locations from manufacturing facilities to warehouses and used in indoor and outdoor facilities.
Their characteristics are close to heavy machineries such as trucks.
Warehouse forklifts
These forklifts have a structure that enables the fork to slide forward (reach) for loading and unloading operations. They bring loads inside when they operate for transport.
Power is provided by batteries.
In a typical warehouse setting most forklifts used have load capacity of around 1.5t.
They are used for operations in cramped areas, such as those inside warehouses.
Specifications required is different by each region (Europe, North America, and Asia).
It is a key factor for success that the proposal that meets the requirements of the individual customers is provided.
1. In general, market trends remain unchanged. - Counterbalance Market; Mature, Warehouse Market; Expand Demands for forklifts powered by internal combustion engines are rapidly increasing in Asian markets, particularly in China.
2. More sophisticated, borderless and bigger customers have made a full lineup approach indispensable.
3. The shift toward an oligopoly has been spurred by globalization.
- Toyota (Toyota Industries Corp.) outdistances the pack.
- Market reorganization has become a possibility.
- A challenge for Nichiyu is to establish a presence in a global market.
- Mitsubishi Heavy Industries have a reputation in a global market, but its main market is an engine-type forklift one.
4. Criteria for survival (Projection) = 20% share for each market (CB & WH)
**Market trends (worldwide)**
(Unit: 1,000 units)
| | 2006 | 2007 | 2008 | 2009 | 2010 |
|----------------|------|------|------|------|------|
| Counterbalance | | | | | |
| Forklifts | | | | | |
| Warehouse | 571 | 223 | 113 | 235 | 100 |
| Electric | 259 | 123 | 109 | 123 | 100 |
| Counterbalance | 672 | 290 | 123 | 290 | 123 |
| Engine-driven | 286 | 322 | 130 | 322 | 137 |
| Forklifts | 824 | 364 | 147 | 364 | 155 |
| Warehouse | 330 | 400 | 155 | 400 | 170 |
**Market shares (2006)**
- **Counterbalance forklifts**
- Toyota 20%
- Nacco 17%
- Linde 14%
- MHI 10%
- Nissan 7%
- Komatsu 6%
- Others 26%
- **Warehouse forklifts (reach forklifts only)**
- Toyota 8%
- BT 18%
- Linde 11%
- Jungheinrich 10%
- Crown 14.5%
- Nichiyu 2.3%
- MHI 2.7%
- Nissan 1.5%
- Others 26.2%
Domestic Market Trends
- Japan is a matured market, and the total market volume has hit a ceiling. The fierce competition has been kept. (the number of players is seven in Japanese players alone.) Environmental issues drive electric forklifts demand up.
- A full-line approach to customers is required in response to expand the demands by major and big customers or in logistics and warehouse business. (Japanese players except for Nichiyu and Mitsubishi have a network all over the Japan and a full-line approach.)
Toyota (Toyota Industries Corp.) outdistances the pack.
TCM was purchased by Hitachi Construction Machinery and has adopted a policy of strengthening battery-driven forklifts.
Komatsu terminated to be allied with Linde (in 2006).
Nichiyu ranks a second player in battery-driven forklift in Japan.
Mitsubishi doesn’t have as the market presence as it has overseas, but competitive in engine-driven forklifts.
Market distribution (2006)
Engine-driven forklifts:
- Toyota: 43%
- Komatsu: 11%
- Nissan: 8%
- TCM: 10%
- MHI: 4%
Electric forklifts:
- Toyota: 44%
- Nichiyu: 25%
- Sumitomo: 7%
- Komatsu: 11%
- TCM: 1%
|
<urn:uuid:7d8e3b7a-28a6-4309-a361-5a34b14b786b>
|
CC-MAIN-2021-17
|
https://www.mhi.com/finance/library/others/pdf/nichiyu.pdf
|
2021-04-20T07:59:11+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00053-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet
| 970,466,747 | 1,060 |
eng_Latn
|
eng_Latn
| 0.985922 |
eng_Latn
| 0.993563 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
1121,
2855,
4000
] |
Course Planning Specifics: Industrial Engineering
In the Foisie Business School (FBS) we encourage students who are interested in Industrial Engineering to work on basic courses during their first year. These would include:
- Math: Three calculus courses and statistics;
- Science: Either (a) two courses in chemistry and one in physics or (b) one course in chemistry and two in physics;
- Humanities & Arts (HU&A); and
- Social Science (SS) or an introductory level engineering (ENGR) course, including ECE 2010, ES 1310, and ME 1800.
Sample Course Recommendations for IE Majors
| | A term | B term | C term |
|---|---|---|---|
| Course 1 | Math | Math | Math |
| Course 2 | CH/PH | CH/PH | CH/PH |
| Course 3 | HU/GPS/SS | HU/GPS/SS | HU/ENGR/SS |
Special notes: Overall math for the major includes Calculus I, II, III, IV (MA 1020 or 1021, 1022, 1023, 1024); Ordinary Differential Equations (MA 2051); Statistics I (MA 2611); and either Stats II (MA 2612) or Probability (MA 2621).
Click here for the degree requirements for Industrial Engineering. Potential Industrial Engineering majors who have specific questions regarding the major and distribution requirements should contact Laurie Stokes, Associate Director in the FBS.
Course Planning Worksheet: Industrial Engineering
Math Placement Test Result: ___________________AP/IB/Transfer Credit: ______________________
Abbreviation Key for Course Planning Tracker:
- GPS = Great Problems Seminar
- HU= Humanities and Arts Course (includes AB, AR, CN, EN, GN, HI, HU, INTL, ISE, MU, PY, RE, SP, TH, WR)
- SS = Social Science Course (includes ECON, ENV, GOV, PSY, SD, SOC, SS)
- BB = Biology Course
- PH= Physics Course
- CH= Chemistry Course
Any courses marked with an asterisk (*) are optional programs, and can be taken in addition to the three courses.
Please Note: The Great Problems Seminars are a two term sequence course. They are also linked. This means that when registering for a GPS course in A term, you must register for its second half in B term.
| | A Term Selections (Include CRN) | | |
|---|---|---|---|
| MA | MA | MA | |
| CH/PH | | CH/PH | |
| GPS, HU, SS, Intro to Engineering Course | | GPS, HU, SS, Intro Engineering course | |
| *Physical Education (1/12 credit unit) | | *Physical Education (1/12 credit unit) | |
| | *Military Science (Must | | *Military Science (Must |
| | be affiliated with an ROTC | | be affiliated with an ROTC |
| | unit) | | unit) |
| | Back-ups | Back-ups | Back-ups |
|
<urn:uuid:a8e55161-5294-4c14-a609-a0de53cfc719>
|
CC-MAIN-2019-04
|
https://cpb-us-w2.wpmucdn.com/wp.wpi.edu/dist/8/178/files/2015/04/Course-Planning-Worksheet-IE18.pdf
|
2019-01-24T09:50:54Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547584519757.94/warc/CC-MAIN-20190124080411-20190124102411-00295.warc.gz
| 480,610,705 | 697 |
eng_Latn
|
eng_Latn
| 0.943549 |
eng_Latn
| 0.945214 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1241,
2513
] |
HOW TO SIZE YOUR CHILD
Our uniform and sportswear garments are generally designed for the best fit. For example, if your child measures 28 inches, then that is the size that we recommend that you buy. If your child is between sizes, then we recommend that you buy the next size up.
Measurements such as height are a better guide than age in choosing the correct size, so if your child is taller than average, it is advisable to order the next size up on tops or trousers.
Woodham Academy School Uniform
- Grey suit jacket with embroidered school logo (separate fit for male and female) to be worn at all times
- Tie: Years 7 to 9 Emerald/Black clip on Years 10 & 11 Black/Emerald with logo
- White shirt (long or short sleeved)
- Grey jumper with school logo (optional)
- Grey slipover with logo (optional)
- Black traditional school trousers or skirt. The skirt should be straight, knee length and must be purchased from the suppliers. No other skirts will be allowed.
- Black leather or similar shoes (not trainer-style shoes, boots or plimsolls.)
We are sure all students will look extremely smart in their uniform and take pride in their appearance as a student of Woodham. The suit jacket, tie, skirt (if selected) and PE kit must be purchased from SWI Ltd. (our uniform suppliers). The white shirt and black school trousers can be purchased independently from stockists of your choice.
Woodham PE Kit:
- Unisex Training Top short sleeve – Black/White
- Boys Training Shorts – Black/Silver
- Girls Training Shorts – Black/Silver
- Unisex Sport Socks – Black (optional)
- Unisex Quarter Zip Training Top long sleeve – Black/White (optional)
- Unisex Training Pants – Black/Silver (optional)
- Girls leggings – Black/Silver (optional)
|
<urn:uuid:2e0f563b-55ef-49ad-b6c7-453c3461d0ad>
|
CC-MAIN-2020-40
|
https://woodham.org.uk/pdf/coronavirus/Year%206/Uniform_Requirements.pdf
|
2020-09-22T16:34:32+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-40/subset=warc/part-00226-50bb8e61-7c5b-4d2c-bd34-dad6ca92b697.c000.gz.parquet
| 724,477,675 | 390 |
eng_Latn
|
eng_Latn
| 0.992577 |
eng_Latn
| 0.992577 |
[
"eng_Latn"
] | false |
docling
|
[
1744
] |
Sound Mind in a Healthy Body
M an is the most evolved creature in Nature. With discrimination and proper use of the intellect man not only can attain the temporal pleasures but he can also attain the Transcendental Eternal bliss, which cannot be attained even by gods. Good physical health is essential to attain the four prime objectives of human life -righteousness, wealth, fulfilment of desires and salvation.
Nature intrinsically strives to keep everyone healthy and free from diseases. People today have either forgotten or just do not know how simple and natural it is to stay healthy. We can protect our health with minimal efforts if we take a little care and follow simple rules of rectitude and restraint.
EYE CARE:
The third chapter of ?Brihad Vagbhatta? which contains the crucial sutras, describes the importance of Anjan thus, ?Anjan being beneficial to eyes, should be used regularly. It makes the eyes beautiful and improves the vision too.?
Anjan or Surma is best when it is prepared at home by pulverizing it in a mortar, with bhavna of lime juice and Bhringaraj added thereto (Adding bhavna means mixing a medicinal substance with a medicinal liquid by stirring them together until the mixture dries up). It is an elixir for the eyes.
It should not be applied after meals, after staying awake at night, after travelling or when suffering from fever. One must remember these points while using Surma to get the best results. It helps improve the vision, maintain the same even in old age and prevents cataract as well. Power of vision is a vital part of one?s life. If it is lost or weakened, one?s life is literally in the dark.
Sri Charakacharya has described its benefits, ?Just as gold becomes pure when it is cleansed with oil and a piece of cloth, similarly, with the application of Anjan the vision becomes clear and it shines like the moon in the clear sky.?
|
<urn:uuid:c411c81d-1378-42e9-8786-5ef78c6a4cee>
|
CC-MAIN-2020-40
|
https://www.hariomgroup.org/hariombooks/SoundMindinaHealthyBody.pdf
|
2020-09-21T12:36:42+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-40/subset=warc/part-00124-50bb8e61-7c5b-4d2c-bd34-dad6ca92b697.c000.gz.parquet
| 885,018,945 | 436 |
eng_Latn
|
eng_Latn
| 0.997025 |
eng_Latn
| 0.997025 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
1919
] |
GRADE:
11
Unit Name: Unit 4 Reading Literature/Writing Literary Essays-Romanticism
Duration: 2 Months
Enduring Understandings:
Readers will analyze elements of the Romantic period of literature
Readers will understand elements and implications of an epistolary novel
Readers will understand role and dangers of technology in society
Readers will determine qualities of a good parent
Readers will understand themes of responsibility, secrecy, alienation
Essential Questions:
How does society create pariahs?
What are the dangers of knowledge?
Can we go too far in terms of creating and relying on technology?
What does it mean to play God?
GRADE: 11
* Close reading
* Reader's and Writer's Notebook
* Engaging in discussions
* Monitoring and repairing comprehension
* Making inferences
* Synthesizing
* Questioning
* Determining themes
* Determining importance of historical/cultural contexts within literature
* Responding to text in oral and written form
* Recognize connections between The Greek myth, Prometheus and Frankenstein
* Judge responsibility of society and Dr. Frankenstein in the development of the monster
* Evaluate the dangers of secrecy as applied to the actions of Dr. Frankenstein
* Apply issues discussed in text to present day technological advances
* Class Discussion of thematic elements
* Critique directorial choices in cast, blocking, camera angle, costume and music as applicable if movie is a part of the class
* Quizzes
* Tests
* Vocabulary Quiz
* Short-constructed responses
* Research paper
* Literary Analysis
* Argumentative Essay
* Expository Essay
* Group project on Canterbury Tales
* Edconnect benchmarks
Formative Assessments
* Conference questions
* Do Now
* Turn and Talk
* Summaries
* Observation of group work
* Exit tickets
Benchmarks (fall, winter, spring)
* Edconnect benchmarks
* Prometheus
Classroom Novels:
* Frankenstein
Digital Texts
* Newsela.com
Classroom Materials and Digital Resources
* Reader's Notebook
* Writer's Notebook
* Graphic Organizers
* Chromebooks
* Promethean technology
Word Study/ Spelling/Vocabulary
* vocabulary.com
GRADE: 11
GRADE: 11
* Acquire and use grade-appropriate general academic and domain-specific words and phrases.
New Jersey Student Learning Standards
READING
RL.11-12.1. Cite strong and thorough textual evidence and make relevant connections to support analysis of what the text says explicitly as well as inferences drawn from the text, including determining where the text leaves matters uncertain.
RL.11-12.2. Determine two or more themes or central ideas of a text and analyze their development over the course of the text, including how they interact and build on one another to produce a complex account; provide an objective summary of the text.
RL.11-12.3. Analyze the impact of the author's choices regarding how to develop and relate elements of a story or drama (e.g., where a story is set, how the action is ordered, how the characters are introduced and developed).
RL.11-12.4. Determine the meaning of words and phrases as they are used in the text, including figurative and connotative meanings; analyze the impact of specific word choices on meaning and tone, including words with multiple meanings or language that is particularly fresh, engaging, or beautiful. (e.g., Shakespeare as well as other authors.)
RL.11-12.5. Analyze how an author's choices concerning how to structure specific parts of a text (e.g., the choice of where to begin or end a story, the choice to provide a comedic or tragic resolution) contribute to its overall structure and meaning as well as its aesthetic impact.
RL.11-12.6. Analyze a case in which grasping a point of view requires distinguishing what is directly stated in a text from what is really meant (e.g., satire, sarcasm, irony, or understatement).
GRADE: 11
RL.11-12.7. Analyze multiple interpretations of a story, drama, or poem (e.g., recorded or live production of a play or recorded novel or poetry), evaluating how each version interprets the source text. (e.g., Shakespeare and other authors.)
RL.11-12.9. Demonstrate knowledge of and reflect on (e.g. practical knowledge, historical/cultural context, and background knowledge) eighteenth-, nineteenth- and early twentieth-century foundational works of literature, including how two or more texts from the same period treat similar themes or topics.
WRITING
W.11-12.2. Write informative/explanatory texts to examine and convey complex ideas, concepts, and information clearly and accurately through the effective selection, organization, and analysis of content.
A. Introduce a topic; organize complex ideas, concepts, and information so that each new element builds on that which precedes it to create a unified whole; include formatting (e.g., headings), graphics (e.g., figures, tables), and multimedia when useful to aiding comprehension.
B. Develop the topic thoroughly by selecting the most significant and relevant facts, extended definitions, concrete details, quotations, or other information and examples appropriate to the audience's knowledge of the topic.
C. Use appropriate and varied transitions and syntax to link the major sections of the text, create cohesion, and clarify the relationships among complex ideas and concepts.
D. Use precise language, domain-specific vocabulary, and techniques such as metaphor, simile, and analogy to manage the complexity of the topic.
E. Establish and maintain a style and tone appropriate to the audience and purpose (e.g. formal and objective for academic writing) while attending to the norms and conventions of the discipline in which they are writing.
F. Provide a concluding paragraph or section that supports the argument presented (e.g., articulating implications or the significance of the topic).
GRADE: 11
W.11-12.4. Produce clear and coherent writing in which the development, organization, and style are appropriate to task, purpose, and audience. (Grade-specific expectations for writing types are defined in standards 1–3 above.)
W.11-12.5. Develop and strengthen writing as needed by planning, revising, editing, rewriting, trying a new approach, or consulting a style manual (such as MLA or APA Style), focusing on addressing what is most significant for a specific purpose and audience.
W.11-12.6. Use technology, including the Internet, to produce, share, and update individual or shared writing products in response to ongoing feedback, including new arguments or information.
W.11-12.7. Conduct short as well as more sustained research projects to answer a question (including a self-generated question) or solve a problem; narrow or broaden the inquiry when appropriate; synthesize multiple sources on the subject, demonstrating understanding of the subject under investigation.
W.11-12.8. Gather relevant information from multiple authoritative print and digital sources, using advanced searches effectively; assess the strengths and limitations of each source in terms of the task, purpose, and audience; integrate information into the text selectively to maintain the flow of ideas, avoiding plagiarism and overreliance on any one source and following a standard format for citation. (MLA or APA Style Manuals).
W.11-12.9. Draw evidence from literary or informational texts to support analysis, reflection, and research.
21 st Century Themes and Skills/Career Ready Practices
CRP2. Apply appropriate academic and technical skills.
CRP4. Communicate clearly and effectively and with reason.
CRP6. Demonstrate creativity and innovation.
CRP7: Employ valid and reliable research strategies
CRP 11: Use technology to enhance productivity.
GRADE: 11
2014 NJCCCS - Technology
8.1 Educational Technology: All students will use digital tools to access, manage, evaluate, and synthesize information in order to solve problems individually and collaborate and to create and communicate knowledge.
A. Technology Operations and Concepts: Students demonstrate a sound understanding of technology concepts, systems and operations.
B. Creativity and Innovation: Students demonstrate creative thinking, construct knowledge and develop innovative products and process using technology.
C. Communication and Collaboration: Students use digital media and environments to communicate and work collaboratively, including at a distance, to support individual learning and contribute to the learning of others.
D. Digital Citizenship: Students understand human, cultural, and societal issues related to technology and practice legal and ethical behavior.
E: Research and Information Fluency: Students apply digital tools to gather, evaluate, and use information.
F: Critical thinking, problem solving, and decision making: students use critical thinking skills to plan and conduct research, manage projects, solve problems, and make informed decisions using appropriate digital tools and resources.
Interdisciplinary Connections:
* Students will connect literature to the time period when developing essays based upon science/technology advancements, feminism, politics, historical, social and economic aspects of the time; or biographical / psychological aspects of the work. They will analyze how the economic, social, and political conditions of a time period can affect the labor market.
* Students will work in groups to link current and past technological advancements and their impact on the world (Text to life connections).
* Students will write literary essay on social injustice in Frankenstein.
21st Century Life and Careers: 9.1.12.A.5 History 6.1-6.3 Science HS-ESS1
Literacy in History/Social Studies, Science and Technical Subjects
GRADE: 11
* RH.9-10.1. Accurately cite strong and thorough textual evidence, to support analysis of primary and secondary sources, attending to such features as the date and origin of the information.
* RH.9-10.2. Determine the theme, central ideas, key information and/or perspective(s) presented in a primary or secondary source; provide an accurate summary that makes clear the relationships among the key details and ideas.
* RH.9-10.3. Analyze in detail a series of events described in a text; draw connections between the events, to determine whether earlier events caused later ones or simply preceded them.
* RH.9-10.4. Determine the meaning of words and phrases as they are used in a text, including vocabulary describing political, social, or economic aspects of history and the social sciences; analyze the cumulative impact of specific word choices on meaning and tone.
* RH.9-10.5. Analyze how a text uses structure to emphasize key points or advance an explanation or analysis.
* RH.9-10.6. Compare the point of view of two or more authors in regards to how they treat the same or similar topics, including which details they include and emphasize in their respective accounts.
* RH.9-10.7. Integrate quantitative or technical analysis (e.g., charts, research data) with qualitative analysis in print or digital text, to analyze information presented via different mediums.
* RH.9-10.8. Assess the extent to which the reasoning and evidence in a text support the author's claims.
* RH.9-10.9. Compare and contrast treatments of the same topic, or of various perspectives, in several primary and secondary sources; analyze how they relate in terms of themes and significant historical concepts.
* RST.9-10.1. Accurately cite strong and thorough evidence from the text to support analysis of science and technical texts, attending to precise details for explanations or descriptions.
* RST.9-10.2. Determine the central ideas, themes, or conclusions of a text; trace the text's explanation or depiction of a complex process, phenomenon, or concept; provide an accurate summary of the text.
* RST.9-10.5. Analyze the relationships among concepts in a text, including relationships among key terms (e.g., force, friction, reaction force, energy ).
* RST.9-10.6. Determine the author's purpose in providing an explanation, describing a procedure, or discussing an experiment in a text, defining the question the author seeks to address.
* RST.9-10.8. Determine if the reasoning and evidence in a text support the author's claim or a recommendation for solving a scientific or technical problem.
GRADE: 11
* RST.9-10.9. Compare and contrast findings presented in a text to those from other sources (including their own experiments), noting when the findings support or contradict previous explanations or accounts.
* NJSLSA.W1. Write arguments to support claims in an analysis of substantive topics or texts, using valid reasoning and relevant and sufficient evidence.
NJSLSA.W4. Produce clear and coherent writing in which the development, organization, and style are appropriate to task, purpose, and audience.
NJSLSA.W5. Develop and strengthen writing as needed by planning, revising, editing, rewriting, or trying a new approach.
NJSLSA.W6. Use technology, including the Internet, to produce and publish writing and to interact and collaborate with others.
NJSLSA.W7. Conduct short as well as more sustained research projects, utilizing an inquiry-based research process, based on focused questions, demonstrating understanding of the subject under investigation.
NJSLSA.W8. Gather relevant information from multiple print and digital sources, assess the credibility and accuracy of each source, and integrate the information while avoiding plagiarism.
NJSLSA.W9. Draw evidence from literary or informational texts to support analysis, reflection, and research.
GRADE: 11
Connect, analyze and synthesize literature to local, national and international stories and events.
Research the historical and cultural background as well as the biography of author to see how they relate to events in story and enhance and deepen understanding of novel and its themes.
Have students role play an interview between two characters
Challenge students to create and perform a monologue based on a scene from the story.
When introducing the story, use a Think-Pair-Write-Share combine their notes into a chart to review key elements in the passage.
Provide wait time
Give students a chance to Turn and Talk
Native Language Supports (peer, online assistive technology, bilingual dictionary, Google translate)
Dialogue journal to help the student write frequently & informally.
Students listen to selection on CD-ROM. Have students reread passage to discuss how the audio helped them visualize the story.
Students create an Anticipation Guide where they respond to the events of the story.
Modify guided reading questions
Use graphic organizers with some of the information partially completed
Provide wait time
Give students a chance to Turn and Talk to process information before responding to the whole class.
Have students pick a particular scene and analyze in depth.
Students take notes of their ideas Have them meet in groups to discuss notes, ask questions, clarity confusion, and make predictions.
Provide small group or remedial instruction to review essential questions/big ideas, to provide additional explanations and examples.
Core Instructional Materials/Resources/Digital Tools: (i.e., specific textbooks,classroom resources, digital tools, links to websites and videos) Textbook: Literature and the Language Arts: British Literature
Newsela.com
Vocabulary.com
GRADE: 11
Turnitin.com
Infotrac.galegroup.com
Jstor.org
Search.epnet.com
Scienceflix.digital.scholastic.com
Questiaschool.com
|
<urn:uuid:83b356cc-c598-47e8-a976-fb6cd3fe75b0>
|
CC-MAIN-2021-17
|
http://www.cliffsidepark.edu/wp-content/uploads/2019/01/ELA-11-Unit-4-Reading-Literature-Writing-Literary-Essays-Romanticism.pdf
|
2021-04-14T11:35:13+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00291-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet
| 125,391,756 | 3,187 |
eng_Latn
|
eng_Latn
| 0.912473 |
eng_Latn
| 0.990492 |
[
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
655,
2145,
2182,
3908,
5907,
7798,
9821,
12455,
13756,
15604,
15763
] |
Norwegian Donation Reinforcement Programme
Kari Balke Øiseth, Director General Ministry of Education and Research Department of Research måndag, 2009 oktober 19
Commitment to Research
* White paper (March 2005) which presented comprehensive measures for strengthening Norwegian research
* The initiative was government based and was first launched by the former Minister of Education and Research, Mrs Kristin Clemet
Very little philanthropic funding of research in Norway
3
Norwegian Ministry of Education and Research måndag, 2009 oktober 19
Funding of public universities
External funding of universities in percent of total external funding 2008
| Institution | Gov./Munic | Organisat. | Industry (Norway) | EU |
|---|---|---|---|---|
| University | 31,3 | 14,1 | 28,7 | 10 |
| University colleges | 44,4 | 3,5 | 37,0 | 5,7 |
4
Norwegian Ministry of Education and Research måndag, 2009 oktober 19
Donation Reinforcement Programme
* Matching government funds – 25% for donations for fundamental research
* Adopted by Norwegian Parliament in June 2005.
* Effective in National Budget of 2006
* Guidelines altered June 2008
Conditions - Who can donate?
* Enterprises (from 2006)
* Private individuals (from 2006)
* Foundations and charities (from 2007)
Conditions - Which donations qualify?
* Donations for long-term basic research
* Cannot fund research directly benefiting donor's business activities
* Must be at least NOK 3 million (€ 0,35 million)
Conditions - Who can receive donations and
* Norwegian universities
* Norwegian university colleges that award doctorates
* The Norwegian Academy of Science and Letters
* The Research Council of Norway
Practical arrangements
* Donor and receiving institution/donee agree on formalities and use of donation
* Receiving institution/donee must complete a simple application form
* Receiving institution/donee must guarantee that donations qualify for reinforcement
* A decision is normally made within 3 weeks
Practical arrangements
* The Research Council of Norway distributes donation reinforcements
* Reinforcement is paid to the institution that receives a donation
* Financial report from the donee
Present status – donations
* 2006 – NOK 531 mill. (~ € 63 mill )
* 2007 – NOK 193 mill. (~ € 23 mill )
* 2008 – NOK 238 mill. (~ € 28 mill )
* 2009 – numbers are not finalised
Some examples of donations 2008
* The Cancer Society donated NOK 15,66 mill. for cancer research at the University of Oslo
* StatoilHydro ASA donated NOK 10 mill. to the Research Council of Norway for research on HMS in the petroleum activity
* Stein Erik Hagen's foundation donated NOK 7 mill. to the University of Oslo for research on long-term clinical cardiovascular diseases
* Telenor ASA donated NOK 5 mill. for a professorship at BI – the Norwegian school of management
Norwegian Ministry of Education and Research måndag, 2009 oktober 19
Evaluation
* No formal evaluation has been carried out
* The programme is successful
* Both donors and receiving institutions are satisfied with the system
* Guidelines altered in 2008
– Size of donation
– Technicalities related to accounting
|
<urn:uuid:d1aa852d-7413-47b4-8b3e-c1079eb59f08>
|
CC-MAIN-2018-05
|
http://www.humane.eu/fileadmin/humane_docs/SEM_2009/Madrid/Madrid_BalkeOiseth_ppp.pdf
|
2018-01-18T11:41:07Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084887253.36/warc/CC-MAIN-20180118111417-20180118131417-00002.warc.gz
| 499,413,228 | 752 |
eng_Latn
|
eng_Latn
| 0.767078 |
eng_Latn
| 0.94121 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"sco_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
161,
419,
549,
912,
1139,
1270,
1472,
1676,
1983,
2179,
2357,
2906,
3151
] |
The Blue Chip Report – July 2020
History Doesn't Repeat Itself, But…
Portfolio Manager & Chief Investment Officer
Todd Johnson, CFA, CIM
The first six months of 2020 have been a roller coaster in capital markets unlike many others. The implications of COVID-19 and the economic shutdown cascaded sharply through global fixed income and equity markets in the first quarter. We have seen an equally sharp reaction to unprecedented fiscal and monetary stimulus which has been the dominant factor in the last three months. In North America, we have seen the effect of massive government spending to support consumption, employment and assistance with lending programs. The monetary support has been equally dramatic with central banks lowering rates and buying bonds to inject liquidity and support to capital markets.
Investors have reacted swiftly to the changes and as a result, led by technology stocks, the Nasdaq Composite, which represents large technology companies, has risen 31% in the last three months alone. The S&P 500 Index, which represents 500 of the largest public companies in the United States also rose by 20% in the quarter (its biggest quarterly jump since 1998). The technology sector was generally the biggest contributor as earnings from large technology companies are perceived to be more resilient in this uncertain economic environment. In Canada the S&P/TSX Composite Index rose 16%, led by the gold companies, as gold prices have risen on investor demand for the precious metal. For many equity securities, this bounce back hasn't erased the losses overall from the first quarter (on average), but most have climbed the proverbial 'wall of worry' amidst the current carnage in the real economy.
The corporate fixed income market has also improved dramatically this quarter as central banking support has alleviated the fear from illiquidity. Hence, we have seen many companies refinance their obligations coming due and bond pricing has strengthened as a result. In the table below one can see sovereign yields in North America are well below 1%. In Canada and the United States, we will likely see short term rates anchored near zero for several years. Notably, Canada did lose its AAA credit rating from one of the main rating agencies (Fitch Ratings Inc.) in the quarter, as higher debt leaves our government with less fiscal flexibility in the future. This did not affect near term yields but reflects the increased debt taken on by the federal government.
Government of Canada Bond yields as of July 1 st , 2020
United States Treasury Bond yields as of July 1 st , 2020
Looking forward, we anticipate monetary stimulus to continue being very supportive of capital markets. That should be positive for fixed income prices and will continue to push yields lower for corporate bonds. With accompanying sovereign rates so low, valuation multiples of many equities may continue to expand, provided the recovery outlook remains in place. The trickier part will be the handoff later this year as governments will eventually stop sending out cheques and the real economy will need to generate the jobs and spending that has been lost. With close to 20 million lost jobs in the United States and over 2 million in Canada, businesses are likely to be tentative in their rehiring, extending the recovery. There is also an election south of the border later this year, which will be impactful to the broad market and certain sectors, however it is decided.
While the current focus is justifiably on the COVID-19 pandemic along with the tentative economy recovery, there will be other obstacles in the future that our companies will need to overcome. We focus on building portfolios to be resilient, and while values have fluctuated tremendously in the first half of the year, the businesses we own continue to generate attractive dividends which are anticipated to rise with a recovering economy. The yields in corporate fixed income continue to remain attractive relative to government bond yields. In this uncertain environment, we continue to remain focused on the future. Though the pace and shape of the anticipated economic recovery are unknown at present, we remain confident our portfolios will survive and thrive into the future.
The Rebound James McInnis, CFA Portfolio Manager
The Canadian Equity and United States Equity indices rebounded more quickly than many had expected this past quarter, and liquidity in the Canadian bond market improved to near normal conditions. Given all the news reports since the beginning of the year, the year-to-date performance for the markets is closer to "normal", although the world does not seem anywhere close to normal. Our Canadian equity portfolio has a dividend yield near 5%, and our United States equity portfolio is near 3%. Our fixed income portfolio has a yield-to-maturity that is in the 4-5% range, which is highly attractive relative to government bonds yielding less than 1%.
The North American Equity market appears quite bifurcated. Technology companies, represented by the Nasdaq index, are hitting all-time highs, while the majority of businesses have a longer road to recovery, particularly smaller firms outside the technology or healthcare sectors. Some of our faster growing businesses with lower dividend yields have snapped back quickly to hit all-time highs and remain quite insulated from the job losses and reduced spending affecting the more economically sensitive sectors. Our higher dividend yielding companies that are tied more closely to main street (e.g. financials) have been slower to rebound, but they continue to provide tax-efficient dividend income. For the businesses in the latter category, we expect a slow, steady improvement as economies emerge from the economic downturn.
Throughout this volatile period, we've been managing your portfolio within the constraints of your Investment Policy Statement. During the quarter we sold fixed income that performed relatively well and added to equities where it made sense, which increased income, made that income more tax efficient and allowed for greater potential upside. We also exited several positions to improve the quality of our portfolios and generate an improved risk-adjusted rate of return. Furthermore, we continued our research on existing holdings by communicating with management teams to get updates on their businesses while also looking for new investment ideas. In fact, we added a new name to our model in Q2 that is less economically sensitive and provides stability given it is an essential service. This business has good pricing power (often being the sole service provider) and can grow organically via acquisitions given the fragmented nature of the North American industry. It's market events like this that allow a value-investor, such as
BCV, to crystalize gains where investment theses have come to fruition and redeploy that capital into the next opportunistic investment.
Where do we go from here as we enter the third quarter of 2020? Investors are wondering when some of these investments will recover, given the current state of uncertainty. We think it is less a matter of when, but that the probability of a recovery over your investment horizon is extremely high. If you don't need to redeem securities to raise capital, then the timing or a recovery is of less importance. If you do need funds in the near term, it is highly likely that you have fixed income which is generating steady flow of interest income. If your portfolio does not contain any fixed income, it is likely that you have a high allocation to equities because: (1) you have a longer time horizon, or (2) you are living off the dividends on your equity holdings making price volatility less of a concern. Despite many dividend cuts that have occurred across many market sectors, we have not had any equity holdings reduce their shareholder payouts – a testament to the quality of the portfolio. But if you must sell stock to fund your lifestyle requirements, take comfort in knowing that not all equities are down in value by the same relative amount – many are at all time highs.
Our goal is to provide peace of mind for our clients by managing your portfolio in line with your long-term investment objectives. If you are a younger investor or capital needs are not required in the near term, depressed market prices for solid, well managed companies with a strong dividend record are an opportunity to add capital to ride an upward trending market. If you are closer to retirement or newly retired, take comfort that your income from your portfolio has remained intact, if not enhanced, as many of the companies within your portfolio have continued to increase their dividends. We continue to believe in our process and philosophy to drive income and growth over your investment time horizon.
Notice to Readers: The Blue-Chip Report is prepared for general informational purposes only, without reference to the investment objectives, financial profile, or risk tolerance of any specific person or entity who may receive it. Investors should seek professional financial advice regarding the appropriateness of investing in any investment strategy or security and no financial decisions should be made on the basis of the information provided in this newsletter. Statements regarding future performance may not be realized and past performance is not a guarantee of future performance. This newsletter and its contents do not constitute a recommendation or solicitation to buy or sell securities of any kind. Investors should note that income, if any, from any investment strategy or security may fluctuate and that portfolio values may rise or fall. BCV Asset Management Inc. does not guarantee the accuracy or completeness of the information contained herein, nor does BCV Asset Management Inc. assume any liability for any loss that may result from the reliance by any person upon any such information or opinions. The information and opinions contained herein are subject to change without notice.
|
<urn:uuid:dbd3f973-4815-43f9-b898-24b6de34dca4>
|
CC-MAIN-2021-04
|
http://bcvassetmanagement.com/upload/reports/202007TheBlueChipReport.pdf
|
2021-01-25T07:39:01+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00043-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet
| 9,780,717 | 1,939 |
eng_Latn
|
eng_Latn
| 0.999026 |
eng_Latn
| 0.999145 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2621,
6871,
10133
] |
BELLEVUE CITY COUNCIL AGENDA
Council Chambers- City Hall (106 N. Third Street)
Work Session
Monday, August 6, 2018- 5:30 p.m.
1. Clerk's Office Staffing Discussion
Regular Session
Monday, August 6, 2018 – 6:30 p.m.
1. Call to Order
2. Pledge of Allegiance
3. Roll Call
4. Approval of Agenda
5. Visitors with Business to Present to the Council
A. Carrie Weaver – Sidewalk Sales
B. Susan Lucke & George Daugherty – Young Museum
6. Consent Agenda
a. Approve June 29, 2018 Special Session and July 23, 2018 Regular Session
b. Approve July Financial Reports
c. Approve Library Bills and Claims
7. Unfinished Business
a. Sidewalk Sales
b. Young Museum
c. Firework Survey
d. StoryWalk
e. Consideration, Approval and Passage into Law upon Publication of the Third Reading of Ordinance No. 429 Amending Article VIII, Exceptions and Modifications of the Zoning Ordinance of the Bellevue Code of Ordinances Pertinent to Front and Rear Yards on Residential Properties Located to the East of Highway 52
f. Consideration and Approval of the Second Reading of Ordinance No. 430 Amending Title III Community Protection, Chapter 2 Nuisances, Section 3-2-9 Abatement by Municipality, of the Bellevue Code of Ordinances (2014) to Provide for Assessment and Collection of Fee for Municipality Mowing Grass and Cutting Weeds
g. Consideration and Approval of the Second Reading of Ordinance No. 431 Amending Title III Community Protection, Chapter 2 Nuisances, Section 3201(1)(h) Definitions and Section 3-2-3(6) Other Conditions Regulated, of the Bellevue Code of Ordinances (2014) to Provide that Grass and Weeds in Excess of a Height of Eight Inches Shall Constitute a Nuisance and/or Other Regulated Condition
h. Attorney RFP's
i. Cole Park Playground Project – Update
j. Park Street Extension
8. New Business
a. Approve Resolution No. 17-18 Authorizing the Acceptance of a Rural County Transportation Program (RCTP) Grant Application with the Jackson County to Assist with the Funding of ADA Compliance
b. Approve IIW Engineer Cost Share for 2018 Municipal Improvement Project on 05/09/2018 for $93.53
9. Other
10. Adjournment
|
<urn:uuid:89031095-001f-4e99-9fb5-969337bd964f>
|
CC-MAIN-2024-30
|
https://cms6.revize.com/revize/bellevue/03-August%206%20Regular%20Session.pdf
|
2024-07-25T06:48:15+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-30/subset=warc/part-00160-65338ae2-db7f-48fa-a620-71777c40d854.c000.gz.parquet
| 152,354,791 | 557 |
eng_Latn
|
eng_Latn
| 0.729022 |
eng_Latn
| 0.732386 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1000,
2125
] |
Georgia State University ScholarWorks @ Georgia State University
Criminal Justice Theses
Department of Criminal Justice
4-19-2010
The Relationship Between Risky Behaviors, Individual Characteristics, and Sexual Revictimization Among College Women
Sadie J. Mummert
Georgia State University, [email protected]
Follow this and additional works at: http://scholarworks.gsu.edu/cj_theses
Part of the Criminology and Criminal Justice Commons
Recommended Citation
Mummert, Sadie J., "The Relationship Between Risky Behaviors, Individual Characteristics, and Sexual Revictimization Among College Women" (2010). Criminal Justice Theses. Paper 11.
This Thesis is brought to you for free and open access by the Department of Criminal Justice at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Criminal Justice Theses by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected].
ABSTRACT
SADIE J. MUMMERT
The Relationship Between Risky Behaviors, Individual Characteristics, and Sexual Revictimization Among College Women (Under the direction of DR. LEAH DAIGLE)
Sexual revictimization of college women is a relatively new area of study within the field of victimology. Although the link between childhood sexual assault (CSA) and adult revictimization has been examined, many aspects of why college-aged females are revictimized have gained little attention. This Master‟s thesis will explore the current literature as well as analyze the possible link between risky behaviors, individual characteristics, and sexual revictimization. Using Jacquelyn W. White and Paige Hall Smith‟s (2004) data, A Longitudinal Perspective on Physical and Sexual Intimate Partner Violence Against Women, bivariate analyses were conducted regarding the revictimization of college women. The findings suggest a few differences between single victims and revictims. The findings also suggested that nonvictims and revictims were found to have multiple differences across variables. Suggestions for future research will be discussed.
INDEX WORDS: risky behaviors, individual characteristics, sexual revictimization
THE RELATIONSHIP BETWEEN RISKY BEHAVIORS, INDIVIDUAL CHARACTERISTICS, AND SEXUAL REVICTIMIZATION AMONG COLLEGE WOMEN
by
SADIE J. MUMMERT
B.A., WITTENBERG UNIVERISTY
A Thesis Submitted to the Graduate Faculty of Georgia State University in Partial Fulfillment of the Requirements for the Degree
MASTER OF SCIENCE
ATLANTA, GEORGIA
2010
THE RELATIONSHIP BETWEEN RISKY BEHAVIORS, INDIVIDUAL CHARACTERISTICS, AND SEXUAL REVICTIMIZATION AMONG COLLEGE WOMEN
by
SADIE J. MUMMERT
Approved:
__Dr. Leah Daigle_____________ Committee Chair
__Dr. Brian Payne_____________ Committee Member
__Dr. Mark Reed______________ Committee Member
__April 19, 2010______________
Date
DEDICATION
I would like to dedicate this Master‟s thesis to my Mom and Dad for their continuous love and support. If it were not for their encouragement, I would not be where I am today. Thank you for all that you both have done for me, I love you.
ACKNOWLEDGMENTS
I would like to thank Georgia State University, the College of Health and Human Sciences, and the Department of Criminal Justice for the opportunity to study in the Criminal Justice Master‟s Program and their encouragement to write this Master‟s Thesis. I would like to extend a special thank you to my thesis committee for their continuous support throughout this process. Thank you to Dr. Brian Payne and Dr. Mark Reed for serving on my committee and volunteering your time during this thesis project. An extra special thank you goes to Dr. Leah Daigle, my thesis chair. Your time and dedication to this thesis and the process are very much appreciated. I could not have accomplished this without your ongoing support.
AUTHOR‟S STATEMENT
In presenting this thesis as a partial fulfillment of the requirements for an advanced degree from Georgia State University, I agree that the Library of the University shall make it available for inspection and circulation in accordance with its regulations governing materials of this type. I agree that permission to quote from, to copy from, or to publish this thesis may be granted by the author or, in his/her absence, by the professor under whose direction it was written, or in his/her absence, by the Associate Dean, College of Health and Human Sciences. Such quoting, copying, or publishing must be solely for scholarly purposes and will not involve potential financial gain. It is understood that any copying from or publication of this dissertation which involves potential financial gain will not be allowed without written permission of the author.
___Sadie J. Mummert________
Signature of Author
NOTICE TO BORROWERS
All theses deposited in the Georgia State University Library must be used in accordance with the stipulations prescribed by the author in the preceding statement.
The author of this thesis is:
Student‟s Name: ___Sadie J. Mummert____________________________
Street Address: __1947 Hanover Pike_____________________________
City, State, and Zip Code: ___Hanover, PA 17331___________________
The Chair of the committee for this thesis is:
Professor‟s Name: __Dr. Leah Daigle_____________________________
Department: ____Criminal Justice________________________________
College: __College of Health and Human Sciences___________________
Georgia State University P.O. Box 4018 Atlanta, Georgia 30302-4018
Users of this thesis who not regularly enrolled as students at Georgia State University are required to attest acceptance of the preceding stipulation by signing below. Libraries borrowing this thesis for the use of their patrons are required to see that each user records here the information requested.
NAME OF USER ADDRESS
DATE
TYPE OF USE (EXAMINATION
ONLY OR
COPYING)
VITA
Sadie J. Mummert
1947 Hanover Pike
Hanover, PA 17331
Phone: (717) 465-7380
[email protected]
EDUCATION
TABLE OF CONTENTS
LIST OF TABLES
Page
CHAPTER I Introduction
The victimization of females by varying forms of sexual assault has become increasingly apparent over the past two decades particularly on among college women. Research shows that college women are at risk of being sexually victimized and revictimized. For example, data from the National College Women Sexual Victimization (NCWSV) study show that 2.8 percent of college women experience an attempted or completed rape in an academic year. For every 1,000 females students on a college campus, about thirty-five rapes take place each year (Fisher, Cullen, & Turner., 2000). College women are also likely to experience other types of sexual victimization such as coercion, unwanted sexual contact, and stalking. In fact, about one third of college women in the NCWSV study experienced unwanted or uninvited sexual incidents of some kind (Fisher et al., 2000).
Revictimization is also an important problem impacting college women. Research shows that about one-fourth of college women of those who had been sexually victimized experienced more than one sexual victimization incident (Fisher et al., 2000). It has been found that those who become the victim of an unwanted sexual experience are at a greater risk of being sexually revictimized in the future (Classen, Palesh, & Aggarwal, 2005; Norris, Nurius, & Dimeff, 1996). Classen and colleagues (2005) found that sexual revictimization was reported by two out of every three women who reported an initial sexual victimized.
Because this area of research is relatively new, it is limited (Classen et al., 2005). In particular, little is known about the causes of female sexual victimization and sexual revictimization. Most research has focused on the link between childhood sexual assault (CSA) and revictimization (Arata, 2000; Desai, Arias, Thompson, & Basile, 2002; Filipas & Ullman, 2006; Messman & Long, 1996; Messman-Moore, Long, & Siegfried, 2000). The revictimization of college women has also been explored and shows an abundance of revictimizations occurring among college women (Daigle, Fisher, & Cullen, 2008; Fisher, Daigle, & Cullen, 2008; Fisher, Daigle, & Cullen, 2010; Fisher & Wilkes, 2003). Due to the limited research examining lifestyles and individual characteristics, a study to examine if some of these traits seem to predispose women to becoming a revictim is an important step to be taken. It is possible that risk seeking and low self-control are two characteristics that may place college women at risk of being sexually revictimized. Revictimizations may also occur if these risky behaviors and individual personality characteristics continue on unchanged after an initial sexual victimization.
The lifestyle-routine activities theory (L/RAT) is one perspective used to examine risky behaviors. The basic premise of this perspective is that risky behaviors and lifestyles make particular persons more vulnerable, in this case to sexual victimization and revictimization. According to this perspective, if there is a suitable or vulnerable victim, then the chances of the crime taking place increase. Other elements of the theory are also important such as the presence of and proximity to motivated offenders and lack of capable guardianship. In regards to proximity to motivated offenders, studies have found that females who socialize in contexts where they are frequently around unfamiliar men are likely to be sexually revictimized (Fisher, Daigle, & Cullen, 2010). Target suitability and exposure to crime are similar; potential victims may place themselves and participate in situations where alcohol consumption is prevalent, which can increase their risk of being revictimized (Fisher et al., 2010).
Another relevant theoretical perspective is risk heterogeneity. Based on the concept of risk heterogeneity, some people are more likely to be sexually revictimized based on personal characteristics such as personality and risk taking. These traits could include things such as low self-control and impulsivity (Schreck, 1999). Although not yet applied to sexual victimization or sexual revictimization, Schreck (1999) found that low self-control increases the likelihood of victimization for individuals. Accordingly, it is possible that college women with low self-control are more likely to be sexually revictimized than those with higher levels. This thesis will add to the current literature on self-control in hopes to further explain its connection to sexual revictimization.
CHAPTER II Literature Review
Sexual Victimization
Rape
With high profile rape trials in the media and Congress being involved in taking action against sexual victimization (Kilpatrick, 1993), it is evident that it is a serious problem in the United States. Kilpatrick, Edmunds, and Seymour (1992) reported that over twelve million women in the United States will be raped at some point during their adult lives. When that number is broken down, women are raped at an alarming rate of almost seven hundred thousand per year. The National Crime Victimization Survey reported that a total of 248,280 rape/sexual assault incidents took place in 2007 (BJS, 2007). Additionally, the Uniform Crime Reports (UCR) indicate that in 2008 .5 rapes occurred for every one thousand people in the United States population (BJS, 2008).
Other Sexual Victimization
Rape is not the only type of sexual victimization that women experience. Other forms of sexual victimization include but are not limited to: sexual coercion, sexual contact with force or the threat of force, sexual contact without force, and threats (Fisher, Daigle, Cullen, & Turner, 2003). Approximately seventeen percent of women in one study were sexually assaulted at some point in their lifetime (Sorenson, Stein, Siegal, Golding, & Burnam, 1987). Sexual victimization is so commonplace that Carmen, Rieker, and Mills (1984) conclude that a sexual victimization at some point in a person‟s life is almost unavoidable.
Sexual Victimization of College Women
College females are part of the population that experiences rape. Using the National College Women Sexual Victimization Study, Fisher, Cullen, and Turner (2000), investigated the extent to which college women are sexually victimized. They focused not only on rape, but a total of 12 different forms of sexual victimization (completed rape, attempted rape, completed sexual coercion, attempted sexual coercion, completed sexual contact with force of the threat of force, completed sexual contact without force, attempted sexual contact with force or the threat of force, attempted sexual contact without force, threat of rape, threat of contact with force or the threat of force, threat of penetration without force, and threat of contact without force). After looking at incidents from a total of 691 college female participants and over thirteen hundred separate incidents, they found that 157 incidents of completed and attempted rape were experienced, resulting in 2.8 percent of college women in the sample having experienced a rape incident (Fisher et al., 2003). More recently, Kilpatrick et al. (2007) conducted a study of two thousand female college students taken from the American Student List. They found that 11.5% of the college women in their sample reported being raped (Kilpatrick et al., 2007).
College-aged females are at particular risk of being sexually victimized (Himelein, 1995) because they fall into the age range (18 to 24) that has the highest sexual victimization rates; although college students are at a lesser risk than their counterparts who are not in college (Hart, 2003). Approximately a little over half of college women have had some kind of experience with sexual victimization of some type, which includes rape and other types of sexual victimization such as sexual coercion and unwanted sexual contact (Koss & Dinero, 1989). Gross, Winslett, Roberts, and Gohn (2006) reported that thirty seven percent of college women surveyed had experienced more than one sexual victimization incident since they entered college. A little over half of the women surveyed by Koss and her associates reported having some type of unwanted sexual contact (Koss et al., 1987; Koss, Woodruff, & Koss, 1990).
Consequences
It is important to investigate the sexual victimization of college women because of the consequences that go along with it. Sexual victimization is oftentimes accompanied by multiple negative consequences. Substance abuse, posttraumatic stress disorder (PTSD), and depression are some of the consequences of rape that victims experience (Kilpatrick et al., 2007). In a study on the effects of rape, Resick (1993) found that women who had been the victims of rape suffered from issues with self-esteem, fear, and anxiety. Depression, PTSD, and problems adjusting to social and sexual situations were also common (Resick, 1993). Importantly, more than a quarter of the women who reported suffering from PTSD as a rape-induced symptom reported still had PTSD a year later (Kilpatrick et al., 1992).
Sexual Revictimization
Revictimization, specifically sexual revictimization, is a growing concern for college women. Sexual revictimization occurs when an individual experiences a sexual victimization following an initial sexual victimization. For example, if a woman is raped
and then raped again after the initial incident, it constitutes sexual revictimization.
Classen, Palesh, and Aggarwal (2005) shed light on the occurrence of sexual victimization and its connection to sexual revictimization. They discovered that those who experienced sexual abuse or assault had an increased risk of being sexually revictimized. In addition, they found that two out of every three women who had experienced sexual victimization of some kind also reported multiple sexual victimizations or sexual revictimization (Classen et al., 2005). Norris, Nurius, and Dimeff (1996) also found that women who were previously sexually victimized are at greater risk of being sexually victimized again in the future.
Sexual revictimization can occur across developmental time periods. For example, an abundance of research indicates that there is a positive relationship between childhood sexual abuse (CSA) and sexual revictimization as an adult (Arata, 2000; Desai, Arias, Thompson, & Basile, 2002; Filipas & Ullman, 2006; Messman & Long, 1996; Messman-Moore, Long, & Siegfried, 2000). In fact, "estimates based on community samples are that child sexual abuse (CSA) doubles or even triples the risk of sexual revictimization for adult women" (Classen, Palesh, & Aggarwal, 2005, p. 103). Walsh, Blaustein, Knight, Spinazzola, and Van der Kolk (2007) examined college-aged female students through self-report surveys. They concluded that childhood sexual abuse was correlated with future sexual assault as an adult (Walsh et al., 2007). Other studies have reported similar findings. Women are more at risk of being sexually revictimized if they were sexually victimized in the past (Fite, 2006). In fact, "those abused as children were two times more likely to experience sexual victimization during adolescence, and those
reporting adolescent victimization were four times more likely to be assaulted" (Fite, 2006).
Some research has considered revictimization within a relatively short time period. Tjaden and Thoennes (2006) assessed sexual revictimization within a time period of a year in the National Violence Against Women Study. They found that women who reported being raped were raped 2.9 times a year on average (Tjaden & Thoennes, 2006). Tjaden and Thoennes (2006) also reported that these numbers increased when the sexual victimizations occurred between the women and an intimate partner.
Like women in general, sexual revictimization is also a problem for college females. Daigle, Fisher, and Cullen (2008) conducted a study that highlighted the problem of sexual revictimization. Using data from two national-level studies of college women with samples that totaled over eight thousand college women, they explored the different type of sexual revictimizations that occurred, the time course of the incidents, and the characteristics of the incidents. Using data derived from the National College Women Violent Victimization (NCWVV) study and the National College Women Sexual Victimization (NCWSV) study, they examined each incident of sexual victimization that the women reported experiencing in a single academic year (Daigle et al., 2008). Daigle and colleagues (2008) looked at five types of sexual victimization (rape, sexual coercion, unwanted sexual contact with force, unwanted sexual contact without force, and threats). They found that 47.3% of the women surveyed who reported at least one sexual victimization were victims of sexual revictimization since the beginning of the academic year (Daigle et al., 2008). They also found that sexual victimization was more likely to
recur than non-sexual victimization (Daigle et al., 2008). By looking at the different types of incidents, they found that 3.3% of those who reported sexual revictimizations experienced almost fifty percent of the total number of sexual victimizations reported (Daigle et al., 2008).
Another important finding in Daigle, Fisher, and Cullen‟s (2008) study was that females were at greater risk of being sexually victimized in the time immediately following the initial incident. Approximately half of the rape revictimizations took place during the same month of the initial sexual victimization (Daigle et al., 2008). Additionally, about one third of repeated sexual coercions and threats were found to occur within the same month. Recurring physical assaults and unwanted sexual contacts with force were also likely to happen within the same month, 31 percent and 28 percent respectively (Daigle et al., 2008).
As with any type of victimization, there are negative outcomes that present themselves once an initial sexual victimization occurs. It is important to acknowledge that revictimizations may increase these negative outcomes. There are many consequences that arise when women are repeatedly victimized. One such consequence is the occurrence of Post Traumatic Stress Disorder (PTSD) (Filipas & Ullman, 2006; Gidycz, Coble, Latham, & Layman, 1993; Messman-Moore et al., 2000). Along with this, self-blame (Filipas & Ullman, 2006), depression, distress, and anxiety (Messman-Moore et al., 2000) have also been reported by women who reported being sexually revictimized. These symptoms were reported as being present during the latter revictimization incidents (Messman-Moore et al., 2000). Gidycz et al. (1993) also found that women who reported sexual revictimizations were more likely to have trouble finding employment and were found in lower levels of economic status resulting in a lower quality of life. Furthermore, those who had been sexually revictimized often became more sexually active in order to cope with their sexual victimization (Filipas & Ullman, 2006).
With the seriousness of these consequences, it is surprising to find that there is little research on the causes of sexual revictimization. As mentioned before, the link between CSA and adult sexual revictimization and sexual revictimization in short time periods has begun to be examined; however, the factors that place college women at risk of being sexually revictimized are not fully understood. It is difficult to pinpoint the reasons why these repeat incidents occur (Gidycz, McNamara, Edwards, 2006); and focus should be placed on the personality, behavioral, and lifestyle characteristics of the victims. Perhaps risky behaviors and underlying personality traits are related to sexual revictimization.
Explanations for Revictimization
Although most criminological theory focuses on the reasons why people commit crimes, the lifestyle-routine activities theory (L/RAT) also provides some insight into why people become victims. According to L/RAT there are three elements that must be present for a victimization to occur. These elements are motivated offenders, suitable targets of criminal victimization, and lack of capable guardians of persons or property
(Cohen & Felson, 1979). Each of these elements can either raise or reduce the probability a crime will take place. The theory "maintains that the convergence in time and space of motivated offenders, attractive targets, and ineffective guardianship determines the risk of victimization" (Schreck & Fisher, 2004, p. 1023). A person‟s daily lifestyle increases his or her vulnerability to victimization (Cohen & Felson, 1979; Hindelang, Gottfredson, & Garofalo, 1978). Hindelang et al. (1978) considered the rate of victimization versus the likelihood of victimization and their impact on the "proneness" of the victim. That is, they investigated how likely a person is to become a victim based on rates. They determined that ecological variables or the victims‟ environments should be included in the risk factors of victimization. Many things such as socioeconomic class and demographics have an impact on a person‟s lifestyle. Moreover, the theory suggests that those people who have lifestyles that have them spending time away from home, at night, and with persons who are not family members are at a greater risk of becoming a victim than those who do not have such lifestyles. Taken together, lifestyles, and the choices people make that impact the coalescence of motivated offenders, suitable targets, and lack of capable guardianship increase susceptibility to becoming a victim according to the L/RAT perspective (Hindelang, Gottfredson, & Garofalo, 1978).
Proximity to Motivated Offenders
The L/RAT perspective assumes that in order for victimization to occur, motivated offenders must be present. When in close proximity to motivated offenders and deviant environments, individuals are in harm‟s way since they are at an increased risk of being victimized (Schwartz & Pitts, 1995). Women are at an increased risk of being
sexually victimized when they are in situations with close proximity to men with whom they are not familiar (Fisher, Daigle, & Cullen, 2010). For example, bars, fraternity houses, and college parties are all environments that may encourage sexual victimization. Fisher and Wilkes (2003) considered the theory in regards to college students. They discussed how proximity and exposure to crime are additional important elements. An environment such as student housing constitutes proximity to crime because it is likely to be a place where personal and property crimes occur. Additionally, they describe exposure to crime in terms of college women spending great amounts of their time in bars, nightclubs, and partying (Fisher & Wilkes, 2003). Fisher et al. (1997) stressed that living quarters were important due to the finding that on campus victimizations were more likely to take place in students‟ housing.
Exposure to Crime
Another aspect of the L/RAT, which coincides with proximity to motivated offenders, is the exposure of the potential victim to crime. Frequenting crime ridden social arenas; such as bars, strip clubs, college parties, and other places where deviant behavior is present can put potential victims at greater risk of being sexually victimized (Fisher & Wilkes, 2003; Fisher, Daigle, & Cullen, 2010). For college women, attending parties and walking alone after dark are examples of situations where crime is likely to occur.
Suitable Target
The third element germane to L/RAT is being a suitable target. A suitable target must be present for a potential offender to feel like he is able to commit the crime. A
suitable target is someone who opens himself or herself up to possible victimization by exposure to deviant environments and/or behaviors. For example, by attending parties, victimization risk factors are increased. This creates increased vulnerability of the targets by providing an increased opportunity for a crime to take place. This applies to the lifestyle choices and routines that the potential victims and do every day (Fisher, Daigle, & Cullen, 2010). College females can easily become suitable targets when they frequent college parties, college bars, or belong to sororities due to the increased deviant behaviors (i.e. alcohol consumption, drug use, sexual promiscuity) present in these environments. These deviant behaviors may lower women‟s inhibitions and expose them as vulnerable targets.
Capable Guardianship
Finally, if there is a guardian present who is protecting or looking after others or property, then victimization risk declines (Cohen & Felson, 1979; Miethe & Meier, 1994). There are two types of guardianship, social and physical. Devices such as pepper spray, security alarms, and rape whistles can serve as physical guardians. Roommates, friends, neighbors, and the police are forms of social guardians. Guardians may not be present in situations where victims live alone, walk across college campuses alone, or frequent high crime areas alone. Unfortunately, those people who students may consider to be social guardians could also become potential offenders (i.e. roommates). Important to college females, Fisher and Wilkes (2003) found that most student victimizations are committed by fellow students.
Research on L/RAT & Sexual Victimization
Overall, the findings are mixed for lifestyle-routine activities theory in regards to its application to sexual victimization. However, for the most part, the findings seem to moderately support the theory. Fisher and Wilkes (2003) completed a study that analyzed L/RAT in regards to college students in the United States and England. Focusing on L/RAT in general, their findings showed that the daily lifestyles and activities of college students help to determine the relationship between risk and victimization (Fisher & Wilkes, 2003). They found that those who had partying and drug use lifestyles, displayed target suitability, and lacked guardianship were found to be at a higher vulnerability and risk of victimization generally (Fisher & Wilkes, 2003).
In the realm of motivated offenders, Schwartz & Pitts (1995) found that frequent physical proximity to males increases the risk that women will be sexually victimized. Other research shows that an increased risk for sexual victimization happens oftentimes in unhealthy romantic relationships (Farrell, Phillips, & Pease, 1995). By being in such relationships, a person is also placing themselves in close physical proximity to a potential offender. Physical proximity to potential offenders is found to increase a female‟s risk of being sexually victimized.
Research on sexual victimization and L/RAT has found that target suitability is an important construct. Much of this research has focused on alcohol use as a measure of target suitability. Using alcohol is linked to an increased risk of sexual victimization for college females. This is because potential offenders are commonly found in places where alcohol consumption is prevalent (Abbey et al., 2001). Consumption by the potential victim can increase the likelihood of victimization occurring. Alcohol may lower the
victim‟s inhibitions making her easily persuaded into a compromising situation. If drinking heavily, victims are "less able to defend themselves" (Schreck, 1999, p. 635).
Many studies have found a relationship between alcohol abuse and increased sexual victimization (Koss & Dinero, 1989; Testa, Livingston, & Collins, 2000; Abbey et al., 2001). Testa et al. (2000) found that woman who consumed alcohol or a placebo they believed to be alcohol were more accepting of men who appeared at their door intoxicated. These females were also more willing and open to allowing the men to gain access into their residence and participating in activities, which would most likely increase their risk of being sexually victimized (Testa et al., 2000).
Capable guardians have also been considered in studies pertaining to L/RAT. Households that have a greater number of adults present, such as two parent families, are less likely to be victimized than those who have a fewer number of adults (Mukherjee & Carcach, 1998). While capable guardians are studied as an aspect of the theory, this element is frequently devalued as a meaningful concept. In many cases, social guardianship is related to sexual victimization in the opposite direction of what the theory suggests. This may be because the potential victim‟s peers, who might oftentimes serve as social guardians, are also the potential offenders.
L/RAT and Revictimization
The L/RAT does provide some key insights as to why women are sexually victimized more than once. In regards to proximity to motivated offenders, studies have found that females who socialize in realms where they are frequently around unfamiliar men are likely to be sexually revictimized (Fisher, Daigle, & Cullen, 2010). Like initial victimizations, these social arenas that increase risk are places such as bars, clubs, and college parties.
Victimization incidents are oftentimes accompanied by alcohol consumption. Women are found to be suitable targets, another element of the R/LAT, when alcohol consumption is involved in their lifestyles. Many studies have supported this argument; alcohol use promotes revictimization (Ellis, Atkeson, & Calhoun, 1982; Gidyz et al., 1995). There is also a possible unexplored link between revictimization and drug use (Fisher, Daigle, & Cullen, 2010).
The L/RAT can help to explain sexual revictimization through the aspect of exposure to crime. Similar to the element of target suitability, potential victims may place themselves and participate in situations where alcohol consumption is prevalent, which can increase their risk of being revictimized. Being a member of organizations on campus such as sororities is also suggested to increase sexual revictimization but has not been supported empirically (Fisher, Daigle, & Cullen, 2010).
Finally, capable guardianship is a factor in determining whether sexual revictimization takes place according to L/RAT. The theory predicts "that sexual victimization is highest among students who engage in routines that expose them more often to motivated offenders in the absence of capable guardianship (e.g., going to parties, going along in an intoxicated condition to men‟s rooms, frequently dating)" (Fisher, Daigle, & Cullen, 2010, pg. 123-124). Research suggests that revictimization and social guardianship are correlated. Tseloni (2000) reported that those households with fewer numbers of adults were also at risk of being revictimized. Physical guardians have not been found to be linked to revictimization (Rodgers & Roberts, 1995; Tseloni, 2000), although there may be evidence that it may help to prevent additional victimizations.
One study to date has attempted to distinguish the factors that place college women at risk of being sexually revictimized. Fisher et al. (2010) found that the L/RAT does contribute to the understanding of sexual revictimization (Fisher, Daigle, & Cullen, 2010). If motivated offenders, suitable target, and capable guardianship coalesce, then victimization is likely to occur. Furthermore, if no change is brought upon these elements and they continue to coalesce, then another victimization is likely, thus revictimization. Basically, the factors that led to the first victimization will lead to another if those factors are not changed (Fisher et al., 2010). Fisher and colleagues (2010) found that there was no difference between the lifestyles and routine activities of victims and those of revictims of sexual victimization. Their daily routines were similar, thus the L/RAT can also provide support and reasoning for not just victimization, but also revictimization. The same factors predicted sexual victimization and sexual revictimization (Fisher et al., 2010). These factors included propensity to be in places exclusively male, being in a committed relationship, propensity to be in places with alcohol, propensity for substance use, carrying self-protection, and living alone (Fisher et al., 2010). Lifestyles place a woman at risk and keep her at risk. Therefore, everyday routines and activities of college females should be considered when explaining their sexual revictimization. Other individual-level characteristics, however, such as low self-control and assertiveness have not been studied.
Individual Factors and Sexual Revictimization
Beyond the L/RAT perspective, there are other alternative possibilities that may explain victimization. One set of factors that may be related to victimization deal with individual-level characteristics. Such an approach has been used to explain risk of victimization. For example, low self-control has been identified as a risk factor for victimization. Gottfredson and Hirschi (1990) introduced the general theory of crime in which they identified the key element of crime to be self-control. They believed that selfcontrol must be present in order for a person to refrain from committing crimes. People with low self-control are attracted to behaviors and acts that require little time commitment, provide instant gratification, and are enacted with relatively little effort or tediousness (Gottfredson & Hirschi, 1990). There are six traits that define self-control. They are future orientation, empathy, tolerance for frustration, diligence, preference for mental rather than physical activity, and risk avoidance (Gottfredson & Hirschi, 1990). If a person has low self-control, he or she will most likely participate in acts that have an immediate gratification (Gottfredson & Hirschi. 1990). Hence, crime is a desirable outlet for them. Furthermore, Gottfredson and Hirschi (1990) argue that low self-control is also a cause of behaviors analogous to crime. Behaviors such as drug use, alcohol consumption, and gambling are argued to be related to self-control (Gottfredson & Hirschi, 1990; Schreck, Stewart, & Fisher, 2006). Unemployment and sexual promiscuity are also cited as being caused by low self-control. It is suggested that self-control is learned through the way a person is raised as a child via parental socialization
(Gottfredson & Hirschi, 1990). If this is the case, then self-control is a learned trait. It is not something innate.
While Gottfredson and Hirschi (1990) associate low self-control with why people commit crimes, low self-control may also be related to crime victimization. Many of these same characteristics of criminals may be similar to those characteristics of victims (Lauritsen, Sampson, & Laub, 1991; Fisher & Wilkes, 2003), which make them more susceptible to becoming victims. Schreck (1999) used the theory of low self-control to explain why persons are victimized by utilizing the six traits of self-control defined by Gottfredson & Hirschi (1990). The first trait is future orientation. The lower the degree of future orientation a person has, the less he or she tends to value the future consequences of their actions, oftentimes resulting in behavior choices that compromise the safety of those with low self-control (Schreck, 1999). Empathy is another element of self-control. Due to insensitivity, those with low self-control often lack close friendships and relationships. Without these important social ties, guardianship is less likely to be present, thus creating more of an opportunity for victimization to occur (Schreck, 1999). The next characteristic of self-control is tolerance for frustration. In regards to the trait of tolerance for frustration, two people fighting will both display aggression. If there is a low tolerance for frustration present in one of the people, then her aggression will be apparent much more quickly and easily. The victim is determined simply by who loses the dispute (Schreck, 1999). A fourth component of self-control according to Schreck (1999) is diligence. With low self-control, persistence is lacking and therefore those suffering from low self-control are unlikely to protect themselves by taking precautions
(Schreck, 1999). Preference for mental rather than physical activity is another factor of self-control. A person with low self-control becomes defensive and belligerent during an altercation. By doing so, he or she makes himself or herself prone to victimization (Schreck, 1999). The sixth and final dimension of self-control is risk avoidance. Thrillseeking behaviors such as gambling and hitchhiking are sought out by those with low self-control. These activities can put them at greater vulnerability of becoming a victim (Schreck, 1999).
There has been an ample amount of support for Gottfredson and Hirshi‟s general theory of crime. A study by Arneklev, Grasmick, Tittle, and Bursik (1993) found that there was a negative correlation between self-control and drinking as well as between self-control and gambling. Keane, Maxim, and Teevan (1993) examined self-control and its effect on whether people drink and drive. They found that there was a significant relationship between the two. After conducting a meta-analysis of findings of the link between self-control and crime and other deviant behaviors, Pratt and Cullen (2000) demonstrated that low self-control is a consistent and robust predictor of such activities.
Research also supports the link between low self-control and victimization. Schreck (1999) reported that victimization and low-self control are significantly related. Low self-control amplifies the risk of victimization. He also considered the effect of selfcontrol on different types of victimization. He found that low self-control was most strongly connected to personal victimization (Schreck, 1999). Schreck, Stewart, and Fisher (2006), using the Gang Resistance Education and Training (GREAT) data, also examined low self-control as a risk factor for revictimization. In support of Schreck‟s
(1999) hypothesis, they found that there was a significant correlation between victimization and low self-control. They also considered whether those people with low self-control who became victims were likely to change their behaviors and lifestyles that increased their risk of being victimized. Their results showed that people with lower levels of self-control who had been victimized were less likely to change their deviant lifestyles over time (Schreck, Stewart, & Fisher, 2006).
The relationship between low self-control and victimization had been further defined. Stewart, Elifson, and Sterk (2004) explain the tie between low self-control and L/RAT and how they intertwine. Self-control and other personality traits seemingly lead to prevalent participation in risky behaviors and lifestyle choices (Stewart, Elifson, & Sterk, 2004). Schreck and Fisher (2004) suggest that the explanation of victimization expands beyond just L/RAT. They found that peer groups as well as family are important variables in the context of becoming a victim. Teenagers who associate themselves with deviant peers are more likely to take part in deviant behaviors, which puts them at greater risk of being victimized (Schreck & Fisher, 2004).
The six elements of self-control brought forth by Gottfredson and Hirschi (1990) have been found to be related to victimization (Schreck, 1999). Low-self control may also be linked to sexual revictimization. Lack of future orientation can be expressed as when a woman makes choices without the consideration of the future consequences those choices have (Schreck, 1999). For example, a woman who repeatedly abuses alcohol may make herself more vulnerable by lowering her inhibitions (Schreck, 1999). If she continues to drink heavily, she will be increasing her risk of becoming a sexual revictim.
Lack of empathy causes a person to be insensitive to others, which causes a lowered amount of close friendships and relationships thus guardianship is decreased (Schreck, 1999). If guardianship is decreased, college women who live alone and walk alone, especially at night, will be increasing their chances of sexual revictimization to occur. Lack of tolerance for frustration can be expressed by easily showing aggression (Schreck, 1999). Women who easily show aggression and become easily overwhelmed display signs of this trait. If a woman continues to seem vulnerable by showing this weakness of not being able to handle pressure, sexual revictimization may occur. For example, if a woman is easily frustrated and in turn lets her frustration get the best of her, then her better judgment my lapse making her vulnerable. Lack of diligence can be explained as a lack of persistence (Schreck, 1999). If an offender sees that a woman continually gives up easily and does not put effort into something she believes in, the chance of sexual revictimization is increased. This is because the offender may see her as being weak and less resistant. Preference for physical rather than mental activity is expressed by becoming defensive or belligerent during an altercation (Schreck, 1999). When a woman consistently engages in altercations she put herself at an increased risk of being revictimized. For example, a woman may continually fight with her boyfriend or intimate partner. This fighter and aggression could continue over into intimate situations. Finally, lack of risk avoidance is expressed by being a thrill-seeking individual (Schreck, 1999). With thrill-seeking behaviors, such as drinking alcohol or doing drugs, comes risk. Rozee and Koss (2001) found that women who are victimized are less likely to recognize risk. In order to avoid risk, a woman must be able to assess, acknowledge, and act (Rozee &
Koss, 2001). Those women who have low self-control may recognize risk, but enjoy taking risk through lack of risk avoidance.
It is possible that personality traits similar to low self-control would be related to sexual revictimization for three reasons. First, research shows that individual traits predict victimization; hence it is possible that the factors that predict an initial sexual victimization also predict subsequent sexual victimizations. Second, it is consistent with one of the explanations of revictimization that centers on the fact that individual factors may distinguish those who are victimized a single time from those who are victimized more than once. This explanation is known as risk heterogeneity. If these factors continue without modification, then the person will remain at risk. For example, if those with low self-control who have been victimized do not change their risky lifestyle behaviors or their level of self-control that may have facilitated their initial victimization (Schreck, Stewart, & Fisher, 2006), they may be at risk of sexual revictimization. Additionally, a study that did not include individual-level factors found that L/RAT factors did not distinguish single sexual victimizations from sexual revictimizations, which suggests that perhaps individual-level factors are what drive sexual revictimization risk. Therefore, further investigations into such factors should be done.
Thus, the purpose of this thesis is to investigate individual characteristics, such as self-control, as well as risky lifestyles and their impact on the sexual revictimization of college females. By doing so, this thesis will contribute to the research already done on sexual revictimization. It will explore a possible new link between the individual characteristic of self-control and sexual revictimization as well as expand on the
knowledge of the relationship between risky behavior use and sexual revictimization.
The specific research questions designed for this exploration are detailed below.
Research Questions
Research Question One: Do low self-control measures and risky behavior measures differ across nonvictims, single victims, and revictims in regards to any sexual revictimization?
Classen et al. (2005) and Norris et al. (1996) found that those who experienced an initial sexual victimization had an increased risk of being revictimized. Increased risky behavior may increase the chance of any sexual revictimization to occur. Additionally, low levels of self-control may also increase this risk. Low self-control is thought to increase the risk of any sexual revictimization. Similarly, those who participate in risky behavior may have an increased chance of being the victim of any sexual revictimization.
Research Question Two: Are there differences between nonvictims, single victims, and revictims and low levels of self-control along with risky behaviors in regards to sexual revictimization from Waves I to II?
Research has shown that 47.3 percent of women who reported at least one sexual victimization were found to be the victim of sexual revictimizations during the course of the academic school year (Daigle et al., 2008). Low levels of self-control and increases risky behaviors may account for the sexual revictimization across Waves I and II, which constitutes an academic school year. It is hypothesized that respondents who have low self-control will have a increased likelihood of being sexually revictimized during an
academic school year. Increased participation in risky behaviors may also increase the risk of sexual revictimization during the course of a year.
Research Question Three: Are there differences among nonvictims, single rape victims, and rape revictims and low self-control as well as risky behaviors?
One study found that half of the women who reported experiencing a completed or attempted raped had experienced sexual victimization in the past (Russell, 1984). This evidence of rape revictimization raises the question of why it occurs. Perhaps there is a difference among nonvictims, single victims, and revictims in regards to individual measures such as self-control. Risky behaviors may also play a role in why women are revicitms of rape. Those who have low self-control may have an increased risk of being revictims of rape. Additionally, those who participate in risky behaviors are also at an increased risk of being revictimized.
Research Question Four: Do nonvictims, single victims, and revictims of rape revictimization from Wave I to Wave II differ in low levels of self-control and risky behaviors?
Women reported being raped 2.9 times a year on average according to the National Violence Against Women Study (Tjaden & Thoennes, 2006). With this evidence, it seems necessary to measure rape revictimization over the course of one year. Research has not indicated if individual characteristics and/or risky behaviors are a factor in why rape revictimization happens. It is hypothesized that low levels of self-control and/or multiple types of risky behavior increase the risk of rape revictimization across waves (equivalent to one year).
Research Question Five: Are people who experience childhood sexual assault and adult sexual revictimization different in levels of low self-control and risky behavior?
Multiple studies indicate that there is a positive relationship between CSA and sexual revictimization as an adult (Arata, 2000; Desai et al., 2002; Filipas & Ullman, 2006; Messman & Long, 1996; Messman-Moore et al., 2000). Could there be more to this relationship? Individual characteristics, such as low self-control, and increased risky behaviors may play a role in why CSA victims become adult revictims, in that childhood sexual assault revictimization is increased when low levels of self-control are present and/or the engagement in risky behavior occurs.
CHAPTER III Methods
The purpose of this thesis is to examine the relationship between risky behaviors, individual characteristics, and sexual revictimization of female college students. Both the lifestyles-routine activities theory and individual characteristics that measure factors indicative of low self-control will be used as the theoretical guidance for the analysis.
Data
The data to be used for this research was originally obtained for a study funded by the National Institute of Mental Health and was collected by Jacquelyn W. White and Paige Hall Smith (2004) in their study entitled A Longitudinal Perspective on Physical and Sexual Intimate Partner Violence Against Women. The purpose of White and Hall‟s (2004) study was to look at the extent of and the factors involved in the physical and sexual victimization of college students. White and Hall‟s (2004) sample consisted of two cohorts, both male and female, from a southeastern state university in the United States. Two separate incoming undergraduate classes (new students in 1990 and 1991) determined the cohorts. A convenience sample of both male and female college students, from the medium sized state university, were surveyed during their new student orientation or by phone calls placed to those students who did not attend. A follow-up survey was administered in the spring of the same school year given to the same class from the new student orientation. A total of 1,580 females and 851 males were included in the study (White & Smith, 2004).
A five year study, the data were collected at five separate waves (Fall 1990/1991, Spring 1991/1992, Spring 1992/1993, Spring 1993/1994, Spring 1994/1995). The first cohort was initially surveyed in the Fall of 1990 then again in the Springs of 1991, 1992, 1993, and 1994, while the second cohort was first administered the survey in the Fall of 1991 and then re-administered the survey in the Springs of 1992, 1993, 1994, and 1995. The students were repeatedly surveyed at the ages of 18 (initial administration), 19, 20, 21, and 22 respectively (White & Smith, 2004). At Wave I, a total of 1,572 female and 514 male college students were surveyed. Seven hundred and twenty five female and 489 male college students were assessed at Wave II. Wave III participants included 1,180 female and 278 male college students. In Wave IV, 953 college females and 301 college males completed the survey. Finally, 746 college females and 142 college males were assessed in Wave V. Longitudinal studies include data from multiple time periods rather than just one single collection of data. This type of study is more effective in establishing causality (Lieberson, 1985). Since the data being used in the current study is longitudinal, time order is easier to establish. It also allows for victimizations across waves to be examined, thus exposing incidents of revictimization.
The students were asked questions regarding social experiences, physical and sexual dating violence, and multiple types of physical or sexual victimization. Individual characteristics were also assessed along with lifestyle choices and routines (White & Smith, 2004).In particular, key variables collected in this data set were personality characteristics pertaining to depression, self-worth and self-image, and anxiety. Drug and alcohol use were also reported. Intimate partner relationships, types of sexual
victimization, the conditions and environment where the victimization occurred, childhood sexual victimization, and perspectives of the same and opposite sex were also measured. Different risky lifestyle behaviors were assessed at each wave.
Sample
For the purposes of this thesis, only the female data are assessed. A total of 1,569 incoming state university college women were included in this sample. The sample for the current study consisted of two cohorts of women; one from 1990 (825 college women) and one from 1991 (744 college women) (White & Hall, 2004). Only wave I and II will be used for this study. This is done in order to provide the largest sample size as well as to avoid problems with sample attrition. Wave I, administered in the Fall of 1990 and Fall of 1991, of the analysis consists of 1,569 female participants, and wave II, administered in Spring 1991 and Spring 1992, is made up of 1,398 female participants all of whom completed the survey at Wave I. This sample consisted of incoming new students in 1990 and 1991. The college women were mostly White (74.3%, n= 1,142).
Plan of Analysis
A secondary data analysis is the foundation of the thesis. In regards to this study, risky behaviors, individual characteristics, and initial sexual victimizations will be measured at Wave I. Sexual revictimization is measured in several ways, which are detailed below. In short, any sexual revictimization experienced at Waves I and II is used, sexual revictimization from Wave I to Wave II is included, and a measure of sexual revictimization that examines childhood sexual assault and any sexual revictimization during Waves I and II is included. As such, the relationship between risk factors,
individual characteristics, and recurring sexual victimization can be examined. Specifically, the independent variables are examined for nonvictims, those who experienced a single sexual victimization, and those who experienced sexual revictimization to see if differences exist. Therefore, bivariate analyses were conducted. Since this is the first step towards identifying individual-level risk factors that may distinguish nonvictims, single sexual victims, and recurring sexual victims, this type of analysis is appropriate.
An analysis of variance (ANOVA) will be used as one of the statistical tests for this analysis. An ANOVA is used to compare the means of three or more groups. It determines whether the means are equal (Weinberg & Abramowitz, 2008). If the means are not equal, a Post Hoc test is run to show where there are differences in the means. In this analysis, the Tukey HSD served as the Post Hoc test. For the purposes of this analysis, the ANOVA was used to analyze the means of the self-control independent variables and the revictimization dependent variables. In this way, differences across nonvictims, single sexual victims, and sexual revictims in the independent variables can be examined.
A second statistical test was used in this analysis as well. Pearson‟s chi-square will be used to determine the probability of an independent measure and a dependent measure both occurring and if that occurrence is significant. Chi-square is used for nominal level variables (Weinberg & Abramowitz, 2008). For the purposes of this analysis, the chi-square test was conducted to analyze the percentages of the risky behavior (nominal level) independent measures across the revictimization dependent measures. The demographic control variable of race and revictimization measures was also tested using the chi-square statistical test.
Measures
Independent Variables
In order to assess the independent variables pertaining to the individual characteristics, measures were created to reflect elements relevant to self-control as set forth by Gottfredson and Hirschi (1990). Each of the independent variables are measured at Wave I of the data.
Low Self-Control
Lack of future orientation. Lack of future orientation was measured by using three statements: "daily life interesting", "future hopeful, promising", and "I feel sure I can do most of the things I try". In regard to the first two statements, participants were asked how they have been during the past month. Respondents were asked how much the third statement reflected what kind of person they thought they were. Items were measured on a scale of zero to five (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). All three of these statements were recoded so that higher scores reflect more lack of future orientation. Responses to the statements were then added together to create the lack of future orientation scale. Cronbach‟s alpha is .649 for this scale. The mean for lack of future orientation is 7.03 and can be found in Table 1.
Lack of empathy. To measure lack of empathy, one item was used. Respondents were asked how much they felt the following statement represented the person they think they are: "I try to understand how other people are feeling". A response set was provided (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). Responses were recoded so that higher values reflect lack of understanding of others‟ feelings. The mean for this variable is 1.66 and can be found in Table 1.
Self-centeredness. A self-centeredness variable was also included. "I am a selfcentered person. I want things to go my way" was used to measure self-centeredness by participants. A response set was provided from which individuals were asked to indicate how much they considered this item to be the person they thought themselves to be in the past month (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). The mean for self-centeredness is 2.05 and can be found in Table 1.
Lack of tolerance for frustration. The third element of self-control according to Gottfredson and Hirschi (1990) is tolerance for frustration. To measure lack of tolerance for frustration, one item is used. Respondents were asked to report how much the following statement represents them as a person in the past month: "I am a fussy person who is easily annoyed and irritated." Participants were provided with a response set (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= not at all like me). Responses were recoded so that a greater lack of tolerance for frustration is reflected by higher scores. The mean for lack of tolerance for frustration is 2.14 and can be found in Table 1.
Lack of diligence. Lack of diligence is also indicative of low self-control. Study participants were asked how much the following statement applied to their thoughts of themselves in the past month: "I am able to do tough things by myself if I have to and I don‟t need other people to help me or tell me what to do." A response set was provided for the participants (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). Item responses were recoded so that higher values reflect lack of diligence. The mean for this variable is 2.70 and can be found in Table 1.
Preference for physical rather than mental activity. To measure the fifth characteristic of self-control, a measure of preference for mental rather than physical activity was included. The statement from the data "I am a very forceful, „take charge‟ kind of person" was used to measure preference for physical activity. Respondents were asked how much this statement described them as a person in the past month (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). Higher scores reflect preference for physical activity rather than mental activity. The mean for this variable is 2.80 and can be found in Table 1.
Lack of risk avoidance. Lack of risk avoidance was also measured. Respondents were asked how the much the statement "I like to play things safe and not take chances" showed what kind of person they think they were in the past month (0= no response, 1= not at all like me, 2= a little like me, 3= somewhat like me, 4= mostly like me, 5= very much like me). It was recoded to display the lack of risk avoidance. Higher scores
showed a greater lack of risk avoidance by the respondent. The mean for lack of risk avoidance is 2.74 and can be found in Table 1.
Risky Behaviors
Measures were also created to analyze the risky behaviors respondents participated in during Wave I. Because alcohol and drug use is common among college students and has been shown to be related to sexual victimization, items used to measure alcohol and drug use are included (Koss & Dinero, 1989; Testa et al., 2000; Abbey et al., 2001).
Alcohol consumption. To measure alcohol use, respondents were asked "How often do you drink alcohol?" Responses ranged from 1= I never drink or have not drunk in the past school year, 2= I drink less than once a month but at least once in the past school year, 3= I drink one to three times a month, 4= I drink one to two times a week, to 5= I drink more than twice a week. This item was recoded to reflect whether the participant had ever drank (0= no, 1= yes). The percentage for alcohol consumption is 70.9% and can be found in Table 1.
Binge drinking. A measure of binge drinking was also used to measure risky behavior. Respondents were asked "In an average month, how many times do you have 5 or more drinks in a row?" Responses included 1= never, 2= one time, 3= two to five times, 4= six to nine times, to 5= ten or more times. Responses were recoded to reflect whether or not a respondent binge drank in an average month (0= no, 1= yes). The percentage of binge drinking is 36.1% and can be found in Table 1.
Marijuana use. The use of marijuana is also a risky behavior. Respondents were asked, "How often do you use marijuana?" in the past year. Individuals who had not used marijuana were originally coded as 1, individuals who had used marijuana less than once a month but at least once in the past year were coded as 2, those who had used marijuana one to three times a month were coded as 3, individuals who had used marijuana one to three times a week were coded as 4, and respondents who had used marijuana more than twice a week were coded as 5. Responses were then recoded to indicate whether respondents ever used marijuana (0=no, 1=yes). The percentage of marijuana use is 19.1% and can be found in Table 1.
Other drug use. Drug usage other than marijuana was also used to measure risky behavior. Respondents were asked "How often do you use drugs other than alcohol or marijuana (for example: cocaine, speed, etc.)?" Responses could range from 1 (never use other drugs in the past year) to 5 (use other drugs more than twice a week). Participant responses were recoded to reflect a yes (coded as 1) or no (coded as 0) answer to the item. The percentage of other drug use is 7.5% and can be found in Table 1.
Ever used drugs. The responses from both marijuana use and other drug use were combined to create one drug use variable. This variable reflects a yes (coded as 1) or no (coded as 0) response to drug use of any kind of drug. The percentage of ever used drugs is 19.9% and can be found in Table 1.
Relationship status. Current relationship status was used to measure the exposure to motivated offenders. In order to assess the current relationship status of the respondents, they were asked to respond to the statement: "Indicate your current
relationship status". Responses included single (1), engaged (2), married (3), and divorced/separated (4). Responses were then recoded to single (coded as 1) that includes single and divorced/separated and not single that includes engaged and married (coded as 0). The percentage of relationship status is 25.1% and can be found in Table 1.
Dependent Variables
Types of Revictimization
Sexual revictimization Across Waves I and II. Sexual revictimization from Wave I or Wave 2 was also used as a dependent variable. All of the reported revictims from the victim type variable were included in this variable. This means those respondents who reported at least one sexual victimization incident at Wave I were then combined with those who reported at least one sexual victimization incident at Wave II. At least one sexual victimization incident at both Waves I and II constituted revictimization across waves. Sexual victimization at both waves was coded as 2, while sexual victimization at only one wave was coded as 1, and no sexual victimization at all was coded as 0. The sample consisted of nonvictims (42.7%, n=592), single victims (14.9%, n= 207), and revictims (42.4%, n= 588) for this variable found in Table 2.
Sexual revictimization. Because college women are at risk of experiencing other forms of sexual victimization, a broad measure of sexual victimization was also included. Ten items pertaining to sexual victimization were used to measure revictimization across Waves I and II. Respondents were asked to answer how often each of the following have occurred from age fourteen to present: "Have you given in to sex play (fondling, kissing or petting but not intercourse) when you didn‟t want to because you were overwhelmed
by a male‟s continual arguments or pressure?", "Have you engaged in sex play (fondling, kissing or petting but not intercourse) when you didn‟t want to because a male used his position of authority (boss, teacher, camp counselor, supervisor) to make you?", "Have you engaged in sex play (fondling, kissing or petting but not intercourse) when you didn‟t want to because a male threatened to use some degree of physical force (twisting your arm, holding you down, etc.) to make you?", "Have you had a male attempt sexual intercourse (get on top of you, attempt to insert his penis) when you didn‟t want to by threatening or using some degree of force (twisting your arm, holding you down, etc.) but intercourse did not occur?", "Has a male ever deliberately given you alcohol or drugs and attempted to engage in sexual intercourse (get on top of you, attempt to insert his penis) when you didn‟t want to but intercourse did not occur?", "Have you given in to sexual intercourse when you didn‟t want to because you were overwhelmed by a male‟s continual arguments and pressure?", "Have you engaged in sexual intercourse when you didn‟t want to because a male used his position of authority (boss, teacher, camp counselor, supervisor) to make you?", "Has a male ever deliberately given you alcohol or drugs and engaged in sexual intercourse when you didn‟t want to?", "Have you engaged in sexual intercourse when you didn‟t want to because a male threatened or used some degree of physical force (twisting your arm, holding you down, etc.) to make you?", and "Have you ever been in a situation where you had sexual acts with a male such as anal or oral intercourse when you didn‟t want to because he used threats or physical force (twisting your arm, holding you down, etc.) to make you?" Responses to each item could be: 1= never, 2= one time, 3= two times, 4= three to five times, or 5= more than five
times. The items were recoded to reflect the type of victim as a nonvictim (never experienced a sexual victimization incident), single victim (experienced one sexual victimization incident), or revictim (experienced more than one sexual victimization incident). Victimizations reported in both Wave I and Wave II were combined to create this variable. The sample consisted of nonvictims (42.7%, n= 592), single victims (34.5%, n= 478), and revictims (22.8%, n=317) for this variable found in Table 3.
Rape revictimization across Waves I and II. Another variable was included to measure rape revictimization from Waves I or II. Instead of measuring any experience of rape revictimization in both Waves I and II, this measure only labels victims as recurring rape victims if they experienced rape in Wave I and rape in Wave II. Women could be categorized as nonvictims, never experienced a rape incident; single victims, experienced only one rape incident; or rape revictims, experienced more than one rape incident. The sample consisted of nonvictims (71.2%, n= 988), single victims (11.4%, n=158), and revictims (16.7%, n=232) for this variable found in Table 4.
Rape revictimization. Participants were asked to respond to five items involving multiple types of rape that they have experienced since the age of fourteen. Respondents were asked during Waves I and II "Have you given in to sexual intercourse when you didn‟t want to because you were overwhelmed by a male‟s continual arguments and pressure?", "Have you engaged in sexual intercourse when you didn‟t want to because a male used his position of authority (boss, teacher, camp counselor, supervisor) to make you?", "Has a male ever deliberately given you alcohol or drugs and engaged in sexual intercourse when you didn‟t want to?", "Have you engaged in sexual intercourse when you didn‟t want to because a male threatened or used some degree of physical force (twisting your arm, holding you down, etc.) to make you?", and "Have you ever been in a situation where you had sexual acts with a male such as anal or oral intercourse when you didn‟t want to because he used threats or physical force (twisting your arm, holding you down, etc.) to make you?" Possible responses included 1 (never), 2 (one time), 3 (two times), 4 (three to five times), and 5 (more than five times). Responses for each item were recoded to reflect whether or not a woman had experienced that particular experience. Those results were then combined in order to create the recurring rape variable. Individuals‟ rape experiences from Waves I and II were used to do so. Those individuals who had not experienced any rape incident were considered to be nonvictims. Those who had experienced only one rape across Waves I and II were considered to be single victims. Those respondents who had experienced more than one rape incident in Waves I and II were considered rape revictims. This measure then indicates rape victim status for respondents in Waves I and II. The sample consisted of nonvictims (71.2%, n=988), single victims (19.8%, n= 275), and revictims (8.3%, n= 115) for this variable found in Table 5.
Childhood sexual assault revictimization. Because research indicates that those sexually victimized in childhood are at risk of being sexually victimized as adults (Classen et al., 2005), a measure of sexual revictimization from childhood to early adulthood was included. Childhood sexual assault is defined as being sexually assaulted before the age of fourteen. Respondents were asked if "Another person showed his/her sex organs to you or asked you to show yours.", "A person fondled you in a sexual way or touched your sex organs or asked you to touch their sex organs.", "A male attempted intercourse with you (but penetration did not occur).", and "A male had intercourse with you (penetration occurred; ejaculation not necessary)." Participants were asked how often the experiences happened to them before the age fourteen. If persons never had these experiences they were coded 1, those who had experienced this one time were coded 2, those who had experienced this more than once were coded 3, those who had experienced three to five were coded 4, and those who indicated they had experienced any of these acts more than five times were coded 5. The responses were recoded to indicate whether or not a person had experienced any childhood sexual victimization (0= no, 1= yes). It is important to note that this variable includes behaviors as a child, which could be classified as experimental behaviors rather than victimization. For example, touching between children, which is not considered a sexual victimization, could possibly be included in this variable in participants responses. The childhood sexual assault revictimizaiton variable represents childhood sexual victimization (a yes response) and any type of adult revictimization occurring in Waves I and/or II. Reported childhood sexual victimization was then combined with sexual victimizations that took place at Wave I. Responses for a childhood victimization and an adult victimization at Wave I were combined to create the childhood sexual assault revictimization variable. The responses were recoded so that nonvictim was coded as 0, single victim was coded as 1, and revictim was coded as 2. The sample consisted of nonvictims (30.6%, n= 411), single victims (40.6%, n=544), and revictims (28.8%, 386) for this variable found in Table 6.
Race. Race was used as a control variable. Respondents were asked "What is your race or ethnic background?" Responses included 1= White, Non-hispanic, 2= Black, Non-hispanic, 3= Hispanic, 4= Asian, or Pacific Islander, or 5= American Indian or Alaskan Native. This variable was then recoded to reflect nonwhite (coded as 0) and white (coded as 1).
Table 1. Characteristics of total sample in analysis
CHAPTER IV Results
In the first step of the analyses, a bivariate analysis of the independent measures and the dependent measure of any sexual revictimization in Waves I or II was conducted. This dependent measure reflected those who reported any sexual victimization incident at either Wave I or Wave II. The results are shown in Table 2. First, ANOVA was run to test for differences in means for the three victim groups across the independent variables, and when the value of F was significant at .05, Tukey‟s HSD test was run to determine where the differences lie between groups. There were five selfcontrol variables that showed significant differences between the victim groups. For nonvictims, the mean for lack of future orientation is 6.82 and for revictims it is 7.27. Self-centeredness was also found to be significantly different between nonvictims and revictims. For nonvictims, the mean of self-centeredness is 1.93 while the mean is 2.15 for revictims. The self-control variable of lack of tolerance for frustration was similarly found to be significant. Nonvictims have a mean of 1.99 for lack of tolerance for frustration and revictims have a mean of 2.25. A fourth self-control variable showed a significant difference between nonvictims and revictims. Nonvictims had a mean of 2.71 on the variable lack of preference for mental rather than physical activity and an average of 2.89 for revictims. Finally, lack of risk avoidance also showed a significant difference between nonvictims and revictims. For nonvictims, the mean is 2.85 and for revictims the mean is 2.63. Revictims, then, reported greater lack of future orientation, were more selfcentered, had greater lack of tolerance for frustration, greater preference for physical
rather than mental activity, nonvictims. Lack of risk avoidance was found to be higher among nonvictims than revictims.
Using the chi-square test of correlations at .05 level of significance, five independent variables for risky behavior showed significant relationships across victim types. Alcohol consumption was found to have a significant relationship with victim type. Fifteen percent of persons who consumed alcohol were single victims, while 48.1 percent of persons who consumed alcohol were revictims. The results for binge drinking showed similar findings. Although only 13.0 percent of binge drinkers in an average month were single victims, 57.3 percent of binge drinkers were revictims. Another variable, marijuana use, was found to have a significant relationship with victim type. Of those respondents who reported using marijuana, 12.8 percent were single victims, while 65.1 percent were revictims. A fourth risky behavior, other drug use, was found to be significantly related to victim type. Only fourteen percent of persons who had used other drugs were nonvictims, but 74.0 percent of people who reported using other drugs were revictims. The fifth and final risky behavior variable that was found to have a significant relationship with victim type was ever used drugs. Although 12.6 percent of those who ever used drugs were single victims, 65.1 percent of those who reported ever using drugs were revictims. Overall, the following risky behavior variables are related to victim type: alcohol consumption, binge drinking, marijuana use, other drug use, and ever used drugs.
Table 2. Bivariate analyses of Any Sexual Revictimization at Wave I or Wave II
*p<.05
a Nonvictims significantly differ from revictims.
b Nonvictims significantly differ from single victims.
Another bivariate analysis of the independent measures and the dependent measure of sexual revictimization was run. This dependent variable reflects sexual revictimization reported from Wave I to Wave II. The results are shown in Table 3. An ANOVA was run and when the value of F was significant at .05, Tukey‟s HSD test was run to determine where the differences lie. There were five self-control variables that showed significant differences across victim groups. For nonvictims, the mean for lack of future orientation is 6.82 and for revictims it is 7.27. Self-centeredness was also found to be significantly different for nonvictims and revictims. For nonvictims, the mean for selfcenteredness is 1.93 while the mean is 2.21 for revictims. The self-control variable of lack of tolerance for frustration was similarly found to be significant. Nonvictims have a mean of 1.99 for lack of tolerance for frustration and revictims have a mean of 2.33 for lack of tolerance for frustration. Nonvictims and victims are also different in terms of lack of preference for mental rather than physical activity. The mean for nonvictims is 2.71 compared to 2.86 for single victims. Finally, lack of risk avoidance also showed a significant difference between nonvictims and revictims. For nonvictims, the mean for lack of risk avoidance is 2.85 and for revictims the mean is 2.58. The results above indicate that revictims have greater levels of lack of future orientation, self-centeredness, and lack of tolerance for frustration than nonvictims. Meanwhile, single victims showed a greater lack of preference for mental rather than physical activity compared to nonvictims. Additionally, nonvictims had a greater lack of risk avoidance than revictims.
Using chi-square test at a .05 level of significance, five independent variables for risky behavior showed significant correlations among the victim types. Alcohol
consumption was found to have a significant relationship with victim type. Of those who reported drinking, 37.2 percent were single victims, while 25.9 percent were revictims. Binge drinking had a significant relationship with victim types. Nonvictims made up 29.8 percent of those who reported binge drinking and single victims made up 39.1 percent of binge drinkers. Another variable, marijuana use, was found to have a significant relationship with victim types. Approximately, 22 percent of marijuana users were nonvictims, while 44.6 percent were single victims. A fourth risky behavior, other drug use, was found to have significant relationship with victim type. Fourteen percent of persons who reported using other drugs were nonvictims, while forty-five percent were single victims. The fifth and final risky behavior variable that was found to have a significant relationship with victim type was ever used drugs. Of those who ever used drugs, 37.2 percent were single victims and 25.9 percent were revictims. Overall, revictims generally expressed higher percentages of risky behaviors then nonvictims in this model. The following risky behavior variables are related to victim type alcohol consumption, binge drinking, marijuana use, other drug use, and ever used drugs.
Table 3. Bivariate analyses of Sexual Revictimization from Wave I to Wave II
*p<.05
b Nonvictims significantly differ from single victims.
a Nonvictims significantly differ from revictims.
Next, a bivariate analysis was run on the independent measures and the dependent measure that captures any rape revictimization at Wave I or Wave II. Participants who reported experiencing rape in Wave I or Wave II are revictims in this measure. The results are shown in Table 4. First, ANOVA was run and when the value of F was significant at .05, Tukey‟s HSD test was run to determine where the differences lie. There were two self-control variables that showed significant differences between the victim groups. For nonvictims, the mean for preference for physical rather than mental activity is 2.73 and for single victims it is 2.97. Lack of risk avoidance was also found to have significant differences between nonvictims and revictims. For nonvictims, the mean for lack of risk avoidance is 2.82, while the mean is 2.51 for revictims. Nonvictims showed a greater lack of risk avoidance than revictims. Single victims had a higher level of preference for physical rather than mental activity than nonvictims.
Five independent variables for risky behavior showed a significant relationshipwith the victim types by use of the chi-square test with a significance level of .05. Alcohol consumption was found to have a significant relationship with victim type. Thirteen percent of those who consumed alcohol were single victims compared to 66.6 percent who were nonvictims. Binge drinking had similar findings. Only fifteen percent of those who reported binge drinking were single victims, while 59.3 percent of binge drinkers were nonvictims. Another variable, marijuana use, was found to have a significant relationship with victim types. Of those who reported using marijuana, 48.8 percent were nonvictims and 17.4 percent were single victims. A fourth risky behavior, other drug use, was found to have significant relationship with victim type. Forty-six
percent of other drug users were revictims, while fifteen percent were single victims. The fifth and final risky behavior variable that was found to have a significant relationship with victim types was ever used drugs. Nonvictims made up 48.7 percent of those who reported ever using drugs compared to single victims who made up 17.1 percent of those who reported ever using drugs. Generally, substance use was shown to have higher percentages among nonvictims then revictims in this model. The following risky behavior variables are related to victim type alcohol consumption, binge drinking, marijuana use, other drug use, and ever used drugs.
Table 4. Bivariate analyses of Any Rape Revitimization at Wave I or Wave II
Sample Characteristic
2
*p<.05
b Nonvictims significantly differ from single victims.
a Nonvictims significantly differ from revictims.
An additional bivariate analysis of the independent measures and the dependent measure rape revictimization from Wave I to Wave II was conducted. This dependent variable consisted of participants who reported rape revictimiziton from Wave I to Wave II. The results are shown in Table 5. An ANOVA was run and when the value of F was significant at .05, Tukey‟s HSD test was run to determine where the differences lie. There were two self-control variables that showed significant differences between the victim groups. For nonvictims, the mean for lack of preference for mental rather than physical activity is 2.73 and for single victims it is 2.89. Lack of risk avoidance was also found to have significant differences between both nonvictims and revictims as well as nonvictims and single victims. For nonvictims, the mean is 2.82, it is 2.63 for single victims, and is 2.39 for revictims in regards to lack of risk avoidance. These results indicate that single victims have more lack of preference for mental rather than physical activity than nonvictims. Lack of risk avoidance is found to be higher in nonvictims than in single victims and revictims.
Using chi-square test at a .05 level of significance, five independent variables for risky behavior were significantly related to victim types. Alcohol consumption was found to have a significant relationship with victim type. Almost ten percent of alcohol consumers were revictims, while 66.6 percent were nonvictims. Binge drinking had similar findings. Of those persons who binge drank, 59.3 percent were nonvictims and 12.6 percent were revictims. Another variable, marijuana use, was found to have a significant relationship with victim types. About fifty percent of marijuana users were nonvictims, while 17.4 percent of marijuana users were revictims. A fourth risky
behavior, other drug use, was found to have significant relationship with victim type. Thirty-nine percent of other drug users were nonvictims compared to twenty-six percent of other drug users who were revictims. The fifth and final risky behavior variable that was found to have a significant relationship with victim types was ever used drugs. Nonvictims made up 48.7 percent of those who ever used drugs, while 17.8 percent of those who eve used drugs were revictims. The following risky behavior variables are related to victim type: alcohol consumption, binge drinking, marijuana use, other drug use, and ever used drugs.
Table 5. Bivariate analyses of Rape Revictimization
*p<.05
b Nonvictims significantly differ from single victims.
a Nonvictims significantly differ from revictims.
Finally, a bivariate analysis of the independent measures and the dependent measure of childhood sexual assault revictimization was conducted. Participants who reported CSA and adult victimization at Wave I were considered revictims for this analysis. An ANOVA was run and when the value of F was significant at .05 level, Tukey‟s HSD test was run to determine where the differences lie. The results are shown in Table 6. There were three self-control variables that showed significant differences between the nonvictim and revictim groups. For nonvictims, the mean for lack of future orientation is 6.78 and for revictims it is 7.16. Self-centeredness was also found to be significantly different for nonvictims and revictims. For nonvictims, the mean of selfcenteredness is 1.91, while the mean is 2.20 for revictims. The self-control variable of lack of tolerance for frustration was similarly found to be significant with revictims having, on average, a greater lack of tolerance for frustration. For lack of tolerance, nonvictims have a mean of 1.97 and revictims have a mean of 2.25. The results above indicate that revictims reported higher levels of lack of future orientation, selfcenteredness, and lack of tolerance on average.
Five risky behavior variables are related to victim type when using chi-square test at a significance level of .05. Alcohol consumption was found to have a significant relationship with victim type. Although 25.2 percent of persons who reported consuming alcohol were nonvictims, 42.8 percent of those who drank alcohol were single victims. Binge drinking showed similar findings. Eighteen percent of binge drinkers were nonvictims, while 46.7 percent of persons who reported binge drinking were single victims. Another variable, marijuana use, was found to have a significant relationship
with victim type. Thirteen percent of marijuana users were nonvictims, while 43.3 percent and 43.7 percent of marijuana users were single victims and revictims respectively. A fourth risky behavior, other drug use, was found to have significant relationship with victim type. Of those persons who reported other drug use, 8.2 percent were nonvictims, 44.3 percent were single victims, and 47.4 percent were revictims. The fifth and final risky behavior variable that was found to have a significant relationship with victim type was ever used drugs. Forty-three percent of those who reported ever using drugs were revictims, while 13.2 percent of persons who ever used drugs were nonvictims, and 43.8 percent of persons who ever used drugs were single victims. Generally, substance use was found to be higher among revictims then nonvictims in this model. The following risky behavior variables are related to victim type alcohol consumption, binge drinking, marijuana use, other drug use, and ever used drugs.
Table 6. Bivariate analyses of Childhood Sexual Assault Revictimization
*p<.05
a Nonvictims significantly differ from revictims.
b Nonvictims significantly differ from single victims.
CHAPTER V Discussion
There are three major findings that can be gleaned from this study. The first is that there is a group of college women who are sexually revictimized. Approximately 23 percent of college women reported being sexually revictimized from Wave I to Wave II, about eight percent were revictims of rape from Wave I to Wave II, and approximately 29 percent were sexually victimized as a child then revictimized as an adult. These findings suggest that sexual revictimization occurs across time from childhood to adulthood. Respondents also reported sexual revictimization while in college.
Another important outcome of this study was that there is evidence that levels of self-control differ for nonvictims, single victims, and revictims. The self-control elements that seem to matter most were lack of future orientation, self-centeredness, lack of tolerance for frustration, preference for physical rather than mental activity, and lack of risk avoidance. While four of these significant variables showed differences of selfcontrol lie mostly between nonvictims and revictims, with a few differences between nonvictims and single victims. Lack of risk avoidance was shown to have the opposite of what was expected. This significant variable showed that lack of risk avoidance was lowered at each level of victim type from nonvictims to single victims to revictims. However, it appears that self-control matters in regards to some outcomes more than others. While all of these self-control measures were found to be significant in the sexual revictimization models, only a few of them were found to be significantly different in the rape revictimization and childhood sexual assault revictimization models. Preference for physical rather than mental activity and lack of risk avoidance were the only self-control measures found to be significant in the rape revictimization models. This could be the result of the decline in sample size of revictims in the rape revictimization and childhood sexual assault revictimization models or because the processes that predict any sexual revictimization while in college are different. Additionally, these results could be due to the possibility that self-control factors may not reflect the same risk among rape revictims or childhood sexual assault revictims because other unique predictors of rape may be causing these specific types revictimization. It could be that self-control becomes more relevant when sexual revictimization is looked at broadly, including all types, instead of considering different types of sexual revictimization individually (Hines, 2007). When examining sexual revictimization by way of different types than perhaps other predictors are more relevant than the self-control measures. Lack of future orientation, selfcenteredness, and lack of tolerance for frustration were the self-control measures found to be significant in the childhood sexual revictimization models.
A third major finding was that risky behaviors are related to sexual revictimization. Alcohol and drug use were generally found to be greater in single victims and revictims than nonvictims. This means that college women who reported consuming alcohol were sexually victimized or sexually revictimized more than those who were nonvictims. Meanwhile, those who reported substance use were more likely to be nonvictims than single victims or revictims. Additionally, of those who reported alcohol and drug use, more of them were single childhood sexual assault victims or childhood sexual assault revictims rather than nonvictims.
Other patterns were apparent throughout the findings. The majority of the selfcontrol measures were different between nonvictims and revictims. Additionally, the selfcontrol measures of lack of empathy and lack of diligence were not found to be significant in any model. The risky behavior measure of relationship status was also not found to be related to the dependent variables. Similarly, race was not found to be significantly related to any outcome.
Taken together, these findings suggest that self-control does matter in sexual revictimization. It only seems, however, to be relevant in regards to some of the elements of self-control and not others. One reason for this is because those elements of selfcontrol that were found to be significant may be better measures of self-control than the others that were not significant. Lack of empathy and lack of diligence seem to be weak measures of self-control in this study.
The finding that some elements of self-control are related to revictimization is in line with Schreck et al.‟s (2006) findings that self-control is related to victimization. One significant low self-control element, lack of future orientation is associated with not valuing the future consequences of a person‟s actions. This usually results in lifestyles that compromise the person‟s safety. When safety is compromised, it makes the person vulnerable due to lowered inhibitions and there is an increased risk of revictimization. This element of low self-control is closely related to an increased risk of sexual revictimization because college women who do not consider the future consequences of their actions have a greater chance of being sexually revictimized. Drinking, using drugs, and partying have consequences of lowered inhibitions of judgment (Schreck, 1999) and safety, therefore sexual revictimization may occur. Lack of tolerance for frustration is another low self-control element that was significant. This element is tied to aggression. Those who display aggression more quickly find themselves in confrontations, which oftentimes lead to endangering themselves. Sexual revictimization is related here because if a college female continually puts herself in harm‟s way and actively displays her aggression in these situations, she is more likely to be victimized. The more attention drawn to herself may also draw the attention of possible sexual offenders as well by highlighting her weakness of being easily frustrated. Preference for physical rather than mental activity, a low self-control element, was also found to be significant. An explanation for this is when a person becomes defensive or belligerent during an altercation. Those who act out and fight back are more prone to victimization. If this continues to happen, revictimization is likely to occur. If a female college student continually acts out in an altercation with a boyfriend, for example, then she will have a greater risk of being sexually victimized and subsequently sexually revictimized. An increase in fighting with an intimate partner may bring about aggression in intimate situations and result in sexual revictimization. Finally, lack of risk avoidance was also found to be a significant element of low self-control. This element can be expressed as thrill-seeking behaviors being sought after. This type of behavior puts a person in dangerous environments and increases their likelihood of becoming a victim. This variable was found to be the opposite in regards to the other significant low self-control elements. Those who were not victimized were found to have the highest lack of risk avoidance, with single victims following them, and finally revictims displaying the
lowest lack of risk avoidance. A lack of risk avoidance found in a college female can mean, for example, that she frequents bars, nightclubs, and parties where drug use and alcohol consumption are prevalent. Sexual revictimization is likely because alcohol and drug use increase a woman‟s risk of being a victim (Schreck, 1999; Abbey et al., 2001). Although the lack of risk avoidance variable is contrary to Schreck‟s (1999) research, it is an important finding. It could be that women who have been single sexual victims decrease their risk taking and subsequently sexual revictims decrease their risk taking even more so due to their victimizations. It could also be that the lack of risk avoidance measure is a broad measure and may not be specific to sexual victimization. This variable may apply to the respondent‟s life in general in regards to playing things safe.
Together, these findings, with the exception of the lack of risk avoidance findings, generally reflect those of Schreck, Stewart, and Fisher (2006); if those with low selfcontrol who have been victimized continue to have low levels of self-control, they may be at risk of sexual revictimization. This exemplifies risk heterogeneity. This perspective suggests that some people are more likely to be sexually revictimized based on personal characteristics that if left unchanged will keep a person at risk, even after an initial victimization. Low self-control falls in line with this perspective.
Schreck, Stewart, and Fisher (2006) expressed the same concern with risky behaviors. If participation in risky behaviors that put a person at risk for victimization go unchanged, then he or she is likely to be revictimized. Alcohol and drug use were used as measures of risky behavior in this study. Overall, participants who reported drinking alcohol and using drugs were more likely to be single victims and revictims than
nonvictims. For example, in the childhood sexual assault revictimization model, 74.0 percent and 12.0 percent of other drug users were revictims and single victims respectively compared to 14.0 percent of other drug users who were nonvictims.
These findings are in line with the research that shows a relationship between alcohol abuse and increased sexual victimization (Koss & Dinero, 1989; Testa et al. (2000); Abbey et al., 2001). Women who drink lower their inhibitions and offenders find them more easily persuaded (Schreck, 1999). Substance use may be related to initial sexual victimization and subsequent sexual revictimization. If risky behaviors such as alcohol consumption and drug use are continued after the initial victimization occurs then it could be that what put the woman at risk in the first place will continue to put her at risk. Additionally, Ellis, Atkeson, and Calhoun (1982) and Gidycz et al. (1995) found that alcohol use promotes revictimization as well. In cases where substance use percentages are higher among single victims compared to revictims, it is possible that those who reported substance use of any kind had not experienced a sexual revictimization yet. Another reason why alcohol and drug use are related to sexual revictimization is that persons may use alcohol and drugs in response to an initial sexual victimization perhaps as a coping mechanism. This is in line with a state dependence explanation. College women may resort to alcohol consumption as a way to block out the consequences and memories of the initial sexual victimization.
It was expected the there would be a difference found between single victims and revictims. Instead, the self-control measures seemed to show differences primarily between nonvictims and revictims. This could be because nonvictims and revictims are the furthest apart on the continuum of victims, and therefore they would have the most differences. However, this does not explain why there were not more differences found between single victims and revictims in the self-control measures. It could be that other individual characteristics differentiate single victims from revictims. Potential individual characteristics differences could be depression and PTSD because of their existing link with sexual victimization (Filipas & Ullman, 2006; Gidycz et al., 1993; Messman-Moore et al., 2000). Greater levels of depression and PTSD could potentially put women at a greater risk of being sexually revictimized if these characteristics are not dealt with properly through practices such as counseling or medication.
Risky behaviors were found to occur among nonvictim, single victim, and revictim. There was particularly not a lot of difference in percentages between single victims and revictims. The majority of the findings suggested nonvictims and revictims showed the most differences in substance use. It could be that the first victimization was more due to chance than brought on by a risky behavior. This study does not have the full measure of L/RAT, only the element of substance use, and therefore conclusions based on L/RAT are beyond the scope of this thesis. If measures of the full L/RAT (proximity to motivated offenders, exposure to crime, target suitability, and capable guardianship) were used rather than just substance use, more differences may be apparent between single victims and revictims.
Jointly low self-control and risky behavior may be related to sexual revictimization for additional reasons. The ability to assess risk is a key factor in explaining why sexual revictimization occurs. Rozee and Koss (2001) found that in order to reduce risk, women need to know how to assess, acknowledge, and act in risky environments. However, women who have been sexually victimized do not easily recognize risk (Rozee & Koss, 2001). If these women also have low self-control, even if they recognize risk, they may not care to avoid it. Those with low self-control are thrillseeking individuals and risk is increased in persons who engage in thrill-seeking behaviors. Extending this concept, women who are revictimized oftentimes stay in risky situations that put them in danger past the point of escaping from them (Messman-Moore & Brown, 2006). This means that women, who are revictims, may not recognize the risk or care about the risk quickly enough to avoid potential revictimization situations.
A few policy implications could arise from these findings. Risk-avoidance training is shown to have an impact on alleviating sexual revictimization (Fisher, Daigle, Cullen, & Santana, 2007). With this type of effectiveness, more self-protective training and risk avoidance strategies should be provided to college women. Drug and alcohol education and potentially treatment are also necessary for college females. Substance use was significantly correlated with all of the sexual revictimization dependent variables, therefore the use of alcohol and drugs appears to be related to sexual revictimization. It could be that those who use and abuse substances are more likely to be sexually revictimized or that persons who experience a sexual victimization turn to alcohol and drugs to cope. Either way, the problematic use of alcohol and drugs cannot be ignored. Finally, aggression and frustration mediation, such as learning to use debate tactics rather than physical violence, could have a positive effect on raising certain elements of selfcontrol. If college women are instructed and educated on how to manage and express
their issues appropriately this may help not only their self-control, but to prevent their actions from escalating a situation into a sexual victimization. By learning effective resistance strategies when an incident has been initiated could further protect a woman from becoming a victim or revictim of sexual violence.
Limitations
As with all research, there were limitations to this study. First, the sample consisted only of college women. While these women were the focus of this thesis, the findings may not be able to be generalized to all women. A second limitation concerns the sample. There were additional risky behaviors measured at Waves III, IV, and V such as gambling, hitchhiking, and being alone with strangers. Unfortunately, these risky behavior measures could not be used due to the considerable decrease in sample size at these later waves from 1,572 college females in Wave I to 1,180 in Wave III to 953 in Wave IV to 746 in Wave V. In regards to the survey itself, a third limitation was the lack of consistency across waves. Questions were changed across waves, which did not allow for comparison of responses at additional waves. For example, as mentioned above, additional measures of risky behavior were found at later waves, but not in Waves I and II. Fourth, there were not measures of self-control to fully capture the complex nature of self-control. The elements used for self-control were selected to capture each element of self-control as best as possible. It is possible that the statements used did not actually measure the elements of self-control that they were supposed to measure. In addition, the individual variables used to measure the elements of self-control were not able to be scaled since reliability tests showed they were not measuring a single construct. Because of this, a self-control scale measure as an index could not be created as it has been in previous research. This means that findings in this study could not be compared to findings in previous studies where a self-control index was used.
Two other limitations concern the bivariate analyses conducted for this study. First, bivariate analyses are not able to establish causal order. Not being able to do so makes it difficult to know for sure which variable is dependent on the value of another variable. Second, single victims and revictims may not be truly independent in that the processes that promote sexual victimization also promote sexual revictimization. An ANOVA test assumes that there is independence among groups (Weinberg & Abramowitz, 2008). If single victims and revictims are not truly independent, then these types of analyses would not be able to find differences between the two groups. If independent groups are not apparent using this statistical analysis would be problematic. The ANOVA would be the incorrect test to be used. A more sophisticated analysis that can account for that possibility should be used in the future.
Future Research
Due to the limitations of this study, there are multiple recommendations for future research in this field of study. As mentioned, the self-control measures could be improved. Better measures of self-control should be used in future research that fully captures the six elements that characterize low self-control. For example, one of the most commonly used measures uses Grasmick, Tittle, Bursik, and Arneklev‟s (1993) measure that includes 23 items. It would also be valuable to have measures of each element of self-control that stick together so that a self-control scale could be created. Therefore, a
self-control scale could be used rather than individual measures of the self-control elements, to examine if low self-control generally predicts sexual revictimization.
Additional risky behavior measures should be explored as well. This study focused mainly on alcohol and substance use as risky behaviors. While these are relevant to college women, other risky behavior measures should also be considered to more fully account for the propositions set forth in L/RAT. These could be behaviors such as partying and sexual promiscuity. Additionally, lack of capable guardianship and exposure to crime and motivated offenders should be examined in the analyses.
Another recommendation for future research is to examine individual characteristics other than self-control. Depression is an individual characteristic that may help to explain sexual revictimization. Depression has been linked to victimization and may be subsequently linked to revictimization (Messman-Moore et al., 2000). It seems as though individual characteristics do play a role in sexual revictimization, therefore additional characteristics should be considered, especially since factors used in this study did not distinguish single victims from revictims.
Future studies should also strive to explain how risky behavior might be related to self-control. For example, low self-control may not be directly related to sexual victimization but related through risky behavior. Those with low self-control engage in risky behavior and that is why they are revictimized. Moreover, risky behavior may encourage less self-control. In this way, risky behavior may impact self-control, which together may increase risk for sexual victimization and revictimization although this flexibility in self-control levels is contrary to the general theory of crime (Gottfredson &
Hirschi, 1990). Future research should establish causal order to examine the relationship between self-control, risky behavior, and sexual revictimization. Research has shown that those with low self-control may be less likely to change their behavior after an initial victimization causing revictimization to occur (Fisher et al., 2010; Schreck, 1999).
Finally, multivariate models should be used along with longitudinal data. As noted, bivariate analyses cannot establish causality. In future studies, multivariate models should be used in order to determine causality. Measures should also be used that examine changes in independent variables after victimization occurs to more fully understand why some college women experience one sexual victimization and others are sexually revictimized.
This is the first study linking self-control, risky behaviors, and sexual revictimization among college women. In this way, its results indicate that there is reason to believe that self-control and risky behaviors are linked to sexual revictimization. Future research should further delineate how these elements impact each other.
References
Abbey, A., et al. (2001). Alcohol and sexual assault. Alcohol Research & Health, 25, 43-51.
Arata, C. M. (2000). From child victim to adult victim: A model for predicting sexual revictimization. Child Maltreatment, 5, 1, 28-38.
Arneklev, B. J., Grasmick, H. G., Tittle, C. R., & Bursik, R. J. Jr. (1993). Low selfcontrol and imprudent behavior. Journal of Quantitative Criminology, 9, 3, 225247.
Bureau of Justice Statistics. (2007). National Crime Victimization Survey. Washington DC: U.S. Department of Justice.
Bureau of Justice Statistics. (2008). Uniform Crime Reports. Washington DC: U.S. Department of Justice.
Carmen, E. H., Rieker, P. P., & Mills, T. (1984). Victims of violence and psychiatric illness. American Journal of Psychiatry, 141, 378-838.
Casey, E. A., & Nurius, P. S. (2005). Trauma exposure and sexual revictimization risk. Violence Against Women, 11, 4, 505-530.
Classen, C. C., Palesh, O. G., & Aggarwal, R. (2005). Sexual revictimization. Trauma, Violence, & Abuse, 6, 2, 103-129.
Cohen, L. E., & Felson, M. (1979). Social change and crime rates trends: A routine activities approach. American Sociological Review, 44, 588-608.
Combs-Lane, A. M., & Smith, D. W. (2002). Risk of sexual victimization in college women. Journal of Interpersonal Violence, 17, 2, 165-183.
Daigle, L. E., Fisher, B. S., & Cullen, F. T. (2008). The violent and sexual victimization of college women: Is repeat victimization a problem? Journal of Interpersonal Violence, 23, 1296-1313.
Davis, J. L., Combs-Lane, A. M., & Jackson, T. L. (2002). Risky behaviors associated with interpersonal victimization. Journal of Interpersonal Violence, 17, 6, 611629.
Desai, S., Arias, I., Thompson, M. P., & Basile, K. C. (2002). Childhood victimization
and subsequent adult revictimization assessed in a nationally representative sample of women and men. Violence and Victims, 17, 6, 639-653.
Ellis, E., Atkeson, B., & Calhoun, K. (1982). An examination of differences between multiple- and single-incident victims of sexual assault. Journal of Abnormal Psychology, 91, 221-224.
Farrell, G., Phillips, C., & Pease, K. (1995). Like taking candy: Why does repeat victimization occur? British Journal of Criminology, 35, 384-399.
Filipas, H. H., & Ullman, S. E. (2006). Child sexual abuse, coping responses, self-blame, posttraumatic stress disorder, and adult sexual revictimization. Journal of Interpersonal Violence, 21, 652-672.
Fisher, B. S., Cullen, F. T., & Turner, M. G. (2000). The sexual victimization of college women. Washington, D.C.: U.S. Department of Justice Office of Justice Programs.
Fisher, B. S., Daigle, L. E., & Cullen, F. T. (2008). Rape against women: What can research offer to guide the development of prevention programs and risk reduction interventions? Journal of Contemporary Criminal Justice, 24, 163-177.
Fisher, B. S., Daigle, L. E., & Cullen, F. T. (2010). What distinguishes single from recurrent sexual victims? The role of lifestyles-routine activities and first-incident characteristics. Justice Quarterly, 27, 1, 102-129.
Fisher, B. S., Daigle, L. E., Cullen, F. T., & Santana, S. A. (2007). Assessing the efficacy of the protective action-completion nexus for sexual victimizations. Violence and Victims, 22, 1, 18-42.
Fisher, B. S., Daigle, L. E., Cullen F. T., & Turner, M. G. (2003). Acknowledging sexual victimization as rape: Results from a nation-level study. Justice Quarterly, 20, 3, 535-574.
Fisher, B. S., Sloan, J. J., Cullen, F. T., & Lu, C. (1997). The on-campus victimization patterns of students: Implications for crime prevention by students and postsecondary institutions. In Steven P. Lab (ed.), Crime Prevention at a Crossroads. Cincinnati, OH: Anderson.
Fisher, B. S., & Wilkes, A. R. P. (2003). A tale of two ivory towers. The British Journal of Criminology, 43, 3, 526-545.
Fite, R. A. (2006). A prospective analysis of the variables predicting sexual victimization
in college-age women: An extension of previous findings. Binghamton, NY: State University of New York at Binghamton.
Forde, D. R., & Kennedy, L. W. (1997). Risky lifestyles, routine activities, and the general theory of crime. Justice Quarterly, 14, 265-294.
Gibson, C., Schreck, C. J., & Miller, J. M. (2004). Binge drinking and negative alcohol related behaviors: A test of self-control theory. Journal of Criminal Justice, 32, 411-420.
Gidycz, C. A., Coble, C. N., Latham, L., & Layman, M. J. (1993). Sexual assault experience in adulthood and prior victimization experiences. Psychology of Women Quarterly, 17, 151-168.
Gidycz, C. A., Hanson, K., & Layman, M. J. (1995). A prospective analysis of the relationships among sexual assault experiences. Psychology of Women Quarterly, 19, 5-29.
Gidycz, C. A., McNamara, J. R., & Edwards, K. M. (2005). Women‟s risk perception and sexual victimization: A review of the literature. Aggression and Violent Behavior, 11, 441-456.
Gottfredson, M. R., & Hirschi, T. (1990). A general theory of crime. Palo Alto, CA: Stanford University Press.
Gover, A. R. (2004). Risky lifestyles and dating violence: A theoretical test of violent victimization. Journal of Criminal Justice, 32, 171-180.
Gross, A. M., Winslett, A., Roberts, M., & Gohn, C. L. (2006). An examination of sexual violence against women. Violence Against Women, 12, 288-300.
Hart, T. C. (2003). Violent victimization of college students. U.S. Department of Justice, Bureau of Justice Statistics Special Report.
Himelein, M. J. (1995). Risk factors for sexual victimization in dating. Psychology of Women Quarterly, 19, 31-48.
Hindelang, M. J., Gottfredson, M. R., & Garofalo, J. (1978). Victims of personal crime: An empirical foundation for a theory of personal victimization from The risk of personal victimizaiton. Cambridge, Mass.: Ballinger Publishing Company.
Hines, D. A. (2007). Predictors of sexual coercion against women and men: A multilevel, multinational study of university students. Sexual Behavior, 36, 403-422.
Kalof, L. (2000). Vulnerability to sexual coercion among college women: A longitudinal study. Gender Issues, 47-58.
Keane, C., Maxim, P. S., & Teevan, J. J. (1993). Drinking and driving, self-control, and gender: Testing a general theory of crime. Journal of Research in Crime and Delinquency, 30, 1, 30-46.
Kilpatrick, D. G. (1993). Introduction. Journal of Interpersonal Violence, 8, 193-197.
Kilpatrick, D. G., Edmunds, C. N., & Seymour, A. K. (1992). Rape in America: A report to the nation. Arlington, VA: National Victim Center.
Kilpatrick, D. G., Resnick, H. S., Ruggiero, K. J., Conoscenti, L. M., & McCauley, J. (2007).Drug-facilitated, Incapacitated, and forcible rape: A national study. U.S. Department of Justice.
Koss, M. P., & Dinero, T. E. (1989). Discriminant analysis of risk factors for sexual victimization among a national sample of college women. Journal of Consulting and Clinical Psychology, 57, 242-250.
Koss, M. P., Gidycz, C. A., & Wisniewski, N. (1987). The scope of rape: Incidence and prevalence of sexual aggression and victimization in a national sample of higher education students. Journal of Consulting and Clinical Psychology, 55, 162-170.
Koss, M. P., Woodruff, W. J., & Koss, P. G. (1990). Relation of criminal victimization to health perceptions amoung women medical patients. Journal of Consulting and Clinical Psychology, 51, 147-152.
Lauritsen, J. L., Sampson, R. J., and Laub, J. H. (1991). The link between offending and victimization among adolescents. Criminology, 29, 265-292.
Lieberson, S. (1991). Small N‟s and big conclusions: An examination of the reasoning in comparative studies based on a small number of cases. Social Forces, 70, 2, 307320.
Messman, T. L., Brown, A. L., & Koelsch, L. E. (2005). Posttraumatic symptoms and self-dysfunction as consequences and predictors of sexual revictimization. Journal of Traumatic Stress, 18, 3, 253-261.
Messman, T. L., & Long, P. J. (1996). Child sexual abuse and its relationship to revictimization in adult women: A review. Clinical Psychology Review, 16, 5, 397-420.
Messman-Moore, T. L., & Brown, A. L. (2006). Risk perception, rape, and sexual revictimization: A prospective study of college women. Psychology of Women Quarterly, 30, 159-172.
Messman-Moore, T. L., Long, P. J., & Siegfried, N. J. (2000). The revictimization of child sexual abuse survivors: An examination of the adjustment of college women with child sexual abuse, adult sexual assault, and adult physical abuse. Child Maltreatment, 5, 1, 18-27.
Miethe, T. D., & Meier, R. F. (1994). Crime and its social context: Toward an integrated theory of offenders, victims, and situations. Albany: State University of New York Press.
Mukherjee, S., & Carcach, C. (1998). Repeat victimization in Australia (Australian Institute of Criminology Research and Public Policy Series No. 15). Griffith: Australian Institute of Criminology.
Mustaine, E. E., & Tewksbury, R. (2000). Comparing the lifestyles of victims, offenders, and victim-offenders: a routine activity theory assessment of similarities and differences for criminal incident participants. Sociological Focus, 33, 3, 339-362.
Mustaine, E. E., & Tewksbury, R. (2002). Sexual assault of college women: A feminist interpretation of a routine activities analysis. Criminal Justice Review, 27, 1, 89121.
Norris, J., Nurius, P., & Dimeff, L. A. (1996). Through her eyes: Factors affecting women‟s perception of and resistance to acquaintance sexual aggression threat. Psychology of Women Quarterly, 20, 1, 123-145.
Paternoster, R., & Brame, R. (1998). The structural similarity of processes generating criminal and analogous behaviors. Criminology, 36, 3, 633-670
Pratt, T. C., & Cullen, F. T. (2000). The empirical status of Gottfredson and Hirschi‟s general theory of crime: A meta-analysis. Criminology, 38, 3, 931-964.
Resick, P. A. (1993). The psychological impact of rape. Journal of Interpersonal Violence, 8, 223-255.
Rodgers, K., & Roberts, G. (1995). Women‟s non-spousal multiple victimization: A test of the routine activities theory. Canadian Journal of Criminology, 37, 363-391.
Rozee, P. D., & Koss, M. P. (2001). Rape: A century of existence. Psychology of Women
Quarterly, 25, 295-311.
Russell, D. E. H. (1984). Sexually exploitation. Beverly Hills, CA: Sage.
Schreck, C. J. (1999). Criminal victimization and low self-control: An extension and test of a general theory of crime. Justice Quarterly, 16, 3, 633-654.
Schreck, C. J., & Fisher, B. S. (2004). Specifying the influence of family and peers on violent victimization: Extending routine activities and lifestyles theories. Journal of Interpersonal Violence, 19, 1021-1041.
Schreck, C. J., Stewart, E. A., & Fisher, B. S. (2006). Self-control, victimization, and their influence on risky activities and delinquent friends: A longitudinal analysis using panel data. Journal of Quantitative Criminology, 22, 319-340.
Schwartz, M. D., & Pitts, V. L. (1995). Exploring a feminist routine activities approach to explaining sexual assault. Justice Quarterly, 12, 1, 9-31.
Siegel, J. A., & Williams L. M. (2003). Risk factors for sexual victimization of women. Violence Against Women, 9, 8, 902-930.
Sorenson, S. B., Stein, J. A., Siegal, J. M., Golding, J. M., & Burnam, M. A., (1987). Prevalence of adult sexual assault: The Los Angeles epidemiologic catchment area study. American Journal of Epidemiology, 126, 1141-1164.
Stewart, E. A., Elifson, K. W., & Sterk, C. E. (2004). Integrating the general theory of crime into an explanation of violent victimization among female offenders. Justice Quarterly, 21, 1, 159-181.
Testa, M., Livingston, J. A., & Collins, R. L. (2000). The roles of women‟s alcohol consumption in evaluation of vulnerability to sexual aggression. Experimental and Clinical Psychopharmacology, 8, 185-191.
Tjaden, P., & Thoennes, N. (2006). Extent, nature, and consequences of rape victimization: Findings from the National Violence Against Women Survey. Washington, DC: National Institute of Justice.
Tseloni, A. (2000). Personal criminal victimization in the United States: Fixed and random effects of individual and household characteristics. Journal of Quantitative Criminology, 16, 415-442.
Ullman, S. E., Karabatsos, G., & Koss, M. P. (1999). Alcohol and sexual assault in a
national sample of college women. Journal of Interpersonal Voilence, 14, 603625.
Walsh, K., Blaustein, M., Knight, W. G., Spinazzola, J., van der Kolk, B. A. (2007). Resiliency factors in the relation between childhood sexual abuse and adulthood sexual assault in college-aged women. Journal of Child Sexual Abuse, 16, 1-17.
Weinberg, S. L., & Abramowitz, S. K. (2008). Statistics using SPSS. New York, NY: Cambridge University Press.
White, J. W., & Smith, P. H. (2004). A longitudinal perspective on physical and sexual intimate partner violence against women.
|
<urn:uuid:a82dc700-5e45-426c-a299-d01d3d3fefc4>
|
CC-MAIN-2013-48
|
http://scholarworks.gsu.edu/cgi/viewcontent.cgi?article=1000&context=cj_theses
|
2013-12-06T05:50:20Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2013-48/segments/1386163049615/warc/CC-MAIN-20131204131729-00007-ip-10-33-133-15.ec2.internal.warc.gz
| 167,052,691 | 27,144 |
eng_Latn
|
eng_Latn
| 0.949765 |
eng_Latn
| 0.9975 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"nob_Latn",
"unknown",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
989,
2210,
2552,
2886,
3137,
3876,
4809,
5919,
6042,
6061,
6083,
7587,
9802,
10585,
12062,
14332,
15422,
17251,
19033,
21116,
22287,
24122,
25762,
27446,
29287,
31154,
32944,
34557,
36346,
38220,
40047,
41881,
43798,
45665,
47292,
48951,
49684,
51211,
53091,
54811,
56667,
58445,
59733,
61475,
62987,
64743,
66487,
68390,
71539,
73855,
74204,
74258,
76012,
77611,
77806,
79716,
81000,
81193,
83056,
83704,
83922,
85754,
86383,
86551,
88381,
89393,
89581,
92541,
93171,
96877,
98775,
101375,
103182,
104310,
106365,
107902,
109737,
110868,
112624,
114798,
116833,
118898,
121023,
123117,
123681
] |
Dated: 16.07.2019
To,
DEPARTMENT OF CORPORATE SERVICES
BSE LIMITED
Phiroze Jeejeebhoy Towers
25th Floor, Dalal Street
Mumbai - 400001
SCRIP CODE: 538863
KIND ATTN: MANAGER – LISTING DEPARTMENT
SUB: COMPLIANCE OF REGULATION 76 OF SEBI (DEPOSITORIES & PARTICIPANTS) REGULATIONS 2018-RECONCILIATION OF SHARE CAPITAL AUDIT REPORT.
Dear Sir/Madam
Please find enclosed herewith Reconciliation of Share Capital Audit Report for the quarter ended on June 30, 2019 in compliance with Regulation 76 of SEBI (Depositories & Participants) Regulations, 2018.
This information may kindly be treated as compliance of Regulation 76 of SEBI (Depositories & Participants) Regulations, 2018 from our end for the Quarter ended on June 30, 2019.
Thanking you
Yours faithfully
For and on behalf
OF SRI AMARNATH FINANCE LIMITED
SUMIT BAJAJ
Company Secretary &
Compliance Officer
Encl: a/a
We have examined the records/information and documents maintained and provided by the Registrar and Transfer agent for issuing the Reconciliation of Share Capital Audit Report. In our opinion and to the best of our information and according to the explanations given to us by the Company and on verification of necessary documents, we certify the details stated below:
1. For Quarter Ended 30th, June, 2019
2. ISIN INE9B5Q01010
3. Face Value Rs. 10/-
4. Name of the Company SRI AMARNATH FINANCE LIMITED
5. Registered Office Address 4883-84, Second Floor, Main Road Kucha Ustad Dag, Chandni Chowk, Delhi-110006
6. Correspondence Address 4883-84, Second Floor, Main Road Kucha Ustad Dag, Chandni Chowk, Delhi-110006
7. Telephone & Fax Nos. Phone: 011-23953204, 23392222
8. Email Address [email protected]
9. Name of the Stock Exchanges where the company’s securities are listed: BSE Limited
| Number of Equity Share | % of total Issued Cap |
|------------------------|-----------------------|
| 99,80,000 | 100.00 % |
| 99,80,000 | 100.00 % |
10. Issued Capital 99,80,000 100.00 %
11. Listed Capital (Exchange-wise) BSE (as per company records)
12. Held in dematerialized form in CDSL 7,30,400 7.32%
13. Held in dematerialized form in NSDL 60,55,140 60.67%
14. Physical 31,94,460 32.01%
15. Total No. of shares (12 + 13 + 14) 99,80,000
16. Reasons for difference if any, between (10&11), (10&15), (11&15) Not Applicable
17. Certifying the details of change in share capital during the quarter under consideration as per Table below:
| Particulars** * | No. of Shares | Applied Not applied for listing | Listed on Stock Exchanges (Specify Names) | Whether intimated to CDSL | Whether intimated to NSDL | In-prinappr. Pending for SE (Specify Names) |
|-----------------|---------------|---------------------------------|------------------------------------------|---------------------------|---------------------------|---------------------------------------------|
| N.A | N.A | N.A | N.A | N.A | N.A | N.A |
***Rights, Bonus, Preferential Issue, ESOPs, Amalgamation, Conversion, Buy Back, Capital Reduction, Forfeiture, any other (to specify)
18. Register of Members is updated (Yes/No)
If not, update upto which date
| Yes | N.A. |
19. Reference of previous Quarter with regards to excess dematerialized shares, if any
20. Has the Company resolved the matter mentioned in point 19 above in the Current Quarter? If not reason why?
21. Mentioned the total no. of requests, If any, confirmed after 21 days and the total no. of requests pending beyond 21 days with the reasons for delay:
| Total No. of demat requests | No. of requests | No. of shares | Reason for delay |
|-----------------------------|-----------------|---------------|------------------|
| Confirmed after 21 days | NIL | NIL | NA |
| Pending for more than 21 days | NIL | NIL | NA |
22. Name, Telephone & Fax No. of the Compliance Officer of the Co.
Mr. Sumit Bajaj
Compliance Officer
phone: 011-23953204
011-23392222
Note:
I, Mr. Sumit Bajaj was appointed as Company Secretary & Compliance Officer of the Company w.e.f. 28.05.2019.
R MIGLANI & CO.
Company Secretaries
207, D.R Chambers, D.B Gupta Road,
Karol Bagh, New Delhi-110005
Tel:011-43012149
Bigshare Services Private Limited
Branch office:- 302 Kushal Bazar, 32-33,
Nehru Place, New Delhi-110019
Nil
Place: New Delhi
Date: 15.07.2019
For R MIGLANI & CO.
Company Secretaries
CS Rajni Miglani
Proprietor
M. No:- 30016
C. P. No: 11273
|
<urn:uuid:8db89490-b493-47d7-91eb-7a45045dcc54>
|
CC-MAIN-2021-04
|
https://sriamarnathfinance.in/images_gellary/RSCA-30062019.pdf
|
2021-01-24T11:19:39+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00200-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet
| 561,078,966 | 1,222 |
eng_Latn
|
eng_Latn
| 0.550791 |
eng_Latn
| 0.59408 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
876,
2374,
4680
] |
For Immediate Release June 6, 2018
Media Advisory 2018-1
MEDIA ADVISORY
ATTORNEY GENERAL RUSSELL SUZUKI TO HOLD NEWS CONFERENCE REGARDING NEW MEDICARE CARDS AND FRAUD PROTECTION
HONOLULU – Attorney General Russell Suzuki, together with a Medicare official, and a representative of the State Executive Office on Aging, will hold a news conference tomorrow, Thursday, June 7, 2018 at 11:00 a.m. at the Department of the Attorney General, 425 Queen Street, Honolulu. The purpose is to provide information about the rollout of new Medicare cards to 262,000 beneficiaries in the State, and how to protect Hawaii's seniors from related fraud and scams.
Attorney General Suzuki will discuss the growing problem of senior identity theft and provide tips to help seniors protect themselves against healthcare fraud.
Tom Duran, Pacific Area Representative for the U.S. Centers for Medicare & Medicaid Services, based in Honolulu, will provide details about the new Medicare cards and display a sample of what they look like.
Kaipolani Cullen, Volunteer Coordinator of the Senior Medicare Patrol at the Executive Office on Aging, will discuss her organization's efforts to educate local seniors about the new Medicare cards and help seniors detect and report Medicare fraud.
# # #
For more information, contact:
James W. Walther Special Assistant to the Attorney General Department of the Attorney General (808) 586-1284
[email protected]
website: http://ag.hawaii.gov/
Twitter: @ATGhigov
DEPARTMENT OF THE ATTORNEY GENERAL
DAVID Y. IGE GOVERNOR
RUSSELL A. SUZUKI ATTORNEY GENERAL
|
<urn:uuid:fbfd3b63-1592-4584-966e-2ad1fae15afc>
|
CC-MAIN-2019-09
|
https://ag.hawaii.gov/wp-content/uploads/2018/06/Media-Advisory-2018-1.pdf
|
2019-02-16T09:59:40Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247480240.25/warc/CC-MAIN-20190216085312-20190216111312-00166.warc.gz
| 488,135,764 | 363 |
eng_Latn
|
eng_Latn
| 0.971997 |
eng_Latn
| 0.971997 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
1595
] |
2018 Crimson Music Camp MAJORETTE CAMP
Wednesday, June 13 - Saturday, June 16, 2018
Wednesday
Thursday
Friday
Saturday
June 13
June 14
June 15
June 16
|
<urn:uuid:982214cd-ef0e-4fff-8373-39d73513ce1f>
|
CC-MAIN-2019-04
|
http://bands.ua.edu/wp-content/uploads/2018/06/2018-Camp-Master-Schedule-4-Majorette.pdf
|
2019-01-16T00:51:06Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583656530.8/warc/CC-MAIN-20190115225438-20190116011438-00393.warc.gz
| 23,811,236 | 53 |
eng_Latn
|
eng_Latn
| 0.986183 |
eng_Latn
| 0.986183 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
159
] |
Qualification Labour: A Fair Wage Isn't Enough if Workers Need to Do 5,000 Low Paid Tasks to Qualify for Your Task
Jonathan K. Kummerfeld
Computer Science & Engineering University of Michigan Ann Arbor, Michigan, 48109 [email protected]
Abstract
Conventions for the Approved HITs Threshold
Extensive work has argued in favour of paying crowd workers a wage that is at least equivalent to the U.S. federal minimum wage. Meanwhile, research on collecting high quality annotations (e.g. for Natural Language Processing) suggests using qualifications such as a minimum number of previously completed tasks. If most requesters who pay fairly use this kind of minimum qualification, then workers may be forced to complete a substantial amount of poorly paid work for other requesters before they can earn a fair wage. This paper (1) explores current conventions for the threshold, (2) discusses possible alternatives, and (3) presents a study of correlation between approved work and work quality.
The Problem
Workers using Amazon Mechanical Turk earn a median wage of $2.54 an hour while completing tasks (Hara et al. 2018), far below U.S.-state minimum wages of $7.25 to $15. Many researchers try to pay workers a higher wage, carefully estimating the time spent on a task and giving workers bonuses when the time required is higher than expected. At the same time, researchers try to maintain the quality of work completed using a variety of methods (Mitra, Hutto, and Gilbert 2015). One common approach, used by 19% of tasks (HITs) on the platform (Hara et al. 2018), is to restrict tasks to workers who have had a certain number of HITs approved. Tasks with this restriction have a median wage of $4.14 an hour, far above the overall average. If this restriction is widely used by high paying requesters it means we are requiring workers to do a substantial amount of low paid "Qualification Labour": work to achieve the qualifications necessary for high paying tasks.
It is difficult to estimate how much time workers have to spend to achieve these qualifications. Academic studies of time spent on HITs may be skewed by experienced workers, who have strategies for finding and completing tasks rapidly. Posts on Reddit mention taking anywhere from a month to a year to reach 5,000 approved HITs. The median of values reported across four threads was 2.25 months ([alisonlovepowell] 2015; [GnomeWaiter] 2013; [FrobozzYogurt] 2020; [Wat3rloo] 2016). Assuming 20 hours of work a week that is almost 200 hours of effort (140 seconds per task).
The value used as the Approved HITS threshold is rarely reported in prior work. Three recent papers specify a 1,000 HIT threshold (Vandenhof 2019; Oppenlaender et al. 2020; Whiting, Hugh, and Bernstein 2019). Outside of Computer Science, advice in articles (Young and Young 2019) and tutorials (Dozo 2020) is to set the value to 100 because that is when another qualification (approval percentage) becomes active. This difference may be because these fields primarily use crowdsourcing for surveys rather than data annotation or human computation systems. It is unclear how representative the samples listed above are. However, there are other sources that can provide information about conventions.
One source is Amazon itself. The Mechanical Turk webinterface provides six threshold options: 50, 100, 500, 1,000, 5,000, 10,000. The MTurk blog has mentioned this qualification in four posts over the past eight years (Amazon Mechanical Turk 2012; 2019; 2017; 2013). In three cases, the recommended value is 5,000 and in the fourth it is 10,000.
Another source is forums and blogs. One pinned/sticky thread on the MTurk Crowd forum advises that "For your first 1000 HITs you may want to concentrate on approval milestones rather than $$$ ... most of the betterpaying requesters require 1000/5000/10000+ approved HITs" ([jklmnop] 2016). This advice is repeated elsewhere on the forum and on Reddit ([WhereIsTheWork] 2019; [CaptainSlop] 2019; [Crazybritzombie] 2018). In discussion between a worker and a requester, the worker recommended a threshold of 5,000 ([clickhappier] 2016). In the blog "Tips For Requesters On Mechanical Turk", one post recommends at least 5,000 if not 10,000 (Miele 2012) while another recommends at least 1,000 (Miele 2018). In the CloudResearch blog, the threshold is mentioned once, noting that a value of 10,000 maintains quality without significantly increasing the time to finish a set of HITs (Robinson 2015).
Finally, qualifications are discussed by courses and tutorials. In the Crowdsourcing & Human Computation course at the University of Pennsylvania, a guest lecture on "The Best Practices of the Best Requesters" mentioned the approved HITs qualification and used 10,000 as an example (Milland 2016). One guide recommends a cutoff of 5,000 (Carlson (n´ee Feenstra) 2014).
Potential Solutions
If this type of qualification undercuts our commitment to paying a fair wage, what are alternative ways to maintain quality? One option is to introduce screening questions that workers must complete with a certain accuracy to proceed to the rest of the task, e.g., requiring 70%+ on three questions with known answers (Shvartzshnaid et al. 2019). The problem with this approach is that it involves unpaid labour from workers who fail to pass the screening. Another option is to simply accept that there will be lower quality workers and drop the lowest performing ones, e.g., the bottom 25% (Bansal et al. 2019). This incurs a substantial cost to the researchers, as do other approaches that involve aggregation of responses or attention checks. Finally, there is the option to have an initial task that a broad set of workers can complete and then limit participation to the workers who did well on that task. The cost of this solution depends on the percentage of workers who do well on the initial task. One drawback of this solution is that the filtering step may produce a biased sample of workers, though with a large enough sample that could be corrected for by weighting if needed.
Recruitment: We considered 15 combinations of ranges for "Approved HITs" and "Percentage Approved", as shown by the axis labels in Figure 1. The task was hosted externally, with Javascript-based checks to ensure each worker completed the task only once. Workers also had to be U.S.based. 216 workers completed the task and 657 opened and returned it. Most groups had 15 who finished, with 14 in four cases (97-98% with 500-1,000 and 1,000-2,500 approved, and 98-99% with 2,500-5,000 and 5,000+), 13 in one (9798%, 5,000+) and 12 in one (97-98%, 2,500-5,000).
Calibrating the Approved HITs Threshold
In the approaches above, the approved HITs qualification is either removed entirely or the threshold is set to a lower value. This section presents a study of the quality of work performed by workers in different ranges for the threshold. 1 Task: Workers were shown a 244 word document and asked to identify when one of two specific entities was mentioned. Workers were asked to check their answers if they tried to submit in less than 75 seconds. If they labeled 8 items in the first 19 words, they were reminded to only label the two entities specified. The task was estimated to take 3 minutes and paid workers 60 cents ($12 / hour). Four reviews of the task on TurkerView (https://turkerview.com/) indicated that workers earned $7.88, $11.25, $12.93, and $14.59.
1 This was completed as part of a larger study approved by the Michigan IRB under study ID HUM00155689.
Results: For this task, an F-Score of 80 is a reasonable threshold for having carefully read the instructions and attempted the task. Figure 1 shows the percentage of workers scoring 80 or higher (leftmost plot) and information about the behaviour of workers who returned the HIT. When the acceptance percentage is below 99, results are consistently poor, with fewer than 25% of workers scoring above 80. When acceptance percentage is 99-100, groups with higher approved HITs have better scores. However, the number of workers returning the HIT is also higher in these cases (see the last column of the rightmost plot), indicating that workers are self-selecting out. Finally, in a follow up experiment with constraints of 99-100% and 1,000+ Approved HITs and a relatively new requester account, 60 out of 92 workers scored 80 or above (65%), indicating that there are more workers in the higher approved HITs groups.
Conclusion
This paper identifies hidden qualification labour and explores ways to reduce it. The common practise of requiring 5,000 approved tasks means workers need to complete approximately two months of work at extremely low rates. This work also considers the impact of changing the threshold on the quality of work for an example Natural Language Processing task. Accuracy correlates with the number of tasks completed, though percentage accepted is more critical, and there is a major shift at the 1,000 approved tasks mark. Shifting to 1,000, as some researchers already have, would substantially reduce qualification labour.
References
[alisonlovepowell]. 2015. How long did it take you to hit 5000 completed hits? https://www.reddit.com/r/mturk/ comments/3by1va/how long did it take you to hit 5000 completed/. Accessed: 2020-08-12.
Amazon Mechanical Turk. 2012. Improving quality with qualifications – tips for api requesters. https://blog.mturk.com/improving-quality-withqualifications-tips-for-api-requesters-87eff638f1d1. Accessed: 2020-08-12.
Amazon Mechanical Turk. 2013. Hit critique: Design tips for improving results. https://blog.mturk.com/hit-critiquedesign-tips-for-improving-results-a53eb8422081. Accessed: 2020-08-12.
Amazon Mechanical Turk. 2017. Tutorial: Understanding requirements and qualifications. https: //blog.mturk.com/tutorial-understanding-requirementsand-qualifications-99a26069fba2. Accessed: 2020-08-12.
Amazon Mechanical Turk. 2019. Qualifications and worker task quality. https://blog.mturk.com/qualificationsand-worker-task-quality-best-practices-886f1f4e03fc. Accessed: 2020-08-12.
Bansal, G.; Nushi, B.; Kamar, E.; Lasecki, W. S.; Weld, D. S.; and Horvitz, E. 2019. Beyond accuracy: The role of mental models in human-ai team performance. In Proceedings of the Seventh AAAI Conference on Human Computation and Crowdsourcing.
[CaptainSlop]. 2019. Newbie that read faq's any tips to getting to 1000. https://www.reddit.com/r/mturk/comments/ 9bfv92/newbie that read faqs any tips to getting to 1000/ e52rbs5/. Accessed: 2020-08-12.
Carlson (n´ee Feenstra), T. N. 2014. Mechanical turk how to guide. http://pages.ucsd.edu/ ∼ tfeenstr/resources/ mturkhowto.pdf. Accessed: 2020-08-12.
[clickhappier]. 2016. Masters qualification info - everything you need to know. https://www.mturkcrowd.com/ threads/masters-qualification-info-everything-you-need-toknow.1453/. Accessed: 2020-08-12.
[Crazybritzombie]. 2018. How to get to 5,000 approved https://www.reddit.com/r/mturk/comments/90zzt5/ how to get to 5000 approved hits/. Accessed: 2020-08-12.
hits? Dozo, N. 2020. Introduction to mturk and prolific.
[FrobozzYogurt]. 2020. Just hit 100k! https://www.reddit. com/r/mturk/comments/i3nvx4/just hit 100k/. Accessed: 2020-08-12.
[GnomeWaiter]. 2013. Over $1100 and 5000+ approvals in my first month of turking, and so can you! https://www.reddit.com/r/mturk/comments/1tjge3/ over 1100 and 5000 approvals in my first month of/. Accessed: 2020-08-12.
Hara, K.; Adams, A.; Milland, K.; Savage, S.; CallisonBurch, C.; and Bigham, J. P. 2018. A data-driven analysis of workers' earnings on amazon mechanical turk. In Proceedings of the 2018 CHI Conference on Human Factors in Computing Systems, 1–14.
[jklmnop]. 2016. Your first 1000 hits. https://www. mturkcrowd.com/threads/your-first-1000-hits.23/. Accessed: 2020-08-12.
Miele, J. 2012. Tips for academic requesters on mturk. http://turkrequesters.blogspot.com/2012/09/tips-foracademic-requesters-on-mturk.html. Accessed: 2020-0812.
Miele, J. 2018. The bot problem on mturk. http://turkrequesters.blogspot.com/2018/08/the-botproblem-on-mturk.html. Accessed: 2020-08-12.
Milland, K. 2016. The best practices of the best requesters. http://crowdsourcing-class.org/slides/bestpractices-of-best-requesters.pdf. Accessed: 2020-08-12.
Mitra, T.; Hutto, C.; and Gilbert, E. 2015. Comparing person- and process-centric strategies for obtaining quality data on amazon mechanical turk. In Proceedings of the 33rd Annual ACM Conference on Human Factors in Computing Systems, 1345–1354.
Oppenlaender, J.; Milland, K.; Visuri, A.; Ipeirotis, P.; and Hosio, S. 2020. Creativity on paid crowdsourcing platforms. In Proceedings of the 2020 CHI Conference on Human Factors in Computing Systems, 1–14.
Robinson, J. 2015. Maximizing hit participation. https: //www.cloudresearch.com/resources/blog/maximizing-hitparticipation/. Accessed: 2020-08-12.
Shvartzshnaid, Y.; Apthorpe, N.; Feamster, N.; and Nissenbaum, H. 2019. Going against the (appropriate) flow: A contextual integrity approach to privacy policy analysis. In Proceedings of the Seventh AAAI Conference on Human Computation and Crowdsourcing.
Vandenhof, C. 2019. A hybrid approach to identifying unknown unknowns of predictive models. In Proceedings of the Seventh AAAI Conference on Human Computation and Crowdsourcing.
[Wat3rloo]. 2016. 5000 approved hits!!?? https://www. reddit.com/r/mturk/comments/4kd1co/5000 approved hits/. Accessed: 2020-08-12.
[WhereIsTheWork]. 2019. How important are qualifications for getting more surveys? https: //www.mturkcrowd.com/threads/how-important-arequalifications-for-getting-more-surveys.4521/. Accessed: 2020-08-12.
Whiting, M. E.; Hugh, G.; and Bernstein, M. S. 2019. Fair work: Crowd work minimum wage with one line of code. In Proceedings of the Seventh AAAI Conference on Human Computation and Crowdsourcing.
Young, J., and Young, K. M. 2019. Don't get lost in the crowd: Best practices for using amazon's mechanical turk in behavioral research. Journal of the Midwest Association for Information Systems (JMWAIS).
|
<urn:uuid:453ce645-2505-4ca9-a973-7ae400112f3e>
|
CC-MAIN-2022-40
|
https://jkk.name/pub/hcomp20fair.pdf
|
2022-10-05T03:19:15+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-40/subset=warc/part-00202-26160df0-1827-4787-a515-95ecaa2c9688.c000.gz.parquet
| 373,999,858 | 3,711 |
eng_Latn
|
eng_Latn
| 0.926804 |
eng_Latn
| 0.992189 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
4848,
9078,
14038
] |
Punta Gorda Garden Club Floral Design Study Units 7, 8, 9
We are offering Advanced Floral Design classes – Units 7, 8, & 9 - in January and February. These are hands on, instructor led, classes which include a review of design guidelines and live demonstrations. Students will create an arrangement and receive constructive feedback on their designs. Details below.
When: January 31, February 7, February 14, 2023
Where: Charlotte Community Foundation, Inc. 227 Sullivan St, Punta Gorda, FL
Time: 10 am (ends approximately 3pm) Bring your lunch
Cost: $55.00
Limit: 30 participants
Registration Begins: October 20, 2022
Checks payable: to Punta Gorda Garden Club PGGC, collected by Joyce Stanley, club
treasurer.
Registration Deadline: December 7 (Christmas luncheon)
If you did not take design class units 1-6, you are still eligible to participate in these three units. See attachment for details of each unit.
Punta Gorda Garden Club Floral Design Study Units 7, 8, 9
Location for each session:
Charlotte Community Foundation 227 Sullivan St, Punta Gorda, FL 33950
Unit #7 – Instructor: Carol Lucia, St Petersburg , Dist. VIII
Date: Tuesday January 31, 2023, 10 am
Dried Plant Material and Decorative Wood
Student provides:
1. Container
2. All plant materials – may use fresh and or dried treated for round forms and
transitional material (but must use decorative wood as line)
3. Tools and mechanics necessary to make a Creative Design using decorative wood for the line.
Unit #8 – Instructor: Barb Jacobson, Englewood, Dist. VIII
Date: Tuesday February 7, 2023, 10 am
Designs That Interpret Themes of Titles
Student provides:
1. All components to complete a Creative Design entitled "Fire."
2. Plant material may include fresh and/or dried and/or treated.
3. Accessories are permitted.
4. Students may subtitle their design.
Unit #9 –Instructor: Margret Kirkpatrick-Longwood, District IV
Date: Tuesday February 14, 2023, 10 am
Creativity And Entering the Flower Show
Student provides:
1. All components to make a Creative Design.
2. Design may be either creative or abstract.
3. Student to title design
|
<urn:uuid:0c80459a-c9e9-46dd-808a-d6d990d69345>
|
CC-MAIN-2022-40
|
https://pggc.org/wp-content/uploads/2022/09/FDS-Advanced-Units-7-8-9.pdf
|
2022-10-02T06:19:58+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-40/subset=warc/part-00246-26160df0-1827-4787-a515-95ecaa2c9688.c000.gz.parquet
| 486,929,461 | 517 |
eng_Latn
|
eng_Latn
| 0.970148 |
eng_Latn
| 0.970558 |
[
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
922,
2135
] |
Magnetic control of transport of particles and droplets in low Reynolds number shear flows
Jie Zhang
Follow this and additional works at: https://scholarsmine.mst.edu/doctoral_dissertations
Part of the Aerodynamics and Fluid Mechanics Commons, Fluid Dynamics Commons, and the Mechanical Engineering Commons
Department: Mechanical and Aerospace Engineering
Recommended Citation
Zhang, Jie, "Magnetic control of transport of particles and droplets in low Reynolds number shear flows" (2020). Doctoral Dissertations. 2926.
https://scholarsmine.mst.edu/doctoral_dissertations/2926
This thesis is brought to you by Scholars' Mine, a service of the Missouri S&T Library and Learning Resources. This work is protected by U. S. Copyright Law. Unauthorized use including reproduction for redistribution requires the permission of the copyright holder. For more information, please contact [email protected].
MAGNETIC CONTROL OF TRANSPORT OF PARTICLES AND DROPLETS IN LOW REYNOLDS NUMBER SHEAR FLOWS
by
JIE ZHANG
A DISSERTATION
Presented to the Graduate Faculty of the
MISSOURI UNIVERSITY OF SCIENCE AND TECHNOLOGY
In Partial Fulfillment of the Requirements for the Degree
DOCTOR OF PHILOSOPHY
in
MECHANICAL ENGINEERING
2020
Approved by:
Cheng Wang, Advisor
K. M. Isaac
Kelly Homan
K. Chandrashekhar
Xiaoming He
Copyright 2020
JIE ZHANG
All Rights Reserved
PUBLICATION DISSERTATION OPTION
This dissertation consists of the following five articles which have been published as follows:
Paper I, found on pages 9-24 is a conference paper published in the proceedings of COMSOL conference 2017 Boston in Boston, Massachusetts.
Paper II, found on pages 25-53 have been published in Magnetochemistry.
Paper III, found on pages 54-89 have been published in Microfluidics and Nanofluidics.
Paper IV, found on pages 90-116 have been published in Journal of Micromechanics and Microengineering.
Paper IV, found on pages 117-138 have been published in Soft Matter.
Magnetic particles and droplets have been used in a wide range applications including biomedicine, biological analysis and chemical reaction. The manipulation of magnetic microparticles or microdroplets in microscale fluid environments is one of the most critical processes in the systems and platforms based on microfluidic technology. The conventional methods are based on magnetic forces to manipulate magnetic particles or droplets in a viscous fluid.
In contrast to conventional magnetic separation method, several recent experimental and theoretical studies have demonstrated a different way to manipulate magnetic nonspherical particles by using a uniform magnetic field in the microchannel. However, the fundamental mechanism behind this method is not fully understood. In this research, we aims to use numerical and experimental methods to explore and investigate manipulation of microparticles and microdroplets in the microfluidics by using a uniform magnetic field. In the first part, rotational dynamics of elliptical particles in a simple shear flow is numerically investigated; then, lateral migration of elliptical particles in a plane Poiseuille flow is numerically investigated; The third part compares the rotational dynamics of paramagnetic and ferromagnetic elliptical particles particles in a simple shear flow; in the fourth part, particle-particle interactions and relative motions of a pair of magnetic elliptical particles in a quiescent flow are numerically investigated; magnetic separation of magnetic microdroplets by the uniform magnetic field is proposed in the fifth part.
The methods demonstrated in this research not only develop numerical and experimental way to understand the fundamental transport properties of magnetic particles and droplets in microscale fluid environments, but also provide a simple and efficient method for the separation of microdroplets in microfluidic device, which can impact biomedical and bio-medicine technologies.
ACKNOWLEDGMENTS
I would like to express my sincere gratitude to my advisor, Dr. Cheng Wang, for his insightful guidance and patience during my graduate study at Missouri University of Science and Technology. He is always open to meet when I need to have a discussion with him. His professional and diligent attitude to do research makes me not only a better researcher but also a better person. Furthermore, I gratefully acknowledges the Department of Mechanical and Aerospace Engineering at Missouri University of Science and Technology for providing financial support during my graduate study.
I would also like to express my thanks to all my dissertation committee members, Dr. K. M. Isaac, Dr. Kelly Homan, Dr. K. Chandrashekhara, and Dr. Xiaoming He. They gave me valuable suggestions and comments, which was very helpful for me to complete this dissertation.
I am very thankful to my research group members, Dr. Ran Zhou, Mr. Christopher Sobecki, and Mr. Md. Rifat Hassan for their support in life and insightful discussions in research. I would also like to thank my friends, Mr. Junji Huang, Dr. Chao Zhang, Mr. Wenyu Liao, and Dr. Wei Wang for their support and help during my study in Rolla.
Ultimately, I would like to express special thanks to my parents for their love, understanding, supports and encouragement during my study in the United States.
# TABLE OF CONTENTS
| Section | Page |
|------------------------------------------------------------------------|------|
| PUBLICATION DISSERTATION OPTION | iii |
| ABSTRACT | iv |
| ACKNOWLEDGMENTS | v |
| LIST OF ILLUSTRATIONS | xi |
| LIST OF TABLES | xv |
| SECTION | |
| 1. INTRODUCTION | 1 |
| 2. ORGANIZATION OF DISSERTATION | 6 |
| PAPER | |
| I. STUDY OF ROTATION OF ELLIPSOIDAL PARTICLES IN COMBINED SIMPLE SHEAR FLOW AND MAGNETIC FIELDS | 9 |
| ABSTRACT | 9 |
| 1. INTRODUCTION | 10 |
| 2. SIMULATION METHOD | 12 |
| 2.1. MATHEMATICAL MODEL | 12 |
| 2.2. COMOL SETTINGS | 15 |
| 2.3. MATERIAL PROPERTIES | 17 |
| 3. RESULTS AND DISCUSSION | 17 |
| 3.1. VALIDATION OF NUMERICAL METHOD | 17 |
3.2. THE EFFECT OF MAGNETIC FIELD STRENGTH ........................................ 18
3.3. THE EFFECT OF THE DIRECTION OF MAGNETIC FIELD .................. 20
3.4. THE EFFECT OF PARTICLE ASPECT RATIO ........................................... 21
4. CONCLUSIONS ......................................................................................... 22
ACKNOWLEDGEMENTS ............................................................................. 23
REFERENCES ............................................................................................... 23
II. NUMERICAL STUDY OF LATERAL MIGRATION OF ELLIPTICAL MAGNETIC MICROPARTICLES IN MICROCHANNELS IN UNIFORM MAGNETIC FIELDS ................................................................. 25
ABSTRACT ........................................................................................................ 25
1. INTRODUCTION ......................................................................................... 26
2. SIMULATION METHOD ............................................................................ 29
2.1. MATHEMATICAL MODEL ................................................................. 29
2.2. MATERIAL PROPERTIES USED IN SIMULATIONS ...................... 32
2.3. GRID INDEPENDENCE ANALYSIS .................................................. 33
3. RESULTS AND DISCUSSION .................................................................. 34
3.1. VALIDATION OF NUMERICAL METHOD ........................................ 34
3.2. PARTICLE MOTION WITHOUT A MAGNETIC FIELD .................. 35
3.3. PARTICLE MOTION IN A MAGNETIC FIELD .................................. 39
3.3.1. Magnetic Field at $\alpha = 0^\circ$ .................................................. 39
3.3.2. Magnetic Field at $\alpha = 90^\circ$ ............................................... 42
3.3.3. Magnetic Field at $\alpha = 135^\circ$ ............................................. 46
3.3.4. Magnetic Field at $\alpha = 45^\circ$ .............................................. 46
3.3.5. Effects of Particle Shape and the Wall ................................. 47
3.4. LATERAL MIGRATION MECHANISM .................................................. 49
4. CONCLUSIONS ......................................................................................... 50
ACKNOWLEDGEMENTS ............................................................................. 51
REFERENCES ........................................................................................................ 51
III. NUMERICAL INVESTIGATION OF ROTATIONAL DYNAMICS OF ELLIPTICAL MAGNETIC MICROPARTICLES IN SHEAR FLOWS .................................................. 54
ABSTRACT .................................................................................................................. 54
1. INTRODUCTION ................................................................................................. 55
2. NUMERICAL METHOD ..................................................................................... 57
2.1. MATHEMATICAL MODEL ........................................................................... 57
2.2. MATERIAL PROPERTIES ............................................................................ 61
2.3. VALIDATION OF NUMERICAL METHOD .................................................... 62
2.4. GRID INDEPENDENCE ANALYSIS ............................................................... 63
3. THEORETICAL ANALYSIS ............................................................................... 64
4. WEAK MAGNETIC FIELD .................................................................................. 68
4.1. PARAMAGNETIC PARTICLES .................................................................... 68
4.2. FERROMAGNETIC PARTICLES .................................................................. 72
5. STRONG MAGNETIC FIELD .............................................................................. 75
5.1. PARAMAGNETIC PARTICLES .................................................................... 75
5.2. FERROMAGNETIC PARTICLES .................................................................. 77
6. PARTICLE LATERAL MIGRATION IN A SIMPLE SHEAR FLOW NEAR THE WALL .................................................................................................................. 77
6.1. WEAK MAGNETIC FIELD ........................................................................... 80
6.2. STRONG MAGNETIC FIELD ....................................................................... 83
7. PARTICLE LATERAL MIGRATION IN A PLANE POISEUILLE FLOW IN A MICROCHANNEL ........................................................................................................ 84
8. CONCLUSION ...................................................................................................... 86
REFERENCES ........................................................................................................ 87
IV. DYNAMICS OF A PAIR OF ELLIPSOIDAL MICROPARTICLES UNDER UNIFORM MAGNETIC FIELDS .................................................................................................. 90
| Section | Page |
|------------------------------------------------------------------------|------|
| ABSTRACT | 90 |
| 1. INTRODUCTION | 91 |
| 2. NUMERICAL METHOD | 94 |
| 2.1. MATHEMATICAL MODEL | 94 |
| 2.2. MATERIAL PROPERTIES | 98 |
| 3. RESULTS AND DISCUSSION | 99 |
| 3.1. PARTICLE INTERACTION OF A PAIR OF CIRCULAR PARTICLES | 99 |
| 3.2. MAGNETO-ORIENTATION OF A SINGLE PROLATE ELLIPTICAL PARTICLE | 101 |
| 3.3. TWO PARTICLES: COMBINED MAGNETO-ORIENTATION AND GLOBAL REORIENTA-| 102 |
| 3.4. TWO PARTICLES: PARALLEL ($\theta_0 = 0^\circ$) OR PERPENDICULAR ($\theta_0 = 90^\circ$) TO MAGNETIC FIELD | 104 |
| 3.5. TWO PARTICLES: GLOBAL REORIENTATION AT ARBITRARY INITIAL POSITION ($0^\circ < \theta_0 < 90^\circ$) | 105 |
| 3.5.1. The Effect of Initial Relative Angle Between Two Particles | 106 |
| 3.5.2. The Effect of Initial Center-to-Center Distance | 109 |
| 3.5.3. The Effect of Particle Aspect Ratio | 110 |
| 4. CONCLUSION | 111 |
| ACKNOWLEDGEMENTS | 112 |
| REFERENCES | 112 |
V. MIGRATION OF FERROFLUID DROPLETS IN SHEAR FLOW UNDER A UNIFORM MAGNETIC FIELD
| Section | Page |
|------------------------------------------------------------------------|------|
| ABSTRACT | 117 |
| 1. INTRODUCTION | 118 |
| 2. EXPERIMENT | 120 |
| 3. RESULTS AND DISCUSSION | 122 |
| 3.1. EFFECT OF DIRECTION OF MAGNETIC FIELD | 122 |
3.2. CROSS-STREAM MIGRATION MECHANISM ........................................ 125
3.3. EFFECTS OF MAGNETIC FIELD STRENGTH, INTERFACIAL TENSION AND FLOW RATE ................................................................. 128
3.4. SEPARATION OF FERROFLUID AND WATER DROPLETS ........... 131
4. CONCLUSIONS .................................................................................. 132
ACKNOWLEDGEMENTS ....................................................................... 133
REFERENCES ..................................................................................... 133
SECTION
3. SUMMARY AND CONCLUSIONS .................................................... 139
REFERENCES ..................................................................................... 142
VITA ...................................................................................................... 154
# LIST OF ILLUSTRATIONS
| Figure | Page |
|--------|------|
| **PAPER I** | |
| 1. Schematic of an ellipsoidal particle in a simple shear flow. | 11 |
| 2. An ellipsoidal particle suspended in a simple shear flow and under a magnetic field $\mathbf{H}_0$, which is directed at an angle $\alpha$. | 12 |
| 3. Magnetic field around the particle under the uniform magnetic field of $H_0 = 3000$ A/m at $\phi = 45^\circ$. | 15 |
| 4. Velocity field in a simple shear flow at a shear rate of $\dot{\gamma} = 200 \text{s}^{-1}$. | 16 |
| 5. Comparison of the period between Jeffery’s theory and the FEM simulation. | 17 |
| 6. The effect of magnetic field strength $H_0$ (A/m) on the rotation period and asymmetry of the particle rotation. | 18 |
| 7. Illustration of particle rotation in the combined flow and magnetic fields. | 19 |
| 8. The effect of the direction of magnetic field at a fixed strength ($H_0 = 2000$ A/m) on the rotational period and asymmetry of particle rotation. | 21 |
| 9. The effect of particle aspect ratio on the rotational period and asymmetry of particle rotation at ($H_0 = 2000$ A/m, $\alpha = 0^\circ$). | 22 |
| **PAPER II** | |
| 1. Schematic view of the numerical model of an elliptical particle suspended in a plane Poiseuille flow under the influence of a uniform magnetic field $\mathbf{H}_0$. | 30 |
| 2. Grid independence analysis: particle orientation as a function of time, for $AR = 4$, $y_{p0} = 12 \mu\text{m}$. | 34 |
| 3. Comparison between the FEM simulation and Jeffery’s theory on particle rotation. | 35 |
| 4. Translation and rotation of the particle without a magnetic field. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \mu\text{m}$. | 36 |
| 5. The effects of initial position $y_{p0}$ and particle aspect ratio $AR$ on transport of elliptical particles without a magnetic field. | 37 |
| 6. Transport of the particle when the magnetic field is applied perpendicular to the flow direction, i.e., $\alpha = 0^\circ$. | 40 |
7. The effect of magnetic field strength on particle transport, with $AR = 4$, $y_{p0} = 12 \mu m$, and $\alpha = 0^\circ$ ................................................................. 41
8. Transport of the particle when the magnetic field is applied parallel to the flow direction, i.e., $\alpha = 90^\circ$ ........................................................................... 43
9. The effect of magnetic field strength on particle transport, with $AR = 4$, $y_{p0} = 12 \mu m$, and $\alpha = 90^\circ$. .................................................................................. 44
10. Effect of the magnetic field when it is applied at $\alpha = 135^\circ$ ............................................. 45
11. Effect of the magnetic field when it is applied at $\alpha = 45^\circ$ .............................................. 47
12. Dependence of (a1) $\tau$ and (a2) $U_v$ on particle aspect ratio $AR$, with the particle is initially located at $y_{p0} = 12 \mu m$ ........................................................................... 48
13. The scaling relationship between $\Delta y_p / A$ and $(\tau - 0.5)$ for $AR = 2(a), 3(b)$ and $4(c)$ ....................................................................................................................... 50
PAPER III
1. Schematic of the numerical model of an elliptical particle suspended in a simple shear flow under a uniform magnetic field $H_0$ ................................................................. 58
2. Comparison between the FEM simulation and Jeffery’s theory for particle aspect ratio $r_p = 4$ and the shear rate $\dot{\gamma} = 200 s^{-1}$ ................................................................. 63
3. Grid independence analysis: particle orientation $\phi$ as a function of time $t$ for particle aspect ratio $r_p = 4$ and the shear rate $\dot{\gamma} = 200 s^{-1}$ ........................................... 64
4. Rotation of the paramagnetic magnetic particle ($r_p = 4$) when the magnetic field is applied perpendicular to the flow direction ($\alpha = 0^\circ$) ........................................... 69
5. The dimensionless period, $T/T^J$, varies with the dimensionless magnetic field strength, $S$ when the magnetic field is applied at $\alpha = 0^\circ(a)$, $\alpha = 45^\circ(b)$, $\alpha = 90^\circ(c)$ and $\alpha = 135^\circ(d)$ for the paramagnetic particle. ........................................... 70
6. The dimensionless parameter, $\tau$, varies with the dimensionless magnetic field strength, $S$ when the magnetic field is applied at $\alpha = 0^\circ(a)$, $\alpha = 45^\circ(b)$, $\alpha = 90^\circ(c)$ and $\alpha = 135^\circ(d)$ for the paramagnetic particle. ........................................... 71
7. The dimensionless period, $T/T^J$, varies with the dimensionless magnetic field strength, $S$, when the magnetic field is applied at $\alpha = 0^\circ(a)$, $\alpha = 45^\circ(b)$, $\alpha = 90^\circ(c)$, $\alpha = 135^\circ(d)$, $\alpha = 180^\circ(e)$, $\alpha = 225^\circ(f)$, $\alpha = 270^\circ(g)$ and $\alpha = 315^\circ(h)$ for the ferromagnetic particle. ......................................................... 73
8. The dimensionless parameter, $\tau$, varies with the dimensionless magnetic field strength, $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c), $\alpha = 135^\circ$ (d), $\alpha = 180^\circ$ (e), $\alpha = 225^\circ$ (f), $\alpha = 270^\circ$ (g) and $\alpha = 315^\circ$ (h) for ferromagnetic particle.
9. The time evolution of orientation angle, $\phi$, and the stable orientation angle, $\phi_s$, as a function of $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c) and $\alpha = 135^\circ$ (d) for the paramagnetic particle.
10. The time evolution of orientation angle, $\phi$, and the stable orientation angle, $\phi_s$, as a function of $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c) and $\alpha = 135^\circ$ (d) for the ferromagnetic particle.
11. Schematic illustration of the numerical model of an elliptical particle suspended in a simple shear flow near the wall and in a plane Poiseuille flow in a microchannel under the influence of a uniform magnetic field $H_0$.
12. Transport of the magnetic particles ($r_p = 4$) near the wall under a weak magnetic field.
13. Transport of the magnetic particles ($r_p = 4$) near the wall under a weak magnetic field.
14. Transport of the magnetic particle ($r_p = 4$) near the wall under a strong magnetic field.
15. Transport of the magnetic particle ($r_p = 4$) in a plane Poiseuille flow in a microchannel when the magnetic field is applied at $0^\circ$ (a)(c) and $90^\circ$ (b)(d).
PAPER IV
1. Schematic of Numerical Model of two elliptical particles suspended in a quiescent flow under the influence of a uniform magnetic field.
2. (a) Trajectories of the centers of the two circular particles under the uniform magnetic field at the five initial relative angles $\theta_0 = 0^\circ$, $\theta_0 = 20^\circ$, $\theta_0 = 45^\circ$, $\theta_0 = 80^\circ$ and $\theta_0 = 90^\circ$; (b) The dimensionless center-to-center distance, $d^*$, varies with dimensionless time, $t^*$.
3. (a) A diagram of the magneto-orientation process for $r_p = 3$ when the magnetic field is directed left to right; (b) The self-orientation angle of a single prolate elliptical particle, $\alpha$ as a function of dimensionless time, $t^*$, for different aspect ratios.
4. The orientation angle of the particle, $\alpha$, and particle trajectory as a function of dimensionless time, $t^*$, for three initial orientation angle $\alpha_0 = 80^\circ$ (a), $90^\circ$ (b) and $110^\circ$ (c).
5. Magnetic field around two particles when the initial relative angle is $0^\circ$ (a) and $90^\circ$ (b). ................................................................. 105
6. Global reorientation of two elliptical particles with $r_p = 2$, $d_0^* = 2.4$ and $\theta_0 = 80^\circ$ for different time (a1-d1), where the magnetic field is applied left to right. 107
7. The effect of initial relative orientation angle between the particles on the particle-particle interaction. (a) Trajectories of particle centers, (b) center-to-center distance varying with dimensionless time, (c) the relative angle between the particles varying with dimensionless time, (d) the orientation angle of the particles varying with dimensionless time when $r_p = 2$ and $d_0^* = 2.4$. 108
8. The effect of initial center-to-center distance on the particle-particle interaction. (a) Trajectories of particle centers, (b) center-to-center distance varying with dimensionless time, (c) the relative angle between the particles varying with dimensionless time, (d) the orientation angle of the particles varying with dimensionless time when $r_p = 2$ and $\theta_0 = 80^\circ$. 109
9. The effect of particle aspect ratio on the particle-particle interaction. 111
PAPER V
1. (a) Photo of the microfluidic chip located in a uniform magnetic field. (b) Schematic showing the dimensions of the microchannel. 121
2. Images at the inlet and outlet, and the corresponding probability density function (PDF) of the centroid of the ferrofluid droplet in the y direction. 123
3. Comparison of the cross-stream migration of a droplet close to the lower wall between the theoretical prediction and experiment. 124
4. (a) Comparison of droplet trajectory between the experiments and simulation (a1), and numerical results of the magnetic field (a2) and velocity field (a3) for ferrofluid droplets when $\alpha = 45^\circ$. (b) Comparison of droplet trajectory between the experiments and numerical simulation (b1), and numerical results of the magnetic field (b2) and velocity field (b3) for ferrofluid droplets when $\alpha = 90^\circ$. 127
5. The effect of magnetic field strength, interfacial tension and flow rates on droplet migration. 129
6. The separation of ferrofluid and water droplets by a uniform magnetic field. 130
# LIST OF TABLES
| Table | Page |
|----------------------------------------------------------------------|------|
| **PAPER II** | |
| 1. Six meshes for grid independence analysis | 33 |
| **PAPER III** | |
| 1. Four meshes for grid independence analysis | 63 |
| 2. The critical strength, $S_{cr}$, calculated for paramagnetic and ferromagnetic particles with $r_p = 4$, and different $\alpha$ (Sobecki et al., 2018) | 68 |
Magnetic particles have been used in a vast number of applications including biomedicine (Pankhurst et al., 2003), biological analysis, and chemical catalysis (Gijs et al., 2009; Pamme, 2012). The separation of magnetic microparticles and nanoparticles in microscale fluid environments is one of the most important processes in the systems and platforms based on microfluidic technology (Pamme, 2006, 2012). A magnetic field is a powerful tool to separate magnetic particles or magnetically labelled cells, antigens, and enzymes (Gijs, 2004; Pamme, 2006; Suwa and Watarai, 2011). Most magnetic separation methods are based on magnetophoresis, which manipulates magnetic particles in a viscous fluid by using magnetic forces. To generate the magnetic force, it requires both magnetic particles and a spatially non-uniform field (magnetic field gradient) (Pamme, 2006). There are two different types of magnetophoresis: one is called negative magnetophoresis – manipulating diamagnetic particles in a magnetic fluid such as ferrofluids (Bucak et al., 2011; Winkleman et al., 2007; Zhou et al., 2016; Zhou and Xuan, 2016); the other one is called positive magnetophoresis – separating paramagnetic or ferromagnetic particles in a non-magnetic fluid such as water (Chen et al., 2015; Zborowski et al., 1999).
In contrast to conventional magnetophoresis, several recent experimental and theoretical studies (Matsunaga et al., 2017a,b; Zhou et al., 2017a,b) have demonstrated a different way to manipulate magnetic non-spherical particles by a uniform magnetic field in the microchannel. The uniform magnetic field does not generate a magnetic force, but instead generates non-zero magnetic torques due to the non-spherical particle shape. When coupled with particle-wall hydrodynamic interaction (Gavze and Shapiro, 1997; Leal, 1980), the uniform magnetic field alters the rotational dynamics of non-spherical particles, and
consequently controls the lateral migration of particles. Experiments preformed by Zhou et al. (Zhou *et al.*, 2017a,b) have demonstrated that a weak uniform magnetic field can separate paramagnetic particles in a microchannel pressure-driven flow. The magnetic torque broke the symmetry of the particle rotation. Due to the particle-wall hydrodynamic interaction, the particles migrated laterally towards or away from the wall depending on the direction of magnetic field. Matsunaga et al. (Matsunaga *et al.*, 2017a,b) proposed a far-field theory and used the boundary element method to demonstrate that a strong uniform magnetic field can separate the ferromagnetic particles in both simple shear flow near the wall and Poiseuille flow between two walls. In this method, ferromagnetic particles are pinned at steady angles and the lateral migration results from particle-wall hydrodynamic interactions as well.
Due to its importance to science and engineering, the dynamics of non-spherical particles in flows have been a subject of extensive theoretical, numerical and experimental investigations. For example, the pioneering work includes Jeffery’s theory (Jeffery, 1922) and experimental studies by Mason’s group (Goldsmith and Mason, 1961; Trevelyan and Mason, 1951). With the advancement of computing capabilities, numerical simulations have been increasingly employed to study the motion of both spherical and non-spherical particles in a variety of shear flows, including plane Couette and Poiseuille flows. Feng et al. (Feng *et al.*, 1994) reported a direction numerical simulation (DNS) based on the finite element method (FEM) to study the lateral migration of the neutrally and non-neutrally buoyant circular particle in plane Couette and Poiseuille flows. The simulation results agree qualitatively with the results of perturbation theories and experimental data. Gavze and Shapiro (Gavze and Shapiro, 1997) used a boundary integral equation method to investigate the effect of particle shape on forces and velocities acting on the particle near the wall in a shear flow. Pan’s group proposed a distributed Lagrange-multiplier-based fictitious domain method (DLM) to investigate the motion of multiple neutrally buoyant circular cylinders and elliptical cylinders in shear flow (Huang *et al.*, 2015; Pan *et al.*, 2013) and plane Poiseuille flow (Chen *et al.*, 2012; Pan and Glowinski, 2002). Yang et al. (Yang
reported two methods, the arbitrary Lagrangian-Eulerian (ALE) method and the distributed Lagrange-multiplier-based fictitious domain method (DLM), to study the migration of a single neutrally buoyant rigid sphere in tube Poiseuille flow. Ai et al. (Ai et al., 2009b) investigated some key factors on pressure-driven transport of particles in a symmetric converging-diverging microchannel by the ALE finite-element method. Lee et al. (Lee et al., 2009a,b) used the same method as Gavze and Shapiro (Gavze and Shapiro, 1997) to study the particle transport behaviour with different size, shape and material properties in the plane Couette flow.
In addition to a single magnetic particle, high density magnetic microparticles or nanoparticles immersed in non-magnetic fluid tend to form chains, clusters or columns under an external magnetic field. The suspension consisting of high density magnetic microparticles or nanoparticles is called as magnetorheological fluids (MRFs) (De Vicente et al., 2011). The MRFs are smart materials which show various rheological properties, such as yield stress and apparent viscosity. The values of these rheological properties are increased to several orders of magnitude under the appropriately applied magnetic field. Due to their remarkable properties and the quick response to the magnetic field, MRFs are the good candidates for a vast number of industrial and medical applications, such as magnetorheological rotor damper, brakes, clutches, valves and cancer therapeutic (Bica et al., 2013; Rabinow, 1948; Sheng et al., 1999). Recently, the experimental (Anupama et al., 2018; Bell et al., 2008, 2007; Bombard et al., 2014; de Vicente et al., 2010; Dong et al., 2015; Jiang et al., 2011; López-López et al., 2009, 2007; Morillas et al., 2015; Ngatu et al., 2008; Sedlacik et al., 2013) and theoretical (Bossis et al., 2015; De Vicente et al., 2009; Kuzhir et al., 2009) investigations reported that the MRFs with non-spherical particles have stronger magnetorheological properties and better sedimentation stability compared to those with spherical particles.
Furthermore, droplet microfluidics has emerged as a powerful technology on a lab-on-a-chip platform for high-throughput screening of chemical and biological assays (Du et al., 2016; Guo et al., 2012; Shembekar et al., 2016). Dispersed in a continuous phase, individual droplets often encapsulate chemical or biological samples (e.g., cells, DNA, proteins, and bacteria), serve as miniaturized reactors, and allow biological and chemical reactions inside individual micro-droplets (Shang et al., 2017). The large surface to volume ratio leads to significantly enhanced mass and heat transfer and bio-/chemical reactions. Moreover, the high-throughput nature enables a vast number of assays in parallel, thereby drastically improving accuracy of the results. Manipulation, e.g., sorting, of the droplets based on their contents or properties is often a critical step in the chemical or biological assay. Droplets can be sorted by passive or active methods. Passive methods are based on hydrodynamic features, such as geometry and fluid properties, to manipulate the droplets (Bowman et al., 2012; Hatch et al., 2013; Kadivar et al., 2013; Tan et al., 2004, 2008; Tan and Lee, 2005). For passive methods to be effective, a complex geometry is usually employed or a particular fluid such as viscoelastic fluid is used as a buffer, which places some limitations on lab-on-a-chip applications. Active methods employ external fields (Xi et al., 2017), such as electric (Agresti et al., 2010; Ahn et al., 2009, 2011, 2006; de Ruiter et al., 2014; Eastburn et al., 2015; Guo et al., 2010; Link et al., 2006; Niu et al., 2007; Rao et al., 2015a,b; Sciambi and Abate, 2014, 2015), acoustic (Lee et al., 2012; Leibacher et al., 2015; Li et al., 2013; Nam et al., 2012; Petersson et al., 2005; Schmid et al., 2014), or magnetic forces (Brouzes et al., 2015; Kim et al., 2014; Li et al., 2016; Lombardi and Dittrich, 2011; Nguyen et al., 2006; Surenjav et al., 2009; Teste et al., 2015; Zhang et al., 2011, 2009), to manipulate droplets. Among the various active methods, magnetic methods have several distinctive advantages such as low or no heat generation, simple implementation and contactless control, and thus, have received increasing attention over the last few years (Huang et al., 2017).
The objective of this doctoral research is to explore and investigate manipulation of microparticles and microdroplets in the microfluidics by using a uniform magnetic field. This approach will have many advantages over the traditional force-based techniques, including simple implementation, feasibility of scaling up, and large reach distance. Specifically, I develop direct numerical models and use experiments to understand the fundamental transport properties of particles and droplets, thus enabling novel applications, e.g., efficient magnetic separation methods, which can impact biomedical and bio-medicine technologies.
2. ORGANIZATION OF DISSERTATION
In this study, many technical developments have been achieved. Due to the page limit, only five major developments are presented in this dissertation. The first four papers are based on numerical simulations to investigate dynamics of magnetic microparticles, while the fifth paper is based on experimental method to study lateral migration of magnetic microdroplets. Specifically, Paper I focuses on rotational dynamics of elliptical particles in a simple shear flow. Paper II studies lateral migration of elliptical particles in a plane Poiseuille flow. Paper III compares translational and rotational dynamics of paramagnetic and ferromagnetic elliptical particles in both simple shear and pressure-driven flows. Paper IV investigates particle-particle interactions and relative motions of a pair of magnetic elliptical particles in a quiescent flow. Paper V proposes a novel method to magnetically separate magnetic droplets from non-magnetic droplets by using a uniform magnetic field.
All five papers share a same research topic: manipulation of microparticles and microdroplets by using a uniform magnetic field, while each of them has a different focus.
Paper I presents direct numerical simulation to investigate the rotational dynamics of elliptical particles in a simple shear flow under the uniform magnetic field. The present of magnetic field breaks the symmetry of particle rotation and alters the period of rotation. The effects of direction and strength of magnetic field, and aspect ratio of particle on particle rotation are numerically investigated.
Based on findings in Paper I, the lateral migration of elliptical paramagnetic particles in a plane Poiseuille flow is investigated in Paper II. The particle shown to exhibit negligible lateral migration in the absence of a magnetic field. When the magnetic field is applied, the particle migrates laterally. The effects of direction and strength of magnetic field on the direction and velocity of particle lateral migration are numerically studied. By investigating a wide range of parameters, our direct numerical simulations yield a comprehensive
understanding of the particle migration mechanism. An empirical scaling relationship is proposed to relate the lateral migration distance to the asymmetry of the rotational velocity and lateral oscillation amplitude.
Paper III compares the rotational dynamics of paramagnetic and ferromagnetic elliptical particles in a simple shear flow. The results shown that paramagnetic and ferromagnetic particles exhibit markedly different rotational dynamics under a uniform magnetic field, which are in good agreement with theoretical predication. The numerical investigation further reveals drastically different lateral migration behaviors of paramagnetic and ferromagnetic particles in a wall bounded simple shear flow under a uniform magnetic field. These two kinds of particles can thus be separated by combining a shear flow and a uniform magnetic field. We also study the lateral migration of paramagnetic and ferromagnetic particles in a pressure-driven flow (a more practical flow configuration in microfluidics), and observe similar lateral migration behaviors. These findings demonstrate a simple but useful way to manipulate non-spherical microparticles in microfluidic devices.
To understand the fundamental mechanism of particle-particle interactions of a pair of magnetic non-spherical particles, Paper IV proposes a fluid-structure interaction model with a full consideration of particle-fluid-magnetic field interaction. The results show that the particles spend much more time for the global reorientation than for the local magneto-orientation. The effects of initial particle position and aspect ratio on relative motion of particles are numerically investigated. The particle-particle interactions and relative motions of a pair of elliptical particles in this study provide insights on the particle alignment and chaining processes under uniform magnetic fields, which are closely related to the response of magneto-rheological fluids to magnetic fields.
In addition to numerical works, a simple and effective mechanism that can achieve the separation of magnetic droplets in microfluidic flow under a uniform magnetic field is demonstrated. In this method, the combination of the uniform magnetic field and the
pressure-driven flow in a microchannel lends to the lateral migration of magnetic droplets. Using high-speed imaging and numerical methods, the effects of magnetic field strength and direction, and interfacial tension on the lateral migration of droplets are investigated.
I. STUDY OF ROTATION OF ELLIPSOIDAL PARTICLES IN COMBINED SIMPLE SHEAR FLOW AND MAGNETIC FIELDS
Jie Zhang, Cheng Wang
Department of Mechanical & Aerospace Engineering
Missouri University of Science and Technology
Rolla, Missouri 65409
Tel: 573–341–4636, Fax: 573–341–4607
Email: [email protected]
ABSTRACT
Jeffery’s theory describes the periodic rotation of ellipsoidal particles in a simple shear flow at vanishing Reynolds number limit. In this paper, we present direct numerical simulations, implemented by using the arbitrary Lagrangian-Eulerian (ALE) method, to study the motion of ellipsoidal paramagnetic particles in a simple shear flow subjected to a uniform magnetic field. We investigated the effect of several parameters, including magnetic field strength, direction of magnetic field, and particle aspect ratio, on rotation period and asymmetry of particle rotation. Without a magnetic field, the simulation results are in good agreement with Jeffery’s theory. When a magnetic field is applied perpendicular to the flow direction, the rotational period became longer, and the magnetic field breaks the symmetry of rotational motion of the ellipsoidal particle. As the magnetic field strength increases...
to a large enough value, the particle could not perform a complete rotation and reaches a steady angle. With other different directions of the magnetic field, the period of rotation and asymmetry of the angular dynamics is also modified.
**Keywords:** microfluidics; magnetic field; microparticle; Jeffory orbits
1. INTRODUCTION
Non-spherical microparticles are widely encountered in industrial, environmental and biological fluids: for example wood fibers in the paper-making industry (Alava and Niskanen, 2006), suspensions in complex fluids (Larson, 1999), and various micron-sized biological objects (Young, 2006). In biology and bioengineering, shape is one of the most important physical attributes of biological relevant particles (Mitragotri and Lahann, 2009; Young, 2006). It plays an important role in various applications of biomedicine and biology, such as diagnosis of diseases (Anstey et al., 2009), drug delivery (Champion et al., 2007) and cell synchronization (Valero et al., 2011). Because biological particles are often suspended in fluid environments, it is critical to understand the fundamental transport behaviors of non-spherical particles suspended in fluids. Over the last few decades there have been comprehensive theoretical and experimental investigations about the motion of ellipsoidal particle in a simple shear flow (Jeffery, 1922; Leal, 1980; Saffman, 1956; Taylor, 1923).
Jeffery firstly studies the motion of ellipsoidal particle immersed in a simple shear viscous flow (Jeffery, 1922). The periodic motion of particle is so called Jeffery orbits. The rotation period of a prolate spheroid with an aspect ratio $AR$ (major semi-axis length/minor semi-axis length) in a simple shear flow $\mathbf{U} = (\dot{\gamma} y, 0, 0)$ is given by
$$T = \frac{2\pi}{\dot{\gamma}(AR + 1/AR)}.$$
The angle between the particle’s major axis and the z-axis, $\theta$, and the angle between the y-axis and xy-projection of the particle axis, $\phi$, are shown in Figure 1, which are given by
$$\tan \theta = \frac{C \cdot AR}{\sqrt{AR^2 \cos^2 \phi + \sin^2 \phi}},$$
$$\tan \phi = AR \tan (2\pi \frac{t}{T}).$$
where $C$ is the orbit constant determined by the initial orientation of the particle. For $C = \infty$ ($\theta = 90^\circ$), the particle just rotates in xy-plane, which means that $\phi$ only depends on the particle aspect ratio and the flow shear rate.
**Figure 1.** Schematic of an ellipsoidal particle in a simple shear flow.
In this paper, a 2D fluid-structure interaction (FSI) model is created to study the effect of magnetic field and particle aspect ratio on the period of rotation and symmetry of ellipsoidal paramagnetic particles. The paper is organized as follows. In Section 2, the simulation method, including mathematical model, COMSOL setting and material properties, is presented. In Section 3, we first compare the rotational period obtained from the simulation to Jeffery’s theory. Then we present the results and discussion about the effect of the strength and direction of magnetic field and particle aspect ratio on particle. In Section 4, the main conclusions of this study are summarized.
2. SIMULATION METHOD
2.1. MATHEMATICAL MODEL
We consider an ellipsoidal particle immersed in a simple shear viscous flow in a Newtonian fluid with density $\rho_f$ and dynamic viscosity $\eta_f$ as shown in Figure 2. The center of the particle, coinciding with the origin of Cartesian coordinate system, is located in the center of a square computational domain. The particle aspect ratio is $AR = a/b$, where $a$ and $b$ are the major and minor semi-axis lengths of particles, respectively. The length of the computational domain is $L$. The rotation angle of particle is defined as $\phi$ between the major axis of the particle and $y$ axis. The shear flow is $u = \dot{\gamma} y$, where $\dot{\gamma}$ is the shear rate of flow. A uniform magnetic field, $\mathbf{H}_0$, is imposed at an arbitrary direction, denoted by $\alpha$.
Figure 2. An ellipsoidal particle suspended in a simple shear flow and under a magnetic field $\mathbf{H}_0$, which is directed at an angle $\alpha$.
The Jeffery orbits are obtained with the assumption of Stokes flow, i.e., zero Reynolds number and no fluid inertia. Therefore, the flow field, \( \mathbf{u} \), is governed by the continuity equation and Stokes equation:
\[
\nabla \cdot \mathbf{u} = 0; \tag{1}
\]
\[
\rho_p \frac{\partial \mathbf{u}}{\partial t} = \nabla \cdot [-p \mathbf{I} + \eta_f (\nabla \mathbf{u} + (\nabla \mathbf{u})^T)], \tag{2}
\]
where \( p \) is the pressure. To have a simple shear flow, the velocities of top and bottom walls are set to have the same magnitude but opposite directions. The periodic flow conditions are set to the left and right boundaries of the computational domain. No-slip condition is set on the particle surface, so the fluid velocities on the particle surface are given as:
\[
\mathbf{u} = \mathbf{U}_p + \omega_p \times (\mathbf{x}_s - \mathbf{x}_p), \tag{3}
\]
where \( \mathbf{U}_p \) and \( \omega_p \) are the translational and rotational velocities of particle, respectively. \( \mathbf{x}_s \) and \( \mathbf{x}_p \) are the position vectors of the surface and the center of the particle. The hydrodynamic force and torque acting on the particle are expressed as:
\[
\mathbf{F}_H = \int (\tau_H \cdot \mathbf{n}) dS, \tag{4}
\]
\[
\mathbf{T}_H = \int [\tau_H \times (\mathbf{x}_s - \mathbf{x}_p) \cdot \mathbf{n}] dS, \tag{5}
\]
where
\[
\tau_H = -p \mathbf{I} + \eta_f (\nabla \mathbf{u} + (\nabla \mathbf{u})^T)
\]
is the hydrodynamic stress tensor on the surface of particle.
The governing equations of the uniform magnetic field are given as:
\[
\mathbf{H} = -\nabla V_m, \tag{6}
\]
where $V_m$ is the magnetic potential. The magnetic potential difference to generate the magnetic field is set on the top and bottom wall. Magnetic insulation boundary condition is applied on the left and the right boundaries of the computational domain. Since the magnetic field is uniform, the force acting on the particle is zero. The magnetic torque acting on particle is expressed as:
$$T_m = \mu_0 V_p \chi_p H^- \times H,$$
where $H^-$ and $H$ are the magnetic fields inside and outside the particle, respectively. $\chi_p$ is the magnetic susceptibility of the particle, $\mu_0$ is the magnetic permeability of the vacuum, and $V_p$ is the volume of particle. The translation and rotation of particle are governed by Newton’s second law and Euler’s equation:
$$m_p \frac{dU_p}{dt} = F_h,$$
$$I_p \frac{d\omega_p}{dt} = T_h + T_m,$$
where $m_p$ and $I_p$ are the mass and the moment of inertia of the particle. The angular velocity of particle $\omega_p = \omega_h + \omega_m$ is the angular velocity produced by hydrodynamic torque and $\omega_m$ is the angular velocity produced by magnetic torque. At each time step, the position of center $C_p(t) = (X_p, Y_p)$ and orientation $\phi_p(t) = \phi(t)$ of the particle are expressed as:
$$C_p(t) = C_p(0) + \int_0^t U_p(s) ds,$$
$$\phi_p(t) = \phi_p(0) + \int_0^t \omega_p(s) ds,$$
where $C_p(0)$ and $\phi_p(0)$ are the initial position and orientation of the particle.
2.2. COMOL SETTINGS
To calculate the magnetic torque acting on the particle, the magnetic field around the ellipsoidal particle is first computed by the AC/DC module in COMSOL Multiphysics software. Figure 3 shows the magnetic field around the particle in the computational domain under the magnetic field of $H_0 = 3000$ A/m, directed at $\alpha = 0^\circ$. Stationary Solver with Parametric Sweep analysis are used to calculate the magnetic field inside and outside of the particle at different rotation angle $\phi$. Due to the symmetry of ellipsoidal particle, the simulation was conducted at $\phi$ from $-90^\circ$ to $90^\circ$ with an angle step of $1^\circ$.
Creeping Flow component is used to compute the flow field around the ellipsoidal particle. The top and bottom walls are set as moving wall condition with velocities at 1.5 mm/s and -1.5 mm/s respectively. Hence, the corresponding shear rate is $200 \text{ s}^{-1}$. The
left and right boundaries are set as periodic flow conditions with zero pressure difference. No-slip boundary condition is set on the surface of particle, so the particle wall is set as a moving wall with fluid velocity of $u$ as defined in Equation 3.
The translational and rotational motion of the particle is determined by solving ordinary differential equations (ODEs) in Global ODEs and DAEs component. Equation 9-12 are used in Global Equations to calculate translational and rotational velocities, and the position and orientation of the particle at each time step.
Moving Mesh component is used to describe the deforming mesh at the particle-fluid boundaries. Automatic Remeshing is enabled to re-initialize the mesh when the mesh quality below a threshold value, in this case, 0.2.
2.3. MATERIAL PROPERTIES
In this study, the fluid and particles in the simulations are water and polystyrene particles respectively. The density and dynamic viscosity of water are $1000 \text{ kg/m}^3$ and $1.002 \times 10^{-3} \text{ Pa·s}$ respectively. The magnetic susceptibilities of fluid and particle are 0 and 0.26 respectively. The density of particle is $1100 \text{ kg/m}^3$. The particles used in the simulation have varying aspect ratios, but have the same volume, which is equivalent to a 7 $\mu\text{m}$-diameter sphere.
3. RESULTS AND DISCUSSION
3.1. VALIDATION OF NUMERICAL METHOD
We first compare the results of our simulation to Jeffery’s theory. Figure 5 shows the period of rotation of Jeffery’s theory and our simulation for particle aspect ratio $AR = 4$ without an applied magnetic field. The theoretical period of Jeffery orbit is 0.06675 s; the period in this simulation is 0.0670 s. The relative error is 0.37%, suggesting that
Figure 6. The effect of magnetic field strength $H_0$ (A/m) on the rotation period and asymmetry of the particle rotation. The magnetic field is applied at angle strength ($\alpha = 0^\circ$).
this simulation has a remarkable agreement with the theory. Therefore, this simulation method has been validated to be sufficiently accurate to study the periodic rotation of particle immersed in the simple shear flow.
3.2. THE EFFECT OF MAGNETIC FIELD STRENGTH
In this section, we investigate the effect of magnetic field strength on the period and asymmetry of rotation of particle for aspect ratio $AR = 4$. Figure 6a shows that the angle of rotation, $\phi$, corresponding to rotation time, $t$, with different magnetic field strength at the direction $\alpha = 0^\circ$. It is shown that the rotation period increases with increasing magnetic field strength. Interestingly, as the magnetic field strength increases to a large enough value, the particle could not perform a complete rotation and reaches a steady angle. In this case, when the magnetic field strength is 5000 A/m, the rotation angle stays at $63.28^\circ$. Figure 6b shows that the angle of rotation, $\phi$, corresponding to the dimensionless rotation time, $t/T$, with different magnetic field strength at the direction $\alpha = 0^\circ$, where $T$ is the rotation period obtained in Figure 6a. We defined a ratio parameter $\tau = T_1/T$ to characterize the symmetry and asymmetry of particle rotation as shown in Figure 6b, where $T_1$ is the time the particle rotating from $\phi = 0^\circ$ to $\phi = 90^\circ$. So the time the particle rotation from $\phi = 90^\circ$
to $\phi = 180^\circ$, $T_2 = T - T_1$. When magnetic field strength is 0 A/m, the curve is axisymmetric to $(t/T, \phi) = (0.5, 90^\circ)$, where $\tau = 0.5$. It is consistent with Jeffery’s theory. However, when magnetic field strength is 1000 A/m, the symmetry is broken, and $\tau > 0.5$. As the magnetic field strength increases, $\tau$ become larger and larger, which means the asymmetry of rotation becomes more pronounced.
Figure 7. Illustration of particle rotation in the combined flow and magnetic fields.
The rotation behavior of the particle during one period in the combined flow and magnetic fields at $\alpha = 0^\circ$ is illustrated in Figure 7a. Without the magnetic field applied, only the hydrodynamic torque acts on the particle and rotates in the clockwise direction. When the magnetic field is applied at $\alpha = 0^\circ$, the angular velocity produced by magnetic torque, $\omega_m$, rotates in counterclockwise direction from $\phi = 0^\circ$ to $\phi = 90^\circ$, which is the opposite to the angular velocity produced by hydrodynamic torque, $\omega_h$; while $\omega_m$ rotates in clockwise direction from $\phi = 90^\circ$ to $\phi = 180^\circ$, which is the same as $\omega_h$. Therefore, the particle will rotate slower, and spend more time from $\phi = 0^\circ$ to $\phi = 90^\circ$, while less time from $\phi = 90^\circ$ to $\phi = 180^\circ$, that is, $T_1 > T_2$. That is the reason why $\tau > 0.5$ when a magnetic field is applied. The larger the magnetic field strength, the larger $\tau$. When the magnetic field strength increases to a large enough value, $\omega_m$ will be equal to $\omega_h$ in a certain angle between $\phi = 0^\circ$ and $\phi = 90^\circ$ and the particle will stop rotating. For magnetic field directed at other directions, the effect is illustrated in Figure 7b-d, and will be discussed further in the next section.
3.3. THE EFFECT OF THE DIRECTION OF MAGNETIC FIELD
In this section, the effect of the direction of magnetic field on the period and asymmetry of rotation of particle for aspect ratio $AR = 4$ is investigated. Figure 8a shows that the angle of rotation corresponding to rotation time with different direction of magnetic field at strength $H_0 = 2000$ A/m. The results show that the period of rotation at $\alpha = 45^\circ$ become longer than the period at $\alpha = 0^\circ$, while the period of rotation at $\alpha = 135^\circ$ become shorter than the period at $\alpha = 0^\circ$. The periods of rotation are almost the same at $\alpha = 90^\circ$ and $\alpha = 0^\circ$. The angle of rotation corresponding to the dimensionless time with different direction of magnetic field at strength $H_0 = 2000$ A/m is shown in Figure 8b. As we can see, $\tau > 0.5$ when $\alpha = 0^\circ$, while $\tau < 0.5$ when $\alpha = 90^\circ$. $\tau = 0.5$ when $\alpha = 45^\circ$ and $135^\circ$. The rotation behaviors of one period in the combined flow and magnetic fields at the different direction are shown in Figure 7. As we discussed before, the particle spend more time from
Figure 8. The effect of the direction of magnetic field at a fixed strength ($H_0 = 2000$ A/m) on the rotational period and asymmetry of particle rotation.
$\phi = 0^\circ$ to $\phi = 90^\circ$, while less time from $\phi = 90^\circ$ to $\phi = 180^\circ$ at $\alpha = 0^\circ$. For $\alpha = 90^\circ$, $\omega_m$ and $\omega_h$ have the same direction from $\phi = 0^\circ$ to $\phi = 90^\circ$, while have the opposite direction from $\phi = 90^\circ$ to $\phi = 180^\circ$ shown in Figure 7b. It means that the particle spends less time from $\phi = 0^\circ$ to $\phi = 90^\circ$, while more time from $\phi = 90^\circ$ to $\phi = 180^\circ$ at $\alpha = 0^\circ$, that is, $T_1 < T_2$ and $\tau < 0.5$. For $\alpha = 45^\circ$, $\omega_m$ and $\omega_h$ have the same direction from $\phi = 0^\circ$ to $\phi = 45^\circ$ and $\phi = 135^\circ$ to $\phi = 180^\circ$, while have the opposite direction from $\phi = 45^\circ$ to $\phi = 135^\circ$ shown in Figure 7c. Due the symmetry of flow field and particle, the time spending from $\phi = 0^\circ$ to $\phi = 45^\circ$ and $\phi = 135^\circ$ to $\phi = 180^\circ$ are equal. At the same time, the time spending from $\phi = 45^\circ$ to $\phi = 90^\circ$ and $\phi = 90^\circ$ to $\phi = 135^\circ$ are equal. So $T_1 = T_2$ and $\tau = 0.5$. The similar reason can explain the rotation behavior at $\alpha = 135^\circ$ shown in Figure 7d.
3.4. THE EFFECT OF PARTICLE ASPECT RATIO
In this section, we study the effect of particle aspect ratio on the period and asymmetry of rotation of particle. Figure 9a shows that the angle of rotation corresponding to rotation time with different particle aspect ratio at $H_0 = 2000$ A/m and $\alpha = 0^\circ$. As particle aspect ratio increases, the period of rotation increases, agreeing well with the trend predicted by Jeffery’s theory. Figure 9b shows the angle of rotation corresponding to the dimensionless
Figure 9. The effect of particle aspect ratio on the rotational period and asymmetry of particle rotation at \((H_0 = 2000\text{A/m}, \alpha = 0^\circ)\).
time with different particle aspect ratio at \(H_0 = 2000\text{ A/m}\) and \(\alpha = 0^\circ\). It is shown that \(\tau\) is always larger than 0.5 for different particle aspect ratio, which is consistent with what we discussed before. When aspect ratio increases, there is a slight increase for \(\tau\), which means that particle aspect ratio has only a marginal effect on the asymmetry of rotation of particle.
4. CONCLUSIONS
The motion of ellipsoidal particles in a simple shear flow subjected to a uniform magnetic field is numerically investigated by a multiphysics model that couples magnetic field, flow field and rigid body motions. The magnetic field strength has a significant effect on the period and asymmetry of rotation of particle. As the magnetic field strength increases, the rotation period of particle increases and the asymmetry of rotation becomes more pronounced. When the magnetic field strength increases to a large enough value, the particle could not perform a complete rotation and reaches a steady angle. Further, the direction of magnetic field modifies both the period and asymmetry of rotation of particle. Placed at \(45^\circ\), the direction of magnetic field shortens the period of rotation, while at \(135^\circ\) it increases the period. The symmetry of particle rotation is preserved for magnetic fields placed at \(45^\circ\) and \(135^\circ\). The magnetic field, when directed at \(0^\circ\) and \(90^\circ\), causes the asymmetry of rotation.
For particle aspect ratio, the results show that it changes the period of rotation of particle, which is consistent with Jeffery’s theory, but has a subtle effect on the asymmetry of particle rotation.
ACKNOWLEDGMENTS
The authors gratefully acknowledge the financial support from the Department of Mechanical and Aerospace Engineering at Missouri University of Science and Technology.
REFERENCES
Alava, M. and Niskanen, K., ‘The physics of paper,’ Reports on progress in physics, 2006, 69(3), p. 669.
Anstey, N. M., Russell, B., Yeo, T. W., and Price, R. N., ‘The pathophysiology of vivax malaria,’ Trends in parasitology, 2009, 25(5), pp. 220–227.
Champion, J. A., Katare, Y. K., and Mitragotri, S., ‘Particle shape: a new design parameter for micro-and nanoscale drug delivery carriers,’ Journal of controlled release, 2007, 121(1-2), pp. 3–9.
Jeffery, G. B., ‘The motion of ellipsoidal particles immersed in a viscous fluid,’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1922, 102(715), pp. 161–179.
Larson, R. G., The structure and rheology of complex fluids, volume 150, Oxford university press New York, 1999.
Leal, L., ‘Particle motions in a viscous fluid,’ Annual Review of Fluid Mechanics, 1980, 12(1), pp. 435–476.
Mitragotri, S. and Lahann, J., ‘Physical approaches to biomaterial design,’ Nature materials, 2009, 8(1), p. 15.
Saffman, P., ‘On the motion of small spheroidal particles in a viscous liquid,’ Journal of Fluid Mechanics, 1956, 1(5), pp. 540–553.
Taylor, G. I., ‘The motion of ellipsoidal particles in a viscous fluid,’ Proceedings of the Royal Society of London. Series A, Containing Papers of a Mathematical and Physical Character, 1923, 103(720), pp. 58–61.
Valero, A., Braschler, T., Rauch, A., Demierre, N., Barral, Y., and Renaud, P., ‘Tracking and synchronization of the yeast cell cycle using dielectrophoretic opacity,’ Lab on a Chip, 2011, **11**(10), pp. 1754–1760.
Young, K. D., ‘The selective value of bacterial shape,’ Microbiol. Mol. Biol. Rev., 2006, **70**(3), pp. 660–703.
II. NUMERICAL STUDY OF LATERAL MIGRATION OF ELLIPTICAL MAGNETIC MICROPARTICLES IN MICROCHANNELS IN UNIFORM MAGNETIC FIELDS
Jie Zhang, Cheng Wang
Department of Mechanical & Aerospace Engineering
Missouri University of Science and Technology
Rolla, Missouri 65409
Tel: 573–341–4636, Fax: 573–341–4607
Email: [email protected]
ABSTRACT
This work reports numerical investigation of lateral migration of a paramagnetic microparticle of an elliptic shape in a plane Poiseuille flow of a Newtonian fluid under a uniform magnetic field by direct numerical simulation (DNS). A finite element method (FEM) based on the arbitrary Lagrangian-Eulerian (ALE) approach is used to study the effects of strength and direction of the magnetic field, particle-wall separation distance and particle shape on the lateral migration. The particle is shown to exhibit negligible lateral migration in the absence of a magnetic field. When the magnetic field is applied, the particle migrates laterally. The migration direction depends on the direction of the external magnetic field, which controls the symmetry property of the particle rotational velocity. The magnitude of net lateral migration velocity over a $\pi$ cycle is increased with the magnetic field strength when the particle is able to execute complete rotations, expect for $\alpha = 45^\circ$ and $135^\circ$. By investigating a wide range of parameters, our direct numerical simulations yield a comprehensive understanding of the particle migration mechanism. Based on the numerical data, an empirical scaling relationship is proposed to relate the lateral migration distance
to the asymmetry of the rotational velocity and lateral oscillation amplitude. The scaling relationship provides useful guidelines on design of devices to manipulate nonspherical micro-particles, which have important applications in lab-on-a-chip technology, biology and biomedical engineering.
**Keywords:** microparticles; magnetic field; direct numerical simulation; particle separation
1. INTRODUCTION
For decades, magnetic fields have been widely used to separate microscale and nanoscale magnetic particles suspended in fluids in various industrial, biological and biomedical applications, such as mineral purification (Yavuz et al., 2009), cell separation (Hejazian et al., 2015), and targeted drug delivery (Arruebo et al., 2007). The underlying principle in these applications is magnetophoresis – the motion of particles due to magnetic forces. The generation of magnetic forces requires both a magnetic particle and a spatially non-uniform magnetic field (or non-zero magnetic field gradients) (Pamme, 2006).
Recent experiments have demonstrated a non-conventional strategy to manipulate magnetic particles by combining a magnetic torque, non-spherical shapes and shear flows (Zhou et al., 2017a,b). Different from traditional techniques based on forces, this torque-based method only requires a uniform magnetic field. As a result, there is no magnetic force, and thus, the method may be better described as “force-free magnetophoresis”. Here, the lateral migration of non-spherical particles stems from the coupling of the magnetic field, flow field and particle-wall hydrodynamic interactions. While earlier experiments provide the first observations of this unique phenomenon, it remains difficult to conduct well-controlled experimental studies. On the other hand, numerical simulations are powerful tools to carry out systematic investigations to gain insights on various factors that influence the particle transport behaviours.
Due to its importance to science and engineering, the dynamics of non-spherical particles in flows have been a subject of extensive theoretical, numerical and experimental investigations. For example, the pioneering work includes Jeffery’s theory (Jeffery, 1922) and experimental studies by Mason’s group (Goldsmith and Mason, 1961; Trevelyan and Mason, 1951). With the advancement of computing capabilities, numerical simulations have been increasingly employed to study the motion of both spherical and non-spherical particles in a variety of shear flows, including plane Couette and Poiseuille flows. Feng et al. (Feng et al., 1994) reported a direction numerical simulation (DNS) based on the finite element method (FEM) to study the lateral migration of the neutrally and non-neutrally buoyant circular particle in plane Couette and Poiseuille flows. The simulation results agree qualitatively with the results of perturbation theories and experimental data. Gavze and Shapiro (Gavze and Shapiro, 1997) used a boundary integral equation method to investigate the effect of particle shape on forces and velocities acting on the particle near the wall in a shear flow. Pan’s group proposed a distributed Lagrange-multiplier-based fictitious domain method (DLM) to investigate the motion of multiple neutrally buoyant circular cylinders and elliptical cylinders in shear flow (Huang et al., 2015; Pan et al., 2013) and plane Poiseuille flow (Chen et al., 2012; Pan and Glowinski, 2002). Yang et al. (Yang et al., 2005) reported two methods, the arbitrary Lagrangian-Eulerian (ALE) method and the distributed Lagrange-multiplier-based fictitious domain method (DLM), to study the migration of a single neutrally buoyant rigid sphere in tube Poiseuille flow. Ai et al. (Ai et al., 2009b) investigated some key factors on pressure-driven transport of particles in a symmetric converging-diverging microchannel by the ALE finite-element method. Lee et al. (Lee et al., 2009a,b) used the same method as Gavze and Shapiro (Gavze and Shapiro, 1997) to study the particle transport behaviour with different size, shape and material properties in the plane Couette flow.
Motions of magnetic particles have been numerically investigated due to their close relevance to biomedical separations (Gijs et al., 2009) and magnetically assisted drug delivery (Martinez et al., 2013). Smistrup et al. (Smistrup et al., 2005) used numerical simulations to study magnetic separation of magnetic beads in the microchannel under the magnetic field of microfabricated electro-magnets. Their simulation results agree qualitatively with the experimental data. Sinha et al. (Sinha et al., 2007) numerically investigated the motion of magnetic microbeads in the microchannel under a non-uniform magnetic field. More recently, shape-dependent drag force and magnetization are exploited to separate non-magnetic particles and biological cells in a ferrofluid (Chen et al., 2017; Zhou and Xuan, 2016). In prior works, the particles are often treated as point masses while the effect of hydrodynamic interactions resulting from particle shape and finite size are not directly considered.
Our previous work focused experimentally on lateral migration when the particle is undergoing rotational motion (Zhou et al., 2017a,b). The work by Matsunaga et al. is mainly concerned lateral migration that occurred when particle is not rotating (Matsunaga et al., 2017a,b). The work by Cao et al. numerically studied the rotation and lateral migration of particles for both scenarios including weak and strong field strengths (Cao et al., 2018). The present work studies the effects of strength and direction of the magnetic field strength, initial particle position, particle aspect ratio, and particularly proposes a scaling relationship between the symmetry properties of the particle’s rotational velocity, and the magnitude of lateral oscillation in the absence of a magnetic field. By implementing an ALE method in the COMSOL FEM solver, our direct numerical simulations couple and simultaneously solve the flow field, magnetic field, and particle motions. The magnetic torque, hydrodynamic torque as well as hydrodynamic force are computed and used to determine the translational and rotational motions of the particle via Newton’s second law and Euler’s law. After validating the numerical model with Jeffery’s theory, systematic numerical simulations are
carried out to understand the roles of key factors, including the strength and direction of the magnetic field, particle aspect ratio, and initial particle-wall separation distance, on the lateral migration of the particle.
2. SIMULATION METHOD
2.1. MATHEMATICAL MODEL
We consider a prolate elliptical particle immersed in a plane Poiseuille flow of an incompressible Newtonian fluid with density $\rho_f$ and dynamic viscosity $\eta_f$ as shown in Figure 1. The computational domain, $\Omega$, is surrounded by the boundary, ABCD, and particle surface, $\Gamma$. The width and length of the computational domain are $W$ and $L$, respectively. The particle aspect ratio is $AR = a/b$, where $a$ and $b$ are the major and minor semi-axis lengths of the particle, respectively. The particle-wall separation distance, $y_p$, is defined as the vertical distance between the particle center and the $x$ axis. The orientation of the particle, $\phi$, is defined as the angle between the major axis of the particle and positive $y$ axis. A uniform magnetic field, $H_0$, is imposed at an arbitrary direction, denoted by $\alpha$, as shown in Figure 1.
The flow field, $u$, is governed by the continuity equation and Navier-Stokes (NS) equations for an incompressible and Newtonian flow:
$$\nabla \cdot u = 0,$$
$$\rho_f \left[ \frac{\partial u}{\partial t} + (u \cdot \nabla) u \right] = -\nabla p + \nabla \cdot \eta_f \left( \nabla u + (\nabla u)^T \right),$$
where $p$ is the pressure and $t$ is the time.
Figure 1. Schematic view of the numerical model of an elliptical particle suspended in a plane Poiseuille flow under the influence of a uniform magnetic field $H_0$. The fluid and particle domains are $\Omega$ and $\Gamma$, respectively. The orientation angle of the particle is denoted by $\phi$. The particle-wall separation distance is denoted by $y_p$.
To obtain a fully developed laminar flow profile, the laminar inflow is at the inlet AC. The zero normal pressure condition is set to the outlet BD. No-slip condition is applied on channel walls AB and CD. No-slip condition also applies on the particle surface, so the fluid velocities on the particle surface are given as:
$$\mathbf{u} = \mathbf{U}_p + \omega_p \times (\mathbf{x}_s - \mathbf{x}_p),$$
where $\mathbf{U}_p$ and $\omega_p$ are translational and rotational velocities of particle, respectively. $\mathbf{x}_s$ and $\mathbf{x}_p$ are the position vectors of the surface and the center of the particle. The hydrodynamic force and torque acting on the particle are expressed as:
$$\mathbf{F}_h = \int (\tau_h \cdot \mathbf{n}) dS,$$
$$\mathbf{T}_h = \int (\tau_h \times (\mathbf{x}_s - \mathbf{x}_p) \cdot \mathbf{n}) dS,$$
where $\tau_h = \eta_f (\nabla \mathbf{u} + (\nabla \mathbf{u})^T)$ is the hydrodynamic stress tensor.
The governing equations of the magnetic field are given as:
\[
\nabla \times \mathbf{H} = 0, \tag{6}
\]
\[
\nabla \cdot \mathbf{B} = 0, \tag{7}
\]
where \( \mathbf{H} \) and \( \mathbf{B} \) are the magnetic field strength and the magnetic flux density, respectively. To obtain a uniform magnetic field, the magnetic scalar potential difference is set to AB and CD. A zero magnetic potential \( V_m = 0 \) is set to AB and a magnetic potential \( V_m = V_{m0} \) is set to CD. The magnetic insulation condition is set at AC and BD. Since the magnetic field is uniform and the particle is paramagnetic, the force acting on the particle is zero. Assuming the magnetic particle is homogeneous, isotropic, and linearly magnetizable, the magnetic torque acting on particle is expressed as (Stratton, 2007):
\[
\mathbf{T}_m = \mu_0 V_p \chi_p \mathbf{H}^- \times \mathbf{H}_0, \tag{8}
\]
where \( \mathbf{H}^- \) and \( \mathbf{H}_0 \) are the magnetic fields inside and outside the particle, respectively, \( \chi_p \) is the magnetic susceptibility of the particle, \( \mu_0 \) is the magnetic permeability of the vacuum, and \( V_p \) is the volume of particle.
The translation and rotation of the particle are governed by Newton’s second law and Euler’s equation:
\[
m_p \frac{d\mathbf{U}_p}{dt} = \mathbf{F}_h, \tag{9}
\]
\[
I_p \frac{d\omega_p}{dt} = \mathbf{T}_h + \mathbf{T}_m, \tag{10}
\]
where \( m_p \) and \( I_p \) are the mass and the moment of inertia of the particle. Since the particle rotation is in the \( xy \) plane, only the \( z \)-component of \( \omega_p \), \( \mathbf{T}_h \) and \( \mathbf{T}_m \) are necessary to calculate the rotational velocity, and \( \omega_p = \omega_p \hat{k} \).
The position of center $C_p(t) = (x_p, y_p)$ and orientation $\phi_p$ of particle are given by:
$$C_p(t) = C_p(0) + \int_0^t U_p(s) ds,$$
$$\phi_p(t) = \phi_p(0) + \int_0^t \omega_p(s) ds,$$
where $C_p(0)$ and $\phi_p(0)$ are the initial position and orientation of the particle.
The position and orientation of the particle will affect the magnetic and flow fields around the particle, and successively alter the magnetic torque and hydrodynamic force and torque acting on the particle. Therefore, we use direct numerical simulation (DNS) based on the finite element method (FEM) and arbitrary Lagrangian-Eulerian (ALE) method to account such coupling among the particle, fluid flow, and magnetic fields. Similar method has been successfully achieved by Hu et al. (Hu et al., 2001) and Ai et al (Ai et al., 2009a,b; Ai and Qian, 2010; Ai et al., 2014). Numerical models are implemented by using a commercial FEM solver COMSOL Multiphysics. First, we use the stationary solver for parametric sweep analysis to simulate the magnetic field inside and outside of the particle, and calculate the magnetic torque acting on the particle. Then, a two-way coupling fluid-particle interaction model is solved by using a time-dependent solver, where the magnetic torque is imported into the model as a variable. Quadratic triangular elements are generated in the simulations. Fine mesh around the particle and finer mesh around the tip of the particle are created to accurately calculate the hydrodynamic force and torque acting on the particle.
### 2.2. MATERIAL PROPERTIES USED IN SIMULATIONS
In this study, the fluid and particles in the simulations are water and magnetite-doped polystyrene particle, respectively. The density and dynamic viscosity of water are $1000 \text{ kg/m}^3$ and $1.002 \times 10^{-3} \text{ Pa-s}$, respectively. The magnetic susceptibility of particle is $\chi_p = 0.26$ according to previous studies (Zhou et al., 2017a,b), whereas the fluid is a non-magnetic
fluid. The density of the particle is $1100 \text{ kg/m}^3$. The particles used in the simulation have varying aspect ratios, but all have the same volume, which is equal to the volume of a 7 $\mu\text{m}$-diameter circular particle. The width and length of the computational domain are $W = 800 \mu\text{m}$ and $L = 50 \mu\text{m}$, respectively. Inlet flow velocity is 2.5 mm/s, so Re = 0.125.
Table 1. Six meshes for grid independence analysis
| Mesh | Domain elements | Boundary elements on particle surface |
|------|-----------------|-------------------------------------|
| 1 | 6184 | 56 |
| 2 | 7794 | 68 |
| 3 | 8281 | 92 |
| 4 | 11608 | 116 |
| 5 | 12359 | 152 |
| 6 | 13079 | 184 |
2.3. GRID INDEPENDENCE ANALYSIS
Grid independence analysis is presented to determine the appropriate meshes for a fast and accurate numerical simulation. The results of six different meshes in a plane Poiseuille flow in the absence of the magnetic field are shown in Table 1 and Figure 2. As can be seen, the numerical results are good enough when the domain element number is larger than 11,600 and the boundary element number on the particle surface is larger than 120. So in the paper, we used about 12,000 elements in the computational domain $\Omega$ in Figure 1, and about 150 elements on the particle surface $\Gamma$, which could give reasonably accurate results.
Figure 2. Grid independence analysis: particle orientation as a function of time, for $AR = 4$, $y_{p0} = 12 \mu m$
3. RESULTS AND DISCUSSION
3.1. VALIDATION OF NUMERICAL METHOD
To validate our numerical method, we first compare the results of our simulation to Jeffery’s theory, which describes the periodic rotation of an axisymmetric ellipsoidal particle in a simple shear flow (Jeffery, 1922). The period of the particle rotating from $0^\circ$ to $360^\circ$ is $T^J = 2\pi / \dot{\gamma}(AR + 1/AR)$, where $\dot{\gamma}$ is the shear rate. Due to the fore-aft symmetry of the particle, here we define $T_0^J$ as the period of rotation from $0^\circ$ to $180^\circ$, i.e., $T_0^J = T^J / 2$. Figure 3 shows the particle rotation predicted by Jeffery’s theory and our simulation for a particle having $AR = 4$ in a simple shear flow with shear rate $\dot{\gamma} = 200 \text{ s}^{-1}$ in the absence of a magnetic field. The theoretical value of $T_0^J$ from the Jeffery theory is 0.0668 s, while the period obtained in our FEM simulation is 0.0670 s. The relative error is 0.37%, suggesting that the simulation has a remarkable agreement with the theory. Therefore, this simulation method has been validated to be sufficiently accurate to study the periodic rotation of particle in this work.
Figure 3. Comparison between the FEM simulation and Jeffery’s theory on particle rotation.
### 3.2. PARTICLE MOTION WITHOUT A MAGNETIC FIELD
In this section, we investigate the effect of particle aspect ratio, $AR$, and its initial particle-wall separation distance, $y_{p0}$, on particle motion without a magnetic field. Figure 4 shows the trajectory of an elliptical particle with $AR = 4$ initially located at $y_{p0} = 12 \mu m$. As can be seen, the particle oscillate away from the wall in the first half period (from $0^\circ$ to $90^\circ$) and towards the wall in the second half period (from $90^\circ$ to $180^\circ$), but there is a negligible net lateral migration. We define the difference between the maximum and minimum values of the oscillatory motion in the $y$ direction as the amplitude, $A$, as shown in Figure 4(a), and define the period as the time spent by the particle to rotate from $0^\circ$ to $180^\circ$, $T_0$, as shown in Figure 4(b).
The orientation of the particle, $\phi$, as a function of the dimensionless time, $t/T_0$, over a period is shown in Figure 4(c). As can be seen, the particle has a symmetry of rotation with respect to $\phi = 90^\circ$. The rotational velocity due to the shear flow is symmetric about $\phi = 90^\circ$.
as shown in Figure 4(d), meaning that the particle spends the same amount of time in the first and second half periods. The presence of the wall induces particle-wall hydrodynamic interaction which causes the oscillatory motion of the elliptical particle. However, due to the equal time the particle spends in the first and second half rotational period, the lateral distance of the particle moving upwards and moving downwards are equal. Thus, there is no net lateral migration.
Figure 4. Translation and rotation of the particle without a magnetic field. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \mu m$. (a) Trajectory of the particle over a rotation of $180^\circ$, with $A$ denoting the amplitude of oscillatory motion. (b) The particle-wall separation distance over one period $T_0$. (c) The evolution of orientation angle, $\phi$ with the dimensionless time $t/T_0$. (d) The rotational velocity $\omega_h$ versus $\phi$.
Figure 5. The effects of initial position $y_{p0}$ and particle aspect ratio $AR$ on transport of elliptical particles without a magnetic field. (a) The effect $y_{p0}$ on the lateral particle-wall separation: $y_{p0} = 12 \, \mu m$ (solid line), $14 \, \mu m$ (dash line) and $16 \, \mu m$ (dash-dot line). The particle has a particle aspect ratio $AR = 4$. (b) The effect of particle aspect ratio on the lateral particle-wall separation distance: $AR = 4$ (solid line), $AR = 3$ (dash line), and $AR = 2$ (dash-dot line). The particles are initially located at $y_{p0} = 12 \, \mu m$. (c) Dependence of amplitude of the oscillatory motion, $A$ on $y_{p0}$. (d) The dimensionless period $T_0/T_y^J$ varies with dimensionless distance $y_{p0}/a$, for $AR = 4$ (circle), 3 (triangle), and 2 (rectangle). $T_y^J$ is the period of Jeffery’s orbit calculated by using the shear rate at the position of the particle centroid.
The lateral migration of the elliptical particle for three initial particle-wall separation distances $y_{p0}$, and different aspect ratio $AR$, are shown in Figure 5(a)(b). In Figure 5(a), as $y_{p0}$ is increased from $12 \, \mu m$ to $16 \, \mu m$, the period of rotation becomes longer, and the amplitude $A$ becomes smaller for a fixed $AR$. As $AR$ is decreased from 4 to 2, the period of rotation becomes shorter, and the amplitude $A$ becomes smaller for a fixed $y_{p0}$ (Figure 5(b)). For example, at $y_{p0} = 12 \, \mu m$, the period of rotation $T_0 = 0.1295 \, s$ and the amplitude $A = 0.6547 \, \mu m$ for $AR = 4$; $T_0 = 0.0844 \, s$ and $A = 0.3137 \, \mu m$ for $AR = 3$; $T_0 = 0.0556 \, s$ and $A =$
0.0841 μm for AR = 2. Further, the net lateral migration is almost zero, regardless of its initial particle-wall separation distance and aspect ratio. It is consistent with our previous experimental observation (Zhou et al., 2017b).
The amplitude and period of the oscillatory motion for different yp0 and different AR are shown in Figure 5(c)(d). As can be seen, for a fixed AR, the curve becomes steeper when the particle approaches to the wall (i.e., yp0 is decreased). The slope of curve becomes larger when the particle shape becomes more non-spherical (AR is increased). Figure 5(d) shows the dimensionless period of rotation, T0/TyJ, varying with the dimensionless particle-wall separation distance, yp0/a. TyJ is the period of Jeffery’s orbit calculated by using the shear rate at the position of the particle centroid and a is the semi-major axis of the particle, respectively. As can be seen in Figure 5(d), the dimensionless time, T0/TyJ, is larger than 1 for the all results. As yp0/a is increased, T0/TyJ is decreased first and then is increased for a constant AR. Further, the decreasing rate in first part and the increasing rate in the second part of T0/TyJ become steeper as AR increases from 2 to 4.
The effect of yp0 and AR on A and T0J in Figure 5(c)(d) can be explained as follows. When the particle is transported in the channel flow, the wall induces particle-wall hydrodynamic interactions and increases resistance on the rotation of particle (Gavze and Shapiro, 1997; Hsu and Ganatos, 1994). The smaller the particle-wall separation (yp0 varying from 16 μm to 12 μm) is, the more prominent the particle-wall interaction is. The amplitude (A) thus increases with decreasing yp0 i.e., increased hydrodynamic interactions, as shown in Figure 5(c)). On the other hand, the particle aspect ratio represents the degree of deviation from the spherical particle. A larger particle aspect ratio induces more prominent particle-wall interaction than a spherical particle (AR = 1). The increasing resistance on the rotation of particle causes the particle spending longer time than that in the absence of the wall. Therefore, the particle-wall separation distance and particle aspect ratio are two important factors affecting the oscillatory motion of the particle in the microchannel.
3.3. PARTICLE MOTION IN A MAGNETIC FIELD
3.3.1. Magnetic Field at $\alpha = 0^\circ$. In this section, we investigate the effect of magnetic fields with the direction $\alpha = 0^\circ$ on the lateral migration of the particle. The particle with $AR = 4$ is initially placed at $y_{p0} = 12 \mu m$. The magnetic field of $H_0 = 3000 \text{ A/m}$ is imposed at the direction of $\alpha = 0^\circ$. Figure 6(a)(b) shows the particle orientation angle and the lateral migration as a function of time. For convenience of discussion, we define a dimensionless parameter, $\tau$, as the ratio of the time that the particle rotates from $0^\circ$ to $90^\circ$ to the entire period of the particle rotation as shown in Figure 6(a). Here, The period of particle rotation is defined the same as in Section 3.2. To distinguish the period of rotation from Section 3.2, we use $T$ as the period of rotation when the magnetic field is applied. As can be seen in Figure 6(a), when $H_0 = 0$, $\tau = 0.5$ and the curve is anti-symmetric to $(0.5, 90^\circ)$; when the magnetic field strength $H_0 = 3000 \text{ A/m}$, $\tau > 0.5$ and the curve is no longer anti-symmetric to $(0.5, 90^\circ)$. Thus, we can use the dimensionless parameter $\tau$ to characterize the symmetry and asymmetry property of the particle’s rotation. Second, we define the net lateral migration of the particle, $\Delta y_p$, as the difference between the position of particle centroid at $\phi = 0^\circ$ and at $\phi = 180^\circ$ in the $y$ direction as shown in Figure 6(b). As can be seen, when a magnetic field is applied at $\alpha = 0^\circ$, $\Delta y_p > 0$, meaning that the particle moves away from the channel wall over a period.
The influence of the perpendicular magnetic field can be explained as follows. In the absence of a magnetic field, the hydrodynamic torque causes the rotational motion of the particle. The corresponding rotational velocity is shown as the dashed line in Figure 6(c). As we discussed before, there is a negligible net migration due to the symmetry of the particle rotational velocity. When a magnetic field is applied at $\alpha = 0^\circ$, the total rotational velocity, $\omega_p = \omega_h + \omega_m$, is asymmetric with respect to $\phi = 90^\circ$, shown as the solid line in Figure 6(c). The rotational velocity due to the magnetic field, $\omega_m$, and the rotational velocity due to the hydrodynamic torque, $\omega_h$ have opposite directions when the particle orientation $\phi$ is between $0^\circ$ to $90^\circ$; $\omega_m$ and $\omega_h$ have the same direction when $90^\circ < \phi < 180^\circ$. As a result,
the particle spends more time in the first half period than in the second half period, causing the asymmetry of the particle rotational velocity. The asymmetric particle rotation further leads to a broken symmetry of the particle’s lateral oscillation motion, via hydrodynamic interactions (Gavze and Shapiro, 1997). Consequently, the particle spends more time moving upwards than moving downwards, and exhibits a net lateral migration away from the wall, as shown in Figure 6(b).
Figure 6. Transport of the particle when the magnetic field is applied perpendicular to the flow direction, i.e., $\alpha = 0^\circ$. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \mu m$. (a) The orientation angle, $\phi$ versus dimensionless time $t/T$. A dimensionless time parameter $\tau$ is defined as the ratio of the time for the particle rotating from $0^\circ$ to $90^\circ$ to the period of rotation, $T$. (b) The particle-wall separation distance, $y_{p0}$ as a function of time ($H_0 = 3000$ A/m, $\alpha = 0^\circ$). $\Delta y_p$ denotes the net lateral migration of the particle over one period. (c) The rotational velocity $\omega_p$ versus $\phi$: $H_0 = 0$ A/m (dash line), and 3000 A/m (solid line). The symmetry of particle rotational velocity $\omega_p$ about $\phi = 90^\circ$ is broken, and $\tau > 0.5$.
Figure 7. The effect of magnetic field strength on particle transport, with $AR = 4$, $y_{p0} = 12 \mu m$, and $\alpha = 0^\circ$. (a) $\phi$ versus time $t$ over a period: $H_0 = 0$ (plus symbol), 1000 A/m (solid line), 2000 A/m (dash line), 3000 A/m (dash-dot line) and 4000 A/m (dot line). (b) $\tau$ varies with the magnetic field strength $H_0$. (c) The net migration of particle $y_p - y_{p0}$ over a period: $H_0 = 0$ (solid symbol), 1000 A/m (circle symbol), 2000 A/m (square symbol), 3000 A/m (triangle symbol) and 4000 A/m (plus symbol). (d) The average vertical migration velocity $U_v$ varies with the magnetic field strength $H_0$.
We investigate the effect of the magnetic field strength on the particle rotation and lateral migration. Figure 7(a) shows the orientation of the particle, $\phi$, with time, $t$, in one period for different magnetic field strengths. As can be seen, when the magnetic field is applied, the period of rotation becomes longer as compared to that without a magnetic field ($H_0 = 0$). From Figure 7(a), we can see that the period of rotation, $T$, is increased as the magnetic field strength is increased from $H_0 = 1000$ A/m to 3000 A/m. In this case, there are two factors affecting the period of rotation. One is the magnetic field. In the simple shear flow, as the magnetic field strength is increased, the period of rotation is increased when $\alpha = 0^\circ$ (Zhang and Wang, 2017). The other factor is the decreased shear rate as the particle moved toward the center. The magnetic field caused that the particle migrated
toward the center, where the shear rate is decreased. Thus, the magnetic field coupled with the nonlinear shear rate induced the increase of period of the rotation. Figure 7(b) shows the dependence of dimensionless parameter, $\tau$, on the magnetic field strength. When the magnetic field strength is applied, $\tau > 0.5$, meaning that the symmetry of particle rotation is broken. As the magnetic field strength increases, $\tau$ increases, meaning that the asymmetry of the particle rotation becomes more pronounced. This asymmetry of particle rotation, combined with oscillatory motion, causes the net lateral migration. Figure 7(c) shows the net migration of particle, $\Delta y_p$, as a function of time, $t$, in one period for different magnetic field strengths. Because $\alpha = 0^\circ$, the particle moves upwards, and the net lateral migration, $\Delta y_p$, increases with the increase of the magnetic field strength.
To characterize the net lateral migration, we define an average vertical migration velocity, $U_v = \Delta y_p / T$, which is the net lateral migration over the rotational period of the particle. The average vertical velocity, $U_v$, for different magnetic field strengths are shown in Figure 7(d). As can be seen, the vertical velocity increases when the magnetic field strength increases from 0 to 3000 A/m. This means that the particle moves upwards faster as the magnetic field increases. Further, as can be seen in Figure 7(a) and (d), when the magnetic field strength is 4000 A/m, the particle could not perform a complete rotation but continuously moved upwards. The reason for the impeded rotation is because of the dynamic balances between the hydrodynamic and magnetic torques. Due to the parabolic velocity profile of the Poiseuille flow, the shear rate becomes smaller closer to the channel center. As a result, the particle orientation continuously decreases as the particle moves towards the channel center.
3.3.2. Magnetic Field at $\alpha = 90^\circ$. In this section, we investigate the effect of magnetic fields with the direction $\alpha = 90^\circ$ on the lateral migration of the elliptical particle. The particle with $AR = 4$ is initially located at $y_{p0} = 12 \mu m$. The magnetic field with a strength of 3000 A/m is imposed at the direction of $90^\circ$. The orientation and the lateral migration varying with time are shown in Figure 8. When the magnetic field is applied at
$\alpha = 90^\circ$, $\tau < 0.5$ and $\Delta y_p < 0$, as we can see in Figure 8(a) and (b). The reason can be similarly explained for the case of $\alpha = 0^\circ$. Here, the magnetic rotational velocity, $\omega_m$, and the hydrodynamic rotational velocity, $\omega_h$, have the same direction in the first half period and opposite directions in the second half period of rotation. The total rotational velocity, $\omega_p$, is asymmetric with respect to $\phi = 90^\circ$, shown as the solid line in Figure 8(c). The particle spends less time to move upwards in the first half period than the second half period. Therefore, the symmetry of the particle rotation is broken and there is a net lateral migration over one period.
Figure 8. Transport of the particle when the magnetic field is applied parallel to the flow direction, i.e., $\alpha = 90^\circ$. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \mu m$. (a) $\phi$ varies with dimensionless time $t/T$. (b) variation of the particle-wall separation distance with time, and (c) the total rotational velocity $\omega_p$ varies with $\phi$ for $H_0 = 0$ A/m (dash line) and 3000 A/m (solid line).
Figure 9. The effect of magnetic field strength on particle transport, with $AR = 4$, $y_{p0} = 12$ $\mu$m, and $\alpha = 90^\circ$. (a) $\phi$ versus $t$ over a period for $H_0 = 0$ (plus symbol), 1000 A/m (solid line), 2000 A/m (dash line), 3000 A/m (dash-dot) and 4000 A/m (dot); (b) $\tau$ versus $H_0$; (c) The lateral migration of particle $y_p - y_{p0}$ with time $t$ over a period for $H_0 = 0$ (solid line), 1000 A/m (circle symbol), 2000 A/m (square symbol), 3000 A/m (triangle symbol) and 4000 A/m (plus symbol); (d) The vertical velocity $U_v$ versus magnetic field strength $H_0$.
For different magnetic field strength, as the magnetic field strength increases, the period of rotation becomes longer as shown in Figure 9(a). It is the same as the case of $\alpha = 0^\circ$. When the magnetic field strength is 4000 A/m, the particle could not perform a complete rotation as well. The difference between cases of $\alpha = 0^\circ$ and $\alpha = 90^\circ$ is the impeded orientation: the maximum orientation is larger than $90^\circ$ when $\alpha = 90^\circ$, whereas the maximum orientation is smaller than $90^\circ$ when $\alpha = 0^\circ$. Figure 9(b) shows the variation of $\tau$ with different magnetic field strengths. As we can see, $\tau < 0.5$ and becomes smaller with an increase of the magnetic field strength, meaning the asymmetry of rotation becomes more pronounced. The lateral migration for different magnetic field strength, and the average vertical velocity, $U_v$, are shown in Figure 9(c) and (d), respectively. As the magnetic
field strength is increased, the particle moves downwards quicker. Interestingly, when the magnetic field strength is 4000 A/m, the rate of the lateral migration becomes slower than $H = 3000$ A/m as shown in the line with plus symbol in Figure 9(c).
Figure 10. Effect of the magnetic field when it is applied at $\alpha = 135^\circ$. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \mu m$. (a) $\omega_p$ versus $\phi$ for $H_0 = 0$ (dash) and 3000 A/m (solid). (b) $\phi$ versus $t$ over a period for $H_0 = 0$ (plus), 1000 A/m (solid), 2000 A/m (dash), 3000 A/m (dash-dot) and 4000 A/m (dot). (c) The dimensionless parameter $\tau$ as a function of $H_0$. (d) The migration of particle $y_p - y_{p0}$ with time $t$ over a period for $H_0 = 0$ (solid), 1000 A/m (circle), 2000 A/m (rectangle), 3000 A/m (triangle) and 4000 A/m (plus). (e) Dependence of lateral migration velocity $U_y$ on magnetic field strength $H_0$.
3.3.3. Magnetic Field at $\alpha = 135^\circ$. In this section, we investigate the effect of magnetic fields with $\alpha = 135^\circ$ on the lateral migration of the elliptical particle. When the magnetic field is imposed at $\alpha = 135^\circ$, the total rotational velocity, $\omega_p$, is symmetric to $\phi = 90^\circ$ as shown in Figure 10(a). For four different magnetic field strengths, the orientation varying with time is shown in Figure 10(b). As the magnetic field strength is increased, the period of rotation becomes shorter, which is different from the results when the magnetic field is imposed at $\alpha = 0^\circ$ and $90^\circ$. But the particle preserves the symmetry of rotational velocity as can be seen in Figure 10(c): $\tau \approx 0.5$ for these four magnetic field strengths. The lateral migration for different magnetic field strengths is shown in Figure 10(d). The oscillatory amplitude is decreased with increasing the magnetic field strength, which is different from the results when the magnetic field is imposed at $\alpha = 0^\circ$ and $90^\circ$. Such a decrease of oscillation is due to the decrease of the rotational velocity, and translation-and-rotation coupling. There is no net migration as can be seen in Figure 10(e). $U_v \approx 0$ for these four magnetic field strengths that have been investigated.
3.3.4. Magnetic Field at $\alpha = 45^\circ$. In this section, we investigate the effect of magnetic fields applied at $\alpha = 45^\circ$ on the lateral migration of the elliptical particle. When the magnetic field is imposed at $\alpha = 45^\circ$, the total rotational velocity, $\omega_p$, is symmetric to $\phi = 90^\circ$ as shown in Figure 11(a). When $H_0 = 1000$ A/m, $\tau \approx 0.5$ and $U_v \approx 0$, meaning that the particle’s rotation velocity is symmetric about $\phi = 90^\circ$ and there is no net lateral migration. However, when the magnetic field strength is equal or larger than 2000 A/m, the particle could not complete a full rotation, but continuously moves upwards as shown in Figure 11(b) and (c). The lateral motion is due to the particle being pinned at a steady angle (Matsunaga et al., 2017a). As the magnetic field strength is increased, the maximum orientation becomes smaller and the lateral migration becomes faster.
Figure 11. Effect of the magnetic field when it is applied at $\alpha = 45^\circ$. The particle ($AR = 4$) is initially located at $y_{p0} = 12 \, \mu\text{m}$. (a) The total rotational velocity $\omega_p$ versus $\phi$ for $H_0 = 0$ (dash) and 3000 A/m (solid). (b) $\phi$ versus time $t$ over a period for $H_0 = 0$ (plus), 1000 A/m (solid), 2000 A/m (dash), 3000 A/m (dash-dot) and 4000 A/m (dot). (c) The migration of particle $y_p - y_{p0}$ as a function of $t$ for $H_0 = 0$ (solid), 1000 A/m (circle), 2000 A/m (rectangle), 3000 A/m (triangle) and 4000 A/m (plus).
3.3.5. Effects of Particle Shape and the Wall. As we discussed in Section 3.2, the particle-wall separation distance and particle aspect ratio are two important factors on the oscillatory motion of the particle. In this section, we investigate the effect of these two factors on particle lateral migration with a magnetic field. Here, the magnetic field strength $H_0 = 2000 \, \text{A/m}$ is applied at $\alpha = 0^\circ$. The dimensionless parameter, $\tau$, and the average vertical velocity, $U_v$, for three different particle aspect ratios are shown in Figure 12(a1) and (a2). As the particle aspect ratio is increased, both $\tau$ and $U_v$ increase. The particle aspect ratio represents the degree of deviation from the spherical particle. As the particle shape deviates more from the spherical particle, the asymmetry of particle rotation
becomes more pronounced, and the particle moves up faster. Therefore, particle aspect ratio is an essential factor on particle lateral migration when a magnetic field is applied. Figure 12(b1) and (b2) show the results when the particle is released at different initial particle-wall separation distances. $\tau$ is increased but $U_v$ is decreased as $y_{p0}$ is increased from 10 $\mu$m to 16 $\mu$m. As the particle is at a larger distance away from the wall, the asymmetry of particle rotation becomes more pronounced. However, the particle moves up slower, due to the small amplitude $A$.
Figure 12. Dependence of (a1) $\tau$ and (a2) $U_v$ on particle aspect ratio $AR$, with the particle is initially located at $y_{p0} = 12 \mu$m. Dependence of (b1) $\tau$ and (b2) $U_v$ on initial particle-wall separation distances $y_{p0}$ when the particle aspect ratio is $AR = 4$. The magnetic field strength $H_0 = 2000$ A/m is applied at $\alpha = 0^\circ$.
3.4. LATERAL MIGRATION MECHANISM
From previous analysis, we can see that the net lateral migration of the particle depends on the lateral oscillation and the asymmetric rotation. The particle lateral oscillation depends on the particle shape (aspect ratio $AR$) and the proximity to the wall (initial particle-wall separation distance $y_p0$). The larger deviation from the spherical shape and the closer to the wall are, the more pronounced particle-wall hydrodynamic interaction is (Gavze and Shapiro, 1997). The degree of particle-wall hydrodynamic interaction is characterized by the amplitude $A$ for a fixed particle aspect ratio. The asymmetric rotation of the particle depends on the non-zero magnetic torque acting on the particle, which in turn depends on the field direction and magnitude. The direction of the magnetic field controls the nature of the asymmetry and thus the direction of the net lateral migration. When $\tau > 0.5$, the particle move upwards; when $\tau < 0.5$, the particle move downwards. The strength of the magnetic field controls the speed of the lateral migration. The more $\tau$ deviates from 0.5, the larger the migration speed is. In other words, the direction of the magnetic field determines whether $\tau - 0.5$ is positive or negative, and the strength of the magnetic field determines the absolute value of $\tau - 0.5$. Therefore, we use $(\tau - 0.5)$ to characterize the asymmetric rotation of the particle. Based on the above analysis, we propose a scaling relationship, $\Delta y_p \propto (\tau - 0.5)A$ for all particle aspect ratios investigated, $AR = 2, 3, 4$. As shown in Figure 13, the numerical results and the linear fitted curves are shown as symbols and lines respectively. The agreement between the fitted curves and numerical results confirms the scaling relationships. Our numerical results suggest that it is reasonably applicable when $|\tau - 0.5| < 0.2$ from Figure 13. However, due to the complex particle-wall hydrodynamic interactions, it is difficult to obtain a quantitative expression relating $\Delta y_p$ to $A$ and $(\tau - 0.5)$. In this work, the linear scaling is fitted very well when $|\tau - 0.5| < 0.2$, which can provide a useful guideline on the effective design for other researchers.
Figure 13. The scaling relationship between $\Delta y_p / A$ and $(\tau - 0.5)$ for $AR = 2(a), 3(b)$ and $4(c)$. The circle, square, triangle and star stands for numerical results of $y_{p0} = 10 \mu m, 12 \mu m, 14 \mu m$ and $16 \mu m$, respectively. The solid lines are the fitting results.
4. CONCLUSIONS
In this paper, we developed a multi-physics numerical model based on direct numerical simulations to investigate the lateral migration of a paramagnetic elliptical particle in a plane Poiseuille flow under a uniform magnetic field. When the magnetic field is absent, there is a negligible net lateral migration of the particle. When the magnetic field is present, the particle migrates laterally. The direction of the magnetic field controls the asymmetric rotation of the particle and the direction of the net lateral migration. The strength of the magnetic field controls the speed of the net lateral migration. We also investigated the effects of particle aspect ratio and initial particle-wall separation distance, on the lateral migration behaviors of the particles. Based on these findings, we explained the lateral migration
mechanism and proposed a scaling relationship which can provide a guideline on effective design of microfluidic devices to manipulate non-spherical micro-particles and biological cells.
ACKNOWLEDGMENTS
The authors gratefully acknowledge the financial support from the Department of Mechanical and Aerospace Engineering at Missouri University of Science and Technology.
REFERENCES
Ai, Y., Beskok, A., Gauthier, D. T., Joo, S. W., and Qian, S., ‘Dc electrokinetic transport of cylindrical cells in straight microchannels,’ Biomicrofluidics, 2009a, 3(4), p. 044110.
Ai, Y., Joo, S. W., Jiang, Y., Xuan, X., and Qian, S., ‘Pressure-driven transport of particles through a converging-diverging microchannel,’ Biomicrofluidics, 2009b, 3(2), p. 022404.
Ai, Y. and Qian, S., ‘Dc dielectrophoretic particle–particle interactions and their relative motions,’ Journal of colloid and interface science, 2010, 346(2), pp. 448–454.
Ai, Y., Zeng, Z., and Qian, S., ‘Direct numerical simulation of ac dielectrophoretic particle–particle interactive motions,’ Journal of colloid and interface science, 2014, 417, pp. 72–79.
Arruebo, M., Fernández-Pacheco, R., Ibarra, M. R., and Santamaría, J., ‘Magnetic nanoparticles for drug delivery,’ Nano today, 2007, 2(3), pp. 22–32.
Cao, Q., Li, Z., Wang, Z., and Han, X., ‘Rotational motion and lateral migration of an elliptical magnetic particle in a microchannel under a uniform magnetic field,’ Microfluidics and Nanofluidics, 2018, 22(1), p. 3.
Chen, Q., Li, D., Zielinski, J., Kozubowski, L., Lin, J., Wang, M., and Xuan, X., ‘Yeast cell fractionation by morphology in dilute ferrofluids,’ Biomicrofluidics, 2017, 11(6), p. 064102.
Chen, S.-D., Pan, T.-W., and Chang, C.-C., ‘The motion of a single and multiple neutrally buoyant elliptical cylinders in plane poiseuille flow,’ Physics of Fluids, 2012, 24(10), p. 103302.
Feng, J., Hu, H. H., and Joseph, D. D., ‘Direct simulation of initial value problems for the motion of solid bodies in a newtonian fluid. part 2. couette and poiseuille flows,’ Journal of fluid mechanics, 1994, 277, pp. 271–301.
Gavze, E. and Shapiro, M., ‘Particles in a shear flow near a solid wall: effect of nonsphericity on forces and velocities,’ International Journal of Multiphase Flow, 1997, **23**(1), pp. 155–182.
Gijs, M. A., Lacharme, F., and Lehmann, U., ‘Microfluidic applications of magnetic particles for biological analysis and catalysis,’ Chemical reviews, 2009, **110**(3), pp. 1518–1563.
Goldsmith, H. and Mason, S., ‘Axial migration of particles in poiseuille flow,’ Nature, 1961, **190**(4781), pp. 1095–1096.
Hejazian, M., Li, W., and Nguyen, N.-T., ‘Lab on a chip for continuous-flow magnetic cell separation,’ Lab on a Chip, 2015, **15**(4), pp. 959–970.
Hsu, R. and Ganatos, P., ‘Gravitational and zero-drag motion of a spheroid adjacent to an inclined plane at low reynolds number,’ Journal of Fluid Mechanics, 1994, **268**, pp. 267–292.
Hu, H. H., Patankar, N. A., and Zhu, M., ‘Direct numerical simulations of fluid–solid systems using the arbitrary lagrangian–eulerian technique,’ Journal of Computational Physics, 2001, **169**(2), pp. 427–462.
Huang, S.-L., Chen, S.-D., Pan, T.-W., Chang, C.-C., and Chu, C.-C., ‘The motion of a neutrally buoyant particle of an elliptic shape in two dimensional shear flow: A numerical study,’ Physics of Fluids, 2015, **27**(8), p. 083303.
Jeffery, G. B., ‘The motion of ellipsoidal particles immersed in a viscous fluid,’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1922, **102**(715), pp. 161–179.
Lee, S.-Y., Ferrari, M., and Decuzzi, P., ‘Design of bio-mimetic particles with enhanced vascular interaction,’ Journal of biomechanics, 2009a, **42**(12), pp. 1885–1890.
Lee, S.-Y., Ferrari, M., and Decuzzi, P., ‘Shaping nano-/micro-particles for enhanced vascular interaction in laminar flows,’ Nanotechnology, 2009b, **20**(49), p. 495101.
Martinez, R., Roshchenko, A., Minev, P., and Finlay, W., ‘Simulation of enhanced deposition due to magnetic field alignment of ellipsoidal particles in a lung bifurcation,’ Journal of aerosol medicine and pulmonary drug delivery, 2013, **26**(1), pp. 31–40.
Matsunaga, D., Meng, F., Zöttl, A., Golestanian, R., and Yeomans, J. M., ‘Focusing and sorting of ellipsoidal magnetic particles in microchannels,’ Phys. Rev. Lett., 2017a, **119**, p. 198002, doi:10.1103/PhysRevLett.119.198002.
Matsunaga, D., Zöttl, A., Meng, F., Golestanian, R., and Yeomans, J. M., ‘Far-field theory for trajectories of magnetic ellipsoids in rectangular and circular channels,’ arXiv preprint arXiv:1711.00376, 2017b.
Pamme, N., ‘Magnetism and microfluidics,’ Lab on a Chip, 2006, **6**(1), pp. 24–38.
Pan, T.-W. and Glowinski, R., ‘Direct simulation of the motion of neutrally buoyant circular cylinders in plane poiseuille flow,’ Journal of Computational Physics, 2002, **181**(1), pp. 260–279.
Pan, T.-W., Huang, S.-L., Chen, S.-D., Chu, C.-C., and Chang, C.-C., ‘A numerical study of the motion of a neutrally buoyant cylinder in two dimensional shear flow,’ Computers & Fluids, 2013, **87**, pp. 57–66.
Sinha, A., Ganguly, R., De, A. K., and Puri, I. K., ‘Single magnetic particle dynamics in a microchannel,’ Physics of Fluids, 2007, **19**(11), p. 117102.
Smistrup, K., Hansen, O., Bruus, H., and Hansen, M. F., ‘Magnetic separation in microfluidic systems using microfabricated electromagnets—experiments and simulations,’ Journal of Magnetism and Magnetic Materials, 2005, **293**(1), pp. 597–604.
Stratton, J. A., *Electromagnetic theory*, John Wiley & Sons, 2007.
Trevelyan, B. and Mason, S., ‘Particle motions in sheared suspensions. i. rotations,’ Journal of Colloid Science, 1951, **6**(4), pp. 354–367.
Yang, B. H., Wang, J., Joseph, D. D., Hu, H. H., Pan, T.-W., and Glowinski, R., ‘Migration of a sphere in tube flow,’ Journal of Fluid Mechanics, 2005, **540**, pp. 109–131.
Yavuz, C. T., Prakash, A., Mayo, J., and Colvin, V. L., ‘Magnetic separations: from steel plants to biotechnology,’ Chemical Engineering Science, 2009, **64**(10), pp. 2510–2521.
Zhang, J. and Wang, C., ‘Study of rotation of ellipsoidal particles in combined simple shear flow and magnetic fields,’ COMSOL Conference 2017 Boston, 2017.
Zhou, R., Bai, F., and Wang, C., ‘Magnetic separation of microparticles by shape,’ Lab on a Chip, 2017a, **17**(3), pp. 401–406.
Zhou, R., Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Magnetic control of lateral migration of ellipsoidal microparticles in microscale flows,’ Physical Review Applied, 2017b, **8**(2), p. 024019.
Zhou, Y. and Xuan, X., ‘Diamagnetic particle separation by shape in ferrofluids,’ Applied Physics Letters, 2016, **109**(10), p. 102405.
III. NUMERICAL INVESTIGATION OF ROTATIONAL DYNAMICS OF ELLIPTICAL MAGNETIC MICROPARTICLES IN SHEAR FLOWS
Jie Zhang, Christopher A. Sobeck, Yanzhi Zhang, Cheng Wang
Department of Mechanical & Aerospace Engineering
Department of Mathematics & Statistics
Missouri University of Science and Technology
Rolla, Missouri 65409
Tel: 573–341–4636, Fax: 573–341–4607
Email: [email protected]
ABSTRACT
We study the rotational dynamics of magnetic prolate elliptical particles in a simple shear flow subjected to a uniform magnetic field, by using direct numerical simulations based on the finite element method (FEM). Focusing on paramagnetic and ferromagnetic particles, we investigate the effects of the magnetic field strength and direction on their rotational dynamics. In the weak field regime (below a critical field strength), the particles are able to perform complete rotations, and the symmetry property of particle rotational speed are influenced by the direction and strength of the magnetic field. In the strong field regime (above a critical strength), the particles are pinned at steady angles. The steady angle depends on both the direction and strength of the magnetic field. Our results show that paramagnetic and ferromagnetic particles exhibit markedly different rotational dynamics in a uniform magnetic field. The numerical findings are in good agreement with theoretical prediction. Our numerical investigation further reveals drastically different lateral migration behaviors of paramagnetic and ferromagnetic particles in a wall bounded simple shear flow under a uniform magnetic field. These two kinds of particles can thus be separated by
combining a shear flow and a uniform magnetic field. We also study the lateral migration of paramagnetic and ferromagnetic particles in a pressure-driven flow (a more practical flow configuration in microfluidics), and observe similar lateral migration behaviors. These findings demonstrate a simple but useful way to manipulate non-spherical microparticles in microfluidic devices.
**Keywords:** microfluidics; particle separation; magnetic particles; rotational dynamics; lateral migration
1. INTRODUCTION
Magnetic particles have been used in a vast number of applications including biomedicine (Pankhurst *et al.*, 2003), biological analysis, and chemical catalysis (Gijs *et al.*, 2009; Pamme, 2012). The separation of magnetic microparticles and nanoparticles in microscale fluid environments is one of the most important processes in the systems and platforms based on microfluidic technology (Pamme, 2006, 2012). A magnetic field is a powerful tool to separate magnetic particles or magnetically labelled cells, antigens, and enzymes (Gijs, 2004; Pamme, 2006; Suwa and Watarai, 2011). Most magnetic separation methods are based on magnetophoresis, which manipulates magnetic particles in a viscous fluid by using magnetic forces. To generate the magnetic force, it requires both magnetic particles and a spatially non-uniform field (magnetic field gradient) (Pamme, 2006). There are two different types of magnetophoresis: one is called negative magnetophoresis – manipulating diamagnetic particles in a magnetic fluid such as ferrofluids (Bucak *et al.*, 2011; Winkleman *et al.*, 2007; Zhou *et al.*, 2016; Zhou and Xuan, 2016); the other one is called positive magnetophoresis – separating paramagnetic or ferromagnetic particles in a non-magnetic fluid such as water (Chen *et al.*, 2015; Zborowski *et al.*, 1999).
In contrast to conventional magnetophoresis, several recent experimental, numerical, and theoretical studies (Cao *et al.*, 2018; Matsunaga *et al.*, 2017a,b; Zhang and Wang, 2018; Zhou *et al.*, 2017a,b) have demonstrated a different way to manipulate magnetic non-spherical
particles by a uniform magnetic field in the microchannel. The uniform magnetic field does not generate a magnetic force, but instead generates non-zero magnetic torques due to the non-spherical particle shape. When coupled with particle-wall hydrodynamic interaction (Gavze and Shapiro, 1997; Leal, 1980), the uniform magnetic field alters the rotational dynamics of non-spherical particles, and consequently controls the lateral migration of particles. Experiments preformed by Zhou et al. (Zhou et al., 2017a,b) have demonstrated that a weak uniform magnetic field can separate paramagnetic particles in a microchannel pressure-driven flow. The magnetic torque broke the symmetry of the particle rotation. Due to the particle-wall hydrodynamic interaction, the particles migrated laterally towards or away from the wall depending on the direction of magnetic field. By using the finite element method (FEM), Cao et al. (Cao et al., 2018) and Zhang et al. (Zhang and Wang, 2018) investigated the effect of several parameters, such as the strength and direction of the magnetic field, particle aspect ratio, and flow rate, on the lateral migration of the paramagnetic particles in microchannels. In another study, Matsunaga et al. (Matsunaga et al., 2017a,b) proposed a far-field theory and used the boundary element method to demonstrate that a strong uniform magnetic field can separate the ferromagnetic particles in both simple shear flow near the wall and Poiseuille flow between two walls. In this method, ferromagnetic particles are pinned at steady angles and the lateral migration results from particle-wall hydrodynamic interactions as well.
Previous investigations have either studied the lateral migration of paramagnetic particles under a weak magnetic field (Cao et al., 2018; Zhang and Wang, 2018; Zhou et al., 2017a,b) or ferromagnetic particles under a strong magnetic field (Matsunaga et al., 2017a,b). A comprehensive understanding on the difference of the lateral migration mechanism between the paramagnetic and ferromagnetic particles under both the weak and strong magnetic fields is absent. In our previous theoretical work (Sobecki et al., 2018), we theoretically analyzed the difference of particle rotational dynamics between the paramagnetic and ferromagnetic particles in a simple shear flow under a magnetic field. However, due to the inherent
complexity of particle dynamics in bounded flows, systematic theoretical analysis is difficult. In this work, we systematically investigate the rotational dynamics of both paramagnetic and ferromagnetic elliptical particles under a uniform magnetic field in simple shear and bounded flows by using direct numerical simulations. Our results suggest that the difference in magnetic properties leads to markedly different rotational dynamics as well as lateral migration. Based on these insights, we demonstrate feasible ways to separate these two kinds of magnetic particles in a pressure-driven flow configuration, which are commonly used in practical applications such as microfluidic devices.
This paper is organized as follows. Section 2 presents the numerical method including mathematical modeling, material parameters used in the simulation, and validation of the numerical method. Section 3 presents a brief theoretical analysis for comparing the numerical and theoretical results in following sections. Section 4 and 5 numerically investigate the rotational dynamics of paramagnetic and ferromagnetic particles in a simple shear flow under weak and strong magnetic fields, and compare the numerical and theoretical results. Based on the discussion in Section 4 and 5, Section 6 studies the lateral migration of paramagnetic and ferromagnetic particles in a simple shear flow near the wall. Finally, in Section 7, the simulation for the lateral migration of paramagnetic and ferromagnetic particles in a microchannel pressure-driven flow under both a weak and strong magnetic fields is preformed to demonstrate particle separation in more practical flows.
2. NUMERICAL METHOD
2.1. MATHEMATICAL MODEL
We consider a rigid prolate elliptical particle suspended in a simple shear flow as shown in Figure 1. The computational domain, $\Omega$, is bounded by the boundary, ABCD, and particle surface, $\Gamma$. The width and length of the computational domain are $W$ and $L$, respectively. The center of the particle is set to be the center of the computational domain.
The particle aspect ratio is $r_p = a/b$, where $a$ and $b$ are the major and minor semi-axis lengths of particles, respectively. The orientation angle of the particle, $\phi$, is the angle between the major axis of the particle and the positive $y$ axis. The background flow is a simple shear flow, where the velocity $u_\infty = \dot{\gamma} y e_x$ is imposed, with $\dot{\gamma}$ being the shear rate. A uniform magnetic field, $H_0$, is applied at an arbitrary direction, denoted by $\alpha$. The fluid is assumed to be incompressible, Newtonian, and non-magnetic. The transient flow field is governed by the continuity equation and Navier-Stokes equation:
$$\nabla \cdot u = 0,$$
\[ \rho_f \left[ \frac{\partial \mathbf{u}}{\partial t} + (\mathbf{u} \cdot \nabla) \mathbf{u} \right] = -\nabla p + \nabla \cdot \eta_f \left( \nabla \mathbf{u} + (\nabla \mathbf{u})^T \right), \tag{2} \]
where \( \mathbf{u} \) is the velocity vector, \( \rho_f \) and \( \eta_f \) are the density and dynamic viscosity of the fluid, respectively, \( p \) is the pressure, and \( t \) is the time.
To impose simple shear, the velocities at the top (AB) and bottom (CD) walls are set to be \( \pm \frac{1}{2} \dot{\gamma} W \mathbf{e}_x \) respectively. The boundaries AC and BD are set to periodic flow conditions. With the no-slip condition applied on the particle surface, the fluid velocities on the particle surface \( \Gamma \) are expressed as:
\[ \mathbf{u} = \mathbf{U}_p + \omega_p \times (\mathbf{x}_s - \mathbf{x}_p), \tag{3} \]
where \( \mathbf{U}_p \) and \( \omega_p \) are the translational and rotational velocities of particle, respectively, \( \mathbf{x}_s \) and \( \mathbf{x}_p \) are the position vectors of the surface and the center of the particle. The hydrodynamic force and torque acting on the particle are:
\[ \mathbf{F}_h = \int (\tau_h \cdot \mathbf{n}) d\Gamma, \tag{4} \]
\[ \mathbf{L}_h = \int (\tau_h \times (\mathbf{x}_s - \mathbf{x}_p) \cdot \mathbf{n}) d\Gamma, \tag{5} \]
where \( \tau_h = \eta_f \left( \nabla \mathbf{u} + (\nabla \mathbf{u})^T \right) \) is the hydrodynamic stress tensor on the particle surface \( \Gamma \).
The magnetic field is governed by the static Maxwell equations:
\[ \nabla \times \mathbf{H} = 0, \tag{6} \]
\[ \nabla \cdot \mathbf{B} = 0, \tag{7} \]
where \( \mathbf{H} \) and \( \mathbf{B} \) are the magnetic field and the magnetic flux density, respectively. To impose a uniform magnetic field, a magnetic scalar potential difference is set across boundaries AB and CD, with a zero magnetic potential \( V_m = 0 \) on AB and a magnetic potential \( V_m = V_{m0} \) on CD. Magnetic insulation condition is applied on boundaries AC and BD.
Assuming that the particle is homogeneous and isotropic in magnetic properties, the magnetic force acting on the particle, due to a uniform magnetic field, is zero (Stratton, 2007). The magnetic torque acting on a magnetic particle is expressed as (Stratton, 2007):
\[
L_m = \mu_0 (\mathbf{m} \times \mathbf{H}_0),
\]
(8)
where \( \mathbf{m} \) is the magnetic moment of the particle, and \( \mu_0 \) is the magnetic permeability of the vacuum.
For two-dimensional elliptical particles, the rotational motion is in the \( x-y \) plane, thus \( \omega_p = \omega_p \mathbf{e}_z \), \( L_h = L_h \mathbf{e}_z \), and \( L_m = L_m \mathbf{e}_z \). The translation and rotation of particles are governed by Newton’s second law and Euler’s equation:
\[
m_p \frac{d\mathbf{U}_p}{dt} = \mathbf{F}_h,
\]
(9)
\[
I_p \frac{d\omega_p}{dt} = L_h + L_m,
\]
(10)
where \( m_p \) and \( I_p \) are the mass and the moment of inertia of the particle, respectively.
The position of the particle center \( \mathbf{x}_p(t) = (x_p, y_p) \) and the orientation \( \phi \) of the particle are expressed as:
\[
\mathbf{x}_p(t) = \mathbf{x}_p(0) + \int_0^t \mathbf{U}_p(t') dt',
\]
(11)
\[
\phi(t) = \phi(0) + \int_0^t \omega_p(t') dt',
\]
(12)
where \( \mathbf{x}_p(0) \) and \( \phi(0) \) are the initial position and orientation of the particle.
The dynamic motions of the particle, the flow field, and the magnetic field are coupled via Equations (3)-(5) and (8)-(10). We use direct numerical simulation (DNS) based on FEM and arbitrary Lagrangian-Eulerian(ALE) method to simultaneously calculate the flow field and particle motion. Similar methodologies have been successfully used by Hu et al. (Hu et al., 2001) and Ai et al. (Ai et al., 2009a,b; Ai and Qian, 2010; Ai et al., 2014).
The numerical model is implemented and solved with a commercial FEM solver (COMSOL Multiphysics). First, we use a stationary solver to calculate the magnetic field inside and outside of the particle and compute the magnetic torque acting on the particle. Then, the two-way coupling of fluid-particle interaction model is solved by using a time-dependent solver and by importing the previously determined magnetic torque. The deformation of the computational domain is solved with the Moving Mesh interface based on the ALE algorithm. The meshes of fluid domain are free to deform, while the particle domain are determined by its trajectory and orientation. As the mesh deforms, the mesh quality is decreased. When the quality value is decreased to 0.2, the re-meshing process initiates. Similar modeling strategy has been successfully carried out in our previous work (Zhang and Wang, 2018) and other work e.g., Cao et al (Cao et al., 2018). Quadratic triangular elements are employed in this simulation. A fine mesh around the particle and a finer mesh around the tip of the particle are created to accurately calculate the hydrodynamic force and torque acting on the particle. The total number of elements was about 7,000 in the fluid domain $\Omega$, and about 130 elements were used to discretize the particle surface $\Gamma$.
### 2.2. MATERIAL PROPERTIES
In this numerical study, water is used as the nonmagnetic fluid ($\chi_f = 0$), which has a density $\rho_f = 1000 \text{ kg/m}^3$ and a dynamic viscosity $\eta_f = 1 \times 10^{-3} \text{ Pa-s}$. The shear rate of the flow is kept constant, such that $\dot{\gamma} = 200 \text{ s}^{-1}$. The particle is assumed to be polystyrene particles containing magnetic nanoparticles, similar to those used in earlier experiments (Zhou et al., 2017a,b), which could be either paramagnetic or ferromagnetic particles. The density of the particle is $\rho_p = 1100 \text{ kg/m}^3$. Here, the particle motion is in the $x$-$y$ plane and the inertia effect is negligible, thus the density difference between the particle and fluid has negligible effect on the particle dynamics. The equivalent diameter of the particle used in this simulation is $d = 7 \mu m$ and the particle aspect ratio $r_p = 4$, thus the major and minor
semi-axis lengths of particles are $a = 7 \, \mu\text{m}$ and $b = 1.75 \, \mu\text{m}$. We consider two kinds of magnetic particles: paramagnetic particles with $\chi_p = 0.26$ and ferromagnetic particle with permanent magnetization $M_0 = 2000 \, \text{A/m}$.
### 2.3. VALIDATION OF NUMERICAL METHOD
In this section, we present validation of the numerical method by comparing the results with Jeffery’s theory, which describes the periodic rotation of an axisymmetric ellipsoidal particle in a simple shear unbounded flow (Jeffery, 1922). Without a magnetic field, the ferromagnetic and paramagnetic particles behave the same way. Here, the width and length of the computational domain are $W = L = 150 \, \mu\text{m}$, which will also be used in the simulations in Section 4 and 5. The confinement effects the walls are negligible due to the large computational domain relative to the particle size. The period of the particle rotation, $T^J$, is defined as the time taken by the particle to rotate from $\phi = 0^\circ$ to $\phi = 360^\circ$, and $T^J = 2\pi / \dot{\gamma}(r_p + 1/r_p)$ (Jeffery, 1922). Due to the fore-aft symmetry of the particle, we define $T^J_0$ as the time taken for rotation from $0^\circ$ to $180^\circ$, i.e., $T^J_0 = T^J/2$. Note that for ease of visualizing results, we use both ‘degree’ and ‘radian’ as units for angles in the remaining sections of this paper.
Figure 2 compares the time evolution of particle orientation angle predicted by Jeffery’s theory and our simulation for a particle with $r_p = 4$ in a simple shear flow ($\dot{\gamma} = 200 \, \text{s}^{-1}$). The theoretical value of $T^J_0$ from Jeffery’s theory is 0.0668 s, while the period obtained in our FEM simulation is 0.0670 s. The relative error is 0.3%, suggesting that the simulation has excellent agreement with the theory. Therefore, this simulation method has been validated to be sufficiently accurate to study the dynamics of the particle in a simple shear flow.
Figure 2. Comparison between the FEM simulation and Jeffery’s theory for particle aspect ratio $r_p = 4$ and the shear rate $\dot{\gamma} = 200 \text{s}^{-1}$.
Table 1. Four meshes for grid independence analysis
| | Domain elements | Boundary elements on particle surface |
|-------|-----------------|--------------------------------------|
| Mesh 1| 3734 | 48 |
| Mesh 2| 4812 | 76 |
| Mesh 3| 6952 | 124 |
| Mesh 4| 7548 | 148 |
2.4. GRID INDEPENDENCE ANALYSIS
We perform grid independence analysis to determine the appropriate meshes for cost-effective numerical simulations without comprising accuracy. The results for four different meshes in a simple shear flow in the absence of the magnetic field are shown in Table 1 and Figure 3. As can be seen, the convergence of numerical results is considered sufficient when the domain element number is larger than 6,952 and the boundary element...
number on the particle surface is larger than 124. In this work, we use about 7500 elements in the computational domain $\Omega$ in Figure 1, and about 150 elements on the particle surface $\Gamma$, which give reasonably accurate results.
**Figure 3.** Grid independence analysis: particle orientation $\phi$ as a function of time $t$ for particle aspect ratio $r_p = 4$ and the shear rate $\dot{\gamma} = 200s^{-1}$.
### 3. THEORETICAL ANALYSIS
In this section, we briefly present the theoretical analysis pertaining to the rotational dynamics of paramagnetic and ferromagnetic particles. We also define relevant dimensionless parameters as well as physical quantities to characterize the rotational behaviors.
Assuming a small particle Reynolds number, (i.e., $\text{Re}_p = \rho_p d^2 \dot{\gamma}/\eta_f \ll 1$, justified by typical microfluidic experimental conditions), the particle inertia is negligible and the particle motion is quasi-steady, similar to the previous studies (Allan and Mason, 1962;
Chaffey and Mason, 1964; Okagawa et al., 1974). Equation (10) is then reduced to:
\[ L_h + L_m = 0. \]
(13)
Under the assumption of Stokes flow, the hydrodynamic torque in the \( xy \) plane acting on an ellipsoidal particle in a simple shear flow with a shear rate \( \dot{\gamma} \) is (Jeffery, 1922; Okagawa et al., 1974):
\[ L_h = \frac{8\pi\eta_f a^3(r_p^2 + 1)}{3r_p^2(D_{xx} + D_{yy})}(r_p^2 - 1)\frac{\cos(2\phi)}{2}\dot{\gamma} + \frac{\dot{\gamma}}{2} - \omega_p), \]
(14)
where \( \omega_p = d\phi/dt \) is the particle rotational speed, \( D_{xx} = 1 - \Lambda \) and \( D_{yy} = \Lambda/2 \) are the ellipsoidal demagnetizing factors, and \( \Lambda = \frac{r_p^2}{r_p^2 - 1} - \frac{r_p \cos^{-1}(r_p)}{(r_p^2 - 1)^{3/2}} \) for a prolate ellipsoid (Okagawa et al., 1974). When the magnetic field is absent, we obtain the rotational speed due to the hydrodynamic torque only:
\[ \omega_h = \frac{r_p^2 \cos(\phi)^2 + \sin^2(\phi)}{r_p^2 + 1}\dot{\gamma}, \]
(15)
which is the Jeffery equation.
When subjected to an external magnetic field, a magnetic moment is induced in a paramagnetic particle, thus resulting a magnetic torque. According to previous works (Shine and Armstrong, 1987; Zhou et al., 2017a,b), the torque experienced by the paramagnetic particle is
\[ L_{mp} = -V_p \frac{\mu_0 \chi_p^2 H_0^2 (D_{yy} - D_{xx}) \sin(2(\phi - \alpha))}{2(\chi_p D_{xx} + 1)(\chi_p D_{yy} + 1)}, \]
(16)
where \( V_p \) is the volume of the particle. Substituting Equations (14) and (16) into Equation (13), the total particle rotational speed is obtained:
\[ \omega_p = \frac{d\phi}{dt} = \frac{r_p^2 \cos(\phi)^2 + \sin^2(\phi) - S_p \sin(2(\phi - \alpha))}{r_p^2 + 1}\dot{\gamma}, \]
(17)
where
\[
S_p = \frac{\mu_0 \chi_p^2 H_0^2 (r_p^2 D_{xx} + D_{yy})(D_{yy} - D_{xx})}{4 \dot{\gamma} \eta_f (1 + \chi_p D_{xx})(1 + \chi_p D_{yy})}.
\]
(18)
The dimensionless parameter \( S_p \) measures the relative strength between the magnetic and hydrodynamic effects on a paramagnetic particle (Zhou et al., 2017a,b).
For a ferromagnetic particle, it is assumed that the magnetization of the particle, \( M_0 \) (its magnitude denoted by \( M_0 \)) is parallel to the particle’s major axis. The magnetic moment of the particle \( m = V_p M_0 = V_p M_0 (\sin(\phi), \cos(\phi), 0) \). Thus, Equation (8) can be written as \( L_{mf} = \mu_0 V_p (M_0 \times H_0) = L_{mf} e_z \), with the magnitude of the torque (Shine and Armstrong, 1987),
\[
L_{mf} = -\mu_0 V_p M_0 H_0 \sin(\phi - \alpha).
\]
(19)
We obtain the total rotational speed of a ferromagnetic particle in a simple shear flow (Sobecki et al., 2018):
\[
\omega_p = \frac{d\phi}{dt} = \frac{r_p^2 \cos(\phi)^2 + \sin^2(\phi) - S_f \sin(\phi - \alpha)}{r_p^2 + 1} \dot{\gamma},
\]
(20)
where
\[
S_f = \frac{\mu_0 M_0 H_0 (r_p^2 D_{xx} + D_{yy})}{2 \eta_f \dot{\gamma}}
\]
(21)
is a dimensionless parameter that measures the relative strength between the magnetic and hydrodynamic effects on a ferromagnetic particle.
As can be seen in equations (17) and (20), the particle rotational behaviour depends on the direction of magnetic field \( \alpha \) and the parameters \( S_p \) or \( S_f \). When \( S_p \) or \( S_f \) is increased to a large enough value, the particle rotation is impeded. In our previous work (Zhou et al., 2017b), we defined \( S_{cr} \) as the critical value of \( S \) for the existence of real solutions to \( \omega_p = 0 \). When \( S \geq S_{cr} \), the particle is impeded at a certain steady angle \( \phi_s \), and we define this field as the strong magnetic field. When \( S < S_{cr} \), the particle is able to perform full rotations, so
we define this field as the weak magnetic field. For simplicity of notation, in the following sections, we use $S$ to represent either $S_p$ for paramagnetic particles or $S_f$ for ferromagnetic particles.
The critical relative strength, $S_{cr}$, can be calculated from the Equation (17) for paramagnetic particles and the Equation (20) for ferromagnetic particles. The values of $S_{cr}$ for $r_p = 4$ is shown in Table 2 for various magnetic field directions ($\alpha$) (Sobecki et al., 2018).
In the weak field regime, to better compare the difference between paramagnetic and ferromagnetic particles, we define the period of rotation as the time taken by the particle to rotate from 0 to $2\pi$ (or $360^\circ$) as $T = T_1 + T_2$ with:
$$T = \int_0^{2\pi} \frac{d\phi}{\omega_p}, \quad T_1 = \int_0^{\pi} \frac{d\phi}{\omega_p}, \quad T_2 = \int_{\pi}^{2\pi} \frac{d\phi}{\omega_p}. \tag{22}$$
In our previous work (Zhou et al., 2017b), due to $\pi(180^\circ)$ period of the paramagnetic particle, we defined a ratio parameter,
$$\tau_1 = \left| \int_0^{\pi/2} \frac{d\phi}{\omega_p} \right| / \int_0^{\pi} \frac{d\phi}{\omega_p}, \tag{23}$$
to characterize the symmetry property of the paramagnetic particle rotation. However, the ferromagnetic particle rotates periodically with a period of $2\pi$ (or $360^\circ$), thus we define an additional ratio parameter:
$$\tau_2 = \left| \int_{\pi}^{3\pi/2} \frac{d\phi}{\omega_p} \right| / \int_{\pi}^{2\pi} \frac{d\phi}{\omega_p}. \tag{24}$$
We use the average of $\tau_1$ and $\tau_2$ as $\tau$ to characterize the overall symmetry property of the particle rotation, that is,
$$\tau = \frac{\tau_1 + \tau_2}{2}. \tag{25}$$
As can be seen, for the paramagnetic particle, $\tau_1 = \tau_2 = \tau$.
Table 2. The critical strength, $S_{cr}$, calculated for paramagnetic and ferromagnetic particles with $r_p = 4$, and different $\alpha$ (Sobecki et al., 2018).
| $\alpha (\circ)$ | 0 | 45 | 90 | 135 | 180 | 225 | 270 | 315 |
|------------------|-----|-----|-----|-----|-----|-----|-----|-----|
| Paramagnetic | 4 | 1 | 4 | 16 | 4 | 1 | 4 | 16 |
| Ferromagnetic | 1 | 1.38| 7.75| 1.38| 1 | 1.38| 7.75| 1.38|
In the following sections, we will investigate the difference of rotational dynamics between paramagnetic and ferromagnetic particles by using systematic numerical simulations under both weak and strong magnetic fields. Specifically, we will study the effect of magnetic field on the period of rotation, symmetry properties of the particle rotation, and impeded angles. In addition, the numerical and theoretical results are compared and discussed.
4. WEAK MAGNETIC FIELD
We will focus on the rotational dynamics of paramagnetic and ferromagnetic particles in the presence of a weak magnetic field ($S < S_{cr}$). In this regime, both particles are able to perform complete rotations. However, the magnetic field will affect their rotation differently because the magnetic torques have different dependence on the parameter $(\phi - \alpha)$ as in Equations (16) and (19).
4.1. PARAMAGNETIC PARTICLES
First, we discuss the rotational dynamics of paramagnetic particle in a weak magnetic field. The rotational motion of the paramagnetic magnetic particle with $r_p = 4$ when the magnetic field is applied perpendicular to the flow direction ($\alpha = 0^\circ$) is shown in Figure 4. Figure 4(a) shows the time evolution of orientation angle of the particle, $\phi$, with time $t$ when the relative strength $S$ is increased from 0 to 5.04. As can be seen, the period of rotation increases with an increasing $S$. With $S \approx 5.04$, the particle is impeded at a steady angle $\phi_s = 61.56^\circ$. The numerical results are in quantitative agreement with the prediction.
\((S_{cr} = 4)\) from our previous theory (Zhou et al., 2017b). We study the dimensionless parameters \(\tau_1\) and \(\tau_2\) in Figure 4(b) and (c). The numerical results show that \(\tau_1 = \tau_2 = \tau\) for the paramagnetic particle, independent of the magnetic strength \(S < S_{cr}\), which is consistent with the theoretical results in Section 3. Thus, we only discuss \(\tau\) in the remaining of this section.
Figure 4. Rotation of the paramagnetic magnetic particle \((r_p = 4)\) when the magnetic field is applied perpendicular to the flow direction \((\alpha = 0^\circ)\). (a) The times evolution of orientation angle, \(\phi\); (b) The evolution of orientation angle, \(\phi\), with the dimensionless time, \(t/T_1\); (c) The evolution of orientation angle, \(\phi\), with the dimensionless time, \(t/T_2\). \(T_1\) and \(T_2\) denote times taken by the particle to rotate from \(0^\circ\) to \(180^\circ\) and from \(180^\circ\) to \(360^\circ\), respectively.
The effect of the magnetic field on the period of rotation is shown in Figure 5. To better illustrate this effect, the dimensionless period is defined by normalizing \(T\) with the Jeffery period \(T^J\). We investigate four different directions of the magnetic field. At each direction, the dimensionless period changing with magnetic field strength \(S\) is studied. The
symbols represent the numerical results and the solid lines are the theoretical predictions from Equation (22). We observe that the dimensionless period, $T/T^J$, increases monotonically with an increase of $S$ when the magnetic field is applied at $\alpha = 0^\circ$(a), $\alpha = 45^\circ$(b), and $\alpha = 90^\circ$(c). When the magnetic field is applied at $\alpha = 135^\circ$(d), the dimensionless period, $T/T^J$, decreases first, and then increases. Furthermore, these numerical results are in quantitative agreement with those when the paramagnetic particle is transported in a pressure-driven flow (Zhang and Wang, 2018). Additionally, the numerical results are in a very good agreement with the theoretical prediction.
Figure 5. The dimensionless period, $T/T^J$, varies with the dimensionless magnetic field strength, $S$ when the magnetic field is applied at $\alpha = 0^\circ$(a), $\alpha = 45^\circ$(b), $\alpha = 90^\circ$(c) and $\alpha = 135^\circ$(d) for the paramagnetic particle.
Figure 6 shows the dimensionless parameter, $\tau$, as a function of $S$ when the magnetic field is applied at $\alpha = 0^\circ$, $\alpha = 45^\circ$, $\alpha = 90^\circ$ and $\alpha = 135^\circ$. When the field is applied at $\alpha = 0^\circ$ and $90^\circ$, as can be seen in Figure 6 (a) and (c), $\tau$ deviates further from 0.5 as $S$ is increased, meaning the asymmetry of the particle rotation becomes more pronounced. Interestingly, when the magnetic field is applied at $\alpha = 45^\circ$ and $135^\circ$ as can be seen in Figure 6 (b) and (d), $\tau$ is always equal to 0.5, independent of the strength $S$, meaning the particle rotation is always symmetric with respect to $\phi = 90^\circ$ and $270^\circ$. The numerical simulation results have a remarkable agreement with the theoretical results.
Figure 6. The dimensionless parameter, $\tau$, varies with the dimensionless magnetic field strength, $S$ when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c) and $\alpha = 135^\circ$ (d) for the paramagnetic particle.
4.2. FERROMAGNETIC PARTICLES
We now look at the rotational dynamics of a ferromagnetic particle under the weak magnetic field regime. Because the rotation of ferromagnetic particle has a period of $2\pi$ (or $360^\circ$) in $\phi$, we perform simulations with the magnetic field applied at $\alpha = 0^\circ, 45^\circ, 90^\circ, 135^\circ, 180^\circ, 225^\circ, 270^\circ$ and $315^\circ$. Figure 7 shows the dimensionless period, $T/T^J$, changing with the dimensionless magnetic field strength, $S$, when the magnetic field is applied at these eight angles. As we can see, the dimensionless period of rotation, $T/T^J$, increases monotonically with an increase of $S$ at all directions of the magnetic field, which is different from the phenomena observed in Figure 6 for paramagnetic particles. When the magnetic field is applied at $135^\circ$, $T/T^J$ is decreased first and then increased monotonically with increasing $S$ for a paramagnetic particle, but for a ferromagnetic particle, $T/T^J$ is increased with increasing $S$. The numerical simulation results show remarkable agreement with the theoretical results.
The dimensionless parameter, $\tau$, depends on the direction of the magnetic field, $\alpha$, and field strength, $S$, as shown in Figure 8. As can be seen from Figure 8(a) and (e), when the magnetic field is applied at $\alpha = 0^\circ$ and $180^\circ$, $\tau_1 = \tau_2 = \tau = 0.5$ as $S$ is increased, which is different from the paramagnetic particle in Section 4.1 where $\tau_1 = \tau_2 = \tau > 0.5$ and increases with increasing $S$. Note that paramagnetic particles behave the same when the magnetic field is applied at $\alpha = 180^\circ$ and $\alpha = 0^\circ$. When the magnetic field is applied at $\alpha = 90^\circ$ as shown in Figure 8(c), $\tau_1 < 0.5$, $\tau_2 > 0.5$, and both deviate more from 0.5 with increasing $S$, but $\tau$ remains 0.5. Similar results are observed when the magnetic field is applied at $\alpha = 270^\circ$ as shown in Figure 8(g). In this case, $\tau_1 > 0.5$, $\tau_2 < 0.5$, and $\tau = 0.5$ for all values of $S$. These results are different from the paramagnetic particle in Section 4.1 where $\tau_1 = \tau_2 = \tau < 0.5$ and are decreased with increasing $S$.
Figure 7. The dimensionless period, $T/T^J$, varies with the dimensionless magnetic field strength, $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c), $\alpha = 135^\circ$ (d), $\alpha = 180^\circ$ (e), $\alpha = 225^\circ$ (f), $\alpha = 270^\circ$ (g) and $\alpha = 315^\circ$ (h) for the ferromagnetic particle.
Figure 8. The dimensionless parameter, $\tau$, varies with the dimensionless magnetic field strength, $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c), $\alpha = 135^\circ$ (d), $\alpha = 180^\circ$ (e), $\alpha = 225^\circ$ (f), $\alpha = 270^\circ$ (g) and $\alpha = 315^\circ$ (h) for ferromagnetic particle.
When the magnetic field is applied at $\alpha = 45^\circ$, $\tau_1 < 0.5$, $\tau_2 > 0.5$, and $\tau < 0.5$; When the magnetic field is applied at $\alpha = 135^\circ$, $\tau_1 < 0.5$, $\tau_2 > 0.5$, but $\tau > 0.5$; When the magnetic field is applied at $\alpha = 225^\circ$, $\tau_1 > 0.5$, $\tau_2 < 0.5$, and $\tau < 0.5$; When the magnetic field is applied at $\alpha = 315^\circ$, $\tau_1 > 0.5$, $\tau_2 < 0.5$, but $\tau > 0.5$. These three parameters deviate further away from 0.5 with increasing $S$ when the magnetic field is applied at $\alpha = 45^\circ$, $135^\circ$, $225^\circ$ and $315^\circ$, which are different from the paramagnetic particle in Section 4.1, where $\tau_1 = \tau_2 = \tau = 0.5$ in the weak field regime.
5. STRONG MAGNETIC FIELD
As we explained earlier, the particle could not have a full rotation when the magnetic field strength is increased to a certain value. So, in this section, we will focus on the impeded steady angles of paramagnetic and ferromagnetic particles in the presence of a strong magnetic field.
5.1. PARAMAGNETIC PARTICLES
We first examine the rotational dynamics of a paramagnetic particle under a strong magnetic field. Figure 9 shows the evolution of particle orientation angle, $\phi$ with time, $t$, and the corresponding impeded angles for different magnetic field strengths and directions. As can be seen, for a fixed magnetic field direction, when the relative strength $S$ is increased, the impeded angle, $\phi_s$, is decreased; for a fixed relative strength, when the magnetic field direction is increased, the impeded angle is increased as can be seen in Figure 9(a2), (b2), (c2) and (d2). For example, when $S = 30$, $\phi_s = 14.95^\circ$ for $\alpha = 0^\circ$; $\phi_s = 51.43^\circ$ for $\alpha = 45^\circ$; $\phi_s = 90.93^\circ$ for $\alpha = 90^\circ$; $\phi_s = 146.09^\circ$ for $\alpha = 135^\circ$. Recall that $S$ is a parameter to characterize the relative strength between the magnetic and hydrodynamic effects on a magnetic particle. A larger $S$ means the magnetic effect is more pronounced than hydrodynamic effect, and the major axis of the particle becomes more aligned to the
magnetic field direction. The theoretical impeded angle, determined from equation (17) for $S$ range from 10 to 40 (20 to 40 for $\alpha = 135^\circ$ due to $S_{cr} = 16$), are shown as solid lines in Figure 9(a2), (b2), (c2) and (d2). The numerical results of the impeded angles are in close agreement with the theoretical prediction.
Figure 9. The time evolution of orientation angle, $\phi$, and the stable orientation angle, $\phi_s$ as a function of $S$, when the magnetic field is applied at $\alpha = 0^\circ$(a), $\alpha = 45^\circ$(b), $\alpha = 90^\circ$(c) and $\alpha = 135^\circ$(d) for the paramagnetic particle.
5.2. FERROMAGNETIC PARTICLES
Here, we will discuss the rotational dynamics of a ferromagnetic particle ($r_p = 4$) under the strong magnetic field. Figure 10 shows the time evolution of orientation angle, $\phi$, and the corresponding impeded angles for different relative strengths and different magnetic field directions. The dependence of $\phi_s$ on $S$ and $\alpha$ is similar to that of paramagnetic particles. For a fixed magnetic field direction, when the relative strength $S$ is increased, the impeded angle, $\phi_s$, is decreased; for a fixed relative strength, when the magnetic field direction is increased, the impeded angle is increased. For example, when $S = 30$, $\phi_s = 25.76^\circ$ for $\alpha = 0^\circ$; $\phi_s = 55.85^\circ$ for $\alpha = 45^\circ$; $\phi_s = 91.82^\circ$ for $\alpha = 90^\circ$; $\phi_s = 163.70^\circ$ for $\alpha = 135^\circ$. The impeded angle, computed from the equation (17) for $S$ range from 10 to 40, are shown as solid lines in Figure 10 (a2), (b2), (c2) and (d2), suggesting good agreement between the numerical results and theoretical prediction.
However, compared with the results of paramagnetic particle shown in Figure 9, the impeded angles of ferromagnetic particles is always larger than those of paramagnetic particles when they are subjected to the same relative strengths($S$) and magnetic field direction ($\alpha$). For example, when $S = 20$ and $\alpha = 0^\circ$, $\phi_s = 22.00^\circ$ for the paramagnetic particle, while $\phi_s = 34.15^\circ$ for the ferromagnetic particle.
6. PARTICLE LATERAL MIGRATION IN A SIMPLE SHEAR FLOW NEAR THE WALL
The results presented in the previous sections have illustrated many differences of rotational dynamics between paramagnetic and ferromagnetic particles when they are subjected a uniform magnetic field, where the wall effects can be neglected. Prior investigations have shown lateral migration in wall-bounded shear flows for either paramagnetic particles in a weak magnetic field (Cao et al., 2018; Zhang and Wang, 2018; Zhou et al., 2017a,b), or ferromagnetic particles in a strong magnetic field (Matsunaga et al., 2017a,b). However,
systemic studies on the lateral migration of paramagnetic and ferromagnetic particles under the weak and strong magnetic field are absent. Therefore, in this section, we will use numerical simulations to study the lateral migration of the two different particles in a simple shear flow near the wall.
Figure 10. The time evolution of orientation angle, $\phi$, and the stable orientation angle, $\phi_s$, as a function of $S$, when the magnetic field is applied at $\alpha = 0^\circ$ (a), $\alpha = 45^\circ$ (b), $\alpha = 90^\circ$ (c) and $\alpha = 135^\circ$ (d) for the ferromagnetic particle.
Figure 11. Schematic illustration of the numerical model of an elliptical particle suspended in a simple shear flow near the wall and in a plane Poiseuille flow in a microchannel under the influence of a uniform magnetic field $H_0$. The fluid and particle domains are $\Omega$ and $\Gamma$, respectively. The orientation angle of the particle is denoted by $\phi$. The particle-wall separation distance is denoted by $y_p$.
The numerical model of an elliptical particle suspended in a simple shear flow near the wall is shown in Figure 11(a). In this model, the velocity of the bottom wall is kept at zero, while the velocity of the top wall is at a constant velocity $\dot{\gamma} W e_x$. The length of the channel $L = 900 \mu m$. The width of the channel $W$ is set to 100 $\mu m$. To investigate the effect of the wall, the particle is initially placed at a particle-wall separation distance $y_{p0} = 10 \mu m$. The effect of the other wall is negligible due to the large separation distance. Our previous numerical study (Zhang and Wang, 2018) indicated that the inertia effect ($Re = 0.125$) can cause a small net lateral migration in the absence of magnetic field. Thus, to avoid the
inertia effect, the viscosity of the fluid is set to 0.1 Pa·s and the shear rate is set to $\dot{\gamma} = 80 \text{ s}^{-1}$, resulting in a small Reynolds number ($\text{Re} = 0.008 \ll 1$). This way, the effect of magnetic field is isolated in order to study its influence on particle migration. The other parameters are the same as before.
6.1. WEAK MAGNETIC FIELD
As we have discussed in Section 4, the symmetry property (characterized by $\tau$) of particle’s rotational velocity depends on the magnetic properties of the particle, and the direction of the magnetic field. Specifically, for paramagnetic particles, $\tau > 0.5$ when the magnetic field is applied at $0^\circ$, and $\tau < 0.5$ for paramagnetic particles when the magnetic field is applied at $90^\circ$, while for ferromagnetic particles, $\tau = 0.5$ when the magnetic field is applied at $0^\circ$, $90^\circ$, $180^\circ$ and $270^\circ$. Second, for paramagnetic particles, $\tau = 0.5$ when the magnetic field is applied at $45^\circ$ and $135^\circ$, while for ferromagnetic particles, $\tau < 0.5$ when the magnetic field is applied at $45^\circ$ and $225^\circ$, and $\tau > 0.5$ when the magnetic field is applied at $135^\circ$ and $315^\circ$. We will discuss those two cases separately to understand their lateral migration.
First, let us discuss about the lateral migration of paramagnetic and ferromagnetic particles when the magnetic field is applied at $0^\circ$, $90^\circ$, $180^\circ$ and $270^\circ$. Due to a periodicity of $\pi(180^\circ)$ in $\phi$ for paramagnetic particles, the results for $\alpha = 0^\circ$ and $180^\circ$, $\alpha = 90^\circ$ and $270^\circ$ are the same, so we only need to perform simulations for $\alpha = 0^\circ$ and $\alpha = 90^\circ$. Figure 12 shows that the lateral migration with time over a $2\pi$ (or $360^\circ$) period for paramagnetic and ferromagnetic particles when the magnetic field of $S = 0.67$ is applied at $0^\circ$, $90^\circ$, $180^\circ$ and $270^\circ$. As can be seen in Figure 12(a) for the paramagnetic particle, the net lateral migration is away from the wall when $\alpha = 0^\circ$, and towards the wall when $\alpha = 90^\circ$. However, for the ferromagnetic particle as shown in Figure 12(b), there are negligible net lateral migrations.
Figure 12. Transport of the magnetic particles ($r_p = 4$) near the wall under a weak magnetic field. (a) The lateral position of the paramagnetic particle, $(y_p - y_{p0})$, over a period; (b) The lateral position of the ferromagnetic particle, $(y_p - y_{p0})$, over a period.
when the magnetic field is applied at $\alpha = 0^\circ, 90^\circ, 180^\circ$ and $270^\circ$. Therefore, we can separate paramagnetic and ferromagnetic particles by using a simple shear flow near the wall when a weak magnetic field is applied at $0^\circ, 90^\circ, 180^\circ$ and $270^\circ$.
Next, we examine lateral migration of paramagnetic and ferromagnetic particles when $\alpha = 45^\circ, 135^\circ, 225^\circ$ and $315^\circ$. We only carry out simulations when $\alpha = 45^\circ$ and $135^\circ$ for paramagnetic particles. Figure 13 shows that the lateral migration changes with time over a $2\pi$ (or $360^\circ$) period for paramagnetic and ferromagnetic particles when a magnetic field of strength $S = 0.67$ is applied at $\alpha = 45^\circ, 135^\circ, 225^\circ$ and $315^\circ$. As can be seen in
Figure 13(a), for the paramagnetic particle, there are no net lateral migrations when $\alpha = 45^\circ$, or $135^\circ$. However, for the ferromagnetic particle as shown in Figure 13(b), there is a positive net lateral migration when $\alpha = 135^\circ$ or $225^\circ$, and a negative net lateral migration when the magnetic field is applied at $\alpha = 45^\circ$ and $315^\circ$. Therefore, we can separate the paramagnetic and ferromagnetic particles in a simple shear flow near the wall when the weak magnetic field is applied at $45^\circ$, $135^\circ$, $225^\circ$ and $315^\circ$. But the net lateral migration over a period is smaller than the first case.
**Figure 13.** Transport of the magnetic particles ($r_p = 4$) near the wall under a weak magnetic field. (a) The lateral position of the paramagnetic particle, $(y_p - y_{p0})$, over a period; (b) The lateral position of the ferromagnetic particle, $(y_p - y_{p0})$, over a period.
For the paramagnetic particle in a weak magnetic field, our numerical results are consistent with findings of several previous studies (Cao et al., 2018; Zhang and Wang, 2018; Zhou et al., 2017b): the particle moves away from the wall when $\tau > 0.5$; the particle moves...
downwards when $\tau < 0.5$; no net lateral migration when $\tau = 0.5$. This numerical study further confirms same results for the ferromagnetic particle in a weak magnetic field: the particle will move upwards when $\tau > 0.5$; the particle will move downwards when $\tau < 0.5$; no net lateral migration when $\tau = 0.5$.
6.2. STRONG MAGNETIC FIELD
As we have discussed in Section 5, the impeded angles of the paramagnetic and ferromagnetic particles are different for the same $S$ and $\alpha$. Thus, we carry out simulations for the paramagnetic and ferromagnetic particles to understand the effect of a strong magnetic field on lateral migration, as shown in Figure 14. When a strong magnetic field is applied at $\alpha = 0^\circ$, the time evolution of orientation angle $\phi$ and the lateral migration, $(y_p - y_{p0})$, of paramagnetic (red line) and ferromagnetic (black line) particles are shown in Figure 14(a) and (b). For both particles, a moderate strength $S = 10$ (solid line) and a large strength $S = 40$ (dash line), the impeded angles and lateral migration are different. But the difference of the impeded angles for $S = 40$ is more significant than those for $S = 10$. The net lateral migration between paramagnetic and ferromagnetic particles also shows marked difference for $S = 40$. This comparison suggests that it would be advantageous to use stronger field strength to separate the paramagnetic and ferromagnetic particles when the magnetic field is applied at $\alpha = 0^\circ$.
Figure 14(c) and (d) shows the evolution of orientation angle $\phi$ and the lateral migration, $(y_p - y_{p0})$, of paramagnetic (red line) and ferromagnetic (black line) particles when a strong magnetic field is applied at $\alpha = 90^\circ$. In this case, there is a larger difference of both impeded angle and lateral migration for $S = 10$ (solid line) than for $S = 40$ (dash line). This finding suggests that a moderate field strength ($S = 10$) can result in better separation between the paramagnetic and ferromagnetic particles than a stronger field ($S = 40$) if the magnetic field is perpendicular to the flow, i.e., $\alpha = 90^\circ$.
Figure 14. Transport of the magnetic particle ($r_p = 4$) near the wall under a strong magnetic field. (a) The evolution of orientation angle $\phi$ and (b) the lateral position of the paramagnetic (red) and ferromagnetic (black) particles ($y_p - y_{p0}$) vary with the time $t$ when the magnetic field is applied at $0^\circ$; (c) The evolution of orientation angle $\phi$ and (d) the lateral migration, ($y_p - y_{p0}$), of paramagnetic (red) and ferromagnetic (black) particles vary with the time $t$ when the magnetic field is applied at $90^\circ$.
7. PARTICLE LATERAL MIGRATION IN A PLANE POISEUILLE FLOW IN A MICROCHANNEL
While the previous findings are obtained for particles suspended in simple shear flows (constant shear rate), we expect that they are qualitatively valid for Poiseuille flows, which are the predominant form of flow in practical applications. In this section, we study particle lateral migration in a plane Poiseuille flow in a microchannel. The numerical model is shown in Figure 11(b). The width and length of the channel are $W = 50 \, \mu m$ and $L = 1200 \, \mu m$, respectively. The initial particle-wall separation distance is $y_{p0} = 12 \, \mu m$. Water is the
most commonly used fluid medium, thus we use water as the fluid in this simulation. The average inlet flow velocity is 2.5 mm/s, resulting Reynolds number $\text{Re} = 0.125$. As we have discussed in Section 6, the separation is possible when the magnetic field is applied at $0^\circ$ and $90^\circ$. Here, we perform simulations when the magnetic field is applied at $\alpha = 0^\circ$ and $90^\circ$. With a weak magnetic field applied, the particle lateral migration in the plane Poiseuille flow in the microchannel are shown in Figure 15(a) and (b). As can be seen, the trajectories of paramagnetic particle (red line in Figure 15) and ferromagnetic particle (black line in Figure 15) are qualitatively similar to those in a simple shear flow near a wall (Figure 11(b)).
When a strong field is used, previous discussions have indicated better separation performance when the magnetic field is applied at $\alpha = 0^\circ$; while for a moderate relative strength (still must be larger than $S_{cr}$), the field applied at $\alpha = 90^\circ$ leads to a better separation. This finding is confirmed by numerical simulations for $S = 40$ with $\alpha = 0^\circ$ and $S = 12$ with $\alpha = 90^\circ$, as shown in Figure 15(c). Note that the parabolic velocity profile does affect the critical strength, and $S = 12$ is used to impede particle rotation. Nevertheless, the conclusions from simple shear flows apply qualitatively to pressure driven flows in a channel.
8. CONCLUSION
In this work, we developed a multi-physics numerical model to investigate the rotational dynamics of paramagnetic and ferromagnetic particles that have elliptical shape, in a simple shear flow and under a uniform magnetic field. We investigated the effects of strength and direction of the magnetic field on rotational dynamics of paramagnetic and ferromagnetic particles. The results show that the symmetry of rotational velocity is modified by the magnetic field. When the magnetic field strength increases to a large enough value (the critical magnetic field strength), the particle rotation is impeded. In a weak field regime (below the critical magnetic field), the particle complete a full rotation, and the symmetrical property of particle rotations depend on the direction of the magnetic field. For the same strength and direction of the magnetic field, paramagnetic and ferromagnetic particles exhibit different asymmetric rotational behaviors. In the strong field (above the critical strength), the particles are pinned at their respected steady angles, which depend on the direction of magnetic field. The steady angles of paramagnetic and ferromagnetic particles are different for the same magnetic field strength and direction. The numerical results have very good agreement with that of theoretical analysis.
Based on the findings of the particle rotational dynamics, the lateral migration of paramagnetic and ferromagnetic elliptical particles in a simple shear flow near the wall is investigated. The results show that the paramagnetic and ferromagnetic particles have
different lateral migration motions for the same flow and magnetic conditions. Thus, we can separate these two kinds of particles in a simple shear flow under the magnetic field. Finally, the lateral migration of paramagnetic and ferromagnetic particles in a pressure-driven channel flow is investigated. Paramagnetic and ferromagnetic particles in pressure-drive flows behave qualitatively similar to those in simple shear flows, suggesting a useful strategy to manipulate non-spherical micro-particles in the microfluidic devices.
REFERENCES
Ai, Y., Beskok, A., Gauthier, D. T., Joo, S. W., and Qian, S., ‘Dc electrokinetic transport of cylindrical cells in straight microchannels,’ Biomicrofluidics. 2009a, 3(4), p. 044110.
Ai, Y., Joo, S. W., Jiang, Y., Xuan, X., and Qian, S., ‘Pressure-driven transport of particles through a converging-diverging microchannel,’ Biomicrofluidics. 2009b, 3(2), p. 022404.
Ai, Y. and Qian, S., ‘Dc dielectrophoretic particle–particle interactions and their relative motions,’ Journal of colloid and interface science. 2010, 346(2), pp. 448–454.
Ai, Y., Zeng, Z., and Qian, S., ‘Direct numerical simulation of ac dielectrophoretic particle–particle interactive motions,’ Journal of colloid and interface science. 2014, 417, pp. 72–79.
Allan, R. and Mason, S., ‘Particle behaviour in shear and electric fields. ii. rigid rods and spherical doublets,’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1962, 267(1328), pp. 62–76.
Bucak, S., Sharpe, S., Kuhn, S., and Hatton, T. A., ‘Cell clarification and size separation using continuous countercurrent magnetophoresis,’ Biotechnology progress, 2011, 27(3), pp. 744–750.
Cao, Q., Li, Z., Wang, Z., and Han, X., ‘Rotational motion and lateral migration of an elliptical magnetic particle in a microchannel under a uniform magnetic field,’ Microfluidics and Nanofluidics, 2018, 22(1), p. 3.
Chaffey, C. and Mason, S., ‘Particle behavior in shear and electric fields. III. rigid spheroids and discs,’ Journal of Colloid Science, 1964, 19(6), pp. 525–548.
Chen, P., Huang, Y.-Y., Hoshino, K., and Zhang, J. X., ‘Microscale magnetic field modulation for enhanced capture and distribution of rare circulating tumor cells,’ Scientific reports, 2015, 5, p. 8745.
Gavze, E. and Shapiro, M., ‘Particles in a shear flow near a solid wall: effect of nonsphericity on forces and velocities,’ International Journal of Multiphase Flow, 1997, **23**(1), pp. 155–182.
Gijs, M. A., ‘Magnetic bead handling on-chip: new opportunities for analytical applications,’ Microfluidics and Nanofluidics, 2004, **1**(1), pp. 22–40.
Gijs, M. A., Lacharme, F., and Lehmann, U., ‘Microfluidic applications of magnetic particles for biological analysis and catalysis,’ Chemical reviews, 2009, **110**(3), pp. 1518–1563.
Hu, H. H., Patankar, N. A., and Zhu, M., ‘Direct numerical simulations of fluid–solid systems using the arbitrary lagrangian–eulerian technique,’ Journal of Computational Physics, 2001, **169**(2), pp. 427–462.
Jeffery, G. B., ‘The motion of ellipsoidal particles immersed in a viscous fluid,’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1922, **102**(715), pp. 161–179.
Leal, L., ‘Particle motions in a viscous fluid,’ Annual Review of Fluid Mechanics, 1980, **12**(1), pp. 435–476.
Matsunaga, D., Meng, F., Zöttl, A., Golestanian, R., and Yeomans, J. M., ‘Focusing and sorting of ellipsoidal magnetic particles in microchannels,’ Phys. Rev. Lett., 2017a, **119**, p. 198002, doi:10.1103/PhysRevLett.119.198002.
Matsunaga, D., Zöttl, A., Meng, F., Golestanian, R., and Yeomans, J. M., ‘Far-field theory for trajectories of magnetic ellipsoids in rectangular and circular channels,’ arXiv preprint arXiv:1711.00376, 2017b.
Okagawa, A., Cox, R., and Mason, S., ‘Particle behavior in shear and electric fields. VI. the microrheology of rigid spheroids,’ Journal of Colloid and Interface Science, 1974, **47**(2), pp. 536–567.
Pamme, N., ‘Magnetism and microfluidics,’ Lab on a Chip, 2006, **6**(1), pp. 24–38.
Pamme, N., ‘On-chip bioanalysis with magnetic particles,’ Current opinion in chemical biology, 2012, **16**(3-4), pp. 436–443.
Pankhurst, Q. A., Connolly, J., Jones, S., and Dobson, J., ‘Applications of magnetic nanoparticles in biomedicine,’ Journal of physics D: Applied physics, 2003, **36**(13), p. R167.
Shine, A. and Armstrong, R., ‘The rotation of a suspended axisymmetric ellipsoid in a magnetic field,’ Rheologica Acta, 1987, **26**(2), pp. 152–161.
Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Dynamics of paramagnetic and ferromagnetic ellipsoidal particles in shear flow under a uniform magnetic field,’ Physical Review Fluids, 2018, **3**(8), p. 084201.
Stratton, J. A., *Electromagnetic theory*, John Wiley & Sons, 2007.
Suwa, M. and Watarai, H., ‘Magnetoanalysis of micro/nanoparticles: A review,’ Analytica chimica acta, 2011, **690**(2), pp. 137–147.
Winkleman, A., Perez-Castillejos, R., Gudiksen, K. L., Phillips, S. T., Prentiss, M., and Whitesides, G. M., ‘Density-based diamagnetic separation: devices for detecting binding events and for collecting unlabeled diamagnetic particles in paramagnetic solutions,’ Analytical chemistry, 2007, **79**(17), pp. 6542–6550.
Zborowski, M., Sun, L., Moore, L. R., Williams, P. S., and Chalmers, J. J., ‘Continuous cell separation using novel magnetic quadrupole flow sorter,’ Journal of Magnetism and Magnetic Materials, 1999, **194**(1-3), pp. 224–230.
Zhang, J. and Wang, C., ‘Numerical study of lateral migration of elliptical magnetic microparticles in microchannels in uniform magnetic fields,’ Magnetochemistry, 2018, **4**(1), p. 16.
Zhou, R., Bai, F., and Wang, C., ‘Magnetic separation of microparticles by shape,’ Lab on a Chip, 2017a, **17**(3), pp. 401–406.
Zhou, R., Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Magnetic control of lateral migration of ellipsoidal microparticles in microscale flows,’ Physical Review Applied, 2017b, **8**(2), p. 024019.
Zhou, Y., Song, L., Yu, L., and Xuan, X., ‘Continuous-flow sheathless diamagnetic particle separation in ferrofluids,’ Journal of Magnetism and Magnetic Materials, 2016, **412**, pp. 114–122.
Zhou, Y. and Xuan, X., ‘Diamagnetic particle separation by shape in ferrofluids,’ Applied Physics Letters, 2016, **109**(10), p. 102405.
IV. DYNAMICS OF A PAIR OF ELLIPSOIDAL MICROPARTICLES UNDER UNIFORM MAGNETIC FIELDS
Jie Zhang, Ran Zhou, Cheng Wang
Department of Mechanical & Aerospace Engineering
Missouri University of Science and Technology
Rolla, Missouri 65409
Department of Mechanical and Civil Engineering
Purdue University Northwest
Hammond, Indiana, 46323
Tel: 573–341–4636. Fax: 573–341–4607
Email: [email protected]
ABSTRACT
Under a uniform magnetic field, magnetic particles tend to form chains, clusters or columns due to particle-particle interactions between the particles. The magnetic particles with non-spherical shape dispersed in liquid medium show different rheological properties. However, there is a lack of fundamental mechanism of the particle-particle interactions of non-spherical particles under the uniform magnetic field. In this work, we numerically investigate the particle-particle interactions and relative motions of a pair of paramagnetic elliptical particles by using direct numerical simulations to create two-dimensional models that resolve the magnetic and flow fields around the finite sized particles. The modeling is based on the finite element method and arbitrary Lagrangian-Eulerian approach with a full consideration of particle-fluid-magnetic field interaction. The effects of initial position and aspect ratio of the particles are investigated. The results show that the particles spend much more time for the global reorientation than for the local magneto-orientation. Larger initial
relative angles and distances, and larger aspect ratios tend to require more time to form a stable chain. The particle-particle interactions and relative motion of a pair of elliptical particles in this study provide insights on the particle alignment and chaining processes under uniform magnetic fields, which are closely related to the response of magneto-rheological fluids to magnetic fields.
**Keywords:** microfluidics, magnetic field, particle interactions, elliptical particles, direction numerical simulation
1. INTRODUCTION
Due to their significant advantages, magnetic particles have been used in various applications, which includes chemical, biomedical, biological and industrial fields (Gijs, 2004; Gijs et al., 2009; Jamshaid et al., 2016). Under an external magnetic field, magnetic microparticles or nanoparticles immersed in non-magnetic fluid tend to form chains, clusters or columns due to the particle-particle interaction between the particles. The suspension consisting of high density magnetic microparticles or nanoparticles is called as magnetorheological fluids (MRFs) (De Vicente et al., 2011). The MRFs are smart materials which show various rheological properties, such as yield stress and apparent viscosity. The values of these rheological properties are increased to several orders of magnitude under the appropriately applied magnetic field. Due to their remarkable properties and the quick response to the magnetic field, MRFs are good candidates for a vast number of industrial and medical applications, such as magnetorheological rotor damper, brakes, clutches, valves and cancer therapeutic (Bica et al., 2013; Rabinow, 1948; Sheng et al., 1999). In addition, magnetic particles have been also used in a wide number of microfluidic applications since it is easy and wireless manipulated by the external magnetic field. Cell separation is one of most important areas benefiting from those applications (Hejazian et al., 2015). The cells digested with magnetic nanoparticles or attaching magnetic microparticles to the cell surface could easily be manipulated by the magnetic field (Gijs et al., 2009).
A pair of magnetic particles suspended in a quiescent fluid is a basic model to investigate the particle-particle interactions in particle suspensions. There are many numerical investigations on the motion of magnetic spherical particles under the magnetic field. The particle-based numerical method are the most popular one, which is based on point-dipole approximation and stokes drag law (Melle and Martin, 2003; Petousis et al., 2007; Stuart et al., 2011). The particle is modeled as a dipole point and the dipole-dipole model is applied to study the particle-particle interactions between the particles. However, the particle-particle interactions due to the hydrodynamic and magnetic effects are neglected in this method, which may result in the quantitatively inaccurate or even erroneous results. More precise models are introduced to investigate the field-induced coupling and hydrodynamic interactions between the particles. Keaveny and Maxey (Keaveny and Maxey, 2008) reported a dipole model including the locally higher-order multipoles to resolve the near-field magnetic interactions between two paramagnetic particles. To consider both hydrodynamic and magnetic interactions between the particles, Gao et al. (Gao et al., 2012) reported a particle-based numerical scheme by using magnetic dipole moments and extended forms of the Oseen-Burgers tensor to study the dynamics of magnetic particle chains in a viscous fluid under the rotating magnetic field. Their numerical results are qualitatively and quantitatively in agreement with the results obtained from video-microscopy experiments. Kang et al. (Kang et al., 2013, 2008) presented a direct numerical simulation model based on finite element method(FEM) and fictitious domain method to solve both two-and three-dimensional flow problems with paramagnetic particles in a non-magnetic fluid under both uniform and rotating magnetic field. The magnetic force acting on the particles are computed through the divergence of Maxwell stress tensor, and works as a body force applied to the momentum equation. Suh and Kang (Kang and Suh, 2011; Suh and Kang, 2011) introduced a direct numerical simulation model based on immersed-boundary finite volume method to solve two-dimensional motion of paramagnetic particles in a viscous fluid under
the uniform magnetic field. They have the similar particle trajectories of two magnetic particles under the uniform magnetic field as two-dimensional simulations in Kang’s paper (Kang et al., 2008).
In regard to the practical application, the complex shapes are also one of the most important properties of the magnetic particles. Recently, the experimental (Anupama et al., 2018; Bell et al., 2008, 2007; Bombard et al., 2014; de Vicente et al., 2010; Dong et al., 2015; Jiang et al., 2011; López-López et al., 2009, 2007; Morillas et al., 2015; Ngatu et al., 2008; Sedlacik et al., 2013) and theoretical (Bossis et al., 2015; De Vicente et al., 2009; Kuzhir et al., 2009) investigations reported that the MRFs with non-spherical particles have stronger magnetorheological properties and better sedimentation stability compared to those with spherical particles. Thus, it is urgent need of an better understanding of the particle-particle interactions and motion behaviors of non-spherical particles under the magnetic field. Even though previous numerical methods have been successfully applied to magnetic spherical particles, there has been limited simulations on two non-spherical particles. Recently, Abbas and Bossis (Abbas and Bossis, 2017) numerically and theoretically investigated the dynamics of two ellipsoidal ferromagnetic particles under the externally alternating magnetic field. They reported that two ellipsoidal ferromagnetic particles repelled with each other due to hydrodynamic interactions under the alternating magnetic field. Despite lots of experimental studies on non-spherical particles, there has little work been done to study the basic particle-particle interactions of magnetic non-spherical particles under a uniform magnetic field.
In this study, we developed a transient multi-physics numerical model to investigate the particle-particle interactions and relative motions of a pair of paramagnetic elliptical particles under an uniform magnetic field. Numerical simulations will be performed by direct numerical simulation(DNS) based on finite element method and arbitrary Lagrangian-Eulerian(ALE) approach. The fluid field, magnetic field and particle motion are coupled and solved by using moving mesh based on ALE approach. For computational efficiency,
we have chosen to use two-dimensional (2D) simulations in order to study a wide range of parameters (i.e., magnetic field direction, initial particle-particle distance, and particle aspect ratio). Prior studies have shown that 2D numerical simulations are able to qualitatively capture the characteristics of the motion of a pair of spherical particles (Ai and Qian, 2010; Ai et al., 2014; Kang and Suh, 2011; Kang et al., 2013, 2008; Suh and Kang, 2011). Here, we have also validated the numerical model with previous studies in Section 3.1 (motion of a pair of circular particles) and 3.2 (motion of a single elliptical particle).
2. NUMERICAL METHOD
2.1. MATHEMATICAL MODEL
We consider a pair of identical rigid prolate elliptical particles immersed in a quiescent fluid in a square with a length of $L$ as shown in Figure 1. $\Omega$ represents the entire computational domain, which includes fluid and two particle domains. $\Gamma_1$ and $\Gamma_2$ are the particle surfaces of those two particles. The center of the square is set as the origin of the Cartesian coordinate system. Two particles are set as axis-symmetric to the center of the square with the center-to-center distance of $d$ and the relative angle of $\theta$ with respect to the positive $x$-axis. The major and minor semi-axis lengths of the particles are $a$ and $b$, so the particle aspect ratio is defined as $r_p = a/b$. The orientation angle of the particle, $\alpha$, is defined as the angle between the major axis of the particle and the positive $x$-axis. A uniform magnetic field, $\mathbf{H}_0$, is applied at the positive $x$ direction.
The fluid is considered as an incompressible, Newtonian, and non-magnetic with the constant density of $\rho_f$, dynamic viscosity of $\eta_f$ and magnetic susceptibility of $\chi_f$. The particles are paramagnetic with magnetic susceptibility of $\chi_p$. The transient flow field, $\mathbf{u}$, in the fluid domain is governed by the continuity equation and Navier-Stokes equation:
$$\nabla \cdot \mathbf{u} = 0,$$ \hspace{1cm} (1)
\[ \rho_f \left[ \frac{\partial \mathbf{u}}{\partial t} + (\mathbf{u} \cdot \nabla) \mathbf{u} \right] = -\nabla p + \nabla \cdot \eta_f \left( \nabla \mathbf{u} + (\nabla \mathbf{u})^T \right), \tag{2} \]
where \( p \) and \( t \) are the pressure and the time, respectively. The open boundary conditions are set on boundaries ABCD, so that the fluid can both enter and leave the computational domain though boundaries. Here, the normal stress is zero on boundaries ABCD.
**Figure 1.** Schematic of Numerical Model of two elliptical particles suspended in a quiescent flow under the influence of a uniform magnetic field.
The particle surface is assumed as the no-slip condition, so the fluid velocities on the particle surface \( \Gamma_1 \) and \( \Gamma_2 \) are expressed as:
\[ \mathbf{u}_i = \mathbf{U}_{pi} + \omega_{pi} \times (\mathbf{x}_{si} - \mathbf{x}_{pi}), \tag{3} \]
where \( i = 1 \) and 2 representing the first and second particle. \( \mathbf{U}_{pi} \) and \( \omega_{pi} \) are the translational and rotational velocities of the \( i \)th particle, respectively. \( \mathbf{x}_{si} \) and \( \mathbf{x}_{pi} \) are the position vectors of the surface and the center of the \( i \)th particle, respectively.
The hydrodynamic stress tensor on the particle surface $\Gamma_i$ are:
$$\tau_{hi} = \eta_f \left( \nabla u_i + (\nabla u_i)^T \right).$$ \hspace{1cm} (4)
Thus, the hydrodynamic force and torque acting on the particle are expressed as:
$$F_{hi} = \int (\tau_{hi} \cdot n) d\Gamma_i,$$ \hspace{1cm} (5)
$$L_{hi} = \int (\tau_{hi} \times (x_{si} - x_{pi}) \cdot n) d\Gamma_i,$$ \hspace{1cm} (6)
The magnetic field in the entire domain $\Omega$ is governed by the static Maxwell equations:
$$\nabla \times H = 0,$$ \hspace{1cm} (7)
$$\nabla \cdot B = 0,$$ \hspace{1cm} (8)
where $H$ and $B$ are the magnetic field and the magnetic flux density, respectively. The constitutive equation describing the relationship between magnetic field and magnetic flux density is $B = \mu H$, where $\mu$ is the magnetic permeability of a linear isotropic material. The relationship between magnetic permeability and magnetic susceptibility is $\mu = \mu_0 (1 + \chi)$, where $\mu_0 = 4\pi \times 10^{-7}$ H/m is the magnetic permeability in vacuum.
The uniform magnetic field is applied by setting a magnetic scalar potential difference between boundaries AC and BD. A magnetic potential $V_m = V_{m0}$ and a zero magnetic potential $V_m = 0$ are set on boundaries AC and BD, respectively. The magnetic potential and magnetic field are related by $H = -\nabla V_m$. The boundaries AB and CD are set as magnetic insulation condition.
The magnetic force and torque acting on the particles are expressed as (Stratton, 2007):
$$F_{mi} = \int (\tau_{mi} \cdot n) d\Gamma_i,$$ \hspace{1cm} (9)
\[ L_{mi} = \int (\tau_{mi} \times (x_{si} - x_{pi}) \cdot n) d\Gamma_i, \]
(10)
where \( \tau_{mi} = \mu(HH - \frac{1}{2} H^2 I) \) is the Maxwell stress tensor on the \( i \)th particle surface \( \Gamma_i \), \( H^2 = H \cdot H \), \( I \) is the identity tensor.
The \( x-y \) plane is the plane of the rotational motion for the two-dimensional elliptical particles, thus \( \omega_{pi} = \omega_{pi} e_z \), \( L_{hi} = L_{hi} e_z \), and \( L_{mi} = L_{mi} e_z \). The Newton’s second law and Euler’s equation are used to describe the translation and rotation of the particles, which are governed by:
\[ m_{pi} \frac{dU_{pi}}{dt} = F_{hi} + F_{mi}, \]
(11)
\[ I_{pi} \frac{d\omega_p}{dt} = L_{hi} + L_{mi}, \]
(12)
where \( m_{pi} \) and \( I_{pi} \) are the mass and the moment of inertia of the \( i \)th particle, respectively.
The particle trajectories of the \( i \)th particle are calculated by:
\[ x_{pi}(t) = x_{pi}(0) + \int_0^t U_{pi}(t') dt', \]
(13)
\[ \alpha_i(t) = \alpha_i(0) + \int_0^t \omega_{pi}(t') dt', \]
(14)
where \( x_{pi}(t) = (x_{pi}, y_{pi}) \) is the position of the \( i \)th particle center; \( \alpha_i(t) \) is the orientation angle of the \( i \)th particle. Due to the axis-symmetric property, \( \alpha_1 \) and \( \alpha_2 \) have the same values. Thus, in the following discussion, \( \alpha \) is used to represent both orientation angles.
The coupling of the particle motions, the flow field, and the magnetic field is through Equations (3)-(6) and (9)-(12). The direct numerical simulation (DNS) based on finite element method(FEM) and arbitrary Lagrangian-Eulerian(ALE) approach is used to calculate the magnetic field, flow field and particle motion at the same time. In the previous researches, Hu et al. (Hu et al., 2001), Ai et al. (Ai et al., 2009a,b; Ai and Qian, 2010; Ai et al., 2014) and previous simulations (Zhang et al., 2018; Zhang and Wang, 2018) employed the similar methodologies successfully applying to fluid-solid systems. The commercial
FEM solver – COMSOL Multiphysics is used to implement and solve the numerical model. The two-way coupling of particle-fluid-magnetic interaction model is solved by using a time-dependent solver through the ALE method, which solves the magnetic field in the entire domain, the fluid field in a Eulerian(deformed) frame, and tracks the particle motion in a Lagrangian(undeformed) frame at the same time. The moving meshing interface is used to track the deformation of the fluid domain where the meshes are free to deform. The meshes of particle domain are fixed which is determined by their trajectories and orientations. As the mesh deforms, the mesh distortion is increased. When the distortion value is increased to 0.3, the re-meshing process initiates. In this simulation, we used quadratic triangular elements in the entire domain. To accurately calculate the hydrodynamic force and torque, as well as magnetic force and torque acting on the particle, fine meshes are applied around the particle surfaces and finer meshes are applied around the tips of the particles. The total number of elements was about 16,000 in the entire domain and about 120 elements on each particle surface to obtain stable and mesh-independent results.
2.2. MATERIAL PROPERTIES
In this numerical study, water is used as the nonmagnetic fluid \((\chi_f = 0)\). The density and dynamic viscosity of the water are \(\rho_f = 1000 \text{ kg/m}^3\) and \(\eta_f = 1 \times 10^{-3} \text{ Pa·s}\) in the room temperature, respectively. The particle is assumed to be polystyrene paramagnetic particles containing magnetic nanoparticles, similar to those used in previous experiments (Zhou et al., 2017a,b). The density and magnetic susceptibility of the particle are \(\rho_p = 1100 \text{ kg/m}^3\) and \(\chi_p = 0.26\), respectively. The equivalent radius of the particle used in this simulation is \(R_0 = 3.5 \mu\text{m}\) and the side length of the square domain is \(L = 50R_0\), which is large enough for this work according to Ref (Ai et al., 2014). The magnetic field strength is \(H_0 = 10,000 \text{ A/m}\).
3. RESULTS AND DISCUSSION
3.1. PARTICLE INTERACTION OF A PAIR OF CIRCULAR PARTICLES
In this section, as a validation of the numerical model, we compare the simulation results from our numerical model to the results from references for particle interaction of a pair of circular particles. When two circular particles suspended in the quiescent flow under a uniform magnetic field, the net forces acting on the particles have the equal magnitude but opposite directions. The directions of those two forces generated by magnetic interactions are changed with time except for the cases where the center-to-center line of the particles is perpendicular or parallel to the magnetic field. In these cases, the magnetic interaction between those two particles under the uniform magnetic field could be either attractive or repulsive, which depends on the center-to-center angle $\theta$. According to the simulation results from Ref. (Kang et al., 2008), the critical angle $\theta_c$ is approximately $45^\circ$, i.e. the magnetic force is attractive when $\theta < 45^\circ$, while it is repulsive when $\theta > 45^\circ$.
Figure 2. (a) Trajectories of the centers of the two circular particles under the uniform magnetic field at the five initial relative angles $\theta_0 = 0^\circ$, $\theta_0 = 20^\circ$, $\theta_0 = 45^\circ$, $\theta_0 = 80^\circ$ and $\theta_0 = 90^\circ$; (b) The dimensionless center-to-center distance, $d^*$, varies with dimensionless time, $t^*$. The dash line is a circle of radius 4 where initial positions of the particles are located.
To compare our simulation results with results in Ref. (Kang et al., 2008), we investigate the same initial positions, i.e. the constant initial center-to-center distance $d_0 = 4R_0$ for the initial relative angle $\theta_0 = 0^\circ$, $20^\circ$, $45^\circ$, $80^\circ$ and $90^\circ$. Here, particle position and center-to-center distance is dimensionless by the particle equivalent radius, $R_0$, i.e. $x^* = x/R_0$, $y^* = y/R_0$ and $d^* = d/R_0$. The dimensionless time is defined as $t^* = t/\tau_m$. For a linear magnetization of the particle we considered in this work, $\tau_m = \eta_f/(\mu_0 \chi_f^2 H_0^2)$ is referred to as the magnetoviscous time constant (Shine and Armstrong, 1987), which represents a characteristic time to measure the relative effect between viscous and magnetic stresses. Figure 2 shows the dimensionless particle trajectories and center-to-center distance of a pair of circular particles under the uniform magnetic field for different initial relative angles when dimensionless initial center-to-center distance $d_0^* = 4$. As we can see, the trajectories of the particles for $\theta_0 = 0^\circ$, $20^\circ$, $45^\circ$, $80^\circ$ and $90^\circ$ in Figure 2a are the similar as in Ref. (Kang et al., 2008). The two particles are aligned with the magnetic field regardless of the initial relative angle, $\theta_0$, except for the case of $\theta_0 = 90^\circ$. When $\theta_0 = 90^\circ$, the two particle move away from each other. However, these positions are highly unstable. If there was a small disturbance acting on the particles, the two particles will also be aligned to the direction of magnetic field for the initial relative angle of $90^\circ$. From Figure 2b, we can see that the dimensionless distance, $d^*$, decreases monotonously with dimensionless time, $t^*$, when $\theta_0 = 0^\circ$. It means that the two particles attract with each other and move towards with each other. As $\theta_0$ increases, the decreasing rate becomes slower, meaning that the attractive force between two particles becomes weaker. When $\theta_0 = 80^\circ$, $d^*$ increases first and then decreases with dimensionless time, $t^*$, meaning that two particles first repulse with each other and then attract with each other. When $\theta_0 = 45^\circ$, $d^*$ increases monotonously with $t^*$, meaning that there are just attractive forces between the particles. These findings are also the same as in Ref. (Kang et al., 2008). Therefore, this simulation method has been validated to be sufficiently accurate to study the dynamics of a pair of paramagnetic particles under the uniform magnetic field.
3.2. MAGNETO-ORIENTATION OF A SINGLE PROLATE ELLIPTICAL PARTICLE
In this section, we investigate the local magneto-orientation of a single prolate elliptical paramagnetic particle under a uniform magnetic field. Uniform magnetic fields are frequently used to align paramagnetic or ferromagnetic materials in the liquid medium. Assuming the magnetic susceptibility of the particle is homogeneous, the particle can also undergo magnetic orientation if its shape is anisotropic (Yamaguchi et al., 2006). The induced magnetic moment of the particle depends on both magnetic susceptibility and particle shape. When a magnetic particle is placed in a uniform magnetic field, the demagnetizing field is induced. As a result, the particle with isotropic magnetic susceptibility tends to be aligned to its major axis parallel to the magnetic field where the magnetic energy is minimum (Figure 3a). When its major axis is perpendicular to the magnetic field, the particle is in an equilibrium state, but is unstable. Once there is a small disturbance, the particle tends to reorient itself to the direction where its major axis is parallel to the magnetic field.
**Figure 3.** (a) A diagram of the magneto-orientation process for $r_p = 3$ when the magnetic field is directed left to right; (b) The self-orientation angle of a single prolate elliptical particle, $\alpha$ as a function of dimensionless time, $t^*$, for different aspect ratios.
Figure 3b shows the simulation result of the orientation angle of the particle, $\alpha$, of a single elliptical particle varying with the dimensionless time, $t^*$ for different aspect ratio, where the initial angle between the major axis of the particle and the magnetic field $\alpha_0 = 85^\circ$. To compare the effect of aspect ratio on the particle rotation, the relaxation time is defined as the time required for the particle rotating from initial angle to the orientation angle $\alpha$ falling below 1% of its initial angle. From the figure 3b, we can see the effect of aspect ratio, $r_p$, on the dimensionless relaxation time, $t^*$. For a circular particle, there is no net magnetic torque acting on the particle under a uniform magnetic field, so the relaxation time is considered as infinite. For a nearly circular particle, we can except it has a larger relaxation time due to a smaller torque acting on the particle. From the figure 3b, we can see that the relaxation time of the particle with aspect ratio $r_p = 1.5$ is the longest among these seven cases. The relaxation time is reduced when $r_p$ increases from 1.5 to 3 as shown in the solid line in Figure 3b. We also can see that the minimum relaxation time is achieved when $r_p = 3$ among those seven cases. As the aspect ratio continues to increase, the relaxation time is increased as shown in the dash line in Figure 3b. Those results have quantitative agreement with the theory from Ref. (Shine and Armstrong, 1987), where the relaxation time is first decreased and then increased as the aspect ratio is increased.
3.3. TWO PARTICLES: COMBINED MAGNETO-ORIENTATION AND GLOBAL REORIENTATION
In this section, we investigate the interaction of two particles for different orientation angle, $\alpha$. Initially, two particles with $r_p = 2$ are placed at $(x^*, y^*) = [\pm 2.2 \cos(80^\circ), \pm 2.2 \sin(80^\circ)]$ under an external magnetic field $H_0 = 10,000$ A/m along the $x$ axis, i.e. $d_0^* = 2.2$ and $\theta_0 = 80^\circ$. Figure 4 shows particle trajectories and orientation angle as a function of dimensionless time for three different initial orientation angles. To see the combination effect of the local
magneto-orientation and global reorientation and how it influences the particle interactions, we compare the relaxation time spending for the magneto-orientation to the relaxation time for the global reorientation.
Figure 4. The orientation angle of the particle, $\alpha$, and particle trajectory as a function of dimensionless time, $t^*$, for three initial orientation angle $\alpha_0 = 80^\circ$ (a), $90^\circ$ (b) and $110^\circ$ (c). The initial position of the particles are $d_0^* = 2.2$ and $\theta_0 = 80^\circ$.
As can be seen, for initial orientation angle $\theta_0 = 80^\circ$, the particles first have a clockwise local magneto-orientation from $80^\circ$ to $0^\circ$, and then spend most of time for the global reorientation. Specifically, in this case, the local magneto-orientation is completed by $t^* = 125$, while the global reorientation requires about $t^* = 642$. There is a similar results for $\theta_0 = 100^\circ$, but the particles have an anticlockwise local orientation and spend longer time in global reorientation than $\theta_0 = 80^\circ$. The particles require $t^* = 133$ to complete the local magneto-orientation, while require $t^* = 1553$ to complete the global reorientation. In a special case when $\theta_0 = 90^\circ$, there is just local magneto-orientation as shown in Figure 4(b). Thus, we can see that those two particles will spend much less time in the local magneto-orientation than global reorientation with the arbitrary initial orientation angle except for $\theta_0 = 90^\circ$ where there is just local magneto-orientation. Since the global reorientation of the particles is what we are most interested in, it is reasonable to assume the particles have already completed the local magneto-orientation process and just simulate the global reorientation process for particles of different conditions.
### 3.4. TWO PARTICLES: PARALLEL($\theta_0 = 0^\circ$) OR PERPENDICULAR($\theta_0 = 90^\circ$) TO MAGNETIC FIELD
First, we consider the cases when the center-to-center line of two particles is parallel($\theta_0 = 0^\circ$) or perpendicular($\theta_0 = 90^\circ$) to the magnetic field when the initial orientation angle $\alpha_0 = 0^\circ$. Figure 5 shows the magnetic field around the two particles when the magnetic field is applied at $x$ direction. We can see that the magnetic field around those two particles is symmetric to each other. This symmetric field leads to the magnetic force that is attractive ($\theta_0 = 0^\circ$) or repulsive ($\theta_0 = 90^\circ$) while no magnetic torque is acting on the particles, so there is no global reorientation for those two particles. When $\theta_0 = 0^\circ$, the region between the particles has a strong magnetic field, resulting in the total mutual magnetic force which drives the particles toward each other along the center-to-center line. When $\theta_0 = 90^\circ$, the region between the particles has a weak magnetic field, resulting in the total mutual
magnetic force which drives the particles away from each other along the center-to-center line. These findings are similar to the circular particles in Section 3.1. However, it’s worth mentioning that the particles are even more unstable for elliptical particles than circular particles when $\theta_0 = 90^\circ$. Even a small disturbance could lead to the particles deviating from the perpendicular position.
**Figure 5.** Magnetic field around two particles when the initial relative angle is $0^\circ$ (a) and $90^\circ$ (b).
### 3.5. TWO PARTICLES: GLOBAL REORIENTATION AT ARBITRARY INITIAL POSITION ($0^\circ < \theta_0 < 90^\circ$)
Generally, the initial orientation of two particles is an arbitrary angle other than two critical angles we mentioned before. Thus, it is more practical to understand the particle-particle interaction and relative motion of two arbitrarily oriented particles.
The global reorientation of two elliptical particles with aspect ratio $r_p = 2$ when $\alpha_0 = 0^\circ$ are shown in Figure 6. Initially, the particles are placed at $(x^*, y^*) = [\pm 2.4 \cos(80^\circ), \pm 2.4 \sin(80^\circ)]$, i.e. $d_0^* = 2.4$ and $\theta_0 = 80^\circ$. At the starting position (i.e. $t^* = 0$), the magnetic field around the particles is asymmetric to either $x$ axis or $y$ axis, but axisymmetric to the midpoint of center-to-center line. Specifically, it generates a weaker magnetic field between the particles than outside of the particles, resulting in net repulsive magnetic forces and net
torques acting on the particles. However, the magnetic field is axisymmetric to the midpoint of center-to-center line of the particles, so those forces and torques have the equal magnitude but opposite direction, which causes the particles moving away from each other in both vertical and horizontal direction. As the particles move, the vertical force become weaker. When the particles move to the position at $t^* = 242$, the vertical magnetic force becomes zero, just remain horizontal force, where the center-to-center distance in y direction reaches the maximum. As the particles continue to move, the asymmetry magnetic field between the particles causes the vertical magnetic forces to attractive, while the horizontal forces stay repulsive, where the vertically attractive forces become weaker and the horizontally repulsive forces become stronger. When the particles move to the position at $t^* = 762$, the horizontal forces become zero, just remain vertical forces, where the center-to-center distance in x direction reach the maximum. As the particles continue moving, the horizontal and vertical forces are both attractive, resulting in the particles moving towards each other. Finally, at $t^* = 1160$, the particles touch with each other to form a stable chain with a small final global orientation angle $\theta_f = 0.20^\circ$. The corresponding velocity field demonstrated our analysis as shown in Figure(a3-d3).
To systematically investigate the global reorientation of two particles, the effect of some important factors on the particle-particle interaction will be studied in the following subsections.
3.5.1. **The Effect of Initial Relative Angle Between Two Particles.** First, we investigate the effect of initial relative angle between two particles, $\theta_0$, on the particle-particle interaction. Initially, the particles with aspect ratio $r_p = 2$ are placed at $(x^*, y^*) = [\pm 2.4 \cos(\theta_0), \pm 2.4 \sin(\theta_0)]$ for different initial center-to-center distance, $\theta_0$, as shown as cross dots in Figure 7(a). As can be seen Figure 7(a) and (b), the particles spend more time for the whole process, and particle trajectory becomes longer as $\theta_0$ increases from $20^\circ$ to $80^\circ$.
Figure 6. Global reorientation of two elliptical particles with $r_p = 2$, $d_0^* = 2.4$ and $\theta_0 = 80^\circ$ for different time (a1-d1), where the magnetic field is applied left to right. The straight and curve vectors represent magnetic force $F_m$ and torque $T_m$, respectively. The corresponding magnetic and velocity fields around the particles are shown as (a2-d2) and (a3-d3) on the right side.
We can see from Figure 7(b) that, when the initial orientation angle $\theta_0 = 80^\circ$ and $60^\circ$, the dimensionless center-to-center distance, $d^*$, first increases and then decreases with dimensionless time, $t^*$; when $\theta_0 = 20^\circ$, $d^*$ decreases with $t^*$. These findings are similar to circular particles discussed in Section 3.1. However, when $\theta_0 = 40^\circ$, the dimensionless distance varying with dimensionless time has the similar result as $\theta_0 = 80^\circ$ and $60^\circ$: $d^*$ first increases and then decreases with $t^*$. It means that the critical angle, $\theta_c$, of the elliptical
Figure 7. The effect of initial relative orientation angle between the particles on the particle-particle interaction. (a) Trajectories of particle centers, (b) center-to-center distance varying with dimensionless time, (c) the relative angle between the particles varying with dimensionless time, (d) the orientation angle of the particles varying with dimensionless time when $r_p = 2$ and $d_0^* = 2.4$. The cross and star dots represent the starting point and the ending point, respectively.
Particles with $r_p = 2$ is smaller than $40^\circ$, which is different from the critical angle of circular particles. In addition, as $\theta_0$ increases, the increasing and decreasing rates become steeper and the maximum $d^*$ become larger. For a fixed relative orientation angle $\theta$, it decreases monotonously with time shown in Figure 7(c). The final global orientation angle when the particles touch are $\theta_f = 0.54^\circ, 0.51^\circ, 0.35^\circ$ and $0.20^\circ$ for $\theta_0 = 20^\circ, 40^\circ, 60^\circ$ and $80^\circ$, respectively. So we can see it becomes smaller as the initial orientation angle becomes larger. There is a similar results for the final particle orientation angle: it becomes smaller as $\theta_0$ becomes larger. From Figure 7(d), we can see that the particle orientation angle
changes drastically. As time elapses, it increases first and then decreases. When it reaches a minimum, it increases and then decreases again until the particles touch. There are two increasing-and-decreasing circles, which are due to the change of direction of magnetic torque.
Figure 8. The effect of initial center-to-center distance on the particle-particle interaction. (a) Trajectories of particle centers. (b) center-to-center distance varying with dimensionless time. (c) the relative angle between the particles varying with dimensionless time, (d) the orientation angle of the particles varying with dimensionless time when $r_p = 2$ and $\theta_0 = 80^\circ$. The cross and star dots represent the starting point and the ending point, respectively.
3.5.2. The Effect of Initial Center-to-Center Distance. Then, we investigate the effect of initial center-to-center distance between two particles, $d_0^*$, on the particle-particle interaction. Initially, the particles with aspect ratio $r_p = 2$ are placed at $(x^*, y^*) = [\pm d_0^* \cos(80^\circ), \pm d_0^* \sin(80^\circ)]$ when initial center-to-center distance, $d_0^*$, varies from 1.1 to
3.0 as shown as cross dots in Figure 8(a). As can be seen from Figure 8(a) and (b), the particles spend more time for the whole process and particle trajectory becomes longer when $d_0^*$ increases from 1.1 to 3.0. There is a similar result for $d_0^*$ as we discussed in Section 3.5.1: it first increases and then decreases with $t^*$ when $d_0^* = 1.5, 2.0, 2.4$ or 3.0. The result is different for $d_0^* = 1.1$: it increases monotonously with $t^*$. The particle orientation angle varying with time shown as black line in Figure 8(b) demonstrates that the magnetic torque has much more influence on the particle-particle interaction when the two particles are so closer. In addition, the change rule for $d_0^* = 1.1$ is also different: it has just one increasing-and-decreasing circle, while other relative distances have the similar results as in Section 3.5.1: two increasing-and-decreasing circles happens. For the final relative orientation angle shown in Figure 8(c), it becomes smaller as the initial center-to-center distance becomes larger. Specifically, $\theta_f = 4.04^\circ, 0.80^\circ, 0.24^\circ, 0.20^\circ$ and $0.06^\circ$ for $d_0^* = 1.1, 1.5, 2.0, 2.4$ and 3.0, respectively. From Figure 8(d), the final particle rotation angle becomes smaller as the initial center-to-center distance becomes larger.
3.5.3. The Effect of Particle Aspect Ratio. Here, we investigate the effect of particle aspect ratio, $r_p$, on the particle-particle interaction. To compare the effect of $r_p$ on the particle-particle interaction, the particle trajectories and the center-to-center distance are dimensionless by its major semi-axis length $a$, where $a = \sqrt{r_p} * R_0$. Figure 9(a) and (b) show the particle trajectories and particle center-to-center distance for $r_p = 1, 2$ and 3. We can see that, as $r_p$ becomes larger, the particle trajectory becomes longer and the particles spend more time for the whole process. What’s more, the maximum of $d^*$ becomes larger and the overall increasing rate from beginning to the maximum becomes smaller as $r_p$ becomes larger. For the final relative orientation angle and particle orientation angle shown in Figure 9(c) and (d), they become larger as the initial orientation angle becomes larger. Specifically, $\theta_f = 0^\circ, 0.06^\circ, 0.30^\circ$, and $\alpha_f = 0^\circ, 0.09^\circ, 0.22^\circ$ for $r_p = 1, 2, 3$, respectively.
Figure 9. The effect of particle aspect ratio on the particle-particle interaction. (a) Trajectories of particle centers, (b) center-to-center distance varying with dimensionless time, (c) the relative angle between the particles varying with dimensionless time, (d) the orientation angle of the particles varying with dimensionless time when $d_0^* = 2.4$ and $\theta_0 = 80^\circ$. The cross and star dots represent the starting point and the ending point, respectively.
4. CONCLUSION
The two-dimensional models of particle-particle interactions and relative motions of a pair of paramagnetic particles of elliptical shapes are numerically investigated using the direct numerical simulations based on the finite element method and arbitrary Lagrangian-Eulerian approach. The numerical modeling considers the particle-fluid-magnetic field interaction. By validating against previous numerical solutions for circular particles, our numerical model was shown to be able to accurately describe the dynamics of a pair of paramagnetic non-spherical particles under the uniform magnetic field. The rotational
dynamics of a single elliptical paramagnetic particle is first investigated. The simulation results are in qualitative agreement with the theory of Shine and Armstrong (Shine and Armstrong, 1987). By investigating the effect of the particle initial orientation angle on the local and global magneto-orientation of a pair of elliptical particles, it shows that the local orientation process is much faster than the global orientation. According to this finding, we focused our simulations on the relative motion of a pair of particles when the initial orientation angle is $0^\circ$ (i.e. the initial major axis is parallel to the magnetic field). Based on this model, we investigated the influence of the initial relative angle and distance of the particles, aspect ratio on the particle-particle interactions and relative motions of two particles. The results show that the particles of larger initial relative angles and distances need more time to form a stable chain and smaller final particle and global relative orientation angles. For a larger particle aspect ratio, more time is required to form a chain, and the final particle and global relative orientation angles are larger. Therefore, this work provides useful information for the fundamental particle-particle interactions mechanism in the magnetic particle suspensions under a uniform magnetic field.
ACKNOWLEDGMENTS
The authors gratefully acknowledge the support from the Department of Mechanical and Aerospace Engineering (MAE) and the Center for Biomedical Research (CBR) at Missouri University of Science and Technology.
REFERENCES
Abbas, M. and Bossis, G., ‘Separation of two attractive ferromagnetic ellipsoidal particles by hydrodynamic interactions under alternating magnetic field,’ Physical Review E, 2017, 95(6), p. 062611.
Ai, Y., Beskok, A., Gauthier, D. T., Joo, S. W., and Qian, S., ‘Dc electrokinetic transport of cylindrical cells in straight microchannels,’ Biomicrofluidics, 2009a, 3(4), p. 044110.
Ai, Y., Joo, S. W., Jiang, Y., Xuan, X., and Qian, S., ‘Pressure-driven transport of particles through a converging-diverging microchannel,’ Biomicrofluidics, 2009b, 3(2), p. 022404.
Ai, Y. and Qian, S., ‘De dielectrophoretic particle–particle interactions and their relative motions,’ Journal of colloid and interface science, 2010, 346(2), pp. 448–454.
Ai, Y., Zeng, Z., and Qian, S., ‘Direct numerical simulation of ac dielectrophoretic particle–particle interactive motions,’ Journal of colloid and interface science, 2014, 417, pp. 72–79.
Anupama, A., Kumaran, V., and Sahoo, B., ‘Magnetorheological fluids containing rod-shaped lithium–zinc ferrite particles: the steady-state shear response,’ Soft matter, 2018, 14(26), pp. 5407–5419.
Bell, R., Karli, J., Vavreck, A., Zimmerman, D., Ngatu, G., and Wereley, N., ‘Magnetorheology of submicron diameter iron microwires dispersed in silicone oil,’ Smart Materials and Structures, 2008, 17(1), p. 015028.
Bell, R., Miller, E., Karli, J., Vavreck, A., and Zimmerman, D., ‘Influence of particle shape on the properties of magnetorheological fluids,’ International Journal of Modern Physics B, 2007, 21(28n29), pp. 5018–5025.
Bica, I., Liu, Y. D., and Choi, H. J., ‘Physical characteristics of magnetorheological suspensions and their applications,’ Journal of Industrial and Engineering Chemistry, 2013, 19(2), pp. 394–406.
Bombard, A. J., Gonçalves, F. R., Morillas, J. R., and De Vicente, J., ‘Magnetorheology of dimorphic magnetorheological fluids based on nanofibers,’ Smart Materials and Structures, 2014, 23(12), p. 125013.
Bossis, G., Marins, J. A., Kuzhir, P., Volkova, O., and Zubarev, A., ‘Functionalized microfibers for field-responsive materials and biological applications,’ Journal of Intelligent Material Systems and Structures, 2015, 26(14), pp. 1871–1879.
De Vicente, J., Klingenberg, D. J., and Hidalgo-Alvarez, R., ‘Magnetorheological fluids: a review,’ Soft matter, 2011, 7(8), pp. 3701–3710.
De Vicente, J., Segovia-Gutiérrez, J., Andablo-Reyes, E., Vereda, F., and Hidalgo-Álvarez, R., ‘Dynamic rheology of sphere-and rod-based magnetorheological fluids,’ The Journal of chemical physics, 2009, 131(19), p. 194902.
de Vicente, J., Vereda, F., Segovia-Gutiérrez, J. P., del Puerto Morales, M., and Hidalgo-Álvarez, R., ‘Effect of particle shape in magnetorheology,’ Journal of Rheology, 2010, 54(6), pp. 1337–1362.
Dong, X., Tong, Y., Ma, N., Qi, M., and Ou, J., ‘Properties of cobalt nanofiber-based magnetorheological fluids,’ RSC Advances, 2015, 5(18), pp. 13958–13963.
Gao, Y., Hulsen, M., Kang, T., and Den Toonder, J., ‘Numerical and experimental study of a rotating magnetic particle chain in a viscous fluid,’ Physical Review E, 2012, **86**(4), p. 041503.
Gijs, M. A., ‘Magnetic bead handling on-chip: new opportunities for analytical applications,’ Microfluidics and Nanofluidics, 2004, **1**(1), pp. 22–40.
Gijs, M. A., Lacharme, F., and Lehmann, U., ‘Microfluidic applications of magnetic particles for biological analysis and catalysis,’ Chemical reviews, 2009, **110**(3), pp. 1518–1563.
Hejazian, M., Li, W., and Nguyen, N.-T., ‘Lab on a chip for continuous-flow magnetic cell separation,’ Lab on a Chip, 2015, **15**(4), pp. 959–970.
Hu, H. H., Patankar, N. A., and Zhu, M., ‘Direct numerical simulations of fluid–solid systems using the arbitrary lagrangian–eulerian technique,’ Journal of Computational Physics, 2001, **169**(2), pp. 427–462.
Jamshaid, T., Neto, E. T. T., Eissa, M. M., Zine, N., Kunita, M. H., El-Salhi, A. E., and Elaissari, A., ‘Magnetic particles: From preparation to lab-on-a-chip, biosensors, microsystems and microfluidics applications,’ TrAC Trends in Analytical Chemistry, 2016, **79**, pp. 344–362.
Jiang, W., Zhang, Y., Xuan, S., Guo, C., and Gong, X., ‘Dimorphic magnetorheological fluid with improved rheological properties,’ Journal of Magnetism and Magnetic Materials, 2011, **323**(24), pp. 3246–3250.
Kang, S. and Suh, Y., ‘Direct simulation of flows with suspended paramagnetic particles using one-stage smoothed profile method,’ Journal of Fluids and Structures, 2011, **27**(2), pp. 266–282.
Kang, T. G., Gao, Y., Hulsen, M. A., den Toonder, J. M., and Anderson, P. D., ‘Direct simulation of the dynamics of two spherical particles actuated magnetically in a viscous fluid,’ Computers & Fluids, 2013, **86**, pp. 569–581.
Kang, T. G., Hulsen, M. A., den Toonder, J. M., Anderson, P. D., and Meijer, H. E., ‘A direct simulation method for flows with suspended paramagnetic particles,’ Journal of Computational Physics, 2008, **227**(9), pp. 4441–4458.
Keaveny, E. E. and Maxey, M. R., ‘Modeling the magnetic interactions between paramagnetic beads in magnetorheological fluids,’ Journal of Computational Physics, 2008, **227**(22), pp. 9554–9571.
Kuzhir, P., López-López, M. T., and Bossis, G., ‘Magnetorheology of fiber suspensions. ii. theory,’ Journal of rheology, 2009, **53**(1), pp. 127–151.
López-López, M. T., Kuzhir, P., and Bossis, G., ‘Magnetorheology of fiber suspensions. i. experimental,’ Journal of Rheology, 2009, **53**(1), pp. 115–126.
López-López, M. T., Vertelov, G., Bossis, G., Kuzhir, P., and Durán, J. D., ‘New magnetorheological fluids based on magnetic fibers,’ Journal of Materials Chemistry, 2007, 17(36), pp. 3839–3844.
Melle, S. and Martin, J. E., ‘Chain model of a magnetorheological suspension in a rotating field,’ The Journal of chemical physics, 2003, 118(21), pp. 9875–9881.
Morillas, J. R., Carreón-González, E., and De Vicente, J., ‘Effect of particle aspect ratio in magnetorheology,’ Smart Materials and Structures, 2015, 24(12), p. 125005.
Ngatu, G., Wereley, N., Karli, J., and Bell, R., ‘Dimorphic magnetorheological fluids: exploiting partial substitution of microspheres by nanowires,’ Smart Materials and Structures, 2008, 17(4), p. 045022.
Petousis, I., Homburg, E., Derks, R., and Dietzel, A., ‘Transient behaviour of magnetic micro-bead chains rotating in a fluid by external fields,’ Lab on a Chip, 2007, 7(12), pp. 1746–1751.
Rabinow, J., ‘The magnetic fluid clutch,’ Electrical Engineering, 1948, 67(12), pp. 1167–1167.
Sedlacik, M., Pavlínek, V., Vyroubal, R., Peer, P., and Filip, P., ‘A dimorphic magnetorheological fluid with improved oxidation and chemical stability under oscillatory shear,’ Smart Materials and Structures, 2013, 22(3), p. 035011.
Sheng, R., Flores, G., and Liu, J., ‘In vitro investigation of a novel cancer therapeutic method using embolizing properties of magnetorheological fluids,’ Journal of magnetism and magnetic materials, 1999, 194(1-3), pp. 167–175.
Shine, A. and Armstrong, R., ‘The rotation of a suspended axisymmetric ellipsoid in a magnetic field,’ Rheologica Acta, 1987, 26(2), pp. 152–161.
Stratton, J. A., *Electromagnetic theory*, John Wiley & Sons, 2007.
Stuart, D. C., Kleijn, C., and Kenjereš, S., ‘An efficient and robust method for lagrangian magnetic particle tracking in fluid flow simulations on unstructured grids,’ Computers & Fluids, 2011, 40(1), pp. 188–194.
Suh, Y. K. and Kang, S., ‘Motion of paramagnetic particles in a viscous fluid under a uniform magnetic field: benchmark solutions,’ Journal of Engineering Mathematics, 2011, 69(1), pp. 25–58.
Yamaguchi, M., Tanimoto, Y., and Yamaguchi, M., *Magneto-science: magnetic field effects on materials: fundamentals and applications*, volume 48, Springer, 2006.
Zhang, J., Sobecki, C. A., Zhang, Y., and Wang, C., ‘Numerical investigation of dynamics of elliptical magnetic microparticles in shear flows,’ Microfluidics and Nanofluidics, 2018, 22(8), p. 83.
Zhang, J. and Wang, C., ‘Numerical study of lateral migration of elliptical magnetic microparticles in microchannels in uniform magnetic fields,’ Magnetochemistry, 2018, **4**(1), p. 16.
Zhou, R., Bai, F., and Wang, C., ‘Magnetic separation of microparticles by shape,’ Lab on a Chip, 2017a, **17**(3), pp. 401–406.
Zhou, R., Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Magnetic control of lateral migration of ellipsoidal microparticles in microscale flows,’ Physical Review Applied, 2017b, **8**(2), p. 024019.
V. MIGRATION OF FERROFLUID DROPLETS IN SHEAR FLOW UNDER A UNIFORM MAGNETIC FIELD
Jie Zhang, Md. Rifat Hassan, Bhargav Rallabandi, and Cheng Wang
Department of Mechanical & Aerospace Engineering
Missouri University of Science and Technology
Rolla, Missouri 65409
Department of Mechanical Engineering
University of California, Riverside
Riverside, California 92521
Tel: 573–341–4636. Fax: 573–341–4607
Email: [email protected]
ABSTRACT
Manipulation of droplets based on physical properties (e.g., size, interfacial tension, electrical, and mechanical properties) is a critical step in droplet microfluidics. Manipulations based on magnetic fields have several benefits compared to other active methods. While traditional magnetic manipulations require spatially inhomogeneous fields to apply forces, the fast spatial decay of magnetic field strength from the source make these techniques difficult to scale up. In this work, we report the observation of lateral migration of ferrofluid (or magnetic) droplets under the combined action of a uniform magnetic field and a pressure-driven flow in a microchannel. While the uniform magnetic field exerts negligible net force on the droplet, the Maxwell stresses deform the droplet into elongated shapes and modulate the orientation relative to the fluid flow. Hydrodynamic interactions between the droplets
and the channel walls results in a directional lateral migration. We experimentally study the effects of field strength and direction, and interfacial tension, and use analytical and numerical modeling to understand the lateral migration mechanism.
**Keywords:** convection
1. INTRODUCTION
Droplet microfluidics has emerged as a powerful technology on lab-on-a-chip platforms for high-throughput screening of chemical and biological assays (Du *et al.*, 2016; Guo *et al.*, 2012; Shembekar *et al.*, 2016). Dispersed in a continuous phase, individual droplets often encapsulate chemical or biological samples (e.g., cells, DNA, proteins, and bacteria), serve as miniaturized reactors, and allow biological and chemical reactions inside individual micro-droplets (Shang *et al.*, 2017). The large surface to volume ratio leads to significantly enhanced mass and heat transfer and bio-/chemical reactions. Furthermore, the high-throughput nature enables a vast number of assays in parallel, thereby drastically improving accuracy of the results.
Manipulation, e.g., sorting, of the droplets based on their contents or properties is often a critical step in a chemical or biological assay. Droplets can be sorted by passive or active methods. Passive methods are based on hydrodynamic features, such as geometry and fluid properties, to manipulate the droplets (Bowman *et al.*, 2012; Hatch *et al.*, 2013; Kadivar *et al.*, 2013; Tan *et al.*, 2004, 2008; Tan and Lee, 2005). For passive methods to be effective, a complex geometry is usually employed or a particular fluid such as viscoelastic fluid is used as a buffer, which places some limitations on lab-on-a-chip applications. Active methods employ external fields (Xi *et al.*, 2017), such as electric (Agresti *et al.*, 2010; Ahn *et al.*, 2009, 2011, 2006; de Ruiter *et al.*, 2014; Eastburn *et al.*, 2015; Guo *et al.*, 2010; Link *et al.*, 2006; Niu *et al.*, 2007; Rao *et al.*, 2015a,b; Sciambi and Abate, 2014, 2015), acoustic (Lee *et al.*, 2012; Leibacher *et al.*, 2015; Li *et al.*, 2013; Nam *et al.*, 2012; Peterssson *et al.*, 2005; Schmid *et al.*, 2014), or magnetic forces (Brouzes *et al.*, 2015; Kim *et al.*, 2014;
Li et al., 2016; Lombardi and Dittrich, 2011; Nguyen et al., 2006; Surenjav et al., 2009; Teste et al., 2015; Zhang et al., 2011, 2009), to manipulate droplets. Among the various active methods, magnetic methods have several distinctive advantages such as low or no heat generation, simple implementation and contactless control, and thus, have received increasing attention over the last few years (Huang et al., 2017).
Ferrofluids are colloidal suspensions consisting of superparamagnetic nanoparticles. Magnetic particles in a ferrofluid commonly have a size of around 10 nm and are coated with surfactant to stabilize and prevent agglomeration. Due to their ability to be controlled by external magnetic fields, ferrofluids have been widely used in applications of mechanical and biomedical fields (Gao et al., 2009; Neuberger et al., 2005; Torres-Díaz and Rinaldi, 2014). Some typical applications of ferrofluids in microfluidics include microvalves (Oh and Ahn, 2006), micropumps (Laser and Santiago, 2004), magnetic drug targeting (Lübbe et al., 2001) and magnetic separations of cells (Hejazian et al., 2015). More recently in droplet microfluidics, ferrofluid droplets have been used to encapsulate cells for culturing and sorting (Sung et al., 2017) purposes, owing to their bio-compability and ease of manipulation with magnetic fields.
Traditional magnetic manipulation of ferrofluid droplets mainly relies on magnetic forces acting on the droplets. Assuming small field variations over the droplet volume $V_p$, the magnetic force is (Inglis et al., 2006)
$$\mathbf{F}_m = \mu_0 V_p [(\mathbf{M}_p - \mathbf{M}_f) \cdot \nabla] \mathbf{H},$$
where $\mu_0$ is the magnetic permeability of vacuum, $\mathbf{H}$ is the magnetic field, and $\mathbf{M}_p$, $\mathbf{M}_f$ denote the magnetization of the droplet and fluid respectively. Selective manipulation of droplets is possible based on the susceptibility contrast between the droplet and the surrounding phase, and droplet size (or volume). A number of groups have utilized the magnetic force approach for various applications, including sorting of microalgae encapsulated in ferrofluid droplets (Sung et al., 2017), on-chip manipulation of ferrofluid droplets in water (Zhang et al., 2009) or water droplets in ferrofluid (Zhang et al., 2011), and selective distribution of water-in-magnetic-fluid droplets in curved channels (Kim et al., 2014). However, due to
the fast decay of magnetic fields with distance from the source (Stratton, 2007), magnetic sources need to be placed in proximity to the droplets in order to exert sufficient influence on droplets. Often permanent magnets have to be placed nearby microfluidic channels (Kim et al., 2014; Sung et al., 2017; Zhang et al., 2011, 2009), further making the scaling up of magnetic manipulation difficult.
In this work, we propose and demonstrate a simple and novel droplet manipulation technique by using a uniform magnetic field. In this method, while the uniform magnetic field does not directly exert magnetic forces on the droplets, it modulates the deformation of micro-droplets, which consequently leads to a net lift force and lateral migrations of droplets in shear flows. We explain the cross-stream migration using a hydrodynamic theory involving the interaction of the deformed droplet’s stresslet field with the walls of the channel. We then also use numerical simulations, based on the level-set method, to better understand the magnetic and flow fields around the droplets and confirm the migration mechanism.
2. EXPERIMENT
Figure 1(a) shows the microfluidic chip placed in a uniform magnetic field with strength $H_0$ and direction $\alpha$, which is generated by a Halbach array (Raich and Blümler, 2004). The microfluidic chip was fabricated with polydimethylsiloxane (PDMS) using a previously reported soft-lithography method (Zhang et al., 2015). The width, depth and length of main microchannel are $w_c = 800 \mu m$, $d_c = 70 \mu m$, and $L \approx 13,000 \mu m$ as shown in Figure 1(b). Three different sets of Halbach arrays were designed to generate the uniform magnetic fields, which consisted of 20 cuboid permanent $0.25'' \times 0.25'' \times 0.25''$, $0.25'' \times 0.25'' \times 0.5''$ or $0.25'' \times 0.25'' \times 1''$ magnets (K&J Magnetics, Inc.). The details of the design and test of the uniform magnetic field can be seen in the ESI of the previous reported work (Zhou et al., 2017). The magnitudes of these magnetic fields within the central region were measured as $H_0 \approx 18,000, 35,000$ and $60,000 \text{ A/m}$ by a gaussmeter. The droplet is generated by a flow-focusing configuration at the upstream, as shown in Figure 1(b). Water-based
Figure 1. (a) Photo of the microfluidic chip located in a uniform magnetic field. (b) Schematic showing the dimensions of the microchannel.
Ferrofluid (EMG 304, Ferrotec Corp.) is the dispersed phase, with the density $\rho_f = 1.24 \times 10^3$ kg/m$^3$, viscosity $\eta_f = 5 \times 10^{-3}$ Pa·s and an initial magnetic susceptibility (i.e. at small field strength) $\chi_f = 5.03$. Olive oil is used as the continuous phase and buffer fluid, with a density $\rho_o = 0.92 \times 10^3$ kg/m$^3$, a viscosity $\eta_o = 78 \times 10^{-3}$ Pa·s, and a magnetic susceptibility $\chi_o \approx 0$. Three different olive oil solutions were prepared by adding 0.125% wt, 0.25% wt, 0.375% wt of surfactant SPAN 80 (Sigma-Aldrich, USA) to vary the interfaical tension. The corresponding oil-ferrofluid interfacial tensions were measured as $5.86 \pm 0.19$, $4.31 \pm 0.22$ and $2.52 \pm 0.22$ mN/m using the pendant droplet method (Daerr and Mogne, 2016). Three syringe pumps (KDS Scientific) were used to control the flow rates of the inlets. The flow rates of the dispersed phase (i.e., ferrofluid), continuous phase and buffer flow are $Q_1 = 0.15$ $\mu$L/min, $Q_2 = 4$ $\mu$L/min and $Q_3 = 6$ $\mu$L/min. At these flow rates, the mean fluid speed is $\bar{u} \approx 3$ mm/s and the corresponding Reynolds number in the main channel is $Re \approx 0.028$. The trajectories of the ferrofluid droplets were recorded through an inverted microscope.
(IX73, Olympus) with a high-speed CCD camera (Phantom Miro M310, Vision Research). Custom MATLAB codes were written to analyze the centroid position and shape (including deformation and orientation) of the droplets from the recorded videos.
3. RESULTS AND DISCUSSION
3.1. EFFECT OF DIRECTION OF MAGNETIC FIELD
Figure 2 shows the images of droplets at the inlet and outlet and the corresponding probability distributions of droplet centroid in the $y$ direction. In this experiment, the oil-ferrofluid interfacial tension $\sigma = 4.31 \pm 0.22$ mN/m. The average radius of undeformed droplet is $R_0 = 60.76 \mu$m. The droplets are generated upstream and enter along the centerline of the channel. As can be seen in Figure 2(a1)–(a3), there is a negligible deformation and almost zero net lateral migration in the cross-stream direction (i.e., $y$ direction) when no magnetic field is applied ($H_0 = 0$). Since the Reynolds number is small ($Re \approx 0.028 \ll 1$), inertial effects are negligible. According to previous theoretical (Chan and Leal, 1979) and numerical (Mortazavi and Tryggvason, 2000) investigations, when the droplet is initially placed at the center-line of a channel flow in the absence of a magnetic field, the droplets will move only in the axial direction (i.e., $x$ direction) for viscosity ratio between dispersed and continuous phases $\lambda \lesssim 0.5$ or $\lambda \gtrsim 10$. In this work, $\lambda = \eta_f / \eta_o = 0.064 < 0.5$, and indeed the droplets moving stably along the axial direction in Figure 2(a1)–(a3).
In the presence of a magnetic field, the droplet is deformed by the combination of shear and magnetic fields, the latter producing Maxwell stresses. The deformation due to shear is quantified by the capillary number $Ca = \bar{u} \eta_o / (\sigma w_c)$, while the deformation due to the magnetic field (assuming a linearly magnetizable material) is quantified by the magnetic bond number $Bo_m = \mu_0 H_0^2 R_0 / (2\sigma)$. In our experiments, $Ca \approx 5 \cdot 10^{-3}$ and $Bo_m \approx 7$, suggesting that the deformation due to the magnetic field greatly dominates that due to shear.
Figure 2. Images at the inlet and outlet, and the corresponding probability density function (PDF) of the centroid of the ferrofluid droplet in the $y$ direction. (a1–a3) without a applied magnetic field ($H_0 = 0$ A/m); (b1–b3) $H_0 \approx 60,000$ A/m, and $\alpha = 0^\circ$; (c1–c3) $H_0 \approx 60,000$ A/m, and $\alpha = 45^\circ$; (d1–d3) $H_0 \approx 60,000$ A/m, and $\alpha = 90^\circ$; and (e1–e3) $H_0 \approx 60,000$ A/m, $\alpha = 135^\circ$. The flow rates are $Q_1 = 0.15$ $\mu$L/min, $Q_2 = 4.0$ $\mu$L/min and $Q_3 = 6.0$ $\mu$L/min for all the experiments. The oil-ferrofluid interfacial tension $\sigma = 4.31 \pm 0.22$ mN/m.
Indeed, this is borne out experimentally: when a uniform magnetic field ($H_0 \approx 60,000$ A/m) is applied at various directions, as shown in Figure 2(b)–(e), the droplets become elongated in the direction of magnetic field independent of their position across
the channel width. Further, the direction of the magnetic field controls the direction of the cross-stream migration. When the magnetic field is parallel to the flow direction (i.e., $\alpha = 0^\circ$) as shown in Figure 2(b1)–(b3), the droplets deform into an ellipsoidal shape with their major axis parallel to the flow direction, and there is only a slight net lateral migration in the cross-stream direction, which might be attributed to imperfection of the experimental conditions. As $\alpha$ increases to $45^\circ$ as shown in Figure 2(c1)–(c3), a similar deformed shape is observed and the elongation axis is aligned to $45^\circ$, which results in the droplet migrating towards the upper channel wall. The average distance of the cross-stream migration between inlet and outlet is measured to be $181.16 \, \mu m$. When $\alpha$ increases to $90^\circ$ as shown in Figure 2(c1)–(c3), the elongation axis is perpendicular to the flow direction, and there is a slight net lateral migration in the cross-stream direction (again might be due to imperfect control of the experiments). At an inclination angle $\alpha = 135^\circ$ shown in Figure 2(e1)–(e3), the elongation axis is aligned to $135^\circ$, which results in the droplets migrating towards the lower wall. The average distance of the cross-stream migration between the inlet and outlet is $-182.17 \, \mu m$.
Figure 3. Comparison of the cross-stream migration of a droplet close to the lower wall between the theoretical prediction and experiment. (a) vertical position of the particle ($y$) as a function of time. (b) cross-stream velocity ($v_y$) a function of $y$. Here the magnetic field is applied at $\alpha = 135^\circ$, and $D \approx 0.156$. Note that the channel width is $300 \, \mu m$.
3.2. CROSS-STREAM MIGRATION MECHANISM
The cross-stream migration of the droplet can be understood by considering hydrodynamic interactions between the droplet and the upper and lower walls of the channel. It is well known for droplets in shear flow alone, the stresslet field around the deformed droplet, by hydrodynamic interactions with nearby boundaries, can result in a cross-stream migration of the droplet (Smart and Leighton Jr, 1989). A key observation is that the component of the stresslet responsible for lateral migration depends on the inclination of the droplet’s long axis relative to the flow. In our experiments, the droplet’s orientation is set largely by the magnetic field, independent of the flow.
We estimate the cross-stream migration velocity by modeling the droplet as a rigid particle with fixed orientation angle $\approx \alpha$ relative to the horizontal axis. Although this approximation neglects the influence of the interior flow of the droplet, it typically results in small errors for deformation due to shear alone (Aggarwal and Sarkar, 2007; Chan and Leal, 1979; Taylor, 1934). The stresslet of the droplet can then be approximated using the relations of (Kim and Karrila, 2013) for rigid ellipsoids. Next, we recognize that in the present experiments the droplet is centered between the channel walls in the depth direction, and therefore experiences shear gradients primarily in the width ($y$) direction. We introduce the Taylor deformation parameter $D = \frac{L - B}{L + B}$, where $L$ and $B$ are the semi-major and semi-minor axes, respectively, of the droplet; note that $0 \leq D < 1$. Then, the $yy$ component of the hydrodynamic stresslet is
$$S_{yy} = \eta_o \pi L^3 \partial_y u_x \left\{ \left( \frac{5}{6} X^M - \frac{5}{6} Z^M - 2Y^H \right) \sin 2\alpha - \left( \frac{5}{4} X^M - \frac{5}{3} Y^M + \frac{5}{12} Z^M \right) \sin 4\alpha \right\},$$
where $X^M$, $Z^M$, $Z^M$ and $Y^H$ are known functions of the deformation $D$ (see Table 3.4 of (Kim and Karrila, 2013)). The term proportional to $\sin 4\alpha$ is numerically much smaller than the term proportional to $\sin 2\alpha$ for the deformations measured in experiments, and is therefore neglected in the following. Accounting only for the first reflection of the stresslet with the upper and lower walls ($y = 0$, $y = w_c$), the cross-stream migration velocity of a droplet whose center is at a position $y_d \gg R_0$ is (Matsunaga et al., 2017; Smart and Leighton Jr,
Note that (1b) is obtained as the leading term of a Taylor expansion of the (1a) for small deformations, although it remains accurate to within 10% even at $D = 0.5$. We note that to evaluate (1), we use the velocity field for a channel with a rectangular cross-section evaluated at the plane of symmetry in the $z$ direction.
The theoretical prediction (1b) quantitatively reproduces the direction of the vertical drift observed in the experiments: the droplet drifts towards the upper wall ($y = w_c$) for $\alpha$ in the first and third quadrants, and towards the lower wall ($y = 0$) for $\alpha$ in the second and fourth quadrants. Figure 3 shows the comparison between the theory and experiment when a droplet was under a magnetic field at $\alpha = 135^\circ$ and migrated towards the lower wall. Note that $u_x$ is determined using the results for a rectangular channel (Mortensen et al., 2005) and $D$ in (1) is obtained from experimental measurements. According to the theory, the symmetry plane $y = 0$ is an unstable fixed point of the trajectory, so the droplet can drift across it. This behavior is similar to recent theoretical predictions for the migration of droplets in Poiseuille flow under uniform electric fields (Mandal et al., 2016). Both the cases of magnetic and electric field are in contrast with the case of a droplet drifting due to deformation by shear alone, where the axis of the droplet follows the elongational axis of the local velocity gradient, which causes the droplet to migrate towards the centerline $y = w/2$, which in this case is a stable fixed point of the migration dynamics when $\lambda \lesssim 0.5$ or $\lambda \gtrsim 10$ (Chan and Leal, 1979).
To further confirm the cross-stream migration mechanism of the droplet, a two-dimensional (2D) numerical model was developed to investigate the ferrofluid droplet transport in the channel. By using commercial a finite element method solver (COMSOL
Figure 4. (a) Comparison of droplet trajectory between the experiments and simulation (a1), and numerical results of the magnetic field (a2) and velocity field (a3) for ferrofluid droplets when $\alpha = 45^\circ$. (b) Comparison of droplet trajectory between the experiments and numerical simulation (b1), and numerical results of the magnetic field (b2) and velocity field (b3) for ferrofluid droplets when $\alpha = 90^\circ$. The magnetic field strength $H_0 = 60000$ A/m and the oil-ferrofluid interfacial tension $\sigma = 4.31 \pm 0.22$ mN/m.
Multiphysics), the numerical model employed the level-set method, and coupled the magnetic and flow fields. Briefly, the magnetic field is first determined by solving the magnetostatic equation, and the magnetic force term is then coupled to the Navier-Stokes equation. More details of the numerical modeling is available from our previous work (Hassan et al., 2018). The magnetic field with strength of 60000 A/m and direction of 45° or 90° was used in the simulations.
Figure 4(a1) shows a comparison of experimental and numerical results when the magnetic field is applied at $\alpha = 45^\circ$. As we can see, the numerical results are in good agreement with the experiment. The magnetic field and velocity field around the droplet are shown in Figure 4(a2) and (a3). The magnetic force acting on the droplet is approximately
zero for an ellipsoidal droplet placed in a uniform field (Stratton, 2007), which is supported by numerical simulation of the magnetic field distribution (Figure 4(a2)). The presence of magnetic fields leads to the generation of Maxwell stresses at the interface between ferrofluid and olive oil, which cause the deformation of the droplet. Further, the direction of elongation (i.e., major axis) is aligned to the direction of magnetic field. As a result of the ellipsoidal shape and relative orientation of the droplet, the velocity profile around the droplet is asymmetric to the flow direction, as shown in Figure 4(a3). This asymmetric orientation of the deformed droplet with respect to the flow direction results in cross-stream migration towards the upper wall. Note at $\alpha = 135^\circ$, the droplet will move towards the lower wall.
When applied at $90^\circ$ to the flow direction, the magnetic field causes the droplet to deform into an ellipsoidal shape and the elongation direction is perpendicular to the flow direction. However, the velocity profile around the droplet is symmetric about the channel’s centerline as can be seen in Figure 4(b). Similarly, for $\alpha = 0^\circ$, the droplet will be elongated parallel to the flow direction, and no cross-stream migration will take place either due to symmetric flow field around the droplet. In both cases, the stresslet of the droplet is zero and therefore there are negligible hydrodynamic interactions with the walls.
### 3.3. EFFECTS OF MAGNETIC FIELD STRENGTH, INTERFACIAL TENSION AND FLOW RATE
As discussed earlier, the cross-stream migration depends on the deformation and relative orientation, which are expected to depend on the properties of the fluids, flow field and magnetic field. In a quiescent flow field, the deformation is related to the magnetic field strength, interfacial tension, and droplet size (Afkhami et al., 2010). The droplet size depends on the flow rates used. So here, we focus on the effect of magnetic field strength, interfacial tension and flow rates on the drop migration by examining the case with a magnetic field applied at $45^\circ$, as shown in Figure 5(a,b). We used the Taylor deformation
Figure 5. The effect of magnetic field strength, interfacial tension and flow rates on droplet migration. (a) Taylor deformation parameter, $D$, and the net lateral migration, $\Delta y$, vary with magnetic field strength, $H_0$, when $\sigma = 4.31 \pm 0.22$ mN/m. (b) Taylor deformation parameter, $D$, and the net lateral migration, $\Delta y$, vary with interfacial tension, $\sigma$, when $H_0 \approx 18000$ A/m. (c) Taylor deformation parameter, $D$, the net lateral migration, $\Delta y$, and equivalent sphere radius, $R_0$, vary with flow rate, $Q_2$, when $H_0 \approx 35000$ A/m. The magnetic field is applied at $\alpha = 45^\circ$.
parameter $D$ to characterize the droplet deformation. From Figure 5(a1), $D$ increases with an increasing magnetic field, meaning the elongation of ferrofluid droplet increases. The larger deformation causes the a larger net lateral migration of droplet as shown in Figure
Figure 6. The separation of ferrofluid and water droplets by a uniform magnetic field. (a) Both ferrofluid and water droplets flow into the sub-microchannel 3 without a magnetic field; (b) The ferrofluid droplets flow into the sub-microchannel 1 when $H_0 \approx 60000$ A/m, $\alpha = 135^\circ$; (c) The ferrofluid droplets flow into the sub-microchannel 2 when $H_0 \approx 60000$ A/m, $\alpha = 115^\circ$. The oil-ferrofluid interfacial tension $\sigma = 2.52 \pm 0.22$ mN/m.
5(a2). Figure 5(b) shows the effect of oil-ferrofluid interfacial tension on the drop migration when magnetic field with $H_0 = 18000$ A/m is applied at $45^\circ$. As can be seen, $D$ increases as the oil-ferrofluid interfacial tension decreases, resulting in the increasing the net lateral
migration of drop. By adjusting the flow rate $Q_2$, the droplet size can be changed. As can be seen in Figure 5(c2), equivalent sphere radius, $R_0$, decreases with an increasing magnetic field, resulting in the decreasing deformation and net lateral migration of drop.
Therefore, we can see that the magnetic field strength, interfacial tension and droplet size are three important factors for the migration of droplet. The droplet deformation measured in the experiments is much smaller than those predicted by existing theory (Afkhami et al., 2010) for a ferrofluid droplet in an unbounded fluid, which could attributed to the confinement effect of the droplet.
3.4. SEPARATION OF FERROFLUID AND WATER DROPLETS
The deformation-dependent migration under a uniform magnetic field can be used for selectively separating droplets that exhibit different deformations, which could be due to differences in size, interfacial tension, or magnetic properties. As an illustration, Figure 6 shows the separation of ferrofluid droplets from water droplets by a uniform magnetic field. In this experiment, the ferrofluid and water droplets are all generated at the center of the channel. The oil-ferrofluid interfacial tension $\sigma = 2.52 \pm 0.22$ mN/m. Without an applied magnetic field, both ferrofluid and water droplets flow into the center sub-microchannel 3 and there is no separation, as can be seen in Figure 6(a). When the magnetic field ($H_0 = 60000$ A/m) is applied at $135^\circ$, the water droplets remained at a similar initial position flowing into sub-microchannel 3, while the ferrofluid droplets moved to the lower wall and flow into the sub-microchannel 1. Thus, complete separation is achieved. This magnetic manipulation is also tunable due to the easy control of the direction of the magnetic field. When the magnetic field is set at $115^\circ$, the ferrofluid droplets can be diverted to flow into sub-microchannel 2.
4. CONCLUSIONS
In summary, we have demonstrated a unique approach to manipulate droplet migration in microfluidics by using a uniform magnetic field. In contrast to conventional magnetic manipulations, the current approach does not induce direct magnetic forces on the droplets. Instead, the Maxwell stresses arise at the droplet interface due to a change of magnetic susceptibility across the droplet interface, and consequently deform the droplet and affect its relative orientation to the flow. Due to the deformed shape and inclined angle to the shear flow, the droplet interacts hydrodynamically with the channel walls, and migrates in the cross-stream direction. We experimentally investigated various parameters that influence the droplet migration, including magnetic field strength, magnetic field direction and interfacial tension. It is found that the lateral migration speed increases with the droplet deformation, which in turn increases with the field strength and decreases with the interfacial tension. The magnetic field direction, on the other hand, controls the orientation of the drop and the direction of the lateral migration. The direction and speed of the lateral migration are well described by hydrodynamic theory that accounts for interactions of the droplet’s stresslet flow with the walls of the channel. We have also developed two-dimensional numerical model that predicts the lateral migration and confirmed negligible magnetic force.
In comparison to conventional magnetic separation, the uniform magnetic field technique is simple to implement and is favorable for high-throughput parallelization. Multiple microfluidic channels can be conveniently integrated onto a single chip while being subjected to the same uniform magnetic field. The demonstrated technique thus provides a general mechanism for separation of micro-droplets, and has great potential for biological and biomedical applications that require sorting of droplets by their size, interfacial tension, or magnetic properties.
ACKNOWLEDGMENTS
The authors gratefully acknowledge the support from the Department of Mechanical and Aerospace Engineering (MAE) and the Center for Biomedical Research (CBR) at the Missouri University of Science and Technology. This work is partially supported by the National Science Foundation (Grant No. DMS-1818642). BR acknowledges the Department of Mechanical Engineering and the Bourns College of Engineering at the University of California, Riverside for support.
REFERENCES
Afkhami, S., Tyler, A., Renardy, Y., Renardy, M., St. Pierre, T., Woodward, R., and Riffle, J., ‘Deformation of a hydrophobic ferrofluid droplet suspended in a viscous medium under uniform magnetic fields,’ J. Fluid Mech., 2010, 663, pp. 358–384, ISSN 00221120 14697645, doi:10.1017/S0022112010003551.
Aggarwal, N. and Sarkar, K., ‘Deformation and breakup of a viscoelastic drop in a newtonian matrix under steady shear,’ Journal of Fluid Mechanics, 2007, 584, pp. 1–21.
Agresti, J. J., Antipov, E., Abate, A. R., Ahn, K., Rowat, A. C., Baret, J.-C., Marquez, M., Klibanov, A. M., Griffiths, A. D., and Weitz, D. A., ‘Ultrahigh-throughput screening in drop-based microfluidics for directed evolution,’ Proceedings of the National Academy of Sciences, 2010.
Ahn, B., Lee, K., Louge, R., and Oh, K. W., ‘Concurrent droplet charging and sorting by electrostatic actuation,’ Biomicrofluidics, 2009, 3(4), p. 044102.
Ahn, B., Lee, K., Panchapakesan, R., and Oh, K. W., ‘On-demand electrostatic droplet charging and sorting,’ Biomicrofluidics, 2011, 5(2), p. 024113.
Ahn, K., Kerbage, C., Hunt, T. P., Westervelt, R., Link, D. R., and Weitz, D. A., ‘Dielectrophoretic manipulation of drops for high-speed microfluidic sorting devices,’ Applied Physics Letters, 2006, 88(2), p. 024104.
Bowman, T., Frechette, J., and Drazer, G., ‘Force driven separation of drops by deterministic lateral displacement,’ Lab on a Chip, 2012, 12(16), pp. 2903–2908.
Brouzes, E., Kruse, T., Kimmerling, R., and Strey, H. H., ‘Rapid and continuous magnetic separation in droplet microfluidic devices,’ Lab on a Chip, 2015, 15(3), pp. 908–919.
Chan, P.-H. and Leal, L., ‘The motion of a deformable drop in a second-order fluid,’ Journal of Fluid Mechanics, 1979, 92(1), pp. 131–170.
Daerr, A. and Mogne, A., ‘Pendent\_drop: an imagej plugin to measure the surface tension from an image of a pendent drop,’ Journal of Open Research Software, 2016, **4**(1).
de Ruiter, R., Pit, A. M., de Oliveira, V. M., Duits, M. H., van den Ende, D., and Mugele, F., ‘Electrostatic potential wells for on-demand drop manipulation in microchannels,’ Lab on a Chip, 2014, **14**(5), pp. 883–891.
Du, G., Fang, Q., and den Toonder, J. M., ‘Microfluidics for cell-based high throughput screening platforms—a review,’ Analytica chimica acta, 2016, **903**, pp. 36–50.
Eastburn, D. J., Huang, Y., Pellegrino, M., Sciambi, A., Ptáček, L. J., and Abate, A. R., ‘Microfluidic droplet enrichment for targeted sequencing,’ Nucleic acids research, 2015, **43**(13), pp. e86–e86.
Gao, J., Gu, H., and Xu, B., ‘Multifunctional magnetic nanoparticles: design, synthesis, and biomedical applications,’ Accounts of chemical research, 2009, **42**(8), pp. 1097–1107.
Guo, F., Ji, X.-H., Liu, K., He, R.-X., Zhao, L.-B., Guo, Z.-X., Liu, W., Guo, S.-S., and Zhao, X.-Z., ‘Droplet electric separator microfluidic device for cell sorting,’ Applied Physics Letters, 2010, **96**(19), p. 193701.
Guo, M. T., Rotem, A., Heyman, J. A., and Weitz, D. A., ‘Droplet microfluidics for high-throughput biological assays,’ Lab on a Chip, 2012, **12**(12), pp. 2146–2155.
Hassan, M. R., Zhang, J., and Wang, C., ‘Deformation of a ferrofluid droplet in simple shear flows under uniform magnetic fields,’ Phys. Fluids, 2018, **30**(9), p. 092002, ISSN 1070-6631, doi:10.1063/1.5047223.
Hatch, A. C., Patel, A., Beer, N. R., and Lee, A. P., ‘Passive droplet sorting using viscoelastic flow focusing,’ Lab on a Chip, 2013, **13**(7), pp. 1308–1315.
Hejazian, M., Li, W., and Nguyen, N.-T., ‘Lab on a chip for continuous-flow magnetic cell separation,’ Lab on a Chip, 2015, **15**(4), pp. 959–970.
Huang, G., Li, M., Yang, Q., Li, Y., Liu, H., Yang, H., and Xu, F., ‘Magnetically actuated droplet manipulation and its potential biomedical applications,’ ACS applied materials & interfaces, 2017, **9**(2), pp. 1155–1166.
Inglis, D. W., Riehn, R., Sturm, J. C., and Austin, R. H., ‘Microfluidic high gradient magnetic cell separation,’ Journal of Applied Physics, 2006, **99**(8), p. 08K101.
Kadivar, E., Herminghaus, S., and Brinkmann, M., ‘Droplet sorting in a loop of flat microfluidic channels,’ Journal of Physics: Condensed Matter, 2013, **25**(28), p. 285102.
Kim, J., Won, J., and Song, S., ‘Dual-mode on-demand droplet routing in multiple microchannels using a magnetic fluid as carrier phase,’ Biomicrofluidics, 2014, **8**(5), p. 054105.
Kim, S. and Karrila, S. J., *Microhydrodynamics: principles and selected applications*, Courier Corporation, 2013.
Laser, D. J. and Santiago, J. G., ‘A review of micropumps,’ Journal of micromechanics and microengineering, 2004, **14**(6), p. R35.
Lee, C., Lee, J., Kim, H. H., Teh, S.-Y., Lee, A., Chung, I.-Y., Park, J. Y., and Shung, K. K., ‘Microfluidic droplet sorting with a high frequency ultrasound beam,’ Lab on a Chip, 2012, **12**(15), pp. 2736–2742.
Leibacher, I., Reichert, P., and Dual, J., ‘Microfluidic droplet handling by bulk acoustic wave (baw) acoustophoresis,’ Lab on a Chip, 2015, **15**(13), pp. 2896–2905.
Li, H., Wu, Y., Wang, X., Zhu, C., Fu, T., and Ma, Y., ‘Magnetofluidic control of the breakup of ferrofluid droplets in a microfluidic y-junction,’ Rsc Advances, 2016, **6**(1), pp. 778–785.
Li, S., Ding, X., Guo, F., Chen, Y., Lapsley, M. I., Lin, S.-C. S., Wang, L., McCoy, J. P., Cameron, C. E., and Huang, T. J., ‘An on-chip, multichannel droplet sorter using standing surface acoustic waves,’ Analytical chemistry, 2013, **85**(11), pp. 5468–5474.
Link, D. R., Grasland-Mongrain, E., Duri, A., Sarrazin, F., Cheng, Z., Cristobal, G., Marquez, M., and Weitz, D. A., ‘Electric control of droplets in microfluidic devices,’ Angewandte Chemie International Edition, 2006, **45**(16), pp. 2556–2560.
Lombardi, D. and Dittrich, P. S., ‘Droplet microfluidics with magnetic beads: a new tool to investigate drug–protein interactions,’ Analytical and bioanalytical chemistry, 2011, **399**(1), pp. 347–352.
Lübbe, A. S., Alexiou, C., and Bergemann, C., ‘Clinical applications of magnetic drug targeting,’ Journal of Surgical Research, 2001, **95**(2), pp. 200–206.
Mandal, S., Bandopadhyay, A., and Chakraborty, S., ‘The effect of uniform electric field on the cross-stream migration of a drop in plane poiseuille flow,’ Journal of Fluid Mechanics, 2016, **809**, pp. 726–774.
Matsunaga, D., Meng, F., Zöttl, A., Golestanian, R., and Yeomans, J. M., ‘Focusing and sorting of ellipsoidal magnetic particles in microchannels,’ Phys. Rev. Lett., 2017, **119**, p. 198002, doi:10.1103/PhysRevLett.119.198002.
Mortazavi, S. and Tryggvason, G., ‘A numerical study of the motion of drops in poiseuille flow. part 1. lateral migration of one drop,’ Journal of Fluid Mechanics, 2000, **411**, pp. 325–350.
Mortensen, N. A., Okkels, F., and Bruus, H., ‘Reexamination of hagen-poiseuille flow: Shape dependence of the hydraulic resistance in microchannels,’ Physical Review E, 2005, **71**(5), p. 057301.
Nam, J., Lim, H., Kim, C., Yoon Kang, J., and Shin, S., ‘Density-dependent separation of encapsulated cells in a microfluidic channel by using a standing surface acoustic wave,’ *Biomicrofluidics*, 2012, **6**(2), p. 024120.
Neuberger, T., Schöpf, B., Hofmann, H., Hofmann, M., and Von Rechenberg, B., ‘Superparamagnetic nanoparticles for biomedical applications: possibilities and limitations of a new drug delivery system,’ *Journal of Magnetism and Magnetic materials*, 2005, **293**(1), pp. 483–496.
Nguyen, N.-T., Ng, K. M., and Huang, X., ‘Manipulation of ferrofluid droplets using planar coils,’ *Applied Physics Letters*, 2006, **89**(5), p. 052509.
Niu, X., Zhang, M., Peng, S., Wen, W., and Sheng, P., ‘Real-time detection, control, and sorting of microfluidic droplets,’ *Biomicrofluidics*, 2007, **1**(4), p. 044101.
Oh, K. W. and Ahn, C. H., ‘A review of microvalves,’ *Journal of micromechanics and microengineering*, 2006, **16**(5), p. R13.
Petersson, F., Nilsson, A., Holm, C., Jönsson, H., and Laurell, T., ‘Continuous separation of lipid particles from erythrocytes by means of laminar flow and acoustic standing wave forces,’ *Lab on a Chip*, 2005, **5**(1), pp. 20–22.
Raich, H. and Blümler, P., ‘Design and construction of a dipolar halbach array with a homogeneous field from identical bar magnets: Nmr mandhalas,’ *Concepts in Magnetic Resonance Part B: Magnetic Resonance Engineering: An Educational Journal*, 2004, **23**(1), pp. 16–25.
Rao, L., Cai, B., Wang, J., Meng, Q., Ma, C., He, Z., Xu, J., Huang, Q., Li, S., Cen, Y., *et al.*, ‘A microfluidic electrostatic separator based on pre-charged droplets,’ *Sensors and Actuators B: Chemical*, 2015a, **210**, pp. 328–335.
Rao, L., Cai, B., Yu, X.-L., Guo, S.-S., Liu, W., and Zhao, X.-Z., ‘One-step fabrication of 3d silver paste electrodes into microfluidic devices for enhanced droplet-based cell sorting,’ *AIP Advances*, 2015b, **5**(5), p. 057134.
Schmid, L., Weitz, D. A., and Franke, T., ‘Sorting drops and cells with acoustics: acoustic microfluidic fluorescence-activated cell sorter,’ *Lab on a Chip*, 2014, **14**(19), pp. 3710–3718.
Sciambi, A. and Abate, A. R., ‘Generating electric fields in pdms microfluidic devices with salt water electrodes,’ *Lab on a Chip*, 2014, **14**(15), pp. 2605–2609.
Sciambi, A. and Abate, A. R., ‘Accurate microfluidic sorting of droplets at 30 khz,’ *Lab on a Chip*, 2015, **15**(1), pp. 47–51.
Shang, L., Cheng, Y., and Zhao, Y., ‘Emerging droplet microfluidics,’ *Chemical reviews*, 2017, **117**(12), pp. 7964–8040.
Shembekar, N., Chaipan, C., Utharala, R., and Merten, C. A., ‘Droplet-based microfluidics in drug discovery, transcriptomics and high-throughput molecular genetics,’ Lab on a Chip, 2016, **16**(8), pp. 1314–1331.
Smart, J. R. and Leighton Jr, D. T., ‘Measurement of the hydrodynamic surface roughness of noncolloidal spheres,’ Physics of Fluids A: Fluid Dynamics, 1989, **1**(1), pp. 52–60.
Stratton, J. A., *Electromagnetic theory*, John Wiley & Sons, 2007.
Sung, Y. J., Kim, J. Y. H., Choi, H. I., Kwak, H. S., and Sim, S. J., ‘Magnetophoretic sorting of microdroplets with different microalgal cell densities for rapid isolation of fast growing strains,’ Scientific Reports, 2017, **7**(1), p. 10390.
Surenjav, E., Priest, C., Herminghaus, S., and Seemann, R., ‘Manipulation of gel emulsions by variable microchannel geometry,’ Lab on a Chip, 2009, **9**(2), pp. 325–330.
Tan, Y.-C., Fisher, J. S., Lee, A. I., Cristini, V., and Lee, A. P., ‘Design of microfluidic channel geometries for the control of droplet volume, chemical concentration, and sorting,’ Lab on a Chip, 2004, **4**(4), pp. 292–298.
Tan, Y.-C., Ho, Y. L., and Lee, A. P., ‘Microfluidic sorting of droplets by size,’ Microfluidics and Nanofluidics, 2008, **4**(4), p. 343.
Tan, Y.-C. and Lee, A. P., ‘Microfluidic separation of satellite droplets as the basis of a monodispersed micron and submicron emulsification system,’ Lab on a Chip, 2005, **5**(10), pp. 1178–1183.
Taylor, G. I., ‘The formation of emulsions in definable fields of flow,’ Proc. R. Soc. Lond. A, 1934, **146**(858), pp. 501–523.
Teste, B., Jamond, N., Ferraro, D., Viovy, J.-L., and Malaquin, L., ‘Selective handling of droplets in a microfluidic device using magnetic rails,’ Microfluidics and Nanofluidics, 2015, **19**(1), pp. 141–153.
Torres-Díaz, I. and Rinaldi, C., ‘Recent progress in ferrofluids research: novel applications of magnetically controllable and tunable fluids,’ Soft matter, 2014, **10**(43), pp. 8584–8602.
Xi, H.-D., Zheng, H., Guo, W., Gañán-Calvo, A. M., Ai, Y., Tsao, C.-W., Zhou, J., Li, W., Huang, Y., Nguyen, N.-T., *et al.*, ‘Active droplet sorting in microfluidics: a review,’ Lab on a Chip, 2017, **17**(5), pp. 751–771.
Zhang, K., Liang, Q., Ai, X., Hu, P., Wang, Y., and Luo, G., ‘On-demand microfluidic droplet manipulation using hydrophobic ferrofluid as a continuous-phase,’ Lab on a Chip, 2011, **11**(7), pp. 1271–1275.
Zhang, K., Liang, Q., Ma, S., Mu, X., Hu, P., Wang, Y., and Luo, G., ‘On-chip manipulation of continuous picoliter-volume superparamagnetic droplets using a magnetic force,’ Lab on a Chip, 2009, **9**(20), pp. 2992–2999.
Zhang, Z., Zhou, R., P Brames, D., and Wang, C., ‘A low-cost fabrication system for manufacturing soft-lithography microfluidic master molds,’ Micro and Nanosystems, 2015, 7(1), pp. 4–12.
Zhou, R., Bai, F., and Wang, C., ‘Magnetic separation of microparticles by shape,’ Lab on a Chip, 2017, 17(3), pp. 401–406.
3. SUMMARY AND CONCLUSIONS
This dissertation has developed numerical and experimental methods to manipulate microparticles and microdroplets in the microfluidics by using a uniform magnetic field. This approach has many advantages over the traditional force-based techniques, including simple implementation, feasibility of scaling up, and large reach distance.
First, the fundamental mechanism of rotational dynamics of elliptical particles in a simple shear flow under a uniform magnetic field was fully numerically investigated. The numerical simulations revealed that the rotation of particle depends on the direction and strength of magnetic field, where the direction controls the symmetry of rotation and the strength controls the period of rotation and the degree of asymmetry of rotation.
Second, the lateral migration mechanism of elliptical paramagnetic particles in a plane Poiseuille flow under a uniform magnetic field was numerically investigated. The particle shown to exhibit negligible lateral migration in the absence of a magnetic field, while it migrates laterally in the presence of a magnetic field. The migration direction depends on the direction of magnetic field, which controls the symmetric property of the particle rotational velocity. The magnitude of lateral migration velocity over a $\pi$ cycle increases with the magnetic field strength. By investigating a wide range of parameters, our direct numerical simulations yield a comprehensive understanding of the particle migration mechanism. An empirical scaling relationship is proposed to relate the lateral migration distance to the asymmetry of the rotational velocity and lateral oscillation amplitude.
Third, the comparison of rotational dynamics between paramagnetic and ferromagnetic elliptical particles in a simple shear flow under a uniform magnetic field was numerically investigated. In a weak field regime (below the critical magnetic field), the particle complete
a full rotation, and the symmetrical property of particle rotations depend on the direction of the magnetic field. For the same strength and direction of the magnetic field, paramagnetic and ferromagnetic particles exhibit different asymmetric rotational behaviors. In the strong field (above the critical strength), the particles are pinned at their respected steady angles, which depend on the direction of magnetic field. The steady angles of paramagnetic and ferromagnetic particles are different for the same magnetic field strength and direction. The numerical results have very good agreement with that of theoretical analysis. Based on these findings, the simulations on lateral migration of paramagnetic and ferromagnetic elliptical particles in a pressure-drive flow shown that these two kinds of particles can be separated, which suggested a useful strategy to manipulate non-spherical micro-particles in the microfluidic devices.
Fourth, the fundamental mechanism of the particle-particle interactions and relative motions of a pair of paramagnetic elliptical particles in a quiescent flow were numerically investigated. Numerical simulations revealed that the particles spend much more time for the global reorientation than for the local magneto-orientation. For a larger particle aspect ratio, more time is required to form a chain, and the final particle and global relative orientation angles are larger. Therefore, this work provides useful information for the fundamental particle-particle interactions mechanism in the magnetic particle suspensions under a uniform magnetic field.
Last, a unique approach to manipulate droplet migration in microfluidic devise by using a uniform magnetic field were proposed. This approach does not induce direct magnetic forces on the droplets, instead, the Maxwell stresses arise at the droplet interface due to a change of magnetic susceptibility across the droplet interface, and consequently deform the droplet and affect its relative orientation to the flow. Due to the deformed shape and inclined angle to the shear flow, the droplet interacts hydrodynamically with the channel walls, and migrates in the cross-stream direction. In comparison to conventional magnetic separation, the uniform magnetic field technique is simple to implement and is favorable
for high-throughput parallelization. Multiple microfluidic channels can be conveniently integrated onto a single chip while being subjected to the same uniform magnetic field. The demonstrated technique thus provides a general mechanism for separation of micro-droplets, and has great potential for biological and biomedical applications that require sorting of droplets by their size, interfacial tension, or magnetic properties.
REFERENCES
Abbas, M. and Bossis, G., ‘Separation of two attractive ferromagnetic ellipsoidal particles by hydrodynamic interactions under alternating magnetic field,’ Physical Review E, 2017, 95(6), p. 062611.
Afkhami, S., Tyler, A., Renardy, Y., Renardy, M., St. Pierre, T., Woodward, R., and Riffle, J., ‘Deformation of a hydrophobic ferrofluid droplet suspended in a viscous medium under uniform magnetic fields,’ J. Fluid Mech., 2010, 663, pp. 358–384, ISSN 00221120 14697645, doi:10.1017/S0022112010003551.
Aggarwal, N. and Sarkar, K., ‘Deformation and breakup of a viscoelastic drop in a newtonian matrix under steady shear,’ Journal of Fluid Mechanics, 2007, 584, pp. 1–21.
Agresti, J. J., Antipov, E., Abate, A. R., Ahn, K., Rowat, A. C., Baret, J.-C., Marquez, M., Klibanov, A. M., Griffiths, A. D., and Weitz, D. A., ‘Ultrahigh-throughput screening in drop-based microfluidics for directed evolution,’ Proceedings of the National Academy of Sciences, 2010.
Ahn, B., Lee, K., Louge, R., and Oh, K. W., ‘Concurrent droplet charging and sorting by electrostatic actuation,’ Biomicrofluidics, 2009, 3(4), p. 044102.
Ahn, B., Lee, K., Panchapakesan, R., and Oh, K. W., ‘On-demand electrostatic droplet charging and sorting,’ Biomicrofluidics, 2011, 5(2), p. 024113.
Ahn, K., Kerbage, C., Hunt, T. P., Westervelt, R., Link, D. R., and Weitz, D. A., ‘Dielectrophoretic manipulation of drops for high-speed microfluidic sorting devices,’ Applied Physics Letters, 2006, 88(2), p. 024104.
Ai, Y., Beskok, A., Gauthier, D. T., Joo, S. W., and Qian, S., ‘Dc electrokinetic transport of cylindrical cells in straight microchannels,’ Biomicrofluidics, 2009a, 3(4), p. 044110.
Ai, Y., Joo, S. W., Jiang, Y., Xuan, X., and Qian, S., ‘Pressure-driven transport of particles through a converging-diverging microchannel,’ Biomicrofluidics, 2009b, 3(2), p. 022404.
Ai, Y. and Qian, S., ‘Dc dielectrophoretic particle–particle interactions and their relative motions,’ Journal of colloid and interface science, 2010, 346(2), pp. 448–454.
Ai, Y., Zeng, Z., and Qian, S., ‘Direct numerical simulation of ac dielectrophoretic particle–particle interactive motions,’ Journal of colloid and interface science, 2014, 417, pp. 72–79.
Alava, M. and Niskanen, K., ‘The physics of paper,’ Reports on progress in physics, 2006, 69(3), p. 669.
Allan, R. and Mason, S., ‘Particle behaviour in shear and electric fields. ii. rigid rods and spherical doublets.’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1962, 267(1328), pp. 62–76.
Anstey, N. M., Russell, B., Yeo, T. W., and Price, R. N., ‘The pathophysiology of vivax malaria,’ Trends in parasitology, 2009, 25(5), pp. 220–227.
Anupama, A., Kumaran, V., and Sahoo, B., ‘Magnetorheological fluids containing rod-shaped lithium–zinc ferrite particles: the steady-state shear response.’ Soft matter, 2018, 14(26), pp. 5407–5419.
Arruebo, M., Fernández-Pacheco, R., Ibarra, M. R., and Santamaría, J., ‘Magnetic nanoparticles for drug delivery,’ Nano today, 2007, 2(3), pp. 22–32.
Bell, R., Karli, J., Vavreck, A., Zimmerman, D., Ngatu, G., and Wereley, N., ‘Magnetorheology of submicron diameter iron microwires dispersed in silicone oil,’ Smart Materials and Structures, 2008, 17(1), p. 015028.
Bell, R., Miller, E., Karli, J., Vavreck, A., and Zimmerman, D., ‘Influence of particle shape on the properties of magnetorheological fluids,’ International Journal of Modern Physics B, 2007, 21(28n29), pp. 5018–5025.
Bica, I., Liu, Y. D., and Choi, H. J., ‘Physical characteristics of magnetorheological suspensions and their applications,’ Journal of Industrial and Engineering Chemistry, 2013, 19(2), pp. 394–406.
Bombard, A. J., Gonçalves, F. R., Morillas, J. R., and De Vicente, J., ‘Magnetorheology of dimorphic magnetorheological fluids based on nanofibers,’ Smart Materials and Structures, 2014, 23(12), p. 125013.
Bossis, G., Marins, J. A., Kuzhir, P., Volkova, O., and Zubarev, A., ‘Functionalized microfibers for field-responsive materials and biological applications,’ Journal of Intelligent Material Systems and Structures, 2015, 26(14), pp. 1871–1879.
Bowman, T., Frechette, J., and Drazer, G., ‘Force driven separation of drops by deterministic lateral displacement.’ Lab on a Chip, 2012, 12(16), pp. 2903–2908.
Brouzes, E., Kruse, T., Kimmerling, R., and Strey, H. H., ‘Rapid and continuous magnetic separation in droplet microfluidic devices,’ Lab on a Chip, 2015, 15(3), pp. 908–919.
Bucak, S., Sharpe, S., Kuhn, S., and Hatton, T. A., ‘Cell clarification and size separation using continuous countercurrent magnetophoresis,’ Biotechnology progress, 2011, 27(3), pp. 744–750.
Cao, Q., Li, Z., Wang, Z., and Han, X., ‘Rotational motion and lateral migration of an elliptical magnetic particle in a microchannel under a uniform magnetic field,’ Microfluidics and Nanofluidics, 2018, 22(1), p. 3.
Chaffey, C. and Mason, S., ‘Particle behavior in shear and electric fields. III. rigid spheroids and discs,’ Journal of Colloid Science, 1964, **19**(6), pp. 525–548.
Champion, J. A., Katare, Y. K., and Mitragotri, S., ‘Particle shape: a new design parameter for micro-and nanoscale drug delivery carriers,’ Journal of controlled release, 2007, **121**(1-2), pp. 3–9.
Chan, P.-H. and Leal, L., ‘The motion of a deformable drop in a second-order fluid,’ Journal of Fluid Mechanics, 1979, **92**(1), pp. 131–170.
Chen, P., Huang, Y.-Y., Hoshino, K., and Zhang, J. X., ‘Microscale magnetic field modulation for enhanced capture and distribution of rare circulating tumor cells,’ Scientific reports, 2015, **5**, p. 8745.
Chen, Q., Li, D., Zielinski, J., Kozubowski, L., Lin, J., Wang, M., and Xuan, X., ‘Yeast cell fractionation by morphology in dilute ferrofluids,’ Biomicrofluidics, 2017, **11**(6), p. 064102.
Chen, S.-D., Pan, T.-W., and Chang, C.-C., ‘The motion of a single and multiple neutrally buoyant elliptical cylinders in plane poiseuille flow,’ Physics of Fluids, 2012, **24**(10), p. 103302.
Daerr, A. and Mogne, A., ‘Pendent_drop: an imagej plugin to measure the surface tension from an image of a pendent drop,’ Journal of Open Research Software, 2016, **4**(1).
de Ruiter, R., Pit, A. M., de Oliveira, V. M., Duits, M. H., van den Ende, D., and Mugele, F., ‘Electrostatic potential wells for on-demand drop manipulation in microchannels,’ Lab on a Chip, 2014, **14**(5), pp. 883–891.
De Vicente, J., Klingenberg, D. J., and Hidalgo-Alvarez, R., ‘Magnetorheological fluids: a review,’ Soft matter, 2011, **7**(8), pp. 3701–3710.
De Vicente, J., Segovia-Gutiérrez, J., Andablo-Reyes, E., Vereda, F., and Hidalgo-Álvarez, R., ‘Dynamic rheology of sphere-and rod-based magnetorheological fluids,’ The Journal of chemical physics, 2009, **131**(19), p. 194902.
De Vicente, J., Vereda, F., Segovia-Gutiérrez, J. P., del Puerto Morales, M., and Hidalgo-Alvarez, R., ‘Effect of particle shape in magnetorheology,’ Journal of Rheology, 2010, **54**(6), pp. 1337–1362.
Dong, X., Tong, Y., Ma, N., Qi, M., and Ou, J., ‘Properties of cobalt nanofiber-based magnetorheological fluids,’ RSC Advances, 2015, **5**(18), pp. 13958–13963.
Du, G., Fang, Q., and den Toonder, J. M., ‘Microfluidics for cell-based high throughput screening platforms—a review,’ Analytica chimica acta, 2016, **903**, pp. 36–50.
Eastburn, D. J., Huang, Y., Pellegrino, M., Sciambi, A., Ptáček, L. J., and Abate, A. R., ‘Microfluidic droplet enrichment for targeted sequencing,’ Nucleic acids research, 2015, **43**(13), pp. e86–e86.
Feng, J., Hu, H. H., and Joseph, D. D., ‘Direct simulation of initial value problems for the motion of solid bodies in a newtonian fluid. part 2. couette and poiseuille flows,’ Journal of fluid mechanics, 1994, **277**, pp. 271–301.
Gao, J., Gu, H., and Xu, B., ‘Multifunctional magnetic nanoparticles: design, synthesis, and biomedical applications,’ Accounts of chemical research, 2009, **42**(8), pp. 1097–1107.
Gao, Y., Hulsen, M., Kang, T., and Den Toonder, J., ‘Numerical and experimental study of a rotating magnetic particle chain in a viscous fluid,’ Physical Review E, 2012, **86**(4), p. 041503.
Gavze, E. and Shapiro, M., ‘Particles in a shear flow near a solid wall: effect of nonsphericity on forces and velocities,’ International Journal of Multiphase Flow, 1997, **23**(1), pp. 155–182.
Gijs, M. A., ‘Magnetic bead handling on-chip: new opportunities for analytical applications,’ Microfluidics and Nanofluidics, 2004, **1**(1), pp. 22–40.
Gijs, M. A., Lacharme, F., and Lehmann, U., ‘Microfluidic applications of magnetic particles for biological analysis and catalysis,’ Chemical reviews, 2009, **110**(3), pp. 1518–1563.
Goldsmith, H. and Mason, S., ‘Axial migration of particles in poiseuille flow,’ Nature, 1961, **190**(4781), pp. 1095–1096.
Guo, F., Ji, X.-H., Liu, K., He, R.-X., Zhao, L.-B., Guo, Z.-X., Liu, W., Guo, S.-S., and Zhao, X.-Z., ‘Droplet electric separator microfluidic device for cell sorting,’ Applied Physics Letters, 2010, **96**(19), p. 193701.
Guo, M. T., Rotem, A., Heyman, J. A., and Weitz, D. A., ‘Droplet microfluidics for high-throughput biological assays,’ Lab on a Chip, 2012, **12**(12), pp. 2146–2155.
Hassan, M. R., Zhang, J., and Wang, C., ‘Deformation of a ferrofluid droplet in simple shear flows under uniform magnetic fields,’ Phys. Fluids, 2018, **30**(9), p. 092002, ISSN 1070-6631, doi:10.1063/1.5047223.
Hatch, A. C., Patel, A., Beer, N. R., and Lee, A. P., ‘Passive droplet sorting using viscoelastic flow focusing,’ Lab on a Chip, 2013, **13**(7), pp. 1308–1315.
Hejazian, M., Li, W., and Nguyen, N.-T., ‘Lab on a chip for continuous-flow magnetic cell separation,’ Lab on a Chip, 2015, **15**(4), pp. 959–970.
Hsu, R. and Ganatos, P., ‘Gravitational and zero-drag motion of a spheroid adjacent to an inclined plane at low reynolds number,’ Journal of Fluid Mechanics, 1994, **268**, pp. 267–292.
Hu, H. H., Patankar, N. A., and Zhu, M., ‘Direct numerical simulations of fluid–solid systems using the arbitrary lagrangian–eulerian technique,’ Journal of Computational Physics, 2001, **169**(2), pp. 427–462.
Huang, G., Li, M., Yang, Q., Li, Y., Liu, H., Yang, H., and Xu, F., ‘Magnetically actuated droplet manipulation and its potential biomedical applications,’ ACS applied materials & interfaces, 2017, 9(2), pp. 1155–1166.
Huang, S.-L., Chen, S.-D., Pan, T.-W., Chang, C.-C., and Chu, C.-C., ‘The motion of a neutrally buoyant particle of an elliptic shape in two dimensional shear flow: A numerical study,’ Physics of Fluids, 2015, 27(8), p. 083303.
Inglis, D. W., Riehn, R., Sturm, J. C., and Austin, R. H., ‘Microfluidic high gradient magnetic cell separation,’ Journal of Applied Physics, 2006, 99(8), p. 08K101.
Jamshaid, T., Neto, E. T. T., Eissa, M. M., Zine, N., Kunita, M. H., El-Salhi, A. E., and Elaissari, A., ‘Magnetic particles: From preparation to lab-on-a-chip, biosensors, microsystems and microfluidics applications,’ TrAC Trends in Analytical Chemistry, 2016, 79, pp. 344–362.
Jeffery, G. B., ‘The motion of ellipsoidal particles immersed in a viscous fluid,’ Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences, 1922, 102(715), pp. 161–179.
Jiang, W., Zhang, Y., Xuan, S., Guo, C., and Gong, X., ‘Dimorphic magnetorheological fluid with improved rheological properties,’ Journal of Magnetism and Magnetic Materials, 2011, 323(24), pp. 3246–3250.
Kadivar, E., Herminghaus, S., and Brinkmann, M., ‘Droplet sorting in a loop of flat microfluidic channels,’ Journal of Physics: Condensed Matter, 2013, 25(28), p. 285102.
Kang, S. and Suh, Y., ‘Direct simulation of flows with suspended paramagnetic particles using one-stage smoothed profile method,’ Journal of Fluids and Structures, 2011, 27(2), pp. 266–282.
Kang, T. G., Gao, Y., Hulsen, M. A., den Toonder, J. M., and Anderson, P. D., ‘Direct simulation of the dynamics of two spherical particles actuated magnetically in a viscous fluid,’ Computers & Fluids, 2013, 86, pp. 569–581.
Kang, T. G., Hulsen, M. A., den Toonder, J. M., Anderson, P. D., and Meijer, H. E., ‘A direct simulation method for flows with suspended paramagnetic particles,’ Journal of Computational Physics, 2008, 227(9), pp. 4441–4458.
Keaveny, E. E. and Maxey, M. R., ‘Modeling the magnetic interactions between paramagnetic beads in magnetorheological fluids,’ Journal of Computational Physics, 2008, 227(22), pp. 9554–9571.
Kim, J., Won, J., and Song, S., ‘Dual-mode on-demand droplet routing in multiple microchannels using a magnetic fluid as carrier phase,’ Biomicrofluidics, 2014, 8(5), p. 054105.
Kim, S. and Karrila, S. J., *Microhydrodynamics: principles and selected applications*, Courier Corporation, 2013.
Kuzhir, P., López-López, M. T., and Bossis, G., ‘Magnetorheology of fiber suspensions. ii. theory,’ Journal of rheology, 2009, **53**(1), pp. 127–151.
Larson, R. G., *The structure and rheology of complex fluids*, volume 150, Oxford university press New York, 1999.
Laser, D. J. and Santiago, J. G., ‘A review of micropumps,’ Journal of micromechanics and microengineering, 2004, **14**(6), p. R35.
Leal, L., ‘Particle motions in a viscous fluid,’ Annual Review of Fluid Mechanics, 1980, **12**(1), pp. 435–476.
Lee, C., Lee, J., Kim, H. H., Teh, S.-Y., Lee, A., Chung, I.-Y., Park, J. Y., and Shung, K. K., ‘Microfluidic droplet sorting with a high frequency ultrasound beam,’ Lab on a Chip, 2012, **12**(15), pp. 2736–2742.
Lee, S.-Y., Ferrari, M., and Decuzzi, P., ‘Design of bio-mimetic particles with enhanced vascular interaction,’ Journal of biomechanics, 2009a, **42**(12), pp. 1885–1890.
Lee, S.-Y., Ferrari, M., and Decuzzi, P., ‘Shaping nano-/micro-particles for enhanced vascular interaction in laminar flows,’ Nanotechnology, 2009b, **20**(49), p. 495101.
Leibacher, I., Reichert, P., and Dual, J., ‘Microfluidic droplet handling by bulk acoustic wave (baw) acoustophoresis,’ Lab on a Chip, 2015, **15**(13), pp. 2896–2905.
Li, H., Wu, Y., Wang, X., Zhu, C., Fu, T., and Ma, Y., ‘Magnetofluidic control of the breakup of ferrofluid droplets in a microfluidic y-junction,’ Rsc Advances, 2016, **6**(1), pp. 778–785.
Li, S., Ding, X., Guo, F., Chen, Y., Lapsley, M. I., Lin, S.-C. S., Wang, L., McCoy, J. P., Cameron, C. E., and Huang, T. J., ‘An on-chip, multichannel droplet sorter using standing surface acoustic waves,’ Analytical chemistry, 2013, **85**(11), pp. 5468–5474.
Link, D. R., Grasland-Mongrain, E., Duri, A., Sarrazin, F., Cheng, Z., Cristobal, G., Marquez, M., and Weitz, D. A., ‘Electric control of droplets in microfluidic devices,’ Angewandte Chemie International Edition, 2006, **45**(16), pp. 2556–2560.
Lombardi, D. and Dittrich, P. S., ‘Droplet microfluidics with magnetic beads: a new tool to investigate drug–protein interactions,’ Analytical and bioanalytical chemistry, 2011, **399**(1), pp. 347–352.
López-López, M. T., Kuzhir, P., and Bossis, G., ‘Magnetorheology of fiber suspensions. i. experimental,’ Journal of Rheology, 2009, **53**(1), pp. 115–126.
López-López, M. T., Vertelov, G., Bossis, G., Kuzhir, P., and Durán, J. D., ‘New magnetorheological fluids based on magnetic fibers,’ Journal of Materials Chemistry, 2007, **17**(36), pp. 3839–3844.
Lübbe, A. S., Alexiou, C., and Bergemann, C., ‘Clinical applications of magnetic drug targeting,’ Journal of Surgical Research, 2001, **95**(2), pp. 200–206.
Mandal, S., Bandopadhyay, A., and Chakraborty, S., ‘The effect of uniform electric field on the cross-stream migration of a drop in plane poiseuille flow,’ Journal of Fluid Mechanics, 2016, **809**, pp. 726–774.
Martinez, R., Roshchenko, A., Minev, P., and Finlay, W., ‘Simulation of enhanced deposition due to magnetic field alignment of ellipsoidal particles in a lung bifurcation,’ Journal of aerosol medicine and pulmonary drug delivery, 2013, **26**(1), pp. 31–40.
Matsunaga, D., Meng, F., Zöttl, A., Golestanian, R., and Yeomans, J. M., ‘Focusing and sorting of ellipsoidal magnetic particles in microchannels,’ Phys. Rev. Lett., 2017a, **119**, p. 198002, doi:10.1103/PhysRevLett.119.198002.
Matsunaga, D., Zöttl, A., Meng, F., Golestanian, R., and Yeomans, J. M., ‘Far-field theory for trajectories of magnetic ellipsoids in rectangular and circular channels,’ arXiv preprint arXiv:1711.00376, 2017b.
Melle, S. and Martin, J. E., ‘Chain model of a magnetorheological suspension in a rotating field,’ The Journal of chemical physics, 2003, **118**(21), pp. 9875–9881.
Mitragotri, S. and Lahann, J., ‘Physical approaches to biomaterial design,’ Nature materials, 2009, **8**(1), p. 15.
Morillas, J. R., Carreón-González, E., and De Vicente, J., ‘Effect of particle aspect ratio in magnetorheology,’ Smart Materials and Structures, 2015, **24**(12), p. 125005.
Mortazavi, S. and Tryggvason, G., ‘A numerical study of the motion of drops in poiseuille flow. part 1. lateral migration of one drop,’ Journal of Fluid Mechanics, 2000, **411**, pp. 325–350.
Mortensen, N. A., Okkels, F., and Bruus, H., ‘Reexamination of hagen-poiseuille flow: Shape dependence of the hydraulic resistance in microchannels,’ Physical Review E, 2005, **71**(5), p. 057301.
Nam, J., Lim, H., Kim, C., Yoon Kang, J., and Shin, S., ‘Density-dependent separation of encapsulated cells in a microfluidic channel by using a standing surface acoustic wave,’ Biomicrofluidics, 2012, **6**(2), p. 024120.
Neuberger, T., Schöpf, B., Hofmann, H., Hofmann, M., and Von Rechenberg, B., ‘Superparamagnetic nanoparticles for biomedical applications: possibilities and limitations of a new drug delivery system,’ Journal of Magnetism and Magnetic materials, 2005, **293**(1), pp. 483–496.
Ngatu, G., Wereley, N., Karli, J., and Bell, R., ‘Dimorphic magnetorheological fluids: exploiting partial substitution of microspheres by nanowires,’ Smart Materials and Structures, 2008, **17**(4), p. 045022.
Nguyen, N.-T., Ng, K. M., and Huang, X., ‘Manipulation of ferrofluid droplets using planar coils,’ Applied Physics Letters, 2006, 89(5), p. 052509.
Niu, X., Zhang, M., Peng, S., Wen, W., and Sheng, P., ‘Real-time detection, control, and sorting of microfluidic droplets,’ Biomicrofluidics, 2007, 1(4), p. 044101.
Oh, K. W. and Ahn, C. H., ‘A review of microvalves,’ Journal of micromechanics and microengineering, 2006, 16(5), p. R13.
Okagawa, A., Cox, R., and Mason, S., ‘Particle behavior in shear and electric fields. VI. the microrheology of rigid spheroids,’ Journal of Colloid and Interface Science, 1974, 47(2), pp. 536–567.
Pamme, N., ‘Magnetism and microfluidics,’ Lab on a Chip, 2006, 6(1), pp. 24–38.
Pamme, N., ‘On-chip bioanalysis with magnetic particles,’ Current opinion in chemical biology, 2012, 16(3-4), pp. 436–443.
Pan, T.-W. and Glowinski, R., ‘Direct simulation of the motion of neutrally buoyant circular cylinders in plane poiseuille flow,’ Journal of Computational Physics, 2002, 181(1), pp. 260–279.
Pan, T.-W., Huang, S.-L., Chen, S.-D., Chu, C.-C., and Chang, C.-C., ‘A numerical study of the motion of a neutrally buoyant cylinder in two dimensional shear flow,’ Computers & Fluids, 2013, 87, pp. 57–66.
Pankhurst, Q. A., Connolly, J., Jones, S., and Dobson, J., ‘Applications of magnetic nanoparticles in biomedicine,’ Journal of physics D: Applied physics, 2003, 36(13), p. R167.
Petersson, F., Nilsson, A., Holm, C., Jönsson, H., and Laurell, T., ‘Continuous separation of lipid particles from erythrocytes by means of laminar flow and acoustic standing wave forces,’ Lab on a Chip, 2005, 5(1), pp. 20–22.
Petousis, I., Homburg, E., Derks, R., and Dietzel, A., ‘Transient behaviour of magnetic micro-bead chains rotating in a fluid by external fields,’ Lab on a Chip, 2007, 7(12), pp. 1746–1751.
Rabinow, J., ‘The magnetic fluid clutch,’ Electrical Engineering, 1948, 67(12), pp. 1167–1167.
Raich, H. and Blümler, P., ‘Design and construction of a dipolar halbach array with a homogeneous field from identical bar magnets: Nmr mandhalas,’ Concepts in Magnetic Resonance Part B: Magnetic Resonance Engineering: An Educational Journal, 2004, 23(1), pp. 16–25.
Rao, L., Cai, B., Wang, J., Meng, Q., Ma, C., He, Z., Xu, J., Huang, Q., Li, S., Cen, Y., et al., ‘A microfluidic electrostatic separator based on pre-charged droplets,’ Sensors and Actuators B: Chemical, 2015a, 210, pp. 328–335.
Rao, L., Cai, B., Yu, X.-L., Guo, S.-S., Liu, W., and Zhao, X.-Z., ‘One-step fabrication of 3d silver paste electrodes into microfluidic devices for enhanced droplet-based cell sorting,’ AIP Advances, 2015b, 5(5), p. 057134.
Saffman, P., ‘On the motion of small spheroidal particles in a viscous liquid,’ Journal of Fluid Mechanics, 1956, 1(5), pp. 540–553.
Schmid, L., Weitz, D. A., and Franke, T., ‘Sorting drops and cells with acoustics: acoustic microfluidic fluorescence-activated cell sorter,’ Lab on a Chip, 2014, 14(19), pp. 3710–3718.
Sciambi, A. and Abate, A. R., ‘Generating electric fields in pdms microfluidic devices with salt water electrodes,’ Lab on a Chip, 2014, 14(15), pp. 2605–2609.
Sciambi, A. and Abate, A. R., ‘Accurate microfluidic sorting of droplets at 30 khz,’ Lab on a Chip, 2015, 15(1), pp. 47–51.
Sedlacik, M., Pavlínek, V., Vyroubal, R., Peer, P., and Filip, P., ‘A dimorphic magnetorheological fluid with improved oxidation and chemical stability under oscillatory shear,’ Smart Materials and Structures, 2013, 22(3), p. 035011.
Shang, L., Cheng, Y., and Zhao, Y., ‘Emerging droplet microfluidics,’ Chemical reviews, 2017, 117(12), pp. 7964–8040.
Shembekar, N., Chaipan, C., Utharala, R., and Merten, C. A., ‘Droplet-based microfluidics in drug discovery, transcriptomics and high-throughput molecular genetics,’ Lab on a Chip, 2016, 16(8), pp. 1314–1331.
Sheng, R., Flores, G., and Liu, J., ‘In vitro investigation of a novel cancer therapeutic method using embolizing properties of magnetorheological fluids,’ Journal of magnetism and magnetic materials, 1999, 194(1-3), pp. 167–175.
Shine, A. and Armstrong, R., ‘The rotation of a suspended axisymmetric ellipsoid in a magnetic field,’ Rheologica Acta, 1987, 26(2), pp. 152–161.
Sinha, A., Ganguly, R., De, A. K., and Puri, I. K., ‘Single magnetic particle dynamics in a microchannel,’ Physics of Fluids, 2007, 19(11), p. 117102.
Smart, J. R. and Leighton Jr, D. T., ‘Measurement of the hydrodynamic surface roughness of noncolloidal spheres,’ Physics of Fluids A: Fluid Dynamics, 1989, 1(1), pp. 52–60.
Smistrup, K., Hansen, O., Bruus, H., and Hansen, M. F., ‘Magnetic separation in microfluidic systems using microfabricated electromagnets—experiments and simulations,’ Journal of Magnetism and Magnetic Materials, 2005, 293(1), pp. 597–604.
Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Dynamics of paramagnetic and ferromagnetic ellipsoidal particles in shear flow under a uniform magnetic field,’ Physical Review Fluids, 2018, 3(8), p. 084201.
Stratton, J. A., *Electromagnetic theory*, John Wiley & Sons, 2007.
Stuart, D. C., Kleijn, C., and Kenjereš, S., ‘An efficient and robust method for lagrangian magnetic particle tracking in fluid flow simulations on unstructured grids,’ Computers & Fluids, 2011, **40**(1), pp. 188–194.
Suh, Y. K. and Kang, S., ‘Motion of paramagnetic particles in a viscous fluid under a uniform magnetic field: benchmark solutions,’ Journal of Engineering Mathematics, 2011, **69**(1), pp. 25–58.
Sung, Y. J., Kim, J. Y. H., Choi, H. I., Kwak, H. S., and Sim, S. J., ‘Magnetophoretic sorting of microdroplets with different microalgal cell densities for rapid isolation of fast growing strains,’ Scientific Reports, 2017, **7**(1), p. 10390.
Surenjav, E., Priest, C., Herminghaus, S., and Seemann, R., ‘Manipulation of gel emulsions by variable microchannel geometry,’ Lab on a Chip, 2009, **9**(2), pp. 325–330.
Suwa, M. and Watarai, H., ‘Magnetoanalysis of micro/nanoparticles: A review,’ Analytica chimica acta, 2011, **690**(2), pp. 137–147.
Tan, Y.-C., Fisher, J. S., Lee, A. I., Cristini, V., and Lee, A. P., ‘Design of microfluidic channel geometries for the control of droplet volume, chemical concentration, and sorting,’ Lab on a Chip, 2004, **4**(4), pp. 292–298.
Tan, Y.-C., Ho, Y. L., and Lee, A. P., ‘Microfluidic sorting of droplets by size,’ Microfluidics and Nanofluidics, 2008, **4**(4), p. 343.
Tan, Y.-C. and Lee, A. P., ‘Microfluidic separation of satellite droplets as the basis of a monodispersed micron and submicron emulsification system,’ Lab on a Chip, 2005, **5**(10), pp. 1178–1183.
Taylor, G. I., ‘The motion of ellipsoidal particles in a viscous fluid,’ Proceedings of the Royal Society of London. Series A, Containing Papers of a Mathematical and Physical Character, 1923, **103**(720), pp. 58–61.
Taylor, G. I., ‘The formation of emulsions in definable fields of flow,’ Proc. R. Soc. Lond. A, 1934, **146**(858), pp. 501–523.
Teste, B., Jamond, N., Ferraro, D., Viovy, J.-L., and Malaquin, L., ‘Selective handling of droplets in a microfluidic device using magnetic rails,’ Microfluidics and Nanofluidics, 2015, **19**(1), pp. 141–153.
Torres-Díaz, I. and Rinaldi, C., ‘Recent progress in ferrofluids research: novel applications of magnetically controllable and tunable fluids,’ Soft matter, 2014, **10**(43), pp. 8584–8602.
Trevelyan, B. and Mason, S., ‘Particle motions in sheared suspensions. i. rotations,’ Journal of Colloid Science, 1951, **6**(4), pp. 354–367.
Valero, A., Braschler, T., Rauch, A., Demierre, N., Barral, Y., and Renaud, P., ‘Tracking and synchronization of the yeast cell cycle using dielectrophoretic opacity,’ Lab on a Chip, 2011, **11**(10), pp. 1754–1760.
Winkleman, A., Perez-Castillejos, R., Gudiksen, K. L., Phillips, S. T., Prentiss, M., and Whitesides, G. M., ‘Density-based diamagnetic separation: devices for detecting binding events and for collecting unlabeled diamagnetic particles in paramagnetic solutions,’ Analytical chemistry, 2007, **79**(17), pp. 6542–6550.
Xi, H.-D., Zheng, H., Guo, W., Gañán-Calvo, A. M., Ai, Y., Tsao, C.-W., Zhou, J., Li, W., Huang, Y., Nguyen, N.-T., *et al.*, ‘Active droplet sorting in microfluidics: a review,’ Lab on a Chip, 2017, **17**(5), pp. 751–771.
Yamaguchi, M., Tanimoto, Y., and Yamaguchi, M., *Magneto-science: magnetic field effects on materials: fundamentals and applications*, volume 48, Springer, 2006.
Yang, B. H., Wang, J., Joseph, D. D., Hu, H. H., Pan, T.-W., and Glowinski, R., ‘Migration of a sphere in tube flow,’ Journal of Fluid Mechanics, 2005, **540**, pp. 109–131.
Yavuz, C. T., Prakash, A., Mayo, J., and Colvin, V. L., ‘Magnetic separations: from steel plants to biotechnology,’ Chemical Engineering Science, 2009, **64**(10), pp. 2510–2521.
Young, K. D., ‘The selective value of bacterial shape,’ Microbiol. Mol. Biol. Rev., 2006, **70**(3), pp. 660–703.
Zborowski, M., Sun, L., Moore, L. R., Williams, P. S., and Chalmers, J. J., ‘Continuous cell separation using novel magnetic quadrupole flow sorter,’ Journal of Magnetism and Magnetic Materials, 1999, **194**(1-3), pp. 224–230.
Zhang, J., Sobecki, C. A., Zhang, Y., and Wang, C., ‘Numerical investigation of dynamics of elliptical magnetic microparticles in shear flows,’ Microfluidics and Nanofluidics, 2018, **22**(8), p. 83.
Zhang, J. and Wang, C., ‘Study of rotation of ellipsoidal particles in combined simple shear flow and magnetic fields,’ COMSOL Conference 2017 Boston, 2017.
Zhang, J. and Wang, C., ‘Numerical study of lateral migration of elliptical magnetic microparticles in microchannels in uniform magnetic fields,’ Magnetochemistry, 2018a, **4**(1), p. 16.
Zhang, J. and Wang, C., ‘Numerical study of lateral migration of elliptical magnetic microparticles in microchannels in uniform magnetic fields,’ Magnetochemistry, 2018b, **4**(1), p. 16.
Zhang, K., Liang, Q., Ai, X., Hu, P., Wang, Y., and Luo, G., ‘On-demand microfluidic droplet manipulation using hydrophobic ferrofluid as a continuous-phase,’ Lab on a Chip, 2011, **11**(7), pp. 1271–1275.
Zhang, K., Liang, Q., Ma, S., Mu, X., Hu, P., Wang, Y., and Luo, G., ‘On-chip manipulation of continuous picoliter-volume superparamagnetic droplets using a magnetic force,’ Lab on a Chip, 2009, **9**(20), pp. 2992–2999.
Zhang, Z., Zhou, R., P Brames, D., and Wang, C., ‘A low-cost fabrication system for manufacturing soft-lithography microfluidic master molds,’ Micro and Nanosystems, 2015, **7**(1), pp. 4–12.
Zhou, R., Bai, F., and Wang, C., ‘Magnetic separation of microparticles by shape,’ Lab on a Chip, 2017a, **17**(3), pp. 401–406.
Zhou, R., Sobecki, C. A., Zhang, J., Zhang, Y., and Wang, C., ‘Magnetic control of lateral migration of ellipsoidal microparticles in microscale flows,’ Physical Review Applied, 2017b, **8**(2), p. 024019.
Zhou, Y., Song, L., Yu, L., and Xuan, X., ‘Continuous-flow sheathless diamagnetic particle separation in ferrofluids,’ Journal of Magnetism and Magnetic Materials, 2016, **412**, pp. 114–122.
Zhou, Y. and Xuan, X., ‘Diamagnetic particle separation by shape in ferrofluids,’ Applied Physics Letters, 2016, **109**(10), p. 102405.
Jie Zhang was born in Lu’an, Anhui, China. He received his Bachelor of Science degree in Thermal Energy and Power Engineering in June 2013 from University of Shanghai for Science and Technology, Shanghai, China. In June 2016, he received his Master of Science degree in Power Machinery and Engineering from University of Shanghai for Science and Technology, Shanghai, China. In August 2020, he received his Doctor of Philosophy degree in Mechanical Engineering from Missouri University of Science and Technology, Rolla, Missouri, USA. His research interests included fluid mechanics, computational fluid dynamics, finite element method, microfluidics, particle suspensions, and droplet dynamics at the microscale scale. During this Ph.D period, Jie worked as a graduate assistant and took charge of the course of Senior Engineering Design and Fluid Mechanics Lab. He authored and co-authored 11 journal papers and 8 conference abstracts/papers/presentations.
|
b2c37534-d28c-47ac-ba7d-6d7459d60170
|
CC-MAIN-2021-04
|
https://scholarsmine.mst.edu/cgi/viewcontent.cgi?article=3931&context=doctoral_dissertations
|
2021-01-22T22:59:08+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00075-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet
| 532,386,307 | 75,944 |
eng_Latn
|
eng_Latn
| 0.823858 |
eng_Latn
| 0.923637 |
[
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"por_Latn",
"por_Latn",
"slv_Latn",
"pol_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | true |
docling
|
[
907,
1323,
1371,
1976,
3961,
5329,
7012,
9493,
12295,
14582,
15486,
17487,
20694,
23330,
25638,
26299,
28221,
30652,
32755,
35040,
35671,
37828,
40058,
40332,
41553,
43378,
44733,
45720,
47333,
48770,
49711,
50505,
51465,
53108,
53628,
56169,
58085,
59731,
61479,
61811,
63433,
65385,
67550,
69813,
71323,
72626,
74347,
76336,
77983,
79286,
80561,
81510,
83155,
85458,
88090,
89415,
90990,
93429,
94601,
96166,
97103,
99410,
100832,
101792,
104066,
105211,
107306,
109936,
111946,
113610,
115718,
118095,
120171,
120858,
122880,
124665,
126942,
128924,
130011,
131124,
132846,
134801,
136561,
138580,
139935,
140939,
142031,
144275,
144657,
145037,
147211,
147840,
149999,
150600,
151795,
154094,
155193,
156480,
158650,
159853,
160630,
162927,
165223,
167704,
169312,
170819,
172963,
175268,
177564,
179627,
180882,
182471,
184501,
186599,
188167,
190808,
192265,
194468,
194994,
197447,
198994,
201238,
202282,
203602,
204763,
207168,
208275,
210264,
212822,
215370,
217845,
218370,
219726,
221922,
224354,
226643,
228091,
230244,
231156,
232925,
235414,
237361,
238745,
240952,
241874,
242649,
244591,
246619,
248868,
251495,
254028,
256585,
259220,
259534,
261500,
263820,
264252,
266586,
269161,
271784,
274371,
276868,
279493,
282129,
284563,
287119,
289621,
292189,
293272,
294232
] |
RAINWORTH PARISH COUNCIL
MINUTES OF THE MEETING HELD ON 8 TH NOVEMBER 2012 at 7pm
IN ATTENDACE
Cllr's L Tift, I Speller, V Stephenson, J Stephenson, B Hardy, J Saunders, J Middleton, M Buttery, M Jefferies, J Bradbury, P Cullen. Parish Clerk – D Jones
County Councillor Geoff Merry 7.45pm to 7.55pm.
The meeting was taped from 7pm.
The meeting was chaired by Cllr M Buttery
APOLOGIES
No apologies were received from Cllr A Armin.
Prior to the start of the meeting the Chairman requested that Register of Members Interests – Dispensations, be added to the agenda under item No.2 Declarations of Interest and Not Just Swimming – Planning Application, be added to agenda under item No.11 Planning. All in favour – Unanimous.
The Chairman asked all members present to switch off and put away any form of recording device and reminded each member present that the recording of any meeting of the Council was not permitted and referred members to Rainworth Parish Council's Standing Order No.11.
DECLARATIONS OF INTEREST
None
The Clerk read aloud information received from Kirsty Cole regarding Councillors requirements to obtain a dispensation to take part in precept discussions and decisions. The Clerk handed each member an application form for dispensation and requested that it be returned prior to the 10-1-2013 meeting. A sub-committee comprising of Cllrs L Tift, V Stephenson, M Buttery and M Jefferies will review the completed forms and report back to the Council.
MINUTES
The minutes of the meeting held on 11-10-2012 were confirmed as a true & correct record by all members at the meeting.
The Chairman signed the minutes.
POLICE
Date of next police surgery – Tuesday 27 th November 10am to 11am.
Signed……………………………………………………… Date……………………….
FINANCE & ACCOUNTS
A schedule of accounts up to 31 st October 2012 including payments to the total of £5,333.24 and remittance of £17.00 was presented to the meeting.
It was proposed and resolved to approve the accounts and payments up to 31-10-2012.
Cllr J Bradbury stated that Section 106 monies were available for future projects.
PLAYING FIELDS & OPEN SPACES
Cllr's M Buttery and M Jefferies will inspect the goal posts on the Preston Rd playing field for stability. Mole hills will be monitored.
TRANSPORT, HIGHWAYS, FOOTWAYS & LIGHTING
Concerns were raised regarding street lighting irregularities, grit bins and overgrown hedging on Southwell Rd East.
County Councillor Geoff Merry reported that a safety barrier will be erected on the carriageway adjacent to the roundabout at the start of Centenary Way.
NCC have cut back and tidied the raised planters on one side of Kirklington Rd.
ENVIRONMENTAL
Email from Shlomo Dowen received and noted RE: Veolia have withdrawal their legal challenge to the Secretary of State's decision to refuse planning permission for a proposed facility at the former Rufford Colliery site.
DONATIONS
Thank you letter received & noted from Ollerton CAB.
Donation request from Sherwood Foreset Money Advice Centre - unsuccessful.
It was unanimously agreed to donate £60 to the 2012 Poppy Appeal.
County Councillor Geoff Merry presented the Parish Council with a cheque for £600 towards community events.
COMMUNITY MATTERS
Councillors discussed the details of the forthcoming O.A.P Christmas Party.
PLANNING APPLICATIONS
12/01400/FUL 62 Rufford Ave P/C Object
It was noted that NSDC had never replied to the Parish Councils objections regarding the planning proposals for the ex-public toilets.
It was proposed and resolved to submit a planning application on behalf of the Not Just Swimming group to help save costs. All monies will be fully reimbursed by the Not Just Swimming group to the Parish Council.
Cllr's M Buttery, L Tift and J Bradbury abstained from the vote.
Signed.................................................................... Date..................................................
VILLAGE HALL REPS REPORT
AGM - 25th October 2012
Forthcoming Christmas Fair - 24th November 2012
CORRESPONDENCE
Notts County Council – 2013/14 Budget Consultation 12 weeks from 5 th November 2012.
DATE OF NEXT MEETING
10 th January 2013.
Meeting closed at 8.05pm.
|
<urn:uuid:42df8e10-d005-4e75-b207-1046c51440cc>
|
CC-MAIN-2020-24
|
http://www.rainworth-pc.org.uk/index.php?option=com_k2&view=item&layout=item&id=6&Itemid=131&jsmallfib=1&dir=JSROOT/Minutes/2012&download_file=JSROOT/Minutes/2012/10+%288th+November%29.pdf
|
2020-05-31T09:22:31+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-24/subset=warc/part-00296-b4a094ce-c3a1-4796-8c26-d927e48e4b4a.c000.gz.parquet
| 193,899,874 | 986 |
eng_Latn
|
eng_Latn
| 0.940143 |
eng_Latn
| 0.996071 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
1766,
3798,
4204
] |
FIND YOUR INNER GLOW AT THIS LUXURY WELLNESS GETAWAY
Text by Aparna Gupta
The way to a facial glow with #NoFilter is through soul-searching.
When stars like Gwyneth Paltrow, Kylie Jenner, Bella Hadid, Salma Hayek and Cindy Crawford posted photographs of their bare faces, sans make-up, they weren’t denouncing the concept of vanity but redefining it. Exuding radiance from within is the new goal for many and entails cleansing your mind, not just your face. As supermodel Alessandra Ambrosio, considered one of the world’s sexiest women, says, ‘Feel good. Once you feel good, you look good, too.’ This belief is inspiring many to take healing holidays and move towards green living.
The concept of a vacation with a purpose brought fitness enthusiast Nikhil Kapur and pranic healer Sharmilee Agrawal Kapur together, as business and life partners. While pursuing a masters in business administration, Agrawal Kapur had an idea for a luxury wellness getaway where the focus was on oneself. ‘A place with a 360-degree approach to wellness — where you can achieve your goals in a concentrated way, away from the stresses of daily deadlines. The food had to be healthy but gourmet, working in tandem with the workout and spa sessions to maximise the benefits and show results in as little as three days.’ Atmantan, a sprawling wellness retreat nestled in
the lap of Sahyadri hills, overlooking the Mulshi Lake near Pune, is their labour of love.
The first glimpse of the aesthetically designed villas, cobbled pathways and lush vines enveloping the walls gives the impression of a luxury retreat rooted in nature. As I check in, a glass of fresh vegetable juice is offered, setting the pace for the day. Golf carts are available on request, but I am encouraged to find my way around the resort on foot. Rooms are equipped with all material comforts imaginable, except for coffee, milk, sugar and aerated beverages. Not without reason. Besides being fattening, the addition of milk in tea negates all the benefits of its leaves. Caffeine and soda can dehydrate and hinder the flushing out of toxins. Instead, there is a variety of herbal teas, packets of assorted nuts and some muesli bars. That’s when I start to realise that this is not your average spa resort. Atmantan means business.
The restaurant follows the farm-to-table philosophy with vegetables and poultry procured from the resort’s own organic farms. No processed food — refined sugar, flour, salt, pickles or jams — is allowed in the pantry. Simple carbohydrates, like white sugar and bread, cause insulin levels to spike, leading to increased inflammation over time. “Inflammation produces enzymes that break down collagen and elastin, resulting in sagging skin and wrinkles,” adds Dr Manoj Kutteri, the wellness director. Slow cooking methods such as steaming, broiling, poaching, grilling, baking and sous vide are embraced to retain the nutritional value of the ingredients. What comes on my small plate is a tiny portion of gorgeously plated organic fare sprinkled with edible flowers and herbs, all freshly picked from the chef’s garden on campus. The Lilliputian tableware is by design. “Once the guests get used to the smaller plates, they are more accepting of the ‘automatic’ portion control,” adds Kapur. The staff waits on me with utmost diligence but politely stops me from texting while eating. Being fully present and committed to one task is an indispensable aspect of mindful living and managing stress. After a couple of meals, my appetite adjusts to the food on offer and I am able to leave the table without craving for more.
The epicentre of the resort, the wellness centre, consists of a spa, state-of-the-art gym, and meditation and yoga areas. The indoor heated pool uses salt instead of chlorine to purify the water. It all begins with a body-fat analysis and Ayurvedic consultation after which one decides the type of programme to follow. The idea is not only to lose weight or inches but also to boost energy levels. The exhaustive spa menu is a melting pot of diverse systems of natural healing — from Chinese medication and Ayurveda to Western massages. Once I am given a list of treatments to complement my wellness targets, I am firmly encouraged to take up a minimum of two physical activities per day. Zumba, bhangra, tai chi, yogic breathing, meditation, asanas, aqua aerobics and functional training leave me spoilt for choice. My fanciful notion that a healing vacation entails massages, eating and sleeping slowly slips out the window!
Firmly believing that relaxing the body is only half the battle won, there is an emphasis on emotional healing through treatments such as Chi Nei Tsang, a unique Taoist abdominal massage. The systematic and intense pressing of the gut promotes circulation while balancing the nervous system to provide relief from grief, fatigue and fear. Mind and skin are intimately intertwined — often dullness, acne and hair loss have their roots in stress. “Modern society places far greater pressure on people. If everyone has the latest designer trends and aspirational goods, what value do they hold? In a way, priorities are now shifting so that the greatest luxury is time and appreciation of experiences,” explains British-born Jacqueline Bourbon, spiritual healer, transformational teacher and a visiting practitioner at Atmantan. Through her sessions she helps her clients realise their potential and lead more joyful lives. “You can use the best of skincare and make-up, but if you are stressed from within, it will reflect on your face. Similarly if you feel good about yourself and life, you glow and it’s very hard to fake this inner radiation.”
As I head home after three days of caring about nothing but energising my body and mind, my biggest challenge is to find ways to continue prioritising my own well-being. Without a team of skilled professionals tending to my needs it is going to be an uphill, though not impossible, task. The trick lies in being mindful.
Tags: Atmantan, Beauty, Featured, Health, Nikhil Kapur, Sharmilee Agrawal Kapur, Skincare, Wellness
|
<urn:uuid:6537dd67-f884-4344-b961-92b817911f8f>
|
CC-MAIN-2018-34
|
https://www.atmantan.com/wp-content/uploads/2018/05/Verve_Jan.pdf
|
2018-08-17T17:05:40Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221212639.36/warc/CC-MAIN-20180817163057-20180817183057-00642.warc.gz
| 833,637,261 | 1,284 |
eng_Latn
|
eng_Latn
| 0.997198 |
eng_Latn
| 0.998372 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
1353,
4539,
6109
] |
AN UMBRELLA OF BROTHERHOOD:
WHAT IS THE "ULT" ANYWAY?
Carlos Cardoso Aveline
Some friends and associates of the ULT complain from time to time:
They say they rarely hear from or read about the United Lodge of Theosophists.
At least one of such students, recently associated to the ULT, wrote that he is happy to have "discovered" the ULT earlier 2005 after 22 years of experience within the "narrow walls" of the Adyar Theosophical Society and after three years as an independent student.
But he added: "I would be STILL HAPPIER if I could have discovered the ULT earlier this life."
It sounded like he was thinking of thousands of Theosophy students worldwide who do not have a chance yet to know much about the ULT.
Indeed, many students nowadays may look around for an authentic umbrella to defend themselves and their spiritual search from the heavy rain of ritualistic pseudo theosophy. If they see nothing outside the Theosophical Society (Adyar), they may believe they are in a worldwide desert.
Some experienced observers say that this need for alternatives is especially true now that the karma of the Adyar TS seems to get quicker.
Yet the problem is not limited to not knowing of ULT's existence.
Students who do get in contact with the ULT, can't always and easily understand the nature of the endeavor started in 1909 by Robert Crosbie, John Garrigues and a few others.
The lack of an aggressive propaganda, the priority to silent forms of work, the absence of centralized and bureaucratic authorities make the task of understanding the U.L.T. somewhat difficult for newcomers.
For these people we say:
"Examine these questions into your own heart. Write to 'The Aquarian Theosophist' and someone will answer to you. Knock at the door and it will be opened."
In order to help clarify at least in part some of the most common doubts about the ULT, we publish below a short text by Dallas TenBroeck which discusses the meaning of the ULT's Associate Card and related issues in everyday life.
TABLE OF CONTENTS
What is the ULT, ANYWAY? 1
Theosophy, the ULT, and its Associate Card 2
The ULT Declaration 3
The ULT Associate Card 4
To The Man in The Street 4
The Global Village 8
HPB Defense Fund Report 11
Every Challenge is an Opportunity 11
Correspondence 12
News from ULT — Athens, GREECE 14
Genius 15
Aethrobacy 21
Dust Storms on the Moon 22
THEOSOPHY, THE U.L.T. AND ITS 'ASSOCIATE CARD'
by Dallas TenBroeck
As far as I can see the signing of a form has a meaning only to the individual who signs.
No "membership" list is kept. People are "associates," and their Association Card is recorded.
After studying the implications of the "DECLARATION OF THE U.L.T." one may, or may not offer to sign such an "associate" card. The decision means no more than that which the individual intends in his own "Heart" to support and sustain. So there is no room for false promises. All signers determine for themselves what they will do. The commitment is to THEOSOPHY, to one's own HIGHER SELF, and to no outside individual or "form."
The U.L.T. will continue to offer its free help and facilities to all-comers.
No questions asked of anyone.
Freedom and independence:
"fearlessness, sincerity, assiduity in devotion, generosity, self-restraint, piety, and alms-givings, study, mortification, and rectitude; harmlessness, veracity, and freedom from anger, resignation, equanimity, and not speaking of the faults of others, universal compassion, modesty, and mildness; patience, power, fortitude, and purity, discretion, dignity, un revengefulness, and freedom from conceit" these are the marks of him whose virtues are of a "godlike" character." [Quoted from Chapter 16, Bhagavad-Gita]
Some ask "What is THEOSOPHY?"
Some say that if we adopt for ourselves and for others rigid ideas of THEOSOPHY we will fail to see the value of others' sayings and teachings.
If we have grasped the eclecticism of THEOSOPHY, we need not fear that mere words will grade or separate individuals. That is not the concept of Brotherhood. There is a vast spiritual Unity in the Universe.
The effect must be an immense and a radical one. In the first place they will change all our conceptions of time and therefore of the relative values of the events that move in time.
The light of law will lift us forever beyond the reach of fear, because we shall know that a cruel or indifferent chance has no part nor lot in our fortunes, that we are masters of our fate and the captain of our soul.
We move forward in the light of a law that is merciful because it is just, that declares its presence in the least of the events of our lives, that holds the universe in its grasp for the sake of the human soul, that inflicts pleasure and pain for no other purpose than to point out the only road that leads to happiness.
This is no philosophy for the elect. It demands no large learning for its comprehension. It owes nothing to authority or to revelation. Its appeal is to every human being whose eyes are open to the facts of his own life, who can take but one step from the seen to the unseen.
Are we apprehensive that the adoption of a spiritual philosophy will militate against what we call our "success in life?" It would indeed be strange if ignorance were more profitable than knowledge, if weakness were a larger advantage than strength. The greatest of all success in life is reserved for those who know what life is, its origin, purpose, laws and destiny. Work comes to those who ally themselves with nature, not to those who resist her: to those who keep her laws, not to those who violate them.
WE ARE ALL ONE.
It is a brotherhood of ideas and, like all sciences and philosophies, it has a few basic concepts — since it is the most ancient wisdom, those concepts are universal, basic and apply to all who profess to speak for THEOSOPHY, in whatever language and in time or clime.
They give the same scope to all, and limit no one.
ANCIENT WISDOM knew — and continues to know — deep and vast knowledge about ourselves, our purpose in life, nature, the universe, the highest god-like principles, and man's long history on this earth.
Theosophy is the portion of that ancient knowledge brought to us by H. P. Blavatsky toward the end of the 19th century, as taught to her by her Teachers.
Or, as remarked on pages 3&4 of *ULT: Its Mission and Its Future*:
THE UNITED LODGE OF THEOSOPHISTS is an association of students of Theosophy originating through the determination of a small number of Theosophists to pursue the objectives of the Theosophical Movement without organizational distractions and formalities. The conception of U.L.T. (United Lodge of Theosophists) as a vehicle for Theosophical work derives from the experience and insight of Robert Crosbie, a man who, throughout a long association with the original Theosophical Society, was witness to the schisms and divisions caused in the movement by organizational claims, controversy over “authority,” and the competition of personal leaders.
In 1909, with the help of a few others who shared his unsectarian view of Theosophy, Mr. Crosbie formed the United Lodge of Theosophists—a body which was defined by a simple statement of intent — the U.L.T. Declaration (see page 3).
The immediate work of the U.L.T. became twofold:
The task of restoring the original Theosophical teachings of Madame Blavatsky and William Q. Judge and making them available to the public.
Inaugurating a program of practical Theosophical education with regular public meetings. These furnish the platform for interaction of seeking minds.
The “Declaration” has remained the guiding focus of work, and remains unchanged.
Although study and understanding of Theosophy are regarded by its advocates and supporters as a lifetime undertaking, a general view of this philosophy is necessary to a comprehension of U.L.T. The basic idea is that there is in every human being the latent capacity for self-knowledge, for self-reliant decision on all the great questions, and for progress in understanding through the study and application of philosophy in daily life. While people may and do learn from one another and, indeed, learn better and more rapidly in cooperative association than in any other way—each individual is ultimately responsible for his own growth, and is himself the only final authority concerning what he will accept as knowledge and truth. It follows that the best association is one which provides a maximum of individual freedom and at the same time full opportunity for contact and collaboration with others who are endeavoring to move in the same direction.
---
**The U.L.T. Declaration**
**THE UNITED LODGE OF THEOSOPHISTS: DECLARATION**
The policy of this Lodge is independent devotion to the cause of Theosophy, without professing
attachment to any Theosophical organization, It is loyal to the great Founders of the Theosophical Movement, but does not concern itself with dissensions or differences of individual opinion.
The work it has on hand and the end it keeps in view are too absorbing and too lofty to leave it the time or inclination to take part in side issues. That work and that end is the dissemination of the Fundamental Principles of the Philosophy of Theosophy, and the exemplification in practice of those principles, through a truer realization of the SELF; a profounder conviction of Universal Brotherhood.
It holds that the unassailable basis for union among Theosophists, wherever and however situated, is “similarity of aim, purpose and teaching,” and therefore has neither Constitution, By-Laws nor Officers, the sole bond between its Associates being that basis. And it aims to disseminate this idea among Theosophists in the furtherance of Unity.
It regards as Theosophists all who are engaged in the true service of Humanity, without distinction of race, creed, sex, condition or organization, and It welcomes to its association all those who are in accord with its declared purposes and who desire to fit themselves, by study and other wise, to be the better able to help and teach others. “The true Theosophist belongs to no cult or sect, yet belongs to each and all.”
**THE ULT ASSOCIATE CARD**
The following is the form signed by Associates of the United Lodge of Theosophists:
Being in sympathy with the purposes of this Lodge, as set forth in its
“Declaration, I hereby record my desire to be enrolled as an Associate, it being understood that such association calls for no obligation on my part, other than that which I, myself, determine.
**TO THE MAN IN THE STREET**
UNLESS Theosophy has something definite to offer to the man in the street it may as well disappear from the field of human interest. If its mission is only to coteries of learning or curiosity it is unworthy the devotion of those who promulgate and defend it. If it is inadequate to any need of humanity, if it retires baffled before any problem of fate and fortune, if it fails to make life better worth living and death better worth dying, its advocates may admit that they have misdirected their energies and dedicated their lives amiss. But it is to the man in the street that Theosophy makes its chief appeal. It is to the masses of humanity—not to the few nor the elect—that its chief gifts are offered. It invites to its study all who would see an orderly law of life in the place of chaotic chance, all who would recognize the operations of an absolute justice dominant over human affairs, all who would enter consciously into an individual existence whose immensities are not limited by death or change.
In protesting against the binding power of creeds we must not overlook the effect of belief upon action and upon character. Every deed of our lives is governed by our conceptions of self-interest, although those conceptions may be as lofty as they are often debased. The toiler among the poor is actuated by an exalted sense of self-interest that demands
service and compassion. The burglar believes that he will benefit by his theft. Cruelty, greed, and passion all are honest in so far as they are interpretations, or rather misinterpretations, of self-interest. According to our readings of life, of time, and of divine law, so will be our actions. Belief governs conduct. It is the yardstick by which we measure the import of events and their value to ourselves. An hour of sunshine is the life of a gnat, a cloud is its tragedy, a drop of rain its extinction. A span of minutes is its standard of values.
It would seem then that religion, which is only another name for philosophy, is actually a standard of values. A religious belief is a yardstick by which we measure the import of events. If we conceive of human life as bounded by birth and by death, with nothingness before and annihilation after, it is obvious that all the events of that life will seem large in inverse proportion to the brevity of the period. A child cries for a broken toy because its conception of life is so narrow as to make the tiny mishap seem a tragedy. Its standard of values is inadequate. Enlarge our time conceptions of life and we dwarf the relative magnitudes of its events and completely change our angle of vision. In the same way a religious or philosophic conception may change our entire estimate of self-interest. If we accept the idea of a perpetual and conscious individual life, we must at once rearrange our computations of value. If we believe that the perpetual and conscious individual life is governed by a precise law of cause and effect we shall be tranquil under the disabilities that we shall know to be self-created, and we shall be hopeful of a future in which there will be fewer seeds of ill to fructify. If we recognize the unity of the life that sweeps through the universe we shall be careful to injure none of its manifestations, and we shall recognize that fraternity is not merely a sentiment but a compelling law that cannot be thwarted. And if we perceive the dominance of an unchanging and resistless law that moves inexorably towards its goal we shall have learned to cast out fear from our hearts. All these things are practical achievements. There is no one whom they do not concern. They come within the scope of the average human intellect. And they give to life a confidence, a strength, and a tranquility that can come from no other source.
Therefore it is evident that every man has some kind of a philosophy of life, even though it be unformulated, even though he be unaware of its existence. Every man without exception is trying to be happy, and his life is governed by some policy that he believes will conduce to his happiness. Every man has some time standard, usually the duration of his own life, or even the duration of his youth, by which he measures the importance of the things that happen to him. Theosophy thus makes a double appeal to the average man. It tries to show him how he may acquire a true and a permanent happiness. And it tries to furnish him with a new time standard so that he may revise the relative values of his daily experiences. But Theosophy seeks to achieve its end, not by the imposition of dogmas nor by the weight of spiritual authority. It asks only for a courageous facing of known facts and for the inferences logically to be drawn from those facts. In other words, it appeals only to universal knowledge and to the reasoning faculty.
Let us then take the two groups of facts most apparent to us, that is to say the facts of consciousness and the facts of experience. It is obvious that consciousness and character are being continually changed by events of experience. Every event that befalls us adds somewhat to the knowledge that governs our future actions. In other words it changes our character, however
slightly. And every such change increases our happiness, or detracts from it. So true is this that every man has made for himself a certain classification of the things that he must not do because they bring unhappiness, and of the things that he ought to do because they bring happiness. He may be wholly wrong in his judgment, he may have based it upon ignorance, but at least he has attempted to reach a judgment, and to discriminate between the things that are good for him and the things that are had for him.
And every experience whether good or evil has changed his character. It is then evident that nature is trying to teach him something, that inasmuch as his character is being constantly changed by experience there must be somewhere in the great mind of nature a destination, a plan, an intention. If we see the foundations and the framework of an unfinished house we know them for exactly what they are, and we may even foresee the ultimate form and appearance of the house when the builder shall have finished his work. We know that somewhere there is an architect's plan, a blue print, that there is purpose and design behind every hammer stroke, that there is no detail too insignificant to find its place. The acorn bursting in the ground is the prediction of the oak tree. Wherever there is motion or change there also there must be intention, a destination, and an architect's plan. Theosophy asks the average man to look at the changes in his own character, at the praise and blame of conscience which bring happiness and unhappiness, and so to ask himself what is the intention of evolutionary nature toward him, what is it that nature would have him be. In other words, what is the architect's plan of this unfinished human house. Surely there can be no other question so practical as this.
And as soon as we recognize that there is a plan, that we ourselves are uncompleted structures, we see at once that the limits of one earth life are pitifully inadequate for its completion. And it is a plan that can be completed nowhere else but on earth, since it concerns itself mainly with our bearing toward our fellow men. We have been born with certain characters, that is to say with certain tendencies in our bearing toward others. As we live through our lives these characters have been gradually changing by experience. Since experience is thus obviously the only factor in a change of character it is evident that the character with which we are born must have been fashioned at some time by experiences of the same nature as those that are now changing it. And since it is equally evident that our characters are still unfinished structures, far short of nature's design, the process of experiencing must be continued, and continued under, like conditions to the present, that is to say, by human contact under earth conditions. And so we reach what may be called the central Theosophic tenet, that all evolution has a destination, and that it proceeds toward that destination through a process of re-embodiment or reincarnation in which the law of ethical cause and effect holds sway: "Whatsoever a man soweth that shall he also reap." And in this there is no dogma, no authority, no supernatural revelation. It is simply an irresistible deduction from obvious facts.
Now it would be possible to argue at great length in support of the contentions
(1) that there is one, Universal Life sweeping through all the kingdoms of nature and that we ourselves are expressions of that One Life and separated from one another only by the illusions of the selfish personality.
(2) That the method of evolution is through constant re-embodiments or reincarnations which are knit
together by the law of cause and effect, such law assuming an ethical aspect in human evolution and producing such circumstances in each earth life as have been earned by the thoughts and acts of the lives that preceded it.
(3) That all evolutionary movements are regulated by a precise and cyclic law, and that nowhere in the universe or in human life can there be such a thing as chance or a permanent injustice. It would be easy to show that these great postulates have been the basis of every religion that the world has ever known and that they are commended alike by reason and by experience. But the present object is not to argue about these things but merely to state them, to leave them for consideration, and to suggest the effect that they must have upon the lives of those who accept them as truths.
The effect must be an immense and a radical one. In the first place they will change all our conceptions of time and therefore of the relative values of the events that move in time. Instead of imagining ourselves as coming at birth from an impenetrable darkness, with darkness for our destination, we shall now see ourselves as being's that have lived for ever, and who will live for ever, and in whom consciousness can never be extinguished even for a moment. The memory of the brain may fail to bridge the abysses of time, but somewhere within the depths of our being, or rather upon its heights, we shall recognize the existence of a soul in which all memories of the past are stored, all knowledge and all power, and that nothing hides us from that radiance except the self-imposed limitations of personality and the love of self. In the presence of such a realization what room can there be for the paltry ambitions, greeds, fears, and griefs that now fill our tortured lives? Against that stupendous background of time all these things sink into insignificance and to their true values. They seemed large only when we viewed them against a background of a few score years, only when we measured them by the false standards of a few score Years: Look at them now against the background of a conscious eternity and forever they lose their power to wound. At last we learn the true value of events, and we are lifted by that new wisdom beyond the reach of personal sorrow. We are no longer as children who cry over broken toys.
But the Theosophic philosophy will do more than this. The light of law will lift us forever beyond the reach of fear, because we shall know that a cruel or indifferent chance has no part nor lot in our fortunes, that we are masters of our fate and the captain of our soul.
And how pitifully, how abjectly, we now cringe before our fears. We are afraid of poverty, afraid of death, afraid of disease. We imagine ourselves as fortified citadels besieged by a pitiless and hostile nature. Terrors lie in wait for us in the dark places of life, and every corner has a foe. A perpetual paralysis of fear destroys our strength and hides the sunlight by its baleful shadows.
And how needless it all is! With what new confidence we move forward in the light of a law that is merciful because it is just, that declares its presence in the least of the events of our lives, that holds the universe in its grasp for the sake of the human soul, that inflicts pleasure and pain for no other purpose than to point out the only road that leads to happiness.
This is no philosophy for the elect. It demands no large learning for its comprehension. It owes nothing to authority or to revelation. Its appeal is to every human being whose eyes are open to the facts of his own life, who can take but one step from the seen to the unseen.
Are we apprehensive that the adoption of a spiritual philosophy will militate against what we call our "success in life?" It would indeed be strange if ignorance were more profitable than knowledge, if weakness were a larger advantage than strength. The greatest of all success in life is reserved for those who know what life is, its origin, purpose, laws and destiny. Strength in our life work comes to those who ally themselves with nature, not to those who resist her; to those who keep her laws, not to those who violate them.
[Theosophy, Vol. I, #5, pp. 169-73]
There must be truth and fact in that which every people of antiquity accepted and made the foundation of its religion and its faith. H. P. Blavatsky—In The Secret Doctrine—Vol. II, p. 794.
There is no existence for that which does not exist, nor is there any non-existence for what exists. By those who see the truth and look into the principles of things, the ultimate characteristic of these both is seen. —Bhagavad-Gita—Chap. 2.
United Lodge of Theosophists
3766 El Cajon Blvd
San Diego, Ca 92105
(619)283-0142
E-Mail: [email protected]
Sundays 10:45-12Noon
Theosophical Book Center Wednesdays — 11a.m.-1p.m.
Wednesdays: 12 Noon to 1p.m.
Psychotherapy of BhagavadGita
Fridays: 7p.m. to 8:30 p.m. Basic Theosophy
Sarasota, Florida
Theosophy Group
Meets Weekly on:
WEDNESDAYS: — 7 - 8:15 P.M.
SUNDAYS — 11 AM - 12:30 PM
We are a very friendly group of students with various religious and philosophical backgrounds. Our goals are to discuss and understand the universal truths of Theosophy.
On Wed. nights we are studying, The Ocean of Theosophy by W.Q. Judge, and on Sunday mornings we're discussing Isis Unveiled by H.P. Blavatsky and Light On The Path by Mabel Collins.
Our address is: 2700 S. Tamiami Trail Suite#11B, Sarasota, Florida 34239 and our phone number is: 941-312-9494.
http://www.theosophyusa.com
941-349-5151
Please feel free to call Bob Waxman if you need any additional information.
United Lodge of Theosophists
1917 Walnut Street
Philadelphia, PA 19103
All welcome No collections
United Lodge of Theosophists
Karma & Reincarnation
The twin doctrines of Theosophy, a mode of living common to the great sages, adepts and Masters who live by the Great Ideal - to benefit humanity.
One humanity, one goal, one Truth
Universal Brotherhood means unity through diversity and mutual respect; its absence is the cause of violence and suffering.
Individuality and Interdependence
"We should aim at creating free men & women, free intellectually, free morally, unprejudiced in all respects, and above all things, unselfish."
"the rational explanation of things..."
H.P.Blavatsky, a great Occultist of the modern age
All welcome to study Theosophy
- Talks & meetings ~ discussions with questions
- Study Group – Wednesdays 7pm from Oct 6th
Bhagavad Gita & Fundamental Theosophical studies
- Correspondence Course – by post or email
contact ULT at [email protected]
Theosophy Discovery Circle
From the Writings of
HP Blavatsky & WQ Judge
Interactive Study Class
Every other Sunday 10:30—12:00
Located at:
NYTS 240-242 E 53rd Street,
THEOSOPHY HALL
347 East 72 Street
New York, NY 10021
(212) 535-2230
E-mail: [email protected]
All meetings are free. No collections, fees or dues.
Discussion — Multi-Media
Monday Night
7:30-9:00pm
Investigation of the unexplained laws of Nature, and the psychical powers latent in man.
Free Study Materials Provided
- Meditation & Raja Yoga
- Dreams and the Dreamer
- Karma and Reincarnation
- Places After Death
- Spiritual and Psychic Realms
- A Relationship with God
- Science and Psi Phenomena
THEOSOPHY HALL
347 East 72 Street, NY NY 10021
Doors Open at 6:45PM
Phone: (212) 535-2230
Refreshments Served
Current topics: Contrasting ancient theosophical teachings with the standard scientific view of the world, and current psi phenomena. Including distance viewing, crop circles, remembering past lives, etc.
Texts include The Secret Doctrine, Isis Unveiled and other original Theosophical sources.
The Bhagavad-Gita
Wed. Night – 7:30-8:45
Free Study Materials Provided
The ancient psychology of the East and its application in this "era of Western Occultism."
SPANISH STUDY CLASS
"Ecos del Oriente", by Wm.Q. Judge
Meets the first two Wednesdays of the month
THEOSOPHY HALL
347 East 72 Street, NY, NY 10021
Doors Open at 6:45PM
Phone: (212) 535-2230
THE UNITED LODGE OF THEOSOPHISTS
"Maitri Bhavan" 4, Sir Krishna Rao Road, Near Lalbagh West Gate, — Basavanagudi, Bangalore-560 004.
United Lodge of Theosophists
4865 Cordell Avenue, Suite 4
Bethesda, MD 20814
phone (301) 656-3566
web: www.ultde.org
Meetings: Sundays 11 a.m. to 12 noon
(Lectures followed by questions and answers, or group discussions.)
THEOSOPHY
Secret Doctrine Classes
Sunday 10:30am - 12:00
Theosophy Discovery Circle, New York City
240-242 E. 53rd St [between 2nd & 3rd Ave.]
Monday 7:30 to 9 pm
New York ULT 347 East 72nd Street, NY
Wednesday 2 to 4 pm
Antwerp ULT, Belgium
Wednesday 7:30 to 8:45 pm
Los Angeles ULT
Saturday 10 am to 12 noon — The Wind Horse
Long Beach — First Saturday of every month
Wednesday — Bangalore ULT, India
Wednesday: 6p.m. — 7.30p.m.
Athens 10680, GREECE
60 Charilaou Trikoupis Str — 3rd floor
LOGIE UNIE DES THÉOSOPHES
Loge Unie des Théosophes
11 bis, rue Kepler – 75116 Paris, FRANCE
Conferences Mercredis, 19 h 30 – 20 h 45
Loge Unie des Théosophes Douala
Camaroon
B.P. 11372 Douala Localisation Ndog - Bong
Heures d'ouverture: mercredi 19h – 20 h 15
Samedi 19h – 20 h 15
Toutes les activités de la Loge sont libres et gratuites
Les réunions commencent et se terminent aux heures précises indiquées
La Loge est maintenue en activité par des participations bénévoles
Tel: 40-76-72
Den TEOSOFISKA
Ursprungliga Undervisningen
UNITED LODGE OF THEOSOPHISTS, Malmölogen
Kungsgatan 16 A, 211 49 Malmö, tel. 0709 26 22 12
TEOSOFISKA FÖREDRAG
Stiftelsen Teosofiska Kompaniet
United Lodge of Theosophists – Malmölogen
Peter Bernin, Roslinsväg 6, 217 55 Malmö
+46 (0)709 26 2212
hemsida: www.teosofiskakompaniet.net
email: [email protected]
Phoenix ULT
THEOSOPHY HALL — 77 W. ENCANTO BLVD.
PHOENIX, ARIZONA 85003
Phone 602-290-0563
PROGRAM - 2004—2005
SUNDAY EVENINGS
7:00 - 7:45 P.M.
Universal Theosophy by Robert Crosbie
8:00 — 8:45 P.M.
Study, read, question, discuss, discover,
the Teaching and Philosophy of Theosophy
IN:
THE SECRET DOCTRINE by H.P. Blavatsky
United Lodge of Theosophists
799 Adelaide Street
London, Ontario N5Y 2L8
CANADA
Wednesday Evening 7:30 to 8:45 PM
A study of the *Key to Theosophy*, the "Proem" from *The Secret Doctrine*, and *Raja Yoga* and *Occultism*.
Sunday Nov. 20 “Karmic Law”
Sunday Dec. 18 The Eternal Pilgrim”
Sunday Jan. 15 “Evolution”
Sunday Feb. 12 “The Sevenfold Man”
Sunday March 12 “The Symbolic Egg”
Sunday April 9 “Magic Through the Ages”
Sunday May 7 “White Lotus Day”
Sunday Evening — 7:00 to 8:00 PM
*Isis Unveiled* by H. P. Blavatsky
Email contact: Laura Gray at [email protected]
---
**HPB DEFENSE FUND REPORT**
$10,000.00 FUND RAISING EFFORT FOR PUBLISHING AN AUTHENTIC VOLUME I OF HPB’s Letters.
Cumulative gifts as of November 10, 2005
| Donor | Amount |
|-------|--------|
| ER | 500.00 |
| Anonymous | 50.00 |
| DLJ | 50.00 |
| EPB | 200.00 |
| MRJ | 50.00 |
| DLJ | 100.00 |
| RD | 250.00 |
| Anonymous | 50.00 |
| PHX | 500.00 |
| Anonymous | 20.00 |
| Anonymous | 20.00 |
| Anonymous | 500.00 |
| RD | 500.00 |
| GR | 1,248.00 |
| CR | 50.00 |
| EPB | 300.00 |
| Anonymous | 20.00 |
| James & Sally Colbert | 50.00 |
| Anonymous | 100.00 |
| Anonymous | 25.00 |
| APGr | 500.00 |
| DB | 50.00 |
| Friends in India | 100.00 |
| Pacific Rim Theosophist | 10.00 |
| GB | 30.00 |
| Anonymous | 25.00 |
| GLS | 500.00 |
| KS | 500.00 |
| Anonymous | 200.00 |
| Anonymous | 200.00 |
| A. B. | 50.00 |
TOTAL AS OF December 15, 2005 6,748.00
The HPB Defense Fund is specifically dedicated to the publication of an authentic Volume I of Madame Blavatsky’s letters. The proposed volume will have the fraudulent letters in the current Adyar edition removed and also take note of other authors who follow the practice of mixing lies side by side with truth as if they were equally relevant. It is our intent to equip the student and
inquirer with eyes to discriminate the authentic from the fraudulent, the clean from the corrupt.
A good companion volume for a historical overview of the life of Madame Blavatsky. Is already in print: *The Extraordinary Life and Influence of Helena Blavatsky.* (600+ pages). This volume is by far the most readable and best documented work available. — Ed., A.T.
"She has no need of any man's praise; but even she has need of Justice." William Q. Judge
---
**THE INNER LEVELS OF THE THEOSOPHICAL MOVEMENT:**
**EVERY CHALLENGE IS AN OPPORTUNITY.**
by Carlos Cardoso Aveline
Dear Editor,
One writer who presents himself as a student of Helena Blavatsky has written one or two articles in a website suggesting that Mr. Robert Crosbie broke the vows he had made as a student of the Esoteric School founded by H.P.B. in the 19th century.
Such writers tend to appear from time to time in several countries. They tend to publish long, high-sounding articles about things of which they know nothing. By doing this, they add extra weight to the well-known verses in the "Tao Te King":
"Those who know, don't talk.
Those who talk, don't know."
At least one of such persons has recently gone beyond discussing occult facts of which he knows nothing. He has been sending long letters to a number of students in several countries, anxiously defending his decision to give as much publicity as he can to the libels originally invented against H. P. Blavatsky more than one century ago.
These people typically write against those who live and who stimulate the search for inner learning or for lay discipleship along the lines established by H.P.B. and her Masters.
Such efforts are not new, and they are not original. We have had persons of this type attacking HPB's work all the time since the mid-1880s. We also have had people successfully defending Theosophy all along. Yet — there is something sad about this.
The very existence of students who try to live up to the inner side of H.P.B.'s Teachings seems to gravely offend these poor people. This is unfortunate. No sincere student could ever aim at that.
One can only wish that all these aggressive and anxious skeptics will understand and accept the existence of such a thing as an occult life and spiritual path.
I wish they could see that there is an inner level of study and action which must be kept to those who have freely decided to pledge themselves to their own hearts to try to improve themselves — and who have made a commitment to help each other along that old, steep and narrow way to Eternal Wisdom.
The lack of respect that these skeptics seem to show for the inner instances of the theosophical movement might be connected to a lack of respect they have for their own inner consciousness and conscience.
It follows that to wish them well, and to send them good thoughts, is part of our task.
On the other hand, our mission also includes actively preserving the movement and the Teaching from these
occult successors of the 19th century slanderers Vsevolod Solovyov, Emma Coulomb and others.
It is not a coincidence that both Solovyov and the Coulombs, as well as their 21st century successors, first infiltrated the theosophical movement, and only then started to attack H.P.B. and the Masters' work from inside the theosophical circles.
As paradoxes are part of the occult life, there is a bright side to this.
Esoteric philosophy states that great opportunities are generally in direct proportion to the difficulty of challenges.
Therefore, putting a limit to the slanderous action of "modern" skeptics may be a golden opportunity now available to earnest students worldwide.
Best regards,
Carlos Cardoso Aveline, from Brazil.
---
**CORRESPONDENCE**
“Revelator, priest, and dogmatist are foreign to the spirit of Theosophy.”
“THE ALGEO LETTERS”
Dear Editor, *The Aquarian Theosophist*:
Regarding Mr. John Algeo’s work *THE HPB LETTERS* Vol. I. TPH. As I understand it, this work contains the following characteristics:
1. **Outdated information.** Which fact makes them to become Tricky Information, since is presented as Updated Information.
2. **Discarded Information.** Discarded many, many years ago.
3. **Non Extant Information Physically.**
4. **Mixing lies, with Truth.**
The above makes me think they should better be considered as:
**THE ALGEO LETTERS.**
If he presents them as “true,” or “maybe true,” or “might be true,” or “I think they may be true,” or whatever words he may use, whether they are false or true, then the name becomes appropriate.
John Charles Bartlett
---
A letter from Odin to a correspondent------
John, I enjoyed your article — certainly is apropos to the mass media controversy. But for my “elevated Theosophical taste” too much of a materialistic-existentialist bent. No allowance for life's little perplexities. Utility aside, bird nests are "imperfect" by strict geometrical and mathematical standards — yet it is their very imperfection (or can we say "lack of perfect symmetry") that endows them with their compelling natural beauty. Not to mention intelligently designed.
You didn't address the *Secret Doctrine* position which is that Intelligent Design, although rejecting fortuitousness is not a perfect process.
Reed Carson in the last BN Newsletter noted that Theosophy definitely grants to Darwinism the power to explain some micro-evolution. But after that concession, it describes Darwinism as only a "minor" law.
“The fact is, that only the partial truth of many of the secondary ‘laws’ of Darwinism is beyond question…” (SD ii, 662)
Concerning “imperfections” the SD teaches:
“…it is those terrestrial spirits of Nature, who form the aggregated Nature; which, if it fails occasionally in its design, is neither to be considered blind, nor to be taxed with the failure; since, belonging to a differentiated sum of qualities and attributes, it is in virtue of that alone conditioned and imperfect.” (SD ii, 732-3)
“As that process is not always perfect; and since, however many proofs it may exhibit of a guiding intelligence behind the veil, it still shows gaps and flaws, and even results very often in evident failures.
Therefore, neither the collective Host (Demiurgos), nor any of the working powers individually, are proper subjects for divine honours or worship.
It now becomes plain that there exists in Nature a triple evolutionary scheme, for the formation of the three periodical Upadhis; or rather three separate schemes of evolution, which in our system are inextricably interwoven and interblended at every point.
These are the Monadic (or spiritual), the intellectual, and the physical evolutions.”
Each of these three systems has its own laws … ‘Nature,’ the physical evolutionary Power, could never evolve intelligence unaided-she can only create ‘senseless forms.’” (SD I, 182).
Care to take on the crop circles?
The crop formations are the finest, most beautiful and original art forms of modern times, and they are totally mysterious. Behind the crop circle phenomenon is an evident purpose. Some intelligence, human, alien or spiritual, is in the process of communication. The secret circle-makers seem to be exposing us to a course of re-education, beginning with the symbols of sacred knowledge and wisdom.
They are too perfect to be accidental. What shall we do? Just ignore them because their origin cannot be proved or disproved?
Odin
NEWS FROM ULT — ATHENS, GREECE
Hello Will and Jerome,
LATEST NEWS FROM ATHENS:
I am looking forward to the beginning of W.J.C Course.
Will, thank you for sending me your telephone numbers.\(^1\)
Chris Bartzokas' book, *Compassion: the truth at the heart of our universe*, is already on line, on www.theosophy.gr, wherefrom it can be downloaded by anyone interested. Would you care to let it be known to the other ULTS?
Jerome, what would you say on it?\(^2\) I believe it is a well written Theosophical book. It is a compilation of selected excerpts from the Ageless Wisdom.
Let me take the occasion to inform you about Theosophical Studies Program locally organised by the Athens ULT. I am sending you the announcement so that you get a rough idea. I think it will be
---
\(^1\) We gave them to Aspasia.
\(^2\) It is an excellent BOOK!! A review of it will be forthcoming. We heartily recommend it to any student for whom the word “Compassion” or “Nirmanakaya” causes a thrill in their heart. — Ed., A.T.
helpful for those who live away from Athens.
"Theosophy is the Spiritual Knowledge conveyed to humanity and aiming at its intellectual and spiritual advancement. The re-appearance of this age-long wisdom through the Theosophical Movement and the writings of H. P. Blavatsky, by directing the world's interest to esoteric knowledge, has given today's researcher the possibility to understand the conditions of both individual and universal evolution and, by so doing, to become aware of the purpose of life.
In a series of monthly meetings, the "Theosophical Studies" program presents the most important Theosophical topics in a comprehensive and explicit way and intends to spread spiritual knowledge by helping ordinary people understand and assimilate it.
The program comprises the following subjects: about the Soul, the law of Cycles, after death existence, devachan and nirvana, the causes of rebirth, occult evolution, rounds and chains, Masters of Wisdom, psychic phenomena, self-knowledge, Theosophy and science etc. The study is based on the writings of H. P. Blavatsky and W. Judge.
The meetings will be taking place at the Athens ULT premises, from 10.30a.m. to 3.30 p.m. on the following Sundays:
January 29,
February 26,
April 2,
May 28,
October 22,
December 3, 2006.
Admittance Free"
If you want more information about the above, I will gladly give it to you.
Last week we met a Greek-American couple from the N.Y. ULT who visited us and assisted in two meetings. The husband has been an associate of the ULT since 1946 and he told us he had made the acquaintance of Wadia.
We have exchanged mailing addresses as well as pieces of information but they had no idea about the work being done through the Internet.
My warm regards
Aspasia Papadomichelaki
ATHENS, GREECE
---
**GENIUS**
by H. P. Blavatsky
Genius! thou gift of Heaven, thou light divine!
Amid what dangers art thou doom'd to shine.
Oft will the body's weakness check thy force,
Oft damp thy vigour, and impede thy course;
And trembling nerves compel thee to restrain
Thy nobler efforts to contend with pain;
Or want, sad guest!
—CRABBE
AMONG many problems hitherto unsolved in the Mystery of Mind, stands prominent the question of Genius. Whence, and what is genius, its raison d'être, the causes of its excessive rarity? Is it indeed "a gift of Heaven"? And if so, why such gifts to one, and dullness of
intellect, or even idiocy, the doom of another? To regard the appearance of men and women of genius as a mere accident, a prize of blind chance, or, as dependent on physical causes alone, is only thinkable to a materialist. As an author truly says, there remains then, only this alternative: to agree with the believer in a personal god "to refer the appearance of every single individual to a special act of divine will and creative energy," or "to recognize, in the whole succession of such individuals, one great act of some will, expressed in an eternal inviolable law."
Genius, as Coleridge defined it, is certainly--to every outward appearance, at least--"the faculty of growth"; yet to the inward intuition of man, it is a question whether it is genius--an abnormal aptitude of mind--that develops and grows, or the physical brain, its vehicle, which becomes through some mysterious process fitter to receive and manifest from within outwardly the innate and divine nature of man's over-soul. Perchance, in their unsophisticated wisdom, the philosophers of old were nearer truth than are our modern wiseacres, when they endowed man with a tutelar deity, a Spirit whom they called genius. The substance of this entity, to say nothing of its essence—observe the distinction, reader,—and the presence of both, manifests itself according to the organism of the person it informs. As Shakespeare says of the genius of great men — what we perceive of his substance "is not here"—
For what you see is but the smallest part. . . .
But were the whole frame here,
It is of such a spacious, lofty pitch.
Your roof were not sufficient to contain it. . . .
This is precisely what the Esoteric philosophy teaches.
The flame of genius is lit by no anthropomorphic hand, save that of one's own Spirit. It is the very nature of the Spiritual Entity itself, of our Ego, which keeps on weaving new life-woofs into the web of reincarnation on the loom of time, from the beginnings to the ends of the great Life-Cycle.\(^1\)
This it is that asserts itself stronger than in the average man, through its personality; so that what we call "the manifestations of genius" in a person, are only the more or less successful efforts of that EGO to assert itself on the outward plane of its objective form--the man of clay--in the matter-of-fact, daily life of the latter.
The EGOS of a Newton, an Æschylus, or a Shakespeare, are of the same essence and substance as the Egos of a yokel, an ignoramus, a fool, or even an idiot; and the self-assertion of their informing genii depends on the physiological and material construction of the physical man.
No Ego differs from another Ego, in its primordial or original essence and nature.
That which makes one mortal a great man and of another a vulgar, silly person is, as said, the quality and make-up of the physical shell or casing, and the adequacy or inadequacy of brain and body to transmit and give expression to the light of the real, Inner man; and this aptness or in aptness is, in its turn, the result of Karma.
Or, to use another simile, physical man is the musical instrument, and the Ego, the performing artist. The potentiality of perfect melody of sound, is in the former--the instrument--and no skill of the latter can awaken a faultless harmony out of a broken or badly made instrument. This harmony depends on the fidelity of transmission, by word or act, to the objective plane, of the unspoken
\(^1\) The period of one full Manvantara composed of Seven Rounds.
divine thought in the very depths of man's subjective or inner nature. Physical man may — to follow our simile — be a priceless Stradivarius or a cheap and cracked fiddle, or again a mediocrity between the two, in the hands of the Paganini who ensouls him.
All ancient nations knew this. But though all had their Mysteries and their Hierophants, not all could be equally taught the great metaphysical doctrine; and while a few elect received such truths at their initiation, the masses were allowed to approach them with the greatest caution and only within the farthest limits of fact.
"From the DIVINE ALL proceeded Amun, the Divine Wisdom . . . give it not to the unworthy," says a Book of Hermes. Paul, the "wise Master-Builder,"¹ (I Cor. III, 10) but echoes Thoth-Hermes when telling the Corinthians "We speak Wisdom among them that are perfect (the initiated) . . . divine Wisdom in a MYSTERY, even the hidden Wisdom." (Ibid. II, 7.)
Yet, to this day the Ancients are accused of blasphemy and fetishism for their "hero worship." But have the modern historians ever fathomed the cause of such "worship"? We believe not. Otherwise they would be the first to become aware that that which was "worshipped," or rather that to which honours were rendered was neither the man of clay, nor the personality--the Hero or Saint So-and-So, which still prevails on the Roman Church, a church which beatifies the body rather than the soul—but the divine imprisoned Spirit, the exiled "god" within that personality. Who, in the profane world, is aware that even the majority of the magistrates (the Archons of Athens, mistranslated in the
¹ A term absolutely theurgic, masonic and occult. Paul, by using it, declares himself an Initiate having the right to initiate others.
made by the divine captive who, under the most adverse circumstances of incarnation, still succeeded in manifesting himself.
Occultism, therefore, teaches nothing new in asserting the above philosophical axiom. Enlarging upon the broad metaphysical truism, it only gives it a finishing touch by explaining certain details.
It teaches, for instance, that the presence in man of various creative powers--called genius in their collection--is due to no blind chance, to no innate qualities through hereditary tendencies--though that which is known as atavism may often intensify these faculties --but to an accumulation of individual antecedent experiences of the *Ego* in its preceding life, and lives. For, though omniscient in its essence and nature, it still requires experience through its *personalities* of the things of earth, earthy on the objective plane, in order to apply the fruition of that abstract omniscience to them. And, adds our philosophy — the cultivation of certain aptitudes throughout a long series of past incarnations must finally culminate in some one life, in a blooming forth as *genius*, in one or another direction.
Great Genius, therefore, if true and innate, and not merely an abnormal expansion of our human intellect--*can never copy or condescend to imitate*, but will ever be original, *sui generis* in its creative impulses and realizations.
Like those gigantic Indian lilies that shoot out from the clefts and fissures of the cloud-nursing, and bare rocks on the highest plateaux of the Nilgiri Hills, true Genius needs but an opportunity to spring forth into existence and blossom in the sight of all in the most arid soil, for its stamp is always unmistakable.
To use a popular saying, innate genius, like murder, will out sooner or later, and the more it will have been suppressed and hidden, the greater will be the flood of light thrown by the sudden eruption. On the other hand artificial genius, so often confused with the former, and which, in truth, is but the outcome of long studies and training, will never be more than, so to say, the flame of a lamp burning outside the portal of the fane; it may throw a long trail of light across road, but it leaves the inside of the building in darkness.
And, as every faculty and property in Nature is dual — *i.e.*, each may be made to serve two ends, evil as well as good — so will artificial genius *betray* itself. Born out of the chaos of terrestrial sensations, of perceptive and retentive faculties, yet of finite memory, it will ever remain the slave of its body; and that body, owing to its unreliability and the natural tendency of matter to confusion, will not fail to lead even the greatest *genius*, so called, back into its own primordial element, which is chaos again, or *evil*, or earth.
Thus between the true and the artificial genius, one born from the light of the immortal Ego, the other from the evanescent will-o'-the-wisp of the terrestrial or purely human intellect and the animal soul, there is a chasm, to be spanned only by him who aspires ever onward; who never loses sight, even when in the depths of matter, of that guiding star the Divine Soul and mind, or what we call *Buddhi-Manas*.
The latter does not require, as does the former, cultivation. The words of the poet who asserts that the lamp of genius--
If not protected, pruned, and fed with care,
Soon dies, or runs to waste with fitful glare—
— can apply only to artificial genius, the outcome of culture and of purely intellectual acuteness.
It is not the direct light of the *Manasa putra*, the "Sons of Wisdom," for true genius lit at the flame of our higher nature, or the EGO, cannot die.
This is why it is so very rare. Lavater calculated that "the proportion of genius (in general) to the vulgar, is like one to a million; but genius without tyranny, without pretension, that judges the weak with equity, the superior with humanity, and equals with justice, is like one in ten millions." This is indeed interesting, though not too complimentary to *human* nature, if, by "genius," Lavater had in mind only the higher sort of human intellect, unfolded by cultivation, "protected, pruned, and fed," and not the genius we speak of. Moreover such genius is always apt to lead to the extremes of weal or woe him through whom this artificial light of the terrestrial mind manifests. Like the good and bad genii of old with whom human genius is made so appropriately to share the name, it takes its helpless possessor by the hand and leads him, one day to the pinnacles of fame, fortune, and glory, but to plunge him on the following day into an abyss of shame, despair, often of crime.
But as, according to the great Physiognomist, there is more of the former than of the latter kind of genius in this our world, because, as Occultism teaches us, *it is easier for the personality with its acute physical senses and tatwas to gravitate toward the lower quaternary than to soar to its triad*--modern philosophy, though quite proficient in treating this lower place of genius, knows nothing of its higher spiritual form--the "one in ten millions."
Thus it is only natural that confusing one with the other, the best modern writers should have failed to define *true* genius. As a consequence, we continually hear and read a good deal of that which to the Occultist seems quite paradoxical. "Genius requires cultivation," says one; "Genius is vain and self-sufficient" declares another; while a third will go on defining the *divine light* but to dwarf it on the Procrustean bed of his own intellectual narrow-mindedness. He will talk of the great eccentricity of genius, and allying it as a general rule with an "inflammable constitution," will even show it "a prey to every passion but seldom delicacy of taste!" (Lord Kaimes.) It is useless to argue with such, or tell them that, original, and great genius puts out the most dazzling rays of human intellectuality, as the sun quenches the flame-light of a fire in an open field; that it is never eccentric, though always *sui generis*; and that no man endowed with true genius can ever give way to his physical animal passions.
In the view of an humble Occultist, only such a grand altruistic character as that of Buddha or Jesus, and of their few close imitators, can be regarded, in our historical cycle, as fully developed GENIUS.
Hence, true genius has small chance indeed of receiving its due in our age of conventionalities, hypocrisy and time-serving. As the world grows in civilization, it expands in fierce selfishness, and stones its true prophets and geniuses for the benefit of its aping shadows.
Alone the surging masses of the ignorant millions, *the great people's heart*, are capable of sensing intuitively a true "great soul" full of divine love for mankind, of god-like compassion for suffering man.
Hence the populace alone is still capable of recognizing a genius, as without such qualities no man has a right to the name.
No genius can be now found in Church or State, and this is proven on their own admission. It seems a long time
since in the XIII century the "Angelic Doctor" snubbed Pope Innocent IV who, boasting of the millions got by him from the sale of absolutions and indulgences, remarked to Aquinas that "the age of the Church is past in which she said 'Silver and gold have I none'!" "True," was the ready reply; "but the age is also past when she could say to a paralytic, 'Rise up and walk.'"
And yet from that time, and far, far earlier, to our own day the hourly crucifixion of their ideal Master both by Church and State has never ceased. While every Christian State breaks with its laws and customs, with every commandment given in the Sermon on the Mount, the Christian Church justifies and approves of this through her own Bishops who despairingly proclaim "A Christian State impossible on Christian Principles." Hence — no Christ-like (or "Buddha-like") way of life is possible in civilized States.
The occultist then, to whom "true genius is a synonym of self-existent and infinite mind," mirrored more or less faithfully by man, fails to find in the modern definitions of the term anything approaching correctness. In its turn the esoteric interpretation of Theosophy is sure to be received with derision.
The very idea that every man with a "soul" in him is the vehicle of a genius will appear supremely absurd, even to believers, while the materialist will fall foul of it as a "crass superstition." As to the popular feeling — the only approximately correct one because purely intuitive, it will not be even taken into account.
The same elastic and convenient epithet "superstition" will, once more, be made to explain why there never was yet a universally recognised genius — whether of one or the other kind — without a certain amount of weird, fantastic and often uncanny, tales and legends attaching themselves to so unique a character, dogging and even surviving him.
Yet it is the unsophisticated alone, and therefore only the so-called uneducated masses, just because of that lack of sophisticated reasoning in them, who feel, whenever coming in contact with an abnormal, out-of-the-way character, that there is in him something more than the mere mortal man of flesh and intellectual attributes.
And feeling themselves in the presence of that which in the enormous majority is ever hidden, of something incomprehensible to their matter-or-fact minds, they experience the same awe that popular masses felt in days of old when their fancy, often more unerring than cultured reason, created of their heroes gods, teaching:
... The weak to bend, the proud to pray
To powers unseen and mightier than they...
This is now called SUPERSTITION...
But what is Superstition? True, we dread that which we cannot clearly explain to ourselves. Like children in the dark we are all of us apt, the educated equally with the ignorant, to people that darkness with phantoms of our own creation; but these "phantoms" prove in no wise that that "darkness" — which is only another term for the invisible and the unseen — is really empty of any Presence save our own. So that if in its exaggerated form, "superstition" is a weird incubus, as a belief in things above and beyond our physical senses, yet it is also a modest acknowledgement that there are things in the universe, and around us, of which we know nothing. In this sense "superstition" becomes not an unreasonable feeling of half wonder and half dread, mixed with admiration and reverence, or with fear, according to the dictates of our intuition. And this is far more reasonable than to repeat with the
too-learned wiseacres that there is nothing "nothing whatever, in that darkness"; nor can there be anything since they, the wiseacres, have failed to discern it.
*E pur se muove!* Where there is smoke there must be fire; where there is a steamy vapour there must be water. Our claim rests but upon one eternal axiomatic truth: *nihil sine causa.* [Lt. There is nothing without a cause] Genius and undeserved suffering, prove an immortal Ego and Reincarnation in our world. As for the rest, *i.e.*, the obloquy and derision with which such theosophical doctrines are met, Fielding — a sort of Genius in his way, too — has covered our answer over a century ago. Never did he utter a greater truth than on the day he wrote that "If superstition makes a man a fool, SKEPTICISM MAKES HIM MAD."
*Lucifer*, November, 1889
---
ÆTHROBACY, is the Greek name for walking or being lifted in the air; *levitation*, so called, among modern spiritualists. It may be either conscious or unconscious; in the one case, it is magic; in the other, either disease or a power which requires a few words of elucidation.
A symbolical explanation of æthrobacy is given in an old Syriac manuscript which was translated in the fifteenth century by one Malchus, an alchemist. In connection with the case of Simon Magus, one passage reads thus:
"Simon, laying his face upon the ground, whispered in her ear, 'O mother Earth, give me, I pray thee, some of thy breath; and I will give thee mine; let me loose,' O mother, that I may carry thy words to the stars, and I will return faithfully to thee after a while.' And the Earth strengthening her status, none to her detriment, sent her genius to breathe of her *breath* on Simon, *while he breathed on her*; and the stars rejoiced to be visited by the mighty One."
The starting-point here is the recognized electro-chemical principle that bodies similarly electrified repel each other, while those differently electrified mutually attract. "The most elementary knowledge of chemistry," says Professor Cooke, "shows that, while radicals of opposite natures combine most eagerly together, two metals, or two closely-allied metalloids, show but little affinity for each other."
The earth is a magnetic body; in fact, as some scientists have found, it is one vast magnet, as Paracelsus affirmed some 300 years ago. It is charged with one form of electricity — let us call it positive — which it evolves continuously by spontaneous action, in its interior or centre of motion. Human bodies, in common with all other forms of matter, are charged with the opposite form of electricity — negative. That is to say, organic or inorganic bodies, if left to themselves will constantly and involuntarily charge themselves with, and evolve the form of electricity opposed to that of the earth itself. Now, what is weight? Simply the attraction of the earth. "Without the attractions of the earth you would have no weight," says Professor Stewart; * "and if you had an earth twice as heavy as this, you would have double the attraction." How then, can we get rid of this attraction? According to the electrical law above stated, there is an attraction between our planet and the organisms upon it, which holds them upon the surface of the ground. But the law of gravitation has been counteracted in many instances, by levitations of persons and inanimate objects; how
account for this? The condition of our physical systems, say theurgic philosophers, is largely dependent upon the action of our will. If well-regulated, it can produce “miracles”; among others a change of this electrical polarity from negative to positive; the man’s relations with the earth-magnet would then become repellent, and “gravity” for him would have ceased to exist. It would then be as natural for him to rush into the air until the repellent force had exhausted itself, as, before, it had been for him to remain upon the ground. The altitude of his levitation would be measured by his ability, greater or less, to charge his body with positive electricity. This control over the physical forces once obtained, alteration of his levity or gravity would be as easy as breathing.
The study of nervous diseases has established that even in ordinary somnambulism, as well as in mesmerized somnambulists, the weight of the body seems to be diminished. Professor Perty mentions a somnambulist, Koehler, who when in the water could not sink, but floated. The seeress of Prevorst rose to the surface of the bath and could not be kept seated in it. He speaks of Anna Fleisher, who being subject to epileptic fits, was often seen by the Superintendent to rise in the air; and was once, in the presence of two trustworthy witnesses (two deans) and others, raised two and a half yards from her bed in a horizontal position. The similar case of Margaret Rule is cited by Upham in his *History of Salem Witchcraft*. “In ecstatic subjects,” adds Professor Perty, “the rising in the air occurs much more frequently than with somnambulists. We are so accustomed to consider gravitation as being a something absolute and unalterable, that the idea of a complete or partial rising in opposition to it seems inadmissible; nevertheless, there are phenomena in which, by means of material forces, gravitation is overcome. In several diseases — as, for instance, nervous fever — the weight of the human body seems to be increased, but in all ecstatic conditions to be diminished. And there may, likewise, be other forces than material ones which can counteract this power.”
A Madrid journal, *El Criterio Espiritista*, of a recent date, reports the case of a young peasant girl near Santiago, which possesses a peculiar interest in this connection. “Two bars of magnetized iron held over her horizontally, half a metre distant, was sufficient to suspend her body in the air.”
Were our physicians to experiment on such levitated subjects, it would be found that they are strongly charged with a similar form of electricity to that of the spot, which, according to the law of gravitation, ought to attract them, or rather prevent their levitation. And, if some physical nervous disorder, as well as spiritual ecstasy produce unconsciously to the subject the same effects, it proves that if this force in nature were properly studied, it could be regulated at will.
---
**DUST STORMS ON THE MOON**
An old Apollo experiment is telling researchers something new and surprising about the moon.
*December 7, 2005:* Every lunar morning, when the sun first peeks over the dusty soil of the moon after two weeks of frigid lunar night, a strange storm stirs the surface.
The next time you see the moon, trace your finger along the terminator, the dividing line between lunar night and day. That's where the storm is. It's a long and
skinny dust storm, stretching all the way from the north pole to the south pole, swirling across the surface, following the terminator as sunrise ceaselessly sweeps around the moon.
Never heard of it? Few have. But scientists are increasingly confident that the storm is real.
The evidence comes from an old Apollo experiment called LEAM, short for Lunar Ejecta and Meteorites. "Apollo 17 astronauts installed LEAM on the moon in 1972," explains Timothy Stubbs of the Solar System Exploration Division at NASA's Goddard Space Flight Center. "It was designed to look for dust kicked up by small meteoroids hitting the moon's surface."
Billions of years ago, meteoroids hit the moon almost constantly, pulverizing rocks and coating the moon's surface with their dusty debris. Indeed, this is the reason why the moon is so dusty. Today these impacts happen less often, but they still happen.
Apollo-era scientists wanted to know, how much dust is ejected by daily impacts? And what are the properties of that dust? LEAM was to answer these questions using three sensors that could record the speed, energy, and direction of tiny particles: one each pointing up, east, and west.
LEAM's three-decade-old data are so intriguing, they're now being reexamined by several independent groups of NASA and university scientists. Gary Olhoeft, professor of geophysics at the Colorado School of Mines in Golden, is one of them:
"To everyone's surprise," says Olhoeft, "LEAM saw a large number of particles every morning, mostly coming from the east or west--rather than above or below--and mostly slower than speeds expected for lunar ejecta."
What could cause this? Stubbs has an idea: "The dayside of the moon is positively charged; the nightside is negatively charged." At the interface between night and day, he explains, "electrostatically charged dust would be pushed across the terminator sideways," by horizontal electric fields.
Even more surprising, Olhoeft continues, a few hours after every lunar sunrise, the experiment's temperature rocketed so high--near that of boiling water--that "LEAM had to be turned off because it was overheating."
Those strange observations could mean that "electrically-charged moondust was sticking to LEAM, darkening its surface so the experiment package absorbed rather than reflected sunlight," speculates Olhoeft.
But nobody knows for sure. LEAM operated for a very short time: only 620 hours of data were gathered during the icy lunar night and a mere 150 hours of data from the blazing lunar day before its sensors were turned off and the Apollo program ended.
Astronauts may have seen the storms, too. While orbiting the Moon, the crews of Apollo 8, 10, 12, and 17 sketched "bands" or "twilight rays" where sunlight was apparently filtering through dust above the moon's surface. This happened before each lunar sunrise and just after each lunar sunset. NASA's Surveyor spacecraft also photographed twilight "horizon glows," much like what the astronauts saw.
It's even possible that these storms have been spotted from Earth: For centuries, there have been reports of strange glowing lights on the moon, known as "lunar transient phenomena" or LTPs. Some LTPs have been observed as momentary flashes--now generally accepted to be visible evidence of meteoroids impacting the lunar surface. But others have appeared as amorphous reddish or whitish glows or even as dusky hazy regions that change shape or disappear over seconds or minutes. Early explanations, never satisfactory, ranged from volcanic gases to observers' overactive imaginations (including visiting extraterrestrials).
Now a new scientific explanation is gaining traction. "It may be that LTPs are caused by sunlight reflecting off rising plumes of electrostatically lofted lunar dust," Olhoeft suggests.
All this matters to NASA because, by 2018 or so, astronauts are returning to the Moon. Unlike Apollo astronauts, who never experienced lunar sunrise, the next explorers are going to establish a permanent outpost. They’ll be there in the morning when the storm sweeps by.
The wall of dust, if it exists, might be diaphanous, invisible, harmless. Or it could be a real problem, clogging spacesuits, coating surfaces and causing hardware to overheat.
Which will it be? Says Stubbs, “we’ve still got a lot to learn about the Moon.”
Authors: Trudy E. Bell & Dr. Tony Phillips | Editor: Dr. Tony Phillips | Credit: Science@NASA
|
<urn:uuid:8980cae7-092c-4c26-8aae-23040b357be6>
|
CC-MAIN-2022-49
|
https://www.carloscardosoaveline.com/wp-content/uploads/2016/07/VolVINumber4Fev2006ULTBirthdayIssue_.pdf
|
2022-11-28T05:42:25+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-49/subset=warc/part-00035-a0906200-461b-4808-9b94-6c53daf73f61.c000.gz.parquet
| 747,072,398 | 15,897 |
eng_Latn
|
eng_Latn
| 0.967657 |
eng_Latn
| 0.997526 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
docling
|
[
2371,
5613,
8820,
11971,
15804,
19504,
23175,
25285,
27455,
29750,
31516,
34496,
36987,
39963,
42360,
45877,
47647,
51179,
54750,
58307,
61689,
65109,
68929,
69555
] |
This addendum shall become a part of the Contract Documents (Proposal, Measurement and Payment, Plans, and Pothole Data) and modify them as stated below. The Bidder shall acknowledge receipt of the addendum on Page 4 of the Proposal.
The Contract Documents have been modified as follows:
**SECTION 00020 – NOTICE TO BIDDERS – REMOVE AND REPLACE “COMPLETION OF WORK SECTION” TO READ**
**COMPLETION OF WORK:** All work shall for the base bid shall be completed in 30 working days. If alternative bid is also selected, all work shall be completed in 50 working days. Work is anticipated to occur during normal working hours from the hours of 8 am to 5 pm, Monday through Friday. No work shall be performed by the Contractor on Saturday or Sunday, or City designated holidays.
**SECTION 00310 – PROPOSAL**
Remove and replace Pages 3 and 4 of the Proposal (Bid Schedule) with the attached revised pages.
- Description for Bid Item No. 1 has been changed to “Mobilization/Demobilization/BMPs”. See changes to Measurement and Payment section below for bid item descriptions.
- Description of Bid Item Nos. 6 and 8 have been updated
- Bid Item 13 – Access Road Improvements has been added to the Base Bid
- Bid Item 6 – Connection to Existing System – Quantity has been revised from 2 to 3 in bid schedule
**SECTION 01200 – MEASUREMENT AND PAYMENT**
REVISE BID ITEM 1 TO READ –
**ITEM 1 – MOBILIZATION/DEMOBILIZATION/BMPS**
Payment for mobilization shall be at the lump sum price bid and shall include mobilization and demobilization, and all costs related to the use, security, maintenance and restoration of the designated contractor construction working and staging area. This item includes all costs associated with general site best management practices for storm water control including preparation of a Water Pollution Control Program (see Section 01090 for additional requirements). 40 percent shall be paid with the first pay request. The remaining 60 percent shall be paid with the last pay request upon completion of
the project, including site restoration and cleanup of all staging areas (including removal of all temporary BMPs). No more than 10% of the total bid will be allowed for this item.
REVISE BID ITEM 6 TO READ –
ITEM 6 – CONNECTION TO EXISTING SYSTEM
Measurement and Payment shall be at the lump sum bid price and shall include installation of the necessary connections for interim and ultimate conditions to the existing sewer main including, but not limited to, equipment, materials, labor and all other appurtenances as necessary to complete this work including tees, valves, reducers, miscellaneous piping, fittings, nut, bolt and gasket sets, valve box, valve riser, ductile iron spools, flex couplings, gripper rings, restraint fittings, locating wire, trenching, bedding, pipe laying, thrust blocking, backfilling, compacting, compaction testing, controlled low-strength material backfill (CLSM), concrete or other import, structural section replacement, temporary and permanent asphalt replacement, landscaping restoration or concrete replacement due to construction activities, complete and in place.
As noted on the plans the Contractor is responsible to determine the final number, type and material of fittings necessary to connect to the existing pipeline. All costs associated with determining and making the final connection shall be included in this line item.
REVISE BID ITEM TO READ
ITEM 8 – SEWER WET-WELL AND PUMP IMPROVEMENTS
Measurement and Payment shall be at the lump sum bid price and shall include but not limited to, equipment, labor and materials for furnishing and installation of all necessary piping, connections, coatings, structures (including wet-well), submersible sewer pumps, reinforced concrete pad, tees, reducers, elbows, fittings, restraints, drains, vents, locating wire, nuts, bolts, gaskets, placement, excavation, rock excavation, bedding, backfilling, compacting of backfill, engineered fill or aggregate base, dewatering, thrust blocking, flushing and testing, temporary and permanent pavement, concrete replacement, landscaping, site restoration and all incidental work in the installation of the sewer lift station complete and in place and no additional compensation will be allowed therefore. Bid item includes all work associated with the Safety Davit Base and Equipment Davit Base. Attention is directed to Section 9-1.16B Schedule of Values per the State Standard Specifications
ADD THE FOLLOWING
ITEM 13 – ACCESS ROAD IMPROVEMENTS (GIOVANNI SITE ONLY)
Measurement and Payment By the Lump Sum. Includes all labor, equipment and materials for providing a stabilized construction entrance and exit along the existing access easement leading to the Giovanni site. The Contractor shall provide a construction access that sufficiently reduces tracking out of the site. Bid item shall include all costs for maintenance and replacement of materials as necessary for the duration of the project. See limits of existing easement included as an attachment to these specifications.
SECTION 02200 – EARTHWORK – REVISE AS SHOWN:
1.01 B. Related Sections:
1. related Work specified elsewhere:
3.02 M. Excavation:
1. Roadways
a. Excavate unsuitable material from subgrade.
b. After shaping, roll subgrade compacted to 95 percent of relative compaction based on the ASTM D1557 test method, to a minimum of 6 inches below subgrade.
2. Hard Rock Excavation
a. Excavation of unrippable rock requiring a larger excavator and/or hydraulic hammering will be paid for as an additional cost above and beyond the cost for excavation and trenching for ordinary excavation. The City Representative will determine when rock excavation for unrippable rock is required per the definition below. Contractor shall refer to the limited seismic refraction investigation report and geological memorandum included in Appendix A for specifics on geological conditions.
b. Definition of Rock: Rock encountered during the course of excavation which is sufficiently hard to cause refusal to appropriately sized equipment as determined by the City Representative and Contractor shall be deemed inexcavatable. Rock deemed inexcavatable shall be removed by substantial means such as reciprocating hydraulic hammers and shall conform to this specification.
SECTION 01140 WORK RESTRICTIONS – REMOVE AND REPLACE SECTION 3 WITH
3.0 WORK MILESTONE
Work on Giovanni Lift Station shall be started as first priority. See also Section titled COMPLETION OF WORK for schedule.
ADD SECTION 06600 – FIBERGLASS WET WELL (SEE ATTACHED)
SECTION 15060 H.5 – PIPE AND PIPE FITTINGS – REVISE AS SHOWN:
H. PVC Pressure pipe (C900), item 5 is revised to read:
5. All joints to be restrained
a. Internal locking gaskets are not acceptable.
b. Provide EBAA Iron Series 1900 Split Serrated Restraint Harness, or equal.
ADD SECTION 15062 DUCTILE IRON PIPING (SEE ATTACHED)
PLANS
The following Plan Sheets have been revised and are attached. A brief description of the major changes made on each sheet is provided below.
1. Sheet 2 – General Notes
a. Added Project Notes 14, 15 and 16 to read:
14. CONTRACTOR SHALL OBTAIN AN APPROVED ASBESTOS MITIGATION PLAN. IF SERPINTINE ROCK IS ENCOUNTERED CONTACT THE CITY ENGINEER IMMEDIATELY.
15. IF UNUSUAL AMOUNTS OF STONE, BONE OR ARTIFACTS ARE FOUND, STOP WORK AND CONTACT THE CITY IMMEDIATELY.
16. THE CONTRACTOR SHALL RECORD THE POSITION, DEPTH AND DIRECTION OF ANY FACILITIES UNCOVERED DURING CONSTRUCTION AS WELL AS ANY MATERIAL CHANGES OR OTHER INFORMATION WHICH IS REQUIRED TO BE SHOWN ON THE RECORD DRAWINGS.
2. Sheet 3 – Site Plan – Giovanni Lift Station
a. Added rip-rap and flared end to drainage outlet.
b. Added notes 10, 11, 12, 13, and 14
c. Added notes and callouts
3. Sheet 4 – Site Plan – Madrone Lift Station
a. Added notes 9, 10, 11 and 12
b. Added notes and callouts
4. Sheet 5 – Typical Lift Station
a. Added notes regarding the plug valve, engineered fill and pump support
5. Sheet 6 – Details 1
a. Removed Typical Sewer Trench Detail
b. Added Paving Detail (Detail 4)
6. Sheet 7 – Details 2
a. Removed Gravel Road Detail and Slab on Grade Detail
7. Sheet 8 – Standard Details
a. Revised Typical Trench Detail callout
ATTACHMENTS
ATTACHMENT 1 – Specification Modifications
- Section 00310 – Proposal
- Section 06600 – Fiberglass Wet Well
- Section 15062 – Ductile Iron Piping
ATTACHMENT 2 – Plan Modifications
- Sheet 2 – General Notes
- Sheet 3 – Site Plan – Giovanni Lift Station
- Sheet 4 – Site Plan – Madrone Lift Station
- Sheet 5 – Typical Lift Station
- Sheet 5A - Paving Plan for Giovanni Lift Station (New sheet)
- Sheet 6 – Details 1
- Sheet 7 – Details 2
- Sheet 8 – Standard Details
Contractors are required to base their bid on the plans, specifications and any issued addenda. To do otherwise shall be at the contractor’s own risk.
END OF ADDENDUM NO. 3
SECTION 00310
PROPOSAL
To: CITY OF PLACERVILLE,
COUNTY OF EL DORADO,
STATE OF CALIFORNIA
For the construction of
MADRONE AND GIOVANNI SEWER LIFT STATIONS REHABILITATION PROJECT
PROJECT No. 40330
Bid Opening: October 5, 2017 at 4:00 p.m.
NAME OF BIDDER ..................................................................................................................................
BUSINESS POST OFFICE BOX ...........................................................................................................
CITY, STATE, ZIP ................................................................................................................................
BUSINESS STREET ADDRESS ...........................................................................................................
(PLEASE INCLUDE EVEN IF POST OFFICE BOX USED)
CITY, STATE, ZIP ................................................................................................................................
TELEPHONE NO. AREA CODE (_____) ..........................................................................................
FAX NO. AREA CODE (_____) .........................................................................................................
The work for which this Proposal is submitted is for the construction in accordance with these Contract Documents (including the payment of not less than the State general prevailing wage rates or Federal minimum wage rates set forth herein), the Project Plans described below, including any addenda thereto, the Contract annexed hereto, and also in accordance with the California Department of Transportation Standard Plans and Standard Specifications, and the Labor Surcharge and Equipment Rental Rates in effect on the date the work is accomplished, and in accordance with the General Prevailing Wage rates. The Project Plans and Contract Documents for the work to be done are entitled:
MADRONE AND GIOVANNI SEWER LIFT STATIONS REHABILITATION PROJECT
PROJECT No. 40330
Bids are to be submitted for the entire work, including additive alternates, if any. The amount of the bid for comparison purposes will be the total of all the base and optional (alternative) bid items. The City reserves the right to award the project to include the base bid only, the alternate bid only or the base and alternate bid together.
The Bidder shall set forth for each unit basis item of work a unit price and a total for the item, and for each lump sum item a total for the item, all in clearly legible figures in the respective spaces provided for
this purpose. In the case of unit basis items, the amount set forth under the “Item Total” column shall be the product of the unit price bid and the estimate quantity for the item.
In case of discrepancy between the item price and the total set forth for a unit basis item, the unit price shall prevail, except as provided in (a) or (b), as follows:
(a) If the amount set forth as a unit price is unreadable or otherwise unclear, or is omitted, or is the same as the amount as the entry in the item total column, then the amount set forth in the total column for the item shall prevail and shall be divided by the estimate quantity for the item and the price thus obtained shall be the unit price.
(b) (Decimal Errors) If the product of the entered unit price and the estimated quantity is exactly off by a factor of ten, one hundred, etc., or one-tenth, or one-hundredth, etc., from the entered total, the discrepancy will be resolved by using the entered unit price or item total, whichever most closely approximates percentage wise the unit price or item total in the Department’s Final Estimate of Cost.
If this Proposal is accepted and the undersigned Bidder shall fail to enter into the Contract and furnish the two bonds in the sums required by the State Contract Act, with surety satisfaction to the City of Placerville within eight days, not including Sundays and legal holidays, after the bidder has received notice from the City of Placerville that the Contract has been awarded, the City of Placerville may, at its option, determine that the Bidder has abandoned the Contract, and thereupon this Proposal and the acceptance thereof shall be null and void and the forfeiture of such security accompanying this Proposal shall operate and the same shall be the property of the City of Placerville.
The undersigned, as Bidder, declares under penalty of perjury under the laws of the State of California that the only persons or parties interested in this Proposal, as principals, are those named herein; that this Proposal is made without collusion with any other person, firm, or corporation; that he has carefully examined the location of the proposed work, the annexed proposed form of Contract, and the Plans therein referred to; and he proposes, and agrees if this Proposal is accepted, that he will contract with the City of Placerville, in the form of the copy of the Contract annexed hereto, to provide all necessary machinery, tools, apparatus, and other means of construction, and to do all the work and furnish all the materials specified in the Contract, in the manner and time therein prescribed, and according to the requirements of the Engineer as therein set forth, and that he will take in full payment therefore the following item prices, to wit:
## CONTRACTOR’S BID AND BID PRICE SCHEDULE
### ADDENDUM #1
**MADRONE AND GIOVANNI SEWER LIFT STATIONS REHABILITATION PROJECT**
**PROJECT No. 40330**
### BASE BID - GIOVANNI SEWER LIFT STATION REHABILITATION
| ITEM NO. | ITEM DESCRIPTION | UNIT OF MEASURE | ESTIMATED QUANTITY | ITEM UNIT PRICE | TOTAL |
|----------|------------------------------------------------------|-----------------|--------------------|-----------------|-------|
| 1 | Mobilization/ Demobilization/ BMPs | LS | 1 | | |
| 2 | Site Safety/ Traffic Control Plan | LS | 1 | | |
| 3 | Potholing Existing Facilities | LS | 1 | | |
| 4 | Clearing and Grubbing | LS | 1 | | |
| 5 | Demolition and Abandonment | LS | 1 | | |
| 6 | Connection to Existing System | LS | 2 | | |
| 7 | New sewer pipeline | LF | 250 | | |
| 8 | Sewer wet-well and pump improvements | LS | 1 | | |
| 9 | Site drainage improvements | LS | 1 | | |
| 10 | Site Electrical | LS | 1 | | |
| 11 | Miscellaneous site improvements | LS | 1 | | |
| 12 | Supplemental Work | LS | 1 | $50,000 | $50,000|
| 13 | Access Road Improvements | LS | 1 | | |
### ALTERNATIVE BID ITEM – MADRONE SEWER LIFT STATION REHABILITATION
| ITEM NO. | ITEM DESCRIPTION | UNIT OF MEASURE | ESTIMATED QUANTITY | ITEM UNIT PRICE | TOTAL |
|----------|------------------------------------------------------|-----------------|--------------------|-----------------|-------|
| 1 | Mobilization/ Demobilization | LS | 1 | | |
| 2 | Site Safety/ Traffic Control Plan | LS | 1 | | |
| 3 | Potholing Existing Facilities | LS | 1 | | |
| 4 | Clearing and Grubbing | LS | 1 | | |
| 5 | Demolition and Abandonment | LS | 1 | | |
| 6 | Connection to Existing System | LS | 3 | | |
| 7 | New sewer pipeline | LF | 250 | | |
| 8 | Sewer wet-well and pump improvements | LS | 1 | | |
| 9 | Site drainage improvements | LS | 1 | | |
| 10 | Site Electrical | LS | 1 | | |
| ITEM NO. | ITEM DESCRIPTION | UNIT OF MEASURE | ESTIMATED QUANTITY | ITEM UNIT PRICE | TOTAL |
|---------|--------------------------------|-----------------|--------------------|-----------------|-------|
| 11 | Miscellaneous site improvements| LS | 1 | | |
| 12 | Supplemental Work | LS | 1 | | |
BASE BID AMOUNT (GIOVANNI LIFT STATION)
________________________________________________________
________________________________________________________ Dollars and _______________ Cents.
AMOUNT IN WRITING
ALTERNATIVE BID AMOUNT (MADRONE LIFT STATION)
________________________________________________________
________________________________________________________ Dollars and _______________ Cents.
AMOUNT IN WRITING
TOTAL BID AMOUNT (BOTH STATIONS)
________________________________________________________
________________________________________________________ Dollars and _______________ Cents.
AMOUNT IN WRITING
Sign Here: __________________________ Date: ____________
CONTRACTOR
________________________________________________________
PRINT SIGNATURE NAME AND TITLE OF BIDDER
(NOTICE: Bidder’s failure to execute the questionnaires and statements contained in this Proposal as required by applicable laws and regulations, or the determinations by City of Placerville based upon those questionnaires and statements, may prohibit award of the subject Contract to the Bidder.)
BIDDER’S PROOF OF DIR REGISTRATION
The Bidder agrees that its Proof of DIR Registration pursuant to Labor Code Section 1725.5 is attached hereto and made a condition of this bid.
SUPPLEMENTAL INFORMATION TO BE SUBMITTED AFTER BID OPENING AND MADE A CONDITION OF THE BID
The Bidder understands that a Bidder will be ineligible for an award of Contract unless the Bidder has furnished the required financial credit rating information required in Item D of Section 00420-CERTIFICATION OF BIDDER’S EXPERIENCE AND QUALIFICATIONS within three (3) business days after the receipt of bids.
ADDENDUM 3 – 9/28/17
CITY OF PLACERVILLE
MADRONE AND GIOVANNI SEWER LIFT STATIONS
SECTION 00310
PROPOSAL
PUBLIC CONTRACT CODE SECTION 10285.1 STATEMENT
In conformance with Public Contract Code Section 10285.1 (Chapter 376, Stats. 1985), the bidder hereby declares under penalty of perjury under the laws of the State of California that the bidder has ☐, has not ☐ been convicted within the preceding three years of any offenses referred to in that section, including any charge of fraud, bribery, collusion, conspiracy, or any other act in violation of any state or Federal antitrust law in connection with the bidding upon, award of, or performance of, any public works contract, as defined in Public Contract Code Section 1101, with any public entity, as defined in Public Contract Code Section 1100, including the Regents of the University of California or the Trustees of the California State University. The term “bidder” is understood to include any partner, member, officer, director, responsible managing officer, or responsible managing officer, or responsible managing employee thereof, as referred to in Section 10285.1.
NOTE The bidder must place a check mark after “has” or “has not” in one of the spaces provided. The above Statement is part of the Proposal. Signing this Proposal on the signature portion thereof shall also constitute signature of this Statement. Bidders are cautioned that making a false certification may subject the certifier to criminal prosecution.
PUBLIC CONTRACT CODE SECTION 10162 QUESTIONNAIRE
In conformance with Public Contract Code Section 10162, the Bidder shall complete, under penalty of perjury, the following questionnaire:
Has the bidder, any officer of the bidder, or any employee of the bidder who has a proprietary interest in the bidder, ever been disqualified, removed, or otherwise prevented from bidding on, or completing a federal state, or local government project because of a violation of law or a safety regulation?
Yes ☐ No ☐
If the answer is yes, explain the circumstances in the following space:
PUBLIC CONTRACT CODE SECTION 10232 STATEMENT
In conformance with Public Contract Code Section 10232, the Contractor hereby states, under penalty of perjury, that no more than one final unappealable finding of contempt of court by a federal court has been issued against the Contractor within the immediately preceding two-year period because of the Contractor’s failure to comply with an order of a federal court which orders the Contractor to comply with an order of the National Labor Relations Board.
NOTE: The above Statement and Questionnaire are part of the Proposal. Signing this Proposal on the signature portion thereof shall also constitute signature of this Statement and Questionnaire. Bidders are cautioned that making a false certification may subject the certifier to criminal prosecution.
NONCOLLUSION AFFIDAVIT
(Title 23 United States Code Section 112 and Public Contract Code Section 7106)
In conformance with Title 23 United States Code Section 112 and Public Contract Code Section 7106, the bidder declares that the bid is not made in the interest of, or on behalf of, any undisclosed person, partnership, company, association, organization, or corporation; that the bid is genuine and not collusive or sham; that the bidders has not directly or indirectly induced or solicited any other bidder to put in a false or sham bid, and has not directly or indirectly colluded, conspired, connived, or agreed with any bidder or anyone else to put in a sham bid, or that anyone shall refrain from bidding; that the bidder has not in any manner, directly or indirectly, sought by agreement, communication, or conference with anyone to fix the bid price of the bidder, or any other bidder, or to fix any overhead, profit, or cost element of the bid price, or of that of any other bidder, or to secure any advantage against the public body awarding the contract of anyone interested in the proposed contract; that all statements contained in the bid are true; and, further, that the bidder has not, directly or indirectly, submitted his or her bid price or any breakdown thereof, or the contents thereof, or divulged information or data relative thereto, or paid, and will not pay, any fee to any corporation, partnership, company association, organization, bid depository, or to any member or agent thereof to effectuate a collusive or sham bid.
NOTE: The above Noncollusion Affidavit is part of the Proposal. Signing this Proposal on the signature portion thereof shall also constitute signature of this Noncollusion Affidavit. Bidders are cautioned that making a false certification may subject the certifier to criminal prosecution.
BUSINESS AND PROFESSIONS CODE SECTION 7028.15 STATEMENT
In accordance with the Business and Professions Code Section 7028.15, the Contractor hereby states, under penalty of perjury, that he/she is licensed in accordance with an act providing for the State of California registration of Contractors,
License No._____________________, Classification(s)__________________________
Expiration Date ________________________________
By my signature on this proposal, I certify, under penalty of perjury under the laws of the State of California, that the foregoing questionnaire and statements of Public Contract Code Section 10162, 10232, and 10285.1 are true and correct and that the bidder has complied with the requirements of Section 8103 of the Fair Employment and Housing Commission Regulation (Chapter 5, Title 2 of the California Administrative Code). By my signature on this proposal, I further certify, under penalty of perjury under the laws of the State of California and the United States of America, that the Noncollusion Affidavit required by title 23 United States Code Section 112 and Public Contract Code Section 7106 are true and correct.
Date: _______________________
SIGNATURE AND TITLE OF BIDDER___________________________________________
NAME OF FIRM___________________________________________________________
Accompanying this proposal is ____________________________ (NOTICE: INSERT THE WORDS “CASH ($______)”, “CASHIER’S CHECK”, “CERTIFIED CHECK”, OR “BIDDER’S BOND”, AS THE CASE MAY BE) in amount equal to at least ten percent (10%) of the total of the bid.
The names of all persons interested in the foregoing proposal as principals are as follows:
IMPORTANT NOTICE: If the Bidder or other interested person is a corporation, state legal name of corporation and place of incorporation, also names of the president, secretary, treasurer, and executive officer thereof; if a partnership, state name of partnership, also names of all individual partners; if Bidder or other interested person is an individual, state first and last names in full.
______________________________________________________________
______________________________________________________________
______________________________________________________________
Licensed in accordance with an act providing for the registration of Contractors,
License No._________________________ Classification(s)________________________________________
!(A copy of the afore-referenced license must be attached hereto)!
ADDENDA:
RECEIPT OF COPIES OF THE FOLLOWING ADDENDA(S) IS HEREBY ACKNOWLEDGED.
ADDENDUM NO. BIDDER’S SIGNATURE DATE ACKNOWLEDGED
___________________ _______________________________ _______________________
___________________ _______________________________ _______________________
___________________ _______________________________ _______________________
By my signature on this proposal, I certify, under penalty of perjury under the laws of the State of California, that the foregoing questionnaire and statements of Public Contract Code Sections 10162, 10232, and 10285.1 are true and correct and that the Bidder has complied with the requirements of Section 8103 of the Fair Employment and Housing Commission Regulations (Chapter 5, Title 2 of the California Administrative Code). By my signature on this Proposal, I further certify, under penalty of perjury under the laws of the State of California and the United States of America that the Noncollusion Affidavit required by Title 23 United States Code, Section 112 and Public Contract Code Section 7106 are true and correct.
The person or persons executing this Proposal on behalf of a corporation or partnership shall be prepared to demonstrate by resolution, article, or otherwise, that such person is or that such persons are appropriately authorized to act in these regards for such corporation or partnership. Such authority shall be demonstrated to the satisfaction of the City of Placerville.
If the signature is by an agent other than an officer of a corporation or a member of a partnership, a power of attorney authorizing said act by the agent on behalf of his principal shall be submitted with the bid; otherwise, the bid may be disregarded as irregular and unauthorized.
The Bidder's execution on the signature portion of this Proposal shall constitute an endorsement and execution of those affidavits, declarations, and certifications which are part of this Proposal.
Executed this ______ day of ____________________, 2017
at __________________________________ County, State of__________________________________________
SIGN HERE ⇒ _______________________________________
Name and Title of Bidder _______________________________
Name of Firm _________________________________________
*** END OF PROPOSAL ***
CITY OF PLACERVILLE
BIDDER'S BOND
!(this form MUST be used)!
KNOW ALL PEOPLE BY THESE PRESENTS, THAT WE ____________________________, as PRINCIPAL, and ____________________________ as Surety are held and firmly bound unto the City of Placerville (Obligee) in the penal sum of TEN (10) PERCENT OF THE AMOUNT OF THE TOTAL BID PRICE of the Principal above named, submitted by said Principal to the Obligee for the work, for the payment of which sum in lawful money of the United States, well and truly to be made to the Obligee, we the Principal and surety bind ourselves, our heirs, executors, administrators and successors, jointly and severally, firmly by these presents. In no case shall the liability of the surety hereunder exceed the sum of $____________________________.
THE CONDITION OF THIS OBLIGATION IS SUCH, THAT:
WHEREAS, the Principal has submitted the above-mentioned bid to the Obligee, as aforesaid, for certain construction specifically described as follows, for which bids are to be opened at Placerville, El Dorado County, California, on October 5, 2017 at 4:00 p.m. for the construction of the
MADRONE AND GIOVANNI SEWER LIFT STATIONS REHABILITATION PROJECT
PROJECT No. 40330
NOW, THEREFORE, if the aforesaid Principal is awarded the Contract and, within the time and manner required under the Contract Documents, after the prescribed forms are presented to him for signature, enters into a written contract, in the prescribed form, in accordance with the Bid, and files two bonds with the City of Placerville, one to guarantee faithful performance and the other to guarantee payment for labor and materials, as required by law, then this obligation shall be null and void; otherwise, it shall remain in full force and virtue.
In the event suit is brought upon this bond by the Obligee and judgment is recovered, the Surety shall pay all costs incurred by the Obligee in such suit, including a reasonable attorney's fee to be fixed by the Court.
IN WITNESS WHEREOF, we have set our hands and seals on this __________ day of _________________ 2017.
SIGNATURES
(SEAL) ___________________________________________________________ Principal
(SEAL) ___________________________________________________________ Surety
Address: _________________________________________________________
(NOTE: Signature of those executing for the Surety shall be properly acknowledged, and accompanied by a Certificate of acknowledgment.)
ADDENDUM 3 – 9/28/17
CITY OF PLACERVILLE
MADRONE AND GIOVANNI SEWER LIFT STATIONS
PART 1 - GENERAL
1.01 QUALITY ASSURANCE
A. Acceptable Manufacturer: Flygt TOPS, or equal
B. Governing Standards, as applicable:
1. American Society for Testing and Materials (ASTM) Standards:
2. ASTM D883: Standard Terminology Related to Plastics
3. ASTM D3753: Standard Specifications for Glass-Fiber-Reinforced Polyester Manholes and Wet Wells
4. ANSI / AWWA D120-09: AWWA Standard for Thermosetting Fiberglass-Reinforced Plastic Tanks
1.02 SCOPE OF WORK
A. The product listed under this section shall include all labor, materials and equipment necessary to furnish a FRP wet well. Unless otherwise indicated the terminology used in this specification shall be in accordance with the definitions in the American Society for Testing and Materials (ASTM) designation D883 – Standard Terminology Related to Plastics.
1.03 SUBMITTALS
A. Shop Drawings: The manufacturer shall supply to engineer, contractor, and/or owner, a complete set of scale drawings detailing dimensions of heights, diameter, elevations to invert, pipe sizes and any other necessary details.
B. Calculations:
1. The manufacturer shall supply the owner buoyancy calculations assuming a flooded condition at finish grade for an empty wet well.
2. Structural design and analysis submittals will include analysis showing a minimum safety factor or 3:1 for longitudinal/axial buckling of the wet well side wall.
PART 2 - PRODUCTS
2.01 FIBERGLASS REINFORCED PLASTIC (FRP) WET WELL
A. Loading Conditions
1. The wet well shall be designed and constructed to withstand or exceed wall collapse and buckling with a 3:1 safety factor.
2. Wet well bottom shall not have more than 1/8 inches of deflection at its center with the vessel empty and water table located at finished grade.
3. Wet well, when installed according to wet well manufacturers current Wet Well Installation Instructions and Operating Guidelines, shall support accessory equipment – such as submersible pumps, rails, valves, and ladders as shown on drawings.
B. Materials
1. Wet well shall be manufactured with 100% premium catalyzed isophthalic resin and glass fibers. No fillers or extenders shall be used.
2. The resin shall be suitable for continuous immersion in sewage in the pH range of 3 to 11 and concentrations of H₂S found in municipal sewer systems. Resins shall be suitable for sulfuric acid concentrations to 20% of solution in waste stream.
C. Wet Well Dimensions
1. Wet well shall have nominal diameter of 72 inches.
2. See drawings for depths.
D. All inside surfaces shall be smooth and free of cracks and crazing. The inside surface will be pigmented or gel coated to a bright white finish. All surfaces other than those made in contact with the mold surface shall be coated with air-inhibited resin or gelcoat, this includes any cut edges of laminate.
2.02 ACCESSORIES AND FEATURES
A. Wet Well Top Flange
1. The wet well top flange shall be designed and built to support a 300 lb. vertical foot traffic load. Flange dimensions shall be a minimum of 3.0 inches wide or greater.
B. Anti-Flotation Flange
1. The station shall be provided with a minimum of two (2) anti-flotation rings located near the bottom of the station.
2. The anti-flotation flange shall be an integral part of the station and of sufficient in design to withstand the forces acting upon the station due to the subsoil water pressure.
C. Piping Stub-outs and Connections
1. Piping stub-outs shall be located in the field and meet manufacturer's requirements.
D. Pump Mounting Base and Studs
1. The pump base mounting studs shall be ¾-inch minimum stainless steel threaded studs.
2. The pump mounting base detail shall be provided by the pump manufacturer.
E. Wet well penetrations
1. All penetrations to the wet well shall be designed/approved by the manufacturer.
2. Seal all penetrations
3. The vector truck extension support beam connections shall be designed by the manufacturer. The epoxy anchor detail shown on the drawings may be modified as required by the manufacturer to ensure a watertight facility.
PART 3 - TESTING, INSTALLATION & WARRANTY
3.01 TESTING & INSTALLATION
A. Wet well shall be installed and tested according to the manufacturers wet well installation instructions and operating guidelines.
3.02 CERTIFICATION AND DESIGN
A. The manufacturer shall verify that the wet well has been sampled, tested and inspected in accordance with this specification and meets all requirements.
1. The manufacturer shall provide anti-flotation calculations for the designed wet well based on site specific parameters contained in the project Geotechnical Engineering Study, see Section 02200.
B. Marking and Identification
1. The wet well shall be marked on the inside and outside with the following information:
a. Manufacturer's trade name or trademark
b. Manufacturer's location
c. Total height and diameter of wet well
d. Date of manufacture
3.03 WARRANTY
A. Warranty
1. Warranty shall be manufacturer's warranty for underground wet wells in effect at time of shipment.
END OF SECTION
This Page Intentionally Left Blank
PART 1 - GENERAL
1.01 SUMMARY
A. Section includes:
1. Provide ductile iron pipe for piping as noted on the Drawings complete with all fittings, jointing materials, pipe hangers and supports, anchors, blocking, encasement, and other necessary appurtenances.
1.02 REFERENCES
A. Reference standards:
1. ANSI/AWWA C104/A21.4: Standard for Cement Mortar Lining for Ductile Iron Pipe and Fitting for Water.
2. ANSI/AWWA C105/A21.5: Standard for Polyethylene Encasement for Ductile Iron Piping for Water and Other Liquids.
3. ANSI/AWWA C110/A21.10: Standard for Ductile Iron and Gray Iron Fittings, 3-In. Through 48-In., for Water and Other Liquids.
4. ANSI/AWWA C111/A21.11: Standard for Rubber Gasket Joints for Ductile-Iron Pressure Pipe and Fittings.
5. ANSI/AWWA C115/A21.15: Standard for Flanged Ductile-Iron Pipe with Threaded Flanges.
6. ANSI/AWWA C150/A21.50: Standard for Thickness of Ductile-Iron Pipe.
7. ANSI/AWWA C151/A21.51: Standard for Ductile Iron Pipe, Centrifugally Cast, for Water and Other Liquids.
8. ANSI/AWWA C153/A21.53: Standard for Ductile Iron Compact Fittings 3-In. through 16-In. for Water and Other Liquids.
9. ANSI/AWWA C600: Standard for Installation of Ductile-Iron Water Mains and Their Appurtenances.
10. ASME/ANSI B16.1: Cast Iron Pipe Flanges and Flanged Fittings.
11. ASTM A48: Standard Specification for Gray Iron Castings.
12. ASTM A377: Standard Index of Specification for Ductile-Iron Pressure Pipe.
13. ASTM A536: Standard Specification for Ductile-Iron Castings.
14. ASTM C150: Standard Specification for Portland Cement.
15. ASTM D1248: Standard Specification for Polyethylene Plastics Molding and Extrusion Materials.
16. ASTM D395-89 Method B: Standard Test Method for Rubber Property - Compression Set.
17. ASTM D412-87: Standard Test Method for Rubber Properties in Tension.
18. ASTM D2240-86: Standard Test Method for Rubber Properties -Durometer Hardness.
19. ASTM A307: Standard Specification for Carbon Steel Bolts and Studs.
1.03 SUBMITTALS
A. Product Data and Shop Drawings:
1. Material specification data.
2. Detailed Pipe layout Drawings.
3. Installation instructions.
1.04 DELIVERY, STORAGE, AND HANDLING
A. During loading, transporting, unloading and storage, prevent damage to material.
1. To ensure undamaged condition.
2. Use wide bearing area slings and wide padded skids.
3. Do not use bare cables, chains, hooks, metal bars, or narrow skids.
4. Laterally support pipe, fittings, and specials to maintain shape.
5. Separate materials so they do not bear against each other.
6. Securely fasten load to prevent movement in transit.
B. Do not drop pipe or fittings.
C. Adequately tag or otherwise mark all piping and fittings as to size.
D. Acceptance at site:
1. Reject products with dents, kinks, abrupt changes of curvature or other injuries.
2. Reject any product dropped from truck or crane.
3. Replace or recondition at Contractor’s expense rejected items.
4. Reconditioning subject to Engineer’s acceptance.
5. Replace coatings as originally specified on reconditioned pipe.
1.05 PROJECT/SITE CONDITIONS
A. Environmental requirements: See specification Section 02000.
PART 2 - PRODUCTS
2.01 MANUFACTURERS
A. Acceptable manufacturers:
1. U.S. Pipe and Foundry Co.
2. Pacific States.
3. American Pipe
4. Or equal.
B. Manufacturers for fittings, joints, and couplings are listed with the specific materials in Section 2.02, Materials.
2.02 MATERIALS
A. Pipe:
1. Ductile iron: ANSI/AWWA C151/A21.51 - Classified as listed below:
a. 18 inches and below: Pressure Class 350.
b. 24 inches and above: Pressure Class 250.
c. All pipe burial depth greater than 15 feet below finished grade: Pressure Class 350.
B. Fittings:
1. Ductile iron: ANSI/AWWA C110/A21.10 dimensions, ASTM A536 Grade 80-60-03 or 70-50-05. ANSI/AWWA C153 fittings are allowed.
C. Joints:
1. Mechanical joints: ANSI/AWWA C111/A21.11.
2. Mechanical joints with tie rods:
a. Tie rods: ASTM A307.
b. Steel pipe spacers: ASTM A120, standard weight.
c. Washers: ANSI A27.2 plain steel.
d. Plastic plugs: As recommended by pipe manufacturer.
3. Flanged joints:
a. Flanges:
1) General use: ANSI A21.15 or ASME/ANSI/B16.1, 125 lb.
b. Flanged bolts and nuts shall be type 316 stainless steel.
c. Gaskets: Full face, 1/8-inch thick, cloth impregnated, Garlock Blue-Guard Style 3300, or equal.
4. Threaded connections: ANSI B2.1 NPT; provide service saddles at all tapped connections.
5. Flexible couplings:
a. Dresser Style 38 or 138, Smith-Blair 411, Straub Flex, or equal.
b. Couplings shall have stainless steel nuts, bolts, and washers.
6. Grooved couplings: Per AWWA C606, only where shown.
a. Coupling: Victaulic Style 77 or equal.
7. Restrained mechanical joint:
a. EBAA Iron Megalug
b. Or equal.
8. Flanged coupling adapters:
a. 12 inches and under: Smith-Blair Type 912, Dresser Style 127, or equal, with anchor wedges (no studs) and stainless steel nuts, bolts, and washers.
b. 14 inches and over: Smith-Blair Type 913, Dresser Style 128, or equal.
9. Service saddles: Ductile iron with double galvanized steel straps and rubber sealing gasket, 250 psi pressure rating, stainless steel nuts, bolts, and washers.
10. Restrained flange adapters:
a. EBAA Iron 2100 Megaflange or equal.
D. Corrosion control:
1. Shop lining and coating:
a. Encasement (buried pipe): 8 mil Polyethylene film per ASTM D1248.
b. Service lines of different type metal within 3 feet of DIP: Polyethylene or dielectric tape wrap.
2.03 FABRICATION
A. Joints, shall be restrained:
1. Type:
a. Buried: Mechanical or push-on.
b. Exposed: Flanged or Grooved where shown.
c. Other: As noted on Drawings.
2. 12 inches and smaller outlets, where minimum line is at least twice the diameter of the branch; tee or a tapping saddle is acceptable.
3. Where tie rods are required, except where indicated otherwise on Drawings provide:
a. 14 inches and below: Two (2) rods.
b. 16 inches through 20 inches: Four (4) rods.
c. 24 inches through 30 inches: Six (6) rods.
d. 36 inches through 48 inches: Eight (8) rods.
4. Mark the centerline of each flange and mechanical joint piece.
5. Screw flanges onto screwed-on flanged pipe so that pipe extends completely through and flush with the flange.
6. Finish machine pipe ends and flange faces flat and perpendicular to pipe centerline in a single operation.
7. Wall castings:
a. Mechanical joint with tapped bolt holes except where indicated otherwise on the Drawings.
b. Provide seep ring.
c. Provide plastic plugs to prevent bolt holes filling with concrete.
B. Shop coating and lining:
1. Lining: Ceramic Epoxy, Protecto 401
2. Coating where exposed: Epoxy Paint, Tnemec Series 69.
3. Coating where buried: Bituminous coating per ANSI/AWWA C104/A21.4.
4. Shop-coat flange faces with rust-preventive compound. Houghton “Rust Veto 344,” Rust-Oleum “R-9.”
PART 3 - EXECUTION
3.01 EXAMINATION
A. Examine areas for:
1. Defects such as weak structural components that adversely affect execution and quality Work.
2. Deviations beyond allowable tolerances for piping clearances.
B. Start installation only when conditions are satisfactory.
C. Pipe:
1. Carefully examine pipe and fittings for cracks and other defects prior to installation.
2. Remove all defective pipe from site and replace.
3.02 INSTALLATION
A. Cutting pipe:
1. Cut pipe neatly without damage to pipe or lining.
2. Cut smooth, straight, and at right angles to pipe axis.
3. Dress and bevel end of cut pipe to remove roughness and sharp corners.
4. Cut cast iron with mechanical pipe cutters.
5. Cut ductile iron pipe with saw or abrasive wheel.
B. Cleaning:
1. Thoroughly clean pipe and fittings of foreign matter before installation.
2. Keep pipe and fittings clean until final acceptance.
3. Joint contact surfaces:
a. Wire brush, if necessary.
b. Wipe clean.
c. Keep clean until jointing is complete.
C. Piping in buildings or structures:
1. Completed installation should present a neat, orderly appearance.
2. Do not block openings, passageways, or pipe galleries.
3. Run piping parallel to walls of building or structure.
4. Keep piping from contacting walls, structures or installed items.
D. Piping underground:
1. Install in accordance with AWWA C600, except as specified herein.
2. Protect from lateral displacement while placing backfill.
3. Embedment and backfill per Earthwork Section.
4. Underground piping shall retain the factory bitumastic coating and shall be entirely wrapped in a polyethylene sleeve.
5. Do not lay pipe:
a. In water.
b. Under unsuitable weather conditions.
c. Under unsuitable trench conditions.
E. Joining:
1. Follow manufacturer’s instructions.
2. Mechanical joints:
a. If an effective seal is not obtained, disassemble joint, clean thoroughly, and reassemble.
b. Do not over-tighten bolts to compensate for poor installation.
c. Carefully align holes in mechanical joints with tie rods to permit installation of the harness bolts.
d. Install flange and mechanical joint pieces so the mechanical joint holes, as well as the flange holes, straddle the top centerline for horizontal piping or the side centerline for vertical piping.
e. Use joint restrainer glands unless indicate otherwise on the Drawings.
3. Flanged joints:
a. Take care when bolting flanges to ensure that there is no restraint on the opposite end of the pipe which would prevent gasket compression or cause unnecessary stress in flanges.
b. Leave one (1) flange free to move in any direction while tightening flange bolts.
c. Tighten bolts gradually at a uniform rate to compress gaskets uniformly.
d. Take special care in connecting to pumping equipment to ensure no stresses are transmitted to pump flanges by connecting piping.
1) Permanently support piping for accurate matching of bolt holes and uniform contact over the entire face of abutting pump and pipe flanges are obtained before bolting those flanges.
2) Allow pump connection piping to move parallel to its longitudinal centerline while bolts are tightened.
3) Level, align, and wedge pipes into position to fit connecting piping; but, do not install grout until after initial pipe fitting and alignment to allow shifting the pump on its foundation.
4) Grout pumps prior to final bolting of connecting piping.
4. Flanged coupling adapters:
a. Flanged coupling adaptors shall be retrained with Mega-lug type devices, those requiring drilled studs shall not be allowed.
5. Mechanical couplings:
a. Cut pipe ends clean and smooth.
b. Leave a space of 1/2-inch between pipe ends.
6. Wall castings: Provide where indicated on the Drawings.
F. Reducers:
1. Provide eccentric reducers.
2. Install with straight side on top to avoid trapping air.
G. Anchorage:
1. In interior locations and where subject to internal pressure block, anchor or harness piping with mechanically coupled or similar joints to prevent separation of joints.
2. Other location: Provide reaction blocking anchorages or other supports for fittings above grade or exposed in structure as indicated on the Drawings or as required to prevent movement.
3. Concrete blocking:
a. Bearing area as indicated on the Drawings, or as directed by the Engineer.
b. Extend from fitting to solid undisturbed earth.
c. Install so joints are accessible for repair.
d. If adequate support against undisturbed earth cannot be obtained, provide restrained joints or metal harness anchorages across the joint and secure by anchoring to the pipes or fittings or other anchorage facilities as required for adequate support.
e. If the lack of a solid vertical excavation face is due to improper excavation, all excess costs shall be borne by Contractor.
4. Restrained joints: Provide sufficient number of restrained joints on either side of bend or fitting in order to develop full thrust restraint at test pressure.
H. Encasement:
1. Provide concrete encasement as indicated on the Drawings.
2. Suitably support and block pipe and anchor against flotation.
I. Connection to existing pipelines:
1. Make connections between new and existing piping with suitable fittings.
2. Schedule connection to minimize inconvenience to the Owner.
3. Provide facilities for adequate dewatering and disposal of water from dewatered line and excavations without damage to adjacent property.
J. Corrosion control:
1. Metal surfaces:
a. Coat all steel clamp rods, bolts, and other metal accessories used in tapping saddles, anchorages or joint harnesses subject to submergence or contact with the earth and not concrete-encased.
b. Apply two (2) coats of coal-tar paint to clean, dry, metal surfaces.
c. Allow the first coat to dry and harden before applying the second coat.
2. Polyethylene pipe encasement: Install Method A, ANSI/AWWA C105/A21.5.
K. Alignment:
1. Unless shown otherwise, piping shall be installed parallel to building lines, plumb, and level.
2. Piping shall be installed without springing or forcing the pipe in a manner which would set up stresses in the pipe, valves, or connected equipment.
3. All pipe flanges shall be set level, plumb, and aligned. All flanged fittings shall be true and perpendicular to the axis of the pipe. All bolt holes in flanges shall straddle vertical centerline of pipes.
3.03 FIELD QUALITY CONTROL
A. Hydrostatic tests:
1. Perform hydrostatic tests in accordance with Section 15060.
This Page Left Intentionally Blank
**PROJECT INFORMATION**
**OWNER:** CITY OF PLACERVILLE
3101 CENTER STREET
PLACERVILLE, CA 95667
**APN:** A PORTION OF 050-401-12-100 AND A PORTION OF 050-400-17-100
**PROJECT ADDRESS:** MADRONE L.S. - 1080 MADRONE LANE, PLACERVILLE, CA 95667
GIOVANNI L.S. - 2462 GIOVANNI DRIVE, PLACERVILLE, CA 95667
**CONTOUR INTERVAL:** 1'
**TOPOGRAPHY:** FIELD SURVEY BY SWEENEY LAND SURVEYING.
**SECTION, TOWNSHIP & RANGE:** POR. OF SEC. 5, T.10 N., R.11 E., MDM
**ZONING:** R120
**EXISTING USE:** RESIDENTIAL/UTILITY
**PROPOSED USE:** RESIDENTIAL/UTILITY
**UTILITIES:**
- WATER: EL DORADO IRRIGATION (EID)
- SEWER: CITY OF PLACERVILLE
- ELECTRIC: PACIFIC GAS & ELECTRIC
- TELEPHONE: AT&T
**FIRE PROTECTION:** EL DORADO COUNTY FIRE PROTECTION
**FINAL MAP DATE:** 1975- GIOVANNI
1976- MADRONE
---
**GENERAL NOTES:**
1. ALL WORK SHALL BE ACCOMPLISHED UNDER THE APPROVAL, INSPECTION AND TO THE SATISFACTION OF THE CITY OF PLACERVILLE, HEREFORTH REFERED TO AS THE "CITY". ALL CONSTRUCTION SHALL CONFORM TO THESE PLANS, ACCOMPANYING SPECIFICATIONS.
2. LOCATION OF ALL UNDERGROUND FACILITIES ARE APPROXIMATE ONLY. THE CONTRACTOR SHALL BE RESPONSIBLE FOR VERIFYING THE LOCATION AND DEPTH OF ALL FACILITIES PRIOR TO ANY TRENCHING. THE CONTRACTOR SHALL REPAIR ALL UTILITIES DAMAGED BY THE CONTRACTOR AT NO ADDED COST TO THE CITY AND SHALL CONTACT UNDERGROUND SERVICE ALERT (USA) 48 HOURS PRIOR TO ANY EXCAVATION WORK FOR DETERMINATION AND LOCATION OF UNDERGROUND UTILITIES.(PHONE 1–800–642–2444)
3. ALL FACILITIES SHALL BE BUILT TO THE DIMENSIONS AND ELEVATIONS SHOWN ON THESE PLANS. CONSTRUCTION STAKING WILL BE PROVIDED BY THE CONTRACTOR AND MUST BE APPROVED BY THE CITY PRIOR TO WORK.
4. THE CONTRACTOR SHALL DESIGNATE A RESPONSIBLE PERSON WHO SHALL HAVE THE AUTHORITY TO REPRESENT AND ACT FOR THE CONTRACTOR ON THE JOB SITE DURING ALL WORKING HOURS.
5. THE CONTRACTOR SHALL NOTIFY THE FOLLOWING PARTIES BY THE TIME SPECIFIED PRIOR TO BEGINNING OR RESTARTING WORK
* CITY OF PLACERVILLE ENGINEERING STAFF (INSPECTION)
48 HOURS
9. THE CITY USED THE DESIGN AND CONSTRUCTION STANDARDS OF THE EL DORADO IRRIGATION DISTRICT (EID). CONTRACTOR SHALL HAVE A COPY OF EID'S CURRENT STANDARDS ON THE JOB SITE.
10. ALL TIE–INS TO THE CITY FACILITIES SHALL BE DONE BY A CLASS A LICENSED CONTRACTOR IN ACCORDANCE WITH THE CONTRACT DOCUMENTS AND WITH CITY WATER, SEWER AND RECYCLED WATER DESIGN AND CONSTRUCTION STANDARDS, AS AVAILABLE ON THE EID WEBSITE: www.eid.org
11. WHERE EXCAVATION EXCEEDS 5 FEET IN DEPTH THE CONTRACTOR SHALL OBTAIN AN EXCAVATION PERMIT FROM THE CAL/OSHA INDUSTRIAL RELATION DEPARTMENT. (PHONE 1–916–920–6123)
12. THE CONTRACTOR SHALL REPAIR OR REPLACE ALL PAVEMENT, UTILITIES, VEGETATION, ROADS, FENCES ETC. DAMAGED BY THE CONTRACTOR'S EQUIPMENT TO LIKE OR BETTER CONDITION AT NO ADDED COST TO THE CITY.
13. ALL REVISIONS TO THESE DRAWINGS MUST BE APPROVED IN WRITING BY THE CITY.
14. CONTRACTOR SHALL OBTAIN AN APPROVED ASBESTOS MITIGATION PLAN. IF SERPENTINE ROCK IS ENCOUNTERED CONTACT THE CITY ENGINEER IMMEDIATELY.
15. IF UNUSUAL AMOUNTS OF STONE, BONE OR ARTIFACTS ARE FOUND, STOP WORK AND CONTACT THE CITY ENGINEER IMMEDIATELY.
16. THE CONTRACTOR SHALL RECORD THE POSITION, DEPTH AND DIRECTION OF ANY FACILITIES UNCOVERED DURING CONSTRUCTION AS WELL AS ANY MATERIAL CHANGES OR OTHER INFORMATION WHICH IS REQUIRED TO BE SHOWN ON THE RECORD DRAWINGS.
---
**EXISTING**
**PROPOSED**
---
**ABBREVIATIONS**
| Abbreviation | Description |
|--------------|-------------|
| AB | AGGREGATE BASE |
| ABAN | ABANDON |
| AC | ASPHALT CONCRETE |
| ARV | AIR RELEASE VALVE |
| AVRV | AIR VACUUM RELEASE VALVE |
| BFV | BUTTERFLY VALVE |
| BFP | BACKFLOW PREVENTER |
| BV | BALL VALVE |
| BW | BACK OF WALK |
| C&G | CURB AND GUTTER |
| CL | CENTERLINE / CLASS |
| CMP | CORRUGATED METAL PIPE |
| CONC | CONCENTRIC |
| CVTOP | TOP OF CULVERT (SIZE) |
| CFL | CURB FLOWLINE |
| DI | DRAIN INLET |
| DT | DITCH (CENTER "V") |
| DIP | DUCTILE IRON PIPE |
| EL | ELEVATION |
| EOP | EDGE OF PAVEMENT |
| FEL&C | FUSION EPOXY LINED AND COATED |
| FF | FINISH FLOOR |
| FG | FINISH GRADE |
| FL | FLOWLINE |
| FH | FIRE HYDRANT |
| FOC | FACE OF CURB |
| GB | GRADE BREAK |
| GV | GATE VALVE |
| HP | HIGH POINT |
| IE | INVERT ELEVATION |
| INV | INVERT |
| L | LENGTH |
| MANF | MANUFACTURER |
| MAX | MAXIMUM |
| MIN | MINIMUM |
| NIC | NOT IN CONTRACT |
| NO. | NUMBER |
| ODS | OUTSIDE DIAMETER STEEL |
| P | PAD ELEVATION |
| PL | PROPERTY LINE |
| PP | POWER POLE |
| PRV | PRESSURE RELIEF VALVE |
| PVMT | PAVEMENT |
| PVT | PRIVATE |
| R | RADIUS |
| REINF | REINFORCEMENT |
| REPL | REPLACE |
| RIM | RIM ELEVATION |
| ROW | RIGHT OF WAY |
| RS | RESILIENT SEATED |
| SD | STORM DRAIN |
| SS | SANITARY SEWER |
| SDMH | STORM DRAIN MANHOLE |
| SSMH | SANITARY SEWER MANHOLE |
| SW | SIDEWALK |
| TC | TOP OF CURB |
| TYP | TYPICAL |
| UE | UNDERGROUND ELECTRICAL |
| UG | UNDERGROUND GAS |
| UT | UNDERGROUND TELEPHONE |
| W | WATER MAIN |
| W/ | WITH |
| WM | WATER METER |
| WS | WATER SERVICE |
---
**NOTE – REFERENCE SHEET E1 FOR ELECTRICAL SYMBOLS AND ABBREVIATIONS**
---
**GENERAL NOTES, ABBREVIATIONS & SYMBOLS**
---
**SHEET 2 OF 23**
NOTES:
1. ALL EXISTING FACILITIES ARE TO REMAIN IN SERVICE DURING CONSTRUCTION UNTIL NEW SYSTEMS ARE TESTED AND IN LINE. IT IS THE CONTRACTOR'S RESPONSIBILITY TO DEVELOP AND IMPLEMENT A PROGRAM TO MAINTAIN THE PUMPING ABILITIES OF THIS STATION DURING CONSTRUCTION. PLAN WILL BE SUBMITTED TO AND APPROVED BY ENGINEER PRIOR TO BEGINNING OF WORK.
2. LOCATION OF ALL UNDERGROUND FACILITIES ARE APPROXIMATE. CONTRACTOR SHALL LOCATE ALL EXISTING UNDERGROUND FACILITIES AND THRUST BLOCKS AND CONTACT ENGINEER FOR ANY DISCREPANCIES ON PLANS. CONTRACTOR SHALL POTHOLE TO CONFIRM SIZE AND MATERIAL OF UNDERGROUND FACILITIES.
3. NOT USED.
4. ALL PROPOSED GRAVITY SEWER PIPE SHALL BE PVC SDR 26.
5. PROPOSED FORCE MAIN SHALL BE PVC CL 150 C800 OR DUCTILE IRON PIPE C151 LINED WITH PROTECTO 401 OR APPROVED EQUAL. CONNECT TO (E) TRANSMISSION PIPE WITH DUCTILE IRON COUPLING.
6. REMOVE WETWELL AND VALVE VAULT IN ITS ENTIRETY. BACKFILL CAVITY WITH NATIVE MATERIAL COMPACTED TO 90% MINIMUM.
7. ADJUST NEW CULVERT INVERTS AND LENGTHS AS NECESSARY TO PROVIDE DRAINAGE, AVOID NEW SEWER AND MAINTAIN A MINIMUM OF 18" COVER. PIPE TO BE 12" HDPE PIPE.
8. (N) 6" CONCRETE PAD W/ #4@8"EW, GRADE TO ACCOMMODATE THE 6-INCH SLAB AND 6-INCHES OF CLASS II AB AT 95% COMPACTION. TOP OF SLAB TO BE 2-INCHES ABOVE FINAL GRADE. CONFORM SLAB TO APPROXIMATE EXISTING GRADE.
9. FINAL LOCATIONS OF SAFETY DAVIT AND EQUIPMENT DAVIT BASE TO BE DETERMINED IN THE FIELD BY THE CITY STAFF.
10. SEE PIPE ABANDONMENT DETAIL 3 ON PAGE 6.
11. PROTECT EXISTING RETAINING WALL IN PLACE. BRACE AS REQUIRED DURING CONSTRUCTION TO PREVENT DAMAGE OR MOVEMENT.
12. CLEAR AND GRUB ALL AREAS TO BE CONSTRUCTED UPON. REMOVE ALL ORGANIC MATERIALS.
13. CONTRACTOR SHALL DETERMINE FINAL NUMBER, TYPE AND MATERIAL OF FITTINGS REQUIRED FOR TIE-IN AND SUBMIT FOR APPROVAL. INSTALLATION OF THE NEW GRAVITY SEWER LINE SHALL MATCH SLOPE AND INVERT AT TIE-IN LOCATION OF EXISTING LINE.
14. 3'x3' RIP-RAP, 8"-12" ROCKS, MINIMUM OF 12-INCHES DEEP, SET RIP-RAP ON WOVEN POLYPROPYLENE GEOTEXTILE FABRIC WITH A MINIMUM THICKNESS OF 1.5MM IN ACCORDANCE WITH ASTM D4632, ASTM D4491, AND ASTM D4355, OR APPROVED EQUAL.
NOTES:
1. ALL EXISTING FACILITIES ARE TO REMAIN IN SERVICE DURING CONSTRUCTION UNTIL NEW SYSTEMS ARE TESTED AND ON LINE. IT IS THE CONTRACTOR'S RESPONSIBILITY TO DEVELOP AND IMPLEMENT A PROGRAM TO MAINTAIN THE PUMPING ABILITIES OF THIS STATION DURING CONSTRUCTION. PLAN WILL BE SUBMITTED TO AND APPROVED BY ENGINEER PRIOR TO BEGINNING OF WORK.
2. LOCATION OF ALL UNDERGROUND FACILITIES ARE APPROXIMATE. CONTRACTOR SHALL LOCATE ALL EXISTING UNDERGROUND FACILITIES AND THRUST BLOCKS AND CONTACT ENGINEER FOR ANY DISCREPANCIES ON PLANS. CONTRACTOR SHALL POTHOLE TO CONFIRM SIZE AND MATERIAL OF UNDERGROUND FACILITIES.
3. NOT USED.
4. ALL PROPOSED GRAVITY SEWER PIPE SHALL BE PVC SDR 26.
5. PROPOSED FORCE MAIN SHALL BE PVC CL 150 C900 OR DUCTILE IRON PIPE C151 LINED WITH PROTECTO 401 OR APPROVED EQUAL CONNECT TO (E) TRANSMISSION PIPE WITH DUCTILE IRON COUPLING.
6. REMOVE WETWELL AND VALVE VAULT IN ITS ENTIRETY. BACKFILL CAVITY WITH NATIVE MATERIAL COMPACTED TO 90% MINIMUM.
7. (N) 6" CONCRETE PAD W/ #4@8"EW, GRADE TO ACCOMMODATE THE 6-INCH SLAB AND 6-INCHES OF CLASS II AB AT 95% COMPACTION. TOP OF SLAB TO BE 2-INCHES ABOVE FINAL GRADE.
8. FINAL LOCATIONS OF SAFETY DAVIT AND EQUIPMENT DAVIT BASE TO BE DETERMINED IN THE FIELD BY THE CITY STAFF.
9. SEE PIPE ABANDONMENT DETAIL 3 ON PAGE 6.
10. PROTECT EXISTING RETAINING WALL IN PLACE. BRACE AS REQUIRED DURING CONSTRUCTION TO PREVENT DAMAGE OR MOVEMENT.
11. CLEAR AND GRUB ALL AREAS TO BE CONSTRUCTED UPON. REMOVE ALL ORGANIC MATERIALS.
12. CONTRACTOR SHALL DETERMINE FINAL NUMBER, TYPE AND MATERIAL FITTINGS REQUIRED FOR TIE-INS AND SUBMIT FOR APPROVAL. INSTALLATION OF THE NEW GRAVITY SEWER LINE SHALL MATCH SLOPE AND INVERT AT TIE-IN LOCATION OF EXISTING LINE.
### ELEVATIONS
| DESCRIPTION | GIOVANNI | MADRONE |
|----------------------|----------|---------|
| WETWELL COVER | 2130.50 | 2057.90 |
| WETWELL BOTTOM | 2118.60 | 2048.00 |
#### LEVEL TRANSDUCER SET POINTS
| DESCRIPTION | GIOVANNI | MADRONE |
|----------------------|----------|---------|
| ALARM | 2124.00 | 2053.50 |
| LAG PUMP ON | 2123.50 | 2053.00 |
| LEAD PUMP ON | 2123.00 | 2052.50 |
| PUMPS OFF | 2121.60 | 2051.00 |
#### FLOAT SWITCH SET POINTS
| DESCRIPTION | GIOVANNI | MADRONE |
|----------------------|----------|---------|
| LAG PUMP ON/ALARM | 2124.00 | 2053.50 |
| LEAD PUMP ON | 2123.50 | 2053.00 |
| PUMPS OFF | 2121.60 | 2051.00 |
---
**NOTES:**
1. AWWA C517, DEZURIK, PLUG AND BODY MATERIAL: DUCTILE IRON
2. ALL EXPOSED DUCTILE IRON PIPE FITTINGS AND VALVES SHALL BE COATED WITH INEMEC SERIES V89 EPOXY AND LINED WITH PROTEC TO 401, OR EQUAL.
---
**TYPICAL LIFT STATION DETAIL**
GIOVANNI & MADRONE SEWER LIFT STATIONS REHABILITATION
---
**CITY OF PLACERVILLE**
3101 CENTER STREET
PLACERVILLE, CA 95667
PHONE: (530) 642-5250
---
**DOMENICHELLI & ASSOCIATES**
1101 Investment Blvd, Suite 115
El Dorado Hills, CA 95762
Ph: (916) 933-1997
Fax: (916) 933-4778
---
**REV DATE BY DESCRIPTION**
---
**SCALE:**
AS NOTED
WARNING
0 1/2 1
IF THIS BAR DOES NOT MEASURE 1" THEN DRAWING IS NOT TO SCALE.
DESIGNED D. HEIGHER
DRAWN J. CADE
CHECKED J. DOMENICHELLI
---
**TYPICAL LIFT STATION**
SHEET 5 OF 23
NOTES:
1. CONTRACTOR TO INCLUDE AS AN OPTION FOR CITY CONSIDERATION, PAVING OF THE ACCESS ROAD FROM THE EXISTING END OF PAVEMENT TO THE PROPOSED SITE PAVING AT THE LIFT STATION AREA. THE DESIGN SECTION IS 3" AC OVER 6" AB. MANHOLE SHALL BE ADJUSTED TO GRADE. APPROXIMATE AREA IS 3600 SF.
PAVING PLAN
SCALE: 1" = 10'
GIOVANNI & MADRONE SEWER LIFT STATIONS REHABILITATION
PAVING PLAN - GIOVANNI LIFT STATION
SHEET 5A
5A OF 23
NOTE:
1. DIAMETER OF CONC FOOTING SHALL BE 3 TIMES OD OF POST (10" MIN)
2. PROVIDE BROWN VINYL SLATS IN ALL NEW FENCING.
FENCE DETAIL
NOTE:
1. DIAMETER OF CONC FOOTING SHALL BE 3 TIMES OD OF POST (10" MIN)
2. PROVIDE BROWN VINYL SLATS IN ALL NEW GATES.
GATE DETAIL
PIPE ABANDONMENT DETAIL
AC PAVEMENT DETAIL
DETAIL REMOVED
EL DORADO IRRIGATION DISTRICT
SEWER TRENCH SECTION
DRAWN BY: M. SIZLOVE
APPROVED: B. MUELLER
GIOVANNI & MADRONE SEWER LIFT STATIONS REHABILITATION
DETAILS 1
SHEET 6
6 OF 23
| ITEM # | DESCRIPTION |
|--------|-------------|
| 1 | MxPE 45° ELL |
| 2 | PVC PIPE W/ LOOSE FITTING CAP |
| 3 | G5 CONCRETE TRAFFIC UTILITY BOX W/ IRON LID MARKED SEWER |
| 4 | CONCRETE COLLAR |
FLUSH WITH EXISTING PAVING OR SIDEWALK OR 1/2" ABOVE SURROUNDING GROUND SURFACE
90% COMPACTED BACKFILL (TYP) NO. 4 REINFORCEMENT HOOP
HORIZONTAL LONG RADIUS SWEEP
FLOW
CLEANOUT ON GRAVITY SEWER AT SWEEP CONNECTIONS 1
SLAB ON GRADE DETAIL 4
NOTES:
1. POUR ALL SLABS IN A CHECKERBOARD PATTERN
DETAIL REMOVED
SAFETY DAVIT BASE, COORDINATE REQUIRED MODEL WITH CITY STAFF TO MATCH EXISTING HOISTS
#4x48" @8" OC DOWELS
#5@12" EWEF
SECTION A-A
SAFETY DAVIT BASE DETAIL
NO SCALE
TYP
EQUIPMENT DAVIT BASE, COORDINATE REQUIRED MODEL WITH CITY STAFF TO MATCH EXISTING HOISTS
#4@8" EW, SLAB REINF
#5@12" EWEF
SECTION A-A
EQUIPMENT DAVIT BASE DETAIL
NO SCALE
TYP
GIOVANNI & MADRONE SEWER LIFT STATIONS REHABILITATION
DETAILS 2
SHEET 7
7 OF 23
CONSTRUCTION NOTES
1. PERMITS SHALL BE REQUIRED FOR ANY EXCAVATION OVER 5 FEET IN DEPTH, INTO WHICH A PERSON IS REQUIRED TO DESCEND OR WHERE TRENCHING IS LESS THAN 5' IN DEPTH IN SOILS WHERE HAZARDOUS GROUND MOVEMENT MAY BE EXPECTED AND INTO WHICH A PERSON IS REQUIRED TO DESCEND.
2. PIPE TO BE LAID WITH LABEL UP ON EACH JOINT.
3. COMPACTION IS RELATIVE TO CAL TRANS CALIF. TEST 231F OR ASTM 1557 BACKFILL WITH CLASS II AB.
4. WHEN COUNTY OR CITY ENCROACHMENT PERMIT CONDITIONS ARE MORE RESTRICTIVE, THEY WILL TAKE PRECEDENCE.
5. NO OTHER UTILITIES PERMITTED WITHIN 12" VERTICALLY OF SEWER FACILITIES.
6. PIPE ZONE EXCAVATION LIMITS ARE NOT TO BE EXCEEDED, PIPE ZONE TRENCH WALLS ARE TO BE VERTICAL, SEE DRAWING S07A FOR UNSTABLE CONDITIONS.
7. TRACER WIRE TO BE INCLUDED ON ALL PIPELINES INCLUDING SERVICE LATERALS.
8. ROAD REPAIR AND PERMANENT PAVING SHALL MATCH EXISTING SECTIONS, PUBLIC ROAD AC SECTION SHALL BE A MINIMUM OF 5" THICK, BIKE PATH AC SECTION SHALL BE A MINIMUM OF 2" THICK, PARKING LOT AC SECTION SHALL BE A MINIMUM OF 3" THICK.
9. ASSUME UP TO 10" INCHES OF EXISTING AC FOR PAVEMENT CUTTING.
10. BACKFILL FOR THE ENTIRE TRENCH SECTION TO PAVEMENT SUBGRADE OR TO FINAL BACKFILL SHALL BE CLASS 2 AB, WHERE UNDERMINING OR CRAGS OCCUR IN TRENCH WALL, CONTRACTOR WILL COLLAPSE OR FILL THESE AREAS WITH CLSM OR EQUIVALENT, FINAL BACKFILL IN UPAVED AREAS SHALL BE 12" NATIVE SOIL.
---
**ITEM #** | **DESCRIPTION**
---|---
① | 12" WIDE GREEN NON-METALLIC WARNING TAPE MARKED "SEWERLINE"
② | TRACER WIRE, #10 AWG, DIR. BUR. PER DETAIL W19 THIS SHEET
**TRENCH WIDTH TABLE**
| PIPE SIZE | MIN | MAX |
|---|---|---|
| 6" | 18" | 24" |
| 12" | 24" | 30" |
| 18" | 42" | 54" |
---
**CONSTRUCTION NOTES**
1. MINIMUM SLOPE OF PIPE SHALL BE 1/4" PER FOOT.
2. A MINIMUM OF 6" OF CITY APPROVED COMPACTED BEDDING MATERIAL UNDER SERVICE CONNECTIONS.
3. IF CLEANOUT DOES NOT EXIST, A CLEANOUT SHALL BE INSTALLED.
4. TRACING WIRE SHALL TIE INTO TRACING WIRE LOCATED ON THE MAIN.
---
**UNSTABLE SUBGRADE**
**DETAIL S07A**
**SEWER SERVICE CONNECTION**
**DETAIL S08**
---
**CONSTRUCTION NOTES**
1. LOCATING WIRE SHALL BE INSTALLED WITH ALL BURIED PIPE.
2. LOCATE WIRE DIRECTLY ON TOP OF THE PIPE AND TAPE TO PIPE. (FOUR PLACES EVERY FULL PIPE SECTION.) WESTERN UNION SPLICE WITH GEL PACK, SOLDER OR OTHER CITY APPROVED METHOD.
3. STRIP APPROXIMATELY 3 INCHES OF INSULATION AT THE TERMINATION OF THE WIRE IN THE CLEANOUT OR METER BOX.
4. THE CONTRACTOR SHALL TEST THE CONTINUITY OF THE FINISHED INSTALLATION.
5. LEAVE 2 FEET OF TRACING WIRE AT TERMINATING ENDS. THE FINISHED INSTALLATION.
---
**LOCATING WIRE INSTALLATION**
**DETAIL W19**
---
**REMOVE INSULATION AT SPLICE & REWRAP WITH SHRINK-PAC OR EQUAL SEE NOTE 2.**
**SPICE DETAIL**
---
**CONSTRUCTION NOTES**
1. LOCATING WIRE SHALL BE INSTALLED WITH ALL BURIED PIPE.
2. LOCATE WIRE DIRECTLY ON TOP OF THE PIPE AND TAPE TO PIPE. (FOUR PLACES EVERY FULL PIPE SECTION.) WESTERN UNION SPLICE WITH GEL PACK, SOLDER OR OTHER CITY APPROVED METHOD.
3. STRIP APPROXIMATELY 3 INCHES OF INSULATION AT THE TERMINATION OF THE WIRE IN THE CLEANOUT OR METER BOX.
4. THE CONTRACTOR SHALL TEST THE CONTINUITY OF THE FINISHED INSTALLATION.
5. LEAVE 2 FEET OF TRACING WIRE AT TERMINATING ENDS. THE FINISHED INSTALLATION.
|
<urn:uuid:a1a9c4dd-6d3c-4bb5-9ca5-202edeebc2aa>
|
CC-MAIN-2019-04
|
https://evogov.s3.amazonaws.com/media/17/media/79338.pdf
|
2019-01-16T07:43:07Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547583657097.39/warc/CC-MAIN-20190116073323-20190116095323-00372.warc.gz
| 510,286,486 | 16,257 |
eng_Latn
|
eng_Latn
| 0.713037 |
eng_Latn
| 0.987667 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"dan_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"dan_Latn",
"eng_Latn",
"slv_Latn",
"dan_Latn",
"eng_Latn"
] | true |
docling
|
[
2029,
5173,
6928,
8316,
8974,
11565,
14344,
18247,
20376,
20483,
23255,
26433,
29087,
29916,
32445,
34459,
36708,
37509,
37545,
39612,
41399,
43629,
45590,
48354,
50915,
51240,
51276,
57055,
59216,
60947,
62506,
62935,
63444,
64419,
67705
] |
THE IMPACT OF SEALASKA CORPORATION ON THE SOUTHEAST ALASKA ECONOMY 2009 UPDATE
Prepared for:
Sealaska Corporation One Sealaska Plaza, Suite 400 Juneau Alaska 99802
August 2009
Table of Contents
The purpose of this study is to measure the economic impact of Sealaska Corporation and its subsidiary operations on Southeast Alaska in 2008. This report presents region-wide data and impacts, as well as data for Kake, Hydaburg, and Prince of Wales Island overall.
Sealaska-Related Spending and Employment in Southeast
* Sealaska Corporation, Sealaska Timber Corporation, and Sealaska Heritage Institute spent $45 million in 2008 in support of corporate and timber-related operations in Southeast Alaska. This spending included payroll and the purchase of goods and services, including timber harvest-related contracts. Spending was spread throughout the Southeast region. Approximately 350 businesses and organizations in 16 Southeast communities received spending from Sealaska-related activities.
* Region-wide, Sealaska and its contractors directly employed approximately 363 full and part-time workers in 2008. These workers earned an estimated $15 million in payroll.
* Sealaska and its contractor employment combined make the corporation one of the largest for-profit private sector employers in Southeast Alaska.
* Including direct and indirect employment and payroll, Sealaska-related employment totaled nearly 490 workers and approximately $21 million in payroll in Southeast Alaska in 2008.
Other Sealaska-Related Benefits in Southeast
Sealaska Corporation has a mission broader than paying dividends to shareholders. In addition to generating dividends, Sealaska's mission includes cultural preservation, shareholder education, and shareholder hire. Sealaska Corporation provides the seed money for the Sealaska Heritage Institute, which sponsors and supports numerous Native culture programs across Southeast Alaska. Using money set aside by Sealaska Corporation, Sealaska Heritage Institute awarded $410,000 in scholarships in 2008.
Role of Sealaska in Southeast Communities
Sealaska logging activity and, in particular, ship-loading activity, represent important sources of cash to many village residents. A total of 135 Hydaburg and Kake residents earned some income from ship-loading in 2008. Though these jobs are part-time, they are an important source of cash income. This income and other Sealaska-related economic activity are increasingly important in light of the long-term decline in these community's economies and population.
Hydaburg
* In Hydaburg, approximately 68 local residents earned income from Sealaska-related ship-loading and logging activity. Sealaska-related personal income in Hydaburg was approximately $700,000 in 2008, about 12 percent of the community's total personal income of $6 million. Hydaburg continues to struggle economically and is Southeast Alaska's poorest community, in terms of per capita income.
Craig, Klawock, and Prince of Wales (POW) Island Economy
* Sealaska is the single largest source of employment on POW Island. Sealaska-related activity contributed approximately 210 jobs to the POW Island economy in 2008. This includes both full-time and part-time employment in Sealaska logging-related activity. (This count includes employment for residents of Hydaburg as well as other POW communities.)
* Sealaska accounted for approximately $6 million in personal income to residents of Prince of Wales Island in 2008.
* Sealaska contracts related to logging in the POW area totaled $25 million in 2008.
* In addition to logging contracts, Sealaska spent $600,000 in 2007 with 31 POW businesses and organizations in Craig, Hydaburg, and Klawock.
Though the Prince of Wales Island population grew slightly in 2008, the island's economy has been in decline in recent years. All of the larger communities on the island have seen population declines, including Craig (down 18 percent since 2000), Klawock (down 8 percent), and Thorne Bay (down 21 percent). In the absence of Sealaska timber harvests, the decline would have been much more severe. Future Sealaska timber harvests will be key in curbing further economic decline on Prince of Wales Island.
Kake
* In Kake, approximately 87 workers earned income from Sealaska-related forest industry activity in 2008. Most of this income is related to ship-loading, but also includes silviculture-related jobs.
* Kake's economy continues to struggle with economic decline. The community's population in 2008 totaled 519 residents, 24 percent below the 2003 population of 679 and 33 percent below Kake's peak population of 775 residents in 1998. The decline in Sealaska timber harvest-related activity is only one of several factors that have affected the local economy.
Summary of Economic Impacts of Sealaska Corporation on Southeast Alaska, 2008
*Note: Individual area totals do not include all indirect impacts of Sealaska activity. The numbers in this table are based on the best available data and should be considered estimates.
Sealaska Corporation is a Native-owned corporation founded in 1971 as one of the 13 regional Native corporations under the Alaska Native Claims Settlement Act (ANCSA). The corporation's mission is to manage corporate assets to provide economic, social, and cultural benefits to its shareholders. Sealaska is the largest private landholder in the Southeast Alaska, and represents more than 20,000 Tlingit, Haida, and Tsimshian shareholders, roughly 40 percent of whom live in Southeast Alaska.
Sealaska's economic activity in Southeast Alaska is generated by its headquarters, and its operations subsidiary Sealaska Timber Corporation (STC) and Sealaska Heritage Institute (SHI). Sealaska Corporation's cultural and educational mission is administered by Sealaska Heritage Institute, which sponsors and supports numerous Native language and culture programs across Southeast Alaska, including the biennial cultural event Celebration. Additionally, Sealaska Heritage Institute awards scholarships each year from funds set aside by Sealaska Corporation to Alaska Natives who are Sealaska shareholders or shareholder descendants.
The purpose of this study is to measure the economic impact of Sealaska Corporation and its subsidiary operations on the Southeast Alaska economy in 2008. Sealaska Timber Corporation, through a number of contracting companies, harvests and exports logs primarily from Prince of Wales Island areas. Communities specifically affected by logging and ship-loading activity include Hydaburg, Klawock, Craig, and the Prince of Wales economy in general. In the past, Kake also has benefitted from STC timber harvests, but currently, activity in these communities is limited to silviculture-related work. Kake residents also are employed loading logs on to ships for export. Juneau, as headquarters to Sealaska Corporation and Sealaska Heritage Institute, benefits from administrative and managerial jobs located in the city.
This analysis includes the employment and personal income effects of Sealaska operations in Southeast overall. Sealaska Corporation, Sealaska Timber Corporation, and Sealaska Heritage Institute provided detailed data on spending and employment in Southeast communities. Additionally, STC provided data on recent timber harvest activity in the region. Key Sealaska contractors were contacted to collect information about the residency of their employees working on Sealaska contracts. This, along with data from the Alaska Department of Labor and Workforce Development (ADOL), the US Bureau of Economic Analysis (BEA), and the US Census Bureau, provided the data used in this analysis.
Personal income is a strong indicator of economic impact in a community or region. Little data, however, exists on personal income in small communities in Alaska. The most current measure of per capita income for communities such as Craig, Klawock, Kake, and Hydaburg is the 2000 Census. More recent data is available from the BEA for larger geographic areas, such as boroughs or census areas; this data, however, does not accurately reflect many of the small communities within these areas.
Given the lack of particularly relevant and timely data, the study team relied on a mix of data to estimate personal income for these communities, including current employment data and wage rate data (ADOL, 2008); census area level income source data (US Census Bureau, 2000 Census and BEA, 2005); as well as other income data from the Commercial Fisheries Entry Commission (CFEC), based on the value of residents' commercial seafood harvest over the last several years.
Sealaska's Economic Impact in Southeast Alaska
This economic impact analysis focuses on the quantifiable impact of Sealaska Corporation business activity, primarily timber harvesting, on Southeast communities in 2008. Impact measures include spending on payroll and on goods and services in Southeast Alaska, as well as local jobs directly related to Sealaska's activities.
In this section, spending and employment data are provided for Sealaska Corporation headquarters and the Sealaska Heritage Institute, both in Juneau, and Sealaska Timber Corporation (STC), headquartered in Ketchikan and with employees in Hoonah and Craig.
Spending and employment data reveal important economic impacts, but do not provide a complete picture of the corporation's impact on the Southeast region or its communities. Each year Sealaska Heritage Institute awards a number of scholarships to shareholders and shareholder descendents. While the dollar value of scholarships awarded in 2008 is included in this analysis, the long-term economic benefits of these investments (such as recipients of educational funding returning to Southeast Alaska with degrees and vocational certificates) are beyond the scope of this report. Sealaska Corporation's shareholder intern program and shareholder hire policy likewise have provided educational and career opportunities that otherwise may not have been available to many Southeast residents. Shareholders also have benefited from corporate dividends. In 2008, Sealaska Corporation paid $7.9 million to shareholders in Southeast communities, an average of $432 per shareholder.
Sealaska-Related Spending in Southeast Alaska
Sealaska Corporation headquarters, the Sealaska Heritage Institute, and Sealaska Timber Corporation spent a combined $45 million in payroll and the purchase of goods and services in Southeast Alaska in 2008. Approximately 350 businesses and nonprofit organizations in 16 Southeast communities received Sealaskarelated spending in 2008. These businesses include logging and towing contractors, marine service centers, air carriers, and nonprofit organizations, among others.
Sealaska Corporation Headquarters Spending
In 2008, Sealaska Corporation headquarters spent approximately $9.1 million on the purchase of goods and services in Southeast communities, compared to $8.6 million spent in 2007. Sealaska Corporation spending was slightly decreased in Kake, from roughly $1.6 million in 2007 to $1.5 million in 2008, and slightly increased in Klawock, from $860,000 in 2007 to $1 million in 2008.
Sealaska Corporation Headquarters Spending in Southeast Alaska, by Community, 2000, 2002, 2003, 2007 and 2008 (in thousands of dollars)
Source: Spending data provided by Sealaska Corporation.
Sealaska Heritage Institute Spending
In 2008, the Sealaska Heritage Institute spent a total of approximately $900,000 on the purchase of goods and services. This includes spending on scholarships awarded to Sealaska shareholders and shareholder descendents. Data on spending by location was unavailable for 2007, but if the proportion spent in Southeast is assumed to be similar to that found in previous studies, approximately two-thirds ($980,000) was spent in Southeast communities in 2007. In 2008, nearly $410,000 of the spending went to scholarships awarded to Sealaska shareholders or shareholder descendents living around the country, including Southeast communities.
Sealaska Heritage Institute Spending, 2003, 2007 and 2008
Source: Spending data provided by Sealaska Heritage Institute.
*Note: The 2007 figure for Heritage Institute spending in Southeast Alaska is a McDowell Group estimate; actual regional spending data were not available from Heritage Institute or Sealaska Corporation at the time of this report.
Sealaska Timber Corporation Spending
Sealaska Timber Corporation spent approximately $28 million on the purchase of goods and services in support of Southeast logging activity in 2008, a 13 percent increase in spending since 2007. Most of STC's spending goes to logging, stevedoring, and towing contractors operating in the Prince of Wales Island area. The following table shows STC's direct spending by community in 2007 and 2008.
Sealaska Timber Corporation Spending in Southeast Alaska, by Community*, 2000, 2002, 2003, 2007 and 2008 (in thousands of dollars)
Source: Vendor data provided by STC.
*Note: Spending attributed to location of contractor or vendor headquarters.
**Note: Ketchikan spending includes STC contracts for logging and related activity located on POW Island.
Sealaska-Related Employment and Payroll
Sealaska Corporation employment and its contractor employment combined continue to make the corporation one of the largest for-profit private sector employers in Southeast Alaska. In terms of peak employment, Sealaska accounts for more jobs than Alaska Airlines or Greens Creek Mining Company, two of the region's other large for-profit private employers.
Sealaska Corporation headquarters employment in Juneau averaged 52 workers in 2008, with a total payroll of $4.6 million. Sealaska Heritage Institute employment in Juneau averaged 25 workers, with a total payroll of $950,000 for the year. STC directly employed an average of 16 workers in Southeast in 2008, including 11 in Ketchikan, four in Craig, and one in Hoonah. These jobs accounted for $1.3 million in total annual payroll.
Sealaska Corporation, Sealaska Timber Corporation, and Sealaska Heritage Institute, Payroll in Southeast Alaska, 2000, 2002, 2003, 2007 and 2008
(in thousands of dollars)
Source: Payroll data provided by Sealaska Corporation, Sealaska Heritage Institute, and STC.
*Sealaska Heritage Institute payroll data was unavailable for 2000.
**Does not include Sealaska Heritage Institute Payroll
Sealaska Timber Corporation timber harvest-related contracts and Sealaska silviculture contracts created an estimated peak of 261 jobs in Southeast Alaska in 2008, down from approximately 330 jobs in 2007. While payroll data is not available for these contractors, it is estimated that STC contractor jobs accounted for roughly $10 million in total payroll in 2008, two-thirds of total Sealaska-related payroll in Southeast Alaska that year.
Sealaska-Related Annual Average Employment in Southeast Alaska, 2002, 2003, 2007 and 2008
Source: Sealaska Corporation, Sealaska Heritage Institute, STC and STC vendor employment data supplied by STC.
Sealaska-Related Peak Employment in Southeast Alaska, 2002, 2003, 2007 and 2008
Source: Sealaska Corporation, Sealaska Heritage Institute, STC and STC vendor employment data supplied by STC.
Region-wide, Sealaska Corporation, Sealaska Heritage Institute, Sealaska Timber Corporation, and STC contractors employed approximately 363 full-time and part-time workers in 2008 in Southeast Alaska. Annual average employment was 258 workers. This represents a 14 percent decline in the total number of employees (peak employment) from 2007 to 2008 and a 15 percent decline in annual average employment during the same time period. Sealaska-related employment created an estimated $15 million in payroll to Southeast Alaska workers.
The following table provides Sealaska contractor-related employment for key communities and areas of Southeast. Hydaburg, Kake, and the Craig/Klawock areas are the most affected by Sealaska-related employment in the region. The total of 303 workers differs from the peak employment figure of 261 noted in the previous table due to how ship-loading employment is measured. At any one time in 2008, the most people employed loading logs onto ships was 79. A total of 135 Kake and Hydaburg residents, however, earned some income from ship loading in 2008. The following table reflects this larger number. Other Kake and Hydaburg residents were employed in other jobs related to Sealaska timber activity, pushing total Sealaska-related employment in those communities to 87 and 68 jobs, respectively.
Sealaska Timber Corporation Contractor Employment in Southeast Alaska, 2000, 2002, 2003, 2007 and 2008
Source: McDowell Group estimates based on data supplied by Sealaska and STC.
Sealaska's direct spending on payroll and the purchase of goods and services creates additional economic activity in the local economy, referred to as the multiplier effect. Including direct and indirect employment and payroll, Sealaska-related employment totals approximately 490 workers and $21 million in payroll in Southeast Alaska, based on McDowell Group estimates.
Sealaska's Impacts in Local Economies
Kake
In the past, Sealaska Timber Corporation timber harvests have played an important role in the Kake economy. Though STC has not harvested any timber in the Kake area since 2006, when 15 mmbf were cut, Sealaska has continued to have a positive economic impact on the community through ship-loading employment and employment associated with silviculture activities. Despite Sealaska's contribution, the community continues to struggle economically.
Population
Kake is a community of 519 residents (2008) located on the northwest coast of Kupreanof Island. The community's population has declined steadily since 2000, when it had 710 residents. Kake's economy is based on commercial fishing and seafood processing, local government, tourism, and remaining timber and silviculture activities.
Kake Population, 1980, 1990, and 2000-2008
800
Source: ADOL 2008 population estimates.
School Enrollment
School enrollment trends reflect the community's population decline. The most recent school enrollment numbers are 45 percent below the peak of seven years ago.
Source: ADEED district enrollment totals, 2000-2009.
Employment
ADOL data illustrates the importance of local government and tribal services in terms of employment in Kake. The top three employers are the City of Kake, the Kake City School District, and the Organized Village of Kake. This indicates a shift from the recent past (2003), when all three top employers were private-sector companies. Currently, Kake Tribal Corporation is the community's largest private-sector employer, and the fourth largest employer overall. Detailed employment data for individual employers is no longer available from ADOL, so 2007 data remains the best available information. The only notable change in the top ten list is the shutdown of LAB Flying Service. It also should be noted that Southeast Stevedoring, which employed 73 Kake residents on a temporary part-time basis in 2008, is not included in ADOL employment data for Kake because it does not have any operations in the Kake area.
Top Ten Employers in Kake, 2007
Non-Agricultural Employment
Source: ADOL, unpublished statewide employer data.
Consistent with population trends, employment in Kake has declined significantly in recent years. From an annual average employment of 311 jobs in 2003, the community's employment fell to 193 in 2007 and recovered very slightly to 196 jobs in 2008. Much of the decrease in employment since 2003 can be attributed to the cessation of Kake Tribal Logging and Timber operations in 2004 and Kake Foods in 2006. Together, these two companies averaged 108 jobs in 2003, according to ADOL.
Employment in Kake, 2003-2008 Non-Agricultural Employment
Source: ADOL, unpublished data.
Wage and salary employment in Kake generated $4.6 million in payroll in 2008, down from the 2007 payroll total of $4.8 million, according to ADOL data.
Commercial Fishing
Commercial fishing activity is an important source of income for Kake residents. While participation in commercial fisheries has declined significantly in recent decades, ex-vessel values have been reasonably stable since 2000, with estimated annual gross earnings ranging from $800,000 to $1.1 million. In 2008, 23 Kake resident permit holders fished 33 different permits, and earned $916,000 in gross (ex-vessel) revenue.
Commercial Fishing Activity in Kake, 2000-2008
Source: Commercial Fishing Entry Commission, permit and fishing activity by community, 2000-2008.
Personal Income
Based on data from the Bureau of Economic Analysis and the US Census Bureau, McDowell Group estimates that personal income in Kake totaled approximately $11 million in 2008.
In 2000, Sealaska directly or indirectly accounted for 30 percent of all personal income dollars flowing into Kake. In 2003, Sealaska accounted for about one-fifth of all personal income dollars, or approximately $2.5 million (including dividends). In 2008, Sealaska-related employment in the Kake area was limited to 87 mostly part-time jobs, including ship-loading and silviculture jobs. These workers earned approximately half a million dollars. Sealaska also contributed $207,000 in dividends to Kake residents in 2008. In total, Sealaska accounted for approximately $700,000 in personal income, or about 6 percent of the community total.
Commercial fishing accounted for an estimated $600,000 in annual personal income. This amount is less than the total ex-vessel value. Ex-vessel value is a measure of gross income to fishermen. Take-home pay (personal income) is ex-vessel value less expenses such as fuel, gear, insurance, etc.
Local government, including city offices and the Kake City School District, contributed $2 million in personal income to community residents in 2008, approximately 18 percent of all local personal income.
Local service organizations include Organized Village of Kake, Southeast Alaska Regional Health Consortium (SEARHC), the Rural Alaska Community Action Program, and other organizations providing services to local
residents. Together these organizations accounted for approximately $1.5 million in personal income, or 14 percent of total personal income in 2008.
In 2008, transfer payments accounted for approximately 30 percent of all personal income for Kake residents, or about $3.3 million. Again, transfer payments include all payments from governments to individuals, such as Alaska Permanent Fund dividends, Social Security payments, welfare payments, and other government transfers.
The "other" category of personal income includes all other sources, in particular income generated from other private sector commercial activity, such as construction, retail sales, and transportation services. It also includes state and federal government, which employ a small number of Kake residents. The total estimated personal income from this category was approximately $3 million in 2008.
Sources of Personal Income in Kake, 2008
Total Personal Income: $11 million
30%
Source: McDowell Group estimates.
Hydaburg
In 2008, STC harvested 30mmbf in the Hydaburg area, down slightly from 31 mmbf in 2007 and significantly from the 81 mmbf harvested in 2004. With regard to Sealaska timber harvests, the community of Hydaburg benefits primarily from the employment opportunities associated with loading logs onto ships for transport to overseas export markets.
Population
Since 1990, Hydaburg has maintained a fairly stable population, ranging between 340 and 385 residents, though the general trend is down. In 2008, the community had a population of 341, its lowest point since prior to 1990. Hydaburg's economy is based on commercial fishing activity, timber harvesting, and local government.
Source: ADOL 2008 population estimates.
School Enrollment
Hydaburg's school enrollment has fallen more significantly than has the local population. School enrollment is currently at about 69 students, 36 percent below the 2000 level.
Hydaburg School Enrollment, 2000-2009
Source: ADEED district enrollment totals 2000-2009.
Employment
As in other remote villages in Southeast, Hydaburg's local school district and tribal council provide a significant number of jobs within the community. Employment data for 2007 indicates the school district was the largest employer in Kake that year; preliminary 2008 data suggests, however, the Hydaburg Cooperative Association moved to the top spot last year.
Top Ten Employers in Hydaburg, 2007
Non-Agricultural Employment
Source: ADOL, unpublished statewide employer data.
In 2007, Southeast Stevedoring was the top private sector employer in the community, providing one-fifth of the annual average employment. Southeast Stevedoring reported having 60 Hydaburg residents on its payroll in 2007 and 62 in 2008.
Between 2005 and 2007, employment in Hydaburg remained fairly stable at between 70 and 80 annualaverage jobs. Employment increased to an average of 87 jobs in 2008, mostly the result of increased local government employment.
Employment in Hydaburg, 2003-2008 Non-Agricultural Employment
Source: ADOL, unpublished data.
Wage and salary employment in Hydaburg generated $2.9 million in payroll in 2008, up from the 2007 payroll total of $2.4 million, according to ADOL data.
Commercial Fishing
Earnings for Hydaburg residents from commercial fishing have been increasing in recent years and reached a high of $1.7 million in 2007. The 2008 total was slightly less, with 23 local fishermen earning just less than $1.5 million.
Commercial Fishing Activity in Hydaburg, 2000-2008
Source: Commercial Fishing Entry Commission, Permit and Fishing Activity by Community, 2000-2008.
Personal Income
Based on McDowell Group estimates, Hydaburg's personal income totaled approximately $6 million in 2008. The community has had among the lowest per capita income rates in the state. At the time of the census, per capita income in Hydaburg was $11,401, about half the Alaska average.
In 2000, Sealaska timber harvests accounted for one-quarter (27 percent) of all personal income in Hydaburg. Southeast Stevedoring was the largest Sealaska-related source of employment, contributing about $600,000 in personal income to the community that year. In 2008, Sealaska-related employment income to Hydaburg residents from Southeast Stevedoring totaled just less than $400,000. Including other sources of employment income (several Hydaburg residents work for STC logging contractors) and dividend payments (about $134,000 in 2008), Sealaska accounted for a total of approximately $700,000 in personal income for Hydaburg residents in 2008, or about 12 percent of the community total.
Commercial fishing accounted for an estimated $900,000 in annual personal income for the 23 Hydaburg resident permit holders who fished 40 different permits in 2008.
Local government, including the school district, accounted for an estimated $1.5 million in personal income in Hydaburg in 2008, 25 percent of the community total.
Local service organizations, including Southeast Alaska Regional Health Consortium (SEARHC), the Rural Alaska Community Action Program, and the Hydaburg Cooperative Association IRA, accounted for an additional $1 million in personal income.
Transfer payments also accounted for about one-quarter of all personal income for Hydaburg residents in 2008, or about $1.5 million. Again, transfer payments include all payments from governments to individuals, such as Permanent Fund dividends, Social Security payments, welfare payments, and other government transfers.
The "other" category of personal income includes all other sources, including Haida Corporation, other local businesses, and US Postal Service positions. The total estimated personal income from this category was roughly $400,000.
Sources of Personal Income in Hydaburg, 2008
Total Personal Income: $6 million
25%
Source: McDowell Group estimates.
Craig, Klawock, and Prince of Wales Island Economy
Though the population of Prince of Wales Island remains well below its peak, the island's population increased slightly in 2008, adding 112 residents, an increase of about 3 percent. Since 2000, the population of POW has declined 13 percent, primarily due to reduced timber harvests. The island's population was 4,581 in 2000, 593 residents more than in 2008. All of the recent growth has been in the Craig/Klawock area. Other communities on the island continue to experience population decline.
POW Island Population, by Community, 2000, 2006-2008
Source: ADOL 2008 population estimates.
The POW Island economy is a mix of timber industry, commercial fishing, government, and tourism related employment. Local government continues to be a mainstay of the POW economy; the City of Craig and the Craig City School District were among the top three employers in 2007 and 2008. Other key employers include Alaska Commercial Company, the US Forest Service, Viking Lumber, and Southeast Alaska Regional Health Consortium (SEARHC).
Top Ten Employers on Prince of Wales Island, 2007 Non-Agricultural Employment
Source: ADOL, unpublished statewide employer data.
Total employment on POW Island in 2008 averaged 1,280 jobs, 36 jobs fewer than in 2007. Total payroll for 2008 was $40.5 million, just above the 2007 total of $40.1 million. Sealaska-related employment on POW Island totaled approximately 210 full and part-time jobs and $8 million in payroll.
Sealaska accounted for approximately $6 million in personal income to residents of Prince of Wales Island in 2008. (Some Sealaska-related payroll on POW is earned by workers who are not residents of the island).
|
<urn:uuid:cca8eac9-cc49-446d-9fd1-6495a2b8495f>
|
CC-MAIN-2018-26
|
http://sealaskatimber.com/sites/default/files/resources/2009-McDowell-Report_0.pdf
|
2018-06-23T17:36:56Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267865145.53/warc/CC-MAIN-20180623171526-20180623191526-00451.warc.gz
| 290,640,439 | 6,267 |
eng_Latn
|
eng_Latn
| 0.950334 |
eng_Latn
| 0.99363 |
[
"ekk_Latn",
"unknown",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
178,
197,
2558,
4785,
5052,
8650,
11206,
12432,
14052,
15818,
17171,
18097,
19258,
20101,
22243,
23239,
23971,
24635,
25469,
27442,
28118,
29331,
29838
] |
Optimising caregiving competences and skills of professional, volunteer and informal caregivers
European research report 2
Anja Machielse
Wander van der Vaart
Hanne Laceulle
Johanneke Klaassens
December 2022
# Content
1. Introduction .......................................................................................................................... 1
2. Transitions in the care systems in European countries .................................................... 2
3. Innovative trends in healthcare ........................................................................................... 4
4. Professionals, volunteers, and informal caregivers .......................................................... 11
5. Competences to ‘see’ older adults ..................................................................................... 14
6. Competences of caregivers according to SeeMe participants ........................................... 22
7. Conclusions ......................................................................................................................... 33
Appendixes and references ...................................................................................................... 37
1. Introduction
The population in Europe is ageing, and the number of older citizens is growing. Consequently, projections predict an increase in care needs. The literature points towards two main challenges. First, older adults with care needs are susceptible to social exclusion.
Second, there are growing challenges in professional care services (i.e., overburdened workforce, and budget cuts). Currently, professional care focuses on the medical and physical aspects of care from a deficit approach (looking at what older adults cannot do anymore). However, many caregivers claim that an innovative paradigm shift is needed towards a positive approach (looking at the potentials of older people) and towards caring for social and meaning needs (Machielse et al., 2022). However, they often lack the competences for this as this is not part of their professional training. Nor does a lifelong learning course on these topics exist.
The SeeMe project aims to improve the quality of care for older adults by contributing to the knowledge of the needs of older adults and by increasing the skills and competences of different groups of caregivers to respond to that needs. The emphasis here is on caregivers' competences to 'see' care as something more than physical and medical care, to 'see' the older person behind the patient, 'see' social and meaning needs, and 'see' the positive talents and dreams of older adults, not only their needs. In this way, the SeeMe project contributes to the social inclusion of older adults.
This report focuses on caregivers' competences and skills to 'see' older adults. It is based on an extensive literature review complemented by qualitative interviews with caregivers. The report starts with a summary of recent developments regarding the care systems in European countries (Chapter 2). Then, we describe some innovative trends in healthcare to meet the needs of older adults and the consequences of caregiving in general (Chapter 3). Next, we describe the different types of caregivers involved in the care of older people (Chapter 4). Subsequently, we address the competences and skills of professional caregivers, volunteers, and informal caregivers, respectively (Chapter 5). After that, we present the perspectives of the SeeMe informants (Chapter 6). We conclude with some points of attention for caregivers and a summary of required competences and skills for caregivers (Chapter 7).
2. Transitions in the care systems in European countries
In many European countries, there have been significant transitions in care in recent decades, leading to shifts in the care division and the care roles of professionals and informal caregivers.\(^1\) Critical points in the transitions are:
In most countries, the criteria for admission to institutional care have been tightened, and institutional care is now only for persons who cannot independently compensate for or cope with physical, cognitive, or mental impairments or health-related burdens or demands. Different care degrees are distinguished and determined by an independent medical service.
- In institutional care, the emphasis is mainly on medical care, based on the biomedical model, which views the person as the recipient of health care, focusing on health variables. In recent years, more attention has been paid to aspects of person-centred care.
- The quality of nursing care is controlled by audits from the (central or federal) government. Based on national and international scientific findings, expert standards are binding for all nursing homes and nursing services and follow a uniform, internationally coordinated procedure. They apply to both inpatient and outpatient care. However, every nurse is also obliged to check the appropriateness of every nursing intervention for the person in need of care.
- Due to the shift from institutional care to home care, more and more older people continue to live independently in their private homes for as long as possible, even when they experience health problems. In addition to the benefits of long-term care insurance, various concepts and models have been developed to ensure that ageing people - even with health restrictions - can live in their familiar living environment. This led to the developing of a wide range of home assistance, welfare, personal care services, and short-term or temporary care facilities. In addition, more emphasis is placed on the older adults' competences and their social environment, whereas professional care is seen as supportive and complementary.
\(^1\) WHO, Health Systems in Transition (HiT) Series.
• Increasingly, care policies in different European countries emphasise the importance of informal caregivers. This is part of a tendency to stimulate ‘ageing in place’. Informal caregivers provide a vast amount of care, thereby forming an indispensable lynchpin in community care. There are high expectations of informal care (family), volunteering and other forms of informal care. Several measures have been taken to support families in their caring process to realise these expectations.
• In all countries, age-appropriate neighbourhoods have been developed to ensure at the municipal level that the necessary infrastructure for a good life in old age is secured and that the development of social networks is initiated and supported.
• Besides, alternative forms of housing are being developed in which a combination of professional and informal care is possible (e.g., communal living, multigenerational living, assisted living, care living, service living, outpatient assisted living-care communities, etcetera).
3. Innovative trends in healthcare
European policies regarding ageing and care for older people strongly emphasise the importance of empowerment, self-management, participation and inclusion of vulnerable older people. Part of the reason for this is budgetary; the rising healthcare costs in light of a rapidly ageing population are a point of grave concern for politicians and policymakers. Another reason is ideological: the awareness grows that by picturing older people, particularly in the ‘fourth’ age, solely in terms of decline and denying their agency and individuality, their potential contribution and value to society is overlooked, with detrimental consequences for individuals, communities, and society at large (Cohen, 2000; Kruse et al., 2012). The negative and stereotypical cultural image of ageing and later life, perceived predominantly in terms of decline and deterioration, also highly affects societal views and expectations concerning institutionalised care. Many older people want to prevent moving to a residential care facility because of the stereotypical negative images that abound about these institutions (Kardol, s.a.).
Therefore, a new paradigm is needed in which the older person is central. A paradigm that looks beyond a purely task-oriented perspective on caregiving starts from a broader definition of health (e.g., Huber et al., 2013). In this view, caregiving is a comprehensive encompassing practice in which care for physical and material needs is intertwined with concern for psychological wellbeing, potentials and talents of older adults, social connectedness and meaning needs. This requires that the organisation and practice of care develop an awareness of older people’s potential, skills, and dreams, rather than just focusing on the limitations resulting from age-related decline. In this chapter, we discuss some theories about caregiving and the improvement of healthcare: person-centred care, ethics of care, capabilities approach, empowerment and self-management, and competence care.
3.1 Person-centred care
One of the most relevant trends in healthcare improvements, based on a broader perspective on health and a holistic view of the person receiving care, is the movement towards person-centred care (Morgan & Yoder, 2011). According to an expert panel of the American Geriatric Society, person-centred care is defined as follows:
“Person-centered care means that individuals’ values and preferences are elicited and, once expressed, guide all aspects of their health care, supporting their realistic health and life goals. Person-centred care is achieved through a dynamic relationship among individuals, others who are important to them, and all relevant providers. This collaboration informs decision-making to the extent that the individual desires” (American Geriatrics Society Expert Panel, 2015: 16).
This person-centred care movement pleads for a holistic approach to caregiving that acknowledges people as bio-psycho-social-spiritual beings with personal lives and needs, the caregivers should adequately respond to (Papathanasiou, Sklavou & Kourkouta, 2013). Its primary concern is ethical: people should be treated as persons, not patients (Entwistle & Watt, 2013).
This personalised approach implies that people who need care are not treated along the lines of generalising protocols but that individual care plans are made with attention to the care receivers’ biography, personality, preferences, needs and dreams. It aims to meet the care needs derived from people’s dependencies, safeguard their rights, preferences, and desires, and treat them as dignified human beings whose autonomy deserves to be respected (Martínez Rodriguez, 2011). The Basic Psychological Needs Theory (Ryan & Deci, 2017) states that for people to experience wellbeing, their needs for autonomy, relatedness and competence should be fulfilled in a well-balanced manner. This requires that caregivers give people meaningful choices in everyday life, safeguarding meaningful relationships with family, friends, and caregivers, and stimulating the use of competences even in physical or mental decline (From et al., 2013).
The person-centred approach is increasingly applied in care for older people, mostly with positive results for their quality of life and wellbeing. For example, a Spanish study using a person-centred care model in long-term care facilities for older people, including cognitively impaired people, showed a significant improvement in quality of life (Diaz-Veiga et al., 2014). A German study showed a similar effect for older people with dementia living at home when a person-centred approach was tested in an intervention trial setting (Thyrian et al., 2012). Studies in the Netherlands and Spain show that a narrative approach can be very helpful to understand the personal experience of care receivers in the context of their biography, which is provisional for realising person-centred care (Leyden Academy, 2019; Villar & Serrat, 2017).
### 3.2 Ethics of care
A promising philosophical framework that founds many holistic approaches to (elderly) care is provided by the ethics of care (Held, 2005; Tronto, 1993). As conceptualised by Fischer and Tronto (1990), care is seen as a fundamental way of being in the world for all human beings, not just an activity we engage in when we attend to the needs of children, people living with disabilities or older people. Rooted in feminist philosophy and critical political thinking, care ethicists depart from moral anthropology, emphasising human beings’ fundamental vulnerability, interdependency, and embodied nature. This creates the understanding that caring is a reciprocal relationship rather than a one-way street. The care-ethical definition of care reads as follows:
"[Care is] a species activity that includes everything that we do to maintain, continue and repair our "world" so that we can live in it as well as possible. That world includes our bodies, our selves, and our environment, all of which we seek to interweave in a complex, life-sustaining web" (Fisher & Tronto, 1990: 40).
Tronto (1993) distinguishes between four elements of good care, which can be considered vital for how caregivers respond and attune to older people's potential and their social and meaning needs (Hupkens et al., 2020). These four elements are summarised as follows:
- **Attentiveness**: recognising the needs of the other, which requires suspending one's own opinions and goals and empathising with the perspective of the other.
- **Responsibility**: feeling responsible for meeting the recognised needs and asking oneself what can be done to fulfil them.
- **Competence**: performing the required acts of care is crucial for care to be qualified as 'good'.
- **Responsiveness**: for care to be perceived as good, it needs to be experienced and received by the care recipient. This requires that caregivers can take the perspective of the other and be aware of their expressions of (dis)satisfaction with care (Tronto, 1993).
Care ethics is a practice-oriented approach in which a shared concern for realising the good life is central. An interesting example of a care-ethics-inspired model from dementia studies is maieutic caregiving, developed by Van der Kooij (2018). This model requires a constant Socratic assessment of the needs of care-receivers and draws on the human intuitions and tacit knowledge of nurses and other caregivers. A critical condition for providing this type of integrated emotion-oriented care is that caregivers develop their empathic abilities. Through empathy, caregivers can imagine themselves in the people they care for, enabling them to understand what is at stake in the patients' situation and what holds meaning for them (Van Dijke et al., 2019). The underlying assumption of maieutic caregiving is that all human beings share a predicament of vulnerability and interdependence, just like in care ethics.
### 3.3 Capabilities approach
An important point of attention is how good care can take the diversity and heterogeneity of the older population into account so that individual people's needs are adequately recognised, even if they belong to a minority or underrepresented group in society. This is all the more important given the insight that social constructions heavily shape how we look at different groups of older people, with sometimes detrimental consequences for their health and wellbeing (Calasanti & King, 2015). Several authors have argued that the capabilities approach developed by Sen (1985) and
further elaborated by Nussbaum (Nussbaum & Sen, 1993) can provide relevant perspectives to acknowledge differences among the older population while at the same time safeguarding their dignity and fundamental needs (Anand, 2005; Gopinath, 2018; Pirhonen, 2015). The capabilities approach is developed as a normative evaluative framework for assessing individual wellbeing with social arrangements and policies that aim to safeguard the dignified and just treatment of every human being (Gopinath, 2018). It enables us to assess differences in wellbeing and quality of life despite inequalities and social disadvantages. It also opens up a space for valuing people’s conceptions of what is meaningful to them, rather than subjecting them to a priori assumptions based on generalising stereotypes of older people as a group.
‘Capabilities’ are defined as genuine opportunities people have to achieve various valued ‘functionings’ (Sen, 1993). Functionings are understood as things that people value to do or be, for instance, to be nourished, to be safe, to be socially valued, to work, to exercise, et cetera. The basic idea of the capabilities approach is that people can have a good life if they have access to the capabilities they need to perform valued functionings. Subsequently, Nussbaum distinguished ten domains she considers essential to a good life that should be accessible for all people: a normal life span, bodily health, bodily integrity, senses, imagination and thought, emotions, practical reason, affiliation, other species, play and control over one’s environment (Nussbaum, 2001).
Nussbaum’s domains of capabilities can be translated to the social practice of care; for example, people should be well-nourished and inhabit a safe space, their bodies should be treated with dignity and respect, they should have access to meaningful activities that stimulate their senses, imagination and thought and bring joy to their lives, be enabled to maintain in contact with people and things they are emotionally attached to, be given a choice in the daily matters of their lives, form and maintain meaningful relationships with others, et cetera (Bleck et al., 2020; Ghiglieri, 2020; Pirhonen, 2015).
Entwistle and Watt (2013) list several concerns to be considered in training caregivers to treat their patients as persons according to the capabilities approach-inspired version of person-centred care. First, care receivers must be included in the “community of ethically significant persons” (34) by treating them with compassion and respect. Second, caregivers should be responsive to the subjective experiences of care receivers, which includes becoming acquainted with their unique biographies, identities and life projects. Third, they should learn to facilitate a relational type of autonomy, that is, supporting people to develop and use their autonomy capabilities so that people’s preferences are taken seriously but in a context-sensitive manner.
In applying the capabilities approach to care for older people, further development of person-centred care can be realised. The aim of person-centred care to treat patients as persons takes shape by recognising and cultivating the capabilities fundamental to being a person and securing that people are given real opportunities to realise the functionings that are valuable to them (Entwistle & Watt, 2013). In the context of care for older people, it is particularly important not to
mix up having a capability with having the actual ability to function. The ability to function refers to realising one's ability, whereas capability is a multidimensional construct that combines desires, abilities, means, and access. For instance, a care home resident's capability to go outside is actualised when the resident wishes to go out, can do so, has a place to go, and may freely enter that place (Pirhonen, 2015).
3.4 Empowerment discourse
Transitions in healthcare policies and care systems also promote self-management and empowerment of older people. This tendency matches the discourse of 'active' ageing, deinstitutionalisation of care, community care, and ageing prevalent in health care policies throughout Europe (Janssen, 2013; Steverink et al., 2005). Empowerment relates to a broad paradigm concerning social inclusion and good care, which is multifaceted and encompasses other paradigms, such as relational care, demand-orientation, participation and diversity (Van Regenmortel, 2009).
The empowerment discourse has an explicit emancipation goal. The underlying value feeding into empowerment discourses is enhancing social justice (Boumans, 2012; Van Regenmortel, 2002). The assumption is that empowering people will result in social inclusion and full citizenship, particularly for marginalised groups. With this in mind, a wide variety of empowerment interventions have been developed for different vulnerable groups (Boumans, 2012; Maertens & Desmet, 2013). Empowerment is thereby defined as follows:
"Empowerment is a strengthening process whereby individuals, organisations and communities gain mastery over their situation and their environment through the process of gaining control, sharpening the critical awareness and stimulating participation" (Van Regenmortel, 2002: 76).
Actively managing one's ageing process is conducive to successful ageing and experiencing the quality of later life. This self-management can also improve the health status of older adults and reduce their use of healthcare (i.e., tertiary prevention) (Jonker et al., 2009; Elzen, 2006; Kempen, 2006). To achieve this, older people need to be supported to develop their self-management competences, which draw on external and internal resources. Important self-management abilities are self-efficacy beliefs, a positive frame of mind, taking the initiative, investment behaviour, multifunctionality of resources, and various resources (Soderbacka et al., 2016; Steverink, Lindenberg & Slaets, 2005). This individual strengthening process is always related to people's connections and relations with others and from the broader communal, organisational and societal setting in which people live their lives. The empowerment discourse is empathically characterised by a multidimensional approach that looks at micro, meso and macrolevel factors and their mutual interactions (Boumans, 2012; Janssen, 2013).
Empowerment is not always aiming for maximal independence; rather, it enables care recipients to fully discover their authenticity and identity (Van Hove, 2001). This is important in the context of vulnerable older people, for whom independence is not always a viable or even desirable goal. Empowerment focuses on enhancing the strengths of individuals and becoming aware of their potential without neglecting the fact that they are vulnerable.
Caregivers can facilitate, support or enable the process of self-management and empowerment of vulnerable older adults. They can help them maintain a sense of mastery by acknowledging the paradoxes inherent to human life, such as the desire to remain autonomous versus the inevitable existential vulnerability. An accepting attitude towards the limitations caused by a vulnerability in later life proved beneficial for people's life quality and resilience against adversities (Janssen, 2013). A focus towards empowerment, which implies that older people are stimulated to use their self-management skills and activate their social networks when necessary, requires other competences from caregivers. Essential competences are, for example, listening carefully to the stories of care receivers, being creative and taking initiatives to meet personal needs, using outreaching approaches and being reflective regarding one's attitudes, skills, knowledge and assumptions (Kluft, 2012).
A specific approach drawing from the literature about self-management and empowerment of older people is competence care (Kardol, s.a.). Competence care refers to "the care of older people to reside and participate in their community in a meaningful and dignified way, until the end of their lives" (ibid: 12). It is based on the notion of competences, which includes being an actively functioning agent and encompasses accepting limitations and receiving help and support where needed. It appeals to the resilience of older persons, and their ability to take care of themselves and make decisions (if desired through a proxy) about their lifestyle and care provision. Competence care aims for the following outcomes (ibid: 13):
- Older people have control over their lives and are resilient.
- They accept diminished self-management and experiences of loss.
- They experience reciprocity and selflessness in relationships.
- They experience opportunities to develop talents, share an interest or participate in activities with others.
- They experience the joy of life and look forward to the next day and certain events.
- They have support in dealing with unfinished business and finding closure/completing their lives.
- They experience that significant others continue to play a role in their lives.
3.5 Implications for caregivers
These caregiving theories aim to improve the healing of the individual as a bio-psycho-social unity. It considers the patient's biological, social, and spiritual needs (Papathanasiou, Skavlou & Kourkouta, 2013). This holistic view of caregiving presupposes that the care recipient is seen as a person, not just a patient. In this view, adequate care requires a differentiated approach that is adequate for older people's heterogeneous needs and capacities (Remmers, 2020).\(^2\) It seeks to unite the perspectives of older people, the family and professional caregivers in promoting person-centred care (Nolan, Davies & Grant, 2001).
This holistic, person-centred approach requires significant changes in the role of health care professionals and the skills and competences of caregivers. It is challenging to meet older patients' basic or fundamental needs to ensure more integrated, holistic patient care practices (Kitson, Athlin & Conroy, 2014).
\(^2\) The Australian "See me, Know me" program and the "Live well, Feel better" program from the Spanish Fundación La Caixa and Matia Institute constitute good examples of interventions where person-centred care for older people is realised.
4. Professionals, volunteers, and informal caregivers
4.1 Formal and informal care
The shift to holistic, person-centred care has implications for the skills and competences of formal and informal caregivers. In the next chapters, we describe the necessary skills and competences that caregivers must have to see the potential and talents of older adults and meet their social and meaning needs. We will focus on three types of caregivers that are important in the current care systems in European countries: professional (formal) caregivers, volunteers, and informal caregivers. These caregivers each have their position and role in caregiving to older adults. Whereas formal help refers to professionals who are paid for their services and are dependent on them for their livelihood, informal care is given by citizens who, in return, receive no financial reward to support themselves. The term ‘informal’ indicates that the assistance provided involves little or no formalised (and sometimes legally covered) accountability procedures in the form of protocols and registrations to legitimise the assistance, whereas formal assistance does. Informal assistance is often an extension of formal assistance; it either precedes it or complements it. As the competences needed to see the client as a person are the same for all caregivers, we will not distinguish when describing the competences. If relevant, we will make additions relating to volunteers and informal caregivers.
4.2 Professional caregivers
Professionals are formal caregivers, practising a profession and being paid for their services. They provide care for which an indicated legitimisation is necessary (the threshold for granting professional care) and have to deal with accountability procedures in the form of protocols and registrations to legitimise their help. Diplomas are required for various professional positions to prove competences and expertise (as quality requirements), including specialist knowledge for specific problems. Professional caregivers are formally responsible for the quality of the assistance provided (Van Daal et al., 2005: 44-48).
Although patients have expectations about the professionals' knowledge and ability to provide good quality technical care, their assessment of the quality of caregiving is significantly improved if nurses also exhibit interpersonal, 'human' attributes such as kindness, trust, and empathy (Calman, 2006). Besides technical competence, patients value it if they can make a real connection with professionals. They perceive a spiritual or 'life-giving' bond as highly empowering. They
expect professional caregivers to create a synergy between knowledge and experience realised in good caring practices (Haugan, 2014). At the same time, they expect a healthy distance between the caregiver and care recipient, based on respect and compassion (Halldorsdottir, 2008, 2012). In this report, we will not address the technical competences of professional caregivers but focus on the competences needed to see the person as a person, with her/his potential and needs.
4.3 Volunteers
Volunteers are not a homogeneous group; the types of care activities vary widely, as do their qualities and competences and the time they invest. Moreover, there are more different groups of volunteers. Examples are volunteers who use their professional expertise (in addition to a job or after retirement), young people with social apprenticeships and experience placements, specialised volunteers, citizens who make a compulsory (i.e. involuntary) unpaid contribution, and companies that undertake a social enterprise and make working hours and employees available for voluntary work (Runia & Machielse, 2012). And then there are the voluntary neighbours who run errands for a vulnerable fellow neighbourhood resident or keep an eye on things (Grootegoed et al., 2018; Van Oostwaard, Machielse & Dangermond, 2014).
The diversity in how volunteering is being interpreted and carried out today and how citizens can be called upon to start volunteering make a fixed definition impossible. For this reason, we use a broad definition. In this report, the term ‘volunteers’ refers to all forms of voluntary efforts that make a valuable contribution to the care of older people, whether organised or unorganised, compulsory or non-compulsory, ‘paid’ or unpaid. Volunteers can be very experienced and skilled. Many highly trained volunteers put their professional experience and skills to use voluntarily. An increasing number of volunteers also attend courses and training programmes to acquire specialised knowledge and skills.
Volunteers and professionals increasingly come across each other in collaborations and within different domains and work areas (Van Daal & Winsemius, 2005). The volunteer is sometimes additional to, sometimes preceding and sometimes extending the professional, and sometimes co-partner of the professional (Boss et al., 2011; Grootegoed et al., 2018; Oudenampsen et al., 2006; Runia & Machielse, 2012).
4.4 Informal caregivers
Informal caregiving is the primary source of care for older people in Europe (Barbabella et al., 2016). Informal caregivers (or ‘family caregivers”) have a pre-existing social relationship with the person they care for. The care recipient may be a person with whom a kinship relationship exists
or a spouse, friend, neighbour, or neighbourhood member. Policymakers tend to embrace a partnership model. Professionals and family/informal caregivers are seen as equal partners to provide well-tailored care to all those in need of it (Nolan, 2001).
A primary objective of care policy is to support informal and family caregivers to enable them to continue their invaluable tasks for as long as possible. There are several reasons for this. First, informal caregivers are often aged: for example, spouses of a person with dementia. Second, they may be overburdened with other activities. Adult children, usually daughters, often have to manage their own families and careers aside from caring for their older relatives. In addition, there is a strong emphasis on the empowerment of informal caregivers, stimulating them to use and develop their strengths and maintain an independent position alongside professionals (Nolan, 2001).
5. Competences to 'see' older adults
To 'see' the older person behind the patient, caregivers must understand care as something more than physical and medical care. The literature clarifies that some critical competences are required to 'see' older adults' positive talents and dreams, not only their needs. This chapter describes nine necessary competences caregivers should have to 'see' the person.
5.1 Relational competences
In person-centred care, the caregiver and the care-recipient relationship is crucial. That is why caregivers should, in the first place, have relational competences. They must be able to reach out to someone, make connections, and bring reciprocity to the relationship. The willingness to engage in a long, kind and reciprocal relationship is hugely important for the experience of good, meaning-sensitive care. It makes patients feel safe and valued (Hupkens et al., 2020). Enhancing the relational competence and the quality of relationships between caregiver and care recipient can significantly affect the overall quality of care outcomes (Church, 2016; McGilton et al., 2003). Relational competences are needed for care that considers what matters to the person and ensures that they can continue to live in a way consistent with their identity (Martinez, 2019).
A good relationship between caregiver and care recipient requires that caregivers develop a positive attitude, respect for autonomy and equal partnership. Involvement, reciprocity, attunement, equality and shared humanity are underlying principles of relational care (Van Regenmortel, 2009). Nurse-patient relationships that have the qualities mentioned can also serve as sources of meaning and purpose (Haugan, 2014). High-quality nurse-patient interaction improves older adults' psychological and physical health, wellbeing, and psycho-spiritual functioning (Haugan et al., 2016).
Several studies argue that good nurse-patient interaction is fundamental in enhancing the experience of meaning in life for nursing home recipients (Haugan, 2014; Haugan, 2013a; 2013b; Hupkens et al., 2019, 2020; Halldorsdottir, 2008). The relational competences of professional caregivers seem crucial to meet their patients' meaning needs because older people turn out to be reluctant to express their existential questions and needs towards nursing staff. They do not always expect them to be willing or able to respond to these needs (Hupkens et al., 2020). Research suggests that simply 'being there' and 'listening' are vital in responding to care recipients who struggle with existential questions (Van der Vaart et al., 2013).
5.1.1 Communicative competences
The ability to enter into a real relationship with the person seeking help requires communicative competences that imply observing the client’s situation and understanding its meaning from the client’s perspective. These include listening well; being observant; having an eye for details, connections and contexts; seeing and understanding the value of the contact for the other, et cetera. Caregivers should be able to change perspectives, look at the situation from the client’s point of view, and notice, interpret, and respond adequately to their clients.
Caring for and caring about people with dementia requires specific communication skills (Eggenberger et al., 2013; Leocadie et al., 2020). In the context of dementia, the needs of the family (who have often served as informal caregivers until the care recipient is moved to an institution) must also be taken into account. Attention to the family’s suffering is also essential for good care for older people (Van de Ven, 2018). Caregivers have to pay attention to the social network of the client and include them in the decisions and practice of daily care (Traynor, Inoue & Crookes, 2011). Dealing with family members may be stressful, especially when conflicts arise. Therefore, communicative competences are crucial for communication with the patient and consulting and negotiating with the care recipients’ social environment (Nathalie et al., 2016).
5.1.2 Empathic competences
Empathy is crucial to understand the patient’s feelings, perspectives, and meanings and acting upon that understanding helpfully. It can affect the quality of care and even health outcomes (Gholamzadeh et al., 2018; Mercer & Reynolds, 2002). Since empathy is a complex, multidimensional concept, the definition is not unambiguous. Still, it is rather common to distinguish between affective empathy and cognitive empathy, whereby affective empathy describes the ability to perceive and relate to another person’s situation from an emotional point of view. Cognitive empathy refers to the ability to mentally reconstruct the experiential world of the other (Van Dijke et al., 2018). Both types of empathy, it is believed, help to sensitise caregivers to the needs of others and enable moral deliberation.
It should be noted, however, that empathy is not just an individual ability of the caregiver but a relational quality that also depends on the qualities and efforts of the care receiver, the quality of the relationship between caregiver and care recipient, and the organisational setting in which the caregiving takes place. Both caregiver and care recipient are engaged in a constant process of mutual attunement, shaping each other’s feelings and understandings (Van Dijke et al., 2019). Given this relational conceptualisation of empathy, empathy is beneficial for the care recipient and plays a vital role for the care providers themselves. It enhances their sense of meaning and protects against work-related emotional distress and burnout (Ekman & Halpern, 2015).
Despite its obvious merits, the concept of empathy can also give rise to some problems and dangers, which caregivers should be well aware of. It may result in the form of projection that fails to respect the otherness of the other (Van Dijke et al., 2018). First, empathy can be biased in different ways. For example, most people find it much easier to feel empathy for people who resemble themselves. This may have detrimental consequences for meeting the care needs of people very different from ourselves because empathy with their situation is less self-evident or lacking. Second, caregivers are at risk of 'over empathising' when situations of care-receivers are particularly distressing. This can lead to undesirable consequences such as so-called 'empathy fatigue' or caregiver burnout. Third, empathy can be distorted by stereotypes and prejudice against certain groups.
5.1.3 Hermeneutic competences
To acquire a holistic image of who the patient is and how the provided care can accommodate the patient's flourishing requires looking beyond the purely medical and physical elements of health and learning to interpret the emotions and experiences of the care recipient (see, e.g. the maieutic model, Van der Kooij, 2018). For example, it requires recognising the meaning needs of the spiritual needs of older clients. Hermeneutic attunement is necessary to check whether the needs and wishes of care-receivers are adequately interpreted and addressed. This is something that requires training and practice, whereby caregivers learn to formulate and reflect on their intuitions and engage in dialogue about the proper interpretation of care receivers' needs and the sensitive attunement to them. Forms of hermeneutic dialogue and moral deliberation can also help improve the active participation of (groups of) care recipients in the organisation of care in institutions, where conflicts between the life-world perspective of older people and the systemic perspective often internalised by professionals can be expressed, and mutual frustrations and misunderstandings can be shared (Baur, 2013).
Hermeneutic competences are also essential for recognising and assisting older people when they have difficulties fulfilling spiritual tasks (MacKinlay, 2006; MacKinlay & Trevit, 2010; Narayanasamy, 1993).\(^3\) They can, for example, facilitate relationships with other people; facilitate reconciliation with family members or friends, and reconciliation with God, if needed; help people express and deal with feelings of guilt, regret, anger or grief; accept and adapt to age-related frailty and physical and mental decline; acquire self-acceptance and ego-integrity; facilitate reminiscence and life-review; pray with residents and/or encourage their participation in religious practices such as
\(^3\) MacKinlay divides the spiritual tasks relevant to later life in different categories: to find a sense of ultimate meaning; to move from self-centeredness to self-transcendence; to develop an adequate spiritual response to ultimate meaning; to acquire intimacy with God and/or others; to make meaning by transforming provisional life meanings to final meanings; to maintain hopeful.
church visit; develop and maintain a loving, caring and respectful relationship with the patient; affirming people in their search for hope; assist them in the process of dying, et cetera.
Finally, hermeneutic competences are crucial in interpreting the behavioural symptoms of people with severe dementia. For example, to consider the possibility of that person experiencing involuntary care. Increased awareness and understanding of the meaning and consequences of behavioural expressions are indispensable for improving dementia care by avoiding restraints and involuntary care to their maximum (De Boer et al., 2019; Vellone, Sansoni & Cohen, 2002).
In person-centred care, caregivers have an important role in identifying the potential and social and meaning needs in older people. By accommodating these needs, they contribute to better health, wellbeing, and quality of life in their patients (Hupkens et al., 2018). Therefore, they should be trained to become aware of the following fields of attention: personal values and meaning orientations of their patients, cultural and socio-economic context; individual coping styles related to adverse events, virtues or character strengths of patients, the life story of the patient and how he/she reflects on that, daily meaning in ordinary things, preservation of meaningful roles and activities for older people, preservation of health to maintain meaningful activities, and connectedness to others and/or to something that transcends the self.
5.2 Competences to learn to know the older adults
5.2.1 Cultural competences
Caregivers must reflect on their own (often non-conscious and implicit) stereotypical and ageist views and how those might affect their interaction with older people, given how deeply these tend to influence people’s belief in themselves and their strengths (Levy, 2009). Therefore, interpreting and understanding clients’ needs also require cultural competences and sensitivity. The cultural diversity of the older population has increased significantly in recent years, whereby caregivers provide care to people with various multi-ethnic roots. Providing culture-specific healthcare can improve the health quality of these patients (Chang et al, 2013).
In European countries, health care is mainly based on Western cultural values. For several decades, self-determination, liberty of choice, and freedom from others’ interference have been the leading principles. Although autonomy is a core aspect of caregiving, caregivers have to be sensitive to race, class, or cultural differences. Social change and the multiple and ever-changing cultural contexts within which older people are embedded are essential factors that shape their experiences over time and impact care facilities and, for example, their ability to age in place (Perkins, Ball, Whittington & Hollingsworth, 2012).
Cultural competences are also needed to match the growing needs of lesbian, gay, bisexual, and transgender (LGBT) older adults. Several studies into the experiences of LGBT older adults show that they face prejudice and discrimination from health care professionals (Foglia & Fredriksen-Goldsen, 2014; Lindroth, 2016; Molinari & Sweeney-Feld, 2017; Putney et al., 2018). Cultural competences are needed to address these older adults’ needs and prevent their estrangement experiences (Fredriksen-Goldsen, Hoy-Ellis, Goldsen, Emlet & Hooyma, 2014; Rinaldi et al., 2005). However, sexual orientation and gender identity are not commonly addressed in health care or education programs for care professionals.
5.2.2 Moral competences
An important theme that requires special attention in caregivers' competences is the moral domain. Good care presupposes moral values in the care relationship, for example, respect for individuality, dignity, safety, a caring community, and closeness (Frilund, Eriksson & Fagerstrom, 2014). In daily practice, caregivers are often confronted with paradoxes, such as the desire to respect the autonomous choice of care recipients and a concern for their safety, or between the needs of the care recipient and the burden for informal caregivers. Another moral element of good caregiving pertains to articulating and balancing personal, social, professional and organisational values in the daily activities of caring. In some cases, there may be tension between different value sets, and specific competences are needed to navigate these situations.
Caregiving may confront caregivers also with moral issues that relate to existential questions. For example, older people struggling with life questions concerning the end of their lives (for instance, they don’t want to live anymore) often generate moral dilemmas and personal life questions for caregivers (Frilund et al., 2014; Van der Vaart et al., 2013). Moral deliberation and self-reflection skills are vital for caregivers to deal with these issues healthily. It is helpful for them to engage in periodical collective reflection with colleagues, for instance, in moral deliberation sessions, to work out the best strategy to deal with these paradoxes, which should be adapted and tailor-made for the situation at stake (Baur, 2013).
Moral competences include moral perception, judgment, and behaviour (Jormsri et al., 2005). Caregivers must develop a perspective regarding ‘dignified care’ and knowledge of providing dignity in care for older people (Kinnear, Williams & Victor, 2014). Furthermore, eight attributes are defined that are conducive to developing this moral competence: loving-kindness, compassion, sympathetic joy, equanimity, responsibility, discipline, honesty, and respect for human values, dignity and rights (Jormsri et al. 2005; Traynor et al., 2011). In addition, it is vital that the organisation is sensitive to moral dilemmas and provides room for ethical dialogues (Kloos, 2020).
5.2.3 Narrative competences
Seeing someone as a person also includes taking people’s life history and social situation into account when accommodating their needs. Person-centred care that fits someone’s life situation and history presupposes narrative competences in the attention of older people Villar & Serrat, year). Biographical work is required to identify older adults’ social and meaning needs, where both generativity and ego-integrity play a role. Looking back on one’s life helps people give a meaningful ordering to life events and thus creates a sense of narrative coherence and closure. It enables people to come to terms with what may be unfinished, regret, anger, sadness, and guilt.
Competences of caregivers that enhance exploring these issues in older age can help people reframe some of these events and come to a new understanding of the meaning and purpose of their lives (Jonsen et al., 2015; MacKinlay & Trevit, 2010). In this respect, narrative interventions have been developed, for example, life reviews, logotherapy, or spiritual reminiscence emphasising meaning in life (Bohlmeijer et al., 2008; Butler, 1963; De Medeiros, 2014; MacKinlay & Trevit, 2010; Morgan, 2012).
5.3 Competences for deciding adequate support
5.3.1 Intervention competences
Professional caregivers have the task of noticing if a client has a problem, interpreting the problem, and selecting an appropriate intervention, for example, by seeking meaningful activities and social roles for people to participate in. To analyse and intervene effectively and adequately, they need to consider what intervention is appropriate in a particular case for a specific client. A ‘one size fits all’ approach to offering activities does not improve people’s quality of life, so a tailor-made approach is required (Drageset, Haugan & Tranvåg, 2017). Intervention competences need professionals to be context-sensitive and flexible in promoting, restoring, sustaining, and/or enhancing positive functioning and a sense of wellbeing in clients (Barber et al., 2007; Nolan et al., 2004).
Engaging in worthwhile activities is quintessential in maintaining a sense of meaning for older people (Steptoe & Fancourt 2019). Many activities are considered valuable and contribute to meaning, such as harmonious family relations and contacts, fulfilling hobbies, religious and spiritual practice, (volunteer) work, nature, travelling, and other stimulating activities. For people living in long-term care facilities, activities are vital to maintain their identity and autonomy and confirm their values (e.g. De Vriendt et al., 2019). To be experienced as valuable, activities need to meet some conditions: be useful; stimulate social interaction; help patients to connect with their home environment and make a connection to their past; provide structure in time during the day;
be self-chosen, and finally enable them to remain active. Thus, autonomy/free choice, social connection and connection with the past were considered to be critical elements of activities capable of stimulating a sense of meaning.
Assumptions of staff and family caregivers may stand in the way of a good provision of meaningful activities. Moreover, there may be differences in how older people evaluate activities as meaningful to them, compared to staff and family carers. In a study on older people living with dementia, it turned out that staff and family carers found activities maintaining older people's physical abilities to be meaningful, whereas, in contrast, the older adults preferred activities that addressed their psychological and social needs more highly (Harmera & Orrell, 2008). The quality of the experience and the social interaction during the experience mattered more to residents than the type of activity. However, even the oldest old can find meaning in activities despite the sometimes severe losses they experience (Harmera & Orrell, 2008).
5.3.2 Empowerment competences
Caregivers can assist older people in recognising their strengths and helping them put their strengths to use. Rather than a paternalistic role, where the caregiver is the expert deciding what is suitable for the care recipient, the caregiver needs to adopt a coaching and supporting role to stimulate self-management skills in older people (Alpay & Jansen, 2010; Boumans, 2012). To guide and encourage the client, caregivers need the ability to think of a creative solution or to arrange things. They must have realistic expectations about clients' possibilities and not start tackling issues a client is not ready for. This requires that caregivers gain insight into a client's wishes, desires, and priorities, involving unprejudiced listening. Next, clients need to be facilitated to express their self-prioritised goals. A plan can be made for how the caregivers can facilitate the client in putting their goals into action (De Vriendt et al., 2019).
Although caregivers can support self-management and empowerment, it should be realised that empowerment has to come from within people and cannot be forced upon them from the outside by caregivers. They can only facilitate, support or enable the process. This is known as the 'empowerment paradox' (Jansen, 2013; Van Regenmortel, 2009). Also, it is essential to be sensitive not to overstep the personal boundaries of both caregivers and care recipients in the care relationship characteristic of the empowerment paradigm. The goals and practices of caregiving should flow from a dialogical exchange between all stakeholders and be regularly evaluated.
5.4 Competences on the role and function of the caregiver
5.4.1 Self-care competences
Improving the relational competences of caregivers requires enhancing skills towards the patient and enhancing self-care skills. Caregivers need to be able and willing to enter into a personal relationship with clients, i.e., to get involved with a specific client as a person. However, personal involvement requires that caregivers can guard their limits to prevent it will negatively affect them (European Charter of rights, 2010). Attention to their self-knowledge, self-reflection, and self-development reduces their burnout risk (Halldorsdottir, 2012). Valuable self-care competences are expressing positive feelings, controlling aggressiveness, and discussing problems (Nathalie et al., 2016).
Self-care is also relevant for informal caregivers and family caregivers (Barbabella et al., 2016). Caring for a dear one can be stressful, decreasing the caregiver’s quality of life. It may involve conflicts or difficulties reconciling differences of opinion or financial issues. Studies into caregiver burden and mental health underscore the importance of the positive aspects of caregiving, such as finding meaning as potential buffers of the burden of caregiving (Che, Yeh & Wu, 2006; Given, Sherwood & Given, 2008; McLennon et al., 2011; McLennona, Habermanna and Rice, 2021). Interventions have been developed to relieve or support informal caregivers or improve informal caregivers’ competences (De Cola et al., 2017; Graffigna et al., 2020; Guida et al., 2019; Nolan, 2001).
The involvement of volunteers in care settings needs special attention in this respect. Often volunteers are highly motivated to help older adults but willing to offer unlimited help (Machielse & Runia, 2014). To reduce the risk of burnout, organisations should develop a clear vision of volunteering that clarifies the role of volunteers. Voluntary work with highly complex and vulnerable clients demands professional supervision. This requires professionals who have the competences and the time to follow and supervise the volunteers. Fundamental issues in this respect are sharing experiences on the care trajectory and monitoring the boundaries of the volunteer. There are also limits to the work of volunteers. Clients with serious, ‘heavy’ existential questions, for example, in case of a death wish, can make the volunteer feel uncomfortable (Leocadie et al., 2020). Professional (spiritual) caregivers are quintessential to meeting the meaning needs of people in situations where the simple attention of informal caregivers and nurses is not enough (Van der Vaart et al., 2013, 2015). Volunteers need to recognise when it is better to bring in a professional and learn to deal with their feelings of powerlessness, as problems cannot be solved (Van der Vaart et al., 2013).
6. Competences of caregivers according to SeeMe participants
6.1 Introduction
This chapter focuses on the skills and competences caregivers need to 'see' older adults and how to improve these skills and competences, as found in the qualitative interviews with caregivers. From the literature review and the SeeMe problem statement (see chapters 1-3) main themes were derived from exploring the competences and skills of informal, volunteer and professional caregivers. This resulted in an interview guide\(^4\) that centred around four main topics:
- **Assistance/help/care**: what kind of help was given, to whom, how; does the contact with clients meet the caregivers' expectations;
- **Attuning to clients’ needs**: were clients' social and meaning needs recognised and met; what kind of barriers were experienced and how to deal with them;
- **Competences and skills**: what competences and skills are needed to help the clients, like understanding the client, practical skills et cetera.;
- **Quality of caregiving**: prerequisites to provide care, like professional competences, needed experiences, personal characteristics and training.
Interviews were conducted with seventeen respondents – six professionals, six volunteers, and five informal caregivers – involved in a local care project\(^5\) chosen by each country (i.e., two from the Netherlands). All interviews were part of the entire SeeMe project, which also covered interviews with older adults (see Machielse, Van der Vaart, Laceulle, & Klaassens, 2022). The current chapter focuses on interviews with caregivers only (see Table 1).
---
\(^4\) The full interviewguide can be found on the website [www.seemeproject.eu](http://www.seemeproject.eu) or requested from the authors.
\(^5\) Further information about the six SeeMe partners and their selected local care project can be found on the website [www.seemeproject.eu](http://www.seemeproject.eu) and in Report 3 – Case studies (also available on the website).
Table 1- SeeMe interviews: overview for this report
| Country | Professional caregiver | Volunteer caregiver | Informal caregiver | Extramural | Intramural |
|---------------|------------------------|---------------------|--------------------|------------|------------|
| Belgium | | 2* | 1 | X | |
| Germany | 1 | 1 | | X | X |
| Italy | 1 | 1 | | | X |
| Netherlands (UHS) | 1 | 1 | 1 | X | |
| Netherlands (AA) | 2 | 1 | 1 | | X |
| Spain | 1 | 1 | 1 | X | |
| **Total** | **N = 6** | **N= 7** | **N= 4** | **10** | **7** |
*) One Belgian volunteer also had a professional function, but the interview focused on the volunteer role.
**) The German professionals were active in both extra and intra mural; they are assigned to one category.
All interviews were summarised, coded and analysed in ATLAS.ti using a coding scheme with sixteen entries (see Appendix II), organised into six main categories:
1) Tasks (which): what kind of assistance/help/care tasks do they perform?
2) Attuning to needs (how): how do they tailor care to clients' needs?
3) Competences and skills needed (which): what assets are needed for good care?
a) Relational (incl. responsiveness, connecting, attunement)
b) Communicative (incl., dialogical, observation)
c) Empathic (perspective-taking, cognitive and affective, compassion)
d) Moral (recognising moral dilemmas, balancing values, moral deliberation)
e) Cultural competences (reflecting on stereotypical views)
f) Hermeneutic (sensitivity for meaning issues)
g) Narrative (sensitivity for stories, co-narrator, intake)
h) Empowering (recognising strengths and helping put them into use)
i) Intervention (problem-solving; finding tailored solutions for problems)
j) Selfcare (self-reflection, self-knowledge, personal limitations)
k) Role (inductive; distinguishing between professional roles)
4) Improving competences and skills (how): in what manner can they be enhanced?
5) Management and organisational quality (what): what is required to enhance the quality of caregiving?
6) Specifics national or cultural issues (which): what affects the quality of caregiving?
The outcomes of the data analysis as presented below follow these main categories. Many topics were discussed, but the analysis focuses on the most salient, surprising and inspiring findings that add insight into social and meaning needs and how to accommodate them in care settings.
6.2 Data analysis
6.2.1 Overall remarks
There are no substantial differences between the five countries, though situations and programs are different and locally defined. The data encompass a limited number of respondents, but all presented experiences and impressions fit well and could have come from any country. Thus the phenomena studied here seem to concern rather generic care issues for older persons. This also applies to the differences between informal, volunteer and professional caregivers. Differences between the three categories of caregivers, of course, were found. Still, they are very much role-related and seem somewhat independent from the country, whether concerning intra- or extra-mural care, client characteristics, et cetera. Below the main findings are depicted for each of the main themes.\(^6\)
6.2.2 Tasks performed by caregivers
Informal caregivers and volunteers in each country describe their everyday tasks mostly in terms of practical care and daily help, from transportation to administration. With those tasks, they also seem to bring an important social role. In particular informal caregivers usually take a comprehensive role. This ranges from social and emotional to practical issues like cleaning, cooking, shopping, and being an intermediary towards health care staff (for example, translating or organising health visits). Also, some volunteers demonstrate such a broad role in exercising their tasks. Meaning tasks are not mentioned as social roles, especially in the volunteers. However, informal caregivers stress that they are important in this respect and should be able to recognise meaning needs (IT5). This meaning role also has a moral component for informal caregivers who – particularly when they are relatives - feel that they are needed to give their family members depth in life. But also volunteers express that they feel the moral need that it is important to help the people who need it (BE1).
\(^6\) Legend for respondent roles in the text: Volunteers: BE1, BE3, D2, NL4 (UHS), #NL6 (AA), SP3; Informal carers: BE5, IT5, NL5 (UHS), #NL3 (AA), SP4; Professionals: D1, IT4, NL6 (UHS), #NL2, #NL4 (AA), SP5.
The professional caregivers describe similar practical, social and meaning tasks and add to this their organisational work, topics that will be dealt with below. One noticeable issue is that they see it as their task - and the task of their organisation - to offer a life perspective to older people: reinstating people's dreams, working with their dreams, and acknowledging the future perspectives of older clients. SPS "[Mentions] a pilot project called 'dreams manufacture' that seeks to identify and meet unmet dreams. Its basic value is that dreams are still there, that older people can still dream, and have the right to have and start life projects."
6.2.3 Attuning to the clients' needs
All respondents acknowledge the importance of tailoring care to the individual client, seeking to recognise and meet their needs. Some specific aspects arise from the interviews as being not self-evident but of particular importance for the quality of care.
Recognising social and meaning needs
First, the issue arises of what's needed to recognise social and meaning needs. Some informal caregivers and volunteers say that they "sense what people need" and that not everyone has this ability (BE1). They listen to the needs of the people they help but state that they don't know how they do this and just might have learned it by long practising their job. Also, they indicate they are not sure whether they can recognise and respond to meaning needs when the client has a reserved personality and barely shares any of these needs (SP3).
Connecting to clients' biography
Informal caregivers that help their relatives state that it is essential to know the person and their life experiences to seeing meaning needs.
"Often, it is not the company or what you tell them, but what (they) need to tell you. Often it is what they need to tell you and of course, without knowing their life story, as you say, or their values, it is very difficult to make contact, to connect, because they don't know how to express those needs". (SP4)
This informal caregiver suggests almost excluding all possibilities for non-family members to make real contact with the client and their life histories. (SP4)
It's salient how caregivers regularly seek to connect to clients' biography to offer them a perspective on life. Volunteer BE1 states that people have been able to do things all their lives and still want to feel like they can. She talks about their wishes and dreams and follows the older people's desires and thoughts even though they're often unrealistic.
"If people want to dream, you have to let them dream. Sometimes there are people who ask for weird or unfeasible things, but I say, no, let them do what they want." (BE1)
Much of such a biographical approach in attuning to specific needs is also acquired by professionals: as well as for attuning to the client (starting with mapping one’s biography and then using it as much as possible in care), as for making a good match between client and professionals, for each task or activity (D1, #NL2).
**Different caregivers**
One possibility to respond to the needs of the residents is by offering different attachment figures (#NL4, D1). As a professional caregiver states: “…the chemistry always has to be right. Because some residents might be better with another colleague than with me” (D1). Moreover, in this case, volunteers are matched with specific tasks and with clients to fit the volunteers’ profile, capabilities, and needs (just like tailoring for clients). Regarding relatives as informal caregivers, such an approach leads to roles that fit their (closer) relationship with the older adult (D1). These diverse opportunities offer volunteers the chance to get involved in different ways. Instead of assigning them a task or even imposing it upon them, each volunteer can contribute with his/her capabilities. Thus, one approach of attuning seems to match clients’ needs to different caregivers and match caregiving tasks with caregivers’ needs.
**Creating an everyday surrounding**
Another method of attuning to clients’ needs is to create a kind of ‘every day’, ‘natural’ surrounding of help for clients in which they feel comfortable and safe (#NL2, NL6). This is demonstrated by professionals eager to have more ‘all round’ volunteers who can help with daily issues, like minor repairs, groceries, and writing a letter. Often such tasks are too limited when the program doesn’t accept requests for just practical help, but care receivers do make such requests. Professionals suspect that there might be some more significant issues behind such practical demands of clients, making it worthwhile to respond to them (NL6).
**Personal involvement**
Additionally, volunteer and informal caregivers (BE3, BE5) view help as something natural, as what one does if others are in need. They provide more help than formally needed and/or get involved more personally, like giving some money for food (which is not allowed). Illustrative is how a volunteer involved her sister in calls with a client, at first accidentally, and noticed how the client enjoyed this (SP3). These approaches seem to create a kind of everyday life for clients, having ‘daily’ contact with people in their surroundings like one had more frequently before with family, neighbours or acquaintances.
6.2.4 Competences and skills needed
Concerning the competences and skills that caregivers need to help clients properly, ten of the eleven distinguished dimensions (see code list in 6.1) were well represented in the data. Only the dimension of ‘cultural competence’ was not recognised in the data. While respondents did talk extensively about really seeing the client and addressing their needs, this was not worded in terms of cultural differences or other (stereotypical) group differences. To summarise the relative importance of the remaining nine competences, we might say that six of them were most valued by respondents (roughly in this order): relational, empathic, hermeneutic (sensitivity), self-care, intervention, empowering, and communicative competences. Less often recognised are aspects of moral, narrative and role competence. It’s important, though, to realise that the ten competences inevitably overlap and that aspects of specific dimensions may also be attributed to other dimensions.
The competences and skills don’t show distinctions between caregivers from different countries, but – given their roles - differentiation can be found between volunteer, informal and professional caregivers.
Volunteer caregivers
The principal competences and skills that volunteer caregivers mention are: being empathic (seeing what the client feels, understanding), relational (being social, showing respect, listening well, being patient and adept to the client), hermeneutic (feeling it, sensing what is going on, connecting to client) and self-care (in particular putting limits to the demands). Volunteers are often very much involved in the care relationships and expect this involvement from other caregivers. They assume it to be the right attitude or disposal required for giving care: “... an attitude, a will to help and to want to get involved” (BE2); “… the willingness to provide affective accompaniment” (SP3). One volunteer articulates the importance of paying respect in this relationship (BE1): “you have to take care of people like they are royalty” […] “you have to take the baggage that a person already has in life into account”.
Informal caregivers
Informal caregivers largely mention the same competences and skills but stress certain aspects. Some emphasise the relational part of adapting oneself to the level of the client: while respecting their limits, not thinking or acting for them. “Because, even if they’re limited to a high degree, some activities they are able to might be very important to them” (SP4). Moreover, informal caregivers seem to emphasise being able to make (affective social and) meaning connections: providing a feeling of trust and connection, and meeting whishes of clients (NL5, SP4, IT5). Since it is hard to judge the clients’ real needs and to connect really with a person, informal caregivers stress the vital role of relatives:
"Sometimes only family members share memories and life history with a client - and know, for example, other persons in the family pictures - and can help. Also, close family relationships aren't replaceable on many issues, particularly since older clients have a bigger need for an intimate circle." (SP4)
Regarding self-care, informal caregivers mention the importance of being able to tell their own story to someone and to request/get help from professionals/others (BE5). Also, moral competency is mentioned more often, like keeping up the spirit, being positive, and balancing the client's wishes and what's needed (e.g., insisting on going out for a walk or not, SP4).
**Professional caregivers**
The data on professional caregivers results in similar main themes as mentioned above, but also lead to two additional competences and skills: they stress the importance of role competence (i.e., being flexible, having some expertise in activities that are organised, planning skills, organisational skills, having contacts with other disciplines and institutions) as well as intervention, and empowering competences (finding creative solutions for individual problems) (D1, IT4, #NL4, NL6). Regarding the other competences and skills, professionals often add some own distinguishable characteristics. Next to empathic skills, they mention in particular relational (i.e., being responsive, calm, showing acceptance, creating feelings of closeness, finding the right tone), hermeneutic (i.e., being attentive, remarking, reflecting on clients' life history), and communicative (i.e., listening, observation skills, moderation skills to include people) aspects (D1, IT4, SP5, #NL2, NL6). According to one professional, the essential attitude can be summarised as:
"You have to love people, which means a bundle of competences: empathy, attentiveness, observational skills, composure, acceptance, the ability to establish closeness and at the same time maintain a good balance of proximity and distance." (D1)
**6.2.5 Improving competences and skills**
Most volunteers mention that their organisation provides some education, workshop, or short talks that address relevant topics and skills they like and do attend (NL4; SP3). There is interest in learning the organisation, preparing for house visits, and dealing with clients' reactions, grief or emotional management (SP3). For instance, a volunteer states that she does not know of any place to follow training on dealing with older persons. Still, she thinks it would benefit her and other volunteers if the organisation offers it to them (BE1). Volunteer BE3 is interested in psychology training or how to react to other people. At the same time, an informal caregiver (SP4) would like more knowledge to understand ageing and age-related pathologies and distinguish between minor illnesses, mood problems, and potentially important problems.
A volunteer states that it is important to pay attention to the dreams of older adults, which might be addressed in training for volunteers (BE1). Being able to listen is important to volunteers. Talking for an hour is easy, but listening until the person has said everything they want without interrupting them can be challenging.
“Volunteers sometimes need to ask questions to get the people to talk, but just listen when the other person is talking. They do not need questions or discussions. They need to be able to empty their thoughts.” (BE1)
Recurrently, informal and volunteer caregivers stated that being sensitive, feeling what others need, and being human can’t be learned; it’s a natural attitude that people have or don’t have (BE1, BE5, D2 IT5). According to volunteer BE1 the critical components of giving care and knowing what people need can be taught, but seeing and feeling what others need is something that cannot. Similarly, a professional (D1) wonders – just like a volunteer/informal carer – whether empathy can be learned.
Many volunteers say to learn mainly by doing (and reflecting); they find continuous support from a coordinator very helpful (SP3) as well as having intervision with peers (BE5). An informal caregiver (NIS) states that, as a form of self-care, she’d value having the opportunity to tell her story to other (professional) caregivers, suggesting a form of colleague-intervision. In the same vein, a professional states that volunteers need continuous, cross-sectional training in emotional management (SP5). According to this professional, a more continuous pedagogic effort to challenge the ageism of volunteers is required, which is a rare reference to enhancing the cultural dimension of caregiving competences (SP5).
6.2.6 Quality of caregiving: organizational and cultural prerequisites
A limited number of times respondents referred to organizational or management issues. No further accounts were given on the more general level of national or cultural issues that might affect the quality of caregiving, except one on ‘ageism’. Overall three main organizational issues came to the fore: setting limits to the tasks and responsibilities of volunteers and informal caregivers, providing professional autonomy, and the role of care organizations in their care network.
Limiting tasks and responsibilities of non-professional caregivers
Respondents mentioned that older clients regularly draw a rather heavy appeal on volunteers and informal caregivers. While this may give a high workload and emotional stress, they find such an appeal hard to resist and expressed that the care organization might help them to deal with this better. An informal caregiver mentions that her mother wants more help every time she’s visiting her and wants her to stay longer. This makes her feel bad because of the continuous feeling that it is not enough (SP4). Both informal and volunteer caregivers sometimes need others – that is to
say the care organization – to set limits to the demands of their relatives/clients (BE3, BE5, SP4). As another informal caregiver states: “An external authority can also help the mom to accept that decisions are being made for her. She does not always listen to her children.” (BE5)
**Providing professional autonomy to caregivers**
While on the one hand caregivers might need help to limit their tasks, on the other hand, they sometimes need more space. As a volunteer expresses: “It’s also important to have the authorisation to help people” (BE3). She explains that she always has to listen to her coordinator and that this is sometimes restricting her to help people.
One care organization explicitly tried to promote the engagement and autonomy of volunteers and facilitated – and supported – new proposals from volunteers and the community (SP5). Also on professional level initiatives exist, like letting staff work from their expertise. As an involved professional state:
“This also means that new staff can contribute with their strengths and skills, instead of having to take on the activity that is currently in short supply.” (D1)
In this case, there is hardly a fixed program into which staff has to fit in, so staff is always qualified for the activities that they are doing and need hardly training for such activities. On a more general level trust is mentioned as a prerequisite for good care. While for informal caregivers ‘having confidence in the care staff is important’ (#NL3), it is evenly important for professional caregivers to be supported by their management and their colleagues (#NL4) in doing their daily work well.
**The role of care organizations in their care network**
Also, care organizations may be hampered by the responsibilities they have to adhere to. While for example the issue of ‘ageism’ is largely out of control for a care organization, being a societal problem, it does affect daily care conditions. A professional caregiver states that the negative image of older people that exists in society, and also affects caregivers, makes older clients behave accordingly:
“That’s the way they are because that’s the way we look at them, so change the way we look at them and many things will change.” (SP5)
Changing the view that care organisations have on older people – for example through community-based interventions (SP5) – also may change the concrete conditions of older clients.
Sometimes society also may have an inappropriate appeal to care organisations. One professional (NL6) states that their project sometimes is used by other organizations to refer older people with heavy social problems like psychiatric issues. She finds it hard to refuse psychiatric clients but isn’t able to address their problems. This is too much for volunteers who are trained to address loneliness by listening and being there for a client. The needs of older adults are often different than the referring organization thinks, and sometimes also hard to detect in an intake interview. In such cases working in a care network is crucial to refer clients properly to other forms of care, and also if care organizations are frequently confronted with care issues that are not within their competences (NL6, SP5).
6.3 Summary
The outcomes on competences and skills of informal, volunteer and professional caregivers showed no substantial differences between the five countries. The issues studied thus appeared to be somewhat generic in care for older persons. Four main themes came to the fore in the data.
First, the task performed by caregivers generally can be characterised as very broad, ranging from health care tasks to transportation and administration. This is particularly striking for informal caregivers, partly because they are very much involved in a ‘meaning role’ with their relatives. In general, a ‘social role’ is more prevalent in caregivers, also as a role that inevitably comes along with more practical forms of caregiving. Volunteers have a significant contribution here. Professionals add to this their organisational position and generally stress the importance of ‘offering a perspective on life’ to older adults.
Second, regarding attuning to the client’s needs, caregivers aim to tailor care to the individual. Many states that a caregiver needs a skill to “sense” what people need, which may be hard to train. Informal caregivers stress the importance of knowing the older person and his/her life history. Also, professionals seek to connect to the clients’ biography to offer perspective in life. Acknowledging wishes and dreams is important, and respecting and creating ‘the natural’ feeling surrounding informal help every day. A salient and recurring finding was the importance of matching both clients’ and caregivers’ capabilities and needs as a prerequisite for good care.
Third, while this chapter distinguished eleven dimensions of competences and skills (one inductively derived from the data), the caregivers in our study seem to stress seven of them: relational, empathic, hermeneutic (sensitivity), self-care, intervention, empowering, and communicative competences. Less often recognised are aspects of moral, narrative and role competence. Cultural
competences were not mentioned, meaning they were not specified in terms of cultural or group differences. It is important to consider that the different competences overlap and that aspects of specific dimensions may be present in the outcome of other dimensions. Overall, it was found that volunteers generally emphasise being empathic, relational, and hermeneutic (sensing what is going on) and self-care (putting limits to demands). Informal caregivers showed a similar pattern, stressing certain aspects like adapting oneself to the older adult and creating a trustful meaningful connection. Professionals emphasise communicative aspects, intervention/empowering competences, and role competence (organisational skills, flexibility, networking).
Fourth, concerning *improving competences and skills*, caregivers seemed to doubt whether empathy and "really seeing and feeling what others need" can be learned. On the other side, they demonstrated a clear interest in education. They attached importance to learning more about organisational issues, fundamental health issues, and (particularly, volunteers) psychological and relational competences (like really listening and paying attention to 'dreams'), having supervision, utilising colleague-intervision meetings, and learning from colleagues in practice.
Finally, the main *organizational and cultural prerequisites for care quality* that caregivers reported, are related in different ways to (putting) 'limitations' to care. On the one hand, volunteer and informal caregivers tend to be overcharged by their older clients and need formal limitations set by the care organization to withstand this (emotional) pressure. On the other hand (all) caregivers sometimes need more autonomy in doing and organizing their job to provide adequate care. This requires trust among caregivers and trust provided to them by their management. In addition, also care organizations sometimes are overcharged by other organizations or limited in providing care because of their formal competences. Quality of care at this level seems to require a care network in which clients can be properly referred to other organisations.
7. Conclusions
7.1 Conditions for person-centred care
Vulnerable older people need help and support from formal and informal caregivers. This support needs to take a holistic look at the person and respect their uniqueness (Åberg et al., 2020). Older adults' needs are adequately served if they are seen as people with potential, talents, and social and meaning needs. To attune to their patient's needs, caregivers must dispose of communicative skills to get beyond the superficial conversation. They also need sensitivity to changes in older adults' potentials, talents, and social and meaning needs due to generativity, ego-integrity and gerotranscendence (Tornstam & Tornqvist, 2000).
The empirical findings of this study illustrate that actually 'seeing' the older clients is the main issue of which professional caregivers and volunteer and informal caregivers are very much aware. All the seventeen interviewed caregivers, connected to care projects from each of the five different countries, portray a care practice in which they take an extensive role on a practical level and a social and meaning level. These roles appear to be highly interconnected, due to which also practical tasks of a volunteer entail important social consequences for clients. Informal caregivers, often relatives of older adults, may have an essential role in recognising and addressing meaning needs due to their relationship. But it applies as well to professional caregivers that knowing the person and his/her life experiences is crucial to attuning care to specific, individual needs. A central theme running through all caregivers' accounts is that matching the needs and capabilities of both clients and caregivers (and caregiving tasks) is a requirement for sensitive and well-tailored care.
Person-centred care also makes demands on the conditions in which caregivers work. The level of autonomy and competence that caregivers have affects the quality of care. The life quality of older people who need care benefits from structures that acknowledge dependencies and vulnerabilities and help people navigate their lives with them in a meaningful way (Bødker et al., 2019). Caregivers and relatives stepping in to take over feel like deprivation of the opportunity to manage one's own life and make choices, which impedes one's sense of dignity and self-worth.
Competence development and sufficient autonomy can contribute significantly to a better quality of care (From et al., 2013). In contrast, several factors form an obstacle to developing the required attitudes and competences for person-centred care, for instance, work pressure or a lack of opportunities for professional development (Chang et al., 2020; Van Stenis, Van Wingerden & Kolkhuis, 2017). Meeting the patients' needs requires several conditions, such as a manageable
workload, satisfying contacts with colleagues, sufficient autonomy to organise their work, room for self-development, shared values, and personal and team development (From et al., 2013). Professional pride comes from a high level of satisfaction with work and recognition. It relates to knowledge and ability, self-confidence, commitment, moral courage, meaningfulness, and independence (Zegelin, 2021).
7.2 Summary of required competences for caregivers
The interviews with caregivers in this study confirm the importance of distinguishing subtle dimensions of care competences and skills. An additional dimension – 'role competence' – was inductively derived from the data and accomplished the ten dimensions derived from the literature review. Professional caregivers particularly mentioned role competence in terms of organisational skills, expertise, and networking abilities. However, similar competences could be 'translated' to the realm of volunteers and informal caregivers. Furthermore, each type of caregiver seems to have its accents and focal points within this multidimensional space of competences.
Below, the competences and skills (formal and informal) caregivers need to 'see' older adults' potential, and their social and meaning needs are summarised.
7.2.1 Relational competences
Relational competences refer to traits that allow caregivers to interact with their clients effectively. Relational competences include responsiveness, connecting, and attunement. Relational competences are overarching and encompass many of the other competences.
- **Communicative competences** refer to the ability to communicate in a given communicative setting. Communicative competences include dialogical competences, observational skills, skills to convey and interpret messages and negotiate meanings in a specific context, and social knowledge required for social interaction.
- **Empathic competences** refer to the ability to perceive and relate to another person's situation from an emotional point of view or mentally construct the experiential world of the other. Empathic competences include perspective-taking (both cognitive and affective) and compassion.
• **Hermeneutic competences** refer to interpreting situations and responding to them by giving meaning to the situations. Hermeneutic competences include sensitivity to meaning issues, recognising layers of meaning in patients’ stories, and listening to the ‘question behind the question’.
### 7.2.2 Competences to learn to know the older adults
Competences to get to know the clients better are needed so that the elderly feel known and seen as persons with specific characteristics, dilemmas and life stories.
- **Cultural competences** refer to the ability of a person to effectively interact, work, and develop meaningful relationships with people of various cultural backgrounds and awareness of stereotypical views. Cultural competences include sensitivity to the beliefs, customs, and behaviours of people from different groups (e.g. race, class, gender, sexuality).
- **Moral competences** refer to recognising moral dilemmas, conflicting values and perspectives, balancing values, and moral deliberation. Moral competences include recognising the moral dimension of situations, moral deliberation skills, awareness of values, personal integrity, and wisdom.
- **Narrative competences** refer to the ability to identify, listen to, understand, be touched by and act on the stories that one is exposed to. Narrative competences include sensitivity for (life)stories, skills to take in and understand these stories, being a co-narrator if required, and preventing narrative foreclosure.
### 7.2.3 Competencies to deploy appropriate interventions
When caregivers ‘see’ older people with their needs and wishes, they should – together with the older people - look for ways to support them in a way that suits them.
- **Intervention competences** refer to the ability to notice and interpret a problem and select an appropriate intervention. Intervention competences include finding creative and tailored solutions for specific problems.
- **Empowering competences** refer to the ability to facilitate and support people to use their skills and talents to benefit their well-being. Empowering competences involves recognising other people’s strengths and helping them put these strengths to use.
7.2.4 Competences related to own role and function
To provide good care, caregivers must be clear about their own roles and tasks and also be able to maintain their own well-being.
- **Self-care competences** refer to the ability to take responsibility for their health and wellbeing. Self-care competences include keeping both the body and mind fit and healthy, self-reflection, self-knowledge, awareness of personal boundaries and limitations.
- **Role competences** refer to the ability to take on a specific role, to know how to act appropriately in this role, and to decide whether to accept this role. Role competences include guarding boundaries and one’s health, social, emotional, and practical needs.
By definition, all the different dimensions show overlap, but the data did indicate relatively unique patterns of competences for each caregiver. Learning more about such patterns of competences is of great importance for creating optimal matches between the needs and capabilities of the caregiver and the care receiver. As shown in this study, such an optimal matching appears to be the primary condition for providing person-centred care that is well-tailored to the clients’ social and meaning needs.
Appendix I
Several roles of professionals
To improve the quality of living and dwelling in residential care, Demaerschalk and Switsers (2017) developed a practical guide in which they distinguish between several roles that the professional can fulfil: being a mentor, monitoring living, guiding activities, including the neighbourhood, being a cultural coach and a reference person. These roles can help caregivers get to know people and facilitate their wishes and needs: their purposes and preferences, how they want to spend their time, and how they want to maintain relationships with others. Where possible, the older person remains in charge, and the caregiver has a facilitating and supporting role. There is a strong focus on participation and citizenship in the context of the care residence.
- Competences that caregivers need to fulfil the mentor role are empathy skills, trust-building skills, relational skills, autonomy-supporting skills, listening skills for distilling important points from people’s stories, and social and networking skills.
- Competences that caregivers need to fulfil the role of monitoring living are: supporting a positive self-image of residents, stimulation skills to improve participation and well-being, sensitivity and abilities for enhancing a pleasant atmosphere in the facility, observation skills, creativity skills to find solutions and improved shared living.
- In their role of guiding activities, caregivers need creative skills to create a tailor-made program of activities, organisational skills, and collaborative skills to work together with other caregivers, volunteers and family.
- Competences that caregivers need in their role of including the neighbourhood are networking skills, building bridges between the neighbourhood and the residential facility, inspirational skills, seeing opportunities, and engagement in presenting a positive and attractive image of the facility to the outside world.
- In their role as cultural coaches, caregivers need networking skills, creativity skills, collaborative skills, project-based working, and using arts-based interventions as a source of personal growth and social connectedness.
- Competences that caregivers need in their role of reference person are: sensitising staff members to the needs of older people and the importance of quality of care, quality management skills, dialogical skills, and intercultural skills to facilitate open dialogue between staff members with different (cultural) values, stimulating innovation and change processes. (Demaerschalk & Switsers, 2017).
Appendix II
Topics of the coding scheme
Tasks (which): what kind of assistance/help/care tasks do they perform?
- Practical, social, meaning, moral aspects
- Task limitations (inductive)
Attuning to needs (how): how do they tailor care to clients' needs?
- Social and meaning needs
Competences and skills needed (which): what assets are needed for good care?
- Relational (incl. responsiveness, connecting, attunement)
- Communicative (incl., dialogical, observation)
- Empathic (perspective-taking, cognitive and affective, compassion)
- Moral (recognising moral dilemmas, balancing values, moral deliberation)
- Cultural competences (reflecting on stereotypical views)
- Hermeneutic (sensitivity for meaning issues)
- Narrative (sensitivity for stories, co-narrator, intake)
- Empowering (recognising strengths and helping put them into use)
- Intervention (problem-solving; finding tailored solutions for problems)
- Selfcare (self-reflection, self-knowledge, personal limitations)
- Role (planning skills, organisational skills)
Improving competences and skills (how): in what manner can they be enhanced?
- Social and meaning competences
Management and organisational quality (what): what is required to enhance the quality of caregiving?
- Policy, facilities, recruitment, training, supervision, support staff capabilities (inductive)
Specifics national or cultural issues (which): what affects the quality of caregiving?
- National policy/cultural setting
- Related (cultural) competences
Åberg, C., Gillisjö, C., Hallgren, J., & Berglund, M. (2020). "It is like living in a diminishing world": Older persons' experiences of living with long-term health problems - prior to the STRENGTH intervention. *International Journal of Qualitative Studies on Health and Well-Being, 15*(1), 1747251. doi:10.1080/17482631.2020.1747251
Alpay, L. L., & Jansen, Y. J. F. M. (2010). Rapportage onderzoek naar patient empowerment en zelfmanagement van ouderen. verkennend onderzoek in het kader van proeftuin peri-operatieve zorg voor ouderen (KIP patiënt empowerment 2010). *TNO Kwaliteit Van Leven*. Retrieved from https://repository.tno.nl/islandora/object/uuid%3A84db32d0-da38-4a7c-bb07-5a5cf6f186ec
American Geriatrics Society Expert Panel. (2015). Person-centered care: A definition and essential elements. *Journal of the American Geriatrics Society, 64*(1), 15-18. Retrieved from https://onlinelibrary.wiley.com/doi/abs/10.1111/jgs.13866
Anand, P. (2005). Capabilities and health. *Journal of Medical Ethics, 31*(5), 299-303. doi:10.1136/jme.2004.008706
Barbabella, F., Poli, A., Andréasson, F., Salzmann, B., Papa, R., Hanson, E., . . . Lamura, G. (2016). A web-based psychosocial intervention for family caregivers of older people: Results from A mixed-methods study in three European countries. *JMIR Research Protocols, 5*(4), e196.
Barber, J. M., Parsons, H., Wilson, C. A., & Cook, C. C. H. (2007). Measuring mental health in the clinical setting: What is important to service users? the mini-service user recovery evaluation scale (mini-SeRVE). *Journal of Mental Health (Abingdon, England), 26*(6), 530-537.
Baur, V. E. (2013). *Participation & partnership: Developing the influence of older people in residential care homes*. Amsterdam: Vrije Universiteit Amsterdam.
Bleck, C., Schultz, L., Conen, I., Frerk, T., Henke, S., Leiber, S., . . . Fuchs, H. (2020). *Selbstbestimmt teilhaben in altenpflegeeinrichtungen: Empirische analysen zu fördernden und hemmenden faktoren*. Nomos Verlagsgesellschaft mbH & Co. KG.
Bødker, M. N., Christensen, U., & Langstrup, H. (2019). Home care as reablement or enabling arrangements? an exploration of the precarious dependencies in living with functional decline. *Sociology of Health & Illness, 41*(7), 1358-1372. doi:10.1111/1467-9566.12946
Bohlmeijer, E. T., Westerhof, G. J., & Jong, M. E. (2008). The effects of integrative reminiscence on meaning in life: Results of a quasi-experimental study. *Aging & Mental Health, 12*(5), 639-646. doi:10.1080/13607860802343209
Boss, E. M., Blauw, W., Alblas, M., & Gort, A. (2011). *Vrijwillige inzet: Trendrapport 2011*. Utrecht: MOVISIE.
Boumans, J. (2012). *Naar het hart van empowerment deel 1. Een onderzoek naar de grondslagen van empowerment van kwetsbare groepen*. Utrecht: MOVISIE.
Butler, R. N. (1963). The life review: An interpretation of reminiscence in the aged. *Psychiatry, 26*, 65-76. doi:10.1080/00332747.1963.11023339
Calasanti, T., & King, N. (2015). *Intersectionality and age*. Routledge.
Calman, L. (2006). Patients' views of nurses' competence. *Nurse Education Today, 26*(8), 719-725. doi:10.1016/j.nedt.2006.07.016
Chang, H., Gil, C., Kim, H., & Bea, H. (2020). Person-centered care, job stress, and quality of life among
long-term care nursing staff. *Journal of Nursing Research, 28*(5), e114.
Chang, H., Yang, Y., & Kuo, Y. (2013). Cultural sensitivity and related factors among community health nurses. *The Journal of Nursing Research: JNR, 21*(1), 67-73.
Che, H., Yeh, M., & Wu, S. (2006). The self-empowerment process of primary caregivers: A study of caring for elderly with dementia. *The Journal of Nursing Research: JNR, 14*(3), 209-218. doi: 10.1097/01.jnr.0000387579.58974.0b
Church, C. D. (2016). Defining competence in nursing and its relevance to quality care. *Journal for Nurses in Professional Development, 32*(5), E9-E14. doi:10.1097/NND.00000000000000289
De Boer, M. E., Depla, Marja F. I. A., Frederiks, B. J. M., Negenman, A. A., Habraken, J. M., Zee, Carlijn H. van Randeraad-van der, . . . Hertogh, Cees M. P. M. (2019). Involuntary care – capturing the experience of people with dementia in nursing homes. A concept mapping study. *Aging & Mental Health, 23*(4), 498-506. Retrieved from https://doi.org/10.1080/13607863.2018.1428934
De Cola, M. C., Lo Buono, V., Mento, A., Foti, M., Marino, S., Bramanti, P., . . . Calabrò, R. S. (2017). Unmet needs for family caregivers of elderly people with dementia living in Italy: What do we know so far and what should we do next? *INQUIRY: The Journal of Health Care Organization, Provision, and Financing, 54*, 0046958017713708. doi:10.1177/0046958017713708
De Medeiros, K. (2014). *Narrative gerontology in research and practice*. New York, NY, US: Springer Publishing Co.
De Vriendt, P., Cornelis, E., Vanbosseghem, R., Desmet, V., & Van de Velde, D. (2019). Enabling meaningful activities and quality of life in long-term care facilities: The stepwise development of a participatory client-centred approach in Flanders. *British Journal of Occupational Therapy, 82*(1), 15-26.
Demaerschalk, M., & Switsers, L. (2017). *Wonen en leven in het woonzorgcentrum in zes rollen*. VVSG.
Díaz-Veiga, P., Sancho, M., García, Á, Rivas, E., Abad, E., Suárez, N., . . . Yanguas, J. (2014). Efectos del modelo de atención centrado en la persona en la calidad de vida de personas con deterioro cognitivo de centros gerontológicos. *Revista Española De Geriatría Y Gerontología, 49*(6), 266-271. doi:10.1016/j.regg.2014.06.003
Dijke, J. v., Nistelrooij, I. v., Bos, P., & Duyndam, J. (2019). Towards a relational conceptualization of empathy. *Nursing Philosophy, 21*(3), e12297. doi:10.1111/nup.12297
Drageset, J., Haugan, G., & Tranvåg, O. (2017). Crucial aspects promoting meaning and purpose in life: Perceptions of nursing home residents. *BMC Geriatrics, 17*(1), 254. doi:10.1186/s12877-017-0650-x
Eggenberger, E., Heimerl, K., & Bennett, M. I. (2013). Communication skills training in dementia care: A systematic review of effectiveness, training content, and didactic methods in different care settings. *International Psychogeriatrics, 25*(3), 345-358. doi:10.1017/S1041610212001664
Ekman, E., & Halpern, J. (2015). Professional distress and meaning in health care: Why professional empathy can help. *Social Work in Health Care, 54*(7), 633-650. doi:10.1080/00981389.2015.1046575
Elzen, H. A. (2006). *Self-management for chronically ill older people*. University Library Groningen.
Entwistle, V. A., & Watt, I. S. (2013). Treating patients as persons: A capabilities approach to support delivery of person-centered care. *The American Journal of Bioethics, 13*(8), 29-39. doi:10.1080/15265161.2013.802060
European Charter of rights. (2010). *Charter of fundamental rights of the European union*. *Official Journal of the European Union*, (C 83/391)
Fisher, B., & Tronto, J. C. (1990). Toward a feminist theory of caring. In E. Abel, & M. Nelson (Eds.), *Circles of care* (pp. 36-54). Albany, NY: SUNY Press.
Foglia, M. B., & Fredriksen-Goldsen, K. I. (2014). Health disparities among LGBT older adults and the role of nonconscious bias. *Hastings Center Report, 44*(s4), S40-S44.
Fredriksen-Goldsen, K. I., Hoy-Ellis, C. P., Goldsen, J., Emlet, C. A., & Hooyman, N. R. (2014). Creating a vision for the future: Key competencies and strategies for culturally competent practice with lesbian, gay, bisexual, and transgender (LGBT) older adults in the health and human services. *Journal of Gerontological Social Work, 57*(2-4), 80-107. doi:10.1080/01634372.2014.890690
Frilund, M., Eriksson, K., & Fagerström, L. (2014). The caregivers' possibilities of providing ethically good care for older people--a study on caregivers' ethical approach. *Scandinavian Journal of Caring Sciences, 28*(2), 245-254. doi:10.1111/scs.12047
From, I., Nordström, G., Wilde-Larsson, B., & Johansson, I. (2013). Caregivers in older peoples' care: Perception of quality of care, working conditions, competence and personal health. *Scandinavian Journal of Caring Sciences, 27*(3), 704-714. doi:10.1111/j.1471-6712.2012.01083.x
Ghiglieri, M., McAndrew, R., Baum, C. M., & Taff, S. D. (2021). Identity, civic engagement, and altruism: A phenomenological exploration of activity engagement in older adults. *Scandinavian Journal of Occupational Therapy, 28*(3), 225-238. doi:10.1080/11038128.2020.1735512
Gholamzadeh, S., Khastavaneh, M., Khademian, Z., & Ghadakpour, S. (2018). The effects of empathy skills training on nursing students' empathy and attitudes toward elderly people. *BMC Medical Education, 18*(1), 198.
Given, B., Sherwood, P. R., & Given, C. W. (2008). What knowledge and skills do caregivers need? *AJN the American Journal of Nursing, 108*(9), 28–34. doi:10.1097/01.NAJ.0000336408.52872.d2
Gopinath, M. (2018). Thinking about later life: Insights from the capability approach. *Ageing International, 43*(2), 254-264. doi:10.1007/s12126-018-9323-0
Graffigna, G., Barello, S., Morelli, N., Gheduzzi, E., Corbo, M., Ginex, V., . . . Masella, C. (2020). Place4Carers: A mixed-method study protocol for engaging family caregivers in meaningful actions for successful ageing in place. *BMJ Open, 10*(8), e037570. doi:10.1136/bmjopen-2020-037570
Grootegeed, E., & Smith, M. (2018). The emotional labour of austerity: How social workers reflect and work on their feelings towards reducing support to needy children and families. *The British Journal of Social Work, 48*(7), 1929-1947.
Grootegeed, E., Machielse, A., Tonkens, E., Blonk, L., & Wouters, S. (2018). "Aan de andere kant van de schutting." *Inspelen op de toenemende vraag naar vrijwillige inzet in het lokale sociaal domein*. Utrecht: Vereniging Nederlandse Organisaties Vrijwilligerswerk NOV/Universiteit voor Humanistiek.
Guida, E., Barello, S., Corsaro, A., Galizi, M. C., Giuffrida, F., Graffigna, G., & Damiani, G. (2019). An italian pilot study of a psycho-social intervention to support family caregivers' engagement in taking care of patients with complex care needs: The engage-in-caring project. *BMC Health Services Research, 19*(1), 541.
Halldorsdottir, S. (2008). The dynamics of the nurse-patient relationship: Introduction of a synthesized theory from the patient's perspective. *Scandinavian Journal of Caring Sciences, 22*(4), 643-652. doi:10.1111/j.1471-6712.2007.00568.x
Halldorsdottir, S. (2012). Nursing as compassionate competence: A theory on professional nursing care based on the patient's perspective. *International Journal for Human Caring, 16*, 7-19. doi:10.20467/1091-5710.16.2.7
Harmer, B. J., & Orrell, M. (2008). What is meaningful activity for people with dementia living in care homes? A comparison of the views of older people with dementia, staff and family carers. *Aging & Mental Health, 12*(5), 548-558. doi:10.1080/13607860802343019
Haugan, G. (2014). Nurse-patient interaction is a resource for hope, meaning in life and self-transcendence in nursing home patients. *Scandinavian Journal of Caring Sciences, 28*(1), 74-88.
Haugan, G. (2013a). Meaning-in-life in nursing-home patients: A correlate with physical and emotional symptoms. *Journal of Clinical Nursing, 23*(7-8), 1030-1043. doi:10.1111/jocn.12282
Haugan, G. (2013b). Meaning-in-life in nursing-home patients: A valuable approach for enhancing psychological and physical well-being? *Journal of Clinical Nursing, 23*(13-14), 1830-1844. doi:10.1111/jocn.12402
Haugan, G., Moksnes, U. K., & Lohre, A. (2016). Intrapersonal self-transcendence, meaning-in-life and nurse–patient interaction: Powerful assets for quality of life in cognitively intact nursing-home patients. *Scandinavian Journal of Caring Sciences, 30*(4), 790-801. doi:10.1111/sccs.12307
Held, V. (2005). *The ethics of care: Personal, political, and global*. Oxford, UK: Oxford University Press Inc.
Huber, M., Van Vliet, M., Giezenberg, M., & Knottnerus, A. (2013). Towards a conceptual framework relating to 'Health as the ability to adapt and self manage'. *Driebergen: Louis Bolk Instituut*.
Hupkens, S., Goumans, M., Derkx, P., & Machielse, A. (2020). Nurse's attunement to patient's meaning in life - A qualitative study of experiences of Dutch adults ageing in place. *BMC Nursing, 19*(1) doi:10.1186/s12912-020-00431-z
Hupkens, S., Goumans, M., Derkx, P., Oldersma, A., Schutter, T., & Machielse, A. (2019). Meaning in life of older adults in daily care: A qualitative analysis of participant observations of home nursing visits. *Journal of Advanced Nursing, 75*(8), 1732-1740. doi:10.1111/jan.14027
Hupkens, S., Machielse, A., Goumans, M., & Derkx, P. (2018). Meaning in life of older persons: An integrative literature review. *Nursing Ethics, 25*(8), 973-991. doi:10.1177/0969733016680122
Janssen, B. M. (2013). *Resilience and old age: Community care from an insider and empowerment perspective* Vrije Universiteit Amsterdam.
Jonker, A. A., Comijs, H. C., Knipscheer, K. C., & Deeg, D. J. (2009). The role of coping resources on change in well-being during persistent health decline. *Journal of Aging and Health, 21*(8), 1063-1082.
Jonsén, E., Norberg, A., & Lundman, B. (2015). Sense of meaning in life among the oldest old people living in a rural area in northern sweden. *International Journal of Older People Nursing, 10*(3), 221-229. doi:10.1111/opn.12077
Jormsri, P., Kunaviktitkul, W., Ketefian, S., & Chaowalit, A. (2005). Moral competence in nursing practice. *Nursing Ethics, 12*(6), 582-594. doi:10.1191/0969733005ne828oa
Kardol. M. (2004). *Zorg voor zelfstandigheid. Verslag van een studie over de zorg in verzorgingshuizen en het bevorderen van die zorg*. Universiteit Maastricht.
Kardol, M. (2011-2015). *Ouderenebehoeftenonderzoeken bij Nederlandse gemeenten*. VU Brussel.
Kempen, G. (2006). Preventie en ouder worden: Mogelijkheden voor zelfmanagement. *Epidemiologisch Bulletin, 41*, 27-32.
Kinnear, D., Williams, V., & Victor, C. (2014). The meaning of dignified care: An exploration of health and social care professionals' perspectives working with older people. *BMC Research Notes, 7*, 854. doi:10.1186/1756-0500-7-854
Kitson, A. L., Muntlin Athlin, A., & Conroy, T. (2014). Anything but basic: Nursing's challenge in meeting patients' fundamental care needs. *Journal of Nursing Scholarship: An Official Publication of Sigma*
Theta Tau International Honor Society of Nursing, 46(5), 331-339. doi:10.1111/jnu.12081
Kloos, N. (2020). *Positive psychology in the nursing home: Well-being of nursing staff and residents*. Enschede, The Netherlands: University of Twente.
Kluft, M. (2012). Zeg, bent u misschien de nieuwe professional? de omslag van de visie over welzijn naar het handelen van de nieuwe professional. *Journal of Social Intervention: Theory and Practice*, 21(1), 59. doi:10.18352/jsi.295
Kruse, A., Rentsch, T., & Zimmermann, H. P. (2012). *Gutes leben im hohen alter. Das altern in seinen entwicklungsmöglichkeiten und entwicklungsgrenzenverstehen*. Heidelberg: Akademische Verlagsgesellschaft AKA.
Leocadie, M., Morvillers, J., Pautex, S., & Rothan-Tondeur, M. (2020). Characteristics of the skills of caregivers of people with dementia: Observational study. *BMC Family Practice*, 21(1), 149. doi:10.1186/s12875-020-01218-6
Levy, B. (2009). Stereotype embodiment: A psychosocial approach to aging. *Current Directions in Psychological Science*, 18(6), 332-336. doi:10.1111/j.1467-8721.2009.01662.x
Leyden Academy. (2019). *Langer leefplezier ervaren: Handreiking voor een narratief kwaliteitskader verpleeghuiszorg*. Leiden: Leyden Academy of Vitality and Ageing.
Lindroth, M. (2016). 'Competent persons who can treat you with competence, as simple as that' - an interview study with transgender people on their experiences of meeting health care professionals. *Journal of Clinical Nursing*, 25(23-24), 3511-3521. doi:10.1111/jocn.13384
Machielse, A., Van der Vaart, W., Laceulle, H. & Klaassens, J (2022). SEEing social and meaning needs, talents and dreams of older adults receiving (informal) care. *European Research Report* 1. SEE ME-consortium. Erasmus+ Programme of the European Union.
Machielse, A., & Runia, K. (2014). Vrijwillige inzet bij sociaal geïsoleerden met multiproblematiek: Mogelijkheden, voorwaarden en rollen. *Journal of Social Intervention: Theory and Practice*, 22(4), 5-23. doi:10.18352/jsi.377
Machielse, A., & Jonkers, M. (2013). *De verbinding tussen formele en informele hulp aan sociaal kwetsbare burgers. Een relatieadvies voor een verstandshuwelijk*. Utrecht: LESI
MacKinlay, E. (2006). *Spiritual growth and care in the fourth age of life*. London; Philadelphia: Jessica Kingsley Publishers. Retrieved from http://www.123library.org/book_details/?id=2232
Mackinlay, E., & Trevitt, C. (2010). Living in aged care: Using spiritual reminiscence to enhance meaning in life for those with dementia. *International Journal of Mental Health Nursing*, 19(6), 394-401. doi:10.1111/j.1447-0349.2010.00684.x
Maertens, M., Desmet, B., & Defrenne, C. (2013). *Empowerment: Visie en theoretische onderbouw*. Centrum Empowerment en Ouderenzorg (CEMO).
Martínez Rodríguez, T. (2016). *La atención centrada en la persona en los servicios gerontológicos*. Modelos de atención y evaluación. Colección Estudios de la Fundación Pilares para la autonomía personal, 3.
Martínez, T. (2019). *Guía para activar el proyecto de vida de personas mayores que viven en entornos residenciales*. Colección Estudios de la Fundación Pilares para la autonomía personal.
McGilton, K. S., O'Brien-Pallas, L. L., Darlington, G., Evans, M., Wynn, F., & Pringle, D. M. (2003). Effects of a relationship-enhancing program of care on outcomes. *Journal of Nursing Scholarship: An Official Publication of Sigma Theta Tau International Honor Society of Nursing*, 35(2), 151-156. doi:10.1111/j.1547-5069.2003.00151.x
McLennon, S. M., Habermann, B., & Rice, M. (2011). Finding meaning as a mediator of burden on the health of caregivers of spouses with dementia. *Aging & Mental Health, 15*(4), 522-530. doi:10.1080/13607863.2010.543656
Mercer, S. W., & Reynolds, W. J. (2002). Empathy and quality of care. *The British Journal of General Practice: The Journal of the Royal College of General Practitioners, 52* Suppl, 9.
Morgan, J. (2012). Geriatric logotherapy: Exploring the psychotherapeutics of memory in treating the elderly. *Psychological Thought, 5* doi:10.5964/psyct.v5i2.39
Morgan, S., & Yoder, L. H. (2011). A concept analysis of person-centered care. *Journal of Holistic Nursing: Official Journal of the American Holistic Nurses' Association, 30*(1), 6-15. doi:10.1177/0898010111412189
Narayanasamy, A. (1993). Nurses' awareness and educational preparation in meeting their patients' spiritual needs. *Nurse Education Today, 13*(3), 196-201. doi:10.1016/0260-6917(93)90102-8
Nolan, J. (2001). Community care. In M. Nolan, S. Davies & G. Grant (Eds.), *Working with older people and their families* (pp. 53-74). Maidenhead, UK: Open University Press.
Nolan, M., Davies, S., & Grant, G. (2001). *Working with older people and their families*. Maidenhead, UK: Open University Press.
Nolan, S. A., Strassle, C. G., Roback, H. B., & Binder, J. L. (2004). Negative treatment effects in dyadic psychotherapy: A focus on prevention and intervention strategies. *Journal of Contemporary Psychotherapy, 34*(4), 311-330.
Nussbaum, M., & Sen, A. (1993). *The quality of life*. Oxford: Clarendon.
Nussbaum, M. (2001). Adaptive preferences and women's options. *Economics and Philosophy, 17*, 67. Retrieved from https://chicagounbound.uchicago.edu/journal_articles/3242
Oostwaard van, S., Machielse, J. E. M., & Dangermond, K. (2014). *De (on)betaalde kracht achter goed vrijwilligerswerk. een onderzoek naar de inzet van betaalde en niet-betaalde coördinatoren binnen de maatjesprojecten van humanitas*. Utrecht: LESI.
Oudenampsen, D., Vliet, K. v., Winsemius, A., & Tenhaeff, C. (2006). *Samenwerking vrijwilligers en beroepskrachten bij maatschappelijke ondersteuning*. Utrecht: Verwey Jonker Instituut/ NIZW.
Papathanasiou, I., M, S., & Kourkouta, L. (2013). Holistic nursing care: Theories and perspectives. *American Journal of Nursing Science, 2*, 1-5. doi:10.11648/j.ajns.20130201.11
Perkins, M. M., Ball, M. M., Whittington, F. J., & Hollingsworth, C. (2012). Relational autonomy in assisted living: A focus on diverse care settings for older adults. *Journal of Aging Studies, 26*(2), 214-225. doi:10.1016/j.jaging.2012.01.001
Pinto, F., Barham, E., & Del Prette, Z. (2016). Interpersonal conflicts among family caregivers of the elderly: The importance of social skills. *Paidéia (Ribeirão Preto), 26*, 161-170. doi:10.1590/1982-43272664201605
Pirhonen, J. (2015). Dignity and the capabilities approach in long-term care for older people. *Nursing Philosophy: An International Journal for Healthcare Professionals, 16*(1), 29-39. doi:10.1111/nup.12057
Putney, J. M., Keary, S., Hebert, N., Krinsky, L., & Halmo, R. (2018). "Fear runs deep:" The anticipated needs of LGBT older adults in long-term care. *Null, 61*(8), 887-907. doi:10.1080/01634372.2018.1508109
Regenmortel, T. (2009). Empowerment als uitdagingend kader voor sociale inclusie en moderne zorg. *Journal of Social Intervention: Theory and Practice, 18* doi:10.18352/jsi.186
Remmers, H. (2020). Providing help. aging and care. In M. Schweda, M. Coors & C. Bozzaro (Eds.), *Aging and human nature. international perspectives on aging* (pp. 191-204) Springer.
Rinaldi, P., Spazzafumo, L., Mastriforti, R., Mattioli, P., Marvardi, M., Polidori, M. C., . . . Mecocci, P. (2005). Predictors of high level of burden and distress in caregivers of demented patients: Results of an Italian multicenter study. *International Journal of Geriatric Psychiatry, 20*(2), 168-174. doi:10.1002/gps.1267
Rodríguez, T. M. (2011). *La atención gerontológica centrada en la persona: guía para la intervención profesional en los centros y servicios de atención a personas mayores en situación de fragilidad o dependencia*. Eusko Jaurlaritzaren Argitalpen Zerbitzu Nagusia= Servicio Central de Publicaciones del Gobierno Vasco.
Rodríguez, T. M. (2011). *La atención gerontológica centrada en la persona: guía para la intervención profesional en los centros y servicios de atención a personas mayores en situación de fragilidad o dependencia*. Eusko Jaurlaritzaren Argitalpen Zerbitzu Nagusia= Servicio Central de Publicaciones del Gobierno Vasco.
Runia, K., & Machielse, A. (2012). Betrokken professionals, betrokken vrijwilligers. *Maatwerk, 13* doi:10.1007/s12459-012-0177-3
Ryan, R. M., & Deci, E. L. (2017). *Self-determination theory: Basic psychological needs in motivation, development, and wellness*. New York, NY, US: The Guilford Press.
Sen, A. (1985). *Commodities and capabilities*. Amsterdam: North Holland.
Sen, A. (1993). Capability and Well-Being. In M. Nussbaum, & A. Sen (Eds.), *The quality of life*. Clarendon Press.
Söderbacka, T., Nyström, L., & Fagerström, L. (2017). Older persons' experiences of what influences their vitality - a study of 65- and 75-year-olds in Finland and Sweden. *Scandinavian Journal of Caring Sciences, 31*(2), 378-387. doi:10.1111/scs.12357
Steptoe, A., & Fancourt, D. (2019). Leading a meaningful life at older ages and its relationship with social engagement, prosperity, health, biology, and time use. *Proceedings of the National Academy of Sciences, 116*(4), 1207-1212.
Steverink, N., Lindenberg, S., & Slaets, J. P. J. (2005). How to understand and improve older people's self-management of wellbeing. *European Journal of Ageing, 2*(4), 235-244. doi:10.1007/s10433-005-0012-y
Thyrian, J. R., Fiß, T., Dreier, A., Böwing, G., Angelow, A., Lueke, S., . . . Hoffmann, W. (2012). Life- and person-centred help in mecklenburg-western pomerania, germany (DelpHi): Study protocol for a randomised controlled trial. *Trials, 13*, 56. doi:10.1186/1745-6215-13-56
Tornstam, L., & Törnqvist, M. (2000). Nursing staff's interpretations of "Gerotranscendental behavior" in the elderly. *Journal of Aging and Identity, 5*, 15-29. doi:10.1023/A:1009593330962
Traynor, V., Inoue, K., & Crookes, P. (2011). Literature review: Understanding nursing competence in dementia care. *Journal of Clinical Nursing, 20*(13-14), 1948-1960. doi:10.1111/j.1365-2702.2010.03511.x
Tronto, J. (1993). *Moral boundaries: A political argument for an ethic of care*. New York, NY, US: Routledge.
Van Daal, H.J., & Winsemius, A. (2005). Vrijwilligers en beroepskrachten. Ontwikkelingen in hun rolverdeling en relatie. *ViO Vrijwillige Inzet Onderzoek, 2*(2), 58-68.
Van der Kooij, C. (2018). Mäeutik in der pflege – ZQP Übersicht, Retrieved from https://www.zqp.de/wp-content/uploads/ZQP_Naturheilkunde_M%C3%A4eutik.pdf
Van der Vaart, W., Arisse, A., Weijers, C., & Van Elteren, A. (2015). *Een exploratie van inhoud en methoden voor een kwaliteitstandaard ‘Omgaan met levensvragen in de langdurende zorg voor ouderen’. De tweede onderzoeksfase*. Utrecht: Universiteit voor Humanistiek.
Van der Vaart, W., Van Oudenaarde, R., Weijers, C., & Van Egmond, M. (2013). *Een exploratie van ‘inhoud en methoden’ voor een kwaliteitstandaard ‘omgaan met levensvragen in de langdurende zorg voor ouderen’. De eerste onderzoeksfase*. Utrecht, The Netherlands: Universiteit voor Humanistiek.
Van Dijke, J., van Nistelrooij, I., Bos, P., & Duyndam, J. (2019). Care ethics: An ethics of empathy? *Nursing Ethics, 26*(5), 1282-1291. doi:10.1177/0969733018761172
Van Hove, V. (2001). Naar een recht op eigenheid in een bedding van verbondenheid, emancipatie en empowerment bij mensen met een verstandelijke handicap en continue ondersteuningsnood. *Vlaams Tijdschrift Voor Orthopedagogiek, 20*(1), 16–20.
Van Regenmortel, T. (2002). *Empowerment en maatzorg. een krachtgerichte psychologische kijk op armoede*. Leuven/Leusden: Acco.
van Stenis, A. R., van Wingerden, J., & Kolkhuis Tanke, I. (2017). The changing role of health care professionals in nursing homes: A systematic literature review of a decade of change. *Frontiers in Psychology, 8*, 2008. doi:10.3389/fpsyg.2017.02008
Vellone, E., Sansoni, J., & Cohen, M. Z. (2002). The experience of Italians caring for family members with Alzheimer’s disease. *Journal of Nursing Scholarship: An Official Publication of Sigma Theta Tau International Honor Society of Nursing, 34*(4), 323-329. doi:10.1111/j.1547-5069.2002.00323.x
Ven, L. (2018). De ‘lastige’ familie en het woonzorgcentrum. *Geron, 20*, 64-66. doi:10.1007/s40718-018-0183-1
Villar, F., & Serrat, R. (2017). Hable con ellos: Cuidados narrativos en el marco de una atención centrada en la persona. *Revista Española De Geriatría Y Gerontología, 52*(4), 216-222. doi:10.1016/j.regg.2016.06.004
WHO. *Health Systems in Transition (HiT)*. [http://www.euro.who.int/en/about-us/partners/observatory/health-systems-in-transition-hit-series](http://www.euro.who.int/en/about-us/partners/observatory/health-systems-in-transition-hit-series)
Zegelin, A. (2021). Pflegende brauchen berufsstolz. *Pflegenetz Magazin, 21*(1), 4-8.
Co-funded by the Erasmus+ Programme of the European Union
|
c2860fa1-858f-46bb-9cbc-21678a419d19
|
CC-MAIN-2023-06
|
https://see-me-project.eu/wp-content/uploads/2022/06/SEE%20ME%20Report%202.pdf
|
2023-01-27T17:16:29+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-06/subset=warc/part-00032-b5ddf469-bf28-43c4-9c36-5b5ccc3b2bf1.c000.gz.parquet
| 522,632,080 | 27,721 |
eng_Latn
|
eng_Latn
| 0.844725 |
eng_Latn
| 0.995275 |
[
"eng_Latn",
"por_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"nld_Latn",
"eng_Latn",
"eng_Latn",
"nld_Latn",
"unknown"
] | true |
docling
|
[
210,
1227,
3665,
5842,
6866,
9740,
12671,
15453,
18913,
21834,
24571,
25800,
28421,
31166,
32100,
34721,
37776,
40975,
43842,
46838,
49703,
52415,
55272,
57262,
59935,
62391,
65117,
67731,
70632,
73537,
76513,
78771,
81755,
83926,
86763,
88946,
91156,
92377,
94971,
96474,
99732,
103344,
107069,
110810,
114323,
117772,
121231,
123542,
123601
] |
Legal Status:
- Complies with Part 6, paragraph 24 (3)(b) of The Education (Independent School Standards) (England) (Amendment) Regulations.
- Special Educational Needs and Disability Code of Practice: 0 to 25 years: statutory guidance for organisations who work with and support children and young people with special educational needs and disabilities.
Applies to:
- Whole School including the Early Years Foundation Stage (EYFS)
Related documents:
- Inclusion Policy
- Curriculum Policy
- Assessment Policy
- Gifted and Talented
- English as an Additional Language Policy
- The Pointer School Local Offer
Availability
This policy is made available to parents, staff and pupils in the following ways: via the School website, and on request a copy may be obtained from the School Office.
Monitoring and Review:
- This policy will be subject to continuous monitoring, refinement and audit by the Headmaster.
- The Proprietor undertakes an annual review of this policy and of the efficiency with which the related duties have been discharged, by no later than one year from the date shown below, or earlier if changes in legislation, regulatory requirements or best practice guidelines so require.
-
Signed:
Date reviewed:
29.08.2019
Mr Adam Greenwood Headmaster
Mr Robert Higgins Proprietor
Date of next review: 29.08.2020
Principles
The Pointer school aims to enable all children to develop a lifelong love of learning. As such, we operate a whole school approach to identifying and supporting children with SEND in order that they might reach their full potential. We aim to identify children with SEND at the earliest opportunity and offer appropriate support and interventions. All staff are involved in supporting pupils with SEND, including peripatetic staff. All staff have a responsibility to differentiate lessons to cater for individual learning needs. Parents / guardians and pupils will be involved fully in the process of the planning and delivery of support. It is the policy of The Pointer School that pupils who have been accepted into the school will be offered appropriate support to
enable them to access the curriculum effectively and fulfil their potential. We are an inclusive school, determined to meet the needs of all our pupils. Our school has a clear approach to identifying and responding to SEN. We recognise the benefits of early identification – identifying need at the earliest point and then making effective provision improves long-term outcomes for the child or young person.
All our pupils will have access to a broad and balanced curriculum, with teachers having high expectations for every pupil, whatever their prior attainment. Teachers at our school will use appropriate assessment to set targets which are deliberately ambitious. Lessons will be planned to address potential areas of difficulty and to remove barriers to pupil achievement. By planning in this way, our pupils with SEN and disabilities will be able to study the full national curriculum. The quality of teaching for pupils with SEN, and the progress made by pupils, will be a core part of our school's performance management arrangements and its approach to professional development for all teaching and support staff.
Interpretation
As part of its commitments under articles 7 and 24 of the United Nations Convention of the Rights of Persons with Disabilities, the UK Government is committed to inclusive education of disabled children and young people and the progressive removal of barriers to learning and participation in mainstream education. The Children and Families Act 2014 secures the general presumption in law of mainstream education in relation to decisions about where children and young people with SEN will be educated and the Equality Act 2010 provides protection from discrimination for disabled people. Independent schools are required to follow the Special educational needs and disability code of practice: 0 to 25 years: Statutory guidance for organisations who work with and support children and young people with special educational needs and disabilities (DfE and Department for Health: 2015).
A pupil has SEN where their learning difficulty or disability calls for special educational provision (provision different from or additional to that normally available to pupils of the same age). Within the context of Pointers pupils who might require additional support at The Pointer School include:
- pupils with specific learning differences e.g. dyslexia, dyscalculia and dyspraxia;
- pupils with hearing and/or visual impairment and
- pupils with specific physical and medical conditions
Equality Act 2010
Our school has a duty under the Equality Act 2010 towards individual disabled children and young people. We will make reasonable adjustments, including the provision of auxiliary aids and services for disabled children, to prevent them being put at a substantial disadvantage. We give prior thought to what disabled children and young people might require and what adjustments might need to be made to prevent that disadvantage. Our school has a duty to prevent discrimination, to promote equality of opportunity and to foster good relations. School leaders regularly review how expertise and resources used to address SEN can be used to build the quality of whole-school provision as part of their approach to school improvement.
Disability Discrimination Act
SEND POLICY APPLIES TO THE WHOLE SCHOOL
The Pointer School aims to support all pupils, including those with SEND, and enable them to realise their potential. We would always consider admitting any pupil, no matter what accompanying disabilities they have, providing we are confident that we are able to meet their special educational needs. In the light of the Disability Discrimination Act, we have carefully considered what we might do to make our building more accessible to those who have a physical disability. Please refer to our Accessibility Plan and also our Single Equalities Policy.
Aims and Objectives
The Pointer Schools' Special Educational Needs policy provides a framework for the provision of teaching and support for pupils with learning difficulties. The framework refers to entitlement, access and partnership. Although we aim to make provision for identified Special Educational Needs, it may not always be possible to do so within the school's resources. In such cases the Headmaster and the pupil's parents would be informed. Where a concern has been raised, any special needs or disabilities will be identified at the earliest possible opportunity. The assessment process will involve partnership with all those concerned with the pupil, including parents/carers, teachers and other professionals. The pupil's views will also be sought. The aims of this policy are:
* to create an environment that meets the special educational needs of each pupil;
* to ensure that the special educational needs of pupils are identified, assessed and provided for;
* to make clear the expectations of all partners in the process;
* to identify the roles and responsibilities of staff in providing for pupil's special educational needs;
* to enable all pupils to have full access to all elements of the school curriculum;
* to ensure that parents are able to play their part in supporting their pupil's education;
* to ensure that our pupils have a voice in this process.
In order to meet these aims, our objectives are:
* to ensure pupils with learning needs are identified as early as possible;
* to assess the pupil to identify specific areas of difficulty;
* to ensure all peripatetic staff are aware of the pupil's needs and are able to meet those needs within the school setting;
* to ensure pupils' records include information relating to their individual needs, interventions and outcomes;
* to assist staff in modifying curriculum to meet the pupil's needs within the classroom and provide training programmes when required;
* to ensure that no pupil with learning needs or disability is discriminated against on the basis of his/her disability;
* to work in partnership with parents, guardians and the pupil themselves in providing appropriate support and advice.
At The Pointer School we have developed a clear approach to identifying and responding to SEN. We always aim to know precisely where children with SEN are in their learning and development. We:
* ensure decisions are informed by the insights of parents and those of children themselves;
* have high ambitions and set stretching targets for them;
SEND POLICY APPLIES TO THE WHOLE SCHOOL
* track their progress towards these goals;
* keep under review the additional or different provision that is made for them;
* promote positive outcomes in the wider areas of personal and social development, and
* ensure that the approaches used are based on the best possible evidence and are having the required impact on progress.
In all cases, early identification and intervention can significantly reduce the need for more costly interventions at a later stage. Special educational provision will be matched to the child's identified SEN. Children's SEN are generally thought of in the following four broad areas of need and support:
* communication and interaction
* cognition and learning
* social, emotional and mental health
* sensory and/or physical needs.
Admission Arrangements
Pupils entering the school from Years 1 - 6 will normally have an English and Maths assessment and a generalised discussion with either the Headmaster or a member of staff. If a pupil has already been identified as having learning needs, relevant reports should be brought to the family interview. If necessary the SENCo or a member of the SEND team will meet the pupil and talk to parents. Pupils are admitted to the school at the discretion of the Headmaster. Pupils with additional needs will be admitted if the school can offer appropriate support. Where a child who has an Education, Health and Care (EHC) Plan joins The Pointer School, we will always consult with parents and, where appropriate, the Local Authority to ensure that the required curriculum is provided for as set out in the EHC Plan. We will also co-operate with the Local Authority to ensure that relevant reviews, including the annual review, are carried out as required by regulation and best practice. The school will make reasonable adjustments to meet the needs of children with an EHC Plan or SEND. Any additional services that are needed to meet the requirements of the EHC Plan or additional services such as dyslexic tuition will be subject to charge. This will be directly to the parents, or the Local Authority if they are responsible for the fees and the Pointer School is named in the EHC Plan.
Use of data and record keeping
Our school has developed its own approach to record keeping in line with the requirements of the Data Protection Act 1998. The provision made for pupils with SEN will be recorded accurately and kept up to date. Our school will particularly record details of additional or different provision made under SEN support. This will form part of regular discussions with parents about the child's progress, expected outcomes from the support and planned next steps. They will ensure that they have accurate information to evidence the SEN support that has been provided over the pupil's time in the school, as well as its impact. We use our information system to monitor the progress and development of all pupils. Details of SEN, outcomes, teaching strategies and the involvement of specialists will be recorded as part of this overall approach. Our school will readily share this information with parents in an accessible format.
SEND Staff at Pointers
- The Headmaster has appointed a Special Educational Needs Co-Ordinator (SENCo) to oversee SEN provision within the school. The current SENCo is Penelope Fisher.
- The Nursery Manager, Pamela Ringer, has responsibility for managing referrals within the Nursery.
- The school also has two Learning Support Assistants (LSAs) who are timetabled termly to work with various pupils either individually or in the classroom. Lisa Vivian provides support for pupils in KS1. Sabine Rogers provides support for pupils in KS2.
Improving outcomes: high aspirations and expectations for children and young people with SEN in our school
All children and young people are entitled to an education that enables them to make progress so that they can:
- achieve their best;
- become confident individuals living fulfilling lives, and
- make a successful transition into adulthood, whether into employment, further or higher education or training
The Pointer School will identify and address the SEN of the pupils that we support. Our school must:
- use our best endeavours to make sure that a child with SEN gets the support they need – this means doing everything our school can to meet children and young people's SEN;
- ensure that children and young people with SEN engage in the activities of our school alongside pupils who do not have SEN;
- designate a teacher to be responsible for co-ordinating SEN provision – the SEN co-ordinator, or SENCO
- inform parents when they are making special educational provision for a child;
- prepare an SEN information report and our arrangements for the admission of disabled children, the steps being taken to prevent disabled children from being treated less favourably than others in our school, the facilities provided to enable access to our school for disabled children and our accessibility plan showing how we plan to improve access progressively over time.
At The Pointer School we follow a four stage approach to helping children with SEND:
-
Assess
- Plan
- Do
- Review
Identification of Pupils with Special Educational Needs and Disabilities (Assess)
The identification of SEND will be built into the overall approach to monitoring the progress and development of all pupils. The identification of pupils with special educational needs and disabilities can be:
- on entry when specific needs are identified and recorded as part of the entrance/transition process;
- by staff recognition of a pupil whom they perceive as having difficulties or specific needs in their particular curriculum area;
- by staff referring a pupil who is experiencing emotional/behavioural problems;
The Pointer School is committed to safeguarding and promoting the welfare of children and young people and expects all staff and volunteers to share this commitment. It is our aim that all pupils fulfil their potential.
- through discussion with external professionals such as doctors, counsellors, therapists and also
- through concern expressed by parents (recorded on the parental meeting record form).
We give our children every opportunity to achieve their potential by taking account of our children's range of life experiences when planning for their learning. Lessons are planned to address potential areas of difficulty and to remove barriers to pupil achievement. Teachers are responsible for tracking children's progress, and set realistic and challenging expectations that meet the needs of our children, so that most should progress as expected. Some children progress beyond this point. For these children we differentiate within the classroom in order to stretch them, where necessary planning more advanced activities which build upon and extend the work that the rest of the class is completing. Despite this teaching and planning, some children do not make expected progress. This can be characterised by progress which:
- is significantly slower than that of their peers starting from the same baseline
- fails to match or better the child's previous rate of progress
- fails to close the attainment gap between the child and their peers
- widens the attainment gap
The first response to such progress will be high quality teaching targeted at their areas of weakness. We recognise the benefits of early identification, identifying need at the earliest point, and then making effective provision to improve long-term outcomes for children. We have a focus on inclusive practice and removing barriers to learning, and therefore special educational provision in our school is underpinned by high quality teaching which is differentiated and personalised. Where progress continues to be less than expected the class or subject teacher, working with the SENCO, will assess whether the child has SEN. In identifying a child as needing SEN support the class or subject teacher, working with the school SENCO, will carry out a clear analysis of the pupil's needs. This will draw on the teacher's assessment and experience of the pupil, their previous progress and attainment, as well as information from our school's core approach to pupil progress, attainment, and behaviour. It will also draw on other subject teachers' assessments where relevant, the individual's development in comparison to their peers and national data, the views and experience of parents, the pupil's own views and, if relevant, advice from external support services. Our school will take seriously any concerns raised by a parent. These will be recorded and compared to the school's own assessment and information on how the pupil is developing. This assessment will be reviewed regularly. This will help ensure that our support and intervention are tailored to need, barriers to learning are identified and overcome, and that a clear picture of the interventions put in place and their effect is developed. For some types of SEN, the way in which a pupil responds to an intervention can be the most reliable method of developing a more accurate picture of need.
Our school will always be alert to other events that can lead to short-term learning difficulties or wider mental health difficulties, such as bullying or bereavement. Such events will not always lead to children having SEN but it can have an impact on well-being and sometimes this can be severe. Our school will ensure that we make appropriate provision for a child's short-term needs in order to prevent problems escalating.
Identifying and assessing SEN for children or young people whose first language is not English requires particular care. Our school will look carefully at all aspects of a child or young person's performance in
different areas of learning and development or subjects to establish whether lack of progress is due to limitations in their command of English or if it arises from SEN or a disability. However difficulties related solely to limitations in English as an additional language are not classed as SEN.
Where a pupil is identified as having SEN, our school will take action to remove barriers to learning and put effective special educational provision in place. This SEN support will take the form of a cycle through which earlier decisions and actions are revisited, refined and revised with a growing understanding of the pupil's needs and of what supports the pupil in making good progress and securing good outcomes. This is known as the graduated approach. It draws on more detailed approaches, more frequent review and more specialist expertise in successive cycles in order to match interventions to the SEN of children and young people.
Plan
Once a pupil's difficulties have been identified appropriate provision is made. At this stage the pupil is placed on the SEND register and staff are made aware of any adaptations including differentiation that needs to take place in the classroom. At this stage parents are formally notified, although they will have already been involved in forming the assessment of needs as outlined above.
The teacher and the SENCO will agree in consultation with the parent and the pupil the school interventions and support to be put in place, as well as the intended targets, along with a clear date for review. This will be set out in a Learning Plan, which should be written for all children who are receiving additional support beyond classroom differentiation. A Learning Plan sets out personal targets they are working towards which are written and reviewed termly (or more regularly if required). Targets are discussed with the child who is encouraged to participate in decision making, at an appropriate level about future options. They are also shared with parents, who are encouraged to work on them at home to reinforce the school's interventions. All staff who are regularly involved with your child in the School are aware of the child's targets. We aim for the targets set to be S.M.A.R.T.E.R.
1. Specific
2. Measurable
3. Achievable
4. Relevant
5. Time bound
6. Evaluated and
7. Reviewed.
Do
The class teacher will remain responsible for working with the child on a daily basis. However, most interventions at The Pointer School are carried out by our Learning Support Assistants, supported by Teaching Assistants in class where appropriate. The class teacher will work closely with any teaching assistants or specialist staff involved, to plan and assess the impact of support and interventions and how they can be linked to classroom teaching. The school SENCO will support the class or subject teacher in the further assessment of the child's particular strengths and weaknesses, in problem solving and advising on the effective implementation of support.
SEND POLICY APPLIES TO THE WHOLE SCHOOL
Review
The effectiveness of the support and interventions and their impact on the pupil's progress will be reviewed in line with the agreed date. The impact and quality of the support and interventions will be evaluated, along with the views of the pupil and their parents. This will feed back into the analysis of the pupil's needs. The class or subject teacher, working with the SENCO, will revise the support in light of the pupil's progress and development, deciding on any changes to the support and outcomes in consultation with the parent and pupil. Parents will have clear information about the impact of the support and interventions provided, enabling them to be involved in planning next steps. Where a pupil has an Education Health Care Plan, the local authority must review that plan as a minimum every twelve months.
Involving Specialists
Where a pupil continues to make less than expected progress, despite evidence-based support and interventions that are provided in school and matched to the pupil's area of need, we will consider involving specialists such as outside agencies. We will always involve a specialist where a pupil makes little or no progress or where they continue to work at levels substantially below those expected of pupils of a similar age despite evidence-based SEN support delivered by appropriately trained staff. The pupil's parents will always be involved and consulted in any decision to involve specialists. The involvement of specialists and what was discussed or agreed will be recorded and shared with the parents and teaching staff supporting the child in the same way as other SEN support. Where our assessments have indicated that support from specialist services is required, it is important that children and young people receive it as quickly as possible. The Pointer School Local Offer sets out clearly what support is available from different services and how it may be accessed. Some of these services may incur an additional cost to parents, which is set out clearly in the Terms and Conditions of the school. In the rare instance that a child is still not making good progress despite the involvement of external specialists, the school may recommend requesting an Education, Health and Care (EHC) Needs Assessment from the Local Education Authority.
Provision mapping
Each term a provision map showing the provision of support by the Specialist Learning Support Assistants is drawn up. Additional interventions are written up for any additional provision that takes place within the year group. These outline details of the provision that is currently taking place. Teachers monitor the pupil's progress and make note of any improvements that can be made or whether the provision should or is necessary to continue. The amount and type of support offered to a pupil is dependent on need. The Pointer School believes that pupils with additional needs should spend as much time as possible in the classroom with the most effective teachers and that removal from class should be avoided wherever possible. We believe that all subjects are important to the pupil's development and that every pupil is entitled to a broad and balanced curriculum. Therefore, timetabled lessons should not be sacrificed for support unless entirely necessary. When a pupil needs to be withdrawn for learning support, every effort is made to ensure that a pupil does not miss core curriculum subjects. Their individual strengths are also taken into account in addition to the advice of staff members and parental requests. Some pupils are withdrawn from a second language in order to ensure extra support is given for English and Maths as appropriate. Some support
lessons are also delivered at the same time as the timetabled subject following the same lesson objectives but in a smaller group with a smaller range of abilities.
Able Pupils
Occasionally a pupil will stand out from their peers as having exceptional abilities. If the need is considered very different from their peer group, the pupil has special needs. In most cases these special abilities can be nurtured within the classroom by differentiation of the curriculum. For further information, please see the Able, Gifted and Talented Policy.
Emotional and Behavioural Difficulties
The Pointer School caters for pupils with mild emotional and behavioural difficulties primarily through effective pastoral care. The school also provides additional support through a designated school counsellor.
Partnership with parents
The Pointer School works closely with parents in the support of those pupils with special educational needs. We encourage an active partnership through an on-going dialogue with parents. Parents will be encouraged to contribute their own ideas about how their child's needs could be met and what helps the child to learn. They will be expected to share with the School success when targets are met at home. Teachers hold meetings to share the progress of special needs pupils with their parents. We inform the parents of any intervention, and we share the process of decision-making by providing clear information relating to the education of pupils with special educational needs. Where a pupil is receiving SEN support, we will talk to parents regularly to set clear outcomes and review progress towards them, discuss the activities and support that will help achieve them, and identify the responsibilities of the parent, the pupil and our school. We will meet parents at least three times each year.
Pupil participation
In our school we encourage pupils to take responsibility and to make decisions. This is part of the culture of our school and relates to pupils of all ages. Pupils are involved at an appropriate level in setting targets and in the termly review meetings. Pupils are encouraged to make judgements about their own performance against their targets. We recognise success here as we do in any other aspect of school life.
Monitoring, evaluation, and continued development
The SENCo supports teachers, where necessary, in drawing up targets for pupils, and reviews all targets that are set on Learning Plans. The Headmaster reviews this policy annually and considers any amendments in the light of the annual review findings. The quality of teaching for pupils with SEN, and the progress made by pupils, is a core part of our school's performance management arrangements and our approach to professional development for all teaching and support staff. Regular training about SEND is provided to all staff.
APPENDIX: SEND in the Early Years Foundation Stage (EYFS)
At the Pointer School EYFS we believe that all our children matter. All the children in our EYFS stage are entitled to an education that enables them to:
- achieve the best possible educational and other outcomes, and
- become confident young children with a growing ability to communicate their own views and ready to make the transition into compulsory education.
We give our children every opportunity to achieve their potential by taking account of our children's range of life experiences when planning for their learning. In the EYFS we set realistic and challenging expectations that meet the needs of our children, so that most achieve the Expected outcome of the Early Learning Goals by the end of the foundation stage. Some children progress beyond this point. For these children we differentiate within the classroom in order to stretch them, where necessary planning more advanced activities which build upon and extend the work that the rest of the class is completing.
At The Pointer School we are aware that some children may not progress at the expected rate as outlined in the document 'Early Years Outcomes' (Department for Education, 2013). As a provider of early years education we have regard to the 'Special educational needs and disability code of practice: 0 to 25 years: Statutory guidance for organisations who work with and support children and young people with special educational needs and disabilities 2014.' (DfE and Department of Health: 2014). As set out in the EYFS framework we take steps to ensure that children with medical conditions get the support required to meet their needs.
In assessing the progress of children in the early years, we use the non-statutory Early Years Outcomes guidance as a measure to assess the extent to which a young child is developing at expected levels for their age. We identify those children who do not meet these developmental milestones through a range of methods. The document 'Tracking Children's Progress', which is completed at periodic intervals throughout the year, allows practitioners to identify specific areas of learning in which children may not be making adequate progress i.e. moving within the developmental brackets from one point of assessment to the next. For more information on identifying progress through tracking, please see the section 'Tracking in the EYFS' in the EYFS Policy. In addition to our formal tracking, we also use a range of information where appropriate to help practitioners to identify children who may not be progressing at the expected rate, which may include information from: parents, Nurseries, or outside agencies. We also use ongoing teacher observations, the Foundation Stage Profile, and the termly school reports to help us to identify any children who may be making little progress.
Any child who is not making adequate progress will have an individual or group target sheet. This will list one or more targets which practitioners will be focussing on over the following weeks, and the small steps that will help the child achieve that target. They allow space for practitioners to note observations as children display their newly developed skills, in order to make a judgement of when each child has met their specific targets. The targets are shared with parents, usually through a specific meeting to discuss the child's progress. These target sheets will only be used as long as practitioners feel is necessary to enable the child to reach the developmental milestones for their age.
Those children who may need additional help in order to meet the Early Learning Goals are largely supported in the EYFS through in-class strategies which are implemented by the class teacher. These may include:
- Planning opportunities that build upon and extend children's knowledge, experience and interests, and develop their self-esteem and confidence;
- Using a wide range of teaching strategies based on children's learning needs;
- Providing extra time/ 1:1 activities with the class teacher or teaching assistant which focus on key areas for development.
- The use of small 'nurture groups' to focus on developing key skills.
- Providing a wide range of opportunities to motivate and support children and to help them to learn effectively;
- Using resources and activities which meet as many of the seven areas of learning as possible: this allows children with different learning styles to engage to their fullest potential;
- Planning challenging activities for children whose ability and understanding are in advance of their language and communication skills;
- Monitoring children's progress and taking action to provide support as necessary. This involves speech therapy for some of our children.
If appropriate, a referral may be made to the Greenwich Early Years Inclusion Team, via a referral form available from the school SENCO, Miss Penelope Fisher, or the Nursery Manager, Mrs Pam Ringer. A formal referral is always made with the consent of parents. This referral will be passed on to the relevant external agencies – Speech and Language, Education Psychology, etc – who will then be able to offer specialist advice and support to the school.
In the rare instance that the advice and help of external professionals has been sought, and the child in question is still making little or no progress, then the school will consider requesting an Education, Health and Care (EHC) Needs Assessment from the Local Education Authority.
|
<urn:uuid:b88094b6-c642-41a3-9d24-de69c425f20e>
|
CC-MAIN-2019-39
|
http://pointers-school.co.uk/wp-content/uploads/2019/08/SEND-Policy.pdf
|
2019-09-16T04:38:28Z
|
s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514572484.20/warc/CC-MAIN-20190916035549-20190916061549-00001.warc.gz
| 157,808,772 | 6,224 |
eng_Latn
|
eng_Latn
| 0.997608 |
eng_Latn
| 0.998308 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
2120,
5430,
8567,
11770,
14619,
18395,
21412,
25161,
28233,
31811,
33552
] |
Writing contest sites, and fiction versus the NBA
By Holly Lisle
I never recommend writing contest sites that charge an entry fee. No exceptions. I've never entered one, because I was out to make a living from my writing, and contests were an unnecessary diversion from my path.
Your mileage may vary. But I received an interesting request from someone building a "perpetual writing contest site" and once I removed all the identifying details, I thought you might find it interesting to observe the conversation.
Here's the link to the article (the first one I've added to "Writing Mind, Heart, and Soul in a while):
http://hollylisle.com/why-i-dont-recommend-writing-contest-sit es-and-why-writing-fiction-isnt-like-the-nba/
From there you can come back here and add your comments on the article if you care to.
Contents © Holly Lisle. https://hollylisle.com All Rights Reserved
|
<urn:uuid:76a1d5db-6ac7-4c52-9585-65bf6f47560f>
|
CC-MAIN-2020-45
|
https://hollylisle.com/writing-contest-sites-and-fiction-versus-the-nba/?print=pdf
|
2020-10-22T07:07:41+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-45/subset=warc/part-00169-6409130e-6e9b-44d1-90ec-9f9d0ade2504.c000.gz.parquet
| 358,180,371 | 224 |
eng_Latn
|
eng_Latn
| 0.998829 |
eng_Latn
| 0.998829 |
[
"eng_Latn"
] | false |
rolmOCR
|
[
915
] |
Naval Affairs Program Briefing Note #18
The Law of the Sea and Canadian Maritime Security
Peace, order, and good government were the founding principles of federal power in Canada 1 and the country has grown prosperous through the application of these same rules to the world's oceans. The majority of global trade moves through the world's sea lanes and, as a trading nation, Canada relies upon the sea to import goods from abroad and send its products to customers worldwide. Strategically, Canada and its allies have long relied upon the seas to project power, to connect North America and Europe in times of war and deploy forces abroad when necessary. As such, the peaceful management of the world's oceans within a stable, rulesbased system of international governance has been a Canadian priority for generations.
Today, this framework is provided by the United Nations Convention on the Law of the Sea (UNCLOS). UNCLOS is one of the world's most comprehensive and effective international treaty systems. Signed in 1982 (and ratified by Canada in 2003) the treaty entered into force in 1994 and has now been ratified by 168 parties. A comprehensive system of maritime governance, UNCLOS sets the rules for the use of the world's oceans, codifying navigational and maritime research rights, environmental responsibilities, and the limits of states' fishing rights, territorial waters, and exclusive economic zones. Upholding this treaty, and defending Canadian rights defined by it, are important components of Canada's maritime policy.
Because Canada relies upon the world's oceans for both trade and defence, maintaining the freedom of the seas has long been a priority for the RCN. Codified by UNCLOS, this freedom provides Canada with navigation and overflight rights through the "high seas", which constitute those parts of the oceans not included in the internal waters or the territorial seas of other states. 2 This free access provides Canada with the right to operate on, above, and below the surface of the high seas, providing global mobility and the ability to reinforce allies or project force anywhere in the world. 3 This area of manoeuvre is expansive, covering nearly half of the earth's surface and, because Canada and its allies and partners possess most of the world's most powerful navies, this freedom skews heavily towards our strategic interest.
UNCLOS also provides access to warships and commercial vessels through the many choke points separating the world ocean. These "international straits," are bodies of water which pass through a state's territorial sea, are commonly used for international navigation, and which connect two parts of the high seas, or the high sea and a state's territorial sea. 4 These strategic, high-traffic locations – such as the Straits of Malacca or Hormuz – carry a disproportionate amount of global trade and vital commodities, such as oil. UNCLOS provides the legal framework which guarantees the right of transit passage to both state and commercial vessels through these straits, without which global commerce would suffer and Canadian and allied strategic mobility would be badly hampered. 5
While deployed abroad, RCN vessels enjoy sovereign immunity, a provision within UNCLOS which essentially conveys diplomatic immunity to warships and other government vessels operating in foreign waters on non-commercial missions. 6 This legal protection exempts Canadian warships from local territorial jurisdiction while operating in a state's territorial waters or exclusive economic zone. As a blue-water fleet with extensive operations abroad, this provision is essential for Canada. 7
UNCLOS also enshrines Canada's sovereign rights and responsibilities in its home waters, an immense region of roughly 7.1-million square kilometres of ocean space – roughly 70% the size of the country itself. 8 This makes Canada one of the world's largest coastal states in the world. It is also one of the richest in terms of the natural resources found in these waters. 9
UNCLOS and Canada's Continental Shelf: Government of Canada
Canada's territorial waters stretch 12 nautical miles from its coast. Within these areas it exercises full sovereignty – though foreign states enjoy the right of innocent passage within these areas. 10 Further out, Canada's jurisdiction over living and non-living resources extends to 200 nautical miles within its Exclusive Economic Zone (EEZ). 11 Within this sizable area, Canada does not have sovereignty but it does have certain rights. Within this area, Canada controls fisheries and other living resources, as well as natural resources such as mineral, oil, and gas deposits.
In addition to its EEZ, Canada also claims jurisdiction over an extended continental shelf in the Atlantic and Arctic. UNCLOS allows states to extend their jurisdiction over shelf resource beyond the 200 nautical miles if they can show that their continental shelf is a natural prolongation, or continuation, of the state's land territory.
The Royal Canadian Navy, in cooperation with the Coast Guard and other government departments, ensures the security of Canada's sovereign waters and those over which it exercises jurisdiction. The maintenance of Canadian sovereignty and its economic interests require the ability to monitor these areas, police and regulate activity, and ensure that Canada's internationally recognized rights are respected.
3
The Maritime Zones of Canada
Internal Waters: includes all waters landward of the baseline. As with land territory, Canada has sovereignty over these waters.
Territorial Sea: extends up to 12 nautical miles out to sea from the baseline. Countries have sovereignty over the airspace, water, seafloor and subsoil in this zone. Ships from other countries have the "right of innocent passage" through this zone as long as they operate under certain conditions.
Contiguous Zone: starts where the territorial sea ends and extends from baselines out to a maximum of 24 nautical miles. Canada can enforce laws relating to pollution, customs, immigration and taxation in this zone.
Exclusive Economic Zone: ranges from 12 to a maximum of 200 nautical miles from baselines. Within this zone, a country has sovereign rights over the exploration, exploitation, management and conservation of resources in the water, on the seabed and under the seafloor. A country also has jurisdiction over certain activities like marine scientific research and protecting the marine environment.
Continental Shelf: comprises the seabed and subsoil to a maximum of 200 nautical miles from baselines or, where the natural prolongation of the continent extends beyond 200 nautical miles, to a distance defined in accordance with the United Nations Convention on the Law of the Sea. A country has sovereign rights over the resources of the seabed and the subsoil of the continental shelf.
High Seas: the water beyond the Exclusive Economic Zone. No state has sovereignty over the high seas.
The Area: the seabed beyond the Continental Shelf. No state has sovereignty over the Area.
From: Fisheries and Oceans Canada
Notes
1. The British North America Act, 1867, SS 1867, section 91.
2. United Nations, Convention on the Law of the Sea, Dec. 10, 1982, 1833 U.N.T.S. 397, Article 87.
3. Royal Canadian Navy, Leadmark: The Navy's Strategy for 2020 (Ottawa: Directorate of Maritime Strategy, 2001), 30.
4. UNCLOS, Article 34-36.
5. Ibid, Article 38.
6. Ibid, Article 95-96.
7. RCN, Leadmark, 33.
8. Department of Fisheries and Oceans, "Defining Canada's Maritime Zones,"
9. Royal Canadian Navy, Canada in a New Maritime World: Leadmark 2050 (Ottawa: Department of National Defence, 2016), iii.
10. UNCLOS, Article 17.
11. Technically the EEZ is measured from the baselines running along the coast from which the country's territorial sea is measured.
|
<urn:uuid:2bcfc4aa-5a3d-42fd-bb91-8a3736f9a379>
|
CC-MAIN-2020-16
|
https://www.navalassoc.ca/wp-content/uploads/2019/12/BN18-LoS.pdf
|
2020-04-10T12:12:38+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-16/subset=warc/part-00012-5e0433ee-fa15-4837-b2dc-d6f38301af97.c000.gz.parquet
| 1,039,267,749 | 1,597 |
eng_Latn
|
eng_Latn
| 0.896028 |
eng_Latn
| 0.994318 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
3166,
5426,
7123,
7856
] |
CITY COUNCIL
CITY OF NEW YORK
------------------------ X
TRANSCRIPT OF THE MINUTES
Of the
SUBCOMMITTEE ON LANDMARKS, PUBLIC
SITINGS AND DISPOSITIONS ------------------------ X
APRIL 6, 2021
Start: 2:07 PM
Recess: 2:58 PM
HELD AT: REMOTE HEARING (VIRTUAL ROOM 1)
B E F O R E: Kevin C. Riley
CHAIRPERSON
COUNCIL MEMBERS: Inez D. Barron Peter A. Koo I. Daneek Miller Mark Treyger
Phone: 914-964-8500 * 800-442-5993 * Fax: 914-964-8470
www.WorldWideDictation.com
APPEARANCES (CONTINUED)
Libby Rohlfing Chief of Staff New York City Housing, Preservation, and Development
Lin Zeng Director Brooklyn Planning
Alice Friedman
Arnima Bouayad Development Team
Parag Mehta
Nancooar Rajcooar Development Team
Sushman Pramod Brooklyn Planner
Alana Smith
Bwana Payeye Kizito President of Bwana Foundation
SERGEANT-AT-ARMS: PC recording underway.
SERGEANT-AT-ARMS: Cloud is up.
SERGEANT-AT-ARMS: Backup is rolling.
SERGEANT-AT-ARMS: Thank you. Sergeant
Bradley with the opening statement.
SERGEANT-AT-ARMS BRADLEY: Yes, good afternoon and welcome to today's New York City Council hearing on Landmarks, public sitings and dispositions. At this time will all panelists please turn on their videos. To minimize disruption please place electronic devices on vibrate or in silent mode. If you wish to submit testimony you may do so at [email protected]. Again, that is [email protected]. Thank you for your cooperation. Chair Riley, you may begin.
CHAIRPERSON RILEY: Good afternoon. I am Councilmember Kevin Riley, Chair of the Subcommittee on Landmarks, public sitings and dispositions. I am joined remotely today by Councilmember Barron, Council Member Koo, Councilmember Miller, and Councilmember Treyger. Today we will be hearing two advocations submitted by HPD for UDAAP in connection with the new Penn Developments, but first I now www.WorldWideDictation.com
recognize Subcommittee Council to review today's hearing procedures.
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA:
Thank you, Chair Riley. I am Jeffery Compagna, Council to this subcommittee. Members of the public who wish to testify were asked to register for today's hearing. If you registered to testify and are not yet signed to ZOOM, please sign in now.
If you wish to testify and have not registered, please go to www.council.nyc.gov to sign up immediately.
If you are not planning to testify on today's items, please watch the hearing on the New York City Council website.
All people testifying before the Subcommittee will be on mute until they are recognized to testify. Please confirm that your mic is unmuted before you begin speaking. Public testimony will be limited to two minutes per witness.
If you have a written testimony, you would like the Subcommittee to consider in addition to or in lieu of appearing before the Subcommittee or if you require an accessible version of a presentation given at today's meeting, please email
[email protected]. Please indicate the LU number and project name or project name in the subject line of the email.
During the hearing Councilmembers who would like ask questions should use the ZOOM raise hand function. The raise hand button should appear at the bottom of the (UNIDENTIFIED) panel. I will announce Councilmembers who have questions in the order that they raise their hands.
Witnesses are reminded to remain in the meeting until they are excused by the Chair.
Lastly, there may be extended pauses if we encounter technical problems. We ask that you please be patient as we work through these issues. Chair Riley will continue with today's agenda.
CHAIRPERSON RILEY: Thank you, Council. I now open up today's public hearing. We will hear application number C 210109 HAK (The New Penn Development I). This application was submitted by the Department of Housing Preservation and Development pursuant to Article 16 of the General Municipal Law and Charter Section 197 c for the designation of an Urban Development Action Area, approval of an Urban Development Action Area Project for such area and the disposition of city-owned property located at 306 Pennsylvania Avenue, 392 Wyona Street, 426 Wyona Street, and 467 Vermont Street in the East New York Neighborhood of Brooklyn to facilitate the development of three new buildings with 46 affordable rental units, Eight of which would be affordable independent residences for seniors. We also hear application number 20215019 HAK (the New Penn Development II UDAAP. The application was submitted by HPD pursuant to Article 16 of the General Municipal Law for approval of an urban development action area project and waiver of the area designation requirements and Sections 197-c and 197-d of the New York City Charter for Property located at 791 Saratoga Avenue, 794 Far… Sorry, excuse me, 792 Rockaway Avenue, 429 Newport Street, 303 Hinsdale Street, 461 New Jersey Avenue, 432 Wyona Street, and 510 Vermont Street also in the East New York Neighborhood of Brooklyn to facilitate the construction of seven buildings containing a total of approximately 25 rental dwelling units plus one unit for a Superintendent. The projects will be presented together. They are located in council district represented by Councilmember Barron and at this time
I will allow, uh, Councilmember Barron to give any remarks regarding these projects as she may. Councilmember Barron.
COUNCILMEMBER BARRON: Yes, thank you. Uh, thank you, Mr. Chair and thank you to the panel for being here. I'm just looking forward to the panel's presentation because I know that there were questions that I had raised and the Community Board had raised. So, I wanted to see how those questions had been addressed in their presentation. Thank you, Mr. Chair.
CHAIRPERSON RILEY: Thank you Councilmember Barron. Council, please call the applicant panel.
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA: The applicant panel is Libby Rohlfing, Lin Zeng, Alice Friedman, and Sushman Pramod on behalf of HPD and Arnima Bouayad, Parog Metta (SP?), Nancooar Rajcooar, and Alana Smith on behalf of the Development Team.
CHAIRPERSON RILEY: Council, please administer the affirmation.
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA: Could we please unmute the panel?
ARNIMA BOUAYAD: Hello.
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA:
One moment, please. Panelists, please raise your right hands and state your names one at a time.
LIBBY ROHLFING: Libby Rohlfing.
LIN ZENG: Lin Zeng.
SUSHMAN PRAMOD: Sushman Pramod.
ALICE FRIEDMAN: Alice Friedman.
ARNIMA BOUAYAD: Arnima Bouayad.
NANCOOAR RAJCOOAR: Nancooar Rajcooar.
PARAG MEHTA: Mehta.
CHAIRPERSON RILEY: Is that everyone?
ALANA SMITH: Alana, uh…
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA:
All Right, do you affirm to tell the truth, the whole truth, and nothing but the truth in your testimony before this Subcommittee and in answer to all Councilmember questions?
LIBBY ROHLFING: Yes, I do.
LIN ZENG: Yes.
SUSHMAN PRAMOD: Yes.
ALICE FRIEDMAN: Yes.
ARNIMA BOUAYAD: Yes.
NANCOOAR RAJCOOAR: Yes.
ALANA SMITH: Yes.
PARAG MEHTA: Yes.
CHAIRPERSON RILEY: Thank you. Before you begin, please state your name and affiliation again for the record and you may begin. Thank you.
LIBBY ROHLFING: Hi, my name if Libby Rohlfing. I am the Chief of Staff at the New York City Department of Housing Preservation and Development. Today we are here to present a project known as New Penn Development. Then land use applications seek UDAAP designation, disposition, and project approval for 10 vacant city-owned blocks in Brooklyn Council district 42.
The first land use item is related to the application of New Penn Development I located at 306 Pennsylvania Avenue, 392 Wyona Street, and 426 Wyona Street to 467 Vermont Street.
The second land use item is related to the application for New Penn Development II located at 791 Saratoga Avenue, 792 Rockaway Avenue, 729 Newport Street, 303 Hinsdale, 461, New Jersey Avenue, 320 Wyona Street, and 510 Vermont Street. One site in the disposition area, listed as site 122, is erroneously designated for open space uses in the
East New York I Urban Renewal Plan. HPD is separately planning to initial a ULURP for an urban renewal amendment to permit residential uses on site 122 as originally intended and that will facilitate the proposed project.
The sponsors of the project are Rajoy Management and PM Architecture, both MBE certified firms, were selected through a competitive process and have proposed to develop these city-owned sites under HPD's Neighborhood Construction Program or NCP. Under NCP, sponsors city-owned or privately-owned land or vacant buildings and construct multi-family buildings in order create mid-size rental housing projects on infill sites affordable to families earning up to 80 percent of area median income or AMI. This is 81,920 for a family of three.
The proposed development will consist of 10 new construction residential buildings on 10 sites with approximately 73 affordable rental units including eight Heirs units and two Superintendents units.
The proposed development will include a mix of studios, one bedroom, two bedroom, and three bedroom apartments. Income tiers include zero
percent, 30 percent, 40 percent, 50 percent, 60 percent, and 80 percent of AMI rents will range from up to $952 for studio at the lowest AMI tier to $2,161 for a three-bedroom unit at the highest AMI tier. This project will also set aside approximately 10 percent of the units for homeless families and individuals referred from other social service agencies such as the Department of Homeless Services.
The buildings will be built to exceed and appraise green community standards and amenities will include a laundry room, bike storage, and landscaped rear yards.
Today HPD is before the Subcommittee seeking approval of the New Penn Development project in order to facilitate construction of these affordable residential buildings and with that, I'd like to turn it over to our Development Team for their presentation.
ARNIMA BOUAYAD: Thank you. Uh, can I have the PDF on the presentation if it is possible. Thank you. Uh, next slide, please. Thank you. So, hi. Thank you for this opportunity to present this project. My name is Arnima and I am with the Development Team. So, this project was awarded to PM Architecture and
Rajoy Management, which are two MBE firms, in 2018 Through the HPD and IHOP and CPRQ and I am very excited to present it to you today. So, it's a proposed (UNIDENTIFIED) of 10 new buildings in East New York with approximately 71 affordable rental units and two supers' units and all of the units will be affordable to very low income and low income families and individuals. Three of the sites with more than four units are currently in (UNIDENTIFIED) or UDAAP process approval and disposition of cityowned land. This was solidified in November 2020 and the seven remaining sites proposed four or less units on each site are accelerated UDAAP sites and will also require City Council approval. Next slide, please.
As you can see on the map, the proposed unit development sites are scattered sites and located on three vacancy city-owned lots in East New York. They are all located within Community District 5 and are within half mile of each other. The neighborhood is mainly residential with access to mass transit. Next slide, please.
Development site I is 306 Pennsylvania located on Pennsylvania Avenue, an important artery in East New York. The building is within a primarily residential district and the land is approximately 5,000 square feet with 50 feet frontage along Pennsylvania avenue. Next slide, please.
306 Pennsylvania will be developed as a seven story elevator building with approximately 25 affordable units including eight affordable independent residences for seniors and we have also one additional two bedroom super's unit. There is common laundry room on the first floor and an indoor bicycle storage and tenant storage room cellar. We modified the façade design to include comments from Councilmembers, Community Board, and City Planning and we are using more contextual materials so our design matches with the neighborhood. Next slide, please.
This is site two, 392 Wyona, with 40 feet frontage along regular street. The land is approximately 4,000 square feet and located within an R6 zoning district. Next slide, please.
392 Wyona will be developed as a fourstory walk-up building with approximately 11 affordable units. We also decided to raise the ground floor by two foot three to provide more privacy to
the first floor units and we will also provide in an access ramp. Next slide, please.
Here is development site three, 426 Wyona, 467 Vermont, and Blake Avenue. The land is 20 feet by 200 feet, which is approximately 4,000 square feet. Next slide, please.
For this building we incorporated the comments from the Community Board and designed 426 Wyona-467 Vermont as a single building with two wings, A and B, connected in the cellar. The building will have approximately 10 affordable units and an open entrance along Blake Avenue. The rendering shown here is along Wyona Street. Its wing A is set back to match the street's walls of adjacent buildings. The ground floor is raised by 30 inches to provide privacy to the first floor units. Next slide, please.
Here the rendering is showing the building along Vermont street, which is wing B and it's four stories high and also set back from the street. We provided fenestration to minimize blank walls and breakdown the facade and maximize natural light for the vertical circulation core. Next slide, please.
Now, on this map you can all of Penn's (UNIDENTIFIED) SITES, The units, and the accelerated UDAAP sites. They are all within one mile of each other. Next slide, please.
The seven accelerated UDAAP sites are all three story walk-up buildings and contain three to four units each. We would have approximately 26 affordable rental units in total. Here you can see a rendering of one empty lot and all seven buildings are proposing mostly brick material to match designs of surrounding buildings. Next slide, please.
The chart on this slide shows the number of different unit types and the percentage of each as a part of the total number of units in whole project. To review the income and rent… renters respectively. Achieving the right units and income mix was important to us and approximately 78 percent of the units will be affordable for households earning up to 60 percent AMI. 43 percent of the units in the entire project are family size two bedroom and three bedroom while remaining units are studios and one bedroom. Providing a variety of apartment sizes allowed us to create housing for seniors. Eight units will be dedicated to the Heirs Program and this project will also include 10 percent of homeless set aside. The affordability metric we used in this project has (UNIDENTIFIED) the desired income, which is aligned with the East New York commitments. Next slide, please.
So, in summary, the entirety of the project will be 10 new energy efficient residential buildings containing 71 affordable rental units, including eight Heir units, and two additional units for supers. For all phases of the project development team, consisting of two MBE's, are committed to hire locally and will conduct outreach through the Community Board, New York City Small Business Services, hire NYC, and Man Up. Our targeted household income ranges are reflective of the communities needs with proposed units affordable to households earning between $30,000 and $81,000 for a family of three and we will also market apartments through Housing Connect. Next slide, please.
This slide shows the breakdown of our timeline as we continue to seek approvals. We aim to close on the project financing in the summer of 2022 and ease up in the winter of 2024. Last slide, please.
In conclusion, the New Penn Development Team wishes to thank you all and we welcome your questions and comments. Thank you.
CHAIRPERSON RILEY: Thank you, panel. Uh, just a few questions before I pass it over to my college Councilmember Barron. Uh, regarding the Heirs Program, the CPC report for New Penn indicates that eight of the 46 units will be affordable independent residence for seniors or the Heirs unit, but the HPD project summary makes no mention of this. Can you clarify the difference whe… the difference and whether the project will include the Heirs?
LIBBY ROHLFING: Yes, it will include the eight Heirs units.
CHAIRPERSON RILEY: Okay, thank you. Can you please describe your plans for insuring WMBE and locally-based contractors and subcontractors' participation in the development?
LIBBY ROHLFING: Arnima, do you want to take this one?
CHAIRPERSON RILEY: Arnima, can… Oh, go ahead.
ARNIMA BOUAYAD: Yes.
PARAG MEHTA: No.
ARMINA BOUAYAD: Sure, hi.
PARAG MEHTA: Hi.
ARMINA BOUAYAD: Parag will take over.
PARAG MEHTA: Hi, my name is Parag. Uh, so, our firm is WMBE and Rajoy is WMBE and we have worked in the city of New York for the past 26 years working with a lot of other engineers and contractors who are WMBE and we have successfully completed many jobs. When the job does go out for construction, we'll put equal emphasis on hiring WMBE.
CHAIRPERSON RILEY: Okay, and can you describe you plans for local hiring during the construction and if so, how many local hires are we typically looking at for a project like this?
PARAG MEHTA: (UNIDENTIFIED), who is also a part of my team, we collectively reached out to different offices where we met with individuals. We thought about hiring with Man Up. That's on the construction side. We will at least get a few people involved in each site depending on the expertise that we can help. There will be a team available for sheet rocking, taping, and painting. That would be people easily available to work on our daily shifts when
have to transport materials. More of plumbing and electrical and the trades which require a license, we may not have a stronger control of hiring them, but everything that does not seek a license that can be done without having a licensed individual (UNIDENTIFIED) on the job. (UNIDENTIFIED)
CHAIRPERSON RILEY: So, So, those without the licenses, is there like an estimated number of local hires that we can bank of for this project?
PARAG MEHTA: yes, we'll, we'll, uh, we'll, uh, try and, uh… Really, uh, like I'm not really prepared to give a number right now.
CHAIRPERSON RILEY: OKAY.
PARAG MEHTA: Yes, our commitment is to hire local people and we have always done in the past. You know, I started my office in Harlem and I did a lot of things in areas long before like in Harlem when we, uh, when we entered Harlem in 1997. So, Yes, we'll bring in local, uh, WMBE.
CHAIRPERSON RILEY: Thank you. How can we assure follow up and progress reports on these commitments, uh, for the local hiring, for the WMBE, Uh, how can we follow up and, and show that you guys are fulling your commitments, uh, for these projects?
PARAG MEHTA: I will need guidance on how it's actually done because there are… We've participated… Like I did a lot of projects architect and my resume says that from 1995 until today, but never played this role as a developer. So, Maybe I'll need some guidance (UNIDENTIFIED). Like what will be typically done. Like how the reporting is done. I am not sure.
CHAIRPERSON RILEY: Well, I think you'll want to stay connected with Councilmember Barron and, and she'll speak on that later on, but staying connected with them, staying connected with the Community Board just to kind of let them know that you guys are doing local hires and are still ensuring the WMBE's and local contractors are a part of this project. I think that's a good start to do so.
PARAG MEHTA: Sure.
CHAIRPERSON RILEY: And my last question, before Councilmember Barron comes on, what sustainability and resiliency measures are incorporated into the building design and construction of this development?
PARAG MEHTA: Okay, so, we want to pursue Passive House building. Our goal is, uh… In general, we have completed a lot of (UNIDENTIFIED) buildings. We also completed a Passive House building, which was, uh… with all of the credentials and certifications, but right now this building, the walls will be heavily insulated, which a primary requirement of Passive House. We will be using triple-glass windows. There will be, uh, ER units, which is energy recovery units, uh, but the essential measures like, you know, plumbing and all of that, that with low-flow, which is standard for a (UNIDENTIFIED) job, but our primary focus is going to be on, uh, heavy insulation and high-efficiency windows and ER units.
CHAIRPERSON RILEY: Thank you. I would like to give my question time to Councilmember Barron if she has any questions for this panel.
COUNCILMEMBER BARRON: Yes, thank you Mr. Chair. I want to thank the panel for coming for their presentation. I had questions, which I hoped you would've addressed in our presentation, which I didn't hear. I did step away. So, I may have missed them. One in particular was the fact that you have store… a four story building, but it is a walk up. I know that HPD does not require elevators in a four
story building, but I asked you to consider an elevator and I didn't hear that included in your presentation. Do you recall that I asked you about that and if so, what is your response?
PARAG MEHTA: Yes, we do recall. I believe we tried to reply just informal letter correspondence. Our response there was that these are extremely small size buildings. So, in a building this size if we bring in a special elevator, special elevator could be approximate size of a room with the hoistway and going… putting a special elevator in a four story building brings a lot of economical burden like, you know, construction costs will go up at least by half million dollars by the time you put all of the hoistway walls and we put in the elevator and Then all of the electrical. (UNIDENTIFIED) connected with the fire alarm. It will just go on auto recall. Every year we'd have to go for inspections. There will a maintenance contract. So, keeping all of those things in mind, uh, we were thinking that the benefits of solving two or three apartments on the top floors, uh, if, uh… in other words, there is a lot more money that is going in the job and the benefits are small and also now we are losing a room in each apartment. You know, so, like a two bedroom is quite likely going to become a one bedroom and likewise a reduction in size of units. So, that was our only reason not to consider an elevator in a four story building and we, we'll put it in the form of a written narrative and send it out.
COUNCILMEMBER BARRON: So, the buildings, how many buildings are there in total?
PARAG MEHTA: Total there are 10 buildings.
COUNCILMEMBER BARRON: And of some of them are three story?
PARAG MEHTA: So…
COUNCILMEMBER BARRON: and some of them are three stories, right?
PARAG MEHTA: Yeah, one, one is a seven story, one is a four story, and most of them are three story except one building, which is on a merged… like, you know, wing A and wing B. That one is like small brownstone with a four story, four story.
COUNCILMEMBER BARRON: Okay.
PARAG MEHTA: So, in other words, if I would say one… half of one building is four story
COUNCILMEMBER BARRON: Right, and the other…
PARAG MEHTA: and one other building is a four story building.
COUNCILMEMBER BARRON: Okay. What is the exterior? We had talked about the exterior. You know, I'm very much concerned about blending with the existing community and I do not favor Hardie Plank, which I have been told has a life span of approximately 50 years. So, that's at the outer limit. So, I do not favor Hardie Plank. So, what is the exterior that you have planned for these buildings?
PARAG MEHTA: We… All of our buildings are brick. They are all brick.
COUNCILMEMBER BARRON: All?
PARAG MEHTA: Yeah, only the one that (UNIDENTIFIED) was a Greystone, 306 Pennsylvania. We, uh… That was the seven story one. The seven story building that was, uh…
COUNCILMEMBER BARRON: Yes.
PARAG MEHTA: 306 Pennsylvania where your concern was about design?
COUNCILMEMBER BARRON: Yes.
PARAG MEHTA: Uh, we are using tow-colored brick. One lighter color and one slightly darker color with a small inlay of, uh, some metal inbetween. The reason is that whole Pennsylvania Avenue is (UNIDENTIFIED) and not really changing.
You know, there are some nicer architecture buildings more to the north of Pennsylvania and there are some really interesting contemporary buildings coming up on Pennsylvania and right next door is a hotel, which also has the large window and, uh, again, a seven story building. So, again, we are keeping in context and keeping absolutely brick and a lighter color brick was suggested to us. With just a little architectural detail like bringing in metal panels.
CHAIRPERSON BARRON: Okay, thank you. In terms of the number of studio apartments in the total that you have, that you're building, how many… What's the total number of buildings and how many of them are studios? Total number of apartments? I'm sorry.
PARAG MEHTA: Just one second. I…
SUSMAN PRAMOD: Sorry, can you hear me?
CHAIRPERSON BARRON: Yes.
SUSMAN PRAMOD: So, in answer the total number in all of the projects is 72 units of which two of them are supers' units, but the studios in total are 17.
CHAIRPERSON BARRON: 17?
SUSHMAN PRAMOD: Yes.
CHAIRPERSON BARRON: And are Heir's apartments relegated to each of those studios or will the heirs also include some one bedrooms?
PARAG MEHTA: There, there… Sorry. Sushman are running with it?
SUSMAN PRAMOD: No, go ahead.
PARAG MEHTA: So, Heirs will… Heirs is studio and one bedroom and it's on the elevator building, 306 Pennsylvania.
CHAIRPERSON BARRON: Okay, it's in the, it's it the elevator building and how… What is the size of the unit for Heirs?
PARAG MEHTA: Sushman, you have the document in front of you?
SUSHMAN PRAMOD: Uh, not the heirs, but I… ALANA SMITH: I'm happy to contribute. if you don't mind?
SUSHMAN PRAMOD: Uh-huh, you can do that.
ALANA SMITH: Yeah, no problem. This is Alana Smith. We have studios ranging from 370 to 401 square feet and, uh, one bedrooms from 474 to 538. So, to specify exactly which, uh, Heirs unit, uh, I can certainly follow up with the exact figure after the fact.
CHAIRPERSON BARRON: Okay, and the same applies for the homeless?
ALANA SMITH: Uh-hm.
CHAIRPERSON BARRON: You know, I would like to know what is the unit size that you're designating for those, uh, families that are formerly homeless coming out of shelter. I would like to get that information and then finally, the Chair based a question about WMBE. I am always concerned about Black people and WMBE's often time don't have any reflection of Black people. They have the other categories, but they don't have the Black, which in turn means that my community is in fact being used perhaps as a domestic colony in as much as the people who are the majority of the people living here in my community, Black and Latino, are providing the base, the land, but they're not getting the benefit of being involved in the hiring and even in the
contracting and the local hires that we're talking about. So, I want to know not totality of WMBE. I want to know Black. I want to know Latino. So, as we go through this process and as we make these contracts and subcontracts that's what I want to know because our community is being drained of its resources without getting the benefit of the economy that others are coming into our community getting the benefit of. So, I'd be very mindful. I'd be very careful. I'd be very concerned to make sure that Black and Latino are a part of what we talk about when we say WMBE. I did have another question, but I didn't write it down and I can't remember it, but if I… If it comes to me, I can send it to you and I'm sure you'll get back to me with a response. Thank you, Mr. Chair.
CHAIRPERSON RILEY: Thank you, Councilmember Barron. I now invite my colleges to ask questions. Council, I did see Councilmember Miller's hand up. I'm not sure if he still has a question. Councilmember Miller.
COUNCILMEMBER MILLER: Yes, sir. Thank you, Mr. Chair and thank you Councilmember Barron for your leadership as usual on these issues here, uh,
land use issues. So, uh, on this application, the developers… Is it one developer for Penn I and Penn II?
SUSHMAN PRAMOD: That is right. It is, uh, well, two companies. It's PM Architecture and Rajoy Management and they are the development team and it is both of them for all 10 buildings.
COUNCILMEMBER MILLER: Okay, and, and so, it's ten buildings. How many total units?
SUSHMAN PRAMOD: 73 including two supers' units.
COUNCILMEMBER MILLER: Okay, and what is the developer's relationship of past affiliations, if any, with this, this New York Community?
NANCOOAR RAJCOOAR: Oh, uh, hi, my name is Nancooar Rajcooar.
COUNCILMEMBER MILLER: UH-HM.
NANCOOAR RAJCOOAR: Call me Raj for short. I have been affiliated with East New York Community from since around 2003. My office is located at 603 Miller Avenue, Brooklyn, New York 11209. In 2005 I was elected to develop and manage a scatter site consisting of nine buildings through the MEP Program.
COUNCILMEMBER MILLER: Uh-hm.
NANCOOAR RAJCOOAR: That project was successful. In 2007 I was also selected by HPD to develop 16 one to four family units to be sold to low and moderate income first time home buyers. That project was also successful. In 2015 I applied for this RFQ and through a rigorous competitive process I was selected to develop and manage these 10 building consisting of 73 units.
COUNCILMEMBER MILLER: Okay, so, so, you… Your relationship is as far as, as a developer. Are there any, uh, other relationships that, that your company has with the community itself. Uh, do you employ folks from the community that, that… Do you have any folks from the community in your employ? Do you… Have, have you employed folks from the community on your previous projects within the East New York Communities? That was my question in terms of affiliations.
NANCOOAR RAJCOOAR: Most likely we did, we did that employed… What happens is that in the beginning we, we, we selected a contractor who did most of the selections.
COUNCILMEMBER MILLER: Uh-huh.
NANCOOAR RAJCOOAR: Now that we know that Councilmember Barron wants that we will definitely ensure that we go to her office and get some of the, some the recommended names or so we can reach out to those WMBE's. Especially a Black and Hispanic person.
COUNCILMEMBER MILLER: And who, who's, who's the contractor that you utilize, construction company?
NANCOOAR RAJCOOAR: Who is the contractor for this project?
COUNCILMEMBER MILLER: Correct.
NANCOOAR RAJCOOAR: It's going be PM Architecture, my partner.
COUNCILMEMBER MILLER: And what's their construction background?
NANCOOAR RAJCOOAR: Parag.
SUSHMAN PRAMOD: I'm sorry. Can we unmute, uh, Alana? Thank you.
PARAG MEHTA: Okay, hi. So, at PM Architecture, we have been working in construction industries from 1995 to now. In my resume, like you know, things we did in Harlem, uh, today we be… We have always hired WMBE company to the point that our masons are Hispanics. Our steel guy is a Black-born company. Two of my supers work, work with me from 1999 'til today. Uh, they are, uh, uh, Black guys. We actually have more minority workers than anything else. I, I think we probably have 80 percent minority workers. Not that we tried very hard to do that, but it just happened that way. So…
COUNCILMEMBER MILLER: How much, how much of… How much of your company's business is affordable housing? How much of the portfolio is, is affordable housing?
PARAG MEHTA: In, in the business that I did as architecture we have, uh, used affordable housing. On other side when whatever I did is probably 30 percent affordable housing.
COUNCILMEMBER MILLER: And, and, and Raj, for your side of the business, how much of, how much of the business is affordable housing?
NANCOOAR RAJCOOAR: 100 percent.
COUNCILMEMBER MILLER: 100 percent?
NANCOOAR RAJCOOAR: Yes.
COUNCILMEMBER MILLER: How much, how much of it is, uh… Do you develop land that you own or is it all by virtue of RFPs on city-owned land?
NANCOOAR RAJCOOAR: RFPs on city-owned land.
COUNCILMEMBER MILLER: Okay, and, and then I have, I have a, a question and, and it's probably more of a HPD question. Uh, I noticed that even at 80 percent of, of AMI in here in, in East New York is something that we're experiencing in, in, in the greater Jamaica area and throughout the city with a decline in rent throughout the city that we're seeing that, that market rate that, that we're seeing now that, uh, affordability is at, at 80 or 100 percent are exceeding market rates in many of these communities. Is there a mechanism of making that adjustment before we go into this project now? Because as I look at some of the numbers at 80 percent and nearly $2,300.00 that, that certainly exceeds the market rate of East New York.
SUSHMAN PRAMOD: Uh, our policy generally is that our affordability is adjusted at the time of closing. So, with this project it will be 2022. So, all of the newer income data that we have will be incorporated into the affordability of these units at the time of closing. Uh, the one argument about, uh, market rate units being a lot more affordable now is that they are is that they are inconsistently affordable and we're not sure how affordable they will be in the future, but all of our HPD buildings are under a 60-year regulatory term. So, you're… They're definitely affordable for the next 60 years at least with an option to renew after that.
COUNCILMEMBER MILLER: Okay, so, so, obviously councilmember's office will, will certainly, uh, be, uh, available and paying attention during the time of closing so that we make sure it is consistent with… uh, like I said, it's something that we've seen… we are seeing all over the city now where, where, uh, affordabil… uh, affordable housing has significantly outpaced a market rate in, in, certain areas of the city and, and, you know, it, it is difficult when people are pinched that they're actually spending 5, $600.00 or more a month on affordable than they are on market rate housing in some areas.
LIN ZENG: Yeah, uh, and appreciate… Uh, we appreciate that, that feedback for sure and, and just anecdotally, you know, we heard from the, the district manager of 45 that there are… Even though, uh, 80 percent is… You know, that seems high, uh, but
I think their also hearing and getting feedback that there are those in the community where their kids have kids have gotten older and, you know, they've become professionals and, and they want to stay in the community and… you know, and that is, and that is like the range that they're able to sort of stay and, and that applies to some of the, the studios and the one bedrooms as well. Uh, so, certainly, I think… I, I think this project kind of provides a, a nice range. It has a little bit of everything, uh, and we would definitely like to revisit that like once it's ready to close to see, uh, how it matches up with, uh…
COUNCILMEMBER MILLER: So, I, I'm okay with that number; although, Councilmember Barron may feel differently about it.
LIN ZENG: Yeah.
COUNCILMEMBER MILLER: Uh, I have a different perspective of it. I do believe the only for us to attract and retain our greatest minds of our children staying at home is to be able to provide housing for them. I'm just a little concerned about the formula that we're using now and whether or not affordability is, is outplacing market rate because
of, you know, the times that we… Covid times that we find ourselves in. Thank you so much, uh, Mr. Chair. Uh, Councilmember Barron Obviously, you know, I look forward to working with you, assisting you in anyway we can on, on this project here, uh, as, as usual. Thank Mr. Chair and thank you for your leadership. I had to jump in again. Thank you and Thank you all for, uh, answering the questions as well.
(UNIDENTIFIED): Thank you.
(UNIDENTIFIED): Thank you.
CHAIRPERSON RILEY: Councilmember Miller. Councilmember Barron, did you want to ask that last question or are you good?
COUNCILMEMBER BARRON: Yes, thank you. I don't have any further questions. I did want to thank the acknowledgment that the Community Board had raised, uh, about that upper level of 80 percent and I just want to tell Councilmember Miller we will be in touch because I appreciate that other perspective that you brought to our conversation and we will certainly be in touch. Thank you so much.
NANCOOAR RAJCOOAR: Thank you. CHAIRPERSON RILEY: Thank you Councilmember Barron. Uh, and just to echo, uh, Raj and (UNIDENTIFIED), I really think Councilmember Miller was talking about the participation in the community. uh, really engaging, uh, with members in the community because a lot of times we do see developers building new developments in the community and they really have no community in the partnerships or engagement, Uh, that goes beyond construction. So, I think that's what he was kind of eluding to. So, just, uh, keep that in mind, you know, moving forward for future projects.
NANCOOAR RAJCOOAR: Yeah, we will… We will definitely reach out to the Community Board.
CHAIRPERSON RILEY: Thank you, thank you, Raj. I really appreciate that and thank you Councilmember Miller and Councilmember Barron for always advocating and making sure that, uh, developers are paying attention to the community. Uh, Council, are there any more questions from any Councilmembers?
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA: There are no other Councilmember questions.
CHAIRPERSON RILEY: Okay. There being no more questions for this panel, this panel is excused. Thank you.
NANCOOAR RAJCOOAR: Thank you.
LIN ZENG: Thank you so much.
CHAIRPERSON RILEY: Council, are there any members of the public who wish to testify on this item?
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA: At
this time all witnesses intending to testify on these items should log in or call into ZOOM. At the present moment we have one public witness, Bwana Payeye Kizito. Please forgive me for the pronunciation. Members of the public will be given two minutes to speak. Please do not begin until the sergeant-at-arms had announced the time has started.
CHAIRPERSON RILEY: Thank you. OKAY, thank you Bwana. I am sorry for pronouncing your name wrong.
BWANA PAYEYE KIZITO: Oh, no problem. Thank you.
CHAIRPERSON RILEY: Uh-huh, uh, please state your name and affiliation before you begin and then you may begin.
BWANA PAYEYE KIZITO: Uh, my name is Bwana Payeye Kizito.
SERGEANT-AT-ARMS: Starting.
BWANA PAYEYE KIZITO: My name is Bwana Payeye Kizito and I am the president of Bwana Foundation.
CHAIRPERSON RILEY: You may begin with your testimony.
BWANA PAYEYE KIZITO: Thank, thank you so much. So, as we know in Brooklyn, Brooklyn is changing. Uh, there is a lot of gentrification going on. I should not have to explain what that is and everything, but developers come in the community without really understanding the history of the community and because Black people and Hispanics are the original members of this community they need to be included in this debate and listened to and respected in this process. It is very important, uh, when developers come into a community, they are changing the community into whatever image they want to make it look like and attract new customers into it and that's great. That's business, but it is very important that Blacks and Hispanics be hired in this process with these contracts and that they benefit from it and be a victim of this process. Since it has been years now that they have been trying to gentrify Brooklyn starting from, you know, and going east it's now a process that we've seen before where if you ask tenants or older community members, they are not satisfied with what has happened to their community. Therefore, you know, you know, I think that developers need to be really engaged and have specifics on what they plan on doing for Black people and the Hispanics. Even though it is a business decision, it's not charity, it's nothing like that, but it is a commitment that needs to be made. where community members see new developers coming in okay, what can I get from that? Are you going to hire me? Are you going to help my community strive? It doesn't… These are the questions that we need to answer and that developers need to answer wherever they want to go into New York and, you know, Harlem is one place that has been left along for a long time around Marcus Garvey Park, Western Heights, and the Bronx. You know, these communities will be next and I have been there many times and…
SERGEANT-AT-ARMS: Time expired.
BWANA PAYEYE KIZITO: Okay, thank you so much.
CHAIRPERSON RILEY: Bwana, you can, you can continue. You can finish up.
BWANA PAYEYE KIZITO: Thank you so much.
So, I've been there… Thank you so much. So, I've been there many times and, you know, I've been to Marcus Garvey Park. It has been left alone and I think communities in Harlem, Bronx, Western Heights, South, South Jamaica, Queens, uh, (UNIDENTIFIED), you know, Queensbridge. All of the communities have been left alone and left behind for decades, since the 60s. So, if we want to renovate, how about we help the community that's already there, not trying to change it. Help it. So, if you want to develop a building, great then promise to hire the kids and the people that are already there. It's very important. We cannot just put buildings in there and say we'll, we'll talk about it later or we'll see what happens. No, you get there, you put your bricks, you put your building, you set it up, Great. Now, the people that are around these buildings, what do they get from it? That is the major question. What to they get from it and if they get, uh, a job from it. If they get any type of, uh, prospects. You know, job prospects or anything like that, then great, but it's just to come in there and then leave them along and, and, and, you know, push them back further into other places around the neighborhood, you know, that's not the way to go. So, there needs to be a real commitment. Not just building businesses. Not just building industrial, industrial complex or anything, but real commitment. So, I just wanted to say that. So, thank you so much for your time. Thank you.
CHAIRPERSON RILEY: Uh, and thank you for your testimony, Bwana. Uh, I think that is on everyone's mind here. Uh, Councilmember Barron, myself, and the rest of the Committee, we really want to, uh, express and, and emphasize to the developers to make sure that community involvement, uh, is something that they are taking care of, uh, when they're coming into a new community. Especially when it comes with our local hiring process. Uh, so, everything that you stated and, and sentiments, uh, we feel the same way. Uh, we encourage you, uh, and thank you so much for coming today, uh, and sharing your testimony and we will continue to fight for you, uh, within the City Council, to make sure that these developers coming into our communities are making sure, uh, that they having, uh, a lot of community involvement and, uh, with that being said, I'm not
sure if our Councilmember Barron, uh, has anything to add to that. Uh, Councilmember Barron.
COUNCILMEMBER BARRON: Thank you. Just want to, uh, thank Mr. Kizito for his comments and say that we are inline with what it is that you're saying, that we need to make sure our community is recognized, appreciated, and respected, and involved. Thank you.
COUNCILMEMBER RILEY: Thank you for your testimony. Council, are there any more members of the public that wish to testify?
SUBCOMMITTEE COUNCIL JEFFERY COMPAGNA: Chair Riley, there are no other members of the public who wish to testify on these items.
COUNCILMEMBER RILEY: There being no other members of the public who wish to testify on these items the public hearing on application C210109HAK (New Penn Development I) and 20215019HAK (New Penn Development II-UDAAP) are now closed and the items are laid over. That concludes today's business. I remind you that if you have, if you have written testimony on today's item you may submit it to [email protected]. Once again, that is [email protected]. Please indicate
the land use number or the project name in the subject heading. I would like to thank the applicants, the members of the public, my colleges, Subcommittee Council, Land Use Staff, and SergeantAt-Arms for participating in today's hearing. This meeting is hereby adjourned. Thank you.
CERTIFICATE
World Wide Dictation certifies that the foregoing transcript is a true and accurate record of the proceedings. We further certify that there is no relation to any of the parties to this action by blood or marriage, and that there is interest in the outcome of this matter.
Date____04/20/2021_______________
|
<urn:uuid:6f9658a6-3b3a-4872-8c8f-d69fa93c3c46>
|
CC-MAIN-2023-23
|
https://legistar.council.nyc.gov/View.ashx?M=F&ID=9327164&GUID=1D8C5301-AF09-41C8-88C7-3E1801FE2689
|
2023-06-09T18:28:01+00:00
|
s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-23/subset=warc/part-00160-ffa3bf93-6ba1-4a27-adea-b0baae3b4389.c000.gz.parquet
| 407,057,438 | 10,762 |
eng_Latn
|
eng_Latn
| 0.959542 |
eng_Latn
| 0.998638 |
[
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn",
"eng_Latn"
] | false |
rolmOCR
|
[
483,
824,
1916,
2961,
5289,
6249,
7039,
8104,
9207,
10337,
11659,
12581,
13642,
15032,
15914,
16842,
17923,
19047,
20733,
21267,
22764,
23395,
24283,
25334,
26200,
27294,
28426,
29410,
30442,
31692,
32394,
33827,
34684,
35797,
37372,
37947,
38843,
40907,
41060,
42587,
43443,
44546,
44830,
45152
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.